Science.gov

Sample records for alpha pparalpha protects

  1. Nonalcoholic steatohepatitic (NASH) mice are protected from higher hepatotoxicity of acetaminophen upon induction of PPAR{alpha} with clofibrate

    SciTech Connect

    Donthamsetty, Shashikiran; Bhave, Vishakha S.; Mitra, Mayurranjan S.; Latendresse, John R.; Mehendale, Harihara M.

    2008-08-01

    The objective was to investigate if the hepatotoxic sensitivity in nonalcoholic steatohepatitic mice to acetaminophen (APAP) is due to downregulation of nuclear receptor PPAR{alpha} via lower cell division and tissue repair. Male Swiss Webster mice fed methionine and choline deficient diet for 31 days exhibited NASH. On the 32nd day, a marginally toxic dose of APAP (360 mg/kg, ip) yielded 70% mortality in steatohepatitic mice, while all non steatohepatitic mice receiving the same dose survived. {sup 14}C-APAP covalent binding, CYP2E1 protein, and enzyme activity did not differ from the controls, obviating increased APAP bioactivation as the cause of amplified APAP hepatotoxicity. Liver injury progressed only in steatohepatitic livers between 6 and 24 h. Cell division and tissue repair assessed by {sup 3}H-thymidine incorporation and PCNA were inhibited only in the steatohepatitic mice given APAP suggesting that higher sensitivity of NASH liver to APAP-induced hepatotoxicity was due to lower tissue repair. The hypothesis that impeded liver tissue repair in steatohepatitic mice was due to downregulation of PPAR{alpha} was tested. PPAR{alpha} was downregulated in NASH. To investigate whether downregulation of PPAR{alpha} in NASH is the critical mechanism of compromised liver tissue repair, PPAR{alpha} was induced in steatohepatitic mice with clofibrate (250 mg/kg for 3 days, ip) before injecting APAP. All clofibrate pretreated steatohepatitic mice receiving APAP exhibited lower liver injury, which did not progress and the mice survived. The protection was not due to lower bioactivation of APAP but due to higher liver tissue repair. These findings suggest that inadequate PPAR{alpha} expression in steatohepatitic mice sensitizes them to APAP hepatotoxicity.

  2. Pretreatment by low-dose fibrates protects against acute free fatty acid-induced renal tubule toxicity by counteracting PPAR{alpha} deterioration

    SciTech Connect

    Takahashi, Kyoko; Kamijo, Yuji; Hora, Kazuhiko; Hashimoto, Koji; Higuchi, Makoto; Nakajima, Takero; Ehara, Takashi; Shigematsu, Hidekazu; Gonzalez, Frank J.; Aoyama, Toshifumi

    2011-05-01

    Development of a preventive strategy against tubular damage associated with proteinuria is of great importance. Recently, free fatty acid (FFA) toxicities accompanying proteinuria were found to be a main cause of tubular damage, which was aggravated by insufficiency of peroxisome proliferator-activated receptor alpha (PPAR{alpha}), suggesting the benefit of PPAR{alpha} activation. However, an earlier study using a murine acute tubular injury model, FFA-overload nephropathy, demonstrated that high-dose treatment of PPAR{alpha} agonist (0.5% clofibrate diet) aggravated the tubular damage as a consequence of excess serum accumulation of clofibrate metabolites due to decreased kidney elimination. To induce the renoprotective effects of PPAR{alpha} agonists without drug accumulation, we tried a pretreatment study using low-dose clofibrate (0.1% clofibrate diet) using the same murine model. Low-dose clofibrate pretreatment prevented acute tubular injuries without accumulation of its metabolites. The tubular protective effects appeared to be associated with the counteraction of PPAR{alpha} deterioration, resulting in the decrease of FFAs influx to the kidney, maintenance of fatty acid oxidation, diminution of intracellular accumulation of undigested FFAs, and attenuation of disease developmental factors including oxidative stress, apoptosis, and NF{kappa}B activation. These effects are common to other fibrates and dependent on PPAR{alpha} function. Interestingly, however, clofibrate pretreatment also exerted PPAR{alpha}-independent tubular toxicities in PPAR{alpha}-null mice with FFA-overload nephropathy. The favorable properties of fibrates are evident when PPAR{alpha}-dependent tubular protective effects outweigh their PPAR{alpha}-independent tubular toxicities. This delicate balance seems to be easily affected by the drug dose. It will be important to establish the appropriate dosage of fibrates for treatment against kidney disease and to develop a novel PPAR{alpha

  3. PPAR{alpha} agonist fenofibrate protects the kidney from hypertensive injury in spontaneously hypertensive rats via inhibition of oxidative stress and MAPK activity

    SciTech Connect

    Hou, Xiaoyang; Shen, Ying H.; Li, Chuanbao; Wang, Fei; Zhang, Cheng; Bu, Peili; Zhang, Yun

    2010-04-09

    Oxidative stress has been shown to play an important role in the development of hypertensive renal injury. Peroxisome proliferator-activated receptors {alpha} (PPAR{alpha}) has antioxidant effect. In this study, we demonstrated that fenofibrate significantly reduced proteinuria, inflammatory cell recruitment and extracellular matrix (ECM) proteins deposition in the kidney of SHRs without apparent effect on blood pressure. To investigate the mechanisms involved, we found that fenofibrate treatment markedly reduced oxidative stress accompanied by reduced activity of renal NAD(P)H oxidase, increased activity of Cu/Zn SOD, and decreased phosphorylation of p38MAPK and JNK in the kidney of SHRs. Taken together, fenofibrate treatment can protect against hypertensive renal injury without affecting blood pressure by inhibiting inflammation and fibrosis via suppression of oxidative stress and MAPK activity.

  4. VLDL hydrolysis by LPL activates PPAR-alpha through generation of unbound fatty acids.

    PubMed

    Ruby, Maxwell A; Goldenson, Benjamin; Orasanu, Gabriela; Johnston, Thomas P; Plutzky, Jorge; Krauss, Ronald M

    2010-08-01

    Recent evidence suggests that lipoproteins serve as circulating reservoirs of peroxisomal proliferator activated receptor (PPAR) ligands that are accessible through lipolysis. The present study was conducted to determine the biochemical basis of PPAR-alpha activation by lipolysis products and their contribution to PPAR-alpha function in vivo. PPAR-alpha activation was measured in bovine aortic endothelial cells following treatment with human plasma, VLDL lipolysis products, or oleic acid. While plasma failed to activate PPAR-alpha, oleic acid performed similarly to VLDL lipolysis products. Therefore, fatty acids are likely to be the PPAR-alpha ligands generated by VLDL lipolysis. Indeed, unbound fatty acid concentration determined PPAR-alpha activation regardless of fatty acid source, with PPAR-alpha activation occurring only at unbound fatty acid concentrations that are unachievable under physiological conditions without lipase action. In mice, a synthetic lipase inhibitor (poloxamer-407) attenuated fasting-induced changes in expression of PPAR-alpha target genes. Apolipoprotein CIII (apoCIII), an endogenous inhibitor of lipoprotein and hepatic lipase, regulated access to the lipoprotein pool of PPAR-alpha ligands, because addition of exogenous apoCIII inhibited, and removal of endogenous apoCIII potentiated, lipolytic PPAR-alpha activation. These data suggest that the PPAR-alpha response is generated by unbound fatty acids released locally by lipase activity and not by circulating plasma fatty acids.

  5. PPAR{alpha} is a key regulator of hepatic FGF21

    SciTech Connect

    Lundasen, Thomas; Hunt, Mary C.; Nilsson, Lisa-Mari; Sanyal, Sabyasachi; Angelin, Bo; Alexson, Stefan E.H.; Rudling, Mats . E-mail: mats.rudling@cnt.ki.se

    2007-08-24

    The metabolic regulator fibroblast growth factor 21 (FGF21) has antidiabetic properties in animal models of diabetes and obesity. Using quantitative RT-PCR, we here show that the hepatic gene expression of FGF21 is regulated by the peroxisome proliferator-activated receptor alpha (PPAR{alpha}). Fasting or treatment of mice with the PPAR{alpha} agonist Wy-14,643 induced FGF21 mRNA by 10-fold and 8-fold, respectively. In contrast, FGF21 mRNA was low in PPAR{alpha} deficient mice, and fasting or treatment with Wy-14,643 did not induce FGF21. Obese ob/ob mice, known to have increased PPAR{alpha} levels, displayed 12-fold increased hepatic FGF21 mRNA levels. The potential importance of PPAR{alpha} for FGF21 expression also in human liver was shown by Wy-14,643 induction of FGF21 mRNA in human primary hepatocytes, and PPAR{alpha} response elements were identified in both the human and mouse FGF21 promoters. Further studies on the mechanisms of regulation of FGF21 by PPAR{alpha} in humans will be of great interest.

  6. Characterization of peroxisome proliferator-activiated receptor alpha (PPARalpha)-independent effects of PPARalpha activators in the rodent liver: Di(2-ethylehexyl) phthalate activates the constitutive activated receptor

    EPA Science Inventory

    Peroxisome proliferator chemicals (PPC) are thought to mediate their effects in rodents on hepatocyte growth and liver cancer through the nuclear receptor peroxisome proliferator-activated receptor alpha (PPARalpha). Recent studies indicate that the plasticizer di-2-ethylhexyl ph...

  7. Cholesteryl ester hydroperoxides increase macrophage CD36 gene expression via PPAR{alpha}

    SciTech Connect

    Jedidi, Iness; Couturier, Martine; Therond, Patrice; Gardes-Albert, Monique; Legrand, Alain; Barouki, Robert; Bonnefont-Rousselot, Dominique; Aggerbeck, Martine . E-mail: Martine.Aggerbeck@univ-paris5.fr

    2006-12-22

    The uptake of oxidized LDL by macrophages is a key event in the development of atherosclerosis. The scavenger receptor CD36 is one major receptor that internalizes oxidized LDL. In differentiated human macrophages, we compared the regulation of CD36 expression by copper-oxidized LDL or their products. Only oxidized derivatives of cholesteryl ester (CEOOH) increased the amount of CD36 mRNA (2.5-fold). Both oxidized LDL and CEOOH treatment increased two to fourfold the transcription of promoters containing peroxisome-proliferator-activated-receptor responsive elements (PPRE) in the presence of PPAR{alpha} or {gamma}. Electrophoretic-mobility-shift-assays with nuclear extracts prepared from macrophages treated by either oxidized LDL or CEOOH showed increased binding of PPAR{alpha} to the CD36 gene promoter PPRE. In conclusion, CEOOH present in oxidized LDL increase CD36 gene expression in a pathway involving PPAR{alpha}.

  8. PPAR{alpha} agonists up-regulate organic cation transporters in rat liver cells

    SciTech Connect

    Luci, Sebastian; Geissler, Stefanie; Koenig, Bettina; Koch, Alexander; Stangl, Gabriele I.; Hirche, Frank; Eder, Klaus . E-mail: klaus.eder@landw.uni-halle.de

    2006-11-24

    It has been shown that clofibrate treatment increases the carnitine concentration in the liver of rats. However, the molecular mechanism is still unknown. In this study, we observed for the first time that treatment of rats with the peroxisome proliferator activated receptor (PPAR)-{alpha} agonist clofibrate increases hepatic mRNA concentrations of organic cation transporters (OCTNs)-1 and -2 which act as transporters of carnitine into the cell. In rat hepatoma (Fao) cells, treatment with WY-14,643 also increased the mRNA concentration of OCTN-2. mRNA concentrations of enzymes involved in carnitine biosynthesis were not altered by treatment with the PPAR{alpha} agonists in livers of rats and in Fao cells. We conclude that PPAR{alpha} agonists increase carnitine concentrations in livers of rats and cells by an increased uptake of carnitine into the cell but not by an increased carnitine biosynthesis.

  9. PPAR{alpha} is a potential therapeutic target of drugs to treat circadian rhythm sleep disorders

    SciTech Connect

    Shirai, Hidenori; Oishi, Katsutaka; Kudo, Takashi; Shibata, Shigenobu; Ishida, Norio . E-mail: n.ishida@aist.go.jp

    2007-06-08

    Recent progress at the molecular level has revealed that nuclear receptors play an important role in the generation of mammalian circadian rhythms. To examine whether peroxisome proliferator-activated receptor alpha (PPAR{alpha}) is involved in the regulation of circadian behavioral rhythms in mammals, we evaluated the locomotor activity of mice administered with the hypolipidemic PPAR{alpha} ligand, bezafibrate. Circadian locomotor activity was phase-advanced about 3 h in mice given bezafibrate under light-dark (LD) conditions. Transfer from LD to constant darkness did not change the onset of activity in these mice, suggesting that bezafibrate advanced the phase of the endogenous clock. Surprisingly, bezafibrate also advanced the phase in mice with lesions of the suprachiasmatic nucleus (SCN; the central clock in mammals). The circadian expression of clock genes such as period2, BMAL1, and Rev-erb{alpha} was also phase-advanced in various tissues (cortex, liver, and fat) without affecting the SCN. Bezafibrate also phase-advanced the activity phase that is delayed in model mice with delayed sleep phase syndrome (DSPS) due to a Clock gene mutation. Our results indicated that PPAR{alpha} is involved in circadian clock control independently of the SCN and that PPAR{alpha} could be a potent target of drugs to treat circadian rhythm sleep disorders including DSPS.

  10. Double gene deletion reveals the lack of cooperation between PPAR{alpha} and PPAR{beta} in skeletal muscle

    SciTech Connect

    Bedu, E.; Desplanches, D.; Pequignot, J.; Bordier, B.; Desvergne, B. . E-mail: beatrice.desvergne@unil.ch

    2007-06-15

    The peroxisome proliferator-activated receptors (PPARs) are involved in the regulation of most of the pathways linked to lipid metabolism. PPAR{alpha} and PPAR{beta} isotypes are known to regulate muscle fatty acid oxidation and a reciprocal compensation of their function has been proposed. Herein, we investigated muscle contractile and metabolic phenotypes in PPAR{alpha}-/-, PPAR{beta}-/-, and double PPAR{alpha}-/- {beta}-/- mice. Heart and soleus muscle analyses show that the deletion of PPAR{alpha} induces a decrease of the HAD activity ({beta}-oxidation) while soleus contractile phenotype remains unchanged. A PPAR{beta} deletion alone has no effect. However, these mild phenotypes are not due to a reciprocal compensation of PPAR{beta} and PPAR{alpha} functions since double gene deletion PPAR{alpha}-PPAR{beta} mostly reproduces the null PPAR{alpha}-mediated reduced {beta}-oxidation, in addition to a shift from fast to slow fibers. In conclusion, PPAR{beta} is not required for maintaining skeletal muscle metabolic activity and does not compensate the lack of PPAR{alpha} in PPAR{alpha} null mice.

  11. PPAR{alpha} gene expression is up-regulated by LXR and PXR activators in the small intestine

    SciTech Connect

    Inoue, Jun; Satoh, Shin-ichi; Kita, Mariko; Nakahara, Mayuko; Hachimura, Satoshi; Miyata, Masaaki; Nishimaki-Mogami, Tomoko; Sato, Ryuichiro

    2008-07-11

    LXR, PXR, and PPAR{alpha} are members of a nuclear receptor family which regulate the expression of genes involved in lipid metabolism. Here, we show the administration of T0901317 stimulates PPAR{alpha} gene expression in the small intestine but not in the liver of both normal and FXR-null mice. The administration of LXR specific ligand GW3965, or PXR specific ligand PCN has the same effect, indicating that ligand-dependent activation of LXR and PXR, but not FXR, is responsible for the increased gene expression of PPAR{alpha} in the mouse small intestine.

  12. The liver-enriched transcription factor CREBH is nutritionally regulated and activated by fatty acids and PPAR{alpha}

    SciTech Connect

    Danno, Hirosuke; Ishii, Kiyo-aki; Nakagawa, Yoshimi; Mikami, Motoki; Yamamoto, Takashi; Yabe, Sachiko; Furusawa, Mika; Kumadaki, Shin; Watanabe, Kazuhisa; Shimizu, Hidehisa; Matsuzaka, Takashi; Kobayashi, Kazuto; Takahashi, Akimitsu; Yatoh, Shigeru; Suzuki, Hiroaki; Yamada, Nobuhiro; Shimano, Hitoshi

    2010-01-08

    To elucidate the physiological role of CREBH, the hepatic mRNA and protein levels of CREBH were estimated in various feeding states of wild and obesity mice. In the fast state, the expression of CREBH mRNA and nuclear protein were high and profoundly suppressed by refeeding in the wild-type mice. In ob/ob mice, the refeeding suppression was impaired. The diet studies suggested that CREBH expression was activated by fatty acids. CREBH mRNA levels in the mouse primary hepatocytes were elevated by addition of the palmitate, oleate and eicosapenonate. It was also induced by PPAR{alpha} agonist and repressed by PPAR{alpha} antagonist. Luciferase reporter gene assays indicated that the CREBH promoter activity was induced by fatty acids and co-expression of PPAR{alpha}. Deletion studies identified the PPRE for PPAR{alpha} activation. Electrophoretic mobility shift assay and chromatin immunoprecipitation (ChIP) assay confirmed that PPAR{alpha} directly binds to the PPRE. Activation of CREBH at fasting through fatty acids and PPAR{alpha} suggest that CREBH is involved in nutritional regulation.

  13. Isoform specific changes in PPAR{alpha} and {beta} in colon and breast cancer with differentiation

    SciTech Connect

    Aung, Cho S.; Faddy, Helen M.; Lister, Erin J.; Monteith, Gregory R.; Roberts-Thomson, Sarah J. . E-mail: S.Roberts-Thomson@pharmacy.uq.edu.au

    2006-02-10

    To investigate the role of peroxisome proliferator-activated receptors (PPARs) {alpha} and {beta} in the differentiation of colon cancer cells, we differentiated HT-29 cells using sodium butyrate (NaB) and culturing post-confluence and assessed differentiation using the marker intestinal alkaline phosphatase. While PPAR{alpha} levels only changed with culturing post confluence, PPAR{beta} levels increased independent of the method of differentiation. To explore further the differences induced by NaB, we assessed changes in both PPAR isoforms in MCF-7 breast cancer cells cultured in the presence of NaB over 48 h. Again a very different expression pattern was observed with PPAR{alpha} increasing after 4 h and remaining elevated, while PPAR{beta} increased transiently. Our studies suggest that the expression of PPARs is dependent upon both the method of differentiation and on time. Moreover, these studies show that changes in PPAR{alpha} levels are not required for the differentiation of colon cancer cell lines, whereas changes in PPAR{beta} are more closely associated with differentiation.

  14. Uncoupling protein-2 up-regulation and enhanced cyanide toxicity are mediated by PPAR{alpha} activation and oxidative stress

    SciTech Connect

    Zhang, X.; Li, L.; Prabhakaran, K.; Zhang, L.; Leavesley, H.B.; Borowitz, J.L.; Isom, G.E.

    2007-08-15

    Uncoupling protein 2 (UCP-2) is an inner mitochondrial membrane proton carrier that modulates mitochondrial membrane potential ({delta}{psi}{sub m}) and uncouples oxidative phosphorylation. We have shown that up-regulation of UCP-2 by Wy14,643, a selective peroxisome proliferator-activated receptor-{alpha} (PPAR{alpha}) agonist, enhances cyanide cytotoxicity. The pathway by which Wy14,643 up-regulates UCP-2 was determined in a dopaminergic cell line (N27 cells). Since dopaminergic mesencephalic cells are a primary brain target of cyanide, the N27 immortalized mesencephalic cell was used in this study. Wy14,643 produced a concentration- and time-dependent up-regulation of UCP-2 that was linked to enhanced cyanide-induced cell death. MK886 (PPAR{alpha} antagonist) or PPAR{alpha} knock-down by RNA interference (RNAi) inhibited PPAR{alpha} activity as shown by the peroxisome proliferator response element-luciferase reporter assay, but only partially decreased up-regulation of UCP-2. The role of oxidative stress as an alternative pathway to UCP-2 up-regulation was determined. Wy14,643 induced a rapid surge of ROS generation and loading cells with glutathione ethyl ester (GSH-EE) or pre-treatment with vitamin E attenuated up-regulation of UCP-2. On the other hand, RNAi knockdown of PPAR{alpha} did not alter ROS generation, suggesting a PPAR{alpha}-independent component to the response. Co-treatment with PPAR{alpha}-RNAi and GSH-EE blocked both the up-regulation of UCP-2 by Wy14,643 and the cyanide-induced cell death. It was concluded that a PPAR{alpha}-mediated pathway and an oxidative stress pathway independent of PPAR{alpha} mediate the up-regulation of UCP-2 and subsequent increased vulnerability to cyanide-induced cytotoxicity.

  15. PPAR{alpha} does not suppress muscle-associated gene expression in brown adipocytes but does influence expression of factors that fingerprint the brown adipocyte

    SciTech Connect

    Walden, Tomas B.; Petrovic, Natasa; Nedergaard, Jan

    2010-06-25

    Brown adipocytes and myocytes develop from a common adipomyocyte precursor. PPAR{alpha} is a nuclear receptor important for lipid and glucose metabolism. It has been suggested that in brown adipose tissue, PPAR{alpha} represses the expression of muscle-associated genes, in this way potentially acting to determine cell fate in brown adipocytes. To further understand the possible role of PPAR{alpha} in these processes, we measured expression of muscle-associated genes in brown adipose tissue and brown adipocytes from PPAR{alpha}-ablated mice, including structural genes (Mylpf, Tpm2, Myl3 and MyHC), regulatory genes (myogenin, Myf5 and MyoD) and a myomir (miR-206). However, in our hands, the expression of these genes was not influenced by the presence or absence of PPAR{alpha}, nor by the PPAR{alpha} activator Wy-14,643. Similarly, the expression of genes common for mature brown adipocyte and myocytes (Tbx15, Meox2) were not affected. However, the brown adipocyte-specific regulatory genes Zic1, Lhx8 and Prdm16 were affected by PPAR{alpha}. Thus, it would not seem that PPAR{alpha} represses muscle-associated genes, but PPAR{alpha} may still play a role in the regulation of the bifurcation of the adipomyocyte precursor into a brown adipocyte or myocyte phenotype.

  16. Time-course comparison of xenobiotic activators of CAR and PPAR{alpha} in mouse liver

    SciTech Connect

    Ross, Pamela K.; Woods, Courtney G.; Bradford, Blair U.; Kosyk, Oksana; Gatti, Daniel M.; Cunningham, Michael L.; Rusyn, Ivan

    2009-03-01

    Constitutive androstane receptor (CAR) and peroxisome proliferator activated receptor (PPAR){alpha} are transcription factors known to be primary mediators of liver effects, including carcinogenesis, by phenobarbital-like compounds and peroxisome proliferators, respectively, in rodents. Many similarities exist in the phenotypes elicited by these two classes of agents in rodent liver, and we hypothesized that the initial transcriptional responses to the xenobiotic activators of CAR and PPAR{alpha} will exhibit distinct patterns, but at later time-points these biological pathways will converge. In order to capture the global transcriptional changes that result from activation of these nuclear receptors over a time-course in the mouse liver, microarray technology was used. First, differences in basal expression of liver genes between C57Bl/6J wild-type and Car-null mice were examined and 14 significantly differentially expressed genes were identified. Next, mice were treated with phenobarbital (100 mg/kg by gavage for 24 h, or 0.085% w/w diet for 7 or 28 days), and liver gene expression changes with regards to both time and treatment were identified. While several pathways related to cellular proliferation and metabolism were affected by phenobarbital in wild-type mice, no significant changes in gene expression were found over time in the Car-nulls. Next, we determined commonalities and differences in the temporal response to phenobarbital and WY-14,643, a prototypical activator of PPAR {alpha}. Gene expression signatures from livers of wild-type mice C57Bl6/J mice treated with PB or WY-14,643 were compared. Similar pathways were affected by both compounds; however, considerable time-related differences were present. This study establishes common gene expression fingerprints of exposure to activators of CAR and PPAR{alpha} in rodent liver and demonstrates that despite similar phenotypic changes, molecular pathways differ between classes of chemical carcinogens.

  17. Fatty Acid Amide Hydrolase (FAAH) Inhibition Enhances Memory Acquisition through Activation of PPAR-alpha Nuclear Receptors

    ERIC Educational Resources Information Center

    Mazzola, Carmen; Medalie, Julie; Scherma, Maria; Panlilio, Leigh V.; Solinas, Marcello; Tanda, Gianluigi; Drago, Filippo; Cadet, Jean Lud; Goldberg, Steven R.; Yasar, Sevil

    2009-01-01

    Inhibitors of fatty acid amide hydrolase (FAAH) increase endogenous levels of anandamide (a cannabinoid CB[subscript 1]-receptor ligand) and oleoylethanolamide and palmitoylethanolamide (OEA and PEA, ligands for alpha-type peroxisome proliferator-activated nuclear receptors, PPAR-alpha) when and where they are naturally released in the brain.…

  18. Activation of peroxisome proliferator-activated receptor-{alpha} (PPAR{alpha}) suppresses postprandial lipidemia through fatty acid oxidation in enterocytes

    SciTech Connect

    Kimura, Rino; Takahashi, Nobuyuki; Murota, Kaeko; Yamada, Yuko; Niiya, Saori; Kanzaki, Noriyuki; Murakami, Yoko; Moriyama, Tatsuya; Goto, Tsuyoshi; Kawada, Teruo

    2011-06-24

    Highlights: {yields} PPAR{alpha} activation increased mRNA expression levels of fatty acid oxidation-related genes in human intestinal epithelial Caco-2 cells. {yields} PPAR{alpha} activation also increased oxygen consumption rate and CO{sub 2} production and decreased secretion of triglyceride and ApoB from Caco-2 cells. {yields} Orally administration of bezafibrate increased mRNA expression levels of fatty acid oxidation-related genes and CO{sub 2} production in small intestinal epithelial cells. {yields} Treatment with bezafibrate decreased postprandial serum concentration of triglyceride after oral injection of olive oil in mice. {yields} It suggested that intestinal lipid metabolism regulated by PPAR{alpha} activation suppresses postprandial lipidemia. -- Abstract: Activation of peroxisome proliferator-activated receptor (PPAR)-{alpha} which regulates lipid metabolism in peripheral tissues such as the liver and skeletal muscle, decreases circulating lipid levels, thus improving hyperlipidemia under fasting conditions. Recently, postprandial serum lipid levels have been found to correlate more closely to cardiovascular diseases than fasting levels, although fasting hyperlipidemia is considered an important risk of cardiovascular diseases. However, the effect of PPAR{alpha} activation on postprandial lipidemia has not been clarified. In this study, we examined the effects of PPAR{alpha} activation in enterocytes on lipid secretion and postprandial lipidemia. In Caco-2 enterocytes, bezafibrate, a potent PPAR{alpha} agonist, increased mRNA expression levels of fatty acid oxidation-related genes, such as acyl-CoA oxidase, carnitine palmitoyl transferase, and acyl-CoA synthase, and oxygen consumption rate (OCR) and suppressed secretion levels of both triglycerides and apolipoprotein B into the basolateral side. In vivo experiments revealed that feeding high-fat-diet containing bezafibrate increased mRNA expression levels of fatty acid oxidation-related genes and

  19. Regulation of miR-200c by nuclear receptors PPAR{alpha}, LRH-1 and SHP

    SciTech Connect

    Zhang, Yuxia; Yang, Zhihong; Whitby, Richard; Wang, Li

    2011-12-09

    Highlights: Black-Right-Pointing-Pointer Knockdown of PPAR{alpha} and LRH-1 abolishes miR-200c inhibition of HCC cell migration. Black-Right-Pointing-Pointer SHP represses miR-200c expression via inhibition of the activity of PPAR{alpha} and LRH-1. Black-Right-Pointing-Pointer RJW100 exhibits strong ability to downregulate ZEB1 and ZEB2 proteins. -- Abstract: We investigated regulation of miR-200c expression by nuclear receptors. Ectopic expression of miR-200c inhibited MHCC97H cell migration, which was abrogated by the synergistic effects of PPAR{alpha} and LRH-1 siRNAs. The expression of miR-200c was decreased by PPAR{alpha}/LRH-1 siRNAs and increased by SHP siRNAs, and overexpression of the receptors reversed the effects of their respective siRNAs. SHP siRNAs also drastically enhanced the ability of the LRH-1 agonist RJW100 to induce miR-200c and downregulate ZEB1 and ZEB2 proteins. Co-expression of PPAR{alpha} and LRH-1 moderately transactivated the miR-200c promoter, which was repressed by SHP co-expression. RJW100 caused strong activation of the miR-200c promoter. This is the first report to demonstrate that miR-200c expression is controlled by nuclear receptors.

  20. Synergistic acceleration of thyroid hormone degradation by phenobarbital and the PPAR{alpha} agonist WY14643 in rat hepatocytes

    SciTech Connect

    Wieneke, N.; Neuschaefer-Rube, F.; Bode, L.M.; Kuna, M.; Andres, J.; Carnevali, L.C.; Hirsch-Ernst, K.I.; Pueschel, G.P.

    2009-10-01

    Energy balance is maintained by controlling both energy intake and energy expenditure. Thyroid hormones play a crucial role in regulating energy expenditure. Their levels are adjusted by a tight feedback-controlled regulation of thyroid hormone production/incretion and by their hepatic metabolism. Thyroid hormone degradation has previously been shown to be enhanced by treatment with phenobarbital or other antiepileptic drugs due to a CAR-dependent induction of phase II enzymes of xenobiotic metabolism. We have recently shown, that PPAR{alpha} agonists synergize with phenobarbital to induce another prototypical CAR target gene, CYP2B1. Therefore, it was tested whether a PPAR{alpha} agonist could enhance the phenobarbital-dependent acceleration of thyroid hormone elimination. In primary cultures of rat hepatocytes the apparent half-life of T3 was reduced after induction with a combination of phenobarbital and the PPAR{alpha} agonist WY14643 to a larger extent than after induction with either compound alone. The synergistic reduction of the half-life could be attributed to a synergistic induction of CAR and the CAR target genes that code for enzymes and transporters involved in the hepatic elimination of T3, such as OATP1A1, OATP1A3, UGT1A3 and UGT1A10. The PPAR{alpha}-dependent CAR induction and the subsequent induction of T3-eliminating enzymes might be of physiological significance for the fasting-induced reduction in energy expenditure by fatty acids as natural PPAR{alpha} ligands. The synergism of the PPAR{alpha} agonist WY14643 and phenobarbital in inducing thyroid hormone breakdown might serve as a paradigm for the synergistic disruption of endocrine control by other combinations of xenobiotics.

  1. Salacia oblonga root improves postprandial hyperlipidemia and hepatic steatosis in Zucker diabetic fatty rats: activation of PPAR-alpha.

    PubMed

    Huang, Tom Hsun-Wei; Peng, Gang; Li, George Qian; Yamahara, Johji; Roufogalis, Basil D; Li, Yuhao

    2006-02-01

    Salacia oblonga (SO) root is an Ayurvedic medicine with anti-diabetic and anti-obese properties. Peroxisome proliferator-activated receptor (PPAR)-alpha, a nuclear receptor, plays an important role in maintaining the homeostasis of lipid metabolism. Here, we demonstrate that chronic oral administration of the water extract from the root of SO to Zucker diabetic fatty (ZDF) rats, a genetic model of type 2 diabetes and obesity, lowered plasma triglyceride and total cholesterol (TC) levels, increased plasma high-density lipoprotein levels and reduced the liver contents of triglyceride, non-esterified fatty acids (NEFA) and the ratio of fatty droplets to total tissue. By contrast, the extract had no effect on plasma triglyceride and TC levels in fasted ZDF rats. After olive oil administration to ZDF the extract also inhibited the increase in plasma triglyceride levels. These results suggest that SO extract improves postprandial hyperlipidemia and hepatic steatosis in ZDF rats. Additionally, SO treatment enhanced hepatic expression of PPAR-alpha mRNA and protein, and carnitine palmitoyltransferase-1 and acyl-CoA oxidase mRNAs in ZDF rats. In vitro, SO extract and its main component mangiferin activated PPAR-alpha luciferase activity in human embryonic kidney 293 cells and lipoprotein lipase mRNA expression and enzyme activity in THP-1 differentiated macrophages; these effects were completely suppressed by a selective PPAR-alpha antagonist MK-886. The findings from both in vivo and in vitro suggest that SO extract functions as a PPAR-alpha activator, providing a potential mechanism for improvement of postprandial hyperlipidemia and hepatic steatosis in diabetes and obesity. PMID:15975614

  2. Salacia oblonga root improves postprandial hyperlipidemia and hepatic steatosis in Zucker diabetic fatty rats: Activation of PPAR-{alpha}

    SciTech Connect

    Hsun-Wei Huang, Tom; Peng Gang; Qian Li, George; Yamahara, Johji; Roufogalis, Basil D.; Li Yuhao . E-mail: yuhao@pharm.usyd.edu.au

    2006-02-01

    Salacia oblonga (SO) root is an Ayurvedic medicine with anti-diabetic and anti-obese properties. Peroxisome proliferator-activated receptor (PPAR)-{alpha}, a nuclear receptor, plays an important role in maintaining the homeostasis of lipid metabolism. Here, we demonstrate that chronic oral administration of the water extract from the root of SO to Zucker diabetic fatty (ZDF) rats, a genetic model of type 2 diabetes and obesity, lowered plasma triglyceride and total cholesterol (TC) levels, increased plasma high-density lipoprotein levels and reduced the liver contents of triglyceride, non-esterified fatty acids (NEFA) and the ratio of fatty droplets to total tissue. By contrast, the extract had no effect on plasma triglyceride and TC levels in fasted ZDF rats. After olive oil administration to ZDF the extract also inhibited the increase in plasma triglyceride levels. These results suggest that SO extract improves postprandial hyperlipidemia and hepatic steatosis in ZDF rats. Additionally, SO treatment enhanced hepatic expression of PPAR-{alpha} mRNA and protein, and carnitine palmitoyltransferase-1 and acyl-CoA oxidase mRNAs in ZDF rats. In vitro, SO extract and its main component mangiferin activated PPAR-{alpha} luciferase activity in human embryonic kidney 293 cells and lipoprotein lipase mRNA expression and enzyme activity in THP-1 differentiated macrophages; these effects were completely suppressed by a selective PPAR-{alpha} antagonist MK-886. The findings from both in vivo and in vitro suggest that SO extract functions as a PPAR-{alpha} activator, providing a potential mechanism for improvement of postprandial hyperlipidemia and hepatic steatosis in diabetes and obesity.

  3. PPAR{alpha} regulates the hepatotoxic biomarker alanine aminotransferase (ALT1) gene expression in human hepatocytes

    SciTech Connect

    Thulin, Petra; Rafter, Ingalill; Stockling, Kenneth; Tomkiewicz, Celine; Norjavaara, Ensio; Aggerbeck, Martine; Hellmold, Heike; Ehrenborg, Ewa; Andersson, Ulf; Cotgreave, Ian; Glinghammar, Bjoern

    2008-08-15

    In this work, we investigated a potential mechanism behind the observation of increased aminotransferase levels in a phase I clinical trial using a lipid-lowering drug, the peroxisome proliferator-activated receptor (PPAR) {alpha} agonist, AZD4619. In healthy volunteers treated with AZD4619, serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities were elevated without an increase in other markers for liver injury. These increases in serum aminotransferases have previously been reported in some patients receiving another PPAR{alpha} agonist, fenofibrate. In subsequent in vitro studies, we observed increased expression of ALT1 protein and mRNA in human hepatocytes after treatment with fenofibric acid. The PPAR effect on ALT1 expression was shown to act through a direct transcriptional mechanism involving at least one PPAR response element (PPRE) in the proximal ALT1 promoter, while no effect of fenofibrate and AZD4619 was observed on the ALT2 promoter. Binding of PPARs to the PPRE located at - 574 bp from the transcriptional start site was confirmed on both synthetic oligonucleotides and DNA in hepatocytes. These data show that intracellular ALT expression is regulated by PPAR agonists and that this mechanism might contribute to increased ALT activity in serum.

  4. Statins and PPAR{alpha} agonists induce myotoxicity in differentiated rat skeletal muscle cultures but do not exhibit synergy with co-treatment

    SciTech Connect

    Johnson, Timothy E. . E-mail: Timothy_Johnson@merck.com; Zhang, Xiaohua; Shi, Shu; Umbenhauer, Diane R.

    2005-11-01

    Statins and fibrates (weak PPAR{alpha} agonists) are prescribed for the treatment of lipid disorders. Both drugs cause myopathy, but with a low incidence, 0.1-0.5%. However, combined statin and fibrate therapy can enhance myopathy risk. We tested the myotoxic potential of PPAR subtype selective agonists alone and in combination with statins in a differentiated rat myotube model. A pharmacologically potent experimental PPAR{alpha} agonist, Compound A, induced myotoxicity as assessed by TUNEL staining at a minimum concentration of 1 nM, while other weaker PPAR{alpha} compounds, for example, WY-14643, Gemfibrozil and Bezafibrate increased the percentage of TUNEL-positive nuclei at micromolar concentrations. In contrast, the PPAR{gamma} agonist Rosiglitazone caused little or no cell death at up to 10 {mu}M and the PPAR{delta} ligand GW-501516 exhibited comparatively less myotoxicity than that seen with Compound A. An experimental statin (Compound B) and Atorvastatin also increased the percentage of TUNEL-positive nuclei and co-treatment with WY-14643, Gemfibrozil or Bezafibrate had less than a full additive effect on statin-induced cell killing. The mechanism of PPAR{alpha} agonist-induced cell death was different from that of statins. Unlike statins, Compound A and WY-14643 did not activate caspase 3/7. In addition, mevalonate and geranylgeraniol reversed the toxicity caused by statins, but did not prevent the cell killing induced by WY-14643. Furthermore, unlike statins, Compound A did not inhibit the isoprenylation of rab4 or rap1a. Interestingly, Compound A and Compound B had differential effects on ATP levels. Taken together, these observations support the hypothesis that in rat myotube cultures, PPAR{alpha} agonism mediates in part the toxicity response to PPAR{alpha} compounds. Furthermore, PPAR{alpha} agonists and statins cause myotoxicity through distinct and independent pathways.

  5. Haploinsufficiency in the PPAR{alpha} and LDL receptor genes leads to gender- and age-specific obesity and hyperinsulinemia

    SciTech Connect

    Sugiyama, Eiko . E-mail: eikoyoko@nagano-kentan.ac.jp; Tanaka, Naoki; Nakajima, Tamie; Kamijo, Yuji; Yokoyama, Shin; Li Yufeng; Gonzalez, Frank J.; Aoyama, Toshifumi

    2006-11-17

    When preparing peroxisome proliferator-activated receptor (PPAR){alpha}:low-density lipoprotein receptor (LDLR) (-/-) double knockout mice, we unexpectedly found a unique gender- and age-specific obesity in the F1 generation, PPAR{alpha} (+/-):LDLR (+/-), even in mice fed standard chow. Body weights of the male heterozygous mice increased up to about 60 g at 75 weeks of age, then decreased by about 30 g at 100 weeks of age. More than 95% of the heterozygous mice between 35- and 75-week-olds were overweight. Of interest, the obese heterozygous mice also exhibited hyperinsulinemia correlating with moderate insulin resistance. Hepatic gene expression of LDLR was lower than expected in the heterozygous mice, particularly at 50 and 75 weeks of age. In contrast, the hepatic expression of PPAR{alpha} was higher than expected in obese heterozygous mice, but decreased in non-obese older heterozygous mice. Modulated expression of these genes may be partially associated with the onset of the hyperinsulinemia.

  6. Phytol directly activates peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) and regulates gene expression involved in lipid metabolism in PPAR{alpha}-expressing HepG2 hepatocytes

    SciTech Connect

    Goto, Tsuyoshi; Takahashi, Nobuyuki; Kato, Sota; Egawa, Kahori; Ebisu, Shogo; Moriyama, Tatsuya; Fushiki, Tohru; Kawada, Teruo . E-mail: fat@kais.kyoto-u.ac.jp

    2005-11-18

    The peroxisome proliferator-activated receptor (PPAR) is one of the indispensable transcription factors for regulating lipid metabolism in various tissues. In our screening for natural compounds that activate PPAR using luciferase assays, a branched-carbon-chain alcohol (a component of chlorophylls), phytol, has been identified as a PPAR{alpha}-specific activator. Phytol induced the increase in PPAR{alpha}-dependent luciferase activity and the degree of in vitro binding of a coactivator, SRC-1, to GST-PPAR{alpha}. Moreover, the addition of phytol upregulated the expression of PPAR{alpha}-target genes at both mRNA and protein levels in PPAR{alpha}-expressing HepG2 hepatocytes. These findings indicate that phytol is functional as a PPAR{alpha} ligand and that it stimulates the expression of PPAR{alpha}-target genes in intact cells. Because PPAR{alpha} activation enhances circulating lipid clearance, phytol may be important in managing abnormalities in lipid metabolism.

  7. A Global Genomic Screening Strategy Reveals Genetic and Chemical Activators ofPeroxisome Proliferator-Activated Receptor alpha (PPARalpha)

    EPA Science Inventory

    A comprehensive survey of chemical, diet and genetic perturbations that activate PPARalpha in the mouse liver has not been carried out but would be useful to identify the factors that may contribute to PPARalpha-dependent liver tumors. A gene signature dependent on PPARalpha ac...

  8. Unlike PPAR{gamma}, PPAR{alpha} or PPAR{beta}/{delta} activation does not promote human monocyte differentiation toward alternative macrophages

    SciTech Connect

    Bouhlel, Mohamed Amine; Brozek, John; Derudas, Bruno; Zawadzki, Christophe; Jude, Brigitte; Staels, Bart; Chinetti-Gbaguidi, Giulia

    2009-08-28

    Macrophages adapt their response to micro-environmental signals. While Th1 cytokines promote pro-inflammatory M1 macrophages, Th2 cytokines promote an 'alternative' anti-inflammatory M2 macrophage phenotype. Peroxisome proliferator-activated receptors (PPARs) are ligand-activated transcription factors expressed in macrophages where they control the inflammatory response. It has been shown that PPAR{gamma} promotes the differentiation of monocytes into anti-inflammatory M2 macrophages in humans and mice, while a role for PPAR{beta}/{delta} in this process has been reported only in mice and no data are available for PPAR{alpha}. Here, we show that in contrast to PPAR{gamma}, expression of PPAR{alpha} and PPAR{beta}/{delta} overall does not correlate with the expression of M2 markers in human atherosclerotic lesions, whereas a positive correlation with genes of lipid metabolism exists. Moreover, unlike PPAR{gamma}, PPAR{alpha} or PPAR{beta}/{delta} activation does not influence human monocyte differentiation into M2 macrophages in vitro. Thus, PPAR{alpha} and PPAR{beta}/{delta} do not appear to modulate the alternative differentiation of human macrophages.

  9. Liver PPAR{alpha} and UCP2 are involved in the regulation of obesity and lipid metabolism by swim training in genetically obese db/db mice

    SciTech Connect

    Oh, Ki Sook; Kim, Mina; Lee, Jinmi; Kim, Min Jeong; Nam, Youn Shin; Ham, Jung Eun; Shin, Soon Shik; Lee, Chung Moo . E-mail: Chung@sookmyung.ac.kr; Yoon, Michung . E-mail: yoon60@mokwon.ac.kr

    2006-07-07

    Swim training for 6 weeks significantly decreased body weight gain, adipose tissue mass, and adipocyte size in both sexes of genetically obese db/db mice compared with their respective sedentary controls. Swim training also caused significant decreases in serum levels of free fatty acids, triglycerides, and total cholesterol in both sexes of obese mice. Concomitantly, hepatic mRNA levels of peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) target enzymes responsible for mitochondrial and peroxisomal fatty acid {beta}-oxidation were significantly increased by swim training. Moreover, mRNA levels of uncoupling protein 2 (UCP2) in liver were also markedly increased by swim training. In conclusion, these results suggest that swim training-induced transcriptional activation of hepatic PPAR{alpha} target enzymes and UCP2 may effectively prevent body weight gain, adiposity, and lipid disorders caused by leptin receptor deficiency in both sexes of mice.

  10. Peroxisome proliferator-activated receptor alpha (PPARalpha) agonists down-regulate alpha2-macroglobulin expression by a PPARalpha-dependent mechanism.

    EPA Science Inventory

    Peroxisome proliferator-activated receptor alpha (PPARα) regulates transcription of genes involved both in lipid and glucose metabolism as well as inflammation. Fibrates are PPARα ligands used to normalize lipid and glucose parameters and exert anti-inflammatory effects. Fibrates...

  11. PPAR{alpha} deficiency augments a ketogenic diet-induced circadian PAI-1 expression possibly through PPAR{gamma} activation in the liver

    SciTech Connect

    Oishi, Katsutaka; Uchida, Daisuke; Ohkura, Naoki; Horie, Shuichi

    2010-10-15

    Research highlights: {yields} PPAR{alpha} deficiency augments a ketogenic diet-induced circadian PAI-1 expression. {yields} Hepatic expressions of PPAR{gamma} and PCG-1{alpha} are induced by a ketogenic diet. {yields} PPAR{gamma} antagonist attenuates a ketogenic diet-induced PAI-1 expression. {yields} Ketogenic diet advances the phase of circadian clock in a PPAR{alpha}-independent manner. -- Abstract: An increased level of plasminogen activator inhibitor-1 (PAI-1) is considered a risk factor for cardiovascular diseases, and PAI-1 gene expression is under the control of molecular circadian clocks in mammals. We recently showed that PAI-1 expression is augmented in a phase-advanced circadian manner in mice fed with a ketogenic diet (KD). To determine whether peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) is involved in hypofibrinolytic status induced by a KD, we examined the expression profiles of PAI-1 and circadian clock genes in PPAR{alpha}-null KD mice. Chronic administration of bezafibrate induced the PAI-1 gene expression in a PPAR{alpha}-dependent manner. Feeding with a KD augmented the circadian expression of PAI-1 mRNA in the hearts and livers of wild-type (WT) mice as previously described. The KD-induced mRNA expression of typical PPAR{alpha} target genes such as Cyp4A10 and FGF21 was damped in PPAR{alpha}-null mice. However, plasma PAI-1 concentrations were significantly more elevated in PPAR{alpha}-null KD mice in accordance with hepatic mRNA levels. These observations suggest that PPAR{alpha} activation is dispensable for KD-induced PAI-1 expression. We also found that hyperlipidemia, fatty liver, and the hepatic expressions of PPAR{gamma} and its coactivator PCG-1{alpha} were more effectively induced in PPAR{alpha}-null, than in WT mice on a KD. Furthermore, KD-induced hepatic PAI-1 expression was significantly suppressed by supplementation with bisphenol A diglycidyl ether, a PPAR{gamma} antagonist, in both WT and PPAR{alpha

  12. The effects of Musk T on peroxisome proliferator-activated receptor [PPAR]-alpha activation, epidermal skin homeostasis and dermal hyaluronic acid synthesis.

    PubMed

    Kim, Seung Hun; Nam, Gae Won; Lee, Hae Kwang; Moon, Seong Joon; Chang, Ih Seop

    2006-11-01

    Peroxisome proliferators activated receptors (PPARs) are a family of nuclear hormone receptors that heterodimer with the retinoid X receptor and function as transcriptional regulators of genes. Topically Applied PPAR-alpha agonists possess receptor mediated, pro-differentiating/anti-proliferative effects, lipid metabolism stimulation, and anti-inflammatory activity, which suggest that they could be beneficial for the treatment of a variety of cutaneous diseases. Hyaluronan (HA), a high-molecular-weight linear glycosaminoglycan consisting of alternating D: -glucuronic acid and N-acetyl-D: -glucosamine residues, is one of the major extracellular matrix components in skin. Among the family of HA synthase genes (HAS1, 2, 3) so far identified, one group has demonstrated that the expressions of HAS2 and HAS3 play crucial roles in the regulation of HA synthesis in human skin fibroblasts and keratinocytes, respectively, but the precise regulatory mechanisms are still unknown. We examine Musk T called Ethylene brassylate, Astratone or 1,4-Dioxacycloheptadecane-5,17-dione, which used as just a perfume ingredient, plays a role as PPAR-alpha ligand in vitro and stimulates skin barrier recovery, ceramide synthesis, beta-Glucocerebrosidase, involucrin expression in epidermis in vivo; and examine that Musk T stimulates HAS expression and HA synthesis in human skin fibroblast. Through these experiments, we conclude that Musk T is PPAR-alpha ligand, effects on keratinocyte differentiation, intercellular lipid synthesis in epidermis, HA synthesis stimulation in dermis.

  13. Peroxisome proliferator-activated receptor alpha (PPARalpha)-mediated regulation of multidrug resistance 2 (Mdr2) expression and function in mice.

    PubMed Central

    Kok, Tineke; Bloks, Vincent W; Wolters, Henk; Havinga, Rick; Jansen, Peter L M; Staels, Bart; Kuipers, Folkert

    2003-01-01

    Peroxisome proliferator-activated receptor alpha (PPARalpha) is a nuclear receptor that controls expression of genes involved in lipid metabolism and is activated by fatty acids and hypolipidaemic fibrates. Fibrates induce the hepatic expression of murine multidrug resistance 2 ( Mdr2 ), encoding the canalicular phospholipid translocator. The physiological role of PPARalpha in regulation of Mdr2 and other genes involved in bile formation is unknown. We found no differences in hepatic expression of the ATP binding cassette transporter genes Mdr2, Bsep (bile salt export pump), Mdr1a / 1b, Abca1 and Abcg5 / Abcg8 (implicated in cholesterol transport), the bile salt-uptake systems Ntcp (Na(+)-taurocholate co-transporting polypeptide gene) and Oatp1 (organic anion-transporting polypeptide 1 gene) or in bile formation between wild-type and Ppar alpha((-/-)) mice. Upon treatment of wild-type mice with ciprofibrate (0.05%, w/w, in diet for 2 weeks), the expression of Mdr2 (+3-fold), Mdr1a (+6-fold) and Mdr1b (+11-fold) mRNAs was clearly induced, while that of Oatp1 (-5-fold) was reduced. Mdr2 protein levels were increased, whereas Bsep, Ntcp and Oatp1 were drastically decreased. Exposure of cultured wild-type mouse hepatocytes to PPARalpha agonists specifically induced Mdr2 mRNA levels and did not affect expression of Mdr1a / 1b. Altered transporter expression in fibrate-treated wild-type mice was associated with a approximately 400% increase in bile flow: secretion of phospholipids and cholesterol was increased only during high-bile-salt infusions. No fibrate effects were observed in Ppar alpha((-/-)) mice. In conclusion, our results show that basal bile formation is not affected by PPARalpha deficiency in mice. The induction of Mdr2 mRNA and Mdr2 protein levels by fibrates is mediated by PPARalpha, while the induction of Mdr1a / 1b in vivo probably reflects a secondary phenomenon related to chronic PPARalpha activation. PMID:12381268

  14. Gypenoside XLIX, a naturally occurring gynosaponin, PPAR-alpha dependently inhibits LPS-induced tissue factor expression and activity in human THP-1 monocytic cells

    SciTech Connect

    Huang, Tom Hsun-Wei; Van Hoan Tran; Roufogalis, Basil D.; Li Yuhao . E-mail: yuhao@pharm.usyd.edu.au

    2007-01-01

    Tissue factor (TF) is involved not only in the progression of atherosclerosis and other cardiovascular diseases, but is also associated with tumor growth, metastasis, and angiogenesis and hence may be an attractive target for directed cancer therapeutics. Gynostemma pentaphyllum (GP) is widely used in the treatment of various cardiovascular diseases including atherosclerosis, as well as cancers. Gypenoside (Gyp) XLIX, a dammarane-type glycoside, is one of the prominent components in GP. We have recently reported Gyp XLIX to be a potent peroxisome proliferator-activated receptor (PPAR)-alpha activator. Here we demonstrate that Gyp XLIX (0-300 {mu}M) concentration dependently inhibited TF promoter activity after induction by the inflammatory stimulus lipopolysaccharide (LPS) in human monocytic THP-1 cells transfected with promoter reporter constructs pTF-LUC. Furthermore, Gyp XLIX inhibited LPS-induced TF mRNA and protein overexpression in THP-1 monocyte cells. Its inhibition of LPS-induced TF hyperactivity was further confirmed by chromogenic enzyme activity assay. The activities of Gyp XLIX reported in this study were similar to those of Wy-14643, a potent synthetic PPAR-alpha activator. Furthermore, the Gyp XLIX-induced inhibitory effect on TF luciferase activity was completely abolished in the presence of the PPAR-alpha selective antagonist MK-886. The present findings suggest that Gyp XLIX inhibits LPS-induced TF overexpression and enhancement of its activity in human THP-1 monocytic cells via PPAR-alpha-dependent pathways. The data provide new insights into the basis of the use of the traditional Chinese herbal medicine G. pentaphyllum for the treatment of cardiovascular and inflammatory diseases, as well as cancers.

  15. The dominant negative thyroid hormone receptor beta-mutant delta337T alters PPAR-alpha signaling in heart

    Technology Transfer Automated Retrieval System (TEKTRAN)

    PPARalpha and TR independently regulate cardiac metabolism. Although ligands for both these receptors are currently under evaluation for treatment of congestive heart failure, their interactions or signaling cooperation have not been investigated in heart. We tested the hypothesis that cardiac TRs i...

  16. Transgenic expression of proximal tubule peroxisome proliferator-activated receptor-alpha in mice confers protection during acute kidney injury.

    PubMed

    Li, Shenyang; Nagothu, Kiran K; Desai, Varsha; Lee, Taewon; Branham, William; Moland, Carrie; Megyesi, Judit K; Crew, Mark D; Portilla, Didier

    2009-11-01

    Our previous studies suggest that peroxisome proliferator-activated receptor-alpha (PPARalpha) plays a critical role in regulating fatty acid beta-oxidation in kidney tissue and this directly correlated with preservation of kidney morphology and function during acute kidney injury. To further study this, we generated transgenic mice expressing PPARalpha in the proximal tubule under the control of the promoter of KAP2 (kidney androgen-regulated protein 2). Segment-specific upregulation of PPARalpha expression by testosterone treatment of female transgenic mice improved kidney function during cisplatin or ischemia-reperfusion-induced acute kidney injury. Ischemia-reperfusion injury or treatment with cisplatin in wild-type mice caused inhibition of fatty-acid oxidation, reduction of mitochondrial genes of oxidative phosphorylation, mitochondrial DNA, fatty-acid metabolism, and the tricarboxylic acid cycle. Similar injury in testosterone-treated transgenic mice resulted in amelioration of these effects. Similarly, there were increases in the levels of 4-hydroxy-2-hexenal-derived lipid peroxidation products in wild-type mice, which were also reduced in the transgenic mice. Similarly, necrosis of the S3 segment was reduced in the two injury models in transgenic mice compared to wild type. Our results suggest proximal tubule PPARalpha activity serves as a metabolic sensor. Its increased expression without the use of an exogenous PPARalpha ligand in the transgenic mice is sufficient to protect kidney function and morphology, and to prevent abnormalities in lipid metabolism associated with acute kidney injury.

  17. Time course investigation of PPAR{alpha}- and Kupffer cell-dependent effects of WY-14,643 in mouse liver using microarray gene expression

    SciTech Connect

    Woods, Courtney G.; Kosyk, Oksana; Bradford, Blair U.; Ross, Pamela K.; Burns, Amanda M.; Cunningham, Michael L.; Qu Pingping; Ibrahim, Joseph G.; Rusyn, Ivan

    2007-12-15

    Administration of peroxisome proliferators to rodents causes proliferation of peroxisomes, induction of {beta}-oxidation enzymes, hepatocellular hypertrophy and hyperplasia, with chronic exposure ultimately leading to hepatocellular carcinomas. Many responses associated with peroxisome proliferators are nuclear receptor-mediated events involving peroxisome proliferators-activated receptor alpha (PPAR{alpha}). A role for nuclear receptor-independent events has also been shown, with evidence of Kupffer cell-mediated free radical production, presumably through NAPDH oxidase, induction of redox-sensitive transcription factors involved in cytokine production and cytokine-mediated cell replication following acute treatment with peroxisome proliferators in rodents. Recent studies have demonstrated, by using p47{sup phox}-null mice which are deficient in NADPH oxidase, that this enzyme is not related to the phenotypic events caused by prolonged administration of peroxisome proliferators. In an effort to determine the timing of the transition from Kupffer cell-to PPAR{alpha}-dependent modulation of peroxisome proliferator effects, gene expression was assessed in liver from Ppar{alpha}-null, p47{sup phox}-null and corresponding wild-type mice following treatment with 4-chloro-6-(2,3-xylidino)-pyrimidynylthioacetic acid (WY-14,643) for 8 h, 24 h, 72 h, 1 week or 4 weeks. WY-14,643-induced gene expression in p47{sup phox}-null mouse liver differed substantially from wild-type mice at acute doses and striking differences in baseline expression of immune related genes were evident. Pathway mapping of genes that respond to WY-14,643 in a time- and dose-dependent manner demonstrates suppression of immune response, cell death and signal transduction and promotion of lipid metabolism, cell cycle and DNA repair. Furthermore, these pathways were largely dependent on PPAR{alpha}, not NADPH oxidase demonstrating a temporal shift in response to peroxisome proliferators. Overall, this

  18. In vitro screening of 200 pesticides for agonistic activity via mouse peroxisome proliferator-activated receptor (PPAR){alpha} and PPAR{gamma} and quantitative analysis of in vivo induction pathway

    SciTech Connect

    Takeuchi, Shinji; Matsuda, Tadashi; Kobayashi, Satoshi; Takahashi, Tetsuo; Kojima, Hiroyuki . E-mail: kojima@iph.pref.hokkaido.jp

    2006-12-15

    Peroxisome proliferator-activated receptors (PPARs) are ligand-dependent transcription factors and key regulators of lipid metabolism and cell differentiation. However, there have been few studies reporting on a variety of environmental chemicals, which may interact with these receptors. In the present study, we characterized mouse PPAR{alpha} and PPAR{gamma} agonistic activities of 200 pesticides (29 organochlorines, 11 diphenyl ethers, 56 organophosphorus pesticides, 12 pyrethroids, 22 carbamates, 11 acid amides, 7 triazines, 8 ureas and 44 others) by in vitro reporter gene assays using CV-1 monkey kidney cells. Three of the 200 pesticides, diclofop-methyl, pyrethrins and imazalil, which have different chemical structures, showed PPAR{alpha}-mediated transcriptional activities in a dose-dependent manner. On the other hand, none of the 200 pesticides showed PPAR{gamma} agonistic activity at concentrations {<=} 10{sup -5} M. To investigate the in vivo effects of diclofop-methyl, pyrethrins and imazalil, we examined the gene expression of PPAR{alpha}-inducible cytochrome P450 4As (CYP4As) in the liver of female mice intraperitoneally injected with these compounds ({<=} 300 mg/kg). RT-PCR revealed significantly high induction levels of CYP4A10 and CYP4A14 mRNAs in diclofop-methyl- and pyrethrins-treated mice, whereas imazalil induced almost no gene expressions of CYP4As. In particular, diclofop-methyl induced as high levels of CYP4A mRNAs as WY-14643, a potent PPAR{alpha} agonist. Thus, most of the 200 pesticides tested do not activate PPAR{alpha} or PPAR{gamma} in in vitro assays, but only diclofop-methyl and pyrethrins induce PPAR{alpha} agonistic activity in vivo as well as in vitro.

  19. The role of PPARalpha in lipid metabolism and obesity: focusing on the effects of estrogen on PPARalpha actions.

    PubMed

    Yoon, Michung

    2009-09-01

    Peroxisome proliferator-activated receptor alpha (PPARalpha) is a ligand-activated transcription factor that belongs to the steroid hormone receptor superfamily. PPARalpha is expressed predominantly in tissues that have a high level of fatty acid catabolism, such as liver, heart, and muscle. PPARalpha regulates the expression of a number of genes critical for lipid and lipoprotein metabolism. PPARalpha ligand fibrates have been used for the treatment of dyslipidemia due to their ability to lower plasma triglyceride levels and elevate HDL cholesterol levels. PPARalpha activators have been shown to regulate obesity in rodents by both increasing hepatic fatty acid oxidation and decreasing the levels of circulating triglycerides responsible for adipose cell hypertrophy and hyperplasia. However, these effects of PPARalpha on obesity and lipid metabolism may be exerted with sexual dimorphism and seem to be influenced by estrogen. Estrogen inhibits the actions of PPARalpha on obesity and lipid metabolism through its effects on PPARalpha-dependent regulation of target genes. Thus, the use of fibrates seems to be effective in men and postmenopausal women with obesity and lipid disorders, but not in premenopausal women with functioning ovaries.

  20. Developmental toxicity and serum levels of perfluorononanoic acid in the wild-type and PPAR-alpha knockout mouse after gestational exposure

    EPA Science Inventory

    Perfluorononanoic acid (PFNA) is a perfluoroalkyl acid detected in.the environment and in tissues of humans and wildlife. PFNA activates peroxisome proliferator-activated receptor-alpha (PPARa) in vitro and negatively impacts development and survival of CD1 mice. Our objective wa...

  1. Role of PPARalpha in mediating the effects of phthalates and metabolites in the liver.

    PubMed

    Lapinskas, Paula J; Brown, Sherri; Leesnitzer, Lisa M; Blanchard, Steven; Swanson, Cyndi; Cattley, Russell C; Corton, J Christopher

    2005-02-01

    Phthalate esters belong to a large class of compounds known as peroxisome proliferators (PP). PP include chemicals that activate different subtypes of the peroxisome proliferator-activated receptor (PPAR) family. The ability of phthalate esters and their metabolites to activate responses through different PPAR subtypes is not fully characterized. We investigated the ability of two phthalate esters di-(2-ethylhexyl) phthalate (DEHP) and di-n-butyl phthalate (DBP) and selected metabolites to activate PPAR (alpha, beta/delta, gamma) using a transient transfection assay. The monoester of DEHP, mono-(2-ethylhexyl) phthalate (MEHP) activated all three subtypes of PPAR, but preferentially activated PPARalpha. A second metabolite of DEHP, 2-ethylhexanoic acid (2-EHXA) was a weaker activator of all three subtypes. DBP, but not the primary metabolite mono-n-butyl phthalate weakly activated all three PPAR subtypes. MEHP and DBP but not DEHP and MBP interacted directly with human PPARalpha and PPARgamma as determined by scintillation proximity assays. Both DEHP and DBP activated expression of PP-inducible gene products in wild-type but not PPARalpha-null mice suggesting that both of these phthalates exert their effects by activation of PPARalpha in vivo. The preferential activation of PPARalpha by phthalate ester metabolites suggests that these phthalates mediate their toxic effects in rodent liver in a manner indistinguishable from other PP.

  2. Molecular basis of non-responsiveness to peroxisome proliferators: the guinea-pig PPARalpha is functional and mediates peroxisome proliferator-induced hypolipidaemia.

    PubMed Central

    Bell, A R; Savory, R; Horley, N J; Choudhury, A I; Dickins, M; Gray, T J; Salter, A M; Bell, D R

    1998-01-01

    The guinea pig does not undergo peroxisome proliferation in response to peroxisome proliferators, in contrast with other rodents. To understand the molecular basis of this phenotype, the peroxisome proliferator activated receptor alpha (PPARalpha) from guinea-pig liver was cloned; it encodes a protein of 467 amino acid residues that is similar to rodent and human PPARalpha. The guinea-pig PPARalpha showed a high substitution rate: maximum likelihood analysis was consistent with rodent monophyly, but could not exclude rodent polyphyly (P approximately 0.06). The guinea-pig PPARalpha cDNA was expressed in 293 cells and mediated the induction of the luciferase reporter gene by the peroxisome proliferator, Wy-14,643, dependent on the presence of a peroxisome proliferator response element. Moreover the PPARalpha RNA and protein were expressed in guinea-pig liver, although at lower levels than in a species which is responsive to peroxisome proliferators, the mouse. To determine whether the guinea-pig PPARalpha mediated any physiological effects, guinea pigs were exposed to two selective PPARalpha agonists, Wy-14, 643 and methylclofenapate; both compounds induced hypolipidaemia. Thus the guinea pig is a useful model for human responses to peroxisome proliferators. PMID:9620871

  3. Activation of PPARalpha inhibits IGF-I-mediated growth and survival responses in medulloblastoma cell lines.

    PubMed

    Urbanska, Katarzyna; Pannizzo, Paola; Grabacka, Maja; Croul, Sidney; Del Valle, Luis; Khalili, Kamel; Reiss, Krzysztof

    2008-09-01

    Recent studies suggest a potential role of lipid lowering drugs, fibrates and statins, in anticancer treatment. One candidate for tumor chemoprevention is fenofibrate, which is a potent agonist of peroxisome proliferator activated receptor alpha (PPARalpha). Our results demonstrate elevated expression of PPARalpha in the nuclei of neoplatic cells in 12 out of 13 cases of medulloblastoma, and of PPARgamma in six out of 13 cases. Further analysis demonstrated that aggressive mouse medulloblastoma cells, BsB8, express PPARalpha in the absence PPARgamma, and human medulloblastoma cells, D384 and Daoy, express both PPARalpha and PPARgamma. Mouse and human cells responded to fenofibrate by a significant increase of PPAR-mediated transcriptional activity, and by a gradual accumulation of cells in G1 and G2/M phase of the cell cycle, leading to the inhibition of cell proliferation and elevated apoptosis. Preincubation of BsB8 cells with fenofibrate attenuated IGF-I-induced IRS-1, Akt, ERKs and GSK3beta phosphorylation, and inhibited clonogenic growth. In Daoy and D384 cells, fenofibrate also inhibited IGF-I-mediated growth responses, and simultaneous delivery of fenofibrate with low dose of the IGF-IR inhibitor, NVP-AEW541, completely abolished their clonogenic growth and survival. These results indicate a strong supportive role of fenofibrate in chemoprevention against IGF-I-induced growth responses in medulloblastoma.

  4. Activation of peroxisome proliferator-activated receptor-{alpha} enhances fatty acid oxidation in human adipocytes

    SciTech Connect

    Lee, Joo-Young; Hashizaki, Hikari; Goto, Tsuyoshi; Sakamoto, Tomoya; Takahashi, Nobuyuki; Kawada, Teruo

    2011-04-22

    Highlights: {yields} PPAR{alpha} activation increased mRNA expression levels of adipocyte differentiation marker genes and GPDH activity in human adipocytes. {yields} PPAR{alpha} activation also increased insulin-dependent glucose uptake in human adipocytes. {yields} PPAR{alpha} activation did not affect lipid accumulation in human adipocytes. {yields} PPAR{alpha} activation increased fatty acid oxidation through induction of fatty acid oxidation-related genes in human adipocytes. -- Abstract: Peroxisome proliferator-activated receptor-{alpha} (PPAR{alpha}) is a key regulator for maintaining whole-body energy balance. However, the physiological functions of PPAR{alpha} in adipocytes have been unclarified. We examined the functions of PPAR{alpha} using human multipotent adipose tissue-derived stem cells as a human adipocyte model. Activation of PPAR{alpha} by GW7647, a potent PPAR{alpha} agonist, increased the mRNA expression levels of adipocyte differentiation marker genes such as PPAR{gamma}, adipocyte-specific fatty acid-binding protein, and lipoprotein lipase and increased both GPDH activity and insulin-dependent glucose uptake level. The findings indicate that PPAR{alpha} activation stimulates adipocyte differentiation. However, lipid accumulation was not changed, which is usually observed when PPAR{gamma} is activated. On the other hand, PPAR{alpha} activation by GW7647 treatment induced the mRNA expression of fatty acid oxidation-related genes such as CPT-1B and AOX in a PPAR{alpha}-dependent manner. Moreover, PPAR{alpha} activation increased the production of CO{sub 2} and acid soluble metabolites, which are products of fatty acid oxidation, and increased oxygen consumption rate in human adipocytes. The data indicate that activation of PPAR{alpha} stimulates both adipocyte differentiation and fatty acid oxidation in human adipocytes, suggesting that PPAR{alpha} agonists could improve insulin resistance without lipid accumulation in adipocytes. The expected

  5. Iridoids from Fraxinus excelsior with adipocyte differentiation-inhibitory and PPARalpha activation activity.

    PubMed

    Bai, Naisheng; He, Kan; Ibarra, Alvin; Bily, Antoine; Roller, Marc; Chen, Xiaozhuo; Rühl, Ralph

    2010-01-01

    Two new secoiridoid glucosides, excelsides A (1) and B (2), were isolated from the seeds of Fraxinus excelsior. Their structures were elucidated as (2S,4S,3E)-methyl 3-ethylidene-4-(2-methoxy-2-oxoethyl)-2-[(6-O-beta-D-glucopyranosyl-beta-d-glucopyranosyl)oxy]-3,4-dihydro-2H-pyran-5-carboxylate and (2S,4S,3E)-methyl 3-ethylidene-4-{2-[2-(4-hydroxyphenyl)ethyl]oxy-2-oxoethyl}-2-[(6-O-beta-d-glucopyranosyl-beta-d-glucopyranosyl)oxy]-3,4-dihydro-2H-pyran-5-carboxylate, respectively, on the basis of NMR and MS data. Eight known compounds were identified as nuzhenide (3), GI3 (4), GI5 (5), ligstroside (6), oleoside 11-methyl ester (7), oleoside dimethyl ester (8), 1'''-O-beta-D-glucosylformoside (9), and salidroside (10). Compounds 1-9 inhibited adipocyte differentiation in 3T3-L1 cells. Dilutions of the aqueous extract of F. excelsior (1:10,000) as well as compounds 2, 3, 4, 5, and 8 activated the peroxisome proliferator-mediated receptor-alpha (PPARalpha) reporter cell system in the range of 10(-4) M, compared to 10(-7)-10(-8) M for the synthetic PPARalpha activator, WY14,643. Both biological activity profiles support the hypothesis that inhibition of adipocyte differentiation and PPARalpha-mediated mechanisms might be relevant pathways for the antidiabetic activity of F. excelsior extract.

  6. Reactivation of peroxisome proliferator-activated receptor alpha is associated with contractile dysfunction in hypertrophied rat heart.

    PubMed

    Young, M E; Laws, F A; Goodwin, G W; Taegtmeyer, H

    2001-11-30

    In pressure overload-induced hypertrophy, the heart increases its reliance on glucose as a fuel while decreasing fatty acid oxidation. A key regulator of this substrate switching in the hypertrophied heart is peroxisome proliferator-activated receptor alpha (PPARalpha). We tested the hypothesis that down-regulation of PPARalpha is an essential component of cardiac hypertrophy at the levels of increased mass, gene expression, and metabolism by pharmacologically reactivating PPARalpha. Pressure overload (induced by constriction of the ascending aorta for 7 days in rats) resulted in cardiac hypertrophy, increased expression of fetal genes (atrial natriuretic factor and skeletal alpha-actin), decreased expression of PPARalpha and PPARalpha-regulated genes (medium chain acyl-CoA dehydrogenase and pyruvate dehydrogenase kinase 4), and caused substrate switching (measured ex vivo in the isolated working heart preparation). Treatment of rats with the specific PPARalpha agonist WY-14,643 (8 days) did not affect the trophic response or atrial natriuretic factor induction to pressure overload. However, PPARalpha activation blocked skeletal alpha-actin induction, reversed the down-regulation of measured PPARalpha-regulated genes in the hypertrophied heart, and prevented substrate switching. This PPARalpha reactivation concomitantly resulted in severe depression of cardiac power and efficiency in the hypertrophied heart (measured ex vivo). Thus, PPARalpha down-regulation is essential for the maintenance of contractile function of the hypertrophied heart. PMID:11574533

  7. A High-Throughput Screen for Alpha Particle Radiation Protectants

    PubMed Central

    Seideman, Jonathan H.; Shum, David; Djaballah, Hakim

    2010-01-01

    Abstract Alpha-particle-emitting elements are of increasing importance as environmental and occupational carcinogens, toxic components of radiation dispersal devices and accidents, and potent therapeutics in oncology. Alpha particle radiation differs from radiations of lower linear energy transfer in that it predominantly damages DNA via direct action. Because of this, radical scavengers effective for other radiations have had only limited effect in mitigating alpha particle toxicity. We describe here a simple assay and a pilot screen of 3,119 compounds in a high-throughput screen (HTS), using the alpha-particle-emitting isotope, 225Ac, for the discovery of compounds that might protect mammalian cells from alpha particles through novel mechanisms. The assay, which monitored the viability of a myeloid leukemic cell line upon alpha particle exposure, was robust and reproducible, yielding a Z' factor of 0.66 and a signal-to-noise ratio of nearly 10 to 1. Surprisingly, 1 compound emerged from this screen, epoxy-4,5-α-dihydroxysantonin (EDHS), that showed considerable protective activity. While the value of EDHS remains to be determined, its discovery is a proof of concept and validation of the utility of this HTS methodology. Further application of the described assay could yield compounds useful in minimizing the toxicity and carcinogenesis associated with alpha particle exposure. PMID:20658946

  8. Effect of cold stress on expression of AMPKalpha-PPARalpha pathway and inflammation genes.

    PubMed

    Zhang, Zi-wei; Bi, Ming-yu; Yao, Hai-dong; Fu, Jing; Li, Shu; Xu, Shi-wen

    2014-09-01

    Animals are exposed to various environmental stresses every day, including the stress associated with living in cold temperatures. The aim of this study was to investigate the possible mechanisms of interaction between lipid metabolism and inflammation induced by cold stress in the livers of chickens. Fifteen-day-old male chicks were randomly allocated into 12 groups (10 chickens per group). After exposure of the chickens to the cold stress, cholesterol fractionation was used to examine high-density lipoprotein (HDL) and low-density lipoprotein (LDL) concentrations. Aminotransferase activities were examined with the use of the aspartate transaminase (AST) and alanine transaminase (ALT) assay. The AMP-activated protein kinase alpha-proliferator-activated receptor alpha (AMPKalpha-PPARalpha) pathway genes (AMPKalpha1, AMPKalpha2, PPARalpha, carnitine palmitoyltransferaseI [CPTI], acetyl-CoA carboxylase [ACC]) and inflammatory cytokines (prostaglandin E synthase [PGEs], inducible nitric oxide synthase [iNOS], heme oxygenase-1 [HO-1], nuclear factor kappa-light-chain-enhancer of activated B cells [NF-kappaB], cyclooxygenase-2 [COX-2], and TNF-alpha-like factor [LITAF]) were also measured. The results showed that during the response to cold stress, serum LDL and HDL cholesterol concentrations increased. Histopathologic analyses provided evidence that liver tissues were seriously injured in the chickens exposed to the cold stress. Serum aminotransferase activities were also increased in the group of animals exposed to the cold stress. Additionally, the expressions of AMPKalpha-PPARalpha pathway genes and inflammatory cytokine genes were significantly increased in the animals exposed to cold temperatures. These results suggested that increased inflammation was a feature associated with a lipid-metabolism disorder in the livers of chickens exposed to cold stress.

  9. The Effect of PPARalpha, PPARdelta, PPARgamma, and PPARpan Agonists on Body Weight, Body Mass, and Serum Lipid Profiles in Diet-Induced Obese AKR/J Mice.

    PubMed

    Harrington, W Wallace; S Britt, Christy; G Wilson, Joan; O Milliken, Naphtali; G Binz, Jane; C Lobe, David; R Oliver, William; C Lewis, Michael; M Ignar, Diane

    2007-01-01

    Activation of peroxisome proliferator-activated receptor (PPAR) alpha, delta, and gamma subtypes increases expression of genes involved in fatty acid transport and oxidation and alters adiposity in animal models of obesity and type-2 diabetes. PPARpan agonists which activate all three receptor subtypes have antidiabetic activity in animal models without the weight gain associated with selective PPARgamma agonists. Herein we report the effects of selective PPAR agonists (GW9578, a PPARalpha agonist, GW0742, a PPARdelta agonist, GW7845, a PPARgamma agonist), combination of PPARalpha and delta agonists, and PPARpan (PPARalpha/gamma/delta) activators (GW4148 or GW9135) on body weight (BW), body composition, food consumption, fatty acid oxidation, and serum chemistry of diet-induced obese AKR/J mice. PPARalpha or PPARdelta agonist treatment induced a slight decrease in fat mass (FM) while a PPARgamma agonist increased BW and FM commensurate with increased food consumption. The reduction in BW and food intake after cotreatment with PPARalpha and delta agonists appeared to be synergistic. GW4148, a PPARpan agonist, induced a significant and sustained reduction in BW and FM similar to an efficacious dose of rimonabant, an antiobesity compound. GW9135, a PPARpan agonist with weak activity at PPARdelta, induced weight loss initially followed by rebound weight gain reaching vehicle control levels by the end of the experiment. We conclude that PPARalpha and PPARdelta activations are critical to effective weight loss induction. These results suggest that the PPARpan compounds may be expected to maintain the beneficial insulin sensitization effects of a PPARgamma agonist while either maintaining weight or producing weight loss.

  10. The PPARalpha Agonist Fenofibrate Preserves Hippocampal Neurogenesis and Inhibits Microglial Activation After Whole-Brain Irradiation

    SciTech Connect

    Ramanan, Sriram; Kooshki, Mitra; Zhao Weiling; Hsu, F.-C.; Riddle, David R.; Robbins, Mike E.

    2009-11-01

    Purpose: Whole-brain irradiation (WBI) leads to cognitive impairment months to years after radiation. Numerous studies suggest that decreased hippocampal neurogenesis and microglial activation are involved in the pathogenesis of WBI-induced brain injury. The goal of this study was to investigate whether administration of the peroxisomal proliferator-activated receptor (PPAR) alpha agonist fenofibrate would prevent the detrimental effect of WBI on hippocampal neurogenesis. Methods and Materials: For this study, 129S1/SvImJ wild-type and PPARalpha knockout mice that were fed either regular or 0.2% wt/wt fenofibrate-containing chow received either sham irradiation or WBI (10-Gy single dose of {sup 137}Cs gamma-rays). Mice were injected intraperitoneally with bromodeoxyuridine to label the surviving cells at 1 month after WBI, and the newborn neurons were counted at 2 months after WBI by use of bromodeoxyuridine/neuronal nuclei double immunofluorescence. Proliferation in the subgranular zone and microglial activation were measured at 1 week and 2 months after WBI by use of Ki-67 and CD68 immunohistochemistry, respectively. Results: Whole-brain irradiation led to a significant decrease in the number of newborn hippocampal neurons 2 months after it was performed. Fenofibrate prevented this decrease by promoting the survival of newborn cells in the dentate gyrus. In addition, fenofibrate treatment was associated with decreased microglial activation in the dentate gyrus after WBI. The neuroprotective effects of fenofibrate were abolished in the knockout mice, indicating a PPARalpha-dependent mechanism or mechanisms. Conclusions: These data highlight a novel role for PPARalpha ligands in improving neurogenesis after WBI and offer the promise of improving the quality of life for brain cancer patients receiving radiotherapy.

  11. Differential modulation of PPARalpha and gamma target gene expression in the liver and kidney of rats treated with aspirin.

    PubMed

    Fidaleo, Marco; Berardi, Emanuele; Sartori, Claudia

    2008-04-01

    Aspirin modified peroxisomal enzymatic activities both in the liver and renal cortex of rats, producing typical effects of peroxisomal proliferators (PPs). Although similar increments in beta-oxidation system and catalase activities were observed in both organs, induction of mRNA-Cyp4a10 and mRNA-FAT/CD36, target genes for peroxisome proliferator-activated receptors alpha (PPARalpha) and gamma (PPARgamma), respectively, was only present in the liver. There was no effect on liver mRNA-PPARalpha, while mRNA-PPARgamma was down-regulated, probably as a result of enzymatic inhibition of cyclooxygenases (COXs) by aspirin which has been shown to decrease the levels of PGJ2 and its metabolites, known as strong endogenous ligands for PPARgamma. Typical PP alterations in cell replication and apoptosis were not found during aspirin treatment or after withdrawal, suggesting that peroxisome proliferation occurs without inducing cell cycle alterations. Probably, the synergic action of both PPARalpha and PPARgamma receptors might reduce the impact on cell proliferation and apoptosis. PMID:18222077

  12. Hepatic triacylglycerol hydrolysis regulates peroxisome proliferator-activated receptor alpha activity.

    PubMed

    Sapiro, Jessica M; Mashek, Mara T; Greenberg, Andrew S; Mashek, Douglas G

    2009-08-01

    Recent evidence suggests that fatty acids generated from intracellular triacylglycerol (TAG) hydrolysis may have important roles in intracellular signaling. This study was conducted to determine if fatty acids liberated from TAG hydrolysis regulate peroxisome proliferator-activated receptor alpha (PPARalpha). Primary rat hepatocyte cultures were treated with adenoviruses overexpressing adipose differentiation-related protein (ADRP) or adipose triacylglycerol lipase (ATGL) or treated with short interfering RNA (siRNA) targeted against ADRP. Subsequent effects on TAG metabolism and PPARalpha activity and target gene expression were determined. Overexpressing ADRP attenuated TAG hydrolysis, whereas siRNA-mediated knockdown of ADRP or ATGL overexpression resulted in enhanced TAG hydrolysis. Results from PPARalpha reporter activity assays demonstrated that decreasing TAG hydrolysis by ADRP overexpression resulted in a 35-60% reduction in reporter activity under basal conditions or in the presence of fatty acids. As expected, PPARalpha target genes were also decreased in response to ADRP overexpression. However, the PPARalpha ligand, WY-14643, was able to restore PPARalpha activity following ADRP overexpression. Despite its effects on PPARalpha, overexpressing ADRP did not affect PPARgamma activity. Enhancing TAG hydrolysis through ADRP knockdown or ATGL overexpression increased PPARalpha activity. These results indicate that TAG hydrolysis and the consequential release of fatty acids regulate PPARalpha activity.

  13. AZ 242, a novel PPARalpha/gamma agonist with beneficial effects on insulin resistance and carbohydrate and lipid metabolism in ob/ob mice and obese Zucker rats.

    PubMed

    Ljung, Bengt; Bamberg, Krister; Dahllöf, Björn; Kjellstedt, Ann; Oakes, Nicholas D; Ostling, Jörgen; Svensson, Lennart; Camejo, Germán

    2002-11-01

    Abnormalities in fatty acid (FA) metabolism underlie the development of insulin resistance and alterations in glucose metabolism, features characteristic of the metabolic syndrome and type 2 diabetes that can result in an increased risk of cardiovascular disease. We present pharmacodynamic effects of AZ 242, a novel peroxisome proliferator activated receptor (PPAR)alpha/gamma agonist. AZ 242 dose-dependently reduced the hypertriglyceridemia, hyperinsulinemia, and hyperglycemia of ob/ob diabetic mice. Euglycemic hyperinsulinemic clamp studies showed that treatment with AZ 242 (1 micromol/kg/d) restored insulin sensitivity of obese Zucker rats and decreased insulin secretion. In vitro, in reporter gene assays, AZ 242 activated human PPARalpha and PPARgamma with EC(50) in the micro molar range. It also induced differentiation in 3T3-L1 cells, an established PPARgamma effect, and caused up-regulation of liver fatty acid binding protein in HepG-2 cells, a PPARalpha-mediated effect. PPARalpha-mediated effects of AZ 242 in vivo were documented by induction of hepatic cytochrome P 450-4A in mice. The results indicate that the dual PPARalpha/gamma agonism of AZ 242 reduces insulin resistance and has beneficial effects on FA and glucose metabolism. This effect profile could provide a suitable therapeutic approach to the treatment of type 2 diabetes, metabolic syndrome, and associated vascular risk factors. PMID:12401884

  14. Peroxisome proliferator-activated receptor-alpha expression in rat liver during postnatal development.

    PubMed

    Panadero, M; Herrera, E; Bocos, C

    2000-08-01

    The expression of the peroxisome proliferator-activated receptor-alpha (PPARalpha) as well as of some related genes was studied in rat liver at different stages of development (from 19-day-old fetuses to 1 month-old rats). The level of PPARalpha mRNA appeared higher in neonates than in fetuses or 1 month-old rats. Whereas the pattern for phosphoenolpyruvate carboxykinase (PEPCK) mRNA level was similar to that of PPARalpha, the mRNA level of both acyl-CoA oxidase (ACO) and apolipoprotein CIII (apo CIII) showed diverse profiles. Western blotting analysis also revealed an increased level of PPARalpha protein in liver of suckling rats. Similarities of mRNA PEPCK and PPARalpha expression indicate a common control mechanism, where both nutritional and hormonal factors may be involved. PMID:11018288

  15. Cloning and characterization of murine 1-acyl-sn-glycerol 3-phosphate acyltransferases and their regulation by PPARalpha in murine heart.

    PubMed

    Lu, Biao; Jiang, Yan J; Zhou, Yaling; Xu, Fred Y; Hatch, Grant M; Choy, Patrick C

    2005-01-15

    AGPAT (1-acyl-sn-glycerol 3-phosphate acyltransferase) exists in at least five isoforms in humans, termed as AGPAT1, AGPAT2, AGPAT3, AGPAT4 and AGPAT5. Although they catalyse the same biochemical reaction, their relative function, tissue expression and regulation are poorly understood. Linkage studies in humans have revealed that AGPAT2 contributes to glycerolipid synthesis and plays an important role in regulating lipid metabolism. We report the molecular cloning, tissue distribution, and enzyme characterization of mAGPATs (murine AGPATs) and regulation of cardiac mAGPATs by PPARalpha (peroxisome-proliferator-activated receptor alpha). mAGPATs demonstrated differential tissue expression profiles: mAGPAT1 and mAGPAT3 were ubiquitously expressed in most tissues, whereas mAGPAT2, mAGPAT4 and mAGPAT5 were expressed in a tissue-specific manner. mAGPAT2 expressed in in vitro transcription and translation reactions and in transfected COS-1 cells exhibited specificity for 1-acyl-sn-glycerol 3-phosphate. When amino acid sequences of five mAGPATs were compared, three highly conserved motifs were identified, including one novel motif/pattern KX2LX6GX12R. Cardiac mAGPAT activities were 25% lower (P<0.05) in PPARalpha null mice compared with wild-type. In addition, cardiac mAGPAT activities were 50% lower (P<0.05) in PPARalpha null mice fed clofibrate compared with clofibrate fed wild-type animals. This modulation of AGPAT activity was accompanied by significant enhancement/reduction of the mRNA levels of mAGPAT3/mAGPAT2 respectively. Finally, mRNA expression of cardiac mAGPAT3 appeared to be regulated by PPARalpha activation. We conclude that cardiac mAGPAT activity may be regulated by both the composition of mAGPAT isoforms and the levels of each isoform. PMID:15367102

  16. Analysis of the Heat Shock Response in Mouse Liver Reveals Transcriptional Dependence on the Nuclear Receptor Peroxisome Proliferator-Activated Receptor alpha (PPARα)

    EPA Science Inventory

    BACKGROUND: The nuclear receptor peroxisome proliferator-activated receptor alpha (PPARalpha) regulates responses to chemical or physical stress in part by altering expression of genes involved in proteome maintenance. Many of these genes are also transcriptionally regulated by h...

  17. Protective effect of alpha-mangostin against oxidative stress induced-retinal cell death

    PubMed Central

    Fang, Yuan; Su, Tu; Qiu, Xiaorong; Mao, Pingan; Xu, Yidan; Hu, Zizhong; Zhang, Yi; Zheng, Xinhua; Xie, Ping; Liu, Qinghuai

    2016-01-01

    It is known that oxidative stress plays a pivotal role in age-related macular degeneration (AMD) pathogenesis. Alpha-mangostin is the main xanthone purified from mangosteen known as anti-oxidative properties. The aim of the study was to test the protective effect of alpha-mangostin against oxidative stress both in retina of light-damaged mice model and in hydrogen peroxide (H2O2)-stressed RPE cells. We observed that alpha-mangostin significantly inhibited light-induced degeneration of photoreceptors and 200 μM H2O2-induced apoptosis of RPE cells. 200 μM H2O2-induced generation of reactive oxygen species (ROS) and light-induced generation of malondialdehyde (MDA) were suppressed by alpha-mangostin. Alpha-mangostin stimulation resulted in an increase of superoxide dismutase (SOD) activity, glutathione peroxidase (GPX) activity and glutathione (GSH) content both in vivo and vitro. Furthermore, the mechanism of retinal protection against oxidative stress by alpha-mangostin involves accumulation and the nuclear translocation of the NF-E2-related factor (Nrf2) along with up-regulation the expression of heme oxygenas-1 (HO-1). Meanwhile, alpha-mangostin can activate the expression of PKC-δ and down-regulate the expression of mitogen-activated protein kinases (MAPKs), including ERK1/2, JNK, P38. The results suggest that alpha-mangostin could be a new approach to suspend the onset and development of AMD. PMID:26888416

  18. Peroxisome proliferator-activated receptor {alpha}-independent peroxisome proliferation

    SciTech Connect

    Zhang Xiuguo; Tanaka, Naoki . E-mail: naopi@hsp.md.shinshu-u.ac.jp; Nakajima, Takero; Kamijo, Yuji; Gonzalez, Frank J.; Aoyama, Toshifumi

    2006-08-11

    Hepatic peroxisome proliferation, increases in the numerical and volume density of peroxisomes, is believed to be closely related to peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) activation; however, it remains unknown whether peroxisome proliferation depends absolutely on this activation. To verify occurrence of PPAR{alpha}-independent peroxisome proliferation, fenofibrate treatment was used, which was expected to significantly enhance PPAR{alpha} dependence in the assay system. Surprisingly, a novel type of PPAR{alpha}-independent peroxisome proliferation and enlargement was uncovered in PPAR{alpha}-null mice. The increased expression of dynamin-like protein 1, but not peroxisome biogenesis factor 11{alpha}, might be associated with the PPAR{alpha}-independent peroxisome proliferation at least in part.

  19. Interferon-γ Protects from Staphylococcal Alpha Toxin-Induced Keratinocyte Death through Apolipoprotein L1.

    PubMed

    Brauweiler, Anne M; Goleva, Elena; Leung, Donald Y M

    2016-03-01

    Staphylococcus aureus is a bacterial pathogen that frequently infects the skin, causing lesions and cell destruction through its primary virulence factor, alpha toxin. Here we show that interferon gamma (IFN-?) protects human keratinocytes from cell death induced by staphylococcal alpha toxin. We find that IFN-? prevents alpha toxin binding and reduces expression of the alpha toxin receptor, a disintegrin and metalloproteinase 10 (ADAM10). We determine that the mechanism for IFN-?-mediated resistance to alpha toxin involves the induction of autophagy, a process of cellular adaptation to sublethal damage. We find that IFN-? potently stimulates activation of the primary autophagy effector, light chain 3 (LC3). This process is dependent on upregulation of apolipoprotein L1. Depletion of apolipoprotein L1 by small interfering RNA significantly increases alpha toxin-induced lethality and inhibits activation of light chain 3. We conclude that IFN-? plays a significant role in protecting human keratinocytes from the lethal effects of staphylococcal alpha toxin through apolipoprotein L1-induced autophagy.

  20. Tumor necrosis factor alpha has a protective role in a murine model of systemic candidiasis.

    PubMed Central

    Louie, A; Baltch, A L; Smith, R P; Franke, M A; Ritz, W J; Singh, J K; Gordon, M A

    1994-01-01

    The role of tumor necrosis factor alpha (TNF-alpha) in host defense against systemic Candida albicans infection was evaluated in a murine model of systemic candidiasis in which uniform death occurred between 5 and 6 days after infection. TNF-alpha was first detected at 16 h postinfection and progressively increased thereafter. Peak levels (700 to 900 pg/ml) were measured in mice near death. Administration of 0.5 to 1.0 mg of polyclonal immunoglobulin G (IgG) TNF-alpha antibody (TNF-alpha Ab) to mice 2 h preinfection neutralized serum TNF-alpha for up to 30 h. However, this regimen shortened survival from a mean of 5.5 days for IgG controls to 3.4 days (P = 1.9 x 10(-12)). Semiquantitative cultures of spleen, lung, liver, and kidney conducted at 1, 2, and 3 days postinfection found colony counts of spleen and kidney to be significantly higher for TNF-alpha Ab recipients but only for the first 48 h. Administration of 1.5 and 1.0 mg of TNF-alpha Ab at 2 h before and 48 h after fungal injection, respectively, shortened the mean survival from 4.9 to 2.3 days (P = 5.2 x 10(-8)). This regimen neutralized serum TNF-alpha throughout infection. With this regimen, colony counts of all organs were significantly higher in TNF-alpha Ab recipients at 1, 2, and 3 days postinfection. Histopathologic studies showed an increase in the number and size of C. albicans foci in tissues. Peripheral leukocyte counts and inflammatory response in tissue were similar for TNF-alpha Ab and IgG sham recipients. In vitro, incubation of C. albicans with four to eight times the peak serum levels of TNF-alpha for up to 24 h did not inhibit the rate of germ tube or pseudohypha formation. Thus, TNF-alpha that was produced during infection with C. albicans augmented host resistance against this organism and prolonged survival. The protective effect of TNF-alpha was not mediated by increased leukocytes in blood or tissues nor by a direct anticandidal effect of TNF-alpha. This study suggests that the

  1. Effect of pH on subunit association and heat protection of soybean alpha-galactosidase

    NASA Technical Reports Server (NTRS)

    Porter, J. E.; Sarikaya, A.; Herrmann, K. M.; Ladisch, M. R.; Mitchell, C. A. (Principal Investigator)

    1992-01-01

    Soybeans contain the enzyme alpha-galactosidase, which hydrolyzes alpha-1, 6 linkages in stachyose and raffinose to give sucrose and galactose. We have found that galactose, a competitive product inhibitor of alpha-galactosidase, strongly promotes the heat stability of the tetrameric form of the enzyme at pH 4.0 and at temperatures of up to 70 degrees C for 60 min. Stachyose and raffinose also protect alpha-galactosidase from denaturation at pH 4.0 although to a lesser extent. Glucose and mannose have little effect. At pH 7.0 the enzyme is a monomer, and galactose has no effect on the heat stability of the enzyme. In the absence of heat protection of the enzyme by added sugars, a series deactivation mechanism was found to describe the deactivation data. In comparison, a unimolecular, non-first order deactivation model applies at pH 4.0, where heat protection effects were observed. At a temperature above 60 degrees C, simple deactivation is a suitable model. The results suggest that alpha-galactosidase conformation and heat stability are directly related.

  2. Peroxisome proliferator-activated receptor {alpha} agonist-induced down-regulation of hepatic glucocorticoid receptor expression in SD rats

    SciTech Connect

    Chen Xiang; Li Ming; Sun Weiping; Bi Yan; Cai Mengyin; Liang Hua; Yu Qiuqiong; He Xiaoying; Weng Jianping

    2008-04-18

    It was reported that glucocorticoid production was inhibited by fenofibrate through suppression of type-1 11{beta}-hydroxysteroid dehydrogenase gene expression in liver. The inhibition might be a negative-feedback regulation of glucocorticoid receptor (GR) activity by peroxisome proliferator-activated receptor alpha (PPAR{alpha}), which is quickly induced by glucocorticoid in the liver. However, it is not clear if GR expression is changed by fenofibrate-induced PPAR{alpha} activation. In this study, we tested this possibility in the liver of Sprague-Dawley rats. GR expression was reduced by fenofibrate in a time- and does-dependent manner. The inhibition was observed in liver, but not in fat and muscle. The corticosterone level in the blood was increased significantly by fenofibrate. These effects of fenofibrate were abolished by PPAR{alpha} inhibitor MK886, suggesting that fenofibrate activated through PPAR{alpha}. In conclusion, inhibition of GR expression may represent a new molecular mechanism for the negative feedback regulation of GR activity by PPAR{alpha}.

  3. Passive immunization with antiserum to a nontoxic alpha-toxin mutant from Staphylococcus aureus is protective in a murine model.

    PubMed Central

    Menzies, B E; Kernodle, D S

    1996-01-01

    A nonhemolytic, nonlethal variant of Staphylococcus aureus alpha-toxin constructed via oligonucleotide-directed mutagenesis and containing a single amino acid substitution (H-35 to L) was used to immunize a rabbit. The resulting antiserum was cross-reactive with wild-type alpha-toxin and neutralized its hemolytic activity in vitro. Passive immunization of mice with rabbit antiserum conferred protection against lethal challenge with wild-type alpha-toxin and against acute lethal challenge with a high-alpha-toxin -producing S. aureus strain. H35L alpha-toxin may be useful as a protective immunogen in S. aureus vaccine studies. PMID:8613399

  4. Tumour necrosis factor (TNF alpha) in leishmaniasis. I. TNF alpha mediates host protection against cutaneous leishmaniasis.

    PubMed Central

    Liew, F Y; Parkinson, C; Millott, S; Severn, A; Carrier, M

    1990-01-01

    Genetically resistant CBA mice developed significantly larger lesions to Leishmania major infection when they were injected with rabbit anti-tumour necrosis factor (TNF)-specific antibodies compared to control mice injected with normal rabbit immunoglobulin. BALB/c mice recovered from a previous infection following prophylactic sublethal irradiation also developed exacerbated lesions when treated with the anti-TNF antibody. Injection of TNF into the lesion of infected CBA mice significantly reduced the lesion development. Furthermore, TNF activates macrophages to kill Leishmania in vitro. These data demonstrate that TNF plays an important role in mediating host-protection against cutaneous leishmaniasis. PMID:2335376

  5. Catalposide is a natural agonistic ligand of peroxisome proliferator-activated receptor-{alpha}

    SciTech Connect

    Lee, Ji Hae; Jun, Hee-jin; Hoang, Minh-Hien; Jia, Yaoyao; Han, Xiang Hua; Lee, Dong-Ho; Lee, Hak-Ju; Hwang, Bang Yeon; Lee, Sung-Joon

    2012-06-15

    Highlights: Black-Right-Pointing-Pointer Catalposide is a novel ligand for PPAR{alpha}. Black-Right-Pointing-Pointer Cell stimulated with catalposide improved fatty acid uptake, regulated target genes in fatty acid {beta}-oxidation and synthesis. Black-Right-Pointing-Pointer Catalposdie reduces hepatic triacylglycerides. Black-Right-Pointing-Pointer Theses demonstrate catalposide could ameliorate hyperlipidemia and hepatic steatosis. -- Abstract: Peroxisome proliferator-activated receptor-alpha (PPAR{alpha}) is a nuclear receptor that regulates the expression of genes related to cellular lipid uptake and oxidation. Thus, PPAR{alpha} agonists may be important in the treatment of hypertriglyceridemia and hepatic steatosis. In this study, we demonstrated that catalposide is a novel natural PPAR{alpha} agonist, identified from reporter gene assay-based activity screening with approximately 900 natural plant and seaweed extracts. Results of time-resolved fluorescence resonance energy transfer analyses suggested that the compound interacted directly with the ligand-binding domain of PPAR{alpha}. Cultured hepatocytes stimulated with catalposide exhibited significantly reduced cellular triglyceride concentrations, by 21%, while cellular uptake of fatty acids was increased, by 70% (P < 0.05). Quantitative PCR analysis revealed that the increase in cellular fatty acid uptake was due to upregulation of fatty acid transporter protein-4 (+19% vs. the control) in cells stimulated with catalposide. Additionally, expression of genes related to fatty acid oxidation and high-density lipoprotein metabolism were upregulated, while that of genes related to fatty acid synthesis were suppressed. In conclusion, catalposide is hypolipidemic by activation of PPAR{alpha} via a ligand-mediated mechanism that modulates the expression of in lipid metabolism genes in hepatocytes.

  6. In vivo involvement of cytochrome P450 4A family in the oxidative metabolism of the lipid peroxidation product trans-4-hydroxy-2-nonenal, using PPARalpha-deficient mice.

    PubMed

    Guéraud, F; Alary, J; Costet, P; Debrauwer, L; Dolo, L; Pineau, T; Paris, A

    1999-01-01

    Trans-4-hydroxy-2-nonenal (HNE) is a potent cytotoxic and genotoxic compound originating from the peroxidation of n-6 polyunsaturated fatty acids. Its metabolism has been previously studied in the rat (Alary et al. 1995. Chem. Res. Toxicol., 8: 35-39). In addition to major urinary mercapturic derivatives, some polar urinary metabolites were isolated and could correspond to hydroxylated compounds. 4-Hydroxynonenoic acid (HNA), resulting from the oxidation of the HNE carbonyl group, is a medium chain fatty acid and its omega-hydroxylation might be hypothesized. Therefore, the involvement of the CYP 4A family isoenzymes in the metabolism of [3H]HNE has been investigated in vivo using inducer treatments (fibrates) in wild-type or in peroxisome proliferator-activated receptor alpha (PPARalpha)-deficient mice. In wild-type mice, but not in PPARalpha (-/-) mice, fibrate treatments resulted in an increase of two urinary metabolites characterized, after HPLC purifications and mass spectrometry analyses, as the omega-hydroxylated metabolite of HNA, i.e., 4,9-dihydroxy-2-nonenoic acid, and its oxidized form, 4-hydroxy-2-nonene-1,9-dicarboxylic acid. The formation of the latter is correlated accurately to laurate hydroxylase activity studied concurrently in microsomes prepared from the liver of these animals. Basal levels of these two metabolites were measured in urine of normal and PPARalpha-deficient mice. These results are in accord with an implication of the P450 4A family in the extended oxidative metabolism of 4-HNE.

  7. Transforming growth factor alpha protection against drug-induced injury to the rat gastric mucosa in vivo.

    PubMed Central

    Romano, M; Polk, W H; Awad, J A; Arteaga, C L; Nanney, L B; Wargovich, M J; Kraus, E R; Boland, C R; Coffey, R J

    1992-01-01

    This study was designed to determine whether transforming growth factor alpha (TGF alpha) protects rat gastric mucosa against ethanol- and aspirin-induced injury. Systemic administration of TGF alpha dose-dependently decreased 100% ethanol-induced gastric mucosal injury; a dose of 50 micrograms/kg delivered intraperitoneally 15 min before ethanol decreased macroscopic mucosal injury by > 90%. At the microscopic level, TGF alpha prevented deep gastric necrotic lesions and reduced disruption of surface epithelium. Pretreatment with orogastric TGF alpha (200 micrograms/kg) only partially (40%) decreased macroscopic ethanol damage. Intraperitoneal administration of TGF alpha at a dose of 10 micrograms/kg, which does not significantly inhibit gastric acid secretion, decreased aspirin-induced macroscopic damage by > 80%. TGF alpha protection does not seem to be mediated by prostaglandin, glutathione, or ornithine decarboxylase-related events, as evidenced by lack of influence of the inhibition of their production. Pretreatment with the sulfhydryl blocking agent N-ethylmaleimide partially abolished (40%) the protective effect of TGF alpha. In addition, systemic administration of TGF alpha resulted in a two-fold increase in tyrosine phosphorylation of phospholipase C-gamma 1 and in a time- and dose-dependent increase in levels of immunoreactive insoluble gastric mucin; these events occurred in a time frame consistent with their participation in the protective effect of TGF alpha. Images PMID:1281834

  8. Estrogen-related receptor {alpha} is essential for the expression of antioxidant protection genes and mitochondrial function

    SciTech Connect

    Rangwala, Shamina M. . E-mail: shamina.rangwala@novartis.com; Li, Xiaoyan; Lindsley, Loren; Wang, Xiaomei; Shaughnessy, Stacey; Daniels, Thomas G.; Szustakowski, Joseph; Nirmala, N.R.; Wu, Zhidan; Stevenson, Susan C.

    2007-05-25

    Estrogen-related receptor {alpha} (ERR{alpha}) is an important mediator of mitochondrial biogenesis and function. To investigate the transcriptional network controlling these phenomena, we investigated mitochondrial gene expression in embryonic fibroblasts isolated from ERR{alpha} null mice. Peroxisome proliferator-activated receptor {gamma} coactivator-1{alpha} (PGC-1{alpha}) stimulated mitochondrial gene expression program in control cells, but not in the ERR{alpha} null cells. Interestingly, the induction of levels of mitochondrial oxidative stress protection genes in response to increased PGC-1{alpha} levels was dependent on ERR{alpha}. Furthermore, we found that the PGC-1{alpha}-mediated induction of estrogen-related receptor {gamma} and nuclear respiratory factor 2 (NRF-2), was dependent on the presence of ERR{alpha}. Basal levels of NRF-2 were decreased in the absence of ERR{alpha}. The absence of ERR{alpha} resulted in a decrease in citrate synthase enzyme activity in response to PGC-1{alpha} overexpression. Our results indicate an essential role for ERR{alpha} as a key regulator of oxidative metabolism.

  9. Alpha-Helical Protein Networks Are Self-Protective and Flaw-Tolerant

    PubMed Central

    Ackbarow, Theodor; Sen, Dipanjan; Thaulow, Christian; Buehler, Markus J.

    2009-01-01

    Alpha-helix based protein networks as they appear in intermediate filaments in the cell’s cytoskeleton and the nuclear membrane robustly withstand large deformation of up to several hundred percent strain, despite the presence of structural imperfections or flaws. This performance is not achieved by most synthetic materials, which typically fail at much smaller deformation and show a great sensitivity to the existence of structural flaws. Here we report a series of molecular dynamics simulations with a simple coarse-grained multi-scale model of alpha-helical protein domains, explaining the structural and mechanistic basis for this observed behavior. We find that the characteristic properties of alpha-helix based protein networks are due to the particular nanomechanical properties of their protein constituents, enabling the formation of large dissipative yield regions around structural flaws, effectively protecting the protein network against catastrophic failure. We show that the key for these self protecting properties is a geometric transformation of the crack shape that significantly reduces the stress concentration at corners. Specifically, our analysis demonstrates that the failure strain of alpha-helix based protein networks is insensitive to the presence of structural flaws in the protein network, only marginally affecting their overall strength. Our findings may help to explain the ability of cells to undergo large deformation without catastrophic failure while providing significant mechanical resistance. PMID:19547709

  10. Alpha-helical protein networks are self-protective and flaw-tolerant.

    PubMed

    Ackbarow, Theodor; Sen, Dipanjan; Thaulow, Christian; Buehler, Markus J

    2009-06-23

    Alpha-helix based protein networks as they appear in intermediate filaments in the cell's cytoskeleton and the nuclear membrane robustly withstand large deformation of up to several hundred percent strain, despite the presence of structural imperfections or flaws. This performance is not achieved by most synthetic materials, which typically fail at much smaller deformation and show a great sensitivity to the existence of structural flaws. Here we report a series of molecular dynamics simulations with a simple coarse-grained multi-scale model of alpha-helical protein domains, explaining the structural and mechanistic basis for this observed behavior. We find that the characteristic properties of alpha-helix based protein networks are due to the particular nanomechanical properties of their protein constituents, enabling the formation of large dissipative yield regions around structural flaws, effectively protecting the protein network against catastrophic failure. We show that the key for these self protecting properties is a geometric transformation of the crack shape that significantly reduces the stress concentration at corners. Specifically, our analysis demonstrates that the failure strain of alpha-helix based protein networks is insensitive to the presence of structural flaws in the protein network, only marginally affecting their overall strength. Our findings may help to explain the ability of cells to undergo large deformation without catastrophic failure while providing significant mechanical resistance.

  11. Protective effect of alpha-tocopherol-6-O-phosphate against ultraviolet B-induced damage in cultured mouse skin.

    PubMed

    Nakayama, Satomi; Katoh, Eiko M; Tsuzuki, Toshi; Kobayashi, Shizuko

    2003-08-01

    The ability of the novel water-soluble provitamin E, alpha-tocopherol-6-O-phosphate, to protect against ultraviolet B-induced damage in cultured mouse skin was investigated and compared with the protectiveness of alpha-tocopherol acetate in cultured mouse skin. Pretreatment of skin with 0.5% (9.4 mM) alpha-tocopherol-6-O-phosphate in medium for 3 h significantly prevented such photodamage as sunburn cell formation, DNA degradation, and lipid peroxidation, which were induced in control cultured skin by a single dose of ultraviolet B irradiation at 0 to 40 kJ per m2 (290-380 nm, maximum 312 nm). This protection was greater than that seen with alpha-tocopherol acetate, the most common provitamin E that is used in commercial human skin care products. The concentration of alpha-tocopherol in cultured skin pretreated with 0.5% alpha-tocopherol-6-O-phosphate rose to approximately two to three times that found in the control skin and the reduction in cutaneous alpha-tocopherol that was induced by ultraviolet irradiation was significantly inhibited. In the group pretreated with 0.5% alpha-tocopherol acetate, however, conversion of alpha-tocopherol acetate to alpha-tocopherol was not observed, although the level of provitamin incorporated into the cultured skin was the same as that for alpha-tocopherol-6-O-phosphate. These findings indicated that the enhanced ability of alpha-tocopherol-6-O-phosphate to protect against ultraviolet B-induced skin damage compared with alpha-tocopherol acetate may have been due to alpha-tocopherol-6-O-phosphate's conversion to alpha-tocopherol. Moreover, following pretreatment with a 0.5% alpha-tocopherol-6-O-phosphate, alpha-tocopherol-6-O-phosphate was incorporated into the human skin in a three-dimensional model and 5% of the incorporated alpha-tocopherol-6-O-phosphate was converted to alpha-tocopherol. These results suggest that treatment with the novel provitamin E, alpha-tocopherol-6-O-phosphate may be useful in preventing ultraviolet

  12. Cervical mucins carry alpha(1,2)fucosylated glycans that partly protect from experimental vaginal candidiasis.

    PubMed

    Domino, Steven E; Hurd, Elizabeth A; Thomsson, Kristina A; Karnak, David M; Holmén Larsson, Jessica M; Thomsson, Elisabeth; Bäckström, Malin; Hansson, Gunnar C

    2009-12-01

    Cervical mucins are glycosylated proteins that form a protective cervical mucus. To understand the role of mucin glycans in Candida albicans infection, oligosaccharides from mouse cervical mucins were analyzed by liquid chromatography-mass spectrometry. Cervical mucins carry multiple alpha(1-2)fucosylated glycans, but alpha(1,2)fucosyltransferase Fut2-null mice are devoid of these epitopes. Epithelial cells in vaginal lavages from Fut2-null mice lacked Ulex europaeus agglutinin-1 (UEA-I) staining for alpha(1-2)fucosylated glycans. Hysterectomy to remove cervical mucus eliminated UEA-I and acid mucin staining in vaginal epithelial cells from wild type mice indicating the cervix as the source of UEA-I positive epithelial cells. To assess binding of alpha(1-2) fucosylated glycans on C. albicans infection, an in vitro adhesion assay was performed with vaginal epithelial cells from wild type and Fut2-null mice. Vaginal epithelial cells from Fut2-null mice were found to bind increased numbers of C. albicans compared to vaginal epithelial cells obtained from wild type mice. Hysterectomy lessened the difference between Fut2-null and wild type mice in binding of C. ablicans in vitro and susceptibility to experimental C. albicans vaginitis in vivo. We generated a recombinant fucosylated MUC1 glycanpolymer to test whether the relative protection of wild type mice compared to Fut2-null mice could be mimicked with exogenous mucin. While a small portion of the recombinant MUC1 epitopes displayed alpha(1-2)fucosylated glycans, the predominant epitopes were sialylated due to endogenous sialyltransferases in the cultured cells. Intravaginal instillation of recombinant MUC1 glycanpolymer partially reduced experimental yeast vaginitis suggesting that a large glycanpolymer, with different glycan epitopes, may affect fungal burden.

  13. The ability of lens alpha crystallin to protect against heat-induced aggregation is age-dependent

    NASA Technical Reports Server (NTRS)

    Horwitz, J.; Emmons, T.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    Alpha crystallin was prepared from newborn and aged bovine lenses. SDS-PAGE and tryptic peptide mapping demonstrated that both preparations contained only the alpha-A and alpha-B chains, with no significant contamination of other crystallins. Compared with alpha crystallin from the aged lens, alpha crystallin from the newborn lens was much more effective in the inhibition of beta L crystallin denaturation and precipitation induced in vitro by heat. Together, these results demonstrate that during the aging process, the alpha crystallins lose their ability to protect against protein denaturation, consistent with the hypothesis that the alpha crystallins play an important role in the maintenance of protein native structure in the intact lens.

  14. The C-terminal region of alpha-crystallin: involvement in protection against heat-induced denaturation

    NASA Technical Reports Server (NTRS)

    Takemoto, L.; Emmons, T.; Horwitz, J.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    Recent studies have demonstrated that the alpha-crystallins can protect other proteins against heat-induced denaturation and aggregation. To determine the possible involvement of the C-terminal region in this activity, the alpha-crystallins were subjected to limited tryptic digestion, and the amount of cleavage from the N-terminal and C-terminal regions of the alpha-A and alpha-B crystallin chains was assessed using antisera specific for these regions. Limited tryptic digestion resulted in cleavage only from the C-terminal region of alpha-A crystallin. This trypsin-treated alpha-A crystallin preparation showed a decreased ability to protect proteins from heat-induced aggregation using an in vitro assay. Together, these results demonstrate that the C-terminal region of alpha-A crystallin is important for its ability to protect against heat-induced aggregation, which is consistent with the hypothesis that post-translational changes that are known to occur at the C-terminal region may have significant effects on the ability of alpha-A crystallin to protect against protein denaturation in vivo.

  15. Erythropoietin protects myocardin-expressing cardiac stem cells against cytotoxicity of tumor necrosis factor-{alpha}

    SciTech Connect

    Madonna, Rosalinda; Shelat, Harnath; Xue, Qun; Willerson, James T.; De Caterina, Raffaele; Geng, Yong-Jian

    2009-10-15

    Cardiac stem cells are vulnerable to inflammation caused by infarction or ischemic injury. The growth factor, erythropoietin (Epo), ameliorates the inflammatory response of the myocardium to ischemic injury. This study was designed to assess the role of Epo in regulation of expression and activation of the cell death-associated intracellular signaling components in cardiac myoblasts stimulated with the proinflammatory cytokine tumor necrosis factor (TNF)-{alpha}. Cardiac myoblasts isolated from canine embryonic hearts characterized by expression of myocardin A, a promyogenic transcription factor for cardiovascular muscle development were pretreated with Epo and then exposed to TNF-{alpha}. Compared to untreated cells, the Epo-treated cardiac myoblasts exhibited better morphology and viability. Immunoblotting revealed lower levels of active caspase-3 and reductions in iNOS expression and NO production in Epo-treated cells. Furthermore, Epo pretreatment reduced nuclear translocation of NF-{kappa}B and inhibited phosphorylation of inhibitor of kappa B (I{kappa}B) in TNF-{alpha}-stimulated cardiac myoblasts. Thus, Epo protects cardiac myocyte progenitors or myoblasts against the cytotoxic effects of TNF-{alpha} by inhibiting NF-{kappa}B-mediated iNOS expression and NO production and by preventing caspase-3 activation.

  16. Alpha-methyl-homocysteine thiolactone protects lung of BALB/c mice irradiated with 6 Gy

    NASA Astrophysics Data System (ADS)

    Lubec, G.; Foltinova, J.; Leplawy, T.; Mallinger, R.; Tichatschek, E.; Getoff, N.

    1996-06-01

    The radiation protective activity of intraperitoneally administered alpha-methyl-homocysteine thiolactone (α-MHCTL; 100 mg/kg body weight) in female BALB/c mice and such treated with cysteine treated (100 mg/kg body weight), using unirradiated and placebo treated irradiated mice were tested as controls. 6 Gy whole body irradiated was applied and after a period of three weeks the animals were sacrificed and lungs were taken for morphometry and the determination of o-tyrosine. Septal areas were highest in the irradiated, placebo treated mice (68.67 + 9.82% septal area to total area)and lowest in the α-MHCTL treated irradiated mice (55.67 +11.29%), significant at the p < 0.05 level. Morphometric data were accompanied by highest levels of o-tyrosine, a reliable parameter for OH-attack, in the irradiated, placebo treated group with 1.87 + 0.40 μM/g lung tissue and 0.32 + 0.13 gmM/g lung tissue in the αMHCTL treated group; the statistical difference was significant. Significant radiation protection in the mammalian system at the morphological and biochemical level were found. The potent effect could be explained by the influence of alpha-alkylation in homocysteine thiolactone (HCTL) which renders amino acids unmetabolizeable, nontoxic, increases lipophilicity and therefore improving permeability through membranes. The present report confirms morphological data on the radiation protective activity of this interesting thiol compound.

  17. Coenzyme Q{sub 10} and alpha-tocopherol protect against amitriptyline toxicity

    SciTech Connect

    Cordero, Mario D.; Moreno-Fernandez, Ana Maria; Gomez-Skarmeta, Jose Luis; Miguel, Manuel de; Garrido-Maraver, Juan; Oropesa-Avila, Manuel; Rodriguez-Hernandez, Angeles; Navas, Placido; Sanchez-Alcazar, Jose Antonio

    2009-03-15

    Since amitriptyline is a very frequently prescribed antidepressant drug, it is not surprising that amitriptyline toxicity is relatively common. Amitriptyline toxic systemic effects include cardiovascular, autonomous nervous, and central nervous systems. To understand the mechanisms of amitriptyline toxicity we studied the cytotoxic effects of amitriptyline treatment on cultured primary human fibroblasts and zebrafish embryos, and the protective role of coenzyme Q{sub 10} and alpha-tocopherol, two membrane antioxidants. We found that amitriptyline treatment induced oxidative stress and mitochondrial dysfunction in primary human fibroblasts. Mitochondrial dysfunction in amitriptyline treatment was characterized by reduced expression levels of mitochondrial proteins and coenzyme Q{sub 10}, decreased NADH:cytochrome c reductase activity, and a drop in mitochondrial membrane potential. Moreover, and as a consequence of these toxic effects, amitriptyline treatment induced a significant increase in apoptotic cell death activating mitochondrial permeability transition. Coenzyme Q{sub 10} and alpha-tocopherol supplementation attenuated ROS production, lipid peroxidation, mitochondrial dysfunction, and cell death, suggesting that oxidative stress affecting cell membrane components is involved in amitriptyline cytotoxicity. Furthermore, amitriptyline-dependent toxicity and antioxidant protection were also evaluated in zebrafish embryos, a well established vertebrate model to study developmental toxicity. Amitriptyline significantly increased embryonic cell death and apoptosis rate, and both antioxidants provided a significant protection against amitriptyline embryotoxicity.

  18. In vitro protective effect of bacteria-derived bovine alpha interferon I1 against selected bovine viruses.

    PubMed

    Gillespie, J H; Robson, D S; Scott, F W; Schiff, E I

    1985-12-01

    We used bacteria-derived bovine alpha-interferon I1 (Bo IFN-alpha I1) to study its antiviral effect in a bovine turbinate cell line on bovine diarrhea virus, infectious bovine rhinotracheitis virus, parainfluenza 3 virus, and pseudorabies virus. We based our study upon replicate tests for each strain by using a block titration system with various concentrations of Bo IFN-alpha I1 against various concentrations of virus. The data were compiled in two-axis tables (replicate X concentration) and were statistically analyzed by the Spearman-Kärber method. An increase in the concentration of Bo IFN-alpha I1 enhanced its protective effect against every test virus strain. Bo IFN-alpha I1 had a marked in vitro effect on the bovine diarrhea viral strains. It demonstrated less protection against the pseudorabies and parainfluenza 3 viruses. Its effectiveness against the two infectious bovine rhinotracheitis viral strains was lesser and of a low order.

  19. Protection against adriamycin-induced skin necrosis in the rat by dimethyl sulfoxide and alpha-tocopherol.

    PubMed

    Svingen, B A; Powis, G; Appel, P L; Scott, M

    1981-09-01

    Extravasation of Adriamycin during i.v. infusion can cause serious local complications. We have used a rat skin model to study the protection afforded by dimethyl sulfoxide and alpha-tocopherol (vitamin E) against Adriamycin-induced skin necrosis. Topical daily application of 1 ml dimethyl sulfoxide for 2 days produced a small decrease in ulcer diameter of up to 11% at 2 weeks. Topical daily applications of 1 ml 10% alpha-tocopherol succinate in dimethyl sulfoxide for 2 days produced a marked decrease in ulcer diameter at 2 weeks of up to 68%. Daily topical application of 1 ml 10% alpha-tocopherol succinate in dimethyl sulfoxide for 7 days offered no greater protection than 2-day application. alpha-Tocopherol acetate appeared to have activity slightly less than that of alpha-tocopherol succinate in reducing ulcer size, and both compounds were considerably more active than was alpha-tocopherol alcohol. Administration of alpha-tocopherol succinate or alpha-tocopherol acetate i.p. had no significant effect upon ulcer diameter. Topically applied dimethyl sulfoxide and alpha-tocopherol may provide an effective way of treating accidentally extravasated Adriamycin in cancer patients.

  20. Silibinin protects OTA-mediated TNF-alpha release from perfused rat livers and isolated rat Kupffer cells.

    PubMed

    Al-Anati, Lauy; Essid, Ebtisam; Reinehr, Roland; Petzinger, Ernst

    2009-04-01

    We studied the inhibitory effect of silibinin on ochratoxin A (OTA) and LPS-mediated tumor necrosis factor alpha (TNF-alpha) release and the leakage of cytotoxic markers glutamate dehydrogenase (GLDH) and lactate dehydrogenase (LDH), from isolated blood-free perfused rat livers, and from isolated pure rat Kupffer cells. In the recirculation perfusion model at the end point 90 min, 2.5 micromol/L OTA released 2600 pg/mL TNF-alpha without effects on liver vitality. LPS at 0.1 microg/mL induced 3000 pg TNF-alpha/mL with slight leakage of GLDH and LDH. Under similar experimental conditions, the addition of silibinin 10 min prior to OTA and LPS showed dose-dependent protection against OTA or LPS-induced hepatic TNF-alpha release. High-dose of silibinin (12.5 microg/mL) also completely restored GLDH and LDH levels in the perfusate. Pretreatment of isolated Kupffer cells with 0.02, 0.1, 0.5, 2.5, and 12.5 microg silibinin/mL 30 min prior to OTA reduced OTA-induced TNF-alpha levels to 90, 70, 25, 25, and 25% at 4 h, respectively, and abrogated any TNF-alpha release at 24 h. Similarly, in the presence of silibinin LPS-induced TNF-alpha levels decreased at 4 h to 71, 57, 18, 22, and 18%, respectively. However, after 24 h of LPS exposition the protection by silibinin vanished and TNF-alpha partially recurred into the incubation medium under LPS. In summary, silibinin had hepatoprotective effects against OTA- or LPS-mediated TNF-alpha release and also reduced the cytotoxicity of both toxins. Isolated Kupffer cells were even more sensitive to the protective effect than perfused livers and responded to very low concentrations of silibinin with a strong inhibition of toxins-mediated TNF-alpha release. PMID:19156713

  1. Comparative gene expression profiles induced by PPAR{gamma} and PPAR{alpha}/{gamma} agonists in rat hepatocytes

    SciTech Connect

    Rogue, Alexandra; Renaud, Marie Pierre; Claude, Nancy; Guillouzo, Andre; Spire, Catherine

    2011-07-01

    Species-differential toxic effects have been described with PPAR{alpha} and PPAR{gamma} agonists between rodent and human liver. PPAR{alpha} agonists (fibrates) are potent hypocholesterolemic agents in humans while they induce peroxisome proliferation and tumors in rodent liver. By contrast, PPAR{gamma} agonists (glitazones) and even dual PPAR{alpha}/{gamma} agonists (glitazars) have caused idiosyncratic hepatic and nonhepatic toxicities in human without evidence of any damage in rodent during preclinical studies. The mechanisms involved in such differences remain largely unknown. Several studies have identified the major target genes of PPAR{alpha} agonists in rodent liver while no comprehensive analysis has been performed on gene expression changes induced by PPAR{gamma} and dual PPAR{alpha}/{gamma} agonists. Here, we investigated transcriptomes of rat hepatocytes after 24 h treatment with two PPAR{gamma} (troglitazone and rosiglitazone) and two PPAR{alpha}/{gamma} (muraglitazar and tesaglitazar) agonists. Although, hierarchical clustering revealed a gene expression profile characteristic of each PPAR agonist class, only a limited number of genes was specifically deregulated by glitazars. Functional analyses showed that many genes known as PPAR{alpha} targets were also modulated by both PPAR{gamma} and PPAR{alpha}/{gamma} agonists and quantitative differences in gene expression profiles were observed between these two classes. Moreover, most major genes modulated in rat hepatocytes were also found to be deregulated in rat liver after tesaglitazar treatment. Taken altogether, these results support the conclusion that differential toxic effects of PPAR{alpha} and PPAR{gamma} agonists in rodent liver do not result from transcriptional deregulation of major PPAR target genes but rather from qualitative and/or quantitative differential responses of a small subset of genes.

  2. Human hyperimmune globulin protects against the cytotoxic action of staphylococcal alpha-toxin in vitro and in vivo.

    PubMed Central

    Bhakdi, S; Mannhardt, U; Muhly, M; Hugo, F; Ronneberger, H; Hungerer, K D

    1989-01-01

    Alpha-toxin, the major cytolysin of Staphylococcus aureus, preferentially attacks human platelets and cultured monocytes, thereby promoting coagulation and the release of interleukin-1 and tumor necrosis factor. Titers of naturally occurring antibodies in human blood are not high enough to substantially inhibit these pathological reactions. In the present study, F(ab')2 fragment preparations from hyperimmune globulin obtained from immunized volunteers were tested for their capacity to inhibit the cytotoxic action of alpha-toxin in vitro and in vivo. These antibody preparations exhibited neutralizing anti-alpha-toxin titers of 80 to 120 IU/ml, whereas titers in commercial immunoglobulin preparations were 1 to 4 IU/ml. In vitro, the presence of 2 to 4 mg of hyperimmune globulin per ml protected human platelets against the action of 1 to 2 micrograms of alpha-toxin per ml. Similarly, these antibodies fully protected human monocytes against the ATP-depleting and cytokine-liberating effects of 0.1 to 1 microgram of alpha-toxin per ml. Intravenous application of 0.5 mg (85 to 120 micrograms/kg of body weight) of alpha-toxin in cynomolgus monkeys elicited acute pathophysiological reactions which were heralded by a selective drop in blood platelet counts. Toxin doses of 1 to 2 mg (170 to 425 micrograms/kg) had a rapid lethal effect, the animals presenting with signs of cardiovascular collapse and pulmonary edema. Prior intravenous application of 4 ml of hyperimmune globulins per kg inhibited the systemic toxic and lethal effects of 1 mg (200 micrograms/kg) of alpha-toxin. In contrast, normal human immunoglobulins exhibited no substantial protective efficacy in vitro and only marginal effects in vivo. It is concluded that high-titered anti-alpha-toxin antibodies effectively protect against the cytotoxic actions of alpha-toxin. PMID:2777380

  3. EFFECTS OF CHRONIC ACTIVATION OF PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR-ALPHA OR HIGH-FAT FEEDING IN A RAT INFARCT MODEL OF HEART FAILURE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Intracardiac accumulation of lipid and related intermediates (e.g., ceramide) is associated with cardiac dysfunction and may contribute to the progression of heart failure (HF). Overexpression of nuclear receptor peroxisome proliferator-activated receptor-alpha (PPAR-alpha) increases intramyocellula...

  4. Berberine is a potent agonist of peroxisome proliferator activated receptor alpha.

    PubMed

    Yu, Huarong; Li, Changqing; Yang, Junqing; Zhang, Tao; Zhou, Qixin

    2016-01-01

    Although berberine has hypolipidemic effects with a high affinity to nuclear proteins, the underlying molecular mechanism for this effect remains unclear. Here, we determine whether berberine is an agonist of peroxisome proliferator-activated receptor alpha (PPARalpha), with a lipid-lowering effect. The cell-based reporter gene analysis showed that berberine selectively activates PPARalpha (EC50 =0.58 mM, Emax =102.4). The radioligand binding assay shows that berberine binds directly to the ligand-binding domain of PPARalpha (Ki=0.73 mM) with similar affinity to fenofibrate. The mRNA and protein levels of CPT-Ialpha gene from HepG2 cells and hyperlipidemic rat liver are remarkably up-regulated by berberine, and this effect can be blocked by MK886, a non-competitive antagonist of PPARalpha. A comparison assay in which berberine and fenofibrate were used to treat hyperlipidaemic rats for three months shows that these drugs produce similar lipid-lowering effects, except that berberine increases high-density lipoprotein cholesterol more effectively than fenofibrate. These findings provide the first evidence that berberine is a potent agonist of PPARalpha and seems to be superior to fenofibrate for treating hyperlipidemia. PMID:27100490

  5. The lipocalin alpha1-microglobulin protects erythroid K562 cells against oxidative damage induced by heme and reactive oxygen species.

    PubMed

    Olsson, Magnus G; Olofsson, Tor; Tapper, Hans; Akerstrom, Bo

    2008-08-01

    Alpha(1)-microglobulin is a 26 kDa plasma and tissue glycoprotein that belongs to the lipocalin protein superfamily. Recent reports show that it is a reductase and radical scavenger and that it binds heme and has heme-degrading properties. This study has investigated the protective effects of alpha(1)-microglobulin against oxidation by heme and reactive oxygen species in the human erythroid cell line, K562. The results show that alpha(1)-microglobulin prevents intracellular oxidation and up-regulation of heme oxygenase-1 induced by heme, hydrogen peroxide and Fenton reaction-generated hydroxyl radicals in the culture medium. It also reduces the cytosol of non-oxidized cells. Endogeneous expression of alpha(1)-microglobulin was up-regulated by these oxidants and silencing of the alpha(1)-microglobulin expression increased the cytosol oxidation. alpha(1)-microglobulin also inhibited cell death caused by heme and cleared cells from bound heme. Binding of heme to alpha(1)-microglobulin increased the radical reductase activity of the protein as compared to the apo-protein. Finally, alpha(1)-microglobulin was localized mainly at the cell surface both when administered exogeneously and in non-treated cells. The results suggest that alpha(1)-microglobulin is involved in the defence against oxidative cellular injury caused by haemoglobin and heme and that the protein may employ both heme-scavenging and one-electron reduction of radicals to achieve this.

  6. The protective and therapeutic effects of alpha-solanine on mice breast cancer.

    PubMed

    Mohsenikia, Maryam; Alizadeh, Ali Mohammad; Khodayari, Saeed; Khodayari, Hamid; Kouhpayeh, Seyed Amin; Karimi, Aliasghar; Zamani, Mina; Azizian, Saleh; Mohagheghi, Mohammad Ali

    2013-10-15

    Alpha-solanine, a naturally steroidal glycoalkaloid, is found in leaves and fruits of plants as a defensive agent against fungi, bacteria and insects. Herein, we investigated solanine toxicity in vitro and in vivo, and assessed its protective and the therapeutic effects on a typical animal model of breast cancer. The study conducted in three series of experiments to obtain (i) solanine effects on cell viability of mammary carcinoma cells, (ii) in vivo toxicity of solanine, and (iv) the protective and therapeutic effects of solanine on animal model of breast cancer. Alpha-solanine significantly suppressed proliferation of mouse mammary carcinoma cells both in vitro and in vivo (P<0.05). Under the dosing procedure, 5 mg/kg solanine has been chosen for assessing its protective and therapeutic effects in mice breast cancer. Tumor take rate in the solanine-treated group was zero compared with a 75% rate in its respective control group (P<0.05). The average tumor size and weight were significantly lower in solanine-treated animals than its respective control ones (P<0.05). Proapoptotic Bax protein expression increased in breast tumor by solanine compared with its respective control group (P<0.05). Antiapoptotic Bcl-2 protein expression found to be lower in solanine-treated animals (P<0.05). Proliferative and angiogenic parameters greatly decreased in solanine-treated mice (P<0.05). Data provide evidence that solanine exerts a significant chemoprotective and chemotherapeutic effects on an animal model of breast cancer through apoptosis induction, cell proliferation and angiogenesis inhibition. These findings reveal a new therapeutic potential for solanine in cancer.

  7. AlphaB-crystallin is involved in oxidative stress protection determined by VEGF in skeletal myoblasts.

    PubMed

    Mercatelli, Neri; Dimauro, Ivan; Ciafré, Silvia Anna; Farace, Maria Giulia; Caporossi, Daniela

    2010-08-01

    Recent studies suggest that the effects of VEGF-A, the prototype VEGF ligand, may extend to a variety of cell types other than endothelial cells. The expression of VEGF-A and its main receptors, Flt-1/VEGFR-1 and KDR/Flk-1/VEGFR-2, was indeed detected in several cell types, including cardiac myocytes and regenerating myotubes. In addition to its proangiogenic activity, evidence indicates that VEGF-A can sustain skeletal muscle regeneration by enhancing the survival and migration of myogenic cells and by promoting the growth of myogenic fibers. In this study, our aim was to investigate whether VEGF could protect skeletal muscle satellite cells from apoptotic cell death triggered by reactive oxygen species and to identify the main molecular mechanisms. C2C12 mouse myoblasts, cultured in vitro in the presence of exogenous VEGF or stably transfected with a plasmid vector expressing VEGF-A, were subjected to oxidative stress and analyzed for cell growth and survival, induction of apoptosis, and molecular signaling. The results of our study demonstrated that VEGF protects C2C12 myoblasts from apoptosis induced by oxidative or hypoxic-like stress. This protection did not correlate with the modulation of the expression of VEGF receptors, but is clearly linked to the phosphorylation of the KDR/Flk-1 receptor, the activation of NF-kappaB, and/or the overexpression of the antiapoptotic protein alphaB-crystallin. PMID:20441791

  8. Peroxisome proliferator-activated receptor {alpha} agonists modulate Th1 and Th2 chemokine secretion in normal thyrocytes and Graves' disease

    SciTech Connect

    Antonelli, Alessandro; Ferrari, Silvia Martina; Frascerra, Silvia; Corrado, Alda; Pupilli, Cinzia; Bernini, Giampaolo; Benvenga, Salvatore; Ferrannini, Ele; Fallahi, Poupak

    2011-07-01

    Until now, no data are present about the effect of peroxisome proliferator-activated receptor (PPAR){alpha} activation on the prototype Th1 [chemokine (C-X-C motif) ligand (CXCL)10] (CXCL10) and Th2 [chemokine (C-C motif) ligand 2] (CCL2) chemokines secretion in thyroid cells. The role of PPAR{alpha} and PPAR{gamma} activation on CXCL10 and CCL2 secretion was tested in Graves' disease (GD) and control primary thyrocytes stimulated with interferon (IFN){gamma} and tumor necrosis factor (TNF){alpha}. IFN{gamma} stimulated both CXCL10 and CCL2 secretion in primary GD and control thyrocytes. TNF{alpha} alone stimulated CCL2 secretion, while had no effect on CXCL10. The combination of IFN{gamma} and TNF{alpha} had a synergistic effect both on CXCL10 and CCL2 chemokines in GD thyrocytes at levels comparable to those of controls. PPAR{alpha} activators inhibited the secretion of both chemokines (stimulated with IFN{gamma} and TNF{alpha}) at a level higher (for CXCL10, about 60-72%) than PPAR{gamma} agonists (about 25-35%), which were confirmed to inhibit CXCL10, but not CCL2. Our data show that CCL2 is modulated by IFN{gamma} and TNF{alpha} in GD and normal thyrocytes. Furthermore we first show that PPAR{alpha} activators inhibit the secretion of CXCL10 and CCL2 in thyrocytes, suggesting that PPAR{alpha} may be involved in the modulation of the immune response in the thyroid.

  9. Ginsenoside Rf, a component of ginseng, regulates lipoprotein metabolism through peroxisome proliferator-activated receptor {alpha}

    SciTech Connect

    Lee, Hyunghee; Gonzalez, Frank J.; Yoon, Michung . E-mail: yoon60@mokwon.ac.kr

    2006-01-06

    We investigated whether ginseng regulates lipoprotein metabolism by altering peroxisome proliferator-activated receptor {alpha} (PPAR{alpha})-mediated pathways, using a PPAR{alpha}-null mouse model. Administration of ginseng extract, ginsenosides, and ginsenoside Rf (Rf) to wild-type mice not only significantly increased basal levels of hepatic apolipoprotein (apo) A-I and C-III mRNA compared with wild-type controls, but also substantially reversed the reductions in mRNA levels of apo A-I and C-III expected following treatment with the potent PPAR{alpha} ligand Wy14,643. In contrast, no effect was detected in the PPAR{alpha}-null mice. Testing of eight main ginsenosides on PPAR{alpha} reporter gene expression indicated that Rf was responsible for the effects of ginseng on lipoprotein metabolism. Furthermore, the inhibition of PPAR{alpha}-dependent transactivation by Rf seems to occur at the level of DNA binding. These results demonstrate that ginseng component Rf regulates apo A-I and C-III mRNA and the actions of Rf on lipoprotein metabolism are mediated via interactions with PPAR{alpha}.

  10. Identification and validation of a linear protective neutralizing epitope in the β-pore domain of alpha toxin.

    PubMed

    Oscherwitz, Jon; Cease, Kemp B

    2015-01-01

    The plethora of virulence factors associated with Staphylococcus aureus make this bacterium an attractive candidate for a molecularly-designed epitope-focused vaccine. This approach, which necessitates the identification of neutralizing epitopes for incorporation into a vaccine construct, is being evaluated for pathogens where conventional approaches have failed to elicit protective humoral responses, like HIV-1 and malaria, but may also hold promise for pathogens like S. aureus, where the elicitation of humoral immunity against multiple virulence factors may be required for development of an effective vaccine. Among the virulence factors employed by S. aureus, animal model and epidemiological data suggest that alpha toxin, a multimeric β-pore forming toxin like protective antigen from Bacillus anthracis, is particularly critical, yet no candidate neutralizing epitopes have been delineated in alpha toxin to date. We have previously shown that a linear determinant in the 2β2-2β3 loop of the pore forming domain of B. anthracis protective antigen is a linear neutralizing epitope. Antibody against this site is highly potent for neutralizing anthrax lethal toxin in vitro and for protection of rabbits in vivo from virulent B. anthracis. We hypothesized that sequences in the β-pore of S. aureus alpha toxin that share structural and functional homology to β-pore sequences in protective antigen would contain a similarly critical neutralizing epitope. Using an in vivo mapping strategy employing peptide immunogens, an optimized in vitro toxin neutralization assay, and an in vivo dermonecrosis model, we have now confirmed the presence of this epitope in alpha toxin, termed the pore neutralizing determinant. Antibody specific for this determinant neutralizes alpha toxin in vitro, and is highly effective for mitigating dermonecrosis and bacterial growth in a mouse model of S. aureus USA300 skin infection. The delineation of this linear neutralizing determinant in alpha

  11. Alpha-lipoic acid protects cardiomyocytes against hypoxia/reoxygenation injury by inhibiting autophagy

    SciTech Connect

    Cao, Xueming; Chen, Aihua Yang, Pingzhen; Song, Xudong; Liu, Yingfeng; Li, Zhiliang; Wang, Xianbao; Wang, Lizi; Li, Yunpeng

    2013-11-29

    Highlights: •We observed the cell viability and death subjected to H/R in H9c2 cardiomyocytes. •We observed the degree of autophagy subjected to H/R in H9c2 cardiomyocytes. •LA inhibited the degree of autophagy in parallel to the enhanced cell survival. •LA inhibited the autophagy in parallel to the decreased total cell death. •We concluded that LA protected cardiomyocytes against H/R by inhibiting autophagy. -- Abstract: Hypoxia/reoxygenation (H/R) is an important in vitro model for exploring the molecular mechanisms and functions of autophagy during myocardial ischemia/reperfusion (I/R). Alpha-lipoic acid (LA) plays an important role in the etiology of cardiovascular disease. Autophagy is widely implicated in myocardial I/R injury. We assessed the degree of autophagy by pretreatment with LA exposed to H/R in H9c2 cell based on the expression levels of Beclin-1, LC3II/LC3I, and green fluorescent protein-labeled LC3 fusion proteins. Autophagic vacuoles were confirmed in H9c2 cells exposed to H/R using transmission electron microscopy. Our findings indicated that pretreatment with LA inhibited the degree of autophagy in parallel to the enhanced cell survival and decreased total cell death in H9c2 cells exposed to H/R. We conclude that LA protects cardiomyocytes against H/R injury by inhibiting autophagy.

  12. Liver-Specific Alpha 2 Interferon Gene Expression Results in Protection from Induced Hepatitis

    PubMed Central

    Aurisicchio, Luigi; Delmastro, Paola; Salucci, Valentina; Paz, Odalys Gonzalez; Rovere, Patrizia; Ciliberto, Gennaro; La Monica, Nicola; Palombo, Fabio

    2000-01-01

    The current therapy for hepatitis B and C is based on systemic administration of recombinant human alpha interferon (r-hIFN-α). However, systemic delivery of r-hIFN-α is associated with severe side effects, but more importantly, it is effective in only a small percentage of patients. In an effort to maximize IFN-α antiviral efficacy, we have explored the therapeutic potential of murine IFN-α2 (mIFNα2) selectively expressed in the liver. To this end, we have developed a helper-dependent adenovirus vector (HD) containing the mIFN-α2 gene under the control of the liver-specific transthyretin promoter (HD-IFN). Comparison with a first-generation adenovirus carrying the same mIFN-α2 expression cassette indicates that at certain HD-IFN doses, induction of antiviral genes can be achieved in the absence of detectable circulating mIFN-α2. Challenge of injected mice with mouse hepatitis virus type 3 showed that HD-IFN provides high liver protection. Moreover, liver protection was also observed in acute nonviral liver inflammation hepatitis induced by concanavalin A at 1 month postinfection. These results hold promise for the development of a gene therapy treatment for chronic viral hepatitis based on liver-restricted expression of IFN-α2. PMID:10775620

  13. Protective effect of dl-alpha-tocopherol on the cytotoxicity of ultraviolet B against human skin fibroblasts in vitro.

    PubMed

    Kondo, S; Mamada, A; Yamaguchi, J; Fukuro, S

    1990-08-01

    The effect of dl-alpha-tocopherol on ultraviolet light, 280-320 nm (UVB)-induced damage of human skin fibroblasts was studied by measuring the colony-forming ability, unscheduled DNA synthesis (UDS) and malondialdehyde (MDA) production. Regarding the cell toxicity, the values of the mean lethal dose (D0) of UV in fibroblast strains from 5 normal subjects were examined. D0 increased dose-dependently when the cells were cultured in the presence of dl-alpha-tocopherol at the concentration of 10-1000 micrograms/ml. UDS induced by 500 J/m2 UVB irradiation was not altered by treatment of 100 micrograms/ml dl-alpha-tocopherol. MDA did not increase after 500 J/m2 UVB irradiation in the fibroblasts cultured with 100 micrograms/ml dl-alpha-tocopherol, while MDA in the fibroblasts cultured without dl-alpha-tocopherol increased after irradiation. These results suggest that dl-alpha-tocopherol protects human skin fibroblasts against the cytotoxic effect of UVB, and its mechanism seems to be related to inhibition of UV-induced lipid peroxidation or to the antioxidation effect of dl-alpha-tocopherol.

  14. Silver(I) triflate-catalyzed direct synthesis of N-PMP protected alpha-aminopropargylphosphonates from terminal alkynes.

    PubMed

    Dodda, Rajasekhar; Zhao, Cong-Gui

    2007-01-01

    [reaction: see text] N-PMP protected alpha-aminopropargylphosphonates have been synthesized by using a silver(I) triflate-catalyzed one-pot three-component reaction of terminal alkynes, p-anisidine, and diethyl formylphosphonate hydrate. Good to excellent yields of the desired products may be obtained with a very simple procedure.

  15. Activated AMPK inhibits PPAR-{alpha} and PPAR-{gamma} transcriptional activity in hepatoma cells.

    PubMed

    Sozio, Margaret S; Lu, Changyue; Zeng, Yan; Liangpunsakul, Suthat; Crabb, David W

    2011-10-01

    AMP-activated protein kinase (AMPK) and peroxisome proliferator-activated receptor-α (PPAR-α) are critical regulators of short-term and long-term fatty acid oxidation, respectively. We examined whether the activities of these molecules were coordinately regulated. H4IIEC3 cells were transfected with PPAR-α and PPAR-γ expression plasmids and a peroxisome-proliferator-response element (PPRE) luciferase reporter plasmid. The cells were treated with PPAR agonists (WY-14,643 and rosiglitazone), AMPK activators 5-aminoimidazole-4-carboxamide riboside (AICAR) and metformin, and the AMPK inhibitor compound C. Both AICAR and metformin decreased basal and WY-14,643-stimulated PPAR-α activity; compound C increased agonist-stimulated reporter activity and partially reversed the effect of the AMPK activators. Similar effects on PPAR-γ were seen, with both AICAR and metformin inhibiting PPRE reporter activity. Compound C increased basal PPAR-γ activity and rosiglitazone-stimulated activity. In contrast, retinoic acid receptor-α (RAR-α), another nuclear receptor that dimerizes with retinoid X receptor (RXR), was largely unaffected by the AMPK activators. Compound C modestly increased AM580 (an RAR agonist)-stimulated activity. The AMPK activators did not affect PPAR-α binding to DNA, and there was no consistent correlation between effects of the AMPK activators and inhibitor on PPAR and the nuclear localization of AMPK-α subunits. Expression of either a constitutively active or dominant negative AMPK-α inhibited basal and WY-14,643-stimulated PPAR-α activity and basal and rosiglitazone-stimulated PPAR-γ activity. We concluded that the AMPK activators AICAR and metformin inhibited transcriptional activities of PPAR-α and PPAR-γ, whereas inhibition of AMPK with compound C activated both PPARs. The effects of AMPK do not appear to be mediated through effects on RXR or on PPAR/RXR binding to DNA. These effects are independent of kinase activity and instead appear to rely on the activated conformation of AMPK. AMPK inhibition of PPAR-α and -γ may allow for short-term processes to increase energy generation before the cells devote resources to increasing their capacity for fatty acid oxidation.

  16. Design, synthesis, and evaluation of a new class of noncyclic 1,3-dicarbonyl compounds as PPARalpha selective activators.

    PubMed

    Li, Zhibin; Liao, Chenzhong; Ko, Ben C B; Shan, Song; Tong, Edith H Y; Yin, Zihui; Pan, Desi; Wong, Vincent K W; Shi, Leming; Ning, Zhi-Qiang; Hu, Weiming; Zhou, Jiaju; Chung, Stephen S M; Lu, Xian-Ping

    2004-07-01

    Lipid accumulation in nonadipose tissues is increasingly linked to the development of type 2 diabetes in obese individuals. We report here the design, synthesis, and evaluation of a series of novel PPARalpha selective activators containing 1,3-dicarbonyl moieties. Structure-activity relationship studies led to the identification of PPARalpha selective activators (compounds 10, 14, 17, 18, and 21) with stronger potency and efficacy to activate PPARalpha over PPARgamma and PPARdelta. Experiments in vivo showed that compounds 10, 14, and 17 had blood glucose lowering effect in diabetic db/db mouse model after two weeks oral dosing. The data strongly support further testing of these lead compounds in other relevant disease animal models to evaluate their potential therapeutic benefits. PMID:15177462

  17. Structure of oxidized alpha-haemoglobin bound to AHSP reveals a protective mechanism for haem.

    PubMed

    Feng, Liang; Zhou, Suiping; Gu, Lichuan; Gell, David A; Mackay, Joel P; Weiss, Mitchell J; Gow, Andrew J; Shi, Yigong

    2005-06-01

    The synthesis of haemoglobin A (HbA) is exquisitely coordinated during erythrocyte development to prevent damaging effects from individual alpha- and beta-subunits. The alpha-haemoglobin-stabilizing protein (AHSP) binds alpha-haemoglobin (alphaHb), inhibits the ability of alphaHb to generate reactive oxygen species and prevents its precipitation on exposure to oxidant stress. The structure of AHSP bound to ferrous alphaHb is thought to represent a transitional complex through which alphaHb is converted to a non-reactive, hexacoordinate ferric form. Here we report the crystal structure of this ferric alphaHb-AHSP complex at 2.4 A resolution. Our findings reveal a striking bis-histidyl configuration in which both the proximal and the distal histidines coordinate the haem iron atom. To attain this unusual conformation, segments of alphaHb undergo drastic structural rearrangements, including the repositioning of several alpha-helices. Moreover, conversion to the ferric bis-histidine configuration strongly and specifically inhibits redox chemistry catalysis and haem loss from alphaHb. The observed structural changes, which impair the chemical reactivity of haem iron, explain how AHSP stabilizes alphaHb and prevents its damaging effects in cells.

  18. Structure of Oxidized Alpha-Haemoglobin Bound to AHSP Reveals a Protective Mechanism for HAEM

    SciTech Connect

    Feng,L.; Zhou, S.; Gu, L.; Gell, D.; MacKay, J.; Weiss, M.; Gow, A.; Shi, Y.

    2005-01-01

    The synthesis of hemoglobin A (HbA) is exquisitely coordinated during erythrocyte development to prevent damaging effects from individual {alpha}- and {beta}-subunits. The {alpha}-hemoglobin-stabilizing protein (AHSP) binds {alpha}-hemoglobin ({alpha}Hb), inhibits the ability of {alpha}Hb to generate reactive oxygen species and prevents its precipitation on exposure to oxidant stress. The structure of AHSP bound to ferrous {alpha}Hb is thought to represent a transitional complex through which {alpha}Hb is converted to a non-reactive, hexacoordinate ferric form. Here we report the crystal structure of this ferric {alpha}Hb-AHSP complex at 2.4 Angstrom resolution. Our findings reveal a striking bis-histidyl configuration in which both the proximal and the distal histidines coordinate the haem iron atom. To attain this unusual conformation, segments of {alpha}Hb undergo drastic structural rearrangements, including the repositioning of several {alpha}-helices. Moreover, conversion to the ferric bis-histidine configuration strongly and specifically inhibits redox chemistry catalysis and haem loss from {alpha}Hb. The observed structural changes, which impair the chemical reactivity of haem iron, explain how AHSP stabilizes {alpha}Hb and prevents its damaging effects in cells.

  19. Matrix metalloproteinase-12 gene regulation by a PPAR alpha agonist in human monocyte-derived macrophages

    SciTech Connect

    Souissi, Imen Jguirim; Billiet, Ludivine; Cuaz-Perolin, Clarisse; Rouis, Mustapha

    2008-11-01

    MMP-12, a macrophage-specific matrix metalloproteinase with large substrate specificity, has been reported to be highly expressed in mice, rabbits and human atherosclerotic lesions. Increased MMP-12 from inflammatory macrophages is associated with several degenerative diseases such as atherosclerosis. In this manuscript, we show that IL-1{beta}, a proinflammatory cytokine found in atherosclerotic plaques, increases both mRNA and protein levels of MMP-12 in human monocyte-derived macrophages (HMDM). Since peroxisome proliferator-activated receptors (PPARs), such as PPAR{alpha} and PPAR{gamma}, are expressed in macrophages and because PPAR activation exerts an anti-inflammatory effect on vascular cells, we have investigated the effect of PPAR{alpha} and {gamma} isoforms on MMP-12 regulation in HMDM. Our results show that MMP-12 expression (mRNA and protein) is down regulated in IL-1{beta}-treated macrophages only in the presence of a specific PPAR{alpha} agonist, GW647, in a dose-dependent manner. In contrast, this inhibitory effect was abolished in IL-1{beta}-stimulated peritoneal macrophages isolated from PPAR{alpha}{sup -/-} mice and treated with the PPAR{alpha} agonist, GW647. Moreover, reporter gene transfection experiments using different MMP-12 promoter constructs showed a reduction of the promoter activities by {approx} 50% in IL-1{beta}-stimulated PPAR{alpha}-pre-treated cells. However, MMP-12 promoter analysis did not reveal the presence of a PPRE response element. The IL-1{beta} effect is known to be mediated through the AP-1 binding site. Mutation of the AP-1 site, located at - 81 in the MMP-12 promoter region relative to the transcription start site, followed by transfection analysis, gel shift and ChIP experiments revealed that the inhibitory effect was the consequence of the protein-protein interaction between GW 647-activated PPAR{alpha} and c-Fos or c-Jun transcription factors, leading to inhibition of their binding to the AP-1 motif. These studies

  20. Alpha-beta T cells provide protection against lethal encephalitis in the murine model of VEEV infection

    SciTech Connect

    Paessler, Slobodan Yun, Nadezhda E.; Judy, Barbara M.; Dziuba, Natallia; Zacks, Michele A.; Grund, Anna H.; Frolov, Ilya; Campbell, Gerald A.; Weaver, Scott C.; Estes, D. Mark

    2007-10-25

    We evaluated the safety and immunogenicity of a chimeric alphavirus vaccine candidate in mice with selective immunodeficiencies. This vaccine candidate was highly attenuated in mice with deficiencies in the B and T cell compartments, as well as in mice with deficient gamma-interferon responsiveness. However, the level of protection varied among the strains tested. Wild type mice were protected against lethal VEEV challenge. In contrast, alpha/beta ({alpha}{beta}) TCR-deficient mice developed lethal encephalitis following VEEV challenge, while mice deficient in gamma/delta ({gamma}{delta}) T cells were protected. Surprisingly, the vaccine potency was diminished by 50% in animals lacking interferon-gamma receptor alpha chain (R1)-chain and a minority of vaccinated immunoglobulin heavy chain-deficient ({mu}MT) mice survived challenge, which suggests that neutralizing antibody may not be absolutely required for protection. Prolonged replication of encephalitic VEEV in the brain of pre-immunized mice is not lethal and adoptive transfer experiments indicate that CD3{sup +} T cells are required for protection.

  1. Protective role of alpha lipoic acid against polychlorobiphenyl (Aroclor 1254)-induced testicular toxicity in rats.

    PubMed

    Güleş, Özay; Eren, Ülker

    2016-01-01

    The present study was aimed to investigate the antioxidant, biochemical, and histological effects of alpha lipoic acid (ALA) on polychlorinated biphenyl (PCB)-induced testicular toxicity in male rats. The rats were divided into five groups: In the control group, the rats were not administered any chemicals for 30 days. In the sham group, the rats were administered corn oil for 30 days. In the PCB group, the rats were administered with Aroclor 1254 for 30 days. In the ALA group, the rats were treated with ALA for 30 days. In the ALA+PCB group, the rats were treated with ALA 24 hours before Aroclor 1254 was administered for 30 days. The total oxidant status (TOS) level in the serum and testis, number of apoptotic cells, vacuolization at the basal membrane, immature spermatids in the tubular lumen, heme oxygenase-1 (HO-1) staining density, and abnormal spermatozoa were significantly increased in the PCB group. Moreover, in the PCB group, the seminiferous tubule diameter (STD) was decreased in stage VII-VIII and XII-XIV tubules. The TOS level in the serum and testis, vacuolization at the basal membrane, immature spermatids in the tubular lumen, and apoptosis were significantly decreased in the ALA+PCB groups. These findings suggested that ALA has a protective role against PCB-induced testicular toxicity. PMID:27516018

  2. Protective effect of alpha-lipoic acid on cypermethrin-induced oxidative stress in Wistar rats.

    PubMed

    Mignini, F; Nasuti, C; Fedeli, D; Mattioli, L; Cosenza, M; Artico, M; Gabbianelli, R

    2013-01-01

    Cypermethrin (CY), a class II pyrethroid pesticide, is globally used to control insects in the household and in agriculture. Despite beneficial roles, its uncontrolled and repetitive application leads to unintended effects in non-target organisms. In light of the relevant anti-oxidant properties of alpha-lipoic acid (ALA), in the work described herein we tested the effect of a commercially available ALA formulation on cypermethrin CY)-induced oxidative stress in Wistar rats. The rats were orally administered with 53.14 mg/kg of ALA and 35.71 mg/kg of CY for 60 days. The treatment with CY did not induce changes in either locomotor activities or in body weight. Differences were observed on superoxide dismutase (SOD), catalase (CAT) and lipid peroxidation that were re-established by ALA treatment at similar levels of the placebo group. Furthermore, ALA formulation increased glutathione (GSH) level and glutathione peroxidase (GPx) activity. Because of the widespread use of CY, higher amounts of pesticide residues are present in food, and a diet supplementation with ALA could be an active free radical scavenger protecting against diseases associated with oxidative stress.

  3. Transforming growth factor alpha treatment alters intracellular calcium levels in hair cells and protects them from ototoxic damage in vitro.

    PubMed

    Staecker, H; Dazert, S; Malgrange, B; Lefebvre, P P; Ryan, A F; Van de Water, T R

    1997-07-01

    To determine if transforming growth factor alpha (TGF alpha) pretreatment protects hair cells from aminoglycoside induced injury by modifying their intracellular calcium concentration, we assayed hair cell calcium levels in organ of Corti explants both before and after aminoglycoside (i.e. neomycin, 10(-3) M) exposure either with or without growth factor pretreatment. After TGF alpha (500 ng/ml) treatment, the intracellular calcium level of hair cells showed a five-fold increase as compared to the levels observed in the hair cells of control cultures. After ototoxin exposure, calcium levels in hair cells of control explants showed an increase relative to their baseline levels, while in the presence of growth factors pretreatment, hair cells showed a relative reduction in calcium levels. Pretreatment of organ of Corti explants afforded significant protection of hair cell stereocilia bundle morphology from ototoxic damage when compared to explants exposed to ototoxin alone. This study correlates a rise in hair cell calcium levels with the otoprotection of hair cells by TGF alpha in organ of Corti explants. PMID:9263032

  4. Protective effects of DL-alpha-tocopherol acetate and sodium selenate on the liver of rats exposed to gamma radiation.

    PubMed

    Yanardağ, R; Bolkent, S; Kizir, A

    2001-12-01

    The aim of this study is to investigate whether vitamin E (as DL-alpha-tocopherol acetate) and selenium (as sodium selenate) exert a protective effect against radiation damage. The liver tissue of rats irradiated with a single dose of 1,000 cGy 60Co-gamma-irradiation was examined for morphological changes after the intraperitoneal (ip) administration DL-alpha-tocopherol acetate and sodium selenate as compared to controls. Also, the amounts of blood glutathione and serum alanine transaminase (ALT), aspartate transaminase (AST), alkaline phosphatase (ALP), lactate dehydrogenase (LDH), and total protein were determined by spectrophotometric methods. Degenerative changes were observed under light and electron microscopy in the liver tissue of the control (radiation only) group. In the group receiving radiation and ip doses of DL-alpha-tocopherol acetate and sodium selenate, the damage to the liver tissue was minimal or absent. In the radiation-only group, a reduction of the blood glutathione level and increases in serum values of AST, ALT, ALP, and LDH activity were observed, whereas in the irradiation-treated group, the reverse was found to occur. Based on these morphological and biochemical observations, it was concluded that the ip administration of DL-alpha-tocopherol acetate and sodium selenate exerts a protective effect against liver radiation damage.

  5. Infection of human fallopian tube epithelial cells with Neisseria gonorrhoeae protects cells from tumor necrosis factor alpha-induced apoptosis.

    PubMed

    Morales, Priscilla; Reyes, Paz; Vargas, Macarena; Rios, Miguel; Imarai, Mónica; Cardenas, Hugo; Croxatto, Horacio; Orihuela, Pedro; Vargas, Renato; Fuhrer, Juan; Heckels, John E; Christodoulides, Myron; Velasquez, Luis

    2006-06-01

    Following infection with Neisseria gonorrhoeae, bacteria may ascend into the Fallopian tubes (FT) and induce salpingitis, a major cause of infertility. In the FT, interactions between mucosal epithelial cells and gonococci are pivotal events in the pathogen's infection cycle and the inflammatory response. In the current study, primary FT epithelial cells were infected in vitro with different multiplicities of infection (MOI) of Pil+ Opa+ gonococci. Bacteria showed a dose-dependent association with cells and induced the secretion of tumor necrosis factor alpha (TNF-alpha). A significant finding was that gonococcal infection (MOI = 1) induced apoptosis in approximately 30% of cells, whereas increasing numbers of bacteria (MOI = 10 to 100) did not induce apoptosis. Apoptosis was observed in only 11% of cells with associated bacteria, whereas >84% of cells with no adherent bacteria were apoptotic. TNF-alpha was a key contributor to apoptosis, since (i) culture supernatants from cells infected with gonococci (MOI = 1) induced apoptosis in naïve cultures, suggesting that a soluble factor was responsible; (ii) gonococcal infection-induced apoptosis was inhibited with anti-TNF-alpha antibodies; and (iii) the addition of exogenous TNF-alpha induced apoptosis, which was inhibited by the presence of increasing numbers of bacteria (MOI = 10 to 100). These data suggest that TNF-alpha-mediated apoptosis of FT epithelial cells is likely a primary host defense mechanism to prevent pathogen colonization. However, epithelial cell-associated gonococci have evolved a mechanism to protect the cells from undergoing TNF-alpha-mediated apoptosis, and this modulation of the host innate response may contribute to establishment of infection. Understanding the antiapoptotic mechanisms used by Neisseria gonorrhoeae will inform the pathogenesis of salpingitis and could suggest new intervention strategies for prevention and treatment of the disease. PMID:16714596

  6. Protective effect of alpha-tocopheral on biochemical and histological alterations induced by cadmium in rat testes.

    PubMed

    Rajendar, B; Bharavi, K; Rao, G S; Kishore, P V S; Kumar, P Ravi; Kumar, C S V Satish; Kumar, D Srinivas

    2011-01-01

    Cadmium (Cd) is a potential environmental pollutant and causes severe damage to reproductive organs in adults including ovary and testes. Of all antioxidants alpha-tocopheral is considered to be most potent chain breaking antioxidant. Our aim was to study the effect of alpha-tocopheral on biochemical and histological alterations induced by Cd in testes of rats. Group 1 served as control, while groups 2 and 3 received subcutaneous injections of CdCl2 (3 mg/kg b.wt) once a week for four weeks. Group 3 in addition received alpha-tocopheral (75 mg/kg b.wt.) orally, daily for six weeks. Cadmium caused testicular tissue biochemical alterations such as significant increase in MDA, a peroxidation marker, decrease in antioxidant markers viz SOD, CAT and GSH and functional markers viz ALP and LDH. Histological alteration induced by Cd consisted of desquamation of basal lamina, shrunken tubules, generalized germ cell depletion with multinucleated gaint cells, degenerating Leydig cells, vascular congestion, interstitial edema and significant reduction in spermatodynamic count. Alpha-tocopheral significantly reversed all the Cd induced alterations. These results indicate that alpha-tocopheral has a protective effect against Cd indeed biochemical and histological alterations in rat testes. PMID:22471227

  7. Reversal of high dietary fructose-induced PPARalpha suppression by oral administration of lipoxygenase/cyclooxygenase inhibitors.

    PubMed

    Kelley, Glen L; Azhar, Salman

    2005-08-01

    High fructose feeding causes diet-induced alterations of lipid metabolism and decreased insulin sensitivity, hallmark of which is a rapid and profound hypertriglyceridemia. One of the mechanisms that contribute to serum hypertriglyceridemia in this model is suppression of hepatic PPARalpha. HMG-CoA inhibitors, which reduce serum triglycerides in these animals, also elevate/restore hepatic PPARalpha. Previously we demonstrated that two known lipoxygenase/cyclooxygenase inhibitors reversed diet-induced hypertriglyceridemia in this model and that reversal of certain inflammatory markers in the liver correlated with the metabolic benefit. In this paper we extended these studies by examining the impact of these compounds on expression of PPARalpha, both at the level of transcription and expression. Our data show that diet-induced suppression of hepaic PPARalpha is reversed upon treatment with lipoxygenase/cyclooxygenase compounds. We then tested one of these compounds, BW-755c, over a range of doses from 10 mg/kg to 100 mg/kg to establish a dose-response relationship with the reduction of serum hypertriglyceridemia in this model. These experiments support the concept of using anti-inflammatory medications as one method to correct metabolic dysfunction. PMID:16091142

  8. PPARalpha and PPARgamma activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene.

    PubMed Central

    Schoonjans, K; Peinado-Onsurbe, J; Lefebvre, A M; Heyman, R A; Briggs, M; Deeb, S; Staels, B; Auwerx, J

    1996-01-01

    Increased activity of lipoprotein lipase (LPL) may explain the hypotriglyceridemic effects of fibrates, thiazolidinediones and fatty acids, which are known activators (and/or ligands) of the various peroxisome proliferator-activated receptors (PPARs). Treatment with compounds which activate preferentially PPARalpha, such as fenofibrate, induced LPL expression exclusively in rat liver. In contrast, the antidiabetic thiazolidinedione BRL 49653, a high affinity ligand for PPARgamma, had no effect on liver, but induced LPL expression in rat adipose tissue. In the hepatocyte cell line AML-12, fenofibric acid, but not BRL 49653, induced LPL mRNA, whereas in 3T3-L1 preadipocytes, the PPARgamma ligand induced LPL mRNA levels much quicker and to a higher extent than fenofibric acid. In both the in vivo and in vitro studies, inducibility by either PPARalpha or gamma activators, correlated with the tissue distribution of the respective PPARs: an adipocyte-restricted expression of PPARgamma, whereas PPARalpha was expressed predominantly in liver. A sequence element was identified in the human LPL promoter that mediates the functional responsiveness to fibrates and thiazolidinediones. Methylation interference and gel retardation assays demonstrated that a PPARalpha or gamma and the 9-cis retinoic acid receptor (RXR) heterodimers bind to this sequence -169 TGCCCTTTCCCCC -157. These data provide evidence that transcriptional activation of the LPL gene by fibrates and thiazolidinediones is mediated by PPAR-RXR heterodimers and contributes significantly to their hypotriglyceridemic effects in vivo. Whereas thiazolidinediones predominantly affect adipocyte LPL production through activation of PPARgamma, fibrates exert their effects mainly in the liver via activation of PPARalpha. Images PMID:8895578

  9. Dexamethasone protection from TNF-alpha-induced cell death in MCF-7 cells requires NF-kappaB and is independent from AKT

    PubMed Central

    Machuca, Catalina; Mendoza-Milla, Criselda; Córdova, Emilio; Mejía, Salvador; Covarrubias, Luis; Ventura, José; Zentella, Alejandro

    2006-01-01

    Background The biochemical bases for hormone dependence in breast cancer have been recognized as an important element in tumor resistance, proliferation and metastasis. On this respect, dexamethasone (Dex) dependent protection against TNF-alpha-mediated cell death in the MCF-7 cell line has been demonstrated to be a useful model for the study of this type of cancer. Recently, cytoplasmic signaling induced by steroid receptors has been described, such as the activation of the PI3K/Akt and NF-kappaB pathways. We evaluated their possible participation in the Dex-dependent protection against TNF-alpha-mediated cell death. Results Cellular cultures of the MCF-7 cell line were exposed to either, TNF-alpha or TNF-alpha and Dex, and cell viability was evaluated. Next, negative dominants of PI3K and IkappaB-alpha, designed to block the PI3K/Akt and NF-kappaB pathways, respectively, were transfected and selection and evaluation of several clones overexpressing the mutants were examined. Also, correlation with inhibitor of apoptosis proteins (IAPs) expression was examined. Independent inhibition of these two pathways allowed us to test their participation in Dex-dependent protection against TNF-alpha-cytotoxicity in MCF-7 cells. Expression of the PI3K dominant negative mutant did not alter the protection conferred by Dex against TNF-alpha mediated cell death. Contrariwise, clones expressing the IkappaB-alpha dominant negative mutant lost the Dex-conferred protection against TNF-alpha. In these clones degradation of c-IAP was accelerated, while that of XIAP was remained unaffected. Conclusion NF-kappaB, but not PI3K/Akt activation, is required for the Dex protective effect against TNF-alpha-mediated cell death, and correlates with lack of degradation of the anti-apoptotic protein c-IAP1. PMID:16504042

  10. Protection against dexamethasone-induced muscle atrophy is related to modulation by testosterone of FOXO1 and PGC-1{alpha}

    SciTech Connect

    Qin, Weiping; Pan, Jiangping; Wu, Yong; Bauman, William A.; Cardozo, Christopher

    2010-12-17

    muscle. Regulation of FOXO1, PGC-1{alpha} and p38 MAPK by testosterone may represent a novel mechanism by which this agent protects against dexamethasone-induced muscle atrophy.

  11. Discovery of an Oxybenzylglycine Based Peroxisome Proliferator Activated Receptor Alpha Selective

    SciTech Connect

    Li, J.; Kennedy, L; Shi, Y; Tao, S; Ye, X; Chen, S; Wang, Y; Hernandez, A; Wang, W; et al.

    2010-01-01

    An 1,3-oxybenzylglycine based compound 2 (BMS-687453) was discovered to be a potent and selective peroxisome proliferator activated receptor (PPAR) {alpha} agonist, with an EC{sub 50} of 10 nM for human PPAR{alpha} and {approx}410-fold selectivity vs human PPAR{gamma} in PPAR-GAL4 transactivation assays. Similar potencies and selectivity were also observed in the full length receptor co-transfection assays. Compound 2 has negligible cross-reactivity against a panel of human nuclear hormone receptors including PPAR{delta}. Compound 2 demonstrated an excellent pharmacological and safety profile in preclinical studies and thus was chosen as a development candidate for the treatment of atherosclerosis and dyslipidemia. The X-ray cocrystal structures of the early lead compound 12 and compound 2 in complex with PPAR{alpha} ligand binding domain (LBD) were determined. The role of the crystal structure of compound 12 with PPAR{alpha} in the development of the SAR that ultimately resulted in the discovery of compound 2 is discussed.

  12. Risk and protective haplotypes of the alpha-synuclein gene associated with Parkinson's disease differentially affect cognitive sequence learning.

    PubMed

    Kéri, S; Nagy, H; Myers, C E; Benedek, G; Shohamy, D; Gluck, M A

    2008-02-01

    Alpha-synuclein (SNCA) is a key factor in the regulation of dopaminergic transmission and is related to Parkinson's disease. In this study, we investigated the effects of risk and protective SNCA haplotypes associated with Parkinson's disease on cognitive sequence learning in 204 healthy volunteers. We found that the 3'-block risk SNCA haplotypes are associated with less effective stimulus-reward learning of sequences and with superior context representation of sequences. In contrast, participants with protective haplotypes exhibit better stimulus-reward learning and worse context representation, which suggest that these functions are inversely affected by risk and protective haplotypes. The Rep1 promoter polymorphism does not influence cognitive sequence learning. Because stimulus-reward learning may be mediated by the basal ganglia and context learning may be related to the medial temporal lobe, our data raise the possibility that dopaminergic signals regulated by SNCA inversely affect these memory systems.

  13. An aqueous extract of Salacia oblonga root, a herb-derived peroxisome proliferator-activated receptor-alpha activator, by oral gavage over 28 days induces gender-dependent hepatic hypertrophy in rats.

    PubMed

    Rong, Xianglu; Kim, Moon Sun; Su, Ning; Wen, Suping; Matsuo, Yukimi; Yamahara, Johji; Murray, Michael; Li, Yuhao

    2008-06-01

    Activation of peroxisome proliferator-activated receptor (PPAR)-alpha by natural and synthetic chemicals induces hepatic hypertrophy. An aqueous extract of Salacia oblonga root (SOW) is an Ayurvedic medicine with anti-diabetic and anti-obesity properties. In the present study, it was found that SOW (100, 300 and 900mg/kg, once daily by oral gavage over a 28 day period) elicited dose-related increases in liver weight (LW) by 1.6%, 13.4% and 42.5%, respectively, and in the ratio of LW to body weight by 8.8%, 16.7% and 40.2%, respectively, in male rats. These effects were less pronounced in females. SOW selectively increased liver mass in male rats but Sudan red staining was not different, which indicates that hepatic lipid accumulation was similar in both genders. However, SOW even at the highest dosage did not influence serum ALT and AST activities in male or female rats. Moreover, SOW was found to activate PPAR-alpha in human hepatoma-derived HepG2 cells, as evidenced by the upregulation of PPAR-alpha and acyl-CoA oxidase mRNA expression. Thus, SOW-dependent PPAR-alpha activation may precede the development of the gender difference in hepatic hypertrophy; this process may be influenced by sex hormone status. PMID:18397819

  14. Telmisartan increases lipoprotein lipase expression via peroxisome proliferator-activated receptor-alpha in HepG2 cells.

    PubMed

    Yin, Shi Nan; Liu, Min; Jing, Dan Qing; Mu, Yi Ming; Lu, Ju Ming; Pan, Chang Yu

    2014-01-01

    In addition to their hypotensive properties, angiotensin receptor blockers (ARBs) have been shown to exert clinical antidyslipidemic effects. The mechanism underlying these ARB lipid metabolic effects remains unclear. Some ARBs, for example, telmisartan, activate peroxisome proliferator-activated activated receptor-gamma (PPAR-gamma). We hypothesized that PPAR-gamma-activating ARBs might exert antidyslipidemic effects via PPAR-alpha. In this study, we assessed the effect of telmisartan on the expression of PPAR-alpha and lipoprotein lipase (LPL). PPAR-alpha expression was detected by reverse-transcription polymerase chain reaction and Western blot in HepG2 hepatocytes as well as differentiated C2C12 myocytes treated with increasing concentrations of telmisartan (0.1-10 μmol/L) for 48 h. Results showed that 1 μmol/L and 10 μmol/L telmisartan significantly increased the expression of PPAR-alpha mRNA and protein in HepG2 cells (p < 0.01). No effect was shown in differentiated C2C12 cells. Similarly, 1 µmol/L and 10 μmol/L telmisartan significantly increased the expression of LPL mRNA and protein in HepG2 cells (p < 0.01), and this increase was significantly (p < 0.01) inhibited by the PPAR-alpha-specific antagonist MK886. These results indicate that certain of the antidyslipidemic effects of telmisartan might be mediated via increased PPAR-alpha-dependent induction of LPL expression. PMID:24067162

  15. Peroxisome proliferator-activated receptor alpha induction of uncoupling protein 2 protects against acetaminophen-induced liver toxicity.

    PubMed

    Patterson, Andrew D; Shah, Yatrik M; Matsubara, Tsutomu; Krausz, Kristopher W; Gonzalez, Frank J

    2012-07-01

    Acetaminophen (APAP) overdose causes acute liver failure in humans and rodents due in part to the destruction of mitochondria as a result of increased oxidative stress followed by hepatocellular necrosis. Activation of the peroxisome proliferator-activated receptor alpha (PPARα), a member of the nuclear receptor superfamily that controls the expression of genes encoding peroxisomal and mitochondrial fatty acid β-oxidation enzymes, with the experimental ligand Wy-14,643 or the clinically used fibrate drug fenofibrate, fully protects mice from APAP-induced hepatotoxicity. PPARα-humanized mice were also protected, whereas Ppara-null mice were not, thus indicating that the protection extends to human PPARα and is PPARα-dependent. This protection is due in part to induction of the PPARα target gene encoding mitochondrial uncoupling protein 2 (UCP2). Forced overexpression of UCP2 protected wildtype mice against APAP-induced hepatotoxicity in the absence of PPARα activation. Ucp2-null mice, however, were sensitive to APAP-induced hepatotoxicity despite activation of PPARα with Wy-14,643. Protection against hepatotoxicity by UCP2-induction through activation of PPARα is associated with decreased APAP-induced c-jun and c-fos expression, decreased phosphorylation of JNK and c-jun, lower mitochondrial H(2)O(2) levels, increased mitochondrial glutathione in liver, and decreased levels of circulating fatty acyl-carnitines. These studies indicate that the PPARα target gene UCP2 protects against elevated reactive oxygen species generated during drug-induced hepatotoxicity and suggest that induction of UCP2 may also be a general mechanism for protection of mitochondria during fatty acid β-oxidation.

  16. Alpha C Protein as a Carrier for Type III Capsular Polysaccharide and as a Protective Protein in Group B Streptococcal Vaccines

    PubMed Central

    Gravekamp, Claudia; Kasper, Dennis L.; Paoletti, Lawrence C.; Madoff, Lawrence C.

    1999-01-01

    The alpha C protein, a protective surface protein of group B streptococci (GBS), is present in most non-type III GBS strains. Conjugate vaccines composed of the alpha C protein and type III capsular polysaccharide (CPS) might be protective against most GBS infections. In this study, the type III CPS was covalently coupled to full-length, nine-repeat alpha C protein (resulting in III-α9r conjugate vaccine) or to two-repeat alpha C protein (resulting in III-α2r conjugate vaccine) by reductive amination. Initial experiments with the III-α9r vaccine showed that it was poorly immunogenic in mice with respect to both vaccine antigens and was suboptimally efficacious in providing protection in mice against challenge with GBS. Therefore, modified vaccination protocols were used with the III-α2r vaccine. Female mice were immunized three times with 0.5, 5, or 20 μg of the III-α2r vaccine with an aluminum hydroxide adjuvant and bred. Ninety-five percent of neonatal mice born to dams immunized with the III-α2r vaccine survived challenge with GBS expressing type III CPS, and 60% survived challenge with GBS expressing wild-type (nine-repeat) alpha C protein; 18 and 17%, respectively, of mice in the negative control groups survived (P, <0.0001). These protection levels did not differ significantly from those obtained with the type III CPS-tetanus toxoid conjugate vaccine and the unconjugated two-repeat alpha C protein, which protected 98 and 58% of neonates from infection with GBS expressing type III CPS or the alpha C protein, respectively. Thus, the two-repeat alpha C protein in the vaccine was immunogenic and simultaneously enhanced the immunogenicity of type III CPS. III-α vaccines may be alternatives to GBS polysaccharide-tetanus toxoid vaccines, eliciting additional antibodies protective against GBS infection. PMID:10225912

  17. Successive Intramuscular Boosting with IFN-Alpha Protects Mycobacterium bovis BCG-Vaccinated Mice against M. lepraemurium Infection

    PubMed Central

    Guerrero, G. G.; Rangel-Moreno, J.; Islas-Trujillo, S.; Rojas-Espinosa, Ó.

    2015-01-01

    Leprosy caused by Mycobacterium leprae primarily affects the skin and peripheral nerves. As a human infectious disease, it is still a significant health and economic burden on developing countries. Although multidrug therapy is reducing the number of active cases to approximately 0.5 million, the number of cases per year is not declining. Therefore, alternative host-directed strategies should be addressed to improve treatment efficacy and outcome. In this work, using murine leprosy as a model, a very similar granulomatous skin lesion to human leprosy, we have found that successive IFN-alpha boosting protects BCG-vaccinated mice against M. lepraemurium infection. No difference in the seric isotype and all IgG subclasses measured, neither in the TH1 nor in the TH2 type cytokine production, was seen. However, an enhanced iNOS/NO production in BCG-vaccinated/i.m. IFN-alpha boosted mice was observed. The data provided in this study suggest a promising use for IFN-alpha boosting as a new prophylactic alternative to be explored in human leprosy by targeting host innate cell response. PMID:26484351

  18. Small heat shock proteins protect against {alpha}-synuclein-induced toxicity and aggregation

    SciTech Connect

    Outeiro, Tiago Fleming; Klucken, Jochen; Strathearn, Katherine E.; Liu Fang; Nguyen, Paul; Rochet, Jean-Christophe; Hyman, Bradley T.; McLean, Pamela J. . E-mail: touteiro@partners.org

    2006-12-22

    Protein misfolding and inclusion formation are common events in neurodegenerative diseases, such as Parkinson's disease (PD), Alzheimer's disease (AD) or Huntington's disease (HD). {alpha}-Synuclein (aSyn) is the main protein component of inclusions called Lewy bodies (LB) which are pathognomic of PD, Dementia with Lewy bodies (DLB), and other diseases collectively known as LB diseases. Heat shock proteins (HSPs) are one class of the cellular quality control system that mediate protein folding, remodeling, and even disaggregation. Here, we investigated the role of the small heat shock proteins Hsp27 and {alpha}B-crystallin, in LB diseases. We demonstrate, via quantitative PCR, that Hsp27 messenger RNA levels are {approx}2-3-fold higher in DLB cases compared to control. We also show a corresponding increase in Hsp27 protein levels. Furthermore, we found that Hsp27 reduces aSyn-induced toxicity by {approx}80% in a culture model while {alpha}B-crystallin reduces toxicity by {approx}20%. In addition, intracellular inclusions were immunopositive for endogenous Hsp27, and overexpression of this protein reduced aSyn aggregation in a cell culture model.

  19. Enhanced immunogenicity of multiple-epitopes of foot-and-mouth disease virus fused with porcine interferon alpha in mice and protective efficacy in guinea pigs and swine.

    PubMed

    Du, Yijun; Li, Yufeng; He, Hairong; Qi, Jing; Jiang, Wenming; Wang, Xinglong; Tang, Bo; Cao, Jun; Wang, Xianwei; Jiang, Ping

    2008-04-01

    Foot-and-mouth disease (FMD) is a highly contagious and economically devastating vesicular disease of cloven-hoofed animals. In this study, three amino acid residues 21-60, 141-160 and 200-213 from VP1 protein of FMDV were selected as multiple-epitopes (VPe), and a recombinant adenovirus expressing the multiple-epitopes fused with porcine interferon alpha (rAd-pIFN alpha-VPe) was constructed. Six groups of female BALB/c mice (18 mice per group) were inoculated subcutaneously (s.c.) twice at 2-week intervals with the recombinant adenoviruses and the immune responses were examined. Following this the protective efficacy of rAd-pIFN alpha-VPe was examined in guinea pigs and swine. The results showed that both FMDV-specific humoral and cell-mediated immune responses could be induced by rAd-VPe and increased when rAd-pIFN alpha is included in this regime in mice model. Moreover, the levels of the immune responses in the group inoculated with rAd-pIFN alpha-VPe were significantly higher than the group inoculated with rAd-VPe plus rAd-pIFN alpha. All guinea pigs and swine vaccinated with rAd-pIFN alpha-VPe were completely protected from viral challenge. It demonstrated that recombinant adenovirus rAd-pIFN alpha-VPe might be an attractive candidate vaccine for preventing FMDV infection. PMID:18294705

  20. Possible protective role of pregnenolone-16 alpha-carbonitrile in lithocholic acid-induced hepatotoxicity through enhanced hepatic lipogenesis.

    PubMed

    Miyata, Masaaki; Nomoto, Masahiro; Sotodate, Fumiaki; Mizuki, Tomohiro; Hori, Wataru; Nagayasu, Miho; Yokokawa, Shinya; Ninomiya, Shin-ichi; Yamazoe, Yasushi

    2010-06-25

    Lithocholic acid (LCA) feeding causes both liver parenchymal and cholestatic damages in experimental animals. Although pregnenolone-16 alpha-carbonitrile (PCN)-mediated protection against LCA-induced hepatocyte injury may be explained by induction of drug metabolizing enzymes, the protection from the delayed cholestasis remains incompletely understood. Thus, the PCN-mediated protective mechanism has been studied from the point of modification of lipid metabolism. At an early stage of LCA feeding, an imbalance of biliary bile acid and phospholipid excretion was observed. Co-treatment with PCN reversed the increase in serum alanine aminotransferase (ALT) as well as alkaline phosphatase (ALP) activities and hepatic hydrophobic bile acid levels. LCA feeding decreased hepatic mRNA levels of several fatty acid- and phospholipid-related genes before elevation of serum ALT and ALP activities. On the other hand, PCN co-treatment reversed the decrease in the mRNA levels and hepatic levels of phospholipids, triglycerides and free fatty acids. PCN co-treatment also reversed the decrease in biliary phospholipid output in LCA-fed mice. Treatment with PCN alone increased hepatic phospholipid, triglyceride and free fatty acid concentrations. Hepatic fatty acid and phosphatidylcholine synthetic activities increased in mice treated with PCN alone or PCN and LCA, compared to control mice, whereas these activities decreased in LCA-fed mice. These results suggest the possibility that PCN-mediated stimulation of lipogenesis contributes to the protection from lithocholic acid-induced hepatotoxicity.

  1. The cooperative effects of TNF-alpha and IFN-gamma are determining factors in the ability of IL-10 to protect mice from lethal endotoxemia.

    PubMed

    Smith, S R; Terminelli, C; Kenworthy-Bott, L; Calzetta, A; Donkin, J

    1994-06-01

    Recent studies have demonstrated that interleukin-10 (IL-10) has the capacity to protect mice from the lethal effects of endotoxin. In this investigation, we have examined the ability of IL-10 to protect both normal mice and Corynebacterium parvum-primed mice against endotoxin lethality. In the overwhelming majority of experiments, recombinant murine IL-10 (rMuIL-10) and recombinant human IL-10 (rHuIL-10) did not protect normal BALB/cJ mice from lipopolysaccharide (LPS)-induced lethality at doses up to 10 micrograms/mouse. Despite their inability to protect, both IL-10 preparations were highly effective in preventing the increase in serum tumor necrosis factor alpha (TNF-alpha) that occurred in response to the lethal dose of LPS. Moreover, a neutralizing antibody against TNF-alpha gave only partial protection when administered alone to BALB/cJ mice. Treatment with a combination of neutralizing antibodies against TNF-alpha and interferon-gamma (IFN-gamma) resulted in complete protection. In contrast to BALB/cJ mice, normal BDF1 mice were protected from lethal endotoxemia by treatment with both rMuIL-10 and rHuIL-10. However, IL-10 did not protect C. parvum-primed BDF1 against LPS lethality even though it caused a reduction in the LPS-induced serum TNF-alpha response in C. parvum-primed mice as well as in normal BDF1 mice. Neutralizing antibodies against TNF-alpha and IFN-gamma were protective when administered alone to normal BDF1 mice, as previously demonstrated in C. parvum-primed mice. These findings suggest that lethal endotoxemia is a result of the cooperative activities of TNF-alpha and IFN-gamma in normal mice of the BALB/cJ and BDF1 strains as well as in C. parvum-primed BDF1 mice. IL-10 appears to be less effective in protecting mice from lethal endotoxemia when cooperation between IFN-gamma and TNF-alpha is facilitated by high-level production of the cytokines as in C. parvum-primed mice or when there is evidence of strong synergy between them as in normal

  2. Administration of interleukin-10 at the time of priming protects Corynebacterium parvum-primed mice against LPS- and TNF-alpha-induced lethality.

    PubMed

    Smith, S R; Terminelli, C; Denhardt, G; Narula, S; Thorbecke, G J

    1996-11-01

    Several laboratories have described the protective effects of interleukin-10 (IL-10) in mouse models of lethal endotoxemia. In most of these experiments, protection was observed in normal mice that were given a lethal dose of LPS. However, we failed to observe protection with IL-10 in LPS-challenged mice that had been primed with Corynebacterium parvum (Proprionibacterium acnes). We have extended our studies with IL-10 in C. parvum-primed mice and in some cases have observed protection that appears to depend on the strength of the sensitization to C. parvum. When IL-10 was administered to mice at the time of priming, it was particularly effective in blocking sensitization, as evidenced by the inability of treated mice to mount a strong inflammatory cytokine response when subsequently challenged with LPS. Following such treatment with IL-10, C. parvum-primed mice were also protected from a subsequent lethal challenge with rMuTNF-alpha. In addition, the mice were protected against LPS- and TNF-alpha-induced lethality with a single dose of an anti-TNF-alpha or anti-IFN-gamma mAb given at the time of priming. Our results suggest that TNF-alpha and IFN-gamma are produced early after priming with C. parvum and are at least partly responsible for the enhanced sensitivity of the mice to LPS and TNF-alpha. IL-10 affords protection to the mice because of its ability to block the C. parvum-induced TNF-alpha and IFN-gamma responses. PMID:8912878

  3. Protective effects of alpha1-acid glycoprotein and serum amyloid A on concanavalin A-induced liver failure via interleukin-6 induction by ME3738.

    PubMed

    Kuzuhara, Hiroyuki; Nakano, Yoshihisa; Yamashita, Nobuyuki; Imai, Masako; Kawamura, Yuji; Kurosawa, Tohru; Nishiyama, Shoji

    2006-07-17

    We examined whether the 22beta-methoxyolean-12-ene-3beta,24(4beta)-diol (ME3738)-mediated selective induction of interleukin-6 increased alpha1-acid glycoprotein and serum amyloid A expression, and whether these proteins protected against liver injury in vitro and in vivo. ME3738 treatment in male mice increased gene expression of alpha1-acid glycoprotein subtypes and serum amyloid A 2 genes, and plasma concentration of serum amyloid A. Treatment with alpha1-acid glycoprotein at 5 mg/animal or serum amyloid A at 0.03 and 0.1 mg/animal prior to concanavalin A administration reduced multifocal necrosis in the liver. Treatment with alpha1-acid glycoprotein and serum amyloid A, but not alpha1-antitrypsin, protected Hep G2 cells against cell injury. These results suggest that alpha1-acid glycoprotein and serum amyloid A, increased by ME3738-induced interleukin-6, might protect against concanavalin A-induced liver injury. PMID:16765939

  4. Protective effects of bacterial osmoprotectant ectoine on bovine erythrocytes subjected to staphylococcal alpha-haemolysin.

    PubMed

    Bownik, Adam; Stępniewska, Zofia

    2015-06-01

    Ectoine (ECT) is a bacterial compatible solute with documented protective action however no data are available on its effects on various cells against bacterial toxins. Therefore, we determined the in vitro influence of ECT on bovine erythrocytes subjected to staphylococcal α-haemolysin (HlyA). The cells exposed to HlyA alone showed a distinct haemolysis and reduced glutathione (GSH)/oxidised glutathione (GSSG) level, however the toxic effects were attenuated in the combinations of HlyA + ECT suggesting ECT-induced protection of erythrocytes from HlyA.

  5. Alpha-synuclein functions in the nucleus to protect against hydroxyurea-induced replication stress in yeast

    PubMed Central

    Liu, Xianpeng; Lee, Yong Joo; Liou, Liang-Chun; Ren, Qun; Zhang, Zhaojie; Wang, Shaoxiao; Witt, Stephan N.

    2011-01-01

    Hydroxyurea (HU) inhibits ribonucleotide reductase (RNR), which catalyzes the rate-limiting synthesis of deoxyribonucleotides for DNA replication. HU is used to treat HIV, sickle-cell anemia and some cancers. We found that, compared with vector control cells, low levels of alpha-synuclein (α-syn) protect S. cerevisiae cells from the growth inhibition and reactive oxygen species (ROS) accumulation induced by HU. Analysis of this effect using different α-syn mutants revealed that the α-syn protein functions in the nucleus and not the cytoplasm to modulate S-phase checkpoint responses: α-syn up-regulates histone acetylation and RNR levels, maintains helicase minichromosome maintenance protein complexes (Mcm2–7) on chromatin and inhibits HU-induced ROS accumulation. Strikingly, when residues 2–10 or 96–140 are deleted, this protective function of α-syn in the nucleus is abolished. Understanding the mechanism by which α-syn protects against HU could expand our knowledge of the normal function of this neuronal protein. PMID:21642386

  6. Effects of sulfide ions on the integrity of the protective film of benzotriazole on alpha brass in salt water

    SciTech Connect

    Ashour, E.A.; Hegazy, H.S.; Ateya, B.G.

    2000-05-01

    The addition of sulfide ions to a solution of 0.58 M NaCl containing benzotriazole (BTAH) results in a decrease of the inhibiting efficiency of BTAH and a momentary increase of the dissolution rate of alpha brass at potentials above the corrosion potential. The effect depends on the sulfide ion concentration and the potential selected for the tests. The results are explained by decomposition of the protective Cu(I)BTA film, caused by the extraction of Cu(I) ions from the film and formation of Cu{sub 2}S: nS{sup 2{minus}} + 2[Cu(I)BTA]{sub n} {yields} nCu{sub 2}S + 2nBTA{sup {minus}}. The breakdown of the film allows metal dissolution from the bare surface and further promotes the effects of sulfide ions.

  7. Protective effects of topical alpha-tocopherol acetate on UVB irradiation in guinea pigs: importance of free radicals.

    PubMed

    Saral, Y; Uyar, B; Ayar, A; Naziroglu, M

    2002-01-01

    Reactive oxygen species can be generated by daily exposure of the skin to ultraviolet light and may cause some subchronic and chronic skin disorders. The aim of this study was to investigate a possible preventive role of alpha-tocopherol acetate (ATA) on ultraviolet B (UVB) induced peroxidation by assessing lipid peroxide (LPO) levels and activity of reactive oxygen scavenging enzymes including glutathione peroxidase and superoxide dismutase (SOD) in guinea pigs. ATA was topically applied to the skin for three weeks before a single dose of 0.9 J/cm2 UVB irradiation on the skin and lipid peroxide levels and antioxidants in plasma, skin and liver and erythrocytes were determined after decapitation. Topical application of ATA prevented the UVB irradiation-induced reduction of scavenging enzyme activities in skin and erythrocytes. In conclusion, we suggest that topical applications of ATA before UVB irradiation is effective in protecting the skin from unwanted effects of UVB irradiation.

  8. Alpha-linolenic acid protects against cardiac injury and remodelling induced by beta-adrenergic overstimulation.

    PubMed

    Folino, A; Sprio, A E; Di Scipio, F; Berta, G N; Rastaldo, R

    2015-07-01

    We investigated the effect of α-linolenic acid (ALA) in protecting the heart from injury caused by β-adrenergic overstimulation. ALA's role either in isoproterenol (ISO)-treated isolated rat cardiomyocytes (H9c2 cells) or in in vivo rat hearts was studied. In isolated cardiomyocytes in vitro, the involvement of kinases (Src and PI3K) in protection was tested using the specific inhibitors (PP2 or LY294002 respectively), while the role of caveolae was assessed by their disruption with methyl-β-cyclodextrin. The rats underwent either a normal chow diet or, alternatively, an ALA-enriched diet before, during and throughout the 60 days after 5 days of isoproterenol administration. Before sacrifice, the hemodynamic changes were measured using echocardiography. In the explanted hearts, histological changes together with molecular markers of cardiac fibrosis and hypertrophy were evaluated. In H9c2 cells, ALA abolished the ISO-induced reduction of viability. This effect was suppressed by both the inhibitor PP2 or LY294002 and the caveolae disrupter methyl-β-cyclodextrin. In the rats, ALA prevented ISO-induced myocardial fibrosis and hypertrophy and kept the cardiac mechanical function as in the control. It also counteracted the increased expressions of transforming growth factor-β (TGF-β) and β-myosin (β-MHC), the decreased expression of tissue inhibitor metalloproteinase-1 (TIMP-1) and the enhanced activity of matrix metalloproteinase-2 (MMP-2). In conclusion, ALA-induced protection requires the integrity of caveolae where β2-adrenergic receptors (β2ARs) are restricted and mediate the activation of the Src-PI3K protective pathway. By preserving this β2AR pro-survival pathway, an ALA-enriched diet protects the heart against ISO-induced fibrosis and hypertrophy. PMID:26068025

  9. Carvacrol, a component of thyme oil, activates PPARalpha and gamma and suppresses COX-2 expression.

    PubMed

    Hotta, Mariko; Nakata, Rieko; Katsukawa, Michiko; Hori, Kazuyuki; Takahashi, Saori; Inoue, Hiroyasu

    2010-01-01

    Cyclooxygenase-2 (COX-2), the rate-limiting enzyme in prostaglandin biosynthesis, plays a key role in inflammation and circulatory homeostasis. Peroxisome proliferator-activated receptors (PPARs) are ligand-dependent transcription factors belonging to the nuclear receptor superfamily and are involved in the control of COX-2 expression, and vice versa. Here, we show that COX-2 promoter activity was suppressed by essential oils derived from thyme, clove, rose, eucalyptus, fennel, and bergamot in cell-based transfection assays using bovine arterial endothelial cells. Moreover, from thyme oil, we identified carvacrol as a major component of the suppressor of COX-2 expression and an activator of PPARalpha and gamma. PPARgamma-dependent suppression of COX-2 promoter activity was observed in response to carvacrol treatment. In human macrophage-like U937 cells, carvacrol suppressed lipopolysaccharide-induced COX-2 mRNA and protein expression, suggesting that carvacrol regulates COX-2 expression through its agonistic effect on PPARgamma. These results may be important in understanding the antiinflammatory and antilifestyle-related disease properties of carvacrol. PMID:19578162

  10. beta-Naphthoflavone protects from peritonitis by reducing TNF-alpha-induced endothelial cell activation.

    PubMed

    Hsu, Sheng-Yao; Liou, Je-Wen; Cheng, Tsung-Lin; Peng, Shih-Yi; Lin, Chi-Chen; Chu, Yuan-Yuan; Luo, Wei-Cheng; Huang, Zheng-Kai; Jiang, Shinn-Jong

    2015-12-01

    β-Naphthoflavone (β-NF), a ligand of the aryl hydrocarbon receptor, has been shown to possess anti-oxidative properties. We investigated the anti-oxidative and anti-inflammatory potential of β-NF in human microvascular endothelial cells treated with tumor necrosis factor-alpha (TNF-α). Pretreatment with β-NF significantly inhibited TNF-α-induced intracellular reactive oxygen species, translocation of p67(phox), and TNF-α-induced monocyte binding and transmigration. In addition, β-NF significantly inhibited TNF-α-induced ICAM-1 and VCAM-1 expression. The mRNA expression levels of the inflammatory cytokines TNF-α and IL-6 were reduced by β-NF, as was the infiltration of white blood cells, in a peritonitis model. The inhibition of adhesion molecules was associated with suppressed nuclear translocation of NF-κB p65 and Akt, and suppressed phosphorylation of ERK1/2 and p38. The translocation of Egr-1, a downstream transcription factor involved in the MEK-ERK signaling pathway, was suppressed by β-NF treatment. Our findings show that β-NF inhibits TNF-α-induced NF-kB and ERK1/2 activation and ROS generation, thereby suppressing the expression of adhesion molecules. This results in reduced adhesion and transmigration of leukocytes in vitro and prevents the infiltration of leukocytes in a peritonitis model. Our findings also suggest that β-NF might prevent TNF-α-induced inflammation.

  11. High Producing Tumor Necrosis Factor Alpha Gene Alleles in Protection against Severe Manifestations of Dengue

    PubMed Central

    Sam, Sing-Sin; Teoh, Boon-Teong; Chinna, Karuthan; AbuBakar, Sazaly

    2015-01-01

    Dengue virus (DENV) infection usually presents with mild self-limiting dengue fever (DF). Few however, would present with the more severe form of the disease, dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS). In the present study, the association between IL-12B, IL-10 and TNF-α gene polymorphisms and dengue severity was investigated. Methods: A case-control study was performed on a total of 120 unrelated controls, 86 DF patients and 196 DHF/DSS patients. The polymorphisms in IL-12B, IL-10 and TNF-α genes were genotyped using PCR-RFLP and PCR-sequencing methods. Results: A protective association of TNF-α -308A allele and -308GA genotype against DHF/DSS was observed, while TNF-α -238A allele and -238GA genotype were associated with DHF/DSS. A combination of TNF-α -308GA+AA genotype and IL-10 non-GCC haplotypes, IL-12B pro homozygotes (pro1/pro1, pro2/pro2) and IL-12B 3'UTR AC were significantly correlated with protective effects against DHF/DSS. An association between the cytokine gene polymorphisms and protection against the clinical features of severe dengue including thrombocytopenia and increased liver enzymes was observed in this study. Conclusion: The overall findings of the study support the correlation of high-producer TNF-α genotypes combined with low-producer IL-10 haplotypes and IL-12B genotypes in reduced risk of DHF/DSS. PMID:25589894

  12. Tumor necrosis factor alpha protects heart cultures against hypoxic damage via activation of PKA and phospholamban to prevent calcium overload.

    PubMed

    El-Ani, Dalia; Philipchik, Irena; Stav, Hagit; Levi, Moran; Zerbib, Jordana; Shainberg, Asher

    2014-11-01

    This study aims to elucidate the mechanisms by which tumor necrosis factor alpha (TNFα) provides protection from hypoxic damage to neonatal rat cardiomyocyte cultures. We show that when intracellular Ca(2+) ([Ca(2+)]i) levels are elevated by extracellular Ca(2+) ([Ca(2+)]o) or by hypoxia, then TNFα decreased [Ca(2+)]i in individual cardiomyocytes. However, TNFα did not reduce [Ca(2+)]i after its increase by thapsigargin, (a SERCA2a inhibitor), indicating that TNFα attenuates Ca(2+) overload through Ca(2+) uptake by SERCA2a. TNFα did not reduce [Ca(2+)]i, following its elevation when [Ca(2+)]o levels were elevated in TNFα receptor knock-out mice. H-89, a protein kinase A (PKA) inhibitor, attenuated the protective effect of TNFα when the cardiomyoctyes were subjected to hypoxia, as determined by lactate dehydrogenase (LDH) and creatine kinase (CK) released and from the cardiomyocytes. Moreover, when the levels of [Ca(2+)]i were increased by hypoxia, H-89, but not KN93, (a calmodulin kinase II inhibitor), prevented the reduction in [Ca(2+)]i by TNFα. TNFα increased the phosphorylation of PKA in normoxic and hypoxic cardiomyoctes, indicating that the cardioprotective effect of TNFα against hypoxic damage was via PKA activation. Hypoxia decreased phosphorylated phospholamban levels; however, TNFα attenuated this decrease following hypoxia. It is suggested that TNFα activates phospholamban phosphorylation in hypoxic heart cultures via PKA to stimulate SERCA2a activity to limit Ca(2+) overload.

  13. The protective effect of dietary Arthrospira (Spirulina) maxima against mutagenicity induced by benzo[alpha]pyrene in mice.

    PubMed

    Chamorro-Cevallos, Germán; Garduño-Siciliano, Leticia; Martínez-Galero, Elizdath; Mojica-Villegas, Angélica; Pages, Nicole; Gutiérrez-Salmeán, Gabriela

    2014-05-01

    Benzo[alpha]pyrene (B[α]P) was used to test the possible antimutagenic effects of Arthrospira (Spirulina) maxima (SP) on male and female mice. SP was orally administered at 0, 200, 400, or 800 mg/kg of body weight to animals of both sexes for 2 weeks before starting the B[α]P (intraperitoneal injection) at 125 mg/kg of body weight for 5 consecutive days. For the male dominant lethal test, each male was caged with two untreated females per week for 3 weeks. For the female dominant lethal test, each female was caged for 1 week with one untreated male. All the females were evaluated 13-15 days after mating for incidence of pregnancy, total corpora lutea, total implants and pre- and postimplant losses. SP protected from B[α]P-induced pre- and postimplant losses in the male dominant lethal test, and from B[α]P-induced postimplantation losses in treated females. Moreover, SP treatment significantly reduced the detrimental effect of B[α]P on the quality of mouse semen. Our results illustrate the protective effects of SP in relation to B[α]P-induced genetic damage to germ cells. We conclude that SP, owing mainly to the presence of phycocyanin, could be of potential clinical interest in cancer treatment or prevention of relapse.

  14. The Protective Effect of Dietary Arthrospira (Spirulina) maxima Against Mutagenicity Induced by Benzo[alpha]pyrene in Mice

    PubMed Central

    Garduño-Siciliano, Leticia; Martínez-Galero, Elizdath; Mojica-Villegas, Angélica; Pages, Nicole; Gutiérrez-Salmeán, Gabriela

    2014-01-01

    Abstract Benzo[alpha]pyrene (B[α]P) was used to test the possible antimutagenic effects of Arthrospira (Spirulina) maxima (SP) on male and female mice. SP was orally administered at 0, 200, 400, or 800 mg/kg of body weight to animals of both sexes for 2 weeks before starting the B[α]P (intraperitoneal injection) at 125 mg/kg of body weight for 5 consecutive days. For the male dominant lethal test, each male was caged with two untreated females per week for 3 weeks. For the female dominant lethal test, each female was caged for 1 week with one untreated male. All the females were evaluated 13–15 days after mating for incidence of pregnancy, total corpora lutea, total implants and pre- and postimplant losses. SP protected from B[α]P-induced pre- and postimplant losses in the male dominant lethal test, and from B[α]P-induced postimplantation losses in treated females. Moreover, SP treatment significantly reduced the detrimental effect of B[α]P on the quality of mouse semen. Our results illustrate the protective effects of SP in relation to B[α]P-induced genetic damage to germ cells. We conclude that SP, owing mainly to the presence of phycocyanin, could be of potential clinical interest in cancer treatment or prevention of relapse. PMID:24787733

  15. Alpha-synuclein (SNCA) polymorphisms exert protective effects on memory after mild traumatic brain injury.

    PubMed

    Shee, Kevin; Lucas, Alexandra; Flashman, Laura A; Nho, Kwangsik; Tsongalis, Gregory J; McDonald, Brenna C; Saykin, Andrew J; McAllister, Thomas W; Rhodes, C Harker

    2016-09-01

    Problems with attention and short-term learning and memory are commonly reported after mild traumatic brain injury (mTBI). Due to the known relationships between α-synuclein (SNCA), dopaminergic transmission, and neurologic deficits, we hypothesized that SNCA polymorphisms might be associated with cognitive outcome after mTBI. A cohort of 91 mTBI patients one month after injury and 86 healthy controls completed a series of cognitive tests assessing baseline intellectual function, attentional function, and memory, and was genotyped at 13 common single nucleotide polymorphisms (SNPs) in the SNCA gene. Significant differences in two memory measures (p=0.001 and 0.002), but not baseline intellectual function or attentional function tasks, were found between the mTBI group and controls. A highly significant protective association between memory performance and SNCA promoter SNP rs1372525 was observed in the mTBI patients (p=0.006 and 0.029 for the long and short delay conditions of the California Verbal Learning Tests, respectively), where the presence of at least one copy of the A (minor) allele was protective after mTBI. These results may help elucidate the pathophysiology of cognitive alterations after mTBI, and thus warrant further investigation.

  16. DNA Protection against Oxidative Damage Using the Hydroalcoholic Extract of Garcinia mangostana and Alpha-Mangostin.

    PubMed

    Carvalho-Silva, Ronaldo; Pereira, Alanna Cibelle Fernandes; Dos Santos Alves, Rúbens Prince; Guecheva, Temenouga N; Henriques, João A P; Brendel, Martin; Pungartnik, Cristina; Rios-Santos, Fabrício

    2016-01-01

    Garcinia mangostana, popularly known as "mangosteen fruit," originates from Southeast Asia and came to Brazil about 80 years ago where it mainly grows in the states of Pará and Bahia. Although mangosteen or its extracts have been used for ages in Asian folk medicine, data on its potential genotoxicity is missing. We, therefore, evaluated genotoxicity/mutagenicity of hydroethanolic mangosteen extract [HEGM, 10 to 640 μg/mL] in established test assays (Comet assay, micronucleus test, and Salmonella/microsome test). In the Comet assay, HEGM-exposed human leukocytes showed no DNA damage. No significant HEGM-induced mutation in TA98 and TA100 strains of Salmonella typhimurium (with or without metabolic activation) was observed and HEGM-exposed human lymphocytes had no increase of micronuclei. However, HEGM suggested exposure concentration-dependent antigenotoxic potential in leukocytes and antioxidant potential in the yeast Saccharomyces cerevisiae. HEGM preloading effectively protected against H2O2-induced DNA damage in leukocytes (Comet assay). Preloading of yeast with HEGM for up to 4 h significantly protected the cells from lethality of chronic H2O2-exposure, as expressed in better survival. Absence of genotoxicity and demonstration of an antigenotoxic and antioxidant potential suggest that HEGM or some substances contained in it may hold promise for pharmaceutical or nutraceutical application.

  17. DNA Protection against Oxidative Damage Using the Hydroalcoholic Extract of Garcinia mangostana and Alpha-Mangostin

    PubMed Central

    Carvalho-Silva, Ronaldo; Pereira, Alanna Cibelle Fernandes; dos Santos Alves, Rúbens Prince; Guecheva, Temenouga N.; Henriques, João A. P.; Brendel, Martin; Rios-Santos, Fabrício

    2016-01-01

    Garcinia mangostana, popularly known as “mangosteen fruit,” originates from Southeast Asia and came to Brazil about 80 years ago where it mainly grows in the states of Pará and Bahia. Although mangosteen or its extracts have been used for ages in Asian folk medicine, data on its potential genotoxicity is missing. We, therefore, evaluated genotoxicity/mutagenicity of hydroethanolic mangosteen extract [HEGM, 10 to 640 μg/mL] in established test assays (Comet assay, micronucleus test, and Salmonella/microsome test). In the Comet assay, HEGM-exposed human leukocytes showed no DNA damage. No significant HEGM-induced mutation in TA98 and TA100 strains of Salmonella typhimurium (with or without metabolic activation) was observed and HEGM-exposed human lymphocytes had no increase of micronuclei. However, HEGM suggested exposure concentration-dependent antigenotoxic potential in leukocytes and antioxidant potential in the yeast Saccharomyces cerevisiae. HEGM preloading effectively protected against H2O2-induced DNA damage in leukocytes (Comet assay). Preloading of yeast with HEGM for up to 4 h significantly protected the cells from lethality of chronic H2O2-exposure, as expressed in better survival. Absence of genotoxicity and demonstration of an antigenotoxic and antioxidant potential suggest that HEGM or some substances contained in it may hold promise for pharmaceutical or nutraceutical application. PMID:27042187

  18. DNA Protection against Oxidative Damage Using the Hydroalcoholic Extract of Garcinia mangostana and Alpha-Mangostin.

    PubMed

    Carvalho-Silva, Ronaldo; Pereira, Alanna Cibelle Fernandes; Dos Santos Alves, Rúbens Prince; Guecheva, Temenouga N; Henriques, João A P; Brendel, Martin; Pungartnik, Cristina; Rios-Santos, Fabrício

    2016-01-01

    Garcinia mangostana, popularly known as "mangosteen fruit," originates from Southeast Asia and came to Brazil about 80 years ago where it mainly grows in the states of Pará and Bahia. Although mangosteen or its extracts have been used for ages in Asian folk medicine, data on its potential genotoxicity is missing. We, therefore, evaluated genotoxicity/mutagenicity of hydroethanolic mangosteen extract [HEGM, 10 to 640 μg/mL] in established test assays (Comet assay, micronucleus test, and Salmonella/microsome test). In the Comet assay, HEGM-exposed human leukocytes showed no DNA damage. No significant HEGM-induced mutation in TA98 and TA100 strains of Salmonella typhimurium (with or without metabolic activation) was observed and HEGM-exposed human lymphocytes had no increase of micronuclei. However, HEGM suggested exposure concentration-dependent antigenotoxic potential in leukocytes and antioxidant potential in the yeast Saccharomyces cerevisiae. HEGM preloading effectively protected against H2O2-induced DNA damage in leukocytes (Comet assay). Preloading of yeast with HEGM for up to 4 h significantly protected the cells from lethality of chronic H2O2-exposure, as expressed in better survival. Absence of genotoxicity and demonstration of an antigenotoxic and antioxidant potential suggest that HEGM or some substances contained in it may hold promise for pharmaceutical or nutraceutical application. PMID:27042187

  19. Alpha-synuclein (SNCA) polymorphisms exert protective effects on memory after mild traumatic brain injury.

    PubMed

    Shee, Kevin; Lucas, Alexandra; Flashman, Laura A; Nho, Kwangsik; Tsongalis, Gregory J; McDonald, Brenna C; Saykin, Andrew J; McAllister, Thomas W; Rhodes, C Harker

    2016-09-01

    Problems with attention and short-term learning and memory are commonly reported after mild traumatic brain injury (mTBI). Due to the known relationships between α-synuclein (SNCA), dopaminergic transmission, and neurologic deficits, we hypothesized that SNCA polymorphisms might be associated with cognitive outcome after mTBI. A cohort of 91 mTBI patients one month after injury and 86 healthy controls completed a series of cognitive tests assessing baseline intellectual function, attentional function, and memory, and was genotyped at 13 common single nucleotide polymorphisms (SNPs) in the SNCA gene. Significant differences in two memory measures (p=0.001 and 0.002), but not baseline intellectual function or attentional function tasks, were found between the mTBI group and controls. A highly significant protective association between memory performance and SNCA promoter SNP rs1372525 was observed in the mTBI patients (p=0.006 and 0.029 for the long and short delay conditions of the California Verbal Learning Tests, respectively), where the presence of at least one copy of the A (minor) allele was protective after mTBI. These results may help elucidate the pathophysiology of cognitive alterations after mTBI, and thus warrant further investigation. PMID:27478013

  20. Activators of the nuclear hormone receptors PPARalpha and FXR accelerate the development of the fetal epidermal permeability barrier.

    PubMed Central

    Hanley, K; Jiang, Y; Crumrine, D; Bass, N M; Appel, R; Elias, P M; Williams, M L; Feingold, K R

    1997-01-01

    Members of the superfamily of nuclear hormone receptors which are obligate heterodimeric partners of the retinoid X receptor may be important in epidermal development. Here, we examined the effects of activators of the receptors for vitamin D3 and retinoids, and of the peroxisome proliferator activated receptors (PPARs) and the farnesoid X-activated receptor (FXR), on the development of the fetal epidermal barrier in vitro. Skin explants from gestational day 17 rats (term is 22 d) are unstratified and lack a stratum corneum (SC). After incubation in hormone-free media for 3-4 d, a multilayered SC replete with mature lamellar membranes in the interstices and a functionally competent barrier appear. 9-cis or all-trans retinoic acid, 1,25 dihydroxyvitamin D3, or the PPARgamma ligands prostaglandin J2 or troglitazone did not affect the development of barrier function or epidermal morphology. In contrast, activators of the PPARalpha, oleic acid, linoleic acid, and clofibrate, accelerated epidermal development, resulting in mature lamellar membranes, a multilayered SC, and a competent barrier after 2 d of incubation. The FXR activators, all-trans farnesol and juvenile hormone III, also accelerated epidermal barrier development. Activities of beta-glucocerebrosidase and steroid sulfatase, enzymes previously linked to barrier maturation, also increased after treatment with PPARalpha and FXR activators. In contrast, isoprenoids, such as nerolidol, cis-farnesol, or geranylgeraniol, or metabolites in the cholesterol pathway, such as mevalonate, squalene, or 25-hydroxycholesterol, did not alter barrier development. Finally, additive effects were observed in explants incubated with clofibrate and farnesol together in suboptimal concentrations which alone did not affect barrier development. These data indicate a putative physiologic role for PPARalpha and FXR in epidermal barrier development. PMID:9239419

  1. Protective Efficacy of Alpha-lipoic Acid against AflatoxinB1-induced Oxidative Damage in the Liver

    PubMed Central

    Li, Y.; Ma, Q. G.; Zhao, L. H.; Guo, Y. Q.; Duan, G. X.; Zhang, J. Y.; Ji, C.

    2014-01-01

    Alpha-lipoic acid (α-LA) is not only involved in energy metabolism, but is also a powerful antioxidant that can protect against hepatic oxidative stress induced by some drugs, toxins, or under various physiological and pathophysiological conditions. Here, we investigated the effect of α-LA against liver oxidative damage in broilers exposed to aflatoxin B1 (AFB1). Birds were randomly divided into four groups and assigned different diets: basal diet, 300 mg/kg α-LA supplementation in basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1, for 3 weeks. The results revealed that the addition of 300 mg/kg α-LA protected against the liver function damage of broilers induced by chronic low dose of AFB1 as estimated by a significant (p<0.05) change in levels of plasma total protein, albumin, alkaline phosphatase and the activities of liver glutamic-oxalacetic transaminase and glutamic-pyruvic transaminase. The histopathological analysis also showed that liver tissues were injured in the AFB1 diet, but this effect was alleviated by the addition of 300 mg/kg α-LA. Additionally, AFB1 induced a profound elevation of oxidative stress in birds, as indicated by an increase in malondialdehyde level, a decrease in glutathione peroxidase activity and a depletion of the glutathione content in the liver. All of these negative effects were inhibited by treatment with α-LA. Our results suggest that the inhibition of AFB1-induced excess production of lipid peroxides and the maintenance of intracellular antioxidant status may play important roles in the protective effects of α-LA against AFB1-induced oxidative damage in the liver. PMID:25050030

  2. Myeloid derived hypoxia inducible factor 1-alpha is required for protection against pulmonary Aspergillus fumigatus infection.

    PubMed

    Shepardson, Kelly M; Jhingran, Anupam; Caffrey, Alayna; Obar, Joshua J; Suratt, Benjamin T; Berwin, Brent L; Hohl, Tobias M; Cramer, Robert A

    2014-09-01

    Hypoxia inducible factor 1α (HIF1α) is the mammalian transcriptional factor that controls metabolism, survival, and innate immunity in response to inflammation and low oxygen. Previous work established that generation of hypoxic microenvironments occurs within the lung during infection with the human fungal pathogen Aspergillus fumigatus. Here we demonstrate that A. fumigatus stabilizes HIF1α protein early after pulmonary challenge that is inhibited by treatment of mice with the steroid triamcinolone. Utilizing myeloid deficient HIF1α mice, we observed that HIF1α is required for survival and fungal clearance early following pulmonary challenge with A. fumigatus. Unlike previously reported research with bacterial pathogens, HIF1α deficient neutrophils and macrophages were surprisingly not defective in fungal conidial killing. The increase in susceptibility of the myeloid deficient HIF1α mice to A. fumigatus was in part due to decreased early production of the chemokine CXCL1 (KC) and increased neutrophil apoptosis at the site of infection, resulting in decreased neutrophil numbers in the lung. Addition of recombinant CXCL1 restored neutrophil survival and numbers, murine survival, and fungal clearance. These results suggest that there are unique HIF1α mediated mechanisms employed by the host for protection and defense against fungal pathogen growth and invasion in the lung. Additionally, this work supports the strategy of exploring HIF1α as a therapeutic target in specific immunosuppressed populations with fungal infections.

  3. Myeloid Derived Hypoxia Inducible Factor 1-alpha Is Required for Protection against Pulmonary Aspergillus fumigatus Infection

    PubMed Central

    Shepardson, Kelly M.; Jhingran, Anupam; Caffrey, Alayna; Obar, Joshua J.; Suratt, Benjamin T.; Berwin, Brent L.; Hohl, Tobias M.; Cramer, Robert A.

    2014-01-01

    Hypoxia inducible factor 1α (HIF1α) is the mammalian transcriptional factor that controls metabolism, survival, and innate immunity in response to inflammation and low oxygen. Previous work established that generation of hypoxic microenvironments occurs within the lung during infection with the human fungal pathogen Aspergillus fumigatus. Here we demonstrate that A. fumigatus stabilizes HIF1α protein early after pulmonary challenge that is inhibited by treatment of mice with the steroid triamcinolone. Utilizing myeloid deficient HIF1α mice, we observed that HIF1α is required for survival and fungal clearance early following pulmonary challenge with A. fumigatus. Unlike previously reported research with bacterial pathogens, HIF1α deficient neutrophils and macrophages were surprisingly not defective in fungal conidial killing. The increase in susceptibility of the myeloid deficient HIF1α mice to A. fumigatus was in part due to decreased early production of the chemokine CXCL1 (KC) and increased neutrophil apoptosis at the site of infection, resulting in decreased neutrophil numbers in the lung. Addition of recombinant CXCL1 restored neutrophil survival and numbers, murine survival, and fungal clearance. These results suggest that there are unique HIF1α mediated mechanisms employed by the host for protection and defense against fungal pathogen growth and invasion in the lung. Additionally, this work supports the strategy of exploring HIF1α as a therapeutic target in specific immunosuppressed populations with fungal infections. PMID:25255025

  4. Adiponectin promotes hyaluronan synthesis along with increases in hyaluronan synthase 2 transcripts through an AMP-activated protein kinase/peroxisome proliferator-activated receptor-{alpha}-dependent pathway in human dermal fibroblasts

    SciTech Connect

    Yamane, Takumi; Kobayashi-Hattori, Kazuo; Oishi, Yuichi

    2011-11-18

    Highlights: Black-Right-Pointing-Pointer Adiponectin promotes hyaluronan synthesis along with an increase in HAS2 transcripts. Black-Right-Pointing-Pointer Adiponectin also increases the phosphorylation of AMPK. Black-Right-Pointing-Pointer A pharmacological activator of AMPK increases mRNA levels of PPAR{alpha} and HAS2. Black-Right-Pointing-Pointer Adiponectin-induced HAS2 mRNA expression is blocked by a PPAR{alpha} antagonist. Black-Right-Pointing-Pointer Adiponectin promotes hyaluronan synthesis via an AMPK/PPAR{alpha}-dependent pathway. -- Abstract: Although adipocytokines affect the functions of skin, little information is available on the effect of adiponectin on the skin. In this study, we investigated the effect of adiponectin on hyaluronan synthesis and its regulatory mechanisms in human dermal fibroblasts. Adiponectin promoted hyaluronan synthesis along with an increase in the mRNA levels of hyaluronan synthase 2 (HAS2), which plays a primary role in hyaluronan synthesis. Adiponectin also increased the phosphorylation of AMP-activated protein kinase (AMPK). A pharmacological activator of AMPK, 5-aminoimidazole-4-carboxamide-1{beta}-ribofuranoside (AICAR), increased mRNA levels of peroxisome proliferator-activated receptor-{alpha} (PPAR{alpha}), which enhances the expression of HAS2 mRNA. In addition, AICAR increased the mRNA levels of HAS2. Adiponectin-induced HAS2 mRNA expression was blocked by GW6471, a PPAR{alpha} antagonist, in a concentration-dependent manner. These results show that adiponectin promotes hyaluronan synthesis along with increases in HAS2 transcripts through an AMPK/PPAR{alpha}-dependent pathway in human dermal fibroblasts. Thus, our study suggests that adiponectin may be beneficial for retaining moisture in the skin, anti-inflammatory activity, and the treatment of a variety of cutaneous diseases.

  5. Relation of in vitro inhibition by chelates of Clostridium perfringens alpha-toxin to their ability to protect against experimental toxemia.

    PubMed

    Senff, L M; Moskowitz, M

    1969-04-01

    The inhibition of Clostridium perfringens alpha-toxin by ethylenediaminetetraacetate (EDTA) and diethylenetriaminepentacetate (DTPA) was studied utilizing three different in vitro assay procedures: diffusion on egg yolk-agar, disintegration of muscle sections, and manometric assay with partially purified lecithin as substrate. DTPA was 10 to 20 times more efficient as an inhibitor than EDTA in systems containing relatively large amounts of calcium; these observations were similar to those observed in previous in vivo protection studies. A number of other chelating agents were tested for their ability to inhibit alpha-toxin in vitro and protect mice against it; the chelating agents which were the most efficient in vitro inhibitors had the greatest in vivo protective ability.

  6. The Protective Effects of Alpha-Lipoic Acid and Coenzyme Q10 Combination on Ovarian Ischemia-Reperfusion Injury: An Experimental Study

    PubMed Central

    Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem

    2016-01-01

    Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion.

  7. The Protective Effects of Alpha-Lipoic Acid and Coenzyme Q10 Combination on Ovarian Ischemia-Reperfusion Injury: An Experimental Study.

    PubMed

    Tuncer, Ahmet Ali; Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem

    2016-01-01

    Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion. PMID:27597986

  8. The Protective Effects of Alpha-Lipoic Acid and Coenzyme Q10 Combination on Ovarian Ischemia-Reperfusion Injury: An Experimental Study

    PubMed Central

    Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem

    2016-01-01

    Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion. PMID:27597986

  9. Entacapone and tolcapone, two catechol O-methyltransferase inhibitors, block fibril formation of alpha-synuclein and beta-amyloid and protect against amyloid-induced toxicity.

    PubMed

    Di Giovanni, Saviana; Eleuteri, Simona; Paleologou, Katerina E; Yin, Guowei; Zweckstetter, Markus; Carrupt, Pierre-Alain; Lashuel, Hilal A

    2010-05-14

    Parkinson disease (PD) is the second most common neurodegenerative disorder after Alzheimer disease (AD). There is considerable consensus that the increased production and/or aggregation of alpha-synuclein (alpha-syn) plays a central role in the pathogenesis of PD and related synucleinopathies. Current therapeutic strategies for treating PD offer mainly transient symptomatic relief and aim at the restitution of dopamine levels to counterbalance the loss of dopaminergic neurons. Therefore, the identification and development of drug-like molecules that block alpha-synuclein aggregation and prevent the loss of dopaminergic neurons are desperately needed to treat or slow the progression of PD. Here, we show that entacapone and tolcapone are potent inhibitors of alpha-syn and beta-amyloid (Abeta) oligomerization and fibrillogenesis, and they also protect against extracellular toxicity induced by the aggregation of both proteins. Comparison of the anti-aggregation properties of entacapone and tolcapone with the effect of five other catechol-containing compounds, dopamine, pyrogallol, gallic acid, caffeic acid, and quercetin on the oligomerization and fibrillization of alpha-syn and Abeta, demonstrate that the catechol moiety is essential for the anti-amyloidogenic activity. Our findings present the first characterization of the anti-amyloidogenic properties of tolcapone and entacapone against both alpha-synuclein and Abeta42 and highlight the potential of this class of nitro-catechol compounds as anti-amyloidogenic agents. Their inhibitory properties, mode of action, and structural properties suggest that they constitute promising lead compounds for further optimization. PMID:20150427

  10. The Protective Effects of Alpha-Lipoic Acid and Coenzyme Q10 Combination on Ovarian Ischemia-Reperfusion Injury: An Experimental Study.

    PubMed

    Tuncer, Ahmet Ali; Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem

    2016-01-01

    Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion.

  11. Limited protective role of V-PYRRO/NO against cholestasis produced by alpha-naphthylisothiocyanate in mice.

    PubMed

    Liu, Jie; He, Yu-Ying; Chignell, Colin F; Clark, James; Myers, Page; Saavedra, Joseph E; Waalkes, Michael P

    2005-07-01

    O(2)-vinyl 1-(pyrrolidin-1-yl)diazen-1-ium-1,2-diolate (V-PYRRO/NO) is a liver-selective nitric oxide donor that has been shown to protect against hepatotoxic effects of endotoxin, acetaminophen and cadmium. This study examined the effects of V-PYRRO/NO on alpha-naphthylisothiocyanate (ANIT)-induced hepatotoxicity in mice. Mice were given V-PYRRO/NO via osmotic pumps (5.4mg/ml; 0.5 microl/h) starting 24h before receiving a hepatotoxic dose of ANIT (150mg/kg in olive oil, i.g.), and continuing for additional 48h (3-day pumps). V-PYRRO/NO administration partially ameliorated ANIT-induced hepatotoxicity, as evidenced by reduced serum alanine aminotransferase and alkaline phosphatase, markers of liver cell death, and by improved liver pathology. However, V-PYRRO/NO had no effect on ANIT-induced cholestasis, as ANIT-increased serum bilirubin levels and gamma-glutamyl transpeptidase activity were not ameliorated. Microarray and real time RT-PCR analysis revealed that ANIT intoxication altered expression of various genes, including genes encoding metabolic enzymes, transporter proteins, acute phase proteins, inflammation- and, apoptosis-related genes, as well as other genes related to liver injury. V-PYRRO/NO treatment attenuated ANIT-induced elevations in certain inflammation- and apoptosis-related genes, but had no effect on ANIT-induced disturbance on the expression of genes related to metabolism, transport, and acute phase proteins. Thus, the liver-selective NO donor, V-PYRRO/NO, was partially protective against ANIT-induced liver injury, without affecting ANIT-induced cholestasis and cholestasis-related gene expression. PMID:15913567

  12. A recombinant DNA vaccine protects mice deficient in the alpha/beta interferon receptor against lethal challenge with Usutu virus.

    PubMed

    Martín-Acebes, Miguel A; Blázquez, Ana-Belén; Cañas-Arranz, Rodrigo; Vázquez-Calvo, Ángela; Merino-Ramos, Teresa; Escribano-Romero, Estela; Sobrino, Francisco; Saiz, Juan-Carlos

    2016-04-19

    Usutu virus (USUV) is a mosquito-borne flavivirus whose circulation had been confined to Africa since it was first detected in 1959. However, in the last decade USUV has emerged in Europe causing episodes of avian mortality and sporadic severe neuroinvasive infections in humans. Remarkably, adult laboratory mice exhibit limited susceptibility to USUV infection, which has impaired the analysis of the immune responses, thus complicating the evaluation of virus-host interactions and of vaccine candidates against this pathogen. In this work, we showed that mice deficient in the alpha/beta interferon receptor (IFNAR (-/-) mice) were highly susceptible to USUV infection and provided a lethal challenge model for vaccine testing. To validate this infection model, a plasmid DNA vaccine candidate encoding the precursor of membrane (prM) and envelope (E) proteins of USUV was engineered. Transfection of cultured cells with this plasmid resulted in expression of USUV antigens and the assembly and secretion of small virus-like particles also known as recombinant subviral particles (RSPs). A single intramuscular immunization with this plasmid was sufficient to elicit a significant level of protection against challenge with USUV in IFNAR (-/-) mice. The characterization of the humoral response induced revealed that DNA vaccination primed anti-USUV antibodies, including neutralizing antibodies. Overall, these results probe the suitability of IFNAR (-/-) mice as an amenable small animal model for the study of USUV host virus interactions and vaccine testing, as well as the feasibility of DNA-based vaccine strategies for the control of this pathogen.

  13. Effects of alpha-zirconium phosphate on thermal degradation and flame retardancy of transparent intumescent fire protective coating

    SciTech Connect

    Xing, Weiyi; Zhang, Ping; Song, Lei; Wang, Xin; Hu, Yuan

    2014-01-01

    Graphical abstract: - Highlights: • A transparent intumescent fire protective coating was obtained by UV-cured technology. • OZrP could enhance the thermal stability and anti-oxidation of the coating. • OZrP could reduce the combustion properties of the coatings. - Abstract: Organophilic alpha-zirconium phosphate (OZrP) was used to improve the thermal and fire retardant behaviors of the phenyl di(acryloyloxyethyl)phosphate (PDHA)-triglycidyl isocyanurate acrylate (TGICA)-2-phenoxyethyl acrylate (PHEA) (PDHA-TGICA-PHEA) coating. The morphology of nanocomposite coating was characterized by X-ray diffraction (XRD) and transmission electron microscopy (TEM). The effect of OZrP on the flame retardancy, thermal stability, fireproofing time and char formation of the coatings was investigated by microscale combustion calorimeter (MCC), thermogravimetric analysis (TGA), X-ray photoelectron spectroscopy (XPS), laser Raman spectroscopy (LRS) and scanning electric microscope (SEM). The results showed that by adding OZrP, the peak heat release rate and total heat of combustion were significantly reduced. The highest improvement was achieved with 0.5 wt% OZrP. XPS analysis indicated that the performance of anti-oxidation of the coating was improved with the addition of OZrP, and SEM images showed that a good synergistic effect was obtained through a ceramic-like layer produced by OZrP covered on the surface of char.

  14. Alpha lipoic acid protects the heart against myocardial post ischemia-reperfusion arrhythmias via KATP channel activation in isolated rat hearts.

    PubMed

    Dudek, Magdalena; Knutelska, Joanna; Bednarski, Marek; Nowiński, Leszek; Zygmunt, Małgorzata; Bilska-Wilkosz, Anna; Iciek, Małgorzata; Otto, Monika; Żytka, Iwona; Sapa, Jacek; Włodek, Lidia; Filipek, Barbara

    2014-06-01

    The cardiovascular effects of alpha lipoic acid were evaluated in isolated rat hearts exposed to ischemia-reperfusion injury in vitro. Alpha-lipoic acid raised the level of sulfane sulfur playing an important role in the release of hydrogen sulfide. H2S was shown to prevent the post-reperfusion arrhythmias and to protect the cardiomyocytes from death caused by hypoxia. The activation of potassium ATP-sensitive channels (K(ATP) channels) is one of the most important mechanisms of action of hydrogen sulfide in the cardiovascular system. The aim of this study was to investigate whether alpha lipoic acid can prevent the occurrence of post-reperfusion arrhythmias in vitro using a Langendorff model of ischemia-reperfusion in rats affecting the K(ATP) channels. Alpha lipoic acid significantly improved post-reperfusion cardiac function (reducing incidence of arrhythmias), especially in a dose of 10(-7)M. These cardiovascular effects of this compound on the measured parameters were reversed by glibenclamide, a selective K(ATP) blocker. Alpha lipoic acid increased the level of sulfane sulfur in the hearts. This may suggest that the positive effects caused by alpha lipoic acid in the cardiovascular system are not only related to its strong antioxidant activity, and the influence on the activity of such enzymes as aldehyde dehydrogenase 2, as previously suggested, but this compound can affect K(ATP) channels. It is possible that this indirect effect of alpha lipoic acid is connected with changes in the release of sulfane sulfur and hydrogen sulfide.

  15. Infection of Human Fallopian Tube Epithelial Cells with Neisseria gonorrhoeae Protects Cells from Tumor Necrosis Factor Alpha-Induced Apoptosis

    PubMed Central

    Morales, Priscilla; Reyes, Paz; Vargas, Macarena; Rios, Miguel; Imarai, Mónica; Cardenas, Hugo; Croxatto, Horacio; Orihuela, Pedro; Vargas, Renato; Fuhrer, Juan; Heckels, John E.; Christodoulides, Myron; Velasquez, Luis

    2006-01-01

    Following infection with Neisseria gonorrhoeae, bacteria may ascend into the Fallopian tubes (FT) and induce salpingitis, a major cause of infertility. In the FT, interactions between mucosal epithelial cells and gonococci are pivotal events in the pathogen's infection cycle and the inflammatory response. In the current study, primary FT epithelial cells were infected in vitro with different multiplicities of infection (MOI) of Pil+ Opa+ gonococci. Bacteria showed a dose-dependent association with cells and induced the secretion of tumor necrosis factor alpha (TNF-α). A significant finding was that gonococcal infection (MOI = 1) induced apoptosis in approximately 30% of cells, whereas increasing numbers of bacteria (MOI = 10 to 100) did not induce apoptosis. Apoptosis was observed in only 11% of cells with associated bacteria, whereas >84% of cells with no adherent bacteria were apoptotic. TNF-α was a key contributor to apoptosis, since (i) culture supernatants from cells infected with gonococci (MOI = 1) induced apoptosis in naïve cultures, suggesting that a soluble factor was responsible; (ii) gonococcal infection-induced apoptosis was inhibited with anti-TNF-α antibodies; and (iii) the addition of exogenous TNF-α induced apoptosis, which was inhibited by the presence of increasing numbers of bacteria (MOI = 10 to 100). These data suggest that TNF-α-mediated apoptosis of FT epithelial cells is likely a primary host defense mechanism to prevent pathogen colonization. However, epithelial cell-associated gonococci have evolved a mechanism to protect the cells from undergoing TNF-α-mediated apoptosis, and this modulation of the host innate response may contribute to establishment of infection. Understanding the antiapoptotic mechanisms used by Neisseria gonorrhoeae will inform the pathogenesis of salpingitis and could suggest new intervention strategies for prevention and treatment of the disease. PMID:16714596

  16. Alpha/Beta Interferon Protects against Lethal West Nile Virus Infection by Restricting Cellular Tropism and Enhancing Neuronal Survival

    PubMed Central

    Samuel, Melanie A.; Diamond, Michael S.

    2005-01-01

    West Nile virus (WNV) is a mosquito-borne flavivirus that is neurotropic in humans, birds, and other animals. While adaptive immunity plays an important role in preventing WNV spread to the central nervous system (CNS), little is known about how alpha/beta interferon (IFN-α/β) protects against peripheral and CNS infection. In this study, we examine the virulence and tropism of WNV in IFN-α/β receptor-deficient (IFN- α/βR−/−) mice and primary neuronal cultures. IFN-α/βR−/− mice were acutely susceptible to WNV infection through subcutaneous inoculation, with 100% mortality and a mean time to death (MTD) of 4.6 ± 0.7 and 3.8± 0.5 days after infection with 100 and 102 PFU, respectively. In contrast, congenic wild-type 129Sv/Ev mice infected with 102 PFU showed 62% mortality and a MTD of 11.9 ± 1.9 days. IFN-α/βR−/− mice developed high viral loads by day 3 after infection in nearly all tissues assayed, including many that were not infected in wild-type mice. IFN-α/βR−/− mice also demonstrated altered cellular tropism, with increased infection in macrophages, B cells, and T cells in the spleen. Additionally, treatment of primary wild-type neurons in vitro with IFN-β either before or after infection increased neuronal survival independent of its effect on WNV replication. Collectively, our data suggest that IFN-α/β controls WNV infection by restricting tropism and viral burden and by preventing death of infected neurons. PMID:16227257

  17. C-peptide signals via Galpha i to protect against TNF-alpha-mediated apoptosis of opossum kidney proximal tubular cells.

    PubMed

    Al-Rasheed, Nawal M; Willars, Gary B; Brunskill, Nigel J

    2006-04-01

    Cell loss by apoptosis occurs in renal injury such as diabetic nephropathy. TNF-alpha is a cytokine that induces apoptosis and has been implicated in the pathogenesis of diabetic nephropathy. The aim was to investigate whether C-peptide or insulin could modulate TNF-alpha-mediated cell death in opossum kidney proximal tubular cells and to examine the mechanism(s) of any effects observed. C-peptide and insulin protect against TNF-alpha-induced proximal tubular cell toxicity and apoptosis. Cell viability was analyzed by methylthiazoletetrazolium assay; cell viability was reduced to 60.8 +/- 2.7% of control after stimulation with 300 ng/ml TNF-alpha. Compromised cell viability was reversed by pretreatment with 5 nM C-peptide or 100 nM insulin. TNF-alpha-induced apoptosis was detected by DNA nick-end labeling and by measuring histone associated DNA fragments using ELISA. By ELISA assay, 300 ng/ml TNF-alpha increased apoptosis by 145.8 +/- 4.9% compared with controls, whereas 5 nM C-peptide and 100 nM insulin reduced apoptosis to 81.6 +/- 4.8 and 77.4 +/- 3.1% of control, respectively. The protective effects of C-peptide and insulin were associated with activation of NF-kappaB. Activation of NF-kappaB by C-peptide was pertussis toxin sensitive and dependent on activation of Galpha(i). Phosphatidylinositol 3-kinase but not extracellular signal regulated mitogen-activated protein kinase mediated C-peptide and insulin activation of NF-kappaB. The cytoprotective effects of both C-peptide and insulin were related to increased expression of TNF receptor-associated factor 2, the product of an NF-kappaB-dependent survival gene. These data suggest that C-peptide and/or insulin activation of NF-kappaB-regulated survival genes protects against TNF-alpha-induced renal tubular injury in diabetes. The data further support the concept of C-peptide as a peptide hormone in its own right and suggest a potential therapeutic role for C-peptide. PMID:16510765

  18. Unexpected tolerance of glycosylation by UDP-GalNAc:polypeptide alpha-N-acetylgalactosaminyltransferase revealed by electron capture dissociation mass spectrometry: carbohydrate as potential protective groups.

    PubMed

    Yoshimura, Yayoi; Matsushita, Takahiko; Fujitani, Naoki; Takegawa, Yasuhiro; Fujihira, Haruhiko; Naruchi, Kentarou; Gao, Xiao-Dong; Manri, Naomi; Sakamoto, Takeshi; Kato, Kentaro; Hinou, Hiroshi; Nishimura, Shin-Ichiro

    2010-07-20

    peptides were employed for the acceptor substrates. Unexpected characteristics of ppGalNAcT2 motivated us to challenge site-directed installation of alpha-GalNAc residues at desired position(s) by protecting some hydroxyl groups of Thr/Ser residues with selectively removable sugars, notably a novel concept as "carbohydrate as protective groups", toward a goal of the systematic chemical and enzymatic synthesis of biologically important mucin glycopeptides.

  19. Chaperone-like activity of alpha-cyclodextrin via hydrophobic nanocavity to protect native structure of ADH.

    PubMed

    Barzegar, Abolfazl; Moosavi-Movahedi, Ali A; Mahnam, Karim; Ashtiani, Saman Hosseini

    2010-01-26

    The chaperone action of alpha-cyclodextrin (alpha-CyD), based on providing beneficial microenvironment of hydrophobic nanocavity to form molecular complex with alcohol dehydrogenase (ADH) was examined by experimental and computational techniques. The results of UV-vis and dynamic light scattering (DLS) indicated that the chaperone-like activity of alpha-CyD depends on molecular complex formation between alpha-CyD and ADH, which caused to decrease the amount and size of polymerized molecules. Computational calculations of molecular dynamic (MD) simulations and blind docking (BD) demonstrated that alpha-CyD acts as an artificial chaperone because of its high affinity to the region of ADH's two chains interface. The hydrophobic nanocavity of alpha-CyD has the ability to form inclusion complex due to the presence of phenyl ring of aromatic phenylalanine (Phe) residue in the dimeric intersection area. Delocalization of ADH subunits, which causes the exposure of Phe110, takes part in the enzyme polymerization and has proven to be beneficial for aggregation inhibition and solubility enhancement within the host alpha-CyD-nanocavity.

  20. Discovery of an Oxybenzylglycine Based Peroxisome Proliferator Activated Receptor [alpha] Selective Agonist 2-((3-((2-(4-Chlorophenyl)-5-methyloxazol-4-yl)methoxy)benzyl)(methoxycarbonyl)amino)acetic Acid (BMS-687453)

    SciTech Connect

    Li, Jun; Kennedy, Lawrence J.; Shi, Yan; Tao, Shiwei; Ye, Xiang-Yang; Chen, Stephanie Y.; Wang, Ying; Hernndez, Andrs S.; Wang, Wei; Devasthale, Pratik V.; Chen, Sean; Lai, Zhi; Zhang, Hao; Wu, Shung; Smirk, Rebecca A.; Bolton, Scott A.; Ryono, Denis E.; Zhang, Huiping; Lim, Ngiap-Kie; Chen, Bang-Chi; Locke, Kenneth T.; O’Malley, Kevin M.; Zhang, Litao; Srivastava, Rai Ajit; Miao, Bowman; Meyers, Daniel S.; Monshizadegan, Hossain; Search, Debra; Grimm, Denise; Zhang, Rongan; Harrity, Thomas; Kunselman, Lori K.; Cap, Michael; Kadiyala, Pathanjali; Hosagrahara, Vinayak; Zhang, Lisa; Xu, Carrie; Li, Yi-Xin; Muckelbauer, Jodi K.; Chang, Chiehying; An, Yongmi; Krystek, Stanley R.; Blanar, Michael A.; Zahler, Robert; Mukherjee, Ranjan; Cheng, Peter T.W.; Tino, Joseph A.

    2010-04-12

    An 1,3-oxybenzylglycine based compound 2 (BMS-687453) was discovered to be a potent and selective peroxisome proliferator activated receptor (PPAR) {alpha} agonist, with an EC{sub 50} of 10 nM for human PPAR{alpha} and 410-fold selectivity vs human PPAR{gamma} in PPAR-GAL4 transactivation assays. Similar potencies and selectivity were also observed in the full length receptor co-transfection assays. Compound 2 has negligible cross-reactivity against a panel of human nuclear hormone receptors including PPAR{delta}. Compound 2 demonstrated an excellent pharmacological and safety profile in preclinical studies and thus was chosen as a development candidate for the treatment of atherosclerosis and dyslipidemia. The X-ray cocrystal structures of the early lead compound 12 and compound 2 in complex with PPAR{alpha} ligand binding domain (LBD) were determined. The role of the crystal structure of compound 12 with PPAR{alpha} in the development of the SAR that ultimately resulted in the discovery of compound 2 is discussed.

  1. Differentiation of Boc-protected alpha,delta-/delta,alpha- and beta,delta-/delta,beta-hybrid peptide positional isomers by electrospray ionization tandem mass spectrometry.

    PubMed

    Raju, G; Ramesh, V; Srinivas, R; Sharma, G V M; Shoban Babu, B

    2010-06-01

    Two new series of Boc-N-alpha,delta-/delta,alpha- and beta,delta-/delta,beta-hybrid peptides containing repeats of L-Ala-delta(5)-Caa/delta(5)-Caa-L-Ala and beta(3)-Caa-delta(5)-Caa/delta(5)-Caa-beta(3)-Caa (L-Ala = L-alanine, Caa = C-linked carbo amino acid derived from D-xylose) have been differentiated by both positive and negative ion electrospray ionization (ESI) ion trap tandem mass spectrometry (MS/MS). MS(n) spectra of protonated isomeric peptides produce characteristic fragmentation involving the peptide backbone, the Boc-group, and the side chain. The dipeptide positional isomers are differentiated by the collision-induced dissociation (CID) of the protonated peptides. The loss of 2-methylprop-1-ene is more pronounced for Boc-NH-L-Ala-delta-Caa-OCH(3) (1), whereas it is totally absent for its positional isomer Boc-NH-delta-Caa-L-Ala-OCH(3) (7), instead it shows significant loss of t-butanol. On the other hand, second isomeric pair shows significant loss of t-butanol and loss of acetone for Boc-NH-delta-Caa-beta-Caa-OCH(3) (18), whereas these are insignificant for its positional isomer Boc-NH-beta-Caa-delta-Caa-OCH(3) (13). The tetra- and hexapeptide positional isomers also show significant differences in MS(2) and MS(3) CID spectra. It is observed that 'b' ions are abundant when oxazolone structures are formed through five-membered cyclic transition state and cyclization process for larger 'b' ions led to its insignificant abundance. However, b(1)(+) ion is formed in case of delta,alpha-dipeptide that may have a six-membered substituted piperidone ion structure. Furthermore, ESI negative ion MS/MS has also been found to be useful for differentiating these isomeric peptide acids. Thus, the results of MS/MS of pairs of di-, tetra-, and hexapeptide positional isomers provide peptide sequencing information and distinguish the positional isomers.

  2. Inhibition of Peripheral TNF-α and Downregulation of Microglial Activation by Alpha-Lipoic Acid and Etanercept Protect Rat Brain Against Ischemic Stroke.

    PubMed

    Wu, Ming-Hsiu; Huang, Chao-Ching; Chio, Chung-Ching; Tsai, Kuen-Jer; Chang, Ching-Ping; Lin, Nan-Kai; Lin, Mao-Tsun

    2016-09-01

    Ischemic stroke, caused by obstruction of blood flow to the brain, would initiate microglia activation which contributes to neuronal damage. Therefore, inhibition of microglia-mediated neuroinflammation could be a therapeutic strategy for ischemic stroke. This study was aimed to elucidate the anti-inflammatory effects of alpha-lipoic acid and etanercept given either singly or in combination in rats subjected to middle cerebral artery occlusion. Both α-lipoic acid and etanercept markedly reduced cerebral infarct, blood-brain barrier disruption, and neurological motor deficits with the former drug being more effective with the dosage used. Furthermore, when used in combination, the reduction was more substantial. Remarkably, a greater diminution in the serum levels of tumor necrosis factor-alpha as well as the brain levels of microglial activation (e.g., microgliosis, amoeboid microglia, and microglial overexpression of tumor necrosis factor-α) was observed with the combined drug treatment as compared to the drugs given separately. We conclude that inhibition of peripheral tumor necrosis factor-alpha as well as downregulation of brain microglial activation by alpha-lipoic acid or etanercept protect rat brain against ischemic stroke. Moreover, when both drugs were used in combination, the stroke recovery was promoted more extensively.

  3. Local expression of tumor necrosis factor alpha and interleukin-2 correlates with protection against corneal scarring after ocular challenge of vaccinated mice with herpes simplex virus type 1.

    PubMed Central

    Ghiasi, H; Wechsler, S L; Kaiwar, R; Nesburn, A B; Hofman, F M

    1995-01-01

    To correlate specific local immune responses with protection from corneal scarring, we examined immune cell infiltrates in the cornea after ocular challenge of vaccinated mice with herpes simplex virus type 1 (HSV-1). This is the first report to examine corneal infiltrates following ocular challenge of a vaccinated mouse rather than following infection of a naive mouse. Mice were vaccinated systemically with vaccines that following ocular challenge with HSV-1 resulted in (i) complete protection against corneal disease (KOS, an avirulent strain of HSV-1); (ii) partial protection, resulting in moderate corneal disease (baculovirus-expressed HSV-1 glycoprotein E [gE]); and (iii) no protection, resulting in severe corneal disease (mock vaccine). Infiltration into the cornea of CD4+ T cells, CD8+ T cells, macrophages, and cells containing various lymphokines was monitored on days 0, 1, 3, 7, and 10 postchallenge by immunocytochemistry of corneal sections. Prior to ocular challenge, no eye disease or corneal infiltrates were detected in any mice. KOS-vaccinated mice developed high HSV-1 neutralizing antibody titers (> 1:640) in serum. After ocular challenge, they were completely protected against death, developed no corneal disease, and had no detectable virus in their tear films at any time examined. In response to the ocular challenge, these mice developed high local levels of infiltrating CD4+ T cells and cells containing interleukin-2 (IL-2), IL-4, IL-6, or tumor necrosis factor alpha (TNF-alpha). In contrast, only low levels of infiltrating CD8+ T cells were found, and gamma interferon (IFN-gamma)-containing cells were not present until day 10. gE-vaccinated mice developed neutralizing antibody titers in serum almost as high as those of the KOS-vaccinated mice (> 1:320). After ocular challenge, they were also completely protected against death. However, the gE-vaccinated mice developed low levels of corneal disease and virus was detected in one-third of their eyes

  4. Endogenous glucocorticoids protect against TNF-alpha-induced increases in anxiety-like behavior in virally infected mice

    PubMed Central

    Silverman, MN; Macdougall, MG; Hu, F; Pace, TWW; Raison, CL; Miller, AH

    2012-01-01

    Endogenous glucocorticoids restrain proinflammatory cytokine responses to immune challenges such as viral infection. In addition, proinflammatory cytokines induce behavioral alterations including changes in locomotor/exploratory activity. Accordingly, we examined proinflammatory cytokines and open-field behavior in virally infected mice rendered glucocorticoid deficient by adrenalectomy (ADX). Mice were infected with murine cytomegalovirus (MCMV), and open-field behavior (36 h post-infection) and plasma concentrations of tumor necrosis factor (TNF)-alpha and interleukin (IL)-6 (42 h post-infection) were assessed. Compared to sham-ADX-MCMV-infected animals, ADX-MCMV-infected mice exhibited significant reductions in total distance moved, number of center entries, and time spent in center. These behavioral alterations were accompanied by significantly higher plasma concentrations of TNF-alpha and IL-6, both of which were correlated with degree of behavioral change. To examine the role of TNF-alpha in these behavioral alterations, open-field behavior was compared in wild-type (WT) and TNF-R1-knockout (KO), ADX-MCMV-infected mice. TNF-R1-KO mice exhibited significantly attenuated decreases in number of rearings, number of center entries and time spent in center, but not distance moved, which correlated with plasma IL-6. Given the potential role of brain cytokines in these findings, mRNA expression of TNF-alpha, IL-1 and IL-6 was assessed in various brain regions. Although MCMV induced increases in proinflammatory cytokine mRNA throughout the brain (especially in ADX animals), no remarkable differences were found between WT and TNF-R1-KO mice. These results demonstrate that endogenous glucocorticoids restrain proinflammatory cytokine responses to viral infection and their impact on locomotor/exploratory activity. Moreover, TNF-alpha appears to mediate cytokine-induced changes in open-field behaviors, especially those believed to reflect anxiety. PMID:17389906

  5. Alpha particles as radiopharmaceuticals in the treatment of bone metastases: mechanism of action of radium-223 chloride (Alpharadin) and radiation protection.

    PubMed

    Cheetham, Philippa J; Petrylak, Daniel P

    2012-04-01

    Approximately 85% to 90% of men with castration-resistant prostate cancer (CRPC) have radiological evidence of bone metastases. To date, however, therapies to manage bone metastases have been primarily palliative. Among CRPC patients with bone metastases, there is a significant unmet need for active antitumor treatment options that are highly efficacious and have a favorable safety profile. This article will present current information about alpha-pharmaceuticals, a new class of targeted cancer therapy for the treatment of patients with CRPC and bone metastases. It will review preclinical and clinical studies of the experimental radiopharmaceutical radium-223 chloride (Alpharadin), a first-in-class, highly targeted and well-tolerated alpha-pharmaceutical under development to improve survival in patients with bone metastases from advanced prostate cancer. Alpharadin kills cancer cells via alpha radiation from the decay of radium-223, a calcium mimetic that naturally self-targets to bone metastases. The mechanism of action of Alpharadin and specifics of administration, radiation protection, and patient management will be discussed.

  6. The alpha7 nicotinic acetylcholine receptor subtype mediates nicotine protection against NMDA excitotoxicity in primary hippocampal cultures through a Ca(2+) dependent mechanism.

    PubMed

    Dajas-Bailador, F A; Lima, P A; Wonnacott, S

    2000-10-01

    Neuronal nicotinic acetylcholine receptors (nAChR) have been suggested to play a role in a variety of modulatory and regulatory processes, including neuroprotection. Here we have characterized the neuroprotective effects of nicotine against an excitotoxic insult in primary hippocampal cultures. Exposure of hippocampal neurons to 200 microM NMDA for 1 h decreased cell viability by 25+/-5%, an effect blocked by NMDA receptor antagonists. Nicotine (10 microM) counteracted the NMDA-induced cell death when co-incubated with NMDA or when present subsequent to the NMDA treatment. Nicotine protection was prevented by 1 microM MLA, confirming that it was mediated by nAChR, and by 1 microM alpha-bungarotoxin, demonstrating that the alpha7 nAChR subtype was responsible. Both the NMDA evoked neurotoxicity and nicotine neuroprotection were Ca(2+)-dependent. In Fura-2-loaded hippocampal neurons, nicotine (10 microM) and NMDA (200 microM) acutely increased intracellular resting Ca(2+) from 70 nM to 200 and 500 nM, respectively. Responses to NMDA were unaffected by the presence of nicotine. (45)Ca(2+) uptake after a 1 h exposure to nicotine or NMDA also demonstrated quantitative differences between the two drugs. This study demonstrates that the alpha7 subtype of nAChR can support neuronal survival after an excitotoxic stimulus, through a Ca(2+) dependent mechanism that operates downstream of NMDA receptor activation.

  7. Effect of TNF{alpha} on activities of different promoters of human apolipoprotein A-I gene

    SciTech Connect

    Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.

    2010-07-23

    Research highlights: {yields} TNF{alpha} stimulates the distal alternative promoter of human apoA-I gene. {yields} TNF{alpha} acts by weakening of promoter competition within apoA-I gene (promoter switching). {yields} MEK1/2 and nuclear receptors PPAR{alpha} and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1{beta} and TNF{alpha}. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNF{alpha}-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNF{alpha} on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNF{alpha} leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNF{alpha}. The MEK1/2-ERK1/2 cascade and nuclear receptors PPAR{alpha} and LXRs are important for TNF{alpha}-mediated apoA-I promoter switching.

  8. Discovery of Azetidinone Acids as Conformationally-Constrained Dual PPARalpha/gamma Agonists

    SciTech Connect

    Wang, W.; Devasthale, P; Farrelly, D; Gu, L; Harrity, T; Cap, M; Chu, C; Kunselman, L; Morgan, N; et. al.

    2008-01-01

    A novel class of azetidinone acid-derived dual PPAR{alpha}/{gamma} agonists has been synthesized for the treatment of diabetes and dyslipidemia. The preferred stereochemistry in this series for binding and functional agonist activity against both PPARa and PPAR? receptors was shown to be 3S,4S. Synthesis, in vitro and in vivo activities of compounds in this series are described. A high-yielding method for N-arylation of azetidinone esters is also described.

  9. Identification of the human ApoAV gene as a novel ROR{alpha} target gene

    SciTech Connect

    Lind, Ulrika; Nilsson, Tina; McPheat, Jane; Stroemstedt, Per-Erik; Bamberg, Krister; Balendran, Clare; Kang, Daiwu . E-mail: Daiwu.Kang@astrazeneca.com

    2005-04-29

    Retinoic acid receptor-related orphan receptor-{alpha} (ROR{alpha}) (NR1F1) is an orphan nuclear receptor with a potential role in metabolism. Previous studies have shown that ROR{alpha} regulates transcription of the murine Apolipoprotein AI gene and human Apolipoprotein CIII genes. In the present study, we present evidence that ROR{alpha} also induces transcription of the human Apolipoprotein AV gene, a recently identified apolipoprotein associated with triglyceride levels. Adenovirus-mediated overexpression of ROR{alpha} increased the endogenous expression of ApoAV in HepG2 cells and ROR{alpha} also enhanced the activity of an ApoAV promoter construct in transiently transfected HepG2 cells. Deletion and mutation studies identified three AGGTCA motifs in the ApoAV promoter that mediate ROR{alpha} transactivation, one of which overlaps with a previously identified binding site for PPAR{alpha}. Together, these results suggest a novel mechanism whereby ROR{alpha} modulates lipid metabolism and implies ROR{alpha} as a potential target for the treatment of dyslipidemia and atherosclerosis.

  10. Multicomponent Synthesis of a N-Protected Alpha-Amino Ester: Ethyl 2-((4-Methoxyphenyl)Amino)-3-Phenylpropanoate

    ERIC Educational Resources Information Center

    Le Gall, Erwan; Pignon, Antoine

    2012-01-01

    This laboratory experiment describes the preparation of a N-protected phenylalanine ethyl ester by a zinc-mediated Mannich-like multicomponent reaction between benzyl bromide, "p"-anisidine, and ethyl glyoxylate. The one-step reaction involves the in situ metallation of benzyl bromide into a benzylzinc reagent and its addition onto imine (Barbier…

  11. Salacia oblonga root improves cardiac lipid metabolism in Zucker diabetic fatty rats: modulation of cardiac PPAR-alpha-mediated transcription of fatty acid metabolic genes.

    PubMed

    Huang, Tom Hsun-Wei; Yang, Qinglin; Harada, Masaki; Uberai, Jasna; Radford, Jane; Li, George Q; Yamahara, Johji; Roufogalis, Basil D; Li, Yuhao

    2006-01-01

    Excess cardiac triglyceride accumulation in diabetes and obesity induces lipotoxicity, which predisposes the myocytes to death. On the other hand, increased cardiac fatty acid (FA) oxidation plays a role in the development of myocardial dysfunction in diabetes. PPAR-alpha plays an important role in maintaining homeostasis of lipid metabolism. We have previously demonstrated that the extract from Salacia oblonga root (SOE), an Ayurvedic anti-diabetic and anti-obesity medicine, improves hyperlipidemia in Zucker diabetic fatty (ZDF) rats (a genetic model of type 2 diabetes and obesity) and possesses PPAR-alpha activating properties. Here we demonstrate that chronic oral administration of SOE reduces cardiac triglyceride and FA contents and decreases the Oil red O-stained area in the myocardium of ZDF rats, which parallels the effects on plasma triglyceride and FA levels. Furthermore, the treatment suppressed cardiac overexpression of both FA transporter protein-1 mRNA and protein in ZDF rats, suggesting inhibition of increased cardiac FA uptake as the basis for decreased cardiac FA levels. Additionally, the treatment also inhibited overexpression in ZDF rat heart of PPAR-alpha mRNA and protein and carnitine palmitoyltransferase-1, acyl-CoA oxidase and 5'-AMP-activated protein kinase mRNAs and restored the downregulated acetyl-CoA carboxylase mRNA. These results suggest that SOE inhibits cardiac FA oxidation in ZDF rats. Thus, our findings suggest that improvement by SOE of excess cardiac lipid accumulation and increased cardiac FA oxidation in diabetes and obesity occurs by reduction of cardiac FA uptake, thereby modulating cardiac PPAR-alpha-mediated FA metabolic gene transcription. PMID:16129467

  12. Salacia oblonga root improves cardiac lipid metabolism in Zucker diabetic fatty rats: Modulation of cardiac PPAR-{alpha}-mediated transcription of fatty acid metabolic genes

    SciTech Connect

    Huang, Tom H.-W.; Yang Qinglin; Harada, Masaki; Uberai, Jasna; Radford, Jane; Li, George Q.; Yamahara, Johji; Roufogalis, Basil D.; Li Yuhao . E-mail: yuhao@pharm.usyd.edu.au

    2006-01-15

    Excess cardiac triglyceride accumulation in diabetes and obesity induces lipotoxicity, which predisposes the myocytes to death. On the other hand, increased cardiac fatty acid (FA) oxidation plays a role in the development of myocardial dysfunction in diabetes. PPAR-{alpha} plays an important role in maintaining homeostasis of lipid metabolism. We have previously demonstrated that the extract from Salacia oblonga root (SOE), an Ayurvedic anti-diabetic and anti-obesity medicine, improves hyperlipidemia in Zucker diabetic fatty (ZDF) rats (a genetic model of type 2 diabetes and obesity) and possesses PPAR-{alpha} activating properties. Here we demonstrate that chronic oral administration of SOE reduces cardiac triglyceride and FA contents and decreases the Oil red O-stained area in the myocardium of ZDF rats, which parallels the effects on plasma triglyceride and FA levels. Furthermore, the treatment suppressed cardiac overexpression of both FA transporter protein-1 mRNA and protein in ZDF rats, suggesting inhibition of increased cardiac FA uptake as the basis for decreased cardiac FA levels. Additionally, the treatment also inhibited overexpression in ZDF rat heart of PPAR-{alpha} mRNA and protein and carnitine palmitoyltransferase-1, acyl-CoA oxidase and 5'-AMP-activated protein kinase mRNAs and restored the downregulated acetyl-CoA carboxylase mRNA. These results suggest that SOE inhibits cardiac FA oxidation in ZDF rats. Thus, our findings suggest that improvement by SOE of excess cardiac lipid accumulation and increased cardiac FA oxidation in diabetes and obesity occurs by reduction of cardiac FA uptake, thereby modulating cardiac PPAR-{alpha}-mediated FA metabolic gene transcription.

  13. Berberine protects against lipopolysaccharide-induced intestinal injury in mice via alpha 2 adrenoceptor-independent mechanisms

    PubMed Central

    Li, Hong-mei; Wang, Yi-yang; Wang, Hua-dong; Cao, Wen-juan; Yu, Xiao-hui; Lu, Da-xiang; Qi, Ren-bin; Hu, Chao-feng; Yan, Yu-xia

    2011-01-01

    Aim: To investigate the mechanisms responsible for the protective action of berberine (Ber) against gut damage in endotoxemic mice. Methods: Male BALB/c mice were administered intragastrically with distilled water (0.1 mL/10 g), Ber (50 mg/kg) alone, yohimbine (2 mg/kg) alone, or Ber (50mg/kg) in combination with yohimbine (2 mg/kg) for 3 d. On the third day, lipopolysaccharide (LPS, 18 mg/kg) or normal saline was intraperitoneally injected one hour after the intragastric administration. Following the treatment, intestinal injury in the ileum was histopathologically accessed; enterocyte apoptosis was examined using TUNEL method; Toll-like receptor 4 (TLR4) mRNA expression was measured using RT-PCR assay; inhibitor protein-κBα (I-κBα) phosphorylation and myeloperoxidase content were examined using Western blloting. The macrophage inflammatory protein-2 (MIP-2) production was measured using ELISA assay. Results: Mice challenged with LPS caused extensive ileum injury, including a significantly increased injury score, decreased intestinal villus height, reduced gut mucosal weight and increased intestinal permeability. Furthermore, LPS significantly induced enterocyte apoptosis, increased TLR4 mRNA expression, I-κBα phosphorylation, MIP-2 production and myeloperoxidase content in the ileum. Pretreatment with Ber significantly alleviated all the alterations in the ileum in the endotoxemic mice. Pretreatment with the α2-adrenoceptor antagonist yohimbine did not block the protective action of Ber against LPS-induced intestinal injury. In addition, treatment with yohimbine alone did not prevent LPS-induced intestinal injury. Conclusion: Pretreatment with Ber provides significant protection against LPS-induced intestinal injury in mice, via reducing enterocyte apoptosis, inhibiting the TLR4-nuclear factor κB-MIP-2 pathway and decreasing neutrophil infiltration that are independent of α2-adrenoceptors. PMID:21963898

  14. Interleukin 1 alpha stimulates hemopoiesis but not tumor cell proliferation and protects mice from lethal total body irradiation

    SciTech Connect

    Constine, L.S.; Harwell, S.; Keng, P.; Lee, F.; Rubin, P.; Siemann, D. )

    1991-03-01

    Interleukin 1 alpha (IL-1) is a polypeptide/glycoprotein growth factor with multiple functions including the modulation of hematopoietic cell proliferation and differentiation. In vivo studies were performed with C57BL/6J mice injected with 0, 0.2, or 2.0 micrograms of IL-1 24 hr before or after lethal total body irradiation (TBI) (9.5 Gy). More mice in the groups administered IL-1 before TBI survived (90% of the 2.0 micrograms group) than those treated 2 or 24 hr after TBI, which was still slightly superior to the uninjected group, which all died within 15 days (p = .0001). Proliferation of bone marrow granulocyte/macrophage colonies following split dose TBI was also greatest for mouse groups treated with IL-1 prior to TBI. These experiments support data from other investigators that IL-1 stimulation of BM is related to IL-1 timing with respect to TBI. Stimulation of hemopoiesis was also assessed in terms of changes in peripheral blood and BM cell numbers and cell cycle kinetics using an electronic particle counter and flow cytometric techniques. Mice injected with 2 micrograms of IL-1 showed an initial decline (at 3-6 hr) and then a selective proliferation (24-48 hr) of early and more committed progenitor cells to 125% and 200% of control values, respectively. Peripheral blood counts rose accordingly. Cells in S and G2/M phases increased over 10 hr and then declined in number. It thus appeared that some synchronization of cell cycling occurred, which might place cells in a more radioresistant phase of the cell cycle. The glutathione (GSH) content and synthesis in BM cells were measured by isocratic paired-ion high performance liquid chromatography and 35S-labelled cysteine incorporation into the GSH tripeptide. An increase in cellular GSH content and synthesis was demonstrated following IL-1 which lasted 24 hr.

  15. Change in fluidity of brain endoplasmic reticulum membranes by oxygen free radicals: a protective effect of stobadine, alpha-tocopherol acetate, and butylated hydroxytoluene.

    PubMed

    Kaplán, P; Racay, P; Lehotský, J; Mézesová, V

    1995-07-01

    Effect of various oxygen free radical generating systems and an oxidant H2O2 on brain endoplasmic reticulum (ER) membrane fluidity was examined using fluorescent membrane probe 1,6-diphenyl-1,3,5-hexatriene, DPH. The relative potency of free radical generating systems to decrease membrane fluidity increased in this order: FeCl3-EDTA, FeSO4-EDTA, FeSO4-EDTA/hydrogen peroxide. Potency to decrease membrane fluidity correlated well with these systems' potencies to induce lipid peroxidation, as detected by conjugated diene formation. Treatment of ER membranes with H2O2 had no effect on fluidity or conjugated diene formation. Using the two most potent free radical generating systems, FeSO4-EDTA and FeSO4-EDTA/hydrogen peroxide, a protective effect of the novel antihypoxic and antiarrhytmic drug stobadine was tested. Stobadine and two well-known antioxidants, alpha-tocopherol acetate and butylated hydroxytoluene, demonstrated the ability to prevent free radical induced alterations in ER membrane fluidity. These results provide new evidence of stobadine's protective effect on membranes attacked by oxygen free radicals.

  16. Alpha thalassemia protects sickle cell anemia patients from macro-albuminuria through its effects on red blood cell rheological properties.

    PubMed

    Lamarre, Yann; Romana, Marc; Lemonne, Nathalie; Hardy-Dessources, Marie-Dominique; Tarer, Vanessa; Mougenel, Danielle; Waltz, Xavier; Tressières, Benoît; Lalanne-Mistrih, Marie-Laure; Etienne-Julan, Maryse; Connes, Philippe

    2014-01-01

    While chronic hemolysis has been suspected to be involved in the development of glomerulopathy in patients with sickle cell anemia (SCA), no study focused on the implications of blood rheology. Ninety-six adults with SCA at steady state were included in the present cross-sectional study. Three categories were defined: normo-albuminuria (NORMO, n = 41), micro-albuminuria (MICRO, n = 23) and macro-albuminuria (MACRO, n = 32). Blood was sampled to measure hematological and hemorheological parameters, and genomic DNA extraction was performed to detect the presence of α-thalassemia. The prevalence of α-thalassemia was lower in the MACRO group compared with the two other groups. Anemia was more severe in the MACRO compared with the NORMO group leading the former group to exhibit decreased blood viscosity. Red blood cell deformability was lower and red blood cell aggregates strength was greater in the MACRO compared to the two other groups, and this was directly attributed to the lower frequency of α-thalassemia in the former group. Our results show the protective role of α-thalassemia against the development of sickle cell glomerulopathy, and strongly suggest that this protection is mediated through the decrease of anemia, the increase of RBC deformability and the lowering of the RBC aggregates strength.

  17. Improved Protection in a Rabbit Model of Community-Associated Methicillin-Resistant Staphylococcus aureus Necrotizing Pneumonia upon Neutralization of Leukocidins in Addition to Alpha-Hemolysin.

    PubMed

    Diep, Binh An; Le, Vien T M; Visram, Zehra C; Rouha, Harald; Stulik, Lukas; Dip, Etyene Castro; Nagy, Gábor; Nagy, Eszter

    2016-10-01

    Community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA), especially the USA300 pulsotype, is a frequent cause of skin and soft tissue infections and severe pneumonia. Despite appropriate antibiotic treatment, complications are common and pneumonia is associated with high mortality. S. aureus strains express multiple cytotoxins, including alpha-hemolysin (Hla) and up to five bicomponent leukocidins that specifically target phagocytic cells for lysis. CA-MRSA USA300 strains carry the genes for all six cytotoxins. Species specificity of the leukocidins greatly contributes to the ambiguity regarding their role in S. aureus pathogenesis. We performed a comparative analysis of the leukocidin susceptibility of human, rabbit, and mouse polymorphonuclear leukocytes (PMNs) to assess the translational value of mouse and rabbit S. aureus models. We found that mouse PMNs were largely resistant to LukSF-PV, HlgAB, and HlgCB and susceptible only to LukED, whereas rabbit and human PMNs were highly sensitive to all these cytotoxins. In the rabbit pneumonia model with a USA300 CA-MRSA strain, passive immunization with a previously identified human monoclonal antibody (MAb), Hla-F#5, which cross-neutralizes Hla, LukSF-PV, HlgAB, HlgCB, and LukED, provided full protection, whereas an Hla-specific MAb was only partially protective. In the mouse USA300 CA-MRSA pneumonia model, both types of antibodies demonstrated full protection, suggesting that Hla, but not leukocidin(s), is the principal virulence determinant in mice. As the rabbit recapitulates the high susceptibility to leukocidins characteristic of humans, this species represents a valuable model for assessing novel, cytotoxin-targeting anti-S. aureus therapeutic approaches.

  18. Transcription coactivator PRIP, the peroxisome proliferator-activated receptor (PPAR)-interacting protein, is redundant for the function of nuclear receptors PParalpha and CAR, the constitutive androstane receptor, in mouse liver.

    PubMed

    Sarkar, Joy; Qi, Chao; Guo, Dongsheng; Ahmed, Mohamed R; Jia, Yuzhi; Usuda, Nobuteru; Viswakarma, Navin; Rao, M Sambasiva; Reddy, Janardan K

    2007-01-01

    Disruption of the genes encoding for the transcription coactivators, peroxisome proliferator-activated receptor (PPAR)-interacting protein (PRIP/ASC-2/RAP250/TRBP/NRC) and PPAR-binding protein (PBP/TRAP220/DRIP205/MED1), results in embryonic lethality by affecting placental and multiorgan development. Targeted deletion of coactivator PBP gene in liver parenchymal cells (PBP(LIV-/-)) results in the near abrogation of the induction of PPARalpha and CAR (constitutive androstane receptor)-regulated genes in liver. Here, we show that targeted deletion of coactivator PRIP gene in liver (PRIP(LIV-/-)) does not affect the induction of PPARalpha-regulated pleiotropic responses, including hepatomegaly, hepatic peroxisome proliferation, and induction of mRNAs of genes involved in fatty acid oxidation system, indicating that PRIP is not essential for PPARalpha-mediated transcriptional activity. We also provide additional data to show that liver-specific deletion of PRIP gene does not interfere with the induction of genes regulated by nuclear receptor CAR. Furthermore, disruption of PRIP gene in liver did not alter zoxazolamine-induced paralysis, and acetaminophen-induced hepatotoxicity. Studies with adenovirally driven EGFP-CAR expression in liver demonstrated that, unlike PBP, the absence of PRIP does not prevent phenobarbital-mediated nuclear translocation/retention of the receptor CAR in liver in vivo and cultured hepatocytes in vitro. These results show that PRIP deficiency in liver does not interfere with the function of nuclear receptors PPARalpha and CAR. The dependence of PPARalpha- and CAR-regulated gene transcription on coactivator PBP but not on PRIP attests to the existence of coactivator selectivity in nuclear receptor function.

  19. Bezafibrate at clinically relevant doses decreases serum/liver triglycerides via down-regulation of sterol regulatory element-binding protein-1c in mice: a novel peroxisome proliferator-activated receptor alpha-independent mechanism.

    PubMed

    Nakajima, Takero; Tanaka, Naoki; Kanbe, Hiroki; Hara, Atsushi; Kamijo, Yuji; Zhang, Xiaowei; Gonzalez, Frank J; Aoyama, Toshifumi

    2009-04-01

    The triglyceride-lowering effect of bezafibrate in humans has been attributed to peroxisome proliferator-activated receptor (PPAR) alpha activation based on results from rodent studies. However, the bezafibrate dosages used in conventional rodent experiments are typically higher than those in clinical use (> or =50 versus < or =10 mg/kg/day), and thus it remains unclear whether such data can be translated to humans. Furthermore, because bezafibrate is a pan-PPAR activator, the actual contribution of PPARalpha to its triglyceride-lowering properties remains undetermined. To address these issues, bezafibrate at clinically relevant doses (10 mg/kg/day; low) was administered to wild-type and Ppara-null mice, and its effects were compared with those from conventionally used doses (100 mg/kg/day; high). Pharmacokinetic analyses showed that maximum plasma concentration and area under the concentration-time curve in bezafibrate-treated mice were similar to those in humans at low doses, but not at high doses. Low-dose bezafibrate decreased serum/liver triglycerides in a PPARalpha-independent manner by attenuation of hepatic lipogenesis and triglyceride secretion. It is noteworthy that instead of PPAR activation, down-regulation of sterol regulatory element-binding protein (SREBP)-1c was observed in mice undergoing low-dose treatment. High-dose bezafibrate decreased serum/liver triglycerides by enhancement of hepatic fatty acid uptake and beta-oxidation via PPARalpha activation, as expected. In conclusion, clinically relevant doses of bezafibrate exert a triglyceride-lowering effect by suppression of the SREBP-1c-regulated pathway in mice and not by PPARalpha activation. Our results may provide novel information about the pharmacological mechanism of bezafibrate action and new insights into the treatment of disorders involving SREBP-1c. PMID:19124612

  20. Inhibition of fatty acid amide hydrolase and cyclooxygenase-2 increases levels of endocannabinoid related molecules and produces analgesia via peroxisome proliferator-activated receptor-alpha in a model of inflammatory pain.

    PubMed

    Jhaveri, Maulik D; Richardson, Denise; Robinson, Ian; Garle, Michael J; Patel, Annie; Sun, Yan; Sagar, Devi R; Bennett, Andrew J; Alexander, Stephen P H; Kendall, David A; Barrett, David A; Chapman, Victoria

    2008-07-01

    The antinociceptive effects of the endocannabinoids (ECs) are enhanced by inhibiting catabolic enzymes such as fatty acid amide hydrolase (FAAH). The physiological relevance of the metabolism of ECs by other pathways, such as cyclooxygenase-2 (COX2) is less clear. To address this question we compared the effects of local inhibition of FAAH versus COX2 (URB597 and nimesulide, respectively) on inflammatory hyperalgesia and levels of endocannabinoids and related molecules in the hindpaw. Inflammatory hyperalgesia was measured following intraplantar injection of carrageenan. Effects of intraplantar injection of URB597 (25 microg and 100 microg) or nimesulide (50 microg) on hyperalgesia and hindpaw levels of anandamide (AEA), 2-arachidonoylglycerol (2AG) and N-palmitoylethanolamine (PEA) were determined. Although both doses of URB597 increased levels of AEA and 2AG in the carrageenan inflamed hindpaw, only the lower dose of URB597 attenuated hyperalgesia (P<0.05). Nimesulide attenuated both hyperalgesia and hindpaw oedema (P<0.001, P<0.01, respectively) and increased levels of PEA (P<0.05) in the hindpaw. Since both AEA and PEA are ligands for peroxisome proliferator-activated receptor-alpha (PPARalpha), the effects of the PPARalpha antagonist GW6471 on nimesulide- and URB597-mediated effects were studied. GW6471, but not a PPARgamma antagonist, blocked the inhibitory effects of nimesulide and URB597 on hyperalgesia. Our data suggest that both COX2 and FAAH play a role in the metabolism of endocannabinoids and related molecules. The finding that PPARalpha antagonism blocked the inhibitory effects of nimesulide and URB597 suggests that PPARalpha contributes to their antinociceptive effects in the carrageenan model of inflammatory hyperalgesia.

  1. Zingiber officinale Roscoe alone and in combination with alpha-tocopherol protect the kidney against cisplatin-induced acute renal failure.

    PubMed

    Ajith, T A; Nivitha, V; Usha, S

    2007-06-01

    Oxidative stress due to abnormal production of reactive oxygen molecules (ROM) is believed to be involved in the etiology of toxicities of many xenobiotics. Evidences suggested that ROM is involved in the nephrotoxicity of a widely used synthetic anticancer drug cisplatin. The nephroprotective effects of ethanol extract of Zingiber officinale alone and in combination with vitamin E (alpha-tocopherol) were evaluated using cisplatin (single dose of 10 mg/kg body wt, i.p) induced acute renal damage in mice. The results of the study indicated that Z. officinale significantly and dose dependently protected the nephrotoxicity induced by cisplatin. The serum urea and creatinine levels in the cisplatin alone treated group were significantly elevated (P<0.01) with respect to normal group of animals. The levels were reduced in the Z. officinale (250 and 500 mg/kg, p.o) plus cisplatin, vitamin E (250 mg/kg) plus cisplatin, and Z. officinale (250 mg/kg) with vitamin E plus vitamin E treated groups. The renal antioxidant enzymes such as superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx) activities and level of reduced glutathione (GSH) were declined; level of malondialdehyde (MDA) was elevated in the cisplatin alone treated group. The activities of SOD, CAT GPx and level of GSH were elevated and level of MDA declined significantly (P<0.05) in the Z. officinale (250 and 500 mg/kg) plus cisplatin and Z. officinale (250 mg/kg) with vitamin E plus cisplatin treated groups. The protective effect of Z. officinale (250 mg/kg body wt) was found to be better than that of vitamin E (250 mg/kg body wt). The results also demonstrated that combination of Z. officinale (250 mg/kg) with vitamin E (250 mg/kg) showed a better protection compared to their 250 mg/kg alone treated groups. This study concluded that ethanol extract of Z. officinale alone and in combination with vitamin E partially ameliorated cisplatin-induced nephrotoxicity. This protection is mediated either

  2. Recent progress in research on peroxisome proliferator-activated receptor alpha-selective ligands.

    PubMed

    Miyachi, Hiroyuki

    2004-08-01

    The understanding of the functions of the nuclear receptor peroxisome proliferator-activated receptor a (PPARalpha) as a regulator of lipid and lipoprotein homeostasis, and the rapid development of parallel high-throughput screening assays to evaluate the activity toward other PPAR subtypes (PPARdelta and PPARgamma), have provided an opportunity to develop novel PPARalpha-selective, PPARalpha/gamma dual and PPAR pan agonists for the treatment of various metabolic diseases. This review focuses on the molecular pharmacology of PPARalpha, and summarizes recent literature and patent applications disclosing medicinal chemistry strategies to identify new PPARalpha-selective agonists. The species selectivity of some classes of PPARalpha-selective agonists in response to in vitro PPARalpha transactivation activity is also reported. PMID:15334308

  3. Disruption of Early Tumor Necrosis Factor Alpha Signaling Prevents Classical Activation of Dendritic Cells in Lung-Associated Lymph Nodes and Development of Protective Immunity against Cryptococcal Infection

    PubMed Central

    Xu, Jintao; Eastman, Alison J.; Flaczyk, Adam; Neal, Lori M.; Zhao, Guolei; Carolan, Jacob; Malachowski, Antoni N.; Stolberg, Valerie R.; Yosri, Mohammed; Chensue, Stephen W.; Curtis, Jeffrey L.; Osterholzer, John J.

    2016-01-01

    ABSTRACT Anti-tumor necrosis factor alpha (anti-TNF-α) therapies have been increasingly used to treat inflammatory diseases and are associated with increased risk of invasive fungal infections, including Cryptococcus neoformans infection. Using a mouse model of cryptococcal infection, we investigated the mechanism by which disruption of early TNF-α signaling results in the development of nonprotective immunity against C. neoformans. We found that transient depletion of TNF-α inhibited pulmonary fungal clearance and enhanced extrapulmonary dissemination of C. neoformans during the adaptive phase of the immune response. Higher fungal burdens in TNF-α-depleted mice were accompanied by markedly impaired Th1 and Th17 responses in the infected lungs. Furthermore, early TNF-α depletion also resulted in disrupted transcriptional initiation of the Th17 polarization program and subsequent upregulation of Th1 genes in CD4+ T cells in the lung-associated lymph nodes (LALN) of C. neoformans-infected mice. These defects in LALN T cell responses were preceded by a dramatic shift from a classical toward an alternative activation of dendritic cells (DC) in the LALN of TNF-α-depleted mice. Taken together, our results indicate that early TNF-α signaling is required for optimal DC activation, and the initial Th17 response followed by Th1 transcriptional prepolarization of T cells in the LALN, which further drives the development of protective immunity against cryptococcal infection in the lungs. Thus, administration of anti-TNF-α may introduce a particularly greater risk for newly acquired fungal infections that require generation of protective Th1/Th17 responses for their containment and clearance. PMID:27406560

  4. Enzymic degradation of plasma arginine using arginine deiminase inhibits nitric oxide production and protects mice from the lethal effects of tumour necrosis factor alpha and endotoxin.

    PubMed Central

    Thomas, J Brandon; Holtsberg, Frederick W; Ensor, C Mark; Bomalaski, John S; Clark, Mike A

    2002-01-01

    Septic shock is mediated in part by nitric oxide (NO) and tumour necrosis factor alpha (TNFalpha). NO is synthesized primarily from extracellular arginine. We tested the ability of an arginine-degrading enzyme to inhibit NO production in mice and to protect mice from the hypotension and lethality that occur after the administration of TNFalpha or endotoxin. Treatment of BALB/c mice with arginine deiminase (ADI) formulated with succinimidyl succinimide polyethylene glycol of M(r) 20000 (ADI-SS PEG(20000)) eliminated all measurable plasma arginine (from normal levels of approximately 155 microM arginine to 2 microM). In addition, ADI-SS PEG(20000) also inhibited the production of NO, as quantified by plasma nitrate+nitrite. Treatment of mice with TNFalpha or endotoxin resulted in a dose-dependent increase in NO production and lethality. Pretreatment of mice with ADI-SS PEG(20000) resulted in increased resistance to the lethal effects of TNFalpha and endotoxin. These observations are consistent with NO production resulting, to some extent, from the metabolism of extracellular arginine. The toxic effects of TNFalpha and endotoxin may be partially inhibited by enzymic degradation of plasma arginine by ADI-SS PEG(20000). Interestingly, pretreatment with ADI-SS PEG(20000) did not inhibit the anti-tumour activity of TNFalpha in vitro or in vivo. This treatment may allow greater amounts of TNFalpha, as well as other cytokines, to be administered while abrogating side effects such as hypotension and death. PMID:11964159

  5. Alpha/Beta Interferon Protects Adult Mice from Fatal Sindbis Virus Infection and Is an Important Determinant of Cell and Tissue Tropism

    PubMed Central

    Ryman, Kate D.; Klimstra, William B.; Nguyen, Khuong B.; Biron, Christine A.; Johnston, Robert E.

    2000-01-01

    Infection of adult 129 Sv/Ev mice with consensus Sindbis virus strain TR339 is subclinical due to an inherent restriction in early virus replication and viremic dissemination. By comparing the pathogenesis of TR339 in 129 Sv/Ev mice and alpha/beta interferon receptor null (IFN-α/βR−/−) mice, we have assessed the contribution of IFN-α/β in restricting virus replication and spread and in determining cell and tissue tropism. In adult 129 Sv/Ev mice, subcutaneous inoculation with 100 PFU of TR339 led to extremely low-level virus replication and viremia, with clearance under way by 96 h postinoculation (p.i.). In striking contrast, adult IFN-α/βR−/− mice inoculated subcutaneously with 100 PFU of TR339 succumbed to the infection within 84 h. By 24 h p.i. a high-titer serum viremia had seeded infectious virus systemically, coincident with the systemic induction of the proinflammatory cytokines interleukin-12 (IL-12) p40, IFN-γ, tumor necrosis factor alpha, and IL-6. Replicating virus was located in macrophage-dendritic cell (DC)-like cells at 24 h p.i. in the draining lymph node and in the splenic marginal zone. By 72 h p.i. virus replication was widespread in macrophage-DC-like cells in the spleen, liver, lung, thymus, and kidney and in fibroblast-connective tissue and periosteum, with sporadic neuroinvasion. IFN-α/β-mediated restriction of TR339 infection was mimicked in vitro in peritoneal exudate cells from 129 Sv/Ev versus IFN-α/βR−/− mice. Thus, IFN-α/β protects the normal adult host from viral infection by rapidly conferring an antiviral state on otherwise permissive cell types, both locally and systemically. Ablation of the IFN-α/β system alters the apparent cell and tissue tropism of the virus and renders macrophage-DC-lineage cells permissive to infection. PMID:10708454

  6. Tumor necrosis factor soluble receptors circulate during experimental and clinical inflammation and can protect against excessive tumor necrosis factor alpha in vitro and in vivo.

    PubMed Central

    Van Zee, K J; Kohno, T; Fischer, E; Rock, C S; Moldawer, L L; Lowry, S F

    1992-01-01

    Tumor necrosis factor alpha (TNF alpha), a primary mediator of systemic responses to sepsis and infection, can be injurious to the organism when present in excessive quantities. Here we report that two types of naturally occurring soluble TNF receptors (sTNFR-I and sTNFR-II) circulate in human experimental endotoxemia and in critically ill patients and demonstrate that they neutralize TNF alpha-induced cytotoxicity and immunoreactivity in vitro. Utilizing immunoassays that discriminate between total sTNFR-I and sTNFR-I not bound to TNF alpha, we show that sTNFR-I-TNF alpha complexes may circulate even in the absence of detectable free TNF alpha. To investigate the therapeutic possibilities of sTNFR-I, recombinant protein was administered to nonhuman primates with lethal bacteremia and found to attenuate hemodynamic collapse and cytokine induction. We conclude that soluble receptors for TNF alpha are inducible in inflammation and circulate at levels sufficient to block the in vitro cytotoxicity associated with TNF alpha levels observed in nonlethal infection. Administration of sTNFR-I can prevent the adverse pathologic sequelae caused by the exaggerated TNF alpha production observed in lethal sepsis. Images PMID:1317575

  7. Neutralization of gamma interferon and tumor necrosis factor alpha blocks in vivo synthesis of nitrogen oxides from L-arginine and protection against Francisella tularensis infection in Mycobacterium bovis BCG-treated mice.

    PubMed Central

    Green, S J; Nacy, C A; Schreiber, R D; Granger, D L; Crawford, R M; Meltzer, M S; Fortier, A H

    1993-01-01

    Peritoneal cells from Mycobacterium bovis BCG-infected C3H/HeN mice produced nitrite (NO2-, an oxidative end product of nitric oxide [NO] synthesis) and inhibited the growth of Francisella tularensis, a facultative intracellular bacterium. Both NO2- production and inhibition of bacterial growth were suppressed by NG-monomethyl-L-arginine, a substrate inhibitor of nitrogen oxidation of L-arginine, and monoclonal antibodies (MAbs) to gamma interferon (IFN-gamma) and tumor necrosis factor alpha (TNF-alpha). Intraperitoneal injection of mice with BCG increased urinary nitrate (NO3-) excretion coincident with development of activated macrophages capable of secreting nitrogen oxides and inhibiting F. tularensis growth in vitro. Eight days after BCG inoculation, mice survived a normally lethal intraperitoneal challenge with F. tularensis. Treatment of these BCG-infected mice with MAbs to IFN-gamma or TNF-alpha at the time of BCG inoculation reduced urinary NO3- levels to those found in normal uninfected mice for up to 14 days. The same anticytokine antibody treatment abolished BCG-mediated protection against F. tularensis: mice died within 4 to 6 days. Intraperitoneal administration of anti-IFN-gamma or anti-TNF-alpha antibody 8 days after BCG infection also reduced urinary NO3- and abolished protection against F. tularensis. Isotype control (immunoglobulin G) or anti-interleukin 4 MAbs had little effect on these parameters at any time of treatment. IFN-gamma and TNF-alpha were clearly involved in the regulation of macrophage activation by BCG in vivo. Protection against F. tularensis challenge by BCG depended upon the physiological generation of reactive nitrogen oxides induced by these cytokines. PMID:8423095

  8. Synthesis and evaluation of novel [alpha]-heteroaryl-phenylpropanoic acid derivatives as PPAR[alpha/gamma] dual agonists

    SciTech Connect

    Casimiro-Garcia, Agustin; Bigge, Christopher F.; Davis, Jo Ann; Padalino, Teresa; Pulaski, James; Ohren, Jeffrey F.; McConnell, Patrick; Kane, Christopher D.; Royer, Lori J.; Stevens, Kimberly A.; Auerbach, Bruce; Collard, Wendy; McGregor, Christine; Song, Kun; Pfizer

    2010-09-27

    The synthesis of a new series of phenylpropanoic acid derivatives incorporating an heteroaryl group at the {alpha}-position and their evaluation for binding and activation of PPAR{alpha} and PPAR{gamma} are presented in this report. Among the new compounds, (S)-3-{l_brace}4-[3-(5-methyl-2-phenyl-oxazol-4-yl)-propyl]-phenyl{r_brace}-2-1,2,3-triazol-2-yl-propionic acid (17j), was identified as a potent human PPAR{alpha}/{gamma} dual agonist (EC{sub 50} = 0.013 and 0.061 {micro}M, respectively) with demonstrated oral bioavailability in rat and dog. 17j was shown to decrease insulin levels, plasma glucose, and triglycerides in the ZDF female rat model. In the human apolipoprotein A-1/CETP transgenic mouse model 17j produced increases in hApoA1 and HDL-C and decreases in plasma triglycerides. The increased potency for binding and activation of both PPAR subtypes observed with 17j when compared to previous analogs in this series was explained based on results derived from crystallographic and modeling studies.

  9. Protective effects of ascorbic acid, dl-alpha-tocopherol acetate, and sodium selenate on ethanol-induced liver damage of rats.

    PubMed

    Ozdil, Sadakat; Bolkent, Sehnaz; Yanardag, Refiye; Arda-Pirincci, Pelin

    2004-02-01

    In this study, the effect of a combination of vitamin C (ascorbic acid), vitamin E (dl-alpha-tocopherol acetate), and selenium (sodium selenate) on ethanol-induced liver damage in rats was investigated, morphologically and biochemically. The ethanol-induced injury was produced by the administration of 1 mL of absolute ethanol to each rat. Animals received vitamin C (250 mg/kg), vitamin E (250 mg/kg), and selenium (0.5 mg/kg) (ViCESe) for 3 d 1 h prior to the administration of absolute ethanol. In the liver of the animals given ethanol, the degenerative changes such as extreme hyperemia, vacuolization in cells of portal areas, a dilation in sinusoids, mononuclear cell infiltration, a swelling in cisternae of granular endoplasmic reticulum and in mitochondrial cristae, an increase in smooth endoplasmic reticulum, many lipid vacuoles were observed both light and electron microscopically. A similar structure was usually distinguished when compared with control animals, in rats given ethanol + ViCESe. In this group, the findings indicating cellular damage were either not observed at all or were decreased. In the group administered ethanol, a reduction of the blood glutathione (GSH) level and increases in serum values of alanine aminotranserase (ALT), aspartate aminotransferase (AST), lactate dehydrogenase (LDH), alkaline phosphatase (ALP), and gamma-glutamyl transferase (GGT) activities were observed, whereas in the control group, the reverse was found to occur. On the other hand, in the group in which ethanol + ViCESe was administered, it was observed that the blood GSH value and serum ALP and ALT activities increased and serum AST, LDH, and GGT activities decreased. As a result, the present study indicates that ViCESe because of their antioxidant activity against ethanol damage have a protective effect on the liver.

  10. Protective effects of ascorbic acid, DL-alpha-tocopherol acetate, and sodium selenate on ethanol-induced gastric mucosal injury of rats.

    PubMed

    Ozdil, Sadakat; Yanardag, Refiye; Koyuturk, Meral; Bolkent, Sehnaz; Arbak, Serap

    2004-01-01

    In this study, the effect of ascorbic acid (vitamin C), DL-alpha-tocopherol acetate (vitamin E), and sodium selenate (selenium) on ethanol-induced gastric mucosal injury in rats was investigated morphologically and biochemically. The gastric mucosal injury was produced by administration of 1 mL of absolute ethanol to each rat. Animals received vitamin C (250 mg/kg), vitamin E (250 mg/kg), and selenium (0.5 mg/kg) for 3 d 1 h prior to the administration of absolute ethanol. In gastric mucosa of rats given ethanol according to control groups, neuronal nitric oxide expression decreased. This immunoreactivity was much lower in the group given ethanol+vitamin C+vitamin E+selenium than the control group and the ethanol-induced group. Scanning electron microscopic evaluation of the ethanol-induced group, when compared to control groups, revealed degenerative changes in gastric mucosa, whereas a good arrangement in surface topography of gastric mucosa in the group given ethanol + vitamin C+vitamin E + selenium was observed. In the group administered ethanol, a reduction of the stomach glutathione (GSH) and serum total protein levels and increases in serum sialic acid, triglycerides, and stomach lipid peroxidation (LPO) levels were observed. Vitamin C+vitamin E+Se administration to alcohol-treated rats significantly increased the serum total protein, triglyceride levels, and stomach GSH levels and significantly lowered the levels of serum sialic acid and stomach LPO compared to untreated alcohol-supplemented rats. As a result of these findings, we can say that the combination of vitamin C, vitamin E, and selenium has a protective effect on ethanol-induced gastric mucosal injury of rats.

  11. Chronic systemic D-galactose exposure induces memory loss, neurodegeneration, and oxidative damage in mice: protective effects of R-alpha-lipoic acid.

    PubMed

    Cui, Xu; Zuo, Pingping; Zhang, Qing; Li, Xuekun; Hu, Yazhuo; Long, Jiangang; Packer, Lester; Liu, Jiankang

    2006-06-01

    Chronic systemic exposure of D-galactose to mice, rats, and Drosophila causes the acceleration of senescence and has been used as an aging model. However, the underlying mechanism is as yet unclear. To investigate the mechanisms of neurodegeneration in this model, we studied cognitive function, hippocampal neuronal apoptosis and neurogenesis, and peripheral oxidative stress biomarkers and also the protective effects of the antioxidant R-alpha-lipoic acid. Chronic systemic exposure of mice to D-galactose (100 mg/kg, s.c., 7 weeks) induced a spatial memory deficit, an increase in cell karyopyknosis, apoptosis, and caspase-3 protein levels in hippocampal neurons, a decrease in the number of new neurons in the subgranular zone in the dentate gyrus, a reduction of migration of neural progenitor cells, and an increase in death of newly formed neurons in the granular cell layer. The D-galactose exposure also induced an increase in peripheral oxidative stress, including an increase in malondialdehyde and decreases in total antioxidative capabilities (T-AOC), total superoxide dismutase (T-SOD), and glutathione peroxidase (GSH-Px) activities. A concomitant treatment with lipoic acid ameliorated cognitive dysfunction and neurodegeneration in the hippocampus and also reduced peripheral oxidative damage by decreasing malondialdehyde and increasing T-AOC and T-SOD, without an effect on GSH-Px. These findings suggest that chronic D-galactose exposure induces neurodegeneration by enhancing caspase-mediated apoptosis and inhibiting neurogenesis and neuron migration, as well as increasing oxidative damage. In addition, D-galactose-induced toxicity in mice is a useful model for studying the mechanisms of neurodegeneration and neuroprotective drugs and agents.

  12. Chronic systemic D-galactose exposure induces memory loss, neurodegeneration, and oxidative damage in mice: protective effects of R-alpha-lipoic acid.

    PubMed

    Cui, Xu; Zuo, Pingping; Zhang, Qing; Li, Xuekun; Hu, Yazhuo; Long, Jiangang; Packer, Lester; Liu, Jiankang

    2006-08-15

    Chronic systemic exposure of mice, rats, and Drosophila to D-galactose causes the acceleration of senescence and has been used as an aging model. The underlying mechanism is yet unclear. To investigate the mechanisms of neurodegeneration in this model, we studied cognitive function, hippocampal neuronal apoptosis and neurogenesis, and peripheral oxidative stress biomarkers, and also the protective effects of the antioxidant R-alpha-lipoic acid. Chronic systemic exposure of D-galactose (100 mg/kg, s.c., 7 weeks) to mice induced a spatial memory deficit, an increase in cell karyopyknosis, apoptosis and caspase-3 protein levels in hippocampal neurons, a decrease in the number of new neurons in the subgranular zone in the dentate gyrus, a reduction of migration of neural progenitor cells, and an increase in death of newly formed neurons in granular cell layer. The D-galactose exposure also induced an increase in peripheral oxidative stress, including an increase in malondialdehyde, a decrease in total anti-oxidative capabilities (T-AOC), total superoxide dismutase (T-SOD), and glutathione peroxidase (GSH-Px) activities. A concomitant treatment with lipoic acid ameliorated cognitive dysfunction and neurodegeneration in the hippocampus, and also reduced peripheral oxidative damage by decreasing malondialdehyde and increasing T-AOC and T-SOD, without an effect on GSH-Px. These findings suggest that chronic D-galactose exposure induces neurodegeneration by enhancing caspase-mediated apoptosis and inhibiting neurogenesis and neuron migration, as well as increasing oxidative damage. In addition, D-galactose-induced toxicity in mice is a useful model for studying the mechanisms of neurodegeneration and neuroprotective drugs and agents.

  13. Enriching M. sternomandibularis with alpha-tocopherol by dietary means does not protect against the lipid oxidation caused by high-pressure processing.

    PubMed

    Tume, R K; Sikes, A L; Smith, S B

    2010-01-01

    We hypothesized that elevating the concentration of alpha-tocopherol in beef muscle tissue by dietary means would increase lipid stability following high-pressure processing. Beef M. sternomandibularis was obtained from cattle that had medium (4.92 microg/g) and high (7.30 microg/g) concentrations of alpha-tocopherol. Post-rigor, paired muscles samples were subjected to pressures of 0.1 (atmospheric), 200 or 800 MPa for 20 min at approximately 60 degrees C. Following high-pressure processing, measurements were made immediately (d 0) or on samples stored in the dark for 6 d at 4 degrees C (d 6). Intramuscular lipid was similar for each group (4.02% vs. 4.26%, respectively; P=0.78), but lipid from the medium alpha-tocopherol muscle was more saturated and less monounsaturated than muscle from the high alpha-tocopherol group. High-pressure processing at 800 MPa and 60 degrees C did not reduce the amount of alpha-tocopherol but significantly reduced the concentration of linoleic acid (18:2n-6) in muscle from both production groups of cattle. Thiobarbituric acid reactive substances increased linearly with treatment pressure only in d 6 samples (day x pressure interaction P=0.0001) and were higher overall (P=0.02) in the high alpha-tocopherol muscle than in the medium alpha-tocopherol muscle. At d 6, lipid peroxides were decreased (P=0.007) by high-pressure treatment and were higher (P<0.0001) in the high alpha-tocopherol group than in the medium alpha-tocopherol group. Therefore, muscle from the high alpha-tocopherol cattle in this study had a greater accumulation of lipid peroxides by d 6, making the muscle from those cattle more susceptible to oxidation. PMID:20374755

  14. Enriching M. sternomandibularis with alpha-tocopherol by dietary means does not protect against the lipid oxidation caused by high-pressure processing.

    PubMed

    Tume, R K; Sikes, A L; Smith, S B

    2010-01-01

    We hypothesized that elevating the concentration of alpha-tocopherol in beef muscle tissue by dietary means would increase lipid stability following high-pressure processing. Beef M. sternomandibularis was obtained from cattle that had medium (4.92 microg/g) and high (7.30 microg/g) concentrations of alpha-tocopherol. Post-rigor, paired muscles samples were subjected to pressures of 0.1 (atmospheric), 200 or 800 MPa for 20 min at approximately 60 degrees C. Following high-pressure processing, measurements were made immediately (d 0) or on samples stored in the dark for 6 d at 4 degrees C (d 6). Intramuscular lipid was similar for each group (4.02% vs. 4.26%, respectively; P=0.78), but lipid from the medium alpha-tocopherol muscle was more saturated and less monounsaturated than muscle from the high alpha-tocopherol group. High-pressure processing at 800 MPa and 60 degrees C did not reduce the amount of alpha-tocopherol but significantly reduced the concentration of linoleic acid (18:2n-6) in muscle from both production groups of cattle. Thiobarbituric acid reactive substances increased linearly with treatment pressure only in d 6 samples (day x pressure interaction P=0.0001) and were higher overall (P=0.02) in the high alpha-tocopherol muscle than in the medium alpha-tocopherol muscle. At d 6, lipid peroxides were decreased (P=0.007) by high-pressure treatment and were higher (P<0.0001) in the high alpha-tocopherol group than in the medium alpha-tocopherol group. Therefore, muscle from the high alpha-tocopherol cattle in this study had a greater accumulation of lipid peroxides by d 6, making the muscle from those cattle more susceptible to oxidation.

  15. Developmental Toxicity of Perfluorononanoic Acid in the Wild-Type and PPAR-alpha Knock-out Mouse After Gestational Exposure

    EPA Science Inventory

    Perfluorononanoic acid (PFNA) is a perfluoroalkyl acid detected in the environment and in tissues of humans and wildlife, and its concentration in human serum has increased in the past few years. PFNA negatively affects development and survival of CD1 mice and activates peroxisom...

  16. Constituents from Terminalia species increase PPAR-Alpha and PPAR-Gamma levels and stimulate glucose uptake without enhancing adipocyte differentiation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The fruits of Terminalia bellerica Roxb.(Combretaceae) and T. chebula Retz. (Combretaceae) are important components of triphala, a popular Ayurvedic formulation, for treating diabetes in Indian traditional medicine. The aim of this study was to evaluate the effects of the constituents of T. belleric...

  17. Increased 4-hydroxynonenal protein adducts in male GSTA4–4/PPAR-alpha double knockout mice enhance injury during early stages of alcoholic liver disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To test the significance of lipid peroxidation in the development of alcoholic liver injury, an ethanol (EtOH) liquid diet was fed to male wild type 129/SvJ mice, and glutathione S-transferase A4-4 null (GSTA4-/-) mice for 40 d. GSTA4-/- mice were also crossed with peroxisome proliferator-activated ...

  18. Tumor necrosis factor alpha-induced apoptosis in human neuronal cells: protection by the antioxidant N-acetylcysteine and the genes bcl-2 and crmA.

    PubMed Central

    Talley, A K; Dewhurst, S; Perry, S W; Dollard, S C; Gummuluru, S; Fine, S M; New, D; Epstein, L G; Gendelman, H E; Gelbard, H A

    1995-01-01

    Tumor necrosis factor alpha (TNF-alpha) is a candidate human immunodeficiency virus type 1-induced neurotoxin that contributes to the pathogenesis of AIDS dementia complex. We report here on the effects of exogenous TNF-alpha on SK-N-MC human neuroblastoma cells differentiated to a neuronal phenotype with retinoic acid, TNF-alpha caused a dose-dependent loss of viability and a corresponding increase in apoptosis in differentiated SK-N-MC cells but not in undifferentiated cultures. Importantly, intracellular signalling via TNF receptors, as measured by activation of the transcription factor NF-kappa B, was unaltered by retinoic acid treatment. Finally, overexpression of bcl-2 or crmA conferred resistance to apoptosis mediated by TNF-alpha, as did the addition of the antioxidant N-acetylcysteine. These results suggest that TNF-alpha induces apoptosis in neuronal cells by a pathway that involves formation of reactive oxygen intermediates and which can be blocked by specific genetic interventions. PMID:7739519

  19. An unusual vitamin E constituent (alpha-tocomonoenol) provides enhanced antioxidant protection in marine organisms adapted to cold-water environments.

    PubMed

    Yamamoto, Y; Fujisawa, A; Hara, A; Dunlap, W C

    2001-11-01

    A new vitamin E constituent having an unusual methylene unsaturation at the isoprenoid-chain terminus of alpha-tocopherol (alpha-Toc) was isolated from chum salmon eggs and was found to have identical antioxidant activity as does alpha-Toc in methanol or liposomal suspension at 37 degrees C. Here we report that this marine-derived tocopherol (MDT) is broadly distributed with alpha-Toc in the tissue of marine fish, and that the MDT composition of total vitamin E is greater in the flesh of cold-water salmon (12-20%) than in that of tropical fish (< or =2.5%). Vitamin E analysis of cultured masu salmon maintained on a MDT-deplete diet showed substantially less MDT content than native masu salmon, suggesting a trophic origin of MDT. This contention is supported by the finding of MDT in marine plankton from the cold waters of Hokkaido. We found that MDT inhibited peroxidation of cholesterol-containing phosphatidylcholine liposomes to a greater extent than did alpha-Toc at 0 degrees C. Furthermore, the ratios of the rate constants for MDT and alpha-Toc to scavenge peroxyl radicals increased with decreasing rates of radical flux in liposomes and fish oil at 0 degrees C, indicating that the enhanced activity of MDT at low temperature is attributed to its greater rate of diffusion in viscous lipids. These results suggest that MDT production, or its trophic accumulation, may reduce lipid peroxidation in marine organisms functionally adapted to cold-water environments.

  20. A Chimeric 18L1-45RG1 Virus-Like Particle Vaccine Cross-Protects against Oncogenic Alpha-7 Human Papillomavirus Types

    PubMed Central

    Huber, Bettina; Schellenbacher, Christina; Jindra, Christoph; Fink, Dieter; Shafti-Keramat, Saeed; Kirnbauer, Reinhard

    2015-01-01

    Persistent infection with oncogenic human papillomaviruses (HPV) types causes all cervical and a subset of other anogenital and oropharyngeal carcinomas. Four high-risk (hr) mucosal types HPV16, 18, 45, or 59 cause almost all cervical adenocarcinomas (AC), a subset of cervical cancer (CxC). Although the incidence of cervical squamous cell carcinoma (SCC) has dramatically decreased following introduction of Papanicolaou (PAP) screening, the proportion of AC has relatively increased. Cervical SCC arise mainly from the ectocervix, whereas AC originate primarily from the endocervical canal, which is less accessible to obtain viable PAP smears. Licensed (bivalent and quadrivalent) HPV vaccines comprise virus-like particles (VLP) of the most important hr HPV16 and 18, self-assembled from the major capsid protein L1. Due to mainly type-restricted efficacy, both vaccines do not target 13 additional hr mucosal types causing 30% of CxC. The papillomavirus genus alpha species 7 (α7) includes a group of hr types of which HPV18, 45, 59 are proportionally overrepresented in cervical AC and only partially (HPV18) targeted by current vaccines. To target these types, we generated a chimeric vaccine antigen that consists of a cross-neutralizing epitope (homologue of HPV16 RG1) of the L2 minor capsid protein of HPV45 genetically inserted into a surface loop of HPV18 L1 VLP (18L1-45RG1). Vaccination of NZW rabbits with 18L1-45RG1 VLP plus alum-MPL adjuvant induced high-titer neutralizing antibodies against homologous HPV18, that cross-neutralized non-cognate hr α7 types HPV39, 45, 68, but not HPV59, and low risk HPV70 in vitro, and induced a robust L1-specific cellular immune response. Passive immunization protected mice against experimental vaginal challenge with pseudovirions of HPV18, 39, 45 and 68, but not HPV59 or the distantly related α9 type HPV16. 18L1-45RG1 VLP might be combined with our previously described 16L1-16RG1 VLP to develop a second generation bivalent vaccine

  1. Peroxisome proliferator-activated receptor-alpha control of lipid and glucose metabolism in human white adipocytes.

    PubMed

    Ribet, Carole; Montastier, Emilie; Valle, Carine; Bezaire, Véronic; Mazzucotelli, Anne; Mairal, Aline; Viguerie, Nathalie; Langin, Dominique

    2010-01-01

    This work aimed at characterizing the role of peroxisome proliferator-activated receptors (PPAR)alpha in human white adipocyte metabolism and at comparing PPAR alpha and PPAR gamma actions in these cells. Primary cultures of human fat cells were treated with the PPAR alpha agonist GW7647 or the PPAR gamma agonist rosiglitazone. Changes in gene expression were determined using DNA microarrays and quantitative RT-PCR. Western blot and metabolic studies were performed to identify the biological effects elicited by PPAR agonist treatments. GW7647 induced an up-regulation of beta-oxidation gene expression and increased palmitate oxidation. Unexpectedly, glycolysis was strongly reduced at transcriptional and functional levels by GW7647 leading to a decrease in pyruvate and lactate production. Glucose oxidation was decreased. Triglyceride esterification and de novo lipogenesis were inhibited by the PPAR alpha agonist. GW7647-induced alterations were abolished by a treatment with a PPAR alpha antagonist. Small interfering RNA-mediated extinction of PPAR alpha gene expression in hMADS adipocytes attenuated GW7647 induction of palmitate oxidation. Rosiglitazone had no major impact on glycolysis and beta-oxidation. Altogether these results show that PPAR alpha can selectively up-regulate beta-oxidation and decrease glucose utilization in human white adipocytes.

  2. Peroxisome proliferator-activated receptor-alpha control of lipid and glucose metabolism in human white adipocytes.

    PubMed

    Ribet, Carole; Montastier, Emilie; Valle, Carine; Bezaire, Véronic; Mazzucotelli, Anne; Mairal, Aline; Viguerie, Nathalie; Langin, Dominique

    2010-01-01

    This work aimed at characterizing the role of peroxisome proliferator-activated receptors (PPAR)alpha in human white adipocyte metabolism and at comparing PPAR alpha and PPAR gamma actions in these cells. Primary cultures of human fat cells were treated with the PPAR alpha agonist GW7647 or the PPAR gamma agonist rosiglitazone. Changes in gene expression were determined using DNA microarrays and quantitative RT-PCR. Western blot and metabolic studies were performed to identify the biological effects elicited by PPAR agonist treatments. GW7647 induced an up-regulation of beta-oxidation gene expression and increased palmitate oxidation. Unexpectedly, glycolysis was strongly reduced at transcriptional and functional levels by GW7647 leading to a decrease in pyruvate and lactate production. Glucose oxidation was decreased. Triglyceride esterification and de novo lipogenesis were inhibited by the PPAR alpha agonist. GW7647-induced alterations were abolished by a treatment with a PPAR alpha antagonist. Small interfering RNA-mediated extinction of PPAR alpha gene expression in hMADS adipocytes attenuated GW7647 induction of palmitate oxidation. Rosiglitazone had no major impact on glycolysis and beta-oxidation. Altogether these results show that PPAR alpha can selectively up-regulate beta-oxidation and decrease glucose utilization in human white adipocytes. PMID:19887568

  3. Increased TNF-alpha/IFN-gamma/IL-2 and decreased TNF-alpha/IFN-gamma production by central memory T cells are associated with protective responses against bovine tuberculosis following BCG vaccination

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Central memory T cells (Tcm’s) and polyfunctional CD4 T responses contribute to vaccine-elicited protection with both human and bovine tuberculosis (TB); however, their combined role in protective immunity to TB is unclear. To address this question, we evaluated polyfunctional cytokine responses by ...

  4. The protective effects of ambroxol on radiation lung injury and influence on production of transforming growth factor beta1 and tumor necrosis factor alpha.

    PubMed

    Xia, De-Hong; Xi, Lei; Xv, Chen; Mao, Wei-Dong; Shen, Wei-Sheng; Shu, Zhong-Qin; Yang, Hong-Zhi; Dai, Min

    2010-09-01

    The aim of this article was to investigate the effect of ambroxol on radiation lung injury and the expression of transforming growth factor beta(1) (TGF-beta(1)), as well as tumor necrosis factor alpha (TNF-alpha) in plasma. Totally, 120 patients with locally advanced lung cancer in radiotherapy were randomized into treatment and control groups. Patients in the treatment group took ambroxol orally at a dosage of 90 mg, three times per day for 3 months from the beginning of radiotherapy. The expression of TGF-beta(1) and TNF-alpha in plasma was analyzed. The clinical symptoms and lung diffusing capacity were monitored using high resolving power computed tomography. The level of TGF-beta(1) in the control group was increased (11.8 +/- 5.5 ng/ml), whereas in ambroxol-treated patients, the increase was not significant (5.6 +/- 2.6 ng/ml, P < 0.001). Radiotherapy-induced elevation of TNF-alpha levels, seen in control patients, was also abolished after treatment with ambroxol (5.1 +/- 1.0 vs. 2.4 +/- 0.8 ng/ml, P < 0.001). In the treatment group, carbon monoxide diffusion capacity was not significantly decreased at 6, 12, and 18 months post-radiotherapy, compared with the control group (P < 0.05). Ambroxol decreased the expression of TGF-beta(1) and TNF-alpha, and minimized the diminishment of lung diffusion capacity after radiotherapy.

  5. Hepatocyte nuclear factor 4 alpha ligand binding and F domains mediate interaction and transcriptional synergy with the pancreatic islet LIM HD transcription factor Isl1.

    PubMed

    Eeckhoute, J; Briche, I; Kurowska, M; Formstecher, P; Laine, B

    2006-12-01

    The orphan nuclear receptor HNF4alpha and the LIM homeodomain factor Isl1 are co-expressed in pancreatic beta-cells and are required for the differentiation and function of these endocrine cells. HNF4alpha activates numerous genes and mutations in its gene are associated with maturity onset diabetes of the young. Cofactors and transcription factors that interact with HNF4alpha are crucial to modulate its transcriptional activity, since the latter is not regulated by conventional ligands. These transcriptional partners interact mainly through the HNF4alpha AF-1 module and the ligand binding domain, which contains the AF-2 module. Here, we showed that Isl1 could enhance the HNF4alpha-mediated activation of transcription of the HNF1alpha, PPARalpha and insulin I promoters. Isl1 interacted with the HNF4alpha AF-2 but also required the HNF4alpha carboxy-terminal F domain for optimal interaction and transcriptional synergy. More specifically, we found that naturally occurring HNF4alpha isoforms, differing only in their F domain, exhibited different abilities to interact and synergize with Isl1, extending the crucial transcriptional modulatory role of the HNF4alpha F domain. HNF4alpha interacted with both the homeodomain and the first LIM domain of Isl1. We found that the transcriptional synergy between HNF4alpha and Isl1 involved an increase in HNF4alpha loading on promoter. The effect was more pronounced on the rat insulin I promoter containing binding sites for both HNF4alpha and Isl1 than on the human HNF1alpha promoter lacking an Isl1 binding site. Moreover, Isl1 could mediate the recruitment of the cofactor CLIM2 resulting in a further transcriptional enhancement of the HNF1alpha promoter activity.

  6. Expression of the human UGT1 locus in transgenic mice by 4-chloro-6-(2,3-xylidino)-2-pyrimidinylthioacetic acid (WY-14643) and implications on drug metabolism through peroxisome proliferator-activated receptor alpha activation.

    PubMed

    Senekeo-Effenberger, Kathy; Chen, Shujuan; Brace-Sinnokrak, Erin; Bonzo, Jessica A; Yueh, Mei-Fei; Argikar, Upendra; Kaeding, Jenny; Trottier, Jocelyn; Remmel, Rory P; Ritter, Joseph K; Barbier, Olivier; Tukey, Robert H

    2007-03-01

    The UDP-glucuronosyltransferase (UGT) 1A genes in humans have been shown to be differentially regulated in a tissue-specific fashion. Transgenic mice carrying the human UGT1 locus (Tg-UGT1) were recently created, demonstrating that expression of the nine UGT1A genes closely resembles the patterns of expression observed in human tissues. In the present study, UGT1A1, UGT1A3, UGT1A4, and UGT1A6 have been identified as targets of the peroxisome proliferator-activated receptor (PPAR) alpha in human hepatocytes and Tg-UGT1 mice. Oral administration of the PPARalpha agonist 4-chloro-6-(2,3-xylidino)-2-pyrimidinylthioacetic acid (pirinixic acid, WY-14643) to Tg-UGT1 mice led to induction of these proteins in either the liver, gastrointestinal tract, or kidney. The levels of induced UGT1A3 gene transcripts in liver and UGT1A4 protein in small intestine correlated with induced lamotrigine glucuronidation activity in these tissues. With UGT1A3 previously identified as the major human enzyme involved in human C24-glucuronidation of lithocholic acid (LCA), the dramatic induction of liver UGT1A3 RNA in Tg-UGT1 mice was consistent with the formation of LCA-24G in plasma. Furthermore, PPAR-responsive elements (PPREs) were identified flanking the UGT1A1, UGT1A3, and UGT1A6 genes by a combination of site-directed mutagenesis, specific binding to PPARalpha and retinoic acid X receptor alpha, and functional response of the concatenated PPREs in HepG2 cells overexpressing PPARalpha. In conclusion, these results suggest that oral fibrate treatment in humans will induce the UGT1A family of proteins in the gastrointestinal tract and liver, influencing bile acid glucuronidation and first-pass metabolism of other drugs that are taken concurrently with hypolipidemic therapy. PMID:17151188

  7. 40 CFR 721.10721 - Poly(oxy-1,2-ethanediyl), .alpha.,.alpha.′-[(1-methylethylidene)di-4,1-phenylene]bis[.omega.-[[6...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Poly(oxy-1,2-ethanediyl), .alpha.,.alpha.â²- bis oxy]-. 721.10721 Section 721.10721 Protection of Environment ENVIRONMENTAL PROTECTION... New Uses for Specific Chemical Substances § 721.10721 Poly(oxy-1,2-ethanediyl), .alpha.,.alpha.′-...

  8. Alpha Thalassemia

    MedlinePlus

    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  9. Effects of the peroxisome proliferator-activated receptor-alpha agonists clofibrate and fish oil on hepatic fatty acid metabolism in weaned dairy calves.

    PubMed

    Litherland, N B; Bionaz, M; Wallace, R L; Loor, J J; Drackley, J K

    2010-06-01

    Peroxisome proliferator-activated receptor-alpha (PPARalpha) agonists increase fatty acid oxidation in liver of nonruminants. If similar effects occur in dairy cattle, enhanced hepatic oxidative capacity could decrease circulating nonesterified fatty acids and hepatic triacylglycerol accumulation in periparturient cows. The objectives of this study were 1) to determine whether partitioning of fatty acid metabolism by liver slices from weaned Holstein calves treated with PPARalpha agonists in vivo is altered compared with partitioning by liver slices from control (untreated) calves, and 2) to measure in vitro metabolism of palmitate and oleate by bovine liver slices and relate these to mRNA abundance for key enzymes. Weaned male Holstein calves (7 wk old; n=15) were assigned to 1 of 3 groups for a 5-d treatment period: control (untreated), clofibrate (62.5 mg/kg of BW), or fish oil (250 mg/kg of BW). Calves treated with clofibrate consumed less dry matter. Body weight, liver weight, liver weight:body weight ratio, blood nonesterified fatty acids, beta-hydroxybutyrate, and liver composition were not significantly different among treatments. Liver slices were incubated for 2, 4, and 8 h to determine in vitro conversion of [1-(14)C] palmitate and [1-(14)C] oleate to CO(2), acid-soluble products, esterified products, and total metabolism. In liver slices incubated for 8 h, conversion of palmitate to CO(2) was greater for calves treated with clofibrate compared with control calves or calves treated with fish oil. Conversion of palmitate to esterified products, total palmitate metabolism, and metabolism of oleate were not different among treatments. Conversion of palmitate to CO(2) was greater than that from oleate for all treatments, but rates of total metabolism did not differ. Clofibrate increased or tended to increase liver expression of several PPARalpha target genes involved in fatty acid oxidation (e.g., ACADVL, ACOX1, CPT1A), whereas fish oil did not significantly

  10. Variable protection against experimental broiler necrotic enteritis after immunization with the C-terminal fragment of Clostridium perfringens alpha-toxin and a non-toxic NetB variant

    PubMed Central

    Fernandes da Costa, Sérgio P.; Mot, Dorien; Geeraerts, Sofie; Bokori-Brown, Monika; Van Immerseel, Filip; Titball, Richard W.

    2016-01-01

    ABSTRACT Necrotic enteritis toxin B (NetB) is a pore-forming toxin produced by Clostridium perfringens and has been shown to play a key role in avian necrotic enteritis, a disease causing significant costs to the poultry production industry worldwide. The aim of this work was to determine whether immunization with a non-toxic variant of NetB (NetB W262A) and the C-terminal fragment of C. perfringens alpha-toxin (CPA247–370) would provide protection against experimental necrotic enteritis. Immunized birds with either antigen or a combination of antigens developed serum antibody levels against NetB and CPA. When CPA247–370 and NetB W262A were used in combination as immunogens, an increased protection was observed after oral challenge by individual dosing, but not after in-feed-challenge. PMID:26743457

  11. Protective effect of nicotine through nicotinic acetylcholine receptor alpha 7 on hypoxia-induced membrane disintegration and DNA fragmentation of cultured PC12 cells.

    PubMed

    Tohgi, H; Utsugisawa, K; Nagane, Y

    2000-05-12

    To investigate the effect of nicotine on hypoxic neuronal damage, cultured PC12 cells were exposed to hypoxia for 9 h and then reoxygenated for 72 h. The cells were stained by propidium iodide (PI), a marker of cell membrane disintegration and the TUNEL method, which indicates DNA fragmentation. In control cultures, the ratio of PI-positive cells to total cells progressively increased during and after exposure to hypoxia, constituting 39% of total cells at 72 h posthypoxia. This increase in PI-positive cells was completely inhibited by nicotine until 12 h posthypoxia, and was partially and dose-dependently inhibited thereafter. The ratio of TUNEL-positive cells to total cells started to increase at 24 h posthypoxia and reached 36% at 72 h in control cultures. This ratio was also dose-dependently inhibited by nicotine. These inhibitory effects of nicotine on the increase in PI-positive and TUNEL-positive cells were abolished by the addition to the medium of alpha-bungarotoxin, an antagonistic ligand for nicotinic acetylcholine receptor (AChR) alpha7. These findings suggest that nicotine inhibits, through AChR alpha7, hypoxia-induced cell membrane disintegration and DNA fragmentation of cultured PC12 cells exposed to hypoxia.

  12. Decay-accelerating factor induction by tumour necrosis factor-alpha, through a phosphatidylinositol-3 kinase and protein kinase C-dependent pathway, protects murine vascular endothelial cells against complement deposition.

    PubMed

    Ahmad, Saifur R; Lidington, Elaine A; Ohta, Rieko; Okada, Noriko; Robson, Michael G; Davies, Kevin A; Leitges, Michael; Harris, Claire L; Haskard, Dorian O; Mason, Justin C

    2003-10-01

    We have shown that human endothelial cells (EC) are protected against complement-mediated injury by the inducible expression of decay-accelerating factor (DAF). To understand further the importance of DAF regulation, we characterized EC DAF expression on murine EC in vitro and in vivo using a model of glomerulonephritis. Flow cytometry using the monoclonal antibody (mAb) Riko-3 [binds transmembrane- and glycosylphosphatidylinositol (GPI)-anchored DAF], mAb Riko-4 (binds GPI-anchored DAF) and reverse transcription-polymerase chain reaction (RT-PCR), demonstrated that murine EC DAF is GPI-anchored. Tumour necrosis factor-alpha (TNF-alpha) increased EC DAF expression, detectable at 6 hr and maximal at 24-48 hr poststimulation. DAF upregulation required increased steady-state DAF mRNA and protein synthesis. In contrast, no increased expression of the murine complement receptor-related protein-Y (Crry) was seen with TNF-alpha. DAF upregulation was mediated via a protein kinase C (PKC)alpha, phosphoinositide-3 kinase (PI-3 kinase), p38 mitogen-activated protein kinase (MAPK) and nuclear factor-kappaB (NF-kappaB)-dependent pathway. The increased DAF was functionally relevant, resulting in a marked reduction in C3 deposition following complement activation. In a nephrotoxic nephritis model, DAF expression on glomerular capillaries was significantly increased 2 hr after the induction of disease. The demonstration of DAF upregulation above constitutive levels suggests that this may be important in the maintenance of vascular integrity during inflammation, when the risk of complement-mediated injury is increased. The mouse represents a suitable model for the study of novel therapeutic approaches by which vascular endothelium may be conditioned against complement-mediated injury.

  13. Human hsp27, Drosophila hsp27 and human alphaB-crystallin expression-mediated increase in glutathione is essential for the protective activity of these proteins against TNFalpha-induced cell death.

    PubMed Central

    Mehlen, P; Kretz-Remy, C; Préville, X; Arrigo, A P

    1996-01-01

    Expression of small stress proteins (shsp) enhances the survival of mammalian cells exposed to heat or oxidative injuries. Recently, we have shown that the expression of shsp from different species, such as human hsp27, Drosophila hsp27 or human alphaB-crystallin protected murine L929 cells against cell death induced by tumor necrosis factor (TNFalpha), hydrogen peroxide or menadione. Here, we report that, in growing L929 cell lines, the presence of these shsp decreased the intracellular level of reactive oxygen species (ROS). shsp expression also abolished the burst of intracellular ROS induced by TNFalpha. Several downstream effects resulting from the TNFalpha-mediated ROS increment, such as NF-kappaB activation, lipid peroxidation and protein oxidation, were inhibited by shsp expression. We also report that the expression of these different shsp raised the total glutathione level in both L929 cell lines and transiently transfected NIH 3T3-ras cells. This phenomenon was essential for the shsp-mediated decrease in ROS and resistance against TNFalpha. Our results therefore suggest that the protective activity shared by human hsp27, Drosophila hsp27 and human alphaB-crystallin against TNFalpha-mediated cell death and probably other types of oxidative stress results from their conserved ability to raise the intracellular concentration of glutathione. Images PMID:8654367

  14. 21 CFR 866.5080 - Alpha-1-antichymotrypsin immunological test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... immunochemical techniques alpha-1-antichymotrypsin (a protein) in serum, other body fluids, and tissues. Alpha-1-antichymotrypsin helps protect tissues against proteolytic (protein-splitting) enzymes released during...

  15. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  16. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  17. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  18. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  19. 40 CFR 721.10214 - Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Poly(oxyalkylenediyl),.alpha... Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic... identified generically as poly(oxyalkylenediyl),.alpha.-substituted...

  20. 40 CFR 721.10214 - Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Poly(oxyalkylenediyl),.alpha... Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic... identified generically as poly(oxyalkylenediyl),.alpha.-substituted...

  1. 40 CFR 721.10214 - Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Poly(oxyalkylenediyl),.alpha... Poly(oxyalkylenediyl),.alpha.-substituted carbomonocycle-.omega.-substituted carbomonocycle (generic... identified generically as poly(oxyalkylenediyl),.alpha.-substituted...

  2. Double di oxygenation by mouse 8S-lipoxygenase: Specific formation of a potent peroxisome proliferator-activated receptor {alpha} agonist

    SciTech Connect

    Jisaka, Mitsuo . E-mail: jisaka@life.shimane-u.ac.jp; Iwanaga, Chitose; Takahashi, Nobuyuki; Goto, Tsuyoshi; Kawada, Teruo; Yamamoto, Tatsuyuki; Ikeda, Izumi; Nishimura, Kohji; Nagaya, Tsutomu; Fushiki, Tohru; Yokota, Kazushige

    2005-12-09

    Mouse 8S-lipoxygenase (8-LOX) metabolizes arachidonic acid (AA) specifically to 8S-hydroperoxyeicosatetraenoic acid (8S-HPETE), which will be readily reduced under physiological circumstances to 8S-hydroxyeicosatetraenoic acid (8S-HETE), a natural agonist of peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}). Here, we investigated whether 8-LOX could further oxygenate AA and whether the products could activate PPARs. The purified recombinant 8-LOX converted AA exclusively to 8S-HPETE and then to (8S,15S)-dihydroperoxy-5Z,9E,11Z,13E-eicosatetraenoic acid (8S,15S-diHPETE). The k {sub cat}/K {sub m} values for 8S-HPETE and AA were 3.3 x 10{sup 3} and 2.7 x 10{sup 4} M{sup -1} s{sup -1}, respectively. 8-LOX also dioxygenated 8S-HETE and 15S-H(P)ETE specifically to the corresponding 8S,15S-disubstituted derivatives. By contrast, 15-LOX-2, a human homologue of 8-LOX, produced 8S,15S-diH(P)ETE from 8S-H(P)ETE but not from AA nor 15S-H(P)ETE. 8S,15S-diHETE activated PPAR{alpha} more strongly than 8S-HETE did. The present results suggest that 8S,15S-diH(P)ETE as well as 8S-H(P)ETE would contribute to the physiological function of 8-LOX and also that 8-LOX can function as a potential 15-LOX.

  3. Testing the Effects of dl-Alpha-Tocopherol Supplementation on Oxidative Damage, Total Antioxidant Protection and the Sex-Specific Responses of Reproductive Effort and Lifespan to Dietary Manipulation in Australian Field Crickets (Teleogryllus commodus)

    PubMed Central

    Archer, C. Ruth; Hempenstall, Sarah; Royle, Nick J.; Selman, Colin; Willis, Sheridan; Rapkin, James; Blount, Jon D.; Hunt, John

    2015-01-01

    The oxidative stress theory predicts that the accumulation of oxidative damage causes aging. More generally, oxidative damage could be a cost of reproduction that reduces survival. Both of these hypotheses have mixed empirical support. To better understand the life-history consequences of oxidative damage, we fed male and female Australian field crickets (Teleogryllus commodus) four diets differing in their protein and carbohydrate content, which have sex-specific effects on reproductive effort and lifespan. We supplemented half of these crickets with the vitamin E isoform dl-alpha-tocopherol and measured the effects of nutrient intake on lifespan, reproduction, oxidative damage and antioxidant protection. We found a clear trade-off between reproductive effort and lifespan in females but not in males. In direct contrast to the oxidative stress theory, crickets fed diets that improved their lifespan had high levels of oxidative damage to proteins. Supplementation with dl-alpha-tocopherol did not significantly improve lifespan or reproductive effort. However, males fed diets that increased their reproductive investment experienced high oxidative damage to proteins. While this suggests that male reproductive effort could elevate oxidative damage, this was not associated with reduced male survival. Overall, these results provide little evidence that oxidative damage plays a central role in mediating life-history trade-offs in T. commodus. PMID:26783958

  4. Testing the Effects of DL-Alpha-Tocopherol Supplementation on Oxidative Damage, Total Antioxidant Protection and the Sex-Specific Responses of Reproductive Effort and Lifespan to Dietary Manipulation in Australian Field Crickets (Teleogryllus commodus).

    PubMed

    Archer, C Ruth; Hempenstall, Sarah; Royle, Nick J; Selman, Colin; Willis, Sheridan; Rapkin, James; Blount, Jon D; Hunt, John

    2015-01-01

    The oxidative stress theory predicts that the accumulation of oxidative damage causes aging. More generally, oxidative damage could be a cost of reproduction that reduces survival. Both of these hypotheses have mixed empirical support. To better understand the life-history consequences of oxidative damage, we fed male and female Australian field crickets (Teleogryllus commodus) four diets differing in their protein and carbohydrate content, which have sex-specific effects on reproductive effort and lifespan. We supplemented half of these crickets with the vitamin E isoform DL-alpha-tocopherol and measured the effects of nutrient intake on lifespan, reproduction, oxidative damage and antioxidant protection. We found a clear trade-off between reproductive effort and lifespan in females but not in males. In direct contrast to the oxidative stress theory, crickets fed diets that improved their lifespan had high levels of oxidative damage to proteins. Supplementation with DL-alpha-tocopherol did not significantly improve lifespan or reproductive effort. However, males fed diets that increased their reproductive investment experienced high oxidative damage to proteins. While this suggests that male reproductive effort could elevate oxidative damage, this was not associated with reduced male survival. Overall, these results provide little evidence that oxidative damage plays a central role in mediating life-history trade-offs in T. commodus. PMID:26783958

  5. Testing the Effects of DL-Alpha-Tocopherol Supplementation on Oxidative Damage, Total Antioxidant Protection and the Sex-Specific Responses of Reproductive Effort and Lifespan to Dietary Manipulation in Australian Field Crickets (Teleogryllus commodus).

    PubMed

    Archer, C Ruth; Hempenstall, Sarah; Royle, Nick J; Selman, Colin; Willis, Sheridan; Rapkin, James; Blount, Jon D; Hunt, John

    2015-12-04

    The oxidative stress theory predicts that the accumulation of oxidative damage causes aging. More generally, oxidative damage could be a cost of reproduction that reduces survival. Both of these hypotheses have mixed empirical support. To better understand the life-history consequences of oxidative damage, we fed male and female Australian field crickets (Teleogryllus commodus) four diets differing in their protein and carbohydrate content, which have sex-specific effects on reproductive effort and lifespan. We supplemented half of these crickets with the vitamin E isoform DL-alpha-tocopherol and measured the effects of nutrient intake on lifespan, reproduction, oxidative damage and antioxidant protection. We found a clear trade-off between reproductive effort and lifespan in females but not in males. In direct contrast to the oxidative stress theory, crickets fed diets that improved their lifespan had high levels of oxidative damage to proteins. Supplementation with DL-alpha-tocopherol did not significantly improve lifespan or reproductive effort. However, males fed diets that increased their reproductive investment experienced high oxidative damage to proteins. While this suggests that male reproductive effort could elevate oxidative damage, this was not associated with reduced male survival. Overall, these results provide little evidence that oxidative damage plays a central role in mediating life-history trade-offs in T. commodus.

  6. Postnatal changes of nicotinic acetylcholine receptor alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits genes expression in rat brain.

    PubMed

    Zhang, X; Liu, C; Miao, H; Gong, Z H; Nordberg, A

    1998-10-01

    Postnatal changes of nicotinic acetylcholine receptor (nAChR) alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits mRNAs were investigated in rat brain using ribonuclease protection assay. Multiple developmental patterns were observed: (1) transient expression during the first few postnatal weeks; alpha 2 in the hippocampus and brain stem, alpha 3 in the striatum, cerebellum and cortex, alpha 4 in the hippocampus, striatum and cerebellum, alpha 7 in the cerebellum and beta 2 in the striatum. (2) Constant expression across development; alpha 2 and alpha 3 in the thalamus, alpha 4 in the cortex, thalamus and brain stem, alpha 7 in the thalamus and brain stem and beta 2 in all brain regions except striatum. (3) Non-detection across development; alpha 2 in the cortex, striatum and cerebellum. (4) Increase with age; alpha 7 in the cortex and hippocampus. (5) Bell-shaped development; alpha 7 in the striatum. Postnatal changes of nAChR isoforms in different brain regions of rat were investigated by receptor binding assays. The developmental patterns of [3H]epibatidine and (-)-[3H]nicotine binding sites were similar to each other in each brain region, but different from that of [3H] alpha-bungarotoxin binding sites. No obvious correlation was observed between the developmental patterns of [3H] alpha-bungarotoxin, [3H]epibatidine and (-)-[3H]nicotine binding sites and corresponding subunits mRNAs. These results indicate that multiple mechanisms are involved in changes of gene expression of nAChRs subunits in the brain of developing rats.

  7. Effects of the alpha 2-adrenoreceptor antagonist dexefaroxan on neurogenesis in the olfactory bulb of the adult rat in vivo: selective protection against neuronal death.

    PubMed

    Bauer, S; Moyse, E; Jourdan, F; Colpaert, F; Martel, J C; Marien, M

    2003-01-01

    A dysfunction of noradrenergic mechanisms originating in the locus coeruleus has been hypothesised to be the critical factor underlying the evolution of central neurodegenerative diseases [Colpaert FC (1994) Noradrenergic mechanism Parkinson's disease: a theory. In: Noradrenergic mechanisms in Parkinson's disease (Briley M, Marien M, eds) pp 225-254. Boca Raton, FL, USA: CRC Press Inc.]. alpha(2)-Adrenoceptor antagonists, presumably in part by facilitating central noradrenergic transmission, afford neuroprotection in vivo in models of cerebral ischaemia, excitotoxicity and devascularization-induced neurodegeneration. The present study utilised the rat olfactory bulb as a model system for examining the effects of the selective alpha(2)-adrenoceptor antagonist dexefaroxan upon determinants of neurogenesis (proliferation, survival and death) in the adult brain in vivo. Cell proliferation (5-bromo-2'-deoxyuridine labelling) and cell death associated with DNA fragmentation (terminal dideoxynucleotidyl transferase-catalysed 2'-deoxyuridine-5'-triphosphate nick end-labelling assay) were quantified following a 7-day treatment with either vehicle or dexefaroxan (0.63 mg/kg i.p., three times daily), followed by a 3-day washout period. The number of terminal dideoxynucleotidyl transferase-catalysed 2'-deoxyuridine-5'-triphosphate nick end-labelling-positive nuclei in the olfactory bulb was lower in dexefaroxan-treated rats, this difference being greatest and significant in the subependymal layer (-52%). In contrast, 5-bromo-2'-deoxyuridine-immunoreactive nuclei were more numerous (+68%) in the bulbs of dexefaroxan-treated rats whilst no differences were detected in the proliferating region of the subventricular zone. Terminal dideoxynucleotidyl transferase-catalysed 2'-deoxyuridine-5'-triphosphate nick end-labelling combination with glial fibrillary acidic protein or neuronal-specific antigen immunohistochemistry revealed that terminal dideoxynucleotidyl transferase

  8. Vaccination with recombinant adenoviruses expressing Ebola virus glycoprotein elicits protection in the interferon alpha/beta receptor knock-out mouse.

    PubMed

    O'Brien, Lyn M; Stokes, Margaret G; Lonsdale, Stephen G; Maslowski, David R; Smither, Sophie J; Lever, Mark S; Laws, Thomas R; Perkins, Stuart D

    2014-03-01

    The resistance of adult immunocompetent mice to infection with ebolaviruses has led to the development of alternative small animal models that utilise immunodeficient mice, for example the interferon α/β receptor knock-out mouse (IFNR(-/-)). IFNR(-/-) mice have been shown to be susceptible to infection with ebolaviruses by multiple routes but it is not known if this murine model is suitable for testing therapeutics that rely on the generation of an immune response for efficacy. We have tested recombinant adenovirus vectors for their ability to protect IFNR(-/-) mice from challenge with Ebola virus and have analysed the humoral response generated after immunisation. The recombinant vaccines elicited good levels of protection in the knock-out mouse and the antibody response in IFNR(-/-) mice was similar to that observed in vaccinated wild-type mice. These results indicate that the IFNR(-/-) mouse is a relevant small animal model for studying ebolavirus-specific therapeutics.

  9. NF-κB Protects Human Papillomavirus Type 38 E6/E7-Immortalized Human Keratinocytes against Tumor Necrosis Factor Alpha and UV-Mediated Apoptosis▿

    PubMed Central

    Hussain, Ishraq; Fathallah, Ikbal; Accardi, Rosita; Yue, Jiping; Saidj, Djamel; Shukla, Ruchi; Hasan, Uzma; Gheit, Tarik; Niu, Yamei; Tommasino, Massimo; Sylla, Bakary S.

    2011-01-01

    Constitutive activation of NF-κB signaling is a key event in virus- and non-virus-induced carcinogenesis. We have previously reported that cutaneous human papillomavirus type 38 (HPV38) displays transforming properties in in vitro and in vivo experimental models. However, the involvement of NF-κB signaling in HPV38-induced cell growth transformation remains to be determined. In this study, we showed that HPV38 E6 and E7 activate NF-κB and that inhibition of the pathway with the IκBα superrepressor sensitizes HPV38E6E7-immortalized human keratinocytes to tumor necrosis factor alpha (TNF-α)- and UVB radiation-mediated apoptosis. Accordingly, inhibition of NF-κB signaling resulted in the downregulation of NF-κB-regulated antiapoptotic genes, including cIAP1, cIAP2, and xIAP genes. These findings demonstrate a critical role of NF-κB activity in the survival of HPV38E6E7-immortalized human keratinocytes exposed to cytokine or UV radiation. Our data provide additional evidence for cooperation between beta HPV infection and UV irradiation in skin carcinogenesis. PMID:21715489

  10. Susceptibility effects of GABA receptor subunit alpha-2 (GABRA2) variants and parental monitoring on externalizing behavior trajectories: Risk and protection conveyed by the minor allele.

    PubMed

    Trucco, Elisa M; Villafuerte, Sandra; Heitzeg, Mary M; Burmeister, Margit; Zucker, Robert A

    2016-02-01

    Understanding factors increasing susceptibility to social contexts and predicting psychopathology can help identify targets for prevention. Persistently high externalizing behavior in adolescence is predictive of psychopathology in adulthood. Parental monitoring predicts low externalizing behavior, yet youth likely vary in the degree to which they are affected by parents. Genetic variants of GABA receptor subunit alpha-2 (GABRA2) may increase susceptibility to parental monitoring, thus impacting externalizing trajectories. We had several objectives: (a) to determine whether GABRA2 (rs279827, rs279826, rs279858) moderates the relationship between a component of parental monitoring, parental knowledge, and externalizing trajectories; (b) to test the form of this interaction to assess whether GABRA2 variants reflect risk (diathesis-stress) or susceptibility (differential susceptibility) factors; and (c) to clarify GABRA2 associations on the development of problem behavior. This prospective study (N = 504) identified three externalizing trajectory classes (i.e., low, decreasing, and high) across adolescence. A GABRA2 × Parental Monitoring effect on class membership was observed, such that A-carriers were largely unaffected by parental monitoring, whereas class membership for those with the GG genotype was affected by parental monitoring. Findings support differential susceptibility in GABRA2.

  11. Susceptibility effects of GABA receptor subunit alpha-2 (GABRA2) variants and parental monitoring on externalizing behavior trajectories: Risk and protection conveyed by the minor allele.

    PubMed

    Trucco, Elisa M; Villafuerte, Sandra; Heitzeg, Mary M; Burmeister, Margit; Zucker, Robert A

    2016-02-01

    Understanding factors increasing susceptibility to social contexts and predicting psychopathology can help identify targets for prevention. Persistently high externalizing behavior in adolescence is predictive of psychopathology in adulthood. Parental monitoring predicts low externalizing behavior, yet youth likely vary in the degree to which they are affected by parents. Genetic variants of GABA receptor subunit alpha-2 (GABRA2) may increase susceptibility to parental monitoring, thus impacting externalizing trajectories. We had several objectives: (a) to determine whether GABRA2 (rs279827, rs279826, rs279858) moderates the relationship between a component of parental monitoring, parental knowledge, and externalizing trajectories; (b) to test the form of this interaction to assess whether GABRA2 variants reflect risk (diathesis-stress) or susceptibility (differential susceptibility) factors; and (c) to clarify GABRA2 associations on the development of problem behavior. This prospective study (N = 504) identified three externalizing trajectory classes (i.e., low, decreasing, and high) across adolescence. A GABRA2 × Parental Monitoring effect on class membership was observed, such that A-carriers were largely unaffected by parental monitoring, whereas class membership for those with the GG genotype was affected by parental monitoring. Findings support differential susceptibility in GABRA2. PMID:25797587

  12. Peroxisome proliferator activated receptor-γ agonists protect oligodendrocyte progenitors against tumor necrosis factor-alpha-induced damage: Effects on mitochondrial functions and differentiation.

    PubMed

    De Nuccio, C; Bernardo, A; Cruciani, C; De Simone, R; Visentin, S; Minghetti, L

    2015-09-01

    The activation of the nuclear receptor peroxisome proliferator-activated receptor-γ (PPAR-γ) is known to exert anti-inflammatory and neuroprotective effects and PPAR-γ agonists are considered potential therapeutic agents in brain diseases including those affecting myelin. In demyelinating diseases such as multiple sclerosis (MS), inflammation is one of the causes of myelin and axonal damage. Oligodendrocyte (OL) differentiation is highly dependent on mitochondria, which are major targets of inflammatory insult. Here we show that PPAR-γ agonists protect OL progenitors against the maturational arrest induced by the inflammatory cytokine TNF-α by affecting mitochondrial functions. We demonstrate that the inhibition of OL differentiation by TNF-α is associated with i) increased mitochondrial superoxide production; ii) decreased mitochondrial membrane potential (mMP); and iii) decreased ADP-induced Ca(2+) oscillations, which we previously showed to be dependent on efficient mitochondria. The TNF-α effects were comparable to those of the mitochondrial toxin rotenone, further suggesting that TNF-α damage is mediated by mitochondrial function impairment. PPAR-γ agonists protected OL progenitors against the inhibitory activities of both TNF-α and rotenone on mMP, mitochondrial ROS production, Ca(2+) oscillations and OL differentiation. Finally, the PPAR-γ agonist pioglitazone increased the expression of PGC-1α (a mitochondrial biogenesis master regulator), UCP2 (a mitochondrial protein known to reduce ROS production), and cytochrome oxidase subunit COX1. These findings confirm the central role of mitochondria in OL differentiation and point to mitochondria as major targets of PPAR-γ agonist protection against TNF-α damage. PMID:26210873

  13. Role of Cyt-C/caspases-9,3, Bax/Bcl-2 and the FAS death receptor pathway in apoptosis induced by zinc oxide nanoparticles in human aortic endothelial cells and the protective effect by alpha-lipoic acid.

    PubMed

    Liang, Shuhang; Sun, Kuo; Wang, Yue; Dong, Shuying; Wang, Cheng; Liu, LianXin; Wu, YongHui

    2016-10-25

    Zinc oxide nanoparticles (ZnO NPs) are widely used in a variety of products used in daily life. However, their impact on human health has not been completely elucidated. This study was designed to investigate the cytotoxicity associated with ZnO NPs, the role of dissolution in the toxicity of ZnO NPs, the molecular mechanisms and mode of cell death induced by ZnO NPs in human aortic endothelial cells (HAECs), and the protective effects of the antioxidant alpha-lipoic acid (LA). ZnO NPs significantly reduced cell viability in a dose- and time-dependent manner, resulted in intracellular oxidative stress and cell membrane leakage when treated with doses of 8-50 μg/mL for 12 and 24 h in HAECs. The toxicity was produced by undissolved ZnO NPs but not dissolved Zn(2+) and metal impurities. Exposure to ZnO NPs was found to induce apoptosis at 12 h and necrosis after 24 h. Apoptosis was confirmed using reactive oxygen species that triggered a decrease in mitochondria membrane potential, increase in Cyt-C release, activation of caspases 3 and caspases9 and increase in the ratio of Bax/Bcl-2. Futhermore, ZnO NPs could activate the Fas death receptor pathway. In addition, the antioxidant LA was able to protect HAECs from apoptosis induced by ZnO NPs. PMID:27544635

  14. Role of Cyt-C/caspases-9,3, Bax/Bcl-2 and the FAS death receptor pathway in apoptosis induced by zinc oxide nanoparticles in human aortic endothelial cells and the protective effect by alpha-lipoic acid.

    PubMed

    Liang, Shuhang; Sun, Kuo; Wang, Yue; Dong, Shuying; Wang, Cheng; Liu, LianXin; Wu, YongHui

    2016-10-25

    Zinc oxide nanoparticles (ZnO NPs) are widely used in a variety of products used in daily life. However, their impact on human health has not been completely elucidated. This study was designed to investigate the cytotoxicity associated with ZnO NPs, the role of dissolution in the toxicity of ZnO NPs, the molecular mechanisms and mode of cell death induced by ZnO NPs in human aortic endothelial cells (HAECs), and the protective effects of the antioxidant alpha-lipoic acid (LA). ZnO NPs significantly reduced cell viability in a dose- and time-dependent manner, resulted in intracellular oxidative stress and cell membrane leakage when treated with doses of 8-50 μg/mL for 12 and 24 h in HAECs. The toxicity was produced by undissolved ZnO NPs but not dissolved Zn(2+) and metal impurities. Exposure to ZnO NPs was found to induce apoptosis at 12 h and necrosis after 24 h. Apoptosis was confirmed using reactive oxygen species that triggered a decrease in mitochondria membrane potential, increase in Cyt-C release, activation of caspases 3 and caspases9 and increase in the ratio of Bax/Bcl-2. Futhermore, ZnO NPs could activate the Fas death receptor pathway. In addition, the antioxidant LA was able to protect HAECs from apoptosis induced by ZnO NPs.

  15. Chiral oxime ethers in asymmetric synthesis. O-(1-Phenylbutyl)benzyloxyacetaldoxime, a versatile reagent for the asymmetric synthesis of protected 1,2-aminoalcohols, alpha-amino acid derivatives, and 2-hydroxymethyl nitrogen heterocycles including iminosugars.

    PubMed

    Cooper, Tracey S; Larigo, Alexander S; Laurent, Pierre; Moody, Christopher J; Takle, Andrew K

    2005-04-01

    Addition of a range of organolithium and Grignard reagents to (E)-O-(1-phenylbutyl)benzyloxyacetaldoxime 1 in the presence of boron trifluoride diethyl etherate is highly diastereoselective. The resulting hydroxylamines undergo N-O bond cleavage upon treatment with zinc-acetic acid or molybdenum hexacarbonyl to give, after N-protection, protected 1,2-aminoalcohols 3 in high enantiomeric purity. Debenzylation of 3a and 3d gave N-Boc (R)-alaninol and (S)-phenylalaninol respectively. The hydroxylamines 2 also serve as alpha-amino acid precursors, 2i being converted into N-formyl-(R)-alaninyl-(S)-(4-bromo)phenylalanine ester 7, the N-terminal dipeptide of a natural depsipeptide. The versatility of the 1,2-aminoalcohol derivatives was further illustrated by their conversion into 5-, 6- and 7-membered 2-hydroxymethyl nitrogen heterocycles 15-19 in high enantiomeric excess by a ring-closing metathesis reaction. Further reaction of the dihydropyrrole 15 gave the iminosugar 1,4-dideoxy-1,4-imino-D-ribitol. PMID:15785815

  16. Induction of mouse UDP-glucuronosyltransferase mRNA expression in liver and intestine by activators of aryl-hydrocarbon receptor, constitutive androstane receptor, pregnane X receptor, peroxisome proliferator-activated receptor alpha, and nuclear factor erythroid 2-related factor 2.

    PubMed

    Buckley, David B; Klaassen, Curtis D

    2009-04-01

    UDP-glucuronosyltransferases (UGTs) catalyze the addition of UDP-glucuronic acid to endo- and xenobiotics, enhancing their water solubility and elimination. Many exogenous compounds, such as microsomal enzyme inducers (MEIs), alter gene expression through xenobiotic-responsive transcription factors, namely, the aryl hydrocarbon receptor (AhR), constitutive androstane receptor (CAR), pregnane X receptor (PXR), peroxisome proliferator-activated receptor alpha (PPARalpha), and nuclear factor erythroid 2-related factor 2 (Nrf2). These transcription factors regulate xenobiotic-inducible expression of hepatic and intestinal biotransformation enzymes and transporters. The purpose of this study was to determine hepatic and intestinal inducibility of mouse Ugt mRNA by MEIs. Male C57BL/6 mice were treated for four consecutive days with activators of AhR [2,3,7,8-tetrachlorodibenzodioxin (TCDD), polychlorinated biphenyl 126, and beta-naphthoflavone], CAR [1,4-bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP), phenobarbital, and diallyl sulfide], PXR [pregnenolone-16alpha-carbonitrile (PCN), spironolactone, and dexamethasone], PPARalpha (clofibrate, ciprofibrate, and diethylhexylphthalate), and Nrf2 (oltipraz, ethoxyquin, and butylated hydroxyanisole), respectively. Ugt1a1 mRNA expression in liver was induced by activators of all five transcription factor pathways, Ugt1a5 by Nrf2 activators, Ugt1a6 by all the pathways except CAR, and Ugt1a9 by all the pathways except Nrf2. Ugt2b35 mRNA in liver was induced by AhR activators and Ugt2b36 by CAR and PPARalpha activators. Throughout the small and large intestine, the AhR ligand TCDD increased Ugt1a6 and Ugt1a7 mRNA. In small intestine, the PXR activator PCN increased Ugt1a1, Ugt1a6, Ugt1a7, Ugt2b34, and Ugt2b35 mRNA in the duodenum. In conclusion, chemical activation of AhR, CAR, PXR, PPARalpha, and Nrf2 in mouse results in induction of distinct Ugt gene sets in liver and intestine, predominantly the Ugt1a isoforms.

  17. Protective effect of alpha glucosyl hesperidin (G-hesperidin) on chronic vanadium induced testicular toxicity and sperm nuclear DNA damage in male Sprague Dawley rats.

    PubMed

    Vijaya Bharathi, B; Jaya Prakash, G; Krishna, K M; Ravi Krishna, C H; Sivanarayana, T; Madan, K; Rama Raju, G A; Annapurna, A

    2015-06-01

    The study was conducted to evaluate the vanadium-induced testicular toxicity and its effect on sperm parameters, sperm nuclear DNA damage and histological alterations in Sprague Dawley rats and to assess the protective effect of G-hesperidin against this damage. Treatment of rats with vanadium at a dose of 1 mg kg bw(-1) for 90 days resulted in significant reduction in serum testosterone levels, sperm count and motility. Further, a parallel increase in abnormal sperm morphology and adverse histopathological changes in testis was also associated with vanadium administration when compared to normal control. Moreover, sperm chromatin dispersion assay revealed that vanadium induces sperm nuclear DNA fragmentation. A marked increase in testicular malondialdehyde levels and decreased activity of antioxidant enzymes such as superoxide dismutase and catalase indicates vanadium-induced oxidative stress. Co-administration of G-hesperidin at a dose of 25 and 50 mg kg bw(-1) significantly attenuated the sperm parameters and histological changes by restoring the antioxidant levels in rat testis. These results suggested that vanadium exposure caused reduced bioavailability of androgens to the tissue and increased free radical formation, thereby causing structural and functional changes in spermatozoa. G-hesperidin exhibited antioxidant effect by protecting the rat testis against vanadium-induced oxidative damage, further ensures antioxidant potential of bioflavonoids.

  18. 40 CFR 721.10491 - Benzenepropanal,.alpha.-methyl-.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Benzenepropanal,.alpha.-methyl-. 721... Substances § 721.10491 Benzenepropanal,.alpha.-methyl-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzenepropanal,.alpha.-methyl- (PMN...

  19. 40 CFR 721.10491 - Benzenepropanal,.alpha.-methyl-.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Benzenepropanal,.alpha.-methyl-. 721... Substances § 721.10491 Benzenepropanal,.alpha.-methyl-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzenepropanal,.alpha.-methyl- (PMN...

  20. Test chamber for alpha spectrometry

    DOEpatents

    Larsen, Robert P.

    1977-01-01

    Alpha emitters for low-level radiochemical analysis by measurement of alpha spectra are positioned precisely with respect to the location of a surface-barrier detector by means of a chamber having a removable threaded planchet holder. A pedestal on the planchet holder holds a specimen in fixed engagement close to the detector. Insertion of the planchet holder establishes an O-ring seal that permits the chamber to be pumped to a desired vacuum. The detector is protected against accidental contact and resulting damage.

  1. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  2. Microspheres containing neutralizing antibodies to tumor necrosis factor-alpha and interleukin-1 beta protect rats from Staphylococcus aureus-induced peritonitis.

    PubMed

    D'Souza, M; Oettinger, C W; Milton, G V

    2000-10-01

    NA is 100% effective in combination with vancomycin in protecting rats from S. aureus-induced peritonitis. The microsphere form was also more efficient in attenuating both TNF and IL-1 levels.

  3. LUTEOLIN PROTECTS AGAINST VASCULAR INFLAMMATION IN MICE AND TNF-ALPHA-INDUCED MONOCYTE ADHESION TO ENDOTHELIAL CELLS VIA SUPPRESSING IΚBα/NF-κB SIGNALING PATHWAY

    PubMed Central

    Jia, Zhenquan; Nallasamy, Palanisamy; Liu, Dongmin; Shah, Halley; Li, Jason Z.; Chitrakar, Rojin; Si, Hongwei; McCormick, John; Zhu, Hong; Zhen, Wei; Li, Yunbo

    2015-01-01

    Vascular inflammation plays a significant role in the pathogenesis of atherosclerosis. Luteolin, a naturally-occurring flavanoid, present in many medicinal plants as well as in some commonly consumed fruits and vegetables has received wide attention for its potential to improve vascular function in vitro. However, its effect in vivo and the molecular mechanism of luteolin at physiological concentrations remain unclear. Here, we report that luteolin as low as 0.5 μM significantly inhibited TNF-α-induced adhesion of monocytes to human EA.hy 926 endothelial cells, a key event in triggering vascular inflammation. Luteolin potently suppressed TNF-α-induced expression of the chemokine monocyte chemotactic protein-1 (MCP-1) and adhesion molecules ICAM-1 and VCAM-1, key mediators involved in enhancing endothelial cell-monocyte interaction. Furthermore, luteolin inhibited TNF-α-induced NF-κB transcriptional activity, IκBα degradation, expression of IκB kinase ß (IKKß), and subsequent NF-κB p65 nuclear translocation in endothelial cells, suggesting that luteolin can inhibit inflammation by suppressing NF-κB signaling. In an animal study, C57BL/6 mice were fed a diet containing 0% or 0.6% luteolin for three weeks and luteolin supplementation greatly suppressed TNF-α-induced increases in circulating levels of MCP-1/JE, CXCL1/KC, and sICAM-1 in C57BL/6 mice. Consistently, dietary intake of luteolin significantly reduced TNF-α-stimulated adhesion of monocytes to aortic endothelial cells ex vivo. Histology shows that luteolin treatment prevented the eruption of endothelial lining in the intima layer of the aorta and preserved elastin fibers’ delicate organization as shown by Verhoeff-van Gieson staining. Immunohistochemistry studies further show that luteolin treatment also reduced VCAM-1 and monocyte-derived F4/80-positive macrophages in the aorta of TNF-α-treated mice. In conclusion, luteolin protects against TNF-α-induced vascular inflammation, in both in

  4. Synthesis of 15 alpha-hydroxyestrogen 15-N-acetylglucosaminides.

    PubMed

    Suzuki, E; Namba, S; Kurihara, H; Goto, J; Matsuki, Y; Nambara, T

    1995-03-01

    The synthesis of 15-N-acetylglucosaminides of 15 alpha-hydroxyesterone, 15 alpha-hydroxyestradiol, and 15 alpha-hydroxyestriol (estetrol) is described. The latter two were prepared by condensation of 2-acetamido-1 alpha-chloro-1,2-dideoxy-3,4,6-trio-O-acetyl-D-glucopyranose with appropriately protected 15 alpha-hydroxyestrogens by the Koenigs-Knorr reaction employing cadmium carbonate as a catalyst. Subsequent removal of protecting groups with methanolic potassium hydroxide provided the desired conjugates. 15 alpha-Hydroxyestrone 15-N-acetylglucosaminide was synthesized from the corresponding 15 alpha-hydroxyestradiol derivative by Jones oxidation followed by brief alkaline hydrolysis. These conjugates underwent enzymatic hydrolysis with beta-N-acetylglucosaminidase from Jack beans to produce 15 alpha-hydroxyestrogens. PMID:7792832

  5. Alpha-lipoic acid and N-acetylcysteine protects intensive swimming exercise-mediated germ-cell depletion, pro-oxidant generation, and alteration of steroidogenesis in rat testis.

    PubMed

    Jana, Kuladip; Dutta, Ananya; Chakraborty, Pratip; Manna, Indranil; Firdaus, Syed Benazir; Bandyopadhyay, Debasish; Chattopadhyay, Ratna; Chakravarty, Baidyanath

    2014-09-01

    Prolonged and strenuous exercise has been proposed as a possible source of male-factor infertility. Forced intensive swimming has also been identified as one source of a dysfunctional male reproduction system. The present study evaluated the possible protective role of α-lipoic acid and N-acetylcysteine (NAC) on intensive swimming-induced germ-cell depletion in adult male rats. Forced exhaustive swimming of 1 hr/day, 6 days/week for 8 consecutive weeks resulted in a significant (P < 0.05) reduction in epididymal sperm; testicular androgenic enzyme activities; and plasma and intra-testicular testosterone; and produced different types of germ cells in the seminiferous epithelium cycle. Conversely, plasma corticosterone levels and sperm-head abnormalities increased. Western-blot analysis showed a considerable decrease in testicular StAR protein expression whereas reverse-transcriptase PCR analysis showed no significant change in cytochrome P450scc (Cyp11a1) gene expression. Significant (P < 0.05) elevation in testicular reactive oxygen species (ROS), lipid peroxidation, protein carbonyl content versus reduction in glucose-6-phosphate dehydrogenase, glutathione peroxidase, glutathione S-transferase, and caspase-3 activities along with a depletion in the glutathione pool, mitochondrial membrane potential (▵ψm ), and intracellular ATP generation. A considerable level of DNA damage in testicular spermatogenic cells were also noted following forced extensive swimming. Alpha-lipoic acid and NAC supplementation prevented the swimming-induced testicular spermatogenic and steroidogenic disorders by lowering ROS generation. We therefore conclude that intensive forced swimming causes germ-cell depletion through the generation of ROS and depletion of steroidogenesis in the testis, which can be protected by the co-administration of α-lipoic acid and NAC. PMID:25104294

  6. Hypoxia-inducible factor 1 mediates hypoxia-induced cardiomyocyte lipid accumulation by reducing the DNA binding activity of peroxisome proliferator-activated receptor {alpha}/retinoid X receptor

    SciTech Connect

    Belanger, Adam J.; Luo Zhengyu; Vincent, Karen A.; Akita, Geoffrey Y.; Cheng, Seng H.; Gregory, Richard J.; Jiang Canwen

    2007-12-21

    In response to cellular hypoxia, cardiomyocytes adapt to consume less oxygen by shifting ATP production from mitochondrial fatty acid {beta}-oxidation to glycolysis. The transcriptional activation of glucose transporters and glycolytic enzymes by hypoxia is mediated by hypoxia-inducible factor 1 (HIF-1). In this study, we examined whether HIF-1 was involved in the suppression of mitochondrial fatty acid {beta}-oxidation in hypoxic cardiomyocytes. We showed that either hypoxia or adenovirus-mediated expression of a constitutively stable hybrid form (HIF-1{alpha}/VP16) suppressed mitochondrial fatty acid metabolism, as indicated by an accumulation of intracellular neutral lipid. Both treatments also reduced the mRNA levels of muscle carnitine palmitoyltransferase I which catalyzes the rate-limiting step in the mitochondrial import of fatty acids for {beta}-oxidation. Furthermore, adenovirus-mediated expression of HIF-1{alpha}/VP16 in cardiomyocytes under normoxic conditions also mimicked the reduction in the DNA binding activity of peroxisome proliferator-activated receptor {alpha} (PPAR{alpha})/retinoid X receptor (RXR), in the presence or absence of a PPAR{alpha} ligand. These results suggest that HIF-1 may be involved in hypoxia-induced suppression of fatty acid metabolism in cardiomyocytes by reducing the DNA binding activity of PPAR{alpha}/RXR.

  7. Transport of Radioactive Material by Alpha Recoil

    SciTech Connect

    Icenhour, A.S.

    2005-05-19

    The movement of high-specific-activity radioactive particles (i.e., alpha recoil) has been observed and studied since the early 1900s. These studies have been motivated by concerns about containment of radioactivity and the protection of human health. Additionally, studies have investigated the potential advantage of alpha recoil to effect separations of various isotopes. This report provides a review of the observations and results of a number of the studies.

  8. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  9. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  10. alpha-Hexachlorocyclohexane (alpha-HCH)

    Integrated Risk Information System (IRIS)

    alpha - Hexachlorocyclohexane ( alpha - HCH ) ; CASRN 319 - 84 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Ass

  11. Suppression of antigen-specific antibody responses in mice exposed to perfluorooctanoic acid: Role of PPARalpha and T- and B-cell targeting

    EPA Science Inventory

    T-cell-dependent antibody responses (TDAR) are suppressed in female C57BL/6N mice exposed to ≥3.75 mg/kg of perfluorooctanoic acid (PFOA) for 15 days. To determine if suppression of humoral immunity by PFOA is peroxisome proliferator activated receptor alpha (PPARa)-dependent and...

  12. Alpha-1 Antitrypsin Test

    MedlinePlus

    ... measures the level of the protein AAT in blood. Alpha-1 antitrypsin phenotype testing evaluates the amount and type of AAT being produced and compares it to normal patterns. Alpha-1 antitrypsin genotype testing ( DNA testing) can ...

  13. Alpha-1 antitrypsin test

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003715.htm Alpha-1 antitrypsin test To use the sharing features on this page, please enable JavaScript. Alpha-1 antitrypsin is a laboratory test to measure the ...

  14. Aldehyde oxidase 1 is highly abundant in hepatic steatosis and is downregulated by adiponectin and fenofibric acid in hepatocytes in vitro

    SciTech Connect

    Neumeier, Markus; Weigert, Johanna; Schaeffler, Andreas; Weiss, Thomas S.; Schmidl, Christian; Buettner, Roland; Bollheimer, Cornelius; Aslanidis, Charalampos; Schoelmerich, Juergen; Buechler, Christa . E-mail: christa.buechler@klinik.uni-regensburg.de

    2006-11-24

    Adiponectin protects the liver from steatosis caused by obesity or alcohol and therefore the influence of adiponectin on human hepatocytes was analyzed. GeneChip experiments indicated that recombinant adiponectin downregulates aldehyde oxidase 1 (AOX1) expression and this was confirmed by real-time RT-PCR and immunoblot. AOX1 is a xenobiotic metabolizing protein and produces reactive oxygen species (ROS), that promote cell damage and fibrogenesis. Adiponectin and fenofibric acid activate peroxisome proliferator-activated receptor-{alpha} (PPAR-{alpha}) and both suppress AOX1 protein and this is blocked by the PPAR-{alpha} antagonist RU486. Obesity is associated with low adiponectin, reduced hepatic PPAR-{alpha} activity and fatty liver, and AOX1 was found induced in the liver of rats on a high-fat diet when compared to controls. Free fatty acids and leptin, that are elevated in obesity, failed to upregulate AOX1 in vitro. The current data indicate that adiponectin reduces AOX1 by activating PPAR-{alpha} whereas fatty liver disease is associated with elevated hepatic AOX1. High AOX1 may be associated with higher ROS well described to induce fibrogenesis in liver tissue but may also influence drug metabolism and activity.

  15. Association between peroxisome proliferator-activated receptor-alpha, delta, and gamma polymorphisms and risk of coronary heart disease

    PubMed Central

    Qian, Yufeng; Li, Peiwei; Zhang, Jinjie; Shi, Yu; Chen, Kun; Yang, Jun; Wu, Yihua; Ye, Xianhua

    2016-01-01

    Abstract Objectives: Risk of coronary heart disease (CHD) has been suggested to be associated with polymorphisms of peroxisome proliferator-activated receptors (PPARs), while the results were controversial. We aimed to systematically assess the association between PPAR polymorphisms and CHD risk. Methods: A case–control study with 446 subjects was conducted to evaluate the association between CHD risk and C161T polymorphism, which was of our special interest as this polymorphism showed different effects on risks of CHD and acute coronary syndrome (ACS). Meta-analyses were conducted to assess all PPAR polymorphisms. Either a fixed- or a random-effects model was adopted to estimate overall odds ratios (ORs). Results: In the case–control study, T allele carriers of C161T polymorphism were not significantly associated with CHD risk (Odds ratio (OR) = 0.74, 95% confidence interval (CI) 0.47–1.15, P = 0.19), while T allele carriers showed higher risk of ACS (OR = 1.63, 95% CI 1.00–2.65, P = 0.048). The meta-analysis indicated that compared with CC homozygous, T allele carriers had lower CHD risk (OR = 0.69, 95% CI 0.59–0.82, P < 0.001) but higher ACS risk (OR = 1.43, 95% CI 1.09–1.87, P = 0.010). Three other polymorphisms were also found to be significantly associated with CHD risk under dominant model: PPAR-alpha intron 7G/C polymorphism (CC+GC vs GG, OR 1.42, 95% CI 1.13–1.78, P = 0.003), L162V polymorphism (VV+LV vs LL, OR 0.74, 95% CI 0.56–0.97, P = 0.031), and PPAR-delta +294T/C polymorphism (CC+TC vs TT, OR 1.51, 95% CI 1.12–2.05, P = 0.007). Conclusions: The results suggested that PPAR-alpha intron 7G/C and L162V, PPAR-delta +294T/C and PPAR-gamma C161T polymorphisms could affect CHD susceptibility, and C161T polymorphism might have different effects on CHD and ACS. PMID:27512842

  16. The Alpha Centauri System.

    ERIC Educational Resources Information Center

    Soderblom, David R.

    1987-01-01

    Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

  17. Bioconversion of α-linolenic acid to n-3 LCPUFA and expression of PPAR-alpha, acyl Coenzyme A oxidase 1 and carnitine acyl transferase I are incremented after feeding rats with α-linolenic acid-rich oils.

    PubMed

    González-Mañán, Daniel; Tapia, Gladys; Gormaz, Juan Guillermo; D'Espessailles, Amanda; Espinosa, Alejandra; Masson, Lilia; Varela, Patricia; Valenzuela, Alfonso; Valenzuela, Rodrigo

    2012-07-01

    High dietary intake of n-6 fatty acids in relation to n-3 fatty acids may generate health disorders, such as cardiovascular and other chronic diseases. Fish consumption rich in n-3 fatty acids is low in Latin America, it being necessary to seek other alternatives to provide α-linolenic acid (ALA), precursor of n-3 LCPUFA (EPA and DHA). Two innovative oils were assayed, chia (Salvia hispanica) and rosa mosqueta (Rosa rubiginosa). This study evaluated hepatic bioconversion of ALA to EPA and DHA, expression of PPAR-α, acyl-Coenzyme A oxidase 1 (ACOX1) and carnitine acyltransferase I (CAT-I), and accumulation of EPA and DHA in plasma and adipose tissue in Sprague-Dawley rats. Three experimental groups were fed 21 days: sunflower oil (SFO, control); chia oil (CO); rosa mosqueta oil (RMO). Fatty acid composition of total lipids and phospholipids from plasma, hepatic and adipose tissue was assessed by gas-liquid chromatography and TLC. Expression of PPAR-α (RT-PCR) and ACOX1 and CAT-I (Western blot). CO and RMO increased plasma, hepatic and adipose tissue levels of ALA, EPA and DHA and decreased n-6:n-3 ratio compared to SFO (p < 0.05, One-way ANOVA and Newman-Keuls test). CO increased levels of ALA and EPA compared to RMO (p < 0.05). No significant differences were observed for DHA levels. CO also increased the expression of PPAR-α, ACOX1 and CAT-I. Only CAT-I levels were increased by RO. CO and RMO may be a nutritional alternative to provide ALA for its bioconversion to EPA and DHA, and to increase the expression of PPAR-α, ACOX1 and CAT-I, especially CO-oil.

  18. Characterization of the alpha-gamma and alpha-beta complex: evidence for an in vivo functional role of alpha-crystallin as a molecular chaperone

    NASA Technical Reports Server (NTRS)

    Boyle, D.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1994-01-01

    Previous studies have demonstrated that in vitro, alpha-crystallin can protect other lens proteins against extensive denaturation and aggregation. The mechanism of this protection involves preferential binding of the partially denatured protein to a central region of the native alpha-crystallin complex. To test whether a similar phenomenon might occur in vivo, a high molecular weight aggregate (HMWA) fraction was isolated from the aged bovine lens. Negative staining of this preparation revealed the presence of particles of 13-14 nm diameter, characteristic of alpha-crystallin. Immunolocalization of the same particles using antiserum specific for gamma- and beta-crystallins demonstrated preferential binding of these crystallins to the central region of the alpha-crystallin complex. Together, these results provide evidence that in the intact lens, the alpha-crystallins are functionally important molecular chaperones.

  19. N-acetylcysteine and 15 deoxy-{delta}12,14-prostaglandin J2 exert a protective effect against autoimmune thyroid destruction in vivo but not against interleukin-1{alpha}/interferon {gamma}-induced inhibitory effects in thyrocytes in vitro.

    PubMed

    Poncin, Sylvie; Colin, Ides M; Decallonne, Brigitte; Clinckspooor, Isabelle; Many, Marie-Christine; Denef, Jean-François; Gérard, Anne-Catherine

    2010-07-01

    Reactive oxygen species (ROS) are crucial for thyroid hormonogenesis, and their production is kept under tight control. Oxidative stress (OS) is toxic for thyrocytes in an inflammatory context. In vitro, Th1 pro-inflammatory cytokines have already been shown to decrease thyroid-specific protein expression. In the present study, OS level and its impact on thyroid function were analyzed in vitro in Th1 cytokine (interleukin [IL]-1alpha/interferon [IFN] gamma)-incubated thyrocytes (rat and human), as well as in vivo in thyroids from nonobese diabetic mice, a model of spontaneous autoimmune thyroiditis. N-acetylcysteine (NAC) and prostaglandin, 15 deoxy-(Delta12,14)-prostaglandinJ2 (15dPGJ2), were used for their antioxidant and anti-inflammatory properties, respectively. ROS production and OS were increased in IL-1alpha/IFNgamma-incubated thyrocytes and in destructive thyroiditis. In vitro, NAC not only reduced ROS production below control levels, but further decreased the expression of thyroid-specific proteins in addition to IL-1alpha/IFNgamma-inhibitory effects. Thus, besides ROS, other intracellular intermediaries likely mediate Th1 cytokine effects. In vivo, NAC and 15dPGJ2 reduced OS and the immune infiltration, thereby leading to a restoration of thyroid morphology. It is therefore likely that NAC and 15dPGJ2 mainly exert their protective effects by acting on infiltrating inflammatory cells rather than directly on thyrocytes.

  20. Determination of Alpha

    NASA Astrophysics Data System (ADS)

    Chmeissani, Mokhtar Abdallah

    The determination of the strong coupling constant alpha_ s, using Energy-Energy Correlation Asymmetry and jet mass difference with Mark II data at SLC (91 GeV) is presented. In Energy-Energy Correlation Asymmetry (EECA), we used the same systematic procedure used to determine alpha_ s with MARK II data at PEP (29 GeV). The chi^2 fit suggests that alpha_ s = 0.119 +/- 0.007(stat.) +/- 0.007(syst.). In addition, we used the EECA method to determine the QCD scale parameter Lambda_{LLA}. The chi^2 fit suggests that Lambda _{LLA} = 420 +/- 90(stat.) MeV. In the jet mass difference method, the determination of alpha_ s is based on QCD calculations up to 2nd order. We showed that in this method we are able to reproduce the value of alpha _ s from a Monte Carlo sample to a very high accuracy. The result with this method is alpha _ s = 0.134 +/- 0.085(stat.) +/- 0.004(syst.). The two values of alpha_ s presented in this work are in agreement within the error bars and in a good agreement with recent results of alpha_ s published from other e^+e^- experiments.

  1. Event counting alpha detector

    DOEpatents

    Bolton, R.D.; MacArthur, D.W.

    1996-08-27

    An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

  2. Event counting alpha detector

    DOEpatents

    Bolton, Richard D.; MacArthur, Duncan W.

    1996-01-01

    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  3. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  4. Imaging alpha particle detector

    DOEpatents

    Anderson, David F.

    1985-01-01

    A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  5. 40 CFR 721.10409 - Poly(oxyalkylenediyl), .alpha. - [ [ [methyl - 3 - [ [ [ (polyfluoroalkyl)oxy]carbonyl ] amino...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Poly(oxyalkylenediyl), .alpha... Poly(oxyalkylenediyl), .alpha. - carbonyl ] amino] phenyl]amino]carbonyl] - .omega. - methoxy... identified generically as poly(oxyalkylenediyl), .alpha.- carbonyl]amino]phenyl]amino]...

  6. Chaperone-like activities of {alpha}-synuclein: {alpha}-Synuclein assists enzyme activities of esterases

    SciTech Connect

    Ahn, Misun; Kim, SeungBum; Kang, Mira; Ryu, Yeonwoo . E-mail: ywryu@ajou.ac.kr; Doohun Kim, T. . E-mail: doohunkim@ajou.ac.kr

    2006-08-11

    {alpha}-Synuclein, a major constituent of Lewy bodies (LBs), has been implicated to play a critical role in the pathogenesis of Parkinson's disease (PD), although the physiological function of {alpha}-synuclein has not yet been known. Here we have shown that {alpha}-synuclein, which has no well-defined secondary or tertiary structure, can protect the enzyme activity of microbial esterases against stress conditions such as heat, pH, and organic solvents. In particular, the flexibility of {alpha}-synuclein and its C-terminal region seems to be important for complex formation, but the structural integrity of the C-terminal region may not be required for stabilization of enzyme activity. In addition, atomic force microscopy (AFM) and in vivo enzyme assays showed highly specific interactions of esterases with {alpha}-synuclein. Our results indicate that {alpha}-synuclein not only protects the enzyme activity of microbial esterases in vitro, but also can stabilize the active conformation of microbial esterases in vivo.

  7. The alpha channeling effect

    SciTech Connect

    Fisch, N. J.

    2015-12-10

    Alpha particles born through fusion reactions in a tokamak reactor tend to slow down on electrons, but that could take up to hundreds of milliseconds. Before that happens, the energy in these alpha particles can destabilize on collisionless timescales toroidal Alfven modes and other waves, in a way deleterious to energy confinement. However, it has been speculated that this energy might be instead be channeled into useful energy, so as to heat fuel ions or to drive current. Such a channeling needs to be catalyzed by waves Waves can produce diffusion in energy of the alpha particles in a way that is strictly coupled to diffusion in space. If these diffusion paths in energy-position space point from high energy in the center to low energy on the periphery, then alpha particles will be cooled while forced to the periphery. The energy from the alpha particles is absorbed by the wave. The amplified wave can then heat ions or drive current. This process or paradigm for extracting alpha particle energy collisionlessly has been called alpha channeling. While the effect is speculative, the upside potential for economical fusion is immense. The paradigm also operates more generally in other contexts of magnetically confined plasma.

  8. Alpha One Foundation

    MedlinePlus

    ... related programs More News Our Number One Goal: Find a cure for Alpha-1. Website Sponsors Helpful Links 3300 Ponce de Leon Blvd. Coral Gables, FL 33134 Phone: (877) 228-7321 Email: info@alphaone.org Copyright ...

  9. Alpha Particle Diagnostic

    SciTech Connect

    Fisher, Ray, K.

    2009-05-13

    The study of burning plasmas is the next frontier in fusion energy research, and will be a major objective of the U.S. fusion program through U.S. collaboration with our international partners on the ITER Project. For DT magnetic fusion to be useful for energy production, it is essential that the energetic alpha particles produced by the fusion reactions be confined long enough to deposit a significant fraction of their initial ~3.5 MeV energy in the plasma before they are lost. Development of diagnostics to study the behavior of energetic confined alpha particles is a very important if not essential part of burning plasma research. Despite the clear need for these measurements, development of diagnostics to study confined the fast confined alphas to date has proven extremely difficult, and the available techniques remain for the most part unproven and with significant uncertainties. Research under this grant had the goal of developing diagnostics of fast confined alphas, primarily based on measurements of the neutron and ion tails resulting from alpha particle knock-on collisions with the plasma deuterium and tritium fuel ions. One of the strengths of this approach is the ability to measure the alphas in the hot plasma core where the interesting ignition physics will occur.

  10. 40 CFR 721.10580 - Poly[oxy(methyl-1,2- ethanediyl)], alpha, alpha′-[1,4- cyclohexanediylbis(methylene)] bis [omega...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Poly , alpha, alphaâ²- bis [omega-(2... Specific Chemical Substances § 721.10580 Poly , alpha, alpha′- bis [omega-(2-aminomethylethoxy)-. (a... poly , alpha, alpha′- bis [omega-(2- aminomethylethoxy)- (PMN P-10-452; CAS No. 1220986-58-2)...

  11. 40 CFR 721.10580 - Poly[oxy (methyl - 1,2 - ethanediyl)], alpha, alpha′ - [1,4 - cyclohexanediylbis(methylene)] bis...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Poly , alpha, alphaâ² - bis [omega... Significant New Uses for Specific Chemical Substances § 721.10580 Poly , alpha, alpha′ - bis [omega - (2... substance identified as poly , alpha, alpha′ - bis [omega - (2 - aminomethylethoxy) - (PMN P-10-452; CAS...

  12. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  13. Identification of a novel selective peroxisome proliferator-activated receptor alpha agonist, 2-methyl-2-(4-{3-[1-(4-methylbenzyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-3-yl]propyl}phenoxy)propanoic acid (LY518674), that produces marked changes in serum lipids and apolipoprotein A-1 expression.

    PubMed

    Singh, Jai Pal; Kauffman, Raymond; Bensch, William; Wang, Guoming; McClelland, Pam; Bean, James; Montrose, Chahrzad; Mantlo, Nathan; Wagle, Asavari

    2005-09-01

    Low high-density lipoprotein-cholesterol (HDL-c) is an important risk factor of coronary artery disease (CAD). Optimum therapy for raising HDL-c is still not available. Identification of novel HDL-raising agents would produce a major impact on CAD. In this study, we have identified a potent (IC50 approximately 24 nM) and selective peroxisome proliferator-activated receptor alpha (PPARalpha) agonist, 2-methyl-2-(4-{3-[1-(4-methylbenzyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-3-yl]propyl}phenoxy)propanoic acid (LY518674). In human apolipoprotein A-1 (apoA-1) transgenic mice, LY518674 produced a dose-dependent increase in serum HDL-c, resulting in 208 +/- 15% elevation at optimum dose. A new synthesis of apoA-1 contributed to the increase in HDL-c. LY518674 increased apoA-1 mRNA levels in liver. Moreover, liver slices from animals treated with LY518674 secreted 3- to 6-fold more apoA-1 than control liver slices. In cultured hepatocytes, LY518674 produced 50% higher apoA-1 secretion, which was associated with increase in radiolabeled methionine incorporation in apoA-1. Thus, LY518674 is a potent and selective PPARalpha agonist that produced a much greater increase in serum HDL-c than the known fibrate drugs. The increase in HDL-c was associated with de novo synthesis of apoA-1. PMID:15933217

  14. Portable alpha spectrometer.

    PubMed

    Martín Sánchez, A; de la Torre Pérez, J

    2012-09-01

    Many portable devices have been designed to detect γ-rays or alpha and beta particles. Most of the α-particle detectors give the total count as a result, without identifying the radionuclides existing in the sample. The development of a device allowing rapid and straightforward α-particle spectrometry would be very useful for detecting the radioactive contents of unknown samples. This work describes the construction of a portable device using silicon semiconductor detectors designed to rapidly detect and possibly identify alpha-emitting radionuclides.

  15. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  16. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  17. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  18. Pre-clinical immunogenicity of human papillomavirus alpha-7 and alpha-9 major capsid proteins.

    PubMed

    Bissett, Sara L; Mattiuzzo, Giada; Draper, Eve; Godi, Anna; Wilkinson, Dianna E; Minor, Philip; Page, Mark; Beddows, Simon

    2014-11-12

    Human papillomavirus (HPV) vaccines confer protection against the oncogenic genotypes HPV16 and HPV18 through the generation of type-specific neutralizing antibodies raised against the constituent virus-like particles (VLP) based upon the major capsid proteins (L1) of these genotypes. The vaccines also confer a degree of cross-protection against some genetically related types from the Alpha-9 (HPV16-like: HPV31, HPV33, HPV35, HPV52, HPV58) and Alpha-7 (HPV18-like: HPV39, HPV45, HPV59, HPV68) species groups. The mechanism of cross-protection is unclear but may involve antibodies capable of recognizing shared inter-genotype epitopes. The relationship(s) between the genetic and antigenic diversity of the L1 protein, particularly for non-vaccine genotypes, is poorly understood. We carried out a comprehensive evaluation of the immunogenicity of L1 VLP derived from genotypes within the Alpha-7 and Alpha-9 species groups in New Zealand White rabbits and used L1L2 pseudoviruses as the target antigens in neutralization assays. The majority antibody response against L1 VLP was type-specific, as expected, but several instances of robust cross-neutralization were nevertheless observed including between HPV33 and HPV58 within the Alpha-9 species and between HPV39, HPV59 and HPV68 in the Alpha-7 species. Immunization with an experimental tetravalent preparation comprising VLP based upon HPV16, HPV18, HPV39 and HPV58 was capable of generating neutralizing antibodies against all the Alpha-7 and Alpha-9 genotypes. Competition of HPV31 and HPV33 cross-neutralizing antibodies in the tetravalent sera confirmed that these antibodies originated from HPV16 and HPV58 VLP, respectively, and suggested that they represent minority specificities within the antibody repertoire generated by the immunizing antigen. These data improve our understanding of the antigenic diversity of the L1 protein per se and may inform the rational design of a next generation vaccine formulation based upon

  19. Pre-clinical immunogenicity of human papillomavirus alpha-7 and alpha-9 major capsid proteins

    PubMed Central

    Bissett, Sara L.; Mattiuzzo, Giada; Draper, Eve; Godi, Anna; Wilkinson, Dianna E.; Minor, Philip; Page, Mark; Beddows, Simon

    2014-01-01

    Human papillomavirus (HPV) vaccines confer protection against the oncogenic genotypes HPV16 and HPV18 through the generation of type-specific neutralizing antibodies raised against the constituent virus-like particles (VLP) based upon the major capsid proteins (L1) of these genotypes. The vaccines also confer a degree of cross-protection against some genetically related types from the Alpha-9 (HPV16-like: HPV31, HPV33, HPV35, HPV52, HPV58) and Alpha-7 (HPV18-like: HPV39, HPV45, HPV59, HPV68) species groups. The mechanism of cross-protection is unclear but may involve antibodies capable of recognizing shared inter-genotype epitopes. The relationship(s) between the genetic and antigenic diversity of the L1 protein, particularly for non-vaccine genotypes, is poorly understood. We carried out a comprehensive evaluation of the immunogenicity of L1 VLP derived from genotypes within the Alpha-7 and Alpha-9 species groups in New Zealand White rabbits and used L1L2 pseudoviruses as the target antigens in neutralization assays. The majority antibody response against L1 VLP was type-specific, as expected, but several instances of robust cross-neutralization were nevertheless observed including between HPV33 and HPV58 within the Alpha-9 species and between HPV39, HPV59 and HPV68 in the Alpha-7 species. Immunization with an experimental tetravalent preparation comprising VLP based upon HPV16, HPV18, HPV39 and HPV58 was capable of generating neutralizing antibodies against all the Alpha-7 and Alpha-9 genotypes. Competition of HPV31 and HPV33 cross-neutralizing antibodies in the tetravalent sera confirmed that these antibodies originated from HPV16 and HPV58 VLP, respectively, and suggested that they represent minority specificities within the antibody repertoire generated by the immunizing antigen. These data improve our understanding of the antigenic diversity of the L1 protein per se and may inform the rational design of a next generation vaccine formulation based upon

  20. Determination of proteinase 3-alpha 1-antitrypsin complexes in inflammatory fluids.

    PubMed

    Dolman, K M; van de Wiel, B A; Kam, C M; Abbink, J J; Hack, C E; Sonnenberg, A; Powers, J C; von dem Borne, A E; Goldschmeding, R

    1992-12-14

    Physiological inhibitors were tested for their in vitro interaction with neutrophil proteinase 3 (PR3). The major plasma proteinase inhibitor of PR3 is alpha 1AT. We have developed a radioimmunoassay (RIA) for quantitative detection of PR3-alpha 1AT complexes formed in vivo in inflammatory exudates such as synovial fluid and plasma from patients with sepsis. Levels of PR3-alpha 1AT complexes correlated significantly with levels of human neutrophil elastase (HNE)-alpha 1AT complexes. Thus, in vivo alpha 1AT not only protects against excessive HNE activity, but also against excessive PR3 activity.

  1. 40 CFR 721.10409 - Poly(oxyalkylenediyl), .alpha.-[[[methyl-3-[[[(polyfluoroalkyl)oxy]carbonyl] amino]phenyl]amino...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Poly(oxyalkylenediyl), .alpha...(oxyalkylenediyl), .alpha.- carbonyl] amino]phenyl]amino]carbonyl]- .omega.-methoxy-(generic). (a) Chemical... as poly(oxyalkylenediyl), .alpha.- carbonyl]amino]phenyl]amino] carbonyl]-.omega.-methoxy- (PMN...

  2. 40 CFR 721.10409 - Poly(oxyalkylenediyl), .alpha.-[[[methyl-3-[[[(polyfluoroalkyl) oxy]carbonyl]amino]phenyl]amino...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Poly(oxyalkylenediyl), .alpha...(oxyalkylenediyl), .alpha.- carbonyl]amino]phenyl]amino] carbonyl]-.omega.-methoxy- (generic). (a) Chemical... as poly(oxyalkylenediyl), .alpha.- carbonyl]amino]phenyl]amino] carbonyl]-.omega.-methoxy- (PMN...

  3. 40 CFR 721.10121 - Poly[oxy(methyl-1,2-ethanediyl)], .alpha.-methyl-.omega.-(4-nonylphenoxy)-, branched.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Poly , .alpha.-methyl-.omega.-(4... Specific Chemical Substances § 721.10121 Poly , .alpha.-methyl-.omega.-(4-nonylphenoxy)-, branched. (a... poly , .alpha.-methyl-.omega.-(4-nonylphenoxy)-, branched (PMN P-05-766; CAS No. 858944-25-9)...

  4. 40 CFR 721.10121 - Poly[oxy(methyl-1,2-ethanediyl)], .alpha.-methyl-.omega.-(4-nonylphenoxy)-, branched.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Poly , .alpha.-methyl-.omega.-(4... Specific Chemical Substances § 721.10121 Poly , .alpha.-methyl-.omega.-(4-nonylphenoxy)-, branched. (a... poly , .alpha.-methyl-.omega.-(4-nonylphenoxy)-, branched (PMN P-05-766; CAS No. 858944-25-9)...

  5. 40 CFR 721.10121 - Poly[oxy(methyl-1,2-ethanediyl)], .alpha.-methyl-.omega.-(4-nonylphenoxy)-, branched.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Poly , .alpha.-methyl-.omega.-(4... Specific Chemical Substances § 721.10121 Poly , .alpha.-methyl-.omega.-(4-nonylphenoxy)-, branched. (a... poly , .alpha.-methyl-.omega.-(4-nonylphenoxy)-, branched (PMN P-05-766; CAS No. 858944-25-9)...

  6. 40 CFR 721.10121 - Poly[oxy(methyl-1,2-ethanediyl)], .alpha.-methyl-.omega.-(4-nonylphenoxy)-, branched.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Poly , .alpha.-methyl-.omega.-(4... Specific Chemical Substances § 721.10121 Poly , .alpha.-methyl-.omega.-(4-nonylphenoxy)-, branched. (a... poly , .alpha.-methyl-.omega.-(4-nonylphenoxy)-, branched (PMN P-05-766; CAS No. 858944-25-9)...

  7. 40 CFR 721.10121 - Poly[oxy(methyl-1,2-ethanediyl)], .alpha.-methyl-.omega.-(4-nonylphenoxy)-, branched.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Poly , .alpha.-methyl-.omega.-(4... Specific Chemical Substances § 721.10121 Poly , .alpha.-methyl-.omega.-(4-nonylphenoxy)-, branched. (a... poly , .alpha.-methyl-.omega.-(4-nonylphenoxy)-, branched (PMN P-05-766; CAS No. 858944-25-9)...

  8. Modulation of type 1 diabetes susceptibility by tumor necrosis factor alpha -308 G/A and lymphotoxin alpha +249 A/G haplotypes and lack of linkage disequilibrium with predisposing DQB1-DRB1 haplotypes in Bahraini patients.

    PubMed

    Stayoussef, Mouna; Al-Jenaidi, Fayza A; Al-Abbasi, Abduljabbar; Al-Ola, Khadija; Khayyat, Haya; Mahjoub, Touhami; Almawi, Wassim Y

    2008-02-01

    Tumor necrosis factor alpha (TNF-alpha) -308 G/A and lymphotoxin alpha (LTalpha) +249 A/G single-nucleotide polymorphisms were investigated in 228 type 1 diabetes mellitus (T1DM) patients and 240 controls. Only LTalpha +249G allele and +249G/+249G genotype frequencies were higher among patients, and no linkage disequilibrium was found between TNF-alpha/LTalpha alleles and susceptible/protective DRB1-DQB1 haplotypes. TNF-alpha/LTalpha T1DM-susceptible (-308G/+249G) and protective (-308G/+249A) haplotypes were identified.

  9. Adenosine decreases post-ischaemic cardiac TNF-alpha production: anti-inflammatory implications for preconditioning and transplantation.

    PubMed Central

    Meldrum, D R; Cain, B S; Cleveland, J C; Meng, X; Ayala, A; Banerjee, A; Harken, A H

    1997-01-01

    Tumour necrosis factor-alpha (TNF-alpha) is an autocrine contributor to myocardial dysfunction and cardiomyocyte death in ischaemia-reperfusion injury (I/R), sepsis, chronic heart failure and cardiac allograft rejection. Cardiac resident macrophages, infiltrating leucocytes, and cardiomyocytes themselves produce TNF-alpha. Although adenosine reduces macrophage TNF-alpha production and protects myocardium against I/R, it remains unknown whether I/R induces an increase in cardiac TNF-alpha in a crystalloid-perfused model (in the absence of blood), and, whether adenosine decreases cardiac TNF-alpha and protects function after I/R. To study this, isolated rat hearts were crystalloid-perfused using the Langendorff method and subjected to I/R, with or without adenosine pretreatment. Post-ischaemic cardiac TNF-alpha (enzyme-linked immunosorbent assay and bioassay) and function were determined (Langendorff). I/R increased cardiac TNF-alpha and impaired myocardial function. Adenosine decreased cardiac TNF-alpha and improved post-ischaemic functional recovery. This study demonstrates that: first, I/R induces an increase in cardiac tissue TNF-alpha in a crystalloid-perfused model: second, adenosine decreases cardiac TNF-alpha and improves post-ischaemic myocardial function; third, decreased cardiac TNF-alpha may represent a mechanism by which adenosine protects myocardium; and fourth, adenosine-induced suppression of cardiac TNF-alpha may provide an anti-inflammatory link to preconditioning and have implications for cardiac allograft preservation. PMID:9497488

  10. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.

    1998-08-19

    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  11. {alpha}-Decay half-lives, {alpha}-capture, and {alpha}-nucleus potential

    SciTech Connect

    Denisov, V. Yu. Khudenko, A.A.

    2009-11-15

    {alpha}-Decay half-lives and {alpha}-capture cross sections are evaluated in the framework of a unified model for {alpha}-decay and {alpha}-capture. In this model {alpha}-decay and {alpha}-capture are considered as penetration of the {alpha}-particle through the potential barrier formed by the nuclear, Coulomb, and centrifugal interactions between the {alpha}-particle and nucleus. The spins and parities of the parent and daughter nuclei as well as the quadrupole and hexadecapole deformations of the daughter nuclei are taken into account for evaluation of the {alpha}-decay half-lives. The {alpha}-decay half-lives for 344 nuclei and the {alpha}-capture cross sections of {sup 40}Ca, {sup 44}Ca, {sup 59}Co, {sup 208}Pb, and {sup 209}Bi agree well with the experimental data. The evaluated {alpha}-decay half-lives within the range of 10{sup -9}{<=}T{sub 1/2}{<=}10{sup 38} s for 1246 {alpha}-emitters are tabulated.

  12. Simultaneous quantification of GABAergic 3alpha,5alpha/3alpha,5beta neuroactive steroids in human and rat serum.

    PubMed

    Porcu, Patrizia; O'Buckley, Todd K; Alward, Sarah E; Marx, Christine E; Shampine, Lawrence J; Girdler, Susan S; Morrow, A Leslie

    2009-01-01

    The 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone enhance GABAergic neurotransmission and produce inhibitory neurobehavioral and anti-inflammatory effects. Despite substantial information on the progesterone derivative (3alpha,5alpha)-3-hydroxypregnan-20-one (3alpha,5alpha-THP, allopregnanolone), the physiological significance of the other endogenous GABAergic neuroactive steroids has remained elusive. Here, we describe the validation of a method using gas chromatography-mass spectrometry to simultaneously identify serum levels of the eight 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone. The method shows specificity, sensitivity and enhanced throughput compared to other methods already available for neuroactive steroid quantification. Administration of pregnenolone to rats and progesterone to women produced selective effects on the 3alpha,5alpha- and 3alpha,5beta-reduced neuroactive steroids, indicating differential regulation of their biosynthetic pathways. Pregnenolone administration increased serum levels of 3alpha,5alpha-THP (+1488%, p<0.001), (3alpha,5alpha)-3,21-dihydroxypregnan-20-one (3alpha,5alpha-THDOC, +205%, p<0.01), (3alpha,5alpha)-3-hydroxyandrostan-17-one (3alpha,5alpha-A, +216%, p<0.001), (3alpha,5alpha,17beta)-androstane-3,17-diol (3alpha,5alpha-A-diol, +190%, p<0.01). (3alpha,5beta)-3-hydroxypregnan-20-one (3alpha,5beta-THP) and (3alpha,5beta)-3-hydroxyandrostan-17-one (3alpha,5beta-A) were not altered, while (3alpha,5beta)-3,21-dihydroxypregnan-20-one (3alpha,5beta-THDOC) and (3alpha,5beta,17beta)-androstane-3,17-diol (3alpha,5beta-A-diol) were increased from undetectable levels to 271+/-100 and 2.4+/-0.9 pg+/-SEM, respectively (5/8 rats). Progesterone administration increased serum levels of 3alpha,5alpha-THP (+1806%, p<0.0001), 3alpha,5beta-THP (+575%, p<0.001), 3alpha,5alpha

  13. Increase of mouse resistance to Candida albicans infection by thymosin alpha 1.

    PubMed Central

    Bistoni, F; Marconi, P; Frati, L; Bonmassar, E; Garaci, E

    1982-01-01

    Studies were carried out to assess the ability of thymosin alpha 1 to prolong the survival of mice challenged with Candida albicans. Two- to four-month-old mice were treated with graded doses of thymosin alpha 1 before, after, or before and after intravenous challenge with C. albicans. Significant resistance ot lethal infection was afforded by 100 micrograms of thymosin alpha 1 per kg given before or before and after challenge, whereas no protection was found in mice treated with thymosin alpha 1 administered at any dose level after inoculation. Pretreatment with thymosin alpha 1 also prevented the increased susceptibility to C. albicans infection of mice pretreated with cyclophosphamide on day -6. The results showed that thymosin alpha 1 was capable of protecting untreated or cyclophosphamide-pretreated mice from C. albicans infection at an optimal dose and schedule of administration. PMID:7085074

  14. Autophagy and protein kinase RNA-like endoplasmic reticulum kinase (PERK)/eukaryotic initiation factor 2 alpha kinase (eIF2α) pathway protect ovarian cancer cells from metformin-induced apoptosis.

    PubMed

    Moon, Hee-Sun; Kim, Boyun; Gwak, HyeRan; Suh, Dong Hoon; Song, Yong Sang

    2016-04-01

    Metformin, an oral biguanide for the treatment of type II diabetes, has been shown to have anticancer effects in ovarian cancer. Energy starvation induced by metformin causes endoplasmic reticulum stress-mediated unfolded protein response (UPR) and autophagy. UPR and autophagy act as a survival or death mechanism in cells. In this study, we observed that metformin-induced apoptosis was relieved by autophagy and the PERK/eIF2α pathway in ovarian cancer cells, but not in peripheral blood mononuclear cells (PBMC) or 'normal' ovarian surface epithelial cells (OSE). Increased PARP cleavage and increased LC3B-II with ATG5-ATG12 complex suggested the induction of apoptosis and autophagy, respectively, in metformin-treated ovarian cancer cells. Accumulation of acidic vacuoles in the cytoplasm and downregulation of p62 further supported late-stage autophagy. Interestingly, metformin induced interdependent activation between autophagy and the UPR, especially the PERK/eIF2α pathway. Inhibition of autophagy-induced PERK inhibition, and vice versa, were demonstrated using small molecular inhibitors (PERK inhibitor I, GSK2606414; autophagy inhibitor, 3-MA, and BafA1). Moreover, autophagy and PERK activation protected ovarian cancer cells against metformin-induced apoptosis. Metformin treatment in the presence of inhibitors of PERK and autophagy, however, had no cytotoxic effects on OSE or PBMC. In conclusion, these results suggest that inhibition of autophagy and PERK can enhance the selective anticancer effects of metformin on ovarian cancer cells. © 2015 Wiley Periodicals, Inc.

  15. alpha-Tocopherol modulates liver toxicity of the pyrethroid cypermethrin.

    PubMed

    Aldana, L; Tsutsumi, V; Craigmill, A; Silveira, M I; Gonzalez de Mejia, E

    2001-12-15

    The objective of the current study was to analyze the hepatotoxic effect caused by cypermethrin (CYP) in rats, and to evaluate the possible protective effect of the antioxidant alpha-tocopherol (alpha-T). Fifty male Wistar rats were given daily i.p. doses of 300 mg/kg per day of CYP during 7 days. Half of them were administered three previous doses of 100 mg/kg per day of alpha-T, followed by seven subsequent oral doses of 40 mg/kg per day of alpha-T. The levels of biochemical indicators and histological liver damage were determined, as well as DCVA in urine. CYP altered the lipid metabolism. Such alterations were inhibited 32% by alpha-T, except for LDL. Alterations in AST were modulated in 29%. In the histology, alpha-T reduced mitochondria damage, and swelling of the endoplasmic reticulum of the liver cells. The results suggest that alpha-T can modify CYP metabolism, changing the lipidic profile and the histological analysis.

  16. 40 CFR 721.10286 - Formaldehyde, polymer with .alpha.- (2-aminomethylethyl)- .omega. - (2 - aminomethylethoxy)poly...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Formaldehyde, polymer with .alpha.- (2-aminomethylethyl)- .omega. - (2 - aminomethylethoxy)poly and 4 - (1,1 -dimethylethyl) phenol. 721.10286 Section 721.10286 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES...

  17. Proteinaceous alpha-amylase inhibitors.

    PubMed

    Svensson, Birte; Fukuda, Kenji; Nielsen, Peter K; Bønsager, Birgit C

    2004-02-12

    Proteins that inhibit alpha-amylases have been isolated from plants and microorganisms. These inhibitors can have natural roles in the control of endogenous alpha-amylase activity or in defence against pathogens and pests; certain inhibitors are reported to be antinutritional factors. The alpha-amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha-amylases in complex with inhibitors from five families. These structures indicate major diversity but also some similarity in the structural basis of alpha-amylase inhibition. Mutational analysis of the mechanism of inhibition was performed in a few cases and various protein engineering and biotechnological approaches have been outlined for exploitation of the inhibitory function. PMID:14871655

  18. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W.; Allander, Krag S.; Bounds, John A.

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  19. Background canceling surface alpha detector

    DOEpatents

    MacArthur, D.W.; Allander, K.S.; Bounds, J.A.

    1996-06-11

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

  20. Long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.

    1993-02-02

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  1. Lorentz violation and {alpha} decay

    SciTech Connect

    Altschul, Brett

    2009-01-01

    Relating the effective Lorentz violation coefficients for composite particles to the coefficients for their constituent fields is a challenging problem. We calculate the Lorentz violation coefficients relevant to the dynamics of an {alpha} particle in terms of proton and neutron coefficients. The {alpha}-particle coefficients would lead to anisotropies in the {alpha} decays of nuclei, and because the decay process involves quantum tunneling, the effects of any Lorentz violations could be exponentially enhanced.

  2. Long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; Wolf, Michael A.; McAtee, James L.; Unruh, Wesley P.; Cucchiara, Alfred L.; Huchton, Roger L.

    1993-01-01

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  3. Modeling Solar Lyman Alpha Irradiance

    NASA Technical Reports Server (NTRS)

    Pap, J.; Hudson, H. S.; Rottman, G. J.; Willson, R. C.; Donnelly, R. F.; London, J.

    1990-01-01

    Solar Lyman alpha irradiance is estimated from various solar indices using linear regression analyses. Models developed with multiple linear regression analysis, including daily values and 81-day running means of solar indices, predict reasonably well both the short- and long-term variations observed in Lyman alpha. It is shown that the full disk equivalent width of the He line at 1083 nm offers the best proxy for Lyman alpha, and that the total irradiance corrected for sunspot effect also has a high correlation with Lyman alpha.

  4. ISS Update: Alpha Magnetic Spectrometer

    NASA Video Gallery

    NASA Public Affairs Officer Kelly Humphries interviews Trent Martin, Johnson Space Center project manager for the Alpha Magnetic Spectrometer (AMS) aboard the International Space Station. Questions...

  5. Arachidonic acid mediates the formation of abundant alpha-helical multimers of alpha-synuclein

    NASA Astrophysics Data System (ADS)

    Iljina, Marija; Tosatto, Laura; Choi, Minee L.; Sang, Jason C.; Ye, Yu; Hughes, Craig D.; Bryant, Clare E.; Gandhi, Sonia; Klenerman, David

    2016-09-01

    The protein alpha-synuclein (αS) self-assembles into toxic beta-sheet aggregates in Parkinson’s disease, while it is proposed that αS forms soluble alpha-helical multimers in healthy neurons. Here, we have made αS multimers in vitro using arachidonic acid (ARA), one of the most abundant fatty acids in the brain, and characterized them by a combination of bulk experiments and single-molecule Fӧrster resonance energy transfer (sm-FRET) measurements. The data suggest that ARA-induced oligomers are alpha-helical, resistant to fibril formation, more prone to disaggregation, enzymatic digestion and degradation by the 26S proteasome, and lead to lower neuronal damage and reduced activation of microglia compared to the oligomers formed in the absence of ARA. These multimers can be formed at physiologically-relevant concentrations, and pathological mutants of αS form less multimers than wild-type αS. Our work provides strong biophysical evidence for the formation of alpha-helical multimers of αS in the presence of a biologically relevant fatty acid, which may have a protective role with respect to the generation of beta-sheet toxic structures during αS fibrillation.

  6. Arachidonic acid mediates the formation of abundant alpha-helical multimers of alpha-synuclein

    PubMed Central

    Iljina, Marija; Tosatto, Laura; Choi, Minee L.; Sang, Jason C.; Ye, Yu; Hughes, Craig D.; Bryant, Clare E.; Gandhi, Sonia; Klenerman, David

    2016-01-01

    The protein alpha-synuclein (αS) self-assembles into toxic beta-sheet aggregates in Parkinson’s disease, while it is proposed that αS forms soluble alpha-helical multimers in healthy neurons. Here, we have made αS multimers in vitro using arachidonic acid (ARA), one of the most abundant fatty acids in the brain, and characterized them by a combination of bulk experiments and single-molecule Fӧrster resonance energy transfer (sm-FRET) measurements. The data suggest that ARA-induced oligomers are alpha-helical, resistant to fibril formation, more prone to disaggregation, enzymatic digestion and degradation by the 26S proteasome, and lead to lower neuronal damage and reduced activation of microglia compared to the oligomers formed in the absence of ARA. These multimers can be formed at physiologically-relevant concentrations, and pathological mutants of αS form less multimers than wild-type αS. Our work provides strong biophysical evidence for the formation of alpha-helical multimers of αS in the presence of a biologically relevant fatty acid, which may have a protective role with respect to the generation of beta-sheet toxic structures during αS fibrillation. PMID:27671749

  7. Molecular mechanism of {alpha}-tocopheryl-phosphate transport across the cell membrane

    SciTech Connect

    Negis, Yesim; Meydani, Mohsen; Zingg, Jean-Marc; Azzi, Angelo . E-mail: angelo.azzi@tufts.edu

    2007-07-27

    {alpha}-Tocopheryl-phosphate ({alpha}-TP) is synthesized and hydrolyzed in animal cells and tissues where it modulates several functions. {alpha}-TP is more potent than {alpha}-T in inhibiting cell proliferation, down-regulating CD36 transcription, inhibiting atherosclerotic plaque formation. Administration of {alpha}-TP to cells or animals requires its transfer through membranes, via a transporter. We show here that {alpha}-TP is passing the plasma membrane via a system that is inhibited by glibenclamide and probenecid, inhibitors of a number of transporters. Glibenclamide and probenecid prevent dose-dependently {alpha}-TP inhibition of cell proliferation. The two inhibitors act on ATP binding cassette (ABC) and organic anion transporters (OAT). Since ABC transporters function to export solutes and {alpha}-TP is transported into cells, it may be concluded that {alpha}-TP transport may occur via an OAT family member. Due to the protection by glibenclamide and probenecid on the {alpha}-TP induced cell growth inhibition it appears that {alpha}-TP acts after its uptake inside cells.

  8. Resting alpha activity predicts learning ability in alpha neurofeedback

    PubMed Central

    Wan, Feng; Nan, Wenya; Vai, Mang I.; Rosa, Agostinho

    2014-01-01

    Individuals differ in their ability to learn how to regulate the brain activity by neurofeedback. This study aimed to investigate whether the resting alpha activity can predict the learning ability in alpha neurofeedback. A total of 25 subjects performed 20 sessions of individualized alpha neurofeedback and the learning ability was assessed by three indices respectively: the training parameter changes between two periods, within a short period and across the whole training time. It was found that the resting alpha amplitude measured before training had significant positive correlations with all learning indices and could be used as a predictor for the learning ability prediction. This finding would help the researchers in not only predicting the training efficacy in individuals but also gaining further insight into the mechanisms of alpha neurofeedback. PMID:25071528

  9. Inhibition of PPAR alpha/RXR alpha-mediated direct hyperplasia pathways during griseofulvin-induced hepatocarcinogenesis.

    PubMed

    Nagao, Y; French, B A; Cai, Y; French, S W; Wan, Y J

    1998-05-01

    Chronic griseofulvin (GF) feeding induces preneoplastic foci followed by hepatocellular carcinoma in the mouse liver. Our previous study suggested that GF-induced hepatocellular proliferation had a different mechanism from that of peroxisome proliferator (PP)-induced direct hyperplasia. The GF-induced hepatocellular proliferation was mediated through activation of immediate early genes such as Fos, Jun, Myc, and NFKB. In contrast, PP-induced direct hyperplasia does not involve activation of any of these immediate early genes. It has been shown that nuclear hormone receptors including peroxisome proliferator activated receptors (PPARs) and retinoid x receptors (RXRs) play important roles in mediating the pleiotropic effects of PPs. To examine the possible roles of PPARs and RXRs during non-PP-induced hepatocellular proliferation and the interaction between PP and non-PP-induced proliferation, we have studied the expression of the PPAR and RXR genes in the GF model using northern blot hybridizations and gel retardation assays. The data showed that the expression of PPARalpha and RXRalpha genes was down-regulated in the livers containing preneoplastic nodules and in the liver tumors induced by GF. The mRNA down-regulation was accompanied by a decrease in the amount of nuclear protein-bound to peroxisome proliferator and retinoic acid responsive elements. Down-regulation was also associated with the suppressed expression of the PPARalpha/RXRalpha target genes (i.e., acyl-Co oxidase and cytochrome P450 4A1) and the catalase gene. The RXR-gamma gene was also down-regulated, but the RARalpha, beta, and gamma and PPARbeta and gamma genes were up-regulated. These results indicated that the hepatocarcinogenesis induced by GF is accompanied by suppression of the PPARalpha/RXRalpha-mediated direct hyperplasia pathway. The differential expression of these nuclear hormone receptors reveals a new aspect for understanding the individual roles and intercommunication of PPAR, RXR

  10. Alpha Magnetic Spectrometer

    NASA Astrophysics Data System (ADS)

    Ting, Samuel

    2012-07-01

    The Alpha Magnetic Spectrometer (AMS) is a precision particle physics magnetic spectrometer designed to measure electrons, positrons, gamma rays and various nuclei and anti-nuclei from the cosmos up to TeV energy ranges. AMS weighs 7.5 tons and measures 5 meters by 4 meters by 3 meters. It contains 300,000 channels of electronics and 650 onboard microprocessors. It was delivered to the International Space Station onboard space shuttle Endeavour and installed on May 19, 2011. Since that time, more than 14 billion cosmic ray events have been collected. All the detectors function properly. At this moment, we are actively engaged in data analysis. AMS is an international collaboration involving 16 countries and 60 institutes. It took 16 years to construct and test. AMS is the only major physical science experiment on the International Space Station and will continue to collect data over the entire lifetime of the Space Station (10-20 years).

  11. Microscopic cluster model of {alpha}+n, {alpha}+p, {alpha}+ {sup 3}He, and {alpha}+{alpha} elastic scattering from a realistic effective nuclear interaction

    SciTech Connect

    Dohet-Eraly, J.; Baye, D.

    2011-07-15

    An effective nucleon-nucleon interaction adapted to cluster-model calculations of collisions is derived from the realistic Argonne potential AV18 with the unitary correlation operator method. The unitary correlation is determined from the {alpha}+{alpha} elastic phase shifts calculated in a cluster approach by the generator coordinate method coupled with the microscopic R-matrix method. With this interaction, the elastic phase shifts for the {alpha}+n, {alpha}+p, and {alpha}+{sup 3}He collisions are calculated within the same model. Without further adjustment, a good agreement with experimental data is obtained with a small model space.

  12. The Role of Alpha-2 Adrenergic Receptors in Anti-ulcer Activity.

    PubMed

    Suleyman, Halis

    2012-04-01

    Although peptic ulcer disease has long been recognized, the proposed mechanisms of its etiopathogenesis change every year. This review shows that gastric ulcers have a significant relationship with alpha-2 adrenergic receptors. The aggravating factors of gastric ulcer formation have been reported to act by blocking alpha-2 adrenergic receptors, whereas drugs possessing anti-ulcer activity have been shown to ensure gastric protection by stimulating the alpha-2 adrenergic receptors. The data derived from the literature indicate the likelihood that any drug or substance selectively stimulating the alpha-2 adrenergic receptors may possess anti-ulcer activity.

  13. Alpha particle emitters in medicine

    SciTech Connect

    Fisher, D.R.

    1989-09-01

    Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ({sup 211}At) and natural bismuth-212 ({sup 212}Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ({sup 223}Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs.

  14. Evaluation of the Performance of the THOR-alpha Dummy.

    PubMed

    van Don, B; van Ratingen, M; Bermond, F; Masson, C; Vezin, P; Hynd, D; Kallieris, D; Martinez, L

    2003-10-01

    Six European laboratories have evaluated the biomechanical response of the new advanced frontal impact dummy THOR-alpha with respect to the European impact response requirements. The results indicated that for many of the body regions (e.g. shoulder, spine, thorax, femur/knee) the THOR-alpha response was close to the human response. In addition, the durability, repeatability and sensitivity for some dummy regions have been evaluated. Based on the tests performed, it was found that the THOR-alpha is not durable enough. The lack in robustness of the THOR-alpha caused a problem in completing the full test program and in evaluating the repeatability of the dummy. The results have demonstrated that the assessment of frontal impact protection can be greatly improved with a more advanced frontal impact dummy. Regarding biofidelity and injury assessment capabilities, the THOR-alpha is a good candidate however it needs to be brought up to standard in other areas. Based on the results obtained recommendations were defined for the improvement of the THOR-alpha dummy.

  15. alpha(1)-Microglobulin: a yellow-brown lipocalin.

    PubMed

    Akerström, B; Lögdberg, L; Berggård, T; Osmark, P; Lindqvist, A

    2000-10-18

    alpha(1)-Microglobulin, also called protein HC, is a lipocalin with immunosuppressive properties. The protein has been found in a number of vertebrate species including frogs and fish. This review summarizes the present knowledge of its structure, biosynthesis, tissue distribution and immunoregulatory properties. alpha(1)-Microglobulin has a yellow-brown color and is size and charge heterogeneous. This is caused by an array of small chromophore prosthetic groups, attached to amino acid residues at the entrance of the lipocalin pocket. A gene in the lipocalin cluster encodes alpha(1)-microglobulin together with a Kunitz-type proteinase inhibitor, bikunin. The gene is translated into the alpha(1)-microglobulin-bikunin precursor, which is subsequently cleaved and the two proteins secreted to the blood separately. alpha(1)-Microglobulin is found in blood and in connective tissue in most organs. It is most abundant at interfaces between the cells of the body and the environment, such as in lungs, intestine, kidneys and placenta. alpha(1)-Microglobulin inhibits immunological functions of white blood cells in vitro, and its distribution is consistent with an anti-inflammatory and protective role in vivo.

  16. 40 CFR 721.5293 - Poly(oxy-1,2-ethanediyl), alpha-(9Z)-9-octadecenyl-.omega.-hydroxy-, phosphate, ammonium salt.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Poly(oxy-1,2-ethanediyl), alpha-(9Z)-9... SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.5293 Poly(oxy-1,2-ethanediyl), alpha...), alpha-(9Z)-9-octadecenyl-.omega.-hydroxy-, phosphate, ammonium salt (PMN P-99-920; CAS No....

  17. 40 CFR 721.10408 - Poly[oxy(methyl-1,2-ethanediyl)], .alpha.-[2-[[2,2-dimethyl-3-[(1-oxododecyl) oxy]propylidene...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Poly , .alpha.- propylidene] amino... SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.10408 Poly , .alpha.- propylidene... new uses subject to reporting. (1) The chemical substance identified as poly , .alpha.-...

  18. 40 CFR 721.10408 - Poly[oxy(methyl-1,2-ethanediyl)], .alpha.-[2-[[2,2-dimethyl-3-[(1-oxododecyl) oxy]propylidene...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Poly , .alpha.- propylidene] amino... SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.10408 Poly , .alpha.- propylidene... new uses subject to reporting. (1) The chemical substance identified as poly , .alpha.-...

  19. 40 CFR 721.10408 - Poly[oxy(methyl-1,2-ethanediyl)], .alpha.-[2-[[2,2-dimethyl-3-[(1-oxododecyl) oxy]propylidene...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Poly , .alpha.- propylidene] amino... SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.10408 Poly , .alpha.- propylidene... new uses subject to reporting. (1) The chemical substance identified as poly , .alpha.-...

  20. Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

    PubMed

    Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

    2006-01-01

    The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

  1. Human cDNA clones for four species of G alpha s signal transduction protein.

    PubMed Central

    Bray, P; Carter, A; Simons, C; Guo, V; Puckett, C; Kamholz, J; Spiegel, A; Nirenberg, M

    1986-01-01

    lambda gt11 cDNA libraries derived from human brain were screened with oligonucleotide probes for recombinants that code for alpha subunits of G signal transduction proteins. Eleven alpha s clones were detected with both probes and characterized. Four types of alpha s cDNA were cloned that differ in nucleotide sequence in the region that corresponds to amino acid residues 71-88. The clones differ in the codon for alpha s amino acid residue 71 (glutamic acid or aspartic acid), the presence or absence of codons for the next 15 amino acid residues, and the presence or absence of an adjacent serine residue. S1 nuclease protection experiments revealed at least two forms of alpha s mRNA. A mechanism for generating four species of alpha s mRNA by alternative splicing of precursor RNA is proposed. Images PMID:3024154

  2. Genetics Home Reference: alpha-mannosidosis

    MedlinePlus

    ... Me Understand Genetics Home Health Conditions alpha-mannosidosis alpha-mannosidosis Enable Javascript to view the expand/collapse boxes. Download PDF Open All Close All Description Alpha-mannosidosis is a rare inherited disorder that causes ...

  3. Selective down-regulation of the alpha6-integrin subunit in melanocytes by UVB light.

    PubMed

    Krengel, Sven; Stark, Imke; Geuchen, Christian; Knoppe, Bettina; Scheel, Gabriele; Schlenke, Peter; Gebert, Andreas; Wünsch, Lutz; Brinckmann, Jürgen; Tronnier, Michael

    2005-06-01

    In vivo, melanocytes bind to laminin (LM) molecules of the basement membrane (BM) via the integrins alpha3beta1 and alpha6beta1, and they adhere to neighbouring keratinocytes via E-cadherin. Only few studies have addressed the impact of ultraviolet (UV) light on the interaction of melanocytes with their microenvironment. In this report, we examined the influence of UVB irradiation on the expression of the most important melanocyte-adhesion molecules (E-, N-cadherin, alpha2-, alpha3-, alpha5-, alpha6-, alphaV-, beta1-, beta3-integrins and ICAM-1) in vitro by flow cytometry. We were able to demonstrate that the alpha6-integrin subunit is selectively and reversibly down-regulated by UVB in a dwzm 150ose-dependent manner. In comparison, keratinocytes lacked UVB-inducible alterations in the expression of alpha6-integrin. In the presence of LM-1, the UVB-induced down-regulation of alpha6-integrin in melanocytes was significantly reduced. Moreover, LM-1 increased the resistance of melanocytes to UVB-induced cell death, as measured by annexinV-binding analysis. This effect was reversed by preincubation with an alpha6-integrin-blocking antibody. By immunofluorescence, we could demonstrate that UVB leads to a dose-dependent internalization of alpha6-integrin, providing an obvious explanation for the down-regulation on the outer cell surface observed by flow cytometry. We suggest that adhesion to LM-1 through alpha6-integrin represents a protective mechanism for melanocytes to withstand UVB damage. Through alpha6-integrin internalization, sunburns might alter the interaction between melanocytes and the BM, resulting in apoptosis induced by loss of anchorage (anoikis). Repeated sunburns may then lead to the selection of a population of melanocytes which are capable of anchorage-independent survival, culminating in solar nevogenesis and melanoma development.

  4. alpha-Synuclein fission yeast model: concentration-dependent aggregation without plasma membrane localization or toxicity.

    PubMed

    Brandis, Katrina A; Holmes, Isaac F; England, Samantha J; Sharma, Nijee; Kukreja, Lokesh; DebBurman, Shubhik K

    2006-01-01

    Despite fission yeast's history of modeling salient cellular processes, it has not yet been used to model human neurodegeneration-linked protein misfolding. Because alpha-synuclein misfolding and aggregation are linked to Parkinson's disease (PD), here, we report a fission yeast (Schizosaccharomyces pombe) model that evaluates alpha-synuclein misfolding, aggregation, and toxicity and compare these properties with those recently characterized in budding yeast (Saccharomyces cerevisiae). Wild-type alpha-synuclein and three mutants (A30P, A53T, and A30P/A53T) were expressed with thiamine-repressible promoters (using vectors of increasing promoter strength: pNMT81, pNMT41, and pNMT1) to test directly in living cells the nucleation polymerization hypothesis for alpha-synuclein misfolding and aggregation. In support of the hypothesis, wild-type and A53T alpha-synuclein formed prominent intracellular cytoplasmic inclusions within fission yeast cells in a concentration- and time-dependent manner, whereas A30P and A30P/A53T remained diffuse throughout the cytoplasm. A53T alpha-synuclein formed aggregates faster than wild-type alpha-synuclein and at a lower alpha-synuclein concentration. Unexpectedly, unlike in budding yeast, wild-type and A53T alpha-synuclein did not target to the plasma membrane in fission yeast, not even at low alpha-synuclein concentrations or as a precursor step to forming aggregates. Despite alpha-synuclein's extensive aggregation, it was surprisingly nontoxic to fission yeast. Future genetic dissection might yield molecular insight into this protection against toxicity. We speculate that alpha-synuclein toxicity might be linked to its membrane binding capacity. To conclude, S. pombe and S. cerevisiae model similar yet distinct aspects of alpha-synuclein biology, and both organisms shed insight into alpha-synuclein's role in PD pathogenesis.

  5. Alpha-particle spectrometer experiment

    NASA Technical Reports Server (NTRS)

    Gorenstein, P.; Bjorkholm, P.

    1972-01-01

    Mapping the radon emanation of the moon was studied to find potential areas of high activity by detection of radon isotopes and their daughter products. It was felt that based on observation of regions overflown by Apollo spacecraft and within the field of view of the alpha-particle spectrometer, a radon map could be constructed, identifying and locating lunar areas of outgassing. The basic theory of radon migration from natural concentrations of uranium and thorium is discussed in terms of radon decay and the production of alpha particles. The preliminary analysis of the results indicates no significant alpha emission.

  6. Alpha--College for Exploring

    ERIC Educational Resources Information Center

    Leppert, William; Koenig, Joan

    1976-01-01

    Describes Alpha, the experimental college of individualized instruction at the College of DuPage (Illinois). At this college, students design their own curricula and work in an open classroom situation, and teachers start with students instead of subjects. (DC)

  7. Genetics Home Reference: alpha thalassemia

    MedlinePlus

    ... in each cell. Each copy is called an allele. For each gene, one allele is inherited from a person's father, and the ... person's mother. As a result, there are four alleles that produce alpha-globin. The different types of ...

  8. Detecting Alpha-1 Antitrypsin Deficiency.

    PubMed

    Stoller, James K

    2016-08-01

    Alpha-1 antitrypsin deficiency is a widely underrecognized condition, with evidence of persisting long diagnostic delays and patients' frequent need to see multiple physicians before initial diagnosis. Reasons for underrecognition include inadequate understanding of alpha-1 antitrypsin deficiency by physicians and allied health care providers; failure to implement available, guideline-based practice recommendations; and the belief that effective therapy is unavailable. Multiple studies have described both the results of screening and targeted detection of individuals with alpha-1 antitrypsin deficiency, with both varying strategies employed to identify at-risk individuals and varying results of testing. Also, various strategies to enhance detection of affected individuals have been examined, including use of the electronic medical record to prompt testing and empowerment of allied health providers, especially respiratory therapists, to promote testing for alpha-1 antitrypsin deficiency. Such efforts are likely to enhance detection with the expected result that the harmful effects of delayed diagnosis can be mitigated. PMID:27564667

  9. Alpha Magnetic Spectrometer (AMS) Overview

    NASA Video Gallery

    The Alpha Magnetic Spectrometer (AMS) is flying to the station on STS-134. The AMS experiment is a state-of-the-art particle physics detector being operated by an international team composed of 60 ...

  10. Synthesis and herbicidal activity of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives.

    PubMed

    Xu, Han; Zou, Xiao-Mao; Zhu, You-Quan; Liu, Bin; Tao, Han-Lin; Hu, Xu-Hong; Song, Hai-Bin; Hu, Fang-Zhong; Wang, Yong; Yang, Hua-Zheng

    2006-06-01

    A series of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives was synthesised. Herbicidal activities of the two intermediate compounds and 15 pyridazinone derivatives were evaluated through barnyardgrass and rape cup tests and Spirodela polyrrhiza (L.) Schleiden tests. Selected compounds were also evaluated under greenhouse conditions. Bleaching activities were observed at 10 microg ml(-1) and some compounds exhibited herbicidal activities at a rate of 300 g ha(-1). The relationship between crystal structures and herbicidal activities is discussed through a comparison of two compounds (5a and 5f). PMID:16602079

  11. Alpha decay in electron surrounding

    SciTech Connect

    Igashov, S. Yu.; Tchuvil’sky, Yu. M.

    2013-12-15

    The influence of atomic electron shells on the constant of alpha decay of heavy and mediummass nuclei was considered in detail. A method for simultaneously taking into account the change in the potential-barrier shape and the effect of reflection of a diverging Coulomb wave in the classically allowed region was developed. The ratios of decay probabilities per unit time for a bare nucleus and the respective neutral atom were found for some alpha-decaying isotopes.

  12. The Thermal Structural Transition of Alpha-Crystallin Modulates Subunit Interactions and Increases Protein Solubility

    PubMed Central

    Maulucci, Giuseppe; De Spirito, Marco; Arcovito, Giuseppe; Papi, Massimiliano

    2012-01-01

    Background Alpha crystallin is an oligomer composed of two types of subunits, alpha-A and alpha-B crystallin, and is the major constituent of human lens. The temperature induced condensation of alpha-crystallin, the main cause for eye lens opacification (cataract), is a two step-process, a nucleation followed by an aggregation phase, and a protective effect towards the aggregation is exhibited over the alpha crystallin phase transition temperature (Tc = 318.16 K). Methods/Results To investigate if a modulation of the subunit interactions over Tc could trigger the protective mechanism towards the aggregation, we followed, by using simultaneously static and dynamic light scattering, the temperature induced condensation of alpha-crystallin. By developing a mathematical model able to uncouple the nucleation and aggregation processes, we find a previously unobserved transition in the nucleation rate constant. Its temperature dependence allows to determine fundamental structural parameters, the chemical potential (Δμ) and the interfacial tension (γ) of the aggregating phase, that characterize subunit interactions. Conclusions/General Significance The decrease of both Δμ and γ at Tc, and a relative increase in solubility, reveal a significative decrease in the strenght of alpha-crystallin subunits interactions, which protects from supramolecolar condensation in hypertermic conditions. On the whole, we suggest a general approach able to understand the structural and kinetic mechanisms involved in aggregation-related diseases and in drugs development and testing. PMID:22347398

  13. 40 CFR 721.10286 - Formaldehyde, polymer with .alpha.-(2-aminomethylethyl)- .omega.-(2- aminomethylethoxy)poly[ oxy...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Formaldehyde, polymer with .alpha.-(2-aminomethylethyl)- .omega.-(2- aminomethylethoxy)poly and 4-(1,1-dimethylethyl)phenol. 721.10286 Section 721.10286 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF...

  14. 40 CFR 721.10286 - Formaldehyde, polymer with .alpha.-(2-aminomethylethyl)- .omega.-(2-aminomethylethoxy) poly[oxy...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Formaldehyde, polymer with .alpha.-(2-aminomethylethyl)- .omega.-(2-aminomethylethoxy) poly and 4-(1,1-dimethylethyl)phenol. 721.10286 Section 721.10286 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF...

  15. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  16. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  17. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  18. Chaperone-like activity and quaternary structure of alpha-crystallin.

    PubMed

    Raman, B; Rao, C M

    1994-11-01

    alpha-Crystallin has been shown to function as a molecular chaperone in preventing thermal aggregation of crystallins and other proteins. The molecular mechanism of this protection is not yet clear. gamma-Crystallin aggregates upon exposure to UV light. We have investigated the effect of the presence of alpha-crystallin in the photoaggregation process and find that alpha-crystallin does not prevent photoaggregation at low temperatures. The protection starts around 30 degrees C and steeply increases with temperature. The plot of protection ability versus temperature is sigmoidal, indicating a structural transition. Perturbation of the quaternary structure of alpha by non-thermal mode, such as 3 M urea, also results in enhanced protection. Pyrene, a hydrophobic fluorophore, is sparingly soluble in water. alpha-Crystallin enhances the solubility of pyrene by severalfold. Temperature dependence of this solubilization shows a transition around 30 degrees C (another at about 50 degrees C). Fluorescence intensity ratio of third and first peaks of pyrene emission (I3/I1,), indicative of hydrophobicity of the reporting area, also shows similar transitions suggesting enhanced hydrophobicity. Gel filtration experiments of irradiated samples indicate the complex formation between gamma- and alpha-crystallins. alpha-Crystallin does not prevent cold precipitation of gamma-crystallin. On the basis of these results, we hypothesize that alpha-crystallin prevents aggregation of non-native structures by providing appropriately placed hydrophobic surfaces. A structural transition above 30 degrees C enhances the protective ability, perhaps by increasing or reorganizing the hydrophobic surfaces. A similar temperature dependence has been reported for GroEL. Whether a structural switch, either activated by temperature, solvent conditions, or small molecule binding, forms a part of the general mechanism of chaperone activity needs to be investigated.

  19. Tobacco plants transformed with the bean. alpha. ai gene express an inhibitor of insect. alpha. -amylase in their seeds. [Nicotiana tabacum; Tenebrio molitor

    SciTech Connect

    Altabella, T.; Chrispeels, M.J. )

    1990-06-01

    Bean (Phaseolus vulgaris L.) seeds contain a putative plant defense protein that inhibits insect and mammalian but not plant {alpha}-amylases. We recently presented strong circumstantial evidence that this {alpha}-amylase inhibitor ({alpha}Al) is encoded by an already-identified lectin gene whose product is referred to as lectin-like-protein (LLP). We have now made a chimeric gene consisting of the coding sequence of the lectin gene that encodes LLP and the 5{prime} and 3{prime} flanking sequences of the lectin gene that encodes phytohemagglutinin-L. When this chimeric gene was expressed in transgenic tobacco (Nicotiana tabacum), we observed in the seeds a series of polypeptides (M{sub r} 10,000-18,000) that cross-react with antibodies to the bean {alpha}-amylase inhibitor. Most of these polypeptides bind to a pig pancreas {alpha}-amylase affinity column. An extract of the seeds of the transformed tobacco plants inhibits pig pancreas {alpha}-amylase activity as well as the {alpha}-amylase present in the midgut of Tenebrio molitor. We suggest that introduction of this lectin gene (to be called {alpha}ai) into other leguminous plants may be a strategy to protect the seeds from the seed-eating larvae of Coleoptera.

  20. Binding of actin to lens alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    Actin has been coupled to a cyanogen bromide-activated Sepharose 4B column, then tested for binding to alpha, beta, and gamma crystallin preparations from the bovine lens. Alpha, but not beta or gamma, crystallins bound to the actin affinity column in a time dependent and saturable manner. Subfractionation of the alpha crystallin preparation into the alpha-A and alpha-B species, followed by incubation with the affinity column, demonstrated that both species bound approximately the same. Together, these studies demonstrate a specific and saturable binding of lens alpha-A and alpha-B with actin.

  1. [Alpha-Synuclein in blood and cerebrospinal fluid of patients with alpha-synucleinopathy].

    PubMed

    Ono, Kenjiro; Yamada, Masahito

    2014-03-01

    Alpha-Synuclein protein(alphaS) aggregates from a monomer to assemblies such as oligomers, protofibrils, and mature fibrils. The early intermediate aggregate, that is, the oligomer, has been reported to be the most toxic species. We recently reported that melatonin inhibits alphaS aggregation, including protofibril and oligomer formations. While the alphaS concentration in cerebrospinal fluid was reported to significantly decrease in patients with Parkinson's disease (PD) and dementia with Lewy bodies, there have been reports that the alphaS oligomer concentration was elevated in the cerebrospinal fluid of PD patients. Moreover, it was reported that the alphaS oligomer concentration was also elevated in the blood of PD patients. Further studies may establish alphaS in cerebrospinal fluid and blood as a biomarker of alpha-synucleinopathies, including PD.

  2. Alpha-melanocyte-stimulating hormone down-regulates CXC receptors through activation of neutrophil elastase.

    PubMed

    Manna, Sunil K; Sarkar, Abira; Sreenivasan, Yashin

    2006-03-01

    Considering the role of interleukin-8 (IL-8) in a large number of acute and chronic inflammatory diseases, the regulation of IL-8-mediated biological responses is important. Alpha-melanocyte-stimulating hormone (alpha-MSH), a tridecapeptide, inhibits most forms of inflammation by an unknown mechanism. In the present study, we have found that alpha-MSH interacts predominantly with melanocortin-1 receptors and inhibits several IL-8-induced biological responses in macrophages and neutrophils. It down-regulated receptors for IL-8 but not for TNF, IL-4, IL-13 or TNF-related apoptosis-inducing ligand (TRAIL) in neutrophils. It down-regulated CXCR type 1 and 2 but not mRNA levels. alpha-MSH did not inhibit IL-8 binding in purified cell membrane or affinity-purified CXCR. IL-8 or anti-CXCR Ab protected against alpha-MSH-mediated inhibition of IL-8 binding. The level of neutrophil elastase, a specific serine protease, but not cathepsin G or proteinase 3 increased in alpha-MSH-treated cells, and restoration of CXCR by specific neutrophil elastase or serine protease inhibitors indicates the involvement of elastase in alpha-MSH-induced down-regulation of CXCR. These studies suggest that alpha-MSH inhibits IL-8-mediated biological responses by down-regulating CXCR through induction of serine protease and that alpha-MSH acts as a potent immunomodulator in neutrophil-driven inflammatory distress. PMID:16479540

  3. Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...

  4. Workshop on Precision Measurements of $\\alpha_s$

    SciTech Connect

    Bethke, Siegfried; Hoang, Andre H.; Kluth, Stefan; Schieck, Jochen; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS

    2011-10-01

    These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

  5. Synthesis of the core tetrasaccharide of Trypanosoma cruzi glycoinositolphospholipids: Manp(alpha1-->6)-Manp(alpha1-->4)-6-(2-aminoethylphosphonic acid)-GlcNp(alpha1-->6)-myo-Ins-1-PO4.

    PubMed

    Hederos, Markus; Konradsson, Peter

    2005-09-01

    [structure: see text] Synthesis of the core tetrasaccharide Manp(alpha1-->6)-Manp(alpha1-->4)-6-(2-aminoethylphosphonic acid)-GlcNp(alpha1-->6)-myo-Ins-1-PO4, found in glycoinositolphospholipids of Trypanosoma cruzi parasites, is described. The key building block, 6-O-(2-azido-3-O-benzyl-6-O-((2-benzyloxycarbonylaminoethyl)phosphonic acid benzyl ester)-2-deoxy-alpha-D-glucopyranosyl)-1-di-O-benzylphosphoryl-4,5-O-isopropylidene-2,3-O-(D-1,7,7-trimethyl[2,2,1]bicyclohept-6-ylidene)-D-myo-inositol, was synthesized using a partially protected glucosyl D-camphorinositolphosphate and a (2-benzyloxycarbonylaminoethyl)phosphonic acid derivative in a regioselective phosphonate esterfication. Elongation with ethyl 2-O-benzoyl-3,4,6-tri-O-benzyl-alpha-D-mannopyranosyl-(1-->6)-2,3,4-tri-O-benzyl-1-alpha-D-thiomannopyranoside using dimethyl(methylthio)sulfonium trifluoromethanesulfonate gave a fully protected tetrasaccharide which was successfully deprotected subsequently with sodium methoxide, sodium in liquid ammonia, and aq hydrochloric acid to give title compound.

  6. Insider protection

    SciTech Connect

    Waddoups, I.G.

    1993-07-01

    The government community is broadly addressing the insider threat. The first section of this paper defines protection approaches and the latter sections present various applicable technology developments. The bulk of the paper discusses technology developments applied to (1) personnel and material tracking and inventory, (2) classified document protection, and (3) protecting security systems. The personnel and material tracking system uses a PC based-host to (1) collect information from proximity tags and material movement sensors, (2) apply rules to this input to assure that the ongoing activity meets the site selectable rules and, (3) forward the results to either an automated inventory system or an alarm system. The document protection system uses a PC network to efficiently and securely control classified material which is stored on write-once-read-mostly optical media. The protection of sensor to multiplexer communications in a security system is emphasized in the discussion of protecting security systems.

  7. Statistical Analysis of Elevated Radium and Gross Alpha Measurement in the Sanitary Landfill

    SciTech Connect

    TUCKFIELD, RICHARD

    2004-04-12

    In 2002, radium 226 and 228 measurements elevated above the 5 pCi/L groundwater protection standard (GWPS) and gross alpha measurements above the 15 pCi/L GWPS were noticed in several groundwater monitoring wells at the SRS Sanitary Landfill. An additional four quarters of confirmatory measurements for Ra in the SLF groundwater were taken during 2003 as directed by the SC Department of Health and Environmental Control. Elevated radium concentrations in groundwater of the Aiken County area are a common occurrence. Price and Michel (1990) compiled radium concentrations in drinking water wells of this area and showed several instances of the concentrations exceeding the regulatory limit. Ra226 is an alpha emitter and contributes much of the natural alpha radioactivity found in uncontaminated groundwater. Thus, the elevated radium concentrations are usually accompanied by elevated gross alpha concentrations. Appendix A2 indicates that this is the case at the SLF where Ra226 accounts for almost all elevated gross alpha.

  8. Immunomodulatory effects of alpha interferon and thymostimulin in patients with neoplasias.

    PubMed Central

    Munno, I; Marinaro, M; Gesario, A; Cannuscio, B; Michel, Y; Paulling, E

    1995-01-01

    In this report, we have evaluated the immunological effects following administration of alpha interferon (IFN-alpha) in combination with thymostimulin (TP-1), as well as of IFN-alpha and TP-1 alone in patients with neoplasias who underwent surgery and were subsequently treated with conventional chemotherapy. Data suggest that the combination of IFN-alpha and TP-1 is the most effective in the up-regulation of some immune parameters such as the CD4(+)-CD8+ cell-dependent antibacterial activity. Since this immune function plays an important role in the host protection against different targets such as invading microorganisms and/or neoplastic cells, the administration of TP-1-IFN-alpha is advisable for patients with neoplasias under chemotherapy. PMID:7583935

  9. Photoremovable hydroxyl group protection. Use of the p-tolylsulfonyl protecting group in. beta. -disaccharide synthesis

    SciTech Connect

    Binkley, R.W.; Koholic, D.J. )

    1989-07-21

    The p-tolylsulfonyl group has been shown to a photoremovable group effective for protection of carbohydrates during disaccharide synthesis. The formation of the versatile, p-tolylsulfonyl-protected disaccharide 13 (methyl 3-O-(4-O-benzoyl-3-O-benzyl-2,6-dideoxy-{beta}-D-arabino-hexopyranosyl)-2,6-dideoxy-4-O-(p-tolylsulfonyl)-{alpha}-D-arabino-hexopyranoside) was accomplished by silver silicate catalyzed coupling of methyl 2,6-dideoxy-4-O-(p-tolylsulfonyl)-{alpha}-D-arabino-hexopyranoside (7) with 4-O-benzyl-2,6-dideoxy-{alpha}-D-arabino-hexopyranosyl bromide (8). Each of the three protecting groups (benzyl, benzoyl, and p-tolylsulfonyl) present in 13 was removed regioselectively under nonacidic conditions.

  10. alpha-Thalassemia caused by an unstable alpha-globin mutant.

    PubMed Central

    Liebhaber, S A; Kan, Y W

    1983-01-01

    In a previous study, molecular cloning of the alpha-globin genes from a patient with nondeletion Hb-H disease (genotype--/alpha alpha) showed that a single nucleotide mutation (CTG to CCG) in one of the genes resulted in a leucine to proline substitution. This paper describes the approach we used to detect the abnormal alpha-globin chain. The chain was identified using a cell-free translation system. It turned over rapidly both in vitro and in vivo in the patient's reticulocytes. The unusual feature of this unstable alpha-globin is that the alpha-globin deficiency causes alpha-thalassemia. Simple heterozygotes for this lesion (alpha Pro alpha/alpha alpha) resemble alpha-thalassemia carriers and do not exhibit the hemolytic anemia usually associated with unstable hemoglobins. Images PMID:6826718

  11. Bremsstrahlung in {alpha} Decay Reexamined

    SciTech Connect

    Boie, H.; Scheit, H.; Jentschura, U. D.; Koeck, F.; Lauer, M.; Schwalm, D.; Milstein, A. I.; Terekhov, I. S.

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the {alpha} decay of {sup 210}Po has been performed, which allows us to follow the photon spectra up to energies of {approx}500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the {alpha} particle and the emitted photon.

  12. NACA Physicist Studying Alpha Rays

    NASA Technical Reports Server (NTRS)

    1957-01-01

    NACA Physicits studying Alpha Rays in a continuous cloud chamber. A cloud chamber is used by Lewis scientists to obtain information aimed at minimizing undesirable effects of radiation on nuclear-powered aircraft components. Here, alpha particles from a polonium source emit in a flower-like pattern at the cloud chamber's center. The particles are made visible by means of alcohol vapor diffusing from an area at room temperature to an area at minus -78 deg. Centigrade. Nuclear-powered aircraft were never developed and aircraft nuclear propulsion systems were canceled in the early 1960s.

  13. Bremsstrahlung in alpha decay reexamined.

    PubMed

    Boie, H; Scheit, H; Jentschura, U D; Köck, F; Lauer, M; Milstein, A I; Terekhov, I S; Schwalm, D

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the alpha decay of (210)Po has been performed, which allows us to follow the photon spectra up to energies of approximately 500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the alpha particle and the emitted photon.

  14. Practical synthesis of the disaccharide epitope, D-galactopyranosyl-alpha-1,3-D-galactopyranose, by using 1,2;5,6-di-O-cyclohexylidene-alpha-D-galactofuranose as the glycosyl acceptor.

    PubMed

    Sakamoto, I; Ohrui, H

    2000-09-01

    D-Galactosyl-alpha-1,3-D-galactopyranose (1) was chemically prepared in a good yield by coupling phenyl 2,3,4,6-tetra-O-benzyl-1-thio-beta-D-galactopyranoside (5) or 2,3,4,6-tetra-O-benzyl-alpha-D-galactopyranosyl bromide (8) with 1,2:5,6-di-O-cyclohexylidene-alpha-D-galactofuranose (3) with subsequent de-O-benzylation and de-O-cyclohexylidenation of the resulting protected alpha1,3-disaccharide.

  15. Selection of novel analogs of thalidomide with enhanced tumor necrosis factor alpha inhibitory activity.

    PubMed Central

    Corral, L. G.; Muller, G. W.; Moreira, A. L.; Chen, Y.; Wu, M.; Stirling, D.; Kaplan, G.

    1996-01-01

    BACKGROUND: Tumor necrosis factor alpha (TNF alpha) is thought to mediate both protective and detrimental manifestations of the inflammatory response. Recently, thalidomide (alpha-N-phthalimidoglutarimide) was shown to partially inhibit monocyte TNF alpha production (by 50-70%) both in vivo and in vitro. More efficient inhibition of TNF alpha may, however, be necessary to rescue the host from more acute and extensive toxicities of TNF alpha-mediated inflammation. MATERIALS AND METHODS: Three structural analogues of thalidomide were selected for study based on increased activity against TNF alpha production. The parent drug and the analogs were tested in vitro in human peripheral blood mononuclear cell cultures for their effects on lipopolysaccharide (LPS) induced cytokine protein and mRNA production using ELISAs and Northern blot hybridization. The in vitro effects of the drugs were then confirmed in vivo in a mouse model of LPS induced lethality. RESULTS: The new compounds (two esters and one amide) showed increased inhibition of TNF alpha production by LPS-stimulated human monocytes, relative to the parent drug thalidomide. The analogs and the parent drug enhanced the production of interleukin 10 (IL-10), but had little effect on IL-6 and IL-1 beta protein and mRNA production. When tested in vivo, the amide analog protected 80% of LPS-treated mice against death from endotoxin induced shock. CONCLUSIONS: Analogs of thalidomide designed to better inhibit TNF alpha production in vitro have correspondingly greater efficacy in vivo. These finding may have therapeutic implication for the treatment of human diseases characterized by acute and extensive TNF alpha production such as tuberculous meningitis or toxic shock. Images FIG. 3 FIG. 4 PMID:8827720

  16. [Amyloid cascade hypothesis of Alzheimer's disease and alpha 7 nicotinic receptor].

    PubMed

    Hashimoto, Kenji; Iyo, Masaomi

    2002-04-01

    It is known that beta amyloid protein (A beta) plays an important role in the pathology of Alzheimer's disease (AD). In this review, the role of cellular signaling in the protective action of nicotine for A beta-induced neurotoxicity is described. Recent biochemical and functional studies have demonstrated that A beta interacts directly with the alpha 7 nicotinic receptor, suggesting that A beta might have a function as an endogenous ligand for this receptor. Thus the role of alpha 7 nicotinic receptor in the A beta cascade hypothesis of AD and the possibility of alpha 7 nicotine receptor agonists as the therapeutic drugs for AD are discussed.

  17. [Antimutagenic action of alpha-tocopherol acetate in carbon tetrachloride poisoning in animals].

    PubMed

    Maganova, N B; Stasenkova, K P; Bondarev, G I

    1982-01-01

    Additional administration of alpha-tocopherol acetate to S57Bl/6 mice and Wistar rats exposed to oral CCl4 under acute and subacute experimental conditions produced no appreciable effect on the frequency of cells with chromosomal aberrations. Additional administration of alpha-tocopherol acetate to S57Bl/6 mice exposed to CCl4 inhalation significantly lessened the frequency of somatic cells with chromosomal aberrations and the frequency of dominant lethals in sexual cells. This attests to a protective action of alpha-tocopherol acetate and confirms the data obtained by other research workers.

  18. {alpha}-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

    SciTech Connect

    Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H. . E-mail: roger.unger@utsouthwestern.edu

    2006-05-26

    {alpha}-Lipoic acid ({alpha}-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, {alpha}-LA protects against cardiac lipotoxicity, {alpha}-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In {alpha}-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-{gamma} cofactor-1{alpha} mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that {alpha}-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity.

  19. Interferon-alpha gene therapy prevents aflatoxin and carbon tetrachloride promoted hepatic carcinogenesis in rats.

    PubMed

    Aziz, Talaat Abdel; Aziz, Mohammed Abdel; Fouad, Hanan Hassan; Rashed, Laila Ahmed; Salama, Hosny; Abd-Alla, Samira; Wehab, Mosaad Attia Abdel; Ahmed, Tauseef

    2005-01-01

    Retrovirus-mediated interferon alpha (IFN-alpha) gene transfer was evaluated with regard to its possible protective effects against aflatoxin B1 (AFB1)-initiated and carbon tetrachloride (CCl4)-promoted hepatic carcinogenesis in rats. To our knowledge, this is the first time an experimental in vivo gene therapy trial was conducted in Egypt. Two genes were examined in liver tissue by RT-PCR: the first was glutathione-S-transferase placental (GST-P) isoenzyme, as an early marker to detect hepatic malignancy; the second was IFN-alpha gene expression to detect the efficiency of gene uptake and its persistence after transduction. Forty male rats, divided equally into 4 groups, were included in the study: the first group was the control; the second group received CCl4 0.2 ml subcutaneously twice weekly for 12 weeks and AFB1 0.25 mg/kg body wt intraperitoneally twice weekly for 6 weeks; the third group received IFN-alpha (10(8) pfu) intravenously in the tail vein prior to the start of CCl4 and AFB1 injections; and the fourth group received IFN-alpha (10(8) pfu) by intrahepatic injection under ultrasonography guide after termination of the CCl4 and AFB1 injection schedule. The results showed that IFN-alpha has a marked and significant protective effect against hepatic fibrogenesis as well as hepatic carcinogenesis. Pathological examination of liver tissue proved that IFN-alpha minimized both fibrotic and cirrhotic processes. The amount of fibrosis was less in both groups receiving IFN-alpha, with more protection in the group that received IFN-alpha intravenously prior to CCl4 and AFB1. The results of RT-PCR showed that the IFN-alpha gene was significantly expressed in both groups receiving IFN-alpha, with a more intense expression in the group that received IFN-alpha by intrahepatic injection after termination of CCl4 and AFB1 injections. The IFN-alpha gene was detected after three months of gene transduction in rats receiving IFN-alpha intravenously prior to CCl4 and AFB1

  20. Alcoholism, Alpha Production, and Biofeedback

    ERIC Educational Resources Information Center

    Jones, Frances W.; Holmes, David S.

    1976-01-01

    Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater…

  1. Targeted therapy using alpha emitters.

    PubMed

    Vaidyanathan, G; Zalutsky, M R

    1996-10-01

    Radionuclides such as 211At and 212Bi which decay by the emission of alpha-particles are attractive for certain applications of targeted radiotherapy. The tissue penetration of 212Bi and 211At alpha-particles is equivalent to only a few cell diameters, offering the possibility of combining cell-specific targeting with radiation of similar range. Unlike the beta-particles emitted by radionuclides such as 131I and 90Y, alpha-particles are radiation of high linear energy transfer and thus greater biological effectiveness. Several approaches have been explored for targeted radiotherapy with 212Bi- and 211At-labelled substances including colloids, monoclonal antibodies, metabolic precursors, receptor-avid ligands and other lower molecular weight molecules. An additional agent which exemplifies the promise of alpha-emitting radiopharmaceuticals is meta-[211At]astatobenzylguanidine. The toxicity of this compound under single-cell conditions, determined both by [3H]thymidine incorporation and by limiting dilution clonogenic assays, for human neuroblastoma cells is of the order of 1000 times higher than that of meta-[131I] iodobenzylguanidine. For meta-[211At] astatobenzylguanidine, the Do value was equivalent to only 6-7 211At atoms bound per cell. These results suggest that meta-[211At] astatobenzylguanidine might be valuable for the targeted radiotherapy of micrometastatic neuroblastomas.

  2. Meet the Alpha-Pets.

    ERIC Educational Resources Information Center

    Zitlaw, Jo Ann Bruce; Frank, Cheryl Standish

    1985-01-01

    "Alpha-Pets" are the focal point of an integrated, multidisciplinary curriculum. Each pet is featured for a week in a vocabulary-rich story and introduces related activities beginning with the featured letter, such as the four food groups during Freddie Fish's week or universe during Ulysses Unicorn's week. (MT)

  3. Alpha proton x ray spectrometer

    NASA Technical Reports Server (NTRS)

    Rieder, Rudi; Waeke, H.; Economou, T.

    1994-01-01

    Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

  4. High-performance liquid chromatographic determination of the glycoalkaloids alpha-solanine and alpha-chaconine in 12 commercial varieties of Mexican potato.

    PubMed

    Sotelo, A; Serrano, B

    2000-06-01

    The glycoalkaloid content in 12 commercial varieties of Mexican potatoes was measured by HPLC in both the peel and the flesh of the potato. The principal glycoalkaloids alpha-solanine and alpha-chaconine were present in higher concentration in the peel than in the flesh of all varieties. The main alkaloid in the peel of the potatoes was alpha-chaconine and comprised about 65-71% of the total glycoalkaloids. The high concentration of alpha-chaconine in peel, which is more toxic than alpha-solanine, gives more protection to the tuber against predators. The total alkaloids in the peel of Alpha, Juanita, Michoacan, Norteña, Rosita, and Tollocan varieties were higher than the limit recommended for food safety. However, the peel represents less than 10% of the total tuber in most of the varieties. The total alkaloids contained in the peel of Atzimba, Lopez, Marciana, Montsama, Murca, and Puebla was lower than the limits recommended for food safety. The glycoalkaloid content in the boiled peeled potatoes was less than 9 mg/100 g but in Alpha, Montsama, and Puebla varieties, both glycoalkaloids were absent. According to the results, the consumption of the 12 commercial varieties of Mexican potatoes does not represent any danger to human health.

  5. 40 CFR 721.10160 - Poly(oxy-1,2-ethanediyl), .alpha.-[(13Z)-1-oxo-13-docosen-1-yl]-.omega.-[[(13Z)-1-oxo-13-docosen...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Poly(oxy-1,2-ethanediyl), .alpha... Specific Chemical Substances § 721.10160 Poly(oxy-1,2-ethanediyl), .alpha.- -.omega.- oxy]-. (a) Chemical...,2-ethanediyl), .alpha.- -.omega.- oxy]- (PMN P-07-629; CAS No. 56565-72-1) is subject to...

  6. 40 CFR 721.10160 - Poly(oxy-1,2-ethanediyl), .alpha.-[(13Z)-1-oxo-13-docosen-1-yl]-.omega.-[[(13Z)-1-oxo-13-docosen...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Poly(oxy-1,2-ethanediyl), .alpha... Specific Chemical Substances § 721.10160 Poly(oxy-1,2-ethanediyl), .alpha.- -.omega.- oxy]-. (a) Chemical...,2-ethanediyl), .alpha.- -.omega.- oxy]- (PMN P-07-629; CAS No. 56565-72-1) is subject to...

  7. 40 CFR 721.10160 - Poly(oxy-1,2-ethanediyl), .alpha.-[(13Z)-1-oxo-13-docosen-1-yl]-.omega.-[[(13Z)-1-oxo-13-docosen...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Poly(oxy-1,2-ethanediyl), .alpha... Specific Chemical Substances § 721.10160 Poly(oxy-1,2-ethanediyl), .alpha.- -.omega.- oxy]-. (a) Chemical...,2-ethanediyl), .alpha.- -.omega.- oxy]- (PMN P-07-629; CAS No. 56565-72-1) is subject to...

  8. Experimental study of transplacental passage of alpha interferon by two assay techniques.

    PubMed Central

    Waysbort, A; Giroux, M; Mansat, V; Teixeira, M; Dumas, J C; Puel, J

    1993-01-01

    Two methods of assaying alpha interferon (IFN-alpha) were compared during an experiment aimed at determining whether IFN-alpha crosses the human placenta. Human placentas, collected after delivery following a normal pregnancy to term, were catheterized on both sides: fetal and maternal. The IFN-alpha was introduced in known amounts in the maternal circulation and was assayed in the efferent fetal fluid. The following two detection methods were used: radioimmunoassay by competition with [125I]IFN-alpha and assay with a biological system in which IFN-alpha protected Madin-Darby bovine kidney cells from destruction by vesicular stomatitis virus. The results obtained by the two methods were in perfect agreement for the efferent fetal fluid samples. They showed the absence of placental transfer of IFN-alpha. The biological method was found to be more sensitive than radioimmunoassay for low IFN-alpha titers (< 10 IU/ml) but was less reproducible, probably owing to the use of twofold dilutions. The specificities of the two methods were similar and their practicalities were equivalent; the biological method, however, was less costly. The study illustrates the complementarity of the two methods, which were based on different principles. The agreement obtained between the two methods provides a clear confirmation of the experimental results. PMID:8328774

  9. Mimicking phosphorylation of alphaB-crystallin affects its chaperone activity.

    PubMed

    Ecroyd, Heath; Meehan, Sarah; Horwitz, Joseph; Aquilina, J Andrew; Benesch, Justin L P; Robinson, Carol V; Macphee, Cait E; Carver, John A

    2007-01-01

    AlphaB-crystallin is a member of the sHsp (small heat-shock protein) family that prevents misfolded target proteins from aggregating and precipitating. Phosphorylation at three serine residues (Ser19, Ser45 and Ser59) is a major post-translational modification that occurs to alphaB-crystallin. In the present study, we produced recombinant proteins designed to mimic phosphorylation of alphaB-crystallin by incorporating a negative charge at these sites. We employed these mimics to undertake a mechanistic and structural investigation of the effect of phosphorylation on the chaperone activity of alphaB-crystallin to protect against two types of protein misfolding, i.e. amorphous aggregation and amyloid fibril assembly. We show that mimicking phosphorylation of alphaB-crystallin results in more efficient chaperone activity against both heat-induced and reduction-induced amorphous aggregation of target proteins. Mimick-ing phosphorylation increased the chaperone activity of alphaB-crystallin against one amyloid-forming target protein (kappa-casein), but decreased it against another (ccbeta-Trp peptide). We observed that both target protein identity and solution (buffer) conditions are critical factors in determining the relative chaperone ability of wild-type and phosphorylated alphaB-crystallins. The present study provides evidence for the regulation of the chaperone activity of alphaB-crystallin by phosphorylation and indicates that this may play an important role in alleviating the pathogenic effects associated with protein conformational diseases. PMID:16928191

  10. Hepatic effects of a methionine-choline-deficient diet in hepatocyte RXR{alpha}-null mice

    SciTech Connect

    Gyamfi, Maxwell Afari; Tanaka, Yuji; He Lin; Klaassen, Curtis D.; Wan, Y.-J.Y.

    2009-01-15

    Retinoid X receptor-{alpha} (RXR{alpha}) is an obligate partner for several nuclear hormone receptors that regulate important physiological processes in the liver. In this study the impact of hepatocyte RXR{alpha} deficiency on methionine and choline deficient (MCD) diet-induced steatosis, oxidative stress, inflammation, and hepatic transporters gene expression were examined. The mRNA of sterol regulatory element-binding protein (SREBP)-regulated genes, important for lipid synthesis, were not altered in wild type (WT) mice, but were increased 2.0- to 5.4-fold in hepatocyte RXR{alpha}-null (H-RXR{alpha}-null) mice fed a MCD diet for 14 days. Furthermore, hepatic mRNAs and proteins essential for fatty acid {beta}-oxidation were not altered in WT mice, but were decreased in the MCD diet-fed H-RXR{alpha}-null mice, resulting in increased hepatic free fatty acid levels. Cyp2e1 enzyme activity and lipid peroxide levels were induced only in MCD-fed WT mice. In contrast, hepatic mRNA levels of pro-inflammatory factors were increased only in H-RXR{alpha}-null mice fed the MCD diet. Hepatic uptake transporters Oatp1a1 and Oatp1b2 mRNA levels were decreased in WT mice fed the MCD diet, whereas the efflux transporter Mrp4 was increased. However, in the H-RXR{alpha}-null mice, the MCD diet only moderately decreased Oatp1a1 and induced both Oatp1a4 and Mrp4 gene expression. Whereas the MCD diet increased serum bile acid levels and alkaline phosphatase activity in both WT and H-RXR{alpha}-null mice, serum ALT levels were induced (2.9-fold) only in the H-RXR{alpha}-null mice. In conclusion, these data suggest a critical role for RXR{alpha} in hepatic fatty acid homeostasis and protection against MCD-induced hepatocyte injury.

  11. Coexistence of {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in {sup 10}Be

    SciTech Connect

    Itagaki, N.; Ito, M.; Milin, M.; Hashimoto, T.; Ishiyama, H.; Miyatake, H.

    2008-06-15

    The coexistence of the {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in the excited states of {sup 10}Be has been discussed. In the previous analysis, all the low-lying states of {sup 10}Be were found to be well described by the motion of the two valence neutrons around two {alpha} clusters. However, the {alpha}+t+t cluster structure was found to coexist with the {alpha}+{alpha}+n+n structure around E{sub x}=15 MeV, close to the corresponding threshold. We have introduced a microscopic model to solve the coupling effect between these two configurations. The K=0 and K=1 states are generated from the {alpha}+t+t configurations due to the spin coupling of two triton clusters. The present case of {sup 10}Be is one of the few examples in which completely different configurations of triton-type ({alpha}+t+t three-center) and {alpha}-type ({alpha}+{alpha}+n+n two-center) clusters coexist in a single nucleus in the same energy region.

  12. A synopsis of collective alpha effects and implications for ITER

    SciTech Connect

    Sigmar, D.J.

    1990-10-01

    This paper discusses the following: Alpha Interaction with Toroidal Alfven Eigenmodes; Alpha Interaction with Ballooning Modes; Alpha Interaction with Fishbone Oscillations; and Implications for ITER.

  13. Translocation of a phycoerythrin alpha subunit across five biological membranes.

    PubMed

    Gould, Sven B; Fan, Enguo; Hempel, Franziska; Maier, Uwe-G; Klösgen, Ralf Bernd

    2007-10-12

    Cryptophytes, unicellular algae, evolved by secondary endosymbiosis and contain plastids surrounded by four membranes. In contrast to cyanobacteria and red algae, their phycobiliproteins do not assemble into phycobilisomes and are located within the thylakoid lumen instead of the stroma. We identified two gene families encoding phycoerythrin alpha and light-harvesting complex proteins from an expressed sequence tag library of the cryptophyte Guillardia theta. The proteins bear a bipartite topogenic signal responsible for the transport of nuclear encoded proteins via the ER into the plastid. Analysis of the phycoerythrin alpha sequences revealed that more than half of them carry an additional, third topogenic signal comprising a twin arginine motif, which is indicative of Tat (twin arginine transport)-specific targeting signals. We performed import studies with several derivatives of one member using a diatom transformation system, as well as intact chloroplasts and thylakoid vesicles isolated from pea. We demonstrated the different targeting properties of each individual part of the tripartite leader and show that phycoerythrin alpha is transported across the thylakoid membrane into the thylakoid lumen and protease-protected. Furthermore, we showed that thylakoid transport of phycoerythrin alpha takes place by the Tat pathway even if the 36 amino acid long bipartite topogenic signal precedes the actual twin arginine signal. This is the first experimental evidence of a protein being targeted across five biological membranes.

  14. Genetics Home Reference: 5-alpha reductase deficiency

    MedlinePlus

    ... gene provides instructions for making an enzyme called steroid 5-alpha reductase 2. This enzyme is involved ... external genitalia. Mutations in the SRD5A2 gene prevent steroid 5-alpha reductase 2 from effectively converting testosterone ...

  15. What Causes Alpha-1 Antitrypsin Deficiency?

    MedlinePlus

    ... from the NHLBI on Twitter. What Causes Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency is an inherited disease. "Inherited" ... have AAT deficiency inherit two faulty AAT genes, one from each parent. These genes tell cells in ...

  16. How Is Alpha-1 Antitrypsin Deficiency Treated?

    MedlinePlus

    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Treated? Alpha-1 antitrypsin (AAT) deficiency has no cure, but its ... of these treatments are the same as the ones used for a lung disease called COPD (chronic ...

  17. Q (Alpha) Function and Squeezing Effect

    NASA Technical Reports Server (NTRS)

    Yunjie, Xia; Xianghe, Kong; Kezhu, Yan; Wanping, Chen

    1996-01-01

    The relation of squeezing and Q(alpha) function is discussed in this paper. By means of Q function, the squeezing of field with gaussian Q(alpha) function or negative P(a)function is also discussed in detail.

  18. Sun protection

    MedlinePlus

    ... your skin from the sun. This includes using sunscreen and other protective measures. Avoid sun exposure, particularly ... the sun. This is in addition to applying sunscreen. Suggestions for clothing include: Long-sleeve shirts and ...

  19. Memory protection

    NASA Technical Reports Server (NTRS)

    Denning, Peter J.

    1988-01-01

    Accidental overwriting of files or of memory regions belonging to other programs, browsing of personal files by superusers, Trojan horses, and viruses are examples of breakdowns in workstations and personal computers that would be significantly reduced by memory protection. Memory protection is the capability of an operating system and supporting hardware to delimit segments of memory, to control whether segments can be read from or written into, and to confine accesses of a program to its segments alone. The absence of memory protection in many operating systems today is the result of a bias toward a narrow definition of performance as maximum instruction-execution rate. A broader definition, including the time to get the job done, makes clear that cost of recovery from memory interference errors reduces expected performance. The mechanisms of memory protection are well understood, powerful, efficient, and elegant. They add to performance in the broad sense without reducing instruction execution rate.

  20. Association of actin with alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Boyle, D.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The alpha crystallins are cytosolic proteins that co-localize and co-purify with actin-containing microfilaments. Affinity column chromatography employing both covalently-coupled actin or alpha crystallin was used to demonstrate specific and saturable binding of actin with alpha crystallin. This conclusion was confirmed by direct visualization of alpha aggregates bound to actin polymerized in vitro. The significance of this interaction in relation to the functional properties of these two polypeptides will be discussed.

  1. Corrosion protection

    DOEpatents

    Brown, Donald W.; Wagh, Arun S.

    2003-05-27

    There has been invented a chemically bonded phosphate corrosion protection material and process for application of the corrosion protection material for corrosion prevention. A slurry of iron oxide and phosphoric acid is used to contact a warm surface of iron, steel or other metal to be treated. In the presence of ferrous ions from the iron, steel or other metal, the slurry reacts to form iron phosphates which form grains chemically bonded onto the surface of the steel.

  2. The ultraviolet spectra of Alpha Aquilae and Alpha Canis Minoris

    NASA Technical Reports Server (NTRS)

    Morton, D. C.; Bruzual A., G.; Kurucz, R. L.; Spinrad, H.

    1977-01-01

    Scans of Alpha Aql (A7 IV, V) and Alpha CMi (F5 IV-V) obtained with the Copernicus satellite spectrometer over the wavelength range from 2100 to 3200 A are presented along with a spectrum of the integrated solar disk over the same range procured during a calibrated rocket flight. About 1500 fairly strong absorption lines in the Alpha CMi spectrum between 2400 and 2961 A are identified by comparison with a solar atlas and by using a theoretical spectrum synthesized from a blanketed LTE model with an effective temperature of 6500 K and a surface gravity of 10,000 cm/sec per sec. The Mg II resonance doublet at 2795.528 and 2802.704 A is found to be present in all three stars together with a discontinuity at 2635 A due to Fe II, Fe I, Cr I, and Mn II. It is concluded that the Mg II resonance lines and the 2635-A continuum break would be the best spectral features for estimating the redshift of a galaxy observed at low resolution provided the redshift is not less than about 0.75.

  3. Effectiveness of Alpha Biofeedback Therapy: Negative Results.

    ERIC Educational Resources Information Center

    Watson, Charles G.; Herder, Joseph

    1980-01-01

    Assessed the utility of alpha biofeedback training in the treatment of patients (N=66). Biofeedback and placebo biofeedback groups were given alpha or mock-alpha training sessions. Improvement on 54 variables was compared to that of no-treatment controls. Only a chance number of significant changes appeared among the groups. (Author)

  4. Recent Results on the CKM Angle Alpha

    SciTech Connect

    Mihalyi, A.; /Wisconsin U., Madison

    2005-10-18

    The method to measure the CKM angle {alpha} and the modes sensitive to it are discussed. It is shown that the B {yields} {rho}{rho} decays provide the most stringent constraint on {alpha}, which is found to be {alpha} = 96{sup o} {+-} 10{sup o}(stat) {+-} 4{sup o}(syst){+-} 13{sup o}(penguin).

  5. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  6. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  7. 6 alpha-Fluoro- and 6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione: synthesis and evaluation of activity and kinetics of their C-22 epimers.

    PubMed

    Thalén, B A; Axelsson, B I; Andersson, P H; Brattsand, R L; Nylander, B; Wickström, L I

    1998-01-01

    It is generally accepted that the anti-inflammatory effect of glucocorticosteroids cannot be separated from their adverse effects at the receptor level. However, modification of the pharmacokinetics through structural alterations could provide steroids with a better therapeutic index than those currently used. Thus, new 16 alpha,17 alpha-acetals between butyraldehyde and 6 alpha-fluoro- or 6 alpha,9 alpha-difluoro-16 alpha-hydroxycortisol were synthesized and studied. Acetalization of the corresponding 16 alpha,17 alpha-diols or transacetalization of their 16 alpha,17 alpha-acetonides in dioxane produced mixtures of C-22 epimers, which were resolved by preparative chromatography. Alternatively, an efficient method was used to produce the 22R-epimer stereoselectively through performing the acetalization and transacetalization in a hydrocarbon with an inert material present. The C-22 configuration of (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione was unambiguously established by single crystal X-ray diffraction. The present compounds, especially the 22R-epimer just mentioned, bind to the rat thymus glucocorticoid receptor with high potency. The C-22 epimers of the 6 alpha,9 alpha-difluoro derivatives showed a 10-fold higher biotransformation rate than the budesonide 22R-epimer when incubated with human liver S9 subcellular fraction. The high receptor affinity in combination with the high biotransformation rate indicates that (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione may be an improved 16 alpha,17 alpha-acetal glucocorticosteroid for therapy of inflammatory diseases, in which the mucous membranes are involved, such as those in the intestinal tract as well in the respiratory tract. PMID:9437793

  8. Metabolomic study of cisplatin-induced nephrotoxicity.

    PubMed

    Portilla, D; Li, S; Nagothu, K K; Megyesi, J; Kaissling, B; Schnackenberg, L; Safirstein, R L; Beger, R D

    2006-06-01

    We have shown that cisplatin inhibits fatty acid oxidation, and that fibrate treatment ameliorates renal function by preventing the inhibition of fatty acid oxidation and proximal tubule cell death. Urine samples of mice treated with single injection of cisplatin (20 mg/kg body weight) were collected for 3 days and analyzed by 1H-nuclear magnetic resonance (NMR) spectroscopy. In a separate group, urine samples of mice treated with peroxisome proliferator-activated receptor-alpha (PPARalpha) ligand WY were also analyzed by NMR after 2 days of cisplatin exposure. Biochemical analysis of endogenous metabolites was performed in serum, urine, and kidney tissue. Electron microscopic studies were carried out to examine the effects of PPARalpha ligand and cisplatin. Principal component analysis demonstrated the presence of glucose, amino acids, and trichloacetic acid cycle metabolites in the urine after 48 h of cisplatin administration. These metabolic alterations precede changes in serum creatinine. Biochemical studies confirmed the presence of glucosuria, but also demonstrated the accumulation of nonesterified fatty acids, and triglycerides in serum, urine, and kidney tissue, in spite of increased levels of plasma insulin. These metabolic alterations were ameliorated by the use of PPARalpha ligand. Electron microscopic analysis confirmed the protective effect of the fibrate on preventing cisplatin-mediated necrosis of the S3 segment of the proximal tubule. Our study shows that cisplatin-induces a unique NMR metabolic profile in urine of mice that developed acute renal failure, and confirms the protective effect of a fibrate class of PPARalpha ligands. We propose that the injury-induced metabolic profile may be used as a biomarker of cisplatin-induced nephrotoxicity.

  9. Alpha voltaic batteries and methods thereof

    NASA Technical Reports Server (NTRS)

    Raffaelle, Ryne P. (Inventor); Jenkins, Phillip (Inventor); Wilt, David (Inventor); Scheiman, David (Inventor); Chubb, Donald (Inventor); Castro, Stephanie (Inventor)

    2011-01-01

    An alpha voltaic battery includes at least one layer of a semiconductor material comprising at least one p/n junction, at least one absorption and conversion layer on the at least one layer of semiconductor layer, and at least one alpha particle emitter. The absorption and conversion layer prevents at least a portion of alpha particles from the alpha particle emitter from damaging the p/n junction in the layer of semiconductor material. The absorption and conversion layer also converts at least a portion of energy from the alpha particles into electron-hole pairs for collection by the one p/n junction in the layer of semiconductor material.

  10. THE LYMAN ALPHA REFERENCE SAMPLE: EXTENDED LYMAN ALPHA HALOS PRODUCED AT LOW DUST CONTENT

    SciTech Connect

    Hayes, Matthew; Oestlin, Goeran; Duval, Florent; Guaita, Lucia; Melinder, Jens; Sandberg, Andreas; Schaerer, Daniel; Verhamme, Anne; Orlitova, Ivana; Mas-Hesse, J. Miguel; Oti-Floranes, Hector; Adamo, Angela; Atek, Hakim; Cannon, John M.; Herenz, E. Christian; Kunth, Daniel; Laursen, Peter

    2013-03-10

    We report on new imaging observations of the Lyman alpha emission line (Ly{alpha}), performed with the Hubble Space Telescope, that comprise the backbone of the Lyman alpha Reference Sample. We present images of 14 starburst galaxies at redshifts 0.028 < z < 0.18 in continuum-subtracted Ly{alpha}, H{alpha}, and the far ultraviolet continuum. We show that Ly{alpha} is emitted on scales that systematically exceed those of the massive stellar population and recombination nebulae: as measured by the Petrosian 20% radius, R{sub P20}, Ly{alpha} radii are larger than those of H{alpha} by factors ranging from 1 to 3.6, with an average of 2.4. The average ratio of Ly{alpha}-to-FUV radii is 2.9. This suggests that much of the Ly{alpha} light is pushed to large radii by resonance scattering. Defining the Relative Petrosian Extension of Ly{alpha} compared to H{alpha}, {xi}{sub Ly{alpha}} = R {sup Ly{alpha}}{sub P20}/R {sup H{alpha}}{sub P20}, we find {xi}{sub Ly{alpha}} to be uncorrelated with total Ly{alpha} luminosity. However, {xi}{sub Ly{alpha}} is strongly correlated with quantities that scale with dust content, in the sense that a low dust abundance is a necessary requirement (although not the only one) in order to spread Ly{alpha} photons throughout the interstellar medium and drive a large extended Ly{alpha} halo.

  11. Subjective pain perception mediated by alpha rhythms.

    PubMed

    Peng, Weiwei; Babiloni, Claudio; Mao, Yanhui; Hu, Yong

    2015-07-01

    Suppression of spontaneous alpha oscillatory activities, interpreted as cortical excitability, was observed in response to both transient and tonic painful stimuli. The changes of alpha rhythms induced by pain could be modulated by painful sensory inputs, experimental tasks, and top-down cognitive regulations such as attention. The temporal and spatial characteristics, as well as neural functions of pain induced alpha responses, depend much on how these factors contribute to the observed alpha event-related desynchronization/synchronization (ERD/ERS). How sensory-, task-, and cognitive-related changes of alpha oscillatory activities interact in pain perception process is reviewed in the current study, and the following conclusions are made: (1) the functional inhibition hypothesis that has been proposed in auditory and visual modalities could be applied also in pain modality; (2) the neural functions of pain induced alpha ERD/ERS were highly dependent on the cortical regions where it is observed, e.g., somatosensory cortex alpha ERD/ERS in pain perception for painful stimulus processing; (3) the attention modulation of pain perception, i.e., influences on the sensory and affective dimensions of pain experience, could be mediated by changes of alpha rhythms. Finally, we propose a model regarding the determinants of pain related alpha oscillatory activity, i.e., sensory-discriminative, affective-motivational, and cognitive-modulative aspects of pain experience, would affect and determine pain related alpha oscillatory activities in an integrated way within the distributed alpha system. PMID:26026894

  12. Lightning Protection

    NASA Technical Reports Server (NTRS)

    1994-01-01

    Kit-built airplanes are more affordable because they are assembled by the owner and do not require Federal Aviation Administration (FAA) certification. The Glasair III, is an advanced technology homebuilt, constructed of a fiberglass and graphite fiber composite material, and equipped with digital instruments. Both technologies make the airplane more susceptible to lightning effects. When Glasair manufacturer, Stoddard-Hamilton, decided that lightning protection would enable more extensive instrument flight and make the plane more marketable, they proposed a joint development program to NASA Langley Research Center (LAR). Under a Small Business Innovation Research (SBIR) contract, Langley contractors designed and tested a lightning protection system, and the Glasair III-LP became the first kit-built composite aircraft to be lightning tested and protection-verified under FAA guidelines for general aviation aircraft.

  13. Cloning, expression, and chaperone-like activity of human alphaA-crystallin.

    PubMed

    Andley, U P; Mathur, S; Griest, T A; Petrash, J M

    1996-12-13

    One of the major protein components of the ocular lens, alpha-crystallin, is composed of alphaA and alphaB chain subunits that have structural homology to the family of mammalian small heat shock proteins. Like other small heat shock proteins, alpha-crystallin subunits associate to form large oligomeric aggregates that express chaperone-like activity, as defined by the ability to suppress nonspecific aggregation of proteins destabilized by treatment with a variety of denaturants including heat, UV irradiation, and chemical modification. It has been proposed that age-related loss of sequences at the C terminus of the alphaA chain subunit may be a factor in the pathogenesis of cataract due to diminished capacity of the truncated crystallin to protect against nonspecific aggregation of lens proteins. To evaluate the functional consequences of alpha-crystallin modification, two mutant forms of alphaA subunits were prepared by site-directed mutagenesis. Like wild type (WT), aggregates of approximately 540 kDa were formed from a tryptophan-free alphaA mutant (W9F). When added in stoichiometric amounts, both WT and W9F subunits completely suppressed the heat-induced aggregation of aldose reductase. In contrast, subunits encoded by a truncation mutant in which the C-terminal 17 residues were deleted (R157STOP), despite having spectroscopic properties similar to WT, formed much larger aggregates with a marked reduction in chaperone-like activity. Similar results were observed when the chaperone-like activity was assessed through inhibition of gamma-crystallin aggregation induced by singlet oxygen. These results demonstrate that the structurally conservative substitution of Phe for Trp-9 has a negligible effect on the functional interaction of alphaA subunits, and that deletion of C-terminal sequences from the alphaA subunit results in substantial loss of chaperone-like activity, despite overall preservation of secondary structure. PMID:8943244

  14. 40 CFR 721.10160 - Poly(oxy-1,2-ethanediyl), .alpha.-[(13Z)-1-oxo-13-docosen-1-yl]-.omega.-[[(13Z)-1-oxo-13-docosen...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ....- -.omega.- oxy]-. 721.10160 Section 721.10160 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Specific Chemical Substances § 721.10160 Poly(oxy-1,2-ethanediyl), .alpha.- -.omega.- oxy]-. (a) Chemical...,2-ethanediyl), .alpha.- -.omega.- oxy]- (PMN P-07-629; CAS No. 56565-72-1) is subject to...

  15. 40 CFR 721.10160 - Poly(oxy-1,2-ethanediyl), .alpha.-[(13Z)-1-oxo-13-docosen-1-yl]-.omega.-[[(13Z)-1-oxo-13-docosen...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ....- -.omega.- oxy]-. 721.10160 Section 721.10160 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Specific Chemical Substances § 721.10160 Poly(oxy-1,2-ethanediyl), .alpha.- -.omega.- oxy]-. (a) Chemical...,2-ethanediyl), .alpha.- -.omega.- oxy]- (PMN P-07-629; CAS No. 56565-72-1) is subject to...

  16. Noise Protection

    NASA Technical Reports Server (NTRS)

    1980-01-01

    Environmental Health Systems puts forth an increasing effort in the U.S. to develop ways of controlling noise, particularly in industrial environments due to Federal and State laws, labor union insistence and new findings relative to noise pollution impact on human health. NASA's Apollo guidance control system aided in the development of a noise protection product, SMART. The basis of all SMART products is SMART compound a liquid plastic mixture with exceptional energy/sound absorbing qualities. The basic compound was later refined for noise protection use.

  17. Orthogonally protected cyclo-beta-tetrapeptides as solid-supported scaffolds for the synthesis of glycoclusters.

    PubMed

    Virta, Pasi; Karskela, Marika; Lönnberg, Harri

    2006-03-01

    Two novel peptide scaffolds, viz. cyclo[(N(alpha)-Alloc)Dpr-beta-Ala-(N(alpha)-Fmoc)Dpr-beta-Ala] (1) and cyclo[(N(alpha)-Alloc)Dpr-alpha-azido-beta-aminopropanoyl-(N(alpha)-Fmoc)Dpr-beta-Ala] (2), composed of orthogonally protected 2,3-diaminopropanoyl (Dpr) and beta-alanyl residues, have been described. Fmoc chemistry on a backbone amide linker derivatized resin has been used for the chain assembly. Selective removal of the 4-methyltrityl (Mtt) and 1-methyl-1-phenylethyl protections (PhiPr) exposes the beta-amino and carboxyl terminus, respectively, and on-resin cyclization then gives the desired orthogonally protected cyclo-beta-tetrapeptides (1 and 2). The alpha-amino groups, bearing the Fmoc and Alloc protections and the azide mask, allow stepwise orthogonal derivatization of these solid-supported cyclo-beta-tetrapeptide cores (1 and 2). This has been demonstrated by attachments of various sugar units [viz., acetyl- or toluoyl-protected carboxymethyl alpha-d-glycopyranosides (13-15) and methyl 6-O-(4-nitrophenoxycarbonyl)-alpha-d-glycopyranosides (22-24)] to obtain diverse di- and trivalent glycoclusters (33-42). Acidolytic release (TFA) from the support, followed by conventional NaOMe-catalyzed transesterification (33-40) or hydrazine-induced acyl substitution in DMF (41 and 42), gives the fully deprotected clusters (43-52) as final products.

  18. 40 CFR 721.9663 - Poly(oxy-1,2-ethanediyl), alpha, alpha′-[thiobis (1-oxo-3,1-propanediyl)]bis [omega-hydroxy-,bis...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Poly(oxy-1,2-ethanediyl), alpha...(oxy-1,2-ethanediyl), alpha, alpha′- bis [omega-hydroxy-,bis (C11-15 and C11-15-isoalkyl) ethers. (a... poly(oxy-1,2-ethanediyl), alpha, alpha′- bis [omega-hydroxy-,bis(C11-15 and C11-15-isoalkyl)...

  19. 40 CFR 721.9663 - Poly(oxy-1,2-ethanediyl), alpha, alpha′-[thiobis (1-oxo-3,1-propanediyl)]bis [omega-hydroxy-,bis...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Poly(oxy-1,2-ethanediyl), alpha...(oxy-1,2-ethanediyl), alpha, alpha′- bis [omega-hydroxy-,bis (C11-15 and C11-15-isoalkyl) ethers. (a... poly(oxy-1,2-ethanediyl), alpha, alpha′- bis [omega-hydroxy-,bis(C11-15 and C11-15-isoalkyl)...

  20. 40 CFR 721.9663 - Poly(oxy-1,2-ethanediyl), alpha, alpha′-[thiobis (1-oxo-3,1-propanediyl)]bis [omega-hydroxy-,bis...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Poly(oxy-1,2-ethanediyl), alpha...(oxy-1,2-ethanediyl), alpha, alpha′- bis [omega-hydroxy-,bis (C11-15 and C11-15-isoalkyl) ethers. (a... poly(oxy-1,2-ethanediyl), alpha, alpha′- bis [omega-hydroxy-,bis(C11-15 and C11-15-isoalkyl)...

  1. 40 CFR 721.10556 - Poly(oxy-1,2-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C12-15-alkyl ethers.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Poly(oxy-1,2-ethanediyl), .alpha.- (2...-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C12-15-alkyl ethers. (a) Chemical substance...-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C12-15-alkyl ethers (PMN P-06-450; CAS...

  2. 40 CFR 721.10557 - Poly(oxy-1,2-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C10-16-alkyl ethers.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Poly(oxy-1,2-ethanediyl), .alpha.- (2...-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C10-16-alkyl ethers. (a) Chemical substance...-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C10-16-alkyl ethers (PMN P-06-451; CAS...

  3. 40 CFR 721.10556 - Poly(oxy-1,2-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C12-15-alkyl ethers.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Poly(oxy-1,2-ethanediyl), .alpha.- (2...-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C12-15-alkyl ethers. (a) Chemical substance...-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C12-15-alkyl ethers (PMN P-06-450; CAS...

  4. 40 CFR 721.10558 - Poly(oxy-1,2-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C12-16-alkyl ethers.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Poly(oxy-1,2-ethanediyl), .alpha.- (2...-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C12-16-alkyl ethers. (a) Chemical substance...-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C12-16-alkyl ethers (PMN P-06-452; CAS...

  5. 40 CFR 721.10557 - Poly(oxy-1,2-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C10-16-alkyl ethers.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Poly(oxy-1,2-ethanediyl), .alpha.- (2...-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C10-16-alkyl ethers. (a) Chemical substance...-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C10-16-alkyl ethers (PMN P-06-451; CAS...

  6. 40 CFR 721.10558 - Poly(oxy-1,2-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C12-16-alkyl ethers.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Poly(oxy-1,2-ethanediyl), .alpha.- (2...-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C12-16-alkyl ethers. (a) Chemical substance...-ethanediyl), .alpha.- (2-methyl-2-propen-1-yl) -.omega.-hydroxy-,C12-16-alkyl ethers (PMN P-06-452; CAS...

  7. 40 CFR 721.9663 - Poly(oxy-1,2-ethanediyl), alpha, alpha′-[thiobis (1-oxo-3,1-propanediyl)]bis [omega-hydroxy-,bis...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ..., alphaâ²- bis [omega-hydroxy-,bis (C11-15 and C11-15-isoalkyl) ethers. 721.9663 Section 721.9663 Protection...(oxy-1,2-ethanediyl), alpha, alpha′- bis [omega-hydroxy-,bis (C11-15 and C11-15-isoalkyl) ethers. (a... poly(oxy-1,2-ethanediyl), alpha, alpha′- bis [omega-hydroxy-,bis(C11-15 and C11-15-isoalkyl)...

  8. 40 CFR 721.9663 - Poly(oxy-1,2-ethanediyl), alpha, alpha′-[thiobis (1-oxo-3,1-propanediyl)]bis [omega-hydroxy-,bis...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ..., alphaâ²- bis [omega-hydroxy-,bis (C11-15 and C11-15-isoalkyl) ethers. 721.9663 Section 721.9663 Protection...(oxy-1,2-ethanediyl), alpha, alpha′- bis [omega-hydroxy-,bis (C11-15 and C11-15-isoalkyl) ethers. (a... poly(oxy-1,2-ethanediyl), alpha, alpha′- bis [omega-hydroxy-,bis(C11-15 and C11-15-isoalkyl)...

  9. Protecting Privacy.

    ERIC Educational Resources Information Center

    Coyle, Karen

    2001-01-01

    Discusses privacy issues related to use of the Internet. Topics include data gathering functions that are built into applications of the World Wide Web; cookies that identify Web site visitors; personal identity information; libraries and privacy, including the need for privacy policies; protecting your privacy; and developing privacy literacy.…

  10. TNF-alpha reverses the disease-exacerbating effect of subcutaneous immunization against murine cutaneous leishmaniasis.

    PubMed Central

    Liew, F Y; Li, Y; Yang, D M; Severn, A; Cox, F E

    1991-01-01

    Earlier studies have demonstrated that mice injected subcutaneously or intramuscularly with leishmanial antigens develop significantly exacerbated disease compared with unimmunized controls when challenged with the cutaneous protozoan parasites Leishmania major. We report here that this disease enhancement can be prevented, and protective immunity induced, by the incorporation of recombinant tumour necrosis factor (TNF-alpha) in the immunizing inoculum. This effect of TNF-alpha is dose-dependent and is not evident when TNF-alpha and the antigens are injected into separate sites. Furthermore, TNF-alpha injected together with p183, a peptide known to preferentially stimulate Th2 cells and disease exacerbation in H-2d mice, activates spleen and lymph node cells secreting more interferon-gamma (IFN-gamma) and less interleukin-4 (IL-4) and induces a modest but significant degree of resistance against L. major infection in highly susceptible BALB/c mice. PMID:1748478

  11. Limited proteolysis by macrophage elastase inactivities human. cap alpha. /sub 1/-proteinase inhibitor

    SciTech Connect

    Banda, M.J.; Clark, E.J.; Werb, Z.

    1980-12-01

    Ever since the initial description of ..cap alpha../sub 1/-proteinase inhibitor (..cap alpha../sub 1/PI), the role of this plasma glycoprotein and its allelic polymorphism in disease and in healthy physiology has been the subject of much investigation, ..cap alpha../sub 1/PI inactivates a number of serine proteinases, including granulocyte elastase, and thus affords protection from the connective tissue degradation mediated by this class of proteinases. Because an imbalance in the ratio between ..cap alpha../sub 1/PI and proteinase may contribute to the development of destructive lung diseases, proteinases have been implicated in the pathogenesis of pulmonary emphysema. Both macrophages and polymorphonuclear leukocytes have been implicated in disruption of the ..cap alpha../sub 1/PI-proteinase balance. In this report, a new mechanism for alteration of the ..cap alpha../sub 1/PI-proteinase balance is demonstrated. It was found that the purified form of macrophage elastase catalytically degrades and inactivates ..cap alpha../sub 1/PI so that it no longer inhibits the elastinolytic activity of granulocyte elastase.

  12. Cortical EEG alpha rhythms reflect task-specific somatosensory and motor interactions in humans.

    PubMed

    Babiloni, Claudio; Del Percio, Claudio; Arendt-Nielsen, Lars; Soricelli, Andrea; Romani, Gian Luca; Rossini, Paolo Maria; Capotosto, Paolo

    2014-10-01

    Anticipating sensorimotor events allows adaptive reactions to environment with crucial implications for self-protection and survival. Here we review several studies of our group that aimed to test the hypothesis that the cortical processes preparing the elaboration of sensorimotor interaction is reflected by the reduction of anticipatory electroencephalographic alpha power (about 8-12Hz; event-related desynchronization, ERD), as an index that regulate task-specific sensorimotor processes, accounted by high-alpha sub-band (10-12Hz), rather than a general tonic alertness, accounted by low-alpha sub-band (8-10Hz). In this line, we propose a model for human cortical processes anticipating warned sensorimotor interactions. Overall, we reported a stronger high-alpha ERD before painful than non-painful somatosensory stimuli that is also predictive of the subjective evaluation of pain intensity. Furthermore, we showed that anticipatory high-alpha ERD increased before sensorimotor interactions between non-painful or painful stimuli and motor demands involving opposite hands. In contrast, sensorimotor interactions between painful somatosensory and sensorimotor demands involving the same hand decreased anticipatory high-alpha ERD, due to a sort of sensorimotor "gating" effect. In conclusion, we suggest that anticipatory cortical high-alpha rhythms reflect the central interference and/or integration of ascending (sensory) and descending (motor) signals relative to one or two hands before non-painful and painful sensorimotor interactions. PMID:24929901

  13. Synthesis of 16 alpha-3H androgen and estrogen substrates for 16 alpha-hydroxylase.

    PubMed

    Cantineau, R; Kremers, P; De Graeve, J; Cornelis, A; Laszlo, P; Gielen, J E; Lambotte, R

    1981-02-01

    The synthesis of 16 alpha-3H androgens and estrogens is described. 1-(3H)-Acetic acid in the presence of zinc dust reacts with 16 alpha-bromo-17-ketosteroids to produce 16 alpha-3H-17-ketosteroids. This chemical reaction was used to prepare 16 alpha-3H-dehydroepiandrosterone (I) and 16 alpha-3H-estrone acetate (XI) from 16 alpha-bromo-dehydroepiandrosterone (X) and from 16 alpha-bromo-estrone acetate (XII), respectively. Using appropriate microbiological techniques, it was possible to convert these radiolabelled substrates into 16 alpha-3H-androstenedione (II) and 16 alpha-3H-estradiol-17 beta (VII). 16 alpha-3H-Estrone (VI) was obtained by the chemical hydrolysis of 16 alpha-3H-estrone acetate. The label distribution as determined by microbiological 16 alpha-hydroxylations indicated a specific labelling of 77% for androgens and 65% for estrogens in the 16 alpha position. These substrates can be used for measuring the 16 alpha hydroxylase activity, an important step in the biosynthesis of estriol (VIII) and estetrol (IX). PMID:7013160

  14. A study of presynaptic alpha2-autoreceptors in alpha2A/D-, alpha2B- and alpha2C-adrenoceptor-deficient mice.

    PubMed

    Trendelenburg, A U; Klebroff, W; Hein, L; Starke, K

    2001-08-01

    The function of presynaptic alpha2-autoreceptors was studied in the hippocampus, occipito-parietal cortex, atria and vas deferens of NMRI mice, mice in which the alpha2A/D-, the alpha2B- or alpha2c-adrenoceptor gene had been disrupted (alpha2A/DKO, alpha2BKO and alpha2CKO, respectively), and the wildtype mice from which the knockout animals had been generated. Tissue pieces were preincubated with 3H-noradrenaline and then superfused and stimulated electrically. The alpha2-adrenoceptor agonist medetomidine reduced the electrically evoked overflow of tritium in all tissues from all mouse strains (stimulation with single pulses or single high-frequency pulse trains, called POPs, i.e. pulse patterns leading to minimal autoinhibition). The effects of medetomidine did not differ in NMRI, wildtype, alpha2BKO and alpha2CKO mice but were greatly reduced in alpha2A/DKO brain preparations and to a lesser extent in alpha2A/DKO atria and vasa deferentia. Six drugs were tested as antagonists against medetomidine. Their pKd values indicated that the hippocampal and occipito-parietal alpha2-autoreceptors in NMRI and wildtype mice were alpha2D (the rodent variant of the alpha2A/D-adrenoceptor) whereas the atrial and vas deferens alpha2-autoreceptors in NMRI and wildtype mice could not be identified with a single alpha2 subtype. Deletion of the alpha2A/D gene changed the pKd values in all tissues so that they now reflected alpha2C properties, whereas deletion of the alpha2C gene changed the pKd values in atria and vasa deferentia so that they now had alpha2D properties (as they had in NMRI and wildtype brain preparations). Autoinhibition by released noradrenaline was created using trains of up to 64 pulses or up to 4 POPs, and the overflow-enhancing effect of the alpha2 antagonist rauwolscine was determined. Results did not differ, irrespective of whether preparations were obtained from NMRI, wildtype, alpha2BKO or alpha2CKO mice: the overflow of tritium elicited by p pulses or POPs

  15. High gas flow alpha detector

    DOEpatents

    Bolton, Richard D.; Bounds, John A.; Rawool-Sullivan, Mohini W.

    1996-01-01

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors.

  16. High gas flow alpha detector

    DOEpatents

    Bolton, R.D.; Bounds, J.A.; Rawool-Sullivan, M.W.

    1996-05-07

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors. 4 figs.

  17. 40 CFR 721.10284 - Poly[oxy(methyl-1,2-ethanediyl)], .alpha.-sulfo-.omega.-hydroxy-, C14-15-branched and linear...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Poly , .alpha.-sulfo-.omega.-hydroxy... CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.10284 Poly , .alpha.-sulfo... significant new uses subject to reporting. (1) The chemical substance identified as poly ,...

  18. 40 CFR 721.10284 - Poly[oxy(methyl-1,2-ethanediyl)], .alpha.-sulfo-.omega.-hydroxy-, C14-15-branched and linear...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Poly , .alpha.-sulfo-.omega.-hydroxy... CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.10284 Poly , .alpha.-sulfo... significant new uses subject to reporting. (1) The chemical substance identified as poly ,...

  19. 40 CFR 721.10283 - Poly[oxy(methyl-1,2-ethanediyl)], .alpha.-sulfo-.omega.-hydroxy-, C12-13-branched and linear...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Poly , .alpha.-sulfo-.omega.-hydroxy... CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.10283 Poly , .alpha.-sulfo... significant new uses subject to reporting. (1) The chemical substance identified as poly ,...

  20. 40 CFR 721.10283 - Poly[oxy(methyl-1,2-ethanediyl)], .alpha.-sulfo-.omega.-hydroxy-, C12-13-branched and linear...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Poly , .alpha.-sulfo-.omega.-hydroxy... CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.10283 Poly , .alpha.-sulfo... significant new uses subject to reporting. (1) The chemical substance identified as poly ,...

  1. 40 CFR 721.10092 - Poly(oxy-1,2-ethanediyl), .alpha.-sulfo-.omega.-[[1-[(2-propen-1-yloxy)methyl]undecyl]oxy...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Poly(oxy-1,2-ethanediyl), .alpha.-sulfo-.omega.- undecyl]oxy]-, ammonium salt (1:1); Poly(oxy-1,2-ethanediyl), .alpha.-sulfo-.omega... Significant New Uses for Specific Chemical Substances § 721.10092 Poly(oxy-1,2-ethanediyl),...

  2. 40 CFR 721.10398 - Poly(oxy-1,2-ethanediyl),. alpha., -monoalkyl ethers-.omega.-mono (hydrogen maleate)- (generic).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...., -monoalkyl ethers-.omega.-mono (hydrogen maleate)- (generic). 721.10398 Section 721.10398 Protection of...-ethanediyl),. alpha., -monoalkyl ethers-.omega.-mono (hydrogen maleate)- (generic). (a) Chemical substance... poly(oxy-1,2-ethanediyl), .alpha., -monoalkyl ethers-.omega.-mono (hydrogen maleate)- (PMN P-10-495)...

  3. 40 CFR 721.10398 - Poly(oxy-1,2-ethanediyl),. alpha., -monoalkyl ethers-.omega.-mono (hydrogen maleate)- (generic).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...., -monoalkyl ethers-.omega.-mono (hydrogen maleate)- (generic). 721.10398 Section 721.10398 Protection of...-ethanediyl),. alpha., -monoalkyl ethers-.omega.-mono (hydrogen maleate)- (generic). (a) Chemical substance... poly(oxy-1,2-ethanediyl), .alpha., -monoalkyl ethers-.omega.-mono (hydrogen maleate)- (PMN P-10-495)...

  4. 40 CFR 721.10398 - Poly(oxy-1,2-ethanediyl),. alpha., -monoalkyl ethers-.omega.-mono (hydrogen maleate)- (generic).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...., -monoalkyl ethers-.omega.-mono (hydrogen maleate)- (generic). 721.10398 Section 721.10398 Protection of...-ethanediyl),. alpha., -monoalkyl ethers-.omega.-mono (hydrogen maleate)- (generic). (a) Chemical substance... poly(oxy-1,2-ethanediyl), .alpha., -monoalkyl ethers-.omega.-mono (hydrogen maleate)- (PMN P-10-495)...

  5. Reliability of {alpha}{sub 1} and {alpha}{sub 2} from lattice codes

    SciTech Connect

    Ng, K.Y.

    1996-10-01

    Whether the higher-order terms in the momentum-compaction factor, {alpha}{sub 1} and {alpha}{sub 2}, can be obtained reliably from lattice codes is an important issue for some quasi-isochronous rings. A FODO lattice consisting of thin quadrupoles, dipoles filling all spaces, and two families of thin sextupoles is solved and {alpha}{sub 1} and {alpha}{sub 2} are derived analytically. We find accurate agreement with SYNCH is examined. Some methods of measurement of {alpha}{sub 1} and {alpha}{sub 2} are discussed.

  6. alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

    PubMed Central

    Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L

    1988-01-01

    An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

  7. Preparation and properties of N alpha-Bpoc-amino acid pentafluorophenyl esters.

    PubMed

    Carey, R I; Bordas, L W; Slaughter, R A; Meadows, B C; Wadsworth, J L; Huang, H; Smith, J J; Furusjö, E

    1997-06-01

    The preparation and properties are reported of several N alpha-Bpoc -amino acid pentafluorophenyl esters, including those bearing tert-butyl-, allyl- and trityl-based protecting groups. These derivatives have been used in the solid-phase peptide synthesis of several short peptides. PMID:9266485

  8. The interferon-alpha gene family of Marmota himalayana, a Chinese marmot species with susceptibility to woodchuck hepatitis virus infection.

    PubMed

    Lu, Yinping; Wang, Baoju; Huang, Hongping; Tian, Yongjun; Bao, Junjie; Dong, Jihua; Roggendorf, Michael; Lu, Mengji; Yang, Dongliang

    2008-01-01

    The interferon-alpha (IFN-alpha) gene family is an important part of the immune system. Recombinant interferon-alpha is widely used to treat viral hepatitis and malignant diseases. Marmota himalayana has been found to be susceptible to woodchuck hepatitis virus, a virus genetically related to hepatitis B virus (HBV), and is suitable as an animal model for studies on HBV infection. Here, the IFN-alpha gene family of M. himalayana (cwIFN-alpha) was characterized. Sequence data indicate that the cwIFN-alpha family consists of at least 8 functional sequences and 6 pseudogenes with high homology within the family and to IFN-alpha of Marmota monax, a related species and well-established animal model. The recombinant cwIFN-alpha subtypes were expressed and tested to be active in viral protection assay and to induce expression of MxA in a species-specific manner. This work provides essential information for future work on testing new therapeutic approaches of HBV infection based on IFN-alpha in M. himalayana.

  9. Alpha-1-adrenergic receptors in heart failure: the adaptive arm of the cardiac response to chronic catecholamine stimulation.

    PubMed

    Jensen, Brian C; OʼConnell, Timothy D; Simpson, Paul C

    2014-04-01

    Alpha-1-adrenergic receptors (ARs) are G protein-coupled receptors activated by catecholamines. The alpha-1A and alpha-1B subtypes are expressed in mouse and human myocardium, whereas the alpha-1D protein is found only in coronary arteries. There are far fewer alpha-1-ARs than beta-ARs in the nonfailing heart, but their abundance is maintained or increased in the setting of heart failure, which is characterized by pronounced chronic elevation of catecholamines and beta-AR dysfunction. Decades of evidence from gain and loss-of-function studies in isolated cardiac myocytes and numerous animal models demonstrate important adaptive functions for cardiac alpha-1-ARs to include physiological hypertrophy, positive inotropy, ischemic preconditioning, and protection from cell death. Clinical trial data indicate that blocking alpha-1-ARs is associated with incident heart failure in patients with hypertension. Collectively, these findings suggest that alpha-1-AR activation might mitigate the well-recognized toxic effects of beta-ARs in the hyperadrenergic setting of chronic heart failure. Thus, exogenous cardioselective activation of alpha-1-ARs might represent a novel and viable approach to the treatment of heart failure.

  10. Protective Coating

    NASA Technical Reports Server (NTRS)

    1984-01-01

    Inorganic Coatings, Inc.'s K-Zinc 531 protective coating is water-based non-toxic, non-flammable and has no organic emissions. High ratio silicate formula bonds to steel, and in 30 minutes, creates a very hard ceramic finish with superior adhesion and abrasion resistance. Improved technology allows application over a minimal commercial sandblast, fast drying in high humidity conditions and compatibility with both solvent and water-based topcoats. Coating is easy to apply and provides long term protection with a single application. Zinc rich coating with water-based potassium silicate binder offers cost advantages in materials, labor hours per application, and fewer applications over a given time span.

  11. Effects of interferon-alpha (IFN-alpha) administration on leucocytes in healthy humans.

    PubMed

    Corssmit, E P; Heijligenberg, R; Hack, C E; Endert, E; Sauerwein, H P; Romijn, J A

    1997-02-01

    Plasma concentrations of IFN-alpha are increased in several inflammatory conditions. Several lines of evidence indicate that IFN-alpha has anti-inflammatory properties. To study the effects of IFN-alpha on leucocyte subsets and activation and on cytokines, we administered IFN-alpha (rhIFN-alpha2b; 5 x 10(6) U/m2) to eight healthy human subjects in a randomized controlled cross-over study and analysed changes in circulating leucocytes and parameters for neutrophil and monocyte activation. After administration of IFN-alpha, neutrophil counts increased, monocyte counts decreased transiently, whereas the number of lymphocytes, basophils and eosinophils showed a sustained decrease. IFN-alpha administration was also associated with neutrophil activation, reflected in an increase in the plasma concentrations of elastase-alpha1-antitrypsin complexes and lactoferrin. Serum neopterin, a marker for monocyte activation, was significantly increased 10 h after administration of IFN-alpha. IFN-alpha significantly increased plasma concentrations of IL-6, IL-8 and IL-10. Although IL-1 and tumour necrosis factor (TNF) remained undetectable, plasma concentrations of soluble TNF receptors p55 and p75 increased after IFN-alpha administration. We conclude that IFN-alpha induces multiple alterations in the distribution and functional properties of leucocytes. IFN-alpha exerts pro- as well as anti-inflammatory effects within the cytokine network.

  12. Beta/alpha continuous air monitor

    DOEpatents

    Becker, G.K.; Martz, D.E.

    1988-06-27

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

  13. Beta/alpha continuous air monitor

    DOEpatents

    Becker, Gregory K.; Martz, Dowell E.

    1989-01-01

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinguishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts.

  14. Functional evidence equating the pharmacologically-defined alpha 1A- and cloned alpha 1C-adrenoceptor: studies in the isolated perfused kidney of rat.

    PubMed Central

    Blue, D. R.; Bonhaus, D. W.; Ford, A. P.; Pfister, J. R.; Sharif, N. A.; Shieh, I. A.; Vimont, R. L.; Williams, T. J.; Clarke, D. E.

    1995-01-01

    1. The present study characterizes and classifies alpha 1-adrenoceptor-mediated vasoconstriction in the isolated perfused kidney of rat using quantitative receptor pharmacology and compares the results to radioligand binding studies (made in cloned alpha 1-adrenoceptor subtypes, native alpha 1A-adrenoceptors in submaxillary gland of rat, and alpha 1A-adrenoceptors in several other tissues of rat). 2. Concentration-effect curves to noradrenaline in the presence of 5-methyl-urapidil were biphasic, indicating alpha 1-adrenoceptor heterogeneity. The alpha 1-adrenoceptor subtype mediating the first phase (low affinity for 5-methyl-urapidil) could not be 'isolated' for detailed pharmacological characterization but was defined by a sensitivity to inhibition by chloroethylclonidine and an inability of methoxamine to activate the site. Additionally, vasoconstriction mediated by this alpha 1-adrenoceptor subtype or subtypes was abolished by nitrendipine (1 microM), thereby allowing characterization of the second, high affinity site for 5-methyl-urapidil. 3. The following antagonists interacted competitively with noradrenaline at the alpha 1-adrenoceptor for which 5-methyl-urapidil exhibits high affinity (pKB value): WB 4101 (10.3) > prazosin (9.5) approximately HV 723 (9.3) approximately 5-methyl-urapidil (9.2) > phenotolamine (8.6) > spiperone (pA2 = 8.1) approximately oxymetazoline (7.9). In contrast, insurmountable antagonism was seen with S(+)- and R(-)-niguldipine, the S(+)-isomer being approximately 30 fold more potent than the R(-)-isomer. Receptor protection experiments indicated that S(+)-niguldipine interacted directly with alpha 1-adrenoceptors. Dehydroniguldipine acted as a competitive antagonist (pKB = 9.0). Thus, the results with antagonists define the alpha 1-adrenoceptor as an alpha 1A-adrenoceptor. 4. An agonist 'fingerprint' was constructed in the presence of nitrendipine to define further the alpha 1A-adrenoceptor. The following order and relativity of

  15. Alpha-2-Macroglobulin Is Acutely Sensitive to Freezing and Lyophilization: Implications for Structural and Functional Studies.

    PubMed

    Wyatt, Amy R; Kumita, Janet R; Farrawell, Natalie E; Dobson, Christopher M; Wilson, Mark R

    2015-01-01

    Alpha-2-macroglobulin is an abundant secreted protein that is of particular interest because of its diverse ligand binding profile and multifunctional nature, which includes roles as a protease inhibitor and as a molecular chaperone. The activities of alpha-2-macroglobulin are typically dependent on whether its conformation is native or transformed (i.e. adopts a more compact conformation after interactions with proteases or small nucleophiles), and are also influenced by dissociation of the native alpha-2-macroglobulin tetramer into stable dimers. Alpha-2-macroglobulin is predominately present as the native tetramer in vivo; once purified from human blood plasma, however, alpha-2-macroglobulin can undergo a number of conformational changes during storage, including transformation, aggregation or dissociation. We demonstrate that, particularly in the presence of sodium chloride or amine containing compounds, freezing and/or lyophilization of alpha-2-macroglobulin induces conformational changes with functional consequences. These conformational changes in alpha-2-macroglobulin are not always detected by standard native polyacrylamide gel electrophoresis, but can be measured using bisANS fluorescence assays. Increased surface hydrophobicity of alpha-2-macroglobulin, as assessed by bisANS fluorescence measurements, is accompanied by (i) reduced trypsin binding activity, (ii) increased chaperone activity, and (iii) increased binding to the surfaces of SH-SY5Y neurons, in part, via lipoprotein receptors. We show that sucrose (but not glycine) effectively protects native alpha-2-macroglobulin from denaturation during freezing and/or lyophilization, thereby providing a reproducible method for the handling and long-term storage of this protein. PMID:26103636

  16. Accelerated Alpha-s deterioration in a geostationary orbit

    NASA Technical Reports Server (NTRS)

    Husmann, O. K.

    1980-01-01

    Between the Teflon substrate and the interference filter a 2 micron varnish layer was sandwiched in. The bending radius of the SSM, measured on a cone, decreased from about 13 mm to 6 mm prior to interference filter fracture, due to increased tensile strength of its substrate. These samples, and for comparison samples of the same make but without varnish and a conductive layer were included in the test. Additionally 2 Teflon FEP samples without the protective interference filter, one of them with a conductive layer, were tested. The sample substrate was 125 micron Teflon FEP, with vapor deposited silver reflector and a thin Inconel film for corrosion protection.

  17. Hemoglobin Evanston (alpha 14 Trp----Arg). An unstable alpha-chain variant expressed as alpha-thalassemia.

    PubMed Central

    Honig, G R; Shamsuddin, M; Vida, L N; Mompoint, M; Valcourt, E; Bowie, L J; Jones, E C; Powers, P A; Spritz, R A; Guis, M

    1984-01-01

    A new hematologic syndrome with phenotypic features of mild Hb H disease was identified in three children from two unrelated black American families. Erythrocytes from each of these children contained Hb H (beta 4) and Hb Barts (gamma 4), as well as a slowly migrating hemoglobin fraction that made up 7-10% of the total hemoglobin. The parents of the affected children all showed mild thalassemia-like changes, with one of the parents in each family also expressing the variant hemoglobin; in the latter individuals the mutant alpha-chains made up less than 2% of the total, and were present mainly or exclusively in combination with delta-chains in the form of a slowly migrating Hb A2. Purified Hb Evanston showed an increased oxygen affinity, but its Bohr effect, cooperativity, and 2,3-diphosphoglycerate effect were normal. The mutant hemoglobin appeared to have normal stability to heat and to isopropanol, and the stability of its alpha-chain in an extended time course synthesis study also appeared to be similar to that of alpha A. However, the results from short-term globin synthesis studies, and from mRNA translation in vitro, suggest that the two types of alpha-chains were synthesized at relatively equal rates, with a major fraction of the newly synthesized variant alpha-chains undergoing rapid catabolism. The hematologic data taken in combination with DNA hybridization and globin synthesis findings indicate that the proposita in each of these families has the genotype--, alpha A/--, alpha Ev. These observations suggest that two separate mechanisms are contributing to the alpha-thalassemia-like expression of Hb Evanston : the newly synthesized alpha EV-chains are unstable and are subject to early proteolytic destruction; and the mutant alpha-allele is linked to an alpha-globin gene deletion. Images PMID:6725558

  18. Teaching calculus with Wolfram|Alpha

    NASA Astrophysics Data System (ADS)

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-12-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to Wolfram|Alpha in our differential and integral calculus labs, together with the positive results from our experience. We also discuss the current limitations of Wolfram|Alpha, including a discussion on why we still use a CAS for our multivariate calculus labs.

  19. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H

    1996-01-01

    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  20. Prospects for alpha particle studies on TFTR

    SciTech Connect

    Zweben, S.J.

    1987-05-01

    TFTR is expected to produce approximately 5 MW of alpha heating during the D/T Q approx. = 1 phase of operation in 1990. At that point the collective confinement properties and the heating effects of alpha particles become accessible for study for the first time. This paper outlines the potential performance of TFTR with respect to alpha particle production, the diagnostics which will be available for alpha particle measurements, and the physics issues which can be studied both before and during D/T operation.

  1. 5 alpha-reductase deficiency without hypospadias.

    PubMed Central

    Ng, W K; Taylor, N F; Hughes, I A; Taylor, J; Ransley, P G; Grant, D B

    1990-01-01

    A boy aged 4 with penoscrotal hypospadias and his brother aged 12 with micropenis had typical changes of homozygous 5 alpha-reductase deficiency. After three injections of chorionic gonadotrophin there was a trivial rise in plasma dihydrotestosterone with a normal increase in plasma testosterone. Urine steroid chromatography showed abnormally high 5 beta: 5 alpha ratios and 5 alpha-reductase activity was appreciably reduced in genital skin fibroblasts. The results indicate that 5 alpha-reductase deficiency is not invariably associated with genital ambiguity. PMID:2248513

  2. Elongation factor-1 alpha is a selective regulator of growth factor withdrawal and ER stress-induced apoptosis.

    PubMed

    Talapatra, S; Wagner, J D O; Thompson, C B

    2002-08-01

    To identify genes that contribute to apoptotic resistance, IL-3 dependent hematopoietic cells were transfected with a cDNA expression library and subjected to growth factor withdrawal. Transfected cells were enriched for survivors over two successive rounds of IL-3 withdrawal and reconstitution, resulting in the identification of a full-length elongation factor 1 alpha (EF-1alpha) cDNA. Ectopic EF-1alpha expression conferred protection from growth factor withdrawal and agents that induce endoplasmic reticulum stress, but not from nuclear damage or death receptor signaling. Overexpression of EF-1alpha did not lead to growth factor independent cell proliferation or global alterations in protein levels or rates of synthesis. These findings suggest that overexpression of EF-1alpha results in selective resistance to apoptosis induced by growth factor withdrawal and ER stress. PMID:12107828

  3. Alpha-tocopherol-doped irradiated UHMWPE for high fatigue resistance and low wear.

    PubMed

    Oral, Ebru; Wannomae, Keith K; Hawkins, Nathaniel; Harris, W H William H; Muratoglu, O K Orhun K

    2004-11-01

    Longevity of total joints has been compromised by wear and fatigue of ultrahigh molecular weight polyethylene (UHMWPE) components. Crosslinking reduces UHMWPE wear, but combined with postirradiation melting, also reduces its fatigue strength, therefore limiting its use in high-stress applications. We hypothesized that a lipophilic antioxidant (alpha-tocopherol, alpha-T) can protect UHMWPE against oxidation eliminating the need for postirradiation melting of crosslinked UHMWPE and improve its fatigue strength. To test these hypotheses, 65- and 100-kGy irradiated, alpha-T-doped and subsequently gamma-sterilized UHMWPE were used. (I) alpha-T-doped irradiated UHMWPEs showed significantly lower oxidation levels (0.48+/-0.25 and 0.44+/-0.06) compared to 100-kGy irradiated UHMWPE (3.74+/-0.16) after 5 weeks of accelerated aging at 80 degrees C in air. (II) Wear rate of alpha-T-doped irradiated UHMWPE (1.9+/-0.5, and 0.9+/-0.1mg/million cycles (MC) for 65- and 100-kGy irradiated UHMWPE, respectively) were comparable to that of 100-kGy irradiated/melted UHMWPE (1.1+/-0.7mg/million cycles). (III) The stress intensity factor at crack inception ( DeltaKi) of 100-kGy irradiated UHMWPE increased significantly upon doping with alpha-T from 0.74 to 0.87MPam(1/2) ( p<0.01 ). The DeltaKi for the 100-kGy irradiated and melted UHMWPE, currently in clinical use, was 0.55MPam(1/2). Doping with alpha-T eliminated the need for postirradiation melting to protect irradiated UHMWPE against long-term oxidation. The fatigue strength was improved by 58% for alpha-T-doped 100-kGy irradiated UHMWPE compared to irradiated and melted UHMWPE. The increase in oxidative stability of alpha-T-doped UHMWPE is attributed to the ability of alpha-T to react with peroxy free radicals on lipid chains and arrest the oxidation reactions. The improved fatigue strength is attributed to the increase in plasticity of UHMWPE due to the lipophilic nature of alpha-T.

  4. The E3 Ubiquitin Ligase- and Protein Phosphatase 2A (PP2A)-binding Domains of the Alpha4 Protein Are Both Required for Alpha4 to Inhibit PP2A Degradation

    SciTech Connect

    LeNoue-Newton, Michele; Watkins, Guy R.; Zou, Ping; Germane, Katherine L.; McCorvey, Lisa R.; Wadzinski, Brian E.; Spiller, Benjamin W.

    2012-04-30

    Protein phosphatase 2A (PP2A) is regulated through a variety of mechanisms, including post-translational modifications and association with regulatory proteins. Alpha4 is one such regulatory protein that binds the PP2A catalytic subunit (PP2Ac) and protects it from polyubiquitination and degradation. Alpha4 is a multidomain protein with a C-terminal domain that binds Mid1, a putative E3 ubiquitin ligase, and an N-terminal domain containing the PP2Ac-binding site. In this work, we present the structure of the N-terminal domain of mammalian Alpha4 determined by x-ray crystallography and use double electron-electron resonance spectroscopy to show that it is a flexible tetratricopeptide repeat-like protein. Structurally, Alpha4 differs from its yeast homolog, Tap42, in two important ways: (1) the position of the helix containing the PP2Ac-binding residues is in a more open conformation, showing flexibility in this region; and (2) Alpha4 contains a ubiquitin-interacting motif. The effects of wild-type and mutant Alpha4 on PP2Ac ubiquitination and stability were examined in mammalian cells by performing tandem ubiquitin-binding entity precipitations and cycloheximide chase experiments. Our results reveal that both the C-terminal Mid1-binding domain and the PP2Ac-binding determinants are required for Alpha4-mediated protection of PP2Ac from polyubiquitination and degradation.

  5. Eye Protection

    PubMed Central

    Pashby, Tom

    1986-01-01

    Eye injuries frequently occur in the home, at work and at play. Many result in legally blind eyes, and most are preventable. Awareness of potential hazards is essential to preventing eye injuries, particularly in children. In addition, protective devices must be used appropriately. We have developed eye protectors that have proved effective in reducing both the overall incidence and the severity of sports eye injuries. ImagesFigures 2a, bFigure 3Figures 4a, b, c, dFigure 5 PMID:21267100

  6. Protecting Antarctica

    NASA Astrophysics Data System (ADS)

    Carlowicz, Michael

    House Science Committee Chairman Robert Walker (R-Pa.) has introduced a bill into Congress to give the United States the legislative authority to implement the 1991 Environmental Protocol to the Antarctic Treaty. That protocol established rules and principles to shield the Antarctic environment from human spoilage—placing limits on the discharge of pollutants, protecting plant and animal life, and requiring environmental impact assessments before new activities and programs are launched. The protocol also forbids prospecting or developing of mineral resources except for scientific research.

  7. Distinct chaperone mechanisms can delay the formation of aggresomes by the myopathy-causing R120G alphaB-crystallin mutant.

    PubMed

    Chávez Zobel, Aura T; Loranger, Anne; Marceau, Normand; Thériault, Jimmy R; Lambert, Herman; Landry, Jacques

    2003-07-01

    A familial form of desmin-related myopathy (DRM) is associated with a missense mutation (R120G) in alphaB-crystallin (alphaB) and is characterized by intracellular desmin aggregation. Because alphaB is a molecular chaperone that participates in the assembly of desmin filaments, it has been suggested that the desmin aggregation might be due to the loss of alphaB function. We report here that alphaBR120G has indeed impaired in vivo function and structure as reflected by a highly reduced capacity to protect cells against heat shock and by an abnormal supramolecular organization even in cells not expressing desmin. In many cells, alphaBR120G accumulated in inclusion bodies that had characteristics of aggresomes concentrating around the centrosome following a microtubule-facilitated process. Three distinct chaperone mechanisms could reduce or even prevent the formation of the alphaBR120G aggresomes. Wild-type alphaB and Hsp27 prevented aggresome formation by co-oligomerizing with alphaBR120G. Hsp70 with its co-chaperone Hdj-1 or Chip-1 but not a mutant of Chip-1 lacking ubiquitin ligase activity, reduced the frequency of aggresome formation likely by targeting alphaBR120G for degradation. Finally, HspB8 interacted only transiently with alphaB but nonetheless rescued the alphaBR120G oligomeric organization, suggesting that it acted as a true chaperone assisting in the folding of the mutant protein. Hence, the formation of inclusion bodies in alphaBR120G-mediated DRM is probably due to the misfolding of alphaBR120G per se and can be delayed or prevented by expression of the wild type alphaB allele or other molecular chaperones, thereby explaining the adult onset of the disease.

  8. Synthesis of anticholinergic agents: N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate salts.

    PubMed

    Oroshnik, W; Soldati, G

    1978-05-01

    The synthesis of a new anticholinergic agent, N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate, obtained by reacting N-methyl-4-piperidinyl alpha-cyclopentylmandelate with benzoyl chloride in the presence of methyllithium, is reported. This material may be useful as an antiperspirant.

  9. Resting-State Alpha in Autism Spectrum Disorder and Alpha Associations with Thalamic Volume

    ERIC Educational Resources Information Center

    Edgar, J. Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D.; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M.; Qasmieh, Saba; Levy, Susan E.; Schultz, Robert T.; Roberts, Timothy P. L.

    2015-01-01

    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha…

  10. The local skin dose conversion coefficients of electrons, protons and alpha particles calculated using the Geant4 code.

    PubMed

    Zhang, Bintuan; Dang, Bingrong; Wang, Zhuanzi; Wei, Wei; Li, Wenjian

    2013-10-01

    The skin tissue-equivalent slab reported in the International Commission on Radiological Protection (ICRP) Publication 116 to calculate the localised skin dose conversion coefficients (LSDCCs) was adopted into the Monte Carlo transport code Geant4. The Geant4 code was then utilised for computation of LSDCCs due to a circular parallel beam of monoenergetic electrons, protons and alpha particles <10 MeV. The computed LSDCCs for both electrons and alpha particles are found to be in good agreement with the results using the MCNPX code of ICRP 116 data. The present work thus validates the LSDCC values for both electrons and alpha particles using the Geant4 code.

  11. Prophylactic and therapeutic effects of a monoclonal antibody to tumor necrosis factor-alpha in experimental gram-negative shock.

    PubMed

    Silva, A T; Bayston, K F; Cohen, J

    1990-08-01

    A monoclonal antibody to recombinant murine tumor necrosis factor-alpha (TNF alpha), TN3-19.12, was used to explore pathogenetic mechanisms and therapeutic strategies in gram-negative shock. In mice receiving an LD90 dose of Escherichia coli O111, TN3-19.12 prevented death if given 1.5 h before or 30 min after challenge. Less protection was conferred if the antibody was given 2.5 h after challenge. In control mice receiving an irrelevant antibody, L2-3D9, TNF alpha levels rose (less than or equal to 185.1 +/- 26.1 ng/ml) by 90 min and had returned to baseline by 5 h. Mice receiving TN3-19.12 did not have this response. TN3-19.12 was of limited benefit in mice receiving Pseudomonas aeruginosa but had no protective effect in cyclophosphamide-treated mice receiving Klebsiella pneumoniae. In L2-3D9-treated mice, TNF alpha levels were elevated to 61.8 +/- 27.9 and 49.7 +/- 5.1 ng/ml by 90 min in the two models, respectively. TNF alpha levels in TN3-19.12-treated mice in these two models were very low (3.9-5.5 ng/ml). TNF alpha is a mediator in gram-negative shock; antibody to TNF alpha can be of value in prophylaxis and treatment, but its clinical use remains to be established.

  12. IL-1 alpha beta blockade prevents cartilage and bone destruction in murine type II collagen-induced arthritis, whereas TNF-alpha blockade only ameliorates joint inflammation.

    PubMed

    Joosten, L A; Helsen, M M; Saxne, T; van De Loo, F A; Heinegard, D; van Den Berg, W B

    1999-11-01

    Anti-TNF-alpha treatment of rheumatoid arthritis patients markedly suppresses inflammatory disease activity, but so far no tissue-protective effects have been reported. In contrast, blockade of IL-1 in rheumatoid arthritis patients, by an IL-1 receptor antagonist, was only moderately effective in suppressing inflammatory symptoms but appeared to reduce the rate of progression of joint destruction. We therefore used an established collagen II murine arthritis model (collagen-induced arthritis(CIA)) to study effects on joint structures of neutralization of either TNF-alpha or IL-1. Both soluble TNF binding protein and anti-IL-1 treatment ameliorated disease activity when applied shortly after onset of CIA. Serum analysis revealed that early anti-TNF-alpha treatment of CIA did not decrease the process in the cartilage, as indicated by the elevated COMP levels. In contrast, anti-IL-1 treatment of established CIA normalized COMP levels, apparently alleviating the process in the tissue. Histology of knee and ankle joints corroborated the finding and showed that cartilage and joint destruction was significantly decreased after anti-IL-1 treatment but was hardly affected by anti-TNF-alpha treatment. Radiographic analysis of knee and ankle joints revealed that bone erosions were prevented by anti-IL-1 treatment, whereas the anti-TNF-alpha-treated animals exhibited changes comparable to the controls. In line with these findings, metalloproteinase activity, visualized by VDIPEN production, was almost absent throughout the cartilage layers in anti-IL-1-treated animals, whereas massive VDIPEN appearance was found in control and sTNFbp-treated mice. These results indicate that blocking of IL-1 is a cartilage- and bone-protective therapy in destructive arthritis, whereas the TNF-alpha antagonist has little effect on tissue destruction.

  13. High-alpha space trucks

    SciTech Connect

    Cook, L.M.; Ball, J.

    1997-01-01

    Vertically-landing Reusable Launch Vehicles (RLVs) are the best hope of building a true {open_quotes}Space Truck{close_quotes} with current technology. Because they do not require a low angle-of-attack (AOA, or alpha) horizontal landing, they can be designed to operate exclusively at very high angles-of-attack. This offers savings in vehicle dry weight and complexity, which can be traded for significantly heavier payload, more ascent velocity, or extra design margin. The price for abandoning low angle-of-attack flight is reduced crossrange. To quantify the potential weight reduction, a trade study was performed to determine the relationship between a vehicle{close_quote}s maximum crossrange (angle-of-attack) and it{close_quote}s dry weight (payload margin). At the study conclusion, three vertically-landing (VL) vehicles provided multiple points on a payload weight vs. maximum crossrange curve, showing significant payload increases as crossrange is sacrificed. This is primarily the result of being able to simplify the structure, fly a cooler entry trajectory, and be aerodynamically stable through the entire flight. This reduces subsystem requirements and complexity, enhancing reliability. Further benefits are realized in reduced landing propellant requirements and simplifying or eliminating the {open_quotes}rotation{close_quotes} maneuver. This paper also suggests unique operability solutions that adapt high-alpha vehicles to traditional high-crossrange missions such as the polar {open_quotes}once-around{close_quotes} flight, and proposes a small scale drop-test program to prove the subsonic and landing portion of the flight envelope. {copyright} {ital 1997 American Institute of Physics.}

  14. Analysis of the local kinetics and localization of interleukin-1 alpha, tumour necrosis factor-alpha and transforming growth factor-beta, during the course of experimental pulmonary tuberculosis.

    PubMed Central

    Hernandez-Pando, R; Orozco, H; Arriaga, K; Sampieri, A; Larriva-Sahd, J; Madrid-Marina, V

    1997-01-01

    became large, vacuolated foamy cells, and containing numerous bacilli with immunoreactivity to mycobacterial lipids and lipoarabinomannan (LAM). These macrophages displayed poor and scarce TNF-alpha and IL-1 alpha immunostaining but still strong immunoreactivity to TGF-beta. These cytokine production kinetics and the spatial relationship between immunostained cells and lung lesions corroborate the important role of TNF-alpha and IL-1 alpha in the constitution of granulomas and immune protection during the early phase of the infection, and also suggest an important if not primary role for TGF-beta in the immunopathogenesis of the advanced forms of pulmonary tuberculosis. Images Figure 1 Figure 4 Figure 5 PMID:9176116

  15. Arrangements of alpha-globin gene cluster in Taiwan.

    PubMed

    Peng, H W; Choo, K B; Ho, C H; Yen, M S; Liung, W Y; Lin, C K; Yang, Z L; Ng, H T; Ching, K N; Han, S H

    1989-01-01

    In a gene mapping study on 217 newborn babies in Taiwan with alpha- and zeta-globin probes, we have observed 4 cases (1.84%) of alpha-thalassemia-2 heterozygotes (zeta zeta-alpha/zeta zeta alpha alpha) without increased levels of hemoglobin (Hb) Bart's in the cord blood. Eleven subjects (5.07%) were found to have the South East Asian alpha-thalassemia-1 haplotype (zeta zeta--SEA/zeta zeta alpha alpha) with increased Hb Bart's levels ranging from 2.2 to 9%. One case, with Hb Bart's level of 14% in the cord blood, was found to have the genotype of zeta zeta--SEA/zeta zeta alpha alpha T (0.46%). Four heterozygotes (1.84%) were found with the triple alpha gene anti-rightward arrangement (zeta zeta alpha alpha alpha 3.7/zeta zeta alpha alpha). Twenty-one heterozygotes (9.68%) were found to have the triple zeta-globin gene arrangement (zeta zeta zeta alpha alpha/zeta zeta alpha alpha). A new triple zeta-globin gene variant with a BamHI polymorphism was also observed in this study.

  16. Alpha Biofeedback Conditioning and Retarded Subjects.

    ERIC Educational Resources Information Center

    Martin, Walter; And Others

    1981-01-01

    An experimental group of three institutionalized severely retarded adult males received binary tone feedback for alpha production while a control group (3) followed identical procedures without feedback. Analysis revealed significant difference between groups in alpha percentage increase over baseline, encouraging research on applications for…

  17. Elementary Processes Underlying Alpha Channeling in Tokamaks

    SciTech Connect

    NM.J. Fisch

    2012-06-15

    Alpha channeling in tokamaks is speculative, but also extraordinarily attractive. Waves that can accomplish this effect have been identified. Key aspects of the theory now enjoy experimental confirmation. This paper will review the elementary processes of wave-particle interactions in plasma that underlie the alpha channeling effect

  18. Alpha-1 Antitrypsin Deficiency (Inherited Emphysema)

    MedlinePlus

    ... 1 protein in the blood with normal alpha-1 antitrypsin from healthy plasma donors. It is given in a vein (IV). The dose is adjusted based on body weight. This treatment is often given once a week. There are three ... the management of Alpha-1 related emphysema includes: • Exercise and a healthy lifestyle ...

  19. Psychiatric Symptoms in Alpha-Mannosidosis

    ERIC Educational Resources Information Center

    Malm, D.; Pantel, J.; Linaker, O. M.

    2005-01-01

    Alpha-mannosidosis is characterized by mild to moderate intellectual disability (ID), moderate to severe neurosensory hearing loss, frequent infections, psychomotor disturbances and skeletal dysmorphism. For the first time, a panel of nine alpha-mannosidosis patients with psychiatric symptoms is presented. The clinical picture has several…

  20. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  1. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  2. Remote Associates Test and Alpha Brain Waves

    ERIC Educational Resources Information Center

    Haarmann, Henk J.; George, Timothy; Smaliy, Alexei; Dien, Joseph

    2012-01-01

    Previous studies found that performance on the remote associates test (RAT) improves after a period of incubation and that increased alpha brain waves over the right posterior brain predict the emergence of RAT insight solutions. We report an experiment that tested whether increased alpha brain waves during incubation improve RAT performance.…

  3. Atypical Alpha Asymmetry in Adults with ADHD

    ERIC Educational Resources Information Center

    Hale, T. Sigi; Smalley, Susan L.; Hanada, Grant; Macion, James; McCracken, James T.; McGough, James J.; Loo, Sandra K.

    2009-01-01

    Introduction: A growing body of literature suggests atypical cerebral asymmetry and interhemispheric interaction in ADHD. A common means of assessing lateralized brain function in clinical populations has been to examine the relative proportion of EEG alpha activity (8-12 Hz) in each hemisphere (i.e., alpha asymmetry). Increased rightward alpha…

  4. Commentary on Coefficient Alpha: A Cautionary Tale

    ERIC Educational Resources Information Center

    Green, Samuel B.; Yang, Yanyun

    2009-01-01

    The general use of coefficient alpha to assess reliability should be discouraged on a number of grounds. The assumptions underlying coefficient alpha are unlikely to hold in practice, and violation of these assumptions can result in nontrivial negative or positive bias. Structural equation modeling was discussed as an informative process both to…

  5. Teaching Calculus with Wolfram|Alpha

    ERIC Educational Resources Information Center

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-01-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to…

  6. Coefficient Alpha Bootstrap Confidence Interval under Nonnormality

    ERIC Educational Resources Information Center

    Padilla, Miguel A.; Divers, Jasmin; Newton, Matthew

    2012-01-01

    Three different bootstrap methods for estimating confidence intervals (CIs) for coefficient alpha were investigated. In addition, the bootstrap methods were compared with the most promising coefficient alpha CI estimation methods reported in the literature. The CI methods were assessed through a Monte Carlo simulation utilizing conditions…

  7. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  8. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  9. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  10. Inhibitory spectrum of alpha 2-plasmin inhibitor.

    PubMed

    Saito, H; Goldsmith, G H; Moroi, M; Aoki, N

    1979-04-01

    alpha 2-Plasmin inhibitor (alpha 2PI) has been recently characterized as a fast-reacting inhibitor of plasmin in human plasma and appears to play an important role in the regulation of fibrinolysis in vivo. We have studied the effect of purified alpha 2PI upon various proteases participating in human blood coagulation and kinin generation. At physiological concentration (50 microgram/ml), alpha 2PI inhibited the clot-promoting and prekallikrein-activating activity of Hageman factor fragments, the amidolytic, kininogenase, and clot-promoting activities of plasma kallikrein, and the clot-promoting properties of activated plasma thromboplastin antecedent (PTA, Factor XIa) and thrombin. alpha 2PI had minimal inhibitory effect on surface-bound activated PTA and activated Stuart factor (Factor Xa). alpha 2PI did not inhibit the activity of activated Christmas factor (Factor IXa) or urinary kallikrein. Heparin (1.5-2.0 units/ml) did not enhance the inhibitory function of alpha 2PI. These results suggest that, like other plasma protease inhibitors, alpha 2PI possesses a broad in vitro spectrum of inhibitory properties.

  11. Total alpha-tocopherol intakes are associated with serum alpha-tocopherol concentrations in African American adults.

    PubMed

    Talegawkar, Sameera A; Johnson, Elizabeth J; Carithers, Teresa; Taylor, Herman A; Bogle, Margaret L; Tucker, Katherine L

    2007-10-01

    African Americans in the southern United States have a high prevalence of chronic disease. Tocopherol intake and status have been associated with protection against several chronic diseases. Our objectives were, therefore, to examine the association between tocopherol intakes as measured by 2 regional FFQ and their corresponding concentrations in serum and to report on dietary sources of tocopherols in 404 men and women participating in the cross-sectional Diet and Physical Activity Sub-Study of the Jackson Heart Study. A large proportion (49% of men and 66% of women) reported dietary supplement use. Only 5.8% of men and 4.5% of women met the estimated average requirement (EAR) for vitamin E from foods alone, whereas 44.2% men and 49.2% women met it from foods and supplements. Total (diet + supplement) intake of alpha-tocopherol was associated with its corresponding measure in serum. Vitamin E supplement use, sex, serum cholesterol, education, and BMI, but not gamma-tocopherol intakes, were associated with serum gamma-tocopherol. For delta-tocopherol, associated variables included sex and serum cholesterol. The top food sources of alpha- and gamma-tocopherol were snack chips and the top food source of delta-tocopherol was margarine. Despite prevalent vitamin E supplement use, more than one-half of this population did not meet the EAR for alpha-tocopherol intake and very few met it from food alone. Supplement use was associated with higher alpha- but lower gamma-tocopherol concentration in serum. The possible health implications of this difference in relative tocopherol subtypes require further study. PMID:17885014

  12. DNA-binding specificity of the Lon protease alpha-domain from Brevibacillus thermoruber WR-249.

    PubMed

    Lin, Yu-Ching; Lee, Huai-Cheng; Wang, Iren; Hsu, Chun-Hua; Liao, Jiahn-Haur; Lee, Alan Yueh-Luen; Chen, Chinpan; Wu, Shih-Hsiung

    2009-10-01

    Lon protease has been well studied in many aspects; however, the DNA-binding specificity of Lon in prokaryotes has not been clearly identified. Here we examined the DNA-binding activity of Lon protease alpha-domains from Brevibacillus thermoruber (Bt), Bacillus subtilis (Bs), and Escherichia coli (Ec). MALDI-TOF mass spectroscopy showed that the alpha-domain from Bt-Lon binds to the duplex nucleotide sequence 5'-CTGTTAGCGGGC-3' (ms1) and protected it from DNase I digestion. Surface plasmon resonance showed that the Bt-Lon alpha-domain binds with ms1 double-stranded DNA tighter than Bs- and Ec-Lon alpha-domains, whereas the Bt-Lon alpha-domain has dramatically lower affinity for double-stranded DNA with 0 and 50% identity to the ms1 binding sequence. Our results indicated that Bt-Lon alpha-domain plays a critical role with ms1 sequence in the DNA-binding specificity.

  13. Suppression of hepatic prostaglandin F2 alpha in rats by dietary alpha-tocopherol acetate is independent of total hepatic alpha-tocopherol.

    PubMed

    Duitsman, P K; Chen, H W; Cook, L R; Hendrich, S

    1992-09-01

    Groups of eight weanling female F344/N rats were fed semipurified diets that supplied 0, 50, 500, 5000, or 15,000 mg alpha-tocopherol acetate/kg diet, with and without 0.05% phenobarbital (PB) for 9 weeks. Both plasma and hepatic alpha-tocopherol levels, measured by HPLC, strongly correlated with alpha-tocopherol intake (r greater than 0.73, p less than 0.0001). Phenobarbital both depleted hepatic alpha-tocopherol and increased plasma alpha-tocopherol significantly. Although treatment with PB for 9 weeks significantly increased GST activity, PB did not affect hepatic prostaglandin (PG)F2 alpha status, as determined by radioimmunoassay. PGF2 alpha was significantly greater (by 52%) in rats fed no alpha-tocopherol than in rats fed 15,000 mg alpha-tocopherol acetate/kg diet. Hepatic PGF2 alpha status was correlated inversely but weakly with dietary alpha-tocopherol (r = -0.24, p less than 0.05). Hepatic PGF2 alpha status was not correlated with hepatic or plasma alpha-tocopherol status. This finding suggests either that there is a small depletion-resistant subcellular alpha-tocopherol pool which regulates PGF2 alpha production or that alpha-tocopherol alters PGF2 alpha production in vivo by an indirect mechanism.

  14. Local Structure and Vibrational Properties of alpha-Pu, alpha-U, and the alpha-U Charge Density Wave

    SciTech Connect

    Nelson, E J; Allen, P G; Blobaum, K M; Wall, M A; Booth, C H

    2004-08-10

    The local atomic environment and vibrational properties of atoms in monoclinic pure {alpha}-plutonium as well as orthorhombic pure {alpha}-uranium and its low-temperature charge-density-wave (CDW) modulation are examined by extended x-ray absorption fine structure spectroscopy (EXAFS). Pu L{sub III}-edge and U L{sub III}-edge EXAFS data measured at low temperatures verify the crystal structures of {alpha}-U and {alpha}-Pu samples previously determined by x-ray diffraction and neutron scattering. Debye-Waller factors from temperature-dependent EXAFS measurements are fit with a correlated Debye model. The observed Pu-Pu bond correlated Debye temperature of {theta}{sub cD}({alpha}-Pu) = 162 {+-} 5 K for the pure {alpha}-Pu phase agrees with our previous measurement of the correlated Debye temperature of the gallium-containing {alpha}'-Pu phase in a mixed phase 1.9 at% Ga-doped {alpha}'-Pu/{delta}-Pu alloy. The temperature dependence of the U-U nearest neighbor Debye-Waller factor exhibits a sharp discontinuity in slope near T{sub CDW} = 43 K, the transition temperature at which the charge-density wave (CDW) in {alpha}-U condenses from a soft phonon mode along the (100) direction. Our measurement of the CDW using EXAFS is the first observation of the structure of the CDW in polycrystalline {alpha}-U. The different temperature dependence of the Debye-Waller factor for T < T{sub CDW} can be modeled by the change in bond length distributions resulting from condensation of the charge density wave. For T > T{sub CDW}, the observed correlated Debye temperature of {theta}{sub cD}({alpha}-U) = 199 {+-} 3 K is in good agreement with other measurements of the Debye temperature for polycrystalline {alpha}-U. CDW structural models fit to the {alpha}-U EXAFS data support a squared CDW at the lowest temperatures, with a displacement amplitude of {var_epsilon} = 0.05 {+-} 0.02 {angstrom}.

  15. Improved peak shape fitting in alpha spectra.

    PubMed

    Pommé, S; Caro Marroyo, B

    2015-02-01

    Peak overlap is a recurrent issue in alpha-particle spectrometry, not only in routine analyses but also in the high-resolution spectra from which reference values for alpha emission probabilities are derived. In this work, improved peak shape formulae are presented for the deconvolution of alpha-particle spectra. They have been implemented as fit functions in a spreadsheet application and optimum fit parameters were searched with built-in optimisation routines. Deconvolution results are shown for a few challenging spectra with high statistical precision. The algorithm outperforms the best available routines for high-resolution spectrometry, which may facilitate a more reliable determination of alpha emission probabilities in the future. It is also applicable to alpha spectra with inferior energy resolution. PMID:25497323

  16. Homomers of alpha 8 and alpha 7 subunits of nicotinic receptors exhibit similar channel but contrasting binding site properties.

    PubMed

    Gerzanich, V; Anand, R; Lindstrom, J

    1994-02-01

    alpha 8 subunits of alpha-bungarotoxin-sensitive chick neuronal nicotinic acetylcholine receptors expressed in Xenopus oocytes from cRNA are shown to form homomeric, acetylcholine-gated, rapidly desensitizing, inwardly rectifying, Ca(2+)-permeable cation channels similar to those of alpha 7 homomers. alpha 8 forms oligomers of several sizes, of which < 14% are expressed on the oocyte surface, which is less efficient than for alpha 7 homomers. alpha 8 homomers are more sensitive to agonists but less sensitive to antagonists than are alpha 7 homomers, and some agonists for alpha 8 homomers are partial agonists or antagonists for alpha 7 homomers. The pharmacological properties of homomers of alpha 8 and alpha 7 subunits generally reflect those of native alpha 8 and alpha 7 receptors.

  17. Effects of alpha-tocopherol on cadmium-induced toxicity in rat testis and spermatogenesis.

    PubMed

    Yang, Hoe Saeng; Han, Dong Keun; Kim, Jung Ran; Sim, Jae Chul

    2006-06-01

    Cadmium is known to exert toxic effects on multiple organs, including the testes. To determine if alpha-tocopherol, an antioxidant, could protect testicular tissues and spermatogenesis from the toxic effects of cadmium, six-week old male Sprague-Dawley rats were randomized to receive cadmium at doses of 0 (control), 1, 2, 4 or 8 mg/kg by the intraperitoneal route (Group A) or alpha-tocopherol for 5 days before being challenged with cadmium (Group B) in an identical dose-dependent manner. When both groups received cadmium at 1 mg/kg, there were no changes in testicular histology relative to controls. When Group A received cadmium at 2 mg/kg, undifferentiated spermatids and dead Sertoli cells increased in the seminiferous tubules while interstitial cells decreased and inflammatory cells increased in the interstitial tissues. On flow cytometric analysis, the numbers of elongated spermatids (M1) and round spermatids (M2) decreased while 2c stage cells (M3, diploid) increased. In contrast, when Group B received cadmium at 2 mg/kg, the histological insults were reduced and the distribution of the germ cell population remained comparable to controls. However, alpha-tocopherol had no protective effects with higher cadmium doses of 4 and 8 mg/kg. These findings indicate that alpha-tocopherol treatment can protect testicular tissue and preserve spermatogenesis from the detrimental effects of cadmium but its effectiveness is dependent on the dose of cadmium exposed. PMID:16778387

  18. Protective Coatings

    NASA Technical Reports Server (NTRS)

    1980-01-01

    General Magnaplate Corporation's pharmaceutical machine is used in the industry for high speed pressing of pills and capsules. Machine is automatic system for molding glycerine suppositories. These machines are typical of many types of drug production and packaging equipment whose metal parts are treated with space spinoff coatings that promote general machine efficiency and contribute to compliance with stringent federal sanitation codes for pharmaceutical manufacture. Collectively known as "synergistic" coatings, these dry lubricants are bonded to a variety of metals to form an extremely hard slippery surface with long lasting self lubrication. The coatings offer multiple advantages; they cannot chip, peel or be rubbed off. They protect machine parts from corrosion and wear longer, lowering maintenance cost and reduce undesired heat caused by power-robbing friction.

  19. Catalytic Mechanism of Human Alpha-galactosidase

    SciTech Connect

    Guce, A.; Clark, N; Salgado, E; Ivanen, D; Kulinskaya, A; Brumer, H; Garman, S

    2010-01-01

    The enzyme {alpha}-galactosidase ({alpha}-GAL, also known as {alpha}-GAL A; E.C. 3.2.1.22) is responsible for the breakdown of {alpha}-galactosides in the lysosome. Defects in human {alpha}-GAL lead to the development of Fabry disease, a lysosomal storage disorder characterized by the buildup of {alpha}-galactosylated substrates in the tissues. {alpha}-GAL is an active target of clinical research: there are currently two treatment options for Fabry disease, recombinant enzyme replacement therapy (approved in the United States in 2003) and pharmacological chaperone therapy (currently in clinical trials). Previously, we have reported the structure of human {alpha}-GAL, which revealed the overall structure of the enzyme and established the locations of hundreds of mutations that lead to the development of Fabry disease. Here, we describe the catalytic mechanism of the enzyme derived from x-ray crystal structures of each of the four stages of the double displacement reaction mechanism. Use of a difluoro-{alpha}-galactopyranoside allowed trapping of a covalent intermediate. The ensemble of structures reveals distortion of the ligand into a {sup 1}S{sub 3} skew (or twist) boat conformation in the middle of the reaction cycle. The high resolution structures of each step in the catalytic cycle will allow for improved drug design efforts on {alpha}-GAL and other glycoside hydrolase family 27 enzymes by developing ligands that specifically target different states of the catalytic cycle. Additionally, the structures revealed a second ligand-binding site suitable for targeting by novel pharmacological chaperones.

  20. Sumoylation and the function of CCAAT enhancer binding protein alpha (C/EBP alpha).

    PubMed

    Khanna-Gupta, Arati

    2008-01-01

    CCAAT enhancer binding protein alpha (C/EBP alpha) is the founding member of a family of basic region/leucine zipper (bZIP) transcription factors and is a master regulator of granulopoiesis. It is expressed at high levels throughout myeloid differentiation and binds to the promoters of multiple myeloid-specific genes at different stages of myeloid maturation. Profound hematopoietic abnormalities occur in mice nullizygous for C/EBP alpha including a selective early block in the differentiation of granulocytes. Mutations in C/EBP alpha are present in a subset of patients with AML presenting with a normal karyotype. These mutations can result in the expression of a 30 kDa dominant negative C/EBP alpha isoform, which contributes to loss of C/EBP alpha function. The molecular basis for this observation remains unknown. In addition to phosphorylation, C/EBP alpha is modified, post-translationally by a small ubiquitin-related modifier (SUMO) at a lysine residue (K159), which lies within the growth inhibitory region of the C/EBP alpha protein. Sumoylation at K159 in the C/EBP alpha protein prevents association of the SWI/SNF chromatin remodeling complex with C/EBP alpha, thereby hampering transactivation. In this review, the functional implications of post-translational modification, particularly sumoylation, of C/EBP alpha in normal granulopoiesis and leukemia are considered. PMID:18406180

  1. Folate receptor {alpha} regulates cell proliferation in mouse gonadotroph {alpha}T3-1 cells

    SciTech Connect

    Yao, Congjun; Evans, Chheng-Orn; Stevens, Victoria L.; Owens, Timothy R.; Oyesiku, Nelson M.

    2009-11-01

    We have previously found that the mRNA and protein levels of the folate receptor alpha (FR{alpha}) are uniquely over-expressed in clinically human nonfunctional (NF) pituitary adenomas, but the mechanistic role of FR{alpha} has not fully been determined. We investigated the effect of FR{alpha} over-expression in the mouse gonadotroph {alpha}T3-1 cell line as a model for NF pituitary adenomas. We found that the expression and function of FR{alpha} were strongly up-regulated, by Western blotting and folic acid binding assay. Furthermore, we found a higher cell growth rate, an enhanced percentage of cells in S-phase by BrdU assay, and a higher PCNA staining. These observations indicate that over-expression of FR{alpha} promotes cell proliferation. These effects were abrogated in the same {alpha}T3-1 cells when transfected with a mutant FR{alpha} cDNA that confers a dominant-negative phenotype by inhibiting folic acid binding. Finally, by real-time quantitative PCR, we found that mRNA expression of NOTCH3 was up-regulated in FR{alpha} over-expressing cells. In summary, our data suggests that FR{alpha} regulates pituitary tumor cell proliferation and mechanistically may involve the NOTCH pathway. Potentially, this finding could be exploited to develop new, innovative molecular targeted treatment for human NF pituitary adenomas.

  2. Alpha1 and Alpha2 Integrins Mediate Invasive Activity of Mouse Mammary Carcinoma Cells through Regulation of Stromelysin-1 Expression

    SciTech Connect

    Lochter, Andre; Navre, Marc; Werb, Zena; Bissell, Mina J

    1998-06-29

    Tumor cell invasion relies on cell migration and extracellular matrix proteolysis. We investigated the contribution of different integrins to the invasive activity of mouse mammary carcinoma cells. Antibodies against integrin subunits {alpha}6 and {beta}1, but not against {alpha}1 and {alpha}2, inhibited cell locomotion on a reconstituted basement membrane in two-dimensional cell migration assays, whereas antibodies against {beta}1, but not against a6 or {alpha}2, interfered with cell adhesion to basement membrane constituents. Blocking antibodies against {alpha}1 integrins impaired only cell adhesion to type IV collagen. Antibodies against {alpha}1, {alpha}2, {alpha}6, and {beta}1, but not {alpha}5, integrin subunits reduced invasion of a reconstituted basement membrane. Integrins {alpha}1 and {alpha}2, which contributed only marginally to motility and adhesion, regulated proteinase production. Antibodies against {alpha}1 and {alpha}2, but not {alpha}6 and {beta}1, integrin subunits inhibited both transcription and protein expression of the matrix metalloproteinase stromelysin-1. Inhibition of tumor cell invasion by antibodies against {alpha}1 and {alpha}2 was reversed by addition of recombinant stromelysin-1. In contrast, stromelysin-1 could not rescue invasion inhibited by anti-{alpha}6 antibodies. Our data indicate that {alpha}1 and {alpha}2 integrins confer invasive behavior by regulating stromelysin-1 expression, whereas {alpha}6 integrins regulate cell motility. These results provide new insights into the specific functions of integrins during tumor cell invasion.

  3. Identification of a putative alpha-glucan synthase essential for cell wall construction and morphogenesis in fission yeast

    PubMed Central

    Hochstenbach, Frans; Klis, Frans M.; van den Ende, Herman; van Donselaar, Elly; Peters, Peter J.; Klausner, Richard D.

    1998-01-01

    The cell wall protects fungi against lysis and determines their cell shape. Alpha-glucan is a major carbohydrate component of the fungal cell wall, but its function is unknown and its synthase has remained elusive. Here, we describe a fission yeast gene, ags1+, which encodes a putative alpha-glucan synthase. In contrast to the structure of other carbohydrate polymer synthases, the predicted Ags1 protein consists of two probable catalytic domains for alpha-glucan assembly, namely an intracellular domain for alpha-glucan synthesis and an extracellular domain speculated to cross-link or remodel alpha-glucan. In addition, the predicted Ags1 protein contains a multipass transmembrane domain that might contribute to transport of alpha-glucan across the membrane. Loss of Ags1p function in a temperature-sensitive mutant results in cell lysis, whereas mutant cells grown at the semipermissive temperature contain decreased levels of cell wall alpha-glucan and fail to maintain rod shapes, causing rounding of the cells. These findings demonstrate that alpha-glucan is essential for fission yeast morphogenesis. PMID:9689051

  4. G alpha 12 and G alpha 13 subunits define a fourth class of G protein alpha subunits.

    PubMed Central

    Strathmann, M P; Simon, M I

    1991-01-01

    Heterotrimeric guanine nucleotide-binding regulatory proteins (G proteins) are central to the signaling processes of multicellular organisms. We have explored the diversity of the G protein subunits in mammals and found evidence for a large family of genes that encode the alpha subunits. Amino acid sequence comparisons show that the different alpha subunits fall into at least three classes. These classes have been conserved in animals separated by considerable evolutionary distances; they are present in mammals, Drosophila, and nematodes. We have now obtained cDNA clones encoding two murine alpha subunits, G alpha 12 and G alpha 13, that define a fourth class. The translation products are predicted to have molecular masses of 44 kDa and to be insensitive to ADP-ribosylation by pertussis toxin. They share 67% amino acid sequence identity with each other and less than 45% identity with other alpha subunits. Their transcripts can be detected in every tissue examined, although the relative levels of the G alpha 13 message appear somewhat variable. Images PMID:1905812

  5. Sensitivity to alpha-amylcinnamic aldehyde and alpha-amylcinnamic alcohol.

    PubMed

    Guin, J D; Haffley, P

    1983-01-01

    Sensitivity to alpha-amylcinnamic aldehyde (alpha-AcAld) is apparently uncommon, but, like allergy to alpha-amylcinnamic alcohol (alpha-AcAlc), it often accompanies allergy to the perfume in Mycolog cream. Although alpha-AcAlc is a known ingredient, alpha-AcAld is not. However, gas-liquid chromatographic analysis shows alpha-AcAld to be present. Of fourteen persons sensitive to either chemical, ten reacted to both. Of these, one man and three women were markedly sensitive, and all three women had chronic recalcitrant vulvar eczema. That condition might have been the cause as well as the result of sensitization, but reexposure to a suspected product reproduced the eruption in both persons tested. Its use with other potent sensitizers, e.g., ethylenediamine, to treat irritations and chronic eczemas in an area of high absorption may partly explain development of allergy to a relatively weak sensitizer.

  6. Effect of UVB on hydrolysis of alpha-tocopherol acetate to alpha-tocopherol in mouse skin.

    PubMed

    Kramer-Stickland, K; Liebler, D C

    1998-08-01

    We have assessed the hydrolysis of alpha-tocopherol acetate (alpha-TAc) to the active antioxidant alpha-tocopherol (alpha-TH) in mouse epidermis and in supernatant from epidermal homogenates. Topically administered alpha-TH prevents UVB photocarcinogenesis in C3H mice, whereas alpha-TAc does not. Hydrolysis in skin was monitored in mice treated topically with deuterium labeled alpha-TAc (d3-alpha-TAc). Epidermal samples were isolated from mice and analyzed for endogenous (d0-alpha-TAc) and d3-alpha-TH by gas chromatography-mass spectrometry. Within 24 h, the levels of d3-alpha-TH increased up to 10-fold over endogenous d0-alpha-TH levels; however, in mice irradiated with UVB prior to the application of d3-alpha-TAc, levels of d3-alpha-TH increased up to 30-40-fold over endogenous d0-alpha-TH. This enhancement of alpha-TAc hydrolysis increased with increasing UVB dose. Prior UVB exposure may increase hydrolysis of alpha-TAc by increasing epidermal esterase activity. Nonspecific esterase activity was measured in the 2000 x g supernatant from epidermis of unirradiated and irradiated mice. Alpha-napthyl acetate, a nonspecific esterase substrate, was converted to alpha-napthol in supernatants from unirradiated mice. Hydrolysis to alpha-napthol increased approximately 3-fold in supernatants from irradiated mice. Hydrolysis of alpha-TAc to alpha-TH also occurred in supernatant from unirradiated mice, and this hydrolysis increased approximately 3-fold in supernatant from irradiated animals. These data indicate that nonspecific esterase activity was increased by UVB in the skin, that alpha-TAc is converted to alpha-TH in the homogenate fraction containing nonspecific esterase, and that UVB exposure modulates the metabolism of alpha-TAc to alpha-TH in vivo.

  7. Modulation of Type 1 Diabetes Susceptibility by Tumor Necrosis Factor Alpha −308 G/A and Lymphotoxin Alpha +249 A/G Haplotypes and Lack of Linkage Disequilibrium with Predisposing DQB1-DRB1 Haplotypes in Bahraini Patients▿

    PubMed Central

    Stayoussef, Mouna; Al-Jenaidi, Fayza A.; Al-Abbasi, Abduljabbar; Al-Ola, Khadija; Khayyat, Haya; Mahjoub, Touhami; Almawi, Wassim Y.

    2008-01-01

    Tumor necrosis factor alpha (TNF-α) −308 G/A and lymphotoxin alpha (LTα) +249 A/G single-nucleotide polymorphisms were investigated in 228 type 1 diabetes mellitus (T1DM) patients and 240 controls. Only LTα +249G allele and +249G/+249G genotype frequencies were higher among patients, and no linkage disequilibrium was found between TNF-α/LTα alleles and susceptible/protective DRB1-DQB1 haplotypes. TNF-α/LTα T1DM-susceptible (−308G/+249G) and protective (−308G/+249A) haplotypes were identified. PMID:17989340

  8. eIF2alpha phosphorylation tips the balance to apoptosis during osmotic stress.

    PubMed

    Bevilacqua, Elena; Wang, Xinglong; Majumder, Mithu; Gaccioli, Francesca; Yuan, Celvie L; Wang, Chuanping; Zhu, Xiongwei; Jordan, Lindsay E; Scheuner, Donalyn; Kaufman, Randal J; Koromilas, Antonis E; Snider, Martin D; Holcik, Martin; Hatzoglou, Maria

    2010-05-28

    Regulation of cell volume is of great importance because persistent swelling or shrinkage leads to cell death. Tissues experience hypertonicity in both physiological (kidney medullar cells) and pathological states (hypernatremia). Hypertonicity induces an adaptive gene expression program that leads to cell volume recovery or apoptosis under persistent stress. We show that the commitment to apoptosis is controlled by phosphorylation of the translation initiation factor eIF2alpha, the master regulator of the stress response. Studies with cultured mouse fibroblasts and cortical neurons show that mutants deficient in eIF2alpha phosphorylation are protected from hypertonicity-induced apoptosis. A novel link is revealed between eIF2alpha phosphorylation and the subcellular distribution of the RNA-binding protein heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1). Stress-induced phosphorylation of eIF2alpha promotes apoptosis by inducing the cytoplasmic accumulation of hnRNP A1, which attenuates internal ribosome entry site-mediated translation of anti-apoptotic mRNAs, including Bcl-xL that was studied here. Hypertonic stress induced the eIF2alpha phosphorylation-independent formation of cytoplasmic stress granules (SGs, structures that harbor translationally arrested mRNAs) and the eIF2alpha phosphorylation-dependent accumulation of hnRNP A1 in SGs. The importance of hnRNP A1 was demonstrated by induction of apoptosis in eIF2alpha phosphorylation-deficient cells that express exogenous cytoplasmic hnRNP A1. We propose that eIF2alpha phosphorylation during hypertonic stress promotes apoptosis by sequestration of specific mRNAs in SGs in a process mediated by the cytoplasmic accumulation of hnRNP A1. PMID:20338999

  9. Mapping High-Velocity H-alpha and Lyman-alpha Emission from Supernova 1987A

    NASA Technical Reports Server (NTRS)

    France, Kevin; McCray, Richard; Fransson, Claes; Larsson, Josefin; Frank, Kari A.; Burrows, David N.; Challis, Peter; Kirshner, Robert P.; Chevalier, Roger A.; Garnavich, Peter; Heng, Kevin; Lawrence, Stephen S.; Lundqvist, Peter; Smith, Nathan; Sonneborn, George

    2015-01-01

    We present new Hubble Space Telescope images of high-velocity H-alpha and Lyman-alpha emission in the outer debris of SN 1987A. The H-alpha images are dominated by emission from hydrogen atoms crossing the reverse shock. For the first time we observe emission from the reverse shock surface well above and below the equatorial ring, suggesting a bipolar or conical structure perpendicular to the ring plane. Using the H-alpha imaging, we measure the mass flux of hydrogen atoms crossing the reverse shock front, in the velocity intervals (-7,500 < V(sub obs) < -2,800 km/s) and (1,000 < V(sub obs) < 7,500 km/s), ?M(sub H) = 1.2 × 10(exp -3) M/ y. We also present the first Lyman-alpha imaging of the whole remnant and new Chandra X-ray observations. Comparing the spatial distribution of the Lyman-alpha and X-ray emission, we observe that the majority of the high-velocity Lyman-alpha emission originates interior to the equatorial ring. The observed Lyman-alpha/H-alpha photon ratio, R(L-alpha/H-alpha) approx. = 17, is significantly higher than the theoretically predicted ratio of approx. = 5 for neutral atoms crossing the reverse shock front. We attribute this excess to Lyman-alpha emission produced by X-ray heating of the outer debris. The spatial orientation of the Lyman-alpha and X-ray emission suggests that X-ray heating of the outer debris is the dominant Lyman-alpha production mechanism in SN 1987A at this phase in its evolution.

  10. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].

    PubMed

    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo

    2004-10-01

    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples.

  11. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].

    PubMed

    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo

    2004-10-01

    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples. PMID:15678944

  12. Nordihydroguaiaretic acid protects against high-fat diet-induced fatty liver by activating AMP-activated protein kinase in obese mice

    SciTech Connect

    Lee, Myoung-Su; Kim, Daeyoung; Jo, Keunae; Hwang, Jae-Kwan

    2010-10-08

    Research highlights: {yields} NDGA decreases high-fat diet-induced body weight gain and adiposity. {yields} NDGA reduces high-fat diet-induced triglyceride accumulation in liver. {yields} NDGA improves lipid storage in vitro through altering lipid regulatory proteins. {yields} Inhibition of lipid storage in vivo and in vitro is mediated by AMPK activation. -- Abstract: Nonalcoholic fatty liver disease, one of the most common causes of chronic liver disease, is strongly associated with metabolic syndrome. Nordihydroguaiaretic acid (NDGA) has been reported to inhibit lipoprotein lipase; however, the effect of NDGA on hepatic lipid metabolism remains unclear. We evaluated body weight, adiposity, liver histology, and hepatic triglyceride content in high-fat diet (HFD)-fed C57BL/6J mice treated with NDGA. In addition, we characterized the underlying mechanism of NDGA's effects in HepG2 hepatocytes by Western blot and RT-PCR analysis. NDGA (100 or 200 mg/kg/day) reduced weight gain, fat pad mass, and hepatic triglyceride accumulation, and improved serum lipid parameters in mice fed a HFD for 8 weeks. NDGA significantly increased AMP-activated protein kinase (AMPK) phosphorylation in the liver and in HepG2 hepatocytes. NDGA downregulated the level of mature SREBP-1 and its target genes (acetyl-CoA carboxylase and fatty acid synthase), but, it upregulated expression of genes involved in fatty acid oxidation, such as peroxisome proliferator-activated receptor (PPAR){alpha}, PPAR{gamma} coactivator-1, carnitine palmitoyl transferase-1, and uncoupling protein-2. The specific AMPK inhibitor compound C attenuated the effects of NDGA on expression of lipid metabolism-related proteins in HepG2 hepatocytes. The beneficial effects of NDGA on HFD-induced hepatic triglyceride accumulation are mediated through AMPK signaling pathways, suggesting a potential target for preventing NAFLD.

  13. A new alpha chain hemoglobin variant: Hb Al-Hammadi Riyadh [alpha75(EF4)Asp-->Val (alpha2)].

    PubMed

    Burnichon, Nelly; Lacan, Philippe; Becchi, Michel; Zanella-Cleon, Isabelle; Aubry, Martine; Mowafy, Mohammed; Couprie, Nicole; Francina, Alain

    2006-01-01

    A new hemoglobin (Hb) variant in the heterozygous state, Hb Al-Hammadi Riyadh [codon 75 (GAC-->GTC); alpha75(EF4)Asp-->Val (alpha2)] corresponding to an A-->T transversion on the second exon of the alpha2-globin gene, is described. The variant was characterized by DNA sequencing and mass spectrometry (MS). The variant was found during a routine Hb analysis for anemia in a 16-month-old boy who lived in Riyadh, Kingdom of Saudi Arabia.

  14. Genetics Home Reference: mucolipidosis III alpha/beta

    MedlinePlus

    ... Health Conditions mucolipidosis III alpha/beta mucolipidosis III alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis III alpha/beta is a slowly progressive disorder that affects ...

  15. Genetics Home Reference: mucolipidosis II alpha/beta

    MedlinePlus

    ... Health Conditions mucolipidosis II alpha/beta mucolipidosis II alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis II alpha/beta (also known as I-cell disease) is ...

  16. 24xi-Methyl 5 alpha-cholestane-3 alpha,6 beta,9 alpha,25-tetrol 24-monoacetate, a novel polyhydroxylated steroid from the soft coral Sarcophyton tortuosum.

    PubMed

    Su, J Y; Peng, T S; Long, K H; Zeng, L M

    1986-01-01

    A novel polyhydroxylated steroid, named sartortuosterol A, with rare 3 alpha- and 6-hydroxyl groups, was isolated from the South China Sea soft coral Sarcophyton tortuosum Tixier-Durivault, and its structure was established as 24xi-methyl 5 alpha-cholestane-3 alpha, 6 beta, 9 alpha,25-tetrol 25-monoacetate from spectroscopic data and chemical conversions.

  17. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed. PMID:7162915

  18. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed.

  19. Applying alpha-channeling to mirror machines

    SciTech Connect

    Zhmoginov, A. I.; Fisch, N. J.

    2012-05-15

    The {alpha}-channeling effect entails the use of radio-frequency waves to expel and cool high-energetic {alpha} particles born in a fusion reactor; the device reactivity can then be increased even further by redirecting the extracted energy to fuel ions. Originally proposed for tokamaks, this technique has also been shown to benefit open-ended fusion devices. Here, the fundamental theory and practical aspects of {alpha} channeling in mirror machines are reviewed, including the influence of magnetic field inhomogeneity and the effect of a finite wave region on the {alpha}-channeling mechanism. For practical implementation of the {alpha}-channeling effect in mirror geometry, suitable contained weakly damped modes are identified. In addition, the parameter space of candidate waves for implementing the {alpha}-channeling effect can be significantly extended through the introduction of a suitable minority ion species that has the catalytic effect of moderating the transfer of power from the {alpha}-channeling wave to the fuel ions.

  20. Lyman alpha radiation in external galaxies

    NASA Technical Reports Server (NTRS)

    Neufeld, David A.; Mckee, Christopher F.

    1990-01-01

    The Ly alpha line of atomic hydrogen is often a luminous component of the radiation emitted by distant galaxies. Except for those galaxies which have a substantial central source of non-stellar ionizing radiation, most of the Ly alpha radiation emitted by galaxies is generated within regions of the interstellar medium which are photoionized by starlight. Conversely, much of the energy radiated by photoionized regions is carried by the Ly alpha line. Only hot, massive stars are capable of ionizing hydrogen in the interstellar medium which surrounds them, and because such stars are necessarily short-lived, Ly alpha emission traces regions of active star formation. Researchers argue that the strength of the Ly alpha emission observed from external galaxies may be used to estimate quantitatively the dust content of the emitting region, while the Ly alpha line profile is sensitive to the presence of shock waves. Interstellar dust particles and shock waves are intimately associated with the process of star formation in two senses. First, both dust particles and shock waves owe their existence to stellar activity; second, they may both serve as agents which facilitate the formation of stars, shocks by triggering gravitational instabilities in the interstellar gas that they compress, and dust by shielding star-forming molecular clouds from the ionizing and dissociative effects of external UV radiation. By using Ly alpha observations as a probe of the dust content in diffuse gas at high redshift, we might hope to learn about the earliest epochs of star formation.