Sample records for alpha gene transfer

  1. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H


    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  2. Genome-Wide Screening of Alpha-Tocopherol Sensitive Genes in Heart Tissue from Alpha-Tocopherol Transfer Protein Null Mice (ATTP−/−)

    PubMed Central

    Vasu, Vihas T.; Hobson, Brad; Gohil, Kishorchandra; Cross, Carroll E.


    Alpha tocopherol transfer protein (ATTP) null mice (ATTP−/−) have a systemic deficiency of alpha-tocopherol (AT). The heart AT levels of ATTP−/− are <10% of those in ATTP+/+ mice. The genomic responses of heart to AT deficiency were determined in 3 months old male ATTP−/− mice and compared with their ATTP+/+ littermate controls using Affymetrix 430A 2.0 high density oligonucleotide arrays. Differential analysis of ~13,000 genes identified repression of genes related to immune system and activation of genes related to lipid metabolism and inflammation with no significant change in the expression of classical antioxidant genes (catalase, superoxide dismutase, glutathione peroxidase) in ATTP−/− as compared to ATTP+/+ mice. The present data identifies novel classes of AT sensitive genes in heart tissue. PMID:17382327

  3. An approach for producing transgenic cloned cows by nuclear transfer of cells transfected with human alpha 1-antitrypsin gene.


    Jang, Goo; Bhuiyan, M M U; Jeon, Hyun Yong; Ko, Kyeong Hee; Park, Hee Jung; Kim, Min Kyu; Kim, Joung Ju; Kang, Sung Keun; Lee, Byeong Chun; Hwang, Woo Suk


    In an attempt to produce transgenic cloned cows secreting alpha 1-antitrypsin (alpha1-AT) protein into milk, bovine cumulus cells were transfected with a plasmid containing an alpha1-AT gene and green fluorescent protein (GFP) reporter gene using Fugene 6 as a lipid carrier. The GFP-expressing cells were selected and transferred into enucleated bovine oocytes. Couplets were fused, chemically activated and cultured. Developmental competence was monitored and the number of inner cell mass (ICM) and trophectoderm (TE) cells in blastocysts were counted after differential staining. The percentage of blastocysts was lower (P < 0.05) in transgenic cloned embryos compared to non-transgenic cloned embryos (23% versus 35%). No difference in the numbers of ICM and TE cells between the two groups of embryos was observed. One or two GFP-expressing blastocysts were transferred into the uterus of each recipient cow. Out of 49 recipient cows, three pregnancies were detected by non-return estrus and rectal palpation. However, the pregnancies failed to maintain to term; two fetuses were aborted at Day 60 and 150, respectively, and one fetus at Day 240. The genomic DNA from the aborted fetus was amplified by polymerase chain reaction (PCR) to investigate integration of the transgene in the fetus. The expected PCR product was sequenced and was identical to the sequence of alpha1-AT transgene. In conclusion, the present study demonstrated that developmental competence of cloned embryos derived from transgenic donor cells was lower than embryos derived from non-transfected donor cells. Although we failed to obtain a viable transgenic cloned calf, integration of alpha1-AT gene into the fetus presents the possibility of producing transgenic cloned cows by somatic cell nuclear transfer.

  4. Gene transfer of master autophagy regulator TFEB results in clearance of toxic protein and correction of hepatic disease in alpha-1-anti-trypsin deficiency.


    Pastore, Nunzia; Blomenkamp, Keith; Annunziata, Fabio; Piccolo, Pasquale; Mithbaokar, Pratibha; Maria Sepe, Rosa; Vetrini, Francesco; Palmer, Donna; Ng, Philip; Polishchuk, Elena; Iacobacci, Simona; Polishchuk, Roman; Teckman, Jeffrey; Ballabio, Andrea; Brunetti-Pierri, Nicola


    Alpha-1-anti-trypsin deficiency is the most common genetic cause of liver disease in children and liver transplantation is currently the only available treatment. Enhancement of liver autophagy increases degradation of mutant, hepatotoxic alpha-1-anti-trypsin (ATZ). We investigated the therapeutic potential of liver-directed gene transfer of transcription factor EB (TFEB), a master gene that regulates lysosomal function and autophagy, in PiZ transgenic mice, recapitulating the human hepatic disease. Hepatocyte TFEB gene transfer resulted in dramatic reduction of hepatic ATZ, liver apoptosis and fibrosis, which are key features of alpha-1-anti-trypsin deficiency. Correction of the liver phenotype resulted from increased ATZ polymer degradation mediated by enhancement of autophagy flux and reduced ATZ monomer by decreased hepatic NFκB activation and IL-6 that drives ATZ gene expression. In conclusion, TFEB gene transfer is a novel strategy for treatment of liver disease of alpha-1-anti-trypsin deficiency. This study may pave the way towards applications of TFEB gene transfer for treatment of a wide spectrum of human disorders due to intracellular accumulation of toxic proteins.

  5. Adenovirus-mediated transfer of a gene encoding cholesterol 7 alpha-hydroxylase into hamsters increases hepatic enzyme activity and reduces plasma total and low density lipoprotein cholesterol.

    PubMed Central

    Spady, D K; Cuthbert, J A; Willard, M N; Meidell, R S


    Clinical interventions that accelerate conversion of cholesterol to bile acids reduce circulating low density lipoprotein (LDL) cholesterol concentrations. The initial and rate-limiting step in the bile acid biosynthetic pathway is catalyzed by hepatic cholesterol 7 alpha-hydroxylase. To examine the effects of transient primary overexpression of this enzyme on sterol metabolism and lipoprotein transport, we constructed a recombinant adenovirus in which a cDNA encoding rat 7 alpha-hydroxylase is expressed from the human cytomegalovirus immediate-early promoter (AdCMV7 alpha). Syrian hamsters administered AdCMV7 alpha intravenously accumulated transgene-specific mRNA in the liver and demonstrated a dose-dependent increase in hepatic microsomal 7 alpha-hydroxylase activity. The increased conversion of cholesterol to bile acids resulted in a compensatory increase in hepatic cholesterol synthesis. In addition, overexpression of 7 alpha-hydroxylase reduced the rate of LDL cholesterol entry into the plasma space and, in animals maintained on a Western-type diet, restored hepatic LDL receptor expression. As a consequence, plasma LDL concentrations fell by approximately 60% in animals maintained on control diet and by approximately 75% in animals consuming a Western-type diet. Plasma high density lipoprotein cholesterol levels were reduced to a lesser degree. These results demonstrate that transient upregulation of bile acid synthesis by direct transfer of a 7 alpha-hydroxylase gene favorably alters circulating lipoprotein profiles and suggest one potential molecular target for genetic strategies aimed at reducing cardiovascular risk. Images PMID:7635963

  6. Alpha-tocopherol transfer protein gene inhibition enhances the acquired immune response during malaria infection in mice.


    Herbas, Maria Shirley; Natama, Magloire Hamtandi; Suzuki, Hiroshi


    Immune response to malaria infection is complex and seems to be regulated by innate and adaptive immune response as well as environmental factors such as host genetics and nutritional status. Previously, we have reported that α-tocopherol transfer protein knockout (α-ttp(Δ)) mice, showing low concentrations of α-tocopherol in circulation, infected with Plasmodium berghei NK65 survived significantly longer as compared with the wild-type mice. In addition, Plasmodium yoelii XL-17, a lethal strain, showed non-lethal virulence in α-ttp(Δ) mice. Thus, we hypothesized that the ability of the α-ttp(Δ) mice to control P. yoelli XL-17 proliferation may allow them to build an efficient immune response against murine malaria infection. On 15 days after infection with P. yoelli XL-17, α-ttp(Δ) mice were challenged to infection with P. berghei NK65. Results indicated that α-ttp(Δ) mice infected with P. yoelli XL-17 built a protective immunity against P. berghei NK65 associated to extremely low levels of parasitemia, a controlled inflammatory response, and a robust antibody response. Moreover, the importance of α-tocopherol for parasite proliferation was remarkable. The results suggest that inhibition of α-tocopherol transfer protein activity is effective for the enhancement of acquired immunity in murine malaria infection.

  7. Recombination and horizontal transfer of nodulation and ACC deaminase (acdS) genes within Alpha- and Betaproteobacteria nodulating legumes of the Cape Fynbos biome.


    Lemaire, Benny; Van Cauwenberghe, Jannick; Chimphango, Samson; Stirton, Charles; Honnay, Olivier; Smets, Erik; Muasya, A Muthama


    The goal of this work is to study the evolution and the degree of horizontal gene transfer (HGT) within rhizobial genera of both Alphaproteobacteria (Mesorhizobium, Rhizobium) and Betaproteobacteria (Burkholderia), originating from South African Fynbos legumes. By using a phylogenetic approach and comparing multiple chromosomal and symbiosis genes, we revealed conclusive evidence of high degrees of horizontal transfer of nodulation genes among closely related species of both groups of rhizobia, but also among species with distant genetic backgrounds (Rhizobium and Mesorhizobium), underscoring the importance of lateral transfer of symbiosis traits as an important evolutionary force among rhizobia of the Cape Fynbos biome. The extensive exchange of symbiosis genes in the Fynbos is in contrast with a lack of significant events of HGT among Burkholderia symbionts from the South American Cerrado and Caatinga biome. Furthermore, homologous recombination among selected housekeeping genes had a substantial impact on sequence evolution within Burkholderia and Mesorhizobium. Finally, phylogenetic analyses of the non-symbiosis acdS gene in Mesorhizobium, a gene often located on symbiosis islands, revealed distinct relationships compared to the chromosomal and symbiosis genes, suggesting a different evolutionary history and independent events of gene transfer. The observed events of HGT and incongruence between different genes necessitate caution in interpreting topologies from individual data types.

  8. Purification of the Lewis blood-group gene associated alpha-3/4-fucosyltransferase from human milk: an enzyme transferring fucose primarily to type 1 and lactose-based oligosaccharide chains.


    Johnson, P H; Watkins, W M


    A soluble Lewis blood-group gene associated alpha-3/4-L-fucosyltransferase has been purified from human milk by a series of steps involving hydrophobic chromatography on Phenyl Sepharose 4B, ion exchange chromatography on CM-Sephadex C-50, affinity chromatography on GDP-hexanolamine Sepharose 4B and gel filtration on Sephacryl S-200. The first step separated alpha-3-L-fucosyltransferase activity directed towards N-acetylglucosamine in Type 2 (Gal beta 1-4GlcNAc-R) acceptors from an alpha-3/4-fucosyltransferase fraction acting on both Type 1 (Gal beta 1-3GlcNAc-R) and Type 2 acceptors. Further purification of this latter fraction on CM-Sephadex and GDP-hexanolamine Sepharose gave a single peak of fucosyltransferase activity that catalysed the addition of fucose to N-acetylglucosamine in both Type 1 and Type 2 acceptors and to the O-3 position of glucose in lactose-based oligosaccharides. The enzyme preparation at this stage resembled previously described alpha-3/4-fucosyltransferase preparations purified from human milk. However, gel filtration of this preparation on Sephacryl S-200 or Sephadex G-150 separated further amounts of alpha-3-fucosyltransferase activity acting solely on Type 2 acceptors and left a residual alpha-3/4-fucosyltransferase that retained strong alpha-4 activity with the Type 1 acceptor, lacto-N-biose 1, and alpha-3 activity with 2'-fucosyllactose, but had relatively little alpha-3 activity with N-acetyllactosamine and virtually no capacity to transfer fucose to glycoproteins with N-linked oligosaccharide chains having unsubstituted terminal Type 2 structures.

  9. Inferring Horizontal Gene Transfer

    PubMed Central

    Lassalle, Florent; Dessimoz, Christophe


    Horizontal or Lateral Gene Transfer (HGT or LGT) is the transmission of portions of genomic DNA between organisms through a process decoupled from vertical inheritance. In the presence of HGT events, different fragments of the genome are the result of different evolutionary histories. This can therefore complicate the investigations of evolutionary relatedness of lineages and species. Also, as HGT can bring into genomes radically different genotypes from distant lineages, or even new genes bearing new functions, it is a major source of phenotypic innovation and a mechanism of niche adaptation. For example, of particular relevance to human health is the lateral transfer of antibiotic resistance and pathogenicity determinants, leading to the emergence of pathogenic lineages [1]. Computational identification of HGT events relies upon the investigation of sequence composition or evolutionary history of genes. Sequence composition-based ("parametric") methods search for deviations from the genomic average, whereas evolutionary history-based ("phylogenetic") approaches identify genes whose evolutionary history significantly differs from that of the host species. The evaluation and benchmarking of HGT inference methods typically rely upon simulated genomes, for which the true history is known. On real data, different methods tend to infer different HGT events, and as a result it can be difficult to ascertain all but simple and clear-cut HGT events. PMID:26020646

  10. Expression of human alpha1-antitrypsin in mice and dogs following AAV6 vector-mediated gene transfer to the lungs.


    Halbert, Christine L; Madtes, David K; Vaughan, Andrew E; Wang, Zejing; Storb, Rainer; Tapscott, Stephen J; Miller, A Dusty


    We evaluated the potential of lung-directed gene therapy for alpha1-antitrypsin (AAT) deficiency using an adeno-associated virus type 6 (AAV6) vector containing a human AAT (hAAT) complementary DNA (cDNA) delivered to the lungs of mice and dogs. The results in normal and immune-deficient mice showed that hAAT concentrations were much higher in lung fluid than in plasma, and therapeutic levels were obtained even in normal mice. However, in normal mice an immune response against the vector and/or transgene limited long-term gene expression. An AAV6 vector expressing a marker protein verified that AAV6 vectors efficiently transduced lung cells in dogs. Delivery of AAV6-hAAT resulted in low levels of hAAT in dog serum but therapeutic levels in the lung that persisted for at least 58 days to 4 months in three immunosuppressed dogs. Expression in the serum was not detectable after 45 days in one nonimmune suppressed dog. A lymphoproliferative response to AAV capsid but not to hAAT was detected even after immunosuppression. These results in mice and dogs show the feasibility of expression of therapeutic levels of AAT in the lungs after AAV vector delivery, and advocate for approaches to prevent cellular immune responses to AAV capsid proteins for persistence of gene expression in humans.

  11. Challenges and Prospects for Alpha-1 Antitrypsin Deficiency Gene Therapy.


    Wozniak, Joanna; Wandtke, Tomasz; Kopinski, Piotr; Chorostowska-Wynimko, Joanna


    Alpha-1 antitrypsin (AAT) is a protease inhibitor belonging to the serpin family. A number of identified mutations in the SERPINA1 gene encoding this protein result in alpha-1 antitrypsin deficiency (AATD). A decrease in AAT serum concentration or reduced biological activity causes considerable risk of chronic respiratory and liver disorders. As a monogenic disease, AATD appears to be an attractive target for gene therapy, particularly for patients with pulmonary dysfunction, where augmentation of functional AAT levels in plasma might slow down respiratory disease development. The short AAT coding sequence and its activity in the extracellular matrix would enable an increase in systemic serum AAT production by cellular secretion. In vitro and in vivo experimental AAT gene transfer with gamma-retroviral, lentiviral, adenoviral, and adeno-associated viral (AAV) vectors has resulted in enhanced AAT serum levels and a promising safety profile. Human clinical trials using intramuscular viral transfer with AAV1 and AAV2 vectors of the AAT gene demonstrated its safety, but did not achieve a protective level of AAT >11 μM in serum. This review provides an in-depth critical analysis of current progress in AATD gene therapy based on viral gene transfer. The factors affecting transgene expression levels, such as site of administration, dose and type of vector, and activity of the immune system, are discussed further as crucial variables for optimizing the clinical effectiveness of gene therapy in AATD subjects.

  12. Lateral gene transfer, rearrangement, reconciliation

    PubMed Central


    Background Models of ancestral gene order reconstruction have progressively integrated different evolutionary patterns and processes such as unequal gene content, gene duplications, and implicitly sequence evolution via reconciled gene trees. These models have so far ignored lateral gene transfer, even though in unicellular organisms it can have an important confounding effect, and can be a rich source of information on the function of genes through the detection of transfers of clusters of genes. Result We report an algorithm together with its implementation, DeCoLT, that reconstructs ancestral genome organization based on reconciled gene trees which summarize information on sequence evolution, gene origination, duplication, loss, and lateral transfer. DeCoLT optimizes in polynomial time on the number of rearrangements, computed as the number of gains and breakages of adjacencies between pairs of genes. We apply DeCoLT to 1099 gene families from 36 cyanobacteria genomes. Conclusion DeCoLT is able to reconstruct adjacencies in 35 ancestral bacterial genomes with a thousand gene families in a few hours, and detects clusters of co-transferred genes. DeCoLT may also be used with any relationship between genes instead of adjacencies, to reconstruct ancestral interactions, functions or complexes. Availability PMID:24564205

  13. Adenovirus-mediated transfer of a recombinant human alpha 1-antitrypsin cDNA to human endothelial cells.

    PubMed Central

    Lemarchand, P; Jaffe, H A; Danel, C; Cid, M C; Kleinman, H K; Stratford-Perricaudet, L D; Perricaudet, M; Pavirani, A; Lecocq, J P; Crystal, R G


    To evaluate the feasibility of using a replication-deficient recombinant adenovirus to transfer human genes to the human endothelium, human umbilical vein endothelial cells were infected in vitro with adenovirus vectors containing the lacZ gene or a human alpha 1-antitrypsin (alpha 1AT) cDNA. After in vitro infection with the lacZ adenovirus vector, cultured endothelial cells expressed beta-galactosidase. In parallel studies with the alpha 1AT adenovirus vector, infected cells expressed human alpha 1AT transcripts, as evidenced by in situ hybridization and Northern analysis, and de novo synthesized and secreted glycosylated, functional alpha 1AT within 6 hr of infection, as shown by [35S]methionine labeling and immunoprecipitation. Quantification of the culture supernatants demonstrated 0.3-0.6 micrograms of human alpha 1AT secreted per 10(6) cells in 24 hr, for at least 14 days after adenovirus vector infection. To demonstrate the feasibility of direct transfer of genes into endothelial cells in human blood vessels, lacZ or alpha 1AT adenovirus vectors were placed in the lumen of intact human umbilical veins ex vivo. Histologic evaluation of the veins after 24 hr demonstrated transfer and expression of the lacZ gene specifically to the endothelium. alpha 1AT adenovirus infection resulted both in expression of alpha 1AT transcripts in the endothelium and in de novo synthesis and secretion of alpha 1AT. Quantification of alpha 1AT in the vein perfusates showed average levels of 13 micrograms/ml after 24 hr. These observations strongly support the feasibility of in vivo human gene transfer to the endothelium mediated by replication-deficient adenovirus vectors. Images PMID:1631146

  14. Panspermia and horizontal gene transfer

    NASA Astrophysics Data System (ADS)

    Klyce, Brig


    Evidence that extremophiles are hardy and ubiquitous is helping to make panspermia a respectable theory. But even if life on Earth originally came from space, biologists assume that the subsequent evolution of life is still governed by the darwinian paradigm. In this review we show how panspermia could amend darwinism and point to a cosmic source for, not only extremophiles but, all of life. This version of panspermia can be called "strong panspermia." To support this theory we will discuss recent evidence pertaining to horizontal gene transfer, viruses, genes apparently older than the Earthly evolution of the features they encode, and primate-specific genes without identifiable precursors.

  15. Isolation and characterization of the human Gs alpha gene.

    PubMed Central

    Kozasa, T; Itoh, H; Tsukamoto, T; Kaziro, Y


    The gene for Gs alpha (the alpha subunit of the guanine nucleotide-binding protein Gs) was isolated from human genomic libraries using rat Gs alpha cDNA as a probe. Comparison of the nucleotide sequence of the human gene with that of the rat cDNA revealed that the human Gs alpha gene spans approximately equal to 20 kilobases and is composed of 13 exons and 12 introns. Genomic Southern blot analysis suggests that the human haploid genome contains a single Gs alpha gene. Previous reports indicated the presence of multiple species of Gs alpha cDNA. The structure of the human Gs alpha gene suggests that four types of Gs alpha mRNAs may be generated from a single Gs alpha gene by alternate use of exon 3 and/or of two 3' splice sites of intron 3, where an unusual splice junction sequence (TG) instead of the consensus (AG) is used. S1 nuclease mapping analysis of human Gs alpha mRNA identified multiple transcriptional initiation sites. The promoter region of the human Gs alpha gene has extremely high G + C content (85%). It contains 4 "GC" boxes, but no typical "TATA" or "CAAT" box sequence. In the 5' flanking region, there are several blocks of sequences that are similar to the sequences of the 5' flanking region of the human c-Ki-ras2 gene. Images PMID:3127824

  16. Population of mixed-symmetry states via {alpha} transfer reactions

    SciTech Connect

    Alonso, C. E.; Arias, J. M.; Fortunato, L.; Vitturi, A.; Pietralla, N.


    Within the neutron-proton interacting boson model we study the population of mixed-symmetry states via {alpha} transfer processes. Closed expressions are deduced in the case of the limiting U{sub {pi}}{sub +{nu}}(5) and SU{sub {pi}}{sub +{nu}}(3). We find that the population of the lowest mixed-symmetry 2{sup +} state, vanishing along the N{sub {pi}}=N{sub {nu}} line, depends on the number of active bosons and is normally smaller than that of the lowest full symmetric 2{sup +} state. In particular, for deformed nuclei where the number of bosons is normally large, the relative population of the mixed-symmetry 2{sup +} state is of the order of a few percent. More favorable cases can be found near shell closures, as in the case of {alpha} transfer leading to {sup 140}Ba.

  17. Identification of Dictyostelium G alpha genes expressed during multicellular development.

    PubMed Central

    Hadwiger, J A; Wilkie, T M; Strathmann, M; Firtel, R A


    Guanine nucleotide-binding protein (G protein)-mediated signal transduction constitutes a common mechanism by which cells receive and respond to a diverse set of environmental signals. Many of the signals involved in the developmental life cycle of the slime mold Dictyostelium have been postulated to be transduced by such pathways and, in some cases, these pathways have been demonstrated to be dependent on specific G proteins. Using the polymerase chain reaction, we have identified two additional Dictyostelium G alpha genes, G alpha 4 and G alpha 5, that are developmentally regulated. Transcripts from both of these genes are primarily expressed during the multicellular stages of development, suggesting possible roles in cell differentiation or morphogenesis. The entire G alpha 4 gene was sequenced and found to encode a protein consisting of 345 amino acids. The G alpha 4 subunit is homologous to other previously identified G alpha subunits, including the Dictyostelium G alpha 1 (43% identity) and G alpha 2 (41% identity) subunits. However, the G alpha 4 subunit contains some unusual sequence divergences in residues highly conserved among most eukaryotic G alpha subunits, suggesting that G alpha 4 may be a member of another class of G alpha subunits. Images PMID:1910174

  18. Fibrinogen {alpha} genes: Conservation of bipartite transcripts and carboxy-terminal-extended {alpha} subunits in vertebrates

    SciTech Connect

    Fu, Y.; Cao, Y.; Hertzberg, K.M.; Grieninger, G.


    All three well-studied subunits of the clotting protein fibrinogen ({alpha}, {beta}, {gamma}) share N-terminal structural homologies, but until recently only the {beta} and {gamma} chains were recognized as having similar globular C-termini. With the discovery of an extra exon in the human fibrinogen {alpha} gene (exon VI), a minor form of the {alpha} subunit ({alpha}{sub E}) with an extended {beta}- and {gamma}-like C-terminus has been identified. In the present study, the polymerase chain reaction has been used to identify sequences that encode counterparts to {alpha}{sub E} in chicken, rabbit, rat, and baboon. The basic six-exon structure of the fibrinogen {alpha} genes is shown to be conserved among mammals and birds, as are the intron positions. Bipartite transcripts - still bearing an intron prior to the last exon - are found among the products of the various vertebrate fibrinogen {alpha} genes. The last exon represents the largest conserved segment of the gene and, in each species examined, encodes exactly 236 amino acids. The C-termini of these {alpha}{sub E} chains align without a single gap and are between 76 and 99% identical. Since the exon VI-encoded domain of {alpha}{sub E} is as well conserved as the corresponding regions of the {beta} and {gamma} chains, it follows that it is equally important and that {alpha}{sub E}-fibrinogen plays a vital, if as-yet unrecognized physiological role. 21 refs., 7 figs., 1 tab.

  19. The chromosomal arrangement of human alpha-like globin genes: sequence homology and alpha-globin gene deletions.


    Lauer, J; Shen, C K; Maniatis, T


    We report the isolation of a cluster of four alpha-like globin genes from a bacteriophage lambda library of human DNA (Lawn et al., 1978). Analysis of the cloned DNA confirms the linkage arrangement of the two adult alpha-globin genes (alpha 1 and alpha 2) previously derived from genomic blotting experiments (Orkin, 1978) and identifies two additional closely linked alpha-like genes. The nucleotide sequence of a portion of each of these alpha-like genes was determined. One of these sequences is tentatively identified as an embryonic zeta-globin gene (zeta 1) by comparison with structural data derived from purified zeta-globin protein (J. Clegg, personal communication), while the other sequence cannot be matched with any known alpha-like polypeptide sequence (we designate this sequence phi alpha 1). Localization of the four alpha-like sequences on a restriction map of the gene cluster indicates that the genes have the same transcriptional orientation and are arranged in the order 5'-zeta 1-phi alpha 1-alpha 2-alpha 1-3'. Genomic blotting experiments identified a second, nonallelic zeta-like globin gene (phi 2) located 10-12 kb 5' to the cloned zeta-globin gene. Comparison of the locations of restriction sites within alpha 1 and alpha 2 and heteroduplex studies reveal extensive sequence homology within and flanking the two genes. The homologous sequences, which are interrupted by two blocks of nonhomology, span a region of approximately 4 kb. This extensive sequence homology between two genes which are thought to be the products of an ancient duplication event suggests the existence of a mechanism for sequence matching during evolution. One consequence of this arrangement of homologous sequences is the occurrence of two types of deletions in recombinant phage DNA during propagation in E. coli. The locations and sizes of the two types of deletions are indistinguishable from those of the two types of deletions associated with alpha-thalassemia 2 (Embury et al., 1979

  20. Alpha thalassaemia and extended alpha globin genes in Sri Lanka.


    Suresh, Sasikala; Fisher, Christopher; Ayyub, Helena; Premawardhena, Anuja; Allen, Angela; Perera, Ashok; Bandara, Dayananda; Olivieri, Nancy; Weatherall, David


    The α-globin genes were studied in nine families with unexplained hypochromic anaemia and in 167 patients with HbE β thalassaemia in Sri Lanka. As well as the common deletion forms of α(+) thalassaemia three families from an ethnic minority were found to carry a novel form of α(0) thalassaemia, one family carried a previously reported form of α(0) thalassaemia, --(THAI), and five families had different forms of non-deletional thalassaemia. The patients with HbE β thalassaemia who had co-inherited α thalassaemia all showed an extremely mild phenotype and reduced levels of HbF and there was a highly significant paucity of α(+) thalassaemia in these patients compared with the normal population. Extended α gene arrangements, including ααα, αααα and ααααα, occurred at a low frequency and were commoner in the more severe phenotypes of HbE β thalassaemia. As well as emphasising the ameliorating effect of α thalassaemia on HbE β thalassaemia the finding of a novel form of α(0) thalassaemia in an ethnic minority, together with an unexpected diversity of forms of non-deletion α thalassaemia in Sri Lanka, further emphasises the critical importance of micro-mapping populations for determining the frequency of clinically important forms of the disease.

  1. Targeting Radiotherapy to Cancer by Gene Transfer

    PubMed Central


    Targeted radionuclide therapy is an alternative method of radiation treatment which uses a tumor-seeking agent carrying a radioactive atom to deposits of tumor, wherever in the body they may be located. Recent experimental data signifies promise for the amalgamation of gene transfer with radionuclide targeting. This review encompasses aspects of the integration of gene manipulation and targeted radiotherapy, highlighting the possibilities of gene transfer to assist the targeting of cancer with low molecular weight radiopharmaceuticals. PMID:12721515

  2. Lateral Gene Transfer from the Dead

    PubMed Central

    Szöllősi, Gergely J.; Tannier, Eric; Lartillot, Nicolas; Daubin, Vincent


    In phylogenetic studies, the evolution of molecular sequences is assumed to have taken place along the phylogeny traced by the ancestors of extant species. In the presence of lateral gene transfer, however, this may not be the case, because the species lineage from which a gene was transferred may have gone extinct or not have been sampled. Because it is not feasible to specify or reconstruct the complete phylogeny of all species, we must describe the evolution of genes outside the represented phylogeny by modeling the speciation dynamics that gave rise to the complete phylogeny. We demonstrate that if the number of sampled species is small compared with the total number of existing species, the overwhelming majority of gene transfers involve speciation to and evolution along extinct or unsampled lineages. We show that the evolution of genes along extinct or unsampled lineages can to good approximation be treated as those of independently evolving lineages described by a few global parameters. Using this result, we derive an algorithm to calculate the probability of a gene tree and recover the maximum-likelihood reconciliation given the phylogeny of the sampled species. Examining 473 near-universal gene families from 36 cyanobacteria, we find that nearly a third of transfer events (28%) appear to have topological signatures of evolution along extinct species, but only approximately 6% of transfers trace their ancestry to before the common ancestor of the sampled cyanobacteria. [Gene tree reconciliation; lateral gene transfer; macroevolution; phylogeny.] PMID:23355531

  3. Biased gene transfer in microbial evolution.


    Andam, Cheryl P; Gogarten, J Peter


    Horizontal gene transfer (HGT) is an important evolutionary process that allows the spread of innovations between distantly related organisms. We present evidence that prokaryotes (bacteria and archaea) are more likely to transfer genetic material with their close relatives than with distantly related lineages. This bias in transfer partners can create phylogenetic signals that are difficult to distinguish from the signal created through shared ancestry. Preferences for transfer partners can be revealed by studying the distribution patterns of divergent genes with identical functions. In many respects, these genes are similar to alleles in a population, except that they coexist only in higher taxonomic groupings and are acquired by a species through HGT. We also discuss the role of biased gene transfer in the formation of taxonomically recognizable natural groups in the tree or net of life.

  4. Cloning and targeted mutations of G alpha 7 and G alpha 8, two developmentally regulated G protein alpha-subunit genes in Dictyostelium.

    PubMed Central

    Wu, L; Gaskins, C; Zhou, K; Firtel, R A; Devreotes, P N


    GTP-binding protein (G protein)-mediated signal transduction pathways play essential roles during the aggregation and differentiation process of Dictyostelium. In addition to the five known G protein alpha-subunit genes, we recently identified three novel alpha-subunit genes, G alpha 6, G alpha 7, and G alpha 8, using the polymerase chain reaction technique. We present here a more complete analysis of G alpha 7 and G alpha 8. The cDNAs of these two genes were cloned, and their complete nucleotide sequences were determined. Sequence analyses indicate that G alpha 8 possesses some unusual features. It lacks the "TCATDT" motif, a sequence of amino acids highly conserved among G alpha subunits, and has an additional 50 amino acids at its C-terminus consisting of long stretches of asparagine. Moreover, G alpha 8 is unusually resistant to protease digestion, which may indicate a slow GTP hydrolysis rate. The possible functions of these alpha-subunits were assessed by generating mutants lacking G alpha 7 or G alpha 8 by gene targeting through homologous recombination and by overexpressing G alpha 7 or G alpha 8 protein. Overexpression of G alpha 7 resulted in abnormal morphogenesis starting at the slug stage, whereas analysis of the other strains failed to reveal any obvious growth or developmental defects under either normal or stressful conditions. The implications of these results are discussed. Images PMID:7949425

  5. Human GABAA receptor alpha 1 and alpha 3 subunits genes and alcoholism.


    Parsian, A; Cloninger, C R


    gamma-Aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the brain. GABA effects are largely mediated by binding to the postsynaptic GABAA receptor, causing the opening of an integral chloride-ion channel. The GABAA antagonists picrotoxin and bicuculline reduce some ethanol-induced behaviors, such as motor impairment, sedation, and hypnosis. The role of this receptor in alcoholism is further supported by effective alleviation of alcohol withdrawal symptoms by GABAA agonists. To determine the role of the GABAA receptor (GABR) genes in the development of alcoholism, we have used alpha 1 and alpha 3 simple sequence repeat polymorphisms in a sample of unrelated alcoholics, alcoholic probands with both parents, and psychiatrically normal controls. For the GABR alpha 1 gene, the differences between allele frequencies, when all alleles were compared together, were not significant between total alcoholics, subtypes of alcoholics, and normal controls. However, for GABR alpha 3, the differences between total alcoholics and normal controls were significant when all alleles were compared together. The differences between subtypes of alcoholics and normal controls were not significant. The results of haplotype relative risk analysis for both genes, GABR alpha 1 and GABR alpha 3, were also negative. It is possible that the sample size in the haplotype relative risk is too small to have power to detect the differences in transmitted versus nontransmitted alleles. There is a need for a replication study in a large family sample that will allow haplotype relative risk or affected sib-pair analysis.

  6. Detecting Highways of Horizontal Gene Transfer

    NASA Astrophysics Data System (ADS)

    Bansal, Mukul S.; Gogarten, J. Peter; Shamir, Ron

    In a horizontal gene transfer (HGT) event a gene is transferred between two species that do not share an ancestor-descendant relationship. Typically, no more than a few genes are horizontally transferred between any two species. However, several studies identified pairs of species between which many different genes were horizontally transferred. Such a pair is said to be linked by a highway of gene sharing. We present a method for inferring such highways. Our method is based on the fact that the evolutionary histories of horizontally transferred genes disagree with the corresponding species phylogeny. Specifically, given a set of gene trees and a trusted rooted species tree, each gene tree is first decomposed into its constituent quartet trees and the quartets that are inconsistent with the species tree are identified. Our method finds a pair of species such that a highway between them explains the largest (normalized) fraction of inconsistent quartets. For a problem on n species, our method requires O(n 4) time, which is optimal with respect to the quartets input size. An application of our method to a dataset of 1128 genes from 11 cyanobacterial species, as well as to simulated datasets, illustrates the efficacy of our method.

  7. Detecting highways of horizontal gene transfer.


    Bansal, Mukul S; Banay, Guy; Gogarten, J Peter; Shamir, Ron


    In a horizontal gene transfer (HGT) event, a gene is transferred between two species that do not have an ancestor-descendant relationship. Typically, no more than a few genes are horizontally transferred between any two species. However, several studies identified pairs of species between which many different genes were horizontally transferred. Such a pair is said to be linked by a highway of gene sharing. We present a method for inferring such highways. Our method is based on the fact that the evolutionary histories of horizontally transferred genes disagree with the corresponding species phylogeny. Specifically, given a set of gene trees and a trusted rooted species tree, each gene tree is first decomposed into its constituent quartet trees and the quartets that are inconsistent with the species tree are identified. Our method finds a pair of species such that a highway between them explains the largest (normalized) fraction of inconsistent quartets. For a problem on n species and m input quartet trees, we give an efficient O(m + n(2))-time algorithm for detecting highways, which is optimal with respect to the quartets input size. An application of our method to a dataset of 1128 genes from 11 cyanobacterial species, as well as to simulated datasets, illustrates the efficacy of our method.

  8. Gene Transfers Between Distantly Related Organisms

    NASA Technical Reports Server (NTRS)

    Doolittle, Russell F.


    With the completion of numerous microbial genome sequences, reports of individual gene transfers between distantly related prokaryotes have become commonplace. On the other hand, transfers between prokaryotes and eukaryotes still excite the imagination. Many of these claims may be premature, but some are certainly valid. In this chapter, the kinds of supporting data needed to propose transfers between distantly related organisms and cite some interesting examples are considered.

  9. Involvement of the clock gene Rev-erb alpha in the regulation of glucagon secretion in pancreatic alpha-cells.


    Vieira, Elaine; Marroquí, Laura; Figueroa, Ana Lucia C; Merino, Beatriz; Fernandez-Ruiz, Rebeca; Nadal, Angel; Burris, Thomas P; Gomis, Ramon; Quesada, Ivan


    Disruption of pancreatic clock genes impairs pancreatic beta-cell function, leading to the onset of diabetes. Despite the importance of pancreatic alpha-cells in the regulation of glucose homeostasis and in diabetes pathophysiology, nothing is known about the role of clock genes in these cells. Here, we identify the clock gene Rev-erb alpha as a new intracellular regulator of glucagon secretion. Rev-erb alpha down-regulation by siRNA (60-70% inhibition) in alphaTC1-9 cells inhibited low-glucose induced glucagon secretion (p<0.05) and led to a decrease in key genes of the exocytotic machinery. The Rev-erb alpha agonist GSK4112 increased glucagon secretion (1.6 fold) and intracellular calcium signals in alphaTC1-9 cells and mouse primary alpha-cells, whereas the Rev-erb alpha antagonist SR8278 produced the opposite effect. At 0.5 mM glucose, alphaTC1-9 cells exhibited intrinsic circadian Rev-erb alpha expression oscillations that were inhibited by 11 mM glucose. In mouse primary alpha-cells, glucose induced similar effects (p<0.001). High glucose inhibited key genes controlled by AMPK such as Nampt, Sirt1 and PGC-1 alpha in alphaTC1-9 cells (p<0.05). AMPK activation by metformin completely reversed the inhibitory effect of glucose on Nampt-Sirt1-PGC-1 alpha and Rev-erb alpha. Nampt inhibition decreased Sirt1, PGC-1 alpha and Rev-erb alpha mRNA expression (p<0.01) and glucagon release (p<0.05). These findings identify Rev-erb alpha as a new intracellular regulator of glucagon secretion via AMPK/Nampt/Sirt1 pathway.

  10. Bacterial Genes in the Aphid Genome: Absence of Functional Gene Transfer from Buchnera to Its Host

    PubMed Central

    Nikoh, Naruo; McCutcheon, John P.; Kudo, Toshiaki; Miyagishima, Shin-ya; Moran, Nancy A.; Nakabachi, Atsushi


    Genome reduction is typical of obligate symbionts. In cellular organelles, this reduction partly reflects transfer of ancestral bacterial genes to the host genome, but little is known about gene transfer in other obligate symbioses. Aphids harbor anciently acquired obligate mutualists, Buchnera aphidicola (Gammaproteobacteria), which have highly reduced genomes (420–650 kb), raising the possibility of gene transfer from ancestral Buchnera to the aphid genome. In addition, aphids often harbor other bacteria that also are potential sources of transferred genes. Previous limited sampling of genes expressed in bacteriocytes, the specialized cells that harbor Buchnera, revealed that aphids acquired at least two genes from bacteria. The newly sequenced genome of the pea aphid, Acyrthosiphon pisum, presents the first opportunity for a complete inventory of genes transferred from bacteria to the host genome in the context of an ancient obligate symbiosis. Computational screening of the entire A. pisum genome, followed by phylogenetic and experimental analyses, provided strong support for the transfer of 12 genes or gene fragments from bacteria to the aphid genome: three LD–carboxypeptidases (LdcA1, LdcA2,ψLdcA), five rare lipoprotein As (RlpA1-5), N-acetylmuramoyl-L-alanine amidase (AmiD), 1,4-beta-N-acetylmuramidase (bLys), DNA polymerase III alpha chain (ψDnaE), and ATP synthase delta chain (ψAtpH). Buchnera was the apparent source of two highly truncated pseudogenes (ψDnaE and ψAtpH). Most other transferred genes were closely related to genes from relatives of Wolbachia (Alphaproteobacteria). At least eight of the transferred genes (LdcA1, AmiD, RlpA1-5, bLys) appear to be functional, and expression of seven (LdcA1, AmiD, RlpA1-5) are highly upregulated in bacteriocytes. The LdcAs and RlpAs appear to have been duplicated after transfer. Our results excluded the hypothesis that genome reduction in Buchnera has been accompanied by gene transfer to the host

  11. Novel gene transfer systems: intelligent gene transfer vectors for gene medicines.


    Nakajima, Toshihiro


    Drug delivery systems for gene transfer are called 'vectors'. These systems were originally invented as a delivery system for the transfection in vitro or in vivo. Several vectors are then developed for clinical use of gene medicines and currently some of them are approved as animal drugs. Conventional drug delivery system generally consists of approved (existing) materials to avoid additional pre-clinical or clinical studies. However, current vectors contain novel materials to improve an efficacy of gene medicines. Thus, these vectors have functions more than a mere delivery of active ingredients. For example some vectors have immunological functions such as adjuvants in vaccines. These new types of vectors are called 'intelligent' or 'innovative' vector system', since the concept or strategy for the development is completely different from conventional drug delivery systems. In this article, we described a current status of 'intelligent gene transfer vectors and discussed on the potentials of them.

  12. Antibody Gene Transfer for HIV Immunoprophylaxis

    PubMed Central

    Balazs, Alejandro B.; West, Anthony P.


    Antibody gene transfer, which involves the delivery of genes that encode potent, broadly neutralizing anti-HIV antibodies, is a promising new strategy to prevent HIV infection. A satellite symposium at the AIDS Vaccine 2012 conference brought together many of the groups working in this field. PMID:23238748

  13. Antibody gene transfer for HIV immunoprophylaxis.


    Balazs, Alejandro B; West, Anthony P


    Antibody gene transfer, which involves the delivery of genes that encode potent, broadly neutralizing antibodies to human immunodeficiency virus (HIV), is a promising new strategy for preventing HIV infection. A satellite symposium at the AIDS Vaccine 2012 conference brought together many of the groups working in this field.

  14. Direct phylogenetic evidence for lateral transfer of elongation factor-like gene.


    Kamikawa, Ryoma; Inagaki, Yuji; Sako, Yoshihiko


    Genes encoding elongation factor-like (EFL) proteins, which show high similarity to elongation factor-1alpha (EF-1alpha), have been found in phylogenetically distantly related eukaryotes. The sporadic distribution of "EFL-containing" lineages within "EF-1alpha-containing" lineages indirectly, but strongly, suggests lateral gene transfer as the principal driving force in EFL evolution. However, one of the most critical aspects in the above hypothesis, the donor lineages in any putative cases of lateral EFL gene transfer, remained unclear. In this study, we provide direct evidence for lateral transfer of an EFL gene through the analyses of 10 diatom EFL genes. All diatom EFL homologues tightly clustered in phylogenetic analyses, suggesting acquisition of the exogenous EFL gene early in diatom evolution. Our survey additionally identified Thalassiosira pseudonana as a eukaryote bearing EF-1alpha and EFL genes and secondary EFL gene loss in Phaeodactylum tricornutum, the complete genome of which encodes only the EF-1alpha gene. Most importantly, the EFL phylogeny recovered a robust grouping of homologues from diatoms, the cercozoan Bigelowiella natans, and the foraminifer Planoglabratella opecularis, with the diatoms nested within the Bigelowiella plus Planoglabratella (Rhizaria) grouping. The particular relationships recovered are further consistent with two characteristic sequence motifs. The best explanation of our data analyses is an EFL gene transfer from a foraminifer to a diatom, the first case in which the donor-recipient relationship was clarified. Finally, based on a reverse transcriptase quantitative PCR assay and the genome information of Thalassiosira and Phaeodactylum, we propose the loss of elongation factor function in Thalassiosira EF-1alpha.

  15. Increase in expression level of alpha- and beta-tubulin genes in Arabidopsis seedlings under hypergravity conditions

    NASA Astrophysics Data System (ADS)

    Saito, Y.; Soga, K.; Wakabayashi, K.; Hoson, T.

    Hypergravity, a gravitational force of more than 1 g, suppresses elongation growth of shoots of various plants. The analysis of the changes in gene expression by hypergravity treatment in Arabidopsis hypocotyls by the differential display method showed that a gene encoding alpha-tubulin, which is a component of microtubules, was up-regulated by hypergravity [Yoshioka et al. (2003) Adv. Space Res. 31: 2187-2193]. However, the detailed relation between hypergravity treatment and the changes in alpha-tubulin gene levels has not been determined yet. Microtubules are formed by the spontaneous polymerization of dimers consisting of one alpha- and one beta-tubulin protein molecule. Thus, the expression levels of beta-tubulin genes may also be affected by hypergravity. In the present study, we examined the dose-response and the time course relations of change in the expression of both alpha- and beta-tubulin genes in Arabidopsis hypocotyls grown under hypergravity conditions. Elongation growth of Arabidopsis hypocotyls was suppressed by increasing gravity. The expression levels of both alpha- and beta-tubulin genes were increased depending on the magnitude of gravity. At 300 g, expression levels of alpha- and beta-tubulin genes were about 400% and 350% of the 1 g control, respectively. The increases in expression of both tubulin genes were detected within a few hours, when the seedlings grown at 1 g were transferred to hypergravity conditions. The increase in alpha- and beta-tubulin genes preceded or occurred at the same time as growth suppression. These results suggest that Arabidopsis hypocotyls regulate the expression level of alpha- and beta-tubulin genes promptly in response to gravity stimuli. The increase in the amount of microtubules due to the activation of tubulin gene expression may be involved in the regulation by gravity signal of shoot growth.

  16. Human gene transfer: Characterization of human tumor-infiltrating lymphocytes as vehicles for retroviral-mediated gene transfer in man

    SciTech Connect

    Kasid, A.; Morecki, S.; Aebersold, P.; Cornetta, K.; Culver, K.; Freeman, S.; Director, E.; Lotze, M.T.; Blaese, R.M.; Anderson, W.F.; Rosenberg, S.A. )


    Tumor-infiltrating lymphocytes (TILs) are cells generated from tumor suspensions cultured in interleukin 2 that can mediate cancer regression when adoptively transferred into mice or humans. Since TILs proliferate rapidly in vitro, recirculate, and preferentially localize at the tumor site in vivo, they provide an attractive model for delivery of exogenous genetic material into man. To determine whether efficient gene transfer into TILs is feasible. The authors transduced human TILs with the bacterial gene for neomycin-resistance (Neo{sup R}) using the retroviral vector N2. The transduced TIL populations were stable and polyclonal with respect to the intact Neo{sup R} gene integration and expressed high levels of neomycin phosphotransferase activity. The Neo{sup R} gene insertion did not alter the in vitro growth pattern and interleukin 2 dependence of the transduced TILs. Analyses of T-cell receptor gene rearrangement for {beta}- and {gamma}-chain genes revealed the oligoclonal nature of the TIL populations with no major change in the DNA rearrangement patterns or the levels of mRNA expression of the {beta} and {gamma} chains following transduction and selection of TILs in the neomycin analog G418. Human TILs expressed mRNA for tumor necrosis factors ({alpha} and {beta}) and interleukin 2 receptor P55. This pattern of cytokine-mRNA expression was not significantly altered following the transduction of TILs. The studies demonstrate the feasibility of TILs as suitable cellular vehicles for the introduction of therapeutic genes into patients receiving autologous TILs.

  17. Drosophilia alpha-tubulin genes and their transcription patterns.


    Kalfayan, L; Loewenberg, J; Wensink, P C


    There are four different alpha-tubulin genes in D. melanogaster DNA; three of them appear as single copies and the other is present as either one or two copies in the haploid genome. The transcripts of three of these genes were examined. Each of them is complementary to a transcript of different length, implying that each is transcribed. Since these transcripts are found on polysomes, it is likely that they are translated. At least two of the genes are complementary to several transcripts, indicating that each of them has more than one transcription start or stop site or perhaps that there are alternative paths of posttranscriptional processing. There is a different developmental pattern of concentrations for transcripts from each of these genes, and different RNAs from the same gene also have different patterns. We conclude that the concentration of transcripts from each gene appears to be independently controlled and that even different transcription products from the same gene appear to independently controlled.

  18. Intrapleural 'outside-in' gene therapy: therapeutics for organs of the chest via gene transfer to the pleura.


    Heguy, Adriana; Crystal, Ronald G


    The pleural space is an attractive site for using viral vectors to deliver gene products to the lung parenchyma, other thoracic structures and the systemic circulation. The advantages of intrapleural gene transfer using viral vectors include: (i) easy accessibility; (ii) large surface area; (iii) ability to provide high concentrations of secreted gene products to chest structures; (iv) low risk of detrimental effects of possible vector-induced inflammation compared with intravascular delivery; and (v) because it is local, lower vector doses can be used to deliver therapeutic genes to thoracic structures than less efficient systemic routes. Examples of pleural gene transfer include the use of adenovirus vectors to treat mesothelioma by transiently expressing genes that encode toxic proteins, immunomodulatory molecules or anti-angiogenesis factors. Intrapleural delivery of adeno-associated viral vectors represents an efficient strategy to treat alpha1-antitrypsin (alpha1AT) deficiency, achieving high lung and systemic therapeutic levels of alpha1AT. Intrapleural delivery of gene transfer vectors holds promise for the treatment of diseases requiring transient, localized gene expression, as well as sustained expression of genes to correct hereditary disorders requiring localized or systemic expression of the therapeutic protein.

  19. Molecular Transfer of Nematode Resistance Genes

    PubMed Central

    Williamson, V. M.; Ho, J.-Y.; Ma, H. M.


    Recombinant DNA techniques have been used to introduce agronomically valuable traits, including resistance to viruses, herbicides, and insects, into crop plants. Introduction of these genes into plants frequently involves Agrobacterium-mediated gene transfer. The potential exists for applying this technology to nematode control by introducing genes conferring resistance to nematodes. Transferred genes could include those encoding products detrimental to nematode development or reproduction as well as cloned host resistance genes. Host genes that confer resistance to cyst or root-knot nematode species have been identified in many plants. The best characterized is Mi, a gene that confers resistance to root-knot nematodes in tomato. A map-based cloning approach is being used to isolate the gene. For development of a detailed map of the region of the genome surrounding Mi, DNA markers genetically linked to Mi have been identified and analyzed in tomato lines that have undergone a recombination event near Mi. The molecular map will be used to identify DNA corresponding to Mi. We estimate that a clone of Mi will be obtained in 2-5 years. An exciting prospect is that introduction of this gene will confer resistance in plant species without currently available sources of resistance. PMID:19282989

  20. Viral Vectors for in Vivo Gene Transfer

    NASA Astrophysics Data System (ADS)

    Thévenot, E.; Dufour, N.; Déglon, N.

    The transfer of DNA into the nucleus of a eukaryotic cell (gene transfer) is a central theme of modern biology. The transfer is said to be somatic when it refers to non-germline organs of a developed individual, and germline when it concerns gametes or the fertilised egg of an animal, with the aim of transmitting the relevant genetic modification to its descendents [1]. The efficient introduction of genetic material into a somatic or germline cell and the control of its expression over time have led to major advances in understanding how genes work in vivo, i.e., in living organisms (functional genomics), but also to the development of innovative therapeutic methods (gene therapy). The efficiency of gene transfer is conditioned by the vehicle used, called the vector. Desirable features for a vector are as follows: Easy to produce high titer stocks of the vector in a reproducible way. Absence of toxicity related to transduction (transfer of genetic material into the target cell, and its expression there) and no immune reaction of the organism against the vector and/or therapeutic protein. Stability in the expression of the relevant gene over time, and the possibility of regulation, e.g., to control expression of the therapeutic protein on the physiological level, or to end expression at the end of treatment. Transduction of quiescent cells should be as efficient as transduction of dividing cells. Vectors currently used fall into two categories: non-viral and viral vectors. In non-viral vectors, the DNA is complexed with polymers, lipids, or cationic detergents (described in Chap. 3). These vectors have a low risk of toxicity and immune reaction. However, they are less efficient in vivo than viral vectors when it comes to the number of cells transduced and long-term transgene expression. (Naked DNA transfer or electroporation is rather inefficient in the organism. This type of gene transfer will not be discussed here, and the interested reader is referred to the

  1. Alpha-globin gene markers identify genetic differences between Australian aborigines and Melanesians.

    PubMed Central

    Tsintsof, A S; Hertzberg, M S; Prior, J F; Mickleson, K N; Trent, R J


    Australian aborigines exhibit a number of alpha-globin cluster rearrangements involving both alpha- and zeta-globin genes. alpha+-Thalassemia (-alpha/) in this population is heterogeneous and includes the 3.7 types I, II, and III gene deletions. The alpha alpha alpha/ and zeta zeta zeta/ rearrangements are each found in association with two haplotypes, indicating origins from at least two separate DNA crossover events. Differences in alpha-globin cluster rearrangements and in haplotypes between Australian aborigines, Papua New Guinea highlanders and island Melanesians, are consistent with multiple colonizing events into Australia. PMID:2294746

  2. 3 alpha-hydroxysteroid dehydrogenase: three dimensional structure and gene regulation.


    Penning, T M


    Mammalian 3 alpha-hydroxysteroid dehydrogenases (3 alpha-HSDs) regulate steroid hormone levels. cDNA cloning indicates that the rat and human liver isoforms display high sequence identity and that they belong to the aldo-keto reductase (AKR) superfamily. Of these the most extensively characterized is rat liver 3 alpha-HSD. The recently solved X-ray crystal structure shows that this enzyme adopts an (alpha/beta)8-barrel scaffold (Hoog et al. 1994). NAD(P)H binds in an extended anti-conformation and lies along the inner surface of the barrel. The nicotinamide ring is stabilized by interaction with Y216. The 4-pro(R)-hydrogen transferred in the reaction is in close proximity to Y55. K84, D50 and H117 which are implicated in catalysis. These residues are located at the base of a hydrophobic pocket which is presumed to be involved in binding steroid hormone. This catalytic tetrad is conserved in members of the AKR superfamily. Mutant enzymes support roles for Y55 in steroid binding and for K84 as the general acid involved in catalysis. The gene for rat 3 alpha-HSD has been cloned and is 47 kb in length and contains 9 exon-intron boundaries which are highly conserved in the human gene(s). The 5'-flanking regions of the rat and human genes contain consensus sequences for AP-1, Oct-1 and multiple copies of perfect and imperfect steroid hormone response elements (REs) (estrogen, glucocorticoid (GRE), and progesterone) which may comprise a steroid response unit (SRU) (Lin & Penning 1995). Constitutive and regulated expression of the rat 3 alpha-HSD gene has been studied by transiently transfecting reporter gene (chloramphenicol acetyltransferase, CAT) constructs into human hepatoma (HepG2) cells. With respect to the transcription start-site (+1), a proximal (-498 to -199bp) and distal (-20 to -4.0kb) enhancer, as well as a powerful silencer (-755 to -498 bp) were located in the promoter. Band-shift and supershift assays provide evidence that Oct-1 binds to the silencer

  3. Genetic analysis of the Drosophila Gs(alpha) gene.


    Wolfgang, W J; Hoskote, A; Roberts, I J; Jackson, S; Forte, M


    One of the best understood signal transduction pathways activated by receptors containing seven transmembrane domains involves activation of heterotrimeric G-protein complexes containing Gs(alpha), the subsequent stimulation of adenylyl cyclase, production of cAMP, activation of protein kinase A (PKA), and the phosphorylation of substrates that control a wide variety of cellular responses. Here, we report the identification of "loss-of-function" mutations in the Drosophila Gs(alpha) gene (dgs). Seven mutants have been identified that are either complemented by transgenes representing the wild-type dgs gene or contain nucleotide sequence changes resulting in the production of altered Gs(alpha) protein. Examination of mutant alleles representing loss-of-Gs(alpha) function indicates that the phenotypes generated do not mimic those created by mutational elimination of PKA. These results are consistent with the conclusion reached in previous studies that activation of PKA, at least in these developmental contexts, does not depend on receptor-mediated increases in intracellular cAMP, in contrast to the predictions of models developed primarily on the basis of studies in cultured cells.

  4. Genetic analysis of the Drosophila Gs(alpha) gene.

    PubMed Central

    Wolfgang, W J; Hoskote, A; Roberts, I J; Jackson, S; Forte, M


    One of the best understood signal transduction pathways activated by receptors containing seven transmembrane domains involves activation of heterotrimeric G-protein complexes containing Gs(alpha), the subsequent stimulation of adenylyl cyclase, production of cAMP, activation of protein kinase A (PKA), and the phosphorylation of substrates that control a wide variety of cellular responses. Here, we report the identification of "loss-of-function" mutations in the Drosophila Gs(alpha) gene (dgs). Seven mutants have been identified that are either complemented by transgenes representing the wild-type dgs gene or contain nucleotide sequence changes resulting in the production of altered Gs(alpha) protein. Examination of mutant alleles representing loss-of-Gs(alpha) function indicates that the phenotypes generated do not mimic those created by mutational elimination of PKA. These results are consistent with the conclusion reached in previous studies that activation of PKA, at least in these developmental contexts, does not depend on receptor-mediated increases in intracellular cAMP, in contrast to the predictions of models developed primarily on the basis of studies in cultured cells. PMID:11454767

  5. Direct transfer of NADH between alpha-glycerol phosphate dehydrogenase and lactate dehydrogenase: fact or misinterpretation?


    Srivastava, D K; Smolen, P; Betts, G F; Fukushima, T; Spivey, H O; Bernhard, S A


    Following the criticism by Chock and Gutfreund [Chock, P.B. & Gutfreund, H. (1988) Proc. Natl. Acad. Sci. USA 85, 8870-8874], that our proposal of direct transfer of NADH between glycerol-3-phosphate dehydrogenase (alpha-glycerol phosphate dehydrogenase, alpha-GDH; EC and L-lactate dehydrogenase (LDH; EC was based on a misinterpretation of the kinetic data, we have reinvestigated the transfer mechanism between this enzyme pair. By using the "enzyme buffering" steady-state kinetic technique [Srivastava, D.K. & Bernhard, S.A. (1984) Biochemistry 23, 4538-4545], we examined the mechanism (random diffusion vs. direct transfer) of transfer of NADH between rabbit muscle alpha-GDH and pig heart LDH. The steady-state data reveal that the LDH-NADH complex and the alpha-GDH-NADH complex can serve as substrate for the alpha-GDH-catalyzed reaction and the LDH-catalyzed reaction, respectively. This is consistent with the direct-transfer mechanism and inconsistent with a mechanism in which free NADH is the only competent substrate for either enzyme-catalyzed reaction. The discrepancy between this conclusion and that of Chock and Gutfreund comes from (i) their incorrect measurement of the Km for NADH in the alpha-GDH-catalyzed reaction, (ii) inadequate design and range of the steady-state kinetic experiments, and (iii) their qualitative assessment of the prediction of the direct-transfer mechanism. Our transient kinetic measurements for the transfer of NADH from alpha-GDH to LDH and from LDH to alpha-GDH show that both are slower than predicted on the basis of free equilibration of NADH through the aqueous environment. The decrease in the rate of equilibration of NADH between alpha-GDH and LDH provides no support for the random-diffusion mechanism; rather, it suggests a direct interaction between enzymes that modulates the transfer rate of NADH. Thus, contrary to Chock and Gutfreund's conclusion, all our experimental data compel us to propose, once again, that

  6. Unsupervised Learning in Detection of Gene Transfer

    PubMed Central

    Hamel, L.; Nahar, N.; Poptsova, M. S.; Zhaxybayeva, O.; Gogarten, J. P.


    The tree representation as a model for organismal evolution has been in use since before Darwin. However, with the recent unprecedented access to biomolecular data, it has been discovered that, especially in the microbial world, individual genes making up the genome of an organism give rise to different and sometimes conflicting evolutionary tree topologies. This discovery calls into question the notion of a single evolutionary tree for an organism and gives rise to the notion of an evolutionary consensus tree based on the evolutionary patterns of the majority of genes in a genome embedded in a network of gene histories. Here, we discuss an approach to the analysis of genomic data of multiple genomes using bipartition spectral analysis and unsupervised learning. An interesting observation is that genes within genomes that have evolutionary tree topologies, which are in substantial conflict with the evolutionary consensus tree of an organism, point to possible horizontal gene transfer events which often delineate significant evolutionary events. PMID:18509479

  7. Mechanism of developmental regulation of alpha pi, the chicken embryonic alpha-globin gene.

    PubMed Central

    Knezetic, J A; Felsenfeld, G


    The chicken alpha pi-globin gene is expressed during development only in the primitive erythrocyte lineage and not in the definitive lineage. We show that stage-specific expression is maintained when plasmids containing the alpha pi promoter are transfected into primitive and definitive lineage primary erythroid cells and that the information contained in the promoter is sufficient to confer this specificity. Detailed analysis of binding sites in the promoter for trans-acting factors, together with studies of the effects of mutagenesis on expression, reveals that the factors critical to stage-specific expression are all present in both primitive and definitive lineages, but at various concentrations. We identify three proteins, an NF1 family member, a Y-box factor, and an Sp1-like factor, which interact to stimulate or inhibit transcription. We propose that the concentration-dependent action of these factors, together with the general erythroid factor GATA-1, is responsible for the stage-specific expression of the alpha pi-globin gene. Images PMID:8336706

  8. Peroxisome proliferator-activated receptor alpha target genes.


    Rakhshandehroo, Maryam; Knoch, Bianca; Müller, Michael; Kersten, Sander


    The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor involved in the regulation of a variety of processes, ranging from inflammation and immunity to nutrient metabolism and energy homeostasis. PPARα serves as a molecular target for hypolipidemic fibrates drugs which bind the receptor with high affinity. Furthermore, PPARα binds and is activated by numerous fatty acids and fatty acid-derived compounds. PPARα governs biological processes by altering the expression of a large number of target genes. Accordingly, the specific role of PPARα is directly related to the biological function of its target genes. Here, we present an overview of the involvement of PPARα in lipid metabolism and other pathways through a detailed analysis of the different known or putative PPARα target genes. The emphasis is on gene regulation by PPARα in liver although many of the results likely apply to other organs and tissues as well.

  9. Peroxisome Proliferator-Activated Receptor Alpha Target Genes

    PubMed Central

    Rakhshandehroo, Maryam; Knoch, Bianca; Müller, Michael; Kersten, Sander


    The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor involved in the regulation of a variety of processes, ranging from inflammation and immunity to nutrient metabolism and energy homeostasis. PPARα serves as a molecular target for hypolipidemic fibrates drugs which bind the receptor with high affinity. Furthermore, PPARα binds and is activated by numerous fatty acids and fatty acid-derived compounds. PPARα governs biological processes by altering the expression of a large number of target genes. Accordingly, the specific role of PPARα is directly related to the biological function of its target genes. Here, we present an overview of the involvement of PPARα in lipid metabolism and other pathways through a detailed analysis of the different known or putative PPARα target genes. The emphasis is on gene regulation by PPARα in liver although many of the results likely apply to other organs and tissues as well. PMID:20936127

  10. Viral vectors for gene transfer: current status of gene therapeutics.


    Heilbronn, Regine; Weger, Stefan


    Gene therapy for the correction of inherited or acquired disease has gained increasing importance in recent years. Successful treatment of children suffering from severe combined immunodeficiency (SCID) was achieved using retrovirus vectors for gene transfer. Encouraging improvements of vision were reported in a genetic eye disorder (LCA) leading to early childhood blindness. Adeno-associated virus (AAV) vectors were used for gene transfer in these trials. This chapter gives an overview of the design and delivery of viral vectors for the transport of a therapeutic gene into a target cell or tissue. The construction and production of retrovirus, lentivirus, and AAV vectors are covered. The focus is on production methods suitable for biopharmaceutical upscaling and for downstream processing. Quality control measures and biological safety considerations for the use of vectors in clinical trials are discussed.

  11. Probable new type of reaction mechanism: Double. cap alpha. direct transfer process

    SciTech Connect

    Xu Shu-wei; Wu Guo-hua; Miao Rong-zhi; Han Fei


    It is assumed that /sup 8/Be consists of two ..cap alpha.. particles which are close to each other in configuration space. A spectroscopic density of /sup 8/Be cluster in the residue nuclei is then obtained, which is proportional to the square of the preformation probability of ..cap alpha.. particle at nuclear surface. Using the improved method of parametrization of EFR-DWBA overlap integral,/sup 1//sup en-dash//sup 2/ we calculate the double differential energy spectra and angular distributions of ..cap alpha.. particles for the reactions /sup 209/Bi (/sup 12/C, ..cap alpha..) /sup 217/Fr and extract the preformation probability of ..cap alpha.. particle at the surface of /sup 217/Fr nuclei from fitting the experimental data. The agreement within the range of calculation error between the preformation probabilities extracted from transfer reactions and ..cap alpha.. decay suggests that the reaction /sup 209/Bi(/sup 12/C, ..cap alpha..) /sup 217/Fr may be explained as a double ..cap alpha.. direct transfer process.

  12. Lateral gene transfer in the subsurface

    SciTech Connect

    Barkay, Tamar; Sobecky, Patricia


    Lateral gene transfer (LGT) is an important adaptive mechanism among prokaryotic organisms. This mechanism is particularly important for the response of microorganisms to changing environmental conditions because it facilitates the transfer of a large number of genes and their rapid expression. Together the transferred genes promote rapid genetic and metabolic changes that may enhance survival to newly established and sometimes hostile environmental conditions. The goal of our project was to examine if and how LGT enhances microbial adaptation to toxic heavy metals in subsurface environments that had been contaminated by mixed wastes due to activities associated with the production of nuclear energy and weapons. This task has been accomplished by dividing the project to several sub-tasks. Thus, we: (1) Determined the level of resistance of subsurface bacterial isolates to several toxic metals, all identified as pollutants of concern in subsurface environments; (2) Designed, tested, and applied, a molecular approach that determined whether metal resistance genes had evolved by LGT among subsurface bacteria; and (3) Developed a DNA hybridization array for the identification of broad host range plasmids and of metal resistance plasmids. The results are briefly summarized below with references to published papers and manuscripts in preparation where details about our research can be found. Additional information may be found in copies of our published manuscripts and conference proceedings, and our yearly reports that were submitted through the RIMS system.

  13. Clinical Applications Involving CNS Gene Transfer

    PubMed Central

    Kantor, Boris; McCown, Thomas; Leone, Paola; Gray, Steven J.


    Diseases of the central nervous system (CNS) have traditionally been the most difficult to treat by traditional pharmacological methods, due mostly to the blood–brain barrier and the difficulties associated with repeated drug administration targeting the CNS. Viral vector gene transfer represents a way to permanently provide a therapeutic protein within the nervous system after a single administration, whether this be a gene replacement strategy for an inherited disorder or a disease-modifying protein for a disease such as Parkinson's. Gene therapy approaches for CNS disorders has evolved considerably over the last two decades. Although a breakthrough treatment has remained elusive, current strategies are now considerably safer and potentially much more effective. This chapter will explore the past, current, and future status of CNS gene therapy, focusing on clinical trials utilizing adeno-associated virus and lentiviral vectors. PMID:25311921

  14. Perinatal Gene Transfer to the Liver

    PubMed Central

    McKay, Tristan R; Rahim, Ahad A; Buckley, Suzanne M.K; Ward, Natalie J; Chan, Jerry K.Y; Howe, Steven J; Waddington, Simon N


    The liver acts as a host to many functions hence raising the possibility that any one may be compromised by a single gene defect. Inherited or de novo mutations in these genes may result in relatively mild diseases or be so devastating that death within the first weeks or months of life is inevitable. Some diseases can be managed using conventional medicines whereas others are, as yet, untreatable. In this review we consider the application of early intervention gene therapy in neonatal and fetal preclinical studies. We appraise the tools of this technology, including lentivirus, adenovirus and adeno-associated virus (AAV)-based vectors. We highlight the application of these for a range of diseases including hemophilia, urea cycle disorders such as ornithine transcarbamylase deficiency, organic acidemias, lysosomal storage diseases including mucopolysaccharidoses, glycogen storage diseases and bile metabolism. We conclude by assessing the advantages and disadvantages associated with fetal and neonatal liver gene transfer. PMID:21774770

  15. Cytotoxicity of HSVtk and hrTNF-alpha fusion genes with IRES in treatment of gastric cancer.


    Zhang, Jian-Hua; Wan, Ming-Xi; Pan, Bo-Rong; Yu, Bing


    The efficacy of the suicide gene therapy by using the herpes simplex virus thymidine kinase/ganciclovir (HSVtk/GCV) system for the treatment of cancer is limited because of the insufficient gene transfer and the low killing activity. To enhance the anti-tumor activity, we probed into whether recombinant retroviral expression vector PLXSN expressing both HSVtk and TNF-alpha genes could potentiate the destruction of SGC7901. The pL(tk-TNF-alpha)SN harboring HSVtk and TNF-alpha genes in sequence was constructed with a bicistronic unit including the internal ribosomal entry site, the recombinant retroviruses were transferred into SGC7901 cells by lipofectamine, and pEGFP and Western blot analysis were used to detect the expression of fusion genes in transfected SGC7901 cells, and then apoptosis of the transfected cells were detected by using the TdT-mediated dUTP nick end labeling, flow cytometric analysis and transmission electron microscopy. In vitro study, the transfected gastric cancer cells were maintained in the GCV-contained medium, to assay the cell killing effect and bystander effect. In vivo experiments, retroviral serum plasmids were transfected into tumor-bearing nude mice, to observe the changes of tumor volumes and survival of the mice. In vitro there was no significant difference of cell survival rate between the three groups. However, in vivo results showed that tk/GCV, tk-TNF-alpha/GCV and TNF-alpha could inhibit the tumor growth, and the obvious anti-tumor effect was shown in tk-TNF-alpha/GCV group, and TNF-alpha obviously enhanced the anti-tumor effect in vivo. The pathologic examination showed necrosis of the cancer in the treated groups.

  16. Gene Therapy for Alpha-1 Antitrypsin Deficiency Lung Disease.


    Chiuchiolo, Maria J; Crystal, Ronald G


    Alpha-1 antitrypsin (AAT) deficiency, characterized by low plasma levels of the serine protease inhibitor AAT, is associated with emphysema secondary to insufficient protection of the lung from neutrophil proteases. Although AAT augmentation therapy with purified AAT protein is efficacious, it requires weekly to monthly intravenous infusion of AAT purified from pooled human plasma, has the risk of viral contamination and allergic reactions, and is costly. As an alternative, gene therapy offers the advantage of single administration, eliminating the burden of protein infusion, and reduced risks and costs. The focus of this review is to describe the various strategies for AAT gene therapy for the pulmonary manifestations of AAT deficiency and the state of the art in bringing AAT gene therapy to the bedside.

  17. Human hTM. cap alpha. gene: Expression in muscle and nonmuscle tissue

    SciTech Connect

    MacLeod, A.R.; Gooding, C.


    The authors isolated a cDNA clone from a human skeletal muscle library which contains the complete protein-coding sequence of a skeletal muscle ..cap alpha..-tropomyosin. This cDNA sequence defines a fourth human tropomyosin gene, the hTM..cap alpha.. gene, which is distinct from the hTM/sub nm/ gene encoding a closely related isoform of skeletal muscle ..cap alpha..-tropomyosin. In cultured human fibroblasts, the hTM..cap alpha.. gene encodes both skeletal-muscle- and smooth-muscle-type ..cap alpha..-tropomyosins by using an alternative mRNA-splicing mechanism.

  18. Horizontal Gene Transfer, Dispersal and Haloarchaeal Speciation

    PubMed Central

    Papke, R. Thane; Corral, Paulina; Ram-Mohan, Nikhil; de la Haba, Rafael R.; Sánchez-Porro, Cristina; Makkay, Andrea; Ventosa, Antonio


    The Halobacteria are a well-studied archaeal class and numerous investigations are showing how their diversity is distributed amongst genomes and geographic locations. Evidence indicates that recombination between species continuously facilitates the arrival of new genes, and within species, it is frequent enough to spread acquired genes amongst all individuals in the population. To create permanent independent diversity and generate new species, barriers to recombination are probably required. The data support an interpretation that rates of evolution (e.g., horizontal gene transfer and mutation) are faster at creating geographically localized variation than dispersal and invasion are at homogenizing genetic differences between locations. Therefore, we suggest that recurrent episodes of dispersal followed by variable periods of endemism break the homogenizing forces of intrapopulation recombination and that this process might be the principal stimulus leading to divergence and speciation in Halobacteria. PMID:25997110

  19. Therapeutic option of plasmid-DNA based gene transfer.


    Taniyama, Yoshiaki; Azuma, Junya; Kunugiza, Yasuo; Iekushi, Kazuma; Rakugi, Hiromi; Morishita, Ryuichi


    Gene therapy offers a novel approach for the prevention and treatment of a variety of diseases, but it is not yet a common method in clinical cases because of various problems. Viral vectors show high efficiency of gene transfer, but they have some problems with toxicity and immunity. On the other hand, plasmid deoxyribonucleic acid (DNA)-based gene transfer is very safe, but its efficiency is relatively low. Especially, plasmid DNA gene therapy is used for cardiovascular disease because plasmid DNA transfer is possible for cardiac or skeletal muscle. Clinical angiogenic gene therapy using plasmid DNA gene transfer has been attempted in patients with peripheral artery disease, but a phase III clinical trial did not show sufficient efficiency. In this situation, more efficient plasmid DNA gene transfer is needed all over the world. This review focuses on plasmid DNA gene transfer and its enhancement, including ultrasound with microbubbles, electroporation, hydrodynamic method, gene gun, jet injection, cationic lipids and cationic polymers.

  20. Horizontal gene transfer in parasitic plants.


    Davis, Charles C; Xi, Zhenxiang


    Horizontal gene transfer (HGT) between species has been a major focus of plant evolutionary research during the past decade. Parasitic plants, which establish a direct connection with their hosts, have provided excellent examples of how these transfers are facilitated via the intimacy of this symbiosis. In particular, phylogenetic studies from diverse clades indicate that parasitic plants represent a rich system for studying this phenomenon. Here, HGT has been shown to be astonishingly high in the mitochondrial genome, and appreciable in the nuclear genome. Although explicit tests remain to be performed, some transgenes have been hypothesized to be functional in their recipient species, thus providing a new perspective on the evolution of novelty in parasitic plants.

  1. Technology Transfer and Outreach for SNL/Rochester ALPHA Project.

    SciTech Connect

    Sinars, Daniel


    This report describes the next stage goals and resource needs for the joint Sandia and University of Rochester ARPA-E project. A key portion of this project is Technology Transfer and Outreach, with the goal being to help ensure that this project develops a credible method or tool that the magneto-inertial fusion (MIF) research community can use to broaden the advocacy base, to pursue a viable path to commercial fusion energy, and to develop other commercial opportunities for the associated technology. This report describes an analysis of next stage goals and resource needs as requested by Milestone 5.1.1.

  2. Molecular mechanisms of alpha-fetoprotein gene expression.


    Lazarevich, N L


    Alpha-fetoprotein (AFP) is the main component of mammalian fetal serum. It is synthesized by visceral endoderm of the yolk sac and by fetal liver. Immediately after birth AFP level in blood decreases dramatically. AFP synthesis is reactivated in liver tumors and germinogeneous teratoblastomas, in a lesser degree after chemical and mechanical liver injuries followed by regeneration (i.e., acute viral hepatitis). AFP blood level change is an important marker for liver tumors that is widely used in clinical practice. Therefore, the study of the molecular and cellular mechanisms participating in regulation of the oncoembryonal protein AFP is an important task. On various experimental models it has been shown that the expression is regulated mainly on the transcriptional level, the AFP gene having a 7 kb regulatory region upstream. Within this region a tissue-specific promoter, three independent enhancers, and a silencer that is at least partially responsible for AFP gene expression decrease in adult liver have been defined. Some ubiquitous and some tissue-specific transcription factors, including hepatocyte nuclear factors (HNFs), which mediate the transcription of most of the liver-specific genes, have been shown to bind to the promoter. However, the mechanisms determining drastic changes of AFP synthesis level in the course of ontogenesis and carcinogenesis remain incompletely clarified. Also, little is known about negative regulators of AFP gene expression in cells of non-hepatic origin and in adult liver.

  3. Reducible cationic lipids for gene transfer.

    PubMed Central

    Wetzer, B; Byk, G; Frederic, M; Airiau, M; Blanche, F; Pitard, B; Scherman, D


    One of the main challenges of gene therapy remains the increase of gene delivery into eukaryotic cells. We tested whether intracellular DNA release, an essential step for gene transfer, could be facilitated by using reducible cationic DNA-delivery vectors. For this purpose, plasmid DNA was complexed with cationic lipids bearing a disulphide bond. This reduction-sensitive linker is expected to be reduced and cleaved in the reducing milieu of the cytoplasm, thus potentially improving DNA release and consequently transfection. The DNA--disulphide-lipid complexation was monitored by ethidium bromide exclusion, and the size of complexes was determined by dynamic light scattering. It was found that the reduction kinetics of disulphide groups in DNA--lipid complexes depended on the position of the disulphide linker within the lipid molecule. Furthermore, the internal structure of DNA--lipid particles was examined by small-angle X-ray scattering before and after lipid reduction. DNA release from lipid complexes was observed after the reduction of disulphide bonds of several lipids. Cell-transfection experiments suggested that complexes formed with selected reducible lipids resulted in up to 1000-fold higher reporter-gene activity, when compared with their analogues without disulphide bonds. In conclusion, reduction-sensitive groups introduced into cationic lipid backbones potentially allow enhanced DNA release from DNA--lipid complexes after intracellular reduction and represent a tool for improved vectorization. PMID:11389682

  4. Reducible cationic lipids for gene transfer.


    Wetzer, B; Byk, G; Frederic, M; Airiau, M; Blanche, F; Pitard, B; Scherman, D


    One of the main challenges of gene therapy remains the increase of gene delivery into eukaryotic cells. We tested whether intracellular DNA release, an essential step for gene transfer, could be facilitated by using reducible cationic DNA-delivery vectors. For this purpose, plasmid DNA was complexed with cationic lipids bearing a disulphide bond. This reduction-sensitive linker is expected to be reduced and cleaved in the reducing milieu of the cytoplasm, thus potentially improving DNA release and consequently transfection. The DNA--disulphide-lipid complexation was monitored by ethidium bromide exclusion, and the size of complexes was determined by dynamic light scattering. It was found that the reduction kinetics of disulphide groups in DNA--lipid complexes depended on the position of the disulphide linker within the lipid molecule. Furthermore, the internal structure of DNA--lipid particles was examined by small-angle X-ray scattering before and after lipid reduction. DNA release from lipid complexes was observed after the reduction of disulphide bonds of several lipids. Cell-transfection experiments suggested that complexes formed with selected reducible lipids resulted in up to 1000-fold higher reporter-gene activity, when compared with their analogues without disulphide bonds. In conclusion, reduction-sensitive groups introduced into cationic lipid backbones potentially allow enhanced DNA release from DNA--lipid complexes after intracellular reduction and represent a tool for improved vectorization.

  5. In silico characterization of the neural alpha tubulin gene promoter of the sea urchin embryo Paracentrotus lividus by phylogenetic footprinting.


    Ragusa, Maria Antonietta; Longo, Valeria; Emanuele, Marco; Costa, Salvatore; Gianguzza, Fabrizio


    During Paracentrotus lividus sea urchin embryo development one alpha and one beta tubulin genes are expressed specifically in the neural cells and they are early end output of the gene regulatory network that specifies the neural commitment. In this paper we have used a comparative genomics approach to identify conserved regulatory elements in the P. lividus neural alpha tubulin gene. To this purpose, we have first isolated a genomic clone containing the entire gene plus 4.5 Kb of 5' upstream sequences. Then, we have shown by gene transfer experiments that its non-coding region drives the spatio-temporal gene expression corresponding substantially to that of the endogenous gene. In addition, we have identified by genome and EST sequence analysis the S. purpuratus alpha tubulin orthologous gene and we propose a revised annotation of some tubulin family members. Moreover, by computational techniques we delineate at least three putative regulatory regions located both in the upstream region and in the first intron containing putative binding sites for Forkhead and Nkx transcription factor families.

  6. Electron transfer, excitation, and ionization in {alpha}-H collisions studied with a Sturmian basis

    SciTech Connect

    Winter, Thomas G.


    Cross sections have been determined for electron transfer, direct excitation, and ionization in collisions between {alpha} particles and H(1s) atoms at {alpha} energies 3 keV-38.4 MeV, extending earlier work [Phys. Rev. A 25, 697 (1982)] restricted to total transfer at 20-200 keV. Transfer as well as excitation cross sections into individual states up to 3d have been determined with several coupled-Sturmian pseudostate bases, and tests of basis sensitivity have been carried out. These and ionization cross sections have been compared with existing experimental and other coupled-state results. Structure is observed in the lower-energy excitation cross sections, which is believed not to be an artifact of the bases used. Ionization and excitation cross sections have also been compared with corresponding Born results at higher energies.

  7. Mutations in the paralogous human alpha-globin genes yielding identical hemoglobin variants.


    Moradkhani, Kamran; Préhu, Claude; Old, John; Henderson, Shirley; Balamitsa, Vera; Luo, Hong-Yuan; Poon, Man-Chiu; Chui, David H K; Wajcman, Henri; Patrinos, George P


    The human alpha-globin genes are paralogues, sharing a high degree of DNA sequence similarity and producing an identical alpha-globin chain. Over half of the alpha-globin structural variants reported to date are only characterized at the amino acid level. It is likely that a fraction of these variants, with phenotypes differing from one observation to another, may be due to the same mutation but on a different alpha-globin gene. There have been very few previous examples of hemoglobin variants that can be found at both HBA1 and HBA2 genes. Here, we report the results of a systematic multicenter study in a large multiethnic population to identify such variants and to analyze their differences from a functional and evolutionary perspective. We identified 14 different Hb variants resulting from identical mutations on either one of the two human alpha-globin paralogue genes. We also showed that the average percentage of hemoglobin variants due to a HBA2 gene mutation (alpha2) is higher than the percentage of hemoglobin variants due to the same HBA1 gene mutation (alpha1) and that the alpha2/alpha1 ratio varied between variants. These alpha-globin chain variants have most likely occurred via recurrent mutations, gene conversion events, or both. Based on these data, we propose a nomenclature for hemoglobin variants that fall into this category.

  8. Horizontal gene transfer from Agrobacterium to plants

    PubMed Central

    Matveeva, Tatiana V.; Lutova, Ludmila A.


    Most genetic engineering of plants uses Agrobacterium mediated transformation to introduce novel gene content. In nature, insertion of T-DNA in the plant genome and its subsequent transfer via sexual reproduction has been shown in several species in the genera Nicotiana and Linaria. In these natural examples of horizontal gene transfer from Agrobacterium to plants, the T-DNA donor is assumed to be a mikimopine strain of A. rhizogenes. A sequence homologous to the T-DNA of the Ri plasmid of Agrobacterium rhizogenes was found in the genome of untransformed Nicotiana glauca about 30 years ago, and was named “cellular T-DNA” (cT-DNA). It represents an imperfect inverted repeat and contains homologs of several T-DNA oncogenes (NgrolB, NgrolC, NgORF13, NgORF14) and an opine synthesis gene (Ngmis). A similar cT-DNA has also been found in other species of the genus Nicotiana. These presumably ancient homologs of T-DNA genes are still expressed, indicating that they may play a role in the evolution of these plants. Recently T-DNA has been detected and characterized in Linaria vulgaris and L. dalmatica. In Linaria vulgaris the cT-DNA is present in two copies and organized as a tandem imperfect direct repeat, containing LvORF2, LvORF3, LvORF8, LvrolA, LvrolB, LvrolC, LvORF13, LvORF14, and the Lvmis genes. All L. vulgaris and L. dalmatica plants screened contained the same T-DNA oncogenes and the mis gene. Evidence suggests that there were several independent T-DNA integration events into the genomes of these plant genera. We speculate that ancient plants transformed by A. rhizogenes might have acquired a selective advantage in competition with the parental species. Thus, the events of T-DNA insertion in the plant genome might have affected their evolution, resulting in the creation of new plant species. In this review we focus on the structure and functions of cT-DNA in Linaria and Nicotiana and discuss their possible evolutionary role. PMID:25157257

  9. Effect of long-term exposure to mobile phone radiation on alpha-Int1 gene sequence of Candida albicans

    PubMed Central

    Shahin-jafari, Ariyo; Bayat, Mansour; Shahhosseiny, Mohammad Hassan; Tajik, Parviz; Roudbar-mohammadi, Shahla


    Over the last decade, communication industries have witnessed a tremendous expansion, while, the biological effects of electromagnetic waves have not been fully elucidated. Current study aimed at evaluating the mutagenic effect of long-term exposure to 900-MHz radiation on alpha-Int1 gene sequences of Candida albicans. A standard 900 MHz radiation generator was used for radiation. 10 ml volumes from a stock suspension of C. albicans were transferred into 10 polystyrene tubes. Five tubes were exposed at 4 °C to a fixed magnitude of radiation with different time periods of 10, 70, 210, 350 and 490 h. The other 5 tubes were kept far enough from radiation. The samples underwent genomic DNA extraction. PCR amplification of alpha-Int1 gene sequence was done using one set of primers. PCR products were resolved using agarose gel electrophoresis and the nucleotide sequences were determined. All samples showed a clear electrophoretic band around 441 bp and further sequencing revealed the amplified DNA segments are related to alpha-Int1 gene of the yeast. No mutations in the gene were seen in radiation exposed samples. Long-term exposure of the yeast to mobile phone radiation under the above mentioned conditions had no mutagenic effect on alpha-Int1 gene sequence. PMID:27081370

  10. Gene duplication and transfer events in plant mitochondria genome

    SciTech Connect

    Xiong Aisheng Peng Rihe; Zhuang Jing; Gao Feng; Zhu Bo; Fu Xiaoyan; Xue Yong; Jin Xiaofen; Tian Yongsheng; Zhao Wei; Yao Quanhong


    Gene or genome duplication events increase the amount of genetic material available to increase the genomic, and thereby phenotypic, complexity of organisms during evolution. Gene duplication and transfer events have been important to molecular evolution in all three domains of life, and may be the first step in the emergence of new gene functions. Gene transfer events have been proposed as another accelerator of evolution. The duplicated gene or genome, mainly nuclear, has been the subject of several recent reviews. In addition to the nuclear genome, organisms have organelle genomes, including mitochondrial genome. In this review, we briefly summarize gene duplication and transfer events in the plant mitochondrial genome.


    SciTech Connect

    Yang Yang; Shu Chiwang; Roy, Ishani; Fang Lizhi


    We investigate the effects of dust on Ly{alpha} photons emergent from an optically thick medium by solving the integro-differential equation of radiative transfer of resonant photons. To solve the differential equations numerically, we use the weighted essentially non-oscillatory method. Although the effects of dust on radiative transfer are well known, the resonant scattering of Ly{alpha} photons makes the problem non-trivial. For instance, if the medium has an optical depth of dust absorption and scattering of {tau}{sub a} >> 1, {tau} >> 1, and {tau} >> {tau}{sub a}, the effective absorption optical depth in a random walk scenario would be equal to {radical}({tau}{sub a}({tau}{sub a}+{tau})). We show, however, that for a resonant scattering at frequency {nu}{sub 0}, the effective absorption optical depth would be even larger than {tau}({nu}{sub 0}). If the cross section of dust scattering and absorption is frequency-independent, the double-peaked structure of the frequency profile given by the resonant scattering is basically dust-independent. That is, dust causes neither narrowing nor widening of the width of the double-peaked profile. One more result is that the timescales of the Ly{alpha} photon transfer in an optically thick halo are also basically independent of the dust scattering, even when the scattering is anisotropic. This is because those timescales are mainly determined by the transfer in the frequency space, while dust scattering, either isotropic or anisotropic, does not affect the behavior of the transfer in the frequency space when the cross section of scattering is wavelength-independent. This result does not support the speculation that dust will lead to the smoothing of the brightness distribution of a Ly{alpha} photon source with an optically thick halo.

  12. [Nucleotide sequence of genes for alpha- and beta-subunits of luciferase from Photobacterium leiognathi].


    Illarionov, B A; Protopopova, M V; Karginov, V A; Mertvetsov, N P; Gitel'zon, I I


    Nucleotide sequence of the Photobacterium leiognathi DNA containing genes of alpha and beta subunits of luciferase has been determined. We also deduced amino acid sequence and molecular mass of luciferase and localized luciferase genes in the sequenced DNA fragment.

  13. Horizontal gene transfer: A critical view

    PubMed Central

    Kurland, C. G.; Canback, B.; Berg, Otto G.


    It has been suggested that horizontal gene transfer (HGT) is the “essence of phylogeny.” In contrast, much data suggest that this is an exaggeration resulting in part from a reliance on inadequate methods to identify HGT events. In addition, the assumption that HGT is a ubiquitous influence throughout evolution is questionable. Instead, rampant global HGT is likely to have been relevant only to primitive genomes. In modern organisms we suggest that both the range and frequencies of HGT are constrained most often by selective barriers. As a consequence those HGT events that do occur most often have little influence on genome phylogeny. Although HGT does occur with important evolutionary consequences, classical Darwinian lineages seem to be the dominant mode of evolution for modern organisms. PMID:12902542

  14. Localization of an alpha-amanitin resistance mutation in the gene encoding the largest subunit of mouse RNA polymerase II.

    PubMed Central

    Bartolomei, M S; Corden, J L


    RNA polymerase II is inhibited by the mushroom toxin alpha-amanitin. A mouse BALB/c 3T3 cell line was selected for resistance to alpha-amanitin and characterized in detail. This cell line, designated A21, was heterozygous, possessing both amanitin-sensitive and -resistant forms of RNA polymerase II; the mutant form was 500 times more resistant to alpha-amanitin than the sensitive form. By using the wild-type mouse RNA polymerase II largest subunit (RPII215) gene (J.A. Ahearn, M.S. Bartolomei, M. L. West, and J. L. Corden, submitted for publication) as the probe, RPII215 genes were isolated from an A21 genomic DNA library. The mutant allele was identified by its ability to transfer amanitin resistance in a transfection assay. Genomic reconstructions between mutant and wild-type alleles localized the mutation to a 450-base-pair fragment that included parts of exons 14 and 15. This fragment was sequenced and compared with the wild-type sequence; a single AT-to-GC transition was detected at nucleotide 6819, corresponding to an asparagine-to-aspartate substitution at amino acid 793 of the predicted protein sequence. Knowledge of the position of the A21 mutation should facilitate the study of the mechanism of alpha-amanitin resistance. Furthermore, the A21 gene will be useful for studying the phenotype of site-directed mutations in the RPII215 gene. Images PMID:3821724

  15. Modulating charge transfer through cyclic D,L-alpha-peptide self-assembly.


    Horne, W Seth; Ashkenasy, Nurit; Ghadiri, M Reza


    We describe a concise, solid support-based synthetic method for the preparation of cyclic d,l-alpha-peptides bearing 1,4,5,8-naphthalenetetracarboxylic acid diimide (NDI) side chains. Studies of the structural and photoluminescence properties of these molecules in solution show that the hydrogen bond-directed self-assembly of the cyclic d,l-alpha-peptide backbone promotes intermolecular NDI excimer formation. The efficiency of NDI charge transfer in the resulting supramolecular assemblies is shown to depend on the length of the linker between the NDI and the peptide backbone, the distal NDI substituent, and the number of NDIs incorporated in a given structure. The design rationale and synthetic strategies described here should provide a basic blueprint for a series of self-assembling cyclic d,l-alpha-peptide nanotubes with interesting optical and electronic properties.

  16. Tumour necrosis factor-alpha gene promoter polymorphism in chronic obstructive pulmonary disease.


    Higham, M A; Pride, N B; Alikhan, A; Morrell, N W


    Tumour necrosis factor(TNF)-alpha levels are elevated in airways of patients with chronic obstructive pulmonary disease (COPD) and may contribute to its pathogenesis. A guanine to adenine substitution at position -308 of the TNF-alpha gene promoter (TNF1/2) has been associated with chronic bronchitis of various aetiologies in a Taiwanese population. The authors performed a study investigating association of the polymorphism with smoking-related COPD in Caucasians. Frequencies of TNF1/2 alleles in 86 Caucasians (52 males) with COPD were compared with 63 (52 males) asymptomatic smoker/exsmoker control subjects and a population control of 199 (99 males) blood donors. Genotyping was performed by the polymerase chain reaction-restriction fragment length polymorphism technique on genomic deoxyribonucleic acid (DNA) obtained from peripheral blood. There were no significant differences in TNF1/2 allele frequencies between groups: 0.85/0.15 in COPD, 0.85/0.15 in smoker control subjects, 0.83/0.17 in population control subjects. Within the COPD group there was no association of TNF1/2 alleles with indices of airflow obstruction (% predicted forced expiratory volume in one second (FEV1) and % predicted FEV1/vital capacity ratio) nor gas transfer (% predicted carbon monoxide transfer coefficient and % predicted carbon monoxide diffusing capacity of the lung). It is concluded that: 1) the tumour necrosis factor gene promoter allele does not influence the risk of developing chronic obstructive pulmonary disease in a Caucasian population of smokers; and 2) there is no association of the tumour necrosis factor gene promoter genotype with severity of airflow obstruction nor degree of emphysema in chronic obstructive pulmonary disease.

  17. Optical gene transfer by femtosecond laser pulses

    NASA Astrophysics Data System (ADS)

    Konig, Karsten; Riemann, Iris; Tirlapur, Uday K.


    Targeted transfection of cells is an important technique for gene therapy and related biomedical applications. We delineate how high-intensity (1012 W/cm2) near-infrared (NIR) 80 MHz nanojoule femtosecond laser pulses can create highly localised membrane perforations within a minute focal volume, enabling non-invasive direct transfection of mammalian cells with DNA. We suspended Chinese hamster ovarian (CHO), rat kangaroo kidney epithelial (PtK2) and rat fibroblast cells in 0.5 ml culture medium in a sterile miniaturized cell chamber (JenLab GmbH, Jena, Germany) containing 0.2 μg plasmid DNA vector pEGFP-N1 (4.7 kb), which codes for green fluorescent protein (GFP). The NIR laser beam was introduced into a femtosecond laser scanning microscope (JenLab GmbH, Jena, Germany; focussed on the edge of the cell membrane of a target cell for 16 ms. The integration and expression efficiency of EGFP were assessed in situ by two-photon fluorescence-lifetime imaging using time-correlated single photon counting. The unique capability to transfer foreign DNA safely and efficiently into specific cell types (including stem cells), circumventing mechanical, electrical or chemical means, will have many applications, such as targeted gene therapy and DNA vaccination.

  18. Plant transformation via pollen tube-mediated gene transfer

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic transformation using foreign genes and the subsequent development of transgenic plants has been employed to develop enhanced elite germplasm. Although some skepticism exits regarding pollen tube-mediated gene transfer (PTT), reports demonstrating improved transformation efficiency with PTT ...

  19. Gene Transfer & Hybridization Studies in Hyperthermophilic Species

    SciTech Connect

    Nelson, Karen E.


    A. ABSTRACT The importance of lateral gene transfer (LGT) in the evolution of microbial species has become increasingly evident with each completed microbial genome sequence. Most significantly, the genome of Thermotoga maritima MSB8, a hyperthermophilic bacterium isolated by Karl Stetter and workers from Vulcano Italy in 1986, and sequenced at The Institute for Genomic Research (TIGR) in Rockville Maryland in 1999, revealed extensive LGT between % . this bacterium and members of the archaeal domain (in particular Archaeoglobus fulgidus, and Pyracoccus frcriosus species). Based on whole genome comparisons, it was estimated that 24% of the genetic information in this organism was acquired by genetic exchange with archaeal species, Independent analyses including periodicity analysis of the T. maritimu genomic DNA sequence, phylogenetic reconstruction based on genes that appear archaeal-like, and codon and amino acid usage, have provided additional evidence for LGT between T. maritima and the archaea. More recently, DiRuggiero and workers have identified a very recent LGT event between two genera of hyperthermophilic archaea, where a nearly identical DNA fragment of 16 kb in length flanked by insertion sequence (IS) elements, exists. Undoubtedly, additional examples of LGT will be identified as more microbial genomes are completed. For the present moment however, the genome sequence of T. maritima and other hyperthermophiles including P. furiosus, Pyrococcus horikoshii, Pyrococcus abyssi, A. fulgidus, and Aquifex aeolicus, have significantly increased out awareness of evolution being a web of life rather than a tree of life, as suggested by single gene phylogenies. In this proposal, we will aim to determine the extent of LGT across the hyperthemophiles, employing iY maritima as the model organism. A variety of biochemical techniques and phylogenetic reconstructions will allow for a detailed and thorough characterization of the extent of LGT in this species. The

  20. Stable transformation of maize after gene transfer by electroporation.


    Fromm, M E; Taylor, L P; Walbot, V

    The graminaceous monocots, including the economically important cereals, seem to be refractory to infection by Agrobacterium tumefaciens, a natural gene transfer system that has been successfully exploited for transferring foreign genes into higher plants. Therefore, direct transfer techniques that are potentially applicable to all plant species have been developed using a few dicot and monocot species as model systems. One of these techniques, electroporation, uses electrical pulses of high field strength to permeabilize cell membranes reversibly so as to facilitate the transfer of DNA into cells. Electroporation-mediated gene transfer has resulted in stably transformed animal cells and transient gene expression in monocot and dicot plant cells. Here we report that electroporation-mediated DNA transfer of a chimaeric gene encoding neomycin phosphotransferase results in stably transformed maize cells that are resistant to kanamycin.

  1. Plasmid DNA-based gene transfer with ultrasound and microbubbles.


    Taniyama, Yoshiaki; Azuma, Junya; Rakugi, Hiromi; Morishita, Ryuichi


    Gene therapy offers a novel approach for the prevention and treatment of a variety of diseases, but it is not yet a common option in the real world because of various problems. Viral vectors show high efficiency of gene transfer, but they have some problems with toxicity and immunity. On the other hand, plasmid DNA-based gene transfer is very safe, but its efficiency is relatively low. Especially, plasmid DNA gene therapy is used for cardiovascular disease because plasmid DNA transfer is possible for cardiac or skeletal muscle. Clinical angiogenic gene therapy using plasmid DNA gene transfer has been attempted in patients with peripheral artery disease, but a Phase III clinical trial did not show sufficient efficiency. Recently, a Phase III clinical trial of hepatocyte growth factor gene therapy in peripheral artery disease (PAD) showed improvement of ischemic ulcers, but it could not salvage limbs from amputation. In addition, a Phase I/II clinical study of fibroblast growth factor gene therapy in PAD extended amputation-free survival, but it seemed to fail in Phase III. In this situation, we and others have developed plasmid DNA-based gene transfer using ultrasound with microbubbles to enhance its efficiency while maintaining safety. Ultrasound-mediated gene transfer has been reported to augment the gene transfer efficiency and select the target organ using cationic microbubble phospholipids which bind negatively charged DNA. Ultrasound with microbubblesis likely to create new therapeutic options inavariety of diseases.

  2. Gene cloning of alpha-methylserine aldolase from Variovorax paradoxus and purification and characterization of the recombinant enzyme.


    Nozaki, Hiroyuki; Kuroda, Shinji; Watanabe, Kunihiko; Yokozeki, Kenzo


    The alpha-methylserine aldolase gene from Variovorax paradoxus strains AJ110406, NBRC15149, and NBRC15150 was cloned and expressed in Escherichia coli. Formaldehyde release activity from alpha-methyl-L-serine was detected in the cell-free extract of E.coli expressing the gene from three strains. The recombinant enzyme from V. paradoxus NBRC15150 was purified. The Vmax and Km of the enzyme for the formaldehyde release reaction from alpha-methyl-L-serine were 1.89 micromol min(-1) mg(-1) and 1.2 mM respectively. The enzyme was also capable of catalyzing the synthesis of alpha-methyl-L-serine and alpha-ethyl-L-serine from L-alanine and L-2-aminobutyric acid respectively, accompanied by hydroxymethyl transfer from formaldehyde. The purified enzyme also catalyzed alanine racemization. It contained 1 mole of pyridoxal 5'-phosphate per mol of the enzyme subunit, and exhibited a specific spectral peak at 429 nm. With L-alanine and L-2-aminobutyric acid as substrates, the specific peak, assumed to be a result of the formation of a quinonoid intermediate, increased at 498 nm and 500 nm respectively.

  3. Preclinical study on combined chemo- and nonviral gene therapy for sensitization of melanoma using a human TNF-alpha expressing MIDGE DNA vector.


    Kobelt, Dennis; Aumann, Jutta; Schmidt, Manuel; Wittig, Burghardt; Fichtner, Iduna; Behrens, Diana; Lemm, Margit; Freundt, Greta; Schlag, Peter M; Walther, Wolfgang


    Nonviral gene therapy represents a realistic option for clinical application in cancer treatment. This preclinical study demonstrates the advantage of using the small-size MIDGE(®) DNA vector for improved transgene expression and therapeutic application. This is caused by significant increase in transcription efficiency, but not by increased intracellular vector copy numbers or gene transfer efficiency. We used the MIDGE-hTNF-alpha vector for high-level expression of hTNF-alpha in vitro and in vivo for a combined gene therapy and vindesine treatment in human melanoma models. The MIDGE vector mediated high-level hTNF-alpha expression leads to sensitization of melanoma cells towards vindesine. The increased efficacy of this combination is mediated by remarkable acceleration and increase of initiator caspase 8 and 9 and effector caspase 3 and 7 activation. In the therapeutic approach, the nonviral intratumoral in vivo jet-injection gene transfer of MIDGE-hTNF-alpha in combination with vindesine causes melanoma growth inhibition in association with increased apoptosis in A375 cell line or patient derived human melanoma xenotransplant (PDX) models. This study represents a proof-of-concept for an anticipated phase I clinical gene therapy trial, in which the MIDGE-hTNF-alpha vector will be used for efficient combined chemo- and nonviral gene therapy of malignant melanoma.

  4. The neuronal nicotinic acetylcholine receptor {alpha}7 subunit gene: Cloning, mapping, structure, and targeting in mouse

    SciTech Connect

    Orr-Urtreger, A.; Baldini, A.; Beaudet, A.L.


    The neuronal nicotinic acetylcholine receptor {alpha}7 subunit is a member of a family of ligand-gated ion channels, and is the only subunit know to bind {alpha}-bungarotoxin in mammalian brain. {alpha}-Bungarotoxin binding sites are known to be more abundant in the hippocampus of mouse strains that are particularly sensitive to nicotine-induced seizures. The {alpha}7 receptor is highly permeable to calcium, which could suggest a role in synaptic plasticity in the nervous system. Auditory gating deficiency, an abnormal response to a second auditory stimulus, is characteristic of schizophrenia. Mouse strains that exhibit a similar gating deficit have reduced hippocampal expression of the {alpha}7 subunit. We have cloned and sequenced the full length cDNA for the mouse {alpha}7 gene (Acra-7) and characterized its gene structure. The murine {alpha}7 shares amino acid identity of 99% and 93% with the rat and human {alpha}7 subunits, respectively. Using an interspecies backcross panel, the murine gene was mapped to chromosome 7 near the p locus, a region syntenic with human chromosome 15; the human gene (CHRNA7) was confirmed to map to 15q13-q14 by FISH. To generate a mouse {alpha}7 mutant by homologous recombination, we have constructed a replacement vector which will delete transmembrane domains II-IV and the cytoplasmic domain from the gene product. Recombinant embryonic stem (ES) cell clones were selected and used to develop mouse chimeras that are currently being bred to obtain germline transmission.

  5. Methods for Gene Transfer to the Central Nervous System

    PubMed Central

    Kantor, Boris; Bailey, Rachel M.; Wimberly, Keon; Kalburgi, Sahana N.; Gray, Steven J.


    Gene transfer is an increasingly utilized approach for research and clinical applications involving the central nervous system (CNS). Vectors for gene transfer can be as simple as an unmodified plasmid, but more commonly involve complex modifications to viruses to make them suitable gene delivery vehicles. This chapter will explain how tools for CNS gene transfer have been derived from naturally occurring viruses. The current capabilities of plasmid, retroviral, adeno-associated virus, adenovirus, and herpes simplex virus vectors for CNS gene delivery will be described. These include both focal and global CNS gene transfer strategies, with short- or long-term gene expression. As is described in this chapter, an important aspect of any vector is the cis-acting regulatory elements incorporated into the vector genome that control when, where, and how the transgene is expressed. PMID:25311922

  6. Transcriptional regulation of human retinoic acid receptor-alpha (RAR-{alpha}) by Wilms` tumour gene product

    SciTech Connect

    Goodyer, P.R.; Torban, E.; Dehbi, M.


    The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-length WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.

  7. Problems associated with gene transfer and opportunities for microgravity environments

    SciTech Connect

    Tennessen, D.J.


    The method of crop improvement by gene transfer is becoming increasingly routine with transgenic foods and ornamental crops now being marketed to consumers. However, biological processes of plants, and the physical barriers of current protocols continue to limit the application of gene transfer in many commercial crops. The goal of this paper is to outline the current limitations of gene transfer and to hypothesize possible opportunities for use of microgravity to overcome such limitations. The limitations detailed in this paper include host-range specificity of {ital Agrobacterium} mediated transformation, probability of gene insertion, position effects of the inserted genes, gene copy number, stability of foreign gene expression in host plants, and regeneration of recalcitrant plant species. Microgravity offers an opportunity for gene transfer where cell growth kinetics, DNA synthesis, and genetic recombination rates can be altered. Such biological conditions may enhance the ability for recombination of reporter genes and other genes of interest to agriculture. Proposed studies would be useful for understanding instability of foreign gene expression and may lead to stable transformed plants. Other aspects of gene transfer in microgravity are discussed. {copyright} {ital 1997 American Institute of Physics.}

  8. Problems associated with gene transfer and opportunities for microgravity environments

    NASA Astrophysics Data System (ADS)

    Tennessen, Daniel J.


    The method of crop improvement by gene transfer is becoming increasingly routine with transgenic foods and ornamental crops now being marketed to consumers. However, biological processes of plants, and the physical barriers of current protocols continue to limit the application of gene transfer in many commercial crops. The goal of this paper is to outline the current limitations of gene transfer and to hypothesize possible opportunities for use of microgravity to overcome such limitations. The limitations detailed in this paper include host-range specificity of Agrobacterium mediated transformation, probability of gene insertion, position effects of the inserted genes, gene copy number, stability of foreign gene expression in host plants, and regeneration of recalcitrant plant species. Microgravity offers an opportunity for gene transfer where cell growth kinetics, DNA synthesis, and genetic recombination rates can be altered. Such biological conditions may enhance the ability for recombination of reporter genes and other genes of interest to agriculture. Proposed studies would be useful for understanding instability of foreign gene expression and may lead to stable transformed plants. Other aspects of gene transfer in microgravity are discussed.

  9. Aggregated Alpha-Synuclein Transfer Efficiently between Cultured Human Neuron-Like Cells and Localize to Lysosomes

    PubMed Central

    Severinsson, Emelie; Agholme, Lotta; Bergström, Joakim; Ingelsson, Martin


    Parkinson’s disease and other alpha-synucleinopathies are progressive neurodegenerative diseases characterized by aggregates of misfolded alpha-synuclein spreading throughout the brain. Recent evidence suggests that the pathological progression is likely due to neuron-to-neuron transfer of these aggregates between neuroanatomically connected areas of the brain. As the impact of this pathological spreading mechanism is currently debated, we aimed to investigate the transfer and subcellular location of alpha-synuclein species in a novel 3D co-culture human cell model based on highly differentiated SH-SY5Y cells. Fluorescently-labeled monomeric, oligomeric and fibrillar species of alpha-synuclein were introduced into a donor cell population and co-cultured with an EGFP-expressing acceptor-cell population of differentiated neuron-like cells. Subsequent transfer and colocalization of the different species were determined with confocal microscopy. We could confirm cell-to-cell transfer of all three alpha-synuclein species investigated. Interestingly the level of transferred oligomers and fibrils and oligomers were significantly higher than monomers, which could affect the probability of seeding and pathology in the recipient cells. Most alpha-synuclein colocalized with the lysosomal/endosomal system, both pre- and postsynaptically, suggesting its importance in the processing and spreading of alpha-synuclein. PMID:28030591

  10. Alpha tubulin genes from Leishmania braziliensis: genomic organization, gene structure and insights on their expression

    PubMed Central


    Background Alpha tubulin is a fundamental component of the cytoskeleton which is responsible for cell shape and is involved in cell division, ciliary and flagellar motility and intracellular transport. Alpha tubulin gene expression varies according to the morphological changes suffered by Leishmania in its life cycle. However, the objective of studying the mechanisms responsible for the differential expression has resulted to be a difficult task due to the complex genome organization of tubulin genes and to the non-conventional mechanisms of gene regulation operating in Leishmania. Results We started this work by analyzing the genomic organization of α-tubulin genes in the Leishmania braziliensis genome database. The genomic organization of L. braziliensis α-tubulin genes differs from that existing in the L. major and L. infantum genomes. Two loci containing α-tubulin genes were found in the chromosomes 13 and 29, even though the existence of sequence gaps does not allow knowing the exact number of genes at each locus. Southern blot assays showed that α-tubulin locus at chromosome 13 contains at least 8 gene copies, which are tandemly organized with a 2.08-kb repetition unit; the locus at chromosome 29 seems to contain a sole α-tubulin gene. In addition, it was found that L. braziliensis α-tubulin locus at chromosome 13 contains two types of α-tubulin genes differing in their 3′ UTR, each one presumably containing different regulatory motifs. It was also determined that the mRNA expression levels of these genes are controlled by post-transcriptional mechanisms tightly linked to the growth temperature. Moreover, the decrease in the α-tubulin mRNA abundance observed when promastigotes were cultured at 35°C was accompanied by parasite morphology alterations, similar to that occurring during the promastigote to amastigote differentiation. Conclusions Information found in the genome databases indicates that α-tubulin genes have been reorganized in a drastic

  11. Phylogenetic relationships within the genus Equus and the evolution of alpha and theta globin genes.


    Oakenfull, E A; Clegg, J B


    Sequences of the alpha1, alpha2 and theta globin genes from six equid species have been determined to investigate relationships within the genus Equus. Analyses using standard phylogenetic methods, or an approach designed to account for the effects of gene conversion between the alpha genes, gave broadly similar results and show that the horses diverged from the zebra/ass ancestor approximately 2.4 million years ago and that the zebra and ass species arose in a rapid radiation approximately 0.9 million years ago. These results from the alpha genes are corroborated by theta gene data and are in contrast to mitochondrial DNA studies of the phylogeny of this genus, which suggest a more gradual set of speciation events.

  12. Hb Bronte or alpha93(FG5)Val-->Gly: a new unstable variant of the alpha2-globin gene, associated with a mild alpha(+)-thalassemia phenotype.


    Lacerra, Giuseppina; Testa, Rosario; De Angioletti, Maria; Schilirò, Gino; Carestia, Clementina


    We report a new unstable variant identified in three carriers of a family from East Sicily; it was named Hb Bronte after the place from which the family originated. DNA sequencing from nucleotides -181 to +894 (alpha1) and to +884 (alpha2) revealed a GTG-->GGG substitution at codon 93 of the alpha2-globin gene. The MCV and MCH values were at the lower end of the normal range in the carriers. On cation exchange high performance liquid chromatography (HPLC), the Hb A2 level was apparently increased to around 6%, and a small abnormal peak (0.3-0.4%) was detected after Hb A2. Two abnormal bands were detected by cellulose acetate electrophoresis: a major band (about 3-4%) migrated between Hb A and Hb F; a minor band (<1%) migrated between Hb A2 and carbonic anhydrase. Normal values of Hb A2 were detected by DEAE microchromatography. On reversed phase HPLC the variant chain was not detected, and most likely it was eluted with the alpha chain peak. The isopropanol stability test was very slightly positive in the carriers. Hemolytic symptoms were absent with the exception of indirect bilirubin, which was at high borderline in 2/3 carriers. In biosynthesis in vitro, the specific activity of the alpha chains was much higher than that of the beta-globin chains, and the alpha/beta biosynthetic ratio in the mother and proband was of the beta-thalassemia (thal) type (2.24 and 2.54, respectively). Time course experiments showed that the increase of the 3H-specific activity of the peak containing normal and variant alpha chains was not linear and was much higher than that of beta chains; moreover, the alpha/beta biosynthetic ratio varied during the 2 hours incubation.

  13. Estrogen-related receptor {alpha} modulates the expression of adipogenesis-related genes during adipocyte differentiation

    SciTech Connect

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi . E-mail:


    Estrogen-related receptor {alpha} (ERR{alpha}) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERR{alpha} in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERR{alpha} and ERR{alpha}-related transcriptional coactivators, peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) coactivator-1{alpha} (PGC-1{alpha}) and PGC-1{beta}, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERR{alpha}-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPAR{gamma}, and PGC-1{alpha} in 3T3-L1 cells in the adipogenesis medium. ERR{alpha} and PGC-1{beta} mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERR{alpha} in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERR{alpha} may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  14. The primary transcription unit of the human alpha 2 globin gene defined by quantitative RT/PCR.

    PubMed Central

    Owczarek, C M; Enriquez-Harris, P; Proudfoot, N J


    We have set up an experimental system to map the primary transcription unit of the human alpha 2 globin gene. The duplicated human alpha globin genes (alpha 2-alpha 1) were linked to the alpha globin locus Positive Regulatory Element (PRE) and stably transfected into murine erythroleukaemia cells. We then developed a quantitative reverse transcriptase, polymerase chain reaction assay to map alpha 2 primary transcripts using primer pairs derived from different parts of the alpha 2 globin gene and its 3' flanking region. This approach has revealed the presence of steady state nuclear RNA past the poly(A) site of the alpha 2 globin gene at approximately 40% of the level of unspliced intron transcript. Furthermore, these 3' flanking transcripts diminish 500 bp into the 3' flanking region, identifying this part of the alpha 2 globin gene as the principal region of termination of transcription. Images PMID:1371868

  15. Identification of Core Alpha 1,3-Fucosyltransferase Gene From Silkworm: An Insect Popularly Used to Express Mammalian Proteins.


    Minagawa, Sachi; Sekiguchi, Satoshi; Nakaso, Yuzuru; Tomita, Masahiro; Takahisa, Manabu; Yasuda, Hideyo


    Silkworm has great potential as production system of recombinant mammalian proteins. When the protein products are used for medical purpose, it is required to reduce the risk of an allergy, the content of core alpha 1,3-fucosyl residue attached to the N-glycan of proteins, for example. We isolated the gene of an enzyme responsible for the transfer of core alpha 1,3-fucosyl residue, core alpha 1,3-fucosyltransferase (Fuc-T C3), from silkworm. A candidate cDNA for silkworm Fuc-T C3 was isolated as a homolog of the fruit fly enzyme gene fucTA. The gene was located on chromosome 7 of the silkworm genome and was composed of seven exons, which spanned approximately 10 kb on the genome. The coding region of the gene was 1,350 bp and encoded a 450-amino acid protein with a molecular mass of 52.2 kDa. Deduced amino acid sequence of the coding region showed one transmembrane domain in its N-terminal and typical motifs common to fucosyltransferases including Fuc-T C3s of other organisms in its C-terminal. The extract of CHO cells transfected with the cDNA showed Fuc-T C3 activity using GDP-fucose and DABS-GnGn peptide as substrates. These results showed this cDNA clone actually encodes silkworm Fuc-T C3.

  16. Expression pattern of the RAR alpha-PML fusion gene in acute promyelocytic leukemia.

    PubMed Central

    Alcalay, M; Zangrilli, D; Fagioli, M; Pandolfi, P P; Mencarelli, A; Lo Coco, F; Biondi, A; Grignani, F; Pelicci, P G


    Two chimeric genes, PML-RAR alpha and RAR alpha-PML, are formed as a consequence of the acute promyelocytic leukemia (APL)-specific reciprocal translocation of chromosomes 15 and 17 [t(15;17)]. PML-RAR alpha is expressed as a fusion protein. We investigated the organization and expression pattern of the RAR alpha-PML gene in a series of APL patients representative of the molecular heterogeneity of the t(15;17) and found (i) two types of RAR alpha-PML mRNA junctions (RAR alpha exon 2/PML exon 4 or RAR alpha exon 2/PML exon 7) that maintain the RAR alpha and PML longest open reading frames aligned and are the result of chromosome 15 breaking at two different sites; and (ii) 10 different RAR alpha-PML fusion transcripts that differ for the assembly of their PML coding exons. A RAR alpha-PML transcript was present in most, but not all, APL patients. Images PMID:1317574

  17. Therapeutic antibody gene transfer: an active approach to passive immunity.


    Bakker, Joost M; Bleeker, Wim K; Parren, Paul W H I


    Advances in gene transfer approaches are enabling the possibility of applying therapeutic antibodies using DNA. In particular gene transfer in combination with electroporation is promising and can result in generating in vivo antibody concentrations in the low therapeutic range. However, several important problems need to be dealt with before antibody gene transfer can become a valuable supplement to the current therapies. As antibody production following gene transfer is difficult to control, the danger of inducing autoimmune conditions or uncontrollable side effects occurs in cases in which autologous antigens are targeted. It is suggested that the most promising area of application therefore appears to be infectious disease in which heterologous antigens are targeted and concerns for long-term antibody exposure are minimal. Finally, genes encoding fully human antibodies will enhance long-term expression and decrease problems linked to immunogenicity.

  18. ''Pulling'' Nanoparticles into Water: Phase Transfer of Oleic Acid Stabilized Monodisperse Nanoparticles into Aqueous Solutions of alpha-Cyclodextrin

    SciTech Connect

    Wang, Y.; Wong, J.F.; Teng, X.; Lin, X.Z.; Yang, H.


    (B204)This paper describes a general method to drastically improve the disparity of oleic acid stabilized nanoparticles in aqueous solutions. We use oleic acid stabilized monodisperse nanoparticles of iron oxides and silver as model systems, and have modified the surface properties of these nanoparticles through the formation of an inclusion complex between surface-bound surfactant molecules and alpha-cyclodextrin (alpha-CD). After the modification, the nanoparticles of both iron oxide and Ag can transfer from hydrophobic solvents, such as hexane, to alpha-CD aqueous phase. The efficiency of the phase transfer to the aqueous solutions depend son the initial alpha-CD concentration. The alpha-CD/oleic acid complex stabilized nanoparticles can be stable for long periods of time in aqueous phase under ambient atmospheric conditions. Transmission electron microscopy (TME), ultraviolet-visible (UV-vis) spectroscopy, Fourier transform-infrared (FT-IR) spectroscopy, and colorimetric methods have been used in the characterization of these nanoparticles.

  19. The power of phylogenetic approaches to detect horizontally transferred genes

    PubMed Central

    Poptsova, Maria S; Gogarten, J Peter


    Background Horizontal gene transfer plays an important role in evolution because it sometimes allows recipient lineages to adapt to new ecological niches. High genes transfer frequencies were inferred for prokaryotic and early eukaryotic evolution. Does horizontal gene transfer also impact phylogenetic reconstruction of the evolutionary history of genomes and organisms? The answer to this question depends at least in part on the actual gene transfer frequencies and on the ability to weed out transferred genes from further analyses. Are the detected transfers mainly false positives, or are they the tip of an iceberg of many transfer events most of which go undetected by current methods? Results Phylogenetic detection methods appear to be the method of choice to infer gene transfers, especially for ancient transfers and those followed by orthologous replacement. Here we explore how well some of these methods perform using in silico transfers between the terminal branches of a gamma proteobacterial, genome based phylogeny. For the experiments performed here on average the AU test at a 5% significance level detects 90.3% of the transfers and 91% of the exchanges as significant. Using the Robinson-Foulds distance only 57.7% of the exchanges and 60% of the donations were identified as significant. Analyses using bipartition spectra appeared most successful in our test case. The power of detection was on average 97% using a 70% cut-off and 94.2% with 90% cut-off for identifying conflicting bipartitions, while the rate of false positives was below 4.2% and 2.1% for the two cut-offs, respectively. For all methods the detection rates improved when more intervening branches separated donor and recipient. Conclusion Rates of detected transfers should not be mistaken for the actual transfer rates; most analyses of gene transfers remain anecdotal. The method and significance level to identify potential gene transfer events represent a trade-off between the frequency of erroneous

  20. Retroviral-mediated gene transfer and expression of human phenylalanine hydroxylase in primary mouse hepatocytes.

    PubMed Central

    Peng, H; Armentano, D; MacKenzie-Graham, L; Shen, R F; Darlington, G; Ledley, F D; Woo, S L


    Genetic therapy for phenylketonuria (severe phenylalanine hydroxylase deficiency) may require introduction of a normal phenylalanine hydroxylase gene into hepatic cells of patients. We report development of a recombinant retrovirus based on the N2 vector for gene transfer and expression of human phenylalanine hydroxylase cDNA in primary mouse hepatocytes. This construct contains an internal promoter of the human alpha 1-antitrypsin gene driving transcription of the phenylalanine hydroxylase cDNA. Primary mouse hepatocytes were isolated from newborn mice, infected with the recombinant virus, and selected for expression of the neomycin-resistance gene. Hepatocytes transformed with the recombinant virus contained high levels of human phenylalanine hydroxylase mRNA transcripts originating form the retroviral and internal promoters. These results demonstrate that the transcriptional regulatory elements of the alpha 1-antitrypsin gene retain their tissue-specific function in the recombinant provirus and establish a method for efficient transfer and high-level expression of human phenylalanine hydroxylase in primary hepatocytes. Images PMID:3186716

  1. A recently transferred cluster of bacterial genes in Trichomonas vaginalis - lateral gene transfer and the fate of acquired genes

    PubMed Central


    Background Lateral Gene Transfer (LGT) has recently gained recognition as an important contributor to some eukaryote proteomes, but the mechanisms of acquisition and fixation in eukaryotic genomes are still uncertain. A previously defined norm for LGTs in microbial eukaryotes states that the majority are genes involved in metabolism, the LGTs are typically localized one by one, surrounded by vertically inherited genes on the chromosome, and phylogenetics shows that a broad collection of bacterial lineages have contributed to the transferome. Results A unique 34 kbp long fragment with 27 clustered genes (TvLF) of prokaryote origin was identified in the sequenced genome of the protozoan parasite Trichomonas vaginalis. Using a PCR based approach we confirmed the presence of the orthologous fragment in four additional T. vaginalis strains. Detailed sequence analyses unambiguously suggest that TvLF is the result of one single, recent LGT event. The proposed donor is a close relative to the firmicute bacterium Peptoniphilus harei. High nucleotide sequence similarity between T. vaginalis strains, as well as to P. harei, and the absence of homologs in other Trichomonas species, suggests that the transfer event took place after the radiation of the genus Trichomonas. Some genes have undergone pseudogenization and degradation, indicating that they may not be retained in the future. Functional annotations reveal that genes involved in informational processes are particularly prone to degradation. Conclusions We conclude that, although the majority of eukaryote LGTs are single gene occurrences, they may be acquired in clusters of several genes that are subsequently cleansed of evolutionarily less advantageous genes. PMID:24898731


    SciTech Connect

    Howard Ochman


    The aims of this research were to elucidate the role and extent of lateral transfer in the differentiation of bacterial strains and species, and to assess the impact of gene transfer on the evolution of bacterial genomes. The ultimate goal of the project is to examine the dynamics of a core set of protein-coding genes (i.e., those that are distributed universally among Bacteria) by developing conserved primers that would allow their amplification and sequencing in any bacterial taxa. In addition, we adopted a bioinformatic approach to elucidate the extent of lateral gene transfer in sequenced genome.

  3. Concomitant T-cell receptor alpha and delta gene rearrangements in individual T-cell precursors.

    PubMed Central

    Thompson, S D; Pelkonen, J; Hurwitz, J L


    A debate has recently surfaced concerning the degree of precommitment attained by alpha beta and gamma delta T-cell precursors prior to T-cell receptor (TCR) gene rearrangement. It has been suggested that precursors may be precommitted to rearrange either alpha or delta genes, but not both, thus giving rise to alpha beta- and gamma delta-producing T cells, respectively. Alternatively, the precursors may be flexible with regard to potential TCR gene rearrangements. To address this controversy, the gene rearrangements among a group of T-cell hybridomas from fetal, newborn, and early postnatal mouse thymi were examined. Six probes spanning the delta and alpha loci were used in Southern blot analyses to characterize the rearrangements which occurred on homologous chromosomes in each cell. Although homologous chromosomes often rearranged in synchrony within the alpha locus, a number of hybridomas were found which had retained a delta rearrangement on one chromosome and an alpha rearrangement on the second. Results show that a precommitment by T cells to rearrange delta or alpha genes in a mutually exclusive manner is not an absolute feature of mouse thymocyte development. Images PMID:2164690

  4. DNA elements regulating alpha1-tubulin gene induction during regeneration of eukaryotic flagella.


    Periz, G; Keller, L R


    Eukaryotic flagella are complex organelles composed of more than 200 polypeptides. Little is known about the regulatory mechanisms governing synthesis of the flagellar protein subunits and their assembly into this complex organelle. The unicellular green alga Chlamydomonas reinhardtii is the premier experimental model system for studying such cellular processes. When acid shocked, C. reinhardtii excises its flagella, rapidly and coordinately activates transcription of a set of flagellar genes, and ultimately regenerates a new flagellar pair. To define functionally the regulatory sequences that govern induction of the set of genes after acid shock, we analyzed the alpha1-tubulin gene promoter. To simplify transcriptional analysis in vivo, we inserted the selectable marker gene ARG7 on the same plasmid with a tagged alpha1-tubulin gene and stably introduced it into C. reinhardtii cells. By deletion of various sequences, two promoter regions (-176 to -122 and -85 to -16) were identified as important for induction of the tagged alpha1-tubulin gene. Deleting the region between -176 and -122 from the transcription start site resulted in an induction level which was only 45 to 70% of that of the resident gene. Deleting the region upstream of -56 resulted in a complete loss of inducibility without affecting basal expression. The alpha1-tubulin promoter region from -85 to -16 conferred partial acid shock inducibility to an arylsulfatase (ARS) reporter gene. These results show that induction of the alpha1-tubulin gene after acid shock is a complex response that requires diverse sequence elements.

  5. Intracellular gene transfer: Reduced hydrophobicity facilitates gene transfer for subunit 2 of cytochrome c oxidase

    PubMed Central

    Daley, Daniel O.; Clifton, Rachel; Whelan, James


    Subunit 2 of cytochrome c oxidase (Cox2) in legumes offers a rare opportunity to investigate factors necessary for successful gene transfer of a hydrophobic protein that is usually mitochondrial-encoded. We found that changes in local hydrophobicity were necessary to allow import of this nuclear-encoded protein into mitochondria. All legume species containing both a mitochondrial and nuclear encoded Cox2 displayed a similar pattern, with a large decrease in hydrophobicity evident in the first transmembrane region of the nuclear encoded protein compared with the organelle-encoded protein. Mitochondrial-encoded Cox2 could not be imported into mitochondria under the direction of the mitochondrial targeting sequence that readily supports the import of nuclear encoded Cox2. Removal of the first transmembrane region promotes import ability of the mitochondrial-encoded Cox2. Changing just two amino acids in the first transmembrane region of mitochondrial-encoded Cox2 to the corresponding amino acids in the nuclear encoded Cox2 also promotes import ability, whereas changing the same two amino acids in the nuclear encoded Cox2 to what they are in the mitochondrial-encoded copy prevents import. Therefore, changes in amino acids in the mature protein were necessary and sufficient for gene transfer to allow import under the direction of an appropriate signal to achieve the functional topology of Cox2. PMID:12142462

  6. Differential regulation of alpha7 nicotinic receptor gene (CHRNA7) expression in schizophrenic smokers.


    Mexal, Sharon; Berger, Ralph; Logel, Judy; Ross, Randal G; Freedman, Robert; Leonard, Sherry


    The alpha7 neuronal nicotinic receptor gene (CHRNA7) has been implicated in the pathophysiology of schizophrenia by genetic and pharmacological studies. Expression of the alpha7* receptor, as measured by [(125)I]alpha-bungarotoxin autoradiography, is decreased in postmortem brain of schizophrenic subjects compared to non-mentally ill controls. Most schizophrenic patients are heavy smokers, with high levels of serum cotinine. Smoking changes the expression of multiple genes and differentially regulates gene expression in schizophrenic hippocampus. We examined the effects of smoking on CHRNA7 expression in the same tissue and find that smoking differentially regulates expression of both mRNA and protein for this gene. CHRNA7 mRNA and protein levels are significantly lower in schizophrenic nonsmokers compared to control nonsmokers and are brought to control levels in schizophrenic smokers. Sufficient protein but low surface expression of the alpha7* receptor, seen in the autoradiographic studies, suggests aberrant assembly or trafficking of the receptor.

  7. Human collagen genes encoding basement membrane. cap alpha. 1(IV) and. cap alpha. 2(IV) chains map to the distal long arm of chromosome 13

    SciTech Connect

    Griffin, C.A.; Emanuel, B.S.; Hansen, J.R.; Cavenee, W.K.; Myers, J.C.


    At least 20 genes encode the structurally related collagen chains that comprise > 10 homo- or heterotrimeric types. Six members of this multigene family have been assigned to five chromosomes in the human genome. The two type I genes, ..cap alpha..1 and ..cap alpha..2, are located on chromosomes 17 and 7, respectively, and the ..cap alpha..1(II) gene is located on chromosome 12. Their recent mapping of the ..cap alpha..1(III) and ..cap alpha..2(V) genes to the q24.3 ..-->.. q31 region of chromosome 2 provided the only evidence that the collagen genes are not entirely dispersed. To further determine their organization, the authors and others localized the ..cap alpha..1(IV) gene to chromosome 13 and in their experiments sublocalized the gene to band q34 by in situ hybridization. Here they show the presence of the ..cap alpha..2 type IV locus also on the distal long arm of chromosome 13 by hybridizing a human ..cap alpha..2(IV) cDNA clone to rodent-human hybrids and to metaphase chromosomes. These studies represent the only demonstration of linkage between genes encoding both polypeptide chains of the same collagen type.

  8. Electrical characterization of a Space Station Freedom alpha utility transfer assembly

    NASA Technical Reports Server (NTRS)

    Yenni, Edward J.


    Electrical power, command signals and data are transferred across the Space Station Freedom solar alpha rotary joint by roll rings, which are incorporated within the Utility Transfer Assembly (UTA) designed and manufactured by Honeywell Space Systems Operations. A developmental Model of the UTA was tested at the NASA Lewis Research Center using the Power Management and Distribution DC test bed. The objectives of these tests were to obtain data for calibrating system models and to support final design of qualification and flight units. This testing marked the first time the UTA was operated at high power levels and exposed to electrical conditions similar to that which it will encounter on the actual Space Station. Satisfactory UTA system performance was demonstrated within the scope of this testing.

  9. The alpha-tubulin gene family expressed during cell differentiation in Naegleria gruberi

    PubMed Central


    Genes that direct the programmed synthesis of flagellar alpha-tubulin during the differentiation of Naegleria gruberi from amebae to flagellates have been cloned, and found to be novel with respect to gene organization, sequence, and conservation. The flagellar alpha- tubulin gene family is represented in the genome by about eight homologous DNA segments that are exceptionally similar and yet are neither identical nor arrayed in a short tandem repeat. The coding regions of three of these genes have been sequenced, two from cDNA clones and one from an intronless genomic gene. These three genes encode an identical alpha-tubulin that is conserved relative to the alpha-tubulins of other organisms except at the carboxyl terminus, where the protein is elongated by two residues and ends in a terminal glutamine instead of the canonical tyrosine. In spite of the protein conservation, the Naegleria DNA sequence has diverged markedly from the alpha-tubulin genes of other organisms, a counterexample to the idea that tubulin genes are conserved. alpha-Tubulin mRNA homologous to this gene family has not been detected in amebae. This mRNA increases markedly in abundance during the first hour of differentiation, and then decreases even more rapidly with a half-life of approximately 8 min. The abundance of physical alpha-tubulin mRNA rises and subsequently falls in parallel with the abundance of translatable flagellar tubulin mRNA and with the in vivo rate of flagellar tubulin synthesis, which indicates that flagellar tubulin synthesis is directly regulated by the relative rates of transcription and mRNA degradation. PMID:2838492

  10. Thiazolidinediones inhibit REG I{alpha} gene transcription in gastrointestinal cancer cells

    SciTech Connect

    Yamauchi, Akiyo; Takahashi, Iwao; Takasawa, Shin; Nata, Koji; Noguchi, Naoya; Ikeda, Takayuki; Yoshikawa, Takeo; Shervani, Nausheen J.; Suzuki, Iwao; Uruno, Akira; Unno, Michiaki; Okamoto, Hiroshi Sugawara, Akira


    REG (Regenerating gene) I{alpha} protein functions as a growth factor for gastrointestinal cancer cells, and its mRNA expression is strongly associated with a poor prognosis in gastrointestinal cancer patients. We here demonstrated that PPAR{gamma}-agonist thiazolidinediones (TZDs) inhibited cell proliferation and REG I{alpha} protein/mRNA expression in gastrointestinal cancer cells. TZDs inhibited the REG I{alpha} gene promoter activity, via its cis-acting element which lacked PPAR response element and could not bind to PPAR{gamma}, in PPAR{gamma}-expressing gastrointestinal cancer cells. The inhibition was reversed by co-treatment with a specific PPAR{gamma}-antagonist GW9662. Although TZDs did not inhibit the REG I{alpha} gene promoter activity in PPAR{gamma}-non-expressing cells, PPAR{gamma} overexpression in the cells recovered their inhibitory effect. Taken together, TZDs inhibit REG I{alpha} gene transcription through a PPAR{gamma}-dependent pathway. The TZD-induced REG I{alpha} mRNA reduction was abolished by cycloheximide, indicating the necessity of novel protein(s) synthesis. TZDs may therefore be a candidate for novel anti-cancer drugs for patients with gastrointestinal cancer expressing both REG I{alpha} and PPAR{gamma}.

  11. Gene transfer in inner ear cells: a challenging race.


    Sacheli, R; Delacroix, L; Vandenackerveken, P; Nguyen, L; Malgrange, B


    Recent advances in human genomics led to the identification of numerous defective genes causing deafness, which represent novel putative therapeutic targets. Future gene-based treatment of deafness resulting from genetic or acquired sensorineural hearing loss may include strategies ranging from gene therapy to antisense delivery. For successful development of gene therapies, a minimal requirement involves the engineering of appropriate gene carrier systems. Transfer of exogenous genetic material into the mammalian inner ear using viral or non-viral vectors has been characterized over the last decade. The nature of inner ear cells targeted, as well as the transgene expression level and duration, are highly dependent on the vector type, the route of administration and the strength of the promoter driving expression. This review summarizes and discusses recent advances in inner ear gene-transfer technologies aimed at examining gene function or identifying new treatment for inner ear disorders.

  12. Drift diffusion model of reward and punishment learning in rare alpha-synuclein gene carriers.


    Moustafa, Ahmed A; Kéri, Szabolcs; Polner, Bertalan; White, Corey


    To understand the cognitive effects of alpha-synuclein polymorphism, we employed a drift diffusion model (DDM) to analyze reward- and punishment-guided probabilistic learning task data of participants with the rare alpha-synuclein gene duplication and age- and education-matched controls. Overall, the DDM analysis showed that, relative to controls, asymptomatic alpha-synuclein gene duplication carriers had significantly increased learning from negative feedback, while they tended to show impaired learning from positive feedback. No significant differences were found in response caution, response bias, or motor/encoding time. We here discuss the implications of these computational findings to the understanding of the neural mechanism of alpha-synuclein gene duplication.

  13. Gene transfer as a future therapy for rheumatoid arthritis.


    Müller-Ladner, Ulf; Pap, Thomas; Gay, Renate E; Gay, Steffen


    Inhibiting key pathogenic processes within the rheumatoid synovium is a most attractive goal to achieve, and the number of potential intra- and extracellular pathways operative in rheumatoid arthritis (RA) that could be used for a gene therapy strategy is increasing continuously. Gene transfer or gene therapy might also be one of the approaches to solve the problem of long-term expression of therapeutic genes, in order to replace the frequent application of recombinant proteins, in the future. However, at present, gene therapy has not reached a realistic clinical stage, which is mainly due to severe side effects in humans, the complexity of RA pathophysiology and the current state of available gene transfer techniques. On the other hand, novel gene delivery systems are not restricted to vectors or certain types of cells, as mobile cells including macrophages, dendritic cells, lymphocytes and multipotent stem cells can also be used as smart gene transfer vehicles. Moreover, the observation in animal models that application of viral vectors into a joint can exert additional therapeutic effects in nearby joints might also facilitate the transfer from animal to human gene therapy. Future strategies will also examine the potential of novel long-term expression vectors such as lentiviruses and cytomegalovirus (CMV)-based viruses as a basis for future clinical trials in RA.

  14. HNF1alpha is involved in tissue-specific regulation of CFTR gene expression.

    PubMed Central

    Mouchel, Nathalie; Henstra, Sytse A; McCarthy, Victoria A; Williams, Sarah H; Phylactides, Marios; Harris, Ann


    The CFTR (cystic fibrosis transmembrane conductance regulator) gene shows a complex pattern of expression with tissue-specific and temporal regulation. However, the genetic elements and transcription factors that control CFTR expression are largely unidentified. The CFTR promoter does not confer tissue specificity on gene expression, suggesting that there are regulatory elements outside the upstream region. Analysis of potential regulatory elements defined as DNase 1-hypersensitive sites within introns of the gene revealed multiple predicted binding sites for the HNF1alpha (hepatocyte nuclear factor 1alpha) transcription factor. HNF1alpha, which is expressed in many of the same epithelial cell types as CFTR and shows similar differentiation-dependent changes in gene expression, bound to these sites in vitro. Overexpression of heterologous HNF1alpha augmented CFTR transcription in vivo. In contrast, antisense inhibition of HNF1 alpha transcription decreased the CFTR mRNA levels. Hnf1 alpha knockout mice showed lower levels of CFTR mRNA in their small intestine in comparison with wild-type mice. This is the first report of a transcription factor, which confers tissue specificity on the expression of this important disease-associated gene. PMID:14656222

  15. Human tumor necrosis factor alpha gene regulation by virus and lipopolysaccharide.


    Goldfeld, A E; Doyle, C; Maniatis, T


    We have identified a region of the human tumor necrosis factor alpha (TNF-alpha) gene promoter that is necessary for maximal constitutive, virus-induced, and lipopolysaccharide (LPS)-induced transcription. This region contains three sites that match an NF-kappa B binding-site consensus sequence. We show that these three sites specifically bind NF-kappa B in vitro, yet each of these sites can be deleted from the TNF-alpha promoter with little effect on the induction of the gene by virus or LPS. Moreover, when multimers of these three sites are placed upstream from a truncated TNF-alpha promoter, or a heterologous promoter, an increase in the basal level of transcription is observed that is influenced by sequence context and cell type. However, these multimers are not sufficient for virus or LPS induction of either promoter. Thus, unlike other virus- and LPS-inducible promoters that contain NF-kappa B binding sites, these sites from the TNF-alpha promoter are neither required nor sufficient for virus or LPS induction. Comparison of the sequence requirements of virus induction of the human TNF-alpha gene in mouse L929 and P388D1 cells reveals significant differences, indicating that the sequence requirements for virus induction of the gene are cell type-specific. However, the sequences required for virus and LPS induction of the gene in a single cell type, P388D1, overlap.

  16. Phytol directly activates peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) and regulates gene expression involved in lipid metabolism in PPAR{alpha}-expressing HepG2 hepatocytes

    SciTech Connect

    Goto, Tsuyoshi; Takahashi, Nobuyuki; Kato, Sota; Egawa, Kahori; Ebisu, Shogo; Moriyama, Tatsuya; Fushiki, Tohru; Kawada, Teruo . E-mail:


    The peroxisome proliferator-activated receptor (PPAR) is one of the indispensable transcription factors for regulating lipid metabolism in various tissues. In our screening for natural compounds that activate PPAR using luciferase assays, a branched-carbon-chain alcohol (a component of chlorophylls), phytol, has been identified as a PPAR{alpha}-specific activator. Phytol induced the increase in PPAR{alpha}-dependent luciferase activity and the degree of in vitro binding of a coactivator, SRC-1, to GST-PPAR{alpha}. Moreover, the addition of phytol upregulated the expression of PPAR{alpha}-target genes at both mRNA and protein levels in PPAR{alpha}-expressing HepG2 hepatocytes. These findings indicate that phytol is functional as a PPAR{alpha} ligand and that it stimulates the expression of PPAR{alpha}-target genes in intact cells. Because PPAR{alpha} activation enhances circulating lipid clearance, phytol may be important in managing abnormalities in lipid metabolism.

  17. Tobacco plants transformed with the bean. alpha. ai gene express an inhibitor of insect. alpha. -amylase in their seeds. [Nicotiana tabacum; Tenebrio molitor

    SciTech Connect

    Altabella, T.; Chrispeels, M.J. )


    Bean (Phaseolus vulgaris L.) seeds contain a putative plant defense protein that inhibits insect and mammalian but not plant {alpha}-amylases. We recently presented strong circumstantial evidence that this {alpha}-amylase inhibitor ({alpha}Al) is encoded by an already-identified lectin gene whose product is referred to as lectin-like-protein (LLP). We have now made a chimeric gene consisting of the coding sequence of the lectin gene that encodes LLP and the 5{prime} and 3{prime} flanking sequences of the lectin gene that encodes phytohemagglutinin-L. When this chimeric gene was expressed in transgenic tobacco (Nicotiana tabacum), we observed in the seeds a series of polypeptides (M{sub r} 10,000-18,000) that cross-react with antibodies to the bean {alpha}-amylase inhibitor. Most of these polypeptides bind to a pig pancreas {alpha}-amylase affinity column. An extract of the seeds of the transformed tobacco plants inhibits pig pancreas {alpha}-amylase activity as well as the {alpha}-amylase present in the midgut of Tenebrio molitor. We suggest that introduction of this lectin gene (to be called {alpha}ai) into other leguminous plants may be a strategy to protect the seeds from the seed-eating larvae of Coleoptera.

  18. Muscle as a target for supplementary factor IX gene transfer.


    Hoffman, Brad E; Dobrzynski, Eric; Wang, Lixin; Hirao, Lauren; Mingozzi, Federico; Cao, Ou; Herzog, Roland W


    Immune responses to the factor IX (F.IX) transgene product are a concern in gene therapy for the X-linked bleeding disorder hemophilia B. The risk for such responses is determined by several factors, including the vector, target tissue, and others. Previously, we have demonstrated that hepatic gene transfer with adeno-associated viral (AAV) vectors can induce F.IX-specific immune tolerance. Muscle-derived F.IX expression, however, is limited by a local immune response. Here, skeletal muscle was investigated as a target for supplemental gene transfer. Given the low invasiveness of intramuscular injections, this route would be ideal for secondary gene transfer, thereby boosting levels of transgene expression. However, this is feasible only if immune tolerance established by compartmentalization of expression to the liver extends to other sites. Immune tolerance to human F.IX established by prior hepatic AAV-2 gene transfer was maintained after subsequent injection of AAV-1 or adenoviral vector into skeletal muscle, and tolerized mice failed to form antibodies or an interferon (IFN)-gamma(+) T cell response to human F.IX. A sustained increase in systemic transgene expression was obtained for AAV-1, whereas an increase after adenoviral gene transfer was transient. A CD8(+) T cell response specifically against adenovirus-transduced fibers was observed, suggesting that cytotoxic T cell responses against viral antigens were sufficient to eliminate expression in muscle. In summary, the data demonstrate that supplemental F.IX gene transfer to skeletal muscle does not break tolerance achieved by liver-derived expression. The approach is efficacious, if the vector for muscle gene transfer does not express immunogenic viral proteins.

  19. Gene organization around the phenylalanyl-transfer ribonucleic acid synthetase locus in Escherichia coli.

    PubMed Central

    Comer, M M


    The organization of seven genes located at about 38 min on the genetic map of Escherichia coli was examined; these genes included pheS and pheT, which code for the alpha and beta subunits of phenylalanyl-transfer ribonucleic acid synthetase, and thrS, the structural gene for threonyl-transfer ribonucleic acid synthetase. Deletion mutants were isolated from an F-prime-containing merodiploid strain and were characterized genetically. Seventeen different kinds of deletions extending into pheS of pheT were identified. These deletions unambiguously defined the gene order as aroD pps himA pheT pheS thrS pfkB. Mutants with deletions covering either pheS or pheT, but not both, were analyzed further by assay of phenylalanyl-transfer ribonucleic acid synthetase. The phenotype of the mutants with a deletion from pfkB through pheS was anomalous; although the pheT gene was apparently still present, its product, the beta subunit, was much reduced in activity. PMID:7012115

  20. Global Analysis of Horizontal Gene Transfer in Fusarium verticillioides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The co-occurrence of microbes within plants and other specialized niches may facilitate horizontal gene transfer (HGT) affecting host-pathogen interactions. We recently identified fungal-to-fungal HGTs involving metabolic gene clusters. For a global analysis of HGTs in the maize pathogen Fusarium ve...

  1. Karyopherin alpha2: a control step of glucose-sensitive gene expression in hepatic cells.

    PubMed Central

    Guillemain, Ghislaine; Muñoz-Alonso, Maria J; Cassany, Aurélia; Loizeau, Martine; Faussat, Anne-Marie; Burnol, Anne-Françoise; Leturque, Armelle


    Glucose is required for an efficient expression of the glucose transporter GLUT2 and other genes. We have shown previously that the intracytoplasmic loop of GLUT2 can divert a signal, resulting in the stimulation of glucose-sensitive gene transcription. In the present study, by interaction with the GLUT2 loop, we have cloned the rat karyopherin alpha2, a receptor involved in nuclear import. The specificity of the binding was restricted to GLUT2, and not GLUT1 or GLUT4, and to karyopherin alpha2, not alpha1. When rendered irreversible by a cross-linking agent, this transitory interaction was detected in vivo in hepatocytes. A role for karyopherin alpha2 in the transcription of two glucose-sensitive genes was investigated by transfection of native and inactive green fluorescent protein-karyopherin alpha2 in GLUT2-expressing hepatoma cells. The amount of inactive karyopherin alpha2 receptor reduced, in a dose-dependent manner, the GLUT2 and liver pyruvate kinase mRNA levels by competition with endogenous active receptor. In contrast, the overexpression of karyopherin alpha2 did not significantly stimulate GLUT2 and liver pyruvate kinase mRNA accumulation in green fluorescent protein-sorted cells. The present study suggests that, in concert with glucose metabolism, karyopherin alpha2 transmits a signal to the nucleus to regulate glucose-sensitive gene expression. The transitory tethering of karyopherin alpha2 to GLUT2 at the plasma membrane might indicate that the receptor can load the cargo to be imported locally. PMID:11988093

  2. Karyopherin alpha2: a control step of glucose-sensitive gene expression in hepatic cells.


    Guillemain, Ghislaine; Muñoz-Alonso, Maria J; Cassany, Aurélia; Loizeau, Martine; Faussat, Anne-Marie; Burnol, Anne-Françoise; Leturque, Armelle


    Glucose is required for an efficient expression of the glucose transporter GLUT2 and other genes. We have shown previously that the intracytoplasmic loop of GLUT2 can divert a signal, resulting in the stimulation of glucose-sensitive gene transcription. In the present study, by interaction with the GLUT2 loop, we have cloned the rat karyopherin alpha2, a receptor involved in nuclear import. The specificity of the binding was restricted to GLUT2, and not GLUT1 or GLUT4, and to karyopherin alpha2, not alpha1. When rendered irreversible by a cross-linking agent, this transitory interaction was detected in vivo in hepatocytes. A role for karyopherin alpha2 in the transcription of two glucose-sensitive genes was investigated by transfection of native and inactive green fluorescent protein-karyopherin alpha2 in GLUT2-expressing hepatoma cells. The amount of inactive karyopherin alpha2 receptor reduced, in a dose-dependent manner, the GLUT2 and liver pyruvate kinase mRNA levels by competition with endogenous active receptor. In contrast, the overexpression of karyopherin alpha2 did not significantly stimulate GLUT2 and liver pyruvate kinase mRNA accumulation in green fluorescent protein-sorted cells. The present study suggests that, in concert with glucose metabolism, karyopherin alpha2 transmits a signal to the nucleus to regulate glucose-sensitive gene expression. The transitory tethering of karyopherin alpha2 to GLUT2 at the plasma membrane might indicate that the receptor can load the cargo to be imported locally.

  3. Evolution of and horizontal gene transfer in the Endornavirus genus.


    Song, Dami; Cho, Won Kyong; Park, Sang-Ho; Jo, Yeonhwa; Kim, Kook-Hyung


    The transfer of genetic information between unrelated species is referred to as horizontal gene transfer. Previous studies have demonstrated that both retroviral and non-retroviral sequences have been integrated into eukaryotic genomes. Recently, we identified many non-retroviral sequences in plant genomes. In this study, we investigated the evolutionary origin and gene transfer of domains present in endornaviruses which are double-stranded RNA viruses. Using the available sequences for endornaviruses, we found that Bell pepper endornavirus-like sequences homologous to the glycosyltransferase 28 domain are present in plants, fungi, and bacteria. The phylogenetic analysis revealed the glycosyltransferase 28 domain of Bell pepper endornavirus may have originated from bacteria. In addition, two domains of Oryza sativa endornavirus, a glycosyltransferase sugar-binding domain and a capsular polysaccharide synthesis protein, also exhibited high similarity to those of bacteria. We found evidence that at least four independent horizontal gene transfer events for the glycosyltransferase 28 domain have occurred among plants, fungi, and bacteria. The glycosyltransferase sugar-binding domains of two proteobacteria may have been horizontally transferred to the genome of Thalassiosira pseudonana. Our study is the first to show that three glycome-related viral genes in the genus Endornavirus have been acquired from marine bacteria by horizontal gene transfer.

  4. Evolution of and Horizontal Gene Transfer in the Endornavirus Genus

    PubMed Central

    Park, Sang-Ho; Jo, Yeonhwa; Kim, Kook-Hyung


    The transfer of genetic information between unrelated species is referred to as horizontal gene transfer. Previous studies have demonstrated that both retroviral and non-retroviral sequences have been integrated into eukaryotic genomes. Recently, we identified many non-retroviral sequences in plant genomes. In this study, we investigated the evolutionary origin and gene transfer of domains present in endornaviruses which are double-stranded RNA viruses. Using the available sequences for endornaviruses, we found that Bell pepper endornavirus-like sequences homologous to the glycosyltransferase 28 domain are present in plants, fungi, and bacteria. The phylogenetic analysis revealed the glycosyltransferase 28 domain of Bell pepper endornavirus may have originated from bacteria. In addition, two domains of Oryza sativa endornavirus, a glycosyltransferase sugar-binding domain and a capsular polysaccharide synthesis protein, also exhibited high similarity to those of bacteria. We found evidence that at least four independent horizontal gene transfer events for the glycosyltransferase 28 domain have occurred among plants, fungi, and bacteria. The glycosyltransferase sugar-binding domains of two proteobacteria may have been horizontally transferred to the genome of Thalassiosira pseudonana. Our study is the first to show that three glycome-related viral genes in the genus Endornavirus have been acquired from marine bacteria by horizontal gene transfer. PMID:23667703

  5. Analysis of the human [alpha]-globin gene cluster in transgenic mice

    SciTech Connect

    Sharpe, J.A.; Vyas, P.; Higgs, D.R.; Wood, W.G. ); Wells, D.J. ); Whitelaw, E. )


    A 350-bp segment of DNA associated with an erythroid-specific DNase I-hypersensitive site (HS -40), upstream of the [alpha]-globin gene cluster, has been identified as the major tissue-specific regulator of the [alpha]-globin genes. However, this element does not direct copy number-dependent or developmentally stable expression of the human genes in transgenic mice. To determine whether additional upstream hypersensitive sites could provide more complete regulation of [alpha] gene expression, the authors have studied 17 lines of transgenic mice bearing various DNA fragments containing HSs -33, -10, -8, and -4, in addition to HS -40. Position-independent, high-level expression of the human [zeta]- and [alpha]-globin genes was consistently observed in embryonic erythroid cells. However, the additional HSs did not confer copy-number dependence, alter the level of expression, or prevent the variable down-regulation of expression in adults. These results suggest that the region upstream of the human [alpha]-globin genes is not equivalent to that upstream of the [beta] locus and that although the two clusters are coordinately expressed, there may be differences in their regulation.

  6. Gene transfer agents: phage-like elements of genetic exchange

    PubMed Central

    Lang, Andrew S.; Zhaxybayeva, Olga; Beatty, J. Thomas


    Horizontal gene transfer is important in the evolution of bacterial and archaeal genomes. An interesting genetic exchange process is carried out by diverse phage-like gene transfer agents (GTAs) that are found in a wide range of prokaryotes. Although GTAs resemble phages, they lack the hallmark capabilities that define typical phages, and they package random pieces of the producing cell’s genome. In this Review, we discuss the defining characteristics of the GTAs that have been identified to date, along with potential functions for these agents and the possible evolutionary forces that act on the genes involved in their production. PMID:22683880

  7. Vector-mediated antibody gene transfer for infectious diseases.


    Schnepp, Bruce C; Johnson, Philip R


    This chapter discusses the emerging field of vector-mediated antibody gene transfer as an alternative vaccine for infectious disease, with a specific focus on HIV. However, this methodology need not be confined to HIV-1; the general strategy of vector-mediated antibody gene transfer can be applied to other difficult vaccine targets like hepatitis C virus, malaria, respiratory syncytial virus, and tuberculosis. This approach is an improvement over classical passive immunization strategies that administer antibody proteins to the host to provide protection from infection. With vector-mediated gene transfer, the antibody gene is delivered to the host, via a recombinant adeno-associated virus (rAAV) vector; this in turn results in long-term endogenous antibody expression from the injected muscle that confers protective immunity. Vector-mediated antibody gene transfer can rapidly move existing, potent broadly cross-neutralizing HIV-1-specific antibodies into the clinic. The gene transfer products demonstrate a potency and breadth identical to the original product. This strategy eliminates the need for immunogen design and interaction with the adaptive immune system to generate protection, a strategy that so far has shown limited promise.

  8. High frequency of horizontal gene transfer in the oceans.


    McDaniel, Lauren D; Young, Elizabeth; Delaney, Jennifer; Ruhnau, Fabian; Ritchie, Kim B; Paul, John H


    Oceanic bacteria perform many environmental functions, including biogeochemical cycling of many elements, metabolizing of greenhouse gases, functioning in oceanic food webs (microbial loop), and producing valuable natural products and viruses. We demonstrate that the widespread capability of marine bacteria to participate in horizontal gene transfer (HGT) in coastal and oceanic environments may be the result of gene transfer agents (GTAs), viral-like particles produced by α-Proteobacteria. We documented GTA-mediated gene transfer frequencies a thousand to a hundred million times higher than prior estimates of HGT in the oceans, with as high as 47% of the culturable natural microbial community confirmed as gene recipients. These findings suggest a plausible mechanism by which marine bacteria acquire novel traits, thus ensuring resilience in the face of environmental change.

  9. Emerging role of regulatory T cells in gene transfer.


    Cao, Ou; Furlan-Freguia, Christian; Arruda, Valder R; Herzog, Roland W


    Induction and maintenance of immune tolerance to therapeutic transgene products are key requirements for successful gene replacement therapies. Gene transfer may also be used to specifically induce immune tolerance and thereby augment other types of therapies. Similarly, gene therapies for treatment of autoimmune diseases are being developed in order to restore tolerance to self-antigens. Regulatory T cells have emerged as key players in many aspects of immune tolerance, and a rapidly increasing body of work documents induction and/or activation of regulatory T cells by gene transfer. Regulatory T cells may suppress antibody formation and cytotoxic T cell responses and may be critical for immune tolerance to therapeutic proteins. In this regard, CD4(+)CD25(+) regulatory T cells have been identified as important components of tolerance in several gene transfer protocols, including hepatic in vivo gene transfer. Augmentation of regulatory T cell responses should be a promising new tool to achieve tolerance and avoid immune-mediated rejection of gene therapy. During the past decade, it has become obvious that immune regulation is an important and integral component of tolerance to self-antigens and of many forms of induced tolerance. Gene therapy can only be successful if the immune system does not reject the therapeutic transgene product. Recent studies provide a rapidly growing body of evidence that regulatory T cells (T(reg)) are involved and often play a crucial role in tolerance to proteins expressed by means of gene transfer. This review seeks to provide an overview of these data and their implications for gene therapy.

  10. Characterization of Two Cysteine Transfer RNA Genes from Xenopus Laevis

    DTIC Science & Technology


    author hereby certifies that the use of any copyrighted material in the dissertation manuscript entitled: "Characterization of two cysteine tRNA genes...Uniformed Services University of the Health Sciences 11 ABSTRACT Title of Thesis: Characterization of Two Cysteine Transfer RNA Genes from Xenopus...method after constructing a set of deletions and reclonlng into the plasmid pUC 8. The DNA fragment is 1737 bp long and contains two cysteine tRNA genes

  11. Localization of the {alpha}7 integrin gene (ITGA7) on human chromosome 12q13: Clustering of integrin and Hox genes implies parallel evolution of these gene families

    SciTech Connect

    Wang, W.; Wu, W.; Kaufman, S.J.


    Expression of the {alpha}7 integrin gene (ITGA7) is developmentally regulated during the formation of skeletal muscle. Increased levels of expression and production of isoforms containing different cytoplasmic and extracellular domains accompany myogenesis. To determine whether a single or multiple {alpha}7 gene(s) underlie the structural diversity in this alpha chain that accompanies development, we have examined the rat and human genomes by Southern blotting and in situ hybridization. Our results demonstrate that there is only one {alpha}7 gene in both the rat and the human genomes. In the human, ITGA7 is present on chromosome 12q13. Phylogenetic analysis of the integrin alpha chain sequences suggests that the early integrin genes evolved in two pathways to form the I-integrins and the non-I-integrins. The I-integrin alpha chains contain an additional sequence of approximately 180 amino acids and arose as a result of an early insertion into the non-I-gene. The I-chain subfamily further evolved by duplications within the same chromosome. The non-I-integrin alpha chain genes are localized in clusters on chromosomes 2, 12, and 17, and this closely coincides with the localization of the human homeobox gene clusters. Non-I-integrin alpha chain genes appear to have evolved in parallel and in proximity to the Hox clusters. Thus, the Hox genes that underlie the design of body structure and the Integrin genes that underlie informed cell-cell and cell-matrix interactions appear to have evolved in parallel and coordinate fashions. 52 refs., 5 figs., 2 tabs.

  12. Lateral Transfer of Genes and Gene Fragments in Staphylococcus Extends beyond Mobile Elements ▿ †

    PubMed Central

    Chan, Cheong Xin; Beiko, Robert G.; Ragan, Mark A.


    The widespread presence of antibiotic resistance and virulence among Staphylococcus isolates has been attributed in part to lateral genetic transfer (LGT), but little is known about the broader extent of LGT within this genus. Here we report the first systematic study of the modularity of genetic transfer among 13 Staphylococcus genomes covering four distinct named species. Using a topology-based phylogenetic approach, we found, among 1,354 sets of homologous genes examined, strong evidence of LGT in 368 (27.1%) gene sets, and weaker evidence in another 259 (19.1%). Within-gene and whole-gene transfer contribute almost equally to the topological discordance of these gene sets against a reference phylogeny. Comparing genetic transfer in single-copy and in multicopy gene sets, we observed a higher frequency of LGT in the latter, and a substantial functional bias in cases of whole-gene transfer (little such bias was observed in cases of fragmentary genetic transfer). We found evidence that lateral transfer, particularly of entire genes, impacts not only functions related to antibiotic, drug, and heavy-metal resistance, as well as membrane transport, but also core informational and metabolic functions not associated with mobile elements. Although patterns of sequence similarity support the cohesion of recognized species, LGT within S. aureus appears frequently to disrupt clonal complexes. Our results demonstrate that LGT and gene duplication play important parts in functional innovation in staphylococcal genomes. PMID:21622749

  13. RANGE: Gene Transfer of Reversibly Controlled Polycistronic Genes

    PubMed Central

    Chen, Yiwei; Cao, Liji; Luo, Chonglin; Ditzel, Désirée AW; Peter, Jörg; Sprengel, Rolf


    We developed a single vector recombinant adeno-associated viral (rAAV) expression system for spatial and reversible control of polycistronic gene expression. Our approach (i) integrates the advantages of the tetracycline (Tet)-controlled transcriptional silencer tTSKid and the self-cleaving 2A peptide bridge, (ii) combines essential regulatory components as an autoregulatory loop, (iii) simplifies the gene delivery scheme, and (iv) regulates multiple genes in a synchronized manner. Controlled by an upstream Tet-responsive element (TRE), both the ubiquitous chicken β-actin promoter (CAG) and the neuron-specific synapsin-1 promoter (Syn) could regulate expression of tTSKid together with two 2A-linked reporter genes. Transduction in vitro exhibited maximally 50-fold regulation by doxycycline (Dox). Determined by gene delivery method as well as promoter, highly specific tissues were transduced in vivo. Bioluminescence imaging (BLI) visualized reversible “ON/OFF” gene switches over repeated “Doxy-Cycling” in living mice. Thus, the reversible rAAV-mediated N-cistronic gene expression system, termed RANGE, may serve as a versatile tool to achieve reversible polycistronic gene regulation for the study of gene function as well as gene therapy. PMID:23571608

  14. [Cloning and structure of gene encoded alpha-latrocrustoxin from the Black widow spider venom].


    Danilevich, V N; Luk'ianov, S A; Grishin, E V


    The primary structure of the crusta gene encoding alpha-latrocrustoxin (alpha-LCT), a high molecular mass neurotoxin specific to crustaceans, was determined in the black widow spider Latrodectus mactans tredicimguttatus genome. The total length of the sequenced DNA was 4693 bp. The structural part of the black widow spider chromosome gene encoding alpha-LCT does not contain introns. The sequenced DNA contains a single extended open reading frame (4185 bp) and encodes a protein precursor of alpha-LCT, comprising 1395 aa. We assume the Met residue at position -10 relative to the N-terminal residue of Glu1 of the mature toxin to be the first one in the protein precursor. The calculated molecular mass of the precursor (156147 Da) exceeds that of the mature toxin by approximately 30 kDa. These data are in agreement with the notion that over the course of maturation the protein precursor undergoes double processing--cleavage of a decapeptide from the N-terminal part and of a approximately 200-aa fragment from the C-terminal part. alpha-LCT displayed a number of imperfect ankyrin-like repeats and areas of structural homology with earlier studied latrotoxins; the highest homology degree (62%) was revealed with alpha-latroinsectotoxin (alpha-LIT).

  15. Horizontal functional gene transfer from bacteria to fishes

    PubMed Central

    Sun, Bao-Fa; Li, Tong; Xiao, Jin-Hua; Jia, Ling-Yi; Liu, Li; Zhang, Peng; Murphy, Robert W.; He, Shun-Min; Huang, Da-Wei


    Invertebrates can acquire functional genes via horizontal gene transfer (HGT) from bacteria but fishes are not known to do so. We provide the first reliable evidence of one HGT event from marine bacteria to fishes. The HGT appears to have occurred after emergence of the teleosts. The transferred gene is expressed and regulated developmentally. Its successful integration and expression may change the genetic and metabolic repertoire of fishes. In addition, this gene contains conserved domains and similar tertiary structures in fishes and their putative donor bacteria. Thus, it may function similarly in both groups. Evolutionary analyses indicate that it evolved under purifying selection, further indicating its conserved function. We document the first likely case of HGT of functional gene from prokaryote to fishes. This discovery certifies that HGT can influence vertebrate evolution. PMID:26691285

  16. Horizontal functional gene transfer from bacteria to fishes.


    Sun, Bao-Fa; Li, Tong; Xiao, Jin-Hua; Jia, Ling-Yi; Liu, Li; Zhang, Peng; Murphy, Robert W; He, Shun-Min; Huang, Da-Wei


    Invertebrates can acquire functional genes via horizontal gene transfer (HGT) from bacteria but fishes are not known to do so. We provide the first reliable evidence of one HGT event from marine bacteria to fishes. The HGT appears to have occurred after emergence of the teleosts. The transferred gene is expressed and regulated developmentally. Its successful integration and expression may change the genetic and metabolic repertoire of fishes. In addition, this gene contains conserved domains and similar tertiary structures in fishes and their putative donor bacteria. Thus, it may function similarly in both groups. Evolutionary analyses indicate that it evolved under purifying selection, further indicating its conserved function. We document the first likely case of HGT of functional gene from prokaryote to fishes. This discovery certifies that HGT can influence vertebrate evolution.

  17. Estrogen-related receptor {alpha} is essential for the expression of antioxidant protection genes and mitochondrial function

    SciTech Connect

    Rangwala, Shamina M. . E-mail:; Li, Xiaoyan; Lindsley, Loren; Wang, Xiaomei; Shaughnessy, Stacey; Daniels, Thomas G.; Szustakowski, Joseph; Nirmala, N.R.; Wu, Zhidan; Stevenson, Susan C.


    Estrogen-related receptor {alpha} (ERR{alpha}) is an important mediator of mitochondrial biogenesis and function. To investigate the transcriptional network controlling these phenomena, we investigated mitochondrial gene expression in embryonic fibroblasts isolated from ERR{alpha} null mice. Peroxisome proliferator-activated receptor {gamma} coactivator-1{alpha} (PGC-1{alpha}) stimulated mitochondrial gene expression program in control cells, but not in the ERR{alpha} null cells. Interestingly, the induction of levels of mitochondrial oxidative stress protection genes in response to increased PGC-1{alpha} levels was dependent on ERR{alpha}. Furthermore, we found that the PGC-1{alpha}-mediated induction of estrogen-related receptor {gamma} and nuclear respiratory factor 2 (NRF-2), was dependent on the presence of ERR{alpha}. Basal levels of NRF-2 were decreased in the absence of ERR{alpha}. The absence of ERR{alpha} resulted in a decrease in citrate synthase enzyme activity in response to PGC-1{alpha} overexpression. Our results indicate an essential role for ERR{alpha} as a key regulator of oxidative metabolism.

  18. Occurrence and expression of gene transfer agent genes in marine bacterioplankton.


    Biers, Erin J; Wang, Kui; Pennington, Catherine; Belas, Robert; Chen, Feng; Moran, Mary Ann


    Genes with homology to the transduction-like gene transfer agent (GTA) were observed in genome sequences of three cultured members of the marine Roseobacter clade. A broader search for homologs for this host-controlled virus-like gene transfer system identified likely GTA systems in cultured Alphaproteobacteria, and particularly in marine bacterioplankton representatives. Expression of GTA genes and extracellular release of GTA particles ( approximately 50 to 70 nm) was demonstrated experimentally for the Roseobacter clade member Silicibacter pomeroyi DSS-3, and intraspecific gene transfer was documented. GTA homologs are surprisingly infrequent in marine metagenomic sequence data, however, and the role of this lateral gene transfer mechanism in ocean bacterioplankton communities remains unclear.

  19. Chicken alpha-globin switching depends on autonomous silencing of the embryonic pi globin gene by epigenetics mechanisms.


    Rincón-Arano, Héctor; Guerrero, Georgina; Valdes-Quezada, Christian; Recillas-Targa, Félix


    Switching in hemoglobin gene expression is an informative paradigm for studying transcriptional regulation. Here we determined the patterns of chicken alpha-globin gene expression during development and erythroid differentiation. Previously published data suggested that the promoter regions of alpha-globin genes contain the complete information for proper developmental regulation. However, our data show a preferential trans-activation of the embryonic alpha-globin gene independent of the developmental or differentiation stage. We also found that DNA methylation and histone deacetylation play key roles in silencing the expression of the embryonic pi gene in definitive erythrocytes. However, drug-mediated reactivation of the embryonic gene during definitive erythropoiesis dramatically impaired the expression of the adult genes, suggesting gene competition or interference for enhancer elements. Our results also support a model in which the lack of open chromatin marks and localized recruitment of chicken MeCP2 contribute to autonomous gene silencing of the embryonic alpha-globin gene in a developmentally specific manner. We propose that epigenetic mechanisms are necessary for in vivo chicken alpha-globin gene switching through differential gene silencing of the embryonic alpha-globin gene in order to allow proper activation of adult alpha-globin genes.

  20. Expression of human beta-hexosaminidase alpha-subunit gene (the gene defect of Tay-Sachs disease) in mouse brains upon engraftment of transduced progenitor cells.


    Lacorazza, H D; Flax, J D; Snyder, E Y; Jendoubi, M


    In humans, beta-hexosaminidase alpha-subunit deficiency prevents the formation of a functional beta-hexosaminidase A heterodimer resulting in the severe neurodegenerative disorder, Tay-Sachs disease. To explore the feasibility of using ex vivo gene transfer in this lysosomal storage disease, we produced ecotropic retroviruses encoding the human beta-hexosaminidase alpha-subunit cDNA and transduced multipotent neural cell lines. Transduced progenitors stably expressed and secreted high levels of biologically active beta-hexosaminidase A in vitro and cross-corrected the metabolic defect in a human Tay-Sachs fibroblasts cell line in vitro. These genetically engineered CNS progenitors were transplanted into the brains of both normal fetal and newborn mice. Engrafted brains, analyzed at various ages after transplant, produced substantial amounts of human beta-hexosaminidase alpha-subunit transcript and protein, which was enzymatically active throughout the brain at a level reported to be therapeutic in Tay-Sachs disease. These results have implications for treating neurologic diseases characterized by inherited single gene mutations.

  1. Recent events dominate interdomain lateral gene transfers between prokaryotes and eukaryotes and, with the exception of endosymbiotic gene transfers, few ancient transfer events persist

    PubMed Central

    Katz, Laura A.


    While there is compelling evidence for the impact of endosymbiotic gene transfer (EGT; transfer from either mitochondrion or chloroplast to the nucleus) on genome evolution in eukaryotes, the role of interdomain transfer from bacteria and/or archaea (i.e. prokaryotes) is less clear. Lateral gene transfers (LGTs) have been argued to be potential sources of phylogenetic information, particularly for reconstructing deep nodes that are difficult to recover with traditional phylogenetic methods. We sought to identify interdomain LGTs by using a phylogenomic pipeline that generated 13 465 single gene trees and included up to 487 eukaryotes, 303 bacteria and 118 archaea. Our goals include searching for LGTs that unite major eukaryotic clades, and describing the relative contributions of LGT and EGT across the eukaryotic tree of life. Given the difficulties in interpreting single gene trees that aim to capture the approximately 1.8 billion years of eukaryotic evolution, we focus on presence–absence data to identify interdomain transfer events. Specifically, we identify 1138 genes found only in prokaryotes and representatives of three or fewer major clades of eukaryotes (e.g. Amoebozoa, Archaeplastida, Excavata, Opisthokonta, SAR and orphan lineages). The majority of these genes have phylogenetic patterns that are consistent with recent interdomain LGTs and, with the notable exception of EGTs involving photosynthetic eukaryotes, we detect few ancient interdomain LGTs. These analyses suggest that LGTs have probably occurred throughout the history of eukaryotes, but that ancient events are not maintained unless they are associated with endosymbiotic gene transfer among photosynthetic lineages. PMID:26323756

  2. Sequence heterogeneity, multiplicity, and genomic organization of alpha- and beta-tubulin genes in sea urchins.

    PubMed Central

    Alexandraki, D; Ruderman, J V


    We analyzed the multiplicity, heterogeneity, and organization of the genes encoding the alpha and beta tubulins in the sea urchin Lytechinus pictus by using cloned complementary deoxyribonucleic acid (cDNA) and genomic tubulin sequences. cDNA clones were constructed by using immature spermatogenic testis polyadenylic acid-containing ribonucleic acid as a template. alpha- and beta-tubulin clones were identified by hybrid selection and in vitro translation of the corresponding messenger ribonucleic acids, followed by immunoprecipitation and two-dimensional gel electrophoresis of the translation products. The alpha cDNA clone contains a sequence that encodes the 48 C-terminal amino acids of alpha tubulin and 104 base pairs of the 3' nontranslated portion of the messenger ribonucleic acid. The beta cDNA insertion contains the coding sequence for the 100-C terminal amino acids of beta tubulin and 83 pairs of the 3' noncoding sequence. Hybrid selections performed at different criteria demonstrated the presence of several heterogeneous, closely related tubulin messenger ribonucleic acids, suggesting the existence of heterogeneous alpha- and beta-tubulin genes. Hybridization analyses indicated that there are at least 9 to 13 sequences for each of the two tubulin gene families per haploid genome. Hybridization of the cDNA probes to both total genomic DNA and cloned germline DNA fragments gave no evidence for close physical linkage of alpha-tubulin genes with beta-tubulin genes at the DNA level. In contrast, these experiments indicated that some genes within the same family are clustered. Images PMID:6287219

  3. Sequence heterogeneity, multiplicity, and genomic organization of. cap alpha. - and. beta. -tubulin genes in Sea Urchins

    SciTech Connect

    Alexandraki, D.; Ruderman, J.V.


    The authors analyzed the multiplicity, heterogeneity, and organization of the genes encoding the ..cap alpha.. and ..beta.. tubulins in the sea urchin Lytechinus pictus by using cloned complementary deoxyribonucleic acid (cDNA) and genomic tubulin sequences. cDNA clones were constructed by using immature spermatogenic testis polyadenylic acid-containing ribonucleic acid as a template. ..cap alpha.. and ..beta..-tubulin clones were identified by hybrid selection and in vitro translation of the corresponding messenger ribonucleic acids, followed by immunoprecipitation and two-dimensional gel electrophoresis of the translation products. The ..cap alpha.. cDNA clone contains a sequence that encodes the 48 C-terminal amino acids of ..cap alpha.. tubulin and 104 base pairs of the 3' nontranslated portion of the messenger ribonucleic acid. The ..beta.. cDNA insertion contains the coding sequence for the 100 C-terminal amino acids of ..beta.. tubulin and 83 base pairs of the 3' noncoding sequence. Hybrid selections performed at different criteria demonstrated the presence of several heterogeneous, closely related tubulin messenger ribonucleic acids, suggesting the existence of heterogeneous ..cap alpha..- and ..beta..-tubulin genes. Hybridization analyses indicated that there are at least 9 to 13 sequences for each of the two tubulin gene families per haploid genome. Hybridization of the cDNA probes to both total genomic DNA and cloned germline DNA fragments gave no evidence for close physical linkage of ..cap alpha..-tubulin genes with ..beta..-tubulin genes at the DNA level. In contrast, these experiments indicated that some genes within the same family are clustered.

  4. TNF-alpha gene polymorphisms in type 1 (insulin-dependent) diabetes mellitus.


    Badenhoop, K; Schwarz, G; Trowsdale, J; Lewis, V; Usadel, K H; Gale, E A; Bottazzo, G F


    Type 1 (insulin-dependent) diabetes mellitus, like some other autoimmune diseases, is linked to certain alleles coded by genes in the HLA-D region. Sequence analysis of DQ beta chains indicates that aspartic acid at codon 57 confers resistance to the development of Type 1 diabetes. However, a full explanation for the HLA-association of Type 1 diabetes, particularly the increased susceptibility of DR3/4 heterozygotes is still awaited. The localisation of tumour necrosis factor genes on the short arm of chromosome 6 between HLA-B and the complement genes (Class III) prompted us to investigate a possible polymorphism of TNF-alpha at the genomic level in relation to Type 1 diabetes susceptibility. A dialleleic TNF-alpha restriction fragment length polymorphism was found with Ncol and its segregation with HLA-haplotypes analysed in diabetic families. We describe here a strong linkage of TNF-alpha alleles with certain DR haplotypes. For example, the common extended haplotype HLA A1-B8-DR3 was almost exclusively associated with the 5.5 kb TNF-alpha allele whereas Bw62-DR4 with the 10.5 kb allele. Thus both alleles segregate to diabetic patients. DR matched haplotypes of affected family members differed significantly from those of the non-affected at the TNF alpha locus. All affected sibling pairs in 11 multiplex affected families were identical for TNF-alpha alleles, even if they were only haploidentical for HLA-B-DR haplotypes. In addition, heterozygosity for the TNF-alpha alleles was significantly more frequent in the patients. This tight linkage of TNF-alpha alleles with some extended haplotypes could help to explain the HLA-association of Type 1 diabetes as well as some other autoimmune diseases.

  5. The interconnection between biofilm formation and horizontal gene transfer.


    Madsen, Jonas Stenløkke; Burmølle, Mette; Hansen, Lars Hestbjerg; Sørensen, Søren Johannes


    Recent research has revealed that horizontal gene transfer and biofilm formation are connected processes. Although published research investigating this interconnectedness is still limited, we will review this subject in order to highlight the potential of these observations because of their believed importance in the understanding of the adaptation and subsequent evolution of social traits in bacteria. Here, we discuss current evidence for such interconnectedness centred on plasmids. Horizontal transfer rates are typically higher in biofilm communities compared with those in planktonic states. Biofilms, furthermore, promote plasmid stability and may enhance the host range of mobile genetic elements that are transferred horizontally. Plasmids, on the other hand, are very well suited to promote the evolution of social traits such as biofilm formation. This, essentially, transpires because plasmids are independent replicons that enhance their own success by promoting inter-bacterial interactions. They typically also carry genes that heighten their hosts' direct fitness. Furthermore, current research shows that the so-called mafia traits encoded on mobile genetic elements can enforce bacteria to maintain stable social interactions. It also indicates that horizontal gene transfer ultimately enhances the relatedness of bacteria carrying the mobile genetic elements of the same origin. The perspective of this review extends to an overall interconnectedness between horizontal gene transfer, mobile genetic elements and social evolution of bacteria.

  6. Heterologous expression of the cloned guinea pig alpha 2A, alpha 2B, and alpha 2C adrenoceptor subtypes. Radioligand binding and functional coupling to a CAMP-responsive reporter gene.


    Svensson, S P; Bailey, T J; Porter, A C; Richman, J G; Regan, J W


    Functional studies have shown that 6-chloro-9-[(3-methyl-2-butenyl)oxy]-3-methyl-1H-2,3,4,5-tetrahydro-3- benzazepine (SKF 104078) has very low affinity for prejunctional alpha 2-adrenoceptors (alpha 2-AR) in the guinea pig atrium. In this study, we have cloned guinea pig homologues of the human alpha 2-C10, alpha 2-C4 AR subtypes and have studied them in isolation by heterologous expression in cultured mammalian cells. Oligonucleotide primers, designed from conserved areas of the human alpha 2-ARs were used in a polymerase chain reaction (PCR) with template cDNA synthesized from guinea pig atrial mRNA. Three PCR products were obtained that shared identity with the three human alpha 2-AR subtypes. A guinea pig (gp) genomic library was screened with a cDNA clone encoding a portion of the gp-alpha 2A, and genes containing the complete coding sequences of the guinea pig alpha 2A, alpha 2B, and alpha 2C AR subtypes were obtained. These guinea pig genes were subcloned into a eukaryotic expression plasmid and were expressed transiently in COS-7 cells. The binding of the alpha 2-selective antagonist [3H]MK-912 to membranes prepared from these cells was specific and of high affinity with Kd values of 810 pM for gp-alpha 2A, 2700 pM for gp-alpha 2B and 110 pM for gp-alpha 2C. Competition for the binding of [3H]MK-912 by SKF 104078 indicated that it was of moderately high affinity (approximately 100 nM) but that it was not selective for any of the guinea pig alpha 2-AR subtypes. Co-expression of guinea pig alpha 2-AR subtypes with a cyclicAMP-responsive chloramphenicol acetyltransferase (CAT) reporter gene resulted in agonist-dependent modulation of CAT activity. For the gp-alpha 2 A, a biphasic response was obtained with low concentrations of noradrenaline (NE) decreasing forskolin-stimulated CAT activity and high concentrations causing a reversal. For the gp-alpha 2B, NE produced mostly potentiation of forskolin-stimulated activity, and for the gp-alpha 2C, NE caused

  7. [Gene doping: gene transfer and possible molecular detection].


    Argüelles, Carlos Francisco; Hernández-Zamora, Edgar


    The use of illegal substances in sports to enhance athletic performance during competition has caused international sports organizations such as the COI and WADA to take anti doping measures. A new doping method know as gene doping is defined as "the non-therapeutic use of genes, genetic elements and/or cells that have the capacity to enhance athletic performance". However, gene doping in sports is not easily identified and can cause serious consequences. Molecular biology techniques are needed in order to distinguish the difference between a "normal" and an "altered" genome. Further, we need to develop new analytic methods and biological molecular techniques in anti-doping laboratories, and design programs that avoid the non therapeutic use of genes.

  8. Antibacterial gene transfer across the tree of life

    PubMed Central

    Metcalf, Jason A; Funkhouser-Jones, Lisa J; Brileya, Kristen; Reysenbach, Anna-Louise; Bordenstein, Seth R


    Though horizontal gene transfer (HGT) is widespread, genes and taxa experience biased rates of transferability. Curiously, independent transmission of homologous DNA to archaea, bacteria, eukaryotes, and viruses is extremely rare and often defies ecological and functional explanations. Here, we demonstrate that a bacterial lysozyme family integrated independently in all domains of life across diverse environments, generating the only glycosyl hydrolase 25 muramidases in plants and archaea. During coculture of a hydrothermal vent archaeon with a bacterial competitor, muramidase transcription is upregulated. Moreover, recombinant lysozyme exhibits broad-spectrum antibacterial action in a dose-dependent manner. Similar to bacterial transfer of antibiotic resistance genes, transfer of a potent antibacterial gene across the universal tree seemingly bestows a niche-transcending adaptation that trumps the barriers against parallel HGT to all domains. The discoveries also comprise the first characterization of an antibacterial gene in archaea and support the pursuit of antibiotics in this underexplored group. DOI: PMID:25422936

  9. Total alpha-globin gene cluster deletion has high frequency in Filipinos

    SciTech Connect

    Hunt, J.A.; Haruyama, A.Z.; Chu, B.M.


    Most {alpha}-thalassemias [Thal] are due to large deletions. In Southeast Asians, the (--{sup SEA}) double {alpha}-globin gene deletion is common, 3 (--{sup Tot}) total {alpha}-globin cluster deletions are known: Filipino (--{sup Fil}), Thai (--{sup Thai}), and Chinese (--{sup Chin}). In a Hawaii Thal project, provisional diagnosis of {alpha}-Thal-1 heterozygotes was based on microcytosis, normal isoelectric focusing, and no iron deficiency. One in 10 unselected Filipinos was an {alpha}-Thal-1 heterozygote, 2/3 of these had a (--{sup Tot}) deletion: a {var_sigma}-cDNA probe consistently showed fainter intensity of the constant 5.5 kb {var_sigma}{sub 2} BamHI band, with no heterzygosity for {var_sigma}-globin region polymorphisms; {alpha}-cDNA or {var_sigma}-cDNA probes showed no BamHI or BglII bands diagnostic of the (--{sup SEA}) deletion; bands for the (-{alpha}) {alpha}-Thal-2 single {alpha}-globin deletions were only seen in Hb H cases. A reliable monoclonal anti-{var_sigma}-peptide antibody test for the (--{sup SEA}) deletion was always negative in (--{sup Tot}) samples. Southern digests with the Lo probe, a gift from D. Higgs of Oxford Univ., confirmed that 49 of 50 (--{sup Tot}) chromosomes in Filipinos were (--{sup Fil}). Of 20 {alpha}-Thal-1 hydrops born to Filipinos, 11 were (--{sup Fil}/--{sup SEA}) compound heterozygotes; 9 were (--{sup SEA}/--{sup SEA}) homozygotes, but none was a (--{sup Fil}/--{sup Fil}).

  10. The phylogenetic and evolutionary history of a novel alpha-globin-type gene in orangutans (Pongo pygmaeus).


    Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen


    The alpha-globin genes are implicated in human resistance to malaria, a disease caused by Plasmodium parasites. This study is the first to analyze DNA sequences from a novel alpha-globin-type gene in orangutans, a species affected by Plasmodium. Phylogenetic methods show that the gene is a duplication of an alpha-globin gene and is located 5' of alpha-2 globin. The alpha-globin-type gene is notable for having four amino acid replacements relative to the orangutan's alpha-1 and alpha-2 globin genes, with no synonymous differences. Pairwise K(a)/K(s) methods and likelihood ratio tests (LRTs) revealed that the evolutionary history of the alpha-globin-type gene has been marked by either neutral or positive evolution, but not purifying selection. A comparative analysis of the amino acid replacements of the alpha-globin-type gene with human hemoglobinopathies and hemoglobin structure showed that two of the four replaced sites are members of the same molecular bond, one that is crucial to the proper functioning of the hemoglobin molecule. This suggested an adaptive evolutionary change. Functionally, this locus may result in a thalassemia-like phenotype in orangutans, possibly as an adaptation to combat Plasmodium.

  11. Alpha1-antitrypsin gene therapy modulates cellular immunity and efficiently prevents type 1 diabetes in nonobese diabetic mice.


    Lu, Yuanqing; Tang, Mei; Wasserfall, Clive; Kou, Zhongchen; Campbell-Thompson, Martha; Gardemann, Thomas; Crawford, James; Atkinson, Mark; Song, Sihong


    An imbalance of the immune-regulatory pathways plays an important role in the development of type 1 diabetes. Therefore, immunoregulatory and antiinflammatory strategies hold great potential for the prevention of this autoimmune disease. Studies have demonstrated that two serine proteinase inhibitors, alpha1-antitrypsin (AAT) and elafin, act as potent antiinflammatory agents. In the present study, we sought to develop an efficient gene therapy approach to prevent type 1 diabetes. Cohorts of 4-week-old female nonobese diabetic (NOD) mice were injected intramuscularly with rAAV1-CB-hAAT, rAAV1-CB-hElafin, or saline. AAV1 vector mediated sustained high levels of transgene expression, sufficient to overcome a humoral immune response against hAAT. AAT gene therapy, contrary to elafin and saline, was remarkably effective in preventing type 1 diabetes. T cell receptor spectratyping indicated that AAT gene therapy altered T cell repertoire diversity in splenocytes from NOD mice. Adoptive transfer experiments demonstrated that AAT gene therapy attenuated cellular immunity associated with beta cell destruction. This study demonstrates that AAT gene therapy attenuates cell-mediated autoimmunity, alters the T cell receptor repertoire, and efficiently prevents type 1 diabetes in the NOD mouse model. These results strongly suggest that rAAV1-mediated AAT gene therapy may be useful as a novel approach to prevent type 1 diabetes.

  12. Replacing and Additive Horizontal Gene Transfer in Streptococcus

    PubMed Central

    Choi, Sang Chul; Rasmussen, Matthew D.; Hubisz, Melissa J.; Gronau, Ilan; Stanhope, Michael J.; Siepel, Adam


    The prominent role of Horizontal Gene Transfer (HGT) in the evolution of bacteria is now well documented, but few studies have differentiated between evolutionary events that predominantly cause genes in one lineage to be replaced by homologs from another lineage (“replacing HGT”) and events that result in the addition of substantial new genomic material (“additive HGT”). Here in, we make use of the distinct phylogenetic signatures of replacing and additive HGTs in a genome-wide study of the important human pathogen Streptococcus pyogenes (SPY) and its close relatives S. dysgalactiae subspecies equisimilis (SDE) and S. dysgalactiae subspecies dysgalactiae (SDD). Using recently developed statistical models and computational methods, we find evidence for abundant gene flow of both kinds within each of the SPY and SDE clades and of reduced levels of exchange between SPY and SDD. In addition, our analysis strongly supports a pronounced asymmetry in SPY–SDE gene flow, favoring the SPY-to-SDE direction. This finding is of particular interest in light of the recent increase in virulence of pathogenic SDE. We find much stronger evidence for SPY–SDE gene flow among replacing than among additive transfers, suggesting a primary influence from homologous recombination between co-occurring SPY and SDE cells in human hosts. Putative virulence genes are correlated with transfer events, but this correlation is found to be driven by additive, not replacing, HGTs. The genes affected by additive HGTs are enriched for functions having to do with transposition, recombination, and DNA integration, consistent with previous findings, whereas replacing HGTs seen to influence a more diverse set of genes. Additive transfers are also found to be associated with evidence of positive selection. These findings shed new light on the manner in which HGT has shaped pathogenic bacterial genomes. PMID:22617954

  13. Structural and EPR characterisation of single electron and alkyl transfer products from reaction of dimethyl magnesium with bulky alpha-diimine ligands.


    Bailey, Philip J; Coxall, Robert A; Dick, Caroline M; Fabre, Sylvie; Parsons, Simon; Yellowlees, Lesley J


    Treatment of dimethylmagnesium with bulky alpha-diimine ligands provides either the biradical methyl-bridged complexes [(alpha-diimine-.)Mg+(mu-CH3)]2 via single electron transfer (SET), or the product of methyl transfer to an imine carbon atom depending upon conditions.

  14. Horizontal gene transfer in the human gastrointestinal tract: potential spread of antibiotic resistance genes

    PubMed Central

    Huddleston, Jennifer R


    Bacterial infections are becoming increasingly difficult to treat due to widespread antibiotic resistance among pathogens. This review aims to give an overview of the major horizontal transfer mechanisms and their evolution and then demonstrate the human lower gastrointestinal tract as an environment in which horizontal gene transfer of resistance determinants occurs. Finally, implications for antibiotic usage and the development of resistant infections and persistence of antibiotic resistance genes in populations as a result of horizontal gene transfer in the large intestine will be discussed. PMID:25018641

  15. Adaptive evolution after gene duplication in alpha-KT x 14 subfamily from Buthus martensii Karsch.


    Cao, Zhijian; Mao, Xin; Xu, Xiuling; Sheng, Jiqun; Dai, Chao; Wu, Yingliang; Luo, Feng; Sha, Yonggang; Jiang, Dahe; Li, Wenxin


    A series of isoforms of alpha-KT x 14 (short chain potassium channel scorpion toxins) were isolated from the venom of Buthus martensii Karsch by RACE and screening cDNA library methods. These isoforms adding BmKK1--3 and BmSKTx1--2 together shared high homology (more than 97%) with each other. The result of genomic sequence analysis showed that a length 79 bp intron is inserted Ala codes between the first and the second base at the 17th amino acid of signal peptide. The introns of these isoforms also share high homology with those of BmKK2 and BmSKT x 1 reported previously. Sequence analysis of many clones of cDNA and genomic DNA showed that a species population or individual polymorphism of alpha-KT x 14 genes took place in scorpion Buthus martensii Karsch and accelerated evolution played an important role in the forming process of alpha-KT x 14 scorpion toxins subfamily. The result of southern hybridization indicated that alpha-KT x 14 toxin genes existed in scorpion chromosome with multicopies. All findings maybe provided an important evidence for an extensive evolutionary process of the scorpion "pharmacological factory": at the early course of evolution, the ancestor toxic gene duplicated into a series of multicopy genes integrated at the different chromosome; at the late course of evolution, subsequent functional divergence of duplicate genes was generated by mutations, deletions and insertion.

  16. Gene Transfer in Mycobacterium tuberculosis: Shuttle Phasmids to Enlightenment

    PubMed Central



    Infectious diseases have plagued humankind throughout history and have posed serious public health problems. Yet vaccines have eradicated smallpox and antibiotics have drastically decreased the mortality rate of many infectious agents. These remarkable successes in the control of infections came from knowing the causative agents of the diseases, followed by serendipitous discoveries of attenuated viruses and antibiotics. The discovery of DNA as genetic material and the understanding of how this information translates into specific phenotypes have changed the paradigm for developing new vaccines, drugs, and diagnostic tests. Knowledge of the mechanisms of immunity and mechanisms of action of drugs has led to new vaccines and new antimicrobial agents. The key to the acquisition of the knowledge of these mechanisms has been identifying the elemental causes (i.e., genes and their products) that mediate immunity and drug resistance. The identification of these genes is made possible by being able to transfer the genes or mutated forms of the genes into causative agents or surrogate hosts. Such an approach was limited in Mycobacterium tuberculosis by the difficulty of transferring genes or alleles into M. tuberculosis or a suitable surrogate mycobacterial host. The construction of shuttle phasmids—chimeric molecules that replicate in Escherichia coli as plasmids and in mycobacteria as mycobacteriophages—was instrumental in developing gene transfer systems for M. tuberculosis. This review will discuss M. tuberculosis genetic systems and their impact on tuberculosis research. “I had to know my enemy in order to prevail against him.”Nelson Mandela PMID:26105819

  17. Plasmid and clonal interference during post horizontal gene transfer evolution.


    Bedhomme, S; Perez Pantoja, D; Bravo, I G


    Plasmids are nucleic acid molecules that can drive their own replication in a living cell. They can be transmitted horizontally and can thrive in the host cell to high-copy numbers. Plasmid replication and gene expression consume cellular resources and cells carrying plasmids incur fitness costs. But many plasmids carry genes that can be beneficial under certain conditions, allowing the cell to endure in the presence of antibiotics, toxins, competitors or parasites. Horizontal transfer of plasmid-encoded genes can thus instantaneously confer differential adaptation to local or transient selection conditions. This conflict between cellular fitness and plasmid spread sets the scene for multilevel selection processes. We have engineered a system to study the short-term evolutionary impact of different synonymous versions of a plasmid-encoded antibiotic resistance gene. Applying experimental evolution under different selection conditions and deep sequencing allowed us to show rapid local adaptation to the presence of antibiotic and to the specific version of the resistance gene transferred. We describe the presence of clonal interference at two different levels: at the within-cell level, because a single cell can carry several plasmids, and at the between-cell level, because a bacterial population may contain several clones carrying different plasmids and displaying different fitness in the presence/absence of antibiotic. Understanding the within-cell and between-cell dynamics of plasmids after horizontal gene transfer is essential to unravel the dense network of mobile elements underlying the worldwide threat to public health of antibiotic resistance.

  18. Horizontal gene transfer in eukaryotes: The weak-link model

    PubMed Central

    Huang, Jinling


    The significance of horizontal gene transfer (HGT) in eukaryotic evolution remains controversial. Although many eukaryotic genes are of bacterial origin, they are often interpreted as being derived from mitochondria or plastids. Because of their fixed gene pool and gene loss, however, mitochondria and plastids alone cannot adequately explain the presence of all, or even the majority, of bacterial genes in eukaryotes. Available data indicate that no insurmountable barrier to HGT exists, even in complex multicellular eukaryotes. In addition, the discovery of both recent and ancient HGT events in all major eukaryotic groups suggests that HGT has been a regular occurrence throughout the history of eukaryotic evolution. A model of HGT is proposed that suggests both unicellular and early developmental stages as likely entry points for foreign genes into multicellular eukaryotes. PMID:24037739

  19. Horizontal gene transfer in eukaryotes: the weak-link model.


    Huang, Jinling


    The significance of horizontal gene transfer (HGT) in eukaryotic evolution remains controversial. Although many eukaryotic genes are of bacterial origin, they are often interpreted as being derived from mitochondria or plastids. Because of their fixed gene pool and gene loss, however, mitochondria and plastids alone cannot adequately explain the presence of all, or even the majority, of bacterial genes in eukaryotes. Available data indicate that no insurmountable barrier to HGT exists, even in complex multicellular eukaryotes. In addition, the discovery of both recent and ancient HGT events in all major eukaryotic groups suggests that HGT has been a regular occurrence throughout the history of eukaryotic evolution. A model of HGT is proposed that suggests both unicellular and early developmental stages as likely entry points for foreign genes into multicellular eukaryotes.

  20. Complete structure and expression of the rat alpha B-crystallin gene.


    Srinivasan, A N; Bhat, S P


    alpha B-Crystallin, a member of the small heat shock family of proteins, is synthesized as a component of various developmental programs, in response to stress and in a number of pathological states. We have determined the complete structure of the alpha B-crystallin gene (6,806 bp encompassing 2,299 bp upstream from ATG and 859 bp at the 3' end, past the first polyadenylation signal). Comparison of the rat and the human alpha B-crystallin genes reveals significant conservation of the nucleotide sequences in almost all regions except in intron 2. The 1-kb region immediately upstream of ATG shows about 75% overall homology. A 78-bp sequence in the intron 1 and sequences in the 3' untranslated region show about 95% and 85% sequence identity, respectively. Characterization of the expression of this gene in different tissues in the rat by extensive analyses, utilizing primer extension. RNase protection, and rapid amplification of cDNA ends (RACE) revealed a predominant transcription initiation site 44 bp upstream of ATG. Northern analyses with "coding-only" and upstream "noncoding" probes did not support the thesis that heterogeneity in the alpha B-crystallin mRNAs arises from variations in the sequences immediately upstream of the predominant transcription initiation site. Importantly, the known relative levels of alpha B-crystallin protein in different tissues correlate best with the presence of transcripts starting from this initiation site.

  1. MHC evolution in three salmonid species: a comparison between class II alpha and beta genes.


    Gómez, Daniela; Conejeros, Pablo; Marshall, Sergio H; Consuegra, Sofia


    The genes of the major histocompatibility complex (MHC) are amongst the most variable in vertebrates and represent some of the best candidates to study processes of adaptive evolution. However, despite the number of studies available, most of the information on the structure and function of these genes come from studies in mammals and birds in which the MHC class I and II genes are tightly linked and class II alpha exhibits low variability in many cases. Teleost fishes are among the most primitive vertebrates with MHC and represent good organisms for the study of MHC evolution because their class I and class II loci are not physically linked, allowing for independent evolution of both classes of genes. We have compared the diversity and molecular mechanisms of evolution of classical MH class II alpha and class II beta loci in farm populations of three salmonid species: Oncorhynchus kisutch, Oncorhynchus mykiss and Salmo salar. We found single classical class II loci and high polymorphism at both class II alpha and beta genes in the three species. Mechanisms of evolution were common for both class II genes, with recombination and point mutation involved in generating diversity and positive selection acting on the peptide-binding residues. These results suggest that the maintenance of variability at the class IIalpha gene could be a mechanism to increase diversity in the MHC class II in salmonids in order to compensate for the expression of one single classical locus and to respond to a wider array of parasites.

  2. Chromosomal localization of the human genes for {alpha}{sub 1A}, {alpha}{sub 1B}, and {alpha}{sub 1E} voltage-dependent Ca{sup 2+} channel subunits

    SciTech Connect

    Diriong, S.; Lory, P.; Taviaux, S.


    The {alpha}{sub 1} subunit genes encoding voltage-dependent Ca{sup 2+} channels are members of a gene family. We have used human brain cDNA probes to localize the neuronal isoform genes CACNL1A4 ({alpha}{sub 1A}), CACNL1A5 ({alpha}{sub 1B}), and CACNL1A6 ({alpha}{sub 1E}) to 19p13, 9q34, and 1q25-q31, respectively, using fluorescene in situ hybridization on human chromosomes. These genes are particularly interesting gene candidates in the pathogenesis of neuronal disorders. Although genetic disorders have been linked to loci 9q34 and 19p13, no genetic disease related to Ca{sup 2+} signaling defects has yet been linked to these loci. 22 refs., 2 figs., 1 tab.

  3. Antibiotics and gene transfer in swine gut bacteria

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The mammalian gastrointestinal (GI) tract hosts a diverse collection bacteria, most of which are beneficial for host health. This bacterial community also supports a community of viruses that infect bacteria (called bacteriophages or phages). Phages transfer genes between bacteria, and phage-media...

  4. Quasispecies theory for horizontal gene transfer and recombination

    NASA Astrophysics Data System (ADS)

    Muñoz, Enrique; Park, Jeong-Man; Deem, Michael W.


    We introduce a generalization of the parallel, or Crow-Kimura, and Eigen models of molecular evolution to represent the exchange of genetic information between individuals in a population. We study the effect of different schemes of genetic recombination on the steady-state mean fitness and distribution of individuals in the population, through an analytic field theoretic mapping. We investigate both horizontal gene transfer from a population and recombination between pairs of individuals. Somewhat surprisingly, these nonlinear generalizations of quasispecies theory to modern biology are analytically solvable. For two-parent recombination, we find two selected phases, one of which is spectrally rigid. We present exact analytical formulas for the equilibrium mean fitness of the population, in terms of a maximum principle, which are generally applicable to any permutation invariant replication rate function. For smooth fitness landscapes, we show that when positive epistatic interactions are present, recombination or horizontal gene transfer introduces a mild load against selection. Conversely, if the fitness landscape exhibits negative epistasis, horizontal gene transfer or recombination introduces an advantage by enhancing selection towards the fittest genotypes. These results prove that the mutational deterministic hypothesis holds for quasispecies models. For the discontinuous single sharp peak fitness landscape, we show that horizontal gene transfer has no effect on the fitness, while recombination decreases the fitness, for both the parallel and the Eigen models. We present numerical and analytical results as well as phase diagrams for the different cases.

  5. "Active" cancer immunotherapy by anti-Met antibody gene transfer.


    Vigna, Elisa; Pacchiana, Giovanni; Mazzone, Massimiliano; Chiriaco, Cristina; Fontani, Lara; Basilico, Cristina; Pennacchietti, Selma; Comoglio, Paolo M


    Gene therapy provides a still poorly explored opportunity to treat cancer by "active" immunotherapy as it enables the transfer of genes encoding antibodies directed against specific oncogenic proteins. By a bidirectional lentiviral vector, we transferred the cDNA encoding the heavy and light chains of a monoclonal anti-Met antibody (DN-30) to epithelial cancer cells. In vitro, the transduced cells synthesized and secreted correctly assembled antibodies with the expected high affinity, inducing down-regulation of the Met receptor and strong inhibition of the invasive growth response. The inhibitory activity resulted (a) from the interference of the antibody with the Met receptor intracellular processing ("cell autonomous activity," in cis) and (b) from the antibody-induced cleavage of Met expressed at the cell surface ("bystander effect," in trans). The monoclonal antibody gene transferred into live animals by systemic administration or by local intratumor delivery resulted in substantial inhibition of tumor growth. These data provide proof of concept both for targeting the Met receptor and for a gene transfer-based immunotherapy strategy.

  6. Horizontal gene transfer and the evolution of methanogenic pathways.


    Fournier, Greg


    Horizontal gene transfer (HGT) is a driving force in the evolution of metabolic pathways, allowing novel enzymatic functions that provide a selective advantage to be rapidly incorporated into an organism's physiology. Here, the role of two HGT events in the evolution of methanogenesis is described. First, the acetoclastic sub-pathway of methanogenesis is shown to have evolved via a transfer of the ackA and pta genes from a cellulolytic clostridia to a family of methanogenic archaea. Second, the system for encoding the amino acid pyrrolysine, used for the synthesis of enzymes for methanogenesis from methylamines, is shown to likely have evolved via transfer from an ancient, unknown, deeply branching organismal lineage.

  7. The PPAR alpha gene is associated with triglyceride, low-density cholesterol and inflammation marker response to fenofibrate intervention: the GOLDN study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    As a peroxisome proliferator-activated receptor alpha (PPAR Alpha) agonist, fenofibrate favorably modulates dyslipidemia and inflammation markers, which are associated with cardiovascular risk. To determine whether variation in the PPAR Alpha receptor gene was associated with lipid and inflammatory ...

  8. Increase in gene dosage is a mechanism of HIF-1alpha constitutive expression in head and neck squamous cell carcinomas.


    Secades, Pablo; Rodrigo, Juan Pablo; Hermsen, Mario; Alvarez, Cesar; Suarez, Carlos; Chiara, María-Dolores


    The HIF-1alpha protein plays a key role in the cellular response to hypoxia via transcriptional regulation of genes involved in erythropoiesis, angiogenesis, and metabolism. Overexpression of HIF-1alpha is commonly found in solid tumors in significant association with increased patient mortality and resistance to therapy. The predominant mode of HIF-1alpha regulation by hypoxia occurs at the level of protein stability. In addition to hypoxia, HIF-1alpha protein stability and synthesis is regulated by nonhypoxic signals such as inactivation of tumor suppressors and activation of oncogenes. Here, we show that an increase in gene dosage may contribute to HIF-1alpha mRNA and protein overexpression in a nonhypoxic environment in head and neck squamous cell carcinomas (HNSCC). Increased HIF-1alpha gene dosage was found in one out of five HNSCC-derived cell lines and three out of 27 HNSCC primary tumors. Significantly, increased gene dosage in those samples was associated with high HIF-1alpha mRNA and protein levels. Normoxic overexpression of HIF-1alpha protein in HNSCC-derived cell lines was also paralleled by higher expression levels of HIF-1alpha target genes. Array CGH analysis confirmed the copy number increase of HIF-1alpha gene and revealed that the gene is contained within a region of amplification at 14q23-q24.2 both in the cell line and primary tumors. In addition, FISH analysis revealed the presence of 11-13 copies on a tetraploid background in SCC2 cells. These data suggest that increased HIF-1alpha gene dosage is a mechanism of HIF-1alpha protein overexpression in HNSCC that possibly prepares the cells for a higher activity in an intratumoral hypoxic environment.

  9. Estrogen-related receptor alpha modulates the expression of adipogenesis-related genes during adipocyte differentiation.


    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi


    Estrogen-related receptor alpha (ERRalpha) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERRalpha in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERRalpha and ERRalpha-related transcriptional coactivators, peroxisome proliferator-activated receptor gamma (PPARgamma) coactivator-1alpha (PGC-1alpha) and PGC-1beta, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERRalpha-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPARgamma, and PGC-1alpha in 3T3-L1 cells in the adipogenesis medium. ERRalpha and PGC-1beta mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERRalpha in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERRalpha may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  10. Biased gene transfer mimics patterns created through shared ancestry

    PubMed Central

    Andam, Cheryl P.; Williams, David; Gogarten, J. Peter


    In phylogenetic reconstruction, two types of bacterial tyrosyl-tRNA synthetases (TyrRS) form distinct clades with many bacterial phyla represented in both clades. Very few taxa possess both forms, and maximum likelihood analysis of the distribution of TyrRS types suggests horizontal gene transfer (HGT), rather than an ancient duplication followed by differential gene loss, as the contributor to the evolutionary history of TyrRS in bacteria. However, for each TyrRS type, phylogenetic reconstruction yields phylogenies similar to the ribosomal phylogeny, revealing that frequent gene transfer has not destroyed the expected phylogeny; rather, the expected phylogenetic signal was reinforced or even created by HGT. We show that biased HGT can mimic patterns created through shared ancestry by in silico simulation. Furthermore, in cases where genomic synteny is sufficient to allow comparisons of relative gene positions, both tyrRS types occupy equivalent positions in closely related genomes, rejecting the loss hypothesis. Although the two types of bacterial TyrRS are only distantly related and only rarely coexist in a single genome, they have many features in common with alleles that are swapped between related lineages. We propose to label these functionally similar homologs as homeoalleles. We conclude that the observed phylogenetic pattern reflects both vertical inheritance and biased HGT and that the signal caused by common organismal descent is difficult to distinguish from the signal due to biased gene transfer. PMID:20495090

  11. Biased gene transfer mimics patterns created through shared ancestry.


    Andam, Cheryl P; Williams, David; Gogarten, J Peter


    In phylogenetic reconstruction, two types of bacterial tyrosyl-tRNA synthetases (TyrRS) form distinct clades with many bacterial phyla represented in both clades. Very few taxa possess both forms, and maximum likelihood analysis of the distribution of TyrRS types suggests horizontal gene transfer (HGT), rather than an ancient duplication followed by differential gene loss, as the contributor to the evolutionary history of TyrRS in bacteria. However, for each TyrRS type, phylogenetic reconstruction yields phylogenies similar to the ribosomal phylogeny, revealing that frequent gene transfer has not destroyed the expected phylogeny; rather, the expected phylogenetic signal was reinforced or even created by HGT. We show that biased HGT can mimic patterns created through shared ancestry by in silico simulation. Furthermore, in cases where genomic synteny is sufficient to allow comparisons of relative gene positions, both tyrRS types occupy equivalent positions in closely related genomes, rejecting the loss hypothesis. Although the two types of bacterial TyrRS are only distantly related and only rarely coexist in a single genome, they have many features in common with alleles that are swapped between related lineages. We propose to label these functionally similar homologs as homeoalleles. We conclude that the observed phylogenetic pattern reflects both vertical inheritance and biased HGT and that the signal caused by common organismal descent is difficult to distinguish from the signal due to biased gene transfer.

  12. Quartet analysis of putative horizontal gene transfer in Crenarchaeota.


    Ching, Travers H; Yoza, Brandon A; Li, Qing X


    Horizontal gene transfers (HGT) between four Crenarchaeota species (Metallosphaera cuprina Ar-4T, Acidianus hospitalis W1T, Vulcanisaeta moutnovskia 768-28T, and Pyrobaculum islandicum DSM 4184T) were investigated with quartet analysis. Strong support was found for individual genes that disagree with the phylogeny of the majority, implying genomic mosaicism. One such gene, a ferredoxin-related gene, was investigated further and incorporated into a larger phylogeny, which provided evidence for HGT of this gene from the Vulcanisaeta lineage to the Acidianus lineage. This is the first application of quartet analysis of HGT for the phylum Crenarchaeota. The results have shown that quartet analysis is a powerful technique to screen homologous sequences for putative HGTs and is useful in visually describing genomic mosaicism and HGT within four taxa.

  13. Rescuing the Failing Heart by Targeted Gene Transfer

    PubMed Central

    Kawase, Yoshiaki; Ladage, Dennis; Hajjar, Roger J.


    Congestive heart failure is a major cause of morbidity and mortality in the US. While progress in conventional treatments is making steady and incremental gains to reduce heart failure mortality, there is a critical need to explore new therapeutic approaches. Gene therapy was initially applied in the clinical setting for inherited monogenic disorders. It is now apparent that gene therapy has broader potential that also includes acquired polygenic diseases, such as congestive heart failure. Recent advances in understanding of the molecular basis of myocardial dysfunction, together with the evolution of increasingly efficient gene transfer technology, has placed heart failure within reach of gene-based therapy. Furthermore, the recent successful and safe completion of a phase 2 trial targeting the sarcoplasmic reticulum calcium ATPase pump (SERCA2a) along with the start of more recent phase 1 trials usher a new era for gene therapy for the treatment of heart failure. PMID:21371634

  14. Evolution, organization, and expression of alpha-tubulin genes in the antarctic fish Notothenia coriiceps. Adaptive expansion of a gene family by recent gene duplication, inversion, and divergence.


    Parker, S K; Detrich, H W


    To assess the organization and expression of tubulin genes in ectothermic vertebrates, we have chosen the Antarctic yellowbelly rockcod, Notothenia coriiceps, as a model system. The genome of N. coriiceps contains approximately 15 distinct DNA fragments complementary to alpha-tubulin cDNA probes, which suggests that the alpha-tubulins of this cold-adapted fish are encoded by a substantial multigene family. From an N. coriiceps testicular DNA library, we isolated a 13.8-kilobase pair genomic clone that contains a tightly linked cluster of three alpha-tubulin genes, designated NcGTbalphaa, NcGTbalphab, and NcGTbalphac. Two of these genes, NcGTbalphaa and NcGTbalphab, are linked in head-to-head (5' to 5') orientation with approximately 500 bp separating their start codons, whereas NcGTbalphaa and NcGTbalphac are linked tail-to-tail (3' to 3') with approximately 2.5 kilobase pairs between their stop codons. The exons, introns, and untranslated regions of the three alpha-tubulin genes are strikingly similar in sequence, and the intergenic region between the alphaa and alphab genes is significantly palindromic. Thus, this cluster probably evolved by duplication, inversion, and divergence of a common ancestral alpha-tubulin gene. Expression of the NcGTbalphac gene is cosmopolitan, with its mRNA most abundant in hematopoietic, neural, and testicular tissues, whereas NcGTbalphaa and NcGTbalphab transcripts accumulate primarily in brain. The differential expression of the three genes is consistent with distinct suites of putative promoter and enhancer elements. We propose that cold adaptation of the microtubule system of Antarctic fishes is based in part on expansion of the alpha- and beta-tubulin gene families to ensure efficient synthesis of tubulin polypeptides.

  15. Reduction and Methyl Transfer Kinetics of the Alpha Subunit from Acetyl-Coenzyme A Synthase

    SciTech Connect

    Xiangshi Tan; Christopher Sewell; Qingwu Yang; Paul A. Lindahl


    OAK-B135 Stopped-flow was used to evaluate the methylation and reduction kinetics of the isolated alpha subunit of acetyl-Coenzyme A synthase from Moorella thermoacetica. This catalytically active subunit contains a novel Ni-X-Fe4S4 cluster and a putative unidentified n =2 redox site called D. The D-site must be reduced for a methyl group to transfer from a corrinoid-iron-sulfur protein, a key step in the catalytic synthesis of acetyl-CoA. The Fe4S4 component of this cluster is also redox active, raising the possibility that it is the D-site or a portion thereof. Results presented demonstrate that the D-site reduces far faster than the Fe4S4 component, effectively eliminating this possibility. Rather, this component may alter catalytically important properties of the Ni center. The D-site is reduced through a pathway that probably does not involve the Fe4S4 component of this active-site cluster.

  16. Endosymbiotic gene transfer from prokaryotic pangenomes: Inherited chimerism in eukaryotes.


    Ku, Chuan; Nelson-Sathi, Shijulal; Roettger, Mayo; Garg, Sriram; Hazkani-Covo, Einat; Martin, William F


    Endosymbiotic theory in eukaryotic-cell evolution rests upon a foundation of three cornerstone partners--the plastid (a cyanobacterium), the mitochondrion (a proteobacterium), and its host (an archaeon)--and carries a corollary that, over time, the majority of genes once present in the organelle genomes were relinquished to the chromosomes of the host (endosymbiotic gene transfer). However, notwithstanding eukaryote-specific gene inventions, single-gene phylogenies have never traced eukaryotic genes to three single prokaryotic sources, an issue that hinges crucially upon factors influencing phylogenetic inference. In the age of genomes, single-gene trees, once used to test the predictions of endosymbiotic theory, now spawn new theories that stand to eventually replace endosymbiotic theory with descriptive, gene tree-based variants featuring supernumerary symbionts: prokaryotic partners distinct from the cornerstone trio and whose existence is inferred solely from single-gene trees. We reason that the endosymbiotic ancestors of mitochondria and chloroplasts brought into the eukaryotic--and plant and algal--lineage a genome-sized sample of genes from the proteobacterial and cyanobacterial pangenomes of their respective day and that, even if molecular phylogeny were artifact-free, sampling prokaryotic pangenomes through endosymbiotic gene transfer would lead to inherited chimerism. Recombination in prokaryotes (transduction, conjugation, transformation) differs from recombination in eukaryotes (sex). Prokaryotic recombination leads to pangenomes, and eukaryotic recombination leads to vertical inheritance. Viewed from the perspective of endosymbiotic theory, the critical transition at the eukaryote origin that allowed escape from Muller's ratchet--the origin of eukaryotic recombination, or sex--might have required surprisingly little evolutionary innovation.

  17. Endosymbiotic gene transfer from prokaryotic pangenomes: Inherited chimerism in eukaryotes

    PubMed Central

    Ku, Chuan; Nelson-Sathi, Shijulal; Roettger, Mayo; Garg, Sriram; Hazkani-Covo, Einat; Martin, William F.


    Endosymbiotic theory in eukaryotic-cell evolution rests upon a foundation of three cornerstone partners—the plastid (a cyanobacterium), the mitochondrion (a proteobacterium), and its host (an archaeon)—and carries a corollary that, over time, the majority of genes once present in the organelle genomes were relinquished to the chromosomes of the host (endosymbiotic gene transfer). However, notwithstanding eukaryote-specific gene inventions, single-gene phylogenies have never traced eukaryotic genes to three single prokaryotic sources, an issue that hinges crucially upon factors influencing phylogenetic inference. In the age of genomes, single-gene trees, once used to test the predictions of endosymbiotic theory, now spawn new theories that stand to eventually replace endosymbiotic theory with descriptive, gene tree-based variants featuring supernumerary symbionts: prokaryotic partners distinct from the cornerstone trio and whose existence is inferred solely from single-gene trees. We reason that the endosymbiotic ancestors of mitochondria and chloroplasts brought into the eukaryotic—and plant and algal—lineage a genome-sized sample of genes from the proteobacterial and cyanobacterial pangenomes of their respective day and that, even if molecular phylogeny were artifact-free, sampling prokaryotic pangenomes through endosymbiotic gene transfer would lead to inherited chimerism. Recombination in prokaryotes (transduction, conjugation, transformation) differs from recombination in eukaryotes (sex). Prokaryotic recombination leads to pangenomes, and eukaryotic recombination leads to vertical inheritance. Viewed from the perspective of endosymbiotic theory, the critical transition at the eukaryote origin that allowed escape from Muller’s ratchet—the origin of eukaryotic recombination, or sex—might have required surprisingly little evolutionary innovation. PMID:25733873

  18. Kidney development and gene expression in the HIF2alpha knockout mouse.


    Steenhard, Brooke M; Freeburg, Paul B; Isom, Kathryn; Stroganova, Larysa; Borza, Dorin-Bogdan; Hudson, Billy G; St John, Patricia L; Zelenchuk, Adrian; Abrahamson, Dale R


    The hypoxia-inducible transcription factor-2 (HIF2), a heterodimer composed of HIF2alpha and HIF1beta subunits, drives expression of genes essential for vascularization, including vascular endothelial growth factor (VEGF) and VEGF receptor-2 (VEGFR-2, Flk-1). Here, we used a HIF2alpha/LacZ transgenic mouse to define patterns of HIF2alpha transcription during kidney development and maturation. Our results from embryonic heterozygotes showed HIF2alpha/LacZ expression by apparently all renal endothelial cells. At 4 weeks of age, glomerular mesangial and vascular smooth muscle cells were also positive together with endothelial cells. These expression patterns were confirmed by electron microscopy using Bluo-gal as a beta-galactosidase substrate. Small numbers of glomerular and tubular epithelial cells were also positive at all stages examined. Light and electron microscopic examination of kidneys from HIF2alpha null embryos showed no defects in renal vascular development or nephrogenesis. Similarly, the same amounts of Flk-1 protein were seen on Western blots of kidney extracts from homozygous and heterozygous HIF2alpha mutants. To examine responsiveness of HIF2alpha null kidneys to hypoxia, embryonic day 13.5 metanephroi were cultured in room air or in mild (5% O(2)) hypoxia. For both heterozygous and null samples, VEGF mRNA levels doubled when metanephroi were cultured in mild hypoxia. Anterior chamber grafts of embryonic HIF2alpha knockouts were morphologically indistinguishable from heterozygous grafts. Endothelial markers, platelet endothelial cell adhesion molecule and BsLB4, as well as glomerular epithelial markers, GLEPP1 and WT-1, were all expressed appropriately. Finally, we undertook quantitative real-time polymerase chain reaction of kidneys from HIF2alpha null embryos and wild-type siblings and found no compensatory up-regulation of HIF1alpha or -3alpha. Our results show that, although HIF2alpha was widely transcribed by kidney endothelium and vascular

  19. Gallus gallus orthologous to human alpha-dystroglycanopathies candidate genes: Gene expression and characterization during chicken embryogenesis.


    Izquierdo-Lahuerta, Adriana; de Luis, Oscar; Gómez-Esquer, Francisco; Cruces, Jesús; Coloma, Antonio


    Alpha-dystroglycanopathies are a heterogenic group of human rare diseases that have in common defects of α-dystroglycan O-glycosylation. These congenital disorders share common features as muscular dystrophy, malformations on central nervous system and more rarely altered ocular development, as well as mutations on a set of candidate genes involved on those syndromes. Severity of the syndromes is variable, appearing Walker-Warburg as the most severe where mutations at protein O-mannosyl transferases POMT1 and POMT2 genes are frequently described. When studying the lack of MmPomt1 in mouse embryonic development, as a murine model of Walker-Warburg syndrome, MmPomt1 null phenotype was lethal because Reitchert's membrane fails during embryonic development. Here, we report gene expression from Gallus gallus orthologous genes to human candidates on alpha-dystroglycanopathies POMT1, POMT2, POMGnT1, FKTN, FKRP and LARGE, making special emphasis in expression and localization of GgPomt1. Results obtained by quantitative RT-PCR, western-blot and immunochemistry revealed close gene expression patterns among human and chicken at key tissues affected during development when suffering an alpha-dystroglycanopathy, leading us to stand chicken as a useful animal model for molecular characterization of glycosyltransferases involved in the O-glycosylation of α-Dystroglycan and its role in embryonic development.

  20. The impact of interferon-alpha2 on HLA genes in patients with polycythemia vera and related neoplasms.


    Skov, Vibe; Riley, Caroline Hasselbalch; Thomassen, Mads; Kjær, Lasse; Stauffer Larsen, Thomas; Bjerrum, Ole Weis; Kruse, Torben A; Hasselbalch, Hans Carl


    Gene expression profiling in Philadelphia-negative chronic myeloproliferative neoplasms (MPNs) have unraveled significant deregulation of several immune and inflammation genes of potential importance for clonal evolution. Other mechanisms might be downregulation of major histocompatibility class I and II genes used by tumor cells to escape antitumor T-cell-mediated immune responses. Several genes encoding human leukocyte antigen (HLA) class I and II molecules have been shown to be significantly downregulated. Upregulation of HLA genes is considered one of the mechanisms of action of interferon (IFN)-alpha2, but regulation of these genes during IFN-alpha2 treatment in MPNs has never been studied. Our findings show a significant upregulation of several HLA genes of importance for tumor immune surveillance by IFN-alpha2 treatment in MPNs. This mechanism might enhance the cytotoxic potential of immune cells against MPNs and explain the induction of minimal residual disease by IFN-alpha2 treatment in these patients.

  1. Nucleotide sequence and expression of the Enterobacter aerogenes alpha-acetolactate decarboxylase gene in brewer's yeast.

    PubMed Central

    Sone, H; Fujii, T; Kondo, K; Shimizu, F; Tanaka, J; Inoue, T


    The nucleotide sequence of a 1.4-kilobase DNA fragment containing the alpha-acetolactate decarboxylase gene of Enterobacter aerogenes was determined. The sequence contains an entire protein-coding region of 780 nucleotides which encodes an alpha-acetolactate decarboxylase of 260 amino acids. The DNA sequence coding for alpha-acetolactate decarboxylase was placed under the control of the alcohol dehydrogenase I promoter of the yeast Saccharomyces cerevisiae in a plasmid capable of autonomous replication in both S. cerevisiae and Escherichia coli. Brewer's yeast cells transformed by this plasmid showed alpha-acetolactate decarboxylase activity and were used in laboratory-scale fermentation experiments. These experiments revealed that the diacetyl concentration in wort fermented by the plasmid-containing yeast strain was significantly lower than that in wort fermented by the parental strain. These results indicated that the alpha-acetolactate decarboxylase activity produced by brewer's yeast cells degraded alpha-acetolactate and that this degradation caused a decrease in diacetyl production. PMID:3278689

  2. Lateral gene transfer, bacterial genome evolution, and the Anthropocene.


    Gillings, Michael R


    Lateral gene transfer (LGT) has significantly influenced bacterial evolution since the origins of life. It helped bacteria generate flexible, mosaic genomes and enables individual cells to rapidly acquire adaptive phenotypes. In turn, this allowed bacteria to mount strong defenses against human attempts to control their growth. The widespread dissemination of genes conferring resistance to antimicrobial agents has precipitated a crisis for modern medicine. Our actions can promote increased rates of LGT and also provide selective forces to fix such events in bacterial populations. For instance, the use of selective agents induces the bacterial SOS response, which stimulates LGT. We create hotspots for lateral transfer, such as wastewater systems, hospitals, and animal production facilities. Conduits of gene transfer between humans and animals ensure rapid dissemination of recent transfer events, as does modern transport and globalization. As resistance to antibacterial compounds becomes universal, there is likely to be increasing selection pressure for phenotypes with adverse consequences for human welfare, such as enhanced virulence, pathogenicity, and transmission. Improved understanding of the ecology of LGT could help us devise strategies to control this fundamental evolutionary process.

  3. Kidney-specific transposon-mediated gene transfer in vivo.


    Woodard, Lauren E; Cheng, Jizhong; Welch, Richard C; Williams, Felisha M; Luo, Wentian; Gewin, Leslie S; Wilson, Matthew H


    Methods enabling kidney-specific gene transfer in adult mice are needed to develop new therapies for kidney disease. We attempted kidney-specific gene transfer following hydrodynamic tail vein injection using the kidney-specific podocin and gamma-glutamyl transferase promoters, but found expression primarily in the liver. In order to achieve kidney-specific transgene expression, we tested direct hydrodynamic injection of a DNA solution into the renal pelvis and found that luciferase expression was strong in the kidney and absent from extra-renal tissues. We observed heterogeneous, low-level transfection of the collecting duct, proximal tubule, distal tubule, interstitial cells, and rarely glomerular cells following injection. To assess renal injury, we performed the renal pelvis injections on uninephrectomised mice and found that their blood urea nitrogen was elevated at two days post-transfer but resolved within two weeks. Although luciferase expression quickly decreased following renal pelvis injection, the use of the piggyBac transposon system improved long-term expression. Immunosuppression with cyclophosphamide stabilised luciferase expression, suggesting immune clearance of the transfected cells occurs in immunocompetent animals. Injection of a transposon expressing erythropoietin raised the haematocrit, indicating that the developed injection technique can elicit a biologic effect in vivo. Hydrodynamic renal pelvis injection enables transposon mediated-kidney specific gene transfer in adult mice.

  4. Kidney-specific transposon-mediated gene transfer in vivo

    PubMed Central

    Woodard, Lauren E.; Cheng, Jizhong; Welch, Richard C.; Williams, Felisha M.; Luo, Wentian; Gewin, Leslie S.; Wilson, Matthew H.


    Methods enabling kidney-specific gene transfer in adult mice are needed to develop new therapies for kidney disease. We attempted kidney-specific gene transfer following hydrodynamic tail vein injection using the kidney-specific podocin and gamma-glutamyl transferase promoters, but found expression primarily in the liver. In order to achieve kidney-specific transgene expression, we tested direct hydrodynamic injection of a DNA solution into the renal pelvis and found that luciferase expression was strong in the kidney and absent from extra-renal tissues. We observed heterogeneous, low-level transfection of the collecting duct, proximal tubule, distal tubule, interstitial cells, and rarely glomerular cells following injection. To assess renal injury, we performed the renal pelvis injections on uninephrectomised mice and found that their blood urea nitrogen was elevated at two days post-transfer but resolved within two weeks. Although luciferase expression quickly decreased following renal pelvis injection, the use of the piggyBac transposon system improved long-term expression. Immunosuppression with cyclophosphamide stabilised luciferase expression, suggesting immune clearance of the transfected cells occurs in immunocompetent animals. Injection of a transposon expressing erythropoietin raised the haematocrit, indicating that the developed injection technique can elicit a biologic effect in vivo. Hydrodynamic renal pelvis injection enables transposon mediated-kidney specific gene transfer in adult mice. PMID:28317878

  5. Two genes encode related cytoplasmic elongation factors 1 alpha (EF-1 alpha) in Drosophila melanogaster with continuous and stage specific expression.

    PubMed Central

    Hovemann, B; Richter, S; Walldorf, U; Cziepluch, C


    We have characterized two previously cloned genes, F1 and F2 (1) that code for elongation factor EF - 1 alpha of Drosophila melanogaster. Genomic Southern blot hybridization revealed that they are the only gene copies present. We isolated cDNA clones of both transcripts from embryonal and pupal stage of development that cover the entire transcription unit. The 5' ends of both genes have been determined by primer extension and for F1 also by RNA sequencing. These start sites have been shown to be used consistently during development. Comparison of cDNA and genomic sequences revealed that EF - 1 alpha,F1 consists of two and EF - 1 alpha,F2 of five exons. The two described elongation factor genes exhibit several regions of strong sequence conservation when compared to five recently cloned eucaryotic elongation factors. Images PMID:3131735

  6. Wolbachia genome integrated in an insect chromosome: Evolution and fate of laterally transferred endosymbiont genes

    PubMed Central

    Nikoh, Naruo; Tanaka, Kohjiro; Shibata, Fukashi; Kondo, Natsuko; Hizume, Masahiro; Shimada, Masakazu; Fukatsu, Takema


    Recent accumulation of microbial genome data has demonstrated that lateral gene transfers constitute an important and universal evolutionary process in prokaryotes, while those in multicellular eukaryotes are still regarded as unusual, except for endosymbiotic gene transfers from mitochondria and plastids. Here we thoroughly investigated the bacterial genes derived from a Wolbachia endosymbiont on the nuclear genome of the beetle Callosobruchus chinensis. Exhaustive PCR detection and Southern blot analysis suggested that ∼30% of Wolbachia genes, in terms of the gene repertoire of wMel, are present on the insect nuclear genome. Fluorescent in situ hybridization located the transferred genes on the proximal region of the basal short arm of the X chromosome. Molecular evolutionary and other lines of evidence indicated that the transferred genes are probably derived from a single lateral transfer event. The transferred genes were, for the length examined, structurally disrupted, freed from functional constraints, and transcriptionally inactive. Hence, most, if not all, of the transferred genes have been pseudogenized. Notwithstanding this, the transferred genes were ubiquitously detected from Japanese and Taiwanese populations of C. chinensis, while the number of the transferred genes detected differed between the populations. The transferred genes were not detected from congenic beetle species, indicating that the transfer event occurred after speciation of C. chinensis, which was estimated to be one or several million years ago. These features of the laterally transferred endosymbiont genes are compared with the evolutionary patterns of mitochondrial and plastid genome fragments acquired by nuclear genomes through recent endosymbiotic gene transfers. PMID:18073380

  7. Horizontal transfer of carbohydrate metabolism genes into ectomycorrhizal Amanita.


    Chaib De Mares, Maryam; Hess, Jaqueline; Floudas, Dimitrios; Lipzen, Anna; Choi, Cindy; Kennedy, Megan; Grigoriev, Igor V; Pringle, Anne


    The genus Amanita encompasses both symbiotic, ectomycorrhizal fungi and asymbiotic litter decomposers; all species are derived from asymbiotic ancestors. Symbiotic species are no longer able to degrade plant cell walls. The carbohydrate esterases family 1 (CE1s) is a diverse group of enzymes involved in carbon metabolism, including decomposition and carbon storage. CE1 genes of the ectomycorrhizal A. muscaria appear diverged from all other fungal homologues, and more similar to CE1s of bacteria, suggesting a horizontal gene transfer (HGT) event. In order to test whether AmanitaCE1s were acquired horizontally, we built a phylogeny of CE1s collected from across the tree of life, and describe the evolution of CE1 genes among Amanita and relevant lineages of bacteria. CE1s of symbiotic Amanita were very different from CE1s of asymbiotic Amanita, and are more similar to bacterial CE1s. The protein structure of one CE1 gene of A. muscaria matched a depolymerase that degrades the carbon storage molecule poly((R)-3-hydroxybutyrate) (PHB). Asymbiotic Amanita do not carry sequence or structural homologues of these genes. The CE1s acquired through HGT may enable novel metabolisms, or play roles in signaling or defense. This is the first evidence for the horizontal transfer of carbohydrate metabolism genes into ectomycorrhizal fungi.

  8. Twenty novel mutations in the alpha-galactosidase A gene causing Fabry disease.

    PubMed Central

    Topaloglu, A. K.; Ashley, G. A.; Tong, B.; Shabbeer, J.; Astrin, K. H.; Eng, C. M.; Desnick, R. J.


    BACKGROUND: Fabry disease, an X-linked inborn error of glycosphingolipid catabolism, results from the deficient activity of the lysosomal exoglycohydrolase alpha-galactosidase A (EC; alpha-Gal A). The nature of the molecular lesions in the alpha-Gal A gene in 30 unrelated families was determined to provide precise heterozygote detection, prenatal diagnosis, and define genotype-phenotype correlations. MATERIALS AND METHODS: Genomic DNA was isolated from affected males and/or carrier females from 30 unrelated families with Fabry disease. The entire alpha-Gal A coding region and flanking intronic sequences were analyzed by PCR amplification and automated sequencing. RESULTS: Twenty new mutations were identified, each in a single family: C142R, G183D, S235C, W236L, D244H, P259L, M267I, I289F, Q321E, C378Y, C52X, W277X, IVS4(+4), IVS6(+2), IVS6(-1), 35del13, 256del1, 892ins1, 1176del4, and 1188del1. In the remaining 10 unrelated Fabry families, 9 previously reported mutations were detected: M42V, R112C, S148R, D165V, N215S (in 2 families), Q99X, C142X, R227X, and 1072del3. Haplotype analysis using markers closely flanking the alpha-Gal A gene indicated that the two patients with the N215S lesion were unrelated. The IVS4(+4) mutation was a rare intronic splice site mutation that causes Fabry disease. CONCLUSIONS: These studies further define the heterogeneity of mutations in the alpha-Gal A gene causing Fabry disease, permit precise heterozygote detection and prenatal diagnosis, and help delineate phenotype-genotype correlations in this disease.

  9. Role of oxidants in NF-kappa B activation and TNF-alpha gene transcription induced by hypoxia and endotoxin.


    Chandel, N S; Trzyna, W C; McClintock, D S; Schumacker, P T


    The transcription factor NF-kappa B stimulates the transcription of proinflammatory cytokines including TNF-alpha. LPS (endotoxin) and hypoxia both induce NF-kappa B activation and TNF-alpha gene transcription. Furthermore, hypoxia augments LPS induction of TNF-alpha mRNA. Previous reports have indicated that antioxidants abolish NF-kappa B activation in response to LPS or hypoxia, which suggests that reactive oxygen species (ROS) are involved in NF-kappa B activation. This study tested whether mitochondrial ROS are required for both NF-kappaB activation and the increase in TNF-alpha mRNA levels during hypoxia and LPS. Our results indicate that hypoxia (1.5% O2) stimulates NF-kappa B and TNF-alpha gene transcription and increases ROS generation as measured by the oxidant sensitive dye 2',7'-dichlorofluorescein diacetate in murine macrophage J774.1 cells. The antioxidants N-acetylcysteine and pyrrolidinedithiocarbamic acid abolished the hypoxic activation of NF-kappa B, TNF-alpha gene transcription, and increases in ROS levels. Rotenone, an inhibitor of mitochondrial complex I, abolished the increase in ROS signal, the activation of NF-kappa B, and TNF-alpha gene transcription during hypoxia. LPS stimulated NF-kappa B and TNF-alpha gene transcription but not ROS generation in J774.1 cells. Rotenone, pyrrolidinedithiocarbamic acid, and N-acetylcysteine had no effect on the LPS stimulation of NF-kappa B and TNF-alpha gene transcription, indicating that LPS activates NF-kappa B and TNF-alpha gene transcription through a ROS-independent mechanism. These results indicate that mitochondrial ROS are required for the hypoxic activation of NF-kappa B and TNF-alpha gene transcription, but not for the LPS activation of NF-kappa B.

  10. Characterization of the lys2 gene of Penicillium chrysogenum encoding alpha-aminoadipic acid reductase.


    Casqueiro, J; Gutiérrez, S; Bañuelos, O; Fierro, F; Velasco, J; Martín, J F


    A DNA fragment containing a gene homologous to LYS2 gene of Saccharomyces cerevisiae was cloned from a genomic DNA library of Penicillium chrysogenum AS-P-78. It encodes a protein of 1409 amino acids (Mr 154859) with strong similarity to the S. cerevisiae (49.9% identity) Schizosaccharomyces pombe (51.3% identity) and Candida albicans (48.12% identity) alpha-aminoadipate reductases and a lesser degree of identity to the amino acid-activating domains of the non-ribosomal peptide synthetases, including the alpha-aminoadipate-activating domain of the alpha-aminoadipyl-cysteinyl-valine synthetase of P. chrysogenum (12.4% identical amino acids). The lys2 gene contained one intron in the 5'-region and other in the 3'-region, as shown by comparing the nucleotide sequences of the cDNA and genomic DNA, and was transcribed as a 4.7-kb monocistronic mRNA. The lys2 gene was localized on chromosome III (7.5 Mb) in P. chrysogenum AS-P-78 and on chromosome IV (5.6 Mb) in strain P2, whereas the penicillin gene cluster is known to be located in chromosome I in both strains. The lys2-encoded protein is a member of the aminoacyladenylate-forming enzyme family with a reductase domain in its C-terminal region.

  11. A functional polymorphism of the TNF-{alpha} gene that is associated with type 2 DM

    SciTech Connect

    Susa, Shinji; Daimon, Makoto Sakabe, Jun-Ichi; Sato, Hidenori; Oizumi, Toshihide; Karasawa, Shigeru; Wada, Kiriko; Jimbu, Yumi; Kameda, Wataru; Emi, Mitsuru; Muramatsu, Masaaki; Kato, Takeo


    To examine the association of the tumor necrosis factor-{alpha} (TNF-{alpha}) gene region with type 2 diabetes (DM), 11 single-nucleotide polymorphisms (SNPs) of the region were analyzed. The initial study using a sample set (148 cases vs. 227 controls) showed a significant association of the SNP IVS1G + 123A of the TNF-{alpha} gene with DM (p = 0.0056). Multiple logistic regression analysis using an enlarged sample set (225 vs. 716) revealed the significant association of the SNP with DM independently of any clinical traits examined (OR: 1.49, p = 0.014). The functional relevance of the SNP were examined by the electrophoretic mobility shift assays using nuclear extracts from the U937 and NIH3T3 cells and luciferase assays in these cells with Simian virus 40 promoter- and TNF-{alpha} promoter-reporter gene constructs. The functional analyses showed that YY1 transcription factor bound allele-specifically to the SNP region and, the IVS1 + 123A allele had an increase in luciferase expression compared with the G allele.

  12. The bean. alpha. -amylase inhibitor is encoded by a lectin gene

    SciTech Connect

    Moreno, J.; Altabella, T.; Chrispeels, M.J. )


    The common bean, Phaseolus vulgaris, contains an inhibitor of insect and mammalian {alpha}-amylases that does not inhibit plant {alpha}-amylase. This inhibitor functions as an anti-feedant or seed-defense protein. We purified this inhibitor by affinity chromatography and found that it consists of a series of glycoforms of two polypeptides (Mr 14,000-19,000). Partial amino acid sequencing was carried out, and the sequences obtained are identical with portions of the derived amino acid sequence of a lectin-like gene. This lectin gene encodes a polypeptide of MW 28,000, and the primary in vitro translation product identified by antibodies to the {alpha}-amylase inhibitor has the same size. Co- and posttranslational processing of this polypeptide results in glycosylated polypeptides of 14-19 kDa. Our interpretation of these results is that the bean lectins constitute a gene family that encodes diverse plant defense proteins, including phytohemagglutinin, arcelin and {alpha}-amylase inhibitor.

  13. Optimization of alpha-acylaminoketone ecdysone agonists for control of gene expression.


    Tice, Colin M; Hormann, Robert E; Thompson, Christine S; Friz, Jennifer L; Cavanaugh, Caitlin K; Saggers, Jessica A


    Fifteen new alpha-acylaminoketones were prepared by four different routes in an initial effort to optimize the potency of these compounds as ecdysone agonists. The compounds were assayed in mammalian cells expressing the ecdysone receptors from Bombyx mori (BmEcR) and Choristoneura fumiferana (CfEcR) for their ability to cause expression of a reporter gene downstream of an ecdysone response element. A new alpha-acylaminoketone was identified which had activity equal to that of the standard dibenzoylhydrazine ecdysone agonist GS()-E in the assay based on CfEcR.

  14. Multiplex pcr assay for detection of human interferon alpha2b gene in transgenic plants.


    Gerasymenko, I M; Sakhno, L O; Mazur, M G; Sheludko, Y V


    During the last decade interferons are regarded as potent candidates for generation of plant-based edible vaccines because of broad spectrum of antiviral activities and adjuvant properties. Establishment and certification of numerous interferon producing plant systems requests development of fast and efficient multiplex PCR protocol for the transgene detection in GM plants. Here we represent a protocol for simultaneous amplification in one assay of fragments of hIFN alpha 2b gene and two control genes, namely virD1 of Agrobacterium tumefaciens and conservative region of plant actin gene.

  15. Growth-related gene product {alpha}: A chemotactic cytokine for neutrophils in rheumatoid arthritis

    SciTech Connect

    Koch, A.E.; Pope, R.M. |; Shah, M.R.; Hosaka, S.


    Leukocyte recruitment is critical in the inflammation seen in rheumatoid arthritis (RA). To determine whether the chemokine growth-related gene product {alpha} (gro{alpha}) plays a role in this process, we examined synovial tissue (ST), synovial fluid (SF), and plasma samples from 102 patients with arthritis. RA SF contained more antigenic gro{alpha} (mean 5.3 {+-} 1.9 ng/ml) than did SFs from either osteoarthritis (OA) or other forms of arthritis (mean 0.1 ng/ml) (p < 0.05). RA plasma contained more gro{alpha} (mean 4.3 {+-} 1.8 ng/ml) than normal plasma (mean 0.1 ng/ml) (p < 0.05). RA ST fibroblasts (1.2 x 10{sup 5}/cells/ml RPMI 1640/24 h) produced antigenic gro{alpha} (mean 0.2 {+-} 0.1 ng/ml), and this production was increased significantly upon incubation with TNF-{alpha} (mean 1.3 {+-} 0.3 ng/ml) or IL-1{beta} (mean 2.3 {+-} 0.6 ng/ml) (p < 0.05). Cells from RA SF also produced gro{alpha}: neutrophils (PMNs) (10{sup 7} cells/ml/24 h) produced 3.7 {+-} 0.7 ng/ml. RA SF mononuclear cells produced gro{alpha}, particularly upon incubation with LPS or PHA. Immunoreactive ST gro{alpha} was found in greater numbers of RA compared with either OA or normal lining cells, as well as in RA compared with OA subsynovial macrophages (p < 0.05). IL-8 accounted for a mean of 36% of the RA SF chemotactic activity for PMNs, while epithelial neutrophil-activating peptide-78 accounted for 34%, and gro{alpha} for 28%, of this activity. Combined neutralization of all three chemokines in RA SFs resulted in a mean decrease of 50% of the chemotactic activity for PMNs present in the RA SFs. These results indicate that gro{alpha} plays an important role in the ingress of PMNs into the RA joint. 54 refs., 6 figs., 1 tab.

  16. Persistent expression of biologically active anti-HER2 antibody by AAVrh.10-mediated gene transfer.


    Wang, G; Qiu, J; Wang, R; Krause, A; Boyer, J L; Hackett, N R; Crystal, R G


    Trastuzumab (Herceptin) is a recombinant humanized monoclonal antibody (mAb) directed against an extracellular region of the human epidermal growth-factor receptor type 2 (HER2) protein. We hypothesized that a single adeno-associated virus (AAV)-mediated genetic delivery of an anti-HER2 antibody should be effective in mediating long-term production of anti-HER2 and in suppressing the growth of human tumors in a xenograft model in nude mice. The adeno-associated virus gene transfer vector AAVrh.10alphaHER2 was constructed based on a non-human primate AAV serotype rh.10 to express the complementary DNAs for the heavy and light chains of mAb 4D5, the murine precursor to trastuzumab. The data show that genetically transferred anti-HER2 selectively bound human HER2 protein and suppressed the proliferation of HER2(+) tumor cell lines. A single administration of AAVrh.10alphaHER2 provided long-term therapeutic levels of anti-HER2 antibody expression without inducing an anti-idiotype response, suppressed the growth of HER2(+) tumors and increased the survival of tumor bearing mice. In the context that trastuzumab therapy requires frequent and repeated administration, this strategy might be developed as an alternate platform for delivery of anti-HER2 therapy.

  17. Characterization of an Ancient Lepidopteran Lateral Gene Transfer

    PubMed Central

    Wheeler, David; Redding, Amanda J.; Werren, John H.


    Bacteria to eukaryote lateral gene transfers (LGT) are an important potential source of material for the evolution of novel genetic traits. The explosion in the number of newly sequenced genomes provides opportunities to identify and characterize examples of these lateral gene transfer events, and to assess their role in the evolution of new genes. In this paper, we describe an ancient lepidopteran LGT of a glycosyl hydrolase family 31 gene (GH31) from an Enterococcus bacteria. PCR amplification between the LGT and a flanking insect gene confirmed that the GH31 was integrated into the Bombyx mori genome and was not a result of an assembly error. Database searches in combination with degenerate PCR on a panel of 7 lepidopteran families confirmed that the GH31 LGT event occurred deep within the Order approximately 65–145 million years ago. The most basal species in which the LGT was found is Plutella xylostella (superfamily: Yponomeutoidea). Array data from Bombyx mori shows that GH31 is expressed, and low dN/dS ratios indicates the LGT coding sequence is under strong stabilizing selection. These findings provide further support for the proposition that bacterial LGTs are relatively common in insects and likely to be an underappreciated source of adaptive genetic material. PMID:23533610

  18. Gene transfer from a parasitic flowering plant to a fern.


    Davis, Charles C; Anderson, William R; Wurdack, Kenneth J


    The rattlesnake fern (Botrychium virginianum (L.) Sw.) is obligately mycotrophic and widely distributed across the northern hemisphere. Three mitochondrial gene regions place this species with other ferns in Ophioglossaceae, while two regions place it as a member of the largely parasitic angiosperm order Santalales (sandalwoods and mistletoes). These discordant phylogenetic placements suggest that part of the genome in B. virginianum was acquired by horizontal gene transfer (HGT), perhaps from root-parasitic Loranthaceae. These transgenes are restricted to B. virginianum and occur across the range of the species. Molecular and life-history traits indicate that the transfer preceded the global expansion of B. virginianum, and that the latter may have happened very rapidly. This is the first report of HGT from an angiosperm to a fern, through either direct parasitism or the mediation of interconnecting fungal symbionts.

  19. Gene transfer from a parasitic flowering plant to a fern

    PubMed Central

    Davis, Charles C; Anderson, William R; Wurdack, Kenneth J


    The rattlesnake fern (Botrychium virginianum (L.) Sw.) is obligately mycotrophic and widely distributed across the northern hemisphere. Three mitochondrial gene regions place this species with other ferns in Ophioglossaceae, while two regions place it as a member of the largely parasitic angiosperm order Santalales (sandalwoods and mistletoes). These discordant phylogenetic placements suggest that part of the genome in B. virginianum was acquired by horizontal gene transfer (HGT), perhaps from root-parasitic Loranthaceae. These transgenes are restricted to B. virginianum and occur across the range of the species. Molecular and life-history traits indicate that the transfer preceded the global expansion of B. virginianum, and that the latter may have happened very rapidly. This is the first report of HGT from an angiosperm to a fern, through either direct parasitism or the mediation of interconnecting fungal symbionts. PMID:16191635

  20. Transcriptional regulation of the mouse alpha A-crystallin gene: binding of USF to the -7/+5 region.


    Sax, C M; Cvekl, A; Piatigorsky, J


    Lens preferred-expression of the mouse alpha A-crystallin gene (alpha A-cry) is regulated at the transcriptional level by multiple elements located in the 5' flanking region of the gene. Here we present the first analysis of the functional role of the mouse alpha A-cry +1 region and the protein(s) which bind to it. The -7/+5 region of this promoter exhibits sequence similarity with the consensus upstream stimulating factor (USF) transcription factor binding site. A wild type oligodeoxyribonucleotide (oligo) spanning the mouse alpha A-cry -15/+15 region specifically inhibited the activity of a mouse alpha A-cry promoter-cat gene fusion (p alpha A 111aCAT) in competitive co-transfection studies in the mouse alpha TN4-1 lens cell line, as did an oligo containing the adenovirus 2 major late promoter strong USF binding site. In contrast, an alpha A-cry oligo mutated (-3/+3) within the USF-like binding site did not inhibit p alpha A111aCAT activity. Western blot analysis indicated that alpha TN4-1 cells express USF1. Co-transfection of p alpha A111aCAT and a USF1 cDNA expression vector into alpha TN4-1 cells resulted in a repression of mouse alpha A-cry promoter activity. Electrophoretic mobility shift analyses (EMSA) demonstrated that proteins in an alpha TN4-1 nuclear extract form a single major complex on synthetic oligos spanning the mouse alpha A-cry -15/+15 region. The formation of this complex was inhibited by the presence of unlabeled -15/+15 oligos or an anti-USF1 antibody. In addition, purified USF1 bound to this region, producing a complex similar in size to that observed with alpha TN4-1 nuclear extracts. Taken together, our findings show that USF can bind to the mouse alpha A-cry +1 site, and support the possibility that USF plays a role in promoter activity of this gene. Sequence similarities surrounding the +1 region of the alpha A-cry gene of the mouse, mole rat, hamster, and human, as well as the previously observed utilization of USF by different cry

  1. Gene transfer in ovarian cancer cells: a comparison between retroviral and lentiviral vectors.


    Indraccolo, Stefano; Habeler, Walter; Tisato, Veronica; Stievano, Laura; Piovan, Erich; Tosello, Valeria; Esposito, Giovanni; Wagner, Ralf; Uberla, Klaus; Chieco-Bianchi, Luigi; Amadori, Alberto


    Local gene therapy could be a therapeutic option for ovarian carcinoma, a life-threatening malignancy, because of disease containment within the peritoneal cavity in most patients. Lentiviral vectors, which are potentially capable of stable transgene expression, may be useful to vehicle therapeutic molecules requiring long-term production in these tumors. To investigate this concept, we used lentiviral vectors to deliver the enhanced green fluorescent protein (EGFP) gene to ovarian cancer cells. Their efficiency of gene transfer was compared with that of a retroviral vector carrying the same envelope. In vitro, both vectors infected ovarian cancer cells with comparable efficiency under standard culture conditions; however, the lentiviral vector was much more efficient in transducing growth-arrested cells when compared with the retroviral vector. Gene transfer was fully neutralized by an anti-VSV-G antibody, and in vitro stability was similar. In vivo, the lentiviral vector delivered the transgene 10-fold more efficiently to ovarian cancer cells growing i.p. in SCID mice, as evaluated by real-time PCR analysis of the tumors. Confocal microscopy analysis of tumor sections showed a dramatic difference at the level of transgene expression, because abundant EGFP(+) cells were detected only in mice receiving the lentiviral vector. Quantitative analysis by flow cytometry confirmed this and indicated 0.05 and 5.6% EGFP(+) tumor cells after administration of the retroviral and lentiviral vector, respectively. Injection of ex vivo transduced tumor cells, sorted for EGFP expression, indicated that the lentiviral vector was considerably more resistant to in vivo silencing in comparison with the retroviral vector. Finally, multiple administrations of a murine IFN-alpha(1)-lentiviral vector to ovarian carcinoma-bearing mice significantly prolonged the animals' survival, indicating the therapeutic efficacy of this approach. These findings indicate that lentiviral vectors deserve

  2. Risks from GMOs due to horizontal gene transfer.


    Keese, Paul


    Horizontal gene transfer (HGT) is the stable transfer of genetic material from one organism to another without reproduction or human intervention. Transfer occurs by the passage of donor genetic material across cellular boundaries, followed by heritable incorporation to the genome of the recipient organism. In addition to conjugation, transformation and transduction, other diverse mechanisms of DNA and RNA uptake occur in nature. The genome of almost every organism reveals the footprint of many ancient HGT events. Most commonly, HGT involves the transmission of genes on viruses or mobile genetic elements. HGT first became an issue of public concern in the 1970s through the natural spread of antibiotic resistance genes amongst pathogenic bacteria, and more recently with commercial production of genetically modified (GM) crops. However, the frequency of HGT from plants to other eukaryotes or prokaryotes is extremely low. The frequency of HGT to viruses is potentially greater, but is restricted by stringent selection pressures. In most cases the occurrence of HGT from GM crops to other organisms is expected to be lower than background rates. Therefore, HGT from GM plants poses negligible risks to human health or the environment.

  3. Functional effect of point mutations in the alpha-folate receptor gene of CABA I ovarian carcinoma cells.


    Mangiarotti, F; Miotti, S; Galmozzi, E; Mazzi, M; Sforzini, S; Canevari, S; Tomassetti, A


    The alpha-folate receptor (alpha FR) is overexpressed in 90% of nonmucinous ovarian carcinomas. In addition to the known role of alpha FR binding and mediating the internalization of folates, functional interaction of alpha FR with signaling molecules was recently shown. To identify a model to study the role of alpha FR in ovarian carcinoma, we characterized the alpha FR gene in the ovarian carcinoma cell line CABA I in comparison to a reference line, IGROV1. In CABA I cells, Northern blot analysis revealed an alpha FR transcript of the expected length and FACS analysis indicated receptor expression on the cell membrane; however, RNase protection assay revealed no specific signals. Southern blot and genomic PCR analysis suggested the presence of a rearrangement(s) involving the 5' region of the gene in CABA I cells as compared to IGROV1 cells. Cloning and sequencing of CABA I alpha FR cDNA revealed several point mutations. The partitioning of alpha FR in membrane microdomains from CABA I cells and its association with regulatory molecules was comparable to that of IGROV1 cells. By contrast, the alpha FR expressed on the CABA I cell membrane bound folic acid with lower affinity, and ectopic expression of the corresponding cDNA in CHO cells confirmed impaired folic acid binding. Thus, CABA I cells may provide a tool to delineate functional domains of the alpha FR.

  4. Characterization of the rat transforming growth factor alpha gene and identification of promoter sequences.

    PubMed Central

    Blasband, A J; Rogers, K T; Chen, X R; Azizkhan, J C; Lee, D C


    We have determined the complete nucleotide sequence of rat transforming growth factor alpha (TGF alpha) mRNA and characterized the six exons that encode this transcript. These six exons span approximately 85 kilobases of genomic DNA, with exons 1 to 3 separated by particularly large introns. What had previously been thought to represent a species-specific difference in the size of the TGF alpha precursor (proTGF alpha) is now shown to be due to microheterogeneity in the splicing of exons 2 and 3. This results from a tandem duplication of the acceptor CAG and gives rise to two alternate forms (159 and 160 amino acids) of the integral membrane precursor. Exon 6, which encodes the 3' untranslated region of TGF alpha mRNA, also encodes, on the opposite strand, a small (approximately 200-nucleotide) transcript whose sequence predicts an open reading frame of 51 amino acids. Expression of this latter transcript does not appear to be coregulated with that of TGF alpha mRNA. Primer extension and S1 nuclease analyses of authentic TGF alpha transcripts revealed two major and multiple minor 5' ends which span more than 200 base pairs of DNA in a G + C-rich region that lacks canonical CCAAT or TATA sequences. The 5' ends of six independently derived cDNAs localized to five different sites in this same region. Restriction fragments that overlap these transcription start sites and extend approximately 300 base pairs in the 5' direction faithfully promote transcription in vitro with HeLa cell nuclear extracts. In addition, they direct the expression of the bacterial chloramphenicol acetyltransferase gene in transient-transfection assays. Images PMID:2325647

  5. Horizontal Gene Transfer is a Significant Driver of Gene Innovation in Dinoflagellates

    PubMed Central

    Wisecaver, Jennifer H.; Brosnahan, Michael L.; Hackett, Jeremiah D.


    The dinoflagellates are an evolutionarily and ecologically important group of microbial eukaryotes. Previous work suggests that horizontal gene transfer (HGT) is an important source of gene innovation in these organisms. However, dinoflagellate genomes are notoriously large and complex, making genomic investigation of this phenomenon impractical with currently available sequencing technology. Fortunately, de novo transcriptome sequencing and assembly provides an alternative approach for investigating HGT. We sequenced the transcriptome of the dinoflagellate Alexandrium tamarense Group IV to investigate how HGT has contributed to gene innovation in this group. Our comprehensive A. tamarense Group IV gene set was compared with those of 16 other eukaryotic genomes. Ancestral gene content reconstruction of ortholog groups shows that A. tamarense Group IV has the largest number of gene families gained (314–1,563 depending on inference method) relative to all other organisms in the analysis (0–782). Phylogenomic analysis indicates that genes horizontally acquired from bacteria are a significant proportion of this gene influx, as are genes transferred from other eukaryotes either through HGT or endosymbiosis. The dinoflagellates also display curious cases of gene loss associated with mitochondrial metabolism including the entire Complex I of oxidative phosphorylation. Some of these missing genes have been functionally replaced by bacterial and eukaryotic xenologs. The transcriptome of A. tamarense Group IV lends strong support to a growing body of evidence that dinoflagellate genomes are extraordinarily impacted by HGT. PMID:24259313

  6. Activating mutations of the G[sub s] [alpha]-gene in nonfucntioning pituitary tumors

    SciTech Connect

    Tordjman, K.; Stern, N.; Friedman, E.; Ouaknine, G.; Razon, N.; Yossiphov, Y. ); Nordenskjoeld, M.; Friedman, E. )


    The majority of pituitary tumors are of monoclonal origin; however, the molecular basis for their formation is poorly understood. Somatic mutations in the [alpha]-subunit of the GTP-binding protein, G[sub s][alpha] (gsp oncogene) have been found in about one third of GH-secreting tumors. Mutations in another [alpha]-subunit of a GTP-binding protein, G[sub i2][alpha] (gip mutations) have been described in other endocrine tumors. In this study, the authors examined 21 nonfunctioning pituitary tumors and 4 macro-prolactinomas for gsp mutations and 27 nonfunctioning tumors and 4 macroprolactinomas for gip mutations. Using the polymerase chain reaction and denaturing gradient gel electrophoresis, 2 nonfunctioning pituitary tumors displayed migration abnormalities when the G[sub s] [alpha]-gene was analyzed. Sequence analysis of these abnormally migrating polymerase chain reaction products revealed two previously known gsp mutations: arginine at codon 201 altered to cysteine, and glutamine at codon 227 changed to leucine. No gip mutations could be demonstrated. These findings emphasize the monoclonal origin of nonfunctioning pituitary tumors and suggest that cAMP may play a role in tumorigenesis of nonfunctioning pituitary tumors. 27 refs., 3 figs., 1 tab.

  7. Erythroid cell-specific alpha-globin gene regulation by the CP2 transcription factor family.


    Kang, Ho Chul; Chae, Ji Hyung; Lee, Yeon Ho; Park, Mi-Ae; Shin, June Ho; Kim, Sung-Hyun; Ye, Sang-Kyu; Cho, Yoon Shin; Fiering, Steven; Kim, Chul Geun


    We previously demonstrated that ubiquitously expressed CP2c exerts potent erythroid-specific transactivation of alpha-globin through an unknown mechanism. This mechanism is reported here to involve specific CP2 splice variants and protein inhibitor of activated STAT1 (PIAS1). We identify a novel murine splice isoform of CP2, CP2b, which is identical to CP2a except that it has an additional 36 amino acids encoded by an extra exon. CP2b has an erythroid cell-specific transcriptional activation domain, which requires the extra exon and can form heteromeric complexes with other CP2 isoforms, but lacks the DNA binding activity found in CP2a and CP2c. Transcriptional activation of alpha-globin occurred following dimerization between CP2b and CP2c in erythroid K562 and MEL cells, but this dimerization did not activate the alpha-globin promoter in nonerythroid 293T cells, indicating that an additional erythroid factor is missing in 293T cells. PIAS1 was confirmed as a CP2 binding protein by the yeast two-hybrid screen, and expression of CP2b, CP2c, and PIAS1 in 293T cell induced alpha-globin promoter activation. These results show that ubiquitously expressed CP2b exerts potent erythroid cell-specific alpha-globin gene expression by complexing with CP2c and PIAS1.

  8. Phylogeographic support for horizontal gene transfer involving sympatric bruchid species

    PubMed Central

    Alvarez, Nadir; Benrey, Betty; Hossaert-McKey, Martine; Grill, Andrea; McKey, Doyle; Galtier, Nicolas


    Background We report on the probable horizontal transfer of a mitochondrial gene, cytb, between species of Neotropical bruchid beetles, in a zone where these species are sympatric. The bruchid beetles Acanthoscelides obtectus, A. obvelatus, A. argillaceus and Zabrotes subfasciatus develop on various bean species in Mexico. Whereas A. obtectus and A. obvelatus develop on Phaseolus vulgaris in the Mexican Altiplano, A. argillaceus feeds on P. lunatus in the Pacific coast. The generalist Z. subfasciatus feeds on both bean species, and is sympatric with A. obtectus and A. obvelatus in the Mexican Altiplano, and with A. argillaceus in the Pacific coast. In order to assess the phylogenetic position of these four species, we amplified and sequenced one nuclear (28S rRNA) and two mitochondrial (cytb, COI) genes. Results Whereas species were well segregated in topologies obtained for COI and 28S rRNA, an unexpected pattern was obtained in the cytb phylogenetic tree. In this tree, individuals from A. obtectus and A. obvelatus, as well as Z. subfasciatus individuals from the Mexican Altiplano, clustered together in a unique little variable monophyletic unit. In contrast, A. argillaceus and Z. subfasciatus individuals from the Pacific coast clustered in two separated clades, identically to the pattern obtained for COI and 28S rRNA. An additional analysis showed that Z. subfasciatus individuals from the Mexican Altiplano also possessed the cytb gene present in individuals of this species from the Pacific coast. Zabrotes subfasciatus individuals from the Mexican Altiplano thus demonstrated two cytb genes, an "original" one and an "infectious" one, showing 25% of nucleotide divergence. The "infectious" cytb gene seems to be under purifying selection and to be expressed in mitochondria. Conclusion The high degree of incongruence of the cytb tree with patterns for other genes is discussed in the light of three hypotheses: experimental contamination, hybridization, and

  9. Tumor necrosis factor-alpha regulation of the Id gene family in astrocytes and microglia during CNS inflammatory injury.


    Tzeng, S F; Kahn, M; Liva, S; De Vellis, J


    The inhibitors of DNA binding (Id) gene family is highly expressed during embryogenesis and throughout adulthood in the rat central nervous system (CNS). In vitro studies suggest that the Id gene family is involved in the regulation of cell proliferation and differentiation. Recently, Id gene expression was shown to be expressed in immature and mature astrocytes during development and upregulated in reactive astrocytes after spinal cord injury. These results suggest that the Id gene family may play an important role in regulating astrocyte development and reactivity; however, the factors regulating Id expression in astrocytes remain undefined. Tumor necrosis factor-alpha (TNF alpha), a proinflammatory cytokine, is thought to play a crucial role in astrocyte/microglia activation after injury to the CNS. To determine if TNF alpha plays a role in Id gene expression, we exogenously administered TNF alpha into developing postnatal rats. We report that TNF alpha injections resulted in a rapid and transient increase in both cell number and mRNA expression for Id2 and Id3 when compared to levels observed in noninjected or control-injected animals. Id1 mRNA levels were also upregulated after TNF alpha treatment, but to a lesser degree. Significant increases in TNF alpha-induced Id2 and Id3 mRNA were observed in the ventricular/subventricular zone, cingulum and corpus callosum. TNF alpha also increased Id2 mRNA expression in the caudate putamen and hippocampus at the injection site. Id2 and Id3 mRNA+ cells were identified as GFAP+ and S100 alpha + astrocytes as well as ED1+ microglia. This is the first report to show TNF-alpha-induced modulation of the Id gene family and suggests that Id may be involved in the formation of reactive astrocytes and activated microglia in the rodent brain. These results suggest a putative role for the Id family in the molecular mechanisms regulating cellular responsiveness to TNF alpha and CNS inflammation.

  10. Six mouse alpha-tubulin mRNAs encode five distinct isotypes: testis-specific expression of two sister genes.

    PubMed Central

    Villasante, A; Wang, D; Dobner, P; Dolph, P; Lewis, S A; Cowan, N J


    Five mouse alpha-tubulin isotypes are described, each distinguished by the presence of unique amino acid substitutions within the coding region. Most, though not all of these isotype-specific amino acids, are clustered at the carboxy terminus. One of the alpha-tubulin isotypes described is expressed exclusively in testis and is encoded by two closely related genes (M alpha 3 and M alpha 7) which have homologous 3' untranslated regions but which differ at multiple third codon positions and in their 5' untranslated regions. We show that a subfamily of alpha-tubulin genes encoding the same testis-specific isotype also exists in humans. Thus, we conclude that the duplication event leading to a pair of genes encoding a testis-specific alpha-tubulin isotype predated the mammalian radiation, and both members of the duplicated sequence have been maintained since species divergence. A second alpha-tubulin gene, M alpha 6, is expressed ubiquitously at a low level, whereas a third gene, M alpha 4, is unique in that it does not encode a carboxy-terminal tyrosine residue. This gene yields two transcripts: a 1.8-kilobase (kb) mRNA that is abundant in muscle and a 2.4-kb mRNA that is abundant in testis. Whereas the 1.8-kb mRNA encodes a distinct alpha-tubulin isotype, the 2.4-kb mRNA is defective in that the methionine residue required for translational initiation is missing. Patterns of developmental expression of the various alpha-tubulin isotypes are presented. Our data support the view that individual tubulin isotypes are capable of conferring functional specificity on different kinds of microtubules. Images PMID:3785200

  11. Dynamic monitoring of horizontal gene transfer in soil

    NASA Astrophysics Data System (ADS)

    Cheng, H. Y.; Masiello, C. A.; Silberg, J. J.; Bennett, G. N.


    Soil microbial gene expression underlies microbial behaviors (phenotypes) central to many aspects of C, N, and H2O cycling. However, continuous monitoring of microbial gene expression in soils is challenging because genetically-encoded reporter proteins widely used in the lab are difficult to deploy in soil matrices: for example, green fluorescent protein cannot be easily visualized in soils, even in the lab. To address this problem we have developed a reporter protein that releases small volatile gases. Here, we applied this gas reporter in a proof-of-concept soil experiment, monitoring horizontal gene transfer, a microbial activity that alters microbial genotypes and phenotypes. Horizontal gene transfer is central to bacterial evolution and adaptation and is relevant to problems such as the spread of antibiotic resistance, increasing metal tolerance in superfund sites, and bioremediation capability of bacterial consortia. This process is likely to be impacted by a number of matrix properties not well-represented in the petri dish, such as microscale variations in water, nutrients, and O2, making petri-dish experiments a poor proxy for environmental processes. We built a conjugation system using synthetic biology to demonstrate the use of gas-reporting biosensors in safe, lab-based biogeochemistry experiments, and here we report the use of these sensors to monitor horizontal gene transfer in soils. Our system is based on the F-plasmid conjugation in Escherichia coli. We have found that the gas signal reports on the number of cells that acquire F-plasmids (transconjugants) in a loamy Alfisol collected from Kellogg Biological Station. We will report how a gas signal generated by transconjugants varies with the number of F-plasmid donor and acceptor cells seeded in a soil, soil moisture, and soil O2 levels.

  12. alpha. -Amylase of Clostridium thermosulfurogenes EM1: Nucleotide sequence of the gene, processing of the enzyme, and comparison to other. alpha. -amylases

    SciTech Connect

    Bahl, H.; Burchhardt, G.; Spreinat, A.; Haeckel, K.; Wienecke, A.; Antranikian, G.; Schmidt, B. )


    The nucleotide sequence of the {alpha}-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes Em1 suggested that the {alpha}-amylase is translated form mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature {alpha}-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 {alpha}-amylase with those from other bacterial and eukaryotic {alpha}-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca{sup 2+}-binding site (consensus region I) of this Ca{sub 2+}-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the {alpha}-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the {beta}-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains.

  13. alpha-Amylase of Clostridium thermosulfurogenes EM1: nucleotide sequence of the gene, processing of the enzyme, and comparison of other alpha-amylases.

    PubMed Central

    Bahl, H; Burchhardt, G; Spreinat, A; Haeckel, K; Wienecke, A; Schmidt, B; Antranikian, G


    The nucleotide sequence of the alpha-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes EM1 suggested that the alpha-amylase is translated from mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature alpha-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 alpha-amylase with those from other bacterial and eucaryotic alpha-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca(2+)-binding site (consensus region I) of this Ca(2+)-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the alpha-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the beta-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains. PMID:1854207

  14. Comparative gene expression profiles induced by PPAR{gamma} and PPAR{alpha}/{gamma} agonists in rat hepatocytes

    SciTech Connect

    Rogue, Alexandra; Renaud, Marie Pierre; Claude, Nancy; Guillouzo, Andre; Spire, Catherine


    Species-differential toxic effects have been described with PPAR{alpha} and PPAR{gamma} agonists between rodent and human liver. PPAR{alpha} agonists (fibrates) are potent hypocholesterolemic agents in humans while they induce peroxisome proliferation and tumors in rodent liver. By contrast, PPAR{gamma} agonists (glitazones) and even dual PPAR{alpha}/{gamma} agonists (glitazars) have caused idiosyncratic hepatic and nonhepatic toxicities in human without evidence of any damage in rodent during preclinical studies. The mechanisms involved in such differences remain largely unknown. Several studies have identified the major target genes of PPAR{alpha} agonists in rodent liver while no comprehensive analysis has been performed on gene expression changes induced by PPAR{gamma} and dual PPAR{alpha}/{gamma} agonists. Here, we investigated transcriptomes of rat hepatocytes after 24 h treatment with two PPAR{gamma} (troglitazone and rosiglitazone) and two PPAR{alpha}/{gamma} (muraglitazar and tesaglitazar) agonists. Although, hierarchical clustering revealed a gene expression profile characteristic of each PPAR agonist class, only a limited number of genes was specifically deregulated by glitazars. Functional analyses showed that many genes known as PPAR{alpha} targets were also modulated by both PPAR{gamma} and PPAR{alpha}/{gamma} agonists and quantitative differences in gene expression profiles were observed between these two classes. Moreover, most major genes modulated in rat hepatocytes were also found to be deregulated in rat liver after tesaglitazar treatment. Taken altogether, these results support the conclusion that differential toxic effects of PPAR{alpha} and PPAR{gamma} agonists in rodent liver do not result from transcriptional deregulation of major PPAR target genes but rather from qualitative and/or quantitative differential responses of a small subset of genes.

  15. Detection of Clostridium perfringens alpha toxin gene in lambs by loop mediated isothermal amplification

    PubMed Central

    Radhika, B.; Kumar, N. Vinod; Sreenivasulu, D.


    Aim: The loop mediated isothermal amplification (LAMP) was standardized for rapid detection of Clostridium perfringens. Materials and Methods: A total of 120 fecal samples were collected from enterotoxemia suspected lambs were used for screening of C. perfringens cpa gene by LAMP. The specificity of the LAMP amplified products was tested by digesting with restriction enzyme XmnI for alpha toxin gene. Results: Out of 120 samples screened 112 (93.3%) samples were positive by both LAMP and polymerase chain reaction (PCR) for detection of cpa gene which indicated the equal sensitivity of both the tests. The enzyme produced single cut in 162 base pair amplified product of alpha toxin gene at 81 base pair resulting in a single band in gel electrophoresis. Conclusion: Both LAMP and PCR for detection of cpa gene indicated the equal sensitivity of both the tests. Standardization of LAMP reaction for amplification of epsilon and beta toxin genes will help to identify the C. perfringens toxin types from the clinical samples. The test could be a suitable alternative to the PCR in detection of toxin types without the help of sophisticated machinery like thermal cycler. Considering its simplicity in operation and high sensitivity, there is the potential use of this technique in clinical diagnosis and surveillance of infectious diseases. PMID:27051186

  16. Horizontal Gene Transfer Contributes to the Evolution of Arthropod Herbivory.


    Wybouw, Nicky; Pauchet, Yannick; Heckel, David G; Van Leeuwen, Thomas


    Within animals, evolutionary transition toward herbivory is severely limited by the hostile characteristics of plants. Arthropods have nonetheless counteracted many nutritional and defensive barriers imposed by plants and are currently considered as the most successful animal herbivores in terrestrial ecosystems. We gather a body of evidence showing that genomes of various plant feeding insects and mites possess genes whose presence can only be explained by horizontal gene transfer (HGT). HGT is the asexual transmission of genetic information between reproductively isolated species. Although HGT is known to have great adaptive significance in prokaryotes, its impact on eukaryotic evolution remains obscure. Here, we show that laterally transferred genes into arthropods underpin many adaptations to phytophagy, including efficient assimilation and detoxification of plant produced metabolites. Horizontally acquired genes and the traits they encode often functionally diversify within arthropod recipients, enabling the colonization of more host plant species and organs. We demonstrate that HGT can drive metazoan evolution by uncovering its prominent role in the adaptations of arthropods to exploit plants.

  17. Horizontal Gene Transfer Contributes to the Evolution of Arthropod Herbivory

    PubMed Central

    Wybouw, Nicky; Pauchet, Yannick; Heckel, David G.; Van Leeuwen, Thomas


    Within animals, evolutionary transition toward herbivory is severely limited by the hostile characteristics of plants. Arthropods have nonetheless counteracted many nutritional and defensive barriers imposed by plants and are currently considered as the most successful animal herbivores in terrestrial ecosystems. We gather a body of evidence showing that genomes of various plant feeding insects and mites possess genes whose presence can only be explained by horizontal gene transfer (HGT). HGT is the asexual transmission of genetic information between reproductively isolated species. Although HGT is known to have great adaptive significance in prokaryotes, its impact on eukaryotic evolution remains obscure. Here, we show that laterally transferred genes into arthropods underpin many adaptations to phytophagy, including efficient assimilation and detoxification of plant produced metabolites. Horizontally acquired genes and the traits they encode often functionally diversify within arthropod recipients, enabling the colonization of more host plant species and organs. We demonstrate that HGT can drive metazoan evolution by uncovering its prominent role in the adaptations of arthropods to exploit plants. PMID:27307274

  18. Gene Therapy Inhibiting Neointimal Vascular Lesion: In vivo Transfer of Endothelial Cell Nitric Oxide Synthase Gene

    NASA Astrophysics Data System (ADS)

    von der Leyen, Heiko E.; Gibbons, Gary H.; Morishita, Ryuichi; Lewis, Neil P.; Zhang, Lunan; Nakajima, Masatoshi; Kaneda, Yasufumi; Cooke, John P.; Dzau, Victor J.


    It is postulated that vascular disease involves a disturbance in the homeostatic balance of factors regulating vascular tone and structure. Recent developments in gene transfer techniques have emerged as an exciting therapeutic option to treat vascular disease. Several studies have established the feasibility of direct in vivo gene transfer into the vasculature by using reporter genes such as β-galactosidase or luciferase. To date no study has documented therapeutic effects with in vivo gene transfer of a cDNA encoding a functional enzyme. This study tests the hypothesis that endothelium-derived nitric oxide is an endogenous inhibitor of vascular lesion formation. After denudation by balloon injury of the endothelium of rat carotid arteries, we restored endothelial cell nitric oxide synthase (ec-NOS) expression in the vessel wall by using the highly efficient Sendai virus/liposome in vivo gene transfer technique. ec-NOS gene transfection not only restored NO production to levels seen in normal untreated vessels but also increased vascular reactivity of the injured vessel. Neointima formation at day 14 after balloon injury was inhibited by 70%. These findings provide direct evidence that NO is an endogenous inhibitor of vascular lesion formation in vivo (by inhibiting smooth muscle cell proliferation and migration) and suggest the possibility of ec-NOS transfection as a potential therapeutic approach to treat neointimal hyperplasia.

  19. PPAR{alpha} gene expression is up-regulated by LXR and PXR activators in the small intestine

    SciTech Connect

    Inoue, Jun; Satoh, Shin-ichi; Kita, Mariko; Nakahara, Mayuko; Hachimura, Satoshi; Miyata, Masaaki; Nishimaki-Mogami, Tomoko; Sato, Ryuichiro


    LXR, PXR, and PPAR{alpha} are members of a nuclear receptor family which regulate the expression of genes involved in lipid metabolism. Here, we show the administration of T0901317 stimulates PPAR{alpha} gene expression in the small intestine but not in the liver of both normal and FXR-null mice. The administration of LXR specific ligand GW3965, or PXR specific ligand PCN has the same effect, indicating that ligand-dependent activation of LXR and PXR, but not FXR, is responsible for the increased gene expression of PPAR{alpha} in the mouse small intestine.

  20. HGTree: database of horizontally transferred genes determined by tree reconciliation.


    Jeong, Hyeonsoo; Sung, Samsun; Kwon, Taehyung; Seo, Minseok; Caetano-Anollés, Kelsey; Choi, Sang Ho; Cho, Seoae; Nasir, Arshan; Kim, Heebal


    The HGTree database provides putative genome-wide horizontal gene transfer (HGT) information for 2472 completely sequenced prokaryotic genomes. This task is accomplished by reconstructing approximate maximum likelihood phylogenetic trees for each orthologous gene and corresponding 16S rRNA reference species sets and then reconciling the two trees under parsimony framework. The tree reconciliation method is generally considered to be a reliable way to detect HGT events but its practical use has remained limited because the method is computationally intensive and conceptually challenging. In this regard, HGTree ( represents a useful addition to the biological community and enables quick and easy retrieval of information for HGT-acquired genes to better understand microbial taxonomy and evolution. The database is freely available and can be easily scaled and updated to keep pace with the rapid rise in genomic information.

  1. HGTree: database of horizontally transferred genes determined by tree reconciliation

    PubMed Central

    Jeong, Hyeonsoo; Sung, Samsun; Kwon, Taehyung; Seo, Minseok; Caetano-Anollés, Kelsey; Choi, Sang Ho; Cho, Seoae; Nasir, Arshan; Kim, Heebal


    The HGTree database provides putative genome-wide horizontal gene transfer (HGT) information for 2472 completely sequenced prokaryotic genomes. This task is accomplished by reconstructing approximate maximum likelihood phylogenetic trees for each orthologous gene and corresponding 16S rRNA reference species sets and then reconciling the two trees under parsimony framework. The tree reconciliation method is generally considered to be a reliable way to detect HGT events but its practical use has remained limited because the method is computationally intensive and conceptually challenging. In this regard, HGTree ( represents a useful addition to the biological community and enables quick and easy retrieval of information for HGT-acquired genes to better understand microbial taxonomy and evolution. The database is freely available and can be easily scaled and updated to keep pace with the rapid rise in genomic information. PMID:26578597

  2. Regional assignment of the structural gene for human alpha-L-iduronidase.

    PubMed Central

    Schuchman, E H; Astrin, K H; Aula, P; Desnick, R J


    The structural gene encoding human alpha-L-iduronidase has been assigned to chromosome 22 by using immunologic, electrophoretic, and somatic cell hybridization techniques. Polyclonal rabbit antibodies raised against purified human low-uptake alpha-L-iduronidase were used to discriminate the human and murine isozymes by a sensitive immuno-precipitation assay. The human chromosome constitution of each clone was determined by cytogenetic and enzyme marker electrophoretic techniques. In 65 human (fibroblast)-mouse (RAG) somatic cell hybrids (from four independent fusions), the expression of human alpha-L-iduronidase was 100% concordant with the presence of human chromosome 22; the assignment was confirmed by the demonstration of the human enzyme in tertiary somatic cell hybrids containing only chromosome 22. Further verification of the gene assignment was made by detection of the human enzyme in tertiary chromosome 22 positive hybrids by Ouchterlony immunodiffusion and rocket immunoelectrophoretic experiments with polyclonal anti-human alpha-L-iduronidase antibodies that were monospecific for the human enzyme. Expression of human enzymatic activity in chromosome 22 positive hybrid lines was markedly reduced; for example, a tertiary hybrid (R-G21-J-15), which contained an average of 1.7 chromosome 22s per cell, only had about 15% of the activity detected in normal diploid fibroblasts. Immunologic studies suggested that the reduced expression was due to abnormal post-translational processing or aggregation (or both) of the human and murine isozymes in these hybrids. Regional assignment of the human structural gene to 22pter----q11 was accomplished by gene dosage studies using diploid human fibroblast lines that were partially monosomic or trisomic for chromosome 22. Images PMID:6422468

  3. Horizontal transfer of expressed genes in a parasitic flowering plant

    PubMed Central


    Background Recent studies have shown that plant genomes have potentially undergone rampant horizontal gene transfer (HGT). In plant parasitic systems HGT appears to be facilitated by the intimate physical association between the parasite and its host. HGT in these systems has been invoked when a DNA sequence obtained from a parasite is placed phylogenetically very near to its host rather than with its closest relatives. Studies of HGT in parasitic plants have relied largely on the fortuitous discovery of gene phylogenies that indicate HGT, and no broad systematic search for HGT has been undertaken in parasitic systems where it is most expected to occur. Results We analyzed the transcriptomes of the holoparasite Rafflesia cantleyi Solms-Laubach and its obligate host Tetrastigma rafflesiae Miq. using phylogenomic approaches. Our analyses show that several dozen actively transcribed genes, most of which appear to be encoded in the nuclear genome, are likely of host origin. We also find that hundreds of vertically inherited genes (VGT) in this parasitic plant exhibit codon usage properties that are more similar to its host than to its closest relatives. Conclusions Our results establish for the first time a substantive number of HGTs in a plant host-parasite system. The elevated rate of unidirectional host-to- parasite gene transfer raises the possibility that HGTs may provide a fitness benefit to Rafflesia for maintaining these genes. Finally, a similar convergence in codon usage of VGTs has been shown in microbes with high HGT rates, which may help to explain the increase of HGTs in these parasitic plants. PMID:22681756

  4. Bacterial gene transfer by natural genetic transformation in the environment.

    PubMed Central

    Lorenz, M G; Wackernagel, W


    Natural genetic transformation is the active uptake of free DNA by bacterial cells and the heritable incorporation of its genetic information. Since the famous discovery of transformation in Streptococcus pneumoniae by Griffith in 1928 and the demonstration of DNA as the transforming principle by Avery and coworkers in 1944, cellular processes involved in transformation have been studied extensively by in vitro experimentation with a few transformable species. Only more recently has it been considered that transformation may be a powerful mechanism of horizontal gene transfer in natural bacterial populations. In this review the current understanding of the biology of transformation is summarized to provide the platform on which aspects of bacterial transformation in water, soil, and sediments and the habitat of pathogens are discussed. Direct and indirect evidence for gene transfer routes by transformation within species and between different species will be presented, along with data suggesting that plasmids as well as chromosomal DNA are subject to genetic exchange via transformation. Experiments exploring the prerequisites for transformation in the environment, including the production and persistence of free DNA and factors important for the uptake of DNA by cells, will be compiled, as well as possible natural barriers to transformation. The efficiency of gene transfer by transformation in bacterial habitats is possibly genetically adjusted to submaximal levels. The fact that natural transformation has been detected among bacteria from all trophic and taxonomic groups including archaebacteria suggests that transformability evolved early in phylogeny. Probable functions of DNA uptake other than gene acquisition will be discussed. The body of information presently available suggests that transformation has a great impact on bacterial population dynamics as well as on bacterial evolution and speciation. PMID:7968924

  5. Construction of an amylolytic industrial strain of Saccharomyces cerevisiae containing the Schwanniomyces occidentalis alpha-amylase gene.


    Kang, Na-Young; Park, Jeong-Nam; Chin, Jong-Eon; Lee, Hwanghee Blaise; Im, Suhn-Young; Bai, Suk


    The gene encoding Schwanniomyces occidentalis alpha-amylase (AMY) was introduced into the chromosomal delta sequences of an industrial strain of Saccharomyces cerevisiae. To obtain a strain suitable for commercial use, an delta-integrative cassette devoid of bacterial DNA sequences was constructed that contains the AMY gene and aureobasidin A resistance gene (AUR1-C) as the selection marker. The AMY gene was expressed under the control of the alcohol dehydrogenase gene promoter (ADC1p). The alpha-amylase activity of Sacc. cerevisiae transformed with this integrative cassette was 6 times higher than that of Sch. occidentalis. The transformants (integrants) were mitotically stable after 100 generations in nonselective medium.

  6. Effect of TNF{alpha} on activities of different promoters of human apolipoprotein A-I gene

    SciTech Connect

    Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.


    Research highlights: {yields} TNF{alpha} stimulates the distal alternative promoter of human apoA-I gene. {yields} TNF{alpha} acts by weakening of promoter competition within apoA-I gene (promoter switching). {yields} MEK1/2 and nuclear receptors PPAR{alpha} and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1{beta} and TNF{alpha}. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNF{alpha}-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNF{alpha} on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNF{alpha} leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNF{alpha}. The MEK1/2-ERK1/2 cascade and nuclear receptors PPAR{alpha} and LXRs are important for TNF{alpha}-mediated apoA-I promoter switching.

  7. Evaluation of "at risk" alpha 1-antitrypsin genotype SZ with synthetic oligonucleotide gene probes.

    PubMed Central

    Nukiwa, T; Brantly, M; Garver, R; Paul, L; Courtney, M; LeCocq, J P; Crystal, R G


    Alpha 1-antitrypsin (alpha 1AT), a 52,000-mol-wt serum glycoprotein produced by hepatocytes and mononuclear phagocytes, functions as the major inhibitor of neutrophil elastase. The alpha 1AT haplotype S is associated with childhood liver disease and/or adult emphysema when inherited with the Z haplotype to give the phenotype SZ. To accurately identify the SZ phenotype at the level of genomic DNA, four 32P-labeled 19-mer synthetic oligonucleotide probes were prepared; two to identify the M and S difference in exon III, and two to identify the M and Z difference in exon V. These probes were hybridized with various cloned DNAs and genomic DNAs cut with the restriction endonucleases BgII and EcoRI; the genomic DNAs represented all six possible phenotype combinations of the M, S, and Z haplotypes (MM, MS, MZ, SS, ZZ, and SZ). Using the four probes to evaluate 42 samples of genomic DNA, the "at risk" SZ and ZZ phenotypes were correctly identified in all cases, as were the "not at risk" phenotypes SS, MS, MM, and MZ, demonstrating that both exon III and exon V directed probes are necessary to properly identify all of the major "at risk" alpha 1AT genes. However, when used to evaluate a very rare family carrying a null allele, these four oligonucleotide probes misidentified the "at risk" null-null and S null phenotypes as "not at risk" MM and SM combinations. These observations indicate that oligonucleotide gene probes yielded reliable and accurate assessment of "at risk" alpha 1AT genotypes in almost all situations, but in the context of prenatal diagnosis and genetic counseling this approach must be used with caution and in combination with family studies so as not to misidentify rare genotypes that may be associated with a risk for disease. Images PMID:3484754

  8. Differential expression of alphaB-crystallin and Hsp27-1 in anaplastic thyroid carcinomas because of tumor-specific alphaB-crystallin gene (CRYAB) silencing

    PubMed Central

    Mineva, Ivelina; Gartner, Wolfgang; Hauser, Peter; Kainz, Alexander; Löffler, Michael; Wolf, Gerhard; Oberbauer, Rainer; Weissel, Michael; Wagner, Ludwig


    Expression of the small heat shock protein alphaB-crystallin in differentiated thyroid tumors has been described recently. In this study, we investigated the molecular mechanisms that affect the expression of alphaB-crystallin in benign goiters (n = 7) and highly malignant anaplastic thyroid carcinomas (ATCs) (n = 3). AlphaB-crystallin expression was compared with that of Hsp27-1. Immunoblot and quantitative real-time (RT) polymerase chain reaction revealed marked downregulation of alphaB-crystallin in all the tested ATCs and the ATC-derived cell line C-643 . In contrast, considerable expression of Hsp27-1 in benign and malignant thyroid tissue was demonstrated. Immunofluorescence analysis revealed no relevant topological differences between benign and malignant thyrocytes in the cytoplasmic staining of both proteins. Consistent and marked downregulation of TFCP2L1 was identified as one of the main mechanisms contributing to CRYAB gene silencing in ATCs. In addition, CRYAB gene promoter methylation seems to occur in distinct ATCs. In silico analysis revealed that the differential expression of alphaB-crystallin and Hsp27-1 results from differences between the alphaB-crystallin and Hsp27-1 promoter fragments (712 bp upstream from the transcriptional start site). Biological activity of the analyzed promoter element is confirmed by its heat shock inducibility. In conclusion, we demonstrate downregulation of alphaB-crystallin expression in highly dedifferentiated ATCs because of a tumor-specific transcription factor pattern. The differential expression of alphaB-crystallin and Hsp27-1 indicates functional differences between both proteins. PMID:16184762

  9. Differential expression of alphaB-crystallin and Hsp27-1 in anaplastic thyroid carcinomas because of tumor-specific alphaB-crystallin gene (CRYAB) silencing.


    Mineva, Ivelina; Gartner, Wolfgang; Hauser, Peter; Kainz, Alexander; Löffler, Michael; Wolf, Gerhard; Oberbauer, Rainer; Weissel, Michael; Wagner, Ludwig


    Expression of the small heat shock protein alphaB-crystallin in differentiated thyroid tumors has been described recently. In this study, we investigated the molecular mechanisms that affect the expression of alphaB-crystallin in benign goiters (n = 7) and highly malignant anaplastic thyroid carcinomas (ATCs) (n = 3). AlphaB-crystallin expression was compared with that of Hsp27-1. Immunoblot and quantitative real-time (RT) polymerase chain reaction revealed marked downregulation of alphaB-crystallin in all the tested ATCs and the ATC-derived cell line C-643 . In contrast, considerable expression of Hsp27-1 in benign and malignant thyroid tissue was demonstrated. Immunofluorescence analysis revealed no relevant topological differences between benign and malignant thyrocytes in the cytoplasmic staining of both proteins. Consistent and marked downregulation of TFCP2L1 was identified as one of the main mechanisms contributing to CRYAB gene silencing in ATCs. In addition, CRYAB gene promoter methylation seems to occur in distinct ATCs. In silico analysis revealed that the differential expression of alphaB-crystallin and Hsp27-1 results from differences between the alphaB-crystallin and Hsp27-1 promoter fragments (712 bp upstream from the transcriptional start site). Biological activity of the analyzed promoter element is confirmed by its heat shock inducibility. In conclusion, we demonstrate downregulation of alphaB-crystallin expression in highly dedifferentiated ATCs because of a tumor-specific transcription factor pattern. The differential expression of alphaB-crystallin and Hsp27-1 indicates functional differences between both proteins.

  10. Molecular nature of alpha-globin genes in the Saudi population

    PubMed Central

    Borgio, J. Francis


    Alpha-thalassemia (α-thal) is a disorder caused by the deletion of single or double α-globin genes, and/or point mutations in the α-globin genes. There are 2 common types of α-globin genes; HBA2 and HBA1. Recently, it has been discovered that the HBA2 gene is replaced by a unique HBA12 gene convert in 5.7% of the Saudi population. The α-globin genes have been emerging as a molecular target for the treatment of β-thalassemia (β-thal). Hence, it is essential to understand the molecular nature of α-globin genes to treat the most prevalent hemoglobin disorders, such as sickle cell disease, α-thal, and β-thal prevalent in the Kingdom of Saudi Arabia. Thirty-two different α-globin genotypes have been observed in the Saudi population. This review outlines the classification of the α-globin genes on the basis of their molecular nature and complex combinations of α-globin genes, and their variants predominant in Saudis. PMID:26593158

  11. Do products of the myc proto-oncogene play a role in transcriptional regulation of the prothymosin alpha gene?

    PubMed Central

    Mol, P C; Wang, R H; Batey, D W; Lee, L A; Dang, C V; Berger, S L


    The Myc protein has been reported to activate transcription of the rat prothymosin alpha gene by binding to an enhancer element or E box (CACGTG) located in the first intron (S. Gaubatz et al., Mol. Cell. Biol. 14:3853-3862, 1994). The human prothymosin alpha gene contains two such motifs: in the promoter region at kb -1.2 and in intron 1, approximately 2 kb downstream of the transcriptional start site in a region which otherwise bears little homology to the rat gene. Using chloramphenicol acetyltransferase (CAT) reporter constructs driven either by the 5-kb human prothymosin alpha promoter or by a series of truncated promoters, we showed that removal of the E-box sequence had no effect on transient expression of CAT activity in mouse L cells. When intron 1 of the prothymosin alpha gene was inserted into the most extensive promoter construct downstream of the CAT coding region, a diminution in transcription, which remained virtually unchanged upon disruption of the E boxes, was observed. CAT constructs driven by the native prothymosin alpha promoter or the native promoter and intron were indifferent to Myc; equivalent CAT activity was observed in the presence of ectopic normal or mutant Myc genes. Similarly, expression of a transiently transfected wild-type prothymosin alpha gene as the reporter was not affected by a repertoire of myc-derived genes, including myc itself and dominant or recessive negative myc mutants. In COS-1 cells, equivalent amounts of the protein were produced from transfected prothymosin alpha genes regardless of whether genomic E boxes were disrupted, intron 1 was removed, or a repertoire of myc-derived genes was included in the transfection cocktail. More importantly, cotransfection of a dominant negative Max gene failed to reduce transcription of the endogenous prothymosin alpha gene in COS cells or the wild-type transfected gene in COS or L cells. Taken together, the data do not support the idea that Myc activates transcription of the

  12. Adaptive Horizontal Gene Transfers between Multiple Cheese-Associated Fungi.


    Ropars, Jeanne; Rodríguez de la Vega, Ricardo C; López-Villavicencio, Manuela; Gouzy, Jérôme; Sallet, Erika; Dumas, Émilie; Lacoste, Sandrine; Debuchy, Robert; Dupont, Joëlle; Branca, Antoine; Giraud, Tatiana


    Domestication is an excellent model for studies of adaptation because it involves recent and strong selection on a few, identified traits [1-5]. Few studies have focused on the domestication of fungi, with notable exceptions [6-11], despite their importance to bioindustry [12] and to a general understanding of adaptation in eukaryotes [5]. Penicillium fungi are ubiquitous molds among which two distantly related species have been independently selected for cheese making-P. roqueforti for blue cheeses like Roquefort and P. camemberti for soft cheeses like Camembert. The selected traits include morphology, aromatic profile, lipolytic and proteolytic activities, and ability to grow at low temperatures, in a matrix containing bacterial and fungal competitors [13-15]. By comparing the genomes of ten Penicillium species, we show that adaptation to cheese was associated with multiple recent horizontal transfers of large genomic regions carrying crucial metabolic genes. We identified seven horizontally transferred regions (HTRs) spanning more than 10 kb each, flanked by specific transposable elements, and displaying nearly 100% identity between distant Penicillium species. Two HTRs carried genes with functions involved in the utilization of cheese nutrients or competition and were found nearly identical in multiple strains and species of cheese-associated Penicillium fungi, indicating recent selective sweeps; they were experimentally associated with faster growth and greater competitiveness on cheese and contained genes highly expressed in the early stage of cheese maturation. These findings have industrial and food safety implications and improve our understanding of the processes of adaptation to rapid environmental changes.

  13. Increased tumor necrosis factor-alpha (TNF-alpha) gene expression in parainfluenza type 1 (Sendai) virus-induced bronchiolar fibrosis.

    PubMed Central

    Uhl, E. W.; Moldawer, L. L.; Busse, W. W.; Jack, T. J.; Castleman, W. L.


    Increased airway resistance and airway hyperresponsiveness induced in rats by infection with parainfluenza type I (Sendai) virus is associated with bronchiolar fibrosis. To determine whether increased tumor necrosis factor (TNF)-alpha gene expression is an important regulatory event in virus-induced bronchiolar fibrosis, pulmonary TNF-alpha mRNA and protein expression was assessed in rat strains that are susceptible (Brown Norway; BN) and resistant (Fischer 344; F344) to virus-induced bronchiolar fibrosis. Virus-inoculated BN rats had increased TNF-alpha pulmonary mRNA levels (P < 0.05) and increased numbers of bronchiolar macrophages and fibroblasts expressing TNF-alpha protein compared with virus-inoculated F344 rats (P < 0.05). Virus inoculation also induced elevated TNF-alpha mRNA and protein levels (P < 0.05) in cultured rat alveolar macrophages (NR8383 cells). A 55-kd soluble TNF receptor-immunoglobulin G fusion protein (sTNFR-IgG) was used to inhibit TNF-alpha bioactivity in virus-inoculated BN rats. Treated rats had fewer proliferating bronchiolar fibroblasts, as detected by bromodeoxyuridine incorporation, compared with virus-inoculated control rats (P < 0.05). There was also increased mortality in p55sTNFR-IgG-treated virus-inoculated rats associated with increased viral replication and decreased numbers of macrophages and lymphocytes in bronchoalveolar lavage fluid (P < 0.05). The results of this study indicate that 1) Sendai virus can directly up-regulate TNF-alpha mRNA and protein expression in macrophages, 2) TNF-alpha is an important mediator of virus-induced bronchiolar fibrosis, and 3) TNF-alpha has a critical role in the termination of Sendai viral replication in the lung. Images Figure 2 PMID:9466578

  14. Adenovirus dodecahedron, a new vector for human gene transfer.


    Fender, P; Ruigrok, R W; Gout, E; Buffet, S; Chroboczek, J


    Recombinant adenovirus is one of most efficient delivery vehicles for gene therapy. However, the initial enthusiasm for the use of recombinant adenovirus for gene therapy has been tempered by strong immune responses that develop to the virus and virus-infected cells. Even though recombinant adenoviruses are replication-defective, they introduce into the recipient cell, together with the gene of interest, viral genetes that might lead to fortuitous recombination if the recipient is infected by wild-type adenovirus. We propose the use of a dodecahedron made of adenovirus pentons or penton bases as an alternative vector for human gene therapy. The penton is a complex of two oligomeric proteins, a penton base and fiber, involved in the cell attachment, internalization, and liberation of virus into the cytoplasm. The dodecahedron retains many of the advantages of adenovirus for gene transfer such as efficiency of entry, efficient release of DNA from endosomes, and wide range of cell and tissue targets. Because it consists of only one or two adenovirus proteins instead of the 11 contained in an adenovirus virion and it does not contain the viral genome, it is potentially a safer alternative to recombinant adenovirus.

  15. AAV-Mediated Gene Transfer to Dorsal Root Ganglion.


    Yu, Hongwei; Fischer, Gregory; Hogan, Quinn H


    Transferring genetic molecules into the peripheral sensory nervous system to manipulate nociceptive pathophysiology is a powerful approach for experimental modulation of sensory signaling and potentially for translation into therapy for chronic pain. This can be efficiently achieved by the use of recombinant adeno-associated virus (rAAV) in conjunction with nociceptor-specific regulatory transgene cassettes. Among different routes of delivery, direct injection into the dorsal root ganglia (DRGs) offers the most efficient AAV-mediated gene transfer selectively into the peripheral sensory nervous system. Here, we briefly discuss the advantages and applications of intraganglionic microinjection, and then provide a detailed approach for DRG injection, including a list of the necessary materials and description of a method for performing DRG microinjection experiments. We also discuss our experience with several adeno-associated virus (AAV) options for in vivo transgene expression in DRG neurons.

  16. High tumor necrosis factor alpha (TNF-alpha) production in Trypanosoma cruzi-infected pregnant mice and increased TNF-alpha gene transcription in their offspring.

    PubMed Central

    Rivera, M T; Marques de Araujo, S; Lucas, R; Deman, J; Truyens, C; Defresne, M P; de Baetselier, P; Carlier, Y


    Since tumor necrosis factor alpha (TNF-alpha) is known to be involved in the feto-maternal relationship, this cytokine was studied in Trypanosoma cruzi-infected pregnant BALB/c mice and their fetuses and offspring. Pregnant chronically infected mice displayed significantly higher levels of circulating TNF-alpha than animals either only infected or only pregnant. TNF-alpha was undetectable in sera of uninfected and nonpregnant mice as well as in breast milk obtained from infected and uninfected animals. Fetuses from infected mice exhibited significantly more cells containing TNF-alpha mRNA in their thymus than fetuses from uninfected mothers. When infected 2 months after birth, offspring born to infected and uninfected mothers displayed similar amounts of circulating TNF-alpha during chronic infection, whereas this cytokine was only weakly detectable during the acute phase of the disease. An intravenous injection of lipopolysaccharide during acute infection strongly increased the production of TNF-alpha in offspring born to infected mothers to levels higher than those in progeny from uninfected mice. These results suggest that TNF-alpha is an important cytokine in the feto-maternal relationship during T. cruzi infection and that fetuses and offspring of infected mothers are primed to produce elevated levels of TNF-alpha. PMID:7822027

  17. Matrix metalloproteinase-12 gene regulation by a PPAR alpha agonist in human monocyte-derived macrophages

    SciTech Connect

    Souissi, Imen Jguirim; Billiet, Ludivine; Cuaz-Perolin, Clarisse; Rouis, Mustapha


    MMP-12, a macrophage-specific matrix metalloproteinase with large substrate specificity, has been reported to be highly expressed in mice, rabbits and human atherosclerotic lesions. Increased MMP-12 from inflammatory macrophages is associated with several degenerative diseases such as atherosclerosis. In this manuscript, we show that IL-1{beta}, a proinflammatory cytokine found in atherosclerotic plaques, increases both mRNA and protein levels of MMP-12 in human monocyte-derived macrophages (HMDM). Since peroxisome proliferator-activated receptors (PPARs), such as PPAR{alpha} and PPAR{gamma}, are expressed in macrophages and because PPAR activation exerts an anti-inflammatory effect on vascular cells, we have investigated the effect of PPAR{alpha} and {gamma} isoforms on MMP-12 regulation in HMDM. Our results show that MMP-12 expression (mRNA and protein) is down regulated in IL-1{beta}-treated macrophages only in the presence of a specific PPAR{alpha} agonist, GW647, in a dose-dependent manner. In contrast, this inhibitory effect was abolished in IL-1{beta}-stimulated peritoneal macrophages isolated from PPAR{alpha}{sup -/-} mice and treated with the PPAR{alpha} agonist, GW647. Moreover, reporter gene transfection experiments using different MMP-12 promoter constructs showed a reduction of the promoter activities by {approx} 50% in IL-1{beta}-stimulated PPAR{alpha}-pre-treated cells. However, MMP-12 promoter analysis did not reveal the presence of a PPRE response element. The IL-1{beta} effect is known to be mediated through the AP-1 binding site. Mutation of the AP-1 site, located at - 81 in the MMP-12 promoter region relative to the transcription start site, followed by transfection analysis, gel shift and ChIP experiments revealed that the inhibitory effect was the consequence of the protein-protein interaction between GW 647-activated PPAR{alpha} and c-Fos or c-Jun transcription factors, leading to inhibition of their binding to the AP-1 motif. These studies

  18. Massive Mitochondrial Gene Transfer in a Parasitic Flowering Plant Clade

    PubMed Central

    Bradley, Robert K.; Sugumaran, M.; Marx, Christopher J.; Rest, Joshua S.; Davis, Charles C.


    Recent studies have suggested that plant genomes have undergone potentially rampant horizontal gene transfer (HGT), especially in the mitochondrial genome. Parasitic plants have provided the strongest evidence of HGT, which appears to be facilitated by the intimate physical association between the parasites and their hosts. A recent phylogenomic study demonstrated that in the holoparasite Rafflesia cantleyi (Rafflesiaceae), whose close relatives possess the world's largest flowers, about 2.1% of nuclear gene transcripts were likely acquired from its obligate host. Here, we used next-generation sequencing to obtain the 38 protein-coding and ribosomal RNA genes common to the mitochondrial genomes of angiosperms from R. cantleyi and five additional species, including two of its closest relatives and two host species. Strikingly, our phylogenetic analyses conservatively indicate that 24%–41% of these gene sequences show evidence of HGT in Rafflesiaceae, depending on the species. Most of these transgenic sequences possess intact reading frames and are actively transcribed, indicating that they are potentially functional. Additionally, some of these transgenes maintain synteny with their donor and recipient lineages, suggesting that native genes have likely been displaced via homologous recombination. Our study is the first to comprehensively assess the magnitude of HGT in plants involving a genome (i.e., mitochondria) and a species interaction (i.e., parasitism) where it has been hypothesized to be potentially rampant. Our results establish for the first time that, although the magnitude of HGT involving nuclear genes is appreciable in these parasitic plants, HGT involving mitochondrial genes is substantially higher. This may represent a more general pattern for other parasitic plant clades and perhaps more broadly for angiosperms. PMID:23459037

  19. Massive mitochondrial gene transfer in a parasitic flowering plant clade.


    Xi, Zhenxiang; Wang, Yuguo; Bradley, Robert K; Sugumaran, M; Marx, Christopher J; Rest, Joshua S; Davis, Charles C


    Recent studies have suggested that plant genomes have undergone potentially rampant horizontal gene transfer (HGT), especially in the mitochondrial genome. Parasitic plants have provided the strongest evidence of HGT, which appears to be facilitated by the intimate physical association between the parasites and their hosts. A recent phylogenomic study demonstrated that in the holoparasite Rafflesia cantleyi (Rafflesiaceae), whose close relatives possess the world's largest flowers, about 2.1% of nuclear gene transcripts were likely acquired from its obligate host. Here, we used next-generation sequencing to obtain the 38 protein-coding and ribosomal RNA genes common to the mitochondrial genomes of angiosperms from R. cantleyi and five additional species, including two of its closest relatives and two host species. Strikingly, our phylogenetic analyses conservatively indicate that 24%-41% of these gene sequences show evidence of HGT in Rafflesiaceae, depending on the species. Most of these transgenic sequences possess intact reading frames and are actively transcribed, indicating that they are potentially functional. Additionally, some of these transgenes maintain synteny with their donor and recipient lineages, suggesting that native genes have likely been displaced via homologous recombination. Our study is the first to comprehensively assess the magnitude of HGT in plants involving a genome (i.e., mitochondria) and a species interaction (i.e., parasitism) where it has been hypothesized to be potentially rampant. Our results establish for the first time that, although the magnitude of HGT involving nuclear genes is appreciable in these parasitic plants, HGT involving mitochondrial genes is substantially higher. This may represent a more general pattern for other parasitic plant clades and perhaps more broadly for angiosperms.

  20. Identification of gene-based responses in human blood cells exposed to alpha particle radiation

    PubMed Central


    Background The threat of a terrorist-precipitated nuclear event places humans at danger for radiological exposures. Isotopes which emit alpha (α)-particle radiation pose the highest risk. Currently, gene expression signatures are being developed for radiation biodosimetry and triage with respect to ionizing photon radiation. This study was designed to determine if similar gene expression profiles are obtained after exposures involving α-particles. Methods Peripheral blood mononuclear cells (PBMCs) were used to identify sensitive and robust gene-based biomarkers of α-particle radiation exposure. Cells were isolated from healthy individuals and were irradiated at doses ranging from 0-1.5 Gy. Microarray technology was employed to identify transcripts that were differentially expressed relative to unirradiated cells 24 hours post-exposure. Statistical analysis identified modulated genes at each of the individual doses. Results Twenty-nine genes were common to all doses with expression levels ranging from 2-10 fold relative to control treatment group. This subset of genes was further assessed in independent complete white blood cell (WBC) populations exposed to either α-particles or X-rays using quantitative real-time PCR. This 29 gene panel was responsive in the α-particle exposed WBCs and was shown to exhibit differential fold-changes compared to X-irradiated cells, though no α-particle specific transcripts were identified. Conclusion Current gene panels for photon radiation may also be applicable for use in α-particle radiation biodosimetry. PMID:25017500

  1. In vivo Cytokine Gene Transfer by Gene Gun Reduces Tumor Growth in Mice

    NASA Astrophysics Data System (ADS)

    Sun, Wenn H.; Burkholder, Joseph K.; Sun, Jian; Culp, Jerilyn; Turner, Joel; Lu, Xing G.; Pugh, Thomas D.; Ershler, William B.; Yang, Ning-Sun


    Implantation of tumor cells modified by in vitro cytokine gene transfer has been shown by many investigators to result in potent in vivo antitumor activities in mice. Here we describe an approach to tumor immunotherapy utilizing direct transfection of cytokine genes into tumorbearing animals by particle-mediated gene transfer. In vivo transfection of the human interleukin 6 gene into the tumor site reduced methylcholanthrene-induced fibrosarcoma growth, and a combination of murine tumor necrosis factor α and interferon γ genes inhibited growth of a renal carcinoma tumor model (Renca). In addition, treatment with murine interleukin 2 and interferon γ genes prolonged the survival of Renca tumor-bearing mice and resulted in tumor eradication in 25% of the test animals. Transgene expression was demonstrated in treated tissues by ELISA and immunohistochemical analysis. Significant serum levels of interleukin 6 and interferon γ were detected, demonstrating effective secretion of transgenic proteins from treated skin into the bloodstream. This in vivo cytokine gene therapy approach provides a system for evaluating the antitumor properties of various cytokines in different tumor models and has potential utility for human cancer gene therapy.

  2. Horizontal gene transfer and recombination in Streptococcus dysgalactiae subsp. equisimilis

    PubMed Central

    McNeilly, Celia L.; McMillan, David J.


    Streptococcus dysgalactiae subsp. equisimilis (SDSE) is a human pathogen that colonizes the skin or throat, and causes a range of diseases from relatively benign pharyngitis to potentially fatal invasive diseases. While not as virulent as the close relative Streptococcus pyogenes the two share a number of virulence factors and are known to coexist in a human host. Both pre- and post-genomic studies have revealed that horizontal gene transfer (HGT) and recombination occurs between these two organisms and plays a major role in shaping the population structure of SDSE. This review summarizes our current knowledge of HGT and recombination in the evolution of SDSE. PMID:25566202

  3. Transfer of nonselectable genes into mouse teratocarcinoma cells and transcription of the transferred human. beta. -globin gene

    SciTech Connect

    Wagner, E.F.; Mintz, B.


    Teratocarcinoma (TCC) stem cells can function as vehicles for the introduction of specific recombinant genes into mice. Because most genes do not code for a selectable marker, the authors investigated the transformation efficiency of vectors with a linked selectable gene. In one series, TCC cells first selected for thymidine kinase deficiency were treated with DNA from the plasmid vector PtkH..beta..1 containing the human genomic ..beta..-globin gene and the thymidine kinase gene of herpes simplex virus. A high transformation frequency was obtained after selection in hypoxanthine-aminopterin-thymidine medium. Hybridization tests revealed that the majority of transformants had intact copies of the human gene among three to six total copies per cell. These were associated with cellular DNA sequences as judged from the presence of additional new restriction fragments and from stability of the sequences in tumors produced by injecting the cells subcutaneously. Total polyadenylate-containing RNA from cell cultures of two out of four transformants examined showed hybridization to the human gene probe: one RNA species resembled mature human ..beta..-globin mRNA transcripts; the others were of larger size. In differentiating tumors, various tissues, including hematopoietic cells of TCC provenance could be found. In a second model set of experiments, wild-type TCC cells were used to test a dominant-selection scheme with pSV-gpt vectors. Numerous transformants were isolated, and their transfected DNA was apparently stably integrated. Thus, any gene of choice can be transferred into TCC stem cells even without mutagenesis of the cells, and selected cell clones can be characterized. Cells of interest may then be introduced into early embryos to produce new mouse strains with predetermined genetic changes.

  4. Transfer and expression of three cloned human non-HLA-A,B,C class I major histocompatibility complex genes in mutant lymphoblastoid cells.

    PubMed Central

    Shimizu, Y; Geraghty, D E; Koller, B H; Orr, H T; DeMars, R


    The HLA-A, -B, and -C class I human histocompatibility antigens and the genes that encode them have been isolated and characterized. Apparently complete class I non-HLA-A, B, C genes have been identified on HindIII-generated 5.4-kilobase (kb), 6.0-kb, and 6.2-kb DNA fragments derived from lymphoblastoid cell line (LCL) 721. We studied the expressibility of these genes by subcloning them into the nonintegrating pHeBo vector and transferring the chimeric plasmids into mutant LCL 721.221. This mutant was derived from LCL 721 by means of immunoselections following gamma-ray mutagenesis that eliminated expressions of the HLA-A, -B, and -C alpha chains. The HLA-A, B, C-null phenotype of mutant 721.221 made it possible to monitor the expression of class I genes transferred into it by assaying cell surface binding of monoclonal antibodies BBM.1 and W6/32, which recognize beta 2-microglobulin and HLA class I alpha-chain epitopes, respectively. Increased binding of BBM.1 and W6/32 was clearly observed in transferents containing the class I gene of the 6.0-kb DNA fragment but not in transferents containing the class I genes of the 5.4- and 6.2-kb DNA fragments. However, one-dimensional gel electrophoresis of BBM.1 and W6/32 immunoprecipitates made with [35S]methionine-labeled cell lysates showed that transfer of each non-HLA-A, B, C class I gene into 721.221 resulted in the appearance of an alpha chain that coprecipitated with beta 2-microglobulin. The three previously unreported alpha chains differed from each other in size and were smaller than HLA-A, -B, and -C alpha chains. These observations clearly show that these three cloned, nonallelic, non-HLA-A, B, C class I genes encode alpha chains that can be expressed in human cells. Images PMID:3257565

  5. DNA restriction-site polymorphisms associated with the alpha 1-antitrypsin gene.

    PubMed Central

    Cox, D W; Billingsley, G D; Mansfield, T


    Restriction-site variation in and around the alpha 1-antitrypsin gene has been studied using two genomic probes. With use of restriction enzymes SstI, MspI, and AvaII, three polymorphic sites have been described with a 4.6-kb probe in the 5' portion of the gene. With use of a 6.5-kb probe, polymorphisms in the coding and 3' regions of the gene have been detected with AvaII, MaeIII, and TaqI. All of these polymorphisms are of sufficiently high frequency to be useful in genetic mapping studies. The polymorphisms with AvaII and MaeIII (6.5-kb probe) are particularly useful for prenatal diagnosis. PI types and M subtypes tend to be associated with specific DNA haplotypes; there are two different types of DNA haplotypes associated with PI M1. The extent of linkage disequilibrium differs throughout the region of the alpha 1-antitrypsin gene. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:2890296

  6. Gene Transfer and Molecular Cloning of the Human NGF Receptor

    NASA Astrophysics Data System (ADS)

    Chao, Moses V.; Bothwell, Mark A.; Ross, Alonzo H.; Koprowski, Hilary; Lanahan, Anthony A.; Buck, C. Randall; Sehgal, Amita


    Nerve growth factor (NGF) and its receptor are important in the development of cells derived from the neural crest. Mouse L cell transformants have been generated that stably express the human NGF receptor gene transfer with total human DNA. Affinity cross-linking, metabolic labeling and immunoprecipitation, and equilibrium binding with 125I-labeled NGF revealed that this NGF receptor had the same size and binding characteristics as the receptor from human melanoma cells and rat PC12 cells. The sequences encoding the NGF receptor were molecularly cloned using the human Alu repetitive sequence as a probe. A cosmid clone that contained the human NGF receptor gene allowed efficient transfection and expression of the receptor.

  7. Passive immunization against HIV/AIDS by antibody gene transfer.


    Yang, Lili; Wang, Pin


    Despite tremendous efforts over the course of many years, the quest for an effective HIV vaccine by the classical method of active immunization remains largely elusive. However, two recent studies in mice and macaques have now demonstrated a new strategy designated as Vectored ImmunoProphylaxis (VIP), which involves passive immunization by viral vector-mediated delivery of genes encoding broadly neutralizing antibodies (bnAbs) for in vivo expression. Robust protection against virus infection was observed in preclinical settings when animals were given VIP to express monoclonal neutralizing antibodies. This unorthodox approach raises new promise for combating the ongoing global HIV pandemic. In this article, we survey the status of antibody gene transfer, review the revolutionary progress on isolation of extremely bnAbs, detail VIP experiments against HIV and its related virus conduced in humanized mice and macaque monkeys, and discuss the pros and cons of VIP and its opportunities and challenges towards clinical applications to control HIV/AIDS endemics.

  8. Sequence analysis of the EF-1 alpha gene family of Mucor racemosus.

    PubMed Central

    Sundstrom, P; Lira, L M; Choi, D; Linz, J E; Sypherd, P S


    Our previous studies have shown that Mucor racemosus possesses three genes (TEF-1, -2 and -3) for EF-1 alpha, and that all three genes are transcribed. However, the level of transcription varies markedly between the three genes, with TEF-1 mRNA levels being approximately two fold higher than TEF-3 and 6 fold higher than TEF-2. We have now completed the DNA sequence of both strands of all three genes and have found that these genes are highly homologous. TEF-2 and TEF-3 are more similar to each other than they are to TEF-1. The TEF-2 and the TEF-3 coding regions differ from TEF-1 at 30 and 37 positions respectively out of 1374 nucleotides. Twenty-six of these nucleotide substitutions were common to both TEF-2 and TEF-3, and the majority of the substitutions were clustered in the 5' region of the coding sequences. While the majority of these changes were silent, TEF-2 and TEF-3 differed from TEF-1 by having a lysine instead of a glutamate at amino acid position 41. In addition, TEF-2 and -3, but not TEF-1, each have an intron located near the 5' end of the coding region, although its size and sequence is not conserved between the two genes. All three genes have a conserved intron near the 3' end of the coding region. The sequence data have been analyzed with respect to the structure and function of EF-1 alpha in protein biosynthesis. PMID:3697088

  9. Isotypic and allotypic variation of human class II histocompatibility antigen alpha-chain genes.


    Auffray, C; Lillie, J W; Arnot, D; Grossberger, D; Kappes, D; Strominger, J L

    DNA sequences of four human class II histocompatibility antigen alpha chain DNA sequences (derived from cDNA and genomic clones representing DC1 alpha, DC4 alpha, DX alpha and SB alpha) are presented and compared to DR alpha and to mouse I-A alpha and I-E alpha sequences. These data suggest possible mechanisms for the generation of polymorphism and the evolution of the DR, DC and SB families.

  10. The interferon-alpha gene family of Marmota himalayana, a Chinese marmot species with susceptibility to woodchuck hepatitis virus infection.


    Lu, Yinping; Wang, Baoju; Huang, Hongping; Tian, Yongjun; Bao, Junjie; Dong, Jihua; Roggendorf, Michael; Lu, Mengji; Yang, Dongliang


    The interferon-alpha (IFN-alpha) gene family is an important part of the immune system. Recombinant interferon-alpha is widely used to treat viral hepatitis and malignant diseases. Marmota himalayana has been found to be susceptible to woodchuck hepatitis virus, a virus genetically related to hepatitis B virus (HBV), and is suitable as an animal model for studies on HBV infection. Here, the IFN-alpha gene family of M. himalayana (cwIFN-alpha) was characterized. Sequence data indicate that the cwIFN-alpha family consists of at least 8 functional sequences and 6 pseudogenes with high homology within the family and to IFN-alpha of Marmota monax, a related species and well-established animal model. The recombinant cwIFN-alpha subtypes were expressed and tested to be active in viral protection assay and to induce expression of MxA in a species-specific manner. This work provides essential information for future work on testing new therapeutic approaches of HBV infection based on IFN-alpha in M. himalayana.

  11. Binding of tissue-specific forms of alpha A-CRYBP1 to their regulatory sequence in the mouse alpha A-crystallin-encoding gene: double-label immunoblotting of UV-crosslinked complexes.


    Kantorow, M; Becker, K; Sax, C M; Ozato, K; Piatigorsky, J


    The alpha A-CRYBP1 regulatory sequence (alpha A-CRYBP1RS), at nucleotides -66 to -57 of the mouse alpha A-crystallin-encoding gene (alpha A-CRY) promoter, is an important control element involved in the regulation of mouse alpha A-CRY expression. The gene encoding a protein (alpha A-CRYBP1) that specifically binds to the alpha A-CRYBP1RS sequence has been cloned from a cultured mouse lens cell line. In the present study, we have used an antibody (specific to the alpha A-CRYBP1 protein and made against a synthetic peptide) to directly identify UV-crosslinked protein-DNA complexes via a double-label immunoblotting technique. Multiple alpha A-CRYB1 antigenically related proteins interacted with alpha A-CRYBP1RS in nuclear extracts from both a cloned mouse lens cell line (alpha TN4-1) that expresses alpha A-CRY and a mouse fibroblast line (L929) that does not express the gene. Two sizes (50 kDa and 90 kDa) of proteins reacting with the alpha A-CRYBP1-specific Ab were detected in both cell lines and, in addition, a > 200-kDa protein reacting with the Ab was unique to the fibroblast line. Thus, alpha A-CRYBP1 antigenically related proteins interact with alpha A-CRYBP1RS regardless of alpha A-CRY expression. Moreover, differential processing of the alpha A-CRYBP1 protein and/or alternative splicing of the alpha A-CRY transcript may affect expression of alpha A-CRY.

  12. Laterally Transferred Gene Recruited as a Venom in Parasitoid Wasps.


    Martinson, Ellen O; Martinson, Vincent G; Edwards, Rachel; Mrinalini; Werren, John H


    Parasitoid wasps use venom to manipulate the immunity and metabolism of their host insects in a variety of ways to provide resources for their offspring. Yet, how genes are recruited and evolve to perform venom functions remain open questions. A recently recognized source of eukaryotic genome innovation is lateral gene transfer (LGT). Glycoside hydrolase family 19 (GH19) chitinases are widespread in bacteria, microsporidia, and plants where they are used in nutrient acquisition or defense, but have previously not been known in metazoans. In this study, a GH19 chitinase LGT is described from the unicellular microsporidia/Rozella clade into parasitoid wasps of the superfamily Chalcidoidea, where it has become recruited as a venom protein. The GH19 chitinase is present in 15 species of chalcidoid wasps representing four families, and phylogenetic analysis indicates that it was laterally transferred near or before the origin of Chalcidoidea (∼95 Ma). The GH19 chitinase gene is highly expressed in the venom gland of at least seven species, indicating a role in the complex host manipulations performed by parasitoid wasp venom. RNAi knockdown in the model parasitoid Nasonia vitripennis reveals that-following envenomation-the GH19 chitinase induces fly hosts to upregulate genes involved in an immune response to fungi. A second, independent LGT of GH19 chitinase from microsporidia into mosquitoes was also found, also supported by phylogenetic reconstructions. Besides these two LGT events, GH19 chitinase is not found in any other sequenced animal genome, or in any fungi outside the microsporidia/Rozella clade.

  13. Characterization of the gene and protein of the common alpha 1-antitrypsin normal M2 allele.

    PubMed Central

    Nukiwa, T; Brantly, M L; Ogushi, F; Fells, G A; Crystal, R G


    The normal M2 variant of alpha 1-antitrypsin (alpha 1AT) was cloned from a genomic DNA library of an individual homozygous for this allele. Sequencing of all coding exons of the M2 gene revealed it was identical to the common M1(Val213) gene except for two bases (M1(Val213) CGT Arg101, M2 CAT His101; M1(Val213) GAA Glu376 M2 GAC Asp376). Analysis of the sequence of the M1(Val213) and M2 genes around residue 101 revealed the M1 Arg101----M2 His101 caused a loss of the cutting site for the restriction endonuclease RsaI. Using this enzyme, as well as 19-mer oligonucleotides probes centered at residues 101 and 376, evaluation of genomic DNA from 22 M1 alleles and 14 M2 alleles revealed that residue 101 was Arg in all M1 alleles and His in all M2 alleles, while residue 376 was Glu in all M1 alleles and Asp in all M2 alleles. Despite the differences in sequence at two amino acids, the M1(Val213) and M2 proteins function similarly as assessed by quantification of the association rate constant of each for their natural substrate neutrophil elastase. In the context that there are two mutations separating the M1(Val213) and M2 alleles, it is likely that there is another alpha 1AT variant that was an intermediate in the evolution of these genes. Images Figure 2 Figure 4 Figure 1 Figure 3 PMID:2901226

  14. The Hd0053 gene of Haemophilus ducreyi encodes an alpha2,3-sialyltransferase.


    Li, Yanhong; Sun, Mingchi; Huang, Shengshu; Yu, Hai; Chokhawala, Harshal A; Thon, Vireak; Chen, Xi


    Haemophilus ducreyi is a Gram-negative bacterium that causes chancroid, a sexually transmitted genital ulcer disease. Different lipooligosaccharide (LOS) structures have been identified from H. ducreyi strain 35000, including those sialylated glycoforms. Surface LOS of H. ducreyi is considered an important virulence factor that is involved in ulcer formation, cell adhesion, and invasion of host tissue. Gene Hd0686 of H. ducreyi, designated lst (for lipooligosaccharide sialyltransferase), was identified to encode an alpha2,3-sialyltransferase that is important for the formation of sialylated LOS. Here, we show that Hd0053 of H. ducreyi genomic strain 35000HP, the third member of the glycosyltransferase family 80 (GT80), also encodes an alpha2,3-sialyltransferase that may be important for LOS sialylation.

  15. Complexation of dimethylmagnesium with alpha-diimines; structural and EPR characterisation of single electron and alkyl transfer products.


    Bailey, Philip J; Dick, Caroline M; Fabre, Sylvie; Parsons, Simon; Yellowlees, Lesley J


    Treatment of dimethylmagnesium with the alpha-diimine ligands Ar'N=C(R)C(R)=NAr' [R = naphth-1,8-diyl (1), H (2), CH3 (3); Ar' = 2,6-diisopropylphenyl] in diethyl ether provides the neutral methyl-bridged dimeric complexes [(alpha-diimine-.)Mg+(mu-CH3)]2 via single electron transfer (SET) to the coordinated diimine and elimination of a methyl radical. These biradical species have been characterised by EPR spectroscopy and, for the ligand , X-ray crystallography. In the presence of THF the reaction of ligand proceeds to the diamagnetic [(ene-1,2-diamide)Mg(THF)3] complex in which the diimine ligand has been doubly reduced to an ene-diamide by two successive SET processes. Comparison of the structural data for the free ligand with that obtained for the alpha-diimine radical anion and ene-diamide complexes shows the expected increases in C-N, and decreases in C-C, bond lengths within the N-C-C-N unit consistent with the progressive reduction of the ligand. In the case of ligand , reaction at low temperature provides the complex [Mg(mu2-Me){Ar'NC(Me)2C(Me)NAr'}]2 in which methyl transfer to a ligand imine carbon atom has occurred. This species has also been structurally characterised. This contrasts with the formation of the radical species at room temperature, and indicates the involvement of an intermediate in which the radical products of the SET process are held in close proximity by the solvent cage. Two competing processes of methyl radical escape and methyl transfer to the ligand account for the formation of the observed products at different temperatures.

  16. The Drosophila melanogaster importin alpha3 locus encodes an essential gene required for the development of both larval and adult tissues.

    PubMed Central

    Mason, D Adam; Máthé, Endre; Fleming, Robert J; Goldfarb, David S


    The nuclear transport of classical nuclear localization signal (cNLS)-containing proteins is mediated by the cNLS receptor importin alpha. The conventional importin alpha gene family in metazoan animals is composed of three clades that are conserved between flies and mammals and are referred to here as alpha1, alpha2, and alpha3. In contrast, plants and fungi contain only alpha1 genes. In this study we report that Drosophila importin alpha3 is required for the development of both larval and adult tissues. Importin alpha3 mutant flies die around the transition from first to second instar larvae, and homozygous importin alpha3 mutant eyes are defective. The transition to second instar larvae was rescued with importin alpha1, alpha2, or alpha3 transgenes, indicating that Importin alpha3 is normally required at this stage for an activity shared by all three importin alpha's. In contrast, an alpha3-specific biochemical activity(s) of Importin alpha3 is probably required for development to adults and photoreceptor cell development, since only an importin alpha3 transgene rescued these processes. These results are consistent with the view that the importin alpha's have both overlapping and distinct functions and that their role in animal development involves the spatial and temporal control of their expression. PMID:14704178

  17. Gene encoding the human beta-hexosaminidase beta chain: extensive homology of intron placement in the alpha- and beta-chain genes.

    PubMed Central

    Proia, R L


    Lysosomal beta-hexosaminidase (EC is composed of two structurally similar chains, alpha and beta, that are the products of different genes. Mutations in either gene causing beta-hexosaminidase deficiency result in the lysosomal storage disease GM2-gangliosidosis. To enable the investigation of the molecular lesions in this disorder and to study the evolutionary relationship between the alpha and beta chains, the beta-chain gene was isolated, and its organization was characterized. The beta-chain coding region is divided into 14 exons distributed over approximately 40 kilobases of DNA. Comparison with the alpha-chain gene revealed that 12 of the 13 introns interrupt the coding regions at homologous positions. This extensive sharing of intron placement demonstrates that the alpha and beta chains evolved by way of the duplication of a common ancestor. PMID:2964638

  18. Mechanism of rifampicin and pregnane X receptor inhibition of human cholesterol 7 alpha-hydroxylase gene transcription.


    Li, Tiangang; Chiang, John Y L


    Bile acids, steroids, and drugs activate steroid and xenobiotic receptor pregnane X receptor (PXR; NR1I2), which induces human cytochrome P4503A4 (CYP3A4) in drug metabolism and cholesterol 7 alpha-hydroxylase (CYP7A1) in bile acid synthesis in the liver. Rifampicin, a human PXR agonist, inhibits bile acid synthesis and has been used to treat cholestatic diseases. The objective of this study is to elucidate the mechanism by which PXR inhibits CYP7A1 gene transcription. The mRNA expression levels of CYP7A1 and several nuclear receptors known to regulate the CYP7A1 gene were assayed in human primary hepatocytes by quantitative real-time PCR (Q-PCR). Rifampicin reduced CYP7A1 and small heterodimer partner (SHP; NR02B) mRNA expression suggesting that SHP was not involved in PXR inhibition of CYP7A1. Rifampicin inhibited CYP7A1 reporter activity and a PXR binding site was localized to the bile acid response element-I. Mammalian two-hybrid assays revealed that PXR interacted with hepatic nuclear factor 4 alpha (HNF4 alpha, NR2A1) and rifampicin was required. Coimmunoprecipitation assay confirmed PXR interaction with HNF4 alpha. PXR also interacted with peroxisome proliferator-activated receptor gamma coactivator (PGC-1 alpha), which interacted with HNF4 alpha and induced CYP7A1 gene transcription. Rifampicin enhanced PXR interaction with HNF4 alpha and reduced PGC-1 alpha interaction with HNF4 alpha. Chromatin immunoprecipitation assay showed that PXR, HNF4 alpha, and PGC-1 alpha bound to CYP7A1 chromatin, and rifampicin dissociated PGC-1 alpha from chromatin. These results suggest that activation of PXR by rifampicin promotes PXR interaction with HNF4 alpha and blocks PGC-1 alpha activation with HNF4 alpha and results in inhibition of CYP7A1 gene transcription. Rifampicin inhibition of bile acid synthesis may be a protective mechanism against drug and bile acid-induced cholestasis.

  19. Predicting gene expression levels from codon biases in alpha-proteobacterial genomes.


    Karlin, Samuel; Barnett, Melanie J; Campbell, Allan M; Fisher, Robert F; Mrazek, Jan


    Predicted highly expressed (PHX) genes in five currently available high G+C complete alpha-proteobacterial genomes are analyzed. These include: the nitrogen-fixing plant symbionts Sinorhizobium meliloti (SINME) and Mesorhizobium loti (MESLO), the nonpathogenic aquatic bacterium Caulobacter crescentus (CAUCR), the plant pathogen Agrobacterium tumefaciens (AGRTU), and the mammalian pathogen Brucella melitensis (BRUME). Three of these genomes, SINME, AGRTU, and BRUME, contain multiple chromosomes or megaplasmids (>1 Mb length). PHX genes in these genomes are concentrated mainly in the major (largest) chromosome with few PHX genes found in the secondary chromosomes and megaplasmids. Tricarboxylic acid cycle and aerobic respiration genes are strongly PHX in all five genomes, whereas anaerobic pathways of glycolysis and fermentation are mostly not PHX. Only in MESLO (but not SINME) and BRUME are most glycolysis genes PHX. Many flagellar genes are PHX in MESLO and CAUCR, but mostly are not PHX in SINME and AGRTU. The nonmotile BRUME also carries many flagellar genes but these are generally not PHX and all but one are located in the second chromosome. CAUCR stands out among available prokaryotic genomes with 25 PHX TonB-dependent receptors. These are putatively involved in uptake of iron ions and other nonsoluble compounds.

  20. Genome-wide experimental determination of barriers to horizontal gene transfer

    SciTech Connect

    Rubin, Edward; Sorek, Rotem; Zhu, Yiwen; Creevey, Christopher J.; Francino, M. Pilar; Bork, Peer; Rubin, Edward M.


    Horizontal gene transfer, in which genetic material is transferred from the genome of one organism to another, has been investigated in microbial species mainly through computational sequence analyses. To address the lack of experimental data, we studied the attempted movement of 246,045 genes from 79 prokaryotic genomes into E. coli and identified genes that consistently fail to transfer. We studied the mechanisms underlying transfer inhibition by placing coding regions from different species under the control of inducible promoters. Their toxicity to the host inhibited transfer regardless of the species of origin and our data suggest that increased gene dosage and associated increased expression is a predominant cause for transfer failure. While these experimental studies examined transfer solely into E. coli, a computational analysis of gene transfer rates across available bacterial and archaeal genomes indicates that the barriers observed in our study are general across the tree of life.

  1. Interspecific evolution: microbial symbiosis, endosymbiosis and gene transfer.


    Hoffmeister, Meike; Martin, William


    Microbial symbioses are interesting in their own right and also serve as exemplary models to help biologists to understand two important symbioses in the evolutionary past of eukaryotic cells: the origins of chloroplasts and mitochondria. Most, if not all, microbial symbioses have a chemical basis: compounds produced by one partner are useful for the other. But symbioses can also entail the transfer of genes from one partner to the other, which in some cases cements two cells into a bipartite, co-evolving unit. Here, we discuss some microbial symbioses in which progress is being made in uncovering the nature of symbiotic interactions: anaerobic methane-oxidizing consortia, marine worms that possess endosymbionts instead of a digestive tract, amino acid-producing endosymbionts of aphids, prokaryotic endosymbionts living within a prokaryotic host within mealybugs, endosymbionts of an insect vector of human disease and a photosynthetic sea slug that steals chloroplasts from algae. In the case of chloroplasts and mitochondria, examples of recent and ancient gene transfer to the chromosomes of their host cell illustrate the process of genetic merger in the wake of organelle origins.

  2. Resistance Gene Transfer during Treatments for Experimental Avian Colibacillosis

    PubMed Central

    Dheilly, Alexandra; Le Devendec, Laëtitia; Mourand, Gwenaëlle; Bouder, Axelle; Jouy, Eric


    An experiment was conducted in animal facilities to compare the impacts of four avian colibacillosis treatments—oxytetracycline (OTC), trimethoprim-sulfadimethoxine (SXT), amoxicillin (AMX), or enrofloxacin (ENR)—on the susceptibility of Escherichia coli in broiler intestinal tracts. Birds were first orally inoculated with rifampin-resistant E. coli strains bearing plasmid genes conferring resistance to fluoroquinolones (qnr), cephalosporins (blaCTX-M or blaFOX), trimethoprim-sulfonamides, aminoglycosides, or tetracyclines. Feces samples were collected before, during, and after antimicrobial treatments. The susceptibilities of E. coli strains were studied, and resistance gene transfer was analyzed. An increase in the tetracycline-resistant E. coli population was observed only in OTC-treated birds, whereas multiresistant E. coli was detected in the dominant E. coli populations of SXT-, AMX-, or ENR-treated birds. Most multiresistant E. coli strains were susceptible to rifampin and exhibited various pulsed-field gel electrophoresis profiles, suggesting the transfer of one of the multiresistance plasmids from the inoculated strains to other E. coli strains in the intestinal tract. In conclusion, this study clearly illustrates how, in E. coli, “old” antimicrobials may coselect antimicrobial resistance to recent and critical molecules. PMID:21986830

  3. Synthetic Fatty Acids Prevent Plasmid-Mediated Horizontal Gene Transfer

    PubMed Central

    Getino, María; Sanabria-Ríos, David J.; Fernández-López, Raúl; Campos-Gómez, Javier; Sánchez-López, José M.; Fernández, Antonio; Carballeira, Néstor M.


    ABSTRACT Bacterial conjugation constitutes a major horizontal gene transfer mechanism for the dissemination of antibiotic resistance genes among human pathogens. Antibiotic resistance spread could be halted or diminished by molecules that interfere with the conjugation process. In this work, synthetic 2-alkynoic fatty acids were identified as a novel class of conjugation inhibitors. Their chemical properties were investigated by using the prototype 2-hexadecynoic acid and its derivatives. Essential features of effective inhibitors were the carboxylic group, an optimal long aliphatic chain of 16 carbon atoms, and one unsaturation. Chemical modification of these groups led to inactive or less-active derivatives. Conjugation inhibitors were found to act on the donor cell, affecting a wide number of pathogenic bacterial hosts, including Escherichia, Salmonella, Pseudomonas, and Acinetobacter spp. Conjugation inhibitors were active in inhibiting transfer of IncF, IncW, and IncH plasmids, moderately active against IncI, IncL/M, and IncX plasmids, and inactive against IncP and IncN plasmids. Importantly, the use of 2-hexadecynoic acid avoided the spread of a derepressed IncF plasmid into a recipient population, demonstrating the feasibility of abolishing the dissemination of antimicrobial resistances by blocking bacterial conjugation. PMID:26330514

  4. Intra- and inter-generic transfer of pathogenicity island-encoded virulence genes by cos phages.


    Chen, John; Carpena, Nuria; Quiles-Puchalt, Nuria; Ram, Geeta; Novick, Richard P; Penadés, José R


    Bacteriophage-mediated horizontal gene transfer is one of the primary driving forces of bacterial evolution. The pac-type phages are generally thought to facilitate most of the phage-mediated gene transfer between closely related bacteria, including that of mobile genetic elements-encoded virulence genes. In this study, we report that staphylococcal cos-type phages transferred the Staphylococcus aureus pathogenicity island SaPIbov5 to non-aureus staphylococcal species and also to different genera. Our results describe the first intra- and intergeneric transfer of a pathogenicity island by a cos phage, and highlight a gene transfer mechanism that may have important implications for pathogen evolution.

  5. Estrogen receptor-alpha gene expression in the cortex: sex differences during development and in adulthood.


    Wilson, Melinda E; Westberry, Jenne M; Trout, Amanda L


    17β-estradiol is a hormone with far-reaching organizational, activational and protective actions in both male and female brains. The organizational effects of early estrogen exposure are essential for long-lasting behavioral and cognitive functions. Estradiol mediates many of its effects through the intracellular receptors, estrogen receptor-alpha (ERα) and estrogen receptor-beta (ERβ). In the rodent cerebral cortex, estrogen receptor expression is high early in postnatal life and declines dramatically as the animal approaches puberty. This decline is accompanied by decreased expression of ERα mRNA. This change in expression is the same in both males and females in the developing isocortex and hippocampus. An understanding of the molecular mechanisms involved in the regulation of estrogen receptor alpha (ERα) gene expression is critical for understanding the developmental, as well as changes in postpubertal expression of the estrogen receptor. One mechanism of suppressing gene expression is by the epigenetic modification of the promoter regions by DNA methylation that results in gene silencing. The decrease in ERα mRNA expression during development is accompanied by an increase in promoter methylation. Another example of regulation of ERα gene expression in the adult cortex is the changes that occur following neuronal injury. Many animal studies have demonstrated that the endogenous estrogen, 17β-estradiol, is neuroprotective. Specifically, low levels of estradiol protect the cortex from neuronal death following middle cerebral artery occlusion (MCAO). In females, this protection is mediated through an ERα-dependent mechanism. ERα expression is rapidly increased following MCAO in females, but not in males. This increase is accompanied by a decrease in methylation of the promoter suggesting a return to the developmental program of gene expression within neurons. Taken together, during development and in adulthood, regulation of ERα gene expression in the

  6. Conservation of position and sequence of a novel, widely expressed gene containing the major human {alpha}-globin regulatory element

    SciTech Connect

    Vyas, P.; Vickers, M.A.; Picketts, D.J.; Higgs, D.R.


    We have determined the cDNA and genomic structure of a gene (-14 gene) that lies adjacent to the human {alpha}-globin cluster. Although it is expressed in a wide range of cell lines and tissues, a previously described erythroid-specific regulatory element that controls expression of the {alpha}-globin genes lies within intron 5 of this gene. Analysis of the -14 gene promoter shows that it is GC rich and associated with a constitutively expressed DNase 1 hypersensitive site; unlike the {alpha}-globin promoter, it does not contain a TATA or CCAAT box. These and other differences in promoter structure may explain why the erythroid regulatory element interacts specifically with the {alpha}-globin promoters and not the -14 gene promoter, which lies between the {alpha} promoters and their regulatory element. Interspecies comparisons demonstrate that the sequence and location of the -14 gene adjacent to the a cluster have been maintained since the bird/mammal divergence, 270 million years ago. 38 refs., 6 figs.

  7. Simultaneous gene quantitation of multiple genes in individual bovine nuclear transfer blastocysts.


    Smith, Craig; Berg, Debbie; Beaumont, Sue; Standley, Neil T; Wells, David N; Pfeffer, Peter L


    During somatic cell nuclear transfer (NT), the transcriptional status of the donor cell has to be reprogrammed to reflect that of an embryo. We analysed the accuracy of this process by comparing transcript levels of four developmentally important genes (Oct4, Otx2, Ifitm3, GATA6), a gene involved in epigenetic regulation (Dnmt3a) and three housekeeping genes (beta-actin, beta-tubulin and GAPDH) in 21 NT blastocysts with that in genetically half-identical in vitro produced (IVP, n=19) and in vivo (n=15) bovine embryos. We have optimised an RNA-isolation and SYBR-green-based real-time RT-PCR procedure allowing the reproducible absolute quantification of multiple genes from a single blastocyst. Our data indicated that transcript levels did not differ significantly between stage and grade-matched zona-free NT and IVP embryos except for Ifitm3/Fragilis, which was expressed at twofold higher levels in NT blastocysts. Ifitm3 expression is confined to the inner cell mass at day 7 blastocysts and to the epiblast in day 14 embryos. No ectopic expression in the trophectoderm was seen in NT embryos. Gene expression in NT and IVP embryos increased between two- and threefold for all eight genes from early to late blastocyst stages. This increase exceeded the increase in cell number over this time period indicating an increase in transcript number per cell. Embryo quality (morphological grading) was correlated to cell number for NT and IVP embryos with grade 3 blastocysts containing 30% fewer cells. However, only NT embryos displayed a significant reduction in gene expression (50%) with loss of quality. Variability in gene expression levels was not significantly different in NT, IVP or in vivo embryos but differed among genes, suggesting that the stringency of regulation is intrinsic to a gene and not affected by culture or nuclear transfer. Oct4 levels exhibited the lowest variability. Analysing the total variability of all eight genes for individual embryos revealed that in

  8. Selenium regulates gene expression for estrogen sulfotransferase and alpha 2U-globulin in rat liver.


    Yang, Q; Christensen, M J


    Dietary intake of the essential trace element selenium (Se) regulates expression of genes for selenoproteins and certain non-Se-containing proteins. However, these proteins do not account for all of Se's biological effects. The objective of this work was to identify additional genes whose expression is regulated by Se. Identification of these genes may reveal new functions for Se or define mechanisms for its biological effects. Weanling male Sprague-Dawley rats were fed a Torula yeast-based Se-deficient basal diet or the same diet supplemented with 0.5 mg Se/kg diet as sodium selenite for 13 weeks. Total RNA was used as template for RNA fingerprinting. Two differentially expressed cDNA fragments were identified and cloned. The first had 99% nucleotide identity with rat liver estrogen sulfotransferase (EST) isoform-6. The second had 99% nucleotide sequence identity with rat liver alpha 2u-globulin. The mRNA levels for both were markedly reduced in Se deficiency. Laser densitometry showed that EST mRNA in Se deficiency was 7.3% of that in Se-adequate rat liver. The level of alpha 2u-globulin mRNA in Se-deficient rat liver was only 12.6% of that in Se-adequate rat liver. These results indicate that dietary Se may play a role in steroid hormone metabolism in rat liver.

  9. The extent to which immunity, apoptosis and detoxification gene expression interact with 17 alpha-methyltestosterone.


    Abo-Al-Ela, Haitham G; El-Nahas, Abeer F; Mahmoud, Shawky; Ibrahim, Essam M


    Innate immunity is the first line of defence against invasion by foreign pathogens. One widely used synthetic androgen for the production of all-male fish, particularly commercially valuable Nile tilapia, Oreochromis niloticus, is 17 alpha-methyltestosterone (MT). The present study investigates the effect of MT on innate immunity, cellular apoptosis and detoxification and the mortality rate, during and after the feeding of fry with 0-, 40-and 60-mg MT/kg. Expression analysis was completed on interleukin 1 beta (il1β), interleukin 8 (il8), tumour necrosis factor alpha (tnfα), CXC2- and CC-chemokines, interferon (ifn), myxovirus resistance (mx), toll-like receptor 7 (tlr7), immunoglobulin M heavy chain (IgM heavy chain), vitellogenin (vtg), cellular apoptosis susceptibility (cas) and glutathione S-transferase α1 (gstα1). Expression analysis revealed that MT had a significant impact on these genes, and this impact varied from induction to repression during and after the treatment. Linear regression analysis showed a significant association between the majority of the tested gene transcript levels and mortality rates on the 7(th) and 21(st) days of hormonal treatment and 2 weeks following hormonal cessation. The results are thoroughly discussed in this article. This is the first report concerning the hazardous effect of MT on a series of genes involved in immunity, apoptosis and detoxification in the Nile tilapia fry.

  10. Adaptive Horizontal Gene Transfers between Multiple Cheese-Associated Fungi

    PubMed Central

    Ropars, Jeanne; Rodríguez de la Vega, Ricardo C.; López-Villavicencio, Manuela; Gouzy, Jérôme; Sallet, Erika; Dumas, Émilie; Lacoste, Sandrine; Debuchy, Robert; Dupont, Joëlle; Branca, Antoine; Giraud, Tatiana


    Summary Domestication is an excellent model for studies of adaptation because it involves recent and strong selection on a few, identified traits [1–5]. Few studies have focused on the domestication of fungi, with notable exceptions [6–11], despite their importance to bioindustry [12] and to a general understanding of adaptation in eukaryotes [5]. Penicillium fungi are ubiquitous molds among which two distantly related species have been independently selected for cheese making—P. roqueforti for blue cheeses like Roquefort and P. camemberti for soft cheeses like Camembert. The selected traits include morphology, aromatic profile, lipolytic and proteolytic activities, and ability to grow at low temperatures, in a matrix containing bacterial and fungal competitors [13–15]. By comparing the genomes of ten Penicillium species, we show that adaptation to cheese was associated with multiple recent horizontal transfers of large genomic regions carrying crucial metabolic genes. We identified seven horizontally transferred regions (HTRs) spanning more than 10 kb each, flanked by specific transposable elements, and displaying nearly 100% identity between distant Penicillium species. Two HTRs carried genes with functions involved in the utilization of cheese nutrients or competition and were found nearly identical in multiple strains and species of cheese-associated Penicillium fungi, indicating recent selective sweeps; they were experimentally associated with faster growth and greater competitiveness on cheese and contained genes highly expressed in the early stage of cheese maturation. These findings have industrial and food safety implications and improve our understanding of the processes of adaptation to rapid environmental changes. PMID:26412136

  11. Gene transfer into older chicken embryos by ex ovo electroporation.


    Luo, Jiankai; Yan, Xin; Lin, Juntang; Rolfs, Arndt


    The chicken embryo provides an excellent model system for studying gene function and regulation during embryonic development. In ovo electroporation is a powerful method to over-express exogenous genes or down-regulate endogenous genes in vivo in chicken embryos(1). Different structures such as DNA plasmids encoding genes(2-4), small interfering RNA (siRNA) plasmids(5), small synthetic RNA oligos(6), and morpholino antisense oligonucleotides(7) can be easily transfected into chicken embryos by electroporation. However, the application of in ovo electroporation is limited to embryos at early incubation stages (younger than stage HH20--according to Hamburg and Hamilton)(8) and there are some disadvantages for its application in embryos at later stages (older than stage HH22--approximately 3.5 days of development). For example, the vitelline membrane at later stages is usually stuck to the shall membrane and opening a window in the shell causes rupture of the vessels, resulting in death of the embryos; older embryos are covered by vitelline and allantoic vessels, where it is difficult to access and manipulate the embryos; older embryos move vigorously and is difficult to control the orientation through a relatively small window in the shell. In this protocol we demonstrate an ex ovo electroporation method for gene transfer into chicken embryos at late stages (older than stage HH22). For ex ovo electroporation, embryos are cultured in Petri dishes(9) and the vitelline and allantoic vessels are widely spread. Under these conditions, the older chicken embryos are easily accessed and manipulated. Therefore, this method overcomes the disadvantages of in ovo electroporation applied to the older chicken embryos. Using this method, plasmids can be easily transfected into different parts of the older chicken embryos(10-12).

  12. Comparative analysis of magnetosome gene clusters in magnetotactic bacteria provides further evidence for horizontal gene transfer.


    Jogler, Christian; Kube, Michael; Schübbe, Sabrina; Ullrich, Susanne; Teeling, Hanno; Bazylinski, Dennis A; Reinhardt, Richard; Schüler, Dirk


    The organization of magnetosome genes was analysed in all available complete or partial genomic sequences of magnetotactic bacteria (MTB), including the magnetosome island (MAI) of the magnetotactic marine vibrio strain MV-1 determined in this study. The MAI was found to differ in gene content and organization between Magnetospirillum species and strains MV-1 or MC-1. Although a similar organization of magnetosome genes was found in all MTB, distinct variations in gene order and sequence similarity were uncovered that may account for the observed diversity of biomineralization, cell biology and magnetotaxis found in various MTB. While several magnetosome genes were present in all MTB, others were confined to Magnetospirillum species, indicating that the minimal set of genes required for magnetosome biomineralization might be smaller than previously suggested. A number of novel candidate genes were implicated in magnetosome formation by gene cluster comparison. Based on phylogenetic and compositional evidence we present a model for the evolution of magnetotaxis within the Alphaproteobacteria, which suggests the independent horizontal transfer of magnetosome genes from an unknown ancestor of magnetospirilla into strains MC-1 and MV-1.

  13. Regulation of the Mycobacterium tuberculosis hypoxic response gene encoding alpha -crystallin.


    Sherman, D R; Voskuil, M; Schnappinger, D; Liao, R; Harrell, M I; Schoolnik, G K


    Unlike many pathogens that are overtly toxic to their hosts, the primary virulence determinant of Mycobacterium tuberculosis appears to be its ability to persist for years or decades within humans in a clinically latent state. Since early in the 20th century latency has been linked to hypoxic conditions within the host, but the response of M. tuberculosis to a hypoxic signal remains poorly characterized. The M. tuberculosis alpha-crystallin (acr) gene is powerfully and rapidly induced at reduced oxygen tensions, providing us with a means to identify regulators of the hypoxic response. Using a whole genome microarray, we identified >100 genes whose expression is rapidly altered by defined hypoxic conditions. Numerous genes involved in biosynthesis and aerobic metabolism are repressed, whereas a high proportion of the induced genes have no known function. Among the induced genes is an apparent operon that includes the putative two-component response regulator pair Rv3133c/Rv3132c. When we interrupted expression of this operon by targeted disruption of the upstream gene Rv3134c, the hypoxic regulation of acr was eliminated. These results suggest a possible role for Rv3132c/3133c/3134c in mycobacterial latency.

  14. Ultrasound Gene Transfer into Fibroblast Cells using Microbubbles

    NASA Astrophysics Data System (ADS)

    Nakamura, Yoji; Hirayama, Kota; Yoshinaka, Kiyoshi; Tei, Yuichi; Takagi, Shu; Matsumoto, Yoichiro


    Ultrasound is widely applied in the medical field and offers the strong advantages of non-invasiveness and high-selectivity. Gene transfer using ultrasound, which is called sonoporation, is one application. Ultrasound has the potential to deliver therapeutic materials such as genes, drugs or proteins into cells. Microbubbles are known to be able to improve delivery efficiency. This is attributed to therapeutic materials passing through the cell membrane after permeability is increased by destruction or oscillation of microbubbles. The present study tried to deliver the GFP plasmids into fibroblast cells. Cells were cultured in 6-well culture plates and exposed to ultrasound (frequency, 2.1 MHz; wave pattern, duty cycle 10%; intensity, 0-26 W/cm2; time, 0-200 s) transmitted through medium containing microbubbles (Levovist® (void fraction, 8×10-5) or Sonazoid® (void fraction, 0-24×10-4)) and GFP plasmids at a concentration of 15 μg/mL. Density of microbubbles after ultrasound irradiation was measured. When ultrasound intensity was increased with Levovist® 8×10-4, transfection efficiency increased, cell viability decreased and microbubbles disappeared. With Sonazoid®, transfection efficiency and cell viability were basically unchanged and microbubbles decreased, but did not disappear. Transfection efficiency also improved with increased ultrasound irradiation time or microbubble density. Microbubble destruction appeared to have the main effect on gene transfection under Levovist® and microbubble oscillation had the main effect under Sonazoid®.

  15. Phylogenetic analyses of cyanobacterial genomes: Quantification of horizontal gene transfer events

    PubMed Central

    Zhaxybayeva, Olga; Gogarten, J. Peter; Charlebois, Robert L.; Doolittle, W. Ford; Papke, R. Thane


    Using 1128 protein-coding gene families from 11 completely sequenced cyanobacterial genomes, we attempt to quantify horizontal gene transfer events within cyanobacteria, as well as between cyanobacteria and other phyla. A novel method of detecting and enumerating potential horizontal gene transfer events within a group of organisms based on analyses of “embedded quartets” allows us to identify phylogenetic signal consistent with a plurality of gene families, as well as to delineate cases of conflict to the plurality signal, which include horizontally transferred genes. To infer horizontal gene transfer events between cyanobacteria and other phyla, we added homologs from 168 available genomes. We screened phylogenetic trees reconstructed for each of these extended gene families for highly supported monophyly of cyanobacteria (or lack of it). Cyanobacterial genomes reveal a complex evolutionary history, which cannot be represented by a single strictly bifurcating tree for all genes or even most genes, although a single completely resolved phylogeny was recovered from the quartets’ plurality signals. We find more conflicts within cyanobacteria than between cyanobacteria and other phyla. We also find that genes from all functional categories are subject to transfer. However, in interphylum as compared to intraphylum transfers, the proportion of metabolic (operational) gene transfers increases, while the proportion of informational gene transfers decreases. PMID:16899658

  16. Neural regulation of muscle acetylcholine receptor epsilon- and alpha- subunit gene promoters in transgenic mice

    PubMed Central


    The effects of denervation were investigated in mice with transgenes containing promoter elements from the muscle acetylcholine receptor epsilon- and alpha-subunit genes. The promoter sequences were coupled to a nuclear localization signal-beta-galactosidase fusion gene (nlacZ) as a reporter. While many postsynaptic specializations form in the embryo, expression of the epsilon subunit is induced during the first two postnatal weeks. When muscles were denervated at birth, before the onset of epsilon expression, epsilon nlacZ still appeared at the former synaptic sites on schedule. This result suggests that the nerve leaves a localized "trace" in the muscle that can continue to regulate transcription. An additional finding was that epsilon nlacZ expression was much stronger in denervated than in intact muscles. This suggests that the epsilon promoter is similar to the other subunits in containing elements that are activated on cessation of neural activity. However, even after denervation, epsilon nlacZ expression was always confined to the synaptic region whereas alpha nlacZ expression increased in nuclei along the entire length of the fiber. This suggests that while the epsilon gene is similar in its activity dependence to other subunit genes, it is unique in that local nerve-derived signals are essential for its expression. Consequently, inactivity enhances epsilon expression only in synaptic nuclei where such signals are present, but enhances expression throughout the muscle fiber. Truncations and an internal deletion of the epsilon promoter indicate that cis-elements essential for the response to synaptic signals are contained within 280 bp of the transcription start site. In contrast to these results in young animals, denervation in older animals leads to an unexpected reduction in nlacZ activity. However, mRNA measurements indicated that transgene expression was increased in these animals. This discordance between nlacZ mRNA and enzyme activity, demonstrates a

  17. PU.1 (Spi-1) and C/EBP alpha regulate expression of the granulocyte-macrophage colony-stimulating factor receptor alpha gene.

    PubMed Central

    Hohaus, S; Petrovick, M S; Voso, M T; Sun, Z; Zhang, D E; Tenen, D G


    Growth factor receptors play an important role in hematopoiesis. In order to further understand the mechanisms directing the expression of these key regulators of hematopoiesis, we initiated a study investigating the transcription factors activating the expression of the granulocyte-macrophage colony-stimulating factor (GM-CSF) receptor alpha gene. Here, we demonstrate that the human GM-CSF receptor alpha promoter directs reporter gene activity in a tissue-specific fashion in myelomonocytic cells, which correlates with its expression pattern as analyzed by reverse transcription PCR. The GM-CSF receptor alpha promoter contains an important functional site between positions -53 and -41 as identified by deletion analysis of reporter constructs. We show that the myeloid and B cell transcription factor PU.1 binds specifically to this site. Furthermore, we demonstrate that a CCAAT site located upstream of the PU.1 site between positions -70 and -54 is involved in positive-negative regulation of the GM-CSF receptor alpha promoter activity. C/EBP alpha is the major CCAAT/enhancer-binding protein (C/EBP) form binding to this site in nuclear extracts of U937 cells. Point mutations of either the PU.1 site or the C/EBP site that abolish the binding of the respective factors result in a significant decrease of GM-CSF receptor alpha promoter activity in myelomonocytic cells only. Furthermore, we demonstrate that in myeloid and B cell extracts, PU.1 forms a novel, specific, more slowly migrating complex (PU-SF) when binding the GM-CSF receptor alpha promoter PU.1 site. This is the first demonstration of a specific interaction with PU.1 on a myeloid PU.1 binding site. The novel complex is distinct from that described previously as binding to B cell enhancer sites and can be formed by addition of PU.1 to extracts from certain nonmyeloid cell types which do not express PU.1, including T cells and epithelial cells, but not from erythroid cells. Furthermore, we demonstrate that the PU

  18. Molecular study of the 5 {alpha}-reductase type 2 gene in three European families with 5 {alpha}-reductase deficiency

    SciTech Connect

    Boudon, C.; Lumbroso, S.; Lobaccaro, J.M. ||


    The molecular basis of 5{alpha}-reductase (5{alpha}R) deficiency was investigated in four patients from three European families. In the French family, the first patient was raised as a female, and gonadectomy was performed before puberty. The second sibling, also raised as female, differed in that gonadal removal was performed after the onset of pubertal masculinization. The other two patients, both from Polish families, developed masculinization of external genitalia during puberty. All patients developed a female sexual identity. In all cases, no known consanguinity or family history of 5{alpha}R deficiency was reported. The genomic DNAs of the patients were sequenced after polymerase chain reaction amplification of the five exons of the 5{alpha}R type 2 gene. We found two homozygous mutations responsible for gutamine to arginine and histidine to arginine substitution in families 1 and 3, respectively. In family 2, we found a heterozygous mutation responsible for an asparagine to serine substitution at position 193. The glutamine/arginine 126 mutation in the French family was previously reported in a Creole ethnic group, and the Polish histidine/arginine 231 mutation was previously reported in a patient from Chicago, Moreover, all of the mutations created new restriction sites, which were used to determine the kindred carrier status in the three families. Because 5{alpha}R deficiency is known to be heterogenous disease in terms of clinical and biochemical expression, our data suggest that molecular biology analysis of the type 2 gene could be an essential step in diagnosing 5{alpha}R deficiency. 22 refs., 3 figs., 1 tab.

  19. Analysis and expression of the alpha-expansin and beta-expansin gene families in maize

    NASA Technical Reports Server (NTRS)

    Wu, Y.; Meeley, R. B.; Cosgrove, D. J.


    Expansins comprise a multigene family of proteins in maize (Zea mays). We isolated and characterized 13 different maize expansin cDNAs, five of which are alpha-expansins and eight of which are beta-expansins. This paper presents an analysis of these 13 expansins, as well as an expression analysis by northern blotting with materials from young and mature maize plants. Some expansins were expressed in restricted regions, such as the beta-expansins ExpB1 (specifically expressed in maize pollen) and ExpB4 (expressed principally in young husks). Other expansins such as alpha-expansin Exp1 and beta-expansin ExpB2 were expressed in several organs. The expression of yet a third group was not detected in the selected organs and tissues. An analysis of expansin sequences from the maize expressed sequence tag collection is also presented. Our results indicate that expansin genes may have general, overlapping expression in some instances, whereas in other cases the expression may be highly specific and limited to a single organ or cell type. In contrast to the situation in Arabidopsis, beta-expansins in maize seem to be more numerous and more highly expressed than are alpha-expansins. The results support the concept that beta-expansins multiplied and evolved special functions in the grasses.

  20. Cloning and characterization of the rat HIF-1 alpha prolyl-4-hydroxylase-1 gene.


    Cobb, Ronald R; McClary, John; Manzana, Warren; Finster, Silke; Larsen, Brent; Blasko, Eric; Pearson, Jennifer; Biancalana, Sara; Kauser, Katalin; Bringmann, Peter; Light, David R; Schirm, Sabine


    Prolyl-4-hydroxylase domain-containing enzymes (PHDs) mediate the oxygen-dependent regulation of the heterodimeric transcription factor hypoxia-inducible factor-1 (HIF-1). Under normoxic conditions, one of the subunits of HIF-1, HIF-1alpha, is hydroxylated on specific proline residues to target HIF-1alpha for degradation by the ubiquitin-proteasome pathway. Under hypoxic conditions, the hydroxylation by the PHDs is attenuated by lack of the oxygen substrate, allowing HIF-1 to accumulate, translocate to the nucleus, and mediate HIF-mediated gene transcription. In several mammalian species including humans, three PHDs have been identified. We report here the cloning of a full-length rat cDNA that is highly homologous to the human and murine PHD-1 enzymes and encodes a protein that is 416 amino acids long. Both cDNA and protein are widely expressed in rat tissues and cell types. We demonstrate that purified and crude baculovirus-expressed rat PHD-1 exhibits HIF-1alpha specific prolyl hydroxylase activity with similar substrate affinities and is comparable to human PHD-1 protein.

  1. [Cloning of Clostridium perfringens alpha-toxin gene and extracellular expression in Escherichia coli].


    Inoue, Masaharu; Kikuchi, Maho; Komoriya, Tomoe; Watanabe, Kunitomo; Kouno, Hideki


    Clostridium perfringens (C. perfringens) is a Gram-positive bacterial pathogen that widely propagets in the soil and the gastrointestinal tract of human and animals. This bacteria causes food poisoning, gas gangrene and other various range of infectious diseases. But there is no standard diagnosis method of C. perfringens. In order to develop a new type of immunoassay for clinical purpose, we studied expression and extracellular secretion of recombinant alpha-toxin having enzyme activity in E. coli expression system. Cloning was carried out after PCR amplification from C. perfringens GAI 94074 which was clinical isolate. Three kinds of fragment were cloned using pET100/D-TOPO vector. These fragments coded for ribosome binding site, signal peptide, and alpha-toxin gene respectively. Recombinant pET100 plasmid transformed into TOP 10 cells and the obtained plasmids were transformed into BL21 (DE3) cells. Then, the transformants were induced expression with IPTG. In conclusion, we successfully cloned, expressed and exteracellular secreted C. perfringens alpha-toxin containing signal peptide. Biologically, the obtained recombinant protein was positive for phospholipase C activity.

  2. Identification of a lens-specific regulatory region (LSR) of the murine alpha B-crystallin gene.


    Gopal-Srivastava, R; Piatigorsky, J


    Previous studies have shown that the -661/+44 sequence of the murine alpha B-crystallin gene contains a muscle-preferred enhancer (-426/-257) and can drive the bacterial chloramphenicol acetyltransferase (CAT) gene in the lens, skeletal muscle and heart of transgenic mice. Here we show that transgenic mice carrying a truncated -164/+44 fragment of the alpha B-crystallin gene fused to the CAT gene expressed exclusively in the lens; by contrast mice carrying a -426/+44 fragment of the alpha B gene fused to CAT expressed highly in the lens, skeletal muscle and heart, and slightly in the lung, brain, kidney, spleen and liver. DNase I protection experiments indicated that the -147/-118 sequence is protected by nuclear proteins from alpha TN4-1 lens cell line, but not by nuclear proteins from myotubes of the C2C12 cell line. Site directed mutagenesis of this sequence decreased promoter activity in transiently-transfected lens cells, consistent with this sequence being a lens-specific regulatory region (LSR). We conclude that the -426/-257 enhancer is required for expression in skeletal muscle, heart and possibly other tissues, and that the -164/+44 sequence of the alpha B-crystallin gene is sufficient for expression in the lens of transgenic mice.

  3. Supra-operonic clusters of functionally related genes (SOCs) are a source of horizontal gene co-transfers

    PubMed Central

    Pang, Tin Yau; Lercher, Martin J.


    Adaptation of bacteria occurs predominantly via horizontal gene transfer (HGT). While it is widely recognized that horizontal acquisitions frequently encompass multiple genes, it is unclear what the size distribution of successfully transferred DNA segments looks like and what evolutionary forces shape this distribution. Here, we identified 1790 gene family pairs that were consistently co-gained on the same branches across a phylogeny of 53 E. coli strains. We estimated a lower limit of their genomic distances at the time they were transferred to their host genomes; this distribution shows a sharp upper bound at 30 kb. The same gene-pairs can have larger distances (up to 70 kb) in other genomes. These more distant pairs likely represent recent acquisitions via transduction that involve the co-transfer of excised prophage genes, as they are almost always associated with intervening phage-associated genes. The observed distribution of genomic distances of co-transferred genes is much broader than expected from a model based on the co-transfer of genes within operons; instead, this distribution is highly consistent with the size distribution of supra-operonic clusters (SOCs), groups of co-occurring and co-functioning genes that extend beyond operons. Thus, we propose that SOCs form a basic unit of horizontal gene transfer. PMID:28067311

  4. Identification of a novel cyclosporin-sensitive element in the human tumor necrosis factor alpha gene promoter

    PubMed Central


    Tumor necrosis factor alpha (TNF-alpha), a cytokine with pleiotropic biological effects, is produced by a variety of cell types in response to induction by diverse stimuli. In this paper, TNF-alpha mRNA is shown to be highly induced in a murine T cell clone by stimulation with T cell receptor (TCR) ligands or by calcium ionophores alone. Induction is rapid, does not require de novo protein synthesis, and is completely blocked by the immunosuppressant cyclosporin A (CsA). We have identified a human TNF-alpha promoter element, kappa 3, which plays a key role in the calcium-mediated inducibility and CsA sensitivity of the gene. In electrophoretic mobility shift assays, an oligonucleotide containing kappa 3 forms two DNA protein complexes with proteins that are present in extracts from unstimulated T cells. These complexes appear in nuclear extracts only after T cell stimulation. Induction of the inducible nuclear complexes is rapid, independent of protein synthesis, and blocked by CsA, and thus, exactly parallels the induction of TNF-alpha mRNA by TCR ligands or by calcium ionophore. Our studies indicate that the kappa 3 binding factor resembles the preexisting component of nuclear factor of activated T cells. Thus, the TNF-alpha gene is an immediate early gene in activated T cells and provides a new model system in which to study CsA-sensitive gene induction in activated T cells. PMID:8376940

  5. Nucleotide sequence of the leukotoxin gene from Actinobacillus actinomycetemcomitans: homology to the alpha-hemolysin/leukotoxin gene family.

    PubMed Central

    Kraig, E; Dailey, T; Kolodrubetz, D


    The leukotoxin produced by Actinobacillus actinomycetemcomitans has been implicated in the etiology of localized juvenile periodontitis. To initiate a genetic analysis into the role of this protein in disease, we have cloned its gene, lktA. We now present the complete nucleotide sequence of the lktA gene from A. actinomycetemcomitans. When the deduced amino acid sequence of the leukotoxin protein was compared with those of other proteins, it was found to be homologous to the leukotoxin from Pasteurella haemolytica and to the alpha-hemolysins from Escherichia coli and Actinobacillus pleuropneumoniae. Each alignment showed at least 42% identity. As in the other organisms, the lktA gene of A. actinomycetemcomitans was linked to another gene, lktC, which is thought to be involved in the activation of the leukotoxin. The predicted LktC protein was related to the leukotoxin/hemolysin C proteins from the other bacteria, since they shared a minimum of 49% amino acid identity. Surprisingly, although actinobacillus species are more closely related to pasteurellae than to members of the family Enterobacteriaciae, LktA and LktC from A. actinomycetemcomitans shared significantly greater sequence identity with the E. coli alpha-hemolysin proteins than with the P. haemolytica leukotoxin proteins. Despite the overall homology to the other leukotoxin/hemolysin proteins, the LktA protein from A. actinomycetemcomitans has several unique properties. Most strikingly, it is a very basic protein with a calculated pI of 9.7; the other toxins have estimated pIs around 6.2. The unusual features of the A. actinomycetemcomitans protein are discussed in light of the different species and target-cell specificities of the hemolysins and the leukotoxins. Images PMID:2318535

  6. Horizontal gene transfer and gene dosage drives adaptation to wood colonization in a tree pathogen


    Dhillon, Braham; Feau, Nicolas; Aerts, Andrea L.; ...


    Some of the most damaging tree diseases are caused by pathogens that induce cankers, a stem deformation often lethal. To investigate the cause of this adaptation, we sequenced the genomes of poplar pathogens that do and do not cause cankers. We found a unique cluster of genes that produce secondary metabolites and are co-activated when the canker pathogen is grown on poplar wood and leaves. The gene genealogy is discordant with the species phylogeny, showing a signature of horizontal transfer from fungi associated with wood decay. Furthermore, genes encoding hemicellulose-degrading enzymes are up-regulated on poplar wood chips, with some havingmore » been acquired horizontally. In conclusion, we propose that adaptation to colonize poplar woody stems is the result of acquisition of these genes.« less

  7. Horizontal gene transfer and gene dosage drives adaptation to wood colonization in a tree pathogen

    SciTech Connect

    Dhillon, Braham; Feau, Nicolas; Aerts, Andrea L.; Beauseigle, Stéphanie; Bernier, Louis; Copeland, Alex; Foster, Adam; Gill, Navdeep; Henrissat, Bernard; Herath, Padmini; LaButti, Kurt M.; Levasseur, Anthony; Lindquist, Erika A.; Majoor, Eline; Ohm, Robin A.; Pangilinan, Jasmyn L.; Pribowo, Amadeus; Saddler, John N.; Sakalidis, Monique L.; de Vries, Ronald P.; Grigoriev, Igor V.; Goodwin, Stephen B.; Tanguay, Philippe; Hamelin, Richard C.


    Some of the most damaging tree diseases are caused by pathogens that induce cankers, a stem deformation often lethal. To investigate the cause of this adaptation, we sequenced the genomes of poplar pathogens that do and do not cause cankers. We found a unique cluster of genes that produce secondary metabolites and are co-activated when the canker pathogen is grown on poplar wood and leaves. The gene genealogy is discordant with the species phylogeny, showing a signature of horizontal transfer from fungi associated with wood decay. Furthermore, genes encoding hemicellulose-degrading enzymes are up-regulated on poplar wood chips, with some having been acquired horizontally. In conclusion, we propose that adaptation to colonize poplar woody stems is the result of acquisition of these genes.

  8. Perilipin, a critical regulator of fat storage and breakdown, is a target gene of estrogen receptor-related receptor {alpha}

    SciTech Connect

    Akter, Mst. Hasina; Yamaguchi, Tomohiro; Hirose, Fumiko; Osumi, Takashi


    Perilipin is a protein localized on lipid droplet surfaces in adipocytes and steroidogenic cells, playing a central role in regulated lipolysis. Expression of the perilipin gene is markedly induced during adipogenesis. We found that transcription from the perilipin gene promoter is activated by an orphan nuclear receptor, estrogen receptor-related receptor (ERR){alpha}. A response element to this receptor was identified in the promoter region by a gene reporter assay, the electrophoretic-gel mobility-shift assay and the chromatin immunoprecipitation assay. Peroxisome proliferator-activated receptor {gamma} coactivator (PGC)-1{alpha} enhanced, whereas small heterodimer partner (SHP) repressed, the transactivating function of ERR{alpha} on the promoter. Thus, the perilipin gene expression is regulated by a transcriptional network controlling energy metabolism, substantiating the functional importance of perilipin in the maintenance of body energy balance.

  9. Cloning, sequencing, and expression of the gene coding for the human platelet. cap alpha. /sub 2/-adrenergic receptor

    SciTech Connect

    Kobilka, B.K.; Matsui, H.; Kobilka, T.S.; Yang-Feng, T.L.; Francke, U.; Caron, M.G.; Lefkowitz, R.J.; Regan, J.W.


    The gene for the human platelet ..cap alpha../sub 2/-adrenergic receptor has been cloned with oligonucleotides corresponding to the partial amino acid sequence of the purified receptor. The identity of this gene has been confirmed by the binding of ..cap alpha../sub 2/-adrenergic ligands to the cloned receptor expressed in Xenopus laevis oocytes. The deduced amino acid sequence is most similar to the recently cloned human ..beta../sub 2/- and ..beta../sub 1/-adrenergic receptors; however, similarities to the muscarinic cholinergic receptors are also evident. Two related genes have been identified by low stringency Southern blot analysis. These genes may represent additional ..cap alpha../sub 2/-adrenergic receptor subtypes.

  10. Analysis of the promoter region and the N-propeptide domain of the human pro alpha 2(I) collagen gene.

    PubMed Central

    Dickson, L A; de Wet, W; Di Liberto, M; Weil, D; Ramirez, F


    We have located the exon coding for the start site of transcription of the human pro alpha 2(I) collagen gene. Comparison with the homologous region of other fibrillar collagen genes has confirmed the existence of a consensus sequence (CATGTCTA-n-TAGACATG) capable of forming a hairpin secondary structure possibly involved in the regulation of collagen biosynthesis. Sequence comparison of the chromosomal regions at the 5' end of the pro alpha 1(I) and pro alpha 2(I) collagen genes failed to identify unique DNA elements potentially mediating common regulatory signals. Sequencing of four exons coding for the N-terminal propeptide has determined most of its structure and it has implied the existence of smaller coding units similar to the 11 and 18 bp exons originally described in the avian gene. Images PMID:4011429

  11. Immunomodulation by mucosal gene transfer using TGF-beta DNA.

    PubMed Central

    Kuklin, N A; Daheshia, M; Chun, S; Rouse, B T


    This report evaluates the efficacy of DNA encoding TGF-beta administered mucosally to suppress immunity and modulate the immunoinflammatory response to herpes simplex virus (HSV) infection. A single intranasal administration of an eukaryotic expression vector encoding TGF-beta1 led to expression in the lung and lymphoid tissue. T cell-mediated immune responses to HSV infection were suppressed with this effect persisting as measured by the delayed-type hypersensitivity reaction for at least 7 wk. Treated animals were more susceptible to systemic infection with HSV. Multiple prophylactic mucosal administrations of TGF-beta DNA also suppressed the severity of ocular lesions caused by HSV infection, although no effects on this immunoinflammatory response were evident after therapeutic treatment with TGF-beta DNA. Our results demonstrate that the direct mucosal gene transfer of immunomodulatory cytokines provides a convenient means of modulating immunity and influencing the expression of inflammatory disorders. PMID:9664086

  12. Horizontal gene transfer: building the web of life.


    Soucy, Shannon M; Huang, Jinling; Gogarten, Johann Peter


    Horizontal gene transfer (HGT) is the sharing of genetic material between organisms that are not in a parent-offspring relationship. HGT is a widely recognized mechanism for adaptation in bacteria and archaea. Microbial antibiotic resistance and pathogenicity are often associated with HGT, but the scope of HGT extends far beyond disease-causing organisms. In this Review, we describe how HGT has shaped the web of life using examples of HGT among prokaryotes, between prokaryotes and eukaryotes, and even between multicellular eukaryotes. We discuss replacement and additive HGT, the proposed mechanisms of HGT, selective forces that influence HGT, and the evolutionary impact of HGT on ancestral populations and existing populations such as the human microbiome.

  13. Studies of DEAE-dextran-mediated gene transfer.


    Yang, Y W; Yang, J C


    DEAE-dextran-mediated gene transfer was studied for the introduction of pSV2neo DNA into Fisher-rat 3T3 (FR3T3) cells. Zeta (zeta) potentials of the DEAE-dextran-DNA complexes and FR3T3 cells were found to be dependent on the concentration of DEAE-dextran in the medium. The maximum transfection efficiency occurred at a DEAE-dextran/DNA ratio of 50:1 or thereabouts. The interaction between DNA and cells is determined by the adsorption process. The results obtained, along with the correlation between the kinetic adsorption behaviour of 3H-labelled DNA and the transfection efficiency, indicated that adsorption of DEAE-dextran-DNA complexes to the negatively charged cell surfaces, due to electrostatic and dispersion attraction, plays the decisive role in determining the DNA transfection efficiencies.

  14. Statistical Mechanics of Horizontal Gene Transfer in Evolutionary Ecology

    NASA Astrophysics Data System (ADS)

    Chia, Nicholas; Goldenfeld, Nigel


    The biological world, especially its majority microbial component, is strongly interacting and may be dominated by collective effects. In this review, we provide a brief introduction for statistical physicists of the way in which living cells communicate genetically through transferred genes, as well as the ways in which they can reorganize their genomes in response to environmental pressure. We discuss how genome evolution can be thought of as related to the physical phenomenon of annealing, and describe the sense in which genomes can be said to exhibit an analogue of information entropy. As a direct application of these ideas, we analyze the variation with ocean depth of transposons in marine microbial genomes, predicting trends that are consistent with recent observations using metagenomic surveys.

  15. Extensive Intra-Kingdom Horizontal Gene Transfer Converging on a Fungal Fructose Transporter Gene

    PubMed Central

    Coelho, Marco A.; Gonçalves, Carla; Sampaio, José Paulo; Gonçalves, Paula


    Comparative genomics revealed in the last decade a scenario of rampant horizontal gene transfer (HGT) among prokaryotes, but for fungi a clearly dominant pattern of vertical inheritance still stands, punctuated however by an increasing number of exceptions. In the present work, we studied the phylogenetic distribution and pattern of inheritance of a fungal gene encoding a fructose transporter (FSY1) with unique substrate selectivity. 109 FSY1 homologues were identified in two sub-phyla of the Ascomycota, in a survey that included 241 available fungal genomes. At least 10 independent inter-species instances of horizontal gene transfer (HGT) involving FSY1 were identified, supported by strong phylogenetic evidence and synteny analyses. The acquisition of FSY1 through HGT was sometimes suggestive of xenolog gene displacement, but several cases of pseudoparalogy were also uncovered. Moreover, evidence was found for successive HGT events, possibly including those responsible for transmission of the gene among yeast lineages. These occurrences do not seem to be driven by functional diversification of the Fsy1 proteins because Fsy1 homologues from widely distant lineages, including at least one acquired by HGT, appear to have similar biochemical properties. In summary, retracing the evolutionary path of the FSY1 gene brought to light an unparalleled number of independent HGT events involving a single fungal gene. We propose that the turbulent evolutionary history of the gene may be linked to the unique biochemical properties of the encoded transporter, whose predictable effect on fitness may be highly variable. In general, our results support the most recent views suggesting that inter-species HGT may have contributed much more substantially to shape fungal genomes than heretofore assumed. PMID:23818872

  16. A microRNA embedded AAV alpha-synuclein gene silencing vector for dopaminergic neurons

    PubMed Central

    Han, Ye; Khodr, Christina E.; Sapru, Mohan K.; Pedapati, Jyothi; Bohn, Martha C.


    Alpha-synuclein (SNCA), an abundantly expressed presynaptic protein, is implicated in Parkinson disease (PD). Since over-expression of human SNCA (hSNCA) leads to death of dopaminergic (DA) neurons in human, rodent and fly brain, hSNCA gene silencing may reduce levels of toxic forms of SNCA and ameliorate degeneration of DA neurons in PD. To begin to develop a gene therapy for PD based on hSNCA gene silencing, two AAV gene silencing vectors were designed, and tested for efficiency and specificity of silencing, as well as toxicity in vitro. The same hSNCA silencing sequence (shRNA) was used in both vectors, but in one vector, the shRNA was embedded in a microRNA backbone and driven by a pol II promoter, and in the other the shRNA was not embedded in a microRNA and was driven by a pol III promoter. Both vectors silenced hSNCA to the same extent in 293T cells transfected with hSNCA. In DA PC12 cells, neither vector decreased expression of rat SNCA, tyrosine hydroxylase (TH), dopamine transporter (DAT) or the vesicular monoamine transporter (VMAT). However, the mir30 embedded vector was significantly less toxic to both PC12 and SH-SY5Y cells. Our in vitro data suggest that this miRNA-embedded silencing vector may be ideal for chronic in vivo SNCA gene silencing in DA neurons. PMID:21338582

  17. Genetically essential and nonessential alpha-tubulin genes specify functionally interchangeable proteins.

    PubMed Central

    Schatz, P J; Solomon, F; Botstein, D


    Microtubules in yeast are essential components of the mitotic and meiotic spindles and are essential for nuclear movement during cell division and mating. The relative importance in these processes of the two divergent alpha-tubulin genes of the budding yeast Saccharomyces cerevisiae, TUB1 and TUB3, was examined through the construction of null mutations and by increasing their copy number on chromosomes and on plasmids. Experiments with null alleles of TUB3 showed that TUB3 was not essential for mitosis, meiosis, or mating. Null alleles of TUB3, however, did cause several phenotypes, including hypersensitivity to the antimicrotubule drug benomyl and poor spore viability. On the other hand, the TUB1 gene was essential for growth of normal haploid cells. Even in diploids heterozygous for a TUB1 null allele, several dominant phenotypes were evident, including slow growth and poor sporulation. This functional difference between the two genes is apparently due to different levels of expression, because extra copies of either gene could suppress the defects caused by a null mutation in the other. We conclude that in spite of the 10% divergence between the products of the two genes, there is no essential qualitative functional difference between them. Images PMID:3540600

  18. Preferential expression of an alpha-tubulin gene of Arabidopsis in pollen.

    PubMed Central

    Carpenter, J L; Ploense, S E; Snustad, D P; Silflow, C D


    The pool of tubulin protein in tissues of Arabidopsis is provided by the expression of multiple alpha-tubulin (TUA) and beta-tubulin genes. Whereas most tubulin genes are expressed in many tissues, previous evidence suggested that the TUA1 gene might be expressed primarily in pollen. We now report a detailed analysis of TUA1 expression during Arabidopsis development. In RNA from tissues of dissected flowers, TUA1 transcripts were detected only in stamens and mature pollen. Chimeric genes containing TUA1 5' flanking DNA fused to the beta-glucuronidase (GUS) coding region were used to create transgenic Arabidopsis plants. Plants containing a chimeric gene with 533 bp of 5' flanking sequence were analyzed by histochemical assay to localize GUS expression within the plant. The blue product of GUS enzyme activity accumulated very rapidly in postmitotic pollen grains. Much lower levels of GUS activity were detected in anthers with uninucleate pollen grains, in flower receptacles, and in a few vegetative tissues. Analysis of 5' deletions of the TUA1 promoter suggested that 97 bp of 5' flanking DNA is sufficient to drive GUS expression in pollen and young anthers, whereas at least 380 bp is required to detect GUS expression in the receptacle. Examination of the TUA1 promoter sequence revealed several motifs that are repeated within the TUA1 promoter and are similar to sequences in other pollen-specific promoters. PMID:1498610

  19. Applying horizontal gene transfer phenomena to enhance non-viral gene therapy

    PubMed Central

    Elmer, Jacob J.; Christensen, Matthew D.; Rege, Kaushal


    Horizontal gene transfer (HGT) is widespread amongst prokaryotes, but eukaryotes tend to be far less promiscuous with their genetic information. However, several examples of HGT from pathogens into eukaryotic cells have been discovered and mimicked to improve non-viral gene delivery techniques. For example, several viral proteins and DNA sequences have been used to significantly increase cytoplasmic and nuclear gene delivery. Plant genetic engineering is routinely performed with the pathogenic bacterium Agrobacterium tumefaciens and similar pathogens (e.g. Bartonella henselae) may also be able to transform human cells. Intracellular parasites like Trypanosoma cruzi may also provide new insights into overcoming cellular barriers to gene delivery. Finally, intercellular nucleic acid transfer between host cells will also be briefly discussed. This article will review the unique characteristics of several different viruses and microbes and discuss how their traits have been successfully applied to improve non-viral gene delivery techniques. Consequently, pathogenic traits that originally caused diseases may eventually be used to treat many genetic diseases. PMID:23994344

  20. Widespread impact of horizontal gene transfer on plant colonization of land

    PubMed Central

    Yue, Jipei; Hu, Xiangyang; Sun, Hang; Yang, Yongping; Huang, Jinling


    In complex multicellular eukaryotes such as animals and plants, horizontal gene transfer is commonly considered rare with very limited evolutionary significance. Here we show that horizontal gene transfer is a dynamic process occurring frequently in the early evolution of land plants. Our genome analyses of the moss Physcomitrella patens identified 57 families of nuclear genes that were acquired from prokaryotes, fungi or viruses. Many of these gene families were transferred to the ancestors of green or land plants. Available experimental evidence shows that these anciently acquired genes are involved in some essential or plant-specific activities such as xylem formation, plant defence, nitrogen recycling as well as the biosynthesis of starch, polyamines, hormones and glutathione. These findings suggest that horizontal gene transfer had a critical role in the transition of plants from aquatic to terrestrial environments. On the basis of these findings, we propose a model of horizontal gene transfer mechanism in nonvascular and seedless vascular plants. PMID:23093189

  1. Widespread impact of horizontal gene transfer on plant colonization of land.


    Yue, Jipei; Hu, Xiangyang; Sun, Hang; Yang, Yongping; Huang, Jinling


    In complex multicellular eukaryotes such as animals and plants, horizontal gene transfer is commonly considered rare with very limited evolutionary significance. Here we show that horizontal gene transfer is a dynamic process occurring frequently in the early evolution of land plants. Our genome analyses of the moss Physcomitrella patens identified 57 families of nuclear genes that were acquired from prokaryotes, fungi or viruses. Many of these gene families were transferred to the ancestors of green or land plants. Available experimental evidence shows that these anciently acquired genes are involved in some essential or plant-specific activities such as xylem formation, plant defence, nitrogen recycling as well as the biosynthesis of starch, polyamines, hormones and glutathione. These findings suggest that horizontal gene transfer had a critical role in the transition of plants from aquatic to terrestrial environments. On the basis of these findings, we propose a model of horizontal gene transfer mechanism in nonvascular and seedless vascular plants.

  2. Human DNA polymerase alpha gene: sequences controlling expression in cycling and serum-stimulated cells.

    PubMed Central

    Pearson, B E; Nasheuer, H P; Wang, T S


    We have investigated the DNA polymerase alpha promoter sequence requirements for the expression of a heterologous gene in actively cycling cells and following serum addition to serum-deprived cells. An 11.4-kb genomic clone that spans the 5' end of this gene and includes 1.62 kb of sequence upstream from the translation start site was isolated. The transcription start site was mapped at 46 +/- 1 nucleotides upstream from the translation start site. The upstream sequence is GC rich and lacks a TATA sequence but has a CCAAT sequence on the opposite strand. Analysis of a set of deletion constructs in transient transfection assays demonstrated that efficient expression of the reporter in cycling cells requires 248 bp of sequence upstream from the cap site. Clustered within these 248 nucleotides are sequences similar to consensus sequences for Sp1-, Ap1-, Ap2-, and E2F-binding sites. The CCAAT sequence and the potential E2F- and Ap1-binding sites are shown to be protected from DNase I digestion by partially purified nuclear proteins. The DNA polymerase alpha promoter can confer upon the reporter an appropriate, late response to serum addition. No single sequence element could be shown to confer serum inducibility. Rather, multiple sequence elements appear to mediate the full serum response. Images PMID:2005899

  3. Identification and characterization of the alpha-acetolactate synthase gene from Lactococcus lactis subsp. lactis biovar diacetylactis.

    PubMed Central

    Marugg, J D; Goelling, D; Stahl, U; Ledeboer, A M; Toonen, M Y; Verhue, W M; Verrips, C T


    The conversion of 3-13C-labelled pyruvate in an acetoin-producing clone from a Lactococcus lactis subsp. lactis biovar diacetylactis strain DSM 20384 plasmid bank in Escherichia coli was studied by 13C nuclear magnetic resonance analysis. The results showed that alpha-acetolactate was the first metabolic product formed from pyruvate, whereas acetoin appeared at a much slower rate and reached only low concentrations. This alpha-acetolactate production shows that the cells express the gene for alpha-acetolactate synthase (als). Nucleotide sequence analysis identified an open reading frame encoding a protein of 554 amino acids. The deduced amino acid sequence exhibits extensive similarities to those of known alpha-acetolactate synthases from both prokaryotes and eukaryotes. The als gene is expressed on a monocistronic transcriptional unit, which is transcribed from a promoter located just upstream of the coding region. Images PMID:8017926

  4. A complete alpha1,3-galactosyltransferase gene is present in the human genome and partially transcribed.


    Lantéri, Marion; Giordanengo, Valérie; Vidal, Frédérique; Gaudray, Patrick; Lefebvre, Jean-Claude


    The synthesis of Galalpha1-3Gal-terminated oligosaccharides (alpha-Gal) epitopes has been interrupted during the course of evolution, starting with Old World primates. Partial sequences similar to the alpha1,3-galactosyltransferase (alpha1,3GalT) gene, which governs the synthesis of alpha-Gal epitopes, have been detected in the human genome and were found to correspond to pseudogenes. We completed the sequence of the human alpha1,3GalT pseudogene present on chromosome 9 and found it to be organized like the murine alpha1,3GalT gene. In human cell lines and several normal and tumor tissues we detected truncated transcripts corresponding to this pseudogene. Considering these mRNAs, translation of an open reading frame containing the first four translated exons but missing the two catalytic exons could predict a truncated alpha1,3GalT polypeptide that should be enzymatically inactive. We show that transcription of human alpha1,3GalT is prematurely terminated at the level of a strong transcriptional stop signal in the middle of intron VII. We were able to reproduce this effect in vitro by subcloning the implicated DNA region upstream from a reporter cDNA. The premature transcriptional arrest of human alpha1,3-GalT gene leads to an ectopic splicing event and to the connection of a short intronic sequence downstream from translated exons. Finally, we show that these truncated transcripts are overexpressed in cell lines with modifications of O-glycans.

  5. Dietary cholesterol fails to stimulate the human cholesterol 7alpha-hydroxylase gene (CYP7A1) in transgenic mice.


    Agellon, Luis B; Drover, Victor A B; Cheema, Sukhinder K; Gbaguidi, G Franck; Walsh, Annemarie


    Dietary cholesterol has been shown to have a stimulatory effect on the murine cholesterol 7alpha-hydroxylase gene (Cyp7a1), but its effect on human cholesterol 7alpha-hydroxylase gene (CYP7A1) expression in vivo is not known. A transgenic mouse strain harboring the human CYP7A1 gene and homozygous for the disrupted murine Cyp7a1 gene was created. Cholesterol feeding increased the expression of the endogenous modified Cyp7a1 allele but failed to stimulate the human CYP7A1 transgene. In transfected hepatoma cells, 25-hydroxycholesterol increased murine Cyp7a1 gene promoter activity, whereas the human CYP7A1 gene promoter was unresponsive. Electrophoretic mobility shift assays demonstrated the interaction of the liver X receptor alpha (LXRalpha): retinoid X receptor (RXR) heterodimer, a transcription factor complex that is activated by oxysterols, with the murine Cyp7a1 gene promoter, whereas no binding to the human CYP7A1 gene promoter was detected. The results demonstrate that the human CYP7A1 gene is not stimulated by dietary cholesterol in the intact animal, and this is attributable to the inability of the CYP7A1 gene promoter to interact with LXRalpha:RXR.

  6. Identification of genes that function in the TNF-alpha-mediated apoptotic pathway using randomized hybrid ribozyme libraries.


    Kawasaki, Hiroaki; Onuki, Reiko; Suyama, Eigo; Taira, Kazunari


    Now that the sequences of many genomes are available, methods are required for the rapid identification of functional genes. We describe here a simple system for the isolation of genes that function in the tumor necrosis factor-alpha (TNF-alpha)-mediated pathway of apoptosis, using RNA helicase-associated ribozyme libraries with randomized substrate-binding arms. Because target-site accessibility considerably limits the effective use of intracellular ribozymes, the effectiveness of a conventional ribozyme library has been low. To overcome this obstacle, we attached to ribozymes an RNA motif (poly(A)-tail) able to interact with endogenous RNA helicase(s) so that the resulting helicase-attached, hybrid ribozymes can more easily attack target sites regardless of their secondary or tertiary structures. When the phenotype of cells changes upon introduction of a ribozyme library, genes responsible for these changes may be identified by sequencing the active ribozyme clones. In the case of TNF-alpha-mediated apoptosis, when a ribozyme library was introduced into MCF-7 cells, surviving clones were completely or partially resistant to TNF-alpha-induced apoptosis. We identified many pro-apoptotic genes and partial sequences of previously uncharacterized genes using this method. Our gene discovery system should be generally applicable to the identification of functional genes in various systems.

  7. Gene-transfer study approval awaits more data

    SciTech Connect

    Marwick, C.


    Approval of the gene-transfer study in cancer patients has been delayed. The proposal was recommended for approval by a National Institutes of Health (NIH) advisory committee, but has been put on hold by James B. Wyngaarden, MD, NIH director, pending submission in writing of further information. Some of this information, now forthcoming, had been withheld because data on preliminary studies had been submitted to peer-reviewed journals. The study involves placing the gene for neomycin-resistance to tumor-infiltrating lymphocytes as a marker. When these cells are injected into the patient, the presence of the marker should enable their fate to be studied over a prolonged period and an improved antitumor regimen could result. The use of tumor-infiltrating lymphocytes as immunotherapy has been studied for two years at the NIH's National Cancer Institute. The patients' tumors are removed and the tumor-infiltrating lymphocytes are cultivated to obtain several billion cells. These cells are then injected back into the patient. Early clinical experience has shown a substantial decease in tumor size in some patients, but not in all, an no one knows why.

  8. Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

    PubMed Central

    Yamazaki, H; Ohmura, K; Nakayama, A; Takeichi, Y; Otozai, K; Yamasaki, M; Tamura, G; Yamane, K


    amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems. Images PMID:6413492

  9. Multiple Inter-Kingdom Horizontal Gene Transfers in the Evolution of the Phosphoenolpyruvate Carboxylase Gene Family

    PubMed Central

    Wang, Wen; Su, Bing


    Pepcase is a gene encoding phosphoenolpyruvate carboxylase that exists in bacteria, archaea and plants,playing an important role in plant metabolism and development. Most plants have two or more pepcase genes belonging to two gene sub-families, while only one gene exists in other organisms. Previous research categorized one plant pepcase gene as plant-type pepcase (PTPC) while the other as bacteria-type pepcase (BTPC) because of its similarity with the pepcase gene found in bacteria. Phylogenetic reconstruction showed that PTPC is the ancestral lineage of plant pepcase, and that all bacteria, protistpepcase and BTPC in plants are derived from a lineage of pepcase closely related with PTPC in algae. However, their phylogeny contradicts the species tree and traditional chronology of organism evolution. Because the diversification of bacteria occurred much earlier than the origin of plants, presumably all bacterialpepcase derived from the ancestral PTPC of algal plants after divergingfrom the ancestor of vascular plant PTPC. To solve this contradiction, we reconstructed the phylogeny of pepcase gene family. Our result showed that both PTPC and BTPC are derived from an ancestral lineage of gamma-proteobacteriapepcases, possibly via an ancient inter-kingdom horizontal gene transfer (HGT) from bacteria to the eukaryotic common ancestor of plants, protists and cellular slime mold. Our phylogenetic analysis also found 48other pepcase genes originated from inter-kingdom HGTs. These results imply that inter-kingdom HGTs played important roles in the evolution of the pepcase gene family and furthermore that HGTsare a more frequent evolutionary event than previouslythought. PMID:23251445

  10. Frequent, independent transfers of a catabolic gene from bacteria to contrasted filamentous eukaryotes

    PubMed Central

    Bruto, Maxime; Prigent-Combaret, Claire; Luis, Patricia; Moënne-Loccoz, Yvan; Muller, Daniel


    Even genetically distant prokaryotes can exchange genes between them, and these horizontal gene transfer events play a central role in adaptation and evolution. While this was long thought to be restricted to prokaryotes, certain eukaryotes have acquired genes of bacterial origin. However, gene acquisitions in eukaryotes are thought to be much less important in magnitude than in prokaryotes. Here, we describe the complex evolutionary history of a bacterial catabolic gene that has been transferred repeatedly from different bacterial phyla to stramenopiles and fungi. Indeed, phylogenomic analysis pointed to multiple acquisitions of the gene in these filamentous eukaryotes—as many as 15 different events for 65 microeukaryotes. Furthermore, once transferred, this gene acquired introns and was found expressed in mRNA databases for most recipients. Our results show that effective inter-domain transfers and subsequent adaptation of a prokaryotic gene in eukaryotic cells can happen at an unprecedented magnitude. PMID:24990676

  11. Frequent, independent transfers of a catabolic gene from bacteria to contrasted filamentous eukaryotes.


    Bruto, Maxime; Prigent-Combaret, Claire; Luis, Patricia; Moënne-Loccoz, Yvan; Muller, Daniel


    Even genetically distant prokaryotes can exchange genes between them, and these horizontal gene transfer events play a central role in adaptation and evolution. While this was long thought to be restricted to prokaryotes, certain eukaryotes have acquired genes of bacterial origin. However, gene acquisitions in eukaryotes are thought to be much less important in magnitude than in prokaryotes. Here, we describe the complex evolutionary history of a bacterial catabolic gene that has been transferred repeatedly from different bacterial phyla to stramenopiles and fungi. Indeed, phylogenomic analysis pointed to multiple acquisitions of the gene in these filamentous eukaryotes-as many as 15 different events for 65 microeukaryotes. Furthermore, once transferred, this gene acquired introns and was found expressed in mRNA databases for most recipients. Our results show that effective inter-domain transfers and subsequent adaptation of a prokaryotic gene in eukaryotic cells can happen at an unprecedented magnitude.

  12. Center for fetal monkey gene transfer for heart, lung, and blood diseases: an NHLBI resource for the gene therapy community.


    Tarantal, Alice F; Skarlatos, Sonia I


    The goals of the National Heart, Lung, and Blood Institute (NHLBI) Center for Fetal Monkey Gene Transfer for Heart, Lung, and Blood Diseases are to conduct gene transfer studies in monkeys to evaluate safety and efficiency; and to provide NHLBI-supported investigators with expertise, resources, and services to actively pursue gene transfer approaches in monkeys in their research programs. NHLBI-supported projects span investigators throughout the United States and have addressed novel approaches to gene delivery; "proof-of-principle"; assessed whether findings in small-animal models could be demonstrated in a primate species; or were conducted to enable new grant or IND submissions. The Center for Fetal Monkey Gene Transfer for Heart, Lung, and Blood Diseases successfully aids the gene therapy community in addressing regulatory barriers, and serves as an effective vehicle for advancing the field.

  13. [Gene transfer agent--a novel and widespread occurrence mechanism of gene exchange in ocean-a review].


    Cai, Haiyuan


    Gene Transfer Agent (GTA) particles are released by bacteria and resemble small, tailed bacteriophages. GTA particles contain small, random pieces of host DNA rather than GTA structural genes or a phage genome. Gene transfer mediated by GTA is efficient and species specific based on knowledge of currently best studied GTAs produced by 4 anaerobes. Genome sequencing projects have revealed a remarkable distribution of GTA gene clusters in the genomes of marine bacterioplankton, implying GTA may be an important mechanism for horizontal gene transfer in ocean. On basis of characterization of the 4 best studied GTAs, this review described GTAs released by numerically dominant marine bacteria, discussed their properties that were important for horizontal gene transfer in ocean, and gave future perspectives to advance GTA research.

  14. Evaluation of biolistic gene transfer methods in vivo using non-invasive bioluminescent imaging techniques

    PubMed Central


    Background Gene therapy continues to hold great potential for treating many different types of disease and dysfunction. Safe and efficient techniques for gene transfer and expression in vivo are needed to enable gene therapeutic strategies to be effective in patients. Currently, the most commonly used methods employ replication-defective viral vectors for gene transfer, while physical gene transfer methods such as biolistic-mediated ("gene-gun") delivery to target tissues have not been as extensively explored. In the present study, we evaluated the efficacy of biolistic gene transfer techniques in vivo using non-invasive bioluminescent imaging (BLI) methods. Results Plasmid DNA carrying the firefly luciferase (LUC) reporter gene under the control of the human Cytomegalovirus (CMV) promoter/enhancer was transfected into mouse skin and liver using biolistic methods. The plasmids were coupled to gold microspheres (1 μm diameter) using different DNA Loading Ratios (DLRs), and "shot" into target tissues using a helium-driven gene gun. The optimal DLR was found to be in the range of 4-10. Bioluminescence was measured using an In Vivo Imaging System (IVIS-50) at various time-points following transfer. Biolistic gene transfer to mouse skin produced peak reporter gene expression one day after transfer. Expression remained detectable through four days, but declined to undetectable levels by six days following gene transfer. Maximum depth of tissue penetration following biolistic transfer to abdominal skin was 200-300 μm. Similarly, biolistic gene transfer to mouse liver in vivo also produced peak early expression followed by a decline over time. In contrast to skin, however, liver expression of the reporter gene was relatively stable 4-8 days post-biolistic gene transfer, and remained detectable for nearly two weeks. Conclusions The use of bioluminescence imaging techniques enabled efficient evaluation of reporter gene expression in vivo. Our results demonstrate that

  15. The elucidation of gene transferring mechanism by ultrasound-responsive unmodified and mannose-modified lipoplexes.


    Un, Keita; Kawakami, Shigeru; Yoshida, Mitsuru; Higuchi, Yuriko; Suzuki, Ryo; Maruyama, Kazuo; Yamashita, Fumiyoshi; Hashida, Mitsuru


    The development of gene transfection methods enhancing the level of gene expression under simple and low-toxic condition is required for gene therapy in clinical. Our group has developed the ultrasound (US)-mediated gene transfection method using Man-PEG(2000) bubble lipoplexes, which are US-responsive and mannose-modified gene carriers, and succeeded in obtaining the enhanced gene expression in mannose receptor-expressing cells selectively by the gene transfer using Man-PEG(2000) bubble lipoplexes with US exposure in vitro and in vivo. Here, we investigated pDNA transferring mechanism followed by US exposure to unmodified and Man-PEG(2000) bubble lipoplexes, in particular, focused on US exposure timing. Following investigation of intracellular transferring characteristics, a large amount of pDNA was transferred into the cytoplasm followed by US-mediated destruction of bubble lipoplexes in the gene transfer using both bubble lipoplexes with US exposure. Moreover, the effective gene expression was obtained without TNF-α production when US was exposed until 5 min after the addition of bubble lipoplexes. These findings suggest that the gene transfer using unmodified and Man-PEG(2000) bubble lipoplexes with US exposure enables to transfer pDNA into the cytoplasm, and optimized US exposure timing is important to achieve the high level of gene expression and the low level of pro-inflammatory cytokine production.

  16. [Teratogenesis and gene targets of 17alpha-ethynylestradiol on embryonic development in zebrafish].


    Tong, Jun-Wei; Zhang, Jing-Pu; Meng, Jie


    The pharmaceutical ethynylestradiol (EE) is a potent endocrine modulator. Application enlargement of ethynylestradiol in clinics and abuse in livestock farming and fishing make it important to explore ethynylestradiol toxicological action on vertebrate embryonic development and to establish an in vivo method for EE toxicity detection efficiently and conveniently. In the present study, using a model animal zebrafish and 17alpha-ethynylestradiol as a representative compound, we have investigated EE2 teratogenicity, target tissues and target genes on zebrafish embryo. The results show that median teratogenesis concentration (TC50) of EE2 is 0.8 microg x mL(-1), and median lethal dose (LD50) is 3.3 microg x mL(-1). Targets of EE2 action were implicated in brain, eyes, heart, muscle, skeleton, pigment and viscera. Embryonic cardiac arrhythmia caused by EE2 is probably resulted from heart abnormal structure. The embryonic stage sensitive to EE2 mainly started at cleavage and last up to the organogenesis with time-accumulating effect. RT-PCR results indicate that EE2 treatment disturbed gene expression pattern at the early period of zebrafish embryonic development by suppressing transcription of gene boz that promotes brain development, upregulating genes for trunk and tail, such as ntl, spt, shh, and perturbing Nodal signal expression of TGFbeta superfamily, for example, cyc, sqt and oep. Using zebrafish, an efficient in vivo method for quick evaluation of EE toxicity on embryonic development has been developed.

  17. Cloning the mouse homologue of the human lysosomal acid {alpha}-glucosidase gene

    SciTech Connect

    Ding, J.H.; Yang, B.Z.; Liu, H.M.


    Pompe disease (GSD II) is an autosomal recessive disorder caused by a deficiency of lysosomal acid {alpha}-glucosidase (GAA). In an attempt to create a mouse model for Pompe disease, we isolated and characterized the gene encoding the mouse homologue of the human GAA. Twenty clones that extend from exon 2 to the poly(A) tail were isolated from a mouse liver cDNA library, but the remainder of the mRNA proved difficult to obtain by conventional cDNA library screening. Sequences spanning exons 1-2 were cloned by RACE from mouse liver RNA. The full-length liver GAA cDNA contains 3365 nucleotides with a coding region of 2859 nucleotides and a 394 base pair 3{prime}-nontranslated region. The deduced amino acid sequence of the mouse GAA shows 84% identity to the human GAA. Southern blot analysis demonstrated that the mouse GAA was encoded by a single copy gene. Then six bacteriophages containing DNA from the GAA gene were isolated by screening 10{sup 6} phage plaques of a mouse 129 genomic library using a mouse GAA cDNA as a probe. From one of these bacteriophages, an 11-kilobase EcoRI fragment containing exons 3 to 15 was subcloned and sequenced. Work is in progress using this genomic clone to disrupt the GAA gene in murine embryonic stem cells in order to create GSD II mice.

  18. Horizontal gene transfer of chlamydial-like tRNA genes into early vascular plant mitochondria.


    Knie, Nils; Polsakiewicz, Monika; Knoop, Volker


    Mitochondrial genomes of lycophytes are surprisingly diverse, including strikingly different transfer RNA (tRNA) gene complements: No mitochondrial tRNA genes are present in the spikemoss Selaginella moellendorffii, whereas 26 tRNAs are encoded in the chondrome of the clubmoss Huperzia squarrosa. Reinvestigating the latter we found that trnL(gag) and trnS(gga) had never before been identified in any other land plant mitochondrial DNA. Sensitive sequence comparisons showed these two tRNAs as well as trnN(guu) and trnS(gcu) to be very similar to their respective counterparts in chlamydial bacteria. We identified homologs of these chlamydial-type tRNAs also in other lycophyte, fern, and gymnosperm DNAs, suggesting horizontal gene transfer (HGT) into mitochondria in the early vascular plant stem lineages. These findings extend plant mitochondrial HGT to affect individual tRNA genes, to include bacterial donors, and suggest that Chlamydiae on top of their recently proposed key role in primary chloroplast establishment may also have participated in early tracheophyte genome evolution.

  19. Horizontal gene transfer and gene dosage drives adaptation to wood colonization in a tree pathogen.


    Dhillon, Braham; Feau, Nicolas; Aerts, Andrea L; Beauseigle, Stéphanie; Bernier, Louis; Copeland, Alex; Foster, Adam; Gill, Navdeep; Henrissat, Bernard; Herath, Padmini; LaButti, Kurt M; Levasseur, Anthony; Lindquist, Erika A; Majoor, Eline; Ohm, Robin A; Pangilinan, Jasmyn L; Pribowo, Amadeus; Saddler, John N; Sakalidis, Monique L; de Vries, Ronald P; Grigoriev, Igor V; Goodwin, Stephen B; Tanguay, Philippe; Hamelin, Richard C


    Some of the most damaging tree pathogens can attack woody stems, causing lesions (cankers) that may be lethal. To identify the genomic determinants of wood colonization leading to canker formation, we sequenced the genomes of the poplar canker pathogen, Mycosphaerella populorum, and the closely related poplar leaf pathogen, M. populicola. A secondary metabolite cluster unique to M. populorum is fully activated following induction by poplar wood and leaves. In addition, genes encoding hemicellulose-degrading enzymes, peptidases, and metabolite transporters were more abundant and were up-regulated in M. populorum growing on poplar wood-chip medium compared with M. populicola. The secondary gene cluster and several of the carbohydrate degradation genes have the signature of horizontal transfer from ascomycete fungi associated with wood decay and from prokaryotes. Acquisition and maintenance of the gene battery necessary for growth in woody tissues and gene dosage resulting in gene expression reconfiguration appear to be responsible for the adaptation of M. populorum to infect, colonize, and cause mortality on poplar woody stems.

  20. Horizontal gene transfer and gene dosage drives adaptation to wood colonization in a tree pathogen

    PubMed Central

    Dhillon, Braham; Feau, Nicolas; Aerts, Andrea L.; Beauseigle, Stéphanie; Bernier, Louis; Copeland, Alex; Foster, Adam; Gill, Navdeep; Henrissat, Bernard; Herath, Padmini; LaButti, Kurt M.; Levasseur, Anthony; Lindquist, Erika A.; Majoor, Eline; Ohm, Robin A.; Pangilinan, Jasmyn L.; Pribowo, Amadeus; Saddler, John N.; Sakalidis, Monique L.; de Vries, Ronald P.; Grigoriev, Igor V.; Goodwin, Stephen B.; Tanguay, Philippe; Hamelin, Richard C.


    Some of the most damaging tree pathogens can attack woody stems, causing lesions (cankers) that may be lethal. To identify the genomic determinants of wood colonization leading to canker formation, we sequenced the genomes of the poplar canker pathogen, Mycosphaerella populorum, and the closely related poplar leaf pathogen, M. populicola. A secondary metabolite cluster unique to M. populorum is fully activated following induction by poplar wood and leaves. In addition, genes encoding hemicellulose-degrading enzymes, peptidases, and metabolite transporters were more abundant and were up-regulated in M. populorum growing on poplar wood-chip medium compared with M. populicola. The secondary gene cluster and several of the carbohydrate degradation genes have the signature of horizontal transfer from ascomycete fungi associated with wood decay and from prokaryotes. Acquisition and maintenance of the gene battery necessary for growth in woody tissues and gene dosage resulting in gene expression reconfiguration appear to be responsible for the adaptation of M. populorum to infect, colonize, and cause mortality on poplar woody stems. PMID:25733908

  1. The ontogeny of alpha-fetoprotein gene expression in the mouse gastrointestinal tract

    PubMed Central


    The ontogeny of alpha-fetoprotein (AFP) gene expression has been examined in the fetal and adult mouse gastrointestinal tract. AFP mRNA constitutes approximately 0.1% of total mRNA in the fetal gut. The transcripts were localized by in situ hybridization to the epithelial cells lining the villi of the fetal gut. At birth, AFP mRNA declines rapidly to achieve low adult basal levels, which are not affected by different alleles of raf, a gene that determines the adult basal level of AFP mRNA in the liver. The basal level in the adult gut is the consequence of continued AFP transcription in a small number of enteroendocrine cells that are distributed infrequently on the villi. These cells were identified by double antibody staining with antibodies to chromogranin A, an enteroendocrine cell marker and AFP. Previous studies resulted in the generation of a line of transgenic mice containing an internally deleted AFP gene that was greatly overexpressed in the fetal gut. The basis for the inappropriately high level expression of the transgene was shown to be the consequence of very high levels of transcription in the epithelial cells of the villi rather than to expression in inappropriate cell types. The cis-acting DNA sequences required for expression of the AFP gene in the gut were investigated using Caco-2 cells, a human colon adenocarcinoma cell line. These experiments indicated that, with one exception, the regulatory elements required in both the promoter and enhancer regions of the gene coincided with those that are necessary for high level expression in the liver. The one exception was enhancer II, located 5 kbp of DNA upstream of the gene, which exhibited no activity in Caco-2 cells. PMID:1691194

  2. Transduction-Like Gene Transfer in the Methanogen Methanococcus voltae

    PubMed Central

    Bertani, Giuseppe


    Strain PS of Methanococcus voltae (a methanogenic, anaerobic archaebacterium) was shown to generate spontaneously 4.4-kbp chromosomal DNA fragments that are fully protected from DNase and that, upon contact with a cell, transform it genetically. This activity, here called VTA (voltae transfer agent), affects all markers tested: three different auxotrophies (histidine, purine, and cobalamin) and resistance to BES (2-bromoethanesulfonate, an inhibitor of methanogenesis). VTA was most effectively prepared by culture filtration. This process disrupted a fraction of the M. voltae cells (which have only an S-layer covering their cytoplasmic membrane). VTA was rapidly inactivated upon storage. VTA particles were present in cultures at concentrations of approximately two per cell. Gene transfer activity varied from a minimum of 2 × 10−5 (BES resistance) to a maximum of 10−3 (histidine independence) per donor cell. Very little VTA was found free in culture supernatants. The phenomenon is functionally similar to generalized transduction, but there is no evidence, for the time being, of intrinsically viral (i.e., containing a complete viral genome) particles. Consideration of VTA DNA size makes the existence of such viral particles unlikely. If they exist, they must be relatively few in number;perhaps they differ from VTA particles in size and other properties and thus escaped detection. Digestion of VTA DNA with the AluI restriction enzyme suggests that it is a random sample of the bacterial DNA, except for a 0.9-kbp sequence which is amplified relative to the rest of the bacterial chromosome. A VTA-sized DNA fraction was demonstrated in a few other isolates of M. voltae. PMID:10321998

  3. Parvalbumin gene transfer impairs skeletal muscle contractility in old mice.


    Murphy, Kate T; Ham, Daniel J; Church, Jarrod E; Naim, Timur; Trieu, Jennifer; Williams, David A; Lynch, Gordon S


    Sarcopenia is the progressive age-related loss of skeletal muscle mass associated with functional impairments that reduce mobility and quality of life. Overt muscle wasting with sarcopenia is usually preceded by a slowing of the rate of relaxation and a reduction in maximum force production. Parvalbumin (PV) is a cytosolic Ca(2+) buffer thought to facilitate relaxation in muscle. We tested the hypothesis that restoration of PV levels in muscles of old mice would increase the magnitude and hasten relaxation of submaximal and maximal force responses. The tibialis anterior (TA) muscles of young (6 month), adult (13 month), and old (26 month) C57BL/6 mice received electroporation-assisted gene transfer of plasmid encoding PV or empty plasmid (pcDNA3.1). Contractile properties of TA muscles were assessed in situ 14 days after transfer. In old mice, muscles with increased PV expression had a 40% slower rate of tetanic force development (p<0.01), and maximum twitch and tetanic force were 22% and 16% lower than control values, respectively (p<0.05). Muscles with increased PV expression from old mice had an 18% lower maximum specific (normalized) force than controls, and absolute force was `26% lower at higher stimulation frequencies (150-300 Hz, p<0.05). In contrast, there was no effect of increased PV expression on TA muscle contractile properties in young and adult mice. The impairments in skeletal muscle function in old mice argue against PV overexpression as a therapeutic strategy for ameliorating aspects of contractile dysfunction with sarcopenia and help clarify directions for therapeutic interventions for age-related changes in skeletal muscle structure and function.

  4. Novel "Superspreader" Bacteriophages Promote Horizontal Gene Transfer by Transformation.


    Keen, Eric C; Bliskovsky, Valery V; Malagon, Francisco; Baker, James D; Prince, Jeffrey S; Klaus, James S; Adhya, Sankar L


    Bacteriophages infect an estimated 10(23) to 10(25) bacterial cells each second, many of which carry physiologically relevant plasmids (e.g., those encoding antibiotic resistance). However, even though phage-plasmid interactions occur on a massive scale and have potentially significant evolutionary, ecological, and biomedical implications, plasmid fate upon phage infection and lysis has not been investigated to date. Here we show that a subset of the natural lytic phage population, which we dub "superspreaders," releases substantial amounts of intact, transformable plasmid DNA upon lysis, thereby promoting horizontal gene transfer by transformation. Two novel Escherichia coli phage superspreaders, SUSP1 and SUSP2, liberated four evolutionarily distinct plasmids with equal efficiency, including two close relatives of prominent antibiotic resistance vectors in natural environments. SUSP2 also mediated the extensive lateral transfer of antibiotic resistance in unbiased communities of soil bacteria from Maryland and Wyoming. Furthermore, the addition of SUSP2 to cocultures of kanamycin-resistant E. coli and kanamycin-sensitive Bacillus sp. bacteria resulted in roughly 1,000-fold more kanamycin-resistant Bacillus sp. bacteria than arose in phage-free controls. Unlike many other lytic phages, neither SUSP1 nor SUSP2 encodes homologs to known hydrolytic endonucleases, suggesting a simple potential mechanism underlying the superspreading phenotype. Consistent with this model, the deletion of endonuclease IV and the nucleoid-disrupting protein ndd from coliphage T4, a phage known to extensively degrade chromosomal DNA, significantly increased its ability to promote plasmid transformation. Taken together, our results suggest that phage superspreaders may play key roles in microbial evolution and ecology but should be avoided in phage therapy and other medical applications.

  5. Transduction-like gene transfer in the methanogen Methanococcus voltae

    NASA Technical Reports Server (NTRS)

    Bertani, G.


    Strain PS of Methanococcus voltae (a methanogenic, anaerobic archaebacterium) was shown to generate spontaneously 4.4-kbp chromosomal DNA fragments that are fully protected from DNase and that, upon contact with a cell, transform it genetically. This activity, here called VTA (voltae transfer agent), affects all markers tested: three different auxotrophies (histidine, purine, and cobalamin) and resistance to BES (2-bromoethanesulfonate, an inhibitor of methanogenesis). VTA was most effectively prepared by culture filtration. This process disrupted a fraction of the M. voltae cells (which have only an S-layer covering their cytoplasmic membrane). VTA was rapidly inactivated upon storage. VTA particles were present in cultures at concentrations of approximately two per cell. Gene transfer activity varied from a minimum of 2 x 10(-5) (BES resistance) to a maximum of 10(-3) (histidine independence) per donor cell. Very little VTA was found free in culture supernatants. The phenomenon is functionally similar to generalized transduction, but there is no evidence, for the time being, of intrinsically viral (i.e., containing a complete viral genome) particles. Consideration of VTA DNA size makes the existence of such viral particles unlikely. If they exist, they must be relatively few in number;perhaps they differ from VTA particles in size and other properties and thus escaped detection. Digestion of VTA DNA with the AluI restriction enzyme suggests that it is a random sample of the bacterial DNA, except for a 0.9-kbp sequence which is amplified relative to the rest of the bacterial chromosome. A VTA-sized DNA fraction was demonstrated in a few other isolates of M. voltae.

  6. An alpha-amylase inhibitor gene from Phaseolus coccineus encodes a protein with potential for control of coffee berry borer (Hypothenemus hampei).


    de Azevedo Pereira, Railene; Nogueira Batista, João Aguiar; da Silva, Maria Cristina Mattar; Brilhante de Oliveira Neto, Osmundo; Zangrando Figueira, Edson Luiz; Valencia Jiménez, Arnubio; Grossi-de-Sa, Maria Fátima


    Plant alpha-amylase inhibitors are proteins found in several plants, and play a key role in natural defenses. In this study, a gene encoding an alpha-amylase inhibitor, named alphaAI-Pc1, was isolated from cotyledons of Phaseolus coccineus. This inhibitor has an enhanced primary structure to P. vulgaris alpha-amylase inhibitors (alpha-AI1 and alpha-AI2). The alphaAI-Pc1 gene, constructed with the PHA-L phytohemaglutinin promoter, was introduced into tobacco plants, with its expression in regenerated (T0) and progeny (T1) transformant plants monitored by PCR amplification, enzyme-linked immunosorbent assay (ELISA) and immunoblot analysis, respectively. Seed protein extracts from selected transformants reacted positively with a polyclonal antibody raised against alphaAI-1, while no reaction was observed with untransformed tobacco plants. Immunological assays showed that the alphaAI-Pc1 gene product represented up to 0.05% of total soluble proteins in T0 plants seeds. Furthermore, recombinant alphaAI-Pc1 expressed in tobacco plants was able to inhibit 65% of digestive H. hampei alpha-amylases. The data herein suggest that the protein encoded by the alphaAI-Pc1 gene has potential to be introduced into coffee plants in order to increase their resistance to the coffee berry borer.

  7. Enzymes that hydrolyze adenine nucleotides in platelets and polymorphisms in the alpha2 gene of integrin alpha2beta1 in patients with von Willebrand disease.


    Santos, Karen Freitas; Battisti, Vanessa; Corrêa, Maísa de Carvalho; Mann, Thaís Rapachi; Pereira, Renata da Silva; Araújo, Maria do Carmo; Brülê, Alice Odete; Schetinger, Maria Rosa Chitolina; Morsch, Vera Maria


    Von Willebrand disease (VWD) is one of the most common inherited bleeding diseases caused by a qualitative or quantitative deficiency of the von Willebrand factor (FvW). FvW is a multimeric glycoprotein synthesized by megakaryocytes and endothelial cells and it is present in the subendothelial matrix, blood plasma, platelets, and endothelium. This glycoprotein plays an important role in thrombus formation by initiating platelet adhesion to sites of injury as well as platelet aggregation. The aim of this study was to evaluate the activities of enzymes that hydrolyze adenine nucleotides in platelets, ristocetin-induced platelet aggregation (RIPA), and polymorphisms of the alpha2 gene of alpha2beta1 integrin from VWD patients. Platelet nucleoside triphosphate diphosphohydrolase (NTPDase), 5'-nucleotidase, and ecto-nucleotide pyrophosphatase/phosphodiesterase (E-NPP) activities were verified in 14 VWD patients. For RIPA determination, a final concentration of 1.25 mg/ml of ristocetin was used. Polymorphisms of the alpha2 gene were analyzed through PCR. Platelet NTPDase and E-NPP were decreased in VWD patients. 5'-Nucleotidase activity was not statistically significant between controls and VWD patients. RIPA was significantly reduced, with an allelic frequency of 78.57% for 807C in VWD patients. Our results indicated reduced platelet NTPDase and E-NPP activities which might be related to the low platelet adhesiveness. The prevalence of the 807C allele might account for the variability in bleeding in VWD.

  8. Multimodality Imaging of Gene Transfer with a Receptor-Based Reporter Gene

    PubMed Central

    Chen, Ron; Parry, Jesse J.; Akers, Walter J.; Berezin, Mikhail Y.; El Naqa, Issam M.; Achilefu, Samuel; Edwards, W. Barry; Rogers, Buck E.


    Gene therapy trials have traditionally used tumor and tissue biopsies for assessing the efficacy of gene transfer. Non-invasive imaging techniques offer a distinct advantage over tissue biopsies in that the magnitude and duration of gene transfer can be monitored repeatedly. Human somatostatin receptor subtype 2 (SSTR2) has been used for the nuclear imaging of gene transfer. To extend this concept, we have developed a somatostatin receptor–enhanced green fluorescent protein fusion construct (SSTR2-EGFP) for nuclear and fluorescent multimodality imaging. Methods An adenovirus containing SSTR2-EGFP (AdSSTR2-EGFP) was constructed and evaluated in vitro and in vivo. SCC-9 human squamous cell carcinoma cells were infected with AdEGFP, AdSSTR2, or AdSSTR2-EGFP for in vitro evaluation by saturation binding, internalization, and fluorescence spectroscopy assays. In vivo biodistribution and nano-SPECT imaging studies were conducted with mice bearing SCC-9 tumor xenografts directly injected with AdSSTR2-EGFP or AdSSTR2 to determine the tumor localization of 111In-diethylenetriaminepentaacetic acid (DTPA)-Tyr3-octreotate. Fluorescence imaging was conducted in vivo with mice receiving intratumoral injections of AdSSTR2, AdSSTR2-EGFP, or AdEGFP as well as ex vivo with tissues extracted from mice. Results The similarity between AdSSTR2-EGFP and wild-type AdSSTR2 was demonstrated in vitro by the saturation binding and internalization assays, and the fluorescence emission spectra of cells infected with AdSSTR2-EGFP was almost identical to the spectra of cells infected with wild-type AdEGFP. Biodistribution studies demonstrated that the tumor uptake of 111In-DTPA-Tyr3-octreotate was not significantly different (P > 0.05) when tumors (n = 5) were injected with AdSSTR2 or AdSSTR2-EGFP but was significantly greater than the uptake in control tumors. Fluorescence was observed in tumors injected with AdSSTR2-EGFP and AdEGFP in vivo and ex vivo but not in tumors injected with AdSSTR2

  9. Spectrum of alpha-globin gene mutations among premarital Baluch couples in southeastern Iran

    PubMed Central

    Miri-Moghaddam, Ebrahim; Nikravesh, Abass; Gasemzadeh, Negin; Badaksh, Mahin; Rakhshi, Nahid


    Background: Alpha thalassemia (α-thal) is one of the most common hemoglobinopathies worldwide. The aim of this study was to investigate the spectrum of α-thal mutations among premarital Baluch couples in southeastern Iran. Subjects and Methods: We assessed 1215 individuals by multiplex gap polymerase chain reaction (gap-PCR) and amplification refractory mutation system (ARMS-PCR). Results: Of the 1215 participants with mean age of 23±5.7 years, 62.3% lived in urban areas, and the rate of consanguineous marriage was 68.1%. Five mutations were identified, the most frequent one was –α3.7 (rightward) with a frequency of 76.5%, followed by α−5 nt (16.8%), α2/ Codon 19(-G) (4%), –α4.2 (leftward)(2.4%), – –MED (0.3%) among mutated alleles of the α -globin gene. Conclusion : Knowing the alpha-genotype is helpful for genetic counseling, microcytic anemia discrimination and hemoglobinopathy prevention. PMID:26261699

  10. PPAR{alpha} does not suppress muscle-associated gene expression in brown adipocytes but does influence expression of factors that fingerprint the brown adipocyte

    SciTech Connect

    Walden, Tomas B.; Petrovic, Natasa; Nedergaard, Jan


    Brown adipocytes and myocytes develop from a common adipomyocyte precursor. PPAR{alpha} is a nuclear receptor important for lipid and glucose metabolism. It has been suggested that in brown adipose tissue, PPAR{alpha} represses the expression of muscle-associated genes, in this way potentially acting to determine cell fate in brown adipocytes. To further understand the possible role of PPAR{alpha} in these processes, we measured expression of muscle-associated genes in brown adipose tissue and brown adipocytes from PPAR{alpha}-ablated mice, including structural genes (Mylpf, Tpm2, Myl3 and MyHC), regulatory genes (myogenin, Myf5 and MyoD) and a myomir (miR-206). However, in our hands, the expression of these genes was not influenced by the presence or absence of PPAR{alpha}, nor by the PPAR{alpha} activator Wy-14,643. Similarly, the expression of genes common for mature brown adipocyte and myocytes (Tbx15, Meox2) were not affected. However, the brown adipocyte-specific regulatory genes Zic1, Lhx8 and Prdm16 were affected by PPAR{alpha}. Thus, it would not seem that PPAR{alpha} represses muscle-associated genes, but PPAR{alpha} may still play a role in the regulation of the bifurcation of the adipomyocyte precursor into a brown adipocyte or myocyte phenotype.

  11. Microbial Evolution Is in the Cards: Horizontal Gene Transfer in the Classroom

    ERIC Educational Resources Information Center

    Kagle, Jeanne; Hay, Anthony G.


    Horizontal gene transfer, the exchange of genetic material between bacteria, is a potentially important factor in the degradation of synthetic compounds introduced to the environment and in the acquisition of other characteristics including antibiotic resistance. This game-based activity illustrates the role of horizontal gene transfer in the…

  12. Targeted gene transfer of different genes to presynaptic and postsynaptic neocortical neurons connected by a glutamatergic synapse.


    Zhang, Guo-rong; Zhao, Hua; Cao, Haiyan; Li, Xu; Geller, Alfred I


    Genetic approaches to analyzing neuronal circuits and learning would benefit from a technology to first deliver a specific gene into presynaptic neurons, and then deliver a different gene into an identified subset of their postsynaptic neurons, connected by a specific synapse type. Here, we describe targeted gene transfer across a neocortical glutamatergic synapse, using as the model the projection from rat postrhinal to perirhinal cortex. The first gene transfer, into the presynaptic neurons in postrhinal cortex, used a virus vector and standard gene transfer procedures. The vector expresses an artificial peptide neurotransmitter containing a dense core vesicle targeting domain, a NMDA NR1 subunit binding domain (from a monoclonal antibody), and the His tag. Upon release, this peptide neurotransmitter binds to NMDA receptors on the postsynaptic neurons. Antibody-mediated targeted gene transfer to these postsynaptic neurons in perirhinal cortex used a His tag antibody, as the peptide neurotransmitter contains the His tag. Confocal microscopy showed that with untargeted gene transfer, ~3% of the transduced presynaptic axons were proximal to a transduced postsynaptic dendrite. In contrast, with targeted gene transfer, ≥ 20% of the presynaptic axons were proximal to a transduced postsynaptic dendrite. Targeting across other types of synapses might be obtained by modifying the artificial peptide neurotransmitter to contain a binding domain for a different neurotransmitter receptor. This technology may benefit elucidating how specific neurons and subcircuits contribute to circuit physiology, behavior, and learning.

  13. Genetic polymorphism of estrogen receptor alpha gene in Egyptian women with type II diabetes mellitus

    PubMed Central

    Motawi, Tarek M.K.; El-Rehany, Mahmoud A.; Rizk, Sherine M.; Ramzy, Maggie M.; el-Roby, Doaa M.


    Estrogen might play an important role in type 2 diabetes mellitus pathogenesis. A number of polymorphisms have been reported in the estrogen receptor alpha gene including the XbaI and PvuII restriction enzyme polymorphisms. The aim of this study was to determine if ESRα gene polymorphisms are associated with type 2 diabetes mellitus and correlated with lipid profile. Ninety diabetic Egyptian patients were compared with forty healthy controls. ESRα genotyping of PvuII and XbaI was performed using restriction fragment length polymorphism analysis. Our study showed that there is more significant difference in the frequency of C and G polymorphic allele between patients and control groups in PvuII and XbaI respectively. Also carriers of minor C and G alleles of PvuII and XbaI gene polymorphisms were associated with increased fasting blood glucose and disturbance in lipid profile as there is an increase in total cholesterol, triglycerides and Low density lipoprotein. So findings of present study suggest the possibility that PvuII and XbaI polymorphisms in ERα are related to T2DM and with increased serum lipids among Egyptian population. PMID:26401488

  14. Estrogen receptor alpha gene amplification in breast cancer: 25 years of debate.


    Holst, Frederik


    Twenty-five years ago, Nembrot and colleagues reported amplification of the estrogen receptor alpha gene (ESR1) in breast cancer, initiating a broad and still ongoing scientific debate on the prevalence and clinical significance of this genetic aberration, which affects one of the most important genes in breast cancer. Since then, a multitude of studies on this topic has been published, covering a wide range of divergent results and arguments. The reported prevalence of this alteration in breast cancer ranges from 0% to 75%, suggesting that ESR1 copy number analysis is hampered by technical and interpreter issues. To date, two major issues related to ESR1 amplification remain to be conclusively addressed: (1) The extent to which abundant amounts of messenger RNA can mimic amplification in standard fluorescence in situ hybridization assays in the analysis of strongly expressed genes like ESR1, and (2) the clinical relevance of ESR1 amplification: Such relevance is strongly disputed, with data showing predictive value for response as well as for resistance of the cancer to anti-estrogen therapies, or for subsequent development of cancers in the case of precursor lesions that display amplification of ESR1. This review provides a comprehensive summary of the various views on ESR1 amplification, and highlights explanations for the contradictions and conflicting data that could inform future ESR1 research.

  15. Persistent gene expression in mouse nasal epithelia following feline immunodeficiency virus-based vector gene transfer.


    Sinn, Patrick L; Burnight, Erin R; Hickey, Melissa A; Blissard, Gary W; McCray, Paul B


    Gene transfer development for treatment or prevention of cystic fibrosis lung disease has been limited by the inability of vectors to efficiently and persistently transduce airway epithelia. Influenza A is an enveloped virus with natural lung tropism; however, pseudotyping feline immunodeficiency virus (FIV)-based lentiviral vector with the hemagglutinin envelope protein proved unsuccessful. Conversely, pseudotyping FIV with the envelope protein from influenza D (Thogoto virus GP75) resulted in titers of 10(6) transducing units (TU)/ml and conferred apical entry into well-differentiated human airway epithelial cells. Baculovirus GP64 envelope glycoproteins share sequence identity with influenza D GP75 envelope glycoproteins. Pseudotyping FIV with GP64 from three species of baculovirus resulted in titers of 10(7) to 10(9) TU/ml. Of note, GP64 from Autographa californica multicapsid nucleopolyhedrovirus resulted in high-titer FIV preparations (approximately 10(9) TU/ml) and conferred apical entry into polarized primary cultures of human airway epithelia. Using a luciferase reporter gene and bioluminescence imaging, we observed persistent gene expression from in vivo gene transfer in the mouse nose with A. californica GP64-pseudotyped FIV (AcGP64-FIV). Longitudinal bioluminescence analysis documented persistent expression in nasal epithelia for approximately 1 year without significant decline. According to histological analysis using a LacZ reporter gene, olfactory and respiratory epithelial cells were transduced. In addition, methylcellulose-formulated AcGP64-FIV transduced mouse nasal epithelia with much greater efficiency than similarly formulated vesicular stomatitis virus glycoprotein-pseudotyped FIV. These data suggest that AcGP64-FIV efficiently transduces and persistently expresses a transgene in nasal epithelia in the absence of agents that disrupt the cellular tight junction integrity.

  16. Thixotropic solutions enhance viral-mediated gene transfer to airway epithelia.


    Seiler, Michael P; Luner, Paul; Moninger, Thomas O; Karp, Philip H; Keshavjee, Shaf; Zabner, Joseph


    Adenovirus-mediated gene transfer to airway epithelia is inefficient in part because its receptor is absent on the apical surface of the airways. Targeting adenovirus to other receptors, increasing the viral concentration, and even prolonging the incubation time with adenovirus vectors can partially overcome the lack of receptors and facilitate gene transfer. Unfortunately, mucociliary clearance would prevent prolonged incubation time in vivo. Thixotropic solutions (TS) are gels that upon a vigorous shearing force reversibly become liquid. We hypothesized that formulating recombinant adenoviruses in TS would decrease virus clearance and thus enhance gene transfer to the airway epithelia. We found that clearance of virus-sized fluorescent beads by human airway epithelia in vitro and by monkey trachea in vivo were markedly decreased when the beads were formulated in TS compared with phosphate-buffered saline (PBS). Adenovirus formulated in TS significantly increased adenovirus-mediated gene transfer of a reporter gene in human airway epithelia in vitro and in murine airway epithelia in vivo. Furthermore, an adenovirus encoding the cystic fibrosis transmembrane regulator (CFTR) gene (AdCFTR) formulated in TS was more efficient in correcting the chloride transport defect in cystic fibrosis airway epithelia than AdCFTR formulated in PBS. These data indicate a novel strategy to augment the efficiency of gene transfer to the airways that may be applicable to a number of different gene transfer vectors and could be of value in gene transfer to cystic fibrosis (CF) airway epithelia in vivo.

  17. Horizontal gene transfer in the acquisition of novel traits by metazoans

    PubMed Central

    Boto, Luis


    Horizontal gene transfer is accepted as an important evolutionary force modulating the evolution of prokaryote genomes. However, it is thought that horizontal gene transfer plays only a minor role in metazoan evolution. In this paper, I critically review the rising evidence on horizontally transferred genes and on the acquisition of novel traits in metazoans. In particular, I discuss suspected examples in sponges, cnidarians, rotifers, nematodes, molluscs and arthropods which suggest that horizontal gene transfer in metazoans is not simply a curiosity. In addition, I stress the scarcity of studies in vertebrates and other animal groups and the importance of forthcoming studies to understand the importance and extent of horizontal gene transfer in animals. PMID:24403327

  18. Comparative quantification of pharmacodynamic parameters of chiral compounds (RRR- vs. all-rac-alpha tocopherol) by global gene expression profiling.


    Muller, Patrick Y; Netscher, Thomas; Frank, Jan; Stoecklin, Elisabeth; Rimbach, Gerald; Barella, Luca


    Pharmacologically active compounds (e.g. from the groups of pharmaceutical drugs, cofactors or vitamins) often consist of two or more stereoisomers (enantiomers or diastereoisomers) which may differ in their pharmacodynamic/kinetic, toxicological and biological properties. A well-known example is vitamin E which is predominantly administered as two different forms, one derived from natural sources (mainly soybeans), and one from production by chemical total-synthesis. While vitamin E from natural sources occurs as a single stereoisomer (RRR-alpha-tocopherol), synthetic vitamin E (all-rac-alpha-tocopherol) is an equimolar mixture of eight stereoisomers. Based on a number of animal studies it has been suggested that the biological potency of natural-source vitamin E is 1.36 greater compared to its counterpart produced by chemical synthesis. In this study, we have used the Affymetrix GeneChip technology to evaluate the feasibility of a new bio-assay where the gene regulatory activities of RRR-alpha-tocopherol and all-rac-alpha-tocopherol were quantified and compared on the genome-wide level. For this purpose, HepG2 cells were supplemented with increasing amounts of RRR- or all-rac-alpha-tocopherol for 7 days. Genes showing a dose-related induction/repression were identified by global gene expression profiling. Our findings show that RRR- and all-rac-alpha-tocopherol share an identical transcriptional activity, i.e. induce/repress the expression of the same set of genes. Based on the transcriptional dose-response data, EC50 and IC50 values were determined for each of these genes. The feasibility of calculating a "transcriptional potency factor" of RRR- vs. all-rac-e-tocopherol was evaluated by dividing the EC50/IC50 of RRR-alpha-tocopherol by the corresponding EC50/IC50 of all-rac-alpha-tocopherol for every of the vitamin E responsive genes. Using this approach we have calculated 215 single biopotency ratios. Subsequently, the mean of all potency ratios was found to be

  19. Sanfilippo syndrome type B: cDNA and gene encoding human {alpha}-N-acetylglucosaminidase

    SciTech Connect

    Zhao, H.G.; Lopez, R.; Rennecker, J.


    Deficiency of the lysosomal enzyme {alpha}-N-acetlyglucosaminidase underlies the type B Sanfilippo syndrome (MPS III B), a mucopolysaccharide storage disease with profound neurologic deterioration. We are acquiring tools to study the molecular basis of the disorder. The enzyme was purified from bovine testis; after ConA-, DEAE- and phenyl-Sepharose chromatography, it was subjected to SDS-PAGE without preheating. Of two bands of activity detected on the gel, 170 kDa and 87 kDa, the larger one, which coincided with a well-defined Coomassie blue band, was selected for sequence analysis. Degenerate 17-base oligonucleotides, corresponding to the ends of an internal 23 amino acid sequence, were used for RT-PCR of RNA from human fibroblasts. A 41-mer was synthesized from the sequence of the RT-PCR product and used to screen a human testis cDNA library. A number of cDNA inserts were isolated, all lacking the 5{prime} end and none longer than 1.7 kb. An additional 300 bp segment has been obtained by RACE. The cDNA sequence accounts for 9 of 11 peptides, allowing for species difference. Northern analysis of fibroblast RNA with a 1.5 kb cDNA probe showed the presence of a 3 kb mRNA; marked deficiency of this mRNA in two MPS III B fibroblast lines confirmed the authenticity of the cloned cDNA. While no homologous amino acid sequence has been found in a search of GenBank, the nucleotide sequence (interrupted by 4 introns) is present in a flanking region upstream of an unrelated gene on chromosome 17q11-21 (human 17{beta}-hydroxysteroid dehydrogenase). This must therefore be the chromosomal locus of the {alpha}-N-acetylglucosaminidase gene and of MPS III B.

  20. Gene transfer for neovascular age-related macular degeneration.


    Campochiaro, Peter A


    Age-related macular degeneration (AMD) is a complex disease that has two phases: a degenerative phase often referred to as nonneovascular AMD (non-NVAMD) or dry AMD and a phase dominated by growth of new blood vessels in the subretinal space, referred to as NVAMD or wet AMD. Advances in the understanding of the molecular pathogenesis of NVAMD have led to new drug therapies that have provided major benefits to patients. However, those treatments require frequent intraocular injections that in many patients must be continued indefinitely to maintain visual benefits. Gene transfer to augment expression of endogenous antiangiogenic proteins is an alternative approach that has the potential to provide long-term stability in patients with NVAMD. Studies in animal models that mimic aspects of NVAMD have identified several possible transgenes, and a clinical trial in patients with advanced NVAMD has suggested that the approach may be feasible. Many important questions remain, but the rationale and preliminary data are compelling. The results of two ongoing clinical trials may answer several of the questions and help direct future research.

  1. Phosphatidylserine immobilization of lentivirus for localized gene transfer

    PubMed Central

    Shin, Seungjin; Tuinstra, Hannah M.; Salvay, David M.; Shea, Lonnie D.


    Localized and efficient gene transfer can be promoted by exploiting the interaction between the vector and biomaterial. Regulation of the vector-material interaction was investigated by capitalizing on the binding between lentivirus and phosphatidylserine (PS), a component of the plasma membrane. PS was incorporated into microspheres composed of the copolymers of lactide and glycolide (PLG) using an emulsion process. Increasing the weight ratio of PS to PLG led to a greater incorporation of PS. Lentivirus, but not adenovirus, associated with PS-PLG microspheres, and binding was specific to PS relative to PLG alone or PLG modified with phosphatidylcholine. Immobilized lentivirus produced large numbers of transduced cells, and increased transgene expression relative to virus alone. Microspheres were subsequently formed into porous tissue engineering scaffolds, with retention of lentivirus binding. Lentivirus immobilization resulted in long-term and localized expression within a subcutaneously implanted scaffold. Microspheres were also formed into multiple channel bridges for implantation into the spinal cord. Lentivirus delivery from the bridge produced maximal expression at the implant and a gradient of expression rostrally and caudally. This specific binding of lentiviral vectors to biomaterial scaffolds may provide a versatile tool for numerous applications in regenerative medicine or within model systems that investigate tissue development. PMID:20206382

  2. Inactivation of the thymidine kinase gene after in vitro modification with benzo(a)pyrene-diol-epoxide and transfer to LTK- cells as a eukaryotic test for carcinogens.


    Schaefer-Ridder, M; Moeroey, T; Engelhardt, U


    A recombinant plasmid containing the thymidine kinase (TK) gene (pAGO; 6.36 kilobases) was reacted in vitro with (+/-)-7 beta, 8 alpha-dihydroxy-9 alpha, 10 alpha-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene, an ultimate carcinogenic metabolite of benzo(a)pyrene. The covalent binding of the metabolite to the circular forms of pAGO was visible by a drastic change in their mobility during agarose gel electrophoresis. The 4% modified DNA was only partially restricted by different endonucleases. Modification and limited restriction were correlated to the biological activity by transfer of the plasmid (TK gene), modified and unmodified, to TK-deficient cells. Upon transfection of mouse LTK- cells with modified plasmid or modified TK gene, no or only a few TK-positive cells were obtained, in contrast to the formation of many colonies after transfection with the unmodified plasmid (gene). Benzo(a)-pyrene itself and phenanthrene oxide, a weakly reactive but noncarcinogenic chemical, did not induce this effect. The reactive diol-epoxides of noncarcinogenic benzo(a)acridine and carcinogenic benzo(c)acridine showed a weaker but similar decreasing effect on the formation of TK+ clones. This inhibition of transformation efficiency suggests inactivation of the gene by chemical modification. Our experimental approach challenges the repair capacity of the eukaryotic cell and thus renders the strategy suitable not only as a eukaryotic test for carcinogens but also as a tool for the study of carcinogenesis as aberrant gene expression.

  3. Cooperative signaling by alpha 5 beta 1 and alpha 4 beta 1 integrins regulates metalloproteinase gene expression in fibroblasts adhering to fibronectin

    PubMed Central


    Rabbit synovial fibroblasts (RSF) express basal levels of the metalloproteinases (MMP) collagenase, stromelysin-1 and 92-kD gelatinase when plated on intact fibronectin (FN), but elevated levels when plated on either the central RGD-containing cell-binding region of FN (120FN) or antibody against the alpha 5 beta 1 integrin, suggesting that domains outside 120FN may suppress the induction of MMP (Werb, Z., P. M. Tremble, O. Behrendtsen, E. Crowley, and C.H. Damsky. 1989. J. Cell Biol. 109:877-889). We therefore attempted to reconstitute the basal signaling of intact FN by plating RSF on 120FN together with domains of FN outside this region. Large COOH-terminal fragments containing both the heparin-binding and HICS domains suppressed MMP when combined with 120FN. To map the active sequences, peptides from this region and larger fragments that did, or did not, include the CS-1 portion of IIICS were tested. Only CS-1 peptide, or larger fragments containing CS-1, suppressed MMP expression induced by 120FN. In contrast, peptide V from the heparin-binding region, shown previously to stimulate focal contact formation, further enhanced MMP expression by RSF when present on the substrate with 120FN. RSF expressed alpha 4 beta 1 integrin, the receptor for CS-1, and the anti-alpha 4 mAb blocked the ability of CS-1 to suppress MMP induction by 120FN. These results show that signals modulating MMP expression and focal contact assembly are regulated independently, and that cooperative signaling by alpha 5 beta 1 and alpha 4 beta 1 integrins plays a dominant role in regulating expression of these extracellular matrix-remodeling genes in response to FN. This work demonstrates directly the modular way in which information in the extracellular matrix is detected and processed by cell surface receptors. PMID:7537277

  4. Human tumor necrosis factor receptor (p55) and interleukin 10 gene transfer in the mouse reduces mortality to lethal endotoxemia and also attenuates local inflammatory responses

    PubMed Central


    Anticytokine therapies have been promulgated in gram-negative sepsis as a means of preventing or neutralizing excessive production of proinflammatory cytokines. However, systemic administration of cytokine inhibitors is an inefficient means of targeting excessive production in individual tissue compartments. In the present study, human gene transfer was used to deliver to organs of the reticuloendothelial system antagonists that either inhibit tumor necrosis factor-alpha (TNF- alpha) synthesis or block its interactions with cellular receptors. Mice were treated intraperitoneally with cationic liposomes containing 200 micrograms of either a pCMV (cytomegalovirus)/p55 expression plasmid that contains the extracellular domain and transmembrane region of the human p55 TNF receptor, or a pcD-SR-alpha/hIL-10 expression plasmid containing the DNA for human interleukin 10. 48 h later, mice were challenged with lipopolysaccharide (LPS) and D-galactosamine. Pretreatment of mice with p55 or IL-10 cDNA-liposome complexes improved survival (p < 0.01) to LPS-D-galactosamine. In additional studies, intratracheal administration of IL-10 DNA-liposome complexes 48 h before an intratracheal LPS challenge reduced pulmonary TNF-alpha levels by 62% and decreased neutrophil infiltration in the lung by 55% as measured by myeloperoxidase activity (both p < 0.05). Gene transfer with cytokine inhibitors is a promising option for the treatment of both the systemic and local sequelae of septic shock. PMID:7760015

  5. Distinct functions for thyroid hormone receptors alpha and beta in brain development indicated by differential expression of receptor genes.

    PubMed Central

    Forrest, D; Hallböök, F; Persson, H; Vennström, B


    Thyroid hormones are essential for correct brain development, and since vertebrates express two thyroid hormone receptor genes (TR alpha and beta), we investigated TR gene expression during chick brain ontogenesis. In situ hybridization analyses showed that TR alpha mRNA was widely expressed from early embryonic stages, whereas TR beta was sharply induced after embryonic day 19 (E19), coinciding with the known hormone-sensitive period. Differential expression of TR mRNAs was striking in the cerebellum: TR beta mRNA was induced in white matter and granule cells after the migratory phase, suggesting a main TR beta function in late, hormone-dependent glial and neuronal maturation. In contrast, TR alpha mRNA was expressed in the earlier proliferating and migrating granule cells, and in the more mature granular and Purkinje cell layers after hatching, indicating a role for TR alpha in both immature and mature neural cells. Surprisingly, both TR genes were expressed in early cerebellar outgrowth at E9, before known hormone requirements, with TR beta mRNA restricted to the ventricular epithelium of the metencephalon and TR alpha expressed in migrating cells and the early granular layer. The results implicate TRs with distinct functions in the early embryonic brain as well as in the late phase of hormone requirement. Images PMID:1991448

  6. Gene recruitment--a common mechanism in the evolution of transfer RNA gene families.


    Wang, Xiujuan; Lavrov, Dennis V


    The evolution of alloacceptor transfer RNAs (tRNAs) has been traditionally thought to occur vertically and reflect the evolution of the genetic code. Yet there have been several indications that a tRNA gene could evolve horizontally, from a copy of an alloacceptor tRNA gene in the same genome. Earlier, we provided the first unambiguous evidence for the occurrence of such "tRNA gene recruitment" in nature--in the mitochondrial (mt) genome of the demosponge Axinella corrugata. Yet the extent and the pattern of this process in the evolution of tRNA gene families remained unclear. Here we analyzed tRNA genes from 21 mt genomes of demosponges as well as nuclear genomes of rhesus macaque, chimpanzee and human. We found four new cases of alloacceptor tRNA gene recruitment in mt genomes and eleven cases in the nuclear genomes. In most of these cases we observed a single nucleotide substitution at the middle position of the anticodon, which resulted in the change of not only the tRNA's amino-acid identity but also the class of the amino-acyl tRNA synthetases (aaRSs) involved in amino-acylation. We hypothesize that the switch to a different class of aaRSs may have prevented the conflict between anticodon and amino-acid identities of recruited tRNAs. Overall our results suggest that gene recruitment is a common phenomenon in tRNA multigene family evolution and should be taken into consideration when tRNA evolutionary history is reconstructed.

  7. Genomic Data Quality Impacts Automated Detection of Lateral Gene Transfer in Fungi

    PubMed Central

    Dupont, Pierre-Yves; Cox, Murray P.


    Lateral gene transfer (LGT, also known as horizontal gene transfer), an atypical mechanism of transferring genes between species, has almost become the default explanation for genes that display an unexpected composition or phylogeny. Numerous methods of detecting LGT events all rely on two fundamental strategies: primary structure composition or gene tree/species tree comparisons. Discouragingly, the results of these different approaches rarely coincide. With the wealth of genome data now available, detection of laterally transferred genes is increasingly being attempted in large uncurated eukaryotic datasets. However, detection methods depend greatly on the quality of the underlying genomic data, which are typically complex for eukaryotes. Furthermore, given the automated nature of genomic data collection, it is typically impractical to manually verify all protein or gene models, orthology predictions, and multiple sequence alignments, requiring researchers to accept a substantial margin of error in their datasets. Using a test case comprising plant-associated genomes across the fungal kingdom, this study reveals that composition- and phylogeny-based methods have little statistical power to detect laterally transferred genes. In particular, phylogenetic methods reveal extreme levels of topological variation in fungal gene trees, the vast majority of which show departures from the canonical species tree. Therefore, it is inherently challenging to detect LGT events in typical eukaryotic genomes. This finding is in striking contrast to the large number of claims for laterally transferred genes in eukaryotic species that routinely appear in the literature, and questions how many of these proposed examples are statistically well supported. PMID:28235827

  8. Identification of multiple independent horizontal gene transfers into poxviruses using a comparative genomics approach

    PubMed Central


    Background Poxviruses are important pathogens of humans, livestock and wild animals. These large dsDNA viruses have a set of core orthologs whose gene order is extremely well conserved throughout poxvirus genera. They also contain many genes with sequence and functional similarity to host genes which were probably acquired by horizontal gene transfer. Although phylogenetic trees can indicate the occurrence of horizontal gene transfer and even uncover multiple events, their use may be hampered by uncertainties in both the topology and the rooting of the tree. We propose to use synteny conservation around the horizontally transferred gene (HTgene) to distinguish between single and multiple events. Results Here we devise a method that incorporates comparative genomic information into the investigation of horizontal gene transfer, and we apply this method to poxvirus genomes. We examined the synteny conservation around twenty four pox genes that we identified, or which were reported in the literature, as candidate HTgenes. We found support for multiple independent transfers into poxviruses for five HTgenes. Three of these genes are known to be important for the survival of the virus in or out of the host cell and one of them increases susceptibility to some antiviral drugs. Conclusion In related genomes conserved synteny information can provide convincing evidence for multiple independent horizontal gene transfer events even in the absence of a robust phylogenetic tree for the HTgene. PMID:18304319

  9. [Polymeric nanoparticles with therapeutic gene for gene therapy: I. Preparation and in vivo gene transfer study].


    Yang, Jing; Song, Cunxian; Sun, Hongfan; Wu, Li; Tang, Lina; Leng, Xigang; Wang, Pengyan; Xu, Yiyao; Li, Yongjun; Guan, Heng


    VEGF nanoparticle (VEGF-NP) was prepared by a multi-emulsification technique using a biodegradable poly-dl-lactic-co-glycolic (PLGA) as matrix material. The nanoparticles were characterized for size, VEGF loading capacity, and in vitro release. VEGF-NP and naked VEGF plasmid were intramuscularly injected into the ischemia site of the rabbit chronic hindlimb ischemia model and the efficiency of VEGF-NP as gene delivery carrier for gene therapy in animal model was evaluated. Gene therapuetic effect was assessed evaluated by RT-PCR, immunohistochemistry and angiography assay. The average size of VEGF-NP was around 300 nm. The encapsulation efficiency of VEGF was above 96%. Loading amount of VEGF in the nanoparticles was about 4%. In vitro, nanoparticles maintained sustained-release of VEGF for two weeks. Two weeks post gene injection the capillary density in VEGF-NP group (81.22 per mm2) was significantly higher than that in control group (29.54 mm2). RT-PCR results showed greatly higher VEGF expression in VEGF-NP group (31.79au * mm) than that in naked VEGF group (9.15 au * mm). As a carrier system for gene therapy in animal model, VEGF-NP is much better than naked DNA plasmid. The results demonstrate great possibility of using NP carrier in human gene therapy.

  10. Analysis of T cell antigen receptor (TCR) expression by human peripheral blood CD4-8- alpha/beta T cells demonstrates preferential use of several V beta genes and an invariant TCR alpha chain

    PubMed Central


    CD4-CD8- (double negative [DN]) alpha/beta T cells are a largely uncharacterized subpopulation of unknown function. To investigate whether these cells are selected to recognize particular antigens or antigen-presenting molecules, DN alpha/beta T cells were purified from the peripheral blood of five normal donors and their T cell receptor (TCR) alpha and beta chains were examined. Random cloning of TCR alpha chains by single-sided polymerase chain reaction (PCR) amplification identified an invariant rearrangement between V alpha 24 and J alpha Q, with no N region diversity, which was expressed preferentially by DN alpha/beta T cells from all donors. Random cloning also identified a precise V alpha 7.2-J alpha (IGRJa14) rearrangement, with two variable amino acids encoded in the V-J junction, which was enriched in the DN alpha/beta T cell preparations from some, but not all, donors. Analysis of TCR beta chains by quantitative PCR amplification demonstrated that the expression of four V beta gene families, V beta 2, 8, 11, and 13, was markedly increased in these DN alpha/beta T cell preparations. The expression of particular TCRs by DN alpha/beta T cells from multiple donors indicates that these cells, or at least a subpopulation of cells with this phenotype, recognize a limited spectrum of antigens and suggests that they may use nonpolymorphic antigen-presenting molecules. PMID:8391057

  11. A single gene codes for the nicotinic acetylcholine receptor alpha-subunit in Torpedo marmorata: structural and developmental implications.

    PubMed Central

    Klarsfeld, A; Devillers-Thiéry, A; Giraudat, J; Changeux, J P


    We have used Southern blot hybridization to analyze the genomic structure encoding the alpha-subunit of the acetylcholine receptor (AChR) in Torpedo marmorata, with cDNA probes isolated from the electric organ. Four different radiolabelled probes, corresponding to various parts of the alpha-subunit mRNA, hybridized to several genomic fragments of T. marmorata DNA generated by digestion with the restriction enzymes SstI, PvuII and PstI. The same hybridization pattern was observed after washing the blots under low- or high-stringency conditions. As a check for detection sensitivity of heterologous sequences, the same probes were hybridized to PvuII-digested chicken DNA, revealing bands at low stringency which disappeared at higher stringencies. Unambiguously, two of our probes (one of them entirely within the coding region) hybridized to a single genomic fragment from T. marmorata DNA. This feature, as well as the results of an extensive study of the whole hybridization pattern, points towards the uniqueness of alpha-subunit-specific sequences in the genome of T. marmorata. Since overall more bands were found than expected from the cDNA sequence, this alpha-subunit gene must be split by several introns (at least four, possibly more). The length of this gene is at least 20 kb. The existence of a single alpha-subunit gene is consistent with the absence of chemical heterogeneity in the NH2-terminal sequence of the purified alpha-chain, and supports the view that the two alpha-chains belonging to one AChR oligomer have an identical primary structure. It also suggests that localization and stabilization of the AChR in well-defined post-synaptic areas of T. marmorata electric organ basically relies, during development, on 'epigenetic' mechanisms. Images Fig. 2. Fig. 3. Fig. 4. PMID:6323168

  12. Role of the interferon-inducible IFI16 gene in the induction of ICAM-1 by TNF-alpha.


    Sponza, Simone; De Andrea, Marco; Mondini, Michele; Gugliesi, Francesca; Gariglio, Marisa; Landolfo, Santo


    The Interferon-inducible gene IFI16, a member of the HIN200 family, is activated by oxidative stress and cell density, in addition to Interferons, and it is implicated in the regulation of endothelial cell proliferation and vessel formation in vitro. We have previously shown that IFI16 is required for proinflammatory gene stimulation by IFN-gamma through the NF-kappaB complex. To examine whether IFI16 induction might be extended to other proinflammatory cytokines such as tumor necrosis factor (TNF)-alpha, we used the strategy of the RNA interference to knock down IFI16 expression, and analyze the capability of TNF-alpha to stimulate intercellular adhesion molecule-1 (ICAM-1 or CD54) expression in the absence of functional IFI16. Our studies demonstrate that IFI16 mediates ICAM-1 stimulation by TNF-alpha through the NF-kappaB pathway, thus reinforcing the role of the IFI16 molecule in the inflammation process.

  13. Functional identification of the promoter for the gene encoding the alpha subunit of calcium/calmodulin-dependent protein kinase II.

    PubMed Central

    Olson, N J; Massé, T; Suzuki, T; Chen, J; Alam, D; Kelly, P T


    To examine the expression of the alpha subunit of calcium/calmodulin-dependent protein kinase II, various 5' flanking genomic sequences were inserted into a chloramphenicol acetyltransferase (CAT) reporter plasmid and CAT enzyme activities were analyzed in transfected NB2a neuroblastoma cells and mRNA transcription was analyzed by nuclease protection assays. A core promoter was identified which contained an essential TATA element located 162 nt 5' to the transcription start site. Sequences 3' to the transcription start site, as well as 5' to the TATA element, increased levels of CAT activity in transfected cells. The alpha-subunit gene promoter displayed higher CAT activities, relative to a simian virus 40 promoter, in transfected neuronal cell lines than in nonneuronal cell lines. Results also suggested that sequence surrounding the natural alpha-gene transcription initiation site may be important for targeting transcription initiation 162 nt downstream of its TATA element. Images Fig. 1 Fig. 3 PMID:7878035

  14. From Mirrors to Windows: Lyman-alpha Radiative Transfer in a Very Clumpy Medium

    NASA Astrophysics Data System (ADS)

    Gronke, Max; Dijkstra, Mark; McCourt, Michael; Oh, S. Peng


    Lyman-alpha (Lyα) is the strongest emission line in the universe and is frequently used to detect and study the most distant galaxies. Because Lyα is a resonant line, photons typically scatter prior to escaping; this scattering process complicates the interpretation of Lyα spectra, but also encodes a wealth of information about the structure and kinematics of neutral gas in the Galaxy. Modeling the Lyα line therefore allows us to study tiny-scale features of the gas. Curiously, observed Lyα spectra can be modeled successfully with very simple, homogeneous geometries (such as an expanding, spherical shell), whereas more realistic, multiphase geometries often fail to reproduce the observed spectra. This seems paradoxical since the gas in galaxies is known to be multiphase. In this Letter, we show that spectra emerging from clumpy geometries with a large number (≳ 10 for a clump column density of {N}{{H}{{I}},{cl}}∼ {10}17 {{cm}}-2) of clouds along the line of sight converge to the predictions from simplified, homogeneous models. We suggest that this resolves the apparent discrepancy and may provide a way to study the gas structure in galaxies on scales far smaller than can be probed in either cosmological simulations or direct (i.e., spatially resolved) observations.

  15. Rapid renal alpha-1 antitrypsin gene induction in experimental and clinical acute kidney injury.


    Zager, Richard A; Johnson, Ali C M; Frostad, Kirsten B


    Alpha-1-antitrypsin (AAT) is a hepatic stress protein with protease inhibitor activity. Recent evidence indicates that ischemic or toxic injury can evoke selective changes within kidney that resemble a hepatic phenotype. Hence, we tested the following: i) Does acute kidney injury (AKI) up-regulate the normally renal silent AAT gene? ii) Does rapid urinary AAT excretion result? And iii) Can AAT's anti-protease/anti-neutrophil elastase (NE) activity protect injured proximal tubule cells? CD-1 mice were subjected to ischemic or nephrotoxic (glycerol, maleate, cisplatin) AKI. Renal functional and biochemical assessments were made 4-72 hrs later. Rapidly following injury, 5-10 fold renal cortical and isolated proximal tubule AAT mRNA and protein increases occurred. These were paralleled by rapid (>100 fold) increases in urinary AAT excretion. AKI also induced marked increases in renal cortical/isolated proximal tubule NE mRNA. However, sharp NE protein levels declines resulted, which strikingly correlated (r, -0.94) with rising AAT protein levels (reflecting NE complexing by AAT/destruction). NE addition to HK-2 cells evoked ∼95% cell death. AAT completely blocked this NE toxicity, as well as Fe induced oxidant HK-2 cell attack. Translational relevance of experimental AAT gene induction was indicated by ∼100-1000 fold urinary AAT increases in 22 AKI patients (matching urine NGAL increases). We conclude: i) AKI rapidly up-regulates the renal cortical/proximal tubule AAT gene; ii) NE gene induction also results; iii) AAT can confer cytoprotection, potentially by blocking/reducing cytotoxic NE accumulation; and iv) marked increases in urinary AAT excretion in AKI patients implies clinical relevance of the AKI- AAT induction pathway.

  16. Transgenic analysis of the thyroid-responsive elements in the alpha-cardiac myosin heavy chain gene promoter.


    Subramaniam, A; Gulick, J; Neumann, J; Knotts, S; Robbins, J


    The role of two putative, cis-acting thyroid hormone-responsive elements, TRE1 and TRE2, located at -129 to -149 and -102 to -120, respectively, on the murine alpha-myosin heavy chain (MHC) gene, has been investigated in transgenic mice. These motifs are present in a 4.5-kilobase fragment lying upstream of the transcriptional start site of the mouse alpha-MHC gene: this fragment directs appropriate expression of a reporter gene in transgenic mice (Subramaniam, A., Jones, W. K., Gulick, J., Wert, S., Neumann, J., and Robbins, J. (1991) J. Biol. Chem. 266, 24613-24620). Here, we independently mutate the TRE1 and TRE2 elements by base substitution. The mice were analyzed for transgene expression in different muscle and non-muscle tissues including the atria and ventricles. Normal levels of transgene expression were observed in euthyroid mice carrying a mutation in TRE1. In contrast to these results, mice in which TRE2 was mutated showed reduced levels of CAT activity in both the atria and ventricles, suggesting a previously undefined role for this element in the constitutive up-regulation of the alpha-MHC gene. In hypothyroid mice carrying either of these mutations, the complete cessation of ventricular expression of the chloramphenicol acetyltransferase transcripts that takes place in the alpha-5.5 (wild type) animals did not occur.

  17. A novel Y243S mutation in the pyruvate dehydrogenase El alpha gene subunit: correlation with thiamine pyrophosphate interaction.


    Benelli, C; Fouque, F; Redonnet-Vernhet, I; Malgat, M; Fontan, D; Marsac, C; Dey, R


    We identified a new Y243S mutation in the X-linked E1 alpha-PDH gene in a patient with pyruvate dehydrogenase complex (PDHc) deficiency. The activity in cultured fibroblasts was very low even in the presence of high thiamine pyrophosphate (TPP) concentrations, indicating that the defect could be due to decreased affinity of PDHc for TPP.

  18. Evolution of the enzymes of the citric acid cycle and the glyoxylate cycle of higher plants. A case study of endosymbiotic gene transfer.


    Schnarrenberger, Claus; Martin, William


    The citric acid or tricarboxylic acid cycle is a central element of higher-plant carbon metabolism which provides, among other things, electrons for oxidative phosphorylation in the inner mitochondrial membrane, intermediates for amino-acid biosynthesis, and oxaloacetate for gluconeogenesis from succinate derived from fatty acids via the glyoxylate cycle in glyoxysomes. The tricarboxylic acid cycle is a typical mitochondrial pathway and is widespread among alpha-proteobacteria, the group of eubacteria as defined under rRNA systematics from which mitochondria arose. Most of the enzymes of the tricarboxylic acid cycle are encoded in the nucleus in higher eukaryotes, and several have been previously shown to branch with their homologues from alpha-proteobacteria, indicating that the eukaryotic nuclear genes were acquired from the mitochondrial genome during the course of evolution. Here, we investigate the individual evolutionary histories of all of the enzymes of the tricarboxylic acid cycle and the glyoxylate cycle using protein maximum likelihood phylogenies, focusing on the evolutionary origin of the nuclear-encoded proteins in higher plants. The results indicate that about half of the proteins involved in this eukaryotic pathway are most similar to their alpha-proteobacterial homologues, whereas the remainder are most similar to eubacterial, but not specifically alpha-proteobacterial, homologues. A consideration of (a) the process of lateral gene transfer among free-living prokaryotes and (b) the mechanistics of endosymbiotic (symbiont-to-host) gene transfer reveals that it is unrealistic to expect all nuclear genes that were acquired from the alpha-proteobacterial ancestor of mitochondria to branch specifically with their homologues encoded in the genomes of contemporary alpha-proteobacteria. Rather, even if molecular phylogenetics were to work perfectly (which it does not), then some nuclear-encoded proteins that were acquired from the alpha

  19. T cell receptor gene usage in the response to lambda repressor cI protein. An apparent bias in the usage of a V alpha gene element

    PubMed Central


    The T cell response to the lambda repressor cI protein is directed to the same region of the protein (residues 12-26) in both BALB/c and A/J mice. A panel of T cell hybridomas specific for P12-26 in the context of either I-Ek or I-Ad have been isolated To further understand the molecular interaction between the TCR and the Ia-P12-26 complex, the primary structures of the TCR of five T cell hybridomas have been determined. Southern and Northern analyses indicate that two members of the V alpha 3 gene family are used by 13 out of 14 I-Ek-restricted T cells. Four different V beta genes are used by these T cell hybridomas, while the majority (8 out of 13) express V beta 1 in combination with the J beta 2.1 element. No clear correlation can be seen in this system between gene usage and MHC restriction. In addition, the fine specificity of I-Ek-restricted T cells to a single amino acid substitution [Phe22/His22]P12-26 is not attributed to the usage of particular V alpha and V beta elements. The V alpha 3 family gene is also used by a few I-Ad-restricted T cells. Interestingly, these I-Ad T cells share a reactivity pattern more similar to that of I-Ek- restricted T cells than other I-Ad-restricted T cells. The nonrandom selection V alpha 3 is also demonstrated by the fact that V alpha 3 is used by P12-26-specific, but not by cytochrome c- or staphylococcal nucleus-specific, I-Ek-restricted T cells. This suggests that although antigen specificity may not be accounted for by either chain of the TCR, the members of V alpha 3 genes may be selected by the antigen (P12- 26). PMID:2971753

  20. Environmental factors influencing gene transfer agent (GTA) mediated transduction in the subtropical ocean.


    McDaniel, Lauren D; Young, Elizabeth C; Ritchie, Kimberly B; Paul, John H


    Microbial genomic sequence analyses have indicated widespread horizontal gene transfer (HGT). However, an adequate mechanism accounting for the ubiquity of HGT has been lacking. Recently, high frequencies of interspecific gene transfer have been documented, catalyzed by Gene Transfer Agents (GTAs) of marine α-Proteobacteria. It has been proposed that the presence of bacterial genes in highly purified viral metagenomes may be due to GTAs. However, factors influencing GTA-mediated gene transfer in the environment have not yet been determined. Several genomically sequenced strains containing complete GTA sequences similar to Rhodobacter capsulatus (RcGTA, type strain) were screened to ascertain if they produced putative GTAs, and at what abundance. Five of nine marine strains screened to date spontaneously produced virus-like particles (VLP's) in stationary phase. Three of these strains have demonstrated gene transfer activity, two of which were documented by this lab. These two strains Roseovarius nubinhibens ISM and Nitratireductor 44B9s, were utilized to produce GTAs designated RnGTA and NrGTA and gene transfer activity was verified in culture. Cell-free preparations of purified RnGTA and NrGTA particles from marked donor strains were incubated with natural microbial assemblages to determine the level of GTA-mediated gene transfer. In conjunction, several ambient environmental parameters were measured including lysogeny indicated by prophage induction. GTA production in culture systems indicated that approximately half of the strains produced GTA-like particles and maximal GTA counts ranged from 10-30% of host abundance. Modeling of GTA-mediated gene transfer frequencies in natural samples, along with other measured environmental variables, indicated a strong relationship between GTA mediated gene transfer and the combined factors of salinity, multiplicity of infection (MOI) and ambient bacterial abundance. These results indicate that GTA-mediated HGT in the

  1. Reduction in breast cancer susceptibility due to XbaI gene polymorphism of alpha estrogen receptor gene in Jordanians

    PubMed Central

    Atoum, Manar Fayiz; Alzoughool, Foad


    Breast cancer is a global health concern among women worldwide. Estrogen receptor alpha (ERα) mediates diverse polymorphic effects in breast tissues that may relate to breast cancer susceptibility. The aim of this study was to evaluate the effect of −397 PvuII (T/C) and −351 XbaI (A/G) restriction fragment length polymorphism within intron 1 of ERα, and its effect on breast cancer susceptibility. A total of 156 women who were histopathologically diagnosed with breast cancer and 142 healthy Jordanian women were enrolled in this case–control study. Genomic DNA was extracted from whole peripheral blood, and the desired fragment was amplified using polymerase chain reaction followed by restriction digestion with PvuII and XbaI restriction enzymes. The results showed no significant association between PvuII polymorphism and breast cancer risk. However, a significant association was found between XbaI polymorphism and reduction in breast cancer risk within the “x” allele of heterozygotes (odds ratio [OR] 0.199, 95% confidence interval [CI] 0.09–0.044) and heterozygotes (OR 0.208, 95% CI 0.09–0.047). The combined analysis of PvuII and XbaI polymorphisms revealed a synergistic effect of Pp/Xx and pp/xx genotypes and a significant reduction in breast cancer risk with these genotypes. The results also showed no statistical differences among PvuII or XbaI polymorphisms based on stage, ER, progesterone receptor and expression of hormone receptor such as human epidermal growth factor receptor 2. This case–control study showed that XbaI polymorphism of alpha estrogen gene modified and reduced breast cancer susceptibility among Jordanians. PMID:28182136

  2. Alpha Thalassemia


    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  3. Structural organization, sequence, and expression of the mouse HEXA gene encoding the alpha subunit of hexosaminidase A.


    Wakamatsu, N; Benoit, G; Lamhonwah, A M; Zhang, Z X; Trasler, J M; Triggs-Raine, B L; Gravel, R A


    Genomic clones of the mouse HEXA gene encoding the alpha subunit of lysosomal beta-hexosaminidase A have been isolated, analyzed, and sequenced. The HEXA gene spans approximately 26 kb and consists of 14 exons and 13 introns. The 5' flanking region of the gene has three candidate GC boxes and a number of potential promoter and regulatory elements. Promoter analysis using deletion constructs of 5' flanking sequence fused to the bacterial chloramphenicol acetyltransferase (CAT) gene showed that 150 bp of 5' sequence was sufficient for expression in transfected monkey kidney COS cells. Determination of the sequence of the 5' end of the Hex alpha mRNA by an "anchor-ligation PCR" procedure showed that transcription is initiated from a cluster of sites centered -42, -32, and -21 bp from the first in-frame ATG. Northern blot analysis from 11 different tissues showed over five times the steady-state level of Hex alpha mRNA in testis as compared to that found in three different brain regions; the lowest level (about 1/3 of brain) was found in liver. Comparison of the 5' flanking sequence with that of the human HEXA gene revealed 78% identity within the first 100 bp. These data suggest that the mouse HEXA gene is controlled mainly by sequences located within 150 bp of the 5' flanking region, and we speculate that it may have a role, not only in brain and other tissues, but also in reproductive function in the adult male mouse.

  4. The skeletal muscle alpha-actin gene of channel catfish (Ictalurus punctatus) and its association with piscine specific SINE elements.


    Kim, S; Karsi, A; Dunham, R A; Liu, Z


    The alpha-actin gene of channel catfish (Ictalurus punctatus) was cloned and sequenced. The gene has a similar organization and exhibited a high level of sequence similarity to those from other vertebrate animals. The upstream region of the alpha-actin gene included a TATA box, a CAAT box, three E-boxes, and a CArG box. Nested deletion segments containing these transcriptional motifs were fused to the reporter gene chloramphenicol acetyl transferase (CAT). Transfection of the clones into C2C12 cells indicated that all these motifs are required for transcriptional activities. The channel catfish alpha-actin gene is associated with two distinct short interspersed repetitive elements (SINEs). The first SINE element showed high levels of sequence similarity to the zebrafish Mermaid element, while the second SINE element is not similar to the Mermaid element except for an 8bp sequence CCCCGTGC suggesting their evolutionary linkage. However, the second SINE element appeared to co-exist with the Mermaid element in most cases and therefore was designated as the Merman element. Approximately 9000 copies and 1200 copies of the Mermaid and Merman elements exist per haploid channel catfish genome, respectively. BLAST searches indicated that both the Mermaid and the Merman elements were frequently associated with gene sequences, mostly those of aquatic animals, suggesting their evolutionary origin in association with aquatic organisms and their function in shaping the evolution of genomes in aquatic animals.

  5. Integron-associated mobile gene cassettes code for folded proteins: the structure of Bal32a, a new member of the adaptable alpha+beta barrel family.


    Robinson, Andrew; Wu, Peter S-C; Harrop, Stephen J; Schaeffer, Patrick M; Dosztányi, Zsuzsanna; Gillings, Michael R; Holmes, Andrew J; Nevalainen, K M Helena; Stokes, H W; Otting, Gottfried; Dixon, Nicholas E; Curmi, Paul M G; Mabbutt, Bridget C


    The wide-ranging physiology and large genetic variability observed for prokaryotes is largely attributed, not to the prokaryotic genome itself, but rather to mechanisms of lateral gene transfer. Cassette PCR has been used to sample the integron/gene cassette metagenome from different natural environments without laboratory cultivation of the host organism, and without prior knowledge of any target protein sequence. Since over 90% of cassette genes are unrelated to any sequence in the current databases, it is not clear whether these genes code for folded functional proteins. We have selected a sample of eight cassette-encoded genes with no known homologs; five have been isolated as soluble protein products and shown by biophysical techniques to be folded. In solution, at least three of these proteins organise as stable oligomeric assemblies. The tertiary structure of one of these, Bal32a derived from a contaminated soil site, has been solved by X-ray crystallography to 1.8 A resolution. From the three-dimensional structure, Bal32a is found to be a member of the highly adaptable alpha+beta barrel family of transport proteins and enzymes. In Bal32a, the barrel cavity is unusually deep and inaccessible to solvent. Polar side-chains in its interior are reminiscent of catalytic sites of limonene-1,2-epoxide hydrolase and nogalonic acid methyl ester cyclase. These studies demonstrate the viability of direct sampling of mobile DNA as a route for the discovery of novel proteins.

  6. Relationship between iris constitution analysis and TNF-alpha gene polymorphism in hypertensives.


    Yoo, Chun-Sang; Hwang, Woo-Jun; Hong, Seung-Heon; Lee, Hye-Jung; Jeong, Hyun-Ja; Kim, Su-Jin; Kim, Hyung-Min; Um, Jae-Young


    Iridology is a complementary and alternative medicine that involves the diagnosis of medical conditions by noting irregularities of the pigmentation in the iris. Iris constitution has a strong hereditary component. Tumor necrosis factor-alpha (TNFalpha), a pleiotropic cytokine, has been implicated in many pathological processes including hypertension. In this paper, the relationship between iris constitution and TNFalpha gene polymorphism in those with hypertension is investigated. Eighty seven hypertensive individuals and 79 controls were classified according to iris constitution and the TNFalpha genotype of each individual determined. Compared to the controls, the frequency of the TNFalpha GA heterozygote was lower in the hypertensive group, although the statistical significance was marginal (p = 0.08). This result implies an association with resistance to the disease. In addition, the frequency of the cardio-renal connective tissue weakness type was significantly higher in the hypertensive group with the TNFalpha GG genotype, as compared to the controls (p = 0.001). An association is demonstrated among TNFalpha gene polymorphism, Koreans with hypertension, and iris constitution.

  7. Alpha-2-macroglobulin gene, oxidized low-density lipoprotein receptor-1 locus, and sporadic Alzheimer's disease.


    Colacicco, Anna Maria; Solfrizzi, Vincenzo; D'Introno, Alessia; Capurso, Cristiano; Kehoe, Patrick G; Seripa, Davide; Pilotto, Alberto; Santamato, Andrea; Capurso, Antonio; Panza, Francesco


    A total sample of 169 AD patients, and 264 age- and sex-matched unrelated caregivers from Apulia, southern Italy, were genotypized for alpha-2-macroglobulin (A2M) Val1000/Ile single-nucleotide polymorphism (SNP) (rs669), apolipoprotein E (APOE), and SNPs (+1073 and +1071) in the oxidized low-density lipoprotein receptor-1 (OLR1) gene on chromosome 12. A2M allele and genotype frequencies were similar between AD patients and controls, also after stratification for late onset (>/=70 years) and early onset (<70 years) or APOE varepsilon4 status. However, there was evidence in support of LD between the OLR1+1071, the OLR1+1073, and the rs669 SNPs, with T-C-A haplotype being associated with significant increased risk of AD in both the whole sample and when we stratified according to early and late onset AD subjects, with the allelic association with AD predominantly from the OLR1+1073 SNP, further supporting the role of OLR1 as a candidate risk gene for sporadic AD.

  8. Three missense variants of metabolic syndrome-related genes are associated with alpha-1 antitrypsin levels.


    Setoh, Kazuya; Terao, Chikashi; Muro, Shigeo; Kawaguchi, Takahisa; Tabara, Yasuharu; Takahashi, Meiko; Nakayama, Takeo; Kosugi, Shinji; Sekine, Akihiro; Yamada, Ryo; Mishima, Michiaki; Matsuda, Fumihiko


    Alpha-1 antitrypsin (AAT) encoded by SERPINA1 is an acute-phase inflammation marker, and AAT deficiency (AATD) is known as one of the common genetic disorders in European populations. However, no genetic determinants to AAT levels apart from the SERPINA gene clusters have been identified to date. Here we perform a genome-wide association study of serum AAT levels followed by a two-staged replication study recruiting a total of 9,359 Japanese community-dwelling population. Three missense variants of metabolic syndrome-related genes, namely, rs671 in ALDH2, rs1169288 in HNF1A and rs1260326 in GCKR, significantly associate with AAT levels (P≤1.5 × 10(-12)). Previous reports have shown the functional relevance of ALDH2 and HNF1A to AAT. We observe a significant interaction of rs671 and alcohol consumption on AAT levels. We confirm the association between AAT and rs2896268 in SERPINA1, which is independent of known causative variants of AATD. These findings would support various AAT functions including metabolic processes.

  9. Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.


    de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J


    The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.

  10. Cloning and Characterization of an alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Mark L.; Ng, Joseph D.; Garriott, Owen K.


    The gene encoding an extracellular alpha-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  11. Ethacrynic and alpha-lipoic acids inhibit vaccinia virus late gene expression.


    Spisakova, Martina; Cizek, Zdenek; Melkova, Zora


    Smallpox was declared eradicated in 1980. However recently, the need of agents effective against poxvirus infection has emerged again. In this paper, we report an original finding that two redox-modulating agents, the ethacrynic and alpha-lipoic acids (EA, LA), inhibit growth of vaccinia virus (VACV) in vitro. The effect of EA and LA was compared with those of beta-mercaptoethanol, DTT and ascorbic acid, but these agents increased VACV growth in HeLa G cells. The inhibitory effects of EA and LA on the growth of VACV were further confirmed in several cell lines of different embryonic origin, in epithelial cells, fibroblasts, macrophages and T-lymphocytes. Finally, we have analyzed the mechanism of action of the two agents. They both decreased expression of VACV late genes, as demonstrated by western blot analysis and activity of luciferase expressed under control of different VACV promoters. In contrast, they did not inhibit virus entry into the cell, expression of VACV early genes or VACV DNA synthesis. The results suggest new directions in development of drugs effective against poxvirus infection.

  12. Ancient allelism at the cytosolic chaperonin-alpha-encoding gene of the zebrafish.

    PubMed Central

    Takami, K; Figueroa, F; Mayer, W E; Klein, J


    The T-complex protein 1, TCP1, gene codes for the CCT-alpha subunit of the group II chaperonins. The gene was first described in the house mouse, in which it is closely linked to the T locus at a distance of approximately 11 cM from the Mhc. In the zebrafish, Danio rerio, in which the T homolog is linked to the class I Mhc loci, the TCP1 locus segregates independently of both the T and the Mhc loci. Despite its conservation between species, the zebrafish TCP1 locus is highly polymorphic. In a sample of 15 individuals and the screening of a cDNA library, 12 different alleles were found, and some of the allelic pairs were found to differ by up to nine nucleotides in a 275-bp-long stretch of sequence. The substitutions occur in both translated and untranslated regions, but in the former they occur predominantly at synonymous codon sites. Phylogenetically, the alleles fall into two groups distinguished also by the presence or absence of a 10-bp insertion/deletion in the 3' untranslated region. The two groups may have diverged as long as 3.5 mya, and the polymorphic differences may have accumulated by genetic drift in geographically isolated populations. PMID:10628990

  13. Long-Range Electron Transfer across Cytochrome-Hematite (alpha-Fe2O3) Interfaces.

    SciTech Connect

    Grantham, Ms. Meg; Wigginton, Nicholas S; Rosso, Kevin M; Stack, Andrew G; HochellaJr., Michael F


    Electrochemical scanning tunneling microscopy was used to assess the distance dependence of electron transfer facilitated by a bacterial multiheme cytochrome to a single crystal iron oxide surface. We measured tunneling current-distance (I-s) profiles across the nanoscale space between Au STM tips and the basal (001) surface of a hematite (R-Fe2O3) crystal and compared them to the case in which an intervening small tetraheme cytochrome (STC) from Shewanella oneidensis was covalently linked to the end of the Au tip. Tunneling profiles were collected at constant surface potentials in solutions having a range of ionic strengths. For the case without intervening cytochrome, at short tip-sample separation, the distance dependence of the tunneling current shows a quasi-linear behavior, whereas at longer distances, near-exponential decay is observed. The different regions can be understood first in terms of reduction of interfacial water and ion layers in the electrical double layer associated with the hematite surface, followed by electron tunneling through bulk water. The effective tunneling range and the transition between the two conduction mechanisms are substantially increased when STC is present in the tunneling junction, suggesting that cytochrome molecules provide enhanced tunneling pathways and stronger electronic coupling to the hematite surface. On the basis of these results, cytochrome-mediated electron transfer during bacterial metal reduction may be possible at distances farther than originally speculated. In addition, as multiheme cytochromes and other similar molecules gain attention for their promising role in fuel cells and molecular electronics, we demonstrate that the solution conditions and surface properties of the substrate must be carefully considered.

  14. Gene transfer into Solanum tuberosum via Rhizobium spp.


    Wendt, Toni; Doohan, Fiona; Winckelmann, Dominik; Mullins, Ewen


    Agrobacterium tumefaciens-mediated transformation (ATMT) is the preferred technique for gene transfer into crops. A major disadvantage of the technology remains the complexity of the patent landscape that surrounds ATMT which restricts its use for commercial applications. An alternative system has been described (Broothaerts et al. in Nature 433:629-633, 2005) detailing the propensity of three rhizobia to transform the model crop Arabidopsis thaliana, the non-food crop Nicotiana tabacum and, at a very low frequency, the monocotyledonous crop Oryza sativa. In this report we describe for the first time the genetic transformation of Solanum tuberosum using the non-Agrobacterium species Sinorhizobium meliloti, Rhizobium sp. NGR234 and Mesorhizobium loti. This was achieved by combining an optimal bacterium and host co-cultivation period with a low antibiotic regime during the callus and shoot induction stages. Using this optimized protocol the transformation frequency (calculated as % of shoots equipped with root systems with the ability to grow in rooting media supplemented with 25 μg/ml hygromycin) of the rhizobia strains was calculated at 4.72, 5.85 and 1.86% for S. meliloti, R. sp. NGR234 and M. loti respectively, compared to 47.6% for the A. tumefaciens control. Stable transgene integration and expression was confirmed via southern hybridisation, quantitative PCR analysis and histochemical screening of both leaf and/or tuber tissue. In light of the rapid advances in potato genomics, combined with the sequencing of the potato genome, the ability of alternative bacteria species to genetically transform this major food crop will provide a novel resource to the Solanaceae community as it continues to develop potato as both a food and non-food crop.

  15. Proteomic profiling of salivary gland after nonviral gene transfer mediated by conventional plasmids and minicircles

    PubMed Central

    Geguchadze, Ramaz; Wang, Zhimin; Zourelias, Lee; Perez-Riveros, Paola; Edwards, Paul C; Machen, Laurie; Passineau, Michael J


    In this study, we compared gene transfer efficiency and host response to ultrasound-assisted, nonviral gene transfer with a conventional plasmid and a minicircle vector in the submandibular salivary glands of mice. Initially, we looked at gene transfer efficiency with equimolar amounts of the plasmid and minicircle vectors, corroborating an earlier report showing that minicircle is more efficient in the context of a physical method of gene transfer. We then sought to characterize the physiological response of the salivary gland to exogenous gene transfer using global proteomic profiling. Somewhat surprisingly, we found that sonoporation alone, without a gene transfer vector present, had virtually no effect on the salivary gland proteome. However, when a plasmid vector was used, we observed profound perturbations of the salivary gland proteome that compared in magnitude to that seen in a previous report after high doses of adeno-associated virus. Finally, we found that gene transfer with a minicircle induces only minor proteomic alterations that were similar to sonoporation alone. Using mass spectrometry, we assigned protein IDs to 218 gel spots that differed between plasmid and minicircle. Bioinformatic analysis of these proteins demonstrated convergence on 68 known protein interaction pathways, most notably those associated with innate immunity, cellular stress, and morphogenesis. PMID:25414909

  16. Apramycin resistance as a selective marker for gene transfer in mycobacteria.

    PubMed Central

    Paget, E; Davies, J


    We have explored the potential of using the apramycin resistance gene as a marker in mycobacterial gene transfer studies. Shuttle plasmids available for both electroporation and conjugation studies have been constructed, and we have successfully validated the use of the apramycin resistance gene as a component of cloning vectors for Mycobacterium smegmatis, M. bovis BCG, and M. tuberculosis. PMID:8892841

  17. uv excision-repair gene transfer in Chinese hamster ovary (CHO) cells

    SciTech Connect

    MacInnes, M.A.; Bingham, J.M.; Strniste, G.F.; Thompson, L.H.


    uvc-sensitive mutants of CHO cells provide a model system for molecular studies of DNA repair. We present our recent results which show that these mutants are competent recipients for plasmid marker gene transfer and incorporation of a putative CHO repair gene. The applicability and advantages of this system for interspecies human repair gene identification are discussed.

  18. The human intestinal fatty acid binding protein (hFABP2) gene is regulated by HNF-4{alpha}

    SciTech Connect

    Klapper, Maja . E-mail:; Boehme, Mike; Nitz, Inke; Doering, Frank


    The cytosolic human intestinal fatty acid binding protein (hFABP2) is proposed to be involved in intestinal absorption of long-chain fatty acids. The aim of this study was to investigate the regulation of hFABP2 by the endodermal hepatocyte nuclear factor 4{alpha} (HNF-4{alpha}), involved in regulation of genes of fatty acid metabolism and differentiation. Electromobility shift assays demonstrated that HNF-4{alpha} binds at position -324 to -336 within the hFABP2 promoter. Mutation of this HNF-4 binding site abolished the luciferase reporter activity of hFABP2 in postconfluent Caco-2 cells. In HeLa cells, this mutation reduced the activation of the hFABP2 promoter by HNF-4{alpha} by about 50%. Thus, binding element at position -336/-324 essentially determines the transcriptional activity of promoter and may be important in control of hFABP2 expression by dietary lipids and differentiation. Studying genotype interactions of hFABP2 and HNF-4{alpha}, that are both candidate genes for diabetes type 2, may be a powerful approach.

  19. Evolution of the cutinase gene family: evidence for lateral gene transfer of a candidate Phytophthora virulence factor.


    Belbahri, Lassaad; Calmin, Gautier; Mauch, Felix; Andersson, Jan O


    Lateral gene transfer (LGT) can facilitate the acquisition of new functions in recipient lineages, which may enable them to colonize new environments. Several recent publications have shown that gene transfer between prokaryotes and eukaryotes occurs with appreciable frequency. Here we present a study of interdomain gene transfer of cutinases -- well documented virulence factors in fungi -- between eukaryotic plant pathogens Phytophthora species and prokaryotic bacterial lineages. Two putative cutinase genes were cloned from Phytophthora brassicae and Northern blotting experiments showed that these genes are expressed early during the infection of the host Arabidopsis thaliana and induced during cyst germination of the pathogen. Analysis of the gene organisation of this gene family in Phytophthora ramorum and P. sojae showed three and ten copies in tight succession within a region of 5 and 25 kb, respectively, probably indicating a recent expansion in Phytophthora lineages by gene duplications. Bioinformatic analyses identified orthologues only in three genera of Actinobacteria, and in two distantly related eukaryotic groups: oomycetes and fungi. Together with phylogenetic analyses this limited distribution of the gene in the tree of life strongly support a scenario where cutinase genes originated after the origin of land plants in a microbial lineage living in proximity of plants and subsequently were transferred between distantly related plant-degrading microbes. More precisely, a cutinase gene was likely acquired by an ancestor of P. brassicae, P. sojae, P. infestans and P. ramorum, possibly from an actinobacterial source, suggesting that gene transfer might be an important mechanism in the evolution of their virulence. These findings could indeed provide an interesting model system to study acquisition of virulence factors in these important plant pathogens.

  20. Horizontal Gene Transfer of Pectinases from Bacteria Preceded the Diversification of Stick and Leaf Insects

    PubMed Central

    Shelomi, Matan; Danchin, Etienne G. J.; Heckel, David; Wipfler, Benjamin; Bradler, Sven; Zhou, Xin; Pauchet, Yannick


    Genes acquired by horizontal transfer are increasingly being found in animal genomes. Understanding their origin and evolution requires knowledge about the phylogenetic relationships from both source and recipient organisms. We used RNASeq data and respective assembled transcript libraries to trace the evolutionary history of polygalacturonase (pectinase) genes in stick insects (Phasmatodea). By mapping the distribution of pectinase genes on a Polyneoptera phylogeny, we identified the transfer of pectinase genes from known phasmatodean gut microbes into the genome of an early euphasmatodean ancestor that took place between 60 and 100 million years ago. This transfer preceded the rapid diversification of the suborder, enabling symbiont-free pectinase production that would increase the insects’ digestive efficiency and reduce dependence on microbes. Bacteria-to-insect gene transfer was thought to be uncommon, however the increasing availability of large-scale genomic data may change this prevailing notion. PMID:27210832

  1. Gene Transfer Efficiency in Gonococcal Biofilms: Role of Biofilm Age, Architecture, and Pilin Antigenic Variation

    PubMed Central

    Kouzel, Nadzeya; Oldewurtel, Enno R.


    ABSTRACT Extracellular DNA is an important structural component of many bacterial biofilms. It is unknown, however, to which extent external DNA is used to transfer genes by means of transformation. Here, we quantified the acquisition of multidrug resistance and visualized its spread under selective and nonselective conditions in biofilms formed by Neisseria gonorrhoeae. The density and architecture of the biofilms were controlled by microstructuring the substratum for bacterial adhesion. Horizontal transfer of antibiotic resistance genes between cocultured strains, each carrying a single resistance, occurred efficiently in early biofilms. The efficiency of gene transfer was higher in early biofilms than between planktonic cells. It was strongly reduced after 24 h and independent of biofilm density. Pilin antigenic variation caused a high fraction of nonpiliated bacteria but was not responsible for the reduced gene transfer at later stages. When selective pressure was applied to dense biofilms using antibiotics at their MIC, the double-resistant bacteria did not show a significant growth advantage. In loosely connected biofilms, the spreading of double-resistant clones was prominent. We conclude that multidrug resistance readily develops in early gonococcal biofilms through horizontal gene transfer. However, selection and spreading of the multiresistant clones are heavily suppressed in dense biofilms. IMPORTANCE Biofilms are considered ideal reaction chambers for horizontal gene transfer and development of multidrug resistances. The rate at which genes are exchanged within biofilms is unknown. Here, we quantified the acquisition of double-drug resistance by gene transfer between gonococci with single resistances. At early biofilm stages, the transfer efficiency was higher than for planktonic cells but then decreased with biofilm age. The surface topography affected the architecture of the biofilm. While the efficiency of gene transfer was independent of the

  2. Tip-alpha (hp0596 gene product) is a highly immunogenic Helicobacter pylori protein involved in colonization of mouse gastric mucosa.


    Godlewska, Renata; Pawlowski, Marcin; Dzwonek, Artur; Mikula, Michal; Ostrowski, Jerzy; Drela, Nadzieja; Jagusztyn-Krynicka, Elzbieta K


    A product of the Helicobacter pylori hp0596 gene (Tip-alpha) is a highly immunogenic homodimeric protein, unique for this bacterium. Cell fractionation experiments indicate that Tip-alpha is anchored to the inner membrane. In contrast, the three-dimensional model of the protein suggests that Tip-alpha is soluble or, at least, largely exposed to the solvent. hp0596 gene knockout resulted in a significant decrease in the level of H. pylori colonization as measured by real-time PCR assay. In addition, the Tip-alpha recombinant protein was determined to stimulate macrophage to produce IL-1alpha and TNF-alpha. Both results imply that Tip-alpha is rather loosely connected to the inner membrane and potentially released during infection.

  3. Horizontal gene transfer and the evolution of transcriptionalregulation in Escherichia coli

    SciTech Connect

    Price, Morgan N.; Dehal, Paramvir S.; Arkin, Adam P.


    Background: Most bacterial genes were acquired by horizontalgene transfer from other bacteria instead of being inherited bycontinuous vertical descent from an ancient ancestor}. To understand howthe regulation of these {acquired} genes evolved, we examined theevolutionary histories of transcription factors and of regulatoryinteractions from the model bacterium Escherichia coli K12. Results:Although most transcription factors have paralogs, these usually arose byhorizontal gene transfer rather than by duplication within the E. colilineage, as previously believed. In general, most neighbor regulators --regulators that are adjacent to genes that they regulate -- were acquiredby horizontal gene transfer, while most global regulators evolvedvertically within the gamma-Proteobacteria. Neighbor regulators wereoften acquired together with the adjacent operon that they regulate, sothe proximity might be maintained by repeated transfers (like "selfishoperons"). Many of the as-yet-uncharacterized (putative) regulators havealso been acquired together with adjacent genes, so we predict that theseare neighbor regulators as well. When we analyzed the histories ofregulatory interactions, we found that the evolution of regulation byduplication was rare, and surprisingly, many of the regulatoryinteractions that are shared between paralogs result from convergentevolution. Another surprise was that horizontally transferred genes aremore likely than other genes to be regulated by multiple regulators, andmost of this complex regulation probably evolved after the transfer.Conclusions: Our results highlight the rapid evolution of niche-specificgene regulation in bacteria.

  4. A direct gene transfer strategy via brain internal capsule reverses the biochemical defect in Tay-Sachs disease.


    Martino, S; Marconi, P; Tancini, B; Dolcetta, D; De Angelis, M G Cusella; Montanucci, P; Bregola, G; Sandhoff, K; Bordignon, C; Emiliani, C; Manservigi, R; Orlacchio, A


    Therapy for neurodegenerative lysosomal Tay-Sachs (TS) disease requires active hexosaminidase (Hex) A production in the central nervous system and an efficient therapeutic approach that can act faster than human disease progression. We combined the efficacy of a non-replicating Herpes simplex vector encoding for the Hex A alpha-subunit (HSV-T0alphaHex) and the anatomic structure of the brain internal capsule to distribute the missing enzyme optimally. With this gene transfer strategy, for the first time, we re-established the Hex A activity and totally removed the GM2 ganglioside storage in both injected and controlateral hemispheres, in the cerebellum and spinal cord of TS animal model in the span of one month's treatment. In our studies, no adverse effects were observed due to the viral vector, injection site or gene expression and on the basis of these results, we feel confident that the same approach could be applied to similar diseases involving an enzyme defect.

  5. Plasmid transfer by conjugation as a possible route of horizontal gene transfer and recombination in Xylella fastidiosa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Horizontal gene transfer is an important component of evolution and adaptation of bacterial species. Xylella fastidiosa has the ability to incorporate exogenous DNA into its genome by homologous recombination at relatively high rates. This genetic recombination is believed to play a role in adaptati...

  6. Hepatoma cell-specific ganciclovir-mediated toxicity of a lentivirally transduced HSV-TkEGFP fusion protein gene placed under the control of rat alpha-fetoprotein gene regulatory sequences.


    Uch, Rathviro; Gérolami, René; Faivre, Jamila; Hardwigsen, Jean; Mathieu, Sylvie; Mannoni, Patrice; Bagnis, Claude


    Suicide gene therapy combining herpes simplex virus thymidine kinase gene transfer and ganciclovir administration can be envisioned as a powerful therapeutical approach in the treatment of hepatocellular carcinoma; however, safety issues regarding transgene expression in parenchyma cells have to be addressed. In this study, we constructed LATKW, a lentiviral vector expressing the HSV-TkEGFP gene placed under the control of the promoter elements that control the expression of the rat alpha-fetoprotein, and assayed its specific expression in vitro in hepatocarcinoma and nonhepatocarcinoma human cell lines, and in epidermal growth factor stimulated human primary hepatocytes. Using LATKW, a strong expression of the transgene was found in transduced hepatocarcinoma cells compared to a very low expression in nonhepatocarcinoma human cell lines, as assessed by Northern blot, RT-PCR, FACS analysis and ganciclovir-mediated toxicity assay, and no expression was found in lentivirally transduced normal human hepatocytes. Altogether, these results demonstrate the possibility to use a lentivirally transduced expression unit containing the rat alpha-fetoprotein promoter to restrict the HSV-TK-mediated induced GCV sensitivity to human hepatocarcinoma cells.

  7. Cloning, expression and evolution of the gene encoding the elongation factor 1alpha from a low thermophilic Sulfolobus solfataricus strain.


    Masullo, Mariorosario; Cantiello, Piergiuseppe; Lamberti, Annalisa; Longo, Olimpia; Fiengo, Antonio; Arcari, Paolo


    The gene encoding the elongation factor 1alpha (EF-1alpha) from the archaeon Sulfolobus solfataricus strain MT3 (optimum growth temperature 75 degrees C) was cloned, sequenced and expressed in Escherichia coli. The structural and biochemical properties of the purified enzyme were compared to those of EF-1alpha isolated from S. solfataricus strain MT4 (optimum growth temperature 87 degrees C). Only one amino acid change (Val15-->Ile) was found. Interestingly, the difference was in the first guanine nucleotide binding consensus sequence G(13)HIDHGK and was responsible for a reduced efficiency in protein synthesis, which was accompanied by an increased affinity for both guanosine diphosphate (GDP) and guanosine triphosphate (GTP), and an increased efficiency in the intrinsic GTPase activity. Despite the different thermophilicities of the two microorganisms, only very marginal effects on the thermal properties of the enzyme were observed. Molecular evolution among EF-1alpha genes from Sulfolobus species showed that the average rate of nucleotide substitution per site per year (0.0312x10(-9)) is lower than that reported for other functional genes.

  8. Ultrasound -Assisted Gene Transfer to Adipose Tissue-Derived Stem/Progenitor Cells (ASCs)

    NASA Astrophysics Data System (ADS)

    Miyamoto, Yoshitaka; Ueno, Hitomi; Hokari, Rei; Yuan, Wenji; Kuno, Shuichi; Kakimoto, Takashi; Enosawa, Shin; Negishi, Yoichi; Yoshinaka, Kiyoshi; Matsumoto, Yoichiro; Chiba, Toshio; Hayashi, Shuji


    In recent years, multilineage adipose tissue-derived stem cells (ASCs) have become increasingly attractive as a promising source for cell transplantation and regenerative medicine. Particular interest has been expressed in the potential to make tissue stem cells, such as ASCs and marrow stromal cells (MSCs), differentiate by gene transfection. Gene transfection using highly efficient viral vectors such as adeno- and sendai viruses have been developed for this purpose. Sonoporation, or ultrasound (US)-assisted gene transfer, is an alternative gene manipulation technique which employs the creation of a jet stream by ultrasonic microbubble cavitation. Sonoporation using non-viral vectors is expected to be a much safer, although less efficient, tool for prospective clinical gene therapy. In this report, we assessed the efficacy of the sonoporation technique for gene transfer to ASCs. We isolated and cultured adipocyets from mouse adipose tissue. ASCs that have the potential to differentiate with transformation into adipocytes or osteoblasts were obtained. Using the US-assisted system, plasmid DNA containing beta-galactosidase (beta-Gal) and green fluorescent protein (GFP) genes were transferred to the ASCs. For this purpose, a Sonopore 4000 (NEPAGENE Co.) and a Sonazoid (Daiichi Sankyo Co.) instrument were used in combination. ASCs were subjected to US (3.1 MHz, 50% duty cycle, burst rate 2.0 Hz, intensity 1.2 W/cm2, exposure time 30 sec). We observed that the gene was more efficiently transferred with increased concentrations of plasmid DNA (5-150 μg/mL). However, further optimization of the US parameters is required, as the gene transfer efficiency was still relatively low. In conclusion, we herein demonstrate that a gene can be transferred to ASCs using our US-assisted system. In regenerative medicine, this system might resolve the current issues surrounding the use of viral vectors for gene transfer.

  9. Horizontally transferred genes in the genome of Pacific white shrimp, Litopenaeus vannamei

    PubMed Central


    Background In recent years, as the development of next-generation sequencing technology, a growing number of genes have been reported as being horizontally transferred from prokaryotes to eukaryotes, most of them involving arthropods. As a member of the phylum Arthropoda, the Pacific white shrimp Litopenaeus vannamei has to adapt to the complex water environments with various symbiotic or parasitic microorganisms, which provide a platform for horizontal gene transfer (HGT). Results In this study, we analyzed the genome-wide HGT events in L. vannamei. Through homology search and phylogenetic analysis, followed by experimental PCR confirmation, 14 genes with HGT event were identified: 12 of them were transferred from bacteria and two from fungi. Structure analysis of these genes showed that the introns of the two fungi-originated genes were substituted by shrimp DNA fragment, two genes transferred from bacteria had shrimp specific introns inserted in them. Furthermore, around other three bacteria-originated genes, there were three large DNA segments inserted into the shrimp genome. One segment was a transposon that fully transferred, and the other two segments contained only coding regions of bacteria. Functional prediction of these 14 genes showed that 6 of them might be related to energy metabolism, and 4 others related to defense of the organism. Conclusions HGT events from bacteria or fungi were happened in the genome of L. vannamei, and these horizontally transferred genes can be transcribed in shrimp. This is the first time to report the existence of horizontally transferred genes in shrimp. Importantly, most of these genes are exposed to a negative selection pressure and appeared to be functional. PMID:23914989

  10. Horizontal gene transfer of an entire metabolic pathway between a eukaryotic alga and its DNA virus

    PubMed Central

    Monier, Adam; Pagarete, António; de Vargas, Colomban; Allen, Michael J.; Read, Betsy; Claverie, Jean-Michel; Ogata, Hiroyuki


    Interactions between viruses and phytoplankton, the main primary producers in the oceans, affect global biogeochemical cycles and climate. Recent studies are increasingly revealing possible cases of gene transfers between cyanobacteria and phages, which might have played significant roles in the evolution of cyanobacteria/phage systems. However, little has been documented about the occurrence of horizontal gene transfer in eukaryotic phytoplankton/virus systems. Here we report phylogenetic evidence for the transfer of seven genes involved in the sphingolipid biosynthesis pathway between the cosmopolitan eukaryotic microalga Emiliania huxleyi and its large DNA virus EhV. PCR assays indicate that these genes are prevalent in E. huxleyi and EhV strains isolated from different geographic locations. Patterns of protein and gene sequence conservation support that these genes are functional in both E. huxleyi and EhV. This is the first clear case of horizontal gene transfer of multiple functionally linked enzymes in a eukaryotic phytoplankton–virus system. We examine arguments for the possible direction of the gene transfer. The virus-to-host direction suggests the existence of ancient viruses that controlled the complex metabolic pathway in order to infect primitive eukaryotic cells. In contrast, the host-to-virus direction suggests that the serial acquisition of genes involved in the same metabolic pathway might have been a strategy for the ancestor of EhVs to stay ahead of their closest relatives in the great evolutionary race for survival. PMID:19451591

  11. The inhibition of the human cholesterol 7alpha-hydroxylase gene (CYP7A1) promoter by fibrates in cultured cells is mediated via the liver x receptor alpha and peroxisome proliferator-activated receptor alpha heterodimer.


    Gbaguidi, G Franck; Agellon, Luis B


    In previous work, we showed that the binding of the liver x receptor alpha:peroxisome proliferator-activated receptor alpha (LXRalpha:PPARalpha) heterodimer to the murine Cyp7a1 gene promoter antagonizes the stimulatory effect of their respective ligands. In this study, we determined if LXRalpha:PPARalpha can also regulate human CYP7A1 gene promoter activity. Co-expression of LXRalpha and PPARalpha in McArdle RH7777 hepatoma cells decreased the activity of the human CYP7A1 gene promoter in response to fibrates and 25-hydroxycholesterol. In vitro, the human CYP7A1 Site I bound LXRalpha:PPARalpha, although with substantially less affinity compared with the murine Cyp7a1 Site I. The binding of LXRalpha:PPARalpha to human CYP7A1 Site I was increased in the presence of either LXRalpha or PPARalpha ligands. In HepG2 hepatoblastoma cells, fibrates and 25-hydroxycholesterol inhibited the expression of the endogenous CYP7A1 gene as well as the human CYP7A1 gene promoter when co-transfected with plasmids encoding LXRalpha and PPARalpha. However, a derivative of the human CYP7A1 gene promoter that contains a mutant form of Site I that does not bind LXRalpha:PPARalpha was not inhibited by WY 14,643 or 25-hydroxycholesterol in both McArdle RH7777 and HepG2 cells. The ligand-dependent recruitment of LXRalpha:PPARalpha heterodimer onto the human CYP7A1 Site I can explain the inhibition of the human CYP7A1 gene promoter in response to fibrates and 25-hydroxycholesterol.

  12. A new computational method for the detection of horizontal gene transfer events.


    Tsirigos, Aristotelis; Rigoutsos, Isidore


    In recent years, the increase in the amounts of available genomic data has made it easier to appreciate the extent by which organisms increase their genetic diversity through horizontally transferred genetic material. Such transfers have the potential to give rise to extremely dynamic genomes where a significant proportion of their coding DNA has been contributed by external sources. Because of the impact of these horizontal transfers on the ecological and pathogenic character of the recipient organisms, methods are continuously sought that are able to computationally determine which of the genes of a given genome are products of transfer events. In this paper, we introduce and discuss a novel computational method for identifying horizontal transfers that relies on a gene's nucleotide composition and obviates the need for knowledge of codon boundaries. In addition to being applicable to individual genes, the method can be easily extended to the case of clusters of horizontally transferred genes. With the help of an extensive and carefully designed set of experiments on 123 archaeal and bacterial genomes, we demonstrate that the new method exhibits significant improvement in sensitivity when compared to previously published approaches. In fact, it achieves an average relative improvement across genomes of between 11 and 41% compared to the Codon Adaptation Index method in distinguishing native from foreign genes. Our method's horizontal gene transfer predictions for 123 microbial genomes are available online at

  13. Purification and gene cloning of alpha-methylserine aldolase from Ralstonia sp. strain AJ110405 and application of the enzyme in the synthesis of alpha-methyl-L-serine.


    Nozaki, Hiroyuki; Kuroda, Shinji; Watanabe, Kunihiko; Yokozeki, Kenzo


    By screening microorganisms that are capable of assimilating alpha-methyl-DL-serine, we detected alpha-methylserine aldolase in Ralstonia sp. strain AJ110405, Variovorax paradoxus AJ110406, and Bosea sp. strain AJ110407. A homogeneous form of this enzyme was purified from Ralstonia sp. strain AJ110405, and the gene encoding the enzyme was cloned and expressed in Escherichia coli. The enzyme appeared to be a homodimer consisting of identical subunits, and its molecular mass was found to be 47 kDa. It contained 0.7 to 0.8 mol of pyridoxal 5'-phosphate per mol of subunit and could catalyze the interconversion of alpha-methyl-L-serine to L-alanine and formaldehyde in the absence of tetrahydrofolate. Formaldehyde was generated from alpha-methyl-L-serine but not from alpha-methyl-D-serine, L-serine, or D-serine. Alpha-methyl-L-serine synthesis activity was detected when L-alanine was used as the substrate. In contrast, no activity was detected when D-alanine was used as the substrate. In the alpha-methyl-L-serine synthesis reaction, the enzymatic activity was inhibited by an excess amount of formaldehyde, which was one of the substrates. We used cells of E. coli as a whole-cell catalyst to express the gene encoding alpha-methylserine aldolase and effectively obtained a high yield of optically pure alpha-methyl-L-serine using L-alanine and formaldehyde.

  14. Human tumor necrosis factor-alpha gene 3' untranslated region confers inducible toxin responsiveness to homologous promoter in monocytic THP-1 cells.


    Seiler-Tuyns, A; Dufour, N; Spertini, F


    To better define the role of 3' untranslated region (3'UTR) on transcriptional regulation of the human tumor necrosis factor (TNF)-alpha gene, monocytic human THP-1 cells were transfected with two TNF-alpha promoter constructs spanning base pairs -1897/-1 and -1214/-1, respectively, and linked to the rabbit beta-globin gene. Quantitative globin gene expression of chimerae was measured by reverse transcription-polymerase chain reaction. A construct linking the chicken beta-actin promoter and a deleted portion of the beta-globin gene was cotransfected and used as internal standard. Unexpectedly, when THP-1 cells were stimulated with lipopolysaccharide or toxic shock syndrome toxin-1, gene regulation was hardly detected. In contrast, endogenous TNF-alpha gene regulation measured by the same reverse transcription-polymerase chain reaction procedure was vigorous. Remarkably, ligation of 3'UTR to chimeric constructs led to a drastic drop in the basal level of chimeric gene expression, resulting in a 15- to 40-fold induction of the reporter gene. Consistently, when the TNF-alpha promoter was replaced by the cytomegalovirus early immediate promoter, gene expression was also uniformly reduced but was no longer up-regulated upon stimulation with lipopolysaccharide and toxic shock syndrome toxin-1. These data provide the first line of evidence that, in addition to its role in TNF-alpha transcript stability and translation, human TNF-alpha 3'UTR also participates in modulating gene expression at the transcriptional level.

  15. Bacteriophage WO Can Mediate Horizontal Gene Transfer in Endosymbiotic Wolbachia Genomes

    PubMed Central

    Wang, Guan H.; Sun, Bao F.; Xiong, Tuan L.; Wang, Yan K.; Murfin, Kristen E.; Xiao, Jin H.; Huang, Da W.


    Phage-mediated horizontal gene transfer (HGT) is common in free-living bacteria, and many transferred genes can play a significant role in their new bacterial hosts. However, there are few reports concerning phage-mediated HGT in endosymbionts (obligate intracellular bacteria within animal or plant hosts), such as Wolbachia. The Wolbachia-infecting temperate phage WO can actively shift among Wolbachia genomes and has the potential to mediate HGT between Wolbachia strains. In the present study, we extend previous findings by validating that the phage WO can mediate transfer of non-phage genes. To do so, we utilized bioinformatic, phylogenetic, and molecular analyses based on all sequenced Wolbachia and phage WO genomes. Our results show that the phage WO can mediate HGT between Wolbachia strains, regardless of whether the transferred genes originate from Wolbachia or other unrelated bacteria. PMID:27965627


    EPA Science Inventory


    We evaluated the safety of agents that enhance gene transfer by modulating paracellular permeability. Lactate dehydrogenase (LDH) and cytokine release were measured in polarized primary human airway epithelial (HAE) cells after luminal application of vehicle, ...

  17. Genome-wide identification of horizontal gene transfer in Fusarium verticillioides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Horizontal gene transfer (HGT), the exchange and stable integration of genetic material between different lineages, breaks species boundaries and generates new biological diversity. In eukaryotes, despite potential barriers, like the nuclear envelope and multicellularity, HGT may be facilitated by t...

  18. Fibroblast growth factor 7 inhibits cholesterol 7{alpha}-hydroxylase gene expression in hepatocytes

    SciTech Connect

    Sun, Zhichao; Yu, Xuemei; Wu, Weibin; Jia, Dongwei; Chen, Yinle; Ji, Lingling; Liu, Xijun; Peng, Xiaomin; Li, Yintao; Yang, Lili; Ruan, Yuanyuan; Gu, Jianxin; Ren, Shifang; Zhang, Songwen


    Highlights: Black-Right-Pointing-Pointer FGF7 strongly and rapidly down-regulates the expression of CYP7A1 in hepatocytes. Black-Right-Pointing-Pointer FGF7 suppresses the expression of CYP7A1 via FGFR2 and downstream JNK activation. Black-Right-Pointing-Pointer Blocking FGF7 abrogates HSC-induced inhibition of CYP7A1 expression in hepatocytes. -- Abstract: Cholesterol 7{alpha}-hydroxylase (CYP7A1) is the initial and rate-limiting enzyme for bile acid synthesis. Transcription of the CYP7A1 gene is regulated by bile acids, nuclear receptors and cytokines. Fibroblast growth factor 7 (FGF7) secreted from activated hepatic stellate cells (HSC) during chronic liver fibrosis regulates hepatocyte survival and liver regeneration. In the carbon tetrachloride (CCl{sub 4})-induced fibrotic mouse liver, we demonstrated that the expression of CYP7A1 was largely decreased while the expression of FGF7 was significantly increased. We further demonstrated that FGF7 inhibited CYP7A1 gene expression in hepatocytes. Knockdown study by short interfering RNA, kinase inhibition and phosphorylation assays revealed that the suppression of CYP7A1 expression by FGF7 was mediated by FGFR2 and its downstream JNK signaling cascade. The FGF7 neutralizing antibody restored CYP7A1 expression in Hep3B cells treated with conditioned medium from HSC. In summary, the data suggest that FGF7 is a novel regulator of CYP7A1 expression in hepatocytes and may prevent hepatocytes from accumulating toxic bile acids during liver injury and fibrosis.

  19. Orofacial clefts, parental cigarette smoking, and transforming growth factor-alpha gene variants

    SciTech Connect

    Shaw, G.M.; Wasserman, C.R.; O`Malley, C.D.


    Results of studies determine whether women who smoke during early pregnancy are at increased risk of delivering infants with orofacial clefts have been mixed, and recently a gene-environment interaction between maternal smoking, transforming growth factor-alpha (TGFa), and clefting has been reported. Using a large population-based case-control study, we investigated whether parental periconceptional cigarette smoking was associated with an increased risk for having offspring with orofacial clefts. We also investigated the influence of genetic variation of the TGFa locus on the relation between smoking and clefting. Parental smoking information was obtained from telephone interviews with mothers of 731 (84.7% of eligible) orofacial cleft case infants and with mothers of 734 (78.2%) nonmalformed control infants. DNA was obtained from newborn screening blood spots and genotyped for the allelic variants of TGFa. We found that risks associated with maternal smoking were most elevated for isolated cleft lip with or without cleft palate, (odds ratio 2.1 [95% confidence interval 1.3-3.6]) and for isolated cleft palate (odds ratio 2.2 [1.1-4.5]) when mothers smoked {ge} 20 cigarrettes/d. These risks for white infants ranged from 3-fold to 11-fold across phenotypic groups. Paternal smoking was not associated with clefting among the offspring of nonsmoking mothers, and passive smoke exposures were associated with at most slightly increased risks. This study offers evidence that the risk for orofacial clefting in infants may be influenced by maternal smoke exposures alone as well as in combination (gene-environment interaction) with the presence of the uncommon TGFa allele. 56 refs., 5 tabs.

  20. Genetic effects of common polymorphisms in estrogen receptor alpha gene on osteoarthritis: a meta-analysis

    PubMed Central

    Ma, Hecheng; Wu, Weiqian; Yang, Xiaodi; Liu, Jianguo; Gong, Yubao


    Objective: The estrogen receptor alpha (ESR1) gene has been implicated in the etiology of osteoarthritis (OA). However, the results are conflicting. We assessed the association of three common ESR1 polymorphisms, rs2234693, rs9340799 and rs2228480, with OA in this meta-analysis. Methods: A comprehensive search was performed to identify related studies. Pooled odds ratio (OR) with 95% confidence interval (CI) was calculated using fixed or random effects model. Results: 15 studies (7036 cases and 9669 controls) for rs2234693 polymorphism, 14 studies (3904 cases and 6991 controls) for rs9340799 and 3 studies (331 cases and 619 controls) for rs2228480 polymorphism were identified. The final results indicated that the G allele in ESR1 rs9340799 was associated with decreased OA risk (GG+GA vs. AA: OR=0.878, 95% CI=0.792-0.972, P=0.012; G vs. A: OR=0.902, 95% CI=0.836-0.975, P=0.009). The A allele in rs2228480 might be associated with increased OA risk. But no significant association of rs2234693 polymorphism with OA susceptibility was observed. Conclusions: This meta-analysis indicates rs9340799 and rs2228480 rather than rs2234693 polymorphisms are associated with the incidence of OA. Some stable associations should be further confirmed in future. PMID:26550281

  1. Immune protective effect of human alpha-1-antitrypsin gene during β cell transplantation in diabetic mice.


    Yang, Lu; Liao, Yu-Ting; Yang, Xiao-Fei; Reng, Li-Wei; Qi, Hui; Li, Fu-Rong


    Type 1 diabetes (T1D) is a chronic autoimmune disease in which β cells are destroyed. Islet transplantation is the most promising therapeutic treatment for T1D patients. However, allograft rejection and autoimmune reaction have been recognized as primary causes of graft loss after transplantation. Alpha-1-antitrypsin (AAT) is an important serine protease inhibitor in serum. AAT is characterized by anti-inflammation, anti-apoptosis, and induction-specific immunological tolerance. In this study, we successfully established NIT-hAAT cell lines, which are murine islet β cell lines with stable expression of human AAT (hAAT) gene. These NIT-hAAT cells were transplanted under the left kidney capsule of BALB/c diabetic mice. Interestingly, the sustained expression of hAAT in vivo can block the inflammatory cell infiltration and reduce the production of proinflammatory cytokines to effectively prevent nonspecific inflammation. Results showed that hAAT can inhibit the proliferation of lymphocytes, shift the balance between Th17 and Treg, and suppress the maturation of dendritic cells. Therefore, hAAT can serve as a beneficial immunomodulator that limits immune rejection to prolong islet allograft survival and achieve long-term successful transplant outcomes.

  2. Regulation of constitutive androstane receptor and its target genes by fasting, cAMP, hepatocyte nuclear factor alpha, and the coactivator peroxisome proliferator-activated receptor gamma coactivator-1alpha.


    Ding, Xunshan; Lichti, Kristin; Kim, Insook; Gonzalez, Frank J; Staudinger, Jeff L


    Animal studies reveal that fasting and caloric restriction produce increased activity of specific metabolic pathways involved in resistance to weight loss in liver. Evidence suggests that this phenomenon may in part occur through the action of the constitutive androstane receptor (CAR, NR1I3). Currently, the precise molecular mechanisms that activate CAR during fasting are unknown. We show that fasting coordinately induces expression of genes encoding peroxisome proliferator-activated receptor gamma coactivator-1alpha (PGC-1alpha), CAR, cytochrome P-450 2b10 (Cyp2b10), UDP-glucuronosyltransferase 1a1 (Ugt1a1), sulfotransferase 2a1 (Sult2a1), and organic anion-transporting polypeptide 2 (Oatp2) in liver in mice. Treatments that elevate intracellular cAMP levels also produce increased expression of these genes in cultured hepatocytes. Our data show that PGC-1alpha interaction with hepatocyte nuclear factor 4alpha (HNF4alpha, NR2A1) directly regulates CAR gene expression through a novel and evolutionarily conserved HNF4-response element (HNF4-RE) located in its proximal promoter. Expression of PGC-1alpha in cells increases CAR expression and ligand-independent CAR activity. Genetic studies reveal that hepatic expression of HNF4alpha is required to produce fasting-inducible CAR expression and activity. Taken together, our data show that fasting produces increased expression of genes encoding key metabolic enzymes and an uptake transporter protein through a network of interactions involving cAMP, PGC-1alpha, HNF4alpha, CAR, and CAR target genes in liver. Given the recent finding that mice lacking CAR exhibit a profound decrease in resistance to weight loss during extended periods of caloric restriction, our findings have important implications in the development of drugs for the treatment of obesity and related diseases.

  3. Genomic organization and chromosomal localization of the human and mouse genes encoding the alpha receptor component for ciliary neurotrophic factor.


    Valenzuela, D M; Rojas, E; Le Beau, M M; Espinosa, R; Brannan, C I; McClain, J; Masiakowski, P; Ip, N Y; Copeland, N G; Jenkins, N A


    Ciliary neurotrophic factor (CNTF) has recently been found to share receptor components with, and to be structurally related to, a family of broadly acting cytokines, including interleukin-6, leukemia inhibitory factor, and oncostatin M. However, the CNTF receptor complex also includes a CNTF-specific component known as CNTF receptor alpha (CNTFR alpha). Here we describe the molecular cloning of the human and mouse genes encoding CNTFR. We report that the human and mouse genes have an identical intron-exon structure that correlates well with the domain structure of CNTFR alpha. That is, the signal peptide and the immunoglobulin-like domain are each encoded by single exons, the cytokine receptor-like domain is distributed among 4 exons, and the C-terminal glycosyl phosphatidylinositol recognition domain is encoded by the final coding exon. The position of the introns within the cytokine receptor-like domain corresponds to those found in other members of the cytokine receptor superfamily. Confirming a recent study using radiation hybrids, we have also mapped the human CNTFR gene to chromosome band 9p13 and the mouse gene to a syntenic region of chromosome 4.

  4. A statistical model for bacterial speciation triggered by lateral gene transfer

    NASA Astrophysics Data System (ADS)

    Sidhu, Sunjeet; Peng, Wequin


    The process of bacterial speciation has been a major unresolved issue in the study of bacterial evolution. It has been proposed that lateral gene transfer and homologous recombination play critical and complementary roles in speciation. We introduce a statistical model, of a population, for the evolution under lateral gene transfer and local homologous recombination. We examine the evolutionary dynamics and its dependence on various evolutionary operators. J. G. Lawrence, Theor. Popul. Biol. 61, 449(2002).

  5. Fabrication of DNA-antibody-apatite composite layers for cell-targeted gene transfer

    NASA Astrophysics Data System (ADS)

    Yazaki, Yushin; Oyane, Ayako; Araki, Hiroko; Sogo, Yu; Ito, Atsuo; Yamazaki, Atsushi; Tsurushima, Hideo


    Surface-mediated gene transfer systems using apatite (Ap)-based composite layers have received increased attention in tissue engineering applications owing to their safety, biocompatibility and relatively high efficiency. In this study, DNA-antibody-apatite composite layers (DA-Ap layers), in which DNA and antibody molecules are immobilized within a matrix of apatite nanocrystals, were fabricated using a biomimetic coating process. They were then assayed for their gene transfer capability for application in a specific cell-targeted gene transfer. A DA-Ap layer that was fabricated with an anti-CD49f antibody showed a higher gene transfer capability to the CD49f-positive CHO-K1 cells than a DNA-apatite composite layer (D-Ap layer). The antibody facilitated the gene transfer capability of the DA-Ap layer only to the specific cells that were expressing corresponding antigens. When the DA-Ap layer was fabricated with an anti-N-cadherin antibody, a higher gene transfer capability compared with the D-Ap layer was found in the N-cadherin-positive P19CL6 cells, but not in the N-cadherin-negative UV♀2 cells or in the P19CL6 cells that were pre-blocked with anti-N-cadherin. Therefore, the antigen-antibody binding that takes place at the cell-layer interface should be responsible for the higher gene transfer capability of the DA-Ap than D-Ap layer. These results suggest that the DA-Ap layer works as a mediator in a specific cell-targeted gene transfer system.

  6. Fabrication of DNA-antibody-apatite composite layers for cell-targeted gene transfer.


    Yazaki, Yushin; Oyane, Ayako; Araki, Hiroko; Sogo, Yu; Ito, Atsuo; Yamazaki, Atsushi; Tsurushima, Hideo


    Surface-mediated gene transfer systems using apatite (Ap)-based composite layers have received increased attention in tissue engineering applications owing to their safety, biocompatibility and relatively high efficiency. In this study, DNA-antibody-apatite composite layers (DA-Ap layers), in which DNA and antibody molecules are immobilized within a matrix of apatite nanocrystals, were fabricated using a biomimetic coating process. They were then assayed for their gene transfer capability for application in a specific cell-targeted gene transfer. A DA-Ap layer that was fabricated with an anti-CD49f antibody showed a higher gene transfer capability to the CD49f-positive CHO-K1 cells than a DNA-apatite composite layer (D-Ap layer). The antibody facilitated the gene transfer capability of the DA-Ap layer only to the specific cells that were expressing corresponding antigens. When the DA-Ap layer was fabricated with an anti-N-cadherin antibody, a higher gene transfer capability compared with the D-Ap layer was found in the N-cadherin-positive P19CL6 cells, but not in the N-cadherin-negative UV♀2 cells or in the P19CL6 cells that were pre-blocked with anti-N-cadherin. Therefore, the antigen-antibody binding that takes place at the cell-layer interface should be responsible for the higher gene transfer capability of the DA-Ap than D-Ap layer. These results suggest that the DA-Ap layer works as a mediator in a specific cell-targeted gene transfer system.

  7. Chemokine gene expression in the murine renal cell carcinoma, RENCA, following treatment in vivo with interferon-alpha and interleukin-2.

    PubMed Central

    Sonouchi, K.; Hamilton, T. A.; Tannenbaum, C. S.; Tubbs, R. R.; Bukowski, R.; Finke, J. H.


    The expression of three chemoattractant cytokine (chemokine) messenger (m)RNAs in the murine renal cell carcinoma (RENCA) from mice treated with a combination of interferon-alpha (IFN-alpha) and interleukin-2 was examined and related to tumor infiltration by inflammatory leukocytes. Using a semi-quantitative reverse transcriptase polymerase chain reaction assay, mRNAs encoding the KC, JE, and IP-10 genes were all elevated in tumor tissue from mice treated systemically with IFN-alpha/interleukin-2 for 4 days. Similarly, the mRNA for tumor necrosis factor-alpha (TNF-alpha) was also increased in tumors from treated as compared to control animals. The same tumors showed a significant increase in Mac-1+ leukocytes, which correlated well with the increase in chemokine and TNF-alpha gene expression. The renal cell carcinoma tumor itself may be responsible for the expression of chemokine genes in the tumor bed following cytokine therapy. Cultures of freshly explanted RENCA cells expressed significant levels of chemokine mRNAs when stimulated in vitro with IFN alpha, IFN gamma, and/or interleukin-2, demonstrating that this tumor cell has potential for expression of these genes in vivo. In contrast, TNF-alpha expression was not detected in cultured tumor cells. Thus TNF-alpha may be expressed by infiltrating monocytes following exposure to recombinant cytokine therapy. Images Figure 1 Figure 2 Figure 4 PMID:8160774

  8. Structure of the human gene and two rat cDNAs encoding the alpha chain of GTP-binding regulatory protein Go: two different mRNAs are generated by alternative splicing.

    PubMed Central

    Tsukamoto, T; Toyama, R; Itoh, H; Kozasa, T; Matsuoka, M; Kaziro, Y


    Go is a specific class ("other") of signal-transducing heterotrimeric GTP-binding proteins (G proteins) that is expressed in high levels in mammalian brain. We have cloned two different rat cDNAs encoding the alpha subunit of Go (Go alpha-1 and Go alpha-2) and a human Go alpha chromosomal gene. The human Go alpha gene spans more than 100 kilobases and contains 11 exons, including one noncoding exon in the 3' flanking region. The 5' flanking region is highly G + C-rich and contains five G.C boxes (Sp1 binding sites) but no TATA box. Exons 7 and 8 coding for amino acid residues 242-354 of Go alpha protein are duplicated (referred to as exons 7A, 7B, 8A, and 8B). It was found that exons 7A and 8A code for Go alpha-1, and 7B and 8B code for Go alpha-2. This indicates that two different Go alpha mRNAs may be generated by alternative splicing of a single Go alpha gene. The splice sites of the Go alpha-1 and Go alpha-2 genes are completely identical with those encoding human inhibitory G protein alpha subunits Gi2 alpha and Gi3 alpha [Itoh, H., Toyama, R., Kozasa, T., Tsukamoto, T., Matsuoka, M. & Kaziro, Y. (1988) J. Biol. Chem. 263, 6656-6664] and also transducin G protein alpha subunit Gt1 alpha [Raport, C. J., Dere, B. & Hurley, J. (1989) J. Biol. Chem. 264, 7122-7128]. Sequence homology and conservation of the exon-intron organization indicate that the genes coding for Go alpha, Gi2 alpha, Gi3 alpha, Gt1 alpha, and probably Gi1 alpha may be evolved from a common progenitor. Like Go alpha-1, Go alpha-2 is expressed mainly in brain. Images PMID:1901650

  9. Cloning and characterization of genes encoding alpha and beta subunits of glutamate-gated chloride channel protein in Cylicocyclus nassatus.


    Tandon, Ritesh; LePage, Keith T; Kaplan, Ray M


    The invertebrate glutamate-gated chloride channels (GluCls) are receptor molecules and targets for the avermectin-milbemycin (AM) group of anthelmintics. Mutations in GluCls are associated with ivermectin resistance in the soil dwelling nematode Caenorhabditis elegans and the parasitic nematode Cooperia oncophora. In this study, full-length cDNAs encoding alpha and beta subunits of GluCl were cloned and sequenced in Cylicocyclus nassatus, a common and important cyathostomin nematode parasite of horses. Both genes possess the sequence characteristics typical of GluCls, and phylogenetic analysis confirms that these genes are evolutionarily closely related to GluCls of other nematodes and flies. Complete coding sequences of C. nassatus GluCl-alpha and GluCl-beta were subcloned into pTL1 mammalian expression vector, and proteins were expressed in COS-7 cells. Ivermectin-binding characteristics were determined by incubating COS-7 cell membranes expressing C. nassatus GluCl-alpha and GluCl-beta proteins with [(3)H]ivermectin. In competitive binding experiments, fitting the data to a one site competition model, C. nassatus GluCl-alpha was found to bind [(3)H]ivermectin with a high amount of displaceable binding (IC(50)=208 pM). Compared to the mock-transfected COS-7 cells, the means of [(3)H]ivermectin binding were significantly different for C. nassatus GluCl-alpha and the Haemonchus contortus GluCl (HcGluCla) (p=0.018 and 0.023, respectively) but not for C. nassatus GluCl-beta (p=0.370). This is the first report of orthologs of GluCl genes and in vitro expression of an ivermectin-binding protein in a cyathostomin species. These data suggest the likelihood of a similar mechanism of action of AM drugs in these parasites, and suggest that mechanisms of resistance may also be similar.

  10. Immune deficiency enhances expression of recombinant human antibody in mice after nonviral in vivo gene transfer.


    Kitaguchi, Kohji; Toda, Mikako; Takekoshi, Masataka; Maeda, Fumiko; Muramatsu, Tatsuo; Murai, Atsushi


    A cDNA encoding human antibody against hepatitis B virus was expressed in normal and severe combined immune deficiency (SCID) mice to clarify whether or not host immune status affects circulating levels of the recombinant human antibody (RhAb) after nonviral in vivo gene transfer. For transferring genes, either electroporation (EP) or hydrodynamics-based transfection (HD) was employed. The former was applied to the leg muscle to express the gene, while the latter primarily targeted foreign gene expression in the liver. The expressed RhAb was secreted into the blood circulation, and its existence was assayed by ELISA. Prior to the investigation of host immune status, suitable forms of plasmid expression vectors and types of electrodes were determined in normal mice. Results showed that the vector encoding both the light and heavy chains driven by the CMV promoter had the highest plasma RhAb concentrations, and a pair of pincette-type electrodes conferred the best performance. In both EP and HD, the SCID state showed an increased and prolonged RhAb production in the blood circulation due probably to suppressed recognition of RhAb as a foreign protein to the host animal. The difference in gene transfer methods demonstrated a characteristic pattern: an early and sharp rise followed by a relatively rapid decrease in HD, in contrast to a gradual rise followed by a plateau level maintained in EP. As a result, with the same amount of gene transferred, the plasma RhAb concentrations for the first 7 or 8 weeks were higher in HD than EP, while the reverse was true for the latter period. Multiple gene transfer contributed to maintaining and prolonging high RhAb concentrations in plasma by both methods with similar characteristic patterns accompanying the respective gene transfer method. These results suggest the importance of host immunological potency for maintaining plasma RhAb concentrations if these gene transfer technologies are used for clinical and therapeutic purposes.

  11. Two bi-allelic single nucleotide polymorphisms within the promoter region of the horse tumour necrosis factor alpha gene.


    Matiasovic, J; Lukeszová, L; Horín, P


    Primers based on GenBank sequences within the 5' untranslated region (UTR) of the human and horse tumour necrosis factor alpha (TNF-alpha) genes were designed and used to amplify a 522-bp product. Sequencing of five clones derived from five independent PCRs obtained from three different animals of three different breeds (Old Kladruber, Akhal-Teke and Shetland Pony) revealed a high level of sequence identity to the TNF-alpha promoter regions of other species. The existing GenBank horse sequences were confirmed and extended upstream by 230 nucleotides. Based on the sequence obtained, a new horse-specific forward primer was designed to amplify a 213-bp PCR product, which was screened for polymorphism using single-strand conformation polymorphism (SSCP). Three allelic variants of the horse TNF-alpha gene were identified and sequenced (GenBank accession numbers ADF 349558-60). Two single nucleotide polymorphisms explained the existence of the three SSCP alleles detected: C/T and T/C single base pair substitutions at positions 137 and 147, respectively. Differences in allelic frequencies between Old Kladruber and Akhal-Teke breeds were observed.

  12. An XMRV Derived Retroviral Vector as a Tool for Gene Transfer

    PubMed Central


    Background Retroviral vectors are widely used tools for gene delivery and gene therapy. They are useful for gene expression studies and genetic manipulation in vitro and in vivo. Many retroviral vectors are derived from the mouse gammaretrovirus, murine leukemia virus (MLV). These vectors have been widely used in gene therapy clinical trials. XMRV, initially found in prostate cancer tissue, was the first human gammaretrovirus described. Findings We developed a new retroviral vector based on XMRV called pXC. It was developed for gene transfer to human cells and is produced by transient cotransfection of LNCaP cells with pXC and XMRV-packaging plasmids. Conclusions We demonstrated that pXC mediates expression of inserted transgenes in cell lines. This new vector will be a useful tool for gene transfer in human and non-human cell lines, including gene therapy studies. PMID:21651801

  13. Direct Gene Transfer into Human Cultured Cells Facilitated by Laser Micropuncture of the Cell Membrane

    NASA Astrophysics Data System (ADS)

    Tao, Wen; Wilkinson, Joyce; Stanbridge, Eric J.; Berns, Michael W.


    The selective alteration of the cellular genome by laser microbeam irradiation has been extensively applied in cell biology. We report here the use of the third harmonic (355 nm) of an yttrium-aluminum garnet laser to facilitate the direct transfer of the neo gene into cultured human HT1080-6TG cells. The resultant transformants were selected in medium containing an aminoglycoside antibiotic, G418. Integration of the neo gene into individual human chromosomes and expression of the gene were demonstrated by Southern blot analyses, microcell-mediated chromosome transfer, and chromosome analyses. The stability of the integrated neo gene in the transformants was shown by a comparative growth assay in selective and nonselective media. Transformation and incorporation of the neo gene into the host genome occurred at a frequency of 8 × 10-4-3 × 10-3. This method appears to be 100-fold more efficient than the standard calcium phosphate-mediated method of DNA transfer.

  14. Horizontal gene transfer from diverse bacteria to an insect genome enables a tripartite nested mealybug symbiosis.


    Husnik, Filip; Nikoh, Naruo; Koga, Ryuichi; Ross, Laura; Duncan, Rebecca P; Fujie, Manabu; Tanaka, Makiko; Satoh, Nori; Bachtrog, Doris; Wilson, Alex C C; von Dohlen, Carol D; Fukatsu, Takema; McCutcheon, John P


    The smallest reported bacterial genome belongs to Tremblaya princeps, a symbiont of Planococcus citri mealybugs (PCIT). Tremblaya PCIT not only has a 139 kb genome, but possesses its own bacterial endosymbiont, Moranella endobia. Genome and transcriptome sequencing, including genome sequencing from a Tremblaya lineage lacking intracellular bacteria, reveals that the extreme genomic degeneracy of Tremblaya PCIT likely resulted from acquiring Moranella as an endosymbiont. In addition, at least 22 expressed horizontally transferred genes from multiple diverse bacteria to the mealybug genome likely complement missing symbiont genes. However, none of these horizontally transferred genes are from Tremblaya, showing that genome reduction in this symbiont has not been enabled by gene transfer to the host nucleus. Our results thus indicate that the functioning of this three-way symbiosis is dependent on genes from at least six lineages of organisms and reveal a path to intimate endosymbiosis distinct from that followed by organelles.

  15. Herpes simplex virus type 1 (HSV-1)-derived recombinant vectors for gene transfer and gene therapy.


    Marconi, Peggy; Fraefel, Cornel; Epstein, Alberto L


    Herpes simplex virus type 1 (HSV-1 ) is a human pathogen whose lifestyle is based on a long-term dual interaction with the infected host, being able to establish both lytic and latent infections. The virus genome is a 153-kilobase pair (kbp) double-stranded DNA molecule encoding more than 80 genes. The interest of HSV-1 as gene transfer vector stems from its ability to infect many different cell types, both quiescent and proliferating cells, the very high packaging capacity of the virus capsid, the outstanding neurotropic adaptations that this virus has evolved, and the fact that it never integrates into the cellular chromosomes, thus avoiding the risk of insertional mutagenesis. Two types of vectors can be derived from HSV-1, recombinant vectors and amplicon vectors, and different methodologies have been developed to prepare large stocks of each type of vector. This chapter summarizes the approach most commonly used to prepare recombinant HSV-1 vectors through homologous recombination, either in eukaryotic cells or in bacteria.

  16. Interleukin-6 gene transfer reverses body weight gain and fatty liver in obese mice.


    Ma, Yongjie; Gao, Mingming; Sun, Hao; Liu, Dexi


    Interleukin-6 (IL-6) is a multifunctional protein and has a major influence on energy metabolism. The current study was designed to assess the therapeutic effect of overexpression of Il-6 gene through gene transfer on high fat diet-induced obese mice. Hydrodynamic delivery of 1 μg pLIVE-IL6 plasmid per mouse into C57BL/6 obese mice resulted in peak level at 10 ng/ml of circulating IL-6 1 day after gene transfer and above 1n g/ml thereafter for a period of 6 weeks. Persistent Il-6 gene expression did not affect food intake but induced a significant reduction in body weight and improved obesity-associated hepatic steatosis. Il-6 gene delivery enhanced thermogenic gene expression and elevated protein levels of phosphorylated STAT3, PGC1α and UCP1 in brown adipose tissue. Il-6 overexpression elevated mRNA levels of lipolysis genes, triggered phosphorylation of STAT3, AMPK, and ACC, and increased expression of genes involved in fatty acid oxidation in skeletal muscle. IL-6 did not affect macrophage infiltration but maintained the M2 macrophage population in adipose tissue. Collectively, these results suggest that overexpression of the Il-6 gene by hydrodynamic gene delivery induces weight loss and alleviates obesity-induced fatty liver and insulin resistance, supporting the notion that gene transfer is a valid approach in managing obesity epidemics.

  17. Evolutionary transfers of mitochondrial genes to the nucleus in the Populus lineage and coexpression of nuclear and mitochondrial Sdh4 genes.


    Choi, Catherine; Liu, Zhenlan; Adams, Keith L


    The transfer of mitochondrial genes to the nucleus is an ongoing evolutionary process in flowering plants. Evolutionarily recent gene transfers provide insights into the evolutionary dynamics of the process and the way in which transferred genes become functional in the nucleus. Genes that are present in the mitochondrion of some angiosperms but have been transferred to the nucleus in the Populus lineage were identified by searches of Populus sequence databases. Sequence analyses and expression experiments were used to characterize the transferred genes. Two succinate dehydrogenase genes and six mitochondrial ribosomal protein genes have been transferred to the nucleus in the Populus lineage and have become expressed. Three transferred genes have gained an N-terminal mitochondrial targeting presequence from other pre-existing genes and two of the transferred genes do not contain an N-terminal targeting presequence. Intact copies of the succinate dehydrogenase gene Sdh4 are present in both the mitochondrion and the nucleus. Both copies of Sdh4 are expressed in multiple organs of two Populus species and RNA editing occurs in the mitochondrial copy. These results provide a genome-wide perspective on mitochondrial genes that were transferred to the nucleus and became expressed, functional genes during the evolutionary history of Populus.

  18. Molecular cloning and characterization of CFT1, a developmentally regulated avian alpha(1,3)-fucosyltransferase gene.


    Lee, K P; Carlson, L M; Woodcock, J B; Ramachandra, N; Schultz, T L; Davis, T A; Lowe, J B; Thompson, C B; Larsen, R D


    Although coordinate expression of carbohydrate epitopes during development is well described, mechanisms which regulate this expression remain largely unknown. In this study we demonstrate that developing chicken B cells express the LewisX terminal oligosaccharide structure in a stage-specific manner. To examine regulation of this expression, we have cloned and expressed the chicken alpha(1,3)-fucosyltransferase gene involved in LewisX biosynthesis, naming it chicken fucosyltransferase 1 (CFT1). CFT1 is characterized by a single long open reading frame of 356 amino acids encoding a type II transmembrane glycoprotein. The domain structure and predicted amino acid sequence are highly conserved between CFT1 and mammalian FucTIV genes (52.8% and 46.3% identity to mouse and human respectively). In vitro CFT1 fucosyltransferase activity utilizes LacNAc > 3'sialyl-LacNAc acceptors with almost no utilization of other neutral type II (lactose, 2-fucosyllactose), or type I (lacto-N-biose I) acceptors. CFT1-transfected cells make cell surface LewisX (COS-7) and LewisX + VIM-2 structures (Chinese hamster ovary). CFT1 gene expression is tissue-specific and includes embryonic thymus and bursa. Furthermore, expression of the CFT1 gene and cell surface LewisX structures are closely linked during B cell development. These findings reveal the evolutionary conservation between nonmammalian and mammalian alpha(1,3)-fucosyltransferase genes and demonstrate a role for fucosyltransferase gene regulation in the developmental expression of oligosaccharide structures.

  19. Exploration of horizontal gene transfer between transplastomic tobacco and plant-associated bacteria.


    Demanèche, Sandrine; Monier, Jean-Michel; Dugat-Bony, Eric; Simonet, Pascal


    The likelihood of gene transfer from transgenic plants to bacteria is dependent on the transgene copy number and on the presence of homologous sequences for recombination. The large number of chloroplast genomes in a plant cell as well as the prokaryotic origin of the transgene may thus significantly increase the likelihood of gene transfer from transplastomic plants to bacteria. In order to assess the probability of such a transfer, bacterial isolates, screened for their ability to colonize decaying tobacco plant tissue and possessing DNA sequence similarity to the chloroplastic genes accD and rbcL flanking the transgene (aadA), were tested for their ability to take up extracellular DNA (broad host-range pBBR1MCS-3-derived plasmid, transplastomic plant DNA and PCR products containing the genes accD-aadA-rbcL) by natural or electrotransformation. The results showed that among the 16 bacterial isolates tested, six were able to accept foreign DNA and acquire the spectinomycin resistance conferred by the aadA gene on plasmid, but none of them managed to integrate transgenic DNA in their chromosome. Our results provide no indication that the theoretical gene transfer-enhancing properties of transplastomic plants cause horizontal gene transfer at rates above those found in other studies with nuclear transgenes.

  20. Nondeletional alpha-thalassemia: first description of alpha Hph alpha and alpha Nco alpha mutations in a Spanish population.


    Ayala, S; Colomer, D; Aymerich, M; Pujades, A; Vives-Corrons, J L


    Several different deletions underlie the molecular basis of alpha-thalassemia. The most common alpha-thalassemia determinant in Spain is the rightward deletion (-alpha 3.7). To our knowledge, however, no cases of alpha-thalassemia due to nondeletional mutations have so far been described in this particular Mediterranean area. Here, we report the existence of nondeletional forms of alpha-thalassemia in ten Spanish families. The alpha 2-globin gene was characterized in ten unrelated patients and their relatives only when the presence of deletional alpha-thalassemia was ruled out. The alpha 2-globin gene analysis was performed using the polymerase chain reaction (PCR) followed by restriction enzyme analysis or by allelespecific priming. This allowed the identification of a 5-base pair (bp) deletion at the donor site of IVS I (alpha Hph alpha) in 9 cases and the alpha 2 initiation codon mutation (alpha Nco alpha) in one case. Although these alpha 2-globin gene mutations are found in other mediterranean areas, our results demonstrate their presence in the Spanish population and suggest that the alpha Hph alpha/alpha alpha genotype is probably the most common nondeletional form of alpha-thalassemia in Spain.

  1. Quantitative analysis of recombination between YFP and CFP genes of FRET biosensors introduced by lentiviral or retroviral gene transfer

    PubMed Central

    Komatsubara, Akira T.; Matsuda, Michiyuki; Aoki, Kazuhiro


    Biosensors based on the principle of Förster (or fluorescence) resonance energy transfer (FRET) have been developed to visualize spatio-temporal dynamics of signalling molecules in living cells. Many of them adopt a backbone of intramolecular FRET biosensor with a cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP) as donor and acceptor, respectively. However, there remains the difficulty of establishing cells stably expressing FRET biosensors with a YFP and CFP pair by lentiviral or retroviral gene transfer, due to the high incidence of recombination between YFP and CFP genes. To address this, we examined the effects of codon-diversification of YFP on the recombination of FRET biosensors introduced by lentivirus or retrovirus. The YFP gene that was fully codon-optimized to E.coli evaded the recombination in lentiviral or retroviral gene transfer, but the partially codon-diversified YFP did not. Further, the length of spacer between YFP and CFP genes clearly affected recombination efficiency, suggesting that the intramolecular template switching occurred in the reverse-transcription process. The simple mathematical model reproduced the experimental data sufficiently, yielding a recombination rate of 0.002–0.005 per base. Together, these results show that the codon-diversified YFP is a useful tool for expressing FRET biosensors by lentiviral or retroviral gene transfer. PMID:26290434

  2. Quantitative analysis of recombination between YFP and CFP genes of FRET biosensors introduced by lentiviral or retroviral gene transfer.


    Komatsubara, Akira T; Matsuda, Michiyuki; Aoki, Kazuhiro


    Biosensors based on the principle of Förster (or fluorescence) resonance energy transfer (FRET) have been developed to visualize spatio-temporal dynamics of signalling molecules in living cells. Many of them adopt a backbone of intramolecular FRET biosensor with a cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP) as donor and acceptor, respectively. However, there remains the difficulty of establishing cells stably expressing FRET biosensors with a YFP and CFP pair by lentiviral or retroviral gene transfer, due to the high incidence of recombination between YFP and CFP genes. To address this, we examined the effects of codon-diversification of YFP on the recombination of FRET biosensors introduced by lentivirus or retrovirus. The YFP gene that was fully codon-optimized to E.coli evaded the recombination in lentiviral or retroviral gene transfer, but the partially codon-diversified YFP did not. Further, the length of spacer between YFP and CFP genes clearly affected recombination efficiency, suggesting that the intramolecular template switching occurred in the reverse-transcription process. The simple mathematical model reproduced the experimental data sufficiently, yielding a recombination rate of 0.002-0.005 per base. Together, these results show that the codon-diversified YFP is a useful tool for expressing FRET biosensors by lentiviral or retroviral gene transfer.

  3. Horizontal transfers of transposable elements in eukaryotes: The flying genes.


    Panaud, Olivier


    Transposable elements (TEs) are the major components of eukaryotic genomes. Their propensity to densely populate and in some cases invade the genomes of plants and animals is in contradiction with the fact that transposition is strictly controlled by several molecular pathways acting at either transcriptional or post-transcriptional levels. Horizontal transfers, defined as the transmission of genetic material between sexually isolated species, have long been considered as rare phenomena. Here, we show that the horizontal transfers of transposable elements (HTTs) are very frequent in ecosystems. The exact mechanisms of such transfers are not well understood, but species involved in close biotic interactions, like parasitism, show a propensity to exchange genetic material horizontally. We propose that HTTs allow TEs to escape the silencing machinery of their host genome and may therefore be an important mechanism for their survival and their dissemination in eukaryotes.

  4. Identification and characterization of an alternative promoter of the human PGC-1{alpha} gene

    SciTech Connect

    Yoshioka, Toyo; Inagaki, Kenjiro; Noguchi, Tetsuya; Sakai, Mashito; Ogawa, Wataru; Hosooka, Tetsuya; Iguchi, Haruhisa; Watanabe, Eijiro; Matsuki, Yasushi; Hiramatsu, Ryuji; Kasuga, Masato


    The transcriptional regulator peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} (PGC-1{alpha}) controls mitochondrial biogenesis and energy homeostasis. Although physical exercise induces PGC-1{alpha} expression in muscle, the underlying mechanism of this effect has remained incompletely understood. We recently identified a novel muscle-enriched isoform of PGC-1{alpha} transcript (designated PGC-1{alpha}-b) that is derived from a previously unidentified first exon. We have now cloned and characterized the human PGC-1{alpha}-b promoter. The muscle-specific transcription factors MyoD and MRF4 transactivated this promoter through interaction with a proximal E-box motif. Furthermore, either forced expression of Ca{sup 2+}- and calmodulin-dependent protein kinase IV (CaMKIV), calcineurin A, or the p38 mitogen-activated protein kinase (p38 MAPK) kinase MKK6 or the intracellular accumulation of cAMP activated the PGC-1{alpha}-b promoter in cultured myoblasts through recruitment of cAMP response element (CRE)-binding protein (CREB) to a putative CRE located downstream of the E-box. Our results thus reveal a potential molecular basis for isoform-specific regulation of PGC-1{alpha} expression in contracting muscle.

  5. In vivo regulation of gene transcription by alpha- and gamma-Tocopherol in murine T lymphocytes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Of the 8 different analogues (alpha-, beta-, gamma-, delta-tocopherols and tocotrienols) designated as vitamin E, alpha-tocopherol (a-T) has been mostly studied, together with gamma-tocopherol (g-T) which is abundant in the US diet. We compared the effect of dietary supplementation with adequate or ...


    SciTech Connect

    Chadima, Pavel; Harmanec, Petr; Wolf, Marek; Firt, Roman; Ruzdjak, Domagoj; Bozic, Hrvoje; Koubsky, Pavel


    H{alpha} emission V/R variations caused by discontinuous mass transfer in interacting binaries with a rapidly rotating accreting star are modeled qualitatively for the first time. The program ZEUS-MP was used to create a non-linear three-dimensional hydrodynamical model of a development of a blob of gaseous material injected into an orbit around a star. It resulted in the formation of an elongated disk with a slow prograde revolution. The LTE radiative transfer program SHELLSPEC was used to calculate the H{alpha} profiles originating in the disk for several phases of its revolution. The profiles have the form of a double emission and exhibit V/R and radial velocity variations. However, these variations should be a temporal phenomenon since imposing a viscosity in the given model would lead to a circularization of the disk and fading-out of the given variations.

  7. Resurrection of an ancestral gene: functional and evolutionary analyses of the Ngrol genes transferred from Agrobacterium to Nicotiana.


    Aoki, Seishiro


    The Ng rol genes, which have high similarity in sequence to the rol genes of Agrobacterium rhizogenes, are present in the genome of untransformed plants of Nicotiana glauca. It is thought that bacterial infection resulted in the transfer of the Ng rol genes to plants early in the evolution of the genus Nicotiana, since several species in this genus contain rol-like sequences but others do not. Plants transformed with the bacterial rol genes exhibit various developmental and morphological changes. The presence of rol-like sequences in plant genomes is therefore thought to have contributed to the evolution of Nicotiana species. This paper focuses on studies of the Ng rol genes in present-day plants and during the evolution of the genus Nicotiana. The functional sequences of several Ng rol genes may have been conserved after their ancient introduction from a bacterium to the plant. Resurrection of an ancestral function of one of the Ng rol genes, as examined by physiological and evolutionary analyses, is also described. The origin of the Ng rol genes is then considered, based on results of molecular phylogenetic analyses. The effects of the horizontal transfer of the Ng rol genes and mutations in the genes are discussed on the plants of the genus Nicotiana during evolution.

  8. Phylogenetic analysis of the incidence of lux gene horizontal transfer in Vibrionaceae.


    Urbanczyk, Henryk; Ast, Jennifer C; Kaeding, Allison J; Oliver, James D; Dunlap, Paul V


    Horizontal gene transfer (HGT) is thought to occur frequently in bacteria in nature and to play an important role in bacterial evolution, contributing to the formation of new species. To gain insight into the frequency of HGT in Vibrionaceae and its possible impact on speciation, we assessed the incidence of interspecies transfer of the lux genes (luxCDABEG), which encode proteins involved in luminescence, a distinctive phenotype. Three hundred three luminous strains, most of which were recently isolated from nature and which represent 11 Aliivibrio, Photobacterium, and Vibrio species, were screened for incongruence of phylogenies based on a representative housekeeping gene (gyrB or pyrH) and a representative lux gene (luxA). Strains exhibiting incongruence were then subjected to detailed phylogenetic analysis of horizontal transfer by using multiple housekeeping genes (gyrB, recA, and pyrH) and multiple lux genes (luxCDABEG). In nearly all cases, housekeeping gene and lux gene phylogenies were congruent, and there was no instance in which the lux genes of one luminous species had replaced the lux genes of another luminous species. Therefore, the lux genes are predominantly vertically inherited in Vibrionaceae. The few exceptions to this pattern of congruence were as follows: (i) the lux genes of the only known luminous strain of Vibrio vulnificus, VVL1 (ATCC 43382), were evolutionarily closely related to the lux genes of Vibrio harveyi; (ii) the lux genes of two luminous strains of Vibrio chagasii, 21N-12 and SB-52, were closely related to those of V. harveyi and Vibrio splendidus, respectively; (iii) the lux genes of a luminous strain of Photobacterium damselae, BT-6, were closely related to the lux genes of the lux-rib(2) operon of Photobacterium leiognathi; and (iv) a strain of the luminous bacterium Photobacterium mandapamensis was found to be merodiploid for the lux genes, and the second set of lux genes was closely related to the lux genes of the lux-rib(2

  9. Phylogenetic Analysis of the Incidence of lux Gene Horizontal Transfer in Vibrionaceae▿ †

    PubMed Central

    Urbanczyk, Henryk; Ast, Jennifer C.; Kaeding, Allison J.; Oliver, James D.; Dunlap, Paul V.


    Horizontal gene transfer (HGT) is thought to occur frequently in bacteria in nature and to play an important role in bacterial evolution, contributing to the formation of new species. To gain insight into the frequency of HGT in Vibrionaceae and its possible impact on speciation, we assessed the incidence of interspecies transfer of the lux genes (luxCDABEG), which encode proteins involved in luminescence, a distinctive phenotype. Three hundred three luminous strains, most of which were recently isolated from nature and which represent 11 Aliivibrio, Photobacterium, and Vibrio species, were screened for incongruence of phylogenies based on a representative housekeeping gene (gyrB or pyrH) and a representative lux gene (luxA). Strains exhibiting incongruence were then subjected to detailed phylogenetic analysis of horizontal transfer by using multiple housekeeping genes (gyrB, recA, and pyrH) and multiple lux genes (luxCDABEG). In nearly all cases, housekeeping gene and lux gene phylogenies were congruent, and there was no instance in which the lux genes of one luminous species had replaced the lux genes of another luminous species. Therefore, the lux genes are predominantly vertically inherited in Vibrionaceae. The few exceptions to this pattern of congruence were as follows: (i) the lux genes of the only known luminous strain of Vibrio vulnificus, VVL1 (ATCC 43382), were evolutionarily closely related to the lux genes of Vibrio harveyi; (ii) the lux genes of two luminous strains of Vibrio chagasii, 21N-12 and SB-52, were closely related to those of V. harveyi and Vibrio splendidus, respectively; (iii) the lux genes of a luminous strain of Photobacterium damselae, BT-6, were closely related to the lux genes of the lux-rib2 operon of Photobacterium leiognathi; and (iv) a strain of the luminous bacterium Photobacterium mandapamensis was found to be merodiploid for the lux genes, and the second set of lux genes was closely related to the lux genes of the lux-rib2

  10. Interleukin 10 gene transfer prevents experimental colitis in rats

    PubMed Central

    Barbara, G; Xing, Z; Hogaboam, C; Gauldie, J; Collins, S


    BACKGROUND—The development of colitis in interleukin 10 (IL-10) deficient mice, together with the known anti-inflammatory and immunomodulatory properties of this cytokine have prompted consideration of IL-10 as a treatment for inflammatory bowel disease (IBD). However, studies using hrIL-10 in IBD models have yielded inconsistent results.
AIMS—To examine the therapeutic potential of overexpressing the IL-10 gene before and after the induction of experimental colitis in rats.
METHODS—Gene transfer was achieved by intraperitoneal injection of non-replicating human type 5 adenovirus bearing the IL-10 gene, either 24 hours before or one hour after intrarectal administration of dinitrobenzene sulphonic acid in rats. Colonic damage and inflammation was assessed macroscopically and by measuring myeloperoxidase activity and leukotriene B4 concentrations.
RESULTS—Gene transfer increased IL-10 protein in serum for up to six days. IL-10 gene transfer prior to colitis improved colitis macroscopically and histologically, and significantly reduced colonic myeloperoxidase activity and leukotriene B4 concentrations. In contrast, IL-10 gene transfer after the onset of colitis had no beneficial effect.
CONCLUSIONS—Gene therapy using an adenovirus-IL-10 construct was successful in preventing but not in reversing experimental colitis in the rat.

Keywords: gene therapy; colitis; interleukin 10; adenovirus vector; leukotrienes; inflammatory bowel disease; maintenance therapy PMID:10673295

  11. Multilevel populations and the evolution of antibiotic resistance through horizontal gene transfer.


    Andam, Cheryl P; Fournier, Gregory P; Gogarten, Johann Peter


    Horizontal gene transfer (HGT) can create diversity in the genetic repertoire of a lineage. Successful gene transfer likely occurs more frequently between more closely related organisms, leading to the formation of higher-level exchange groups that in some respects are comparable to single-species populations. Genes that appear fixed in a single species can be replaced through distant homologs or iso-functional analogs acquired through HGT. These genes may originate from other species or they may be acquired by an individual strain from the species pan-genome. Because of their similarity to alleles in a population, we label these gene variants that are exchanged between related species as homeoalleles. In a case study, we show that biased gene transfer plays an important role in the evolution of aminoacyl-tRNA synthetases (aaRS). Many microorganisms make use of these genes against naturally occurring antibiotics. We suggest that the resistance against naturally occurring antibiotics is the likely driving force behind the frequent switching between divergent aaRS types and the reason for the maintenance of these homeoalleles in higher-level exchange groups. Resistance to naturally occurring antibiotics may lead to the maintenance of different types of aminoacyl-tRNA synthetases in Bacteria through gene transfer.

  12. Studies on the transfer techniques of three maize genes.


    Wang, G; Zhang, H; Ding, Q; Xie, Y; Dai, J


    Maize transformation has been carried out through microprojectile bombardment, ultrasonication in a DNA buffer, and ovary-injection with a self-made microinjector. The plasmid pB48.415, which carries a 3'-truncated Bt-toxin protein gene and a hygromycin phosphotransferase (hpt) gene, was used in the transformation. Transgenic maize plants were obtained from immature embryos and embryogenic calli bombarded with a particle gun, embryogenic calli ultrasonicated under different conditions of ovaries injected 10-20 hours after pollination. The results of Dot blotting and Southern blotting analyses proved the integration of the Bt gene into maize genome.

  13. Horizontal Gene Transfers from Bacteria to Entamoeba Complex: A Strategy for Dating Events along Species Divergence

    PubMed Central

    Romero, Miguel; Ximenez, Cecilia


    Horizontal gene transfer has proved to be relevant in eukaryotic evolution, as it has been found more often than expected and related to adaptation to certain niches. A relatively large list of laterally transferred genes has been proposed and evaluated for the parasite Entamoeba histolytica. The goals of this work were to elucidate the importance of lateral gene transfer along the evolutionary history of some members of the genus Entamoeba, through identifying donor groups and estimating the divergence time of some of these events. In order to estimate the divergence time of some of the horizontal gene transfer events, the dating of some Entamoeba species was necessary, following an indirect dating strategy based on the fossil record of plausible hosts. The divergence between E. histolytica and E. nuttallii probably occurred 5.93 million years ago (Mya); this lineage diverged from E. dispar 9.97 Mya, while the ancestor of the latter separated from E. invadens 68.18 Mya. We estimated times for 22 transferences; the most recent occurred 31.45 Mya and the oldest 253.59 Mya. Indeed, the acquisition of genes through lateral transfer may have triggered a period of adaptive radiation, thus playing a major role in the evolution of the Entamoeba genus. PMID:27239333

  14. Cre Recombinase Gene Transfer In Vitro and Detection of loxP-Dependent Recombination.


    Ohtsubo, Kazuaki; Marth, Jamey D


    INTRODUCTIONAltering the genome of intact cells and organisms by site-specific DNA recombination has become an important gene-transfer methodology. The inclusion of exogenous recombinase target sequences within transferred DNA segments allows subsequent modifications to previously altered genomic structure that increase the utility of gene transfer and enhance experimental design. In this protocol, correctly targeted mouse embryonic stem (ES) cell clones bearing the F[tkneo] allele (containing several loxP sites) are subjected to in vitro Cre gene transfer to generate ES cell subclones bearing either Type 1 (Δ) or Type 2 (F) alleles. Type 2 ES cells are used to generate chimeric mice that are then crossed to germ-line Cre-expressing mice, such as ZP3-Cre transgenic mates. The additional time needed to breed the mice (~2-3 mo) is typically less troublesome than the cost and effort of maintaining multiple clone-derived lines of mice.

  15. A silent mutation in human alpha-A crystallin gene in patients with age-related nuclear or cortical cataract.


    Mynampati, Bharani K; Muthukumarappa, Thungapathra; Ghosh, Sujata; Ram, Jagat


    A cataract is a complex multifactorial disease that results from alterations in the cellular architecture, i.e. lens proteins. Genes associated with the development of lens include crystallin genes. Although crystallins are highly conserved proteins among vertebrates, a significant number of polymorphisms exist in human population. In this study, we screened for polymorphisms in crystallin alpha A (CRYAA) and alpha B (CRYAB) genes in 200 patients over 40 years of age, diagnosed with age-related cataract (ARC; nuclear and cortical cataracts). Genomic DNA was extracted from the peripheral blood. The coding regions of the CRYAA and CRYAB gene were amplified using polymerase chain reaction and subjected to restriction digestion. Restriction fragment length polymorphism (RFLP) was performed using known restriction enzymes for CRYAA and CRYAB genes. Denaturing high performance liquid chromatography and direct sequencing were performed to detect sequence variation in CRYAA gene. In silico analysis of secondary CRYAA mRNA structure was performed using CLC RNA Workbench. RFLP analysis did not show any changes in the restriction sites of CRYAA and CRYAB genes. In 6 patients (4 patients with nuclear cataract and 2 with cortical cataract), sequence analysis of the exon 1 in the CRYAA gene showed a silent single nucleotide polymorphism [D2D] (CRYAA: C to T transition). One of the patients with nuclear cataract was homozygous for this allele. The in silico analysis revealed that D2D mutation results in a compact CRYAA mRNA secondary structure, while the wild type CRYAA mRNA has a weak or loose secondary structure. D2D mutation in the CRYAA gene may be an additional risk factor for progression of ARC.

  16. Molecular Description and Industrial Potential of Tn6098 Conjugative Transfer Conferring Alpha-Galactoside Metabolism in Lactococcus lactis▿ †

    PubMed Central

    Machielsen, Ronnie; Siezen, Roland J.; van Hijum, Sacha A. F. T.; van Hylckama Vlieg, Johan E. T.


    A novel 51-kb conjugative transposon of Lactococcus lactis, designated Tn6098, encoding the capacity to utilize α-galactosides such as raffinose and stachyose, was identified and characterized. Alpha-galactosides are a dominant carbon source in many plant-derived foods. Most dairy lactococcus strains are unable to use α-galactosides as a growth substrate, yet many of these strains are known to have beneficial industrial traits. Conjugal transfer of Tn6098 was demonstrated from the plant-derived donor strain L. lactis KF147 to the recipient L. lactis NZ4501, a derivative of the dairy model strain L. lactis MG1363. The integration of Tn6098 into the genome of the recipient strain was confirmed by Illumina sequencing of the transconjugant L. lactis NIZO3921. The molecular structure of the integration site was confirmed by a PCR product spanning the insertion site. A 15-bp direct repeat sequence (TTATACCATAATTAC) is present on either side of Tn6098 in the chromosome of L. lactis KF147. One copy of this sequence is also present in the L. lactis MG1363 chromosome and represents the sole integration site. Phenotypic characterization of all strains showed that the transconjugant has not only acquired the ability to grow well in soy milk, a substrate rich in α-galactosides, but also has retained the flavor-forming capabilities of the recipient strain L. lactis MG1363. This study demonstrates how (induced) conjugation can be used to exploit the beneficial industrial traits of industrial dairy lactic acid bacteria in fermentation of plant-derived substrates. PMID:21115709

  17. Genetic mapping of the alpha-galactosidase MEL gene family on right and left telomeres of Saccharomyces cerevisiae.


    Naumov, G I; Naumova, E S; Louis, E J


    The alpha-galactosidase MEL2-MEL10 genes have been genetically mapped to right and left telomere regions of the following chromosomes of Saccharomyces cerevisiae: MEL2 at VII L, MEL3 at XVI L, MEL4 at XI L, MEL5 at IV L, MEL6 at XIII R, MEL7 at VI R, MEL8 at XV R, MEL9 at X R and MEL10 at XII R. A set of tester strains with URA3 inserted into individual telomeres and no MEL genes was used for mapping.

  18. Hereditary Persistence of Alpha-Fetoprotein Is Associated with the −119G>A Polymorphism in AFP Gene

    PubMed Central

    Deshpande, Neha; Chavan, Radhika; Bale, Govardhan; Avanthi, Urmila Steffie; Aslam, Mohsin; Ramchandani, Mohan; Reddy, D. Nageshwar


    Alpha-fetoprotein (AFP) is a glycoprotein that is produced by the liver and yolk sac during fetal development. Its levels are usually raised in malignant conditions. Hereditary persistence of AFP (HPAFP) is a rare benign condition with elevated levels of AFP. It is inherited in a dominant mode with complete penetrance and is usually not associated with any clinical disability. We report two individuals with elevated levels of AFP harboring the −119G>A polymorphism in the AFP gene. A genetic screening to rule out variants in the AFP gene is advised in cases with unexplained persistent AFP levels to avoid inappropriate treatment and surgical options. PMID:28286798

  19. Hereditary Persistence of Alpha-Fetoprotein Is Associated with the -119G>A Polymorphism in AFP Gene.


    Deshpande, Neha; Chavan, Radhika; Bale, Govardhan; Avanthi, Urmila Steffie; Aslam, Mohsin; Ramchandani, Mohan; Reddy, D Nageshwar; Ravikanth, V V


    Alpha-fetoprotein (AFP) is a glycoprotein that is produced by the liver and yolk sac during fetal development. Its levels are usually raised in malignant conditions. Hereditary persistence of AFP (HPAFP) is a rare benign condition with elevated levels of AFP. It is inherited in a dominant mode with complete penetrance and is usually not associated with any clinical disability. We report two individuals with elevated levels of AFP harboring the -119G>A polymorphism in the AFP gene. A genetic screening to rule out variants in the AFP gene is advised in cases with unexplained persistent AFP levels to avoid inappropriate treatment and surgical options.

  20. Development of an Autologous Macrophage-based Adoptive Gene Transfer Strategy to Treat Posttraumatic Osteoarthritis (PTOA) and Osteoarithritis (OA)

    DTIC Science & Technology


    AWARD NUMBER: W81XWH-13-1-0228 TITLE: Development of an Autologous Macrophage-based Adoptive Gene Transfer Strategy to Treat Posttraumatic...Final 3. DATES COVERED 1 Sep 2013 - 28 Feb 2016 4. TITLE AND SUBTITLE Development of an Autologous Macrophage-based Adoptive Gene Transfer Strategy to...autologous macrophage-based adoptive gene transfer strategy can effectively deliver and confine expression of an anti-catabolic gene (IL-1ra or IL-1β

  1. Catalytic versatility of Bacillus pumilus. beta. -xylosidase: glycosyl transfer and hydrolysis promoted with. cap alpha. - and. beta. -D-xylosyl fluoride

    SciTech Connect

    Kasumi, T.; Tsumuraya, Y.; Brewer, C.F.; Kersters-Hilderson, H.; Claeyssens, M.; Hehre, E.J.


    Bacillus pumilus ..beta..-xylosidase, an enzyme considered restricted to hydrolyzing a narrow range of ..beta..-D-xylosidic substrates with inversion of configuration, was found to catalyze different stereochemical, essentially irreversible, glycosylation reactions with ..cap alpha..- and ..beta..-D-xylopyranosyl fluoride. The enzyme promoted the hydrolysis of ..beta..-D-xylopyranosyl fluoride at a high rate, V = 6.25 min/sup -1/ mg/sup -1/ at 0/sup 0/C, in a reaction that obeyed Michaelis-Menten kinetics. In contrast, its action upon ..cap alpha..-D-xylopyranosyl fluoride was slow and characterized by an unusual relation between the rate of fluoride release and the substrate concentration, suggesting the possible need for two substrate molecules to be bound at the active center in order for reaction to occur. Moreover, /sup 1/H NMR spectra of a digest of ..cap alpha..-D-xylosyl fluoride showed the substrate to be specifically converted to ..cap alpha..-D-xylose by the enzyme. The observed retention of configuration is not consistent with direct hydrolysis by this inverting enzyme but is strongly indicative of the occurrence of two successive inverting reactions: xylosyl transfer from ..cap alpha..-D-xylosyl fluoride to form a ..beta..-D-xylosidic product, followed by hydrolysis of the latter to produce ..cap alpha..-D-xylose. The transient intermediate product formed enzymically from ..cap alpha..-D-xylosyl fluoride in the presence of (/sup 14/C)xylose was isolated and shown by its specific radioactivity and /sup 1/H NMR spectrum as well as by methylatino and enzymic analyses to be 4-O-..beta..-D-xylopyranosyl-D-xylopyranose containing one (/sup 14/C)xylose residue.

  2. Linear topology confers in vivo gene transfer activity to polyethylenimines.


    Brissault, B; Leborgne, C; Guis, C; Danos, O; Cheradame, H; Kichler, A


    Although polyethylenimines (PEIs) are frequently used transfection agents, it is still unclear which of their properties are required for efficient gene delivery. This is even more striking when working in vivo since some PEIs are able to generate significant gene expression, whereas others are not. To facilitate a rational development of compounds with improved transfection activities, studies aimed at identifying the properties involved in the transfection process seem indispensable. In the present work, we investigated how transfection with linear PEI of 22 kDa allows for high reporter gene expression in lungs after intravenous injection, whereas the branched PEI of 25 kDa does not. To this end, we synthesized L-PEI derivatives that are intermediates between linear and branched PEIs. Our results show that the topology plays a crucial role in obtaining in vivo reporter gene expression, whereas the content of primary, secondary, and tertiary amines is only of minor importance.

  3. DNA sequence analysis of a mouse pro alpha 1 (I) procollagen gene: evidence for a mouse B1 element within the gene.

    PubMed Central

    Monson, J M; Friedman, J; McCarthy, B J


    In a 3.8-kilobase mouse DNA sequence encoding amino acid sequences for the pro alpha 1(I) chain of type I procollagen, 14 coding sequences were identified which specify a sequence 95% homologous to amino acid residues 568 to 963 of the bovine alpha 1(I) chain. All of these coding sequences were flanked by appropriate splice junctions following the GT/AG rule. These observations suggest, but do not prove, that this pro alpha 1(I) gene is transcriptionally active. Of the 14 coding sequences, 7 were 54 base pairs in length, whereas the remainder were higher multiples of 54 base pairs. Nonrandom utilization of codons pertained throughout all of the coding sequences showing a preference (56%) for U in the wobble position. Two of the intervening sequences encoded imperfect vestiges of coding sequences which exhibited a codon preference different from that of the pro alpha 1(I) gene proper and were not flanked by splice junctions. One intervening sequence encoded a member of the mouse B1 family of middle repetitive sequences. It was flanked by 8-base-pair direct repeats and had a truncated A-rich region, suggesting that it may be a mobile element. Within this element were sequences which could function as a RNA polymerase III split promoter. Images PMID:6298597

  4. Horizontal Gene Transfer and the Evolution of Bacterial and Archaeal Population Structure

    PubMed Central

    Alm, Eric J.; Hanage, William P.


    Many bacterial and archaeal lineages have a history of extensive and ongoing horizontal gene transfer and loss, as evidenced by the large differences in genome content even among otherwise closely related isolates. How ecologically cohesive populations might evolve and be maintained under such conditions of rapid gene turnover has remained controversial. Here we synthesize recent literature demonstrating the importance of habitat and niche in structuring horizontal gene transfer. This leads to a model of ecological speciation via gradual genetic isolation triggered by differential habitat association of nascent populations. Further, we hypothesize that subpopulations can evolve through local gene exchange networks by tapping into a gene pool that is adaptive towards local, continuously changing organismic interactions and is, to a large degree, responsible for the observed rapid gene turnover. Overall, these insights help explain how bacteria and archaea form populations that display both ecological cohesion and high genomic diversity. PMID:23332119

  5. SAG/ROC2/RBX2 is a HIF-1 target gene that promotes HIF-1 alpha ubiquitination and degradation.


    Tan, M; Gu, Q; He, H; Pamarthy, D; Semenza, G L; Sun, Y


    SAG (sensitive to apoptosis gene) or ROC2/RBX2 is the second family member of ROC1/RBX1, a component of SCF (Skp1, Cullin, F-box protein) and VCB (von Hippel-Lindau (VHL), Cullin and Elongin B/C) E3 ubiquitin ligases. SAG protected cells from hypoxia-induced apoptosis when overexpressed. We report here that SAG was subjected to hypoxia induction at the levels of mRNA and protein. Hypoxia induction of SAG was largely HIF-1alpha dependent. A consensus HIF-1-binding site, GCGTG was identified in the first intron of the SAG gene. In response to hypoxia, HIF-1 bound to this site and transactivated SAG expression. SAG transactivation required both the intact binding site in cis and HIF-1alpha in trans. On the other hand, like its family member, ROC1, SAG promoted VHL-mediated HIF-1alpha ubiquitination and degradation, which was significantly inhibited upon small interfering RNA silencing of SAG or ROC1. Furthermore, the endogenous HIF-1alpha at both basal and hypoxia-induced levels was significantly increased upon SAG silencing. Finally, SAG forms in vivo complex with Cul-5 and VHL under hypoxia condition. These results suggest an HIF-1-SAG feedback loop in response to hypoxia, as follows: hypoxia induces HIF-1 to transactivate SAG. Induced SAG then promotes HIF-1alpha ubiquitination and degradation. This feedback loop may serve as a cellular defensive mechanism to reduce potential cytotoxic effects of prolonged HIF-1 activation under hypoxia.

  6. Targeted gene transfer into rat facial muscles by nanosecond pulsed laser-induced stress waves.


    Kurita, Akihiro; Matsunobu, Takeshi; Satoh, Yasushi; Ando, Takahiro; Sato, Shunichi; Obara, Minoru; Shiotani, Akihiro


    We investigate the feasibility of using nanosecond pulsed laser-induced stress waves (LISWs) for gene transfer into rat facial muscles. LISWs are generated by irradiating a black natural rubber disk placed on the target tissue with nanosecond pulsed laser light from the second harmonics (532 nm) of a Q-switched Nd:YAG laser, which is widely used in head and neck surgery and proven to be safe. After injection of plasmid deoxyribose nucleic acid (DNA) coding for Lac Z into rat facial muscles, pulsed laser is used to irradiate the laser target on the skin surface without incision or exposure of muscles. Lac Z expression is detected by X-gal staining of excised rat facial skin and muscles. Strong Lac Z expression is observed seven days after gene transfer, and sustained for up to 14 days. Gene transfer is achieved in facial muscles several millimeters deep from the surface. Gene expression is localized to the tissue exposed to LISWs. No tissue damage from LISWs is observed. LISW is a promising nonviral target gene transfer method because of its high spatial controllability, easy applicability, and minimal invasiveness. Gene transfer using LISW to produce therapeutic proteins such as growth factors could be used to treat nerve injury and paralysis.

  7. Targeted gene transfer into rat facial muscles by nanosecond pulsed laser-induced stress waves

    NASA Astrophysics Data System (ADS)

    Kurita, Akihiro; Matsunobu, Takeshi; Satoh, Yasushi; Ando, Takahiro; Sato, Shunichi; Obara, Minoru; Shiotani, Akihiro


    We investigate the feasibility of using nanosecond pulsed laser-induced stress waves (LISWs) for gene transfer into rat facial muscles. LISWs are generated by irradiating a black natural rubber disk placed on the target tissue with nanosecond pulsed laser light from the second harmonics (532 nm) of a Q-switched Nd:YAG laser, which is widely used in head and neck surgery and proven to be safe. After injection of plasmid deoxyribose nucleic acid (DNA) coding for Lac Z into rat facial muscles, pulsed laser is used to irradiate the laser target on the skin surface without incision or exposure of muscles. Lac Z expression is detected by X-gal staining of excised rat facial skin and muscles. Strong Lac Z expression is observed seven days after gene transfer, and sustained for up to 14 days. Gene transfer is achieved in facial muscles several millimeters deep from the surface. Gene expression is localized to the tissue exposed to LISWs. No tissue damage from LISWs is observed. LISW is a promising nonviral target gene transfer method because of its high spatial controllability, easy applicability, and minimal invasiveness. Gene transfer using LISW to produce therapeutic proteins such as growth factors could be used to treat nerve injury and paralysis.

  8. Complexity of genetic sequences modified by horizontal gene transfer and degraded-DNA uptake

    NASA Astrophysics Data System (ADS)

    Tremberger, George; Dehipawala, S.; Nguyen, A.; Cheung, E.; Sullivan, R.; Holden, T.; Lieberman, D.; Cheung, T.


    Horizontal gene transfer has been a major vehicle for efficient transfer of genetic materials among living species and could be one of the sources for noncoding DNA incorporation into a genome. Our previous study of lnc- RNA sequence complexity in terms of fractal dimension and information entropy shows a tight regulation among the studied genes in numerous diseases. The role of sequence complexity in horizontal transferred genes was investigated with Mealybug in symbiotic relation with a 139K genome microbe and Deinococcus radiodurans as examples. The fractal dimension and entropy showed correlation R-sq of 0.82 (N = 6) for the studied Deinococcus radiodurans sequences. For comparison the Deinococcus radiodurans oxidative stress tolerant catalase and superoxide dismutase genes under extracellular dGMP growth condition showed R-sq ~ 0.42 (N = 6); and the studied arsenate reductase horizontal transferred genes for toxicity survival in several microorganisms showed no correlation. Simulation results showed that R-sq < 0.4 would be improbable at less than one percent chance, suggestive of additional selection pressure when compared to the R-sq ~ 0.29 (N = 21) in the studied transferred genes in Mealybug. The mild correlation of R-sq ~ 0.5 for fractal dimension versus transcription level in the studied Deinococcus radiodurans sequences upon extracellular dGMP growth condition would suggest that lower fractal dimension with less electron density fluctuation favors higher transcription level.

  9. Gene transfers shaped the evolution of de novo NAD+ biosynthesis in eukaryotes.


    Ternes, Chad M; Schönknecht, Gerald


    NAD(+) is an essential molecule for life, present in each living cell. It can function as an electron carrier or cofactor in redox biochemistry and energetics, and serves as substrate to generate the secondary messenger cyclic ADP ribose and nicotinic acid adenine dinucleotide phosphate. Although de novo NAD(+) biosynthesis is essential, different metabolic pathways exist in different eukaryotic clades. The kynurenine pathway starting with tryptophan was most likely present in the last common ancestor of all eukaryotes, and is active in fungi and animals. The aspartate pathway, detected in most photosynthetic eukaryotes, was probably acquired from the cyanobacterial endosymbiont that gave rise to chloroplasts. An evolutionary analysis of enzymes catalyzing de novo NAD(+) biosynthesis resulted in evolutionary trees incongruent with established organismal phylogeny, indicating numerous gene transfers. Endosymbiotic gene transfers probably introduced the aspartate pathway into eukaryotes and may have distributed it among different photosynthetic clades. In addition, several horizontal gene transfers substituted eukaryotic genes with bacterial orthologs. Although horizontal gene transfer is accepted as a key mechanism in prokaryotic evolution, it is supposed to be rare in eukaryotic evolution. The essential metabolic pathway of de novo NAD(+) biosynthesis in eukaryotes was shaped by numerous gene transfers.

  10. The agricultural antibiotic carbadox induces phage-mediated gene transfer in Salmonella

    PubMed Central

    Bearson, Bradley L.; Allen, Heather K.; Brunelle, Brian W.; Lee, In Soo; Casjens, Sherwood R.; Stanton, Thaddeus B.


    Antibiotics are used for disease therapeutic or preventative effects in humans and animals, as well as for enhanced feed conversion efficiency in livestock. Antibiotics can also cause undesirable effects in microbial populations, including selection for antibiotic resistance, enhanced pathogen invasion, and stimulation of horizontal gene transfer. Carbadox is a veterinary antibiotic used in the US during the starter phase of swine production for improved feed efficiency and control of swine dysentery and bacterial swine enteritis. Carbadox has been shown in vitro to induce phage-encoded Shiga toxin in Shiga toxin-producing Escherichia coli (STEC) and a phage-like element transferring antibiotic resistance genes in Brachyspira hyodysenteriae, but the effect of carbadox on prophages in other bacteria is unknown. This study examined carbadox exposure on prophage induction and genetic transfer in Salmonella enterica serovar Typhimurium, a human foodborne pathogen that frequently colonizes swine without causing disease. S. Typhimurium LT2 exposed to carbadox induced prophage production, resulting in bacterial cell lysis and release of virions that were visible by electron microscopy. Carbadox induction of phage-mediated gene transfer was confirmed by monitoring the transduction of a sodCIII::neo cassette in the Fels-1 prophage from LT2 to a recipient Salmonella strain. Furthermore, carbadox frequently induced generalized transducing phages in multidrug-resistant phage type DT104 and DT120 isolates, resulting in the transfer of chromosomal and plasmid DNA that included antibiotic resistance genes. Our research indicates that exposure of Salmonella to carbadox induces prophages that can transfer virulence and antibiotic resistance genes to susceptible bacterial hosts. Carbadox-induced, phage-mediated gene transfer could serve as a contributing factor in bacterial evolution during animal production, with prophages being a reservoir for bacterial fitness genes in the

  11. Horizontal Gene Transfer of Phytochelatin Synthases from Bacteria to Extremophilic Green Algae.


    Olsson, Sanna; Penacho, Vanessa; Puente-Sánchez, Fernando; Díaz, Silvia; Gonzalez-Pastor, José Eduardo; Aguilera, Angeles


    Transcriptomic sequencing together with bioinformatic analyses and an automated annotation process led us to identify novel phytochelatin synthase (PCS) genes from two extremophilic green algae (Chlamydomonas acidophila and Dunaliella acidophila). These genes are of intermediate length compared to known PCS genes from eukaryotes and PCS-like genes from prokaryotes. A detailed phylogenetic analysis gives new insight into the complicated evolutionary history of PCS genes and provides evidence for multiple horizontal gene transfer events from bacteria to eukaryotes within the gene family. A separate subgroup containing PCS-like genes within the PCS gene family is not supported since the PCS genes are monophyletic only when the PCS-like genes are included. The presence and functionality of the novel genes in the organisms were verified by genomic sequencing and qRT-PCR. Furthermore, the novel PCS gene in Chlamydomonas acidophila showed very strong induction by cadmium. Cloning and expression of the gene in Escherichia coli clearly improves its cadmium resistance. The gene in Dunaliella was not induced, most likely due to gene duplication.

  12. Evidence for Horizontal Gene Transfer as Origin of Putrescine Production in Oenococcus oeni RM83▿

    PubMed Central

    Marcobal, Ángela; de las Rivas, Blanca; Moreno-Arribas, M. Victoria; Muñoz, Rosario


    The nucleotide sequence of a 17.2-kb chromosomal DNA fragment containing the odc gene encoding ornithine decarboxylase has been determined in the putrescine producer Oenococcus oeni RM83. This DNA fragment contains 13 open reading frames, including genes coding for five transposases and two phage proteins. This description might represent the first evidence of a horizontal gene transfer event as the origin of a biogenic amine biosynthetic locus. PMID:17056681

  13. The alpha- and beta-expansin and xyloglucan endotransglucosylase/hydrolase gene families of wheat: molecular cloning, gene expression, and EST data mining.


    Liu, Yong; Liu, Dongcheng; Zhang, Haiying; Gao, Hongbo; Guo, Xiaoli; Wang, Daowen; Zhang, Xiangqi; Zhang, Aimin


    Expansins and xyloglucan endotransglucosylase/hydrolases (XTHs) are families of extracellular proteins with members that have been shown to play an important role in cell wall growth. In this study, three, six, and five members of the wheat alpha-expansin (TaEXPA1 to TaEXPA3), beta-expansin (TaEXPB1 to TaEXPB6), and XTH (TaXTH1 to TaXTH5) gene families, respectively, were isolated from a dwarf wheat line. The mRNA expression analysis by real-time RT-PCR indicates that these genes display different transcription levels in different stages/organs/treatments, possibly suggesting their functional roles in the cell wall expansion process. Moreover, the comparison of the expression levels reveals that most of the expansins show lower expression than the XTHs. Finally, we present the analysis of wheat alpha- and beta-expansins and XTH families by expressed sequence tag data mining.

  14. Study of photoinduced energy and electron transfer in alpha-terthienyl-bovine serum albumin conjugates: a laser flash photolysis study.


    Boch, R; Mohtat, N; Lear, Y; Arnason, J T; Durst, T; Scaiano, J C


    The photochemistry of alpha-terthienyl (alpha-T) has been examined in bovine serum albumin (BSA). Freely associated and covalently conjugated alpha-T chromophores show similar behavior toward nonpolar quenchers such as oxygen and benzoquinone but show significant differences in the case of quenching by methyl viologen, a watersoluble cationic electron acceptor; in this case, triplet quenching reveals two distinct alpha-T populations, attributed to chromophores in sites showing very different accessibility from the aqueous phase. Rate constants for triplet quenching in BSA are generally slower than those observed in homogeneous solution for free alpha-T. For example, in the case of oxygen, the rate constant is about one order of magnitude smaller when alpha-T is associated or conjugated with the protein compared with alpha-T in solution. While triplet yields for alpha-T are essentially the same in solution and in the protein environment, the yield of detectable singlet oxygen is substantially reduced in the protein. This is attributed to a geminate reaction within the protein involving singlet oxygen trapping in the vicinity of the generation site.

  15. Gene Loss and Horizontal Gene Transfer Contributed to the Genome Evolution of the Extreme Acidophile "Ferrovum".


    Ullrich, Sophie R; González, Carolina; Poehlein, Anja; Tischler, Judith S; Daniel, Rolf; Schlömann, Michael; Holmes, David S; Mühling, Martin


    Acid mine drainage (AMD), associated with active and abandoned mining sites, is a habitat for acidophilic microorganisms that gain energy from the oxidation of reduced sulfur compounds and ferrous iron and that thrive at pH below 4. Members of the recently proposed genus "Ferrovum" are the first acidophilic iron oxidizers to be described within the Betaproteobacteria. Although they have been detected as typical community members in AMD habitats worldwide, knowledge of their phylogenetic and metabolic diversity is scarce. Genomics approaches appear to be most promising in addressing this lacuna since isolation and cultivation of "Ferrovum" has proven to be extremely difficult and has so far only been successful for the designated type strain "Ferrovum myxofaciens" P3G. In this study, the genomes of two novel strains of "Ferrovum" (PN-J185 and Z-31) derived from water samples of a mine water treatment plant were sequenced. These genomes were compared with those of "Ferrovum" sp. JA12 that also originated from the mine water treatment plant, and of the type strain (P3G). Phylogenomic scrutiny suggests that the four strains represent three "Ferrovum" species that cluster in two groups (1 and 2). Comprehensive analysis of their predicted metabolic pathways revealed that these groups harbor characteristic metabolic profiles, notably with respect to motility, chemotaxis, nitrogen metabolism, biofilm formation and their potential strategies to cope with the acidic environment. For example, while the "F. myxofaciens" strains (group 1) appear to be motile and diazotrophic, the non-motile group 2 strains have the predicted potential to use a greater variety of fixed nitrogen sources. Furthermore, analysis of their genome synteny provides first insights into their genome evolution, suggesting that horizontal gene transfer and genome reduction in the group 2 strains by loss of genes encoding complete metabolic pathways or physiological features contributed to the observed

  16. Genomic organization of the CC chemokine mip-3alpha/CCL20/larc/exodus/SCYA20, showing gene structure, splice variants, and chromosome localization.


    Nelson, R T; Boyd, J; Gladue, R P; Paradis, T; Thomas, R; Cunningham, A C; Lira, P; Brissette, W H; Hayes, L; Hames, L M; Neote, K S; McColl, S R


    We describe the genomic organization of a recently identified CC chemokine, MIP3alpha/CCL20 (HGMW-approved symbol SCYA20). The MIP-3alpha/CCL20 gene was cloned and sequenced, revealing a four exon, three intron structure, and was localized by FISH analysis to 2q35-q36. Two distinct cDNAs were identified, encoding two forms of MIP-3alpha/CCL20, Ala MIP-3alpha/CCL20 and Ser MIP-3alpha/CCL20, that differ by one amino acid at the predicted signal peptide cleavage site. Examination of the sequence around the boundary of intron 1 and exon 2 showed that use of alternative splice acceptor sites could give rise to Ala MIP-3alpha/CCL20 or Ser MIP-3alpha/CCL20. Both forms of MIP-3alpha/CCL20 were chemically synthesized and tested for biological activity. Both flu antigen plus IL-2-activated CD4(+) and CD8(+) T lymphoblasts and cord blood-derived dendritic cells responded to Ser and Ala MIP-3alpha/CCL20. T lymphocytes exposed only to IL-2 responded inconsistently, while no response was detected in naive T lymphocytes, monocytes, or neutrophils. The biological activity of Ser MIP-3alpha/CCL20 and Ala MIP-3alpha/CCL20 and the tissue-specific preference of different splice acceptor sites are not yet known.

  17. Expression of the human granulocyte-macrophage colony stimulating factor (hGM-CSF) gene under control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a MAR element in transgenic mice.


    Burkov, I A; Serova, I A; Battulin, N R; Smirnov, A V; Babkin, I V; Andreeva, L E; Dvoryanchikov, G A; Serov, O L


    Expression of the human granulocyte-macrophage colony-stimulating factor (hGM-CSF) gene under the control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a matrix attachment region (MAR) element from the Drosophila histone 1 gene was studied in four and eight transgenic mouse lines, respectively. Of the four transgenic lines carrying the transgene without MAR, three had correct tissues-specific expression of the hGM-CSF gene in the mammary gland only and no signs of cell mosaicism. The concentration of hGM-CSF in the milk of transgenic females varied from 1.9 to 14 μg/ml. One line presented hGM-CSF in the blood serum, indicating ectopic expression. The values of secretion of hGM-CSF in milk of 6 transgenic lines carrying the transgene with MAR varied from 0.05 to 0.7 μg/ml, and two of these did not express hGM-CSF. Three of the four examined animals from lines of this group showed ectopic expression of the hGM-CSF gene, as determined by RT-PCR and immunofluorescence analyses, as well as the presence of hGM-CSF in the blood serum. Mosaic expression of the hGM-CSF gene in mammary epithelial cells was specific to all examined transgenic mice carrying the transgene with MAR but was never observed in the transgenic mice without MAR. The mosaic expression was not dependent on transgene copy number. Thus, the expected "protective or enhancer effect" from the MAR element on the hGM-CSF gene expression was not observed.

  18. Horizontal Transfer and Death of a Fungal Secondary Metabolic Gene Cluster

    PubMed Central

    Campbell, Matthew A.; Rokas, Antonis; Slot, Jason C.


    A cluster composed of four structural and two regulatory genes found in several species of the fungal genus Fusarium (class Sordariomycetes) is responsible for the production of the red pigment bikaverin. We discovered that the unrelated fungus Botrytis cinerea (class Leotiomycetes) contains a cluster of five genes that is highly similar in sequence and gene order to the Fusarium bikaverin cluster. Synteny conservation, nucleotide composition, and phylogenetic analyses of the cluster genes indicate that the B. cinerea cluster was acquired via horizontal transfer from a Fusarium donor. Upon or subsequent to the transfer, the B. cinerea gene cluster became inactivated; one of the four structural genes is missing, two others are pseudogenes, and the fourth structural gene shows an accelerated rate of nonsynonymous substitutions along the B. cinerea lineage, consistent with relaxation of selective constraints. Interestingly, the bik4 regulatory gene is still intact and presumably functional, whereas bik5, which is a pathway-specific regulator, also shows a mild but significant acceleration of evolutionary rate along the B. cinerea lineage. This selective preservation of the bik4 regulator suggests that its conservation is due to its likely involvement in other non–bikaverin-related biological processes in B. cinerea. Thus, in addition to novel metabolism, horizontal transfer of wholesale metabolic gene clusters might also be contributing novel regulation. PMID:22294497

  19. Optimizing A Lipocomplex-Based Gene Transfer Method into HeLa Cell Line

    PubMed Central

    Asgharian, Alimohammad; Banan, Mehdi; Najmabadi, Hossein


    One of the most significant steps in gene expression studies is transferring genes into cell cultures. Despite there are different methods for gene delivery such as viral and non-viral producers, some cationic lipid reagents have recently developed to transfect into mam- malian cell lines. The main aim of this study was optimizing and improving lipocomplex based transient transfection procedures into HeLa cell line which is being used widely as a typical cell in biological studies. This study was an experimental research. In this work, pCMV β-Gal DNA plasmid was used as a reporter DNA for determining the rate of gene transfection into HeLa cells. To accomplish the highest gene delivery into HeLa cells, optimizing experiments were carried out in different volumes of FuGENE-HD, LipofectamineTM2000 and X-tremeGENE. Also, we investigated tranasfection efficiency in presence of various cell densities of HeLa cells. Then, transfection efficiency and cell toxicity were measured by beta gal staining and trypan blue methods, respectively. Using FuGENE-HD in volume of 4µl along with 105 HeLa cells, transfection efficiency was higher (43.66 ± 1.52%) in comparison with the cationic lipids LipofectamineTM2000 and X-tremeGENE. In addition, the rate of cell toxicity in presence of FuGENE-HD was less than 5%. In summary, the cationic lipid FuGENE-HD indicates a suitable potential to transfer DNA into HeLa cells and it can be an efficient reagent for gene delivery for HeLa cells in vitro. Moreover, it is worth designing and optimizing gene transfer experiments for other cell lines with FuGENE-HD due to its low toxicity and high efficiency. PMID:24381863

  20. Optimizing A Lipocomplex-Based Gene Transfer Method into HeLa Cell Line.


    Asgharian, Alimohammad; Banan, Mehdi; Najmabadi, Hossein


    One of the most significant steps in gene expression studies is transferring genes into cell cultures. Despite there are different methods for gene delivery such as viral and non-viral producers, some cationic lipid reagents have recently developed to transfect into mam- malian cell lines. The main aim of this study was optimizing and improving lipocomplex based transient transfection procedures into HeLa cell line which is being used widely as a typical cell in biological studies. This study was an experimental research. In this work, pCMV β-Gal DNA plasmid was used as a reporter DNA for determining the rate of gene transfection into HeLa cells. To accomplish the highest gene delivery into HeLa cells, optimizing experiments were car- ried out in different volumes of FuGENE-HD, Lipofectamine(TM)2000 and X-tremeGENE. Also, we investigated tranasfection efficiency in presence of various cell densities of HeLa cells. Then, transfection efficiency and cell toxicity were measured by beta gal stainin