Science.gov

Sample records for alpha administration zmiany

  1. Effects of interferon-alpha (IFN-alpha) administration on leucocytes in healthy humans.

    PubMed

    Corssmit, E P; Heijligenberg, R; Hack, C E; Endert, E; Sauerwein, H P; Romijn, J A

    1997-02-01

    Plasma concentrations of IFN-alpha are increased in several inflammatory conditions. Several lines of evidence indicate that IFN-alpha has anti-inflammatory properties. To study the effects of IFN-alpha on leucocyte subsets and activation and on cytokines, we administered IFN-alpha (rhIFN-alpha2b; 5 x 10(6) U/m2) to eight healthy human subjects in a randomized controlled cross-over study and analysed changes in circulating leucocytes and parameters for neutrophil and monocyte activation. After administration of IFN-alpha, neutrophil counts increased, monocyte counts decreased transiently, whereas the number of lymphocytes, basophils and eosinophils showed a sustained decrease. IFN-alpha administration was also associated with neutrophil activation, reflected in an increase in the plasma concentrations of elastase-alpha1-antitrypsin complexes and lactoferrin. Serum neopterin, a marker for monocyte activation, was significantly increased 10 h after administration of IFN-alpha. IFN-alpha significantly increased plasma concentrations of IL-6, IL-8 and IL-10. Although IL-1 and tumour necrosis factor (TNF) remained undetectable, plasma concentrations of soluble TNF receptors p55 and p75 increased after IFN-alpha administration. We conclude that IFN-alpha induces multiple alterations in the distribution and functional properties of leucocytes. IFN-alpha exerts pro- as well as anti-inflammatory effects within the cytokine network.

  2. Vitamin E kinetics after intraperitoneal administration of DL-alpha-tocopherol and DL-alpha-tocopherol acetate in sheep.

    PubMed

    Toutain, P L; Laurentie, M P; Hidiroglou, N; Hidiroglou, M

    1992-01-01

    The disposition of radiotocopherol after intraperitoneal administration of 14C-labelled-DL-alpha-tocopherol (1 microCi/kg bw, dose 1) and 3H-labelled-DL-alpha-tocopherol (4 microCi/kg bw dose 4) and of D-alpha-tocopherol, after intraperitoneal administration of DL-alpha-tocopherol acetate (100 mg/kg bw) was investigated in sheep. Plasma samples were taken at regular intervals after dosing and assayed for radioactivity and D-alpha-tocopherol. Plasma profiles were modelized using a compartmental approach and the input entry rate (for radioactivity) was identified using a numerical deconvolution method. Based on plasma specific activity (dose 1 and dose 4) and D-alpha-tocopherol plasma concentration (unlabelled alpha-tocopherol acetate), half-lives were not significantly different (99.6 +/- 28.3 h, 121.3 +/- 38.5 h and 75.0 +/- 49.75 h after dose 1, dose 4 and unlabelled alpha-tocopherol respectively). The times to reach maximal plasma concentrations were similar for the 3 test articles (mean values ranging from 21.5 to 26.7 h). The only significant difference was observed for the apparent volume of distribution (with respect to bioavailability) which was much larger for the unlabelled test article. Deconvolution study of plasma specific activity showed: i), that the maximal input rate was reached only after a short delay (3 to 12 h); ii), that half of the activity was absorbed after a delay of 38.13 +/- 16.76 h (dose 1) and 44.3 +/- 6.50 h (dose 4); and iii), that 90% of the activity was absorbed after 151.2 +/- 27.3 h (dose 1) and 162.3 +/- 11.2 (dose 4). It is concluded that the intraperitoneal route is of interest for alpha-tocopherol administration, but that more information is required to determine the exact process of absorption.

  3. Ibuprofen administration attenuates serum TNF-{alpha} levels, hepatic glutathione depletion, hepatic apoptosis and mouse mortality after Fas stimulation

    SciTech Connect

    Cazanave, Sophie; Vadrot, Nathalie; Tinel, Marina; Berson, Alain; Letteron, Philippe; Larosche, Isabelle; Descatoire, Veronique; Feldmann, Gerard; Robin, Marie-Anne |; Pessayre, Dominique |

    2008-09-15

    Fas stimulation recruits neutrophils and activates macrophages that secrete tumor necrosis factor-{alpha} (TNF-{alpha}), which aggravates Fas-mediated liver injury. To determine whether nonsteroidal anti-inflammatory drugs modify these processes, we challenged 24-hour-fasted mice with the agonistic Jo2 anti-Fas antibody (4 {mu}g/mouse), and treated the animals 1 h later with saline or ibuprofen (250 mg/kg), a dual cyclooxygenase (COX)-1 and COX-2 inhibitor. Ibuprofen attenuated the Jo2-mediated recruitment/activation of myeloperoxidase-secreting neutrophils/macrophages in the liver, and attenuated the surge in serum TNF-{alpha}. Ibuprofen also minimized hepatic glutathione depletion, Bid truncation, caspase activation, outer mitochondrial membrane rupture, hepatocyte apoptosis and the increase in serum alanine aminotransferase (ALT) activity 5 h after Jo2 administration, to finally decrease mouse mortality at later times. The concomitant administration of pentoxifylline (decreasing TNF-{alpha} secretion) and infliximab (trapping TNF-{alpha}) likewise attenuated the Jo2-mediated increase in TNF-{alpha}, the decrease in hepatic glutathione, and the increase in serum ALT activity 5 h after Jo2 administration. The concomitant administration of the COX-1 inhibitor, SC-560 (10 mg/kg) and the COX-2 inhibitor, celecoxib (40 mg/kg) 1 h after Jo2 administration, also decreased liver injury 5 h after Jo2 administration. In contrast, SC-560 (10 mg/kg) or celecoxib (40 or 160 mg/kg) given alone had no significant protective effects. In conclusion, secondary TNF-{alpha} secretion plays an important role in Jo2-mediated glutathione depletion and liver injury. The combined inhibition of COX-1 and COX-2 by ibuprofen attenuates TNF-{alpha} secretion, glutathione depletion, mitochondrial alterations, hepatic apoptosis and mortality in Jo2-treated fasted mice.

  4. Administration of nicotine to adolescent rats evokes regionally selective upregulation of CNS alpha 7 nicotinic acetylcholine receptors.

    PubMed

    Slotkin, Theodore A; Cousins, Mandy M; Seidler, Frederic J

    2004-12-24

    Alpha 7 Nicotinic acetylcholine receptors (nAChRs) play a role in axonogenesis, synaptogenesis and synaptic plasticity, and are therefore targets for developmental neurotoxicants. We administered nicotine to adolescent rats and evaluated the effects on alpha 7 nAChRs in the striatum, brainstem and cerebellum. During the period of nicotine administration (30-47.5 days of age), nicotine elicited alpha 7 nAChR upregulation with a regional hierarchy of striatum>brainstem>cerebellum. Values returned to normal or became slightly subnormal almost immediately after the cessation of treatment (50 days of age) with no further changes through 75 days of age. The temporal and regional patterns of the effects on alpha 7 nAChRs were distinct from those reported earlier for the alpha 4 beta 2 subtype, and neither adult nor fetal/neonatal administration upregulates the alpha 7 subtype in the striatum. Targeting of the striatum is thus unique to nicotine exposure during adolescence and parallels earlier work showing regionally selective effects of this treatment on synaptic signaling. We obtained preliminary evidence for nicotine-induced oxidative stress as a potential contributory mechanism. The present findings reinforce the concept of biologically distinct effects of nicotine in the adolescent brain and provide evidence for a mechanistic involvement of alpha 7 nAChRs in its unique effects during this developmental period.

  5. Enhancement of ovalbumin-induced pulmonary eosinophilia by intranasal administration of alpha1-proteinase inhibitor type 2 antisense oligonucleotides.

    PubMed

    Sung, Ha-Na; Jeon, Chang-Hwan; Gill, Byoung-Chul; Kim, Hye-Rin; Cheong, Sun-Woo; Park, Joo-Hung

    2009-01-29

    To identify asthma-susceptibility genes, we did proteome analyses of the lung from control and ovalbumin-sensitized BALB/c mice. Among the 6 up-regulated proteins is alpha(1)-protease inhibitor (alpha(1)-PI) type 2, which is a member of the serine protease inhibitor superfamily of protease inhibitors that participate in a variety of physiological functions, including extracellular matrix remodeling and inflammation. The up-regulated expression of alpha(1)-PI type 2 was confirmed by real-time PCR. Then we examined mRNA expression of five members of the alpha(1)-PI family genes (alpha(1)-PI types 1-5) in several organs of BALB/c mice and found that in addition to the liver, all the organs tested also expressed different isoforms of alpha(1)-PI in a tissue-specific manner, albeit to a lesser extent compared with the liver. When a similar study was performed with C57BL/6 mice, which have been shown to be more susceptible to ovalbumin-induced asthma than BALB/c mice, a pair of remarkable differences between the mouse strains were revealed: (1) the magnitude of alpha(1)-PI type 2 mRNA in all the organs was much higher in BALB/c than in C57BL/6 mice and (2) alpha(1)-PI type 2 is the only isoform expressed in the lung of BALB/c, but not of C57BL/c mice. Using the antisense oligonucleotide technology to specifically down-regulate expression of alpha(1)-PI type 2, we demonstrated that pulmonary infiltration of eosinophils was significantly increased by intranasal administration of alpha(1)-PI type 2 antisense oligonucleotides in OVA-sensitized mice, suggesting that alpha(1)-PI type 2 may suppress the progress of asthma, probably by acting on neutrophil elastase, which can produce many of the pathological features of asthma.

  6. Clinical ineffectiveness of IL-2 and/or IFN alpha administration after autologous PBSC transplantation in pediatric oncological patients.

    PubMed

    Vlk, V; Eckschlager, T; Kavan, P; Kabícková, E; Koutecký, J; Sobota, V; Bubenik, J; Pospísilová, D

    2000-01-01

    Clinical impact of s.c. administration of IL-2 and/or IFN alpha was studied in 23 pediatric patients with Hodgkin lymphoma (IFN alpha group) and sarcoma, non-Hodgkin lymphoma, peripheral neuroepitelioma, neuroblastoma, and embryonic carcinoma (IL-2 + IFN alpha group) after autologous PBSC transplantation. Expression of CD3, CD4, CD8, CD25, CD38, CD56, CD71, CD122, and HLA-DR antigens, serum level of the soluble IL-2R alpha, and NK activity against K562 cell line were evaluated in 11 patients representative for both types of immunotherapy. T and, more markedly, NK cell proliferation, induction of activation markers on the surface of T and NK subsets, and elevation of sIL-2R alpha concentrations were seen in the IL-2 + IFN alpha subgroup. In the IFN alpha subgroup, the total number of lymphocytes and expression of activation markers remained unchanged, but the number of CD8+ T cells increased at the expense of CD4+ T and NK cells during the therapy. Cytotoxic activity against K562 cells was not influenced by the immunotherapy in either subgroup. No significant clinical benefit of the immunotherapy was seen in these patients compared to 27 control patients with relevant diagnoses who did not receive immunotherapy.

  7. Expressions of VEGF and its receptors in rat corpus luteum during interferon alpha administration in early and pseudopregnancy.

    PubMed

    Celik-Ozenci, Ciler; Akkoyunlu, Gokhan; Korgun, Emin Turkay; Savas, Burhan; Demir, Ramazan

    2004-04-01

    It is accepted that angiogenesis plays an important role in the development of the corpus luteum (CL) and is probably necessary for normal lutein cell function. A number of drugs currently being tested in clinical trials as possible angiogenesis inhibitors were not originally developed with the intention of suppressing tumor angiogenesis. Interferon alpha (IFN-alpha) is one of the notable examples of such 'accidental angiogenesis inhibitors' and daily administration of IFN-alpha is known to suppress tumor growth, tumor vascularization, and down-regulation of various growth factors. We investigated the effects of IFN-alpha treatment on the expression of vascular endothelial growth factor (VEGF), and its receptors KDR and Flt-1, and CD34 in CL during the first week of pseudopregnancy and pregnancy in hormonally induced rat ovaries by immunohistochemistry and Western blot techniques. Basal body temperatures of the drug-treated rats, as an indicator of treatment effect, were determined daily and were increased significantly when compared to controls (38.03 +/- 0.18 vs. 36.6 +/- 0.1 degrees C), respectively. The effect of IFN-alpha treatment was minimal when the entire week was evaluated, however, the expression of VEGF decreased at 3rd, 5th, and 7th days of both pregnancy and pseudopregnancy, when compared to the 1st day, whereas there was not a such alteration in the untreated rats regarding these days. The daily subcutaneous administrations of 672.500 U IFN-alpha2b had minimal effects on the expressions of VEGF, and its two receptors KDR and Flt-1 in either pregnant or pseudopregnant corpora lutea utilizing HSCORE.

  8. Homologue gene of bile acid transporters ntcp, asbt, and ost-alpha in rainbow trout Oncorhynchus mykiss: tissue expression, effect of fasting, and response to bile acid administration.

    PubMed

    Murashita, Koji; Yoshiura, Yasutoshi; Chisada, Shin-Ichi; Furuita, Hirofumi; Sugita, Tsuyoshi; Matsunari, Hiroyuki; Iwashita, Yasuro; Yamamoto, Takeshi

    2014-04-01

    Bile acid transporters belonging to the SLC10A protein family, Na+ taurocholate cotransporting polypeptide (NTCP or SLC10A1), apical sodium-dependent bile salt transporter (ASBT or SLC10A2), and organic solute transporter alpha (Ost-alpha) have been known to play critical roles in the enterohepatic circulation of bile acids in mammals. In this study, ntcp, asbt, and ost-alpha-1/-2 cDNA were cloned, their tissue distributions were characterized, and the effects of fasting and bile acid administration on their expression were examined in rainbow trout Oncorhynchus mykiss. The structural characteristics of Ntcp, Asbt, and Ost-alpha were well conserved in trout, and three-dimensional structure analysis showed that Ntcp and Asbt were similar to each other. Tissue distribution analysis revealed that trout asbt was primarily expressed in the hindgut, while ntcp expression occurred in the brain, and ost-alpha-1/-2 was mainly expressed in the liver or ovary. Although asbt and ost-alpha-1 mRNA levels in the gut increased in response to fasting for 4 days, ost-alpha-1 expression in the liver decreased. Similarly, bile acid administration increased asbt and ost-alpha-1 expression levels in the gut, while those of ntcp and ost-alpha-2 in the liver decreased. These results suggested that the genes asbt, ntcp, and ost-alpha are involved in bile acid transport in rainbow trout.

  9. Plasma luteinizing hormone and progesterone concentrations in goats with estrous cycles of normal or short duration after prostaglandin F2 alpha administration during diestrus or pregnancy.

    PubMed

    Bretzlaff, K N; Weston, P G; Hixon, J E; Ott, R S

    1988-06-01

    Plasma luteinizing hormone (LH) and progesterone concentrations were compared in does experiencing short-duration estrous cycles and in does with estrous cycles of normal duration. The short-duration estrous cycles were observed immediately after induction of abortion in pregnant does by use of prostaglandin (PG) F2 alpha. Intramuscular administration of 5 mg of PGF2 alpha was accomplished in 8 does that were 52 to 63 days into gestation and in 9 cycling does at 7 to 10 days after estrus. In both groups, the mean plasma concentration of progesterone decreased from a luteal phase concentration immediately before to less than 1 ng/ml by 24 hours after PGF2 alpha administration. Of the 8 does that aborted, 6 experienced short-duration estrous cycles, and 4 of these 6 had an LH surge during the time of blood sample collection. The mean time from PGF2 alpha administration to the LH surge was significantly (P less than 0.05) longer in does with short-duration estrous cycles (71 hours) than that in does with estrous cycles of normal duration (58 hours). The mean area under the LH concentration curve was significantly (P less than 0.005) less for does with short-duration estrous cycles. Short-duration estrous cycles were associated with delayed preovulatory LH surges of reduced magnitude. PMID:3165252

  10. Short-Term Effects of Repeated Olfactory Administration of Homeopathic Sulphur or Pulsatilla on Electroencephalographic Alpha Power in Healthy Young Adults

    PubMed Central

    Bell, Iris R.; Brooks, Audrey J.; Howerter, Amy; Jackson, Nicholas; Schwartz, Gary E.

    2011-01-01

    Introduction Homeopathic pathogenetic trials usually rely on symptom self report measures. Adding objective biomarkers could enhance detection of subtle initial remedy effects. The present feasibility study examined electroencephalographic (EEG) effects of repeated olfactory administration of two polycrest remedies. Methods College student volunteers (ages 18–30, both sexes) from an introductory psychology course were screened for good health and relatively elevated Sulphur OR Pulsatilla symptom scores on the Homeopathic Constitutional Type Questionnaire. Subjects underwent a series of 3 once-weekly double-blind sessions during which they repeatedly sniffed the remedy matched to their CTQ type and solvent controls. Each remedy was given in a 6c, 12c, and 30c potency, one potency per week, in randomly assigned order. Solvent controls included both plain distilled water and a water-ethanol (95%) solution. All sniff test solutions were further diluted just prior to laboratory sessions (0.5 ml test solution in 150 ml distilled water). Within a session, remedies and control solvents were administered via 2-second sniffs (8 sniffs of each of 4 different succussion levels for the potency in randomized order). Primary outcome variable was relative EEG power (alpha 1 8–10 hertz; alpha 2 10–12 hertz) averaged over 19 electrode sites, including all succussions for a given potency. Results Mixed-effect models revealed significant main effects for remedy type (Sulphur>Pulsatilla) in both alpha bands, controlling for gender, baseline resting EEG alpha, and solvent control responses. Additional analyses showed significant non-linear interactions between dilution and time (weekly session) in alpha 2 for both remedies and alpha 1 for Sulphur. Conclusion EEG alpha offers an objective biomarker of remedy effects for future studies and potential method for distinguishing time-dependent effects of specific remedies and remedy potencies from one another. PMID:21962194

  11. Repeated systemic administration of the nutraceutical alpha-linolenic acid exerts neuroprotective efficacy, an antidepressant effect and improves cognitive performance when given after soman exposure.

    PubMed

    Pan, Hongna; Piermartiri, Tetsade C B; Chen, Jun; McDonough, John; Oppel, Craig; Driwech, Wafae; Winter, Kristin; McFarland, Emylee; Black, Katelyn; Figueiredo, Taiza; Grunberg, Neil; Marini, Ann M

    2015-12-01

    Exposure to nerve agents results in severe seizures or status epilepticus caused by the inhibition of acetylcholinesterase, a critical enzyme that breaks down acetylcholine to terminate neurotransmission. Prolonged seizures cause brain damage and can lead to long-term consequences. Current countermeasures are only modestly effective against the brain damage supporting interest in the evaluation of new and efficacious therapies. The nutraceutical alpha-linolenic acid (LIN) is an essential omega-3 polyunsaturated fatty acid that has a wide safety margin. Previous work showed that a single intravenous injection of alpha-linolenic acid (500 nmol/kg) administered before or after soman significantly protected against soman-induced brain damage when analyzed 24h after exposure. Here, we show that administration of three intravenous injections of alpha-linolenic acid over a 7 day period after soman significantly improved motor performance on the rotarod, enhanced memory retention, exerted an anti-depressant-like activity and increased animal survival. This dosing schedule significantly reduced soman-induced neuronal degeneration in four major vulnerable brain regions up to 21 days. Taken together, alpha-linolenic acid reduces the profound behavioral deficits induced by soman possibly by decreasing neuronal cell death, and increases animal survival.

  12. Termination of pseudopregnancy by administration of prostaglandin F2alpha and termination of early pregnancy by administration of prostaglandin F2alpha or colchicine or by removal of embryo in mares.

    PubMed

    Kooistra, L H; Ginther, O J

    1976-01-01

    At day 24 of gestation, pregnant mares were allotted to 1 of 5 treatment groups (3 to 5 mares/group): group A--nontreated controls; group B--intraembryonic injection of 4 mg of colchicine on day 24; group C--removal of embryo on day 24; group D--subcutaneous injection of 1.25 mg of prostaglandin F2alpha (PGF2alpha) on day 32; and group E--removal of embryo on day 24 and subcutaneous injection of PGF2alpha on day 32. In all mares treated with colchicine (group B), the fetal bulge was absent within 2 days. The interval from injection of colchicine to onset of estrus was very short (mean, 4 days). These results indicated that treatment with colchicine was lethal to the 24-day embryo, and pseudopregnancy did not occur. Surgical removal of the embryo (group C) resulted in pseudopregnancy characterized by a prolonged interval from treatment to return to estrus (mean, greater than 31 days), prolonged production of progesterone, and prolonged maintenance of tense uterine and cervical tone. The interval from treatment to ovulatory estrus was longer (P less than 0.05) for group C mares than for group B mares. The mean interval from treatment to complete loss of tense tubular uterine tone was not significantly different between group A pregnant controls (28.3 days) and group C pseudopregnant mares (30 days). Treatment of pregnant mares (group D) with a single injection of PGF2alpha on day 32 resulted in loss of pregnancy in 4 of 4 mares within 2 to 5 days, and in all group D mares a large decrease in progesterone concentration occurred on day 33, 34, or 35. Although subsequent reproductive activity was variable, all group D mares rapidly lost the tense uterine and cervical tone characteristic of early pregnancy. These results indicated that a single subcutaneous injection of 1.25 mg of PGF2alpha caused loss of pregnancy, and pseudopregnancy did not occur. Treatment of group E mares, which had been made pseudopregnant by removal of embryo, with 1.25 mg of PGF2alpha resulted in

  13. Increased division of alpha beta TCR+ and gamma delta TCR+ intestinal intraepithelial lymphocytes after oral administration of cholera toxin.

    PubMed Central

    Penney, I; Kilshaw, P J; MacDonald, T T

    1996-01-01

    Cholera toxin (CT) or its subunits were given orally to mice and division of intestinal intraepithelial lymphocytes (IEL) in vivo measured by double immunofluorescence using 5-bromo-2'-deoxyuridine (BRdU) and membrane alpha beta T-cell receptors (TCR) or gamma delta TCR staining in frozen sections. Cholera toxin (10 micrograms) produced a two- to eightfold-increase in the uptake of BRdU in alpha beta TCR+ IEL in the duodenum and a two-to fivefold increase in gamma delta TCR IEL in the ileum. Increased uptake of BRdU was also seen after a dose of 100 micrograms of CT but this dose was also associated with the loss of alpha beta TCR+ IEL and gamma delta TCR+ IEL in the duodenum. CT-A and CT-B subunit produced increased BRdU incorporation by alpha beta TCR in the duodenum and by gamma delta TCR IEL in the ileum. Cholera toxin therefore appears to be mitogenic for IEL probably due to an indirect mechanism. Images Figure 1 PMID:8911140

  14. Subcutaneous administration of interleukin 2 and interferon-alpha-2b in advanced renal cell carcinoma: a confirmatory study.

    PubMed Central

    Facendola, G.; Locatelli, M. C.; Pizzocaro, G.; Piva, L.; Pegoraro, C.; Pallavicini, E. B.; Signaroldi, A.; Meregalli, M.; Lombardi, F.; Beretta, G. D.

    1995-01-01

    Recent clinical studies have suggested that the combination of subcutaneous recombinant human interleukin 2 (rIL-2) and interferon alpha (rIFN-alpha) is especially promising in advanced renal cell carcinoma. We assessed the safety, activity and toxicity of home therapy with these two agents in 50 patients. Each treatment cycle consisted of a 2 day pulse phase, with 9 x 10(6) IU m-2 of rIL-2 being given subcutaneously every 12 h, followed by a 6 week maintenance phase during which rIL-2 1.8 x 10(6) IU m-2 was administered subcutaneously every 12 h on days 1-5 and rIFN-alpha 2b 5 x 10(6) IU m-2 once a day on days 1, 3 and 5. Objective responses (CR+PR) occurred in 9/50 (18%) patients, six of whom (12%) achieved a complete response. Disease stabilisation was observed in 17 cases (34%) and 18 patients progressed during therapy. In the other six cases, treatment was interrupted early for toxicity or patient refusal. One patient died of myocardial infarction during the second cycle. The overall median survival was 12 months. Home therapy with subcutaneous rIL-2 + rIFN-alpha 2b proved to be active, feasible and moderately toxic, but serious adverse events can sometimes occur. PMID:8519672

  15. Effects of combined maternal administration with alpha-ketoglutarate (AKG) and β-hydroxy-β-methylbutyrate (HMB) on prenatal programming of skeletal properties in the offspring

    PubMed Central

    2012-01-01

    Background Nutritional manipulations during fetal growth may induce long-term metabolic effects in postnatal life. The aim of the study was to test whether combined treatment of pregnant sows with alpha-ketoglutarate and β-hydroxy-β-methylbutyrate induces additive long-term effects on skeletal system properties in the offspring. Methods The study was performed on 290 pigs obtained from 24 sows divided into 4 equal groups and subjected to experimental treatment during two weeks before delivery. The first group consisted of control sows, while the second group received alpha-ketoglutarate. The third group was treated with β-hydroxy-β-methylbutyrate and the fourth group underwent combined administration of alpha-ketoglutarate and β-hydroxy-β-methylbutyrate. Piglets obtained from sows were reared until slaughter age to perform morphometric, densitometric and mechanical analyses of femur. Serum evaluations of growth hormone, insulin-like growth factor-1, bone-specific alkaline phosphatase and osteocalcin were performed in newborns and 90-day old piglets; additionally, plasma amino acid concentration was measured in newborns. Results Maternal treatment with alpha-ketoglutarate and β-hydroxy-β-methylbutyrate significantly reduced fattening time and increased birth body weight, daily body weight gain, bone weight, volumetric bone mineral density, geometrical parameters and mechanical endurance of femur. These effects were associated with increased serum concentrations of growth hormone, insulin-like growth factor-1, bone-specific alkaline phosphatase and osteocalcin. Furthermore, alpha-ketoglutarate and β-hydroxy-β-methylbutyrate administered solely or in combination significantly increased plasma level of 19 amino acids. Conclusions Hormonal and amino acid evaluations in pigs indicate additive effects of AKG and HMB on systemic growth and development; however, determination of bone properties has not shown such phenomenon. PMID:22578071

  16. Expression of luteal estrogen receptor, interleukin-1, and apoptosis-associated genes after PGF2alpha administration in rabbits at different stages of pseudopregnancy.

    PubMed

    Maranesi, M; Zerani, M; Lilli, L; Dall'Aglio, C; Brecchia, G; Gobbetti, A; Boiti, C

    2010-08-01

    The dynamic expression for estrogen receptor subtype-1 (ESR1), interleukin-1beta (IL1B), and apoptosis-associated genes, as well as nitric oxide synthase activity, were examined in corpora lutea (CL) of rabbits after prostaglandin F(2alpha) (PGF(2alpha)) administration on either day 4 or day 9 of pseudopregnancy. By reverse transcriptase polymerase chain reaction, the steady-state level of ESR1 transcript was lower (P < 0.01) and that of anti-apoptotic B-cell CLL/lymphoma 2 (BCL2) -like 1 (BCL2L1) was greater in day 4 (P < 0.01) than in day 9 CL. Western blot analysis revealed that BCL2-associated X protein (BAX) abundance was greater in day 4 (P < 0.01) than in day 9 CL, whereas BCL2L1 protein was undetectable at both luteal stages. After PGF(2alpha), ESR1 transcript decreased (P < 0.01) in day 9 CL, whereas IL1B mRNA showed a transitory increase (P < 0.01) at both stages. The pro-apoptotic tumor protein p53 (TP53) gene had diminished (P < 0.01) on day 4 and on day 9 after a transitory increase (P < 0.01), whereas the BAX/BCL2L1 expression ratio increased (P < 0.01) in day 9 CL 24 h after treatment. Following PGF(2alpha), TP53 protein increased (P < 0.01) at both luteal stages, and BAX decreased (P < 0.01) in day 4 CL but increased (P < 0.01) 24 h later in day 9 CL; BCL2L1 became detectable 6 h later in day 4 CL. Nitric oxide synthase activity temporarily increased (P < 0.01) following PGF(2alpha). These findings suggest that PGF(2alpha) regulates luteolysis by ESR1 mRNA down-regulation and modulation of pro- and anti-apoptotic pathways in CL that have acquired a luteolytic capacity.

  17. Vitamin E levels in sheep tissues at various times after a single oral administration of d-alpha-tocopherol acetate.

    PubMed

    Hidiroglou, M

    1987-01-01

    Five groups, each of 5 sheep of 40-45 kg body weight were used. One group acted as control (killed at 0 time, no vitamin E dose) while the other four groups were given a single oral dose of d-alpha-tocopherol acetate (100 mg/kg body weight) and killed 24, 48, 72 and 240 h after dosing. Samples of adrenal, adipose, heart, liver, kidney, lung, muscle, pancreas and spleen were taken from all 25 sheep and were analyzed for their vitamin E content. In the control sheep the tocopherol concentration in some tissues such as pancreas and adrenal were substantially higher than in the other tissues. Muscle and adipose tissue contained the lowest tocopherol concentrations among the various tissues. Tissues responded differently to the vitamin E dosing. Liver was characterized by a rapid accumulation of alpha-tocopherol at 24 h followed by a progressive loss. In the adrenal and lung the peak occurred 48 h after vitamin E loading. The variable pattern in tocopherol concentrations in the various sheep tissues following vitamin E dosing was considered a reflection of their different metabolic activities.

  18. Intravenous administration of alpha-1-proteinase inhibitor in patients of PiZ and PiM phenotype. Preliminary report

    SciTech Connect

    Moser, K.M.; Smith, R.M.; Spragg, R.G.; Tisi, G.M.

    1988-06-24

    Nine patients with moderate pulmonary emphysema, six of PiZ phenotype and three of PiM phenotype, have received a single intravenous infusion of alpha-1-proteinase inhibitor (human) (A1PI), in a dose of 60 mg/kg over a 30-minute period. They also received a tracer dose (300 microCi) of /sup 131/I-labeled A1PI. No active or passive immunization against hepatitis was given. No acute toxicity was observed. Compared with baseline data, significant elevations of serum A1PI (measured both antigenically and as anti-elastase activity) occurred, with a serum half-life approximating 110 hours. Bronchoalveolar lavage fluid, obtained 48 hours after infusion, reflected a significant increase in A1PI concentration versus baseline bronchoalveolar lavage fluid values. Serial gamma camera images of the lungs confirmed persistence of enhanced lung radioactivity for several days. Urinary desmosine excretion did not change following A1PI infusion. During the period of follow-up thus far, no patient has had chronic toxicity, results of liver function tests have been stable, and there has been no development of hepatitis B antigen or antibodies to hepatitis B surface or core antigens.

  19. Simultaneous quantification of GABAergic 3alpha,5alpha/3alpha,5beta neuroactive steroids in human and rat serum.

    PubMed

    Porcu, Patrizia; O'Buckley, Todd K; Alward, Sarah E; Marx, Christine E; Shampine, Lawrence J; Girdler, Susan S; Morrow, A Leslie

    2009-01-01

    The 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone enhance GABAergic neurotransmission and produce inhibitory neurobehavioral and anti-inflammatory effects. Despite substantial information on the progesterone derivative (3alpha,5alpha)-3-hydroxypregnan-20-one (3alpha,5alpha-THP, allopregnanolone), the physiological significance of the other endogenous GABAergic neuroactive steroids has remained elusive. Here, we describe the validation of a method using gas chromatography-mass spectrometry to simultaneously identify serum levels of the eight 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone. The method shows specificity, sensitivity and enhanced throughput compared to other methods already available for neuroactive steroid quantification. Administration of pregnenolone to rats and progesterone to women produced selective effects on the 3alpha,5alpha- and 3alpha,5beta-reduced neuroactive steroids, indicating differential regulation of their biosynthetic pathways. Pregnenolone administration increased serum levels of 3alpha,5alpha-THP (+1488%, p<0.001), (3alpha,5alpha)-3,21-dihydroxypregnan-20-one (3alpha,5alpha-THDOC, +205%, p<0.01), (3alpha,5alpha)-3-hydroxyandrostan-17-one (3alpha,5alpha-A, +216%, p<0.001), (3alpha,5alpha,17beta)-androstane-3,17-diol (3alpha,5alpha-A-diol, +190%, p<0.01). (3alpha,5beta)-3-hydroxypregnan-20-one (3alpha,5beta-THP) and (3alpha,5beta)-3-hydroxyandrostan-17-one (3alpha,5beta-A) were not altered, while (3alpha,5beta)-3,21-dihydroxypregnan-20-one (3alpha,5beta-THDOC) and (3alpha,5beta,17beta)-androstane-3,17-diol (3alpha,5beta-A-diol) were increased from undetectable levels to 271+/-100 and 2.4+/-0.9 pg+/-SEM, respectively (5/8 rats). Progesterone administration increased serum levels of 3alpha,5alpha-THP (+1806%, p<0.0001), 3alpha,5beta-THP (+575%, p<0.001), 3alpha,5alpha

  20. [State of the antioxidative activity of erythrocyte membranes in rats exposed to x-rays after administration of alpha-tocopherol acetate].

    PubMed

    Tsvetkova, T V; Tsokur, E V

    1988-01-01

    Injection of alpha-tocopherol acetate to albino mongrel rats potentiates antioxidant activity (AOA) that involves water-soluble factors of the antioxidant system in erythrocyte membranes. The activation of AOA by alpha-tocopherol takes place immediately after irradiation and drug injection and persists during the first 24 h following irradiation.

  1. The effect of chronic administration of corticosterone on anxiety- and depression-like behavior and the expression of GABA-A receptor alpha-2 subunits in brain structures of low- and high-anxiety rats.

    PubMed

    Skórzewska, Anna; Lehner, Małgorzata; Wisłowska-Stanek, Aleksandra; Krząścik, Paweł; Ziemba, Andrzej; Płaźnik, Adam

    2014-01-01

    The aim of this study was to examine changes in rat emotional behavior and determine differences in the expression of GABA-A receptor alpha-2 subunits in brain structures of low- (LR) and high-anxiety (HR) rats after the repeated corticosterone administration. The animals were divided into LR and HR groups based on the duration of their conditioned freezing in a contextual fear test. Repeated daily administration of corticosterone (20 mg/kg) for 21 days decreased activity in a forced swim test, reduced body weight and decreased prefrontal cortex corticosterone concentration in both the LR and HR groups. These effects of corticosterone administration were stronger in the HR group in comparison with the appropriate control group, and compared to LR treated and LR control animals. Moreover, in the HR group, chronic corticosterone administration increased anxiety-like behavior in the open field and elevated plus maze tests. The behavioral effects in HR rats were accompanied by a decrease in alpha-2 subunit density in the medial prefrontal cortex (prelimbic cortex and frontal association cortex) and by an increase in the expression of alpha-2 subunits in the basolateral amygdala. These studies have shown that HR rats are more susceptible to anxiogenic and depressive effects of chronic corticosterone administration, which are associated with modification of GABA-A receptor function in the medial prefrontal cortex and basolateral amygdala. The current data may help to better understand the neurobiological mechanisms responsible for individual differences in changes in mood and emotions induced by repeated administration of high doses of glucocorticoids or by elevated levels of these hormones associated with chronic stress or affective pathology.

  2. Effects of a single administration of prostaglandin F2alpha, or a combination of prostaglandin F2alpha and prostaglandin E2, or placebo on fertility variables in dairy cows 3–5 weeks post partum, a randomized, double-blind clinical trial

    PubMed Central

    Hirsbrunner, Gaby; Burkhardt, Heinz W; Steiner, Adrian

    2006-01-01

    Background Delayed uterine involution has negative effects on the fertility of cows; use of prostaglandin F2alpha alone as a single treatment has not been shown to consistently improve fertility. Combined administration of PGF2alpha and PGE2 increased uterine pressure in healthy cows. We hypothesized, that the combination of both prostaglandins would accelerate uterine involution and have, therefore, a positive effect on fertility variables. In commercial dairy farming, the benefit of a single post partum combined prostaglandin treatment should be demonstrated. Methods 383 cows from commercial dairy farms were included in this study. Uterine size and secretion were evaluated at treatment 21–35 days post partum and 14 days later. Cows were randomly allocated to one of three treatment groups: PGF2alpha and PGE2, PGF2alpha or placebo. For every animal participating in the study, the following reproduction variables were recorded: Interval from calving to first insemination, days open, number of artificial inseminations (AI) to conception; subsequent treatment of uterus, subsequent treatment of ovaries. Plasma progesterone level at time of treatment was used as a covariable. For continuous measurements, analysis of variance was performed. Fisher's exact test for categorical non-ordered data and exact Kruskal-Wallis test for ordered data were used; pairwise group comparisons with Bonferroni adjustment of significance level were performed. Results There was no significant difference among treatment groups in uterine size. Furthermore, there was no significant difference among treatments concerning days open, number of AI, and subsequent treatment of uterus and ovaries. Days from calving to first insemination tended to be shorter for cows with low progesterone level given PGF2alpha and PGE2 in combination than for the placebo-group (P = 0.024). Conclusion The results of this study indicate that the administration of PGF2alpha or a combination of PGF2alpha and PGE2 21 to

  3. Radioimmunoassay of norethindrone (17 alpha-ethynyl-17 beta-hydroxy-4-estren-3-one) and ethynyl-estradiol (17 alpha-ethynyl-1,3,5, (10)-estratien-3, 17 beta-diol). Application to human plasma determination of norethindrone after oral administration of this steroid.

    PubMed

    Pasqualini, J R; Castellet, R; Portois, M C; Hill, J L; Kincl, F A; Cortes-Prieto, J

    1975-01-01

    The experiment conditions for the evaluation of Norethindrone (17 alpha-Ethynyl-17 beta-hydroxy-4-estren-3-one, NET) and Ethynyl-estradiol (17 alpha-ethynyl-1, 3, 5 (10) estratrien-3, 17 beta-diol, EE) by radioimmunoassay are described. A minimal quantity of 25 pg of these two steroids could be evaluated using different reduced metabolites of NET, very little cross reaction is observed with 200 pg of these metabolites. No effect was observed with estradiol for the EE-antiserum. The NET-antiserum was used to evaluate this steroid and ethynodiol diacetate after oral administration to female volunteers. Maximal values in the plasma (2-3% of the administered dose) was found between 1-3 h after administration and at 24 h a concentration of 0.1-0.3% still remained in the plasma.

  4. Administration of interleukin-10 at the time of priming protects Corynebacterium parvum-primed mice against LPS- and TNF-alpha-induced lethality.

    PubMed

    Smith, S R; Terminelli, C; Denhardt, G; Narula, S; Thorbecke, G J

    1996-11-01

    Several laboratories have described the protective effects of interleukin-10 (IL-10) in mouse models of lethal endotoxemia. In most of these experiments, protection was observed in normal mice that were given a lethal dose of LPS. However, we failed to observe protection with IL-10 in LPS-challenged mice that had been primed with Corynebacterium parvum (Proprionibacterium acnes). We have extended our studies with IL-10 in C. parvum-primed mice and in some cases have observed protection that appears to depend on the strength of the sensitization to C. parvum. When IL-10 was administered to mice at the time of priming, it was particularly effective in blocking sensitization, as evidenced by the inability of treated mice to mount a strong inflammatory cytokine response when subsequently challenged with LPS. Following such treatment with IL-10, C. parvum-primed mice were also protected from a subsequent lethal challenge with rMuTNF-alpha. In addition, the mice were protected against LPS- and TNF-alpha-induced lethality with a single dose of an anti-TNF-alpha or anti-IFN-gamma mAb given at the time of priming. Our results suggest that TNF-alpha and IFN-gamma are produced early after priming with C. parvum and are at least partly responsible for the enhanced sensitivity of the mice to LPS and TNF-alpha. IL-10 affords protection to the mice because of its ability to block the C. parvum-induced TNF-alpha and IFN-gamma responses. PMID:8912878

  5. Prolonged administration in vivo of alpha and beta adrenergic agonists decreases insulin binding to rat myocardial membranes in vitro by different mechanisms

    SciTech Connect

    Desoye, G.; Ertl-Stockinger, U.; Porta, S. )

    1991-01-01

    Male Sprague Dawley rats were continuously treated in vivo for 6, 12 and 20 hours with a combination of an alpha- (beta-) adrenoreceptor agonist and a beta- (alpha-) adrenoreceptor antagonist in subcutaneously implanted depot tablets. Crude membranes prepared from myocardial cells exhibited a decreased maximum binding of ({sup 125}I)-insulin after 20 hours irrespective of the treatment applied. Scatchard and non-linear regression analysis of the displacement curves assuming two non-cooperative binding sites revealed a downregulation of the high affinity receptors for about 85% and a concomitant 2.5-fold increased receptor affinity under beta-adrenergic influence. In contrast, alpha-adrenergic treatment did not affect the receptor number but decreased the high affinity by 70%. The low affinity binding sites were virtually unaffected by the different treatments. The phospholipid and cholesterol contents of the membranes were not significantly altered. The phospholipid/cholesterol ratios after 12 and 20 hours of alpha-adrenergic treatment, however, were decreased.

  6. Chronic administration of cholesterol oximes in mice increases transcription of cytoprotective genes and improves transcriptome alterations induced by alpha-synuclein overexpression in nigrostriatal dopaminergic neurons

    PubMed Central

    Richter, Franziska; Gao, Fuying; Medvedeva, Vera; Lee, Patrick; Bove, Nicholas; Fleming, Sheila M.; Michaud, Magali; Lemesre, Vincent; Patassini, Stefano; De La Rosa, Krystal; Mulligan, Caitlin K.; Sioshansi, Pedrom; Zhu, Chunni; Coppola, Giovanni; Bordet, Thierry; Pruss, Rebecca; Chesselet, Marie-Françoise

    2014-01-01

    Cholesterol-oximes TRO19622 and TRO40303 target outer mitochondrial membrane proteins and have beneficial effects in preclinical models of neurodegenerative diseases leading to their advancement to clinical trials. Dopaminergic neurons degenerate in Parkinson’s disease (PD) and are prone to oxidative stress and mitochondrial dysfunction. In order to provide insights into the neuroprotective potential of TRO19622 and TRO40303 for dopaminergic neurons in vivo, we assessed their effects on gene expression in laser captured nigrostriatal dopaminergic neurons of wildtype mice and of mice that over-express alpha-synuclein, a protein involved in both familial and sporadic forms of PD (Thy1-aSyn mice). Young mice were fed the drugs in food pellets or a control diet from 1 to 4 months of age, approximately 10 months before the appearance of striatal dopamine loss in this model. Unbiased weighted gene co-expression network analysis (WGCNA) of transcriptional changes revealed effects of cholesterol oximes on transcripts related to mitochondria, cytoprotection and anti-oxidant response in wild-type and transgenic mice, including increased transcription of stress defense (e.g. Prdx1, Prdx2, Glrx2, Hspa9, Pink1, Drp1, Trak1) and dopamine-related (Th, Ddc, Gch1, Dat, Vmat2, Drd2, Chnr6a) genes. Even at this young age transgenic mice showed alterations in transcripts implicated in mitochondrial function and oxidative stress (e.g. Bcl-2, Bax, Casp3, Nos2), and both drugs normalized about 20% of these alterations. Young Thy1-aSyn mice exhibit motor deficits that differ from parkinsonism and are established before the onset of treatment; these deficits were not improved by cholesterol oximes. However, high doses of TRO40303 improved olfaction and produced the same effects as dopamine agonists on a challenging beam test, specifically an increase in footslips, an observation congruent with its effects on transcripts involved in dopamine synthesis. High doses of TRO19622 increased

  7. Alpha 7-type nicotinic acetylcholine receptor and prodynorphin mRNA expression after administration of (-)-nicotine and U-50,488H in beta-amyloid peptide (25-35)-treated mice.

    PubMed

    Hiramatsu, M; Watanabe, M; Baba, S; Kojima, R; Nabeshima, T

    2004-10-01

    We previously reported that (-)-nicotine and kappa-opioid receptor agonists lessened impairment of learning and/or memory in several animal models. Furthermore, these drugs prevented neurodegenerative damage induced by ischemia or beta-amyloid peptide (25-35). In the present study, we tested whether (-)-nicotine and U-50,488H prevent delayed-memory impairment induced by beta-amyloid peptide (25-35), and changes of expression of alpha7-type nicotinic acetylcholine receptor mRNA and prodynorphin mRNA. Seven days after treatment with beta-amyloid peptide (25-35) (9 nmol/mouse, i.c.v.), memory impairment was observed in the Y-maze test. Memory impairment was prevented when (-)-nicotine (6.16 micromol/kg, s.c.) or U-50,488H (21 micromol/kg, s.c.) was administered 1 h before, but not 1 h after, beta-amyloid peptide (25-35) treatment. There was no change in prodynorphin mRNA or alpha7-type nicotinic acetylcholine receptor mRNA expression in the hippocampus 10 days after beta-amyloid peptide (25-35) treatment alone. Of interest, mRNA expression of not only prodynorphin, but also the alpha7-type nicotinic acetylcholine receptor, was significantly decreased when U-50,488H was administered 1 h before, but not 1 h after, treatment with beta-amyloid peptide (25-35). However, these changes were not observed after the administration of (-)-nicotine. These results suggest that activation of the kappa-opioid system, but not beta7-type nicotinic receptors has a neuroprotective effect on beta-amyloid peptide (25-35)-induced memory impairment, and may be involved in the long-lasting changes in the expression of these mRNAs.

  8. Effect of alpha lipoic acid co-administration on structural and immunohistochemical changes in subcutaneous tissue of anterior abdominal wall of adult male albino rat in response to polypropylene mesh implantation

    PubMed Central

    Mazroa, Shireen A; Asker, Samar A; Asker, Waleed; Abd Ellatif, Mohamed

    2015-01-01

    Polypropylene mesh is commonly used in the treatment of abdominal hernia. Different approaches were addressed to improve their tissue integration and consequently reduce long-term complications. This study aimed to investigate the effect of alpha-lipoic acid (ALA) co-administration on structural and immunohistochemical (IHC) changes in the subcutaneous tissues of the anterior abdominal wall of the adult rat in response to polypropylene mesh implantation. Forty adult male albino rats were divided into: group I (control), group II (receiving ALA), group III (polypropylene mesh implantation) and group IV (mesh implantation + ALA co-administration). After 4 weeks, subcutaneous tissue samples were prepared for light microscopy and IHC study of CD34 as a marker for angiogenesis. In groups I and II rats, positive CD34 expression was demonstrated by IHC reaction, localized to endothelial cells lining small blood vessels. Group III showed an excess inflammatory reaction, deposition of both regular and irregularly arranged collagen fibres around mesh pores and few elastic fibres. CD34-positive was detected not only in cells lining small blood vessels but also in other cells scattered in the connective tissue indicating angiogenesis. In group IV, ALA co-administration resulted in less inflammatory reaction, regular collagen deposition, enhanced elastic fibres synthesis and a significant increase in CD34-positive cells and small blood vessels reflecting improved angiogenesis. ALA co-administration with polypropylene mesh implantation controlled the inflammatory reaction, helped regular collagen deposition, enhanced elastic fibres synthesis and improved angiogenesis in the subcutaneous tissue of anterior abdominal wall of adult albino rats, suggesting a possible role of ALA in optimizing mesh integration in subcutaneous tissue. PMID:25891652

  9. Effect of alpha lipoic acid co-administration on structural and immunohistochemical changes in subcutaneous tissue of anterior abdominal wall of adult male albino rat in response to polypropylene mesh implantation.

    PubMed

    Mazroa, Shireen A; Asker, Samar A; Asker, Waleed; Abd Ellatif, Mohamed

    2015-06-01

    Polypropylene mesh is commonly used in the treatment of abdominal hernia. Different approaches were addressed to improve their tissue integration and consequently reduce long-term complications. This study aimed to investigate the effect of alpha-lipoic acid (ALA) co-administration on structural and immunohistochemical (IHC) changes in the subcutaneous tissues of the anterior abdominal wall of the adult rat in response to polypropylene mesh implantation. Forty adult male albino rats were divided into: group I (control), group II (receiving ALA), group III (polypropylene mesh implantation) and group IV (mesh implantation + ALA co-administration). After 4 weeks, subcutaneous tissue samples were prepared for light microscopy and IHC study of CD34 as a marker for angiogenesis. In groups I and II rats, positive CD34 expression was demonstrated by IHC reaction, localized to endothelial cells lining small blood vessels. Group III showed an excess inflammatory reaction, deposition of both regular and irregularly arranged collagen fibres around mesh pores and few elastic fibres. CD34-positive was detected not only in cells lining small blood vessels but also in other cells scattered in the connective tissue indicating angiogenesis. In group IV, ALA co-administration resulted in less inflammatory reaction, regular collagen deposition, enhanced elastic fibres synthesis and a significant increase in CD34-positive cells and small blood vessels reflecting improved angiogenesis. ALA co-administration with polypropylene mesh implantation controlled the inflammatory reaction, helped regular collagen deposition, enhanced elastic fibres synthesis and improved angiogenesis in the subcutaneous tissue of anterior abdominal wall of adult albino rats, suggesting a possible role of ALA in optimizing mesh integration in subcutaneous tissue.

  10. SU-E-T-588: Optimization of Imaging Following 223Ra Administration in Targeted Alpha-Emitting Radionuclide Therapy of Bone Metastases

    SciTech Connect

    Benabdallah, N; Bernardini, M; Desbree, A; Labriolle-Vaylet, C de; Franck, D

    2015-06-15

    Purpose: With a growing demand of alpha-emitting radiopharmaceuticals, especially Xofigo ({sup 223}RaCl{sub 2}) which is used in the treatment of metastatic bone disease, the optimization of dosimetry becomes necessary. Indeed, in Europe, as stated on the council directive 2013/59/euratom, exposures of target volumes for radiotherapeutic purposes shall be individually planned taking into account that doses to non-target volumes and tissues shall be as low as reasonably achievable. To that aim, the possibility of imaging {sup 223}Ra was first investigated. Methods: The experiments were conducted at the Hopital Europeen Georges Pompidou with an Infinia Hawkeye 4 gamma camera, equipped with a medium-energy collimator. Imaging parameters, such as sensibility, spatial resolution and energy spectrum, were determined using several physical phantoms with a source of 6 MBq of {sup 223}Ra. Bone metastases were modeled with a NEMA Body Phantom to investigate image degradation based on the concentration of {sup 223}Ra. Results: The acquired energy spectrum allowed to visualize several photon peaks: at 85, 154 and 270 keV. Camera sensitivity measured from the phantom study was 102.3 cps/MBq for the 85 keV ± 20 %, 89.9 cps/MBq for the 154 ± 20 % window and 65.4 cps/MBq for the 270 ± 10 % window. The spatial resolution (full-width at half-maximum) was respectively 1.7, 1.9 and 1.8 cm for the three energy windows. SPECT/CT images of NEMA Body Phantom without and with attenuation have permitted to determine the best reconstruction parameters. Conclusion: This study has demonstrated that it is possible to obtain clinically relevant information from images of {sup 223}Ra. All these results will be valuable to analyze biodistribution imaging of the radiopharmaceutical in the patient body and go further in the reconstruction of patient images in order to personalize the dosimetry.

  11. Contribution of interleukin-1 to activation of coagulation and fibrinolysis, neutrophil degranulation, and the release of secretory-type phospholipase A2 in sepsis: studies in nonhuman primates after interleukin-1 alpha administration and during lethal bacteremia.

    PubMed

    Jansen, P M; Boermeester, M A; Fischer, E; de Jong, I W; van der Poll, T; Moldawer, L L; Hack, C E; Lowry, S F

    1995-08-01

    Although studies with interleukin-1 receptor antagonist (IL-1ra) in animal models have shown that IL-1 contributes to mortality in sepsis, the mechanisms whereby IL-1 mediates lethal effects are not well established. A possible mechanism is that IL-1 enhances the activation and release of other inflammatory mediator systems such as coagulation, fibrinolysis, neutrophils, and secretory-type phospholipase A2 (sPLA2). We investigated this possibility by assessing the effect of intravenously injected recombinant human IL-1 alpha (rhIL-1 alpha) on these plasma parameters in baboons. In addition, we examined the course of these inflammatory parameters in baboons after a challenge with a lethal dose of Escherichia coli and while receiving a 24-hour constant infusion of IL-1ra or placebo. Intravenous administration of IL-1 alpha (10 micrograms/kg) induced the formation of thrombin, as evidenced by the appearance of thrombin-antithrombin III (TAT) complexes into the circulation (peak levels, 188 +/- 92 ng/mL at 2 hours), as well as the activation of fibrinolysis, assessed by circulating plasmin-alpha 2-antiplasmin complexes (PAP complexes; peak levels, 0.4% +/- 0.03% of fully activated plasma at 1 hour), the release of tissue-type plasminogen activator (t-PA; peak levels, 6 +/- 2 ng/mL at 2 hours), and its inhibitor, plasminogen activator inhibitor (PAI; peak levels, 724 +/- 246 ng/mL at 4 hours). Il-1 alpha administration also induced the release of sPLA2 (maximal levels, 336 +/- 185 ng/mL at 8 hours), but not degranulation of neutrophils. In the septic baboons, a significant reduction of the formation of thrombin (peak TAT levels decreased from 582 +/- 78 ng/mL to 219 +/- 106 ng/mL; P < .005), the release of t-PA (peak levels decreased from 37 +/- 11 ng/mL to 17 +/- 2 ng/mL; P < .001), and its inhibitor, PAI (peak levels decreased from 2,639 +/- 974 ng/mL to 1,110 +/- 153 ng/mL; P <.001), was observed in the group receiving IL-1ra compared to that receiving placebo. The

  12. Boron concentration measurements by alpha spectrometry and quantitative neutron autoradiography in cells and tissues treated with different boronated formulations and administration protocols.

    PubMed

    Bortolussi, Silva; Ciani, Laura; Postuma, Ian; Protti, Nicoletta; Luca Reversi; Bruschi, Piero; Ferrari, Cinzia; Cansolino, Laura; Panza, Luigi; Ristori, Sandra; Altieri, Saverio

    2014-06-01

    The possibility to measure boron concentration with high precision in tissues that will be irradiated represents a fundamental step for a safe and effective BNCT treatment. In Pavia, two techniques have been used for this purpose, a quantitative method based on charged particles spectrometry and a boron biodistribution imaging based on neutron autoradiography. A quantitative method to determine boron concentration by neutron autoradiography has been recently set-up and calibrated for the measurement of biological samples, both solid and liquid, in the frame of the feasibility study of BNCT. This technique was calibrated and the obtained results were cross checked with those of α spectrometry, in order to validate them. The comparisons were performed using tissues taken form animals treated with different boron administration protocols. Subsequently the quantitative neutron autoradiography was employed to measure osteosarcoma cell samples treated with BPA and with new boronated formulations.

  13. Alpha Thalassemia

    MedlinePlus

    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  14. Reversal of age-related increase in brain protein oxidation, decrease in enzyme activity, and loss in temporal and spatial memory by chronic administration of the spin-trapping compound N-tert-butyl-alpha-phenylnitrone

    SciTech Connect

    Carney, J.M.; Starke-Reed, P.E.; Oliver, C.N.; Landum, R.W.; Cheng, M.S.; Wu, J.F.; Floyd, R.A. )

    1991-05-01

    Oxygen free radicals and oxidative events have been implicated as playing a role in bringing about the changes in cellular function that occur during aging. Brain readily undergoes oxidative damage, so it is important to determine if aging-induced changes in brain may be associated with oxidative events. Previously we demonstrated that brain damage caused by an ischemia/reperfusion insult involved oxidative events. In addition, pretreatment with the spin-trapping compound N-tert-butyl-alpha-phenylnitrone (PBN) diminished the increase in oxidized protein and the loss of glutamine synthetase (GS) activity that accompanied ischemia/reperfusion injury in brain. We report here that aged gerbils had a significantly higher level of oxidized protein as assessed by carbonyl residues and decreased GS and neutral protease activities as compared to young adult gerbils. We also found that chronic treatment with the spin-trapping compound PBN caused a decrease in the level of oxidized protein and an increase in both GS and neutral protease activity in aged Mongolian gerbil brain. In contrast to aged gerbils, PBN treatment of young adult gerbils had no significant effect on brain oxidized protein content or GS activity. Male gerbils, young adults (3 months of age) and retired breeders (15-18 months of age), were treated with PBN for 14 days with twice daily dosages of 32 mg/kg. If PBN administration was ceased after 2 weeks, the significantly decreased level of oxidized protein and increased GS and neutral protease activities in old gerbils changed in a monotonic fashion back to the levels observed in aged gerbils prior to PBN administration. We also report that old gerbils make more errors than young animals and that older gerbils treated with PBN made fewer errors in a radial arm maze test for temporal and spatial memory than the untreated aged controls.

  15. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  16. Variations in Mechanical Parameters of Rock Mass Affecting Shaft Lining / Zmiany Parametrów Mechanicznych Górotworu I Ich Wpływ Na Obudowę Szybową

    NASA Astrophysics Data System (ADS)

    Majcherczyk, Tadeusz; Niedbalski, Zbigniew; Wałach, Daniel

    2013-09-01

    początkowej długości. W otoczeniu głębionego szybu występują grunty spoiste, głównie w postaci glin z przerostami piasków oraz pyły. Taka litologia powoduje, że na różnych poziomach część warstw gruntu jest zawodniona. Wpływa to na dużą zmienność własności gruntów wokół szybu oraz zmiany tych własności w czasie. Przy dużym zawodnieniu grunt był wymywany zza obudowy, co prowadziło do lokalnej utraty kontaktu pomiędzy obudową a otaczającym gruntem oraz braku właści- wego podparcia dla stóp szybowych. Efektem tego było na niewielkim odcinku szybu pękanie obudowy. Podjęte działania, które sprowadziły się do wykonania iniekcji na pewnym odcinku szybu doprowadziły do przywrócenia właściwej współpracy obudowa - górotwór. Przeprowadzone badania gruntu zza obudowy posłużyły do podjęcia działań w celu zwiększenia nośności stóp szybowych. Badania gruntu wykazały, że kąt tarcia wewnętrznego oraz spójność zmieniają się nie tylko na poszczególnych głębokościach, ale także obserwuje się duże różnice dla próbek pobranych z tej samej głębokości ale z różnych punktów na obwodzie szybu. Badania wykazały także wzrost parametrów mechanicznych badanych gruntów wraz z oddalaniem się od obudowy, co świadczy o zmianie własności gruntów bezpośrednio w sąsiedztwie szybu. Duża liczba wykonanych badań pozwoliła na opracowanie zależności pomiędzy wilgotnością a kątem tarcia wewnętrznego i spójnością. Na podstawie uzyskanych zależności można szacować z dużą dokładnością zmianę własności gruntów pod wpływem działania wody. Zrealizowane wzmocnienia stóp szybowych z wykorzystaniem kotew gruntowych pozwoliły na podjęcie dalszego głębienia szybu. Przeprowadzone na analizowanym odcinku badania betonu z obudowy szybu wykazały wartości zgodne z projektem.

  17. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  18. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  19. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  20. alpha-Hexachlorocyclohexane (alpha-HCH)

    Integrated Risk Information System (IRIS)

    alpha - Hexachlorocyclohexane ( alpha - HCH ) ; CASRN 319 - 84 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Ass

  1. Alpha-1 Antitrypsin Test

    MedlinePlus

    ... measures the level of the protein AAT in blood. Alpha-1 antitrypsin phenotype testing evaluates the amount and type of AAT being produced and compares it to normal patterns. Alpha-1 antitrypsin genotype testing ( DNA testing) can ...

  2. Alpha-1 antitrypsin test

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003715.htm Alpha-1 antitrypsin test To use the sharing features on this page, please enable JavaScript. Alpha-1 antitrypsin is a laboratory test to measure the ...

  3. The Alpha Centauri System.

    ERIC Educational Resources Information Center

    Soderblom, David R.

    1987-01-01

    Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

  4. The Alpha-Helix Concept: Innovative utilization of the Space Station Program. A report to the National Aeronautical and Space Administration requesting establishment of a Sensory Physiology Laboratory on the Space Station

    NASA Astrophysics Data System (ADS)

    Bandurski, R. S.; Singh, N.

    1983-10-01

    A major laboratory dedicated to biological-medical research is proposed for the Space Platform. The laboratory would focus on sensor physiology and biochemistry since sensory physiology represents the first impact of the new space environment on living organisms. Microgravity and the high radiation environment of space would be used to help solve the problems of prolonged sojourns in space but, more importantly, to help solve terrestrial problems of human health and agricultural productivity. The emphasis would be on experimental use of microorganisms and small plants and small animals to minimize the space and time required to use the Space Platform for maximum human betterment. The Alpha Helix Concept, that is, the use of the Space Platform to bring experimental biomedicine to a new and extreme frontier is introduced so as to better understand the worldly environment. Staffing and instrumenting the Space Platform biomedical laboratory in a manner patterned after successful terrestrial sensory physiology laboratories is also proposed.

  5. The Alpha-Helix Concept: Innovative utilization of the Space Station Program. A report to the National Aeronautical and Space Administration requesting establishment of a Sensory Physiology Laboratory on the Space Station

    NASA Technical Reports Server (NTRS)

    Bandurski, R. S.; Singh, N.

    1983-01-01

    A major laboratory dedicated to biological-medical research is proposed for the Space Platform. The laboratory would focus on sensor physiology and biochemistry since sensory physiology represents the first impact of the new space environment on living organisms. Microgravity and the high radiation environment of space would be used to help solve the problems of prolonged sojourns in space but, more importantly, to help solve terrestrial problems of human health and agricultural productivity. The emphasis would be on experimental use of microorganisms and small plants and small animals to minimize the space and time required to use the Space Platform for maximum human betterment. The Alpha Helix Concept, that is, the use of the Space Platform to bring experimental biomedicine to a new and extreme frontier is introduced so as to better understand the worldly environment. Staffing and instrumenting the Space Platform biomedical laboratory in a manner patterned after successful terrestrial sensory physiology laboratories is also proposed.

  6. 29 CFR 1915.1004 - alpha-Naphthylamine.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 29 Labor 7 2012-07-01 2012-07-01 false alpha-Naphthylamine. 1915.1004 Section 1915.1004 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... § 1915.1004 alpha-Naphthylamine. Note: The requirements applicable to shipyard employment under...

  7. 29 CFR 1910.1004 - alpha-Naphthylamine.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 29 Labor 6 2013-07-01 2013-07-01 false alpha-Naphthylamine. 1910.1004 Section 1910.1004 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... alpha-Naphthylamine. See § 1910.1003, 13 carcinogens....

  8. 29 CFR 1910.1004 - alpha-Naphthylamine.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 29 Labor 6 2012-07-01 2012-07-01 false alpha-Naphthylamine. 1910.1004 Section 1910.1004 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... alpha-Naphthylamine. See § 1910.1003, 13 carcinogens....

  9. 29 CFR 1910.1004 - alpha-Naphthylamine.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 29 Labor 6 2014-07-01 2013-07-01 true alpha-Naphthylamine. 1910.1004 Section 1910.1004 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... alpha-Naphthylamine. See § 1910.1003, 13 carcinogens....

  10. 29 CFR 1915.1004 - alpha-Naphthylamine.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 29 Labor 7 2014-07-01 2014-07-01 false alpha-Naphthylamine. 1915.1004 Section 1915.1004 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... § 1915.1004 alpha-Naphthylamine. Note: The requirements applicable to shipyard employment under...

  11. 29 CFR 1915.1004 - alpha-Naphthylamine.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 29 Labor 7 2013-07-01 2013-07-01 false alpha-Naphthylamine. 1915.1004 Section 1915.1004 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... § 1915.1004 alpha-Naphthylamine. Note: The requirements applicable to shipyard employment under...

  12. Lactose and fatty acid synthesis in lactating-rat mammary gland. Effects of starvation, re-feeding, and administration of insulin, adrenaline, streptozotocin and 2-bromo-alpha-ergocryptine.

    PubMed Central

    Bussmann, L E; Ward, S; Kuhn, N J

    1984-01-01

    Lactose synthesis and fatty acid synthesis in intact lactating-rat mammary gland were measured simultaneously by incorporation of [U-14C]glucose and of both [U-14C]glucose and 3H2O respectively. Both processes were almost abolished by overnight starvation. Self-re-feeding caused recovery of lipogenesis to 100% of normal by 2 h and to 170% by 5 h. Lactose synthesis recovered to 80% of normal by 5 h. Food intubated to starved rats caused partial recovery in 3 h, standard diet favouring lactose synthesis and sugars favouring lipogenesis. Casein and starch were ineffective. Olive oil intubated to fed rats suppressed lipogenesis greatly and lactose synthesis slightly. Paraffin oil or water partly mimicked these effects. Adrenaline (subcutaneous) decreased lipogenesis from glucose, whereas insulin (subcutaneous) caused hypoglycaemia associated with loss of lactose synthesis but unchanged fatty acid synthesis. Streptozotocin and 2-bromo-alpha-ergocryptine (CB-154) impaired lipogenesis but not lactose synthesis. The results are interpreted in terms of competition for intracellular glucose by biosynthetic pathways for lactose and fat, and the possible implications for variations in milk composition are discussed. PMID:6232923

  13. Administrative Synergy

    ERIC Educational Resources Information Center

    Hewitt, Kimberly Kappler; Weckstein, Daniel K.

    2012-01-01

    One of the biggest obstacles to overcome in creating and sustaining an administrative professional learning community (PLC) is time. Administrators are constantly deluged by the tyranny of the urgent. It is a Herculean task to carve out time for PLCs, but it is imperative to do so. In this article, the authors describe how an administrative PLC…

  14. Peripherally mediated antinociception of the mu-opioid receptor agonist 2-[(4,5alpha-epoxy-3-hydroxy-14beta-methoxy-17-methylmorphinan-6beta-yl)amino]acetic acid (HS-731) after subcutaneous and oral administration in rats with carrageenan-induced hindpaw inflammation.

    PubMed

    Bileviciute-Ljungar, Indre; Spetea, Mariana; Guo, Yan; Schütz, Johannes; Windisch, Petra; Schmidhammer, Helmut

    2006-04-01

    Opioids induce analgesia by activating opioid receptors not only within the central nervous system but also on peripheral sensory neurons. This study investigated peripherally mediated antinociception produced by the mu-opioid receptor agonist 2-[(4,5alpha-epoxy-3-hydroxy-14beta-methoxy-17-methylmorphinan-6beta-yl)amino]acetic acid (HS-731) after s.c. and oral administration in rats with carrageenan-induced hindpaw inflammation. Antinociceptive effects after s.c. administration were assessed 3 h after intraplantar carrageenan injection and compared with those of centrally acting mu-opioid agonists 14-methoxymetopon and morphine. Opioid agonists caused dose-dependent increases in inflamed paw withdrawal latencies to mechanical and thermal stimulation. The time course of action was different, in that HS-731 (20 microg/kg s.c.) produced significant long-lasting effects up to 4 h after administration, whereas 14-methoxymetopon (20 microg/kg) and morphine (2 mg/kg) reached their peak of action at 10 to 30 min, and their effect declined rapidly thereafter. Subcutaneous administration of the peripherally selective opioid antagonist naloxone methiodide inhibited antinociception elicited by HS-731 (20 microg/kg s.c.), whereas it was ineffective against 14-methoxymetopon (20 microg/kg s.c.). Moreover, the antinociception produced by 100 microg/kg s.c. HS-731 was dose-dependently reversed by s.c. naloxone methiodide. This indicates that HS-731 preferentially activates peripheral opioid receptors, whereas 14-methoxymetopon mediates analgesia via central mechanisms. Orally administered HS-731 significantly reduced hyperalgesia in the inflamed paw induced by carrageenan, which was reversible by s.c. administered naloxone methiodide. These results show that systemic (s.c. and oral) treatment with the mu-opioid agonist HS-731 produces potent and long-lasting antinociception through peripheral mechanisms in rats with carrageenan-induced hindpaw inflammation.

  15. Assessment of Impact of the Rheological Parameters Change on Sensitivity of the Asphalt Strain Based on the Test Results / Ocena Wpływu Zmiany Parametrów Reologicznych Na Wrażliwość Deformacji Mieszanek Mineralno - Asfaltowych Na Podstawie Wyników Badań

    NASA Astrophysics Data System (ADS)

    Kurpiel, Artur; Wysokowski, Adam

    2015-03-01

    żna określić parametry oparte o różne teorie pełzania a szczególnie cenne parametry reologiczne w oparciu o wybrane modele lepkosprężyste [1]. Parametry z modeli lepkosprężystych są miarodajnymi wskaźnikami obrazującymi odporność mieszanek na deformacje. Można za ich pomocą prognozować głębokości koleiny w przyjętym modelu reologicznym [1]. W niniejszym artykule przedstawiono jaki wpływ na głębokość koleiny mają różne wartości parametrów reologicznych z analizowanego modelu lepkosprężystego oraz wpływ parametrów na kształt i przebieg krzywej pełzania. Przedstawione w artykule mieszanki mineralno - asfaltowe charakteryzują się zmiennymi parametrami reologicznymi, zatem trudno jest określić, który parametr decyduje o wielkości odkształcenia danej mieszanki. Mając na uwadze powyższe, w artykule podjęto próbę analizy zmiany wartości odkształcenia mieszanki mineralno - asfaltowej przy zmianie jednego oraz dwóch parametrów w danym modelu reologicznym - w tym przypadku - Bürgersa.

  16. 21 CFR 866.5400 - Alpha-globulin immuno-logical test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha-globulin immuno-logical test system. 866.5400 Section 866.5400 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN....5400 Alpha-globulin immuno-logical test system. (a) Identification. An alpha-globulin...

  17. 21 CFR 866.5620 - Alpha-2-macroglobulin immunological test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha-2-macroglobulin immunological test system. 866.5620 Section 866.5620 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... the alpha-2-macroglobulin (a serum protein) in plasma. Measurement of alpha-2-macroglobulin may aid...

  18. 21 CFR 866.5400 - Alpha-globulin immuno-logical test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Alpha-globulin immuno-logical test system. 866.5400 Section 866.5400 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... alpha-globulin (a serum protein) in serum and other body fluids. Measurement of alpha-globulin may...

  19. Has iprindole an alpha adrenergic activity?

    PubMed

    Ganry, H; Bourin, M

    1993-05-01

    1. Acute administration of iprindole potentiated the toxicity of 1-norepinephrine and increased the intensity of oxotremorine-induced tremors. 2. On the forced swimming test combination iprindole with imipramine reduced the duration of immobility. 3. The action of yohimbine on the locomotor activity was antagonized by a pre-injection of iprindole. 4. Iprindole increased and prolonged exophthalmia and loss of righting reflex induced by xylazine. 5 All these results seems indicate that iprindole has an indirect alpha 1 and alpha 2 adrenergic activity.

  20. Determination of Alpha

    NASA Astrophysics Data System (ADS)

    Chmeissani, Mokhtar Abdallah

    The determination of the strong coupling constant alpha_ s, using Energy-Energy Correlation Asymmetry and jet mass difference with Mark II data at SLC (91 GeV) is presented. In Energy-Energy Correlation Asymmetry (EECA), we used the same systematic procedure used to determine alpha_ s with MARK II data at PEP (29 GeV). The chi^2 fit suggests that alpha_ s = 0.119 +/- 0.007(stat.) +/- 0.007(syst.). In addition, we used the EECA method to determine the QCD scale parameter Lambda_{LLA}. The chi^2 fit suggests that Lambda _{LLA} = 420 +/- 90(stat.) MeV. In the jet mass difference method, the determination of alpha_ s is based on QCD calculations up to 2nd order. We showed that in this method we are able to reproduce the value of alpha _ s from a Monte Carlo sample to a very high accuracy. The result with this method is alpha _ s = 0.134 +/- 0.085(stat.) +/- 0.004(syst.). The two values of alpha_ s presented in this work are in agreement within the error bars and in a good agreement with recent results of alpha_ s published from other e^+e^- experiments.

  1. Bioavailability of alpha-tocopherol fed with retinol and relative bioavailability of D-alpha-tocopherol or DL-alpha-tocopherol acetate.

    PubMed

    Eicher, S D; Morrill, J L; Velazco, J

    1997-02-01

    Two experiments were conducted to examine the effects of the form of alpha-tocopherol or interactions of alpha-tocopherol with vitamin A on its bioavailability. In Experiment 1, Holstein steers were fed a diet that was low in vitamins A and E for 1 mo; then, steers were blocked by body weight (X = 97.5 kg) and assigned randomly to one of four oral treatments: 1) no added vitamins, 2) 442 mg of retinyl acetate, 3) 1342 mg of D-alpha-tocopherol, or 4) 442 mg of retinyl acetate and 1342 mg of D-alpha-tocopherol. Each treatment was given as a pulse dose. Blood was sampled over a 36-h period. Concentrations of plasma retinyl palmitate peaked at 2 to 6 h postsupplementation for all calves and then peaked again at 22 to 28 h for calves receiving vitamin supplements. Concentrations of plasma alpha-tocopherol peaked earliest with D-alpha-tocopherol supplementation alone at 12 to 20 h after supplementation, but simultaneous supplementation with retinyl acetate resulted in lower plasma alpha-tocopherol concentrations. Plasma retinyl palmitate decreased during peak alpha-tocopherol concentrations. In Experiment 2, blood and tissue were analyzed after a single gastric tube administration of a powder (DL-alpha-tocopheryl acetate) or a liquid (D-alpha-tocopherol) form of vitamin E to Holstein calves. Plasma and kidney concentrations of alpha-tocopherol were higher when calves were fed D-alpha-tocopherol than when calves were fed the DL-alpha-tocopherol acetate form. Concentrations in the liver, spleen, adipose tissue, heart, muscle, cellular blood fraction, and gut did not differ between the two forms.

  2. Event counting alpha detector

    DOEpatents

    Bolton, R.D.; MacArthur, D.W.

    1996-08-27

    An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

  3. Event counting alpha detector

    DOEpatents

    Bolton, Richard D.; MacArthur, Duncan W.

    1996-01-01

    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  4. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  5. Imaging alpha particle detector

    DOEpatents

    Anderson, David F.

    1985-01-01

    A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  6. Administrative Ecology

    ERIC Educational Resources Information Center

    McGarity, Augustus C., III; Maulding, Wanda

    2007-01-01

    This article discusses how all four facets of administrative ecology help dispel the claims about the "impossibility" of the superintendency. These are personal ecology, professional ecology, organizational ecology, and community ecology. Using today's superintendency as an administrative platform, current literature describes a preponderance of…

  7. Administrative Support.

    ERIC Educational Resources Information Center

    Doran, Dorothy; And Others

    This guide is intended to assist business education teachers in administrative support courses. The materials presented are based on the Arizona validated occupational competencies and tasks for the occupations of receptionist, secretary, and administrative assistant. Word processing skills have been infused into each of the three sections. The…

  8. The alpha channeling effect

    SciTech Connect

    Fisch, N. J.

    2015-12-10

    Alpha particles born through fusion reactions in a tokamak reactor tend to slow down on electrons, but that could take up to hundreds of milliseconds. Before that happens, the energy in these alpha particles can destabilize on collisionless timescales toroidal Alfven modes and other waves, in a way deleterious to energy confinement. However, it has been speculated that this energy might be instead be channeled into useful energy, so as to heat fuel ions or to drive current. Such a channeling needs to be catalyzed by waves Waves can produce diffusion in energy of the alpha particles in a way that is strictly coupled to diffusion in space. If these diffusion paths in energy-position space point from high energy in the center to low energy on the periphery, then alpha particles will be cooled while forced to the periphery. The energy from the alpha particles is absorbed by the wave. The amplified wave can then heat ions or drive current. This process or paradigm for extracting alpha particle energy collisionlessly has been called alpha channeling. While the effect is speculative, the upside potential for economical fusion is immense. The paradigm also operates more generally in other contexts of magnetically confined plasma.

  9. 77 FR 44511 - Airworthiness Directives; Alpha Aviation Concept Limited Airplanes

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-30

    ... 12866, (2) Is not a ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034... Federal Aviation Administration 14 CFR Part 39 RIN 2120-AA64 Airworthiness Directives; Alpha Aviation Concept Limited Airplanes AGENCY: Federal Aviation Administration (FAA), Department of Transportation...

  10. Alpha One Foundation

    MedlinePlus

    ... related programs More News Our Number One Goal: Find a cure for Alpha-1. Website Sponsors Helpful Links 3300 Ponce de Leon Blvd. Coral Gables, FL 33134 Phone: (877) 228-7321 Email: info@alphaone.org Copyright ...

  11. Alpha Particle Diagnostic

    SciTech Connect

    Fisher, Ray, K.

    2009-05-13

    The study of burning plasmas is the next frontier in fusion energy research, and will be a major objective of the U.S. fusion program through U.S. collaboration with our international partners on the ITER Project. For DT magnetic fusion to be useful for energy production, it is essential that the energetic alpha particles produced by the fusion reactions be confined long enough to deposit a significant fraction of their initial ~3.5 MeV energy in the plasma before they are lost. Development of diagnostics to study the behavior of energetic confined alpha particles is a very important if not essential part of burning plasma research. Despite the clear need for these measurements, development of diagnostics to study confined the fast confined alphas to date has proven extremely difficult, and the available techniques remain for the most part unproven and with significant uncertainties. Research under this grant had the goal of developing diagnostics of fast confined alphas, primarily based on measurements of the neutron and ion tails resulting from alpha particle knock-on collisions with the plasma deuterium and tritium fuel ions. One of the strengths of this approach is the ability to measure the alphas in the hot plasma core where the interesting ignition physics will occur.

  12. The Change of Structural and Thermal Properties of Rocks Exposed to High Temperatures in the Vicinity of Designed Geo-Reactor / Zmiany właściwości strukturalnych i cieplnych skał poddanych wysokim temperaturom w rejonie projektowanego georeaktora

    NASA Astrophysics Data System (ADS)

    Małkowski, Piotr; Niedbalski, Zbigniew; Hydzik-Wiśniewska, Joanna

    2013-06-01

    Among the main directions of works on energy acquisition, there is the development and application of the technology of underground gasification of coal deposits (UCG). During the process of deposit burning and oxidation, there is also impact of temperatures exceeding 1000°C on rocks surrounding the deposit. As a result of subjecting carboniferous rocks to high temperatures for a prolonged period of time, their structure will change, which in turn will result in the change of their physical properties. Due to the project of underground coal gasification, as performed in Poland, laboratory tests are currently under way to a broad extent, including physical properties of carboniferous rocks subjected to high temperatures. The article presents results of laboratory tests of rocks surrounding the designed geo-reactor: changes to bulk density, specific density and porosity due to high temperature, and confronts the above results with the results of tests of thermal conductivity, specific heat and heat diffusivity (temperature conductivity) of the rocks. The mineralogical investigations were presented too. Jednym z głównych kierunków prac nad pozyskiwaniem energii jest opracowanie i zastosowanie technologii podziemnej gazyfikacji pokładów węgla. W czasie procesu spalania i utleniania pokładu dochodzi również do oddziaływania temperatur przekraczających 1000°C na skały otaczające pokład. W wyniku poddania skał karbońskich wysokim temperaturom przez dłuższy okres czasu będzie dochodzić do zmian ich struktury, co z kolei spowoduje zmiany ich właściwości fizycznych. Ze względu na realizowany w Polsce projekt podziemnego zgazowania węgla prowadzone są obecnie badania laboratoryjne w szerokim zakresie, m.in. właściwości fizycznych skał karbońskich poddanych wysokim temperaturom. W artykule przedstawiono wyniki badań laboratoryjnych skał otaczających projektowany georeaktor: zmian gęstości objętościowej, gęstości właściwej i porowato

  13. The role of TNF-alpha in fever: opposing actions of human and murine TNF-alpha and interactions with IL-beta in the rat.

    PubMed

    Stefferl, A; Hopkins, S J; Rothwell, N J; Luheshi, G N

    1996-08-01

    1. The role of tumour necrosis factor-alpha (TNF-alpha) in fever is controversial. Some studies have indicated that TNF-alpha acts as a cryogen to inhibit fever, while others suggest that TNF-alpha is an endogenous pyrogen which mediates fever. The majority of studies in experimental animals supporting a cryogenic action have been conducted using human (h)TNF-alpha, which has been shown to bind only to one (p55) of the two TNF-alpha receptors in rodents. 2. The aim of the present investigation was to study the role of TNF-alpha in fever by comparing effects of hTNF-alpha, which binds only to the p55 receptor, with those of murine (m) TNF-alpha, which binds to both p55 and p75 TNF-alpha receptors, and to investigate the relationship between TNF-alpha and interleukin-1 (IL-1), an important endogenous pyrogen. 3. Injection of hTNF-alpha (0.3-10 micrograms kg-1, i.p.) had no effect on core temperature in conscious rats (measured by remote radiotelemetry), whereas mTNF-alpha (3 micrograms kg-1) induced fever which was maximal 1 h after the injection (38.2 +/- 0.2 degrees C compared to 37.3 +/- 0.1 degrees C in controls). Intracerebroventricular (i.c.v.) administration of either form of TNF-alpha elicited dose-dependent fever at doses higher than 0.12 microgram kg-1. 4. Peripheral injection of hIL-1 beta (1 microgram kg-1) resulted in fever (38.3 +/- 0.2 degree C compared to 37.2 +/- 0.1 degrees C in controls at 2 h), which was significantly attenuated (P < 0.01) by co-administration of a sub-pyrogenic dose of hTNF-alpha (1 microgram kg-1), but was unaffected by co-administration of mTNF-alpha (0.1 or 0.3 microgram kg-1, i.p.). In contrast, intracerebroventricular (i.c.v.) co-administration of a sub-pyrogenic dose (0.12 microgram kg-1) of hTNF-alpha did not attenuate fever induced by intraperitoneal (i.p.) injection of IL-1 beta, and sub-pyrogenic dose (0.12 microgram kg-1, i.c.v.) of mTNF-alpha significantly prolonged the febrile response to IL-1 beta. Pretreatment of

  14. Administrative IT

    ERIC Educational Resources Information Center

    Grayson, Katherine, Ed.

    2006-01-01

    When it comes to Administrative IT solutions and processes, best practices range across the spectrum. Enterprise resource planning (ERP), student information systems (SIS), and tech support are prominent and continuing areas of focus. But widespread change can also be accomplished via the implementation of campuswide document imaging and sharing,…

  15. Database Administrator

    ERIC Educational Resources Information Center

    Moore, Pam

    2010-01-01

    The Internet and electronic commerce (e-commerce) generate lots of data. Data must be stored, organized, and managed. Database administrators, or DBAs, work with database software to find ways to do this. They identify user needs, set up computer databases, and test systems. They ensure that systems perform as they should and add people to the…

  16. ADMINISTRATIVE CLIMATE.

    ERIC Educational Resources Information Center

    BRUCE, ROBERT L.; CARTER, G.L., JR.

    IN THE COOPERATIVE EXTENSION SERVICE, STYLES OF LEADERSHIP PROFOUNDLY AFFECT THE QUALITY OF THE SERVICE RENDERED. ACCORDINGLY, MAJOR INFLUENCES ON ADMINISTRATIVE CLIMATE AND EMPLOYEE PRODUCTIVITY ARE EXAMINED IN ESSAYS ON (1) SOURCES OF JOB SATISFACTION AND DISSATISFACTION, (2) MOTIVATIONAL THEORIES BASED ON JOB-RELATED SATISFACTIONS AND NEEDS,…

  17. Engineering Administration.

    ERIC Educational Resources Information Center

    Naval Personnel Program Support Activity, Washington, DC.

    This book is intended to acquaint naval engineering officers with their duties in the engineering department. Standard shipboard organizations are analyzed in connection with personnel assignments, division operations, and watch systems. Detailed descriptions are included for the administration of directives, ship's bills, damage control, training…

  18. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  19. Portable alpha spectrometer.

    PubMed

    Martín Sánchez, A; de la Torre Pérez, J

    2012-09-01

    Many portable devices have been designed to detect γ-rays or alpha and beta particles. Most of the α-particle detectors give the total count as a result, without identifying the radionuclides existing in the sample. The development of a device allowing rapid and straightforward α-particle spectrometry would be very useful for detecting the radioactive contents of unknown samples. This work describes the construction of a portable device using silicon semiconductor detectors designed to rapidly detect and possibly identify alpha-emitting radionuclides.

  20. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  1. A stereochemical examination of the equine metabolism of 17alpha-methyltestosterone.

    PubMed

    McKinney, Andrew R; Suann, Craig J; Stenhouse, Allen M

    2007-01-01

    An investigation was conducted into the stereochemistry of the equine urinary metabolites of 17alpha-methyltestosterone observed after oral administration. Standards of the complete range of C3/C5/C16 stereoisomeric 17alpha-methylandrostane-3,17beta-diols, 17alpha-methylandrostane-3,16,17beta-triols and 17alpha-hydroxymethylandrostane-3,17beta-diols were purchased or synthesised, and were used to unequivocally identify the absolute structures of the metabolites. Phase I metabolism was found to involve combinations of Delta(4)-3-ketone reduction with both 5alpha,3beta- and 5beta,3alpha-stereochemistry, hydroxylation at C16 with both 16alpha- and 16beta-stereochemistry and hydroxylation of the 17alpha-methyl substituent. Phase II metabolism involved mainly sulfation with a lesser degree of beta-glucuronidation.

  2. alpha(1)-Adrenoceptors augment thermal hyperalgesia in mildly burnt skin.

    PubMed

    Drummond, Peter D

    2009-03-01

    The effect of the alpha(1)-adrenoceptor agonist phenylephrine on sensitivity to heat was investigated at three sites of mild burn injury in the cutaneous forearm of 19 healthy participants. Two of the sites were pre-treated with the alpha(1)-antagonist terazosin, to determine whether the effect of phenylephrine was mediated by alpha(1)-adrenoceptors. Terazosin was administered before the burn injury at one site, and after the burn injury at the other site. In another 15 participants, the nociceptive effect of the alpha(2)-adrenoceptor agonist clonidine was investigated with and without prior treatment with the alpha(2)-antagonist rauwolscine. Drugs were introduced into the skin by iontophoresis, and burns were induced by heating the skin to 48 degrees C for 2min. Heat pain thresholds to a temperature ramp (0.5 degrees C/s), and heat pain ratings to a thermal stimulus (45 degrees C, 7s), were determined before and after the administration of each drug. Thermal hyperalgesia provoked by phenylephrine was inhibited by terazosin administered after the burn injury, but not by terazosin administered before the burn injury. However, neither alpha(2)-adrenoceptor stimulation nor blockade affected sensitivity to heat in the mildly burnt skin. These findings suggest that stimulation of cutaneous alpha(1)-adrenoceptors increased the excitability of heat-sensitized nociceptive afferents. As terazosin was more effective when administered in burnt skin, an inflammatory response induced by the burn injury may have facilitated access of adrenergic agents to alpha(1)-adrenoceptors.

  3. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  4. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  5. Alpha-MSH and coat color changes in the mouse.

    PubMed

    Thody, A J; Ridley, K; Carter, R J; Lucas, A M; Shuster, S

    1984-01-01

    The effect of alpha-MSH on coat color was examined in viable yellow mice (C3H/He-A*vy). These mice normally grow a coat of darkly pigmented hair at puberty. This darkening effect was also evident in hair that grew in a region that had been plucked at 13 days of age. Administration of alpha-MSH increased the darkness of this hair and the hair which grew naturally in an unplucked area. However, the natural coat darkening that occurred at puberty was not associated with an increase in plasma immunoreactive alpha-MSH levels. Moreover, although bromocryptine, a dopamine agonist that inhibits alpha-MSH release from the pituitary reduced the darkness of the coat that grew after plucking the reduction in coat darkening was unrelated to changes in plasma alpha-MSH. Nevertheless, this effect of bromocryptine was reversed when alpha-MSH was administered together with the drug. Apomorphine had no effect on coat darkening and produced only a slight decrease in plasma alpha-MSH. Melatonin reduced coat darkening slightly but, like apomorphine, had little effect on plasma alpha-MSH concentrations. Although alpha-MSH may have a physiological role in coat darkening in the C3H/He-A*vy mouse at puberty the response seems to be unrelated to an increase in circulating alpha-MSH. Thus, other factors, such as changes in melanocyte sensitivity to alpha-MSH or inhibitory mechanisms that prevent coat darkening during prepubertal and adult life may be involved in regulation of coat color in the viable yellow mouse. PMID:6531269

  6. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.

    1998-08-19

    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  7. {alpha}-Decay half-lives, {alpha}-capture, and {alpha}-nucleus potential

    SciTech Connect

    Denisov, V. Yu. Khudenko, A.A.

    2009-11-15

    {alpha}-Decay half-lives and {alpha}-capture cross sections are evaluated in the framework of a unified model for {alpha}-decay and {alpha}-capture. In this model {alpha}-decay and {alpha}-capture are considered as penetration of the {alpha}-particle through the potential barrier formed by the nuclear, Coulomb, and centrifugal interactions between the {alpha}-particle and nucleus. The spins and parities of the parent and daughter nuclei as well as the quadrupole and hexadecapole deformations of the daughter nuclei are taken into account for evaluation of the {alpha}-decay half-lives. The {alpha}-decay half-lives for 344 nuclei and the {alpha}-capture cross sections of {sup 40}Ca, {sup 44}Ca, {sup 59}Co, {sup 208}Pb, and {sup 209}Bi agree well with the experimental data. The evaluated {alpha}-decay half-lives within the range of 10{sup -9}{<=}T{sub 1/2}{<=}10{sup 38} s for 1246 {alpha}-emitters are tabulated.

  8. An overview on 5alpha-reductase inhibitors.

    PubMed

    Aggarwal, Saurabh; Thareja, Suresh; Verma, Abhilasha; Bhardwaj, Tilak Raj; Kumar, Manoj

    2010-02-01

    Benign prostatic hyperplasia (BPH) is the noncancerous proliferation of the prostate gland associated with benign prostatic obstruction and lower urinary tract symptoms (LUTS) such as frequency, hesitancy, urgency, etc. Its prevalence increases with age affecting around 70% by the age of 70 years. High activity of 5alpha-reductase enzyme in humans results in excessive dihydrotestosterone levels in peripheral tissues and hence suppression of androgen action by 5alpha-reductase inhibitors is a logical treatment for BPH as they inhibit the conversion of testosterone to dihydrotestosterone. Finasteride (13) was the first steroidal 5alpha-reductase inhibitor approved by U.S. Food and Drug Administration (USFDA). In human it decreases the prostatic DHT level by 70-90% and reduces the prostatic size. Dutasteride (27) another related analogue has been approved in 2002. Unlike Finasteride, Dutasteride is a competitive inhibitor of both 5alpha-reductase type I and type II isozymes, reduced DHT levels >90% following 1 year of oral administration. A number of classes of non-steroidal inhibitors of 5alpha-reductase have also been synthesized generally by removing one or more rings from the azasteroidal structure or by an early non-steroidal lead (ONO-3805) (261). In this review all categories of inhibitors of 5alpha-reductase have been covered. PMID:19879888

  9. Acute toxicity of high doses of the glycoalkaloids, alpha-solanine and alpha-chaconine, in the Syrian Golden hamster.

    PubMed

    Langkilde, Søren; Schrøder, Malene; Stewart, Derek; Meyer, Otto; Conner, Sean; Davies, Howard; Poulsen, Morten

    2008-09-24

    Sprouted, stressed, or spoiled potato tubers have reportedly led to human acute intoxication, coma, and death when consumed in high amounts. These effects have been attributed to glycoalkaloids (GAs), primarily alpha-solanine and alpha-chaconine, naturally present in all potatoes. The level of GAs in potato tubers has previously been shown to increase substantially as a result of improper handling and postharvest storage. A short-term study was performed to investigate the dose-response profile of alpha-solanine and alpha-chaconine alone or in combination, administered daily by oral gavage to Syrian Golden hamsters. Daily doses of 100 mg of alpha-solanine [kg body weight (BW)] (-1) induced death in two of four hamsters within 4 days, when administered by gavage to female Syrian hamsters. Doses of 100 mg of alpha-chaconine alone or alpha-solanine and alpha-chaconine combined in a ratio of 1:2.5, in doses of 75 or 100 mg (kg BW) (-1), induced death in one of four hamsters within the same period. Animals dosed with alpha-solanine alone or in combination with alpha-chaconine suffered from fluid-filled and dilated small intestines. The GA administration had no effect on acetyl cholinesterase (AChE) or butyryl cholinesterase (BuChE) activity in plasma or brain. Liquid chromatography-mass spectrometry-based metabolomics showed that there was a specific accumulation of alpha-chaconine in the liver tissues. In addition, metabolomics gave direct evidence of glycolytic metabolism of the GA with the beta 1, beta 2, and gamma-GAs detected in the urine and, to a lesser extent, the feces. Doses from 75 mg (kg BW) (-1) of alpha-chaconine, alpha-solanine, or the two compounds combined were potentially lethal within 4-5 days in the Syrian Golden hamster. However, the cause of death in these studies could not be established. No synergistic effects of alpha-solanine combined with alpha-chaconine were evident.

  10. Measures of Alpha Heating in Inertial Confinement Fusion

    NASA Astrophysics Data System (ADS)

    Betti, R.; Christopherson, A. R.

    2014-10-01

    Assessing the degree to which fusion alpha particles contribute to the fusion yield is essential to the understanding of the onset of the thermal runaway process of thermonuclear ignition. It is shown that in inertial confinement fusion, the yield enhancement resulting from alpha particle heating (before ignition occurs) depends on the fractional alpha energy or, equivalently, on the generalized Lawson criterion. Both the fractional alpha energy and the generalized Lawson criterion can be inferred from experimental observables. This result can be used to assess the performance of current ignition experiments at the National Ignition Facility. This material is based upon work supported by the Department of Energy National Nuclear Security Administration under Award Number DE-NA0001944 and the Office of Fusion Energy Sciences Number DE-FG02-04ER54786.

  11. GABAergic agents prevent alpha-melanocyte stimulating hormone induced anxiety and anorexia in rats.

    PubMed

    Rao, T Lakshmi; Kokare, Dadasaheb M; Sarkar, Sumit; Khisti, Rahul T; Chopde, Chandrabhan T; Subhedar, Nishikant

    2003-12-01

    Alpha-melanocyte stimulating hormone (alpha-MSH) is a hypothalamic peptide believed to play a tonic inhibitory role in feeding and energy homeostasis. Systemic administration of alpha-MSH is known to produce anorexia and anxiety. Since synaptic contacts between gamma-aminobutyric acid (GABA)ergic terminals and alpha-MSH neurons in the hypothalamus have been reported, the present work was undertaken to refine our knowledge on the role of GABAergic systems in anxiety and anorexia induced by intracerebroventricular (icv) administration of alpha-MSH in rats. The anxiety was assessed by elevated plus maze, and spontaneous food consumption was monitored during dark cycle. Prior administration of diazepam and muscimol that promote the function of GABA(A) receptors reversed the anxiogenic response and decreased food intake elicited by alpha-MSH. In contrast, bicuculline, the GABA(A) receptor antagonist, not only enhanced the effects of alpha-MSH but also prevented the influence of GABAergic drugs on alpha-MSH-induced anorexia and anxiety. These findings suggest that alpha-MSH-induced anxiety and anorexia are due to its negative influence on GABAergic system.

  12. 21 CFR 866.5620 - Alpha-2-macroglobulin immunological test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Alpha-2-macroglobulin immunological test system. 866.5620 Section 866.5620 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems § 866.5620 Alpha-2-macroglobulin...

  13. 21 CFR 866.5580 - Alpha-1-lipoprotein immuno-logical test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha-1-lipoprotein immuno-logical test system. 866.5580 Section 866.5580 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN....5580 Alpha-1-lipoprotein immuno-logical test system. (a) Identification. An...

  14. 21 CFR 866.5130 - Alpha-1-antitrypsin immunological test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Alpha-1-antitrypsin immunological test system. 866.5130 Section 866.5130 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... the alpha-1-antitrypsin (a plasma protein) in serum, other body fluids, and tissues. The...

  15. 77 FR 15980 - Airworthiness Directives; Alpha Aviation Concept Limited (Type Certificate Previously Held by...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-19

    ... 12866, (2) Is not a ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034... TRANSPORTATION Federal Aviation Administration 14 CFR Part 39 RIN 2120-AA64 Airworthiness Directives; Alpha Aviation Concept Limited (Type Certificate Previously Held by Alpha Aviation Design Limited)...

  16. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail

    2011-01-01

    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  17. 29 CFR 1910.1004 - alpha-Naphthylamine.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 29 Labor 6 2010-07-01 2010-07-01 false alpha-Naphthylamine. 1910.1004 Section 1910.1004 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR (CONTINUED) OCCUPATIONAL SAFETY AND HEALTH STANDARDS (CONTINUED) Toxic and Hazardous Substances §...

  18. 29 CFR 1910.1004 - alpha-Naphthylamine.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 29 Labor 6 2011-07-01 2011-07-01 false alpha-Naphthylamine. 1910.1004 Section 1910.1004 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR (CONTINUED) OCCUPATIONAL SAFETY AND HEALTH STANDARDS (CONTINUED) Toxic and Hazardous Substances §...

  19. 29 CFR 1915.1004 - alpha-Naphthylamine.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 29 Labor 7 2010-07-01 2010-07-01 false alpha-Naphthylamine. 1915.1004 Section 1915.1004 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR (CONTINUED) OCCUPATIONAL SAFETY AND HEALTH STANDARDS FOR SHIPYARD EMPLOYMENT Toxic and Hazardous...

  20. 29 CFR 1915.1004 - alpha-Naphthylamine.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 29 Labor 7 2011-07-01 2011-07-01 false alpha-Naphthylamine. 1915.1004 Section 1915.1004 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR (CONTINUED) OCCUPATIONAL SAFETY AND HEALTH STANDARDS FOR SHIPYARD EMPLOYMENT Toxic and Hazardous...

  1. 29 CFR 1926.1104 - alpha-Naphthylamine.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 29 Labor 8 2014-07-01 2014-07-01 false alpha-Naphthylamine. 1926.1104 Section 1926.1104 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR (CONTINUED) SAFETY AND HEALTH REGULATIONS FOR CONSTRUCTION Toxic and Hazardous Substances § 1926.1104...

  2. 29 CFR 1926.1104 - alpha-Naphthylamine.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 29 Labor 8 2012-07-01 2012-07-01 false alpha-Naphthylamine. 1926.1104 Section 1926.1104 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR (CONTINUED) SAFETY AND HEALTH REGULATIONS FOR CONSTRUCTION Toxic and Hazardous Substances § 1926.1104...

  3. 29 CFR 1926.1104 - alpha-Naphthylamine.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 29 Labor 8 2011-07-01 2011-07-01 false alpha-Naphthylamine. 1926.1104 Section 1926.1104 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR (CONTINUED) SAFETY AND HEALTH REGULATIONS FOR CONSTRUCTION Toxic and Hazardous Substances § 1926.1104...

  4. 29 CFR 1926.1104 - alpha-Naphthylamine.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 29 Labor 8 2010-07-01 2010-07-01 false alpha-Naphthylamine. 1926.1104 Section 1926.1104 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR (CONTINUED) SAFETY AND HEALTH REGULATIONS FOR CONSTRUCTION Toxic and Hazardous Substances § 1926.1104...

  5. 29 CFR 1926.1104 - alpha-Naphthylamine.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 29 Labor 8 2013-07-01 2013-07-01 false alpha-Naphthylamine. 1926.1104 Section 1926.1104 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR (CONTINUED) SAFETY AND HEALTH REGULATIONS FOR CONSTRUCTION Toxic and Hazardous Substances § 1926.1104...

  6. Identification and quantification of metabolites common to 17alpha-methyltestosterone and mestanolone in horse urine.

    PubMed

    Yamada, Masayuki; Aramaki, Sugako; Okayasu, Toshimasa; Hosoe, Tomoo; Kurosawa, Masahiko; Kijima-Suda, Isao; Saito, Koichi; Nakazawa, Hiroyuki

    2007-09-21

    Anabolic steroids with the 17alpha-methyl,17beta-hydroxyl group, which were developed as oral formulations for therapeutic purposes, have been abused in the field of human sports. These anabolic steroids are also used to enhance racing performance in racehorses. In humans, structurally related 17alpha-methyltestosterone (MTS) and mestanolone (MSL), which are anabolic steroids with the 17alpha-methyl,17beta-hydroxyl group, have metabolites in common. The purpose of this study was to determine metabolites common to these two steroids in horses, which may serve as readily available screening targets for the doping test of these steroids in racehorses. Urine sample collected after administering MTS and MSL to horses was treated to obtain unconjugated steroid, glucuronide, and sulfate fractions. The fractions were subjected to gas chromatography/mass spectrometry (GC/MS), and 17alpha-methyl-5alpha-androstan-3beta,17beta-diol, 17alpha-hydroxymethyl-5alpha-androstan-3beta,17beta-diol, 17alpha-methyl-5alpha-androstan-3beta,16beta,17beta-triol, and 17alpha-methyl-5alpha-androstan-3beta,16alpha,17beta-triol were detected as the common metabolites by comparison with synthesized reference standards. The urinary concentrations of these metabolites after dosing were determined by GC/MS. 17Alpha-methyl-5alpha-androstan-3beta,16beta,17beta-triol was mainly detected in the sulfate fractions of urine samples after administration. This compound was consistently detected for the longest time in the urine samples after dosing with both steroids. The results suggest that 17alpha-methyl-5alpha-androstan-3beta,16beta,17beta-triol is a very useful screening target for the doping test of MTS and MSL in racehorses.

  7. Proteinaceous alpha-amylase inhibitors.

    PubMed

    Svensson, Birte; Fukuda, Kenji; Nielsen, Peter K; Bønsager, Birgit C

    2004-02-12

    Proteins that inhibit alpha-amylases have been isolated from plants and microorganisms. These inhibitors can have natural roles in the control of endogenous alpha-amylase activity or in defence against pathogens and pests; certain inhibitors are reported to be antinutritional factors. The alpha-amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha-amylases in complex with inhibitors from five families. These structures indicate major diversity but also some similarity in the structural basis of alpha-amylase inhibition. Mutational analysis of the mechanism of inhibition was performed in a few cases and various protein engineering and biotechnological approaches have been outlined for exploitation of the inhibitory function. PMID:14871655

  8. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W.; Allander, Krag S.; Bounds, John A.

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  9. Background canceling surface alpha detector

    DOEpatents

    MacArthur, D.W.; Allander, K.S.; Bounds, J.A.

    1996-06-11

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

  10. Long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.

    1993-02-02

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  11. Lorentz violation and {alpha} decay

    SciTech Connect

    Altschul, Brett

    2009-01-01

    Relating the effective Lorentz violation coefficients for composite particles to the coefficients for their constituent fields is a challenging problem. We calculate the Lorentz violation coefficients relevant to the dynamics of an {alpha} particle in terms of proton and neutron coefficients. The {alpha}-particle coefficients would lead to anisotropies in the {alpha} decays of nuclei, and because the decay process involves quantum tunneling, the effects of any Lorentz violations could be exponentially enhanced.

  12. Long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; Wolf, Michael A.; McAtee, James L.; Unruh, Wesley P.; Cucchiara, Alfred L.; Huchton, Roger L.

    1993-01-01

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  13. Modeling Solar Lyman Alpha Irradiance

    NASA Technical Reports Server (NTRS)

    Pap, J.; Hudson, H. S.; Rottman, G. J.; Willson, R. C.; Donnelly, R. F.; London, J.

    1990-01-01

    Solar Lyman alpha irradiance is estimated from various solar indices using linear regression analyses. Models developed with multiple linear regression analysis, including daily values and 81-day running means of solar indices, predict reasonably well both the short- and long-term variations observed in Lyman alpha. It is shown that the full disk equivalent width of the He line at 1083 nm offers the best proxy for Lyman alpha, and that the total irradiance corrected for sunspot effect also has a high correlation with Lyman alpha.

  14. ISS Update: Alpha Magnetic Spectrometer

    NASA Video Gallery

    NASA Public Affairs Officer Kelly Humphries interviews Trent Martin, Johnson Space Center project manager for the Alpha Magnetic Spectrometer (AMS) aboard the International Space Station. Questions...

  15. Molecular mechanism of {alpha}-tocopheryl-phosphate transport across the cell membrane

    SciTech Connect

    Negis, Yesim; Meydani, Mohsen; Zingg, Jean-Marc; Azzi, Angelo . E-mail: angelo.azzi@tufts.edu

    2007-07-27

    {alpha}-Tocopheryl-phosphate ({alpha}-TP) is synthesized and hydrolyzed in animal cells and tissues where it modulates several functions. {alpha}-TP is more potent than {alpha}-T in inhibiting cell proliferation, down-regulating CD36 transcription, inhibiting atherosclerotic plaque formation. Administration of {alpha}-TP to cells or animals requires its transfer through membranes, via a transporter. We show here that {alpha}-TP is passing the plasma membrane via a system that is inhibited by glibenclamide and probenecid, inhibitors of a number of transporters. Glibenclamide and probenecid prevent dose-dependently {alpha}-TP inhibition of cell proliferation. The two inhibitors act on ATP binding cassette (ABC) and organic anion transporters (OAT). Since ABC transporters function to export solutes and {alpha}-TP is transported into cells, it may be concluded that {alpha}-TP transport may occur via an OAT family member. Due to the protection by glibenclamide and probenecid on the {alpha}-TP induced cell growth inhibition it appears that {alpha}-TP acts after its uptake inside cells.

  16. Remission of liver fibrosis by interferon-alpha 2b.

    PubMed

    Moreno, M G; Muriel, P

    1995-08-01

    Fibrosis is a dynamic process associated with the continuous deposition and resorption of connective tissue, mainly collagen. Therapeutic strategies are emerging by which this dynamic process can be modulated. Since interferons are known to inhibit collagen production, the aim of this study was to investigate if the administration of interferon-alpha 2b (IFN-alpha) can restore the normal hepatic content of collagen in rats with established fibrosis. Fibrosis was induced by prolonged bile duct ligation. IFN-alpha (100,000 IU/rat/day; s.c.) was administered to fibrotic rats for 15 days. Bile duct ligation increased liver collagen content 6-fold. In addition, serum and liver markers of hepatic injury increased significantly; liver histology showed an increase in collagen deposition, and the normal architecture was lost, with large zones of necrosis being observed frequently. IFN-alpha administration reversed to normal the values of all the biochemical markers measured and restored the normal architecture of the liver. Our results demonstrated that IFN-alpha is useful in reversing fibrosis and liver damage induced by biliary obstruction in the rat. However, further investigations are required to evaluate the therapeutic relevance of interferons on non-viral fibrosis and cholestasis. PMID:7646558

  17. The effects of interferon-alpha/beta in a model of rat heart transplantation

    NASA Technical Reports Server (NTRS)

    Slater, A. D.; Klein, J. B.; Sonnenfeld, G.; Ogden, L. L. 2nd; Gray, L. A. Jr

    1992-01-01

    Interferons have multiple immunologic effects. One such effect is the activation of expression of cell surface antigens. Interferon alpha/beta enhance expression of class I but not class II histocompatibility antigens. Contradictory information has been published regarding the effect of interferon-alpha/beta administration in patients with kidney transplantation. In a model of rat heart transplantation we demonstrated that administration of interferon-alpha/beta accelerated rejection in a dose-dependent fashion in the absence of maintenance cyclosporine. Animals treated with maintenance cyclosporine had evidence of increased rejection at 20 days that was resolved completely at 45 days with cyclosporine alone.

  18. [Antimutagenic action of alpha-tocopherol acetate in carbon tetrachloride poisoning in animals].

    PubMed

    Maganova, N B; Stasenkova, K P; Bondarev, G I

    1982-01-01

    Additional administration of alpha-tocopherol acetate to S57Bl/6 mice and Wistar rats exposed to oral CCl4 under acute and subacute experimental conditions produced no appreciable effect on the frequency of cells with chromosomal aberrations. Additional administration of alpha-tocopherol acetate to S57Bl/6 mice exposed to CCl4 inhalation significantly lessened the frequency of somatic cells with chromosomal aberrations and the frequency of dominant lethals in sexual cells. This attests to a protective action of alpha-tocopherol acetate and confirms the data obtained by other research workers.

  19. Resting alpha activity predicts learning ability in alpha neurofeedback

    PubMed Central

    Wan, Feng; Nan, Wenya; Vai, Mang I.; Rosa, Agostinho

    2014-01-01

    Individuals differ in their ability to learn how to regulate the brain activity by neurofeedback. This study aimed to investigate whether the resting alpha activity can predict the learning ability in alpha neurofeedback. A total of 25 subjects performed 20 sessions of individualized alpha neurofeedback and the learning ability was assessed by three indices respectively: the training parameter changes between two periods, within a short period and across the whole training time. It was found that the resting alpha amplitude measured before training had significant positive correlations with all learning indices and could be used as a predictor for the learning ability prediction. This finding would help the researchers in not only predicting the training efficacy in individuals but also gaining further insight into the mechanisms of alpha neurofeedback. PMID:25071528

  20. Immunomodulatory effects of alpha interferon and thymostimulin in patients with neoplasias.

    PubMed Central

    Munno, I; Marinaro, M; Gesario, A; Cannuscio, B; Michel, Y; Paulling, E

    1995-01-01

    In this report, we have evaluated the immunological effects following administration of alpha interferon (IFN-alpha) in combination with thymostimulin (TP-1), as well as of IFN-alpha and TP-1 alone in patients with neoplasias who underwent surgery and were subsequently treated with conventional chemotherapy. Data suggest that the combination of IFN-alpha and TP-1 is the most effective in the up-regulation of some immune parameters such as the CD4(+)-CD8+ cell-dependent antibacterial activity. Since this immune function plays an important role in the host protection against different targets such as invading microorganisms and/or neoplastic cells, the administration of TP-1-IFN-alpha is advisable for patients with neoplasias under chemotherapy. PMID:7583935

  1. Alpha Magnetic Spectrometer

    NASA Astrophysics Data System (ADS)

    Ting, Samuel

    2012-07-01

    The Alpha Magnetic Spectrometer (AMS) is a precision particle physics magnetic spectrometer designed to measure electrons, positrons, gamma rays and various nuclei and anti-nuclei from the cosmos up to TeV energy ranges. AMS weighs 7.5 tons and measures 5 meters by 4 meters by 3 meters. It contains 300,000 channels of electronics and 650 onboard microprocessors. It was delivered to the International Space Station onboard space shuttle Endeavour and installed on May 19, 2011. Since that time, more than 14 billion cosmic ray events have been collected. All the detectors function properly. At this moment, we are actively engaged in data analysis. AMS is an international collaboration involving 16 countries and 60 institutes. It took 16 years to construct and test. AMS is the only major physical science experiment on the International Space Station and will continue to collect data over the entire lifetime of the Space Station (10-20 years).

  2. Microscopic cluster model of {alpha}+n, {alpha}+p, {alpha}+ {sup 3}He, and {alpha}+{alpha} elastic scattering from a realistic effective nuclear interaction

    SciTech Connect

    Dohet-Eraly, J.; Baye, D.

    2011-07-15

    An effective nucleon-nucleon interaction adapted to cluster-model calculations of collisions is derived from the realistic Argonne potential AV18 with the unitary correlation operator method. The unitary correlation is determined from the {alpha}+{alpha} elastic phase shifts calculated in a cluster approach by the generator coordinate method coupled with the microscopic R-matrix method. With this interaction, the elastic phase shifts for the {alpha}+n, {alpha}+p, and {alpha}+{sup 3}He collisions are calculated within the same model. Without further adjustment, a good agreement with experimental data is obtained with a small model space.

  3. Alpha particle emitters in medicine

    SciTech Connect

    Fisher, D.R.

    1989-09-01

    Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ({sup 211}At) and natural bismuth-212 ({sup 212}Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ({sup 223}Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs.

  4. Behavioral action of ethanol in Porsolt's forced swim test: modulation by 3 alpha-hydroxy-5 alpha-pregnan-20-one.

    PubMed

    Hirani, K; Khisti, R T; Chopde, C T

    2002-12-01

    Ethanol is known to increase cortical and plasma content of GABAergic neurosteroid 3alpha-hydroxy-5alpha-pregnan-20-one (3alpha,5alpha-THP) which is responsible for some of its behavioral and electrophysiological effects. We have previously demonstrated the antidepressant like effect of 3alpha,5alpha-THP in mice. This study investigated the role of 3alpha,5alpha-THP in acute, chronic and withdrawal effects of ethanol using mouse forced swim test (FST) paradigm. While acute systemic ethanol (2 or 2.5 g/kg) administration exhibited an antidepressant like effect, its prolonged consumption produced tolerance to this effect and its withdrawal, on the other hand, elicited enhanced behavioral despair (depression). The antidepressant like effect of ethanol was potentiated by GABA(A) receptor agonist, muscimol (0.5 mg/kg, i.p.), 3alpha,5alpha-THP (0.5, 1 or 2 microg/mouse, i.c.v.) and by neurosteroidogenic drugs viz. selective serotonin reuptake inhibitor (SSRI), fluoxetine (5 or 20 mg/kg, i.p.), agonist at mitochondrial diazepam binding inhibitor receptor, FGIN 1-27 (0.5 or 1 microg/mouse, i.c.v.), or 11beta-hydroxylase inhibitor, metyrapone (0.5 or 1 microg/mouse, i.c.v.) which are known to increase endogenous 3alpha,5alpha-THP content. Furthermore, inhibition of the endogenous neurosteroid biosynthesis by drugs like 5alpha-reductase inhibitor, finasteride (50 mg/kg, s.c.), 3beta-hydroxysteroid dehydrogenase inhibitor, trilostane (30 mg/kg i.p.) or 3alpha-hydroxysteroid dehydrogenase inhibitor, indomethacin (5 mg/kg, i.p.) and GABA(A) receptor antagonist, bicuculline (1 mg/kg, i.p.) blocked the antidepressant like effect of ethanol. Withdrawal of ethanol from mice consuming it chronically displayed enhanced behavioral despair and elicited tolerance to antidepressant like action of acute ethanol (2.5, 3 or 3.5 g/kg). Moreover, sub-antidepressant doses (0.25 or 0.5 microg/mouse, i.c.v.) of 3alpha,5alpha-THP and fluoxetine (5 mg/kg, i.p.) but not imipramine (1 mg/kg, i

  5. Increase of mouse resistance to Candida albicans infection by thymosin alpha 1.

    PubMed Central

    Bistoni, F; Marconi, P; Frati, L; Bonmassar, E; Garaci, E

    1982-01-01

    Studies were carried out to assess the ability of thymosin alpha 1 to prolong the survival of mice challenged with Candida albicans. Two- to four-month-old mice were treated with graded doses of thymosin alpha 1 before, after, or before and after intravenous challenge with C. albicans. Significant resistance ot lethal infection was afforded by 100 micrograms of thymosin alpha 1 per kg given before or before and after challenge, whereas no protection was found in mice treated with thymosin alpha 1 administered at any dose level after inoculation. Pretreatment with thymosin alpha 1 also prevented the increased susceptibility to C. albicans infection of mice pretreated with cyclophosphamide on day -6. The results showed that thymosin alpha 1 was capable of protecting untreated or cyclophosphamide-pretreated mice from C. albicans infection at an optimal dose and schedule of administration. PMID:7085074

  6. Transforming growth factor alpha protection against drug-induced injury to the rat gastric mucosa in vivo.

    PubMed Central

    Romano, M; Polk, W H; Awad, J A; Arteaga, C L; Nanney, L B; Wargovich, M J; Kraus, E R; Boland, C R; Coffey, R J

    1992-01-01

    This study was designed to determine whether transforming growth factor alpha (TGF alpha) protects rat gastric mucosa against ethanol- and aspirin-induced injury. Systemic administration of TGF alpha dose-dependently decreased 100% ethanol-induced gastric mucosal injury; a dose of 50 micrograms/kg delivered intraperitoneally 15 min before ethanol decreased macroscopic mucosal injury by > 90%. At the microscopic level, TGF alpha prevented deep gastric necrotic lesions and reduced disruption of surface epithelium. Pretreatment with orogastric TGF alpha (200 micrograms/kg) only partially (40%) decreased macroscopic ethanol damage. Intraperitoneal administration of TGF alpha at a dose of 10 micrograms/kg, which does not significantly inhibit gastric acid secretion, decreased aspirin-induced macroscopic damage by > 80%. TGF alpha protection does not seem to be mediated by prostaglandin, glutathione, or ornithine decarboxylase-related events, as evidenced by lack of influence of the inhibition of their production. Pretreatment with the sulfhydryl blocking agent N-ethylmaleimide partially abolished (40%) the protective effect of TGF alpha. In addition, systemic administration of TGF alpha resulted in a two-fold increase in tyrosine phosphorylation of phospholipase C-gamma 1 and in a time- and dose-dependent increase in levels of immunoreactive insoluble gastric mucin; these events occurred in a time frame consistent with their participation in the protective effect of TGF alpha. Images PMID:1281834

  7. Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

    PubMed

    Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

    2006-01-01

    The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

  8. Tumor necrosis factor alpha has a protective role in a murine model of systemic candidiasis.

    PubMed Central

    Louie, A; Baltch, A L; Smith, R P; Franke, M A; Ritz, W J; Singh, J K; Gordon, M A

    1994-01-01

    The role of tumor necrosis factor alpha (TNF-alpha) in host defense against systemic Candida albicans infection was evaluated in a murine model of systemic candidiasis in which uniform death occurred between 5 and 6 days after infection. TNF-alpha was first detected at 16 h postinfection and progressively increased thereafter. Peak levels (700 to 900 pg/ml) were measured in mice near death. Administration of 0.5 to 1.0 mg of polyclonal immunoglobulin G (IgG) TNF-alpha antibody (TNF-alpha Ab) to mice 2 h preinfection neutralized serum TNF-alpha for up to 30 h. However, this regimen shortened survival from a mean of 5.5 days for IgG controls to 3.4 days (P = 1.9 x 10(-12)). Semiquantitative cultures of spleen, lung, liver, and kidney conducted at 1, 2, and 3 days postinfection found colony counts of spleen and kidney to be significantly higher for TNF-alpha Ab recipients but only for the first 48 h. Administration of 1.5 and 1.0 mg of TNF-alpha Ab at 2 h before and 48 h after fungal injection, respectively, shortened the mean survival from 4.9 to 2.3 days (P = 5.2 x 10(-8)). This regimen neutralized serum TNF-alpha throughout infection. With this regimen, colony counts of all organs were significantly higher in TNF-alpha Ab recipients at 1, 2, and 3 days postinfection. Histopathologic studies showed an increase in the number and size of C. albicans foci in tissues. Peripheral leukocyte counts and inflammatory response in tissue were similar for TNF-alpha Ab and IgG sham recipients. In vitro, incubation of C. albicans with four to eight times the peak serum levels of TNF-alpha for up to 24 h did not inhibit the rate of germ tube or pseudohypha formation. Thus, TNF-alpha that was produced during infection with C. albicans augmented host resistance against this organism and prolonged survival. The protective effect of TNF-alpha was not mediated by increased leukocytes in blood or tissues nor by a direct anticandidal effect of TNF-alpha. This study suggests that the

  9. Genetics Home Reference: alpha-mannosidosis

    MedlinePlus

    ... Me Understand Genetics Home Health Conditions alpha-mannosidosis alpha-mannosidosis Enable Javascript to view the expand/collapse boxes. Download PDF Open All Close All Description Alpha-mannosidosis is a rare inherited disorder that causes ...

  10. Tumor necrosis factor alpha and glutathione interplay in chronic heart failure.

    PubMed

    Adamy, C; Le Corvoisier, P; Candiani, G; Kirsch, M; Pavoine, C; Defer, N; Bourin, M C; Su, J B; Vermes, E; Hittinger, L; Pecker, E

    2005-09-01

    The pro-inflammatory cytokine, tumor necrosis factor alpha (TNF alpha), in concert with neurohormones, contributes to chronic heart failure (CHF) progression. This implies that TNF a antagonism may constitute an important target for CHF therapy. However, clinical trials in CHF patients using compounds that trap TNF alpha, comprising infliximab, an antibody directed to TNF alpha, and etanercept, a soluble recombinant receptor of TNF alpha, gave disappointing results bringing back to light the dual, short-term beneficial and long-term harmful effect of TNF alpha. This review focuses on the dual, concentration- and time-related effects of TNF alpha, the yin and yang action of TNF alpha in cardiac ischemia/reperfusion and contraction. Importantly, the harmful effects of TNF a are related to glutathione deficiency, a common hallmark to several other chronic inflammatory diseases. Recently, in rat models of CHF, oral administration of the glutathione precursor, N-acetylcysteine (NAC), was shown to hinder pathways of TNF alpha harmful signalling and to rescue cardiac structure and function. These results suggest that glutathione deficiency in association with TNF alpha activation may play a role in the pathophysiology of CHF and that NAC may represent a potential therapy in CHF.

  11. Infusions of alpha-2 noradrenergic agonists and antagonists into the amygdala: effects on kindling.

    PubMed

    Pelletier, M R; Corcoran, M E

    1993-12-31

    We reported previously that activation of alpha-2 adrenoceptors with infusions of clonidine into the amygdala/pyriform region is sufficient to retard kindling. To characterize further the involvement in kindling of alpha-2 receptors in the amygdala/pyriform, we exposed rats to unilateral intraamygdaloid infusions of a variety of noradrenergic drugs followed by either low-frequency stimulation of the amygdala, to induce rapid kindling, or conventional high-frequency stimulation. Infusions and electrical stimulation were administered once every 48 h. The prophylactic effects of clonidine were blocked by simultaneous infusion of idazoxan, an alpha-2 adrenergic antagonist, which suggests strongly that these effects were produced at an alpha-2 receptor. Intraamygdaloid infusions of xylazine, another alpha-2 agonist, also significantly retarded low-frequency kindling. Unexpectedly, intraamygdaloid infusions of the alpha-2 antagonists idazoxan, yohimbine, and SK&F 104856 failed to accelerate kindling. Infusion of the alpha-1 antagonist corynanthine also failed to affect kindling. We propose that the alpha-2 adrenoceptors in the amygdala/pyriform region contribute to the prophylactic effects of systemically administered clonidine and that the facilitation of kindling observed after systemic administration of alpha-2 antagonists may be due to blockade of alpha-2 adrenoceptors outside of the amygdala/pyriform region.

  12. Senior Administrators Should Have Administrative Contracts.

    ERIC Educational Resources Information Center

    Posner, Gary J.

    1987-01-01

    Recognizing that termination is viewed by the employee as the equivalent to capital punishment of a career, an administrative contract can reduce the emotional and financial entanglements that often result. Administrative contracts are described. (MLW)

  13. 76 FR 15986 - Alpha Omega Technology, Inc.; Denial Without Prejudice of Food Additive Petition

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-22

    ... the Federal Register of March 15, 1990 (55 FR 9772), FDA announced that a food additive petition (FAP... HUMAN SERVICES Food and Drug Administration (Formerly Docket No. 90F-0074) Alpha Omega Technology, Inc.; Denial Without Prejudice of Food Additive Petition AGENCY: Food and Drug Administration, HHS....

  14. Alpha-particle spectrometer experiment

    NASA Technical Reports Server (NTRS)

    Gorenstein, P.; Bjorkholm, P.

    1972-01-01

    Mapping the radon emanation of the moon was studied to find potential areas of high activity by detection of radon isotopes and their daughter products. It was felt that based on observation of regions overflown by Apollo spacecraft and within the field of view of the alpha-particle spectrometer, a radon map could be constructed, identifying and locating lunar areas of outgassing. The basic theory of radon migration from natural concentrations of uranium and thorium is discussed in terms of radon decay and the production of alpha particles. The preliminary analysis of the results indicates no significant alpha emission.

  15. Impact of the Tamsulosin in Alpha Adrenergic Receptor of Airways at Patients with Increased Bronchial Reactibility

    PubMed Central

    Mustafa, Lirim; Ilazi, Ali; Dauti, Arta; Islami, Pellumb; Kastrati, Bashkim; Islami, Hilmi

    2015-01-01

    Objective: In this work, effect of tamsulosin as antagonist of alpha1A and alpha1B adrenergic receptor and effect of agonists of beta2 adrenergic receptor–salbutamol in patients with increased bronchial reactibility was studied. Methods: Parameters of the lung function are determined with Body plethysmography six (6) hours after administration of tamsulosin. Raw and ITGV were registered and specific resistance (SRaw) was calculated as well. Tamsulosin was administered in per os manner as a preparation in the shape of the capsules with a brand name of “Prolosin”, produced by Niche Generics Limited, Hitchin, Herts. Results: After six (6) hours of administration of tamsulosin, results gained indicate that blockage of alpha1A and alpha1B-adrenergic receptor (0.8 mg per os) has not changed significantly (p > 0.1) the bronchomotor tonus of tracheobronchial tree in comparison to the check-up that has inhaled salbutamol agonist of adrenergic beta2 receptor (2 inh. x 0.2 mg), (p < 0.05). Blood pressure suffered no significant decrease following administration of the 0.8 mg dose of tamsulosin. Conclusion: This suggests that even after six hours of administration of tamsulosin, and determining of lung function parameters, the activity of alpha1A and alpha1B-adrenergic receptor in the smooth bronchial musculature has not changed in patients with increased bronchial reactibility. PMID:26543414

  16. Alpha--College for Exploring

    ERIC Educational Resources Information Center

    Leppert, William; Koenig, Joan

    1976-01-01

    Describes Alpha, the experimental college of individualized instruction at the College of DuPage (Illinois). At this college, students design their own curricula and work in an open classroom situation, and teachers start with students instead of subjects. (DC)

  17. Genetics Home Reference: alpha thalassemia

    MedlinePlus

    ... in each cell. Each copy is called an allele. For each gene, one allele is inherited from a person's father, and the ... person's mother. As a result, there are four alleles that produce alpha-globin. The different types of ...

  18. Detecting Alpha-1 Antitrypsin Deficiency.

    PubMed

    Stoller, James K

    2016-08-01

    Alpha-1 antitrypsin deficiency is a widely underrecognized condition, with evidence of persisting long diagnostic delays and patients' frequent need to see multiple physicians before initial diagnosis. Reasons for underrecognition include inadequate understanding of alpha-1 antitrypsin deficiency by physicians and allied health care providers; failure to implement available, guideline-based practice recommendations; and the belief that effective therapy is unavailable. Multiple studies have described both the results of screening and targeted detection of individuals with alpha-1 antitrypsin deficiency, with both varying strategies employed to identify at-risk individuals and varying results of testing. Also, various strategies to enhance detection of affected individuals have been examined, including use of the electronic medical record to prompt testing and empowerment of allied health providers, especially respiratory therapists, to promote testing for alpha-1 antitrypsin deficiency. Such efforts are likely to enhance detection with the expected result that the harmful effects of delayed diagnosis can be mitigated. PMID:27564667

  19. Alpha Magnetic Spectrometer (AMS) Overview

    NASA Video Gallery

    The Alpha Magnetic Spectrometer (AMS) is flying to the station on STS-134. The AMS experiment is a state-of-the-art particle physics detector being operated by an international team composed of 60 ...

  20. Synthesis and herbicidal activity of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives.

    PubMed

    Xu, Han; Zou, Xiao-Mao; Zhu, You-Quan; Liu, Bin; Tao, Han-Lin; Hu, Xu-Hong; Song, Hai-Bin; Hu, Fang-Zhong; Wang, Yong; Yang, Hua-Zheng

    2006-06-01

    A series of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives was synthesised. Herbicidal activities of the two intermediate compounds and 15 pyridazinone derivatives were evaluated through barnyardgrass and rape cup tests and Spirodela polyrrhiza (L.) Schleiden tests. Selected compounds were also evaluated under greenhouse conditions. Bleaching activities were observed at 10 microg ml(-1) and some compounds exhibited herbicidal activities at a rate of 300 g ha(-1). The relationship between crystal structures and herbicidal activities is discussed through a comparison of two compounds (5a and 5f). PMID:16602079

  1. Alpha decay in electron surrounding

    SciTech Connect

    Igashov, S. Yu.; Tchuvil’sky, Yu. M.

    2013-12-15

    The influence of atomic electron shells on the constant of alpha decay of heavy and mediummass nuclei was considered in detail. A method for simultaneously taking into account the change in the potential-barrier shape and the effect of reflection of a diverging Coulomb wave in the classically allowed region was developed. The ratios of decay probabilities per unit time for a bare nucleus and the respective neutral atom were found for some alpha-decaying isotopes.

  2. Generation, characterization and therapeutic potential of anti-feline TNF-alpha MAbs for feline infectious peritonitis.

    PubMed

    Doki, Tomoyoshi; Takano, Tomomi; Nishiyama, Yuri; Nakamura, Michiyo; Hohdatsu, Tsutomu

    2013-12-01

    Feline infectious peritonitis (FIP) is a lethal infectious disease affecting domestic and wild cats. Several reports suggested that TNF-alpha is related to the progression of FIP. Thus, the administration of a feline TNF-alpha-neutralizing antibody to cats with FIP may reduce the disease progression. In this study, we have prepared nine monoclonal antibodies (MAbs) that recognize feline TNF-alpha. All MAbs neutralized recombinant TNF-alpha. The 50% inhibitory concentrations (IC50) of the MAbs for the cytotoxicity of recombinant TNF-alpha were 5-684 ng/ml. MAb 2-4 exhibited high neutralizing activity against natural TNF-alpha derived from FIPV-infected macrophages, and was confirmed to inhibit the following feline TNF-alpha-induced conditions in vitro: (i) an increase in the survival rate of neutrophils from cats with FIP, (ii) aminopeptidase N (APN) mRNA expression in macrophages, and (iii) apoptosis of a feline T-lymphocyte cell line.

  3. Fibrinolytic response to interferon-alpha in healthy human subjects.

    PubMed

    Corssmit, E P; Levi, M; Hack, C E; ten Cate, J W; Sauerwein, H P; Romijn, J A

    1996-01-01

    Interferons (IFNs) are used for a variety of disorders. It has been postulated that part of the effects of IFN may be mediated by IFN-induced modulation of endothelial cells. Since the principal activating and inhibiting factors of the fibrinolytic system are synthesized and stored in endothelial cells, we have studied the effects on fibrinolysis and coagulation of the administration of recombinant IFN-alpha (5 x 10(6) U/m2) to healthy human subjects (n = 8) in a randomized controlled cross-over study. IFN-alpha significantly increased plasma levels of tissue-type plasminogen activator (t-PA) and urokinase-type plasminogen activator (u-PA). Simultaneously, plasma levels of the inhibitor of plasminogen activation, PAI-1, sharply increased. The net effect on plasma plasminogen activator activity (PA-activity) was a modest increase to 116% of baseline, however without a significant effect on plasmin generation, as reflected by plasma levels of plasmin-alpha 2-antiplasmin complexes. IFN-alpha had no effect on the plasma levels of thrombin-antithrombin III (TAT) complexes. We conclude that despite considerable effects on endothelial cells, IFN-alpha does not significantly alter the coagulant-fibrinolytic balance, although the occurrence of such changes under pathological circumstances is not excluded.

  4. Alpha Heating and Burning Plasmas in Inertial Confinement Fusion

    NASA Astrophysics Data System (ADS)

    Christopherson, A. R.

    2015-11-01

    In inertial confinement fusion, a spherical capsule of cryogenic DT is accelerated inward at a high velocity. Near stagnation, a dense hot spot is formed where the deuterium and tritium ions begin to fuse, creating a 3.5-MeV alpha particle per reaction. These alpha particles deposit energy back into the plasma, thereby increasing the pressure, temperature, and reaction rate. This feedback process is called ``alpha heating,'' and ignition is a direct consequence of this thermal instability. The onset of a burning-plasma regime occurs when the total alpha-particle energy produced exceeds the shell compression work. Using an analytic compressible-shell model for the implosion, it is found that the onset of the burning-plasma regime is a unique function of the neutron yield enhancement caused by alpha particles for any target, direct or indirect drive. This yield enhancement can then be inferred from experimentally measureable quantities, such as the Lawson parameter. From this analysis, the onset of a burning plasma occurs at yields exceeding 50 kJ for implosions at the National Ignition Facility. This material is based upon work supported by the Department of Energy National Nuclear Security Administration under Award Number DE-NA0001944 and DE-FC02-04ER54789 (Fusion Science Center).

  5. Interferon-alpha stimulates the hypothalamic-pituitary-adrenal axis in vivo and in vitro.

    PubMed

    Gisslinger, H; Svoboda, T; Clodi, M; Gilly, B; Ludwig, H; Havelec, L; Luger, A

    1993-03-01

    The successful therapeutic use of interferon-alpha (IFN-alpha) in myeloproliferative disorders offered the possibility to test its acute and long-term effects on the hypothalamic-pituitary-adrenal (HPA) axis in humans. ACTH and cortisol plasma concentrations were measured in 8 patients hourly starting from 4 p.m. through 12 p.m. on three occasions. The first time all patients were studied before initiation of therapy, when the vehicle was injected alone. The patients were studied again on day 1 of IFN-alpha therapy (5 million units) and once more after 3 weeks of therapy. On the control day, plasma concentrations of ACTH and cortisol were in the range expected for this time of day. In contrast, after the first administration of IFN-alpha a significant stimulation of the HPA axis was observed. After 3 weeks of IFN-alpha therapy, no significant stimulation of the HPA axis occurred after administration of IFN-alpha. IFN-alpha-induced adaptive changes in the HPA axis were also indicated by a significantly enhanced ACTH and cortisol response to exogenously administered supramaximal doses of corticotropin-releasing hormone (CRH) when the patients had been on IFN-alpha treatment for 3 weeks. To determine the exact locus of the IFN-alpha action, in vitro experiments were performed using rat hypothalamic organ and primary pituitary and adrenal cell culture systems. Thereby a significant stimulation of hypothalamic CRH secretion and rat adrenal corticosterone production was observed after INF-alpha at concentrations of 5 x 10(-8) M or 10(-7) M respectively. In contrast, no direct IFN-alpha effect on pituitary ACTH secretion could be observed in vitro.(ABSTRACT TRUNCATED AT 250 WORDS)

  6. Matrix metalloproteinase expression and activity following prostaglandin F(2 alpha)-induced luteolysis.

    PubMed

    Ricke, William A; Smith, George W; Smith, Michael F

    2002-03-01

    Luteal tissue contains matrix metalloproteinases (MMPs) that cleave specific components of the extracellular matrix (ECM) and are inhibited by tissue inhibitors of metalloproteinases (TIMPs). We previously reported a decrease in luteal TIMP-1 within 15 min of prostaglandin F(2 alpha) (PGF(2 alpha))-induced luteolysis. An increase in the MMP:TIMP ratio may promote ECM degradation and apoptosis, as observed in other tissues that undergo involution. The objectives of these experiments were to determine whether 1) PGF(2 alpha) affects expression of mRNA encoding fibrillar collagenases (MMP-1 and -13), gelatinases A and B (MMP-2 and -9), membrane type (mt)-1 MMP (MMP-14), stromelysin (MMP-3), and matrilysin (MMP-7), and 2) PGF(2 alpha) increases MMP activity during PGF(2 alpha)-induced luteolysis in sheep. Corpora lutea (n = 3-10/time point) were collected at 0, 15, and 30 min and 1, 2, 4, 6, 12, 24, and 48 h after PGF(2 alpha) administration. Northern blot analysis confirmed the presence of all MMPs except MMP-9. Expression of mRNA for the above MMPs (except MMP-2) increased significantly (P < 0.05) by 30 min, and all MMPs increased significantly (P < 0.05) by 6 h after PGF(2 alpha) administration. Expression of MMP-14 mRNA increased significantly (P < 0.05) by 15 min post-PGF(2 alpha) and remained elevated through 48 h. MMP activity in luteal homogenates (following proenzyme activation and inactivation of inhibitors) was increased significantly (P < 0.05) by 15 min and remained elevated through 48 h post-PGF(2 alpha). MMP activity was localized (in situ zymography) to the pericellular area of various cell types in the 0-h group and was markedly increased by 30 min post-PGF(2 alpha). MMP mRNA expression and activity were significantly increased following PGF(2 alpha) treatment. Increased MMP activity may promote ECM degradation during luteolysis.

  7. A 28-day repeat dose toxicity study of steroidal glycoalkaloids, alpha-solanine and alpha-chaconine in the Syrian Golden hamster.

    PubMed

    Langkilde, Søren; Mandimika, Tafadzwa; Schrøder, Malene; Meyer, Otto; Slob, Wout; Peijnenburg, Ad; Poulsen, Morten

    2009-06-01

    Glycoalkaloids alpha-solanine and alpha-chaconine are naturally present toxicants in the potato plant (Solanumtuberosum). Human intake of high doses of glycoalkaloids has led to acute intoxication, in severe cases coma and death. Previous studies have indicated that the ratio of alpha-solanine to alpha-chaconine may determine the degree and nature of the glycoalkaloid toxicity in potatoes, as the toxicity of the two alkaloids act synergistically. The aim of the present study was to investigate whether an altered ratio of alpha-solanine and alpha-chaconine would reduce the toxicity of the glycoalkaloids. The Syrian Golden hamster was given daily doses of alpha-solanine and alpha-chaconine by gavage for 28 days. Doses of up to 33.3 mg total glycoalkaloids/kg body weight were applied in ratios of 1:3.7 and 1:70 (alpha-solanine:alpha-chaconine). Administration of the highest doses of both ratios resulted in distended and fluid filled small intestines and stomach. Animals receiving the ratio with the reduced content of alpha-solanine were less affected compared to those receiving the other ratio. Gene expression profiling experiments were conducted using RNA from epithelial scrapings from the small intestines of the hamsters administered the highest doses of the glycoalkaloid treatments. In general, more differential gene expression was observed in the epithelial scrapings of the hamsters fed the ratio of 1:3.7. Mostly, pathways involved in lipid and energy metabolism were affected by the ratio of 1:3.7.

  8. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  9. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  10. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  11. Therapeutic effect of anti-feline TNF-alpha monoclonal antibody for feline infectious peritonitis.

    PubMed

    Doki, Tomoyoshi; Takano, Tomomi; Kawagoe, Kohei; Kito, Akihiko; Hohdatsu, Tsutomu

    2016-02-01

    Feline infectious peritonitis virus (FIPV) replication in macrophages/monocytes induced tumor necrosis factor (TNF)-alpha production, and that the TNF-alpha produced was involved in aggravating the pathology of FIP. We previously reported the preparation of a feline TNF-alpha (fTNF-alpha)-neutralizing mouse monoclonal antibody (anti-fTNF-alpha mAb). This anti-fTNF-alpha mAb 2-4 was confirmed to inhibit the following fTNF-alpha-induced conditions in vitro. In the present study, we investigated whether mAb 2-4 improved the FIP symptoms and survival rate of experimentally FIPV-inoculated SPF cats. Progression to FIP was prevented in 2 out of 3 cats treated with mAb 2-4, whereas all 3 cats developed FIP in the placebo control group. Plasma alpha1-glycoprotein and vascular endothelial growth factor levels were improved by the administration of mAb 2-4, and the peripheral lymphocyte count also recovered. These results strongly suggested that the anti-fTNF-alpha antibody is effective for the treatment of FIP.

  12. Alpha-melanocyte-stimulating hormone reduces endotoxin-induced liver inflammation.

    PubMed

    Chiao, H; Foster, S; Thomas, R; Lipton, J; Star, R A

    1996-05-01

    Alpha-Melanocyte-stimulating hormone (MSH) is a potent anti-inflammatory agent in many models of inflammation, suggesting that it inhibits a critical step common to different forms of inflammation. We showed previously that alpha-MSH inhibits nitric oxide (NO) production in cultured macro-phages. To determine how alpha-MSH acts in vivo, we induced acute hepatic inflammation by administering endotoxin (LPS) to mice pretreated with Corynebacterium parvum, alpha-MSH prevented liver inflammation even when given 30 min after LPS administration. To determine the mechanisms of action of alpha-MSH, we tested its influence on NO, infiltrating inflammatory cells, cytokines, and chemokines. Alpha-MSH inhibited systemic NO production, hepatic neutrophil infiltration, and increased hepatic mRNA abundance for TNF alpha, and the neutrophil and monocyte chemokines (KC/IL-8 and MCP-1). We conclude that alpha-MSH prevents LPS-induced hepatic inflammation by inhibiting production of chemoattractant chemokines which then modulate infiltration of inflammatory cells. Thus, alpha-MSH has an effect very early in the inflammatory cascade. PMID:8621792

  13. Binding of actin to lens alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    Actin has been coupled to a cyanogen bromide-activated Sepharose 4B column, then tested for binding to alpha, beta, and gamma crystallin preparations from the bovine lens. Alpha, but not beta or gamma, crystallins bound to the actin affinity column in a time dependent and saturable manner. Subfractionation of the alpha crystallin preparation into the alpha-A and alpha-B species, followed by incubation with the affinity column, demonstrated that both species bound approximately the same. Together, these studies demonstrate a specific and saturable binding of lens alpha-A and alpha-B with actin.

  14. [The radioprotective and antioxidant properties of solubilized alpha-tocopherol acetate].

    PubMed

    Samoĭlov, A V; Seĭfulla, R D; Kamaev, N O; Lukoianova, T I; Gukasov, V M; Belous, M V

    1992-01-01

    A single intravenous administration of solubilized alpha-tocopherol acetate in a dose of 1 mg/kg to CBA x C57Bl x F1 male mice 3 and 24 hours before radiation was demonstrated to increase 30-day survival rates in the animals. Oily alpha-tocopherol acetate had the identical effects when the agent was intramuscularly given in a dose of 10 mg/kg. There was a rise in peripheral leukocyte counts 0.5 hour after solubilized alpha-tocopherol acetate administration. The antioxidative activity of the solubilized agent was 3.3 times as high as that the routine agent when attacking Tween 80. The higher radioprotective activity of solubilized alpha-tocopherol acetate is accounted for by its enhanced bioavailability, antioxidative activity and effects on the factors of nonspecific body's resistance.

  15. [Alpha-Synuclein in blood and cerebrospinal fluid of patients with alpha-synucleinopathy].

    PubMed

    Ono, Kenjiro; Yamada, Masahito

    2014-03-01

    Alpha-Synuclein protein(alphaS) aggregates from a monomer to assemblies such as oligomers, protofibrils, and mature fibrils. The early intermediate aggregate, that is, the oligomer, has been reported to be the most toxic species. We recently reported that melatonin inhibits alphaS aggregation, including protofibril and oligomer formations. While the alphaS concentration in cerebrospinal fluid was reported to significantly decrease in patients with Parkinson's disease (PD) and dementia with Lewy bodies, there have been reports that the alphaS oligomer concentration was elevated in the cerebrospinal fluid of PD patients. Moreover, it was reported that the alphaS oligomer concentration was also elevated in the blood of PD patients. Further studies may establish alphaS in cerebrospinal fluid and blood as a biomarker of alpha-synucleinopathies, including PD.

  16. Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...

  17. Augmentation of host resistance to microbial infections by recombinant human interleukin-1 alpha.

    PubMed Central

    Minami, A; Fujimoto, K; Ozaki, Y; Nakamura, S

    1988-01-01

    Recombinant human interleukin-1 alpha augmented resistance of mice to microbial infections caused by Pseudomonas aeruginosa, Klebsiella pneumoniae, Staphylococcus aureus, Streptococcus pneumoniae, Salmonella typhimurium, and Candida albicans. The effective doses of interleukin-1 alpha ranged from 0.01 to 10 micrograms per mouse, depending on the infecting organism, route of administration, and challenge dose. Intravenous interleukin-1 alpha was, dose for dose, more effective than intravenous muramyl dipeptide and lentinan against the P. aeruginosa and K. pneumoniae infections. Augmentation by interleukin-1 alpha of resistance to infection was also observed in P. aeruginosa-infected mice in a state of cyclophosphamide-induced leucopenia. Interleukin-1 alpha may be useful for controlling obstinate infections not curable by antimicrobial agents alone. PMID:3263325

  18. Functional expression of alpha 7 nicotinic acetylcholine receptors in human periodontal ligament fibroblasts and rat periodontal tissues.

    PubMed

    Wang, Xiao-Jing; Liu, Ying-Feng; Wang, Qing-Yu; Tsuruoka, Morito; Ohta, Kazumasa; Wu, Sheng-Xi; Yakushiji, Masashi; Inoue, Takashi

    2010-05-01

    Tobacco smoking is the main risk factor associated with chronic periodontitis, but the mechanisms that underlie this relationship are largely unknown. Recent reports proposed that nicotine plays an important role in tobacco-related morbidity by acting through the nicotinic acetylcholine receptors (nAChRs) expressed by non-neuronal cells. The aim of this study was to investigate whether alpha 7 nAChR was expressed in periodontal tissues and whether it functions by regulating IL-1 beta in the process of periodontitis. In vitro, human periodontal ligament (PDL) cells were cultured with 10(-12) M of nicotine and/or 10(-9) M of alpha-bungarotoxin (alpha-Btx), a alpha 7 nAChR antagonist. The expression of alpha 7 nAChR and IL-1 beta in PDL cells and the effects of nicotine/alpha-Btx administration on their expression were explored. In vivo, an experimental periodontitis rat model was established, and the effects of nicotine/alpha-Btx administration on expression of alpha 7 nAChR and development of periodontitis were evaluated. We found that alpha 7 nAChR was present in human PDL cells and rat periodontal tissues. The expressions of alpha 7 nAChR and IL-1 beta were significantly increased by nicotine administration, whereas alpha-Btx treatment partially suppressed these effects. This study was the first to demonstrate the functional expression of alpha 7 nAChR in human PDL cells and rat periodontal tissues. Our results may be pertinent to a better understanding of the relationships among smoking, nicotine, and periodontitis.

  19. Workshop on Precision Measurements of $\\alpha_s$

    SciTech Connect

    Bethke, Siegfried; Hoang, Andre H.; Kluth, Stefan; Schieck, Jochen; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS

    2011-10-01

    These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

  20. 3{alpha}-6{alpha}-Dihydroxy-7{alpha}-fluoro-5{beta}-cholanoate (UPF-680), physicochemical and physiological properties of a new fluorinated bile acid that prevents 17{alpha}-ethynyl-estradiol-induced cholestasis in rats

    SciTech Connect

    Clerici, Carlo . E-mail: clerici@unipg.it; Castellani, Danilo; Asciutti, Stefania; Pellicciari, Roberto; Setchell, Kenneth D.R. |; O'Connell, Nancy C. |; Sadeghpour, Bahman; Camaioni, Emidio; Fiorucci, Stefano; Renga, Barbara; Nardi, Elisabetta; Sabatino, Giuseppe; Clementi, Mattia; Giuliano, Vittorio; Baldoni, Monia; Orlandi, Stefano; Mazzocchi, Alessandro; Morelli, Antonio; Morelli, Olivia

    2006-07-15

    3{alpha}-6{alpha}-Dihydroxy-7{alpha}-fluoro-5{beta}-cholanoate (UPF-680), the 7{alpha}-fluorine analog of hyodeoxycholic acid (HDCA), was synthesized to improve bioavailability and stability of ursodeoxycholic acid (UDCA). Acute rat biliary fistula and chronic cholestasis induced by 17{alpha}-ethynyl-estradiol (17EE) models were used to study and compare the effects of UPF-680 (dose range 0.6-6.0 {mu}mol/kg min) with UDCA on bile flow, biliary bicarbonate (HCO{sub 3} {sup -}), lipid output, biliary bile acid composition, hepatic enzymes and organic anion pumps. In acute infusion, UPF-680 increased bile flow in a dose-related manner, by up to 40.9%. Biliary HCO{sub 3} {sup -} output was similarly increased. Changes were observed in phospholipid secretion only at the highest doses. Treatment with UDCA and UPF-680 reversed chronic cholestasis induced by 17EE; in this model, UDCA had no effect on bile flow in contrast to UPF-680, which significantly increased bile flow. With acute administration of UPF-680, the biliary bile acid pool became enriched with unconjugated and conjugated UPF-680 (71.7%) at the expense of endogenous cholic acid and muricholic isomers. With chronic administration of UPF-680 or UDCA, the main biliary bile acids were tauro conjugates, but modification of biliary bile acid pool was greater with UPF-680. UPF-680 increased the mRNA for cytochrome P450 7A1 (CYP7A1) and cytochrome P450 8B (CYP8B). Both UDCA and UPF-680 increased the mRNA for Na{sup +} taurocholate co-transporting polypeptide (NCTP). In conclusion, UPF-680 prevented 17EE-induced cholestasis and enriched the biliary bile acid pool with less detergent and cytotoxic bile acids. This novel fluorinated bile acid may have potential in the treatment of cholestatic liver disease.

  1. Nicotine cue: lack of effect of the alpha 7 nicotinic receptor antagonist methyllycaconitine.

    PubMed

    Brioni, J D; Kim, D J; O'Neill, A B

    1996-04-22

    To assess the role of the alpha 7 neuronal nicotinic acetylcholine receptor in the discriminative stimulus properties of (-)-nicotine, this study investigated the ability of the alpha 7 receptor antagonist methyllycaconitine to modulate the nicotine cue. In rats trained to discriminate (-)-nicotine from saline, intraperitoneal injections of methyllycaconitine neither induced nor blocked the nicotine cue. Intracerebroventricular administration of methyllycaconitine, neither potentiated nor blocked the effect of (-)-nicotine. On the other hand, intracerebroventricular injections of mecamylamine blocked the nicotine cue. The available evidence indicate that the nicotinic acetylcholine receptors in the brain blocked by methyllycaconitine, those presumably containing alpha 7 subunits, do not participate in the expression of the discriminative stimulus properties of (-)-nicotine.

  2. In vitro and in vivo gene delivery mediated by Lactosylated dendrimer/alpha-cyclodextrin conjugates (G2) into hepatocytes.

    PubMed

    Arima, Hidetoshi; Yamashita, Shogo; Mori, Yoshimasa; Hayashi, Yuya; Motoyama, Keiichi; Hattori, Kenjiro; Takeuchi, Tomoko; Jono, Hirofumi; Ando, Yukio; Hirayama, Fumitoshi; Uekama, Kaneto

    2010-08-17

    The purpose of this study is to evaluate in vitro and in vivo gene delivery efficiency of polyamidoamine (PAMAM) starburst dendrimer (generation 2, G2) conjugates with alpha-cyclodextrin (alpha-CDE (G2)) bearing lactose (Lac-alpha-CDE) with various degrees of substitution of the lactose moiety (DSL) as a novel hepatocyte-selective carrier in hepatocytes. Lac-alpha-CDE (DSL 2.6) was found to have much higher gene transfer activity than dendrimer, alpha-CDE, Lac-alpha-CDE (DSL 1.2, 4.6, 6.2 and 10.2) and lactosylated dendrimer (Lac-dendrimer, DSL 2.4) in HepG2 cells, which are dependent on the expression of cell-surface asialoglycoprotein receptor (ASGP-R), reflecting the cellular association of the plasmid DNA (pDNA) complexes. The physicochemical properties of pDNA complex with Lac-alpha-CDE (DSL 2.6) were almost comparable to that with alpha-CDE. Lac-alpha-CDE (DSL 2.6) provided negligible cytotoxicity up to a charge ratio of 150 in HepG2 cells. Lac-alpha-CDE (DSL 2.6) provided gene transfer activity higher than jetPEI-Hepatocyte to hepatocytes with much less changes of blood chemistry values 12h after intravenous administration in mice. These results suggest the potential use of Lac-alpha-CDE (DSL 2.6) as a non-viral vector for gene delivery toward hepatocytes.

  3. The modulation of tumour necrosis factor-alpha, interleukin-1 alpha and glucose levels with GMDP and other analogues of muramyl dipeptide.

    PubMed

    Adeleye, T A; Moreno, C; Ivanyi, J; Aston, R

    1994-02-01

    Immunomodulatory agent muramyl dipeptide (MDP) and seven of its analogues were tested for ability to counteract the toxic actions of lipopolysaccharide (LPS) in experimental mouse models. Female BALB/c mice were presensitized with Corynebacterium parvum (P. acnes) and given MDP or equimolar doses of one of its analogues after 2 weeks, followed by intravenous challenge with LPS 18 h later. This treatment produced a sharp increase in blood cytokine (TNF-alpha, IL-1 alpha) levels 4 h after LPS administration followed by a decline to control values after 6 h. Four analogues, GMDP, threonylMDP, GMDPBenz and GMDPOBut, were able to reduce the level of cytokines induced with LPS. For most of the analogues, the higher doses reduced the levels of TNF-alpha but slightly increased the concomitant IL-1 alpha levels. GMDP was the most effective compound tested in terms of reduction of TNF-alpha and IL-1 alpha levels, as well as for reduction of the hypoglycaemia caused by the administration of LPS. PMID:8167010

  4. Lactobacillus casei secreting alpha-MSH induces the therapeutic effect on DSS-induced acute colitis in Balb/c Mice.

    PubMed

    Yoon, Sun-Woo; Lee, Chul-Ho; Kim, Jeong-Yoon; Kim, Jie-Youn; Sung, Moon-Hee; Poo, Haryoung

    2008-12-01

    The neuropeptide alpha-melanocyte-stimulating hormone (alpha- MSH) has anti-inflammatory property by downregulating the expressions of proinflammatory cytokines. Because alpha-MSH elicits the anti-inflammatory effect in various inflammatory disease models, we examined the therapeutic effect of oral administration of recombinant Lactobacillus casei, which secretes alpha-MSH (L. casei-alpha-MSH), on dextran sulfate sodium (DSS)-induced colitis in Balb/c mice. Thus, we constructed the alpha-MSH-secreting Lactobacillus casei by the basic plasmid, pLUAT-ss, which was composed of a PldhUTLS promoter and alpha-amylase signal sequence from Streptococcus bovis strain. Acute colitis was induced by oral administration of 5% DSS in drinking water for 7 days. To investigate the effect of L. casei-alpha-MSH on the colitis, L. casei or L. casei-alpha-MSH was orally administered for 7 days and their effects on body weight, mortality rate, cytokine production, and tissue myeloperoxidase (MPO) activity were observed. Administration of L. casei-alpha-MSH reduced the symptom of acute colitis as assessed by body weight loss (DSS alone: 14.45+/-0. 2 g; L. casei-alpha- MSH: 18.2+/-0.12 g), colitis score (DSS alone: 3.6+/-0.4; L. casei-alpha-MSH: 1.4+/-0.6), MPO activity (DSS alone: 42.7+/-4.5 U/g; L. casei-alpha-MSH: 10.25+/-0.5 U/g), survival rate, and histological damage compared with the DSS alone mice. L. casei-alpha-MSH-administered entire colon showed reduced in vitro production of proinflammatory cytokines and NF-kappaB activation. The alpha-MSH-secreting recombinant L. casei showed significant anti-inflammatory effects in the murine model of acute colitis and suggests a potential therapeutic role for this agent in clinical inflammatory bowel diseases.

  5. Involvement of interleukin-8, vascular endothelial growth factor, and basic fibroblast growth factor in tumor necrosis factor alpha-dependent angiogenesis.

    PubMed Central

    Yoshida, S; Ono, M; Shono, T; Izumi, H; Ishibashi, T; Suzuki, H; Kuwano, M

    1997-01-01

    Tumor necrosis factor alpha (TNF-alpha) is a macrophage/monocyte-derived polypeptide which modulates the expression of various genes in vascular endothelial cells and induces angiogenesis. However, the underlying mechanism by which TNF-alpha mediates angiogenesis is not completely understood. In this study, we assessed whether TNF-alpha-induced angiogenesis is mediated through TNF-alpha itself or indirectly through other TNF-alpha-induced angiogenesis-promoting factors. Cellular mRNA levels of interleukin-8 (IL-8), vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), and their receptors were increased after the treatment of human microvascular endothelial cells with TNF-alpha (100 U/ml). TNF-alpha-dependent tubular morphogenesis in vascular endothelial cells was inhibited by the administration of anti-IL-8, anti-VEGF, and anti-bFGF antibodies, and coadministration of all three antibodies almost completely abrogated tubular formation. Moreover, treatment with Sp1, NF-kappaB, and c-Jun antisense oligonucleotides inhibited TNF-alpha-dependent tubular morphogenesis by microvascular endothelial cells. Administration of a NF-kappaB antisense oligonucleotide almost completely inhibited TNF-alpha-dependent IL-8 production and partially abrogated TNF-alpha-dependent VEGF production, and an Sp1 antisense sequence partially inhibited TNF-alpha-dependent production of VEGF. A c-Jun antisense oligonucleotide significantly inhibited TNF-alpha-dependent bFGF production but did not affect the production of IL-8 and VEGF. Administration of an anti-IL-8 or anti-VEGF antibody also blocked TNF-alpha-induced neovascularization in the rabbit cornea in vivo. Thus, angiogenesis by TNF-alpha appears to be modulated through various angiogenic factors, both in vitro and in vivo, and this pathway is controlled through paracrine and/or autocrine mechanisms. PMID:9199336

  6. alpha-Thalassemia caused by an unstable alpha-globin mutant.

    PubMed Central

    Liebhaber, S A; Kan, Y W

    1983-01-01

    In a previous study, molecular cloning of the alpha-globin genes from a patient with nondeletion Hb-H disease (genotype--/alpha alpha) showed that a single nucleotide mutation (CTG to CCG) in one of the genes resulted in a leucine to proline substitution. This paper describes the approach we used to detect the abnormal alpha-globin chain. The chain was identified using a cell-free translation system. It turned over rapidly both in vitro and in vivo in the patient's reticulocytes. The unusual feature of this unstable alpha-globin is that the alpha-globin deficiency causes alpha-thalassemia. Simple heterozygotes for this lesion (alpha Pro alpha/alpha alpha) resemble alpha-thalassemia carriers and do not exhibit the hemolytic anemia usually associated with unstable hemoglobins. Images PMID:6826718

  7. PPAR{alpha} gene expression is up-regulated by LXR and PXR activators in the small intestine

    SciTech Connect

    Inoue, Jun; Satoh, Shin-ichi; Kita, Mariko; Nakahara, Mayuko; Hachimura, Satoshi; Miyata, Masaaki; Nishimaki-Mogami, Tomoko; Sato, Ryuichiro

    2008-07-11

    LXR, PXR, and PPAR{alpha} are members of a nuclear receptor family which regulate the expression of genes involved in lipid metabolism. Here, we show the administration of T0901317 stimulates PPAR{alpha} gene expression in the small intestine but not in the liver of both normal and FXR-null mice. The administration of LXR specific ligand GW3965, or PXR specific ligand PCN has the same effect, indicating that ligand-dependent activation of LXR and PXR, but not FXR, is responsible for the increased gene expression of PPAR{alpha} in the mouse small intestine.

  8. Bremsstrahlung in {alpha} Decay Reexamined

    SciTech Connect

    Boie, H.; Scheit, H.; Jentschura, U. D.; Koeck, F.; Lauer, M.; Schwalm, D.; Milstein, A. I.; Terekhov, I. S.

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the {alpha} decay of {sup 210}Po has been performed, which allows us to follow the photon spectra up to energies of {approx}500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the {alpha} particle and the emitted photon.

  9. NACA Physicist Studying Alpha Rays

    NASA Technical Reports Server (NTRS)

    1957-01-01

    NACA Physicits studying Alpha Rays in a continuous cloud chamber. A cloud chamber is used by Lewis scientists to obtain information aimed at minimizing undesirable effects of radiation on nuclear-powered aircraft components. Here, alpha particles from a polonium source emit in a flower-like pattern at the cloud chamber's center. The particles are made visible by means of alcohol vapor diffusing from an area at room temperature to an area at minus -78 deg. Centigrade. Nuclear-powered aircraft were never developed and aircraft nuclear propulsion systems were canceled in the early 1960s.

  10. Bremsstrahlung in alpha decay reexamined.

    PubMed

    Boie, H; Scheit, H; Jentschura, U D; Köck, F; Lauer, M; Milstein, A I; Terekhov, I S; Schwalm, D

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the alpha decay of (210)Po has been performed, which allows us to follow the photon spectra up to energies of approximately 500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the alpha particle and the emitted photon.

  11. Test chamber for alpha spectrometry

    DOEpatents

    Larsen, Robert P.

    1977-01-01

    Alpha emitters for low-level radiochemical analysis by measurement of alpha spectra are positioned precisely with respect to the location of a surface-barrier detector by means of a chamber having a removable threaded planchet holder. A pedestal on the planchet holder holds a specimen in fixed engagement close to the detector. Insertion of the planchet holder establishes an O-ring seal that permits the chamber to be pumped to a desired vacuum. The detector is protected against accidental contact and resulting damage.

  12. Selective increase of alpha 1-adrenoceptors and muscarinic cholinergic receptors in rat cerebral cortex after chronic haloperidol.

    PubMed

    Pazo, J H; Levi de Stein, M; Jerusalinsky, D; Novas, M L; Raskovsky, S; Tumilasci, O R; Medina, J H; De Robertis, E

    1987-06-30

    The effect of chronic administration of haloperidol on alpha 1-, alpha 2-, and beta-adrenoceptors, cholinergic muscarinic, GABAA and benzodiazepine receptors in the cerebral cortex of the rat was investigated. Doses of 0.3 and 2 mg/kg of haloperidol during 7 days increased markedly the density of alpha 1-adrenoceptors without changes in affinity. The alpha 2- and beta-adrenoceptors were not modified after neuroleptic administration. The number of muscarinic receptors were also increased after haloperidol treatment (2 mg/kg/day). However, the GABAA and benzodiazepine binding sites remained unchanged. In the brainstem an increment in the alpha 1-, but not the beta-adrenoceptors was observed. The well known increase in the dopamine receptors in the striatum was confirmed. These observations demonstrate a multireceptor effect of haloperidol in the cerebral cortex.

  13. Users Speak Out: A Look at Six Administrative Software Programs.

    ERIC Educational Resources Information Center

    Bruder, Isabelle

    1988-01-01

    Reviews six microcomputer-based administrative software programs that handle scheduling, grade reporting, and attendance tasks: (1) Alpha II, (2) Harts III, (3) Mount Castor, (4) The Osiris System, (5) The School System, and (6) STARS (Student Academic Records System). Companies producing the programs, systems they run on, and price information…

  14. Androgen regulated expression of the alpha 2u-globulin gene in pancreatic hepatocytes of rat

    PubMed Central

    1990-01-01

    Under a copper-deficient regimen, pancreatic cells in the adult rat can be found to undergo differentiation into hepatocytes. Pancreatic hepatocytes induced in male and female rats were examined for the expression of the androgen-inducible hepatic protein, alpha 2u- globulin. Alpha 2u-Globulin protein was demonstrable by immunoperoxidase method in all the pancreatic hepatocytes of male rats. Northern blot analysis confirmed the presence of 1.3 kb alpha 2u- globulin mRNA transcript in the pancreas of male rats with hepatocytes. Orchiectomy resulted in marked decrease of alpha 2u-globulin protein and its mRNA. Administration of dihydrotestosterone to castrated rats resulted in increased levels of alpha 2u-globulin mRNA and the amount of alpha 2u-globulin protein in the pancreatic hepatocytes. Unlike normal males, in intact and ovariectomized females alpha 2u-globulin was not detectable in pancreatic hepatocytes. These results indicate that similar to hepatic parenchymal cells pancreatic hepatocytes synthesize alpha 2u-globulin under androgenic regulation. Furthermore, unlike in liver where it is expressed predominantly in perivenular and midlobular hepatocytes, there is no localized difference in the expression of this gene in the transdifferentiated pancreatic hepatocytes. PMID:1688854

  15. Ginsenoside Rf, a component of ginseng, regulates lipoprotein metabolism through peroxisome proliferator-activated receptor {alpha}

    SciTech Connect

    Lee, Hyunghee; Gonzalez, Frank J.; Yoon, Michung . E-mail: yoon60@mokwon.ac.kr

    2006-01-06

    We investigated whether ginseng regulates lipoprotein metabolism by altering peroxisome proliferator-activated receptor {alpha} (PPAR{alpha})-mediated pathways, using a PPAR{alpha}-null mouse model. Administration of ginseng extract, ginsenosides, and ginsenoside Rf (Rf) to wild-type mice not only significantly increased basal levels of hepatic apolipoprotein (apo) A-I and C-III mRNA compared with wild-type controls, but also substantially reversed the reductions in mRNA levels of apo A-I and C-III expected following treatment with the potent PPAR{alpha} ligand Wy14,643. In contrast, no effect was detected in the PPAR{alpha}-null mice. Testing of eight main ginsenosides on PPAR{alpha} reporter gene expression indicated that Rf was responsible for the effects of ginseng on lipoprotein metabolism. Furthermore, the inhibition of PPAR{alpha}-dependent transactivation by Rf seems to occur at the level of DNA binding. These results demonstrate that ginseng component Rf regulates apo A-I and C-III mRNA and the actions of Rf on lipoprotein metabolism are mediated via interactions with PPAR{alpha}.

  16. Responsiveness of alpha 1 and beta 1 cochlear Na, K-ATPase isoforms to thyroid hormone.

    PubMed

    Zuo, J; Rarey, K E

    1996-05-01

    The effects of thyroid hormone on Na, K-ATPase subunit isoforms under euthyroid (EUTH), hypothyroid (HYPO) and hyperthyroid (HYPER) states were investigated via immunocytochemistry and the use of polyclonal antibodies specific to each isoform (alpha 1, alpha 2, alpha 3 and beta 1, beta 2). In HYPO animals, there was a distinct decrease in Na, K-ATPase alpha 1 isoform immunoreactivity in the stria vascularis (SV), spiral ganglion (SG) cells, spiral limbus (SLi) and cochlear nerve (CN) as compared with that in EUTH animals by the 17th day of the experiment. Immunostaining of the alpha 1 isoform increased in HYPER animals as compared with that in HYPO animals, and reached a level comparable to that in EUTH animals after 2 days of triiodothyronine (T3) treatment. Levels of alpha 2, alpha 3 and beta 2 isoforms did not appear to be affected by T3 administration. By the 19th day of a low I2 diet, the immunoreactive intensity of the beta 1 isoform was reduced in cochlear tissues of HYPO animals as compared with that in EUTH animals. The immunoreactivity of the beta 1 isoform increased after treatment with T3 for 4 days and was comparable with levels in EUTH animals. These data indicate that alpha 1 and beta 1 isoforms within specific cochlear regions of the adult rat are responsive to thyroid hormone.

  17. Alcoholism, Alpha Production, and Biofeedback

    ERIC Educational Resources Information Center

    Jones, Frances W.; Holmes, David S.

    1976-01-01

    Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater…

  18. Targeted therapy using alpha emitters.

    PubMed

    Vaidyanathan, G; Zalutsky, M R

    1996-10-01

    Radionuclides such as 211At and 212Bi which decay by the emission of alpha-particles are attractive for certain applications of targeted radiotherapy. The tissue penetration of 212Bi and 211At alpha-particles is equivalent to only a few cell diameters, offering the possibility of combining cell-specific targeting with radiation of similar range. Unlike the beta-particles emitted by radionuclides such as 131I and 90Y, alpha-particles are radiation of high linear energy transfer and thus greater biological effectiveness. Several approaches have been explored for targeted radiotherapy with 212Bi- and 211At-labelled substances including colloids, monoclonal antibodies, metabolic precursors, receptor-avid ligands and other lower molecular weight molecules. An additional agent which exemplifies the promise of alpha-emitting radiopharmaceuticals is meta-[211At]astatobenzylguanidine. The toxicity of this compound under single-cell conditions, determined both by [3H]thymidine incorporation and by limiting dilution clonogenic assays, for human neuroblastoma cells is of the order of 1000 times higher than that of meta-[131I] iodobenzylguanidine. For meta-[211At] astatobenzylguanidine, the Do value was equivalent to only 6-7 211At atoms bound per cell. These results suggest that meta-[211At] astatobenzylguanidine might be valuable for the targeted radiotherapy of micrometastatic neuroblastomas.

  19. Meet the Alpha-Pets.

    ERIC Educational Resources Information Center

    Zitlaw, Jo Ann Bruce; Frank, Cheryl Standish

    1985-01-01

    "Alpha-Pets" are the focal point of an integrated, multidisciplinary curriculum. Each pet is featured for a week in a vocabulary-rich story and introduces related activities beginning with the featured letter, such as the four food groups during Freddie Fish's week or universe during Ulysses Unicorn's week. (MT)

  20. Alpha proton x ray spectrometer

    NASA Technical Reports Server (NTRS)

    Rieder, Rudi; Waeke, H.; Economou, T.

    1994-01-01

    Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

  1. Postnatal changes of nicotinic acetylcholine receptor alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits genes expression in rat brain.

    PubMed

    Zhang, X; Liu, C; Miao, H; Gong, Z H; Nordberg, A

    1998-10-01

    Postnatal changes of nicotinic acetylcholine receptor (nAChR) alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits mRNAs were investigated in rat brain using ribonuclease protection assay. Multiple developmental patterns were observed: (1) transient expression during the first few postnatal weeks; alpha 2 in the hippocampus and brain stem, alpha 3 in the striatum, cerebellum and cortex, alpha 4 in the hippocampus, striatum and cerebellum, alpha 7 in the cerebellum and beta 2 in the striatum. (2) Constant expression across development; alpha 2 and alpha 3 in the thalamus, alpha 4 in the cortex, thalamus and brain stem, alpha 7 in the thalamus and brain stem and beta 2 in all brain regions except striatum. (3) Non-detection across development; alpha 2 in the cortex, striatum and cerebellum. (4) Increase with age; alpha 7 in the cortex and hippocampus. (5) Bell-shaped development; alpha 7 in the striatum. Postnatal changes of nAChR isoforms in different brain regions of rat were investigated by receptor binding assays. The developmental patterns of [3H]epibatidine and (-)-[3H]nicotine binding sites were similar to each other in each brain region, but different from that of [3H] alpha-bungarotoxin binding sites. No obvious correlation was observed between the developmental patterns of [3H] alpha-bungarotoxin, [3H]epibatidine and (-)-[3H]nicotine binding sites and corresponding subunits mRNAs. These results indicate that multiple mechanisms are involved in changes of gene expression of nAChRs subunits in the brain of developing rats.

  2. Transportation Security Administration

    MedlinePlus

    ... content Official website of the Department of Homeland Security Transportation Security Administration A - Z Index What Can I Bring? Search form Apples Main menu Administrator Travel Security Screening Special Procedures TSA Pre✓® Passenger Support Travel ...

  3. cap alpha. -Methyl-p-tyrosine shifts circadian temperature rhythms

    SciTech Connect

    Cahill, A.L.; Ehret, C.F.

    1982-09-01

    ..cap alpha..-Methyl-p-tyrosine shifts the acrophase (time of highest temperature) of the circadian temperature rhythm of the rat to earlier or later times of day depending on the phase of the cicadian cycle at which the drug is administered. When ..cap alpha..-methyl-p-tyrosine methyl ester HCl is injected intraperitoneally at a dose of 100 mg/kg late in the projected 8-h light phase, the acrophase of the intraperitoneal temperature rhythm is delayed by up to 3 h.However, when the same dose of drug is given 9-10 h into the projected 16-h dark phase of the daily cycle, the acrophase of the temperature rhythm occurs about 2 h earlier than expected. The times of ..cap alpha..-methyl-p-tyrosine administration leading to maximal phase delays or advances are correlated with the times of minimal and maximal turnover of norepinephrine in the hypothalamus. These results suggest that changing rates of norepinephrine turnover in the hypothalamus may regulate the circadian temperature rhythm in rats. The results also emphasize the fact that the effects of drugs may vary as a function of the time of administration. This fact must be taken into account in pharmacologic testing.

  4. NASA, NOAA administrators nominated

    NASA Astrophysics Data System (ADS)

    Richman, Barbara T.

    President Ronald Reagan recently said he intended to nominate James Montgomery Beggs as NASA Administrator and John V. Byrne as NOAA Administrator. These two positions are key scientific posts that have been vacant since the start of the Reagan administration on January 20. The President also said he intends to nominate Hans Mark as NASA Deputy Administrator. At press time, Reagan had not designated his nominee for the director of the Office of Science and Technology Policy.

  5. Coexistence of {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in {sup 10}Be

    SciTech Connect

    Itagaki, N.; Ito, M.; Milin, M.; Hashimoto, T.; Ishiyama, H.; Miyatake, H.

    2008-06-15

    The coexistence of the {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in the excited states of {sup 10}Be has been discussed. In the previous analysis, all the low-lying states of {sup 10}Be were found to be well described by the motion of the two valence neutrons around two {alpha} clusters. However, the {alpha}+t+t cluster structure was found to coexist with the {alpha}+{alpha}+n+n structure around E{sub x}=15 MeV, close to the corresponding threshold. We have introduced a microscopic model to solve the coupling effect between these two configurations. The K=0 and K=1 states are generated from the {alpha}+t+t configurations due to the spin coupling of two triton clusters. The present case of {sup 10}Be is one of the few examples in which completely different configurations of triton-type ({alpha}+t+t three-center) and {alpha}-type ({alpha}+{alpha}+n+n two-center) clusters coexist in a single nucleus in the same energy region.

  6. A synopsis of collective alpha effects and implications for ITER

    SciTech Connect

    Sigmar, D.J.

    1990-10-01

    This paper discusses the following: Alpha Interaction with Toroidal Alfven Eigenmodes; Alpha Interaction with Ballooning Modes; Alpha Interaction with Fishbone Oscillations; and Implications for ITER.

  7. A Philosophy of Administration.

    ERIC Educational Resources Information Center

    Bruening, William H.

    Justification is given for paying relatively large salaries to college administrators, specifically the president or chancellor and the chief academic officer. Three administrative task areas are discussed as criteria: management, administration per se, and leadership. It is contended that only leadership can be used as a criterion for…

  8. Genetics Home Reference: 5-alpha reductase deficiency

    MedlinePlus

    ... gene provides instructions for making an enzyme called steroid 5-alpha reductase 2. This enzyme is involved ... external genitalia. Mutations in the SRD5A2 gene prevent steroid 5-alpha reductase 2 from effectively converting testosterone ...

  9. What Causes Alpha-1 Antitrypsin Deficiency?

    MedlinePlus

    ... from the NHLBI on Twitter. What Causes Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency is an inherited disease. "Inherited" ... have AAT deficiency inherit two faulty AAT genes, one from each parent. These genes tell cells in ...

  10. How Is Alpha-1 Antitrypsin Deficiency Treated?

    MedlinePlus

    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Treated? Alpha-1 antitrypsin (AAT) deficiency has no cure, but its ... of these treatments are the same as the ones used for a lung disease called COPD (chronic ...

  11. Q (Alpha) Function and Squeezing Effect

    NASA Technical Reports Server (NTRS)

    Yunjie, Xia; Xianghe, Kong; Kezhu, Yan; Wanping, Chen

    1996-01-01

    The relation of squeezing and Q(alpha) function is discussed in this paper. By means of Q function, the squeezing of field with gaussian Q(alpha) function or negative P(a)function is also discussed in detail.

  12. Interleukin-1 alpha has antiallodynic and antihyperalgesic activities in a rat neuropathic pain model.

    PubMed

    Mika, Joanna; Korostynski, Michal; Kaminska, Dorota; Wawrzczak-Bargiela, Agnieszka; Osikowicz, Maria; Makuch, Wioletta; Przewlocki, Ryszard; Przewlocka, Barbara

    2008-09-15

    Nerve injury and the consequent release of interleukins (ILs) are processes implicated in pain transmission. To study the potential role of IL-1 in the pathogenesis of allodynia and hyperalgesia, IL-1alpha and comparative IL-1beta, IL-6, and IL-10 mRNA levels were quantified using competitive RT-PCR of the lumbar spinal cord and dorsal root ganglia (DRG; L5-L6) three and seven days after chronic constriction injury (CCI) in rats. Microglial and astroglial activation in the ipsilateral spinal cord and DRG were observed after injury. In naive and CCI-exposed rats, IL-1alpha mRNA and protein were not detected in the spinal cord. IL-1beta and IL-6 mRNAs were strongly ipsilaterally elevated on day seven after CCI. In the ipsilateral DRG, IL-1alpha, IL-6, and IL-10 mRNA levels were increased on days three and seven; IL-1beta was elevated only on day seven. Western blot analysis revealed both the presence of IL-1alpha proteins (45 and 31 kDa) in the DRG and the down-regulation of these proteins after CCI. Intrathecal administration of IL-1alpha (50-500 ng) in naive rats did not influence nociceptive transmission, but IL-1beta (50-500 ng) induced hyperalgesia. In rats exposed to CCI, an IL-1alpha or IL-1 receptor antagonist dose-dependently attenuated symptoms of neuropathic pain; however, no effect of IL-1beta was observed. In sum, the first days after CCI showed a high abundance of IL-1alpha in the DRG. Together with the antiallodynic and antihyperalgesic effects observed after IL-1alpha administration, this finding indicates an important role for IL-1alpha in the development of neuropathic pain symptoms.

  13. Evidence that nicotinic alpha(7) receptors are not involved in the hyperlocomotor and rewarding effects of nicotine.

    PubMed

    Grottick, A J; Trube, G; Corrigall, W A; Huwyler, J; Malherbe, P; Wyler, R; Higgins, G A

    2000-09-01

    Neuronal nicotinic receptors are comprised of combinations of alpha(2-9) and beta(2-4) subunits arranged to form a pentameric receptor. Currently, the principal central nervous system (CNS) subtypes are believed to be alpha(4)beta(2) and a homomeric alpha(7) receptor, although other combinations almost certainly exist. The identity of the nicotinic receptor subtype(s) involved in the rewarding effects of nicotine are unknown. In the present study, using some recently described subtype selective nicotinic agonists and antagonists, we investigated the role of the alpha(7) nicotinic receptor in the mediation of nicotine-induced hyperactivity and self-administration in rats. The alpha(7) receptor agonists AR-R 17779 and DMAC failed to stimulate locomotor activity in both nicotine-nontolerant and -sensitized rats. In contrast, nicotine and the putative alpha(4)beta(2) subtype selective agonist SIB1765F increased activity in both experimental conditions. In nicotine-sensitized rats, the high affinity (including the alpha(4)beta(2) subtype) nicotinic antagonist dihydro-beta-erythroidine (DHbetaE), but not the selective alpha(7) antagonist methyllycaconitine (MLA), antagonized a nicotine-induced hyperactivity. Similarly, DHbetaE, but not MLA, pretreatment reduced nicotine self-administration. Electrophysiology experiments using Xenopus oocytes expressing the human alpha(7) receptor confirmed AR-R 17779 and DMAC to be potent agonists at this site, and further studies demonstrated the ability of systemically administered AR-R 17779 to penetrate into the CNS. Taken together, these results indicate a negligible role of alpha(7) receptors in nicotine-induced hyperlocomotion and reward in the rat, and support the view for an involvement of a member from the high-affinity nicotinic receptor subclass, possibly alpha(4)beta(2). Issues such as drug potency, CNS penetration, and desensitization of the alpha(7) receptor are discussed.

  14. Association of actin with alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Boyle, D.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The alpha crystallins are cytosolic proteins that co-localize and co-purify with actin-containing microfilaments. Affinity column chromatography employing both covalently-coupled actin or alpha crystallin was used to demonstrate specific and saturable binding of actin with alpha crystallin. This conclusion was confirmed by direct visualization of alpha aggregates bound to actin polymerized in vitro. The significance of this interaction in relation to the functional properties of these two polypeptides will be discussed.

  15. Proscar (Finasteride) inhibits 5 alpha-reductase activity in the ovaries and testes of Lytechinus variegatus Lamarck (Echinodermata: Echinoidea).

    PubMed

    Wasson, K M; Watts, S A

    1998-10-01

    Recent investigations into the steroid metabolic pathway in the echinoid Lytechinus variegatus demonstrated the capacity of the gonads to convert androstenedione, the classical mammalian precursor to bioactive androgens, into testosterone and a variety of 5 alpha-reduced androgens including 5 alpha-androstane-3 beta, 17 beta-diol and 5 alpha-androstane-3 alpha, 17 beta-diol. The synthesis of these steroids, which requires 5 alpha-reductase activity, varies with sex and reproductive state in L. variegatus, suggesting that these steroids may be involved in reproductive processes. The classical method of castration followed by steroid replacement therapy to determine the biological role of steroids in the gonads of higher vertebrates is not possible in echinoids. Therefore, this study was designed to determine the efficacy of finasteride, a selective 5 alpha-reductase inhibitor in the mammalian prostate gland, on 5 alpha-reductase activity in the gonads of L. variegatus. Finasteride inhibits echinoid 5 alpha-reductase in a dose-dependent manner with IC50 approximately 2.7 microM for both ovaries and testes. These echinoid IC50s are significantly higher than those reported for humans and rats. In addition, oral administration of finasteride to the echinoids appeared to inhibit 5 alpha-reductase with no apparent stress (no spine loss) to the animals. These data suggest that finasteride may be used to selectively and chemically ablate 5 alpha-reduced androgen synthesis in the gonads of L. variegatus. PMID:9827060

  16. The ultraviolet spectra of Alpha Aquilae and Alpha Canis Minoris

    NASA Technical Reports Server (NTRS)

    Morton, D. C.; Bruzual A., G.; Kurucz, R. L.; Spinrad, H.

    1977-01-01

    Scans of Alpha Aql (A7 IV, V) and Alpha CMi (F5 IV-V) obtained with the Copernicus satellite spectrometer over the wavelength range from 2100 to 3200 A are presented along with a spectrum of the integrated solar disk over the same range procured during a calibrated rocket flight. About 1500 fairly strong absorption lines in the Alpha CMi spectrum between 2400 and 2961 A are identified by comparison with a solar atlas and by using a theoretical spectrum synthesized from a blanketed LTE model with an effective temperature of 6500 K and a surface gravity of 10,000 cm/sec per sec. The Mg II resonance doublet at 2795.528 and 2802.704 A is found to be present in all three stars together with a discontinuity at 2635 A due to Fe II, Fe I, Cr I, and Mn II. It is concluded that the Mg II resonance lines and the 2635-A continuum break would be the best spectral features for estimating the redshift of a galaxy observed at low resolution provided the redshift is not less than about 0.75.

  17. Effectiveness of Alpha Biofeedback Therapy: Negative Results.

    ERIC Educational Resources Information Center

    Watson, Charles G.; Herder, Joseph

    1980-01-01

    Assessed the utility of alpha biofeedback training in the treatment of patients (N=66). Biofeedback and placebo biofeedback groups were given alpha or mock-alpha training sessions. Improvement on 54 variables was compared to that of no-treatment controls. Only a chance number of significant changes appeared among the groups. (Author)

  18. Recent Results on the CKM Angle Alpha

    SciTech Connect

    Mihalyi, A.; /Wisconsin U., Madison

    2005-10-18

    The method to measure the CKM angle {alpha} and the modes sensitive to it are discussed. It is shown that the B {yields} {rho}{rho} decays provide the most stringent constraint on {alpha}, which is found to be {alpha} = 96{sup o} {+-} 10{sup o}(stat) {+-} 4{sup o}(syst){+-} 13{sup o}(penguin).

  19. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  20. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  1. 6 alpha-Fluoro- and 6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione: synthesis and evaluation of activity and kinetics of their C-22 epimers.

    PubMed

    Thalén, B A; Axelsson, B I; Andersson, P H; Brattsand, R L; Nylander, B; Wickström, L I

    1998-01-01

    It is generally accepted that the anti-inflammatory effect of glucocorticosteroids cannot be separated from their adverse effects at the receptor level. However, modification of the pharmacokinetics through structural alterations could provide steroids with a better therapeutic index than those currently used. Thus, new 16 alpha,17 alpha-acetals between butyraldehyde and 6 alpha-fluoro- or 6 alpha,9 alpha-difluoro-16 alpha-hydroxycortisol were synthesized and studied. Acetalization of the corresponding 16 alpha,17 alpha-diols or transacetalization of their 16 alpha,17 alpha-acetonides in dioxane produced mixtures of C-22 epimers, which were resolved by preparative chromatography. Alternatively, an efficient method was used to produce the 22R-epimer stereoselectively through performing the acetalization and transacetalization in a hydrocarbon with an inert material present. The C-22 configuration of (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione was unambiguously established by single crystal X-ray diffraction. The present compounds, especially the 22R-epimer just mentioned, bind to the rat thymus glucocorticoid receptor with high potency. The C-22 epimers of the 6 alpha,9 alpha-difluoro derivatives showed a 10-fold higher biotransformation rate than the budesonide 22R-epimer when incubated with human liver S9 subcellular fraction. The high receptor affinity in combination with the high biotransformation rate indicates that (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione may be an improved 16 alpha,17 alpha-acetal glucocorticosteroid for therapy of inflammatory diseases, in which the mucous membranes are involved, such as those in the intestinal tract as well in the respiratory tract. PMID:9437793

  2. A Role for Presynaptic alpha(sub 2)-Adrenoceptors in Angiotensin 2-Induced Drinking in Rats

    NASA Technical Reports Server (NTRS)

    Fregly, Melvin J.; Rowland, Neil E.; Greenleaf, John E.

    1984-01-01

    Studies from this laboratory have shown that either central or peripheral administration of clonidine, the alpha(sub 2)-adrenoceptor agonist, can attenuate a variety of dipsogenic stimuli in rats. Further, yohimbine and tolazoline, alpha(sub 2)-adrenoceptor antagonists, augment the drinking response to both peripherally administered isoproterenol and angiotensin 2. Studies reported here establish a dose-inhibition relationship between the dose of clonidine administered (2 to 32 micrograms/kg) intracerebroventricularly (IVT) and inhibition of the drinking response to peripherally administered angiotensin 2 (200 micrograms/kg, SC). DI(sub 50) was approximately 4 micrograms/kg. Yohimbine (300 micrograms/kg, SC) reversed the antidipsogenic effect of centrally administered clonidine (32 micrograms/kg, IVT) on angiotensin 2-induced (200 micrograms/kg, SC) water intake. Phenylephrine, an alpha(sub 2)-adrenoceptor agonist, administered IVT (40 and 80 micrograms/kg) also inhibited angiotensin 2-induced drinking in a dose-related fashion. The antidipsogenic effect of phenylephfine (80 micrograms/kg) was blocked by administration of yohimbine (100 micrograms/kg, SC). Thus, this effect of phenylephrine most likely occurs by way of alpha(sub 2)- adrenoceptors. These results support a role for the pre-synaptic alpha(sub 2)-adrenoceptor in the mediation of drinking in rats. Activation of alpha(sub 2)-adrenoceptors is accompanied by reduced water intake while inhibition of these receptors enhances water intake.

  3. Transgenic Over Expression of Nicotinic Receptor Alpha 5, Alpha 3, and Beta 4 Subunit Genes Reduces Ethanol Intake in Mice

    PubMed Central

    Gallego, Xavier; Ruiz, Jessica; Valverde, Olga; Molas, Susanna; Robles, Noemí; Sabrià, Josefa; Crabbe, John C.; Dierssen, Mara

    2012-01-01

    Abuse of alcohol and smoking are extensively co-morbid. Some studies suggest partial commonality of action of alcohol and nicotine mediated through nicotinic acetylcholine receptors (nAChRs). We tested mice with transgenic over expression of the alpha 5, alpha 3, beta 4 receptor subunit genes, which lie in a cluster on human chromosome 15, that were previously shown to have increased nicotine self-administration, for several responses to ethanol. Transgenic and wild-type mice did not differ in sensitivity to several acute behavioral responses to ethanol. However, transgenic mice drank less ethanol than wild-type in a two-bottle (ethanol vs. water) preference test. These results suggest a complex role for this receptor subunit gene cluster in the modulation of ethanol’s as well as nicotine’s effects. PMID:22459873

  4. Transgenic over expression of nicotinic receptor alpha 5, alpha 3, and beta 4 subunit genes reduces ethanol intake in mice.

    PubMed

    Gallego, Xavier; Ruiz-Medina, Jessica; Valverde, Olga; Molas, Susanna; Robles, Noemí; Sabrià, Josefa; Crabbe, John C; Dierssen, Mara

    2012-05-01

    Abuse of alcohol and smoking are extensively co-morbid. Some studies suggest partial commonality of action of alcohol and nicotine mediated through nicotinic acetylcholine receptors (nAChRs). We tested mice with transgenic over expression of the alpha 5, alpha 3, beta 4 receptor subunit genes, which lie in a cluster on human chromosome 15, that were previously shown to have increased nicotine self-administration, for several responses to ethanol. Transgenic and wild-type mice did not differ in sensitivity to several acute behavioral responses to ethanol. However, transgenic mice drank less ethanol than wild-type in a two-bottle (ethanol vs. water) preference test. These results suggest a complex role for this receptor subunit gene cluster in the modulation of ethanol's as well as nicotine's effects.

  5. [Application of alpha1-adrenoblockers in treatment of ureteral calculi].

    PubMed

    Dutov, V V; Popov, D V; Rumiantsev, A A; Pashchenko, V B

    2012-01-01

    The results of evaluation of the efficacy of alpha1-adrenoblockers in treatment of ureteral calculi are presented. Comparative, prospective, placebo-uncontrolled nonrandomized single-center study was performed, which included 118 patients with solitary diagnosed calculi in various parts of ureter. After the pain relief, all the patients underwent conservative therapy aimed at spontaneous discharge of concretions. The maximum duration of conservative treatment was 28 days. Ultrasound monitoring was performed every week in all patients. The control group of patients received only Drotaverinum 40 mg three times a day, and analgesics. The main group received alpha1-adrenoblocker tamsulosin at a standard dose of 0.4 mg once a day along with Drotaverinum and analgesics. The overall probability of a discharge of concrements localized in the distal ureter was significantly (P = 0.02) higher in the patients treated with alpha1-adrenoblockers. Treatment regimen in main group of patients allowed better control of pain during all periods of observation, even if the discharge of concretions was not registered. The overall probability of migration of concrements from the proximal to the distal ureter in main group of patients was 52% versus 32% in controls (P = 0.17). The frequency of adverse effects was comparable in both groups. Vertigo, postural hypotension, and weakness were significantly more frequent in the main group of patients. Univariate and multivariate analyses of the proportional hazards model have demonstrated that the administration of alpha1-adrenoblocker increased the likelihood of a discharge of concrement from the distal ureter. It is shown that the nature of the applied therapy has directly influence on the risk of an earlier discharge of concretions. Inclusion of alpha1-adrenoblockers in the treatment scheme increased the probability of discharge of concrements at 4.11 times.

  6. alpha. -Adrenergic vasoconstriction and receptor subtypes in large coronary arteries of calves

    SciTech Connect

    Young, M.A.; Vatner, D.E.; Knight, D.R.; Graham, R.M.; Homcy, C.J.; Vatner, S.F. New England Regional Primate Research Center, Southborough, MA )

    1988-12-01

    The authors investigated {alpha}-adrenoceptor subtype distribution in large coronary arteries from both functional and biochemical perspectives. The effects of intracoronary administration of the selective {alpha}{sub 1}-adrenoceptor agonist phenylephrine, of the selective {alpha}{sub 2}-adrenoceptor agonist B-HT 920 and of the mixed {alpha}{sub 1+2}-adrenoceptor agonist norepinephrine were examined on measurements of left circumflex coronary artery diameter in conscious calves. After {beta}-adrenergic blockade, equivalent reductions in large coronary artery diameter were observed with phenylephrine, B-HT, and norepinephrine. Phenylephrine-induced constrictions were abolished by prazosin, an {alpha}{sub 1}-selective antagonist, but unaffected by rauwolscine, an {alpha}{sub 2}-selective antagonist. Conversely, the B-HT-induced constriction was abolished by rauwolscine but unaffected by prazosin. Coronary constriction with norepinephrine was attenuated with either prazosin or rauwolscine and abolished by the two antagonists combined. Ligand-binding studies in which ({sup 3}H)prazosin and ({sup 3}H)rauwolscine and sarcolemmal membranes were used revealed an {alpha}{sub 1}-adrenoceptor density of 15 {plus minus} 3.1 fmol/mg protein with a dissociation constant (K{sub D}) of 0.7 {plus minus} 0.2 nM and an {alpha}{sub 2}-adrenoceptor density of 68 {plus minus} 5.1 fmol/mg protein, with a K{sub D} of 7.4 {plus minus} 1.2 nM. Thus large coronary arteries of the calf contain both {alpha}{sub 1}- and {alpha}{sub 2}-adrenoceptor subtypes, each of which elicits constriction of the large coronary artery in the conscious animal.

  7. Alpha voltaic batteries and methods thereof

    NASA Technical Reports Server (NTRS)

    Raffaelle, Ryne P. (Inventor); Jenkins, Phillip (Inventor); Wilt, David (Inventor); Scheiman, David (Inventor); Chubb, Donald (Inventor); Castro, Stephanie (Inventor)

    2011-01-01

    An alpha voltaic battery includes at least one layer of a semiconductor material comprising at least one p/n junction, at least one absorption and conversion layer on the at least one layer of semiconductor layer, and at least one alpha particle emitter. The absorption and conversion layer prevents at least a portion of alpha particles from the alpha particle emitter from damaging the p/n junction in the layer of semiconductor material. The absorption and conversion layer also converts at least a portion of energy from the alpha particles into electron-hole pairs for collection by the one p/n junction in the layer of semiconductor material.

  8. THE LYMAN ALPHA REFERENCE SAMPLE: EXTENDED LYMAN ALPHA HALOS PRODUCED AT LOW DUST CONTENT

    SciTech Connect

    Hayes, Matthew; Oestlin, Goeran; Duval, Florent; Guaita, Lucia; Melinder, Jens; Sandberg, Andreas; Schaerer, Daniel; Verhamme, Anne; Orlitova, Ivana; Mas-Hesse, J. Miguel; Oti-Floranes, Hector; Adamo, Angela; Atek, Hakim; Cannon, John M.; Herenz, E. Christian; Kunth, Daniel; Laursen, Peter

    2013-03-10

    We report on new imaging observations of the Lyman alpha emission line (Ly{alpha}), performed with the Hubble Space Telescope, that comprise the backbone of the Lyman alpha Reference Sample. We present images of 14 starburst galaxies at redshifts 0.028 < z < 0.18 in continuum-subtracted Ly{alpha}, H{alpha}, and the far ultraviolet continuum. We show that Ly{alpha} is emitted on scales that systematically exceed those of the massive stellar population and recombination nebulae: as measured by the Petrosian 20% radius, R{sub P20}, Ly{alpha} radii are larger than those of H{alpha} by factors ranging from 1 to 3.6, with an average of 2.4. The average ratio of Ly{alpha}-to-FUV radii is 2.9. This suggests that much of the Ly{alpha} light is pushed to large radii by resonance scattering. Defining the Relative Petrosian Extension of Ly{alpha} compared to H{alpha}, {xi}{sub Ly{alpha}} = R {sup Ly{alpha}}{sub P20}/R {sup H{alpha}}{sub P20}, we find {xi}{sub Ly{alpha}} to be uncorrelated with total Ly{alpha} luminosity. However, {xi}{sub Ly{alpha}} is strongly correlated with quantities that scale with dust content, in the sense that a low dust abundance is a necessary requirement (although not the only one) in order to spread Ly{alpha} photons throughout the interstellar medium and drive a large extended Ly{alpha} halo.

  9. The role of integrin alpha D beta2 (CD11d/CD18) in monocyte/macrophage migration.

    PubMed

    Yakubenko, Valentin P; Belevych, Nataly; Mishchuk, Daria; Schurin, Aleksey; Lam, Stephen C-T; Ugarova, Tatiana P

    2008-08-15

    Integrin alpha(D)beta(2) (CD11d/CD18) is a multiligand macrophage receptor with recognition specificity identical to that of the major myeloid cell-specific integrin alpha(M)beta(2) (CD11b/CD18, Mac-1). Despite its prominent upregulation on inflammatory macrophages, the role of alpha(D)beta(2) in monocyte and macrophage migration is unknown. In this study, we have generated model and natural cell lines expressing different densities of alpha(D)beta(2) and examined their migration to various extracellular matrix proteins. When expressed at a low density, alpha(D)beta(2) on the surface of recombinant HEK293 cells and murine IC-21 macrophages cooperates with beta(1)/beta(3) integrins to support cell migration. However, its increased expression on the alpha(D)beta(2)-expressing HEK293 cells and its upregulation by PMA on the IC-21 macrophages result in increased cell adhesiveness and inhibition of cell migration. Furthermore, ligation of alpha(D)beta(2) with anti-alpha(D) blocking antibodies restores beta(1)/beta(3)-driven cell migration by removing the excess alpha(D)beta(2)-mediated adhesive bonds. Consistent with in vitro data, increased numbers of inflammatory macrophages were recovered from the inflamed peritoneum of mice after the administration of anti-alpha(D) antibody. These results demonstrate that the density of alpha(D)beta(2) is critically involved in modulating macrophage adhesiveness and their migration, and suggest that low levels of alpha(D)beta(2) contribute to monocyte migration while alpha(D)beta(2) upregulation on differentiated macrophages may facilitate their retention at sites of inflammation. PMID:18621369

  10. Absorption and transport of deuterium-substituted 2R,4'R,8'R-alpha-tocopherol in human lipoproteins

    SciTech Connect

    Traber, M.G.; Ingold, K.U.; Burton, G.W.; Kayden, H.J.

    1988-08-01

    Oral administration of a single dose of tri- or hexadeuterium substituted 2R,4'R,8'R-alpha-tocopheryl acetate (d3- or d6-alpha-T-Ac) to humans was used to follow the absorption and transport of vitamin E in plasma lipoproteins. Three hr after oral administration of d3-alpha-T-Ac (15 mg) to 2 subjects, plasma levels of d3-alpha-T were detectable; these increased up to 10 hr, reached a plateau at 24 hr, then decreased. Following administration of d6-alpha-T-Ac (15-16 mg) to 2 subjects, the percentage of deuterated tocopherol relative to the total tocopherol in chylomicrons increased more rapidly than the corresponding percentage in whole plasma. Chylomicrons and plasma lipoproteins were isolated from 2 additional subjects following administration of d3-alpha-T-Ac (140 or 60 mg). The percentage of deuterated tocopherol relative to the total tocopherol increased most rapidly in chylomicrons, then in very low density lipoproteins (VLDL), followed by essentially identical increases in low and high density lipoproteins (LDL and HDL, respectively) and lastly, in the red blood cells. This pattern of appearance of deuterated tocopherol is consistent with the concept that newly absorbed vitamin E is secreted by the intestine into chylomicrons; subsequently, chylomicron remnants are taken up by the liver from which the vitamin E is secreted in VLDL. The metabolism of VLDL in the circulation results in the simultaneous delivery of vitamin E into LDL and HDL.

  11. Subjective pain perception mediated by alpha rhythms.

    PubMed

    Peng, Weiwei; Babiloni, Claudio; Mao, Yanhui; Hu, Yong

    2015-07-01

    Suppression of spontaneous alpha oscillatory activities, interpreted as cortical excitability, was observed in response to both transient and tonic painful stimuli. The changes of alpha rhythms induced by pain could be modulated by painful sensory inputs, experimental tasks, and top-down cognitive regulations such as attention. The temporal and spatial characteristics, as well as neural functions of pain induced alpha responses, depend much on how these factors contribute to the observed alpha event-related desynchronization/synchronization (ERD/ERS). How sensory-, task-, and cognitive-related changes of alpha oscillatory activities interact in pain perception process is reviewed in the current study, and the following conclusions are made: (1) the functional inhibition hypothesis that has been proposed in auditory and visual modalities could be applied also in pain modality; (2) the neural functions of pain induced alpha ERD/ERS were highly dependent on the cortical regions where it is observed, e.g., somatosensory cortex alpha ERD/ERS in pain perception for painful stimulus processing; (3) the attention modulation of pain perception, i.e., influences on the sensory and affective dimensions of pain experience, could be mediated by changes of alpha rhythms. Finally, we propose a model regarding the determinants of pain related alpha oscillatory activity, i.e., sensory-discriminative, affective-motivational, and cognitive-modulative aspects of pain experience, would affect and determine pain related alpha oscillatory activities in an integrated way within the distributed alpha system. PMID:26026894

  12. Mechanisms regulating male sexual behavior in the rat: role of 3 alpha- and 3 beta-androstanediols.

    PubMed

    Morali, G; Oropeza, M V; Lemus, A E; Perez-Palacios, G

    1994-09-01

    To assess whether naturally occurring 5 alpha-androstanediols (5 alpha-androstane-3 alpha, 17 beta-diol and 5 alpha-androstane-3 beta, 17 beta-diol) play a role in the regulation of male sexual behavior in the rat, their capability to restore copulatory behavior in castrated animals was evaluated. Androstanediols were chronically administered either alone or in combination with 5 alpha-dihydrotestosterone (DHT) or with estradiol-17 beta (E2). Animals treated with testosterone (T), DHT, E2, and vehicle, either alone or in different combinations, served as controls. The occurrence of mounting, intromission, and ejaculation as well as detailed parameters of copulatory behavior were recorded twice per week for 3 weeks. At the end of treatments, the weights of sex accessory organs were also recorded. When 3 beta, 5 alpha-androstanediol (3 beta-diol; 500 micrograms/day) was administered in combination with DHT (300 micrograms/day), full copulatory behavior was restored in all subjects in a manner similar to that obtained with E2 plus DHT or T plus DHT combinations, thus indicating an estrogen-like behavioral effect of 3 beta-diol. Administration of 3 alpha, 5 alpha-androstanediol (3 alpha-diol; 500 micrograms/day) combined with DHT also restored sexual behavior, though to a lesser extent. When 3 alpha-diol (500 micrograms/day) was simultaneously administered with E2 (5 micrograms/day), the copulatory behavior of castrated animals was fully restored in a fashion similar to that observed after administration of DHT plus E2 and T plus E2 combinations, indicating a potent androgen-like effect of 3 alpha-diol.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7803627

  13. Veterans Administration Databases

    Cancer.gov

    The Veterans Administration Information Resource Center provides database and informatics experts, customer service, expert advice, information products, and web technology to VA researchers and others.

  14. [alpha]2A-Adrenoceptor Stimulation Improves Prefrontal Cortical Regulation of Behavior through Inhibition of cAMP Signaling in Aging Animals

    ERIC Educational Resources Information Center

    Verduzco, Luis; van Dyck, Christopher H.; Arnsten, Amy F. T.; Ramos, Brian P.; Stark, David

    2006-01-01

    The working-memory functions of the prefrontal cortex (PFC) are improved by stimulation of postsynaptic, [alpha]2A-adrenoceptors, especially in aged animals with PFC cognitive deficits. Thus, the [alpha]2A-adrenoceptor agonist, guanfacine, greatly improves working-memory performance in monkeys and rats following systemic administration or…

  15. Delivery of Alpha-1 Antitrypsin to Airways.

    PubMed

    Griese, Matthias; Scheuch, Gerhard

    2016-08-01

    Treatment with exogenous alpha-1 antitrypsin (AAT), a potent serine protease inhibitor, was developed originally for chronic obstructive pulmonary disease associated with AAT deficiency; however, other lung conditions involving neutrophilic inflammation and proteolytic tissue injury related to neutrophil elastase and other serine proteases may also be considered for AAT therapy. These conditions include bronchiectasis caused by primary ciliary dyskinesia, cystic fibrosis, and other diseases associated with an increased free elastase activity in the airways. Inhaled AAT may be a viable option to counteract proteolytic tissue damage. This form of treatment requires efficient drug delivery to the targeted pulmonary compartment. Aerosol technology meeting this requirement is currently available and offers an alternative therapeutic approach to systemic AAT administration. To date, early studies in humans have shown biochemical efficacy and have established the safety of inhaled AAT. However, to bring aerosol AAT therapy to patients, large phase 3 protocols in carefully selected patient populations (i.e., subgroups of patients with AAT deficiency, cystic fibrosis, or other lung diseases with bronchiectasis) will be needed with clinical end points in addition to the measurement of proteolytic activity in the airway. The outcomes likely will have to include lung function, lung structure assessed by computed tomography imaging, disease exacerbations, health status, and mortality. PMID:27564672

  16. 21 CFR 866.5420 - Alpha-1-glycoproteins immunological test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Alpha-1-glycoproteins immunological test system. 866.5420 Section 866.5420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... diabetes. (b) Classification. Class I (general controls). The device is exempt from the...

  17. 21 CFR 866.5420 - Alpha-1-glycoproteins immunological test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Alpha-1-glycoproteins immunological test system. 866.5420 Section 866.5420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... diabetes. (b) Classification. Class I (general controls). The device is exempt from the...

  18. 21 CFR 866.5420 - Alpha-1-glycoproteins immunological test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha-1-glycoproteins immunological test system. 866.5420 Section 866.5420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... diabetes. (b) Classification. Class I (general controls). The device is exempt from the...

  19. 21 CFR 866.5620 - Alpha-2-macroglobulin immunological test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha-2-macroglobulin immunological test system. 866.5620 Section 866.5620 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... the diagnosis of blood-clotting or clot lysis disorders. (b) Classification. Class II...

  20. Capture of sandhill cranes using alpha-chloralose: a 10-year follow-up.

    PubMed

    Hartup, Barry K; Schneider, Lauren; Engels, J Michael; Hayes, Matthew A; Barzen, Jeb A

    2014-01-01

    Seasonal adjustment of alpha-chloralose captures of sandhill cranes was associated with a modest increase in capture efficacy (+13%), decreased morbidity from exertional myopathy (-1.4%), and overall mortality (-1.7%) rates despite little change in sedation scores. Postcapture fluid administration also decreased confinement times by several hours over most sedation scores.

  1. Capture of sandhill cranes using alpha-chloralose: a 10-year follow-up.

    PubMed

    Hartup, Barry K; Schneider, Lauren; Engels, J Michael; Hayes, Matthew A; Barzen, Jeb A

    2014-01-01

    Seasonal adjustment of alpha-chloralose captures of sandhill cranes was associated with a modest increase in capture efficacy (+13%), decreased morbidity from exertional myopathy (-1.4%), and overall mortality (-1.7%) rates despite little change in sedation scores. Postcapture fluid administration also decreased confinement times by several hours over most sedation scores. PMID:24171579

  2. 21 CFR 866.5890 - Inter-alpha trypsin inhibitor immunological test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... system. 866.5890 Section 866.5890 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test... measure by immunochemical techniques the inter-alpha trypsin inhibitor (a protein) in serum and other...

  3. 21 CFR 866.5890 - Inter-alpha trypsin inhibitor immunological test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... system. 866.5890 Section 866.5890 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test... measure by immunochemical techniques the inter-alpha trypsin inhibitor (a protein) in serum and other...

  4. 21 CFR 866.5400 - Alpha-globulin immuno-logical test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha-globulin immuno-logical test system. 866.5400 Section 866.5400 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems §...

  5. 21 CFR 866.5080 - Alpha-1-antichymotrypsin immunological test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha-1-antichymotrypsin immunological test system. 866.5080 Section 866.5080 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems §...

  6. 21 CFR 866.5890 - Inter-alpha trypsin inhibitor immunological test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... system. 866.5890 Section 866.5890 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems § 866.5890 Inter-alpha trypsin inhibitor immunological test system. (a) Identification. An...

  7. 21 CFR 866.5130 - Alpha-1-antitrypsin immunological test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha-1-antitrypsin immunological test system. 866.5130 Section 866.5130 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems §...

  8. 21 CFR 866.5080 - Alpha-1-antichymotrypsin immunological test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha-1-antichymotrypsin immunological test system. 866.5080 Section 866.5080 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems §...

  9. 21 CFR 866.5080 - Alpha-1-antichymotrypsin immunological test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Alpha-1-antichymotrypsin immunological test system. 866.5080 Section 866.5080 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems §...

  10. 21 CFR 866.5420 - Alpha-1-glycoproteins immunological test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha-1-glycoproteins immunological test system. 866.5420 Section 866.5420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems §...

  11. 21 CFR 866.5130 - Alpha-1-antitrypsin immunological test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Alpha-1-antitrypsin immunological test system. 866.5130 Section 866.5130 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems §...

  12. 21 CFR 866.5420 - Alpha-1-glycoproteins immunological test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Alpha-1-glycoproteins immunological test system. 866.5420 Section 866.5420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems §...

  13. 21 CFR 866.5400 - Alpha-globulin immuno-logical test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Alpha-globulin immuno-logical test system. 866.5400 Section 866.5400 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems §...

  14. 21 CFR 866.5890 - Inter-alpha trypsin inhibitor immunological test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... system. 866.5890 Section 866.5890 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems § 866.5890 Inter-alpha trypsin inhibitor immunological test system. (a) Identification. An...

  15. 21 CFR 866.5080 - Alpha-1-antichymotrypsin immunological test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Alpha-1-antichymotrypsin immunological test system. 866.5080 Section 866.5080 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems §...

  16. Norepinephrine and brain damage: alpha noradrenergic pharmacology alters functional recovery after cortical trauma.

    PubMed

    Feeney, D M; Westerberg, V S

    1990-06-01

    The goal of these experiments was to evaluate the effects of some drugs affecting noradrenergic (NE) synaptic transmission, commonly prescribed following stroke or traumatic brain injury, on functional recovery. Measurement of recovery from a transient hemiplegia produced by a traumatic unilateral focal contusion in sensorimotor cortex (SMCX) of rats was used to assess the effects of chronic haloperidol (HAL) treatment begun early (1 day) or late (18 days to recovered animals) after injury. Additionally, using the same model, the effects of a single administration of drugs with selective action at NE receptors were also evaluated early or late (30 days) after injury. These drugs were: phenoxybenzamine (PBZ), an alpha 1-NE antagonist; prazosin (PRAZ), an alpha 1-NE antagonist; yohimbine (YOH), an alpha 2-NE antagonist; propranolol (PROP), a beta 1- and 2-NE receptor antagonist; methoxymine (METHOX), an alpha 1-NE agonist; and clonidine (CLON), an alpha 2-NE agonist. The data indicate that drugs with antagonistic effects at alpha 1 NE receptors, including HAL and PRAZ but not PROP, administered early after SMCX contusion retard locomotor recovery. Beneficial effects of enhancing NE transmission by METHOX or YOH were not observed. In animals recovered from beam walk (BW) deficits, a single administration of PBZ or PRAZ (alpha 1 NE antagonists) or CLON (alpha 2 NE agonist) transiently reinstated hemiplegic symptoms. The nonspecific beta NE receptor antagonist PROP had no effect in recovered animals. A single dose of HAL had no effect in recovered animals, but a BW deficit transiently developed in some animals following chronic treatment. The data are discussed with reference to drug contraindications noted in clinical studies of recovery from poststroke aphasia and cognition in demented patients with degenerative brain disease. PMID:2166617

  17. Activation of peroxisome proliferator-activated receptor-{alpha} (PPAR{alpha}) suppresses postprandial lipidemia through fatty acid oxidation in enterocytes

    SciTech Connect

    Kimura, Rino; Takahashi, Nobuyuki; Murota, Kaeko; Yamada, Yuko; Niiya, Saori; Kanzaki, Noriyuki; Murakami, Yoko; Moriyama, Tatsuya; Goto, Tsuyoshi; Kawada, Teruo

    2011-06-24

    Highlights: {yields} PPAR{alpha} activation increased mRNA expression levels of fatty acid oxidation-related genes in human intestinal epithelial Caco-2 cells. {yields} PPAR{alpha} activation also increased oxygen consumption rate and CO{sub 2} production and decreased secretion of triglyceride and ApoB from Caco-2 cells. {yields} Orally administration of bezafibrate increased mRNA expression levels of fatty acid oxidation-related genes and CO{sub 2} production in small intestinal epithelial cells. {yields} Treatment with bezafibrate decreased postprandial serum concentration of triglyceride after oral injection of olive oil in mice. {yields} It suggested that intestinal lipid metabolism regulated by PPAR{alpha} activation suppresses postprandial lipidemia. -- Abstract: Activation of peroxisome proliferator-activated receptor (PPAR)-{alpha} which regulates lipid metabolism in peripheral tissues such as the liver and skeletal muscle, decreases circulating lipid levels, thus improving hyperlipidemia under fasting conditions. Recently, postprandial serum lipid levels have been found to correlate more closely to cardiovascular diseases than fasting levels, although fasting hyperlipidemia is considered an important risk of cardiovascular diseases. However, the effect of PPAR{alpha} activation on postprandial lipidemia has not been clarified. In this study, we examined the effects of PPAR{alpha} activation in enterocytes on lipid secretion and postprandial lipidemia. In Caco-2 enterocytes, bezafibrate, a potent PPAR{alpha} agonist, increased mRNA expression levels of fatty acid oxidation-related genes, such as acyl-CoA oxidase, carnitine palmitoyl transferase, and acyl-CoA synthase, and oxygen consumption rate (OCR) and suppressed secretion levels of both triglycerides and apolipoprotein B into the basolateral side. In vivo experiments revealed that feeding high-fat-diet containing bezafibrate increased mRNA expression levels of fatty acid oxidation-related genes and

  18. Detection of urinary metabolites common to structurally related 17alpha-alkyl anabolic steroids in horses and application to doping tests in racehorses: methandienone, methandriol, and oxymetholone.

    PubMed

    Yamada, Masayuki; Aramaki, Sugako; Kurosawa, Masahiko; Saito, Koichi; Nakazawa, Hiroyuki

    2008-06-01

    Methandienone, methandriol, and oxymetholone, which are anabolic steroids possessing 17alpha-methyl and 17beta-hydroxy groups, were developed as oral formulations for therapeutic purposes. However, they have been used in racehorses to enhance racing performance. In humans, it has been reported that structurally related anabolic steroids having the 17alpha-methyl and 17beta-hydroxy groups, including 17alpha-methyltestosterone, mestanolone, methandienone, methandriol, and oxymetholone, have metabolites in common. In this study, we found that metabolites common to those of 17alpha-methyltestosterone and mestanolone were detected in horse urine after the administration of oxymetholone, methandienone, and methandriol. Based on analytical data, we confirmed these to be the common metabolites of five structurally related steroids, 17alpha-methyltestosterone, mestanolone, oxymetholone, methandienone, and methandriol. Furthermore, we detected hitherto unknown urinary metabolites of methandriol and oxymetholone in horses. The parent steroid itself was detected in horse urine after the administration of methandriol, other than metabolites common to 17alpha-methyltestosterone and mestanolone. On the other hand, the major metabolite of oxymetholone was mestanolone, aside from metabolites presumed to be the stereoisomers of 2-hydroxymethyl-17alpha-methyl-5alpha-androstan-3,17beta-diol and 2,17alpha-di(hydroxymethyl)-5alpha-androstan-3,17beta-diol. The simultaneous detection of common metabolites and other main metabolites would help us narrow down the candidate-administered steroid for the doping tests in racehorses. PMID:18544225

  19. Synthesis of 16 alpha-3H androgen and estrogen substrates for 16 alpha-hydroxylase.

    PubMed

    Cantineau, R; Kremers, P; De Graeve, J; Cornelis, A; Laszlo, P; Gielen, J E; Lambotte, R

    1981-02-01

    The synthesis of 16 alpha-3H androgens and estrogens is described. 1-(3H)-Acetic acid in the presence of zinc dust reacts with 16 alpha-bromo-17-ketosteroids to produce 16 alpha-3H-17-ketosteroids. This chemical reaction was used to prepare 16 alpha-3H-dehydroepiandrosterone (I) and 16 alpha-3H-estrone acetate (XI) from 16 alpha-bromo-dehydroepiandrosterone (X) and from 16 alpha-bromo-estrone acetate (XII), respectively. Using appropriate microbiological techniques, it was possible to convert these radiolabelled substrates into 16 alpha-3H-androstenedione (II) and 16 alpha-3H-estradiol-17 beta (VII). 16 alpha-3H-Estrone (VI) was obtained by the chemical hydrolysis of 16 alpha-3H-estrone acetate. The label distribution as determined by microbiological 16 alpha-hydroxylations indicated a specific labelling of 77% for androgens and 65% for estrogens in the 16 alpha position. These substrates can be used for measuring the 16 alpha hydroxylase activity, an important step in the biosynthesis of estriol (VIII) and estetrol (IX). PMID:7013160

  20. Protection against adriamycin-induced skin necrosis in the rat by dimethyl sulfoxide and alpha-tocopherol.

    PubMed

    Svingen, B A; Powis, G; Appel, P L; Scott, M

    1981-09-01

    Extravasation of Adriamycin during i.v. infusion can cause serious local complications. We have used a rat skin model to study the protection afforded by dimethyl sulfoxide and alpha-tocopherol (vitamin E) against Adriamycin-induced skin necrosis. Topical daily application of 1 ml dimethyl sulfoxide for 2 days produced a small decrease in ulcer diameter of up to 11% at 2 weeks. Topical daily applications of 1 ml 10% alpha-tocopherol succinate in dimethyl sulfoxide for 2 days produced a marked decrease in ulcer diameter at 2 weeks of up to 68%. Daily topical application of 1 ml 10% alpha-tocopherol succinate in dimethyl sulfoxide for 7 days offered no greater protection than 2-day application. alpha-Tocopherol acetate appeared to have activity slightly less than that of alpha-tocopherol succinate in reducing ulcer size, and both compounds were considerably more active than was alpha-tocopherol alcohol. Administration of alpha-tocopherol succinate or alpha-tocopherol acetate i.p. had no significant effect upon ulcer diameter. Topically applied dimethyl sulfoxide and alpha-tocopherol may provide an effective way of treating accidentally extravasated Adriamycin in cancer patients.

  1. A study of presynaptic alpha2-autoreceptors in alpha2A/D-, alpha2B- and alpha2C-adrenoceptor-deficient mice.

    PubMed

    Trendelenburg, A U; Klebroff, W; Hein, L; Starke, K

    2001-08-01

    The function of presynaptic alpha2-autoreceptors was studied in the hippocampus, occipito-parietal cortex, atria and vas deferens of NMRI mice, mice in which the alpha2A/D-, the alpha2B- or alpha2c-adrenoceptor gene had been disrupted (alpha2A/DKO, alpha2BKO and alpha2CKO, respectively), and the wildtype mice from which the knockout animals had been generated. Tissue pieces were preincubated with 3H-noradrenaline and then superfused and stimulated electrically. The alpha2-adrenoceptor agonist medetomidine reduced the electrically evoked overflow of tritium in all tissues from all mouse strains (stimulation with single pulses or single high-frequency pulse trains, called POPs, i.e. pulse patterns leading to minimal autoinhibition). The effects of medetomidine did not differ in NMRI, wildtype, alpha2BKO and alpha2CKO mice but were greatly reduced in alpha2A/DKO brain preparations and to a lesser extent in alpha2A/DKO atria and vasa deferentia. Six drugs were tested as antagonists against medetomidine. Their pKd values indicated that the hippocampal and occipito-parietal alpha2-autoreceptors in NMRI and wildtype mice were alpha2D (the rodent variant of the alpha2A/D-adrenoceptor) whereas the atrial and vas deferens alpha2-autoreceptors in NMRI and wildtype mice could not be identified with a single alpha2 subtype. Deletion of the alpha2A/D gene changed the pKd values in all tissues so that they now reflected alpha2C properties, whereas deletion of the alpha2C gene changed the pKd values in atria and vasa deferentia so that they now had alpha2D properties (as they had in NMRI and wildtype brain preparations). Autoinhibition by released noradrenaline was created using trains of up to 64 pulses or up to 4 POPs, and the overflow-enhancing effect of the alpha2 antagonist rauwolscine was determined. Results did not differ, irrespective of whether preparations were obtained from NMRI, wildtype, alpha2BKO or alpha2CKO mice: the overflow of tritium elicited by p pulses or POPs

  2. The Administrative Power Grab

    ERIC Educational Resources Information Center

    Sorenson, Richard D.

    2007-01-01

    Administrative power for some school teachers can be an aphrodisiac that can be applied negatively, especially when a leader has devastating instinct for the weaknesses of others. A leader's intellect and heart closes shop and ceases to function when drunk on power. In this article, the author describes how the use of administrative power can be…

  3. Innovation in Administrator Preparation.

    ERIC Educational Resources Information Center

    Coleman, Don

    An innovative administrator preparation program based on guidelines established by national boards and commissions is described in this paper. The California State University, Fresno, administrator education curriculum was reorganized by faculty and an advisory committee of 11 superintendents to meet the needs of local school districts. The…

  4. Migrant Education Administrative Guide.

    ERIC Educational Resources Information Center

    North Carolina State Dept. of Public Instruction, Raleigh. Div. of Compensatory Education.

    Relating specifically to the North Carolina migrant education program's administrative responsibilities, this guide is designed to aid administrators in program management, monitoring project activities, project evaluation, self-assessment, determining needs for training and staff development, site-visit preparation, policy development, and…

  5. Administration of Computer Resources.

    ERIC Educational Resources Information Center

    Franklin, Gene F.

    Computing at Stanford University has, until recently, been performed at one of five facilities. The Stanford hospital operates an IBM 370/135 mainly for administrative use. The university business office has an IBM 370/145 for its administrative needs and support of the medical clinic. Under the supervision of the Stanford Computation Center are…

  6. Issues in Educational Administration.

    ERIC Educational Resources Information Center

    Ediger, Marlow

    School administrators need to study and analyze the pros and cons of issues before making decisions. Ultimately, decisions need to be made by administrators as to which philosophies of education to implement in resolving conflicting points of view. More research studies would lead to an increased number of syntheses of the pros and cons of certain…

  7. Justifying Educational Administration.

    ERIC Educational Resources Information Center

    Evers, Colin; Lakomski, Gabriele

    1993-01-01

    The traditional conceptions of science dominating educational administration are mistaken. Unacceptable epistemologies, like those implicit in logical positivism, justify knowledge solely in terms of empirical adequacy. An improved science of educational administration embraces a coherent global theory accounting for all the phenomena of human…

  8. Test Administration Models

    ERIC Educational Resources Information Center

    Becker, Kirk A.; Bergstrom, Betty A.

    2013-01-01

    The need for increased exam security, improved test formats, more flexible scheduling, better measurement, and more efficient administrative processes has caused testing agencies to consider converting the administration of their exams from paper-and-pencil to computer-based testing (CBT). Many decisions must be made in order to provide an optimal…

  9. Champions of Children. Administrators . . .

    ERIC Educational Resources Information Center

    Chaffee, John; Olds, H. Robert

    Today, in an era of taxpayer revolts, lack of clarity in values, and changing family structure, children need advocates in the political arena as well as in the schools. This pamphlet suggests that administrators are in an excellent position to defend the rights of children on all fronts. It focuses on what administrators have done and specific…

  10. The School Personnel Administrator.

    ERIC Educational Resources Information Center

    Knox, Rodney F.

    This paper provides an overview of the development of the school-personnel administrator role. It first describes the influence of the science-management and human-relations movements and the behavioral sciences on personnel administration and human resource management. It next discusses the role of the personnel-performance-appraisal system and…

  11. Tenure for Administrators?

    ERIC Educational Resources Information Center

    Holyer, Robert

    2004-01-01

    The practice of granting tenure to academic administrators, especially presidents and academic deans, seems fairly prevalent. However, it is important to consider the possible advantages and disadvantages carefully before making such an offer. Boards interested in attracting talented administrators empowered to do what is in the best interest of…

  12. 47 CFR 54.715 - Administrative expenses of the Administrator.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 3 2011-10-01 2011-10-01 false Administrative expenses of the Administrator. 54.715 Section 54.715 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES (CONTINUED) UNIVERSAL SERVICE Administration § 54.715 Administrative expenses of the Administrator. (a) The annual administrative expenses...

  13. High gas flow alpha detector

    DOEpatents

    Bolton, Richard D.; Bounds, John A.; Rawool-Sullivan, Mohini W.

    1996-01-01

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors.

  14. High gas flow alpha detector

    DOEpatents

    Bolton, R.D.; Bounds, J.A.; Rawool-Sullivan, M.W.

    1996-05-07

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors. 4 figs.

  15. Reliability of {alpha}{sub 1} and {alpha}{sub 2} from lattice codes

    SciTech Connect

    Ng, K.Y.

    1996-10-01

    Whether the higher-order terms in the momentum-compaction factor, {alpha}{sub 1} and {alpha}{sub 2}, can be obtained reliably from lattice codes is an important issue for some quasi-isochronous rings. A FODO lattice consisting of thin quadrupoles, dipoles filling all spaces, and two families of thin sextupoles is solved and {alpha}{sub 1} and {alpha}{sub 2} are derived analytically. We find accurate agreement with SYNCH is examined. Some methods of measurement of {alpha}{sub 1} and {alpha}{sub 2} are discussed.

  16. alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

    PubMed Central

    Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L

    1988-01-01

    An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

  17. Endocrine-mediated mechanisms of fatigue during treatment with interferon-alpha.

    PubMed

    Jones, T H; Wadler, S; Hupart, K H

    1998-02-01

    Fatigue occurs in more than 70% of patients treated with interferon-alpha (IFN-alpha) and is the most problematic toxicity associated with IFN-based immunotherapy. Abundant evidence suggests that immune-mediated endocrine disease occurs during IFN-alpha therapy, which may contribute to the etiology of fatigue. Autoimmune thyroid disease is a well-recognized consequence of IFN-alpha therapy and may be mediated by the induction of IFN-gamma production by lymphocytes. Administration of exogenous IFN-gamma has been associated with upregulation of class II major histocompatibility antigens in the thyroid and the development of thyroiditis. Interferon-alpha also stimulates the production of interleukin-6; both interleukin-6 and IFN-gamma have specific effects on thyrocyte function. There also is evidence suggesting that IFN-alpha initiates a cytokine cascade that effects the hypothalamic-pituitary-adrenal and hypothalamic-pituitary-gonadal axes, thus affecting regulation of glucocorticoid and sex steroid hormone secretion, but the clinical significance of these observations has not been established. Although endocrine disease will not explain the occurrence of fatigue symptoms in all patients, there is clear evidence that hormonal deficiency syndromes occur in a relatively large portion of patients receiving systemic IFN-alpha therapy. Most importantly, the possibility of hypothyroidism must be considered; however, diagnosis of hypothyroidism in cancer patients is complicated by the occurrence of the "sick euthyroid syndrome." Clinical recommendations for assessment and treatment of IFN-alpha-induced fatigue are offered. Most importantly, measurements of thyroid-stimulating hormone and antithyroid autoantibodies should be used to evaluate thyroid status. Acknowledging the limitations of current clinical data, adrenal- and gonadal-axis dysfunction also must be considered in patients with IFN-alpha-induced fatigue.

  18. Cyclodextrins and chitosan derivatives in sublingual delivery of low solubility peptides: A study using cyclosporin A, alpha-cyclodextrin and quaternary chitosan N-betainate.

    PubMed

    Mannila, Janne; Järvinen, Kristiina; Holappa, Jukka; Matilainen, Laura; Auriola, Seppo; Jarho, Pekka

    2009-10-20

    Systemic drug delivery through intraoral membranes may offer a promising administration route for lipophilic peptide drugs. The aim of the present study was to investigate the effect of alpha-cyclodextrin (alpha-CD) and a novel chitosan derivative, chitosan N-betainate (CH), on sublingual absorption of a hydrophobic model peptide cyclosporin A (CsA), and the effect of temperature on the complexation of CsA with alpha-CD. Complexation of CsA with alpha-CD was studied using the phase-solubility method. Sublingual absorption of CsA was studied by administration of solid CsA/alpha-CD complex (with and without CH solution), solid CsA/alpha-CD/CH formulation and solid plain CsA to rabbits. The solubility of CsA in aqueous alpha-CD solution (14%) increased with decreasing temperature; the solubility of CsA at room temperature, +5 and +1 degrees C was 1.2, 12 and 19mg/ml, respectively. The bioavailability of CsA after administration of plain CsA, solid CsA/alpha-CD and solid CsA/alpha-CD/CH (0.6+/-0.5, 1.4+/-0.7 and 1.7+/-0.8%, respectively; mean+/-S.D.) was further increased when solid CsA/alpha-CD was administered together with CH solution (3.2+/-2.2%). The present study shows that decreased temperature can be effectively utilized to produce CsA/alpha-CD complexes. It was also shown that alpha-CD and CH may be advantageous in sublingual delivery of lipophilic peptides, although the absolute bioavailability remains low.

  19. Beta/alpha continuous air monitor

    DOEpatents

    Becker, G.K.; Martz, D.E.

    1988-06-27

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

  20. Beta/alpha continuous air monitor

    DOEpatents

    Becker, Gregory K.; Martz, Dowell E.

    1989-01-01

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinguishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts.

  1. Hemoglobin Evanston (alpha 14 Trp----Arg). An unstable alpha-chain variant expressed as alpha-thalassemia.

    PubMed Central

    Honig, G R; Shamsuddin, M; Vida, L N; Mompoint, M; Valcourt, E; Bowie, L J; Jones, E C; Powers, P A; Spritz, R A; Guis, M

    1984-01-01

    A new hematologic syndrome with phenotypic features of mild Hb H disease was identified in three children from two unrelated black American families. Erythrocytes from each of these children contained Hb H (beta 4) and Hb Barts (gamma 4), as well as a slowly migrating hemoglobin fraction that made up 7-10% of the total hemoglobin. The parents of the affected children all showed mild thalassemia-like changes, with one of the parents in each family also expressing the variant hemoglobin; in the latter individuals the mutant alpha-chains made up less than 2% of the total, and were present mainly or exclusively in combination with delta-chains in the form of a slowly migrating Hb A2. Purified Hb Evanston showed an increased oxygen affinity, but its Bohr effect, cooperativity, and 2,3-diphosphoglycerate effect were normal. The mutant hemoglobin appeared to have normal stability to heat and to isopropanol, and the stability of its alpha-chain in an extended time course synthesis study also appeared to be similar to that of alpha A. However, the results from short-term globin synthesis studies, and from mRNA translation in vitro, suggest that the two types of alpha-chains were synthesized at relatively equal rates, with a major fraction of the newly synthesized variant alpha-chains undergoing rapid catabolism. The hematologic data taken in combination with DNA hybridization and globin synthesis findings indicate that the proposita in each of these families has the genotype--, alpha A/--, alpha Ev. These observations suggest that two separate mechanisms are contributing to the alpha-thalassemia-like expression of Hb Evanston : the newly synthesized alpha EV-chains are unstable and are subject to early proteolytic destruction; and the mutant alpha-allele is linked to an alpha-globin gene deletion. Images PMID:6725558

  2. Teaching calculus with Wolfram|Alpha

    NASA Astrophysics Data System (ADS)

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-12-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to Wolfram|Alpha in our differential and integral calculus labs, together with the positive results from our experience. We also discuss the current limitations of Wolfram|Alpha, including a discussion on why we still use a CAS for our multivariate calculus labs.

  3. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H

    1996-01-01

    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  4. Prospects for alpha particle studies on TFTR

    SciTech Connect

    Zweben, S.J.

    1987-05-01

    TFTR is expected to produce approximately 5 MW of alpha heating during the D/T Q approx. = 1 phase of operation in 1990. At that point the collective confinement properties and the heating effects of alpha particles become accessible for study for the first time. This paper outlines the potential performance of TFTR with respect to alpha particle production, the diagnostics which will be available for alpha particle measurements, and the physics issues which can be studied both before and during D/T operation.

  5. 5 alpha-reductase deficiency without hypospadias.

    PubMed Central

    Ng, W K; Taylor, N F; Hughes, I A; Taylor, J; Ransley, P G; Grant, D B

    1990-01-01

    A boy aged 4 with penoscrotal hypospadias and his brother aged 12 with micropenis had typical changes of homozygous 5 alpha-reductase deficiency. After three injections of chorionic gonadotrophin there was a trivial rise in plasma dihydrotestosterone with a normal increase in plasma testosterone. Urine steroid chromatography showed abnormally high 5 beta: 5 alpha ratios and 5 alpha-reductase activity was appreciably reduced in genital skin fibroblasts. The results indicate that 5 alpha-reductase deficiency is not invariably associated with genital ambiguity. PMID:2248513

  6. Early activation of p38 mitogen activated protein kinase is associated with interferon-alpha-induced depression and fatigue

    PubMed Central

    Felger, Jennifer C.; Alagbe, Oyetunde; Pace, Thaddeus W. W.; Woolwine, Bobbi J.; Hu, Fang; Raison, Charles L.; Miller, Andrew H.

    2011-01-01

    Cytokine-induced stimulation of p38 mitogen activated protein kinase (MAPK) has been shown to influence behaviorally-relevant pathophysiologic pathways including monoamine neurotransmission and neuroendocrine function and thus may contribute to behavioral changes that occur during chronic administration of the innate immune cytokine, interferon (IFN)-alpha. Accordingly, in the current study, phosphorylation (activation) of intracellular p38 MAPK in peripheral blood lymphocytes was analyzed by flow cytometry every 2 hours for 12 hours following the initial injection of IFN-alpha in eleven patients with chronic hepatitis C. Hourly assessments of plasma concentrations of adrenocorticotropic hormone, cortisol and interleukin-6 were also obtained. Symptoms of depression and fatigue were measured at baseline and after 4 and 12 weeks of IFN-alpha treatment. Acute administration of IFN-alpha significantly increased the percentage of lymphocytes staining positive for intracellular phosphorylated p38 (p-p38). IFN-alpha-induced increases in p-p38 were significantly greater in patients that developed clinically significant depressive symptoms [Montgomery Asberg Depression Rating Scale (MADRS) score ≥15] during the first 12 weeks of IFN-alpha treatment. Increases in the percentage of p-p38-positive lymphocytes following the first IFN-alpha injection also highly correlated with depression severity at weeks 4 (r=0.85, p=0.001) and 12 (r=0.70, p=0.018). Similar relationships were observed for fatigue. Examination of relationships between p-p38 induction and factors previously reported to predict IFN-alpha-induced depressive symptoms revealed strong associations of p-p38 with baseline MADRS (r=0.82, p=0.002) and cortisol responses to the initial injection of IFN-alpha (r=0.91, p=0.000). Taken together, these findings indicate that sensitivity of p38 MAPK signaling pathways to immune stimulation is associated with depressive symptoms during chronic IFN-alpha treatment. PMID

  7. Occurrence of alpha- and beta-nortestosterone residues in the urine of injured male cattle.

    PubMed

    Glenn Kennedy, D; Desmond Shortt, H; Crooks, Steven R H; Young, Paul B; Price, Henrietta J; Smyth, Wesley G; Hewitt, S Armstrong

    2009-05-01

    The administration of anabolic steroids, for the purposes of growth promotion, to food-producing animals is banned in the EU. Among the compounds covered by this prohibition is ss-nortestosterone (beta-NT). This hormone is known to occur naturally in stallions and boars, and its main bovine metabolite, alpha-nortestosterone (alpha-NT), occurs naturally in pregnant cows and neonatal calves. However, neither compound is believed to occur naturally in male cattle. During 2006, the presence of alpha-NT and, on occasion, beta-NT was confirmed in male cattle (bulls and steers) slaughtered in Northern Ireland on welfare grounds, as a result of acute injury. Subsequent investigations revealed no evidence of abuse at any of the farms involved and revealed that the phenomenon also occurred in three other regions of the EU, in similarly injured animals. A hypothetical link to release of the adrenal steroid, dehydroepiandrosterone (DHEA), in response to the stress of the injury was tested. Following the intravenous administration of DHEA to two normal steers, beta-NT (but not alpha-NT) was confirmed in the urine of one steer. Thus, it may be concluded that both beta-NT and, by implication, alpha-NT can occur naturally in male cattle (or a specific cohort thereof) in contrast to previously accepted scientific knowledge.

  8. Thoughts for New Administrators

    ERIC Educational Resources Information Center

    LaCrosse, E. Robert

    1977-01-01

    Discusses issues in program administration, with specific reference to preschool programs. Some of the issues discussed include coping with conflict, leadership, the sharing of power, and honesty. A short annotated bibliography is included. (BD)

  9. Evaluation of Administrators.

    ERIC Educational Resources Information Center

    Ryan, Edmund G.

    1979-01-01

    Guidelines are presented for the evaluation of college administrators: (1) purposes of the evaluation; (2) approaches to evaluation; (3) criteria for evaluation; (4) participants or evaluators in the process; and (5) evaluation results and use of results. (GDC)

  10. Serving the Space Administration

    ERIC Educational Resources Information Center

    Campbell, Jack E.; Thompson, Arthur W.

    1974-01-01

    The purpose of the current program was to establish an upward mobility program that afforded employees an opportunity to improve their credibility in job opportunity selection under the directives of the National Aeronautics and Space Administration. (Author/RK)

  11. Goldstone (GDSCC) administrative computing

    NASA Technical Reports Server (NTRS)

    Martin, H.

    1981-01-01

    The GDSCC Data Processing Unit provides various administrative computing services for Goldstone. Those activities, including finance, manpower and station utilization, deep-space station scheduling and engineering change order (ECO) control are discussed.

  12. Administrators Speak Out

    ERIC Educational Resources Information Center

    Miner, Fred V.

    1976-01-01

    A summary is presented of the issues and concerns discussed and the recommendations made by the American Vocational Association's (AVA) Administration Policy Committee during its meeting at the 1975 AVA Convention. (AJ)

  13. Effect of anti-tumor necrosis factor alpha antibodies on histopathology of primary Salmonella infections.

    PubMed

    Mastroeni, P; Skepper, J N; Hormaeche, C E

    1995-09-01

    We reported that administration of anti-tumor necrosis factor alpha (anti-TNF-alpha) antibodies exacerbates the course of a Salmonella infection in both susceptible and resistant mice by preventing the suppression of bacterial growth in the reticuloendothelial system. In the present study, we evaluated the effect of in vivo neutralization of TNF-alpha on the histopathology of primary Salmonella infections. We show that in primary infections, the suppression of bacterial growth in the reticuloendothelial system coincides with granuloma formation in the spleen and liver. Administration of anti-TNF-alpha globulins on day -1 of salmonellosis affected neither the histological picture nor the course of the infection in the early stages of the disease (days 1 to 3), with splenic and hepatic lesions consisting mainly of polymorphonuclear leukocytes (PMNs); conversely, later in infection (days 3 to 7), the treatment inhibited the formation of granulomas. When the anti-TNF-alpha treatment was started well after the suppression of bacterial growth in the reticuloendothelial system and the formation of granulomatous lesions in the spleen and liver, a prompt relapse of the infection and regression of already established granulomas were seen. In anti-TNF-alpha-treated mice, salmonellae were found inside macrophages and PMNs and extracellularly in the necrotic tissue of the spleen, while in the liver the organisms were seen mainly in inflammatory mononuclear cells, resident Kupffer cells, and hepatocytes and occasionally in the extracellular compartment within necrotic lesions. The bacteria appeared most often in clusters, being morphologically intact when in the extracellular space or within hepatocytes, while undergoing various degrees of degeneration when inside phagocytes. The results suggest that TNF-alpha is required for granuloma formation in salmonellosis and that its neutralization does not completely abrogate the bactericidal activity of macrophages and PMNs

  14. Synthesis of anticholinergic agents: N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate salts.

    PubMed

    Oroshnik, W; Soldati, G

    1978-05-01

    The synthesis of a new anticholinergic agent, N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate, obtained by reacting N-methyl-4-piperidinyl alpha-cyclopentylmandelate with benzoyl chloride in the presence of methyllithium, is reported. This material may be useful as an antiperspirant.

  15. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  16. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  17. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  18. Resting-State Alpha in Autism Spectrum Disorder and Alpha Associations with Thalamic Volume

    ERIC Educational Resources Information Center

    Edgar, J. Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D.; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M.; Qasmieh, Saba; Levy, Susan E.; Schultz, Robert T.; Roberts, Timothy P. L.

    2015-01-01

    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha…

  19. Targeted alpha therapy: evidence for potential efficacy of alpha-immunoconjugates in the management of micrometastatic cancer.

    PubMed

    Allen, B J

    1999-11-01

    There can be little doubt that one of the most important problems in the management of cancer is control of metastatic disease. This objective must be achieved ideally with a systemic therapeutic modality that targets cancer cells and gives minimal collateral damage to critical normal cells. The efficacy of targeted cancer therapy relies on the ability of a toxin to be located in the target cancer cell. The ideal toxin is one that is active only in the cancer cell, and not in critical normal cells. Failing this, the next best approach is a toxin with a short effective lifetime to target early stage micrometastatic disease. This rules out chemical toxins, given that they remain effective until excreted from the body, and localization of dose to the cancer cell rules out beta-emitting radio-isotopes (RI). Alpha-emitting RI, however, are much more appropriate toxins because they are short-lived and because their cytotoxicity is the result of their high rate of energy loss and short range of the alpha particles. These radionuclides have properties that are particularly suited for the elimination of single cells in transit or small nests of cancer cells. In vitro and in vivo experiments with alpha RI show dramatic superiority over beta RI. Only a few nuclear hits are needed to kill cells, and the formation of metastatic lung lesions and subcutaneous lesions in mice can be inhibited by systemic administration of alpha emitters. But alpha RI have not been able to control solid tumours, for which beta RI are better suited. A small number of alpha-emitting radionuclides are currently under investigation. These are terbium (Tb)-149, astatine (At)-211, bismuth (Bi)-212 and Bi-213. Terbium-149 and At-211 both require accelerators in close proximity to the place of application. The Bi isotopes are produced by long-lived parents and, as such, can be obtained from generators. The first phase-1 dose escalation trial with Bi-213 radioimmunoconjugate (RIC) commenced in New York in

  20. Regulation and function of the alpha/sub 2/ adrenergic autoreceptor in the central nervous system

    SciTech Connect

    Spengler, R.N.

    1987-01-01

    The purpose of this investigation was to determine whether changes observed in the number of alpha/sub 2/ adrenergic receptors in the brain as measured by radioligand binding experiments reflect changes in the function of alpha/sub 2/ autoregulatory receptors which are located on noradrenergic nerve terminals. Inhibition by clonidine of field stimulated /sup 3/H-norepinephrine (/sup 3/H-NE) release from rat hippocampal slices before and after several drug treatments was analyzed to investigate changes in alpha/sub 2/ adrenergic receptor function. Clonidine in a concentration-dependent manner inhibited /sup 3/H-NE release. The effect of clonidine was blocked by the specific alpha/sub 2/ adrenergic receptor antagonist, idazoxan. The cumulative administration of clonidine generated a smooth and well-fitted log-concentration-effect curve. Results are presented which demonstrate that this technique can be employed to investigate the role of changes in the function of the alpha/sub 2/ autoregulatory receptor. The present investigation also examined representatives of four drug classes which have been shown to alter the specific binding of /sup 3/H-clonidine to neural membranes to determine whether changes in the alpha/sub 2/ autoregulatory receptor function also occur.

  1. A Critical Review of Alpha Radionuclide Therapy-How to Deal with Recoiling Daughters?

    PubMed

    de Kruijff, Robin M; Wolterbeek, Hubert T; Denkova, Antonia G

    2015-01-01

    This review presents an overview of the successes and challenges currently faced in alpha radionuclide therapy. Alpha particles have an advantage in killing tumour cells as compared to beta or gamma radiation due to their short penetration depth and high linear energy transfer (LET). Touching briefly on the clinical successes of radionuclides emitting only one alpha particle, the main focus of this article lies on those alpha-emitting radionuclides with multiple alpha-emitting daughters in their decay chain. While having the advantage of longer half-lives, the recoiled daughters of radionuclides like 224Ra (radium), 223Ra, and 225Ac (actinium) can do significant damage to healthy tissue when not retained at the tumour site. Three different approaches to deal with this problem are discussed: encapsulation in a nano-carrier, fast uptake of the alpha emitting radionuclides in tumour cells, and local administration. Each approach has been shown to have its advantages and disadvantages, but when larger activities need to be used clinically, nano-carriers appear to be the most promising solution for reducing toxic effects, provided there is no accumulation in healthy tissue. PMID:26066613

  2. A Critical Review of Alpha Radionuclide Therapy—How to Deal with Recoiling Daughters?

    PubMed Central

    de Kruijff, Robin M.; Wolterbeek, Hubert T.; Denkova, Antonia G.

    2015-01-01

    This review presents an overview of the successes and challenges currently faced in alpha radionuclide therapy. Alpha particles have an advantage in killing tumour cells as compared to beta or gamma radiation due to their short penetration depth and high linear energy transfer (LET). Touching briefly on the clinical successes of radionuclides emitting only one alpha particle, the main focus of this article lies on those alpha-emitting radionuclides with multiple alpha-emitting daughters in their decay chain. While having the advantage of longer half-lives, the recoiled daughters of radionuclides like 224Ra (radium), 223Ra, and 225Ac (actinium) can do significant damage to healthy tissue when not retained at the tumour site. Three different approaches to deal with this problem are discussed: encapsulation in a nano-carrier, fast uptake of the alpha emitting radionuclides in tumour cells, and local administration. Each approach has been shown to have its advantages and disadvantages, but when larger activities need to be used clinically, nano-carriers appear to be the most promising solution for reducing toxic effects, provided there is no accumulation in healthy tissue. PMID:26066613

  3. 17alpha-ethyl-5beta-estrane-3alpha, 17beta-diol, a biological marker for the abuse of norethandrolone and ethylestrenol in slaughter cattle.

    PubMed

    Van Puymbroeck, M; Kuilman, M E; Maas, R F; Witkamp, R F; Leyssens, L; Van Miert, A S; Hendriks, L; Vanderzande, D; Adriaensens, P; Jacobs, M P; Raus, J

    1999-05-28

    The metabolism of the illegal growth promoter ethylestrenol (EES) was evaluated in bovine liver cells and subcellular fractions of bovine liver preparations. Incubations with bovine microsomal preparations revealed that EES is extensively biotransformed into norethandrolone (NE), another illegal growth promoter. Furthermore, incubations of monolayer cultures of hepatocytes with NE indicated that NE itself is rapidly reduced to 17alpha-ethyl-5beta-estrane-3alpha, 17beta-diol (EED). In vivo tests confirmed that, after administration of either EES or NE, EED is excreted as a major metabolite. Therefore, it was concluded that, both in urine and faeces samples, EED can be used as a biological marker for the illegal use of EES and/or NE. Moreover, by monitoring EED in urine or faeces samples, the detection period after NE administration is significantly prolonged. These findings were further confirmed by three cases of norethandrolone abuse in a routine screening program for forbidden growth promoters.

  4. 17alpha-ethyl-5beta-estrane-3alpha, 17beta-diol, a biological marker for the abuse of norethandrolone and ethylestrenol in slaughter cattle.

    PubMed

    Van Puymbroeck, M; Kuilman, M E; Maas, R F; Witkamp, R F; Leyssens, L; Van Miert, A S; Hendriks, L; Vanderzande, D; Adriaensens, P; Jacobs, M P; Raus, J

    1999-05-28

    The metabolism of the illegal growth promoter ethylestrenol (EES) was evaluated in bovine liver cells and subcellular fractions of bovine liver preparations. Incubations with bovine microsomal preparations revealed that EES is extensively biotransformed into norethandrolone (NE), another illegal growth promoter. Furthermore, incubations of monolayer cultures of hepatocytes with NE indicated that NE itself is rapidly reduced to 17alpha-ethyl-5beta-estrane-3alpha, 17beta-diol (EED). In vivo tests confirmed that, after administration of either EES or NE, EED is excreted as a major metabolite. Therefore, it was concluded that, both in urine and faeces samples, EED can be used as a biological marker for the illegal use of EES and/or NE. Moreover, by monitoring EED in urine or faeces samples, the detection period after NE administration is significantly prolonged. These findings were further confirmed by three cases of norethandrolone abuse in a routine screening program for forbidden growth promoters. PMID:10406207

  5. High-alpha space trucks

    SciTech Connect

    Cook, L.M.; Ball, J.

    1997-01-01

    Vertically-landing Reusable Launch Vehicles (RLVs) are the best hope of building a true {open_quotes}Space Truck{close_quotes} with current technology. Because they do not require a low angle-of-attack (AOA, or alpha) horizontal landing, they can be designed to operate exclusively at very high angles-of-attack. This offers savings in vehicle dry weight and complexity, which can be traded for significantly heavier payload, more ascent velocity, or extra design margin. The price for abandoning low angle-of-attack flight is reduced crossrange. To quantify the potential weight reduction, a trade study was performed to determine the relationship between a vehicle{close_quote}s maximum crossrange (angle-of-attack) and it{close_quote}s dry weight (payload margin). At the study conclusion, three vertically-landing (VL) vehicles provided multiple points on a payload weight vs. maximum crossrange curve, showing significant payload increases as crossrange is sacrificed. This is primarily the result of being able to simplify the structure, fly a cooler entry trajectory, and be aerodynamically stable through the entire flight. This reduces subsystem requirements and complexity, enhancing reliability. Further benefits are realized in reduced landing propellant requirements and simplifying or eliminating the {open_quotes}rotation{close_quotes} maneuver. This paper also suggests unique operability solutions that adapt high-alpha vehicles to traditional high-crossrange missions such as the polar {open_quotes}once-around{close_quotes} flight, and proposes a small scale drop-test program to prove the subsonic and landing portion of the flight envelope. {copyright} {ital 1997 American Institute of Physics.}

  6. Regulation of lipid peroxidation by nitric oxide and PGF2alpha during luteal regression in rats.

    PubMed

    Motta, A B; Estevez, A; Franchi, A; Perez-Martinez, S; Farina, M; Ribeiro, M L; Lasserre, A; Gimeno, M F

    2001-04-01

    Corpus luteum regression is related to an increased generation of reactive oxygen species. Although several studies indicate that PGF(2alpha) is involved in regression of the corpus luteum in mammalian species through an increase in reactive oxygen species, the exact mechanism remains unknown. In the present study, the relationship between nitric oxide and PGF(2alpha) in regulation of lipid peroxidation was studied. Ovarian tissue from pseudopregnant rats at mid- (day 5) or late phase or at the time of regression (day 9 of pseudopregnancy) of corpus luteum development was used. Thiobarbituric acid reactants, used as a lipid peroxidation index, were higher on day 9 of pseudopregnancy than on day 5. In contrast, glutathione content (an antioxidant metabolite) was lower on day 9 than on day 5 of pseudopregnancy. These results indicate that there was an enhanced oxidative status in ovarian tissue during luteolysis. Administration of N(omega)-nitro-L-arginine methyl ester (L-NAME: 600 micromol l(-1)), a competitive nitric oxide synthase (NOS) inhibitor, led to a decrease in basal thiobarbituric acid reactant content in ovarian tissue from rats on day 9 of pseudopregnancy only, indicating that during regression of the corpus luteum, NO could act as intermediary in ovarian lipid peroxidation. Administration of a luteolytic dose (3 microg kg(-1) body weight i.p.) of a synthetic PGF(2alpha) increased thiobarbituric acid reactant content in ovaries from rats on day 9 of pseudopregnancy. As this effect was reversed partially by L-NAME, it is proposed that during regression of corpora lutea, PGF(2alpha) and NO are involved in regulation of lipid peroxidation. As this effect was only reversed partially, it is possible that there is another mechanism involving PGF(2alpha) (but not the NO-NOS pathway) in regulation of ovarian lipid peroxidation. Furthermore, the administration of PGF(2alpha) enhanced ovarian NOS activity, whereas cyclooxygenase inhibition (by indomethacin

  7. Arrangements of alpha-globin gene cluster in Taiwan.

    PubMed

    Peng, H W; Choo, K B; Ho, C H; Yen, M S; Liung, W Y; Lin, C K; Yang, Z L; Ng, H T; Ching, K N; Han, S H

    1989-01-01

    In a gene mapping study on 217 newborn babies in Taiwan with alpha- and zeta-globin probes, we have observed 4 cases (1.84%) of alpha-thalassemia-2 heterozygotes (zeta zeta-alpha/zeta zeta alpha alpha) without increased levels of hemoglobin (Hb) Bart's in the cord blood. Eleven subjects (5.07%) were found to have the South East Asian alpha-thalassemia-1 haplotype (zeta zeta--SEA/zeta zeta alpha alpha) with increased Hb Bart's levels ranging from 2.2 to 9%. One case, with Hb Bart's level of 14% in the cord blood, was found to have the genotype of zeta zeta--SEA/zeta zeta alpha alpha T (0.46%). Four heterozygotes (1.84%) were found with the triple alpha gene anti-rightward arrangement (zeta zeta alpha alpha alpha 3.7/zeta zeta alpha alpha). Twenty-one heterozygotes (9.68%) were found to have the triple zeta-globin gene arrangement (zeta zeta zeta alpha alpha/zeta zeta alpha alpha). A new triple zeta-globin gene variant with a BamHI polymorphism was also observed in this study.

  8. Alpha Biofeedback Conditioning and Retarded Subjects.

    ERIC Educational Resources Information Center

    Martin, Walter; And Others

    1981-01-01

    An experimental group of three institutionalized severely retarded adult males received binary tone feedback for alpha production while a control group (3) followed identical procedures without feedback. Analysis revealed significant difference between groups in alpha percentage increase over baseline, encouraging research on applications for…

  9. Elementary Processes Underlying Alpha Channeling in Tokamaks

    SciTech Connect

    NM.J. Fisch

    2012-06-15

    Alpha channeling in tokamaks is speculative, but also extraordinarily attractive. Waves that can accomplish this effect have been identified. Key aspects of the theory now enjoy experimental confirmation. This paper will review the elementary processes of wave-particle interactions in plasma that underlie the alpha channeling effect

  10. Alpha-1 Antitrypsin Deficiency (Inherited Emphysema)

    MedlinePlus

    ... 1 protein in the blood with normal alpha-1 antitrypsin from healthy plasma donors. It is given in a vein (IV). The dose is adjusted based on body weight. This treatment is often given once a week. There are three ... the management of Alpha-1 related emphysema includes: • Exercise and a healthy lifestyle ...

  11. Psychiatric Symptoms in Alpha-Mannosidosis

    ERIC Educational Resources Information Center

    Malm, D.; Pantel, J.; Linaker, O. M.

    2005-01-01

    Alpha-mannosidosis is characterized by mild to moderate intellectual disability (ID), moderate to severe neurosensory hearing loss, frequent infections, psychomotor disturbances and skeletal dysmorphism. For the first time, a panel of nine alpha-mannosidosis patients with psychiatric symptoms is presented. The clinical picture has several…

  12. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  13. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  14. Remote Associates Test and Alpha Brain Waves

    ERIC Educational Resources Information Center

    Haarmann, Henk J.; George, Timothy; Smaliy, Alexei; Dien, Joseph

    2012-01-01

    Previous studies found that performance on the remote associates test (RAT) improves after a period of incubation and that increased alpha brain waves over the right posterior brain predict the emergence of RAT insight solutions. We report an experiment that tested whether increased alpha brain waves during incubation improve RAT performance.…

  15. Atypical Alpha Asymmetry in Adults with ADHD

    ERIC Educational Resources Information Center

    Hale, T. Sigi; Smalley, Susan L.; Hanada, Grant; Macion, James; McCracken, James T.; McGough, James J.; Loo, Sandra K.

    2009-01-01

    Introduction: A growing body of literature suggests atypical cerebral asymmetry and interhemispheric interaction in ADHD. A common means of assessing lateralized brain function in clinical populations has been to examine the relative proportion of EEG alpha activity (8-12 Hz) in each hemisphere (i.e., alpha asymmetry). Increased rightward alpha…

  16. Commentary on Coefficient Alpha: A Cautionary Tale

    ERIC Educational Resources Information Center

    Green, Samuel B.; Yang, Yanyun

    2009-01-01

    The general use of coefficient alpha to assess reliability should be discouraged on a number of grounds. The assumptions underlying coefficient alpha are unlikely to hold in practice, and violation of these assumptions can result in nontrivial negative or positive bias. Structural equation modeling was discussed as an informative process both to…

  17. Teaching Calculus with Wolfram|Alpha

    ERIC Educational Resources Information Center

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-01-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to…

  18. Coefficient Alpha Bootstrap Confidence Interval under Nonnormality

    ERIC Educational Resources Information Center

    Padilla, Miguel A.; Divers, Jasmin; Newton, Matthew

    2012-01-01

    Three different bootstrap methods for estimating confidence intervals (CIs) for coefficient alpha were investigated. In addition, the bootstrap methods were compared with the most promising coefficient alpha CI estimation methods reported in the literature. The CI methods were assessed through a Monte Carlo simulation utilizing conditions…

  19. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  20. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  1. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  2. Inhibitory spectrum of alpha 2-plasmin inhibitor.

    PubMed

    Saito, H; Goldsmith, G H; Moroi, M; Aoki, N

    1979-04-01

    alpha 2-Plasmin inhibitor (alpha 2PI) has been recently characterized as a fast-reacting inhibitor of plasmin in human plasma and appears to play an important role in the regulation of fibrinolysis in vivo. We have studied the effect of purified alpha 2PI upon various proteases participating in human blood coagulation and kinin generation. At physiological concentration (50 microgram/ml), alpha 2PI inhibited the clot-promoting and prekallikrein-activating activity of Hageman factor fragments, the amidolytic, kininogenase, and clot-promoting activities of plasma kallikrein, and the clot-promoting properties of activated plasma thromboplastin antecedent (PTA, Factor XIa) and thrombin. alpha 2PI had minimal inhibitory effect on surface-bound activated PTA and activated Stuart factor (Factor Xa). alpha 2PI did not inhibit the activity of activated Christmas factor (Factor IXa) or urinary kallikrein. Heparin (1.5-2.0 units/ml) did not enhance the inhibitory function of alpha 2PI. These results suggest that, like other plasma protease inhibitors, alpha 2PI possesses a broad in vitro spectrum of inhibitory properties.

  3. Determination of alpha-naphthylisothiocyanate and metabolites alpha-naphthylamine and alpha-naphthylisocyanate in rat plasma and urine by high-performance liquid chromatography.

    PubMed

    Hu, Ke; Morris, Marilyn E

    2003-05-01

    A rapid and sensitive high-performance liquid chromatographic (HPLC) assay for the determination of alpha-naphthylisothiocyanate (1-NITC) and two metabolites alpha-naphthylamine (1-NA) and alpha-naphthylisocyanate (1-NIC) in rat plasma and urine has been developed. The chromatographic analysis was carried out using reversed-phase isocratic elution with a Partisphere C(18) 5-microm column, a mobile phase of acetonitrile-water (ACN-H(2)O 70:30, v/v), and detection by ultraviolet (UV) absorption at 305 nm. The lower limits of quantitation (LLQ) in rat plasma, urine, and ACN were 10, 30, and 10 ng/ml for 1-NITC; 30, 100, and 30 ng/ml for 1-NA; and 30 ng/ml in ACN for 1-NIC. At low (10 ng/ml), medium (500 ng/ml), and high (5000 ng/ml) concentrations of quality control samples (QCs), the range of within-day and between-day accuracies were 95-106 and 97-103% for 1-NITC in plasma, respectively. Stability studies showed that 1-NITC was stable at all tested temperatures in ACN, and at -20 and -80 degrees C in plasma, urine, and ACN precipitated plasma and urine, but degraded at room temperature and 4 degrees C. 1-NA was stable in all of the tested matrices at all temperatures. 1-NIC was unstable in plasma, urine, and ACN precipitated plasma and urine, but stable in ACN. The degradation product of 1-NITC and 1-NIC in universal buffer was confirmed to be 1-NA. 1-NITC and 1-NA were detected and quantified in rat plasma and urine, following the administration of a 25 mg/kg i.v. dose of 1-NITC to a female Sprague-Dawley rat.

  4. Suppression of hepatic prostaglandin F2 alpha in rats by dietary alpha-tocopherol acetate is independent of total hepatic alpha-tocopherol.

    PubMed

    Duitsman, P K; Chen, H W; Cook, L R; Hendrich, S

    1992-09-01

    Groups of eight weanling female F344/N rats were fed semipurified diets that supplied 0, 50, 500, 5000, or 15,000 mg alpha-tocopherol acetate/kg diet, with and without 0.05% phenobarbital (PB) for 9 weeks. Both plasma and hepatic alpha-tocopherol levels, measured by HPLC, strongly correlated with alpha-tocopherol intake (r greater than 0.73, p less than 0.0001). Phenobarbital both depleted hepatic alpha-tocopherol and increased plasma alpha-tocopherol significantly. Although treatment with PB for 9 weeks significantly increased GST activity, PB did not affect hepatic prostaglandin (PG)F2 alpha status, as determined by radioimmunoassay. PGF2 alpha was significantly greater (by 52%) in rats fed no alpha-tocopherol than in rats fed 15,000 mg alpha-tocopherol acetate/kg diet. Hepatic PGF2 alpha status was correlated inversely but weakly with dietary alpha-tocopherol (r = -0.24, p less than 0.05). Hepatic PGF2 alpha status was not correlated with hepatic or plasma alpha-tocopherol status. This finding suggests either that there is a small depletion-resistant subcellular alpha-tocopherol pool which regulates PGF2 alpha production or that alpha-tocopherol alters PGF2 alpha production in vivo by an indirect mechanism.

  5. Local Structure and Vibrational Properties of alpha-Pu, alpha-U, and the alpha-U Charge Density Wave

    SciTech Connect

    Nelson, E J; Allen, P G; Blobaum, K M; Wall, M A; Booth, C H

    2004-08-10

    The local atomic environment and vibrational properties of atoms in monoclinic pure {alpha}-plutonium as well as orthorhombic pure {alpha}-uranium and its low-temperature charge-density-wave (CDW) modulation are examined by extended x-ray absorption fine structure spectroscopy (EXAFS). Pu L{sub III}-edge and U L{sub III}-edge EXAFS data measured at low temperatures verify the crystal structures of {alpha}-U and {alpha}-Pu samples previously determined by x-ray diffraction and neutron scattering. Debye-Waller factors from temperature-dependent EXAFS measurements are fit with a correlated Debye model. The observed Pu-Pu bond correlated Debye temperature of {theta}{sub cD}({alpha}-Pu) = 162 {+-} 5 K for the pure {alpha}-Pu phase agrees with our previous measurement of the correlated Debye temperature of the gallium-containing {alpha}'-Pu phase in a mixed phase 1.9 at% Ga-doped {alpha}'-Pu/{delta}-Pu alloy. The temperature dependence of the U-U nearest neighbor Debye-Waller factor exhibits a sharp discontinuity in slope near T{sub CDW} = 43 K, the transition temperature at which the charge-density wave (CDW) in {alpha}-U condenses from a soft phonon mode along the (100) direction. Our measurement of the CDW using EXAFS is the first observation of the structure of the CDW in polycrystalline {alpha}-U. The different temperature dependence of the Debye-Waller factor for T < T{sub CDW} can be modeled by the change in bond length distributions resulting from condensation of the charge density wave. For T > T{sub CDW}, the observed correlated Debye temperature of {theta}{sub cD}({alpha}-U) = 199 {+-} 3 K is in good agreement with other measurements of the Debye temperature for polycrystalline {alpha}-U. CDW structural models fit to the {alpha}-U EXAFS data support a squared CDW at the lowest temperatures, with a displacement amplitude of {var_epsilon} = 0.05 {+-} 0.02 {angstrom}.

  6. Improved peak shape fitting in alpha spectra.

    PubMed

    Pommé, S; Caro Marroyo, B

    2015-02-01

    Peak overlap is a recurrent issue in alpha-particle spectrometry, not only in routine analyses but also in the high-resolution spectra from which reference values for alpha emission probabilities are derived. In this work, improved peak shape formulae are presented for the deconvolution of alpha-particle spectra. They have been implemented as fit functions in a spreadsheet application and optimum fit parameters were searched with built-in optimisation routines. Deconvolution results are shown for a few challenging spectra with high statistical precision. The algorithm outperforms the best available routines for high-resolution spectrometry, which may facilitate a more reliable determination of alpha emission probabilities in the future. It is also applicable to alpha spectra with inferior energy resolution. PMID:25497323

  7. Homomers of alpha 8 and alpha 7 subunits of nicotinic receptors exhibit similar channel but contrasting binding site properties.

    PubMed

    Gerzanich, V; Anand, R; Lindstrom, J

    1994-02-01

    alpha 8 subunits of alpha-bungarotoxin-sensitive chick neuronal nicotinic acetylcholine receptors expressed in Xenopus oocytes from cRNA are shown to form homomeric, acetylcholine-gated, rapidly desensitizing, inwardly rectifying, Ca(2+)-permeable cation channels similar to those of alpha 7 homomers. alpha 8 forms oligomers of several sizes, of which < 14% are expressed on the oocyte surface, which is less efficient than for alpha 7 homomers. alpha 8 homomers are more sensitive to agonists but less sensitive to antagonists than are alpha 7 homomers, and some agonists for alpha 8 homomers are partial agonists or antagonists for alpha 7 homomers. The pharmacological properties of homomers of alpha 8 and alpha 7 subunits generally reflect those of native alpha 8 and alpha 7 receptors.

  8. Mushroom acidic glycosphingolipid induction of cytokine secretion from murine T cells and proliferation of NK1.1 {alpha}/{beta} TCR-double positive cells in vitro

    SciTech Connect

    Nozaki, Hirofumi; Itonori, Saki; Sugita, Mutsumi; Nakamura, Kimihide; Ohba, Kiyoshi; Suzuki, Akemi; Kushi, Yasunori

    2008-08-29

    Interferon (IFN)-{gamma} and interleukin (IL)-4 regulate many types of immune responses. Here we report that acidic glycosphingolipids (AGLs) of Hypsizigus marmoreus and Pleurotus eryngii induced secretion of IFN- {gamma} and IL-4 from T cells in a CD11c-positive cell-dependent manner similar to that of {alpha}-galactosylceramide ({alpha}-GalCer) and isoglobotriaosylceramide (iGb3), although activated T cells by AGLs showed less secretion of cytokine than those activated by {alpha}-GalCer. In addition, stimulation of these mushroom AGLs induced proliferation of NK1.1 {alpha}/{beta} TCR-double positive cells in splenocytes. Administration of a mixture of {alpha}-GalCer and AGLs affected the stimulation of {alpha}-GalCer and generally induced a subtle Th1 bias for splenocytes but induced an extreme Th2 bias for thymocytes. These results suggested that edible mushroom AGLs contribute to immunomodulation.

  9. Catalytic Mechanism of Human Alpha-galactosidase

    SciTech Connect

    Guce, A.; Clark, N; Salgado, E; Ivanen, D; Kulinskaya, A; Brumer, H; Garman, S

    2010-01-01

    The enzyme {alpha}-galactosidase ({alpha}-GAL, also known as {alpha}-GAL A; E.C. 3.2.1.22) is responsible for the breakdown of {alpha}-galactosides in the lysosome. Defects in human {alpha}-GAL lead to the development of Fabry disease, a lysosomal storage disorder characterized by the buildup of {alpha}-galactosylated substrates in the tissues. {alpha}-GAL is an active target of clinical research: there are currently two treatment options for Fabry disease, recombinant enzyme replacement therapy (approved in the United States in 2003) and pharmacological chaperone therapy (currently in clinical trials). Previously, we have reported the structure of human {alpha}-GAL, which revealed the overall structure of the enzyme and established the locations of hundreds of mutations that lead to the development of Fabry disease. Here, we describe the catalytic mechanism of the enzyme derived from x-ray crystal structures of each of the four stages of the double displacement reaction mechanism. Use of a difluoro-{alpha}-galactopyranoside allowed trapping of a covalent intermediate. The ensemble of structures reveals distortion of the ligand into a {sup 1}S{sub 3} skew (or twist) boat conformation in the middle of the reaction cycle. The high resolution structures of each step in the catalytic cycle will allow for improved drug design efforts on {alpha}-GAL and other glycoside hydrolase family 27 enzymes by developing ligands that specifically target different states of the catalytic cycle. Additionally, the structures revealed a second ligand-binding site suitable for targeting by novel pharmacological chaperones.

  10. Sumoylation and the function of CCAAT enhancer binding protein alpha (C/EBP alpha).

    PubMed

    Khanna-Gupta, Arati

    2008-01-01

    CCAAT enhancer binding protein alpha (C/EBP alpha) is the founding member of a family of basic region/leucine zipper (bZIP) transcription factors and is a master regulator of granulopoiesis. It is expressed at high levels throughout myeloid differentiation and binds to the promoters of multiple myeloid-specific genes at different stages of myeloid maturation. Profound hematopoietic abnormalities occur in mice nullizygous for C/EBP alpha including a selective early block in the differentiation of granulocytes. Mutations in C/EBP alpha are present in a subset of patients with AML presenting with a normal karyotype. These mutations can result in the expression of a 30 kDa dominant negative C/EBP alpha isoform, which contributes to loss of C/EBP alpha function. The molecular basis for this observation remains unknown. In addition to phosphorylation, C/EBP alpha is modified, post-translationally by a small ubiquitin-related modifier (SUMO) at a lysine residue (K159), which lies within the growth inhibitory region of the C/EBP alpha protein. Sumoylation at K159 in the C/EBP alpha protein prevents association of the SWI/SNF chromatin remodeling complex with C/EBP alpha, thereby hampering transactivation. In this review, the functional implications of post-translational modification, particularly sumoylation, of C/EBP alpha in normal granulopoiesis and leukemia are considered. PMID:18406180

  11. Folate receptor {alpha} regulates cell proliferation in mouse gonadotroph {alpha}T3-1 cells

    SciTech Connect

    Yao, Congjun; Evans, Chheng-Orn; Stevens, Victoria L.; Owens, Timothy R.; Oyesiku, Nelson M.

    2009-11-01

    We have previously found that the mRNA and protein levels of the folate receptor alpha (FR{alpha}) are uniquely over-expressed in clinically human nonfunctional (NF) pituitary adenomas, but the mechanistic role of FR{alpha} has not fully been determined. We investigated the effect of FR{alpha} over-expression in the mouse gonadotroph {alpha}T3-1 cell line as a model for NF pituitary adenomas. We found that the expression and function of FR{alpha} were strongly up-regulated, by Western blotting and folic acid binding assay. Furthermore, we found a higher cell growth rate, an enhanced percentage of cells in S-phase by BrdU assay, and a higher PCNA staining. These observations indicate that over-expression of FR{alpha} promotes cell proliferation. These effects were abrogated in the same {alpha}T3-1 cells when transfected with a mutant FR{alpha} cDNA that confers a dominant-negative phenotype by inhibiting folic acid binding. Finally, by real-time quantitative PCR, we found that mRNA expression of NOTCH3 was up-regulated in FR{alpha} over-expressing cells. In summary, our data suggests that FR{alpha} regulates pituitary tumor cell proliferation and mechanistically may involve the NOTCH pathway. Potentially, this finding could be exploited to develop new, innovative molecular targeted treatment for human NF pituitary adenomas.

  12. Alpha1 and Alpha2 Integrins Mediate Invasive Activity of Mouse Mammary Carcinoma Cells through Regulation of Stromelysin-1 Expression

    SciTech Connect

    Lochter, Andre; Navre, Marc; Werb, Zena; Bissell, Mina J

    1998-06-29

    Tumor cell invasion relies on cell migration and extracellular matrix proteolysis. We investigated the contribution of different integrins to the invasive activity of mouse mammary carcinoma cells. Antibodies against integrin subunits {alpha}6 and {beta}1, but not against {alpha}1 and {alpha}2, inhibited cell locomotion on a reconstituted basement membrane in two-dimensional cell migration assays, whereas antibodies against {beta}1, but not against a6 or {alpha}2, interfered with cell adhesion to basement membrane constituents. Blocking antibodies against {alpha}1 integrins impaired only cell adhesion to type IV collagen. Antibodies against {alpha}1, {alpha}2, {alpha}6, and {beta}1, but not {alpha}5, integrin subunits reduced invasion of a reconstituted basement membrane. Integrins {alpha}1 and {alpha}2, which contributed only marginally to motility and adhesion, regulated proteinase production. Antibodies against {alpha}1 and {alpha}2, but not {alpha}6 and {beta}1, integrin subunits inhibited both transcription and protein expression of the matrix metalloproteinase stromelysin-1. Inhibition of tumor cell invasion by antibodies against {alpha}1 and {alpha}2 was reversed by addition of recombinant stromelysin-1. In contrast, stromelysin-1 could not rescue invasion inhibited by anti-{alpha}6 antibodies. Our data indicate that {alpha}1 and {alpha}2 integrins confer invasive behavior by regulating stromelysin-1 expression, whereas {alpha}6 integrins regulate cell motility. These results provide new insights into the specific functions of integrins during tumor cell invasion.

  13. G alpha 12 and G alpha 13 subunits define a fourth class of G protein alpha subunits.

    PubMed Central

    Strathmann, M P; Simon, M I

    1991-01-01

    Heterotrimeric guanine nucleotide-binding regulatory proteins (G proteins) are central to the signaling processes of multicellular organisms. We have explored the diversity of the G protein subunits in mammals and found evidence for a large family of genes that encode the alpha subunits. Amino acid sequence comparisons show that the different alpha subunits fall into at least three classes. These classes have been conserved in animals separated by considerable evolutionary distances; they are present in mammals, Drosophila, and nematodes. We have now obtained cDNA clones encoding two murine alpha subunits, G alpha 12 and G alpha 13, that define a fourth class. The translation products are predicted to have molecular masses of 44 kDa and to be insensitive to ADP-ribosylation by pertussis toxin. They share 67% amino acid sequence identity with each other and less than 45% identity with other alpha subunits. Their transcripts can be detected in every tissue examined, although the relative levels of the G alpha 13 message appear somewhat variable. Images PMID:1905812

  14. Sensitivity to alpha-amylcinnamic aldehyde and alpha-amylcinnamic alcohol.

    PubMed

    Guin, J D; Haffley, P

    1983-01-01

    Sensitivity to alpha-amylcinnamic aldehyde (alpha-AcAld) is apparently uncommon, but, like allergy to alpha-amylcinnamic alcohol (alpha-AcAlc), it often accompanies allergy to the perfume in Mycolog cream. Although alpha-AcAlc is a known ingredient, alpha-AcAld is not. However, gas-liquid chromatographic analysis shows alpha-AcAld to be present. Of fourteen persons sensitive to either chemical, ten reacted to both. Of these, one man and three women were markedly sensitive, and all three women had chronic recalcitrant vulvar eczema. That condition might have been the cause as well as the result of sensitization, but reexposure to a suspected product reproduced the eruption in both persons tested. Its use with other potent sensitizers, e.g., ethylenediamine, to treat irritations and chronic eczemas in an area of high absorption may partly explain development of allergy to a relatively weak sensitizer.

  15. Effect of UVB on hydrolysis of alpha-tocopherol acetate to alpha-tocopherol in mouse skin.

    PubMed

    Kramer-Stickland, K; Liebler, D C

    1998-08-01

    We have assessed the hydrolysis of alpha-tocopherol acetate (alpha-TAc) to the active antioxidant alpha-tocopherol (alpha-TH) in mouse epidermis and in supernatant from epidermal homogenates. Topically administered alpha-TH prevents UVB photocarcinogenesis in C3H mice, whereas alpha-TAc does not. Hydrolysis in skin was monitored in mice treated topically with deuterium labeled alpha-TAc (d3-alpha-TAc). Epidermal samples were isolated from mice and analyzed for endogenous (d0-alpha-TAc) and d3-alpha-TH by gas chromatography-mass spectrometry. Within 24 h, the levels of d3-alpha-TH increased up to 10-fold over endogenous d0-alpha-TH levels; however, in mice irradiated with UVB prior to the application of d3-alpha-TAc, levels of d3-alpha-TH increased up to 30-40-fold over endogenous d0-alpha-TH. This enhancement of alpha-TAc hydrolysis increased with increasing UVB dose. Prior UVB exposure may increase hydrolysis of alpha-TAc by increasing epidermal esterase activity. Nonspecific esterase activity was measured in the 2000 x g supernatant from epidermis of unirradiated and irradiated mice. Alpha-napthyl acetate, a nonspecific esterase substrate, was converted to alpha-napthol in supernatants from unirradiated mice. Hydrolysis to alpha-napthol increased approximately 3-fold in supernatants from irradiated mice. Hydrolysis of alpha-TAc to alpha-TH also occurred in supernatant from unirradiated mice, and this hydrolysis increased approximately 3-fold in supernatant from irradiated animals. These data indicate that nonspecific esterase activity was increased by UVB in the skin, that alpha-TAc is converted to alpha-TH in the homogenate fraction containing nonspecific esterase, and that UVB exposure modulates the metabolism of alpha-TAc to alpha-TH in vivo.

  16. MCS Systems Administration Toolkit

    2001-09-30

    This package contains a number of systems administration utilities to assist a team of system administrators in managing a computer environment by automating routine tasks and centralizing information. Included are utilities to help install software on a network of computers and programs to make an image of a disk drive, to manage and distribute configuration files for a number of systems, and to run self-testss on systems, as well as an example of using amore » database to manage host information and various utilities.« less

  17. Computer hardware fault administration

    DOEpatents

    Archer, Charles J.; Megerian, Mark G.; Ratterman, Joseph D.; Smith, Brian E.

    2010-09-14

    Computer hardware fault administration carried out in a parallel computer, where the parallel computer includes a plurality of compute nodes. The compute nodes are coupled for data communications by at least two independent data communications networks, where each data communications network includes data communications links connected to the compute nodes. Typical embodiments carry out hardware fault administration by identifying a location of a defective link in the first data communications network of the parallel computer and routing communications data around the defective link through the second data communications network of the parallel computer.

  18. River basin administration

    NASA Astrophysics Data System (ADS)

    Management of international rivers and their basins is the focus of the Centre for Comparative Studies on (International) River Basin Administration, recently established at Delft University of Technology in the Netherlands. Water pollution, sludge, and conflicting interests in the use of water in upstream and downstream parts of a river basin will be addressed by studying groundwater and consumption of water in the whole catchment area of a river.Important aspects of river management are administrative and policy aspects. The Centre will focus on policy, law, planning, and organization, including transboundary cooperation, posing standards, integrated environmental planning on regional scale and environmental impact assessments.

  19. Mapping High-Velocity H-alpha and Lyman-alpha Emission from Supernova 1987A

    NASA Technical Reports Server (NTRS)

    France, Kevin; McCray, Richard; Fransson, Claes; Larsson, Josefin; Frank, Kari A.; Burrows, David N.; Challis, Peter; Kirshner, Robert P.; Chevalier, Roger A.; Garnavich, Peter; Heng, Kevin; Lawrence, Stephen S.; Lundqvist, Peter; Smith, Nathan; Sonneborn, George

    2015-01-01

    We present new Hubble Space Telescope images of high-velocity H-alpha and Lyman-alpha emission in the outer debris of SN 1987A. The H-alpha images are dominated by emission from hydrogen atoms crossing the reverse shock. For the first time we observe emission from the reverse shock surface well above and below the equatorial ring, suggesting a bipolar or conical structure perpendicular to the ring plane. Using the H-alpha imaging, we measure the mass flux of hydrogen atoms crossing the reverse shock front, in the velocity intervals (-7,500 < V(sub obs) < -2,800 km/s) and (1,000 < V(sub obs) < 7,500 km/s), ?M(sub H) = 1.2 × 10(exp -3) M/ y. We also present the first Lyman-alpha imaging of the whole remnant and new Chandra X-ray observations. Comparing the spatial distribution of the Lyman-alpha and X-ray emission, we observe that the majority of the high-velocity Lyman-alpha emission originates interior to the equatorial ring. The observed Lyman-alpha/H-alpha photon ratio, R(L-alpha/H-alpha) approx. = 17, is significantly higher than the theoretically predicted ratio of approx. = 5 for neutral atoms crossing the reverse shock front. We attribute this excess to Lyman-alpha emission produced by X-ray heating of the outer debris. The spatial orientation of the Lyman-alpha and X-ray emission suggests that X-ray heating of the outer debris is the dominant Lyman-alpha production mechanism in SN 1987A at this phase in its evolution.

  20. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].

    PubMed

    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo

    2004-10-01

    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples.

  1. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].

    PubMed

    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo

    2004-10-01

    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples. PMID:15678944

  2. A new alpha chain hemoglobin variant: Hb Al-Hammadi Riyadh [alpha75(EF4)Asp-->Val (alpha2)].

    PubMed

    Burnichon, Nelly; Lacan, Philippe; Becchi, Michel; Zanella-Cleon, Isabelle; Aubry, Martine; Mowafy, Mohammed; Couprie, Nicole; Francina, Alain

    2006-01-01

    A new hemoglobin (Hb) variant in the heterozygous state, Hb Al-Hammadi Riyadh [codon 75 (GAC-->GTC); alpha75(EF4)Asp-->Val (alpha2)] corresponding to an A-->T transversion on the second exon of the alpha2-globin gene, is described. The variant was characterized by DNA sequencing and mass spectrometry (MS). The variant was found during a routine Hb analysis for anemia in a 16-month-old boy who lived in Riyadh, Kingdom of Saudi Arabia.

  3. Genetics Home Reference: mucolipidosis III alpha/beta

    MedlinePlus

    ... Health Conditions mucolipidosis III alpha/beta mucolipidosis III alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis III alpha/beta is a slowly progressive disorder that affects ...

  4. Genetics Home Reference: mucolipidosis II alpha/beta

    MedlinePlus

    ... Health Conditions mucolipidosis II alpha/beta mucolipidosis II alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis II alpha/beta (also known as I-cell disease) is ...

  5. 24xi-Methyl 5 alpha-cholestane-3 alpha,6 beta,9 alpha,25-tetrol 24-monoacetate, a novel polyhydroxylated steroid from the soft coral Sarcophyton tortuosum.

    PubMed

    Su, J Y; Peng, T S; Long, K H; Zeng, L M

    1986-01-01

    A novel polyhydroxylated steroid, named sartortuosterol A, with rare 3 alpha- and 6-hydroxyl groups, was isolated from the South China Sea soft coral Sarcophyton tortuosum Tixier-Durivault, and its structure was established as 24xi-methyl 5 alpha-cholestane-3 alpha, 6 beta, 9 alpha,25-tetrol 25-monoacetate from spectroscopic data and chemical conversions.

  6. The IL-6/sIL-6R treatment of a malignant melanoma cell line enhances susceptibility to TNF-{alpha}-induced apoptosis

    SciTech Connect

    Wagley, Yadav; Yoo, Yung-Choon; Seo, Han Geuk; Rhee, Man Hee; Kim, Tae-Hyoung; Kang, Keon Wook; Nah, Seung-Yeol; Oh, Jae-Wook . E-mail: ohjw@mail.chosun.ac.kr

    2007-03-23

    Melanoma is an intractable tumor that has shown very impressive and promising response to local administration of high dose recombinant TNF-{alpha} in combination with IFN-{gamma} in clinical studies. In this study, we investigated the effect of IL-6/sIL-6R on TNF-{alpha}-resistant B16/F10.9 melanoma cells. A low dose of TNF-{alpha} or IL-6/sIL-6R had minimal affect on the cell growth. However, the highly active fusion protein of sIL-6R and IL-6 (IL6RIL6), covalently linked by a flexible peptide, sensitized TNF-{alpha}-resistant F10.9 melanoma cells to TNF-{alpha}-induced apoptosis. Stimulation of the cells with IL6RIL6 plus TNF-{alpha} resulted in both the activation of caspase-3 and the reduction of bcl-2 expression. Flow cytometry analysis showed that IL6RIL6-upregulated TNF-R55 and TNF-R75 expression, suggesting an increase in TNF-{alpha} responsiveness by IL6RIL6 resulting from the induction of TNF receptors. Moreover, exposure of F10.9 cells to neutralizing antibody to TNF-R55 significantly inhibited IL6RIL6/TNF-{alpha}-induced cytotoxicity. These results suggest that the IL6/sIL6R/gp130 system, which sensitizes TNF-{alpha}-resistant melanoma cells to TNF-{alpha}-induced apoptosis, may provide a new target for immunotherapy.

  7. Mechanisms of alpha 1-adrenergic vascular desensitization in conscious dogs

    NASA Technical Reports Server (NTRS)

    Kiuchi, K.; Vatner, D. E.; Uemura, N.; Bigaud, M.; Hasebe, N.; Hempel, D. M.; Graham, R. M.; Vatner, S. F.

    1992-01-01

    To investigate the mechanisms of alpha 1-adrenergic vascular desensitization, osmotic minipumps containing either saline (n = 9) or amidephrine mesylate (AMD) (n = 9), a selective alpha 1-adrenergic receptor agonist, were implanted subcutaneously in dogs with chronically implanted arterial and right atrial pressure catheters and aortic flow probes. After chronic alpha 1-adrenergic receptor stimulation, significant physiological desensitization to acute AMD challenges was observed, i.e., pressor and vasoconstrictor responses to the alpha 1-adrenergic agonist were significantly depressed (p < 0.01) compared with responses in the same dogs studied in the conscious state before pump implantation. However, physiological desensitization to acute challenges of the neurotransmitter norepinephrine (NE) (0.1 micrograms/kg per minute) in the presence of beta-adrenergic receptor blockade was not observed for either mean arterial pressure (MAP) (30 +/- 7 versus 28 +/- 5 mm Hg) or total peripheral resistance (TPR) (29.8 +/- 4.9 versus 28.9 +/- 7.3 mm Hg/l per minute). In the presence of beta-adrenergic receptor plus ganglionic blockade after AMD pump implantation, physiological desensitization to NE was unmasked since the control responses to NE (0.1 micrograms/kg per minute) before the AMD pumps were now greater (p < 0.01) than after chronic AMD administration for both MAP (66 +/- 5 versus 32 +/- 2 mm Hg) and TPR (42.6 +/- 10.3 versus 23.9 +/- 4.4 mm Hg/l per minute). In the presence of beta-adrenergic receptor, ganglionic, plus NE-uptake blockade after AMD pump implantation, desensitization was even more apparent, since NE (0.1 micrograms/kg per minute) induced even greater differences in MAP (33 +/- 5 versus 109 +/- 6 mm Hg) and TPR (28.1 +/- 1.8 versus 111.8 +/- 14.7 mm Hg/l per minute). The maximal force of contraction induced by NE in the presence or absence of endothelium was significantly decreased (p < 0.05) in vitro in mesenteric artery rings from AMD pump dogs

  8. Oromucosal Administration of Interferon to Humans

    PubMed Central

    Beilharz, Manfred W.; Cummins, Martin J.; Bennett, Alayne L.; Cummins, Joseph M.

    2010-01-01

    The prevailing dogma is that, to be systemically effective, interferon-alpha (IFNα) must be administered in sufficiently high doses to yield functional blood concentrations. Such an approach to IFNα therapy has proven effective in some instances, but high-dose parenteral IFNα therapy has the disadvantage of causing significant adverse events. Mounting evidence suggests that IFNα delivered into the oral cavity in low doses interacts with the oral mucosa in a unique manner to induce systemic host defense mechanisms without IFNα actually entering the circulation, thus reducing the potential for toxic side effects. A better understanding of the applications and potential benefits of this treatment modality are under active investigation. This paper provides a review of the relevant literature on the clinical use of the oromucosal route of administration of interferon, with an emphasis on the treatment of influenza.

  9. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed. PMID:7162915

  10. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed.

  11. Applying alpha-channeling to mirror machines

    SciTech Connect

    Zhmoginov, A. I.; Fisch, N. J.

    2012-05-15

    The {alpha}-channeling effect entails the use of radio-frequency waves to expel and cool high-energetic {alpha} particles born in a fusion reactor; the device reactivity can then be increased even further by redirecting the extracted energy to fuel ions. Originally proposed for tokamaks, this technique has also been shown to benefit open-ended fusion devices. Here, the fundamental theory and practical aspects of {alpha} channeling in mirror machines are reviewed, including the influence of magnetic field inhomogeneity and the effect of a finite wave region on the {alpha}-channeling mechanism. For practical implementation of the {alpha}-channeling effect in mirror geometry, suitable contained weakly damped modes are identified. In addition, the parameter space of candidate waves for implementing the {alpha}-channeling effect can be significantly extended through the introduction of a suitable minority ion species that has the catalytic effect of moderating the transfer of power from the {alpha}-channeling wave to the fuel ions.

  12. Lyman alpha radiation in external galaxies

    NASA Technical Reports Server (NTRS)

    Neufeld, David A.; Mckee, Christopher F.

    1990-01-01

    The Ly alpha line of atomic hydrogen is often a luminous component of the radiation emitted by distant galaxies. Except for those galaxies which have a substantial central source of non-stellar ionizing radiation, most of the Ly alpha radiation emitted by galaxies is generated within regions of the interstellar medium which are photoionized by starlight. Conversely, much of the energy radiated by photoionized regions is carried by the Ly alpha line. Only hot, massive stars are capable of ionizing hydrogen in the interstellar medium which surrounds them, and because such stars are necessarily short-lived, Ly alpha emission traces regions of active star formation. Researchers argue that the strength of the Ly alpha emission observed from external galaxies may be used to estimate quantitatively the dust content of the emitting region, while the Ly alpha line profile is sensitive to the presence of shock waves. Interstellar dust particles and shock waves are intimately associated with the process of star formation in two senses. First, both dust particles and shock waves owe their existence to stellar activity; second, they may both serve as agents which facilitate the formation of stars, shocks by triggering gravitational instabilities in the interstellar gas that they compress, and dust by shielding star-forming molecular clouds from the ionizing and dissociative effects of external UV radiation. By using Ly alpha observations as a probe of the dust content in diffuse gas at high redshift, we might hope to learn about the earliest epochs of star formation.

  13. Urban School Administration.

    ERIC Educational Resources Information Center

    McKelvey, Troy V., Ed.; Swanson, Austin D., Ed.

    This document contains 12 papers presented at an institute for urban school administrators designed to deal with the contemporary urban educational problems incident to school desegregation, social integration, and the equality of educational opportunity. The authors of the papers relate recent research findings to practical field experience, and…

  14. Telecommunications administration standard

    SciTech Connect

    Gustwiller, K.D.

    1996-05-01

    The administration of telecommunications is critical to proper maintenance and operation. The intent is to be able to properly support telecommunications for the distribution of all information within a building/campus. This standard will provide a uniform administration scheme that is independent of applications, and will establish guidelines for owners, installers, designers and contractors. This standard will accommodate existing building wiring, new building wiring and outside plant wiring. Existing buildings may not readily adapt to all applications of this standard, but the requirement for telecommunications administration is applicable to all buildings. Administration of the telecommunications infrastructure includes documentation (labels, records, drawings, reports, and work orders) of cables, termination hardware, patching and cross-connect facilities, telecommunications rooms, and other telecommunications spaces (conduits, grounding, and cable pathways are documented by Facilities Engineering). The investment in properly documenting telecommunications is a worthwhile effort. It is necessary to adhere to these standards to ensure quality and efficiency for the operation and maintenance of the telecommunications infrastructure for Sandia National Laboratories.

  15. Hospital Library Administration.

    ERIC Educational Resources Information Center

    Cramer, Anne

    The objectives of a hospital are to improve patient care, while the objectives of a hospital library are to improve services to the staff which will support their efforts. This handbook dealing with hospital administration is designed to aid the librarian in either implementing a hospital library, or improving services in an existing medical…

  16. Administrative Salary Summary Data.

    ERIC Educational Resources Information Center

    Colorado Commission on Higher Education, Denver.

    This report presents salary data on selected administrative positions from all public higher education institutions, governing boards, and other higher education state-level agencies in Colorado. Table 1 presents, by institutional type, the median and mean salaries for 1994-95, as well as the frequency and range of salaries, for the following…

  17. A Treatise on Administration.

    ERIC Educational Resources Information Center

    Moore, Thomas R.

    1988-01-01

    Expands Henri Fayol's definition of the administrative process to include a humanistic approach involving planning, organizing, implementing, controlling, evaluating, and satisfying functions. This empirical definition differs from some theoretical approaches by looking beyond resource consumption to consider ecological effects on the environment…

  18. Guidebook for School Administrators.

    ERIC Educational Resources Information Center

    Hess, Fritz, Ed.

    To provide guidance and advice regarding day-to-day responsibilities of new and experienced school administrators and superintendents in New York State, this compendium of knowledge and advice submitted by practitioners is presented with emphasis on all major aspects of superintendency. The section on general aspects of superintendency includes…

  19. Administrators Confront Student "Sexting"

    ERIC Educational Resources Information Center

    Manzo, Kathleen Kennedy

    2009-01-01

    Cellphone-savvy students have created instructional and disciplinary challenges for educators for years. But the recent emergence of "sexting" by adolescents over their mobile phones caught many school administrators off guard, and the practice is prompting efforts around the country to craft policy responses. Students' sharing of nude or…

  20. IVA: Improving Vocational Administration.

    ERIC Educational Resources Information Center

    EPD Consortium D, Richardson, TX.

    These six instructional units are intended to provide instructors of vocational education administration with a systematic package of materials for their programs of preservice and/or inservice instruction and to provide materials which could be reproduced for learner use. These units cover the following subject matter: (1) federal legislation…

  1. Administrative Utility Analysis: Appendices.

    ERIC Educational Resources Information Center

    Peat, Marwick, Mitchell and Co., San Juan, Puerto Rico.

    Appendixes to a study on administrative utility analysis and vocational education programs for the Area of Vocational and Technical Education (AVTE) in the Puerto Rico Department of Education contain the planning and budgeting system elements, position descriptions, and information on the growth of vocational education in Puerto Rico. The elements…

  2. Standards and Administration.

    ERIC Educational Resources Information Center

    Gross, S. P.

    1978-01-01

    Presents a literature review of water quality standards and administration, covering publications of 1976-77. Consideration is given to municipal facilities, National Pollutant Discharge Elimination Systems, regional and international water quality management, and effluent standards. A list of 99 references is also presented. (HM)

  3. Research Administration: Lessons Learned.

    ERIC Educational Resources Information Center

    Dummer, George H.

    1995-01-01

    The ways in which accountability issues have affected federal-university relationships, particularly in the area of academic research, are examined. Lessons university administrators have learned since issuance of Office of Management and Budget Circular A-21 in 1958, Congressional hearings on the operations of the National Institutes of Health…

  4. Educational Administration's Weber.

    ERIC Educational Resources Information Center

    Gronn, Peter

    1994-01-01

    Discusses Max Weber's importance in Greenfield's work, particularly in Greenfield and Ribbins'"Greenfield on Educational Administration" (1993). In concentrating on human actors' subjective understanding, Greenfield was a faithful Weberian. However, he deviated from Weber by disavowing structural explanations of social and organizational…

  5. Administrative Uses of Microcomputers.

    ERIC Educational Resources Information Center

    Crawford, Chase

    1987-01-01

    This paper examines the administrative uses of the microcomputer, stating that high performance educational managers are likely to have microcomputers in their organizations. Four situations that would justify the use of a computer are: (1) when massive amounts of data are processed through well-defined operations; (2) when data processing is…

  6. Educator Effectiveness Administrative Manual

    ERIC Educational Resources Information Center

    Pennsylvania Department of Education, 2014

    2014-01-01

    The goal of this manual is to provide guidance in the evaluation of educators, highlight critical components of effectiveness training, and offer opportunities for professional growth. The term "educator" includes teachers, all professional and temporary professional employees, education specialists, and school administrators/principals.…

  7. Discretionary Grants Administration Manual.

    ERIC Educational Resources Information Center

    Office of Human Development Services (DHHS), Washington, DC.

    This manual sets forth applicable administrative policies and procedures to recipients of discretionary project grants or cooperative agreements awarded by program offices in the Office of Human Development Services (HDS). It is intended to serve as a basic reference for project directors and business officers of recipient organizations who are…

  8. Study Shows Administrative Shortage.

    ERIC Educational Resources Information Center

    Sullivan, John R., Jr.

    1989-01-01

    Summarizes "Administrative Shortage in New England: The Evidence, the Causes, the Recommendations." High pressure, long hours, low salaries, and high housing costs are among the reasons cited for the shortage. Recommendations are centered on role identity, staff support, training, and recruitment. (SI)

  9. Professionalism in Educational Administration.

    ERIC Educational Resources Information Center

    Silver, Paula F.

    That the quest for a general theory of educational administration has been a misdirection of effort and that the advancement of professionalism within this field would represent a more sensible endeavor for the production of useful knowledge is the focus of this essay. The advancement of professionalism would entail a reorientation of research…

  10. Public Relations for Administrators.

    ERIC Educational Resources Information Center

    Bagin, Don; And Others

    This volume provides information and recommendations about public relations to assist school administrators in developing effective communication. The document contains 15 chapters. "The Scope of Public Relations," chapter 1, specifies characteristics of and individuals responsible for an effective program. Chapter 2, "Personal Public Relations,"…

  11. Championing the Latino Administrator

    ERIC Educational Resources Information Center

    Garcia, Carlos A.

    2011-01-01

    When the author worked as a vice principal at a K-8 school in Watsonville, California, a school predominantly filled with migrant workers' children, he felt a lack of support as a Latino as he began moving up into school administration. He also continued to see what he had seen as a teacher--which was how underserved minority students were. These…

  12. Indicators of Administrative Effectiveness.

    ERIC Educational Resources Information Center

    Skipper, Charles E.; Hofmann, Richard J.

    Ten personal characteristics and seven administrative skills that differentiated effective from ineffective university leaders were assessed by multiple discriminate analysis. The personal characteristics identified by previous research (Skipper, 1975, 1977) are: responsibility, integrity, self-control, intellectual efficiency, flexibility,…

  13. Migrant Education Administrative Handbook.

    ERIC Educational Resources Information Center

    Louisiana State Dept. of Education, Baton Rouge. Bureau of Migrant Education.

    Intended to provide information pertaining to the administration of migrant education projects in Louisiana, the handbook is divided into two sections: basic guidelines for program operations and support services--nursing. Section I covers the Federal and State migrant program, local migrant projects, project personnel and staff development, and…

  14. Redis database administration tool

    SciTech Connect

    Martinez, J. J.

    2013-02-13

    MyRedis is a product of the Lorenz subproject under the ASC Scirntific Data Management effort. MyRedis is a web based utility designed to allow easy administration of instances of Redis databases. It can be usedd to view and manipulate data as well as run commands directly against a variety of different Redis hosts.

  15. Renaissance Administrator, Spring 1998.

    ERIC Educational Resources Information Center

    Dowdy, June P., Ed.

    1998-01-01

    This spring 1998 issue of Renaissance Administrator features the following articles: (1) "Servant Leadership and Higher Education--What is Leadership?" (Richard E. Hasselbach); (2) "Teaching Writing in the 90's--Carnivorous Printers and Dying Grandmothers" (Helen Ruggieri); (3) Assignment--Journal Writing" (Lynn Muscato); and (4) "A Business…

  16. Diagnostics for PLX-alpha

    NASA Astrophysics Data System (ADS)

    Gilmore, Mark; Hsu, Scott

    2015-11-01

    The goal of the Plasma Liner eXperiment PLX-alpha at Los Alamos National Laboratory is to establish the viability of creating a spherically imploding plasma liner for MIF and HED applications, using a spherical array of supersonic plasma jets launched by innovative contoured-gap coaxial plasma guns. PLX- α experiments will focus in particular on establishing the ram pressure and uniformity scalings of partial and fully spherical plasma liners. In order to characterize these parameters experimentally, a suite of diagnostics is planned, including multi-camera fast imaging, a 16-channel visible interferometer (upgraded from 8 channels) with reconfigurable, fiber-coupled front end, and visible and VUV high-resolution and survey spectroscopy. Tomographic reconstruction and data fusion techniques will be used in conjunction with interferometry, imaging, and synthetic diagnostics from modeling to characterize liner uniformity in 3D. Diagnostic and data analysis design, implementation, and status will be presented. Supported by the Advanced Research Projects Agency - Energy - U.S. Department of Energy.

  17. Lyman Alpha Spicule Observatory (LASO)

    NASA Technical Reports Server (NTRS)

    Chamberlin, Phillip C.

    2011-01-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe smallscale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mAngstroms (33mAngstroms pixels) across a broad 20Angstrom spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-a emission at 1216Angstroms. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  18. Lyman Alpha Spicule Observatory (LASO)

    NASA Astrophysics Data System (ADS)

    Chamberlin, Phillip C.; Allred, J.; Airapetian, V.; Gong, Q.; Fontenla, J.; McIntosh, S.; de Pontieu, B.

    2011-05-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe small-scale eruptive events called "Rapid Blue-shifted Events” (RBEs), the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1” pixels) over a 2'x2' field of view with high spectral resolution of 66mÅ (33mÅ pixels) across a broad 20Å spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-α emission at 1216Å. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  19. Lyman Alpha Spicule Observatory (LASO)

    NASA Astrophysics Data System (ADS)

    Chamberlin, P. C.; Allred, J. C.; Airapetian, V.; Gong, Q.; Mcintosh, S. W.; De Pontieu, B.; Fontenla, J. M.

    2011-12-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe small-scale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mÅ (33mÅ pixels) across a broad 20Å spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-α emission at 1216Å. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  20. Divergence of human [alpha]-chain constant region gene sequences: A novel recombinant [alpha]2 gene

    SciTech Connect

    Chintalacharuvu, K. R.; Morrison, S.L. ); Raines, M. )

    1994-06-01

    IgA is the major Ig synthesized in humans and provides the first line of defense at the mucosal surfaces. The constant region of IgA heavy chain is encoded by the [alpha] gene on chromosome 14. Previous studies have indicated the presence of two [alpha] genes, [alpha]1 and [alpha]2 existing in two allotypic forms, [alpha]2 m(1) and [alpha]2 m(2). Here the authors report the cloning and complete nucleotide sequence determination of a novel human [alpha] gene. Nucleotide sequence comparison with the published [alpha] sequences suggests that the gene arose as a consequence of recombination or gene conversion between the two [alpha]2 alleles. The authors have expressed the gene as a chimeric protein in myeloma cells indicating that it encodes a functional protein. The novel IgA resembles IgA2 m(2) in that disulfide bonds link H and L chains. This novel recombinant gene provides insights into the mechanisms of generation of different constant regions and suggests that within human populations, multiple alleles of [alpha] may be present providing IgAs of different structures.

  1. Fibrinogen {alpha} genes: Conservation of bipartite transcripts and carboxy-terminal-extended {alpha} subunits in vertebrates

    SciTech Connect

    Fu, Y.; Cao, Y.; Hertzberg, K.M.; Grieninger, G.

    1995-11-01

    All three well-studied subunits of the clotting protein fibrinogen ({alpha}, {beta}, {gamma}) share N-terminal structural homologies, but until recently only the {beta} and {gamma} chains were recognized as having similar globular C-termini. With the discovery of an extra exon in the human fibrinogen {alpha} gene (exon VI), a minor form of the {alpha} subunit ({alpha}{sub E}) with an extended {beta}- and {gamma}-like C-terminus has been identified. In the present study, the polymerase chain reaction has been used to identify sequences that encode counterparts to {alpha}{sub E} in chicken, rabbit, rat, and baboon. The basic six-exon structure of the fibrinogen {alpha} genes is shown to be conserved among mammals and birds, as are the intron positions. Bipartite transcripts - still bearing an intron prior to the last exon - are found among the products of the various vertebrate fibrinogen {alpha} genes. The last exon represents the largest conserved segment of the gene and, in each species examined, encodes exactly 236 amino acids. The C-termini of these {alpha}{sub E} chains align without a single gap and are between 76 and 99% identical. Since the exon VI-encoded domain of {alpha}{sub E} is as well conserved as the corresponding regions of the {beta} and {gamma} chains, it follows that it is equally important and that {alpha}{sub E}-fibrinogen plays a vital, if as-yet unrecognized physiological role. 21 refs., 7 figs., 1 tab.

  2. Variable displacement alpha-type Stirling engine

    NASA Astrophysics Data System (ADS)

    Homutescu, V. M.; Bălănescu, D. T.; Panaite, C. E.; Atanasiu, M. V.

    2016-08-01

    The basic design and construction of an alpha-type Stirling engine with on load variable displacement is presented. The variable displacement is obtained through a planar quadrilateral linkage with one on load movable ground link. The physico-mathematical model used for analyzing the variable displacement alpha-type Stirling engine behavior is an isothermal model that takes into account the real movement of the pistons. Performances and power adjustment capabilities of such alpha-type Stirling engine are calculated and analyzed. An exemplification through the use of the numerical simulation was performed in this regard.

  3. Alpha spectral analysis via artificial neural networks

    SciTech Connect

    Kangas, L.J.; Hashem, S.; Keller, P.E.; Kouzes, R.T.; Troyer, G.L.

    1994-10-01

    An artificial neural network system that assigns quality factors to alpha particle energy spectra is discussed. The alpha energy spectra are used to detect plutonium contamination in the work environment. The quality factors represent the levels of spectral degradation caused by miscalibration and foreign matter affecting the instruments. A set of spectra was labeled with a quality factor by an expert and used in training the artificial neural network expert system. The investigation shows that the expert knowledge of alpha spectra quality factors can be transferred to an ANN system.

  4. Determining cellular role of G alpha 12.

    PubMed

    Dermott, Jonathan M; Dhanasekaran, N

    2002-01-01

    Using the expression strategies described here, we have demonstrated a model system whereby the sequential signaling events involved in cell proliferation and subsequent transformation regulated by G alpha 12 can be investigated. The model system presented here can also be used to study the temporal interrelationships between small GTPases, kinases, and other signaling proteins involved in G alpha 12-signaling pathways. Further analyses using this model system and the strategies presented here should provide valuable clues in defining the signaling network regulated by G alpha 12 in stimulating cell proliferation and oncogenic transformation. PMID:11771390

  5. Accelerated transport and maturation of lysosomal alpha-galactosidase A in Fabry lymphoblasts by an enzyme inhibitor.

    PubMed

    Fan, J Q; Ishii, S; Asano, N; Suzuki, Y

    1999-01-01

    Fabry disease is a disorder of glycosphingolipid metabolism caused by deficiency of lysosomal alpha-galactosidase A (alpha-Gal A), resulting in renal failure along with premature myocardial infarction and strokes. No effective treatment of this disorder is available at present. Studies of residual activities of mutant enzymes in many Fabry patients showed that some of them had kinetic properties similar to those for normal alpha-Gal A, but were significantly less stable, especially in conditions of neutral pH (refs. 3-5). The biosynthetic processing was delayed in cultured fibroblasts of a Fabry patient, and the mutant protein formed an aggregate in endoplasmic reticulum, indicating that the enzyme deficiency in some mutants was mainly caused by abortive exit from the endoplasmic reticulum, leading to excessive degradation of the enzyme. We report here that 1-deoxy-galactonojirimycin (DGJ), a potent competitive inhibitor of alpha-Gal A, effectively enhanced alpha-Gal A activity in Fabry lymphoblasts, when administrated at concentrations lower than that usually required for intracellular inhibition of the enzyme. DGJ seemed to accelerate transport and maturation of the mutant enzyme. Oral administration of DGJ to transgenic mice overexpressing a mutant alpha-Gal A substantially elevated the enzyme activity in some organs. We propose a new molecular therapeutic strategy for genetic metabolic diseases of administering competitive inhibitors as 'chemical chaperons' at sub-inhibitory intracellular concentrations. PMID:9883849

  6. Crystallization of hepatocyte nuclear factor 4 alpha (HNF4 alpha) in complex with the HNF1 alpha promoter element.

    PubMed

    Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G; Chi, Young-In

    2008-04-01

    Hepatocyte nuclear factor 4alpha (HNF4alpha) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4alpha cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4alpha DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1alpha. The HNF4alpha protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 A using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 A, beta = 119.36 degrees . A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants. PMID:18391435

  7. A novel positive allosteric modulator of the alpha7 neuronal nicotinic acetylcholine receptor: in vitro and in vivo characterization.

    PubMed

    Hurst, Raymond S; Hajós, Mihaly; Raggenbass, Mario; Wall, Theron M; Higdon, Nicole R; Lawson, Judy A; Rutherford-Root, Karen L; Berkenpas, Mitchell B; Hoffmann, W E; Piotrowski, David W; Groppi, Vincent E; Allaman, Geraldine; Ogier, Roch; Bertrand, Sonia; Bertrand, Daniel; Arneric, Stephen P

    2005-04-27

    Several lines of evidence suggest a link between the alpha7 neuronal nicotinic acetylcholine receptor (nAChR) and brain disorders including schizophrenia, Alzheimer's disease, and traumatic brain injury. The present work describes a novel molecule, 1-(5-chloro-2,4-dimethoxy-phenyl)-3-(5-methyl-isoxazol-3-yl)-urea (PNU-120596), which acts as a powerful positive allosteric modulator of the alpha7 nAChR. Discovered in a high-throughput screen, PNU-120596 increased agonist-evoked calcium flux mediated by an engineered variant of the human alpha7 nAChR. Electrophysiology studies confirmed that PNU-120596 increased peak agonist-evoked currents mediated by wild-type receptors and also demonstrated a pronounced prolongation of the evoked response in the continued presence of agonist. In contrast, PNU-120596 produced no detectable change in currents mediated by alpha4beta2, alpha3beta4, and alpha9alpha10 nAChRs. PNU-120596 increased the channel mean open time of alpha7 nAChRs but had no effect on ion selectivity and relatively little, if any, effect on unitary conductance. When applied to acute hippocampal slices, PNU-120596 increased the frequency of ACh-evoked GABAergic postsynaptic currents measured in pyramidal neurons; this effect was suppressed by TTX, suggesting that PNU-120596 modulated the function of alpha7 nAChRs located on the somatodendritic membrane of hippocampal interneurons. Accordingly, PNU-120596 greatly enhanced the ACh-evoked inward currents in these interneurons. Systemic administration of PNU-120596 to rats improved the auditory gating deficit caused by amphetamine, a model proposed to reflect a circuit level disturbance associated with schizophrenia. Together, these results suggest that PNU-120596 represents a new class of molecule that enhances alpha7 nAChR function and thus has the potential to treat psychiatric and neurological disorders. PMID:15858066

  8. TNF{alpha} acting on TNFR1 promotes breast cancer growth via p42/P44 MAPK, JNK, Akt and NF-{kappa}B-dependent pathways

    SciTech Connect

    Rivas, Martin A.; Carnevale, Romina P.; Proietti, Cecilia J.; Rosemblit, Cinthia; Beguelin, Wendy; Salatino, Mariana; Charreau, Eduardo H.; Frahm, Isabel; Sapia, Sandra; Brouckaert, Peter; Elizalde, Patricia V.; Schillaci, Roxana

    2008-02-01

    Tumor necrosis factor {alpha} (TNF{alpha}) enhances proliferation of chemically-induced mammary tumors and of T47D human cell line through not fully understood pathways. Here, we explored the intracellular signaling pathways triggered by TNF{alpha}, the participation of TNF{alpha} receptor (TNFR) 1 and TNFR2 and the molecular mechanism leading to breast cancer growth. We demonstrate that TNF{alpha} induced proliferation of C4HD murine mammary tumor cells and of T47D cells through the activation of p42/p44 MAPK, JNK, PI3-K/Akt pathways and nuclear factor-kappaB (NF-{kappa}B) transcriptional activation. A TNF{alpha}-specific mutein selectively binding to TNFR1 induced p42/p44 MAPK, JNK, Akt activation, NF-{kappa}B transcriptional activation and cell proliferation, just like wild-type TNF{alpha}, while a mutein selective for TNFR2 induced only p42/p44 MAPK activation. Interestingly, blockage of TNFR1 or TNFR2 with specific antibodies was enough to impair TNF{alpha} signaling and biological effect. Moreover, in vivo TNF{alpha} administration supported C4HD tumor growth. We also demonstrated, for the first time, that injection of a selective inhibitor of NF-{kappa}B activity, Bay 11-7082, resulted in regression of TNF{alpha}-promoted tumor. Bay 11-7082 blocked TNF{alpha} capacity to induce cell proliferation and up-regulation of cyclin D1 and of Bcl-x{sub L}in vivo and in vitro. Our results reveal evidence for TNF{alpha} as a breast tumor promoter, and provide novel data for a future therapeutic approach using TNF{alpha} antagonists and NF-{kappa}B pharmacological inhibitors in established breast cancer treatment.

  9. Production of tumor necrosis factor alpha, interleukin-1 alpha, and interleukin-6 during murine coccidioidomycosis.

    PubMed Central

    Cox, R A; Magee, D M

    1995-01-01

    The proinflammatory cytokines tumor necrosis factor alpha (TNF-alpha), interleukin-1 alpha (IL-1 alpha), and interleukin-6 (IL-6) were induced in mice infected with Coccidioides immitis. Analyses of the cytokine profiles of two inbred mouse strains which differ in their susceptibility to pulmonary challenge with C. immitis revealed higher levels of IL-6 in lungs from DBA/2 mice (resistant strain) than in those from BALB/c mice (susceptible strain) beginning at day 6 and continuing through day 15 postinfection. Spleen cells from both mouse strains secreted TNF-alpha, IL-1 alpha, and IL-6 in vitro in response to stimulation with killed spherules but differed in that spleen cells from the resistant strain produced increased levels of these cytokines earlier after pulmonary challenge and at increased levels throughout the course of the disease. PMID:7558338

  10. Influence of fast alpha diffusion and thermal alpha buildup on tokamak reactor performance

    SciTech Connect

    Uckan, N.A.; Tolliver, J.S.; Houlberg, W.A.; Attenberger, S.E.

    1987-11-01

    The effect of fast alpha diffusion and thermal alpha accumulation on the confinement capability of a candidate Engineering Test Reactor (ETR) plasma (Tokamak Ignition/Burn Experimental Reactor (TIBER-II)) in achieving ignition and steady-state driven operation has been assessed using both global and 1-1/2-D transport models. Estimates are made of the threshold for radial diffusion of fast alphas and thermal alpha buildup. It is shown that a relatively low level of radial transport, when combined with large gradients in the fast alpha density, leads to a significant radial flow with a deleterious effect on plasma performance. Similarly, modest levels of thermal alpha concentration significantly influence the ignition and steady-state burn capability. 23 refs., 9 figs., 4 tabs.

  11. Radioimmunotherapy with alpha-particle emitting radionuclides.

    PubMed

    Zalutsky, M R; Pozzi, O R

    2004-12-01

    An important consideration in the development of effective strategies for radioimmunotherapy is the nature of the radiation emitted by the radionuclide. Radionuclides decaying by the emission of alpha-particles offer the possibility of matching the cell specific reactivity of monoclonal antibodies with radiation with a range of only a few cell diameters. Furthermore, alpha-particles have important biological advantages compared with external beam radiation and beta-particles including a higher biological effectiveness, which is nearly independent of oxygen concentration, dose rate and cell cycle position. In this review, the clinical settings most likely to benefit from alpha-particle radioimmunotherapy will be discussed. The current status of preclinical and clinical research with antibodies labeled with 3 promising alpha-particle emitting radionuclides - (213)Bi, (225)Ac, and (211)At - also will be summarized.

  12. Radioimmunotherapy with alpha-particle emitting radionuclides.

    PubMed

    Zalutsky, M R; Pozzi, O R

    2004-12-01

    An important consideration in the development of effective strategies for radioimmunotherapy is the nature of the radiation emitted by the radionuclide. Radionuclides decaying by the emission of alpha-particles offer the possibility of matching the cell specific reactivity of monoclonal antibodies with radiation with a range of only a few cell diameters. Furthermore, alpha-particles have important biological advantages compared with external beam radiation and beta-particles including a higher biological effectiveness, which is nearly independent of oxygen concentration, dose rate and cell cycle position. In this review, the clinical settings most likely to benefit from alpha-particle radioimmunotherapy will be discussed. The current status of preclinical and clinical research with antibodies labeled with 3 promising alpha-particle emitting radionuclides - (213)Bi, (225)Ac, and (211)At - also will be summarized. PMID:15640792

  13. Alpha Coincidence Spectroscopy studied with GEANT4

    SciTech Connect

    Dion, Michael P.; Miller, Brian W.; Tatishvili, Gocha; Warren, Glen A.

    2013-11-02

    Abstract The high-energy side of peaks in alpha spectra, e.g. 241Am, as measured with a silicon detector has structure caused mainly by alpha-conversion electron and to some extent alphagamma coincidences. We compare GEANT4 simulation results to 241Am alpha spectroscopy measurements with a passivated implanted planar silicon detector. A large discrepancy between the measurements and simulations suggest that the GEANT4 photon evaporation database for 237Np (daughter of 241Am decay) does not accurately describe the conversion electron spectrum and therefore was found to have large discrepancies with experimental measurements. We describe how to improve the agreement between GEANT4 and alpha spectroscopy for actinides of interest by including experimental measurements of conversion electron spectroscopy into the photon evaporation database.

  14. Radioimmunotherapy with alpha-emitting nuclides.

    PubMed

    McDevitt, M R; Sgouros, G; Finn, R D; Humm, J L; Jurcic, J G; Larson, S M; Scheinberg, D A

    1998-09-01

    This review discusses the application of alpha particle-emitting radionuclides in targeted radioimmunotherapy. It will outline the production and chemistry of astatine-211, bismuth-212, lead-212, actinium-225, bismuth-213, fermium-255, radium-223 and terbium-149, which at present are the most promising alpha-emitting isotopes available for human clinical use. The selective cytotoxicity offered by alpha particle-emitting radioimmunoconstructs is due to the high linear energy transfer and short particle path length of these radionuclides. Based upon the pharmacokinetics of alpha particle-emitting radioimmunoconstructs, both stochastic and conventional dosimetric methodology is discussed, as is the preclinical and initial clinical use of these radionuclides conjugated to monoclonal antibodies for the treatment of human neoplasia. PMID:9724387

  15. Genetics Home Reference: alpha-1 antitrypsin deficiency

    MedlinePlus

    ... and genetic modifiers of emphysema risk. Thorax. 2004 Mar;59(3):259-64. Review. Citation on PubMed ... alpha}1-antitrypsin deficiency. Arch Intern Med. 2009 Mar 23;169(6):546-50. doi: 10.1001/ ...

  16. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, L.R.; Post, D.E. Jr.; Dawson, J.M.

    1983-11-23

    This invention relates generally to high energy confined plasmas and more particularly is directed to measuring the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a confined energetic plasma.

  17. Note on Two Generalizations of Coefficient Alpha.

    ERIC Educational Resources Information Center

    Raju, Nambury S.

    1979-01-01

    An important relationship is given for two generalizations of coefficient alpha: (1) Rajaratnam, Cronbach, and Gleser's generalizability formula for stratified-parallel tests, and (2) Raju's coefficient beta. (Author/CTM)

  18. [Multiplex PCR for detecting genotypes of deletional alpha-thalassemia].

    PubMed

    Wu, Jie-Ying; Liao, Can; Li, Jian; Huang, Yi-Ning

    2004-08-01

    To investigate the clinical application of multiplex PCR in detecting genotypes of deletional alpha-thalassemia in South China and observe the distribution frequency of alpha-globin gene deletion, 145 patients with silent carrier, alpha thalassemia trait or HbH were identified by M-PCR and 1.2% agarose gel electrophoresis. There are 1.3, 1.6, 1.8 and 2.0 kb bands which indicate --(SEA), -alpha(4.2), alphaalpha and -alpha(3.7), respectively. The results showed that among 145 patients, 100 patients with --(SEA)/alphaalpha (68.9%), 15 with -alpha(3.7)/alphaalpha (10.3%), 8 with -alpha(4.2)/alphaalpha (5.52%), 2 with -alpha(3.7)/-alpha(4.2) (1.38%), 1 with -alpha(3.7)/-alpha(3.7) (0.69%), 1 with -alpha(4.2)/-alpha(4.2) (0.69%), 14 with --(SEA)/-alpha(3.7) (9.65%), 2 with --(SEA)/-alpha(4.2) (1.38%) were found. Two patients prenatal diagnosed were confirmed with Bart's hydrops fetuses. In conclusion, M-PCR analysis is a simple, rapid and accurate method for detection of alpha-thalassemia gene deletion. This technique is helpful in screening, carrier identification and prenatal diagnosis of deletional alpha-thalassemia.

  19. The ALPHA Experiment: A Cold Antihydrogen Trap

    SciTech Connect

    Bertsche, W.; Chapman, S.; Deutsch, A.; Fajans, J.; Gomberoff, K.; Wurtele, J.; Boston, A.; Chartier, M.; Nolan, P.; Page, R.D.; Bowe, P.D.; Hangst, J.S.; Madsen, N.; Cesar, C.L.; Miranda, D.; Charlton, M.; Jenkins, M.; Joergensen, L.V.; Telle, H.H.; Werf, D.P. van der

    2005-10-26

    The ALPHA experiment aims to trap antihydrogen as the next crucial step towards a precise CPT test, by a spectroscopic comparison of antihydrogen with hydrogen. The experiment will retain the salient techniques developed by the ATHENA collaboration during the previous phase of antihydrogen experiments at the antiproton decelerator (AD) at CERN. The collaboration has identified the key problems in adding a neutral antiatom trap to the previously developed experimental configuration. The solutions identified by ALPHA are described in this paper.

  20. Transport of Radioactive Material by Alpha Recoil

    SciTech Connect

    Icenhour, A.S.

    2005-05-19

    The movement of high-specific-activity radioactive particles (i.e., alpha recoil) has been observed and studied since the early 1900s. These studies have been motivated by concerns about containment of radioactivity and the protection of human health. Additionally, studies have investigated the potential advantage of alpha recoil to effect separations of various isotopes. This report provides a review of the observations and results of a number of the studies.

  1. Measurement of the angle alpha at BABAR

    SciTech Connect

    Perez, A.; /Orsay, LAL

    2009-06-25

    The authors present recent measurements of the CKM angle {alpha} using data collected by the BABAR detector at the PEP-II asymmetric-energy e{sup +}e{sup -} collider at the SLAC National Accelerator Laboratory, operating at the {Upsilon}(4S) resonance. They present constraints on {alpha} from B {yields} {pi}{pi}, B {yields} {rho}{rho} and B {yields} {rho}{pi} decays.

  2. Alpha-emitters for medical therapy workshop

    SciTech Connect

    Feinendegen, L.E.; McClure, J.J.

    1996-12-31

    A workshop on ``Alpha-Emitters for Medical Therapy`` was held May 30-31, 1996 in Denver Colorado to identify research goals and potential clinical needs for applying alpha-particle emitters and to provide DOE with sufficient information for future planning. The workshop was attended by 36 participants representing radiooncology, nuclear medicine, immunotherapy, radiobiology, molecular biology, biochemistry, radiopharmaceutical chemistry, dosimetry, and physics. This report provides a summary of the key points and recommendations arrived at during the conference.

  3. 7. Administrative structures.

    PubMed

    2014-05-01

    The basic systems of any society rarely can operate independently. Instead, they are dependent and often interdependent upon other entities. Such entities control the resources within their respective systems. Thus, coordination and control agencies require contracts or memoranda of understanding with these entities in order to assure access to the resources required during a crisis. These administrative structures include: (1) governmental institutions and agencies, including the military; (2) intergovernmental organisations; (3) nongovernmental organisations; (4) commercial private sector organisations; and (5) academic institutions. These dependencies create potential barriers to the provision of coordination and control including: (1) the complexity of the administrative structures with which coordination and control must interact; (2) the location of resources; (3) finding responsible person(s); (4) the competence and compatibility; (5) methods of access; (6) payment; (7) contracts and memoranda of understanding; (8) inventories of accessible resources; (9) competition for the mandate, power, and resources; and (10) jealousy. The need for potential interactions between administrative structures requires that agreements for the sharing of resources during crises be reached as part of planning and preparedness. Gaining an understanding of these relationships is an important area for research.

  4. Different polyphenolic components of soft fruits inhibit alpha-amylase and alpha-glucosidase.

    PubMed

    McDougall, Gordon J; Shpiro, Faina; Dobson, Patricia; Smith, Pauline; Blake, Alison; Stewart, Derek

    2005-04-01

    Polyphenol-rich extracts from soft fruits were tested for their ability to inhibit alpha-amylase and alpha-glucosidase. All extracts tested caused some inhibition of alpha-amylase, but there was a 10-fold difference between the least and most effective extracts. Strawberry and raspberry extracts were more effective alpha-amylase inhibitors than blueberry, blackcurrant, or red cabbage. Conversely, alpha-glucosidase was more readily inhibited by blueberry and blackcurrant extracts. The extent of inhibition of alpha-glucosidase was related to their anthocyanin content. For example, blueberry and blackcurrant extracts, which have the highest anthocyanin content, were the most effective inhibitors of alpha-glucosidase. The extracts most effective in inhibiting alpha-amylase (strawberry and raspberry) contain appreciable amounts of soluble tannins. Other tannin-rich extracts (red grape, red wine, and green tea) were also effective inhibitors of alpha-amylase. Indeed, removing tannins from strawberry extracts with gelatin also removed inhibition. Fractionation of raspberry extracts on Sephadex LH-20 produced an unbound fraction enriched in anthocyanins and a bound fraction enriched in tannin-like polyphenols. The unbound anthocyanin-enriched fraction was more effective against alpha-glucosidase than the original extract, whereas the alpha-amylase inhibitors were concentrated in the bound fraction. The LH-20 bound sample was separated by preparative HPLC, and fractions were assayed for inhibition of alpha-amylase. The inhibitory components were identified as ellagitannins using LC-MS-MS. This study suggests that different polyphenolic components of fruits may influence different steps in starch digestion in a synergistic manner. PMID:15796622

  5. Control of luteal relaxin release by prostaglandin F2 alpha: differences in the sow cycle and pregnancy.

    PubMed

    Bagnell, C A; Baker, N K; McMurtry, J P; Brocht, D M; Lewis, G S

    1990-06-01

    The effect of an in vivo prostaglandin F2 alpha (PGF2 alpha) challenge in pregnant and cyclic sows was compared to determine whether PGF2 alpha-induced release of relaxin (RLX) from the corpus luteum (CL) in late pregnancy is also effective during the cycle. Ovarian venous RLX and progesterone were monitored by radioimmunoassay and RLX localized in the CL by immunohistochemistry. In Day 108 pregnant sows, infusion of PGF2 alpha (100 micrograms) into the ovarian artery resulted in an immediate and sustained rise in ovarian venous RLX with an initial decline in progesterone levels by 30 min which then returned to pretreatment levels. In Day 13 or 15 cyclic sows with functional corpora lutea (i.e., elevated progesterone), RLX was undetectable in ovarian venous blood after 100 micrograms of PGF2 alpha. Administration of PGF2 alpha via either the jugular vein or intramuscular route was also ineffective in releasing RLX from the CL of the cycle. The intensity of RLX immunostaining of the CL was similar in saline and PGF2 alpha-treated sows. These studies indicate that the control of RLX release from the sow CL differs in the estrous cycle and pregnancy.

  6. Cell-specific activation of the human skeletal alpha-actin by androgens.

    PubMed

    Hong, Mei Hua; Sun, Hong; Jin, Cheng He; Chapman, Mark; Hu, Junlian; Chang, William; Burnett, Kelven; Rosen, Jon; Negro-Vilar, Andres; Miner, Jeffrey N

    2008-03-01

    Although it is evident that androgens increase muscle mass and strength, little is known about the critical molecular targets of androgens in skeletal muscle. In rodents, the skeletal alpha-actin gene is a tissue-specific gene expressed only in the levator ani and other skeletal muscles but not in the prostate or preputial gland, the well-known androgen target tissue. We identified tissue-specific androgen-regulated genes in the skeletal muscle in rats after oral administration of androgens and focused on androgen-dependent up-regulation of the skeletal alpha-actin gene. To investigate the mechanism of action, an in vitro system with various cell lines and a series of deletion mutants of the alpha-actin promoter were used. The human skeletal alpha-actin promoter was activated by androgens in the muscle cell line C2C12 but not in the liver, prostate, or breast cancer cell lines in which exogenous human androgen receptor is expressed. The sequence of the promoter is sufficient for cell-specific androgen response, providing a model for the tissue specificity demonstrated in vivo. Using a series of deletion mutants, the androgen response can be maintained using just the proximal promoter region. The importance of androgen regulation of this small portion of the human skeletal alpha-actin promoter was demonstrated by the correlation between muscle and the alpha-actin promoter activity for an array of selective androgen receptor modulators (SARMs), including an orally active SARM LGD2226. Taken together, the results suggest that the regulation of skeletal alpha-actin by androgens/SARMs may represent an important model system for understanding androgen anabolic action in the muscle.

  7. Isolation and activity of an alpha-amylase inhibitor from white kidney beans.

    PubMed

    Zhang, Xiao-qi; Yang, Ming-yan; Ma, Yu; Tian, Jia; Song, Ji-Rong

    2007-12-01

    An alpha-amylase inhibitor (alpha-AI) was isolated from white kidney beans (Phaseolus vulgaris L) by ethanol fractional precipitation, ion exchange chromatography and gel filtration column chromatography. It was a homogeneity glycoprotein demonstrated by SDS-PAGE and gel filtration on CL-6B. The glycoprotein contained 88.2% protein and was rich in aspartic acid, glutamic acid, leucine, threonine and serine. The carbohydrate moiety was consisted of Man, Glc, Gal and Xyl in a mole ratio of 2.42: 1.50: 1.52: 1.00. The glycan and the core protein backbone was connected by O-linkage as determined by beta-elimination reaction. The continuous oral administration of the alpha-AI (150 mg x kg(-1) x d(-1)) for 7 days can lower fasting blood glucose and 300 mg x kg(-1) x d(-1) alpha-AI for 7 days can improve the sugar tolerance on alloxan-dependent diabetic model rats. The result showed the alpha-AI obtained from white kidney beans had good hypoglycemic effect on alloxan induced diabetic rats and may have high potential pharmaceutical value as a regulative digestive-starch degradation in patients suffering from diabetes.

  8. Effect of repeated treatment with tianeptine and fluoxetine on the central alpha(1)-adrenergic system.

    PubMed

    Rogóz, Z; Skuza, G; Dlaboga, D; Maj, J; Dziedzicka-Wasylewska, M

    2001-09-01

    Tianeptine (TIA) is an antidepressant drug which enhances the reuptake of serotonin but, in contrast to tricyclics, shows no affinity for neurotransmitter receptors. The present study was aimed at determining whether repeated TIA treatment induced adaptive changes in the alpha(1)-adrenergic system, similar to those reported by us earlier for tricyclic antidepressants. The experiments were carried out on male mice and rats. TIA was administered at a dose of 5 or 10mg/kg once or repeatedly (twice daily for 14 days) and fluoxetine (FLU), used as a reference compound, at a dose of 10mg/kg. The obtained results showed that TIA administered repeatedly potentiated the methoxamine- and phenylephrine (PHEN)-induced exploratory hyperactivity in rats and clonidine-induced aggressiveness in mice, the effects mediated by alpha(1)-adrenoceptors. TIA given repeatedly (but not acutely) increased the binding (B(max)) of alpha(1)-adrenergic receptors in cerebral cortex for [(3)H]prazosin. However, the ability of the alpha(1)-adrenoceptor agonist PHEN to compete for these sites was not significantly changed. The above results indicate that repeated TIA administration increases the responsiveness of the alpha(1)-adrenergic system (behavioural and biochemical changes). On the other hand, FLU did not affect any behavioural and biochemical changes in this system.

  9. Isolation and activity of an alpha-amylase inhibitor from white kidney beans.

    PubMed

    Zhang, Xiao-qi; Yang, Ming-yan; Ma, Yu; Tian, Jia; Song, Ji-Rong

    2007-12-01

    An alpha-amylase inhibitor (alpha-AI) was isolated from white kidney beans (Phaseolus vulgaris L) by ethanol fractional precipitation, ion exchange chromatography and gel filtration column chromatography. It was a homogeneity glycoprotein demonstrated by SDS-PAGE and gel filtration on CL-6B. The glycoprotein contained 88.2% protein and was rich in aspartic acid, glutamic acid, leucine, threonine and serine. The carbohydrate moiety was consisted of Man, Glc, Gal and Xyl in a mole ratio of 2.42: 1.50: 1.52: 1.00. The glycan and the core protein backbone was connected by O-linkage as determined by beta-elimination reaction. The continuous oral administration of the alpha-AI (150 mg x kg(-1) x d(-1)) for 7 days can lower fasting blood glucose and 300 mg x kg(-1) x d(-1) alpha-AI for 7 days can improve the sugar tolerance on alloxan-dependent diabetic model rats. The result showed the alpha-AI obtained from white kidney beans had good hypoglycemic effect on alloxan induced diabetic rats and may have high potential pharmaceutical value as a regulative digestive-starch degradation in patients suffering from diabetes. PMID:18338641

  10. Regulation of 5alpha-reductase isoforms by oxytocin in the rat ventral prostate.

    PubMed

    Assinder, S J; Johnson, C; King, K; Nicholson, H D

    2004-12-01

    Oxytocin (OT) is present in the male reproductive tract, where it is known to modulate contractility, cell growth, and steroidogenesis. Little is known about how OT regulates these processes. This study describes the localization of OT receptor in the rat ventral prostate and investigates if OT regulates gene expression and/or activity of 5alpha-reductase isoforms I and II. The ventral prostates of adult male Wistar rats were collected following daily sc administration of saline (control), OT, a specific OT antagonist or both OT plus antagonist for 3 d. Expression of the OT receptor was identified in the ventral prostate by RT-PCR and Western blot, and confirmed to be a single active binding site by radioreceptor assay. Immunohistochemistry localized the receptor to the epithelium of prostatic acini and to the stromal tissue. Real-time RT-PCR determined that OT treatment significantly reduced expression of 5alpha-reductase I but significantly increased 5alpha-reductase II expression in the ventral prostate. Activity of both isoforms of 5alpha-reductase was significantly increased by OT, resulting in increased concentration of prostatic dihydrotestosterone. In conclusion, OT is involved in regulating conversion of testosterone to the biologically active dihydrotestosterone in the rat ventral prostate. It does so by differential regulation of 5alpha-reductase isoforms I and II.

  11. Second-by-second analysis of alpha 7 nicotine receptor regulation of glutamate release in the prefrontal cortex of awake rats.

    PubMed

    Konradsson-Geuken, Asa; Gash, Clelland R; Alexander, Kathleen; Pomerleau, Francois; Huettl, Peter; Gerhardt, Greg A; Bruno, John P

    2009-12-01

    These experiments utilized an enzyme-based microelectrode selective for the second-by-second detection of extracellular glutamate to reveal the alpha 7-based nicotinic modulation of glutamate release in the prefrontal cortex (PFC) of freely moving rats. Rats received intracortical infusions of the nonselective nicotinic agonist nicotine (12.0 mM, 1.0 microg/0.4 microl) or the selective alpha 7 agonist choline (2.0 mM/0.4 microl). The selectivity of drug-induced glutamate release was assessed in subgroups of animals pretreated with the alpha 7 antagonist, alpha-bungarotoxin (alpha-BGT, 10 microM), or kynurenine (10 microM) the precursor of the astrocyte-derived, negative allosteric alpha 7 modulator kynurenic acid. Local administration of nicotine increased glutamate signals (maximum amplitude = 4.3 +/- 0.6 microM) that were cleared to baseline levels in 493 +/- 80 seconds. Pretreatment with alpha-BGT or kynurenine attenuated nicotine-induced glutamate by 61% and 60%, respectively. Local administration of choline also increased glutamate signals (maximum amplitude = 6.3 +/- 0.9 microM). In contrast to nicotine-evoked glutamate release, choline-evoked signals were cleared more quickly (28 +/- 6 seconds) and pretreatment with alpha-BGT or kynurenine completely blocked the stimulated glutamate release. Using a method that reveals the temporal dynamics of in vivo glutamate release and clearance, these data indicate a nicotinic modulation of cortical glutamate release that is both alpha 7- and non-alpha 7-mediated. Furthermore, these data may also provide a mechanism underlying the recent focus on alpha 7 full and partial agonists as therapeutic agents in the treatment of cortically mediated cognitive deficits in schizophrenia.

  12. HETDEX: Evolution of Lyman Alpha Emitters

    NASA Astrophysics Data System (ADS)

    Blanc, Guillermo A.; Gebhardt, K.; Hill, G. J.; Gronwall, C.; Ciardullo, R.; Finkelstein, S.; Gawiser, E.; HETDEX Collaboration

    2012-01-01

    The Hobby Eberly Telescope Dark Energy Experiment (HETDEX) will produce a sample of 800,000 Lyman Alpha Emitters (LAEs) over the 1.9Alpha photon escape fraction. Our results show a strong evolution in the Lyman Alpha escape fraction with redshift, most likely associated with the buildup of dust in the ISM. Dust is shown to be the main parameter setting the escape of Lyman Alpha photons. The observed relation between E(B-V) and the escape fraction indicates that radiative transfer effects in LAEs promote the escape of Lyman Alpha photons, but only up to the point of them suffering similar amounts of extinction as continuum photons. Enhancement of the Lyman Alpha EW (e.g. due to the presence of a clumpy medium) seems not to be a common process in these objects. We also discuss the potential of the full HETDEX sample to study the evolution of LAE properties.

  13. Alpha-dispersion in human tissue

    NASA Astrophysics Data System (ADS)

    Grimnes, Sverre; Martinsen, Ørjan G.

    2010-04-01

    Beta dispersion is found in living tissue in the kilohertz - megahertz range and is caused by the cellular structure of biological materials with low frequency properties caused by cell membranes. Alpha dispersion is found in the hertz range and the causes are not so well known. Alpha dispersions are the first to disappear when tissue dies. Tissue data have often been based upon excised specimen from animals and are therefore not necessarily representative for human tissue alpha dispersions. Here we present data obtained with non-invasive skin surface electrodes for different segments of the living human body. We found alpha dispersions in all cases; the ankle-wrist results had the smallest. Large alpha dispersions were found where the distance between the electrodes and muscle masses was small, e.g. on the calf. Further studies on electrode technique and reciprocity, electrode positioning, statistical variations, gender, age and bodily constitutions are necessary in order to reveal more about the alpha dispersion, its appearance and disappearance.

  14. [Alpha-1 antitrypsin deficiency: diagnosis and treatment].

    PubMed

    Camelier, Aquiles A; Winter, Daniel Hugo; Jardim, José Roberto; Barboza, Carlos Eduardo Galvão; Cukier, Alberto; Miravitlles, Marc

    2008-07-01

    Alpha-1 antitrypsin deficiency is a recently identified genetic disease that occurs almost as frequently as cystic fibrosis. It is caused by various mutations in the SERPINA1 gene, and has numerous clinical implications. Alpha-1 antitrypsin is mainly produced in the liver and acts as an antiprotease. Its principal function is to inactivate neutrophil elastase, preventing tissue damage. The mutation most commonly associated with the clinical disease is the Z allele, which causes polymerization and accumulation within hepatocytes. The accumulation of and the consequent reduction in the serum levels of alpha-1 antitrypsin cause, respectively, liver and lung disease, the latter occurring mainly as early emphysema, predominantly in the lung bases. Diagnosis involves detection of low serum levels of alpha-1 antitrypsin as well as phenotypic confirmation. In addition to the standard treatment of chronic obstructive pulmonary disease, specific therapy consisting of infusion of purified alpha-1 antitrypsin is currently available. The clinical efficacy of this therapy, which appears to be safe, has yet to be definitively established, and its cost-effectiveness is also a controversial issue that is rarely addressed. Despite its importance, in Brazil, there are no epidemiological data on the prevalence of the disease or the frequency of occurrence of deficiency alleles. Underdiagnosis has also been a significant limitation to the study of the disease as well as to appropriate treatment of patients. It is hoped that the creation of the Alpha One International Registry will resolve these and other important issues. PMID:18695797

  15. Alpha particle analysis using PEARLS spectrometry

    SciTech Connect

    McKlveen, J.W.; Klingler, G.W.; McDowell, W.J.; Case, G.N.

    1984-01-01

    Alpha particle assay by conventional plate-counting methods is difficult because chemical separation, tracer techniques, and/or self-absorption losses in the final sample may cause either non-reproducible results or create unacceptable errors. PEARLS (Photon-Electron Rejecting Alpha Liquid Scintillation) Spectrometry is an attractive alternative since radionuclides may be extracted into a scintillator in which there would be no self-absorption or geometry problems and in which up to 100% chemical recovery and counting efficiency is possible. Sample preparation may include extraction of the alpha emitter of interest by a specific organic-phase-soluble compound directly into the liquid scintillator. Detection electronics use energy and pulse-shape discrimination to provide discrete alpha spectra and virtual absence of beta and gamma backgrounds. Backgrounds on the order of 0.01 cpm are readily achievable. Accuracy and reproducibility are typically in the 100 +-1% range. Specific procedures have been developed for gross alpha, uranium, plutonium, thorium, and polonium assay. This paper will review liquid scintillation alpha counting methods and reference some of the specific applications. 8 refs., 1 fig.

  16. Toxicity of dermally applied alpha-cypermethrin in rats.

    PubMed

    Luty, S; Latuszyńska, J; Halliop, J; Tochman, A; Obuchowska, D; Przylepa, E; Korczak, E

    1998-01-01

    The aim of the study was to assess the immunotoxic effect of dermally applied alpha-cypermethrin in rats based on phagocytic and bactericidal activity of neutrophils of peripheral blood, and the general toxic effect based on histological and ultrastructural examination of internal organs. The preparation was dermally applied in doses of 50 mg/kg and 250 mg/kg. It was administered to the tail skin of female Wistar rats, 4 hours daily for 28 days. After the experiment, the animals were anaesthetized and heart blood was taken in order to evaluate the activity of granulocyte system. The following organs were taken for histological examinations: brain, lung, heart, liver, spleen, kidneys, thymus and lymphatic nodes. Lung, liver, kidney and heart were used for ultrastructural studies. The results of the study showed that bactericidal and phagocytic activity of neutrophils was stimulated after administration of 50 mg/kg alpha-cypermethrin. Dermal application of the preparation resulted in slight histological changes in liver, kidney, lung and brain. Pathological changes in heart were observed only on the level of ultrastructure.

  17. Randomized, Placebo-Controlled Trials in Alpha-1 Antitrypsin Deficiency.

    PubMed

    Sandhaus, Robert A

    2016-08-01

    Alpha-1 antitrypsin deficiency (AATD) is a condition caused by the inheritance of two mutated SERPINA1 gene alleles. Individuals with AATD are at increased risk of injury to the liver and lungs. The pulmonary manifestations include precocious onset of pulmonary emphysema and bronchiectasis. For nearly three decades, treatment has been available to individuals with emphysema caused by AATD, but this therapy-augmentation of plasma and tissue alpha-1 antitrypsin levels by intravenous administration of human plasma-derived protein-was approved by regulatory authorities based on its biochemical efficacy. This therapy appears to slow the progression of emphysema in patients with AATD. The medical, patient, and regulatory communities have sought assurance that this expensive therapy provides measurable clinical benefit. Documenting such benefit has been difficult because of the slow progression of the underlying lung disease in AATD, the rarity of this genetic condition, and the lack of direct quantitative measurements of emphysema progression. Over the past decade, quantitative computed tomography (CT) densitometry of the lungs has been found to correlate with severity and progression of emphysema. The recent publication of a well-powered, masked, placebo-controlled study using CT densitometry to evaluate the effectiveness of augmentation therapy at slowing the progression of emphysema has provided some assurance of the clinical efficacy of this therapy. PMID:27564674

  18. Enzymic conversion of alpha-oxyprotohaem IX into biliverdin IX alpha by haem oxygenase.

    PubMed Central

    Yoshinaga, T; Sudo, Y; Sano, S

    1990-01-01

    Conversion of four isomers of meso-oxyprotohaem IX into the corresponding biliverdin IX was attempted with a reconstituted haem oxygenase system in the presence of NADPH-cytochrome c reductase and NADPH. Only the alpha-isomer of meso-oxyprotohaem IX was converted effectively into biliverdin IX alpha, which was further reduced to bilirubin IX alpha by biliverdin reductase. Only trace amounts of biliverdins IX beta, IX gamma and IX delta were respectively formed from the incubation mixture of the corresponding oxyprotohaemin IX isomers with the complete haem oxygenase system under the same conditions. In a kinetic study, the Km for alpha-meso-oxyprotohaem IX was 3.6 microM, which was 2-fold higher than that for protohaem IX. The maximum velocity (Vmax.) of the conversion of alpha-meso-oxyprotohaem IX into biliverdin IX alpha was twice as fast as that of protohaem IX. These results demonstrate that alpha-meso-oxyprotohaem IX is an intermediate of haem degradation and it was converted stereospecifically into biliverdin IX alpha via verdohaem IX alpha. PMID:2122884

  19. Assembly of an alpha-gamma coincidence measuring device for checking alpha decay schemes.

    PubMed

    Martín Sánchez, A; Caro Marroyo, B

    2012-09-01

    Two new chambers for measuring alpha-particle emissions have been made: a low-geometry chamber with a powerful magnet to eliminate conversion electrons, and an alpha-gamma coincidence chamber. Both devices incorporate a high-resolution Si detector, and the second chamber, a low-energy Ge detector as well. A dual parameter multichannel analyzer was used to register coincidences in the second device. Alpha-particle and gamma-ray detectors work simultaneously in both individual and dual modes, providing single and coincidence spectra. Some preliminary alpha-gamma coincidence spectra have been obtained.

  20. Methods for the synthesis and polymerization of .alpha.,.alpha.'-dihalo-p-xylenes

    DOEpatents

    Ferraris, John P.; Neef, Charles J.

    2002-07-30

    The present invention describes an improved method for the polymerization of .alpha.,.alpha.-dihalo-p-xylene's such as the .alpha.,.alpha.'-dihalo-2-methoxy-5-(2-ethylhexyloxy)-xylene's. The procedure for synthesis is based on the specific order of addition of reagents and the use of an anionic initiator that allows control of the molecular weight of the polymer. The molecular weight control allows processability of the polymer which is important for its utility in applications including in light-emitting-diodes, field effect transistors and photovoltaic devices.

  1. Gene Therapy for Alpha-1 Antitrypsin Deficiency Lung Disease.

    PubMed

    Chiuchiolo, Maria J; Crystal, Ronald G

    2016-08-01

    Alpha-1 antitrypsin (AAT) deficiency, characterized by low plasma levels of the serine protease inhibitor AAT, is associated with emphysema secondary to insufficient protection of the lung from neutrophil proteases. Although AAT augmentation therapy with purified AAT protein is efficacious, it requires weekly to monthly intravenous infusion of AAT purified from pooled human plasma, has the risk of viral contamination and allergic reactions, and is costly. As an alternative, gene therapy offers the advantage of single administration, eliminating the burden of protein infusion, and reduced risks and costs. The focus of this review is to describe the various strategies for AAT gene therapy for the pulmonary manifestations of AAT deficiency and the state of the art in bringing AAT gene therapy to the bedside. PMID:27564673

  2. Cross-resistance to alpha-cypermethrin after xanthotoxin ingestion in Helicoverpa zea (Lepidoptera: Noctuidae).

    PubMed

    Li, X; Zangerl, A R; Schuler, M A; Berenbaum, M R

    2000-02-01

    Cytochrome P450 monooxygenases (P450) are membrane-bound hemoproteins that play important roles in conferring protection against both naturally occurring phytochemicals and synthetic organic insecticides. Despite the potential for common modes of detoxification, cross-resistance between phytochemicals and synthetic organic insecticides has rarely been documented. In this study, we examined the responses of a susceptible strain of corn earworm, Helicoverpa zea (Boddie), a polyphagous noctuid, to exposure by an allelochemical infrequently encountered in its host plants and by an insecticide widely used for control purposes. Within a single generation, survivors of xanthotoxin exposure displayed higher levels of tolerance to alpha-cypermethrin than did unexposed control larvae. The F1 offspring of xanthotoxin-exposed survivors also displayed higher alpha-cypermethrin tolerance than did offspring of unexposed control larvae, suggesting that increased alpha-cypermethrin tolerance after xanthotoxin exposure represents, at least in part, heritable resistance. Administration of piperonyl butoxide, a P450 synergist, demonstrated that resistance to both xanthotoxin and alpha-cypermethrin is P450-mediated. Alpha-cypermethrin-exposed survivors, however, failed to show superior growth on xanthotoxin diets. Assays with control larvae, larvae induced by both xanthotoxin and alpha-cypermethrin, and survivors of LD50 doses of both compounds indicated that H. zea midgut P450s are capable of metabolizing both xanthotoxin and alpha-cypermethrin. Metabolism of each compound is significantly inhibited by the presence of the other compound, suggesting that at least one form of P450 in H. zea midguts degrades both compounds and may constitute the biochemical basis for possible cross-resistance. Compared with control larvae, xanthotoxin- and alpha-cypermethrin-induced larvae displayed 2- to 4-fold higher P450-mediated metabolism of both compounds. However, xanthotoxin- and alpha

  3. Tumor necrosis factor-alpha triggers mucus production in airway epithelium through an IkappaB kinase beta-dependent mechanism.

    PubMed

    Lora, José M; Zhang, Dong Mei; Liao, Sha Mei; Burwell, Timothy; King, Anne Marie; Barker, Philip A; Singh, Latika; Keaveney, Marie; Morgenstern, Jay; Gutiérrez-Ramos, José Carlos; Coyle, Anthony J; Fraser, Christopher C

    2005-10-28

    Excessive mucus production by airway epithelium is a major characteristic of a number of respiratory diseases, including asthma, chronic bronchitis, and cystic fibrosis. However, the signal transduction pathways leading to mucus production are poorly understood. Here we examined the potential role of IkappaB kinase beta (IKKbeta) in mucus synthesis in vitro and in vivo. Tumor necrosis factor-alpha (TNF-alpha) or transforming growth factor-alpha stimulation of human epithelial cells resulted in mucus secretion as measured by MUC5AC mRNA and protein. TNF-alpha stimulation induced IKKbeta-dependent p65 nuclear translocation, mucus synthesis, and production of cytokines from epithelial cells. TNF-alpha, but not transforming growth factor-alpha, induced mucus production dependent on IKKbeta-mediated NF-kappaB activation. In vivo, TNF-alpha induced NF-kappaB as determined by whole mouse body bioluminescence. This activation was localized to the epithelium as revealed by LacZ staining in NF-kappaB-LacZ transgenic mice. TNF-alpha-induced mucus production in vivo could also be inhibited by administration into the epithelium of an IKKbeta dominant negative adenovirus. Taken together, our results demonstrated the important role of IKKbeta in TNF-alpha-mediated mucus production in airway epithelium in vitro and in vivo. PMID:16123045

  4. Tumor necrosis factor soluble receptors circulate during experimental and clinical inflammation and can protect against excessive tumor necrosis factor alpha in vitro and in vivo.

    PubMed Central

    Van Zee, K J; Kohno, T; Fischer, E; Rock, C S; Moldawer, L L; Lowry, S F

    1992-01-01

    Tumor necrosis factor alpha (TNF alpha), a primary mediator of systemic responses to sepsis and infection, can be injurious to the organism when present in excessive quantities. Here we report that two types of naturally occurring soluble TNF receptors (sTNFR-I and sTNFR-II) circulate in human experimental endotoxemia and in critically ill patients and demonstrate that they neutralize TNF alpha-induced cytotoxicity and immunoreactivity in vitro. Utilizing immunoassays that discriminate between total sTNFR-I and sTNFR-I not bound to TNF alpha, we show that sTNFR-I-TNF alpha complexes may circulate even in the absence of detectable free TNF alpha. To investigate the therapeutic possibilities of sTNFR-I, recombinant protein was administered to nonhuman primates with lethal bacteremia and found to attenuate hemodynamic collapse and cytokine induction. We conclude that soluble receptors for TNF alpha are inducible in inflammation and circulate at levels sufficient to block the in vitro cytotoxicity associated with TNF alpha levels observed in nonlethal infection. Administration of sTNFR-I can prevent the adverse pathologic sequelae caused by the exaggerated TNF alpha production observed in lethal sepsis. Images PMID:1317575

  5. Overview Of Suborbital Human Transportation Concept Alpha

    NASA Astrophysics Data System (ADS)

    Adirim, H.; Pilz, N.; Marini, M.; Hendrick, P.; Schmid, M.; Behr, R.; Barth, T.; Tarfeld, F.; Wiegand, A.; Charbonnier, D.; Haya Ramos, R.; Steeland, J.; Mack, A.

    2011-05-01

    Within the EC co-funded project FAST20XX (Future high-Altitude high-Speed Transport 20XX), the European suborbital passenger transportation system concept ALPHA (Airplane Launched PHoenix Aircraft), which shall be based to a maximum extent on existing technologies and capabilities, is currently being investigated as collaborative project by a European consortium under coordination of ESA. The ALPHA concept incorporates an air-launch from a carrier aircraft, which shall be used as first stage. The ALPHA vehicle shall be capable of transporting up to four passengers plus one pilot to an altitude of at least 100 km. The ALPHA vehicle is a down-scaled version of the suborbital space transportation concept Hopper, which was already deeply investigated within the European FESTIP System Study and the German ASTRA program including the successfully flown experimental landing demonstrator Phoenix. This approach has allowed the use of existing aerodynamic vehicle data and has led to the adaptation of the external Hopper/Phoenix configuration for ALPHA. In FESTIP and ASTRA, the Hopper configuration showed sufficient stability margins. Due to the geometric similarity of the ALPHA and Hopper vehicles, a trimable and flyable configuration could be derived by means of ALPHA flight trajectory calculations. In its current configuration, the ALPHA vehicle has a length of ca. 9 m and a gross take-off mass of ca. 3.5 Mg. The launch, staging and separation of ALPHA shall be performed either as internal air-launch from the cargo bay of the carrier aircraft, as under-wing air-launch or as towed air-launch. After separation from the carrier aircraft, the ALPHA vehicle ignites its onboard rocket propulsion system. Since conventional liquid and solid propulsion did not seem suitable for ALPHA due to Their high cost, limited safety and toxicity, a low-cost, “green” and non-hazardous hybrid propulsion system based on liquid nitrous oxide in combination with a solid polymer fuel was

  6. Recent advances in the discovery of alpha1-adrenoceptor agonists.

    PubMed

    Bishop, Michael J

    2007-01-01

    The alpha(1) adrenoceptors are three of nine well-characterized receptors that are activated by epinephrine and norepinephrine. Agonists acting at the alpha(1) adrenoceptors produce numerous physiological effects, and are used therapeutically for several indications. Many known alpha(1) adrenoceptor agonists are alpha(1A) selective, but the discovery of highly selective alpha(1B) and alpha(1D) adrenoceptor agonists has proven to be an extremely difficult goal to achieve. This review will focus on recent advances in the discovery, development and clinical utility of subtype-specific alpha(1) agonists as well as contributions to our understanding of agonist-receptor interactions.

  7. Pharmacologic specificity of alpha-2 adrenergic receptor subtypes

    SciTech Connect

    Petrash, A.; Bylund, D.

    1986-03-01

    The authors have defined alpha-2 adrenergic receptor subtypes in human and rat tissues using prazosin as a subtype selective drug. Prazosin has a lower affinity (250 nM) at alpha-2A receptor and a higher affinity (5 nM) at alpha-2B receptors. In order to determine if other adrenergic drugs are selective for one or the other subtypes, the authors performed (/sup 3/H)yohimbine inhibition experiments with various adrenergic drugs in tissues containing alpha-2A, alpha-2B or both subtypes. Oxymetazoline, WB4101 and yohimbine were found to be 80-, 20- and 10-fold more potent at alpha-2A receptors than at alpha-2B receptors. Phentolamine, adazoxan, (+)- and (-)-mianserin, clonidine, (+)-butaclamol, (-)- and (+)-norepinephrine, epinephrine, dopamine and thioridazine were found to have equal affinities for the two subtypes. These results further validate the subdivision of alpha-2 adrenergic receptors into alpha-2A and alpha-2B subtypes.

  8. Cancer radioimmunotherapy with alpha-emitting nuclides.

    PubMed

    Couturier, Olivier; Supiot, Stéphane; Degraef-Mougin, Marie; Faivre-Chauvet, Alain; Carlier, Thomas; Chatal, Jean-François; Davodeau, François; Cherel, Michel

    2005-05-01

    In lymphoid malignancies and in certain solid cancers such as medullary thyroid carcinoma, somewhat mixed success has been achieved when applying radioimmunotherapy (RIT) with beta-emitters for the treatment of refractory cases. The development of novel RIT with alpha-emitters has created new opportunities and theoretical advantages due to the high linear energy transfer (LET) and the short path length in biological tissue of alpha-particles. These physical properties offer the prospect of achieving selective tumoural cell killing. Thus, RIT with alpha-emitters appears particularly suited for the elimination of circulating single cells or cell clusters or for the treatment of micrometastases at an early stage. However, to avoid non-specific irradiation of healthy tissues, it is necessary to identify accessible tumoural targets easily and rapidly. For this purpose, a small number of alpha-emitters have been investigated, among which only a few have been used for in vivo preclinical studies. Another problem is the availability and cost of these radionuclides; for instance, the low cost and the development of a reliable actinium-225/bismuth-213 generator were probably determining elements in the choice of bismuth-213 in the only human trial of RIT with an alpha-emitter. This article reviews the literature concerning monoclonal antibodies radiolabelled with alpha-emitters that have been developed for possible RIT in cancer patients. The principal radio-immunoconjugates are considered, starting with physical and chemical properties of alpha-emitters, their mode of production, the possibilities and difficulties of labelling, in vitro studies and finally, when available, in vivo preclinical and clinical studies. PMID:15841373

  9. Alpha Channeling in Rotating Plasma with Stationary Waves

    SciTech Connect

    A. Fetterman and N.J. Fisch

    2010-02-15

    An extension of the alpha channeling effect to supersonically rotating mirrors shows that the rotation itself can be driven using alpha particle energy. Alpha channeling uses radiofrequency waves to remove alpha particles collisionlessly at low energy. We show that stationary magnetic fields with high nθ can be used for this purpose, and simulations show that a large fraction of the alpha energy can be converted to rotation energy.

  10. Experimental and Theoretical Electron Density Distribution of Alpha,Alpha-Trehalose Dihydrate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alpha,alpha-rehalose is of interest because of its cryoprotective and antidessicant properties, and because it possesses various technical anomalies such as 13C NMR spectra that give misleading indications of intramolecular structural symmetry. It is a non-reducing disaccharide, with the glycosidic...

  11. Correcting Coefficient Alpha for Correlated Errors: Is [alpha][K]a Lower Bound to Reliability?

    ERIC Educational Resources Information Center

    Rae, Gordon

    2006-01-01

    When errors of measurement are positively correlated, coefficient alpha may overestimate the "true" reliability of a composite. To reduce this inflation bias, Komaroff (1997) has proposed an adjusted alpha coefficient, ak. This article shows that ak is only guaranteed to be a lower bound to reliability if the latter does not include correlated…

  12. Amyloid formation and disaggregation of {alpha}-synuclein and its tandem repeat ({alpha}-TR)

    SciTech Connect

    Bae, Song Yi; Kim, Seulgi; Hwang, Heejin; Kim, Hyun-Kyung; Yoon, Hyun C.; Kim, Jae Ho; Lee, SangYoon; Kim, T. Doohun

    2010-10-01

    Research highlights: {yields} Formation of the {alpha}-synuclein amyloid fibrils by [BIMbF{sub 3}Im]. {yields} Disaggregation of amyloid fibrils by epigallocatechin gallate (EGCG) and baicalein. {yields} Amyloid formation of {alpha}-synuclein tandem repeat ({alpha}-TR). -- Abstract: The aggregation of {alpha}-synuclein is clearly related to the pathogenesis of Parkinson's disease. Therefore, detailed understanding of the mechanism of fibril formation is highly valuable for the development of clinical treatment and also of the diagnostic tools. Here, we have investigated the interaction of {alpha}-synuclein with ionic liquids by using several biochemical techniques including Thioflavin T assays and transmission electron microscopy (TEM). Our data shows a rapid formation of {alpha}-synuclein amyloid fibrils was stimulated by 1-butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide [BIMbF{sub 3}Im], and these fibrils could be disaggregated by polyphenols such as epigallocatechin gallate (EGCG) and baicalein. Furthermore, the effect of [BIMbF{sub 3}Im] on the {alpha}-synuclein tandem repeat ({alpha}-TR) in the aggregation process was studied.

  13. Administration of Educational Services: A Glossary of Basic Administration Terminology.

    ERIC Educational Resources Information Center

    Wheelbarger, J. J.

    From "achievement motivation" and "administration" to "Theory Z" and "viscidity and hedonic tone," this glossary defines 87 terms as they are used in educational administration. The terms include philosophical, psychological, organizational, and social concepts, but they all are employed in the theory and practice of administration. A short…

  14. The Efficacy of Administrator Preparation Programs: Private School Administrators' Attitudes.

    ERIC Educational Resources Information Center

    Hughes, H. Woodrow; Johnson, Ruth N.; Madjidi, Farzin

    This report examines divergent views that may exist among administrators based on administrators' demographic characteristics and how these differences affect curriculum design for this group. It looks at factors, such as the person's age, gender, and ethnicity, that might have influenced whether or not an administrator completed a…

  15. A Review of the Literature on College Administrators and Administrations.

    ERIC Educational Resources Information Center

    Nash, George; Uhse, Stefan

    A review of the extensive literature on college administration and college administrators reveals there are relatively few empirical studies in the field. It was also observed that: there is widespread agreement on a few broad principles; there has been a heavy emphasis on human relations and proper administrative procedures; there are fundamental…

  16. TNF alpha acting on TNFR1 promotes breast cancer growth via p42/P44 MAPK, JNK, Akt and NF-kappa B-dependent pathways.

    PubMed

    Rivas, Martín A; Carnevale, Romina P; Proietti, Cecilia J; Rosemblit, Cinthia; Beguelin, Wendy; Salatino, Mariana; Charreau, Eduardo H; Frahm, Isabel; Sapia, Sandra; Brouckaert, Peter; Elizalde, Patricia V; Schillaci, Roxana

    2008-02-01

    Tumor necrosis factor alpha (TNF alpha) enhances proliferation of chemically-induced mammary tumors and of T47D human cell line through not fully understood pathways. Here, we explored the intracellular signaling pathways triggered by TNF alpha, the participation of TNF alpha receptor (TNFR) 1 and TNFR2 and the molecular mechanism leading to breast cancer growth. We demonstrate that TNFalpha induced proliferation of C4HD murine mammary tumor cells and of T47D cells through the activation of p42/p44 MAPK, JNK, PI3-K/Akt pathways and nuclear factor-kappa B (NF-kappa B) transcriptional activation. A TNF alpha-specific mutein selectively binding to TNFR1 induced p42/p44 MAPK, JNK, Akt activation, NF-kappa B transcriptional activation and cell proliferation, just like wild-type TNF alpha, while a mutein selective for TNFR2 induced only p42/p44 MAPK activation. Interestingly, blockage of TNFR1 or TNFR2 with specific antibodies was enough to impair TNF alpha signaling and biological effect. Moreover, in vivo TNF alpha administration supported C4HD tumor growth. We also demonstrated, for the first time, that injection of a selective inhibitor of NF-kappa B activity, Bay 11-7082, resulted in regression of TNF alpha-promoted tumor. Bay 11-7082 blocked TNF alpha capacity to induce cell proliferation and up-regulation of cyclin D1 and of Bcl-xLin vivo and in vitro. Our results reveal evidence for TNF alpha as a breast tumor promoter, and provide novel data for a future therapeutic approach using TNF alpha antagonists and NF-kappa B pharmacological inhibitors in established breast cancer treatment.

  17. Prostaglandin E2 and F2 alpha inhibit growth of human gastric carcinoma cell line KATO III with simultaneous stimulation of cyclic AMP production.

    PubMed

    Nakamura, A; Chiba, T; Yamatani, T; Yamaguchi, A; Inui, T; Morishita, T; Kadowaki, S; Fujita, T

    1989-01-01

    The effects of prostaglandins (PGs) on the growth of human gastric carcinoma cell line KATO III were investigated. PGE2 as well as PGF2 alpha significantly and dose-dependently inhibited the growth of this gastric carcinoma cell line (PGE2 greater than PGF2 alpha). This inhibition of cell growth by the PGs was associated with the increase in cyclic AMP production (PGE2 greater than PGF2 alpha), whereas inositol-phospholipid turnover was not affected by either PGE2 or PGF2 alpha as assessed by the formation of 3H-inositol phosphates. Furthermore, the proliferation of these gastric carcinoma cells was also suppressed by the administration of forskolin as well as of dibutyryl cyclic AMP. These results suggest that PGE2 and PGF2 alpha inhibit the growth of cultured human gastric carcinoma cells KATO III via stimulation of cyclic AMP production. PMID:2536452

  18. Rapid postexposure decay of. cap alpha. /sub 2u/-globulin and hyaline droplets in the kidneys of gasoline-treated male rats

    SciTech Connect

    Garg, B.D.; Olson, M.J.; Demyan, W.F.; Roy, A.K.

    1988-01-01

    Renal ..cap alpha../sub 2u/-globulin content increased to 210% of control within 18 h of a single oral dose of gasoline (2.0 ml/kg) in male rats; maximal levels (320% of control) were attained following gasoline administration for 3 d. Increases in renal ..cap alpha../sub 2u/-globulin caused by gasoline were accompanied by concurrent proliferation of hyaline droplets. However, within 3 d of terminating gasoline administration renal ..cap alpha../sub2u/-globulin content decreased to the same level as that in unexposed rats, although renal hyaline droplet number returned to pretreatment levels somewhat more slowly. The conjoint effect of postexposure recovery and estradiol (an inhibitor of hepatic ..cap alpha../sub 2u/-globulin synthesis) administration was also determined in male rats. On postexposure of 3, 6, and 9, estradiol treatment (1 mg/kg, sc, 4 d, starting on d 9 of gasoline treatment) decreased renal ..cap alpha../sub 2u/-globulin content to 75%, 59%, and 48%, respectively, of that in rats allowed to recover from gasoline with no hormone treatment. Hepatic ..cap alpha../sub 2u/-globulin content in estradiol-treated rats was decreased by 74%, 97%, and 96% at the same intervals. Estradiol treatment during recovery from gasoline also appeared to increase the removal of accumulated hyaline droplets from the renal cortex. Thus, accumulation of ..cap alpha../sub 2u/-globulin-containing hyaline droplets after subacute exposure of male rats to gasoline is rapidly reversible, dependent on continuous exposure to gasoline and maintenance of the normal rate of hepatic ..cap alpha../sub 2u/-globulin synthesis. These results emphasize the dynamic state of renal cortical hyaline droplets and suggest strongly that gasoline hydrocarbons cause hyaline droplet accumulation by prolonging the half-time degradation of ..cap alpha../sub 2u/-globulin.

  19. Prestimulus EEG alpha activity reflects temporal expectancy.

    PubMed

    Min, Byoung-Kyong; Park, Jin Young; Kim, Eun Joo; Kim, Joong Il; Kim, Jae-Jin; Park, Hae-Jeong

    2008-06-27

    Since prestimulus EEG alpha activity has recently been considered to convey prestimulus top-down processing, we investigated whether prestimulus alpha activity reflects temporal expectancy of upcoming stimulation even under the non-classical contingent negative variation (CNV) paradigm. EEG was recorded from 16 subjects performing a color and a shape discrimination task manipulated with constant and variable inter-stimulus interval (ISI) conditions. The power of oscillatory activity was investigated by convolving the EEG signals with Morlet wavelets. The constant ISI condition yielded significantly shorter reaction times than the variable ISI condition, indicating more efficient preparation for upcoming stimuli during the constant ISI. We found significantly higher prestimulus alpha activity in the constant ISI condition than in the variable ISI condition, but no significant CNV even in the constant ISI condition. Such a reflection of temporal expectancy in the prestimulus alpha activity corroborates that the prestimulus top-down mental state for preparing upcoming task-performance is considerably reflected in the prestimulus ongoing alpha activity. PMID:18486342

  20. Role of Frontal Alpha Oscillations in Creativity

    PubMed Central

    Lustenberger, Caroline; Boyle, Michael R.; Foulser, A. Alban; Mellin, Juliann M.; Fröhlich, Flavio

    2015-01-01

    Creativity, the ability to produce innovative ideas, is a key higher-order cognitive function that is poorly understood. At the level of macroscopic cortical network dynamics, recent EEG data suggests that cortical oscillations in the alpha frequency band (8 – 12 Hz) are correlated with creative thinking. However, whether alpha oscillations play a fundamental role in creativity has remained unknown. Here we show that creativity is increased by enhancing alpha power using 10 Hz transcranial alternating current stimulation (10Hz-tACS) of the frontal cortex. In a study of 20 healthy participants with a randomized, balanced cross-over design, we found a significant improvement of 7.4% in the Creativity Index measured by the Torrance Test of Creative Thinking, a comprehensive and most frequently used assay of creative potential and strengths. In a second similar study with 20 subjects, 40Hz-tACS was used in instead of 10Hz-tACS to rule out a general “electrical stimulation” effect. No significant change in the Creativity Index was found for such frontal gamma stimulation. Our results suggest that alpha activity in frontal brain areas is selectively involved in creativity; this enhancement represents the first demonstration of specific neuronal dynamics that drive creativity and can be modulated by non-invasive brain stimulation. Our findings agree with the model that alpha recruitment increases with internal processing demands and is involved in inhibitory top-down control, which is an important requirement for creative ideation. PMID:25913062

  1. Alpha-particle sensitive test SRAMs

    NASA Technical Reports Server (NTRS)

    Buehler, M. G.; Blaes, B. R.

    1990-01-01

    A bench-level test is being developed to evaluate memory-cell upsets in a test SRAM designed with a cell offset voltage. This offset voltage controls the critical charge needed to upset the cell. The effect is demonstrated using a specially designed 2-micron n-well CMOS 4-kb test SRAM and a Po-208 5.1-MeV 0.61-LET alpha-particle source. This test SRAM has been made sensitive to alpha particles through the use of a cell offset voltage, and this has allowed a bench-level characterization in a laboratory setting. The experimental data are linked to a alpha-particle interaction physics and to SPICE circuit simulations through the alpha-particle collection depth. The collection depth is determined by two methods and found to be about 7 micron. In addition, alpha particles that struck outside the bloated drain were able to flip the SRAM cells. This lateral charge collection was observed to be more than 6 micron.

  2. H-alpha Observations of MKW10

    NASA Astrophysics Data System (ADS)

    Johnson, Harold; Coble, Kimberly A.; Koopmann, Rebecca A.; Durbala, Adriana; Undergraduate ALFALFA Team

    2016-01-01

    As part of the Undergraduate ALFALFA Team project looking at clusters and groups of galaxies to investigate the effects of environment on star formation, we analyzed H-alpha and R-band observations of the group MKW10 from the WIYN 0.9-m telescope with MOSAIC camera at Kitt Peak. We continuum-subtract the H-alpha images by scaling and subtracting the broadband R images. This process includes: determining the seeing of each image by calculating the FWHM values of several stars in the image; convolving all images to the worst seeing; stacking images for each filter; subtracting sky background; scaling the R image to H-alpha; and subtracting the scaled R from H-alpha. We then use the H-alpha-continuum-subtracted image to perform surface photometry of individual galaxies in MKW10. The data will be used to determine star formation rates and distributions of galaxies in this group environment and will be compared to results for galaxies in other UAT group and cluster environments. Analysis is ongoing.This work has been supported by NSF grant AST-1211005 and the Illinois Space Grant Consortium.

  3. Venus - False Color Image of Alpha Regio

    NASA Technical Reports Server (NTRS)

    1991-01-01

    This Magellan radar image shows Alpha Regio, a topographic upland approximately 1,300 kilometers (806 miles) across which is centered on 25 degrees south latitude, 4 degrees east longitude. In 1963 Alpha Regio was the first feature on Venus to be identified from Earth based radar. The radar bright area of Alpha Regio is characterized by multiple sets of intersecting trends of structural features such as ridges, troughs and flat floored fault valleys that together form a polygonal outline. Circular to oblong dark patches within the complex terrain are local topographic lows that are filled with smooth volcanic lava. Complex ridged terrains such as Alpha, formerly called 'tessera' in the Soviet Venera 15 and 16 radar missions and the Arecibo radar data, appear to be widespread and common surface expressions of Venusian tectonic processes. Directly south of the complex ridged terrain is a large ovoid shaped feature named Eve. The radar bright spot located centrally within Eve marks the location of the prime meridian of Venus. Magellan radar data reveals that relatively young lava flows emanate from Eve and extends into the southern margin of the ridged terrain at Alpha. The mosaic was produced by Eric de Jong and Myche McAuley in the JPL Multimission Image Processing Laboratory.

  4. ALPHA ATTENUATION DUE TO DUST LOADING

    SciTech Connect

    Dailey, A; Dennis Hadlock, D

    2007-08-09

    Previous studies had been done in order to show the attenuation of alpha particles in filter media. These studies provided an accurate correction for this attenuation, but there had not yet been a study with sufficient results to properly correct for attenuation due to dust loading on the filters. At the Savannah River Site, filter samples are corrected for attenuation due to dust loading at 20%. Depending on the facility the filter comes from and the duration of the sampling period, the proper correction factor may vary. The objective of this study was to determine self-absorption curves for each of three counting instruments. Prior work indicated significant decreases in alpha count rate (as much as 38%) due to dust loading, especially on filters from facilities where sampling takes place over long intervals. The alpha count rate decreased because of a decrease in the energy of the alpha. The study performed resulted in a set of alpha absorption curves for each of three detectors. This study also took into account the affects of the geometry differences in the different counting equipment used.

  5. Benchmarking the External Surrogate Ratio Method using the (alpha,alpha' f) reaction at STARS

    SciTech Connect

    Lesher, S R; Bernstein, L A; Ai, H; Beausang, C W; Bleuel, D; Burke, J T; Clark, R M; Fallon, P; Gibelin, J; Lee, I Y; Lyles, B F; Macchiavelli, A O; McMahan, M A; Moody, K J; Norman, E B; Phair, L; Rodriguez-Vieitez, E; Wiedeking, M

    2008-01-09

    We measured the ratio of the fission probabilities of {sup 234}U* relative to {sup 236}U* formed via an ({alpha},{alpha}{prime}) direct reactions using the STARS array at the 88-inch cyclotron at the Lawrence Berkeley National Laboratory. This ratio has a shape similar to the ratio of neutron capture probabilities from {sup 233}U(n; f) and {sup 235}U(n; f), indicating the alpha reactions likely formed a compound nucleus. This result indicates that the ratios of fission exit channel probabilities for two actinide nuclei populated via ({alpha}, {alpha}{prime}) can be used to determine an unknown fission cross section relative to a known one. The validity of the External Surrogate Ratio Method (ESRM) is tested and the results support the conclusions of Burke et al. [1].

  6. Optimizing anaemia management with subcutaneous administration of epoetin.

    PubMed

    Besarab, Anatole

    2005-06-01

    European and US guidelines for renal anaemia management recommend subcutaneous (s.c.) epoetin as the preferred route of administration in pre-dialysis, peritoneal dialysis and haemodialysis patients. However, the restriction of Eprex/Erypro to intravenous (i.v.) administration in Europe has increased the interest of health care professionals regarding the optimal route of administration for all epoetin formulations. There are five major considerations for the 'optimal' route of epoetin administration: efficacy; dosing frequency; convenience; safety and tolerability; and cost. Although epoetin bioavailability is lower after s.c. administration, its efficacy is higher, owing to its prolonged elimination half-life compared with i.v. epoetin. Several studies and clinical surveys comparing s.c. and i.v. administration have demonstrated that equivalent target haemoglobin levels can be maintained at much lower doses of epoetin when administered s.c. Furthermore, s.c. epoetin dosing frequency can be reduced in some patients to once every 2 weeks, without compromising efficacy. Devices such as the Reco-Pen have been specifically designed to facilitate self-administration of s.c. epoetin-beta. An upsurge in the incidence of pure red cell aplasia (PRCA) was linked to the epoetin-alpha product Eprex/Erypo in Europe, and an increase in PRCA cases of the same magnitude was not seen in patients taking other epoetin products s.c. Therefore, PRCA should not be used as an argument against s.c. administration. The reduced dose with s.c. administration of epoetin-beta provides significant cost benefits, without compromising either safety or efficacy, and may also increase patient satisfaction and compliance with treatment. PMID:15958820

  7. Lessons from the Top: Administration.

    ERIC Educational Resources Information Center

    Rude, Ron

    1999-01-01

    A superintendent with 20-plus years' teaching experience in the district discusses with a "both sides of the fence" perspective issues of standards, teacher pay, training and compensation for board members, teacher/administrator relationship, and the administrator role. (MLF)

  8. Administrative Aspects of Human Experimentation.

    ERIC Educational Resources Information Center

    Irvine, George W.

    1992-01-01

    The following administrative aspects of scientific experimentation with human subjects are discussed: the definition of human experimentation; the distinction between experimentation and treatment; investigator responsibility; documentation; the elements and principles of informed consent; and the administrator's role in establishing and…

  9. Tumor necrosis factor alpha and interleukin-1 stimulate bone resorption in vivo as measured by urinary ( sup 3 H)tetracycline excretion from prelabeled mice

    SciTech Connect

    Koenig, A.M.; Muehlbauer, R.C.F.; Fleisch, H. )

    1988-12-01

    Tumor necrosis factor alpha (TNF-alpha) and interleukin-1 (IL-1) have been shown to stimulate bone resorption in vitro. We have now investigated whether these cytokines also cause a similar action when administered in vivo. This was made possible by the adaptation of a newly developed technique that enables the continual assessment of bone resorption in vivo in mice by measuring urinary excretion of {sup 3}H from ({sup 3}H)tetracycline-prelabeled animals. Experiments using maneuvers known to influence bone resorption, such as a change in dietary calcium or administration of parathyroid hormone or dichloromethylenebisphosphonate, indicate that the technique is reliable and sensitive in mice. Daily intravenous administration of either recombinant human or recombinant murine TNF-alpha, as well as subcutaneous administration of recombinant human IL-1 alpha, were found to stimulate bone resorption in a dose-dependent manner. The effect was maximal within 2 days. Thus, exogenous TNF-alpha and IL-1 alpha can stimulate bone resorption in vivo, suggesting that these cytokines may also exert a systemic effect on bone.

  10. Alpha-decay of light protactinium isotopes

    SciTech Connect

    Faestermann, T.; Gillitzer, A.; Hartel, K.; Henning, W.; Kienle, P.

    1987-12-10

    Light protactinium isotopes have been produced with /sup 204/Pb (/sup 19/F,xn) reactions. ..cap alpha..-activities with E/sub ..cap alpha../ = 9.90(5) MeV, T/sub 1/2/ = 53(10) ns and E/sub ..cap alpha../ = 9.65(5) MeV, T/sub 1/2/ = 0.78(16) ..mu..s could be attributed to the previously unobserved nuclei /sup 219/Pa and /sup 220/Pa with the help of excitation functions. The peak cross sections for the 4n and 3n evaporation channels are on the order of 10 ..mu..b. The decay energies as well as the halflives fit well into the systematics of these nuclei close to the magic neutron number N = 126. /sup 219/Pa is the shortest lived nuclide known with directly measured halflife.

  11. Coefficient alpha and interculture test selection.

    PubMed

    Thurber, Steven; Kishi, Yasuhiro

    2014-04-01

    The internal consistency reliability of a measure can be a focal point in an evaluation of the potential adequacy of an instrument for adaptation to another cultural setting. Cronbach's alpha (α) coefficient is often used as the statistical index for such a determination. However, alpha presumes a tau-equivalent test and may constitute an inaccurate population estimate for multidimensional tests. These notions are expanded and examined with a Japanese version of a questionnaire on nursing attitudes toward suicidal patients, originally constructed in Sweden using the English language. The English measure was reported to have acceptable internal consistency (α) albeit the dimensionality of the questionnaire was not addressed. The Japanese scale was found to lack tau-equivalence. An alternative to alpha, "composite reliability," was computed and found to be below acceptable standards in magnitude and precision. Implications for research application of the Japanese instrument are discussed. PMID:22523134

  12. Radiation risks from inhaled alpha emitters

    NASA Astrophysics Data System (ADS)

    Simmons, Jack A.

    2001-06-01

    The alpha emitter that gives rise to the greatest concern over its link to the induction of lung cancer is radon. As noted by the ICRP, attempts to relate the risk of cancer induction to the dose delivered by the alpha particles result in a value for this risk which is unrealistically high. Instead, an estimate based on the epidemiology of radon in mines is preferred. The logical result, that the weighting factor for these alpha particles should be very much lesser than the recommended value of 20, appears to have been ignored. It will be shown that there are two fundamental reasons for this large discrepancy. The first is that the implied "linear non-threshold" hypothesis is not supported by recent investigations. The second is that the concept of "dose" is meaningless at the levels of exposure considered in this context. Alternative proposals in terms of fluence and the effect cross-section will be presented.

  13. Synthesis of peptide .alpha.-thioesters

    DOEpatents

    Camarero, Julio A.; Mitchell, Alexander R.; De Yoreo, James J.

    2008-08-19

    Disclosed herein is a new method for the solid phase peptide synthesis (SPPS) of C-terminal peptide .alpha. thioesters using Fmoc/t-Bu chemistry. This method is based on the use of an aryl hydrazine linker, which is totally stable to conditions required for Fmoc-SPPS. When the peptide synthesis has been completed, activation of the linker is achieved by mild oxidation. The oxidation step converts the acyl-hydrazine group into a highly reactive acyl-diazene intermediate which reacts with an .alpha.-amino acid alkylthioester (H-AA-SR) to yield the corresponding peptide .alpha.-thioester in good yield. A variety of peptide thioesters, cyclic peptides and a fully functional Src homology 3 (SH3) protein domain have been successfully prepared.

  14. ALPHA MIS: Reference manual. Revision 2

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  15. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, Larry R.; Post Jr., Douglass E.; Dawson, John M.

    1986-06-03

    Measurement of the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a magnetically contained plasma is provided. The fusion plasma is seeded with energetic boron neutrals for producing, by means of the reaction .sup.10 B (.alpha.,n) .sup.13 N reaction, radioactive nitrogen nuclei which are then collected by a probe. The radioactivity of the probe is then measured by conventional techniques in determining the energy distribution of the alpha particles in the plasma. In a preferred embodiment, diborane gas (B.sub.2 H.sub.6) is the source of the boron neutrals to produce .sup.13 N which decays almost exclusively by positron emission with a convenient half-life of 10 minutes.

  16. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, Larry R.; Post, Jr., Douglass E.; Dawson, John M.

    1986-01-01

    Measurement of the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a magnetically contained plasma is provided. The fusion plasma is seeded with energetic boron neutrals for producing, by means of the reaction .sup.10 B (.alpha.,n) .sup.13 N reaction, radioactive nitrogen nuclei which are then collected by a probe. The radioactivity of the probe is then measured by conventional techniques in determining the energy distribution of the alpha particles in the plasma. In a preferred embodiment, diborane gas (B.sub.2 H.sub.6) is the source of the boron neutrals to produce .sup.13 N which decays almost exclusively by positron emission with a convenient half-life of 10 minutes.

  17. Microdosimetry for Targeted Alpha Therapy of Cancer

    PubMed Central

    Huang, Chen-Yu; Guatelli, Susanna; Oborn, Bradley M.; Allen, Barry J.

    2012-01-01

    Targeted alpha therapy (TAT) has the advantage of delivering therapeutic doses to individual cancer cells while reducing the dose to normal tissues. TAT applications relate to hematologic malignancies and now extend to solid tumors. Results from several clinical trials have shown efficacy with limited toxicity. However, the dosimetry for the labeled alpha particle is challenging because of the heterogeneous antigen expression among cancer cells and the nature of short-range, high-LET alpha radiation. This paper demonstrates that it is inappropriate to investigate the therapeutic efficacy of TAT by macrodosimetry. The objective of this work is to review the microdosimetry of TAT as a function of the cell geometry, source-target configuration, cell sensitivity, and biological factors. A detailed knowledge of each of these parameters is required for accurate microdosimetric calculations. PMID:22988479

  18. Ultraviolet observations of alpha Aurigae from Copernicus

    NASA Technical Reports Server (NTRS)

    Dupree, A. K.

    1975-01-01

    Emission lines of L-alpha (1215.67 A) and O VI (1031.94 A) were detected in the spectroscopic binary alpha Aur (Capella) with the Princeton experiment on Copernicus. Temperatures of the emitting regions are inferred to be in excess of 300,000 K. The temperature and emission measure are consistent with a variable source of soft X-rays. If the emission is attributed to the primary star (G5 III), the atmosphere is expanding with velocities of about 20-100 km/s. Such expansion can lead to material within the binary system. The density of interstellar hydrogen inferred from absorption of stellar L-alpha appears to be approximately 0.01 hydrogen atoms per cu cm.

  19. The evolutionary conservation of DNA polymerase. alpha

    SciTech Connect

    Miller, M.A.; Korn, D.; Wang, T.S.F. )

    1988-08-25

    The evolutionary conservation of DNA polymerase {alpha} was assessed by immunological and molecular genetic approaches. Four anti-human KB cell DNA polymerase {alpha} monoclonal antibodies were tested for their ability to recognize a phylogenetically broad array of eukaryotic DNA polymerases. While the single non-neutralizing antibody used in this study recognizes higher mammalian (human, simian, canine, and bovine) polymerases only, three neutralizing antibodies exhibit greater, but variable, extents of cross-reactivity among vertebrate species. Genomic Southern hybridization studies with the cDNA of the human DNA polymerase {alpha} catalytic polypeptide identify the existence of many consensus DNA sequences within the DNA polymerase genes of vertebrate, invertebrate, plant and unicellular organisms. These findings illustrate the differential evolutionary conservation of four unique epitopes on DNA sequences, presumably reflective of critical functional domains, in the DNA polymerase genes from a broad diversity of living forms.

  20. Alternating current long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; McAtee, J.L.

    1993-02-16

    An alpha particle detector, utilizing alternating currents, which is capable of detecting alpha particles from distinct sources. The use of alternating currents allows use of simpler ac circuits which, in turn, are not susceptible to dc error components. It also allows the benefit of gas gain, if desired. In the invention, a voltage source creates an electric field between two conductive grids, and between the grids and a conductive enclosure. Air containing air ions created by collision with alpha particles is drawn into the enclosure and detected. In some embodiments, the air flow into the enclosure is interrupted, creating an alternating flow of ions. In another embodiment, a modulated voltage is applied to the grid, also modulating the detection of ions.

  1. Alternating current long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; McAtee, James L.

    1993-01-01

    An alpha particle detector, utilizing alternating currents, whcih is capable of detecting alpha particles from distinct sources. The use of alternating currents allows use of simpler ac circuits which, in turn, are not susceptible to dc error components. It also allows the benefit of gas gain, if desired. In the invention, a voltage source creates an electric field between two conductive grids, and between the grids and a conductive enclosure. Air containing air ions created by collision with alpha particles is drawn into the enclosure and detected. In some embodiments, the air flow into the enclosure is interrupted, creating an alternating flow of ions. In another embodiment, a modulated voltage is applied to the grid, also modulating the detection of ions.

  2. Lyman-alpha imagery of Comet Kohoutek

    NASA Technical Reports Server (NTRS)

    Carruthers, G. R.; Opal, C. B.; Page, T. L.; Meier, R. R.; Prinz, D. K.

    1974-01-01

    Electrographic imagery of Comet Kohoutek in the 1100-1500 A wavelength range was obtained from a sounding rocket on Jan. 8, 1974, and from the Skylab space station on 13 occasions between Nov. 26, 1973 and Feb. 2, 1974. These images are predominantly due to Lyman-alpha (1216 A) emission from the hydrogen coma of the comet. The rocket pictures have been calibrated for absolute sensitivity and a hydrogen production rate has been determined. However, the Skylab camera suffered degradation of its sensitivity during the mission, and its absolute sensitivity for each observation can only be estimated by comparison of the comet images with those taken by the rocket camera, with imagery of the geocoronal Lyman-alpha glow, of the moon in reflected Lyman-alpha, and of ultraviolet-bright stars. The rocket and geocoronal comparisons are used to derive a preliminary, qualitative history of the development of the cometary hydrogen coma and the associated hydrogen production rate.

  3. Goiter formation following prostaglandin administration in rats.

    PubMed Central

    Lupulescu, A.

    1976-01-01

    Prostaglandins (PGE1 and PGE2) induced a hyperplastic microfollicular goiter with a high radioiodine (131I) thyroid uptake, increased endocytosis, a heavy autoradiographic (125I) reaction, and a moderate increase of thyroid hormones (T4, T3), thyroxine-binding globulin (TGB), and thyrotropin (TSH) concentrations in adult rats. Ultrastructurally, both prostaglandins (E1 and E2) markedly stimulated the thyroid cell activity and increased the number of pseudopodia, the size of colloid and dense granule populations, and the number of polysomes. Conversely, a hypofunction of thyroid glands with low radioiodine (131I) thyroid uptake, a decreased autoradiographic (125I) reaction, and a moderate decrease in T4, T3, TGB, and TSH concentrations were observed following prostaglandin F 2alpha. Ultrastructurally, a decrease in size of the colloid and dense granule population and the number of degenerative mitochondria occurred infollicular cells. An intense hyperplasia of parafollicular (C) cells, with abundant population of characteristic dense granules, could be seen in PGF 2alpha-treated rats. A marked decrease of radioiodine (131I) uptake, endocytosis, and autoradiographic (125I) reaction and a sharp decline in T4, T3, and TBG were observed in hypophysectomized and chronically prostaglandin-treated rats. Light and electron microscopy revealed signs of an advanced thyroid hypofunction with flat cuboidal cells, reduced microvilli, scarce endoplasmic reticulum, and few dense droplets. The present findings demonstrate that the chronic administration of prostaglandins exerts significant effects of thyroid gland and goiter formation (goitrogenesis), radioiodine metabolism, and hormone synthesis, and that these effects are mediated by TSH secretion. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 PMID:970439

  4. Three Generations of Educational Administration.

    ERIC Educational Resources Information Center

    Sharpe, F. G.

    This paper compares two Australian educational administration texts published in 1963 to reflect critically on the radical changes that have occurred in educational administration in Australia since then. The books are "Headmasters for Better Schools," by Bassett, Crane, and Walker; and "Training the Administrator," by Cunningham and Radford. The…

  5. Straight Talk about School Administrators.

    ERIC Educational Resources Information Center

    Association of California School Administrators.

    In this report, the Association of California School Administrators examined some of the myths and misrepresentations about administration in California's public schools. Specifically, it examined the following five myths: (1) A lot of money that could be better spent in the classroom is being wasted on administration. (2) There are too many…

  6. Special Education Administration Training Program.

    ERIC Educational Resources Information Center

    Watherman, Richard F.; Hollingsworth, Sue Ann

    Presented are course materials from a competency based education program in special education administration. It is explained that the Special Education Administration Training Program (SEATP) is designed for continuing education of administrators. Materials are divided into three self contained curriculum areas: fiscal management, personnel…

  7. Administrators' Decisions about Resource Allocation

    ERIC Educational Resources Information Center

    Knight, William E.; Folkins, John W.; Hakel, Milton D.; Kennell, Richard P.

    2011-01-01

    Do academic administrators make decisions about resource allocation differently depending on the discipline receiving the funding? Does an administrator's academic identity influence these decisions? This study explored those questions with a sample of 1,690 academic administrators at doctoral-research universities. Participants used fictional…

  8. Certification of Financial Aid Administrators

    ERIC Educational Resources Information Center

    Peterson, Stacey A.

    2011-01-01

    The certification of financial aid administrators has been debated for over 37 years. A job satisfaction survey conducted by the National Association of Student Financial Aid Administrators (NASFAA, 2008a) revealed that college and university administrators' perceptions of the efficiency, effectiveness, and quality of the services provided by the…

  9. Solution structure of {alpha}-conotoxin PIA, a novel antagonist of {alpha}6 subunit containing nicotinic acetylcholine receptors

    SciTech Connect

    Chi, Seung-Wook; Lee, Si-Hyung; Kim, Do-Hyoung; Kim, Jae-Sung; Olivera, Baldomero M.; McIntosh, J. Michael; Han, Kyou-Hoon . E-mail: khhan600@kribb.re.kr

    2005-12-30

    {alpha}-Conotoxin PIA is a novel nicotinic acetylcholine receptor (nAChR) antagonist isolated from Conus purpurascens that targets nAChR subtypes containing {alpha}6 and {alpha}3 subunits. {alpha}-conotoxin PIA displays 75-fold higher affinity for rat {alpha}6/{alpha}3{beta}2{beta}3 nAChRs than for rat {alpha}3{beta}2 nAChRs. We have determined the three-dimensional structure of {alpha}-conotoxin PIA by nuclear magnetic resonance spectroscopy. The {alpha}-conotoxin PIA has an '{omega}-shaped' overall topology as other {alpha}4/7 subfamily conotoxins. Yet, unlike other neuronally targeted {alpha}4/7-conotoxins, its N-terminal tail Arg{sup 1}-Asp{sup 2}-Pro{sup 3} protrudes out of its main molecular body because Asp{sup 2}-Pro{sup 3}-Cys{sup 4}-Cys{sup 5} forms a stable type I {beta}-turn. In addition, a kink introduced by Pro{sup 15} in the second loop of this toxin provides a distinct steric and electrostatic environment from those in {alpha}-conotoxins MII and GIC. By comparing the structure of {alpha}-conotoxin PIA with other functionally related {alpha}-conotoxins we suggest structural features in {alpha}-conotoxin PIA that may be associated with its unique receptor recognition profile.

  10. Low-valent niobium-mediated double activation of C-F/C-H bonds: fluorene synthesis from o-arylated alpha,alpha,alpha-trifluorotoluene derivatives.

    PubMed

    Fuchibe, Kohei; Akiyama, Takahiko

    2006-02-01

    By the treatment of 0.3 molar amount of NbCl5 and LiAlH4, o-arylated alpha,alpha,alpha-trifluorotoluenes afforded fluorene derivatives in good yields. C-F bonds of the CF3 group and the neighboring ortho C-H bond were doubly activated to give the coupling products. PMID:16448098

  11. Opposite effects of the acute promyelocytic leukemia PML-retinoic acid receptor alpha (RAR alpha) and PLZF-RAR alpha fusion proteins on retinoic acid signalling.

    PubMed Central

    Ruthardt, M; Testa, U; Nervi, C; Ferrucci, P F; Grignani, F; Puccetti, E; Grignani, F; Peschle, C; Pelicci, P G

    1997-01-01

    Fusion proteins involving the retinoic acid receptor alpha (RAR alpha) and the PML or PLZF nuclear protein are the genetic markers of acute promyelocytic leukemias (APLs). APLs with the PML-RAR alpha or the PLZF-RAR alpha fusion protein are phenotypically indistinguishable except that they differ in their sensitivity to retinoic acid (RA)-induced differentiation: PML-RAR alpha blasts are sensitive to RA and patients enter disease remission after RA treatment, while patients with PLZF-RAR alpha do not. We here report that (i) like PML-RAR alpha expression, PLZF-RAR alpha expression blocks terminal differentiation of hematopoietic precursor cell lines (U937 and HL-60) in response to different stimuli (vitamin D3, transforming growth factor beta1, and dimethyl sulfoxide); (ii) PML-RAR alpha, but not PLZF-RAR alpha, increases RA sensitivity of hematopoietic precursor cells and restores RA sensitivity of RA-resistant hematopoietic cells; (iii) PML-RAR alpha and PLZF-RAR alpha have similar RA binding affinities; and (iv) PML-RAR alpha enhances the RA response of RA target genes (those for RAR beta, RAR gamma, and transglutaminase type II [TGase]) in vivo, while PLZF-RAR alpha expression has either no effect (RAR beta) or an inhibitory activity (RAR gamma and type II TGase). These data demonstrate that PML-RAR alpha and PLZF-RAR alpha have similar (inhibitory) effects on RA-independent differentiation and opposite (stimulatory or inhibitory) effects on RA-dependent differentiation and that they behave in vivo as RA-dependent enhancers or inhibitors of RA-responsive genes, respectively. Their different activities on the RA signalling pathway might underlie the different responses of PML-RAR alpha and PLZF-RAR alpha APLs to RA treatment. The PLZF-RAR alpha fusion protein contains an approximately 120-amino-acid N-terminal motif (called the POZ domain), which is also found in a variety of zinc finger proteins and a group of poxvirus proteins and which mediates protein

  12. Lunar surface outgassing and alpha particle measurements

    SciTech Connect

    Lawson, S. L.; Feldman, W. C.; Lawrence, David J. ,; Moore, K. R.; Elphic, R. C.; Maurice, S.; Belian, Richard D.; Binder, Alan B.

    2002-01-01

    The Lunar Prospector Alpha Particle Spectrometer (LP APS) searched for lunar surface gas release events and mapped their distribution by detecting alpha particle?; produced by the decay of gaseous radon-222 (5.5 MeV, 3.8 day half-life), solid polonium-2 18 (6.0 MeV, 3 minute half-life), and solid polonium-210 (5.3 MeV, 138 day half-life, but held up in production by the 21 year half-life of lead-210). These three nuclides are radioactive daughters from the decay of uranium-238.

  13. HETDEX: Diffuse Lyman-Alpha Emission

    NASA Astrophysics Data System (ADS)

    Tuttle, Sarah E.; Finkelstein, S.; Gebhardt, K.; HETDEX Collaboration

    2012-01-01

    The intermediate redshift universe probed by HETDEX, 1.8 < z < 3.0, holds a great deal of information about star formation and the evolution of galaxies. Although simulations reveal a regime active with gas accretion and feeding of galaxies via filaments, observational evidence for this accretion from the Intergalactic Medium (IGM) at any redshift has been very limited. Here we use data from VIRUS-P across several well-characterized fields to put limits on diffuse emission of Lyman-Alpha at the outskirts of galaxies. This work is done in preparation for a similar program with the full HETDEX sample of Lyman-Alpha Emitters (LAEs).

  14. Hydrogen Lyman-alpha coronagraph/polarimeter

    NASA Technical Reports Server (NTRS)

    Fineschi, Silvano; Hoover, Richard B.; Walker, Arthur B. C., Jr.

    1992-01-01

    The present treatment of vector magnetic field measurement in coronas by means of the Hanle effect of the Lyman-alpha line uses data from all-reflecting imaging coronagraph/polarimeters. The polarization sensitivity, bandpass, and spatial resolution of these instruments are defined through a modeling of the Hanle-effect signature in Lyman-alpha emission from coronal magnetic loops; the line-of-sight integration through an inhomogeneous coronal medium is taken into account. The use of the Hanle effect to measure solar corona vector magnetic fields is verified.

  15. Alpha particles in effective field theory

    SciTech Connect

    Caniu, C.

    2014-11-11

    Using an effective field theory for alpha (α) particles at non-relativistic energies, we calculate the strong scattering amplitude modified by Coulomb corrections for a system of two αs. For the strong interaction, we consider a momentum-dependent interaction which, in contrast to an energy dependent interaction alone [1], could be more useful in extending the theory to systems with more than two α particles. We will present preliminary results of our EFT calculations for systems with two alpha particles.

  16. Parallel Genetic Algorithm for Alpha Spectra Fitting

    NASA Astrophysics Data System (ADS)

    García-Orellana, Carlos J.; Rubio-Montero, Pilar; González-Velasco, Horacio

    2005-01-01

    We present a performance study of alpha-particle spectra fitting using parallel Genetic Algorithm (GA). The method uses a two-step approach. In the first step we run parallel GA to find an initial solution for the second step, in which we use Levenberg-Marquardt (LM) method for a precise final fit. GA is a high resources-demanding method, so we use a Beowulf cluster for parallel simulation. The relationship between simulation time (and parallel efficiency) and processors number is studied using several alpha spectra, with the aim of obtaining a method to estimate the optimal processors number that must be used in a simulation.

  17. Fan-less long range alpha detector

    DOEpatents

    MacArthur, Duncan W.; Bounds, John A.

    1994-01-01

    A fan-less long range alpha detector which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces.

  18. Fan-less long range alpha detector

    DOEpatents

    MacArthur, D.W.; Bounds, J.A.

    1994-05-10

    A fan-less long range alpha detector is disclosed which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces. 2 figures.

  19. Chronic nicotine treatment attenuates alpha 7 nicotinic receptor deficits following traumatic brain injury.

    PubMed

    Verbois, S L; Scheff, S W; Pauly, J R

    2003-02-01

    Traumatic brain injury (TBI) often causes a persistent and debilitating impairment of cognitive function. Although the neurochemical basis for TBI-induced cognitive dysfunction is not well characterized, some studies suggest prominent involvement of the CNS cholinergic system. Previous studies from our laboratories have shown that alpha 7* nicotinic cholinergic receptors (nAChrs) are especially vulnerable to the pathophysiological effects of TBI. Hippocampal and cortical alpha-[(125)I]-bungarotoxin (BTX) expression of alpha 7* nAChrs is significantly decreased in many brain regions following TBI and this reduction persists for at least 3 weeks following injury. In the present study we evaluated whether chronic nicotine infusion could attenuate TBI-induced deficits in alpha 7* nAChr expression. Male Sprague-Dawley rats were sham-operated, or subjected to mild or moderate unilateral cortical contusion injury. Immediately following brain injury, osmotic mini-pumps that delivered chronic saline or nicotine (0.125 or 0.25 mg/kg/h) were implanted. The animals were euthanatized and the brains prepared for nAChr quantitative autoradiography, 7 days following surgery. Brain injury caused significant decreases in BTX binding in several regions of the hippocampus. TBI-induced deficits in alpha 7* nAChr density were reversed in four of the six hippocampal brain regions evaluated following chronic nicotine administration. If TBI-induced deficits in alpha 7* nAChr expression play a role in post-injury cognitive impairment, pharmacological treatments which restore nAChr binding to control levels may be therapeutically useful.

  20. Daily treatment with {alpha}-naphthoflavone enhances follicular growth and ovulation rate in the rat

    SciTech Connect

    Barreiro, Karina A.; Di Yorio, Maria P.; Artillo-Guida, Romina D.; Paz, Dante A.; Faletti, Alicia G.

    2011-04-01

    The aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor and the first protein involved in a variety of physiological and toxicological processes, including those of xenobiotic metabolizing enzymes. AhR has been found in the ovary of many species and seems to mediate the ovarian toxicity of many environmental contaminants, which are AhR ligands. However, the role of AhR in the ovarian function is unknown. Therefore, the aim of this work was to study the action of {alpha}-naphthoflavone ({alpha}NF), known to be an AhR antagonist, on both follicular growth and ovulation. Immature Sprague-Dawley rats were daily injected intraperitoneally with {alpha}NF (0.1-80 mg/kg) or vehicle for 12 days, and primed with gonadotrophins (eCG/hCG) to induce follicular growth and ovulation. Ovaries were obtained 20 h after hCG administration. By means of immunohistochemistry, we found that the numbers of primordial, primary and antral follicles were increased in rats treated with 80 mg/kg {alpha}NF and that there were no differences with other doses. Likewise, the ovarian weight and the ovulation rate, measured by both number of oocytes within oviducts and corpora lutea in ovarian sections, were increased when the rats received either 1 or 10 mg/kg daily. Although further studies are necessary to know the mechanism of action of {alpha}NF, it is possible that the different ovarian processes can be differentially responsive to the presence of different levels of {alpha}NF, and that the same or different endogenous AhR ligands can be involved in these ovarian processes in a cell type-dependent manner.

  1. Topical and subcutaneous alpha-interferon fails to suppress corneal neovascularization.

    PubMed

    Nguyen, N; Goldberg, M; Pico, J; Kim, W; Abbott, R L; Levy, B

    1995-03-01

    Corneal neovascularization is a potentially blinding complication of a variety of corneal disorders. alpha-Interferon has been shown to inhibit endothelial cell migration and proliferation. It has been used successfully in the treatment of pediatric pulmonary hemangioma and hairy cell leukemia. This study was undertaken to evaluate the effect of topical and subcutaneous (s.c.) alpha-interferon on corneal neovascularization. Corneal neovascularization was induced in 40 male New Zealand white rabbits by placing silk sutures (7.0) bilaterally in each rabbit eye at the 3 and 9 o'clock positions of the cornea, 3 mm from the limbus. Animals were randomized into two main treatment groups for topical (group 1) and s.c. (group 2) administration of interferon. Group 1 (n = 24) was then randomized into four subgroups and treated daily with topical doses of (a) rabbit specific alpha-interferon; (b) alpha-interferon plus 1% prednisolone acetate; (c) 1% prednisolone acetate; and (d) buffered phosphate control. Group 2 (n = 16) was randomized into two subgroups that received s.c. injections every other day of (a) alpha-interferon and (b) phosphate buffer. Rate of corneal neovascularization was documented photographically, with the end-point being the arrival of vessels at the suture for each group. The results of this study indicated that at the concentration and dosing regimens we used, neither topical nor s.c. alpha-interferon inhibits the rate of corneal vascular growth significantly when compared with our phosphate buffered solution control group (p = 0.88 and p = 0.84, respectively). Prednisolone acetate appeared to be the most effective in inhibiting corneal neovascularization (p = 0.003).(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Role of. alpha. sub 2 -adrenergic receptors in the carotid body response to hypoxia

    SciTech Connect

    Kou, Y.R.; Ernsberger, P.; Cherniack, N.S.; Prabhakar, N.R. )

    1990-02-26

    Clonidine, which acts in part as an {alpha}{sub 2}-adrenergic receptor agonist, depresses ventilation. The authors examined the role of {alpha}{sub 2}-receptors in carotid chemoreceptor activity. The density of {alpha}{sub 2}-receptors was determined in membrane fractions of 18 cat carotid bodies using {sup 125}I-iodoclonidine with 0.1 mM epinephrine or 10 {mu}M SKF-86466 defining nonspecific binding. {alpha}{sub 2}-Adrenergic receptor density averaged 0.6{plus minus}0.1 fmol/carotid body (mean {plus minus} SEM) and was comparable to other sympathetic target tissues. The authors then studied the effects of an agonist (guanabenz) and an antagonist (SKF-86466; 6-Cl-N-methyl-2,3,4,5-tetrahydro-1-H3-benzazepine) specific for {alpha}{sub 2}-receptors on baseline and hypoxia-stimulated carotid body discharge, in 10 anesthetized, paralyzed and artificially ventilated cats. Intracarotid infusion of guanabenz for 5 minutes caused a dose-dependent depression of the baseline activity and reduced the chemoreceptor response to hypoxia by 88.0{plus minus}5.8% of the vehicle-injected controls. Intravenous administration of SKF-86466 reversed the effects of guanabenz on the carotid body activity. in contrast, chemoreceptor depression caused by dopamine was unaffected by SKF-86466. SKF-86466 alone increased baseline discharge and potentiated the chemoreceptor response to hypoxia by 34.0 {plus minus} 9.6% of the controls. These results demonstrate that {alpha}{sub 2}-adrenergic receptors are present in the cat carotid body and they exert an inhibitory influence on the chemoreceptor response to hypoxia.

  3. Subacute toxicity of orally applied alpha-cypermethrin in Swiss mice.

    PubMed

    Luty, S; Latuszynska, J; Obuchowska-Przebirowska, D; Tokarska, M; Haratym-Maj, A

    2000-01-01

    The effect of a synthetic pyrethroid - alpha-cypermethrin administered per os for 28 days to Swiss mice was examined on phagocytic and bactericidal activity of neutrophils, and leukocytic image, IL-12 p70 level in blood plasma, as well as histologic and ultrastructural picture of the liver, heart, kidneys, lung and spleen. A synthetic pyrethroid alpha-cypermethrin, [(R,S)-alpha-cyano-3-phenoxybenzyl (R,S)-cis,trans-3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropanecarboxylate], produced by the Chemical Plant in Jaworzno was used in the study. The preparation for the application per os was used in doses 1/2 LD(50) (25 mg/kg body mass) and 1/5 LD(50) (10 mg/kg body mass). The results were presented as mean (x) +/- standard error (SEM) and subjected to statistical analysis by the parametric t-Student test. Subacute poisoning of mice with alpha-cypermethrin in doses 1/2 LD(50) and 1/5 LD(50) resulted in decreased bactericidal activity of neutrophils. The dose 10 mg/kg body mass had a stronger stimulatory effect on phagocytic activity than 25 mg/kg body mass. Significantly higher numbers of monocytes and lymphocytes were observed in the blood of male mice poisoned with 1/5 LD(50) alpha-cypermethrin. The administration of alpha-cypermethrin resulted for both doses in the decrease in IL-12 p70 serum secretion. The lowest IL-12 p70 level (pg/ml) was noted among female mice administered 1/2 LD(50) of the preparation. The results of the study may indicate that the pyrethroid in the study had a suppressive effect on Il-12 p70 production. In mice administered 1/5 LD(50) or 1/2 LD(50) of the preparation examined, histopathologic and ultrastructural changes were observed in the liver and kidneys.

  4. Identification and quantification of alphaS1, alphaS2, beta, and kappa-caseins in water buffalo milk by reverse phase-high performance liquid chromatography and mass spectrometry.

    PubMed

    Feligini, Maria; Bonizzi, Ivan; Buffoni, Joanna Natalia; Cosenza, Gianfranco; Ramunno, Luigi

    2009-04-01

    A method for the simultaneous quantitation of alpha(S1), alpha(S2), beta, and kappa-caseins in water buffalo (Bubalus bubalis) milk using reverse phase high-performance liquid chromatography was developed. The molecular masses of the peaks separated by the described chromatographic protocol were determined by ESI-MS. alpha(S1)- and kappa-caseins were found to be heteromorphic in several individual milk samples. In particular, alpha(S1)-casein showed two peaks with a molecular mass of 23,490 Da and 23,516 Da, and kappa-casein showed three peaks with molecular masses of 19,165 Da, 19,177 Da, and 19,247 Da. Only one form for beta-casein (24,033 Da) and alpha(S2)-casein (22,741 Da) were detected. The mean values of casein fraction concentration observed throughout the individual samples were 8.89 gL(-1) with a relative standard deviation (RSD) of 20% for alpha(S1)-casein, 5.08 gL(-1) with a RSD of 25% for alpha(S2)-casein, 20.91 gL(-1) with a RSD of 16% for beta-casein, and 4.13 gL(-1) with a RSD of 24% for kappa-casein. Linear and second-order polynomial correlations with total nitrogen were calculated for all casein fractions.

  5. alpha(1A)- and alpha(1B)-adrenergic receptors differentially modulate antidepressant-like behavior in the mouse.

    PubMed

    Doze, Van A; Handel, Evelyn M; Jensen, Kelly A; Darsie, Belle; Luger, Elizabeth J; Haselton, James R; Talbot, Jeffery N; Rorabaugh, Boyd R

    2009-08-18

    Tricyclic antidepressant (TCA) drugs are used for the treatment of chronic depression, obsessive-compulsive disorder (OCD), and anxiety-related disorders. Chronic use of TCA drugs increases the expression of alpha(1)-adrenergic receptors (alpha(1)-ARs). Yet, it is unclear whether increased alpha(1)-AR expression contributes to the antidepressant effects of these drugs or if this effect is unrelated to their therapeutic benefit. In this study, mice expressing constitutively active mutant alpha(1A)-ARs (CAM alpha(1A)-AR) or CAM alpha(1B)-ARs were used to examine the effects of alpha(1A)- and alpha(1B)-AR signaling on rodent behavioral models of depression, OCD, and anxiety. CAM alpha(1A)-AR mice, but not CAM alpha(1B)-AR mice, exhibited antidepressant-like behavior in the tail suspension test and forced swim test. This behavior was reversed by prazosin, a selective alpha(1)-AR inverse agonist, and mimicked by chronically treating wild type mice with cirazoline, an alpha(1A)-AR agonist. Marble burying behavior, commonly used to model OCD in rodents, was significantly decreased in CAM alpha(1A)-AR mice but not in CAM alpha(1B)-AR mice. In contrast, no significant differences in anxiety-related behavior were observed between wild type, CAM alpha(1A)-AR, and CAM alpha(1B)-AR animals in the elevated plus maze and light/dark box. This is the first study to demonstrate that alpha(1A)- and alpha(1B)-ARs differentially modulate antidepressant-like behavior in the mouse. These data suggest that alpha(1A)-ARs may be a useful therapeutic target for the treatment of depression.

  6. Effect of alpha-ketoglutarate and oxaloacetate on brain mitochondrial DNA damage and seizures induced by kainic acid in mice.

    PubMed

    Yamamoto, Hiro-aki; Mohanan, Parayanthala V

    2003-07-20

    The effects of alpha-ketoglutarate and oxaloacetate on brain mitochondrial DNA (mtDNA) damage and seizures induced by kainic acid were examined both in vivo and in vitro. An intraperitoneal (ip) injection of kainic acid (45 mg/kg) produced broad-spectrum limbic and severe sustained seizures in all of the treated mice. The seizures were abolished when alpha-ketoglutarate (2 g/kg) or oxaloacetate (1 g/kg) was injected intraperitoneally in the animals 1 min before kainic acid administration. In addition, the administration of kainic acid caused damage to mtDNA in brain frontal and middle cortex of mice. These effects were completely abolished by the ip preinjection of alpha-ketoglutarate (2 g/kg) or oxaloacetate (1 g/kg). In vitro exposure of kainic acid (0.25, 0.5 or 1.0 mM) to brain homogenate inflicted damage to mtDNA in a concentration-dependent manner. The damage of mtDNA induced by 1.0 mM kainic acid was attenuated by the co-treatment with alpha-ketoglutarate (2.5 or 5.0 mM) or oxaloacetate (0.75 or 1.0 mM). Furthermore, in vivo and in vitro exposure of kainic acid elicited an increase in lipid peroxidation. However, the increased lipid peroxidation was completely inhibited by cotreatment of alpha-ketoglutarate or oxaloacetate. These results suggest that alpha-keto acids such as alpha-ketoglutarate and oxaloacetate play a role in the inhibition of seizures and subsequent mtDNA damage induced by the excitotoxic/neurotoxic agent, kainic acid.

  7. Key Obama officials leave administration

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2013-01-01

    Secretary of the Interior Ken Salazar is one of the latest members of the Obama administration to announce that he is leaving his position near the start of President Obama's second term in office. Salazar, who has served as interior secretary since January 2009, intends to leave the department by the end of March, the department noted on 16 January. Salazar joins a number of other key officials who are planning to leave the administration. They include Environmental Protection Agency administrator Lisa Jackson, National Oceanic and Atmospheric Administration administrator Jane Lubchenco, and U.S. Geological Survey director Marcia McNutt.

  8. A practical alpha particle irradiator for studying internal alpha particle exposure.

    PubMed

    Lee, Ki-Man; Lee, Ui-Seob; Kim, Eun-Hee

    2016-09-01

    An alpha particle irradiator has been built in the Radiation Bioengineering Laboratory at Seoul National University (SNU) to investigate the cellular responses to alpha emissions from radon and the progeny. This irradiator is designed to have the energy of alpha particles entering target cells similar to that of alpha emissions from the radon progeny Po-218 and Po-214 residing in the human respiratory tract. For the SNU alpha particle irradiator, an irradiation system is equipped with cell dishes of 4µm thick Mylar bottom and a special setup of cells on slide for gamma-H2AX assay. Dose calibration for the alpha particle irradiator was performed by dual approaches, detection and computer simulation, in consideration of the source-to-target distance (STD) and the size of a cell dish. The uniformity of dose among cells in a dish is achieved by keeping the STD and the size of cell dish in certain ranges. The performance of the SNU alpha particle irradiator has been proven to be reliable through the gamma-H2AX assay with the human lung epithelial cells irradiated. PMID:27475622

  9. Quantification of functional and inactivated alpha 2-macroglobulin in sepsis.

    PubMed

    Abbink, J J; Nuijens, J H; Eerenberg, A J; Huijbregts, C C; Strack van Schijndel, R J; Thijs, L G; Hack, C E

    1991-01-23

    Alpha 2-macroglobulin (alpha 2 M) in vitro inhibits numerous proteinases that are generated during inflammatory reactions and therefore, probably plays an important role in diseases such as sepsis. To monitor the state of alpha 2 M in sepsis, we developed novel assays for functional and inactive alpha 2M. Functional alpha 2M in plasma was measured by quantitating the binding of alpha 2M to solid-phase trypsin. Inactive alpha 2M (i alpha 2M) was assessed with a monoclonal antibody, mcAb M1, that specifically reacts with a neodeterminant exposed on i alpha 2M. This mcAb in combination with chromogenic substrates was used to detect alpha 2M-proteinase complexes. Functional alpha 2M was reduced in plasma from 48 patients with clinical sepsis compared to healthy controls (p less than 0.0001). Levels of functional alpha 2M on admission and the lowest levels encountered in 23 patients with shock were lower than in 25 normotensive patients (p = 0.023 and p = 0.009, respectively). Increased levels of i alpha 2M (greater than 30 nM) at least on one occasion were found in only 4 of the 48 patients, being not different in hypotensive compared with normotensive patients, and not in patients who died compared with those who survived. Levels of functional alpha 2M correlated significantly with levels of factor XII and prekallikrein suggesting that decreases in alpha 2M at least in part were due to contact activation. Indeed, in two patients with increased i alpha 2M, complexes between alpha 2M and kallikrein were demonstrated in addition to plasmin- and thrombin-alpha 2M complexes.

  10. Substrate specificity of human liver neutral alpha-mannosidase.

    PubMed Central

    al Daher, S; De Gasperi, R; Daniel, P; Hirani, S; Warren, C; Winchester, B

    1992-01-01

    The digestion of radiolabelled natural oligosaccharide substrates by human liver neutral alpha-mannosidase has been studied by h.p.l.c. and h.p.t.l.c. The high-mannose oligosaccharides Man9GlcNAc and Man8GlcNAc are hydrolysed by the enzyme by two distinct non-random routes to a common product of composition Man6GlcNAc, which is then slowly converted into a unique Man5GlcNAc oligosaccharide, Man alpha(1----2)Man alpha(1----2)Man alpha(1----3)[Man alpha (1----6)] Man beta(1----4)GlcNAc. These pathways are different from the processing and lysosomal catabolic pathways for these structures. In particular, the alpha(1----2)-linked mannose residues attached to the core alpha(1----3)-linked mannose residue are resistant to hydrolysis. The key processing intermediate, Man alpha(1----3)[Man alpha(1----6)]Man alpha(1----6)[Man alpha(1----3)] Man beta(1----4)GlcNAc, is not produced in the digestion of high-mannose glycans by the neutral alpha-mannosidase, but it is hydrolysed by the enzyme by a non-random route to Man beta(1----4)GlcNAc via the core structure Man alpha(1----3)[Man alpha(1----6)]Man beta(1----4)GlcNAc. In contrast with its ready hydrolysis by lysosomal alpha-mannosidase, the core alpha(1----3)-mannosidic linkage is quite resistant to hydrolysis by neutral alpha-mannosidase. The precise specificity of neutral alpha-mannosidase towards high-mannose oligosaccharides suggests that it has a role in the modification of such structures in the cytosol. Images Fig. 4. PMID:1520283

  11. Sequence analysis of frog alpha B-crystallin cDNA: sequence homology and evolutionary comparison of alpha A, alpha B and heat shock proteins.

    PubMed

    Lu, S F; Pan, F M; Chiou, S H

    1995-11-22

    alpha-Crystallin is a major lens protein present in the lenses of all vertebrate species. Recent studies have revealed that bovine alpha-crystallins possess genuine chaperone activity similar to small heat-shock proteins. In order to facilitate the determination of the primary sequence of amphibian alpha B-crystallin, cDNA encoding alpha B subunit chain was amplified using a new "Rapid Amplification of cDNA Ends" (RACE) protocol of Polymerase Chain Reaction (PCR). PCR-amplified product corresponding to alpha B subunit was then subcloned into pUC18 vector and transformed into E. coli strain JM109. Plasmids purified from the positive clones were prepared for nucleotide sequencing by the automatic fluorescence-based dideoxynucleotide chain-termination method. Sequencing more than five clones containing DNA inserts coding for alpha B-crystallin subunit constructed only one complete full-length reading frame of 522 base pairs similar to that of alpha A subunit, covering a deduced protein sequence of 173 amino acids including the universal translation-initiating methionine. The frog alpha B crystallin shows 69, 66 and 56% whereas alpha A crystallin shows 83, 81 and 69% sequence similarity to the homologous chains of bovine, chicken and dogfish, respectively, revealing a more divergent structural relationship among these alpha B subunits as compared to alpha A subunits. Structural analysis and comparison of alpha A- and alpha B-crystallin subunits from eye lenses of different classes of vertebrates also shed some light on the evolutionary relatedness between alpha B/alpha A crystallins and the small heat-shock proteins.

  12. Topical application of alpha-tocopherol modulates the antioxidant network and diminishes ultraviolet-induced oxidative damage in murine skin.

    PubMed

    Lopez-Torres, M; Thiele, J J; Shindo, Y; Han, D; Packer, L

    1998-02-01

    The aim of this study was to investigate the effects of topical alpha-tocopherol application on epidermal and dermal antioxidants and its ability to prevent ultraviolet (UV)-induced oxidative damage. Hairless mice received topical applications of alpha-tocopherol 24 h before a single, acute UV irradiation (10 x minimal erythemal dose). The four major antioxidant enzymes (catalase, superoxide dismutase, glutathione reductase and glutathione peroxidase), hydrophilic and lipophilic antioxidants, and lipid hydroperoxides, markers of oxidative damage, were assayed in both epidermis and dermis of hairless mice. Topical alpha-tocopherol treatment increased dermal superoxide dismutase activity by 30% (P < 0.01) and protected epidermal glutathione peroxidase and superoxide dismutase from depletion after UV irradiation. Total and reduced glutathione levels in the epidermis increased by 50% after the topical treatment (P < 0.05), as did dermal ascorbate levels (by 40%: P < 0.01). The topical treatment increased alpha-tocopherol levels both in the epidermis (62-fold) and the dermis (22-fold: P < 0.001 in each layer). Furthermore, alpha-tocopherol treatment significantly reduced the formation of epidermal lipid hydroperoxides after UV irradiation (P < 0.05). These results demonstrate that topical administration of alpha-tocopherol protects cutaneous tissues against oxidative damage induced by UV irradiation in vivo, and suggest that the underlying mechanism of this effect involves the up-regulation of a network of enzymatic and non-enzymatic antioxidants.

  13. Synergistic alpha-1 and alpha-2 adrenergic stimulation of rat proximal nephron Na+/H+ exchange

    SciTech Connect

    Gesek, F.A.; Cragoe, E.J. Jr.; Strandhoy, J.W.

    1989-06-01

    Both alpha-1 and alpha-2 adrenoceptors have been localized to the renal cortex, with the majority of binding sites on the proximal tubule. Because the major regulator of Na+ uptake into the proximal tubule is the Na+/H+ exchanger, and because alpha-1 and alpha-2 adrenoceptors stimulate it in other tissues, we tested the hypothesis that both alpha adrenoceptor subtypes can increase Na+ uptake into the proximal nephron by stimulating the Na+/H+ antiporter. Enhancement of Na+ transport by agonists was studied in isolated rat proximal tubules by determining the uptake of 22Na that was suppressible by the Na+/H+ inhibitor, 5-(N-ethyl-N-isopropyl)amiloride (EIPA). The phorbol ester, phorbol-12-myristate-13-acetate, (0.1 microM), directly stimulated the antiporter through protein kinase C and increased EIPA-suppressible 22Na uptake 250% above control. The alpha-1 adrenoceptor agonists, cirazoline and phenylephrine, in addition to the mixed agonist, norepinephrine, maximally stimulated uptake by 226 to 232% at 1 microM concentrations. alpha-2 agonists produced a range of maximal stimulations at 1 microM from 65% with guanabenz to 251% with B-HT 933. Increases in 22Na uptake by agonists were inhibited by selective adrenergic antagonists and by EIPA. The drugs did not change the EIPA-resistant component of 22Na uptake. Inasmuch as the adrenoceptor subtypes likely stimulated Na+/H+ exchange by differing intracellular pathways impinging upon common transport steps, we examined whether simultaneous stimulation of both pathways was additive. Submaximal concentrations (5 nM each) of alpha-1 and alpha-2 adrenoceptor agonists in combination synergistically enhanced 22Na uptake to a level similar to 1 microM concentrations of adrenoceptor agonists alone or in combination.

  14. Plant alpha-amylase inhibitors and their interaction with insect alpha-amylases.

    PubMed

    Franco, Octávio L; Rigden, Daniel J; Melo, Francislete R; Grossi-De-Sá, Maria F

    2002-01-01

    Insect pests and pathogens (fungi, bacteria and viruses) are responsible for severe crop losses. Insects feed directly on the plant tissues, while the pathogens lead to damage or death of the plant. Plants have evolved a certain degree of resistance through the production of defence compounds, which may be aproteic, e.g. antibiotics, alkaloids, terpenes, cyanogenic glucosides or proteic, e.g. chitinases, beta-1,3-glucanases, lectins, arcelins, vicilins, systemins and enzyme inhibitors. The enzyme inhibitors impede digestion through their action on insect gut digestive alpha-amylases and proteinases, which play a key role in the digestion of plant starch and proteins. The natural defences of crop plants may be improved through the use of transgenic technology. Current research in the area focuses particularly on weevils as these are highly dependent on starch for their energy supply. Six different alpha-amylase inhibitor classes, lectin-like, knottin-like, cereal-type, Kunitz-like, gamma-purothionin-like and thaumatin-like could be used in pest control. These classes of inhibitors show remarkable structural variety leading to different modes of inhibition and different specificity profiles against diverse alpha-amylases. Specificity of inhibition is an important issue as the introduced inhibitor must not adversely affect the plant's own alpha-amylases, nor the nutritional value of the crop. Of particular interest are some bifunctional inhibitors with additional favourable properties, such as proteinase inhibitory activity or chitinase activity. The area has benefited from the recent determination of many structures of alpha-amylases, inhibitors and complexes. These structures highlight the remarkable variety in structural modes of alpha-amylase inhibition. The continuing discovery of new classes of alpha-amylase inhibitor ensures that exciting discoveries remain to be made. In this review, we summarize existing knowledge of insect alpha-amylases, plant alpha

  15. Induction of a deficiency of steroid delta 4-5 alpha-reductase activity in liver by a porphyrinogenic drug.

    PubMed Central

    Kappas, A; Bradlow, H L; Bickers, D R; Alvares, A P

    1977-01-01

    The hepatic enzymes that catalyze drug oxidations and the reductive metabolism of steroid hormones to 5alpha-derivatives are localized in membranes of the endoplasmic reticulum. Phenobarbital, which exacerbates acute intermittent porphyria in man, induces drug-oxidizing enzymes in liver. Additionally, patients in whome the primary gene defect (uroporphyrinogen-I-synthetase deficiency) of acute intermittent porphyria has become clinically expressed have low levels of hepatic steroid delta4-5alpha-reductase activity. This 5alpha-reductase deficiency in acute intermittent porphyria leads to the disproportionate generation of 5beta-steroid metabolites from precursor hormones; such steroid metabolites have significant porphyria-inducing action experimentally. In this study the effects of phenobarbital on drug oxidation and steroid 5alpha-reduction in man were examined to determine if this drug could produce changes in steroid 5alpha-reductase activity which mimicked those seen in patients with acute intermittent porphyria. Metabolic studies with [14C]-testosterone and 11beta-[3H]hydroxyandrostenedione were carried out in five normal volunteers. In all five subjects phenobarbital administration (2 mg/kg/per day for 21 days) enhanced plasma removal of the test drugs antipyrine and phenylbutazone as expected; but in four subjects phenobarbital also substantially depressed 5alpha-metabolite formation from [14C]testosterone and resulted in a pattern of hormone biotransformation characterized by a high ratio of 5beta/5alpha-metabolite formation. Studies with 11beta-[3H]hydroxy-androstenedione in three subjects confirmed that phenobarbital produced this high 5beta/5alpha ratio of steroid metabolism by depressing 5alpha-reductase activity for steroid hormones in liver. The high ratio of 5beta/5alpha-metabolites formed in normals after drug treatment mimicks the high 5beta/5alpha-steroid metabolite ratio formed from endogenous hormones in acute intermittent porphyria. The

  16. Interaction of per 3,6-anhydro-alpha cyclodextrins (alpha 36CD) and lead-alpha 36CD complex with biological systems.

    PubMed

    Debouzy, J C; Fauvelle, F; Gadelle, A; Baudin, C; Richard, M; Perly, B; Chouteau, F; Joets, J; Tazz, J J; Daveloose, D

    1998-05-01

    The interactions of per (3,6 anhydro) alpha cyclodextrin (alpha 36CD) and of lead-alpha 36CD complex with biological systems were tested by NMR, ESR and electronic microscopy using erythrocytes and model membranes. It was found that the haemolytic activity of alpha 36CD alone was seven fold lower than that of natural alpha cyclodextrin (evaluated by the concentration inducing 50% haemolysis, DH50 = 35 mM). Conversely, the formation of the complex resulted in an increase of haemolytic properties, with DH50 of 1 mM. The mechanism proposed was an increased membrane diffusion by endocytosis of the complex, leading to higher amounts of intracellular lead.

  17. Determining the alpha dynamo parameter in incompressible homogeneous magnetohydrodynamic turbulence

    NASA Technical Reports Server (NTRS)

    Matthaeus, W. H.; Goldstein, M. L.; Lantz, S. R.

    1983-01-01

    Alpha, an important parameter in dynamo theory, is proportional to either the kinetic, current, magnetic, or velocity helicity of the fluctuating magnetic field and fluctuating velocity field. The particular helicity to which alpha is proportional depends on the assumptions used in deriving the first order smoothed equations that describe the alpha effect. In two cases, when alpha is proportional to either the magnetic helicity or velocity helicity, alpha is determined experimentally from two point measurements of the fluctuating fields in incompressible, homogeneous turbulence having arbitrary symmetry. For the other two possibilities, alpha is determined if the turbulence is isotropic.

  18. The alpha-form of the hydroxides of bivalent metals

    NASA Technical Reports Server (NTRS)

    Feitknecht, W.

    1984-01-01

    X-ray analyses were made of the hydroxides of the bivalent metals. The freshly pptd. hydroxide is usually in the alpha-form, which on standing is converted to another form or other forms. The alpha and c grating dimensions of the alpha-form and the C6-type of Co, Zn, C, Co-Zn and Ni-Zn hydroxides are tabulated. Ni hydroxide does not exhibit an alpha-form. The alpha-Co(OH)2, the blue form, is stabilized by sugar or by the higher alcohols: these compounds do not stabilize alpha-Zn(OH)2.

  19. Aspergillus nidulans alpha-galactosidase of glycoside hydrolase family 36 catalyses the formation of alpha-galacto-oligosaccharides by transglycosylation.

    PubMed

    Nakai, Hiroyuki; Baumann, Martin J; Petersen, Bent O; Westphal, Yvonne; Hachem, Maher Abou; Dilokpimol, Adiphol; Duus, Jens Ø; Schols, Henk A; Svensson, Birte

    2010-09-01

    The alpha-galactosidase from Aspergillus nidulans (AglC) belongs to a phylogenetic cluster containing eukaryotic alpha-galactosidases and alpha-galacto-oligosaccharide synthases of glycoside hydrolase family 36 (GH36). The recombinant AglC, produced in high yield (0.65 g.L(-1) culture) as His-tag fusion in Escherichia coli, catalysed efficient transglycosylation with alpha-(1-->6) regioselectivity from 40 mm 4-nitrophenol alpha-d-galactopyranoside, melibiose or raffinose, resulting in a 37-74% yield of 4-nitrophenol alpha-D-Galp-(1-->6)-D-Galp, alpha-D-Galp-(1-->6)-alpha-D-Galp-(1-->6)-D-Glcp and alpha-D-Galp-(1-->6)-alpha-D-Galp-(1-->6)-D-Glcp-(alpha1-->beta2)-d-Fruf (stachyose), respectively. Furthermore, among 10 monosaccharide acceptor candidates (400 mm) and the donor 4-nitrophenol alpha-D-galactopyranoside (40 mm), alpha-(1-->6) linked galactodisaccharides were also obtained with galactose, glucose and mannose in high yields of 39-58%. AglC did not transglycosylate monosaccharides without the 6-hydroxymethyl group, i.e. xylose, L-arabinose, L-fucose and L-rhamnose, or with axial 3-OH, i.e. gulose, allose, altrose and L-rhamnose. Structural modelling using Thermotoga maritima GH36 alpha-galactosidase as the template and superimposition of melibiose from the complex with human GH27 alpha-galactosidase supported that recognition at subsite +1 in AglC presumably requires a hydrogen bond between 3-OH and Trp358 and a hydrophobic environment around the C-6 hydroxymethyl group. In addition, successful transglycosylation of eight of 10 disaccharides (400 mm), except xylobiose and arabinobiose, indicated broad specificity for interaction with the +2 subsite. AglC thus transferred alpha-galactosyl to 6-OH of the terminal residue in the alpha-linked melibiose, maltose, trehalose, sucrose and turanose in 6-46% yield and the beta-linked lactose, lactulose and cellobiose in 28-38% yield. The product structures were identified using NMR and ESI-MS and five of the 13

  20. Alpha 4-integrins mediate antigen-induced late bronchial responses and prolonged airway hyperresponsiveness in sheep.

    PubMed

    Abraham, W M; Sielczak, M W; Ahmed, A; Cortes, A; Lauredo, I T; Kim, J; Pepinsky, B; Benjamin, C D; Leone, D R; Lobb, R R

    1994-02-01

    Eosinophils and T lymphocytes are thought to be involved in allergic airway inflammation. Both cells express the alpha 4 beta 1-integrin, very late antigen-4 (VLA-4, CD49d/CD29); alpha 4-integrins can promote cellular adhesion and activation. Therefore, we examined the in vivo effects of a blocking anti-alpha 4 monoclonal antibody, HP 1/2, on antigen-induced early and late bronchial responses, airway hyperresponsiveness, inflammatory cell influx, and peripheral leukocyte counts in allergic sheep. Sheep blood lymphocytes, monocytes, and eosinophils expressed alpha 4 and bound HP 1/2. In control sheep, Ascaris antigen challenge produced early and late increases in specific lung resistance of 380 +/- 42% and 175 +/- 16% over baseline immediately and 7 h after challenge, respectively, as well as airway hyperresponsiveness continuing for 14 d after antigen challenge. Treatment with HP 1/2 (1 mg/kg, i.v.) 30 min before antigen challenge did not affect the early increase in specific lung resistance but inhibited the late-phase increase at 5-8 h by 75% (P < 0.05) and inhibited the post-antigen-induced airway hyperresponsiveness at 1, 2, 7, and 14 d (P < 0.05, for each time). Intravenous HP 1/2 given 2 h after antigen challenge likewise blocked late-phase airway changes and postchallenge airway hyperresponsiveness. Airway administration of HP 1/2 (16-mg dose) was also effective in blocking these antigen-induced changes. Response to HP 1/2 was specific since an isotypic monoclonal antibody, 1E6, was ineffective by intravenous and aerosol administration. Inhibition of leukocyte recruitment did not totally account for the activity of anti-alpha 4 antibody since HP 1/2 neither diminished the eosinopenia or lymphopenia that followed antigen challenge nor consistently altered the composition of leukocytes recovered by bronchoalveolar lavage. Because airway administration of HP 1/2 was also active, HP 1/2 may have inhibited cell activation. Reduction of platelet-activating factor

  1. Alpha 4-integrins mediate antigen-induced late bronchial responses and prolonged airway hyperresponsiveness in sheep.

    PubMed Central

    Abraham, W M; Sielczak, M W; Ahmed, A; Cortes, A; Lauredo, I T; Kim, J; Pepinsky, B; Benjamin, C D; Leone, D R; Lobb, R R

    1994-01-01

    Eosinophils and T lymphocytes are thought to be involved in allergic airway inflammation. Both cells express the alpha 4 beta 1-integrin, very late antigen-4 (VLA-4, CD49d/CD29); alpha 4-integrins can promote cellular adhesion and activation. Therefore, we examined the in vivo effects of a blocking anti-alpha 4 monoclonal antibody, HP 1/2, on antigen-induced early and late bronchial responses, airway hyperresponsiveness, inflammatory cell influx, and peripheral leukocyte counts in allergic sheep. Sheep blood lymphocytes, monocytes, and eosinophils expressed alpha 4 and bound HP 1/2. In control sheep, Ascaris antigen challenge produced early and late increases in specific lung resistance of 380 +/- 42% and 175 +/- 16% over baseline immediately and 7 h after challenge, respectively, as well as airway hyperresponsiveness continuing for 14 d after antigen challenge. Treatment with HP 1/2 (1 mg/kg, i.v.) 30 min before antigen challenge did not affect the early increase in specific lung resistance but inhibited the late-phase increase at 5-8 h by 75% (P < 0.05) and inhibited the post-antigen-induced airway hyperresponsiveness at 1, 2, 7, and 14 d (P < 0.05, for each time). Intravenous HP 1/2 given 2 h after antigen challenge likewise blocked late-phase airway changes and postchallenge airway hyperresponsiveness. Airway administration of HP 1/2 (16-mg dose) was also effective in blocking these antigen-induced changes. Response to HP 1/2 was specific since an isotypic monoclonal antibody, 1E6, was ineffective by intravenous and aerosol administration. Inhibition of leukocyte recruitment did not totally account for the activity of anti-alpha 4 antibody since HP 1/2 neither diminished the eosinopenia or lymphopenia that followed antigen challenge nor consistently altered the composition of leukocytes recovered by bronchoalveolar lavage. Because airway administration of HP 1/2 was also active, HP 1/2 may have inhibited cell activation. Reduction of platelet-activating factor

  2. Synthesis of 16 alpha-/sub 3/H androgen and estrogen substrates for 16 alpha-hydroxylase

    SciTech Connect

    Cantineau, R.; Kremers, P.; De Graeve, J.; Cornelis, A.; Laszlo, P.; Gielen, J.E.; Lambotte, R.

    1981-02-01

    The synthesis of 16 alpha-/sup 3/H androgens and estrogens is described. 1-(/sup 3/H)-Acetic acid in the presence of zinc dust reacts with 16 alpha-bromo-17-ketosteroids to produce 16 alpha-/sup 3/H-17-ketosteroids. This chemical reaction was used to prepare 16 alpha-/sup 3/H-dehydroepiandrosterone (I) and 16 alpha-/sub 4/H-estrone acetate (XI) from 16 alpha-bromo-dehydroepiandrosterone (X) and from 16 alpha-bromo-estrone acetate (XII), respectively. Using appropriate microbiological techniques, it was possible to convert these radiolabelled substrates into 16 alpha-/sup 3/H-androstenedione (II) and 16 alpha-/sup 3/H-estradiol-17 beta (VII). 16 alpha-/sup 3/H-Estrone (VI) was obtained by the chemical hydrolysis of 16 alpha-/sup 3/H-estrone acetate. The label distribution as determined by microbiological 16 alpha-hydroxylations indicated a specific labelling of 77% for androgens and 65% for estrogens in the 16 alpha position. These substrates can be used for measuring the 16 alpha hydroxylase activity, an important step in the biosynthesis of estriol (VIII) and estetrol (IX).

  3. Prediction of {alpha}-decay half-lives and Q{sub {alpha}} values of superheavy nuclei by a global potential for {alpha} + nucleus systems

    SciTech Connect

    Sahu, Basudeb

    2011-09-15

    An approach we have proposed recently for calculation of Q{sub {alpha}} energy and decay half-life T{sub 1/2}{sup {alpha}} on the {alpha} decay of radioactive heavy ions is applied to the evaluation of these two important parameters for the nuclei in the superheavy region Z = 112-118 for which experimental data are not available. It is shown that the {alpha} + nucleus potential represented by an exactly solvable potential used in the calculation could be expressed in terms of proton (Z) and neutron (N) numbers of the {alpha} emitter so that varieties of {alpha}-emitting nuclei differing in their Z and N values could be addressed for their decay properties without the help of any adjustable parameter and the results of Q{sub {alpha}} and T{sub 1/2}{sup {alpha}} for a nucleus are estimated without any prior knowledge of any one of these quantities. This procedure to obtain the values of Q{sub {alpha}} and T{sub 1/2}{sup {alpha}} works well to reproduce the known experimental results for superheavy nuclei and hence, the procedure is expected to provide proper information about these parameters in experiments on {alpha} decay of new nuclei in the superheavy region.

  4. Understanding a Widely Misunderstood Statistic: Cronbach's "Alpha"

    ERIC Educational Resources Information Center

    Ritter, Nicola L.

    2010-01-01

    It is important to explore score reliability in virtually all studies, because tests are not reliable. The present paper explains the most frequently used reliability estimate, coefficient alpha, so that the coefficient's conceptual underpinnings will be understood. Researchers need to understand score reliability because of the possible impact…

  5. Systemic Targeted Alpha Radiotherapy for Cancer

    PubMed Central

    Allen, BJ

    2013-01-01

    Background: The fundamental principles of internal targeted alpha therapy forcancer were established many decades ago.The high linear energy transfer (LET) ofalpha radiation to the targeted cancer cellscauses double strand breaks in DNA. Atthe same time, the short range radiation spares adjacent normal tissues. This targeted approach complements conventional external beam radiotherapy and chemotherapy. Such therapies fail on several fronts, such as lack of control of some primary cancers (e.g. glioblastoma multiforme) and to inhibit the development of lethal metastaticcancer after successful treatment of the primary cancer. Objective: This review charts the developing role of systemic high LET, internalradiation therapy. Method: Targeted alpha therapy is a rapidly advancing experimental therapy thatholds promise to deliver high cytotoxicity to targeted cancer cells. Initially thoughtto be indicated for leukemia and micrometastases, there is now evidence that solidtumors can also be regressed. Results: Alpha therapy may be molecular or physiological in its targeting. Alphaemitting radioisotopes such as Bi-212, Bi-213, At-211 and Ac-225 are used to labelmonoclonal antibodies or proteins that target specific cancer cells. Alternatively, Radium-233 is used for palliative therapy of breast and prostate cancers because of its bone seeking properties. Conclusion: Preclinical studies and clinical trials of alpha therapy are discussedfor leukemia, lymphoma, melanoma, glioblastoma multiforme, bone metastases, ovarian cancer, pancreatic cancer and other cancers. PMID:25505750

  6. Cosmetic use of alpha-hydroxy acids.

    PubMed

    Vidt, D G; Bergfeld, W F

    1997-06-01

    Frequent and daily use of cosmetic and skin-care products that contain alpha-hydroxy acids (AHAs) moisturizes the skin and produces smoother, less-wrinkled skin surfaces. The cosmetic products developed as astringents and exfoliants diminish skin scales and remove excess skin oil. New studies suggest that photodamaged skin improves with AHA treatment. PMID:9188214

  7. Production of alpha-amylase by yeast

    SciTech Connect

    Thomse, K.K.

    1987-01-01

    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  8. Electron Screening Effects on {alpha}-decay

    SciTech Connect

    Musumarra, A.; Bonasera, A.; Del Zoppo, A.; Di Pietro, A.; Figuera, P.; Kimura, S.; Lattuada, M.; Pellegriti, M. G.; Scuderi, V.; Torresi, D.; Farinon, F.; Geissel, H.; Knoebel, R.; Prochazka, A.; Scheidenberger, C.; Nociforo, C.; Behr, K.-H.; Bosch, F.; Boutin, D.; Bruenle, A.

    2009-08-26

    An open problem in Nuclear Astrophysics concerns the understanding of electron-screening effects on nuclear reaction rates at stellar energies. In this framework, we have proposed to investigate the influence of the electron cloud on {alpha}-decay by measuring Q-values and {alpha}-decay half-lives of fully stripped, H-like and He-like ions. These kinds of measurements have been feasible just recently for highly-charged radioactive nuclides by fragmentation of {sup 238}U at relativistic energies at the FRS-ESR facility at GSI. In this way it is possible to produce, efficiently separate and store highly-charged {alpha}-emitters. Candidates for the proposed investigation were carefully selected and will be studied by using the Schottky Mass Spectroscopy technique. In order to establish a solid reference data set, lifetimes and Q{sub {alpha}}-value measurements of the corresponding neutrals have been performed directly at the FRS, by implanting the separated ions into an active Silicon stopper.

  9. E-PERM alpha surface monitor

    SciTech Connect

    Fricke, V.

    1999-12-16

    Innovative Technology Summary Reports are designed to provide potential users with the information they need to quickly determine if a technology would apply to a particular environmental management problem. They are also designed for readers who may recommend that a technology be considered by prospective users. Each report describes a technology, system, or process that has been developed and tested with funding from DOE's Office of Science and Technology (OST). The E-PERM{reg{underscore}sign} Alpha Surface Monitor is an integrating electret ion chamber innovative technology used to measure alpha radiation on surfaces of materials. The technology is best used on surfaces with low contamination levels such as areas with potential for free release, but can also be used in areas with higher levels of contamination. Measurement accuracy and production of the E-PERM {reg{underscore}sign} Alpha Surface Monitor compared favorably with the baseline technology. The innovative technology cost is approximately 28% higher than the baseline with an average unit cost per reading costing %6.04 vs. $4.36; however, the flexibility of the E-PERM{reg{underscore}sign} Alpha Surface Monitor may offer advantages in ALARA, reduction of operator error, waste minimization, and measurement accuracy.

  10. Alpha particles diffusion due to charge changes

    SciTech Connect

    Clauser, C. F. Farengo, R.

    2015-12-15

    Alpha particles diffusion due to charge changes in a magnetized plasma is studied. Analytical calculations and numerical simulations are employed to show that this process can be very important in the pedestal-edge-SOL regions. This is the first study that presents clear evidence of the importance of atomic processes on the diffusion of alpha particles. A simple 1D model that includes inelastic collisions with plasma species, “cold” neutrals, and partially ionized species was employed. The code, which follows the exact particle orbits and includes the effect of inelastic collisions via a Monte Carlo type random process, runs on a graphic processor unit (GPU). The analytical and numerical results show excellent agreement when a uniform background (plasma and cold species) is assumed. The simulations also show that the gradients in the density of the plasma and cold species, which are large and opposite in the edge region, produce an inward flux of alpha particles. Calculations of the alpha particles flux reaching the walls or divertor plates should include these processes.

  11. Cytokine therapeutics: lessons from interferon alpha.

    PubMed Central

    Gutterman, J U

    1994-01-01

    Cytokines are soluble proteins that allow for communication between cells and the external environment. Interferon (IFN) alpha, the first cytokine to be produced by recombinant DNA technology, has emerged as an important regulator of growth and differentiation, affecting cellular communication and signal transduction pathways as well as immunological control. This review focuses on the biological and clinical activities of the cytokine. Originally discovered as an antiviral substance, the efficacy of IFN-alpha in malignant, viral, immunological, angiogenic, inflammatory, and fibrotic diseases suggests a spectrum of interrelated pathophysiologies. The principles learned from in vivo studies will be discussed, particularly hairy cell leukemia, chronic myelogenous leukemia, certain angiogenic diseases, and hepatitis. After the surprising discovery of activity in a rare B-cell neoplasm, IFN-alpha emerged as a prototypic tumor suppressor protein that represses the clinical tumorigenic phenotype in some malignancies capable of differentiation. Regulatory agencies throughout the world have approved IFN-alpha for treatment of 13 malignant and viral disorders. The principles established with this cytokine serve as a paradigm for future development of natural proteins for human disease. PMID:8108387

  12. Alpha 97: Basic Education and Institutional Environments.

    ERIC Educational Resources Information Center

    Hautecoeur, Jean-Paul, Ed.

    This document was published by Alpha, a research program specializing in alternative, experimental approaches to adult basic education. It is an attempt to widen the field and examine the relationship between the micro and macro levels, between the diversity of different practices and the major policy orientations that foster or limit this…

  13. H. cap alpha. in RS CVn binaries

    SciTech Connect

    Bopp, B.W.; Talcott, J.C.

    1980-01-01

    The 1976--78 results of a spectroscopic program to monitor H..cap alpha.. in several RS CVn-type binaries are reported. For six objects well observed over orbital phase, four (HR 4665, HR 5110, sigma Gem, Z Her) show H..cap alpha.. as an absorption feature having a constant ( +- 15%) equivalent width (EW). AR Lac exhibits an absorption profile also, but the EW varies by a factor of three due to partial filling by emission. This variation is sporadic and not phase dependent. The H..cap alpha.. feature in HK Lac shows the most extreme variation: normally seen as an absorption feature with variable EW, it has been observed as a pure emission feature on three spectrograms, showing a blueshift with respect to the photosphere of approx.50--100 km sec/sup -1/. On a single occasion HK Lac showed double H..cap alpha.. emission with a separation of the peaks of approx.300 km sec/sup -1/. These high velocity features are interpreted in terms of prominence-like structure in the atmosphere of the active star.

  14. Method of making nanocrystalline alpha alumina

    DOEpatents

    Siegel, Richard W.; Hahn, Horst; Eastman, Jeffrey A.

    1992-01-01

    Method of making selected phases of nanocrystalline ceramic materials. Various methods of controlling the production of nanocrystalline alpha alumina and titanium oxygen phases are described. Control of the gas atmosphere and use of particular oxidation treatments give rise to the ability to control the particular phases provided in the aluminum/oxygen and titanium/oxygen system.

  15. Alpha and Beta at the B Factories

    SciTech Connect

    Finocchiaro, Giuseppe; /Frascati

    2007-10-15

    We review recent experimental results on time-dependent CP asymmetries in the B system from the BABAR and Belle experiments. Measurements of the {alpha} and {beta} angles of the Unitarity Triangle of the CKM matrix are discussed. These measurements constitute stringent tests of the Standard Model, and are also used to search for new physics.

  16. Coefficient Alpha and Reliability of Scale Scores

    ERIC Educational Resources Information Center

    Almehrizi, Rashid S.

    2013-01-01

    The majority of large-scale assessments develop various score scales that are either linear or nonlinear transformations of raw scores for better interpretations and uses of assessment results. The current formula for coefficient alpha (a; the commonly used reliability coefficient) only provides internal consistency reliability estimates of raw…

  17. MCNP S(. alpha. beta. ) detector scheme

    SciTech Connect

    Hendricks, J.S.; Prael, R.E.

    1990-10-01

    An approximate method to allow S({alpha},{Beta}) thermal collision contributions to point detectors and DXTRAN by Prael has been implemented in MCNP4. The method is described and test results are presented, including some results that indicate inadequacies in the NJOY processing of the nuclear data. 9 refs., 53 figs., 6 tabs.

  18. The Ups and Downs of Alpha Centauri

    NASA Astrophysics Data System (ADS)

    Ayres, Thomas R.

    2013-07-01

    The nearby Alpha Centauri triple system has two solar-type stars in a relatively close orbit (20 au separation), and a dim red dwarf companion -- Proxima -- about 10,000 au away, on the Sun-ward side of the group. The heaviest star -- Alpha Cen A -- is a close twin of the Sun. Its slightly less massive companion -- Alpha Cen B -- is a K-type dwarf, and is the closest star thought to host an exoplanet (Earth-sized, but in a much tighter orbit). The close pair has been scrutinized for more than a decade in X-rays by XMM and Chandra, on a semiannual basis since 2003 and 2005, respectively. However, in recent years only Chandra has been able to cleanly separate the pair, which are approaching closest separation on the sky (only a few arcseconds) in their 80-year orbit. For the past 3 years, the HST STIS spectrograph has joined the crowd, also capturing FUV snapshots of the pair every six months. The Alpha Cen stars provide an important complement to long-term studies of the Sun at high energies. The K-star has displayed a clear 8-year cycle in recent years, while the G-star remains mired in a Maunder-like minimum.

  19. Alpha particles diffusion due to charge changes

    NASA Astrophysics Data System (ADS)

    Clauser, C. F.; Farengo, R.

    2015-12-01

    Alpha particles diffusion due to charge changes in a magnetized plasma is studied. Analytical calculations and numerical simulations are employed to show that this process can be very important in the pedestal-edge-SOL regions. This is the first study that presents clear evidence of the importance of atomic processes on the diffusion of alpha particles. A simple 1D model that includes inelastic collisions with plasma species, "cold" neutrals, and partially ionized species was employed. The code, which follows the exact particle orbits and includes the effect of inelastic collisions via a Monte Carlo type random process, runs on a graphic processor unit (GPU). The analytical and numerical results show excellent agreement when a uniform background (plasma and cold species) is assumed. The simulations also show that the gradients in the density of the plasma and cold species, which are large and opposite in the edge region, produce an inward flux of alpha particles. Calculations of the alpha particles flux reaching the walls or divertor plates should include these processes.

  20. Prolactin increases the synthesis of 7alpha-hydroxypregnenolone, a key factor for induction of locomotor activity, in breeding male Newts.

    PubMed

    Haraguchi, Shogo; Koyama, Teppei; Hasunuma, Itaru; Vaudry, Hubert; Tsutsui, Kazuyoshi

    2010-05-01

    We recently found that the Japanese red-bellied newt, Cynops pyrrhogaster, actively produces 7alpha-hydroxypregnenolone, a previously undescribed amphibian neurosteroid. 7alpha-Hydroxypregnenolone stimulates locomotor activity of male newts. Locomotor activity of male newts increases during the breeding period as in other wild animals, but the molecular mechanism for such a change in locomotor activity is poorly understood. Here we show that the adenohypophyseal hormone prolactin (PRL) stimulates 7alpha-hydroxypregnenolone synthesis in the brain, thus increasing locomotor activity of breeding male newts. In this study, cytochrome P450(7alpha) (CYP7B), a steroidogenic enzyme catalyzing the formation of 7alpha-hydroxypregnenolone, was first identified to analyze seasonal changes in 7alpha-hydroxypregnenolone synthesis. Only males exhibited marked seasonal changes in 7alpha-hydroxypregnenolone synthesis and CYP7B expression in the brain, with a maximum level in the spring breeding period when locomotor activity of males increases. Subsequently we identified PRL as a key component of the mechanism regulating 7alpha-hydroxypregnenolone synthesis. Hypophysectomy decreased 7alpha-hydroxypregnenolone synthesis in the male brain, whereas administration of PRL but not gonadotropins to hypophysectomized males caused a dose-dependent increase in 7alpha-hydroxypregnenolone synthesis. To analyze the mode of PRL action, CYP7B and the receptor for PRL were localized in the male brain. PRL receptor was expressed in the neurons expressing CYP7B in the magnocellular preoptic nucleus. Thus, PRL appears to act directly on neurosteroidogenic magnocellular preoptic nucleus neurons to regulate 7alpha-hydroxypregnenolone synthesis, thus inducing seasonal locomotor changes in male newts. This is the first report describing the regulation of neurosteroidogenesis in the brain by an adenohypophyseal hormone in any vertebrate.