Science.gov

Sample records for alpha radiation influencia

  1. Lyman alpha radiation in external galaxies

    NASA Technical Reports Server (NTRS)

    Neufeld, David A.; Mckee, Christopher F.

    1990-01-01

    The Ly alpha line of atomic hydrogen is often a luminous component of the radiation emitted by distant galaxies. Except for those galaxies which have a substantial central source of non-stellar ionizing radiation, most of the Ly alpha radiation emitted by galaxies is generated within regions of the interstellar medium which are photoionized by starlight. Conversely, much of the energy radiated by photoionized regions is carried by the Ly alpha line. Only hot, massive stars are capable of ionizing hydrogen in the interstellar medium which surrounds them, and because such stars are necessarily short-lived, Ly alpha emission traces regions of active star formation. Researchers argue that the strength of the Ly alpha emission observed from external galaxies may be used to estimate quantitatively the dust content of the emitting region, while the Ly alpha line profile is sensitive to the presence of shock waves. Interstellar dust particles and shock waves are intimately associated with the process of star formation in two senses. First, both dust particles and shock waves owe their existence to stellar activity; second, they may both serve as agents which facilitate the formation of stars, shocks by triggering gravitational instabilities in the interstellar gas that they compress, and dust by shielding star-forming molecular clouds from the ionizing and dissociative effects of external UV radiation. By using Ly alpha observations as a probe of the dust content in diffuse gas at high redshift, we might hope to learn about the earliest epochs of star formation.

  2. Alpha-beta radiation detector

    DOEpatents

    Fleming, D.M.; Simmons, K.L.; Froelich, T.J.; Carter, G.L.

    1998-08-18

    The invention is based in part on the discovery that a plastic housing that is lightweight is surprisingly efficient inasmuch as background signals from any gamma radiation are significantly reduced by using a plastic housing instead of a metal housing. A further aspect of the present invention is the profile of the housing as a bi-linear approximation to a parabola resulting in full optical response from any location on the scintillation material to the photomultiplier tube. A yet further aspect of the present invention is that the survey probe is resistant to magnetic fields. A yet further aspect of the present invention is the use of a snap-fit retaining bracket that overcomes the need for multiple screws. 16 figs.

  3. Alpha-beta radiation detector

    DOEpatents

    Fleming, Dale M.; Simmons, Kevin L.; Froelich, Thomas J.; Carter, Gregory L.

    1998-01-01

    The invention is based in part on the discovery that a plastic housing that is lightweight is surprisingly efficient inasmuch as background signals from any gamma radiation are significantly reduced by using a plastic housing instead of a metal housing. A further aspect of the present invention is the profile of the housing as a bi-linear approximation to a parabola resulting in full optical response from any location on the scintillation material to the photomultiplier tube. A yet further aspect of the present invention is that the survey probe is resistant to magnetic fields. A yet further aspect of the present invention is the use of a snap-fit retaining bracket that overcomes the need for multiple screws.

  4. Standoff alpha radiation detection via excited state absorption of air

    SciTech Connect

    Yao, Jimmy; Yin, Stuart Shizhuo; Brenizer, Jack; Hui, Rongqing

    2013-06-24

    A standoff alpha radiation detection technique based on the physical mechanism of excited state absorption of air molecules was explored and is presented in this paper. Instead of directly detecting the radiation via measuring the intensity of radiation induced air fluorescence, the radiation is detected via the excited state absorption of alpha radiation excited/ionized air molecules. Both theoretical analyses and experimental verifications were conducted. The experimental results confirmed that the radiation could be detected via excited state absorption of radiation excited/ionized air molecules at a 10 m standoff distance, which was consistent with the theoretical analyses.

  5. A High-Throughput Screen for Alpha Particle Radiation Protectants

    PubMed Central

    Seideman, Jonathan H.; Shum, David; Djaballah, Hakim

    2010-01-01

    Abstract Alpha-particle-emitting elements are of increasing importance as environmental and occupational carcinogens, toxic components of radiation dispersal devices and accidents, and potent therapeutics in oncology. Alpha particle radiation differs from radiations of lower linear energy transfer in that it predominantly damages DNA via direct action. Because of this, radical scavengers effective for other radiations have had only limited effect in mitigating alpha particle toxicity. We describe here a simple assay and a pilot screen of 3,119 compounds in a high-throughput screen (HTS), using the alpha-particle-emitting isotope, 225Ac, for the discovery of compounds that might protect mammalian cells from alpha particles through novel mechanisms. The assay, which monitored the viability of a myeloid leukemic cell line upon alpha particle exposure, was robust and reproducible, yielding a Z' factor of 0.66 and a signal-to-noise ratio of nearly 10 to 1. Surprisingly, 1 compound emerged from this screen, epoxy-4,5-α-dihydroxysantonin (EDHS), that showed considerable protective activity. While the value of EDHS remains to be determined, its discovery is a proof of concept and validation of the utility of this HTS methodology. Further application of the described assay could yield compounds useful in minimizing the toxicity and carcinogenesis associated with alpha particle exposure. PMID:20658946

  6. Quasiclassical description of bremsstrahlung accompanying {alpha} decay including quadrupole radiation

    SciTech Connect

    Jentschura, U. D.; Milstein, A. I.; Terekhov, I. S.; Boie, H.; Scheit, H.; Schwalm, D.

    2008-01-15

    We present a quasiclassical theory of {alpha} decay accompanied by bremsstrahlung with a special emphasis on the case of {sup 210}Po, with the aim of finding a unified description that incorporates both the radiation during the tunneling through the Coulomb wall and the finite energy E{sub {gamma}} of the radiated photon up to E{sub {gamma}}{approx}Q{sub {alpha}}/{radical}({eta}), where Q{sub {alpha}} is the {alpha}-decay Q-value and {eta} is the Sommerfeld parameter. The corrections with respect to previous quasiclassical investigations are found to be substantial, and excellent agreement with a full quantum mechanical treatment is achieved. Furthermore, we find that a dipole-quadrupole interference significantly changes the {alpha}-{gamma} angular correlation. We obtain good agreement between our theoretical predictions and experimental results.

  7. Detection of alpha radiation in a beta radiation field

    DOEpatents

    Mohagheghi, Amir H.; Reese, Robert P.

    2001-01-01

    An apparatus and method for detecting alpha particles in the presence of high activities of beta particles utilizing an alpha spectrometer. The apparatus of the present invention utilizes a magnetic field applied around the sample in an alpha spectrometer to deflect the beta particles from the sample prior to reaching the detector, thus permitting detection of low concentrations of alpha particles. In the method of the invention, the strength of magnetic field required to adequately deflect the beta particles and permit alpha particle detection is given by an algorithm that controls the field strength as a function of sample beta energy and the distance of the sample to the detector.

  8. Radiation risks from inhaled alpha emitters

    NASA Astrophysics Data System (ADS)

    Simmons, Jack A.

    2001-06-01

    The alpha emitter that gives rise to the greatest concern over its link to the induction of lung cancer is radon. As noted by the ICRP, attempts to relate the risk of cancer induction to the dose delivered by the alpha particles result in a value for this risk which is unrealistically high. Instead, an estimate based on the epidemiology of radon in mines is preferred. The logical result, that the weighting factor for these alpha particles should be very much lesser than the recommended value of 20, appears to have been ignored. It will be shown that there are two fundamental reasons for this large discrepancy. The first is that the implied "linear non-threshold" hypothesis is not supported by recent investigations. The second is that the concept of "dose" is meaningless at the levels of exposure considered in this context. Alternative proposals in terms of fluence and the effect cross-section will be presented.

  9. Apparatus for detecting alpha radiation in difficult access areas

    DOEpatents

    Steadman, P.; MacArthur, D.W.

    1997-09-02

    An electrostatic alpha radiation detector for measuring alpha radiation emitted from inside an enclosure comprising an electrically conductive expandable electrode for insertion into the enclosure is disclosed. After insertion, the electrically conductive expandable electrode is insulated from the enclosure and defines a decay cavity between the electrically conductive expandable electrode and the enclosure so that air ions generated in the decay cavity are electrostatically captured by the electrically conductive expandable electrode and the enclosure when an electric potential is applied between the electrically conductive expandable electrode and the enclosure. Indicator means are attached to the electrically conductive expandable electrode for indicating an electrical current produced by generation of the air ions generated in the decay cavity by collisions between air molecules and the alpha particles emitted from the enclosure. A voltage source is connected between the indicator means and the electrically conductive enclosure for creating an electric field between the electrically conductive expandable electrode and the enclosure. 4 figs.

  10. Apparatus for detecting alpha radiation in difficult access areas

    DOEpatents

    Steadman, Peter; MacArthur, Duncan W.

    1997-09-02

    An electrostatic alpha radiation detector for measuring alpha radiation emitted from inside an enclosure comprising an electrically conductive expandable electrode for insertion into the enclosure. After insertion, the electrically conductive expandable electrode is insulated from the enclosure and defines a decay cavity between the electrically conductive expandable electrode and the enclosure so that air ions generated in the decay cavity are electrostatically captured by the electrically conductive expandable electrode and the enclosure when an electric potential is applied between the electrically conductive expandable electrode and the enclosure. Indicator means are attached to the electrically conductive expandable electrode for indicating an electrical current produced by generation of the air ions generated in the decay cavity by collisions between air molecules and the alpha particles emitted from the enclosure. A voltage source is connected between the indicator means and the electrically conductive enclosure for creating an electric field between the electrically conductive expandable electrode and the enclosure.

  11. Increased tumor necrosis factor alpha mRNA after cellular exposure to ionizing radiation.

    PubMed Central

    Hallahan, D E; Spriggs, D R; Beckett, M A; Kufe, D W; Weichselbaum, R R

    1989-01-01

    We report that tumor necrosis factor alpha (TNF-alpha) mRNA is increased after treatment with x-rays in certain human sarcoma cells. An increase in TNF-alpha mRNA is accompanied by the increased production of TNF-alpha protein. TNF-alpha enhances radiation lethality in both TNF-alpha-producing and -nonproducing tumor cells. These data suggest that, in addition to the direct cytotoxic effects of x-rays, production of TNF-alpha may add to radiation lethality through autocrine and paracrine mechanisms. Combinations of TNF-alpha and therapeutic radiation may be useful in clinical cancer therapy. Images PMID:2602359

  12. Radiation cross-linking of ethylene vinyl alcohol copolymer functionalized with m-isopropenyl-{alpha},{alpha}-dimethyl benzyl isocyanate

    SciTech Connect

    Ekman, K.B.; Naesman, J.H.

    1993-12-31

    In order to allow radiation cross-linking at low radiation doses, pendant unsaturation was introduced by reactive processing of ethylene vinyl alcohol copolymer and m-isopropenyl-{alpha},{alpha}-dimethyl benzyl isocyanate. Oxygen permeability of ethylene vinyl alcohol copolymer decreased with increasing degree of functionalization, while irradiation of the samples form trapped radicals, which act as oxygen scavengers and consequently no oxygen permeability was detected. However, radical activity was inhibited by annealing the samples at 110{degrees}C for 2.5 h, resulting in a 24% higher oxygen permeability value for the irradiated unfunctionalized copolymer, while the oxygen permeability values of the irradiated functionalized samples were 13% lower. Laminates, of m-isopropenyl-{alpha},{alpha}-dimethyl benzyl isocyanate functionalized ethylene vinyl alcohol copolymer and m-isopropenyl-{alpha},{alpha}-dimethyl benzyl isocyanate functionalized ethylene hydroxyethyl methacrylate copolymer acquired improved adhesive strength both at dry and wet conditions as well as at elevated temperatures upon exposure to radiation.

  13. Enhanced homologous recombination is induced by alpha-particle radiation in somatic cells of Arabidopsis thaliana

    NASA Astrophysics Data System (ADS)

    Bian, Po; Liu, Ping; Wu, Yuejin

    Almost 9 percent of cosmic rays which strike the earth's atmosphere are alpha particles. As one of the ionizing radiations (IR), its biological effects have been widely studied. However, the plant genomic instability induced by alpha-particle radiation was not largely known. In this research, the Arabidopsis thaliana transgenic for GUS recombination substrate was used to evaluate the genomic instability induced by alpha-particle radiation (3.3MeV). The pronounced effects of systemic exposure to alpha-particle radiation on the somatic homologous recombination frequency (HRF) were found at different doses. The 10Gy dose of radiation induced the maximal HRF which was 1.9-fold higher than the control. The local radiation of alpha-particle (10Gy) on root also resulted in a 2.5-fold increase of somatic HRF in non-radiated aerial plant, indicating that the signal(s) of genomic instability was transferred to non-radiated parts and initiated their genomic instability. Concurrent treatment of seedlings of Arabidopsis thaliana with alpha-particle and DMSO(ROS scavenger) both in systemic and local radiation signifi- cantly suppressed the somatic HR, indicating that the free radicals produced by alpha-particle radiation took part in the production of signal of genomic instability rather than the signal transfer. Key words: alpha-particle radiation, somatic homologous recombination, genomic instability

  14. A novel nanometric DNA thin film as a sensor for alpha radiation

    NASA Astrophysics Data System (ADS)

    Kulkarni, Atul; Kim, Byeonghoon; Dugasani, Sreekantha Reddy; Joshirao, Pranav; Kim, Jang Ah; Vyas, Chirag; Manchanda, Vijay; Kim, Taesung; Park, Sung Ha

    2013-06-01

    The unexpected nuclear accidents have provided a challenge for scientists and engineers to develop sensitive detectors, especially for alpha radiation. Due to the high linear energy transfer value, sensors designed to detect such radiation require placement in close proximity to the radiation source. Here we report the morphological changes and optical responses of artificially designed DNA thin films in response to exposure to alpha radiation as observed by an atomic force microscope, a Raman and a reflectance spectroscopes. In addition, we discuss the feasibility of a DNA thin film as a radiation sensing material. The effect of alpha radiation exposure on the DNA thin film was evaluated as a function of distance from an 241Am source and exposure time. Significant reflected intensity changes of the exposed DNA thin film suggest that a thin film made of biomolecules can be one of promising candidates for the development of online radiation sensors.

  15. A novel nanometric DNA thin film as a sensor for alpha radiation

    PubMed Central

    Kulkarni, Atul; Kim, Byeonghoon; Dugasani, Sreekantha Reddy; Joshirao, Pranav; Kim, Jang Ah; Vyas, Chirag; Manchanda, Vijay; Kim, Taesung; Park, Sung Ha

    2013-01-01

    The unexpected nuclear accidents have provided a challenge for scientists and engineers to develop sensitive detectors, especially for alpha radiation. Due to the high linear energy transfer value, sensors designed to detect such radiation require placement in close proximity to the radiation source. Here we report the morphological changes and optical responses of artificially designed DNA thin films in response to exposure to alpha radiation as observed by an atomic force microscope, a Raman and a reflectance spectroscopes. In addition, we discuss the feasibility of a DNA thin film as a radiation sensing material. The effect of alpha radiation exposure on the DNA thin film was evaluated as a function of distance from an 241Am source and exposure time. Significant reflected intensity changes of the exposed DNA thin film suggest that a thin film made of biomolecules can be one of promising candidates for the development of online radiation sensors. PMID:23792924

  16. Alpha radiation effects on weapons-grade plutonium encapsulating materials

    NASA Astrophysics Data System (ADS)

    Saglam, Mehmet

    The scientific understanding of material problems in the long-term storage of plutonium pits is investigated using experimental and theoretical models. The durability of the plutonium pit depends on the integrity of the metal cladding that encapsulates the plutonium. Given sufficient time, the energetic alpha particles (helium nuclei) produced by nuclear decay of the plutonium would degrade the mechanical strength of the metal cladding which could lead to cladding failure and dispersion of plutonium. It is shown that the long-term behavior of the encapsulating materials can be simulated by beam implantation and subsequent analysis using experimental techniques of Electron Microscopy and Neutron Depth Profiling (NDP). In addition computer simulations using the TRIM code were made in order to correlate the measurements to cladding damage. The Neutron Depth Profiling measurements done with samples that had 10 16 cm-2 3He beam implant dose showed no helium redistribution, indicating no microcracking between bubbles, for both beryllium and stainless steel, the pit cladding materials of interest. However, helium redistribution and significant helium loss were observed for samples with a beam implant dose of 1018 cm-2 , indicating microstructural damage. The SEM observations were consistent with the NDP measurements. The proper interpretation of the results rests on the realization that (i)the deleterious effects are related to helium concentration, not implant dose, and (ii)a specified maximum concentration of helium is achieved with a much smaller dose when monoenergetic ions are implanted using beam geometry than for the situation where Pu alphas stop in the pit cladding. Helium is distributed over a much smaller depth interval for beam implantation of monoenergetic ions as compared to the pit cladding implanted ions. Taking this effect into account and using the calculated pit implant dose gives a pit storage time for the 1016 cm-2 beam implant dose results equal to

  17. Evaluation of pGL1-TNF-alpha therapy in combination with radiation

    NASA Technical Reports Server (NTRS)

    Li, J.; Andres, M. L.; Fodor, I.; Nelson, G. A.; Gridley, D. S.

    1998-01-01

    Long-term control of high-grade brain tumors is rarely achieved with current therapeutic regimens. In this study a new plasmid-based human tumor necrosis factor-alpha (TNF-alpha) expression vector was synthesized (pGL1-TNF-alpha) and evaluated together with radiation in the aggressive, rapidly growing C6 rat glioma model. pGL1-TNF-alpha was successfully transfected into C6 cells in vitro using a cationic polyamine method. Expression was detected up to 7 days and averaged 0.4 ng of TNF-alpha in the culture medium from 1x10(5) cells. The expressed protein was biologically functional, as evidenced by growth inhibition of L929, a TNF-alpha-susceptible cell line. Using fluorescence-labeled monoclonal antibodies and laser scanning cytometry, we confirmed that both the P55 and P75 receptors for TNF-alpha were present on the C6 cell membrane. However, the receptors were present at low density and P55 was expressed more than the P75 receptor. These findings were in contrast to results obtained with TNF-alpha-susceptible L929 cells. Tests in athymic mice showed that pGL1-TNF-alpha administered intratumorally 16-18 h before radiation (each modality given three times) significantly inhibited C6 tumor progression (P<0.05). This effect was more than additive, because pGL1-TNF-alpha alone did not slow tumor growth and radiation alone had little effect on tumor growth. These results indicate that pGL1-TNF-alpha has potential to augment the antitumor effects of radiation against a tumor type that is virtually incurable.

  18. Development of an alpha/beta/gamma detector for radiation monitoring

    SciTech Connect

    Yamamoto, Seiichi; Hatazawa, Jun

    2011-11-15

    For radiation monitoring at the site of nuclear power plant accidents such as Fukushima Daiichi, radiation detectors not only for gamma photons but also for alpha and beta particles are needed because some nuclear fission products emit beta particles and gamma photons and some nuclear fuels contain plutonium that emits alpha particles. We developed a radiation detector that can simultaneously monitor alpha and beta particles and gamma photons for radiation monitoring. The detector consists of three-layered scintillators optically coupled to each other and coupled to a photomultiplier tube. The first layer, which is made of a thin plastic scintillator (decay time: 2.4 ns), detects alpha particles. The second layer, which is made of a thin Gd{sub 2}SiO{sub 5} (GSO) scintillator with 1.5 mol.% Ce (decay time: 35 ns), detects beta particles. The third layer made of a thin GSO scintillator with 0.4 mol.% Ce (decay time: 70 ns) detects gamma photons. By using pulse shape discrimination, the count rates of these layers can be separated. With individual irradiation of alpha and beta particles and gamma photons, the count rate of the first layer represented the alpha particles, the second layer represented the beta particles, and the third layer represented the gamma photons. Even with simultaneous irradiation of the alpha and beta particles and the gamma photons, these three types of radiation can be individually monitored using correction for the gamma detection efficiency of the second and third layers. Our developed alpha, beta, and gamma detector is simple and will be useful for radiation monitoring, especially at nuclear power plant accident sites or other applications where the simultaneous measurements of alpha and beta particles and gamma photons are required.

  19. Ly{alpha} DOMINANCE OF THE CLASSICAL T TAURI FAR-ULTRAVIOLET RADIATION FIELD

    SciTech Connect

    Schindhelm, Eric; France, Kevin; Brown, Alexander; Herczeg, Gregory J.; Bergin, Edwin; Yang Hao; Brown, Joanna M.; Linsky, Jeffrey L.; Valenti, Jeff

    2012-09-01

    Far-ultraviolet (FUV) radiation plays an important role in determining chemical abundances in protoplanetary disks. H I Lyman {alpha} (Ly{alpha}) is suspected to be the dominant component of the FUV emission from Classical T Tauri Stars (CTTSs), but is difficult to measure directly due to circumstellar and interstellar H I absorption. To better characterize the intrinsic Ly{alpha} radiation, we present FUV spectra of 14 CTTSs taken with the Hubble Space Telescope Cosmic Origins Spectrograph and Space Telescope Imaging Spectrograph instruments. H{sub 2} fluorescence, commonly seen in the spectra of CTTSs, is excited by Ly{alpha} photons, providing an indirect measure of the Ly{alpha} flux incident upon the warm disk surface. We use observed H{sub 2} progression fluxes to reconstruct the CTTS Ly{alpha} profiles. The Ly{alpha} flux correlates with total measured FUV flux, in agreement with an accretion-related source of FUV emission. With a geometry-independent analysis, we confirm that in accreting T Tauri systems Ly{alpha} radiation dominates the FUV flux ({approx}1150 A -1700 A). In the systems surveyed this one line comprises 70%-90% of the total FUV flux.

  20. Development of optical monitor of alpha radiations based on CR-39.

    PubMed

    Joshirao, Pranav M; Shin, Jae Won; Vyas, Chirag K; Kulkarni, Atul D; Kim, Hojoong; Kim, Taesung; Hong, Seung-Woo; Manchanda, Vijay K

    2013-11-01

    Fukushima accident has highlighted the need to intensify efforts to develop sensitive detectors to monitor the release of alpha emitting radionuclides in the environment caused by the meltdown of the discharged spent fuel. Conventionally, proportional counting, scintillation counting and alpha spectrometry are employed to assay the alpha emitting radionuclides but these techniques are difficult to be configured for online operations. Solid State Nuclear Track Detectors (SSNTDs) offer an alternative off line sensitive technique to measure alpha emitters as well as fissile radionuclides at ultra-trace level in the environment. Recently, our group has reported the first ever attempt to use reflectance based fiber optic sensor (FOS) to quantify the alpha radiations emitted from (232)Th. In the present work, an effort has been made to develop an online FOS to monitor alpha radiations emitted from (241)Am source employing CR-39 as detector. Here, we report the optical response of CR-39 (on exposure to alpha radiations) employing techniques such as Atomic Force Microscopy (AFM) and Reflectance Spectroscopy. In the present work GEANT4 simulation of transport of alpha particles in the detector has also been carried out. Simulation includes validation test wherein the projected ranges of alpha particles in the air, polystyrene and CR-39 were calculated and were found to agree with the literature values. An attempt has been further made to compute the fluence as a function of the incidence angle and incidence energy of alphas. There was an excellent correlation in experimentally observed track density with the simulated fluence. The present work offers a novel approach to design an online CR-39 based fiber optic sensor (CRFOS) to measure the release of nanogram quantity of (241)Am in the environment.

  1. CHEMISTRY OF A PROTOPLANETARY DISK WITH GRAIN SETTLING AND Ly{alpha} RADIATION

    SciTech Connect

    Fogel, Jeffrey K. J.; Bethell, Thomas J.; Bergin, Edwin A.; Calvet, Nuria; Semenov, Dmitry E-mail: tbethell@umich.edu E-mail: ncalvet@umich.edu

    2011-01-01

    We present results from a model of the chemical evolution of protoplanetary disks. In our models, we directly calculate the changing propagation and penetration of a high energy radiation field with Ly{alpha} radiation included. We also explore the effect on our models of including dust grain settling. We find that, in agreement with earlier studies, the evolution of dust grains plays a large role in determining how deep the UV radiation penetrates into the disk. Significant grain settling at the midplane leads to much smaller freeze-out regions and a correspondingly larger molecular layer, which leads to an increase in column density for molecular species such as CO, CN, and SO. The inclusion of Ly{alpha} radiation impacts the disk chemistry through specific species that have large photodissociation cross sections at 1216 A. These include HCN, NH{sub 3}, and CH{sub 4}, for which the column densities are decreased by an order of magnitude or more due to the presence of Ly{alpha} radiation in the UV spectrum. A few species, such as CO{sub 2} and SO, are enhanced by the presence of Ly{alpha} radiation, but rarely by more than a factor of a few.

  2. TESTING PULSAR RADIATION MODELS USING AN alpha-WEAK-DEPENDENT ALTITUDE RATIO

    SciTech Connect

    Lee, K. J.; Cui, X. H.; Qiao, G. J.; Xu, R. X.; Wang, H. G.

    2009-09-20

    It is found that pulsar radiation altitude ratios between different radio frequencies are weak-dependent on the inclination angle alpha. This is proved via series expansion techniques and illustrated by using pulsar examples of PSR B0329+54, B1508+55, B2016+28, B1133+16, and B2319+60. It is emphasized that this alpha-weak-dependent radiation altitude ratio offers a good tool to test pulsar radiation models. We use the measured altitude ratios to constrain the parameter space for the Ruderman-Sutherland model and the inverse Compton scattering model. It is found that the Ruderman-Sutherland model is not compatible with the measured altitude ratios, while the results are compatible with the inverse Compton scattering model. The potential possible applications of this method in studying pulsar timing and in studying pulsar high energy radiation are also discussed.

  3. Alpha particle response study of polycrstalline diamond radiation detector

    NASA Astrophysics Data System (ADS)

    Kumar, Amit; Topkar, Anita

    2016-05-01

    Chemical vapor deposition has opened the possibility to grow high purity synthetic diamond at relatively low cost. This has opened up uses of diamond based detectors for wide range of applications. These detectors are most suitable for harsh environments where standard semiconductor detectors cannot work. In this paper, we present the fabrication details and performance study of polycrystalline diamond based radiation detector. Effect of different operating parameters such as bias voltage and shaping time for charge collection on the performance of detector has been studied.

  4. Coupling the emission of ionizing radiation and Lyman alpha

    NASA Astrophysics Data System (ADS)

    Hayes, Matthew

    2013-10-01

    The class of objects that reionized intergalactic hydrogen remains an observational and theoretical problem that is in contention for being the most prominent puzzle piece in contemporary astrophysics. The current consensus - determined almost entirely by ruling out bright active galaxies - is that the process was possibly begun and almost certainly finished by faint, lower-mass galaxies forming their early generations of stars. Recent observations of z 3 galaxies may even have identified the analog populations.However understanding how the emitted ionizing power of galaxies is causally related to their {robustly determined} physical properties is not a study that can be performed at high-z: neither the spatial information nor the standard multi-wavelength diagnostics are available. Moreover, on a case-by-case basis, the intervening IGM absorption is impossible to determine. These considerations have spawned a number of detailed studies with UV space telescopes, the synthesis of which however is that a characteristic population of Lyman continuum {LyC} emitting objects has not yet been identified. We show in this proposal that we have identified a characteristic trait in galaxy spectra that is highly indicative of LyC emission, by combining {a} high-z phenomenological studies, {b} new high-resolution UV spectra of local galaxies, and {c} sophisticated models of radiation transport. Believing that we have determined the signature, we propose to test the new hypothesis with deep spectroscopic observations with HST/COS under the Cycle 21 UV initiative.

  5. The role of protein kinase C alpha translocation in radiation-induced bystander effect.

    PubMed

    Fang, Zihui; Xu, An; Wu, Lijun; Hei, Tom K; Hong, Mei

    2016-01-01

    Ionizing radiation is a well known human carcinogen. Evidence accumulated over the past decade suggested that extranuclear/extracellular targets and events may also play a critical role in modulating biological responses to ionizing radiation. However, the underlying mechanism(s) of radiation-induced bystander effect is still unclear. In the current study, AL cells were irradiated with alpha particles and responses of bystander cells were investigated. We found out that in bystander AL cells, protein kinase C alpha (PKCα) translocated from cytosol to membrane fraction. Pre-treatment of cells with PKC translocation inhibitor chelerythrine chloride suppressed the induced extracellular signal-regulated kinases (ERK) activity and the increased cyclooxygenase 2 (COX-2) expression as well as the mutagenic effect in bystander cells. Furthermore, tumor necrosis factor alpha (TNFα) was elevated in directly irradiated but not bystander cells; while TNFα receptor 1 (TNFR1) increased in the membrane fraction of bystander cells. Further analysis revealed that PKC activation caused accelerated internalization and recycling of TNFR1. Our data suggested that PKCα translocation may occur as an early event in radiation-induced bystander responses and mediate TNFα-induced signaling pathways that lead to the activation of ERK and up-regulation of COX-2. PMID:27165942

  6. The comparative effects of gamma radiation and in situ alpha particles on five strong-base anion exchange resins

    SciTech Connect

    Marsh, S.F.

    1991-01-01

    The effects of external gamma radiation and in situ alpha particles were measured on a recently available, macroporous, strong-base polyvinylpyridine resin and on four strong-base polystyrene anion exchange resins. Each resin was irradiated in 7 M nitric acid to 1--10 megaGray of gamma radiation from external {sup 60}Co, or to 5--14 megaGray of alpha particles from sorbed {sup 238}Pu. Each irradiated resin was measured for changes in dry weight, wet volume, weak-base and strong-base chloride exchange capacities, and exchange capacities for Pu(4) from nitric acid. Alpha-induced resin damage was significantly less than that caused by an equivalent dose of gamma radiation. The polyvinylpyridine resin offers the greatest resistance to damage from gamma radiation and from alpha particles. 5 refs., 1 figs. 5 tabs.

  7. Quantification of actinide alpha-radiation damage in minerals and ceramics.

    PubMed

    Farnan, Ian; Cho, Herman; Weber, William J

    2007-01-11

    There are large amounts of heavy alpha-emitters in nuclear waste and nuclear materials inventories stored in various sites around the world. These include plutonium and minor actinides such as americium and curium. In preparation for geological disposal there is consensus that actinides that have been separated from spent nuclear fuel should be immobilized within mineral-based ceramics rather than glass because of their superior aqueous durability and lower risk of accidental criticality. However, in the long term, the alpha-decay taking place in these ceramics will severely disrupt their crystalline structure and reduce their durability. A fundamental property in predicting cumulative radiation damage is the number of atoms permanently displaced per alpha-decay. At present, this number is estimated to be 1,000-2,000 atoms/alpha in zircon. Here we report nuclear magnetic resonance, spin-counting experiments that measure close to 5,000 atoms/alpha in radiation-damaged natural zircons. New radiological nuclear magnetic resonance measurements on highly radioactive, 239Pu zircon show damage similar to that caused by 238U and 232Th in mineral zircons at the same dose, indicating no significant effect of half-life or loading levels (dose rate). On the basis of these measurements, the initially crystalline structure of a 10 weight per cent 239Pu zircon would be amorphous after only 1,400 years in a geological repository (desired immobilization timescales are of the order of 250,000 years). These measurements establish a basis for assessing the long-term structural durability of actinide-containing ceramics in terms of an atomistic understanding of the fundamental damage event. PMID:17215840

  8. Semi-Automatic Segmentation of Optic Radiations and LGN, and Their Relationship to EEG Alpha Waves.

    PubMed

    Renauld, Emmanuelle; Descoteaux, Maxime; Bernier, Michaël; Garyfallidis, Eleftherios; Whittingstall, Kevin

    2016-01-01

    At rest, healthy human brain activity is characterized by large electroencephalography (EEG) fluctuations in the 8-13 Hz range, commonly referred to as the alpha band. Although it is well known that EEG alpha activity varies across individuals, few studies have investigated how this may be related to underlying morphological variations in brain structure. Specifically, it is generally believed that the lateral geniculate nucleus (LGN) and its efferent fibres (optic radiation, OR) play a key role in alpha activity, yet it is unclear whether their shape or size variations contribute to its inter-subject variability. Given the widespread use of EEG alpha in basic and clinical research, addressing this is important, though difficult given the problems associated with reliably segmenting the LGN and OR. For this, we employed a multi-modal approach and combined diffusion magnetic resonance imaging (dMRI), functional magnetic resonance imaging (fMRI) and EEG in 20 healthy subjects to measure structure and function, respectively. For the former, we developed a new, semi-automated approach for segmenting the OR and LGN, from which we extracted several structural metrics such as volume, position and diffusivity. Although these measures corresponded well with known morphology based on previous post-mortem studies, we nonetheless found that their inter-subject variability was not significantly correlated to alpha power or peak frequency (p >0.05). Our results therefore suggest that alpha variability may be mediated by an alternative structural source and our proposed methodology may in general help in better understanding the influence of anatomy on function such as measured by EEG or fMRI. PMID:27383146

  9. Semi-Automatic Segmentation of Optic Radiations and LGN, and Their Relationship to EEG Alpha Waves

    PubMed Central

    Descoteaux, Maxime; Bernier, Michaël; Garyfallidis, Eleftherios; Whittingstall, Kevin

    2016-01-01

    At rest, healthy human brain activity is characterized by large electroencephalography (EEG) fluctuations in the 8-13 Hz range, commonly referred to as the alpha band. Although it is well known that EEG alpha activity varies across individuals, few studies have investigated how this may be related to underlying morphological variations in brain structure. Specifically, it is generally believed that the lateral geniculate nucleus (LGN) and its efferent fibres (optic radiation, OR) play a key role in alpha activity, yet it is unclear whether their shape or size variations contribute to its inter-subject variability. Given the widespread use of EEG alpha in basic and clinical research, addressing this is important, though difficult given the problems associated with reliably segmenting the LGN and OR. For this, we employed a multi-modal approach and combined diffusion magnetic resonance imaging (dMRI), functional magnetic resonance imaging (fMRI) and EEG in 20 healthy subjects to measure structure and function, respectively. For the former, we developed a new, semi-automated approach for segmenting the OR and LGN, from which we extracted several structural metrics such as volume, position and diffusivity. Although these measures corresponded well with known morphology based on previous post-mortem studies, we nonetheless found that their inter-subject variability was not significantly correlated to alpha power or peak frequency (p >0.05). Our results therefore suggest that alpha variability may be mediated by an alternative structural source and our proposed methodology may in general help in better understanding the influence of anatomy on function such as measured by EEG or fMRI. PMID:27383146

  10. Epigenetic regulation of diacylglycerol kinase alpha promotes radiation-induced fibrosis

    PubMed Central

    Weigel, Christoph; Veldwijk, Marlon R.; Oakes, Christopher C.; Seibold, Petra; Slynko, Alla; Liesenfeld, David B.; Rabionet, Mariona; Hanke, Sabrina A.; Wenz, Frederik; Sperk, Elena; Benner, Axel; Rösli, Christoph; Sandhoff, Roger; Assenov, Yassen; Plass, Christoph; Herskind, Carsten; Chang-Claude, Jenny; Schmezer, Peter; Popanda, Odilia

    2016-01-01

    Radiotherapy is a fundamental part of cancer treatment but its use is limited by the onset of late adverse effects in the normal tissue, especially radiation-induced fibrosis. Since the molecular causes for fibrosis are largely unknown, we analyse if epigenetic regulation might explain inter-individual differences in fibrosis risk. DNA methylation profiling of dermal fibroblasts obtained from breast cancer patients prior to irradiation identifies differences associated with fibrosis. One region is characterized as a differentially methylated enhancer of diacylglycerol kinase alpha (DGKA). Decreased DNA methylation at this enhancer enables recruitment of the profibrotic transcription factor early growth response 1 (EGR1) and facilitates radiation-induced DGKA transcription in cells from patients later developing fibrosis. Conversely, inhibition of DGKA has pronounced effects on diacylglycerol-mediated lipid homeostasis and reduces profibrotic fibroblast activation. Collectively, DGKA is an epigenetically deregulated kinase involved in radiation response and may serve as a marker and therapeutic target for personalized radiotherapy. PMID:26964756

  11. Epigenetic regulation of diacylglycerol kinase alpha promotes radiation-induced fibrosis.

    PubMed

    Weigel, Christoph; Veldwijk, Marlon R; Oakes, Christopher C; Seibold, Petra; Slynko, Alla; Liesenfeld, David B; Rabionet, Mariona; Hanke, Sabrina A; Wenz, Frederik; Sperk, Elena; Benner, Axel; Rösli, Christoph; Sandhoff, Roger; Assenov, Yassen; Plass, Christoph; Herskind, Carsten; Chang-Claude, Jenny; Schmezer, Peter; Popanda, Odilia

    2016-03-11

    Radiotherapy is a fundamental part of cancer treatment but its use is limited by the onset of late adverse effects in the normal tissue, especially radiation-induced fibrosis. Since the molecular causes for fibrosis are largely unknown, we analyse if epigenetic regulation might explain inter-individual differences in fibrosis risk. DNA methylation profiling of dermal fibroblasts obtained from breast cancer patients prior to irradiation identifies differences associated with fibrosis. One region is characterized as a differentially methylated enhancer of diacylglycerol kinase alpha (DGKA). Decreased DNA methylation at this enhancer enables recruitment of the profibrotic transcription factor early growth response 1 (EGR1) and facilitates radiation-induced DGKA transcription in cells from patients later developing fibrosis. Conversely, inhibition of DGKA has pronounced effects on diacylglycerol-mediated lipid homeostasis and reduces profibrotic fibroblast activation. Collectively, DGKA is an epigenetically deregulated kinase involved in radiation response and may serve as a marker and therapeutic target for personalized radiotherapy.

  12. Identification of gene-based responses in human blood cells exposed to alpha particle radiation

    PubMed Central

    2014-01-01

    Background The threat of a terrorist-precipitated nuclear event places humans at danger for radiological exposures. Isotopes which emit alpha (α)-particle radiation pose the highest risk. Currently, gene expression signatures are being developed for radiation biodosimetry and triage with respect to ionizing photon radiation. This study was designed to determine if similar gene expression profiles are obtained after exposures involving α-particles. Methods Peripheral blood mononuclear cells (PBMCs) were used to identify sensitive and robust gene-based biomarkers of α-particle radiation exposure. Cells were isolated from healthy individuals and were irradiated at doses ranging from 0-1.5 Gy. Microarray technology was employed to identify transcripts that were differentially expressed relative to unirradiated cells 24 hours post-exposure. Statistical analysis identified modulated genes at each of the individual doses. Results Twenty-nine genes were common to all doses with expression levels ranging from 2-10 fold relative to control treatment group. This subset of genes was further assessed in independent complete white blood cell (WBC) populations exposed to either α-particles or X-rays using quantitative real-time PCR. This 29 gene panel was responsive in the α-particle exposed WBCs and was shown to exhibit differential fold-changes compared to X-irradiated cells, though no α-particle specific transcripts were identified. Conclusion Current gene panels for photon radiation may also be applicable for use in α-particle radiation biodosimetry. PMID:25017500

  13. Growth and Characterization of alpha-PbO for Room Temperature Radiation Detection

    NASA Astrophysics Data System (ADS)

    Ford, Erin Leigh

    A global trading structure and high throughput of shipping containers into ports around the world increases the chance of nuclear terrorism via cargo containers. Harmless radioactive sources confuse and impede detection of the materials that pose a real threat, making spectroscopy difficult and requiring detectors with high resolution. The current methods that are used to check containers in ports have security flaws, and only 5% of all shipping containers are checked. The development of semiconductor gamma-ray detectors is one of the protocols being advanced to alleviate this risk because they can function at room temperature and they are cost effective, easily produced, and have high resolution. This dissertation has addressed the current lack of "perfect" room temperature detector materials by investigating alpha-PbO, a novel material in this field. This includes the development of a growth process for alpha-PbO thin films, as well as its structural and performance characterization as a detector material. Because we intend alpha-PbO to be a photoconductive detector, it should have certain properties. A photoconductive detector consists of a highly resistive material with a voltage bias across it. It absorbs incident gamma-rays, creating electron-hole pairs that provide a signal. To function well, it must have a high atomic number and a high density in order to absorb high-energy photons via the photoelectric effect. It should also have a large resistivity and a wide band gap to avoid large leakage currents at room temperature. Finally, it must have good charge carrier transport properties and detector resolution in order to be able to determine the characteristic energy peaks of the radiation-emitting source. We chose alpha-PbO because it has a very high Z and a very high density and a band gap in the correct range. It also has a rich history of use as a photoconductor that reaches back to the 1950s. Numerous methods have been used to grow thin films of alpha

  14. Energetic response of Chlorella vulgaris to alpha radiation and PCB stress

    SciTech Connect

    Schaffer, S.A.

    1982-01-01

    This research project has evaluated the bioenergetic response of the green alga Chlorella vulgaris following acute exposure to either the physical stress of radiation or the chemical stress of PCBs. After exposure, changes in survival or growth, adenylate pools (ATP, ADP, and AMP), CO/sub 2/ fixation and oxygen evolution and uptake were measured. By employing anaerobic conditions, or the electron transport inhibitor DCMU or dark conditions separately and in specific combinations, this study evaluated the response of three separate algal ATP producing mechanisms (respiration, total and cyclic photophosphorylation) to alpha radiation or PCB. The use of the adenylate energy charge ratio as an indicator of stress was also evaluated. The results of the radiation experiments indicated that alpha particle exposure between 25 to 275 rads caused a one-hour latent demand for ATP due to radioinduced DNA repair. In order to compensate for this ATP demand, nonessential utilization of ATP was decreased by slowing the rate of carbon fixation. The results also suggest that use of radiation as a tool to study algal physiology. The data obtained from the PCB experiments again showed each phosphorylation mechanism to be insensitive to 10, 100 and 200 ppm Aroclor 1254 exposures. Data suggest, however, that PCBs caused an increased photosynthetic rate, and total adenylate pool with decreased growth. The use of the adenylate energy charge ratio as a stress indicator was assessed. Because this ratio did not fluctuate at doses of radiation or PCBs that caused reduced survival and growth rates, this study concluded that for Chlorella the adenylate energy charge ration was a poor indicator of sublethal stress.

  15. Scintillator assembly for alpha radiation detection and an associated method of making

    DOEpatents

    Lauf, R.J.; McElhaney, S.A.; Bates, J.B.

    1994-07-26

    A scintillator assembly for use in conjunction with a photomultiplier or the like in the detection of alpha radiation utilizes a substrate or transparent yttrium aluminum garnet and a relatively thin film of cerium-doped yttrium aluminum garnet coated upon the substrate. The film material is applied to the substrate in a sputtering process, and the applied film and substrate are annealed to effect crystallization of the film upon the substrate. The resultant assembly provides relatively high energy resolution during use in a detection instrument and is sufficiently rugged for use in field environments. 4 figs.

  16. Scintillator assembly for alpha radiation detection and an associated method of making

    DOEpatents

    Lauf, Robert J.; McElhaney, Stephanie A.; Bates, John B.

    1994-01-01

    A scintillator assembly for use in conjunction with a photomultiplier or the like in the detection of alpha radiation utilizes a substrate or transparent yttrium aluminum garnet and a relatively thin film of cerium-doped yttrium aluminum garnet coated upon the substrate. The film material is applied to the substrate in a sputtering process, and the applied film and substrate are annealed to effect crystallization of the film upon the substrate. The resultant assembly provides relatively high energy resolution during use in a detection instrument and is sufficiently rugged for use in field environments.

  17. Effect of alpha-lipoic acid on radiation-induced small intestine injury in mice

    PubMed Central

    Jeong, Bae Kwon; Song, Jin Ho; Jeong, Hojin; Choi, Hoon Sik; Jung, Jung Hwa; Hahm, Jong Ryeal; Woo, Seung Hoon; Jung, Myeong Hee; Choi, Bong-Hoi; Kim, Jin Hyun; Kang, Ki Mun

    2016-01-01

    Purpose Radiation therapy is a highly effective treatment for patients with solid tumors. However, it can cause damage and inflammation in normal tissues. Here, we investigated the effects of alpha-lipoic acid (ALA) as radioprotection agent for the small intestine in a mouse model. Materials and Methods Whole abdomen was evenly irradiated with total a dose of 15 Gy. Mice were treated with either ALA (100 mg/kg, intraperitoneal injection [i.p.]) or saline (equal volume, i.p.) the prior to radiation as 100 mg/kg/day for 3 days. Body weight, food intake, histopathology, and biochemical parameters were evaluated. Results Significant differences in body weight and food intake were observed between the radiation (RT) and ALA + RT groups. Moreover, the number of crypt cells was higher in the ALA + RT group. Inflammation was decreased and recovery time was shortened in the ALA + RT group compared with the RT group. The levels of inflammation-related factors (i.e., phosphorylated nuclear factor kappa B and matrix metalloproteinase-9) and mitogen-activated protein kinases were significantly decreased in the ALA + RT group compared with those in the RT group. Conclusions ALA treatment prior to radiation decreases the severity and duration of radiation-induced enteritis by reducing inflammation, oxidative stress, and cell death. PMID:26943777

  18. Differential Effects of Alpha-Particle Radiation and X-Irradiation on Genes Associated with Apoptosis

    PubMed Central

    Chauhan, Vinita; Howland, Matthew; Chen, Jeremy; Kutzner, Barbara; Wilkins, Ruth C.

    2011-01-01

    This study examined differential effects of alpha-(α-) particle radiation and X-rays on apoptosis and associated changes in gene expression. Human monocytic cells were exposed to α-particle radiation and X-rays from 0 to 1.5 Gy. Four days postexposure, cell death was measured by flow cytometry and 84 genes related to apoptosis were analyzed using real-time PCR. On average, 33% of the cells were apoptotic at 1.5 Gy of α-particle radiation. Transcript profiling showed statistical expression of 15 genes at all three doses tested. Cells exposed to X-rays were <5% apoptotic at ~1.5 Gy and induced less than a 2-fold expression in 6 apoptotic genes at the higher doses of radiation. Among these 6 genes, Fas and TNF-α were common to the α-irradiated cells. This data suggests that α-particle radiation initiates cell death by TNF-α and Fas activation and through intermediate signalling mediators that are distinct from X-irradiated cells. PMID:22091383

  19. Effects of PGF{sub 2{alpha}} on human melanocytes and regulation of the FP receptor by ultraviolet radiation

    SciTech Connect

    Scott, Glynis . E-mail: Glynis_Scott@urmc.rochester.edu; Jacobs, Stacey; Leopardi, Sonya; Anthony, Frank A.; Learn, Doug; Malaviya, Rama; Pentland, Alice

    2005-04-01

    Prostaglandins are potent lipid hormones that activate multiple signaling pathways resulting in regulation of cellular growth, differentiation, and apoptosis. In the skin, prostaglandins are rapidly released by keratinocytes following ultraviolet radiation and are chronically present in inflammatory skin lesions. We have shown previously that melanocytes, which provide photoprotection to keratinocytes through the production of melanin, express several receptors for prostaglandins, including the PGE{sub 2} receptors EP{sub 1} and EP{sub 3} and the PGF{sub 2{alpha}} receptor FP, and that PGF{sub 2{alpha}} stimulates melanocyte dendricity. We now show that PGF{sub 2{alpha}} stimulates the activity and expression of tyrosinase, the rate-limiting enzyme in melanin synthesis. Analysis of FP receptor regulation showed that the FP receptor is regulated by ultraviolet radiation in melanocytes in vitro and in human skin in vivo. We also show that ultraviolet irradiation stimulates production of PGF{sub 2{alpha}} by melanocytes. These results show that PGF{sub 2{alpha}} binding to the FP receptor activates signals that stimulate a differentiated phenotype (dendricity and pigmentation) in melanocytes. The regulation of the FP receptor and the stimulation of production of PGF{sub 2{alpha}} in melanocytes in response to ultraviolet radiation suggest that PGF{sub 2{alpha}} could act as an autocrine factor for melanocyte differentiation.

  20. Resonance-enhanced two-photon ionization of ions by Lyman alpha radiation in gaseous nebulae.

    PubMed

    Johansson, S; Letokhov, V

    2001-01-26

    One of the mysteries of nebulae in the vicinity of bright stars is the appearance of bright emission spectral lines of ions, which imply fairly high excitation temperatures. We suggest that an ion formation mechanism, based on resonance-enhanced two-photon ionization (RETPI) by intense H Lyman alpha radiation (wavelength of 1215 angstroms) trapped inside optically thick nebulae, can produce these spectral lines. The rate of such an ionization process is high enough for rarefied gaseous media where the recombination rate of the ions formed can be 10(-6) to 10(-8) per second for an electron density of 10(3) to 10(5) per cubic centimeter in the nebula. Under such conditions, the photo-ions formed may subsequently undergo further RETPI, catalyzed by intense He i and He ii radiation, which also gets enhanced in optically thick nebulae that contain enough helium. PMID:11158669

  1. Effect of long-term exposure to mobile phone radiation on alpha-Int1 gene sequence of Candida albicans.

    PubMed

    Shahin-Jafari, Ariyo; Bayat, Mansour; Shahhosseiny, Mohammad Hassan; Tajik, Parviz; Roudbar-Mohammadi, Shahla

    2016-05-01

    Over the last decade, communication industries have witnessed a tremendous expansion, while, the biological effects of electromagnetic waves have not been fully elucidated. Current study aimed at evaluating the mutagenic effect of long-term exposure to 900-MHz radiation on alpha-Int1 gene sequences of Candida albicans. A standard 900 MHz radiation generator was used for radiation. 10 ml volumes from a stock suspension of C. albicans were transferred into 10 polystyrene tubes. Five tubes were exposed at 4 °C to a fixed magnitude of radiation with different time periods of 10, 70, 210, 350 and 490 h. The other 5 tubes were kept far enough from radiation. The samples underwent genomic DNA extraction. PCR amplification of alpha-Int1 gene sequence was done using one set of primers. PCR products were resolved using agarose gel electrophoresis and the nucleotide sequences were determined. All samples showed a clear electrophoretic band around 441 bp and further sequencing revealed the amplified DNA segments are related to alpha-Int1 gene of the yeast. No mutations in the gene were seen in radiation exposed samples. Long-term exposure of the yeast to mobile phone radiation under the above mentioned conditions had no mutagenic effect on alpha-Int1 gene sequence. PMID:27081370

  2. Effect of long-term exposure to mobile phone radiation on alpha-Int1 gene sequence of Candida albicans

    PubMed Central

    Shahin-jafari, Ariyo; Bayat, Mansour; Shahhosseiny, Mohammad Hassan; Tajik, Parviz; Roudbar-mohammadi, Shahla

    2015-01-01

    Over the last decade, communication industries have witnessed a tremendous expansion, while, the biological effects of electromagnetic waves have not been fully elucidated. Current study aimed at evaluating the mutagenic effect of long-term exposure to 900-MHz radiation on alpha-Int1 gene sequences of Candida albicans. A standard 900 MHz radiation generator was used for radiation. 10 ml volumes from a stock suspension of C. albicans were transferred into 10 polystyrene tubes. Five tubes were exposed at 4 °C to a fixed magnitude of radiation with different time periods of 10, 70, 210, 350 and 490 h. The other 5 tubes were kept far enough from radiation. The samples underwent genomic DNA extraction. PCR amplification of alpha-Int1 gene sequence was done using one set of primers. PCR products were resolved using agarose gel electrophoresis and the nucleotide sequences were determined. All samples showed a clear electrophoretic band around 441 bp and further sequencing revealed the amplified DNA segments are related to alpha-Int1 gene of the yeast. No mutations in the gene were seen in radiation exposed samples. Long-term exposure of the yeast to mobile phone radiation under the above mentioned conditions had no mutagenic effect on alpha-Int1 gene sequence. PMID:27081370

  3. Effect of long-term exposure to mobile phone radiation on alpha-Int1 gene sequence of Candida albicans.

    PubMed

    Shahin-Jafari, Ariyo; Bayat, Mansour; Shahhosseiny, Mohammad Hassan; Tajik, Parviz; Roudbar-Mohammadi, Shahla

    2016-05-01

    Over the last decade, communication industries have witnessed a tremendous expansion, while, the biological effects of electromagnetic waves have not been fully elucidated. Current study aimed at evaluating the mutagenic effect of long-term exposure to 900-MHz radiation on alpha-Int1 gene sequences of Candida albicans. A standard 900 MHz radiation generator was used for radiation. 10 ml volumes from a stock suspension of C. albicans were transferred into 10 polystyrene tubes. Five tubes were exposed at 4 °C to a fixed magnitude of radiation with different time periods of 10, 70, 210, 350 and 490 h. The other 5 tubes were kept far enough from radiation. The samples underwent genomic DNA extraction. PCR amplification of alpha-Int1 gene sequence was done using one set of primers. PCR products were resolved using agarose gel electrophoresis and the nucleotide sequences were determined. All samples showed a clear electrophoretic band around 441 bp and further sequencing revealed the amplified DNA segments are related to alpha-Int1 gene of the yeast. No mutations in the gene were seen in radiation exposed samples. Long-term exposure of the yeast to mobile phone radiation under the above mentioned conditions had no mutagenic effect on alpha-Int1 gene sequence.

  4. Radiation-induced peroxidation of lipid dissolved in organic solvent and its inhibition by alpha-tocopherol and cepharanthine

    SciTech Connect

    Shiraishi, N.; Joja, I.; Kuroda, M.; Fujishima, M.; Miyake, M.; Aono, K.

    1985-01-01

    Effects of cepharanthine and alpha-tocopherol on radiation-induced peroxidation of lipids dissolved in methanol(MeOH)-chloroform (CHCl3)-H2O(v/v, 2/1/0.8) were examined. alpha-Tocopherol strongly inhibited radiation-induced peroxidation of lipids dissolved in MeOH-CHCl3-H2O. However, cepharanthine exhibited a weak inhibitory action in this system. The change in the absorption spectrum of alpha-tocopherol and cepharanthine by X-irradiation was measured. The reagents were dissolved in 95% EtOH acidified with 20 mM HCl and in MeOH-CHCl3-H2O. alpha-Tocopherol exhibited the change in its absorption spectrum in both systems, and seemed to be oxidized at a high rate by free radicals. However, cepharanthine slightly exhibited the change in its spectrum in MeOH-CHCl3-H2O, but not in acidified EtOH.

  5. Prevention and Treatment of Functional and Structural Radiation Injury in the Rat Heart by Pentoxifylline and Alpha-Tocopherol

    SciTech Connect

    Boerma, Marjan Roberto, Kerrey A.; Hauer-Jensen, Martin

    2008-09-01

    Purpose: Radiation-induced heart disease (RIHD) is a severe side effect of thoracic radiotherapy. This study examined the effects of pentoxifylline (PTX) and {alpha}-tocopherol on cardiac injury in a rat model of RIHD. Methods and Materials: Male Sprague-Dawley rats received fractionated local heart irradiation with a daily dose of 9 Gy for 5 days and were observed for 6 months after irradiation. Rats were treated with a combination of PTX, 100 mg/kg/day, and {alpha}-tocopherol (20 IU/kg/day) and received these compounds either from 1 week before until 6 months after irradiation or starting 3 months after irradiation, a time point at which histopathologic changes become apparent in our model of RIHD. Results: Radiation-induced increases in left ventricular diastolic pressure (in mm Hg: 35 {+-} 6 after sham-irradiation, 82 {+-} 11 after irradiation) were significantly reduced by PTX and {alpha}-tocopherol (early treatment: 48 {+-} 7; late treatment: 53 {+-} 6). PTX and {alpha}-tocopherol significantly reduced deposition of collagen types I (radiation only: 3.5 {+-} 0.2 {mu}m{sup 2} per 100 {mu}m{sup 2}; early treatment: 2.7 {+-} 0.8; late treatment: 2.2 {+-} 0.2) and III (radiation only: 13.9 {+-} 0.8; early treatment: 11.0 {+-} 1.2; late treatment: 10.6 {+-} 0.8). On the other hand, radiation-induced alterations in heart/body weight ratios, myocardial degeneration, left ventricular mast cell densities, and most echocardiographic parameters were not significantly altered by PTX and {alpha}-tocopherol. Conclusions: Treatment with PTX and {alpha}-tocopherol may have beneficial effects on radiation-induced myocardial fibrosis and left ventricular function, both when started before irradiation and when started later during the process of RIHD.

  6. Alpha-tocopherol succinate- and AMD3100-mobilized progenitors mitigate radiation combined injury in mice

    PubMed Central

    Singh, Vijay K.; Wise, Stephen Y.; Fatanmi, Oluseyi O.; Beattie, Lindsay A.; Ducey, Elizabeth J.; Seed, Thomas M.

    2014-01-01

    The purpose of this study was to elucidate the role of alpha-tocopherol succinate (TS)- and AMD3100-mobilized progenitors in mitigating combined injury associated with acute radiation exposure in combination with secondary physical wounding. CD2F1 mice were exposed to high doses of cobalt-60 gamma-radiation and then transfused intravenously with 5 million peripheral blood mononuclear cells (PBMCs) from TS- and AMD3100-injected mice after irradiation. Within 1 h after irradiation, mice were exposed to secondary wounding. Mice were observed for 30 d after irradiation and cytokine analysis was conducted by multiplex Luminex assay at various time-points after irradiation and wounding. Our results initially demonstrated that transfusion of TS-mobilized progenitors from normal mice enhanced survival of acutely irradiated mice exposed 24 h prior to transfusion to supralethal doses (11.5–12.5 Gy) of 60Co gamma-radiation. Subsequently, comparable transfusions of TS-mobilized progenitors were shown to significantly mitigate severe combined injuries in acutely irradiated mice. TS administered 24 h before irradiation was able to protect mice against combined injury as well. Cytokine results demonstrated that wounding modulates irradiation-induced cytokines. This study further supports the conclusion that the infusion of TS-mobilized progenitor-containing PBMCs acts as a bridging therapy in radiation-combined-injury mice. We suggest that this novel bridging therapeutic approach involving the infusion of TS-mobilized hematopoietic progenitors following acute radiation exposure or combined injury might be applicable to humans. PMID:23814114

  7. Growth and Characterization of alpha-PbO for Room Temperature Radiation Detection

    NASA Astrophysics Data System (ADS)

    Ford, Erin Leigh

    A global trading structure and high throughput of shipping containers into ports around the world increases the chance of nuclear terrorism via cargo containers. Harmless radioactive sources confuse and impede detection of the materials that pose a real threat, making spectroscopy difficult and requiring detectors with high resolution. The current methods that are used to check containers in ports have security flaws, and only 5% of all shipping containers are checked. The development of semiconductor gamma-ray detectors is one of the protocols being advanced to alleviate this risk because they can function at room temperature and they are cost effective, easily produced, and have high resolution. This dissertation has addressed the current lack of "perfect" room temperature detector materials by investigating alpha-PbO, a novel material in this field. This includes the development of a growth process for alpha-PbO thin films, as well as its structural and performance characterization as a detector material. Because we intend alpha-PbO to be a photoconductive detector, it should have certain properties. A photoconductive detector consists of a highly resistive material with a voltage bias across it. It absorbs incident gamma-rays, creating electron-hole pairs that provide a signal. To function well, it must have a high atomic number and a high density in order to absorb high-energy photons via the photoelectric effect. It should also have a large resistivity and a wide band gap to avoid large leakage currents at room temperature. Finally, it must have good charge carrier transport properties and detector resolution in order to be able to determine the characteristic energy peaks of the radiation-emitting source. We chose alpha-PbO because it has a very high Z and a very high density and a band gap in the correct range. It also has a rich history of use as a photoconductor that reaches back to the 1950s. Numerous methods have been used to grow thin films of alpha

  8. Protective effects of DL-alpha-tocopherol acetate and sodium selenate on the liver of rats exposed to gamma radiation.

    PubMed

    Yanardağ, R; Bolkent, S; Kizir, A

    2001-12-01

    The aim of this study is to investigate whether vitamin E (as DL-alpha-tocopherol acetate) and selenium (as sodium selenate) exert a protective effect against radiation damage. The liver tissue of rats irradiated with a single dose of 1,000 cGy 60Co-gamma-irradiation was examined for morphological changes after the intraperitoneal (ip) administration DL-alpha-tocopherol acetate and sodium selenate as compared to controls. Also, the amounts of blood glutathione and serum alanine transaminase (ALT), aspartate transaminase (AST), alkaline phosphatase (ALP), lactate dehydrogenase (LDH), and total protein were determined by spectrophotometric methods. Degenerative changes were observed under light and electron microscopy in the liver tissue of the control (radiation only) group. In the group receiving radiation and ip doses of DL-alpha-tocopherol acetate and sodium selenate, the damage to the liver tissue was minimal or absent. In the radiation-only group, a reduction of the blood glutathione level and increases in serum values of AST, ALT, ALP, and LDH activity were observed, whereas in the irradiation-treated group, the reverse was found to occur. Based on these morphological and biochemical observations, it was concluded that the ip administration of DL-alpha-tocopherol acetate and sodium selenate exerts a protective effect against liver radiation damage.

  9. Radiation-induced cationic polymerization of limonene oxide,. cap alpha. -pinene oxide, and. beta. -pinene oxide

    SciTech Connect

    Aikins, J.A.; Williams, F.

    1984-01-01

    After suitable drying, the subject monomers in the form of neat liquids undergo radiation-induced polymerization with no apparent side reactions and high conversions to precipitatable polymers of low molecular weight. A cationic mechanism is evidenced by the strongly retarding effect of tri-n-propylamine on the polymerization rate. At 25/sup 0/C, limonene oxide gives the highest polymerization rates, an average conversion of 36% per Mrad being obtained in comparison with values of 5.7 and 7.3% per Mrad for the ..cap alpha..-pinene and ..beta..-pinene oxides, respectively. Similarly, the average anti DP/sub n/ decreases from 11.8 for the limonene oxide polymer to 5.6 and 4.0 for the ..cap alpha..-pinene oxide and ..beta..-pinene oxide polymers, respectively. A high frequency of chain transfer to monomer is indicated in each case by the fact that the kinetic chain lengths are estimated to be on the order of a hundred times larger than the anti DP/sub n/ values. Structural characterization of the limonene oxide polymer by /sup 1/H and /sup 13/C NMR spectroscopy provides conclusive evidence that the polymerization proceeds by the opening of the epoxide ring to yield a 1,2-trans polyether. Similar NMR studies on the polymers formed from the ..cap alpha..-pinene and ..beta..-pinene oxides show that in the polymerization of these monomers, the opening of the epoxide ring is generally accompanied by the concomitant ring opening of the cyclobutane ring structure to yield a gem-dimethyl group in the main chain. The detection of isopropenyl end groups in the pinene oxide polymers is also consistent with this mode of propagation being followed by chain (proton) transfer to monomer.

  10. Lyman-{alpha} radiation of a metastable hydrogen beam to measure electric fields

    SciTech Connect

    Lejeune, A.; Cherigier-Kovacic, L.; Doveil, F.

    2011-10-31

    The interaction between a metastable H(2s) atomic hydrogen beam and an external electric field leads to the emission of the Lyman-{alpha} line. It originates in the Stark mixing of the near-degenerate 2s{sub 1/2} and 2p{sub 1/2} levels separated by the Lamb shift. The quenched radiation proportional to the square of the electric field amplitude is recovered in vacuum by using such an atomic probe beam. We observe the strong enhancement of the signal when the field is oscillating at the Lamb shift frequency. This technique is applied in a plasma, offering an alternative way to measure weak electric fields by direct and non-intrusive means.

  11. Radiation dosimetry of iodine-123 HEAT, an alpha-1 receptor imaging agent

    SciTech Connect

    Thomas, K.D.; Greer, D.M.; Couch, M.W.; Williams, C.M.

    1987-11-01

    Biologic distribution data in the rat were obtained for the alpha-1 adrenoceptor imaging agent (+/-) 2-(beta-(iodo-4-hydroxyphenyl)ethylaminomethyl)tetralone (HEAT) labeled with (/sup 123/I). The major excretory routes were through the liver (67%) and the kidney (33%). Internal radiation absorbed dose estimates to nine source organs, total body, the GI tract, gonads, and red bone marrow were calculated for the human using the physical decay data for (/sup 123/I). The critical organ was found to be the lower large intestine, receiving 1.1 rad per mCi of (/sup 123/I)HEAT administered. The total-body dose was found to be 58 mrad per mCi.

  12. Scintillator assembly for alpha radiation detection and method of making the assembly

    DOEpatents

    McElhaney, Stephanie A.; Bauer, Martin L.; Chiles, Marion M.

    1992-01-01

    A scintillator assembly for use in the detection of alpha radiation includes a body of optically-transparent epoxy and an amount of phosphor particles embedded within the body adjacent one surface thereof. When making the body, the phosphor particles are mixed with the epoxy when in an uncured condition and permitted to settle to the bottom surface of a mold within which the epoxy/phosphor mixture is contained. When the mixture subsequently cures to form a hardened body, the one surface of the body which cured against the bottom surface of the mold is coated with a thin layer of opaque material for preventing ambient light form entering the body through the one surface. The layer of opaque material is thereafter coated with a layer of protective material to provide the assembly with a damage-resistant entrance window.

  13. Scintillator assembly for alpha radiation detection and method of making the assembly

    DOEpatents

    McElhaney, S.A.; Bauer, M.L.; Chiles, M.M.

    1992-09-22

    A scintillator assembly for use in the detection of alpha radiation includes a body of optically-transparent epoxy and an amount of phosphor particles embedded within the body adjacent one surface thereof. When making the body, the phosphor particles are mixed with the epoxy when in an uncured condition and permitted to settle to the bottom surface of a mold within which the epoxy/phosphor mixture is contained. When the mixture subsequently cures to form a hardened body, the one surface of the body which cured against the bottom surface of the mold is coated with a thin layer of opaque material for preventing ambient light form entering the body through the one surface. The layer of opaque material is thereafter coated with a layer of protective material to provide the assembly with a damage-resistant entrance window. 6 figs.

  14. Mitigation of radiation nephropathy after internal {alpha}-particle irradiation of kidneys

    SciTech Connect

    Jaggi, Jaspreet Singh; Seshan, Surya V.; McDevitt, Michael R.; Sgouros, George; Hyjek, Elizabeth; Scheinberg, David A. . E-mail: d-scheinberg@ski.mskcc.org

    2006-04-01

    Purpose: Internal irradiation of kidneys as a consequence of radioimmunotherapy, radiation accidents, or nuclear terrorism can result in radiation nephropathy. We attempted to modify pharmacologically, the functional and morphologic changes in mouse kidneys after injection with the actinium ({sup 225}Ac) nanogenerator, an in vivo generator of {alpha}- and {beta}-particle emitting elements. Methods and Materials: The animals were injected with 0.35 {mu}Ci of the {sup 225}Ac nanogenerator, which delivers a dose of 27.6 Gy to the kidneys. Then, they were randomized to receive captopril (angiotensin-converting enzyme inhibitor), L-158,809 (angiotensin II receptor-1 blocker), spironolactone (aldosterone receptor antagonist), or a placebo. Results: Forty weeks after the {sup 225}Ac injection, the placebo-control mice showed a significant increase in blood urea nitrogen (BUN) (87.6 {+-} 6.9 mg/dL), dilated Bowman spaces, and tubulolysis with basement membrane thickening. Captopril treatment accentuated the functional (BUN 119.0 {+-} 4.0 mg/dL; p <0.01 vs. placebo controls) and histopathologic damage. In contrast, L-158,809 offered moderate protection (BUN 66.6 {+-} 3.9 mg/dL; p = 0.02 vs. placebo controls). Spironolactone treatment, however, significantly prevented the development of histopathologic and functional changes (BUN 31.2 {+-} 2.5 mg/dL; p <0.001 vs. placebo controls). Conclusions: Low-dose spironolactone and, to a lesser extent, angiotensin receptor-1 blockade can offer renal protection in a mouse model of internal {alpha}-particle irradiation.

  15. Thermal conditions on the International Space Station: Effects of operations of the station Main Radiators on the Alpha Magnetic Spectrometer

    NASA Astrophysics Data System (ADS)

    Xie, Min; Burger, Joseph

    2016-04-01

    A thermal model of the Alpha Magnetic Spectrometer on the International Space Station (ISS) has been developed, and Thermal Desktop® (with RadCAD®) and SINDA/FLUINT software have been used to calculate the effects of the operations of the ISS Main Radiators on AMS temperatures. We find that the ISS Starboard Main Radiator has significant influence on temperatures on the port side of AMS. The simulation results are used in AMS thermal control operations.

  16. SU-C-303-02: Correlating Metabolic Response to Radiation Therapy with HIF-1alpha Expression

    SciTech Connect

    Campos, D; Peeters, W; Nickel, K; Eliceiri, K; Kimple, R; Van Der Kogel, A; Kissick, M

    2015-06-15

    Purpose: To understand radiation induced alterations in cellular metabolism which could be used to assess treatment or normal tissue response to aid in patient-specific adaptive radiotherapy. This work aims to compare the metabolic response of two head and neck cell lines, one malignant (UM-SCC-22B) and one benign (Normal Oral Keratinocyte), to ionizing radiation. Responses are compared to alterations in HIF-1alpha expression. These dynamics can potentially serve as biomarkers in assessing treatment response allowing for patient-specific adaptive radiotherapy. Methods: Measurements of metabolism and HIF-1alpha expression were taken before and X minutes after a 10 Gy dose of radiation delivered via an orthovoltage x-ray source. In vitro changes in metabolic activity were measured via fluorescence lifetime imaging (FLIM) to assess the mean lifetime of NADH autofluorescence following a dose of 10 Gy. HIF-1alpha expression was measured via immunohistochemical staining of in vitro treated cells and expression was quantified using the FIJI software package. Results: FLIM demonstrated a decrease in the mean fluorescence lifetime of NADH by 100 ps following 10 Gy indicating a shift towards glycolytic pathways for malignant cells; whereas this benign cell line showed little change in metabolic signature. Immunohistochemical analysis showed significant changes in HIF-1alpha expression in response to 10 Gy of radiation that correlate to metabolic profiles. Conclusion: Radiation induces significant changes in metabolic activity and HIF-1alpha expression. These alterations occur on time scales approximating the duration of common radiation treatments (approximately tens of minutes). Further understanding these dynamics has important implications with regard to improvement of therapy and biomarkers of treatment response.

  17. The promoting effect of tumour necrosis factor alpha in radiation-induced cell transformation.

    PubMed Central

    Guo, R. F.; Gong, Y. F.

    1998-01-01

    The ability of tumour necrosis factor alpha (TNF-alpha), a potent endogenous inflammatory agent, to promote malignant transformation of Syrian hamster embryo cells (SHE) initiated by a 0.5-Gy dose of alpha-particles was investigated. Opsonized zymosan particles, which were phagocytosed by a human macrophage-like cell line, triggered TNF-alpha production from U937 cells. This cell supernatant could significantly increase the transformation frequency (TF) of primary SHE cells previously irradiated by a 0.5-Gy dose of alpha-particles. The TF decreased significantly if monoclonal antibody against TNF-alpha was added to the supernatant. Similarly, recombinant human TNF-alpha (rhTNF-alpha) increased the TF of alpha-irradiated primary SHE cells to an even greater extent. Addition of TNF-alpha to subcultures of irradiated SHE cells permitted the continuous propagation of these primary cells. In contrast, both TNF-alpha-treated control and alpha-irradiated cells without subsequent TNF-alpha treatment senesced after 7-15 passages. Irradiated SHE cells treated continuously with TNF-alpha could be subcultured over 40 passages and produced fibrosarcomas upon inoculation into nude mice. Our results provide the first evidence that TNF-alpha released by activated macrophages may contribute to the process of malignant transformation initiated by low-dose alpha-particles. PMID:9579824

  18. A two-temperature model of radiation damage in {alpha}-quartz

    SciTech Connect

    Phillips, Carolyn L.; Magyar, Rudolph J.; Crozier, Paul S.

    2010-10-14

    Two-temperature models are used to represent the physics of the interaction between atoms and electrons during thermal transients such as radiation damage, laser heating, and cascade simulations. We introduce a two-temperature model applied to an insulator, {alpha}-quartz, to model heat deposition in a SiO{sub 2} lattice. Our model of the SiO{sub 2} electronic subsystem is based on quantum simulations of the electronic response in a SiO{sub 2} repeat cell. We observe how the parametrization of the electronic subsystem impacts the degree of permanent amorphization of the lattice, especially compared to a metallic electronic subsystem. The parametrization of the insulator electronic subsystem has a significant effect on the amount of residual defects in the crystal after 10 ps. While recognizing that more development in the application of two-temperature models to insulators is needed, we argue that the inclusion of a simple electronic subsystem substantially improves the realism of such radiation damage simulations.

  19. Thermal conditions on the International Space Station: Heat flux and temperature investigation of main radiators for the Alpha Magnetic Spectrometer

    NASA Astrophysics Data System (ADS)

    Xie, Min; Gao, Jianmin; Wu, Shaohua; Qin, Yukun

    2016-09-01

    The investigation on heat flux can clarify the thermal condition and explain temperature behavior on the main radiators of the Alpha Magnetic Spectrometer (AMS). In this paper, a detailed investigation of heat flux on the AMS main radiators is proposed. The heat transfer process of the AMS main radiators is theoretically analyzed. An updated thermal model of the AMS on the International Space Station (ISS) is developed to calculate the external heat flux density on the AMS main radiators. We conclude the ISS components and operations affect on the solar flux density of the AMS main radiators by reflecting or shading solar illumination. According to the energy conservation on the AMS main radiators, the temperature variation mainly depends on the solar flux change. The investigations are conducive to reference for the long-duration thermal control of the AMS, and knowledge for the thermal conditions on the ISS.

  20. Calculation of the Electronic Parameters of an Al/DNA/p-Si Schottky Barrier Diode Influenced by Alpha Radiation

    PubMed Central

    Al-Ta’ii, Hassan Maktuff Jaber; Amin, Yusoff Mohd; Periasamy, Vengadesh

    2015-01-01

    Many types of materials such as inorganic semiconductors have been employed as detectors for nuclear radiation, the importance of which has increased significantly due to recent nuclear catastrophes. Despite the many advantages of this type of materials, the ability to measure direct cellular or biological responses to radiation might improve detector sensitivity. In this context, semiconducting organic materials such as deoxyribonucleic acid or DNA have been studied in recent years. This was established by studying the varying electronic properties of DNA-metal or semiconductor junctions when exposed to radiation. In this work, we investigated the electronics of aluminium (Al)/DNA/silicon (Si) rectifying junctions using their current-voltage (I-V) characteristics when exposed to alpha radiation. Diode parameters such as ideality factor, barrier height and series resistance were determined for different irradiation times. The observed results show significant changes with exposure time or total dosage received. An increased deviation from ideal diode conditions (7.2 to 18.0) was observed when they were bombarded with alpha particles for up to 40 min. Using the conventional technique, barrier height values were observed to generally increase after 2, 6, 10, 20 and 30 min of radiation. The same trend was seen in the values of the series resistance (0.5889–1.423 Ω for 2–8 min). These changes in the electronic properties of the DNA/Si junctions could therefore be utilized in the construction of sensitive alpha particle detectors. PMID:25730484

  1. On the excitation of Lyman beta and Balmer alpha radiation by electron-impact dissociation of methane

    NASA Technical Reports Server (NTRS)

    Mclaughlin, R. W.; Zipf, E. C.

    1978-01-01

    The cross sections for the excitation of Ly-beta and H-alpha when methane is dissociated by electron impact have values of 17.1 by 10 to the -19th power sq cm and 26.0 by 10 to the -19th power sq cm, respectively, at an electron impact energy of 100 eV. These results are in disagreement with the implications of recent polarization measurements of H-alpha radiation that suggest negligible H(3p) excitation in the dissociation of CH4 by electron impact.

  2. Measurement of potential alpha energy exposure and potential alpha energy concentration and estimating radiation dose of radon in Sari city in the north region of Iran.

    PubMed

    Rahimi, Seyed Ali; Nikpour, Behzad

    2014-12-01

    In dwellings in Sari city in the northern region of Iran, the potential alpha energy exposure (PAEE) and potential alpha energy concentration (PAEC) have been measured and the radiation dose due to radon and its progenies has been estimated. In this study, the dosemeters DOSEman and SARAD GmbH (Germany), which are sensitive to alpha particles, were used. The population of the city of Sari is 495,369 people and the density of population is 116.5 people per km(2). A percentage of the total household population of Sari in areas of geographically different samples was selected. The PAEE, PAEC and radon concentration in four different seasons in a year in homes for sampling were measured. The mean PAEE due to indoor radon in homes of four cities in Sari city was estimated to be 28.23 Bq m(-3) and the mean PAEC was estimated to be 27.11 Bq m(-3). Also the mean indoor radon level was found to be 29.95 Bq m(-3). The annual dose equivalent is ∼0.0151 μSv y(-1). Measurement results show that the average PAEE, PAEC and radon concentration are higher in winter than in other seasons. This difference could be due to stillness and lack of air movement indoors in winter.

  3. Transcriptional and Secretomic Profiling of Epidermal Cells Exposed to Alpha Particle Radiation

    PubMed Central

    Chauhan, Vinita; Howland, Matthew; Greene, Hillary Boulay; Wilkins, Ruth C

    2012-01-01

    Alpha (α)-particle emitters are probable isotopes to be used in a terrorist attack. The development of biological assessment tools to identify those who have handled these difficult to detect materials would be an asset to our current forensic capacity. In this study, for the purposes of biomarker discovery, human keratinocytes were exposed to α-particle and X-radiation (0.98 Gy/h at 0, 0.5, 1.0, 1.5 Gy) and assessed for differential gene and protein expression using microarray and Bio-Plex technology, respectively. Secretomic analysis of supernatants showed expression of two pro-inflammatory cytokines (IL-13 and PDGF-bb) to be exclusively affected in α-particle exposed cells. The highest dose of α-particle radiation modulated a total of 67 transcripts (fold change>|1.5|, (False discovery rate) FDR<0.05) in exposed cells. Several genes which responded with high expression levels (>2 fold) included KIF20A, NEFM, C7orf10, HIST1H2BD, BMP6, and HIST1H2AC. Among the high expressing genes, five (CCNB2, BUB1, NEK2, CDC20, AURKA) were also differentially expressed at the medium (1.0 Gy) dose however, these genes were unmodulated following exposure to X-irradiation. Networks of these genes clustered around tumor protein-53 and transforming growth factor-beta signaling. This study has identified some potential gene /protein responses and networks that may be validated further to confirm their specificity and potential to be signature biomarkers of α-particle exposure. PMID:23002402

  4. Telomere Length in Aged Mayak PA Nuclear Workers Chronically Exposed to Internal Alpha and External Gamma Radiation.

    PubMed

    Scherthan, Harry; Sotnik, Natalia; Peper, Michel; Schrock, Gerrit; Azizova, Tamara; Abend, Michael

    2016-06-01

    Telomeres consist of GC-rich DNA repeats and the "shelterin" protein complex that together protect chromosome ends from fusion and degradation. Telomeres shorten with age due to incomplete end replication and upon exposure to environmental and intrinsic stressors. Exposure to ionizing radiation is known to modulate telomere length. However, the response of telomere length in humans chronically exposed to radiation is poorly understood. Here, we studied relative telomere length (RTL) by IQ-FISH to leukocyte nuclei in a group of 100 workers from the plutonium production facility at the Mayak Production Association (PA) who were chronically exposed to alpha-emitting ((239)Pu) radiation and/or gamma (photon) radiation, and 51 local residents serving as controls, with a similar mean age of about 80 years. We applied generalized linear statistical models adjusted for age at biosampling and the second exposure type on a linear scale and observed an age-dependent telomere length reduction. In those individuals with the lowest exposure, a significant reduction of about 20% RTL was observed, both for external gamma radiation (≤1 Gy) and internal alpha radiation (≤0.05-0.1 Gy to the red bone marrow). In highly exposed individuals (>0.1 Gy alpha, 1-1.5 Gy gamma), the RTL was similar to control. Stratification by gender revealed a significant (∼30%) telomere reduction in low-dose-exposed males, which was absent in females. While the gender differences in RTL may reflect different working conditions, lifestyle and/or telomere biology, absence of a dose response in the highly exposed individuals may reflect selection against cells with short telomeres or induction of telomere-protective effects. Our observations suggest that chronic systemic exposure to radiation leads to variable dose-dependent effects on telomere length. PMID:27340887

  5. Telomere Length in Aged Mayak PA Nuclear Workers Chronically Exposed to Internal Alpha and External Gamma Radiation.

    PubMed

    Scherthan, Harry; Sotnik, Natalia; Peper, Michel; Schrock, Gerrit; Azizova, Tamara; Abend, Michael

    2016-06-01

    Telomeres consist of GC-rich DNA repeats and the "shelterin" protein complex that together protect chromosome ends from fusion and degradation. Telomeres shorten with age due to incomplete end replication and upon exposure to environmental and intrinsic stressors. Exposure to ionizing radiation is known to modulate telomere length. However, the response of telomere length in humans chronically exposed to radiation is poorly understood. Here, we studied relative telomere length (RTL) by IQ-FISH to leukocyte nuclei in a group of 100 workers from the plutonium production facility at the Mayak Production Association (PA) who were chronically exposed to alpha-emitting ((239)Pu) radiation and/or gamma (photon) radiation, and 51 local residents serving as controls, with a similar mean age of about 80 years. We applied generalized linear statistical models adjusted for age at biosampling and the second exposure type on a linear scale and observed an age-dependent telomere length reduction. In those individuals with the lowest exposure, a significant reduction of about 20% RTL was observed, both for external gamma radiation (≤1 Gy) and internal alpha radiation (≤0.05-0.1 Gy to the red bone marrow). In highly exposed individuals (>0.1 Gy alpha, 1-1.5 Gy gamma), the RTL was similar to control. Stratification by gender revealed a significant (∼30%) telomere reduction in low-dose-exposed males, which was absent in females. While the gender differences in RTL may reflect different working conditions, lifestyle and/or telomere biology, absence of a dose response in the highly exposed individuals may reflect selection against cells with short telomeres or induction of telomere-protective effects. Our observations suggest that chronic systemic exposure to radiation leads to variable dose-dependent effects on telomere length.

  6. Radiation damage induced by krypton ions in sintered alpha-Al2O3.

    PubMed

    Dalmasso, C; Iacconi, P; Beauvy, M; Lapraz, D; Balan, E; Calas, G

    2006-01-01

    Alpha-alumina is a useful thermoluminescence (TL) dosemeter. The knowledge of its behaviour under irradiation is thus of primary importance. The purpose of this paper is to characterise the radiation damage produced by swift krypton ions using various experimental methods, namely TL, optical absorption, fluorescence and electron paramagnetic resonance (EPR). After ion irradiation, the TL intensity is shown to decrease, whereas the optical absorption rises in the whole studied wavelength range. These two phenomena seem to be related to one another. Furthermore, optical absorption measurements highlight the appearance of new absorption bands probably owing to oxygen vacancies. Induced defects are also observed in the EPR spectra of irradiated pellets. They are likely related to electronic holes trapped on oxygen ions. The concentration of these defects increases with ion fluence and fluorescence measurements indicate that some pre-existing defects such as F2(2+) centres follow the same trend up to approximately 4.1 x 10(13) ions cm(-2).

  7. Radiation-induced cationic polymerization of limonene oxide,. cap alpha. -pinene oxide, and. beta. -pinene oxide

    SciTech Connect

    Aikins, J.A.; Williams, F.

    1985-01-01

    After suitable drying, the subject monomers in the form of neat liquids undergo radiation-induced polymerization with no apparent side reactions and high conversions to precipitatable polymers of low molecular weights. A high frequency of chain (proton) transfer to monomer is indicated by the fact that the kinetic chain lengths are estimated to be several hundred times larger than the range of DP/sub n/ values (12-4). Structural characterization of the limonene oxide polymer by /sup 1/H and /sup 13/C NMR spectroscopy provides conclusive evidence that the polymerization proceeds by the opening of the epoxide ring to yield a 1,2-trans polyether. Similar NMR studies on the polymers formed from the ..cap alpha..-pinene and ..beta..-pinene oxides show that the opening of the epoxide ring for these monomers is generally accompanied by the concomitant ring opening of the cyclobutane ring structure to yield a gem-di-methyl group in the main chain.

  8. Photodiode radiation hardness, lyman-alpha emitting galaxies and photon detection in liquid argon neutrino detectors

    NASA Astrophysics Data System (ADS)

    Baptista, Brian

    My dissertation is comprised of three projects: 1) studies of Lyman-alpha Emitting galaxies (LAEs), 2) radiation hardness studies of InGaAs photodiodes (PDs), and 3) scintillation photon detection in liquid argon (LAr) neutrino detectors. I began work on the project that has now become WFIRST, developing a science case that would use WFIRST after launch for the observation of LAEs. The radiation hardness of PDs was as an effort to support the WFIRST calibration team. When WFIRST was significantly delayed, I joined an R&D effort that applied my skills to work on photon detection in LAr neutrino detectors. I report results on a broadband selection method developed to detect high equivalent width (EW) LAEs. Using photometry from the CFHT-Legacy Survey Deep 2 and 3 fields, I have spectroscopically confirmed 63 z=2.5-3.5 LAEs using the WIYN/Hydra spectrograph. Using UV continuum-fitting techniques I computed properties such as EWs, internal reddening and star formation rates. 62 of my LAEs show evidence to be normal dust-free LAEs. Second, I present an investigation into the effects of ionizing proton radiation on commercial off-the-shelf InGaAs PDs. I developed a monochromator-based test apparatus that utilized NIST-calibrated reference PDs. I tested the PDs for changes to their dark current, relative responsivity as a function of wavelength, and absolute responsivity. I irradiated the test PDs using 30, 52, and 98 MeV protons at the IU Cyclotron Facility. I found the InGaAs PDs showed increased dark current as the fluence increased with no evidence of broadband response degradation at the fluences expected at an L2 orbit and a 10-year mission lifetime. Finally, I detail my efforts on technology development of both optical detector technologies and waveshifting light guide construction for LAr vacuum UV scintillation light. Cryogenic neutrino detectors use photon detection for both accelerator based science and for SNe neutrino detection and proton decay. I have

  9. alpha-Tocopherol, an inhibitor of epidermal lipid peroxidation, prevents ultraviolet radiation from suppressing the skin immune system.

    PubMed

    Yuen, K S; Halliday, G M

    1997-03-01

    We investigated the involvement of epidermal lipid peroxidation in the induction of ultraviolet radiation (UVR)-induced suppression of the skin immune system. The shaved dorsal skin of C3H/HeJ mice was irradiated with one of two subinflammatory solar-simulated UVR protocols 3 days per week for 4 weeks. Then half of 1 mg, 1, 2.5 or 5 mg alpha-tocopherol in a vehicle of acetone was topically applied to the shaved dorsal skin before UVR, A 5 mg dose of vitamin E gave complete protection against a UVR protocol that induced a 55% reduction in the contact hypersensitivity response to 2,4,6-trinitrochlorobenzene and a 23% reduction in epidermal Langerhans cell density. Lower doses were ineffective. alpha-Tocopherol was unable to protect against a higher UVR protocol. As 5 mg alpha-tocopherol did not prevent postirradiation inflammatory edema it is unlikely that the antioxidant acted as a sunscreen. However, 5 mg alpha-tocopherol inhibited UVR-induced epidermal lipid peroxidation, suggesting that this may be one mechanism by which alpha-tocopherol prevented UVR-induced local immunosuppression. Scavenging of UVR-generated lipid peroxides and reactive oxygen may have inhibited loss of cell membrane integrity preventing depletion of LC numbers, thus protecting from local immunosuppression.

  10. Radiation Transport of Heliospheric Lyman-alpha from Combined Cassini and Voyager Data Sets

    NASA Technical Reports Server (NTRS)

    Pryor, W.; Gangopadhyay, P.; Sandel, B.; Forrester, T.; Quemerais, E.; Moebius, E.; Esposito, L.; Stewart, I.; McClintock, W.; Jouchoux, A.; Colwell, J.; Izmodenov, V.; Malama, Y.; Shemansky, D.; Ajello, J.; Hansen, C.; Bzowski, M.

    2008-01-01

    Heliospheric neutral hydrogen scatters solar Lyman-alpha radiation from the Sun with '27-day' intensity modulations observed near Earth due to the Sun's rotation combined with Earth's orbital motion. These modulations are increasingly damped in amplitude at larger distances from the Sun due to multiple scattering in the heliosphere, providing a diagnostic of the interplanetary neutral hydrogen density independent of instrument calibration. This paper presents Cassini data from 2003-2004 obtained downwind near Saturn at approximately 10 AU that at times show undamped '27-day' waves in good agreement with the single-scattering models of Pryor et al., 1992. Simultaneous Voyager 1 data from 2003- 2004 obtained upwind at a distance of 88.8-92.6 AU from the Sun show waves damped by a factor of -0.21. The observed degree of damping is interpreted in terms of Monte Carlo multiple-scattering calculations (e.g., Keller et al., 1981) applied to two heliospheric hydrogen two-shock density distributions (discussed in Gangopadhyay et al., 2006) calculated in the frame of the Baranov-Malama model of the solar wind interaction with the two-component (neutral hydrogen and plasma) interstellar wind (Baranov and Malama 1993, Izmodenov et al., 2001, Baranov and Izmodenov, 2006). We conclude that multiple scattering is definitely occurring in the outer heliosphere. Both models compare favorably to the data, using heliospheric neutral H densities at the termination shock of 0.085 cm(exp -3) and 0.095 cm(exp -3). This work generally agrees with earlier discussions of Voyager data in Quemerais et al., 1996 showing the importance of multiple scattering but is based on Voyager data obtained at larger distances from the Sun (with larger damping) simultaneously with Cassini data obtained closer to the Sun.

  11. Radiation brain injury is reduced by the polyamine inhibitor [alpha]-difluoromethylornithine

    SciTech Connect

    Fike, J.R.; Seilhan, T.M.; Gobbel, G.T. ); Marton, L.J. )

    1994-04-01

    [alpha]-difluoromethylornithine (DFMO) was used to reduce [sup 125]I-induced brain injury in normal beagle dogs. Different DFMO doses and administration schedules were used to determine if the reduction in brain injury was dependent on dose and/or dependent upon when the drug was administered relative to the radiation treatment. Doses of DMFO of 75 mg/kg/day and 37.5 mg/kg/day given 2 days before, during and for 14 days after irradiation reduced levels of putrescine (PU) in the cerebrospinal fluid relative to controls. Volume of edema was significantly reduced by 75 mg/kg/day of DFMO before, during and after irradiation and by the same dose when the drug was started immediately after irradiation. A reduction in edema volume after 37.5 mg/kg/day of DFMO before, during and after irradiation was very near significance. Ultrafast CT studies performed on dogs that received a DFMO dose of 75 mg/kg/day before, during and after irradiation suggested that the reduce edema volume was associated with reduced vascular permeability. Volume of necrosis and volume of contrast enhancement (breakdown of the blood-brain barrier) were significantly lower than controls only after a DFMO dose of 75 mg/kg/day before, during and after irradiation. These latter data, coupled with the findings relative to edema, suggest that different mechanisms may be involved with respect to the effects of DFMO on brain injury, or that the extents of edema, necrosis and breakdown of the blood-brain barrier may depend upon different levels of polyamine depletion. The precise mechanisms by which DFMO exerts the effects observed here need to be determined. 41 refs., 5 figs.

  12. Influence of alpha and gamma radiations and non-radiation risk factors on the incidence of malignant liver tumors among Mayak PA workers.

    PubMed

    Tokarskaya, Z B; Zhuntova, G V; Scott, B R; Khokhryakov, V F; Belyaeva, Z D; Vasilenko, E K; Syrchikov, V A

    2006-10-01

    This Mayak worker-based study focuses on evaluating possible associations between malignant liver cancers and chronic alpha irradiation, chronic gamma irradiation, and non-radiation risk factors (alcohol consumption, smoking, viral hepatitis, chemical exposure, and chronic digestive diseases). This is the first multivariate study related to liver cancer among Mayak workers. The study was performed using the nested, case-control approach and includes 44 cases of malignant liver tumors diagnosed from 1972 to 1999, and 111 matched controls. Adjusted odds ratio (OR(ad)) was evaluated relative to a group of workers with alpha radiation doses to liver (D(alpha)) < 2.0 Gy. Dose estimates of D(alpha) > 2.0 Gy (corresponding (239)Pu body burden estimates >20.4 kBq) were significantly associated (p < 0.003) with the occurrence of hemangiosarcomas (HAS) but only marginal significance (0.05 < p < 0.1) was found for hepatocellular cancers (HCC). The ORad for HAS was 41.7 [95% confidence interval (CI): 4.6, 333] for a group with D(alpha) in the range >2.0-5.0 Gy and was 62.5 (7.4, 500) for a group with D(alpha) > 5.0-16.9 Gy. The attributable risk (AR) was calculated as 82%. For HCC, O(Rad) was estimated as 8.4 (0.8, 85.3; p < 0.07) for a group with D(alpha) in the range >2.0-9.3 Gy. For the indicated group, the AR was 14%. An association with high external gamma-ray doses (D(gamma)) to the total body was revealed for both HCC and for combined liver cancers when dose was treated as a continuous variable. However, we find no evidence that chronic low doses of gamma rays are associated with liver cancer occurrence. Cholangiocarcinoma (CHC) was not associated with either alpha- or gamma-ray exposure. As expected, an association between alcohol abuse and HCC was inferred [O(Rad) = 3.3 (1.2, 9); AR = 41%] but not for CHC or HAS.

  13. The influence of salt aerosol on alpha radiation detection by WIPP continuous air monitors

    SciTech Connect

    Bartlett, W.T.; Walker, B.A.

    1997-08-01

    Waste Isolation Pilot Plant (WIPP) alpha continuous air monitor (CAM) performance was evaluated to determine if CAMs could detect accidental releases of transuranic radioactivity from the underground repository. Anomalous alpha spectra and poor background subtraction were observed and attributed to salt deposits on the CAM sampling filters. Microscopic examination of salt laden sampling filters revealed that aerosol particles were forming dendritic structures on the surface of the sampling filters. Alpha CAM detection efficiency decreased exponentially as salt deposits increased on the sampling filters, suggesting that sampling-filter salt was performing like a fibrous filter rather than a membrane filter. Aerosol particles appeared to penetrate the sampling-filter salt deposits and alpha particle energy was reduced. These findings indicate that alpha CAMs may not be able to detect acute releases of radioactivity, and consequently CAMs are not used as part of the WIPP dynamic confinement system. 12 refs., 12 figs., 1 tab.

  14. Comparison of cytotoxic and genotoxic effects of plutonium-239 alpha particles and mobile phone GSM 900 radiation in the Allium cepa test.

    PubMed

    Pesnya, Dmitry S; Romanovsky, Anton V

    2013-01-20

    The goal of this study was to compare the cytotoxic and genotoxic effects of plutonium-239 alpha particles and GSM 900 modulated mobile phone (model Sony Ericsson K550i) radiation in the Allium cepa test. Three groups of bulbs were exposed to mobile phone radiation during 0 (sham), 3 and 9h. A positive control group was treated during 20min with plutonium-239 alpha-radiation. Mitotic abnormalities, chromosome aberrations, micronuclei and mitotic index were analyzed. Exposure to alpha-radiation from plutonium-239 and exposure to modulated radiation from mobile phone during 3 and 9h significantly increased the mitotic index. GSM 900 mobile phone radiation as well as alpha-radiation from plutonium-239 induced both clastogenic and aneugenic effects. However, the aneugenic activity of mobile phone radiation was more pronounced. After 9h of exposure to mobile phone radiation, polyploid cells, three-groups metaphases, amitoses and some unspecified abnormalities were detected, which were not registered in the other experimental groups. Importantly, GSM 900 mobile phone radiation increased the mitotic index, the frequency of mitotic and chromosome abnormalities, and the micronucleus frequency in a time-dependent manner. Due to its sensitivity, the A. cepa test can be recommended as a useful cytogenetic assay to assess cytotoxic and genotoxic effects of radiofrequency electromagnetic fields.

  15. Mutations of the human interferon alpha-2b (hIFN-α2b) gene in occupationally protracted low dose radiation exposed personnel.

    PubMed

    Shahid, Saman; Mahmood, Nasir; Chaudhry, Muhammad Nawaz; Sheikh, Shaharyar; Ahmad, Nauman

    2015-05-01

    Ionizing radiations impact human tissues by affecting the DNA bases which constitute genes. Human interferon alpha 2b gene synthesizes a protein which is an important anticancerous, immunomodulatory, anti-proliferative and antiviral protein. This study was aimed to identify interferon alpha-2b mutations as a consequence of the use of occupational chronic low dose radiation by hospital radiation exposed workers. A molecular analysis was done in which DNAs were extracted from blood samples from radiology, radiotherapy and nuclear medicine workers. The gene was amplified through polymerase chain reaction and further genetic data from sequencing results analyzed by bioinformatics tools in order to determine as to how mutations in interferon alpha 2b sequences will lead to changes in human interferon alpha-2b protein. A total of 41% gene mutations was detected among all radiation exposed workers in which higher percentage (5.4%) of base insertion mutations and 14% frameshift mutations were found in radiology workers. The chronic use of low dose of radiations by occupational workers has a significant correlation with mutational effects on interferon alpha 2b gene, further evident by depressed interferon alpha levels in serum. This can lead to depressed immunity in radiation exposed workers. Hematological profiling of this group also showed hyperimmune response in the form of lymphocytosis.

  16. Monte Carlo treatment of Lyman-alpha radiation in a plane-parallel atmosphere.

    NASA Technical Reports Server (NTRS)

    Modali, S. B.; Brandt, J. C.; Kastner, S. O.

    1972-01-01

    A Monte Carlo technique involving Stokes vectors is used to obtain the state of polarization and intensity of solar Lyman-alpha photons as they diffuse through a plane-parallel homogeneous model of earth's hydrogen envelope. Fine structure of Lyman-alpha and Doppler redistribution of frequencies are taken into account. Comparison of the results with Heath's observed upper limit for polarization of 1.5 per cent implies an optical thickness tau greater than 7 and intensities of 8-10 kilorayleighs for a solar Lyman-alpha flux of 5.8 ergs per sq cm per sec.

  17. Radiative processes in Alpha-ZnAl_2S4: Ti spinel type single crystals

    NASA Astrophysics Data System (ADS)

    Kulyuk, Leonid; Klokishner, Sophia; Sushkevich, Konstantin; Koshchug, Dmitrii; Boulon, Georges; Brenier, Alain; Fortin, Emery

    2008-06-01

    The radiative properties of the alpha-ZnAl_2S4 wide band -gap semiconductor (E_g=3.4eV) doped with Ti-ions are investigated . It is shown, that the ZnAl_2S_4:Ti spinel type crystals exhibit a IR luminescence in the spectral range 0.8-1.4 micrometers. The observed spectroscopic and temporal characteristics are assigned to the emission bands arising from the ligand - -Ti^4+ charge transfer for octahedral sites of titanium. Bulk stoichiometric alpha-ZnAl2S4:Ti crystals with impurity concentration 0.1-0.5 at % were grown by a closed tube vapor method with halogen as a transport agent. At temperatures T=2-300K the steady state and time-resolved photoluminescence (PL) studies, as well as the optical absorption measurements , were carried out in the spectral range 0.4-1.5 μm using a liquid nitrogen cooled Ge-detector or photomultiplier. The steady-state PL excitation was provided by Ar^+ (λ_ex1=514nm) and He-Ne (Lambda_ex2=633nm) lasers. The PL kinetics has been examined under pulsed excitation (tau_P~10^-8 s) with wavelengths: "green"-λ_ex1P=532nm and "red"-λ_ex2P=630nm (dye laser and OPO) close to Lambda_ex1 and λ_ex2. The EPR studies of the samples have been carried out as well. Under the "green" excitation (λ_ex1), that corresponds to the maximum of the Ti-impurity absorption (λ_abs~510nm), the steady -state PL spectra of ZnAl^2S^4:Ti crystals consist of 2 broad bands centered at λ_1=1.1μm and Lambda_20.8μm. Τhe first component λ_1 dominates in the spectrum at low temperatures (T<200K). At T~300K the shape of the integral spectrum practically is determined by the second broad band Lambda_2. At "red" excitation (λ_ex2, λ_ex2P) the main contribution to the PL spectra in the whole temperature range is provided by the second component, the kinetics of which obeys the exponential law with a single decay time. In contrast to the second band , the emission decay can be described by the superposition of two exponents with different lifetimes. At low

  18. Analysis of radiation risk from alpha particle component of solar particle events.

    PubMed

    Cucinotta, F A; Townsend, L W; Wilson, J W; Golightly, M J; Weyland, M

    1994-01-01

    The solar particle events (SPE) will contain a primary alpha particle component, representing a possible increase in the potential risk to astronauts during an SPE over the often studied proton component. We discuss the physical interactions of alpha particles important in describing the transport of these particles through spacecraft and body shielding. Models of light ion reactions are presented and their effects on energy and linear energy transfer (LET) spectra in shielding discussed. We present predictions of particle spectra, dose, and dose equivalent in organs of interest for SPE spectra typical of those occurring in recent solar cycles. The large events of solar cycle 19 are found to have substantial increase in biological risk from alpha particles, including a large increase in secondary neutron production from alpha particle breakup. PMID:11538031

  19. Alpha slow-moving high-density-lipoprotein subfraction in serum of a patient with radiation enteritis and peritoneal carcinosis

    SciTech Connect

    Peynet, J.; Legrand, A.; Messing, B.; Thuillier, F.; Rousselet, F.

    1989-04-01

    An alpha slow-moving high-density-lipoprotein (HDL) subfraction was seen in a patient presenting with radiation enteritis and peritoneal carcinosis, who was given long-term cyclic parenteral nutrition. This subfraction, observed in addition to normal HDL, was precipitated with low-density lipoproteins (LDL) and very-low-density lipoproteins (VLDL) by sodium phosphotungstate-magnesium chloride. The patient's serum lipoproteins were analyzed after fractionation by density gradient ultracentrifugation. The alpha slow-moving HDL floated in the ultracentrifugation subfractions with densities ranging from 1.028 to 1.084 kg/L, and their main apolipoproteins included apolipoprotein E in addition to apolipoprotein A-I. These HDL were larger than HDL2. The pathogenesis of this unusual HDL subfraction is hypothesized.

  20. DEVELOPMENT OF AN ON-LINE, REAL-TIME ALPHA RADIATION MEASURING INSTRUMENT FOR LIQUID STREAMS

    SciTech Connect

    1996-11-22

    The Department of Energy (DOE) has expressed a need for an on-line, real-time instrument for assaying alpha-emitting radionuclides (uranium and the transuranics) in effluent waters leaving DOE sites to ensure compliance with regulatory limits. Due to the short range of alpha particles in water ({approximately}40 Tm), it is necessary now to intermittently collect samples of water and send them to a central laboratory for analysis. A lengthy and costly procedure is used to separate and measure the radionuclides from each sample. Large variations in radionuclide concentrations in the water may go undetected due to the sporadic sampling. Even when detected, the reading may not be representative of the actual stream concentration. To address these issues, Tecogen, a division of Thermo Power Corporation, a Thermo Electron company, is developing a real-time, field-deployable, alpha monitor based on a solid-state silicon wafer semiconductor (patent pending, to be assigned to the Department of Energy). The Thermo Alpha Monitor (TAM) will serve to monitor effluent water streams (Subsurface Contaminants Focus Area) and will be suitable for process control of remediation as well as decontamination and decommissioning operations, such as monitoring scrubber or rinse water radioactivity levels (Mixed Waste Focus Area and D&D Focus Area). It would be applicable for assaying other liquids, such as oil, or solids after proper preconditioning. Rapid isotopic alpha air monitoring is also possible using this technology. This instrument for direct counting of alpha-emitters in aqueous streams is presently being developed by Thermo Power under a development program funded by the DOE Environmental Management program (DOE-EM), administered by the Morgantown Energy Technology Center (METC). Under this contract, Thermo Power has demonstrated a solid-state, silicon-based semiconductor instrument, which uses a proprietary film-based collection system to quantitatively extract the

  1. Monte Carlo treatment of Lyman-alpha. II - Radiation in a spherical atmosphere

    NASA Technical Reports Server (NTRS)

    Modali, S. B.; Brandt, J. C.; Kastner, S. O.

    1975-01-01

    Intensity and state of polarization of solar L-alpha photons as they diffuse through an inhomogeneous, spherically symmetric, isothermal geocorona are theoretically determined. The fine structure of L-alpha and Doppler redistribution of frequencies are taken into account. The calculation use the Monte Carlo technique involving Stokes vectors. Comparison of the results with OGO-4 and OSO-4 observed intensities at an altitude of 650 km shows good agreement. Calculations of the polarization versus solar zenith angle show a residual polarization at large zenith angles which is mainly due to multiply scattered photons.

  2. DEVELOPMENT OF AN ON-LINE, REAL-TIME ALPHA RADIATION MEASURING INSTRUMENT FOR LIQUID STREAMS

    SciTech Connect

    Unknown

    1999-03-14

    The US Department of Energy (DOE) has expressed a need for an on-line, real-time instrument for assaying alpha-emitting radionuclides (uranium and the transuranics) in effluent waters leaving DOE sites to ensure compliance with regulatory limits. Due to the short range of alpha particles in water ({approximately}40 Im), it is necessary now to intermittently collect samples of water and send them to a central laboratory for analysis. A lengthy and costly procedure is used to separate and measure the radionuclides from each sample. Large variations in radionuclide concentrations in the water may go undetected due to the sporadic sampling. Even when detected, the reading may not be representative of the actual stream concentration. To address these issues, the Advanced Technologies Group of Thermo Power Corporation (a Thermo Electron company) is developing a real-time, field-deployable alpha monitor based on a solid-state silicon wafer semiconductor (US Patent 5,652,013 and pending, assigned to the US Department of Energy). The Thermo Water Alpha Monitor will serve to monitor effluent water streams (Subsurface Contaminants Focus Area) and will be suitable for process control of remediation as well as decontamination and decommissioning (D and D) operations, such as monitoring scrubber or rinse water radioactivity levels (Mixed Waste, Plutonium, and D and D Focus Area). It would be applicable for assaying other liquids, such as oil, or solids after proper preconditioning. Rapid isotopic alpha air monitoring is also possible using this technology. This report details the program's accomplishments to date. Most significantly, the Alpha Monitoring Instrument was successfully field demonstrated on water 100X below the Environmental Protection Agency's proposed safe drinking water limit--down to under 1 pCi/1. During the Field Test, the Alpha Monitoring Instrument successfully analyzed isotopic uranium levels on a total of five different surface water, process water, and

  3. Enhancement of Lyman-. alpha. radiation following foil-induced dissociation of fast ionic hydrogen clusters H sub n sup +

    SciTech Connect

    Farizon, M.; Clouvas, A.; de Castro Faria, N.V.; Farizon-Mazuy, B.; Gaillard, M.J.; Gerlic, E. ); Denis, A.; Desesquelles, J.; Ouerdane, Y. )

    1991-01-01

    We have measured the Lyman-{alpha} radiation following foil breakup of hydrogen ionic clusters H{sub {ital n}}{sup +} ({ital n}=2 and {ital n}=3 to 61, odd) with velocities above and around the Bohr velocity. An enhancement of this radiation was observed and could reach a factor of 3 with respect to the proton case of the same velocity. Cluster mass number, velocity, and thickness dependences of the relative population of the 2{ital p} state in hydrogen fragments following H{sub {ital n}}{sup +} foil dissociation have been extracted. A specific collective effect on the 2{ital p}-state hydrogen has been observed and interpreted in terms of charge-exchange processes.

  4. Influence of reactor radiation on {alpha}-Al{sub 2}O{sub 3} in electrically insulating ceramic

    SciTech Connect

    Astapova, E.S.; Kostyukov, N.S.

    1995-11-01

    Under the action of radiation, structural changes occur in ceramic materials; these changes influence its mechanical properties and corrosion resistance. Neutron resistance has the strongest effect, inducing a number of complex processes. Most ceramic materials consist of one or more crystalline phases cemented by glass phases. Neutron radiation produces opposite density changes in the crystalline and glass phase. The conflict between these processes in the ceramic leads to increase in radiation resistance, which is the essence of the compensation effect. Thus, on irradiation, the density of crystalline quartz in the free state decreases by 15%, while the density of quartz glass increase by 3%, with corresponding changes in the volume of the phases. In porcelain, such changes facilitate an increase in strength. The radiational strength of ceramic materials was investigated - in particular, the structural changes in the irradiation of the ceramic by fast neutrons in a flux of no more than 2{center_dot}10{sup 20} cm{sup -2}. The main effects noticed after irradiation of the ceramic by fast distance and decrease in intensity of the diffractional maxima in the crystalline phases of the ceramic, for example, in the {alpha}-Al{sub 2}O{sub 3} phase of the ceramics microlite, GB-7, ultraporcelain, and 22KhS. In the initial state, GB-7 ceramic has a homogeneous, analogous, but the {alpha}-Al{sub 2}O{sub 3} crystals are smaller. According to chemical analysis, the mass fraction of aluminum oxide in GB-7 and 22KhS is 97.09% and 95.14%, respectively.

  5. A review of electrodeposition methods for the preparation of alpha-radiation sources.

    PubMed

    Crespo, M T

    2012-01-01

    This paper addresses an approach to the theory and practice of electrodeposition processes of alpha-emitting nuclides. Some of the main contributions made to this field are reviewed, including the rotating disk electrode technique. Also, several interpretations concerning the electrodeposition process as well as a number of practical recommendations are included in the study. PMID:21975108

  6. Radiative corrections to e/sup +/e/sup -/ reactions to all orders in. cap alpha. using the renormalization group

    SciTech Connect

    Tsai, Y.S.

    1983-01-01

    Renormalization group technique is used to improve the accuracy of the lowest order radiative corrections in QED. The exponentiation of infrared terms comes automatically. It also leads to exponentiation of the vertex functions. It predicts the existence of conversion of photons into pairs and the result agrees with the Kroll-Wada relation. Kinoshita-Lee-Nauenberg cancellation of mass singularities occurs to all order in ..cap alpha.. in leading log approximation in the final state if we sum over all the final states. Higher order corrections to the order ..cap alpha../sup 3/ asymmetry is shown to be small. The results are used to derive useful formulas for the radiative corrections to processes such as e/sup +/e/sup -/ ..-->.. ..mu../sup +/..mu../sup -/, e/sup +/e/sup -/ ..-->.. ..mu../sup +/..mu../sup -/..gamma.., e/sup +/e/sup -/ ..-->.. hadron continuum, e/sup +/e/sup -/ ..-->.. very narrow resonance such as phi, and e/sup +/e/sup -/ ..-->.. not very narrow resonance such as Z/sup 0/.

  7. The influence of salt aerosol on alpha radiation detection by WIPP continuous air monitors

    SciTech Connect

    Bartlett, W.T.; Walker, B.A.

    1996-01-01

    Alpha continuous air monitors (CAMs) will be used at the Waste Isolation Pilot Plant (WIPP) to measure airborne transuranic radioactivity that might be present in air exhaust or in work-place areas. WIPP CAMs are important to health and safety because they are used to alert workers to airborne radioactivity, to actuate air-effluent filtration systems, and to detect airborne radioactivity so that the radioactivity can be confined in a limited area. In 1993, the Environmental Evaluation Group (EEG) reported that CAM operational performance was affected by salt aerosol, and subsequently, the WIPP CAM design and usage were modified. In this report, operational data and current theories on aerosol collection were reviewed to determine CAM quantitative performance limitations. Since 1993, the overall CAM performance appears to have improved, but anomalous alpha spectra are present when sampling-filter salt deposits are at normal to high levels. This report shows that sampling-filter salt deposits directly affect radon-thoron daughter alpha spectra and overall monitor efficiency. Previously it was assumed that aerosol was mechanically collected on the surface of CAM sampling filters, but this review suggests that electrostatic and other particle collection mechanisms are more important than previously thought. The mechanism of sampling-filter particle collection is critical to measurement of acute releases of radioactivity. 41 refs.

  8. Oncogenic action of beta, proton, alpha and electron radiation on the rat skin

    SciTech Connect

    Burns, F.J.

    1980-01-01

    Rat skin is being utilized as an empirical model for testing dose and time related aspects of the oncogenic action of ionizing radiation, ultraviolet light, and polycyclic aromatic hydrocarbons. Molecular lesions in the skin DNA, including, strand breaks and thymine dimers, are being measured and compared to tumor induction. The induction and repair kinetics of molcular lesions are being compared to split dose repair. Modifiers and radiosensitizers are being utilized to test specific aspects of a chromosome breakage theory of radiation oncogenesis.

  9. Alterations in alpha-adrenergic and muscarinic cholinergic receptor binding in rat brain following nonionizing radiation

    SciTech Connect

    Gandhi, V.C.; Ross, D.H.

    1987-01-01

    Microwave radiation produces hyperthermia. The mammalian thermoregulatory system defends against changes in temperature by mobilizing diverse control mechanisms. Neurotransmitters play a major role in eliciting thermoregulatory responses. The involvement of adrenergic and muscarinic cholinergic receptors was investigated in radiation-induced hyperthermia. Rats were subjected to radiation at 700 MHz frequency and 15 mW/cm/sup 2/ power density and the body temperature was raised by 2.5 degrees C. Of six brain regions investigated only the hypothalamus showed significant changes in receptor states, confirming its pivotal role in thermoregulation. Adrenergic receptors, studied by (/sup 3/H)clonidine binding, showed a 36% decrease in binding following radiation after a 2.5 degrees C increase in body temperature, suggesting a mechanism to facilitate norepinephrine release. Norepinephrine may be speculated to maintain thermal homeostasis by activating heat dissipation. Muscarinic cholinergic receptors, studied by (3H)quinuclidinyl benzilate binding, showed a 65% increase in binding at the onset of radiation. This may be attributed to the release of acetylcholine in the hypothalamus in response to heat cumulation. The continued elevated binding during the period of cooling after radiation was shut off may suggest the existence of an extra-hypothalamic heat-loss pathway.

  10. Isochronal annealing of radiation damage in (alpha)- and (delta)-Pu alloys

    SciTech Connect

    McCall, S K; Fluss, M J; Chung, B W; Haire, R G

    2009-06-22

    Magnetic isochronal annealing curves were measured on specimens of self damaged {alpha}-Pu and several {delta}-Pu alloys stabilized by Ga and Am. These results are compared to one another and to isochronal resistivity annealing curves, where distinct differences are observed between the magnetic and resistive annealing for the case of {delta}-Pu. The first stage of annealing observed in the resistivity measurements is largely missing from the magnetic measurements, indicating that interstitials contribute little if any signal to the magnetization, while the onset of vacancy migration is strongly reflected in the magnetization signal.

  11. Mechanism and computational model for Lyman-{alpha}-radiation generation by high-intensity-laser four-wave mixing in Kr-Ar gas

    SciTech Connect

    Louchev, Oleg A.; Saito, Norihito; Wada, Satoshi; Bakule, Pavel; Yokoyama, Koji; Ishida, Katsuhiko; Iwasaki, Masahiko

    2011-09-15

    We present a theoretical model combined with a computational study of a laser four-wave mixing process under optical discharge in which the non-steady-state four-wave amplitude equations are integrated with the kinetic equations of initial optical discharge and electron avalanche ionization in Kr-Ar gas. The model is validated by earlier experimental data showing strong inhibition of the generation of pulsed, tunable Lyman-{alpha} (Ly-{alpha}) radiation when using sum-difference frequency mixing of 212.6 nm and tunable infrared radiation (820-850 nm). The rigorous computational approach to the problem reveals the possibility and mechanism of strong auto-oscillations in sum-difference resonant Ly-{alpha} generation due to the combined effect of (i) 212.6-nm (2+1)-photon ionization producing initial electrons, followed by (ii) the electron avalanche dominated by 843-nm radiation, and (iii) the final breakdown of the phase matching condition. The model shows that the final efficiency of Ly-{alpha} radiation generation can achieve a value of {approx}5x10{sup -4} which is restricted by the total combined absorption of the fundamental and generated radiation.

  12. Protective effects of alpha lipoic acid on radiation-induced salivary gland injury in rats

    PubMed Central

    Kim, Jin Hyun; Kim, Kyung Mi; Jung, Myeong Hee; Jung, Jung Hwa; Kang, Ki Mun; Jeong, Bae Kwon; Kim, Jin Pyeong; Park, Jung Je; Woo, Seung Hoon

    2016-01-01

    Purpose Radiation therapy is a treatment for patients with head and neck (HN) cancer. However, radiation exposure to the HN often induces salivary gland (SG) dysfunction. We investigated the effect of α-lipoic acid (ALA) on radiation-induced SG injury in rats. Results ALA preserved acinoductal integrity and acinar cell secretary function following irradiation. These results are related to the mechanisms by which ALA inhibits oxidative stress by inhibiting gp91 mRNA and 8-OHdG expression and apoptosis of acinar cells and ductal cells by inactivating MAPKs in the early period and expression of inflammation-related factors including NF-κB, IκB-α, and TGF-β1 and fibrosis in late irradiated SG. ALA effects began in the acute phase and persisted for at least 56 days after irradiation. Materials and Methods Rats were assigned to followings: control, ALA only (100 mg/kg, i.p.), irradiated, and ALA administered 24 h and 30 min prior to irradiation. The neck area including the SG was evenly irradiated with 2 Gy per minute (total dose, 18 Gy) using a photon 6-MV linear accelerator. Rats were killed at 4, 7, 28, and 56 days after radiation. Conclusions Our results show that ALA could be used to ameliorate radiation-induced SG injury in patients with HN cancer. PMID:27072584

  13. Note: Real time optical sensing of alpha-radiation emitting radioactive aerosols based on solid state nuclear track detector.

    PubMed

    Kulkarni, A; Ha, S; Joshirao, P; Manchanda, V; Bak, M S; Kim, T

    2015-06-01

    A sensitive radioactive aerosols sensor has been designed and developed. Its design guidance is based on the need for a low operational cost and reliable measurements to provide daily aerosol monitoring. The exposure of diethylene-glycol bis (allylcarbonate) to radiation causes modification of its physico-chemical properties like surface roughness and reflectance. In the present study, optical sensor based on the reflectance measurement has been developed with an aim to monitor real time presence of alpha radioactive aerosols emitted from thorium nitrate hydrate. The results shows that the fabricated sensor can detect 0.0157 kBq to 0.1572 kBq of radio activity by radioactive aerosols generated from (Th(NO3)4 ⋅ 5H2O) at 0.1 ml/min flow rate. The proposed instrument will be helpful to monitor radioactive aerosols in/around a nuclear facility, building construction sites, mines, and granite polishing factories. PMID:26133876

  14. Note: Real time optical sensing of alpha-radiation emitting radioactive aerosols based on solid state nuclear track detector.

    PubMed

    Kulkarni, A; Ha, S; Joshirao, P; Manchanda, V; Bak, M S; Kim, T

    2015-06-01

    A sensitive radioactive aerosols sensor has been designed and developed. Its design guidance is based on the need for a low operational cost and reliable measurements to provide daily aerosol monitoring. The exposure of diethylene-glycol bis (allylcarbonate) to radiation causes modification of its physico-chemical properties like surface roughness and reflectance. In the present study, optical sensor based on the reflectance measurement has been developed with an aim to monitor real time presence of alpha radioactive aerosols emitted from thorium nitrate hydrate. The results shows that the fabricated sensor can detect 0.0157 kBq to 0.1572 kBq of radio activity by radioactive aerosols generated from (Th(NO3)4 ⋅ 5H2O) at 0.1 ml/min flow rate. The proposed instrument will be helpful to monitor radioactive aerosols in/around a nuclear facility, building construction sites, mines, and granite polishing factories.

  15. Fluorescence Quenching of Alpha-Fetoprotein by Gold Nanoparticles: Effect of Dielectric Shell on Non-Radiative Decay

    NASA Astrophysics Data System (ADS)

    Zhu, Jian; Li, Jian-Jun; Wang, A.-Qing; Chen, Yu; Zhao, Jun-Wu

    2010-09-01

    Fluorescence quenching spectrometry was applied to study the interactions between gold colloidal nanoparticles and alpha-fetoprotein (AFP). Experimental results show that the gold nanoparticles can quench the fluorescence emission of adsorbed AFP effectively. Furthermore, the intensity of fluorescence emission peak decreases monotonously with the increasing gold nanoparticles content. A mechanism based on surface plasmon resonance-induced non-radiative decay was investigated to illuminate the effect of a dielectric shell on the fluorescence quenching ability of gold nanoparticles. The calculation results show that the increasing dielectric shell thickness may improve the monochromaticity of fluorescence quenching. However, high energy transfer efficiency can be obtained within a wide wavelength band by coating a thinner dielectric shell.

  16. Hit rates and radiation doses to nuclei of bone lining cells from alpha-particle-emitting radionuclides

    NASA Technical Reports Server (NTRS)

    Polig, E.; Jee, W. S.; Kruglikov, I. L.

    1992-01-01

    Factors relating the local concentration of a bone-seeking alpha-particle emitter to the mean hit rate have been determined for nuclei of bone lining cells using a Monte Carlo procedure. Cell nuclei were approximated by oblate spheroids with dimensions and location taken from a previous histomorphometric study. The Monte Carlo simulation is applicable for planar and diffuse labels at plane or cylindrical bone surfaces. Additionally, the mean nuclear dose per hit, the dose mean per hit, the mean track segment length and its second moment, the percentage of stoppers, and the frequency distribution of the dose have been determined. Some basic features of the hit statistics for bone lining cells have been outlined, and the consequences of existing standards of radiation protection with regard to the hit frequency to cell nuclei are discussed.

  17. Note: Real time optical sensing of alpha-radiation emitting radioactive aerosols based on solid state nuclear track detector

    SciTech Connect

    Kulkarni, A.; Bak, M. S. E-mail: moonsoo@skku.edu; Ha, S.; Joshirao, P.; Manchanda, V.; Kim, T. E-mail: moonsoo@skku.edu

    2015-06-15

    A sensitive radioactive aerosols sensor has been designed and developed. Its design guidance is based on the need for a low operational cost and reliable measurements to provide daily aerosol monitoring. The exposure of diethylene-glycol bis (allylcarbonate) to radiation causes modification of its physico-chemical properties like surface roughness and reflectance. In the present study, optical sensor based on the reflectance measurement has been developed with an aim to monitor real time presence of alpha radioactive aerosols emitted from thorium nitrate hydrate. The results shows that the fabricated sensor can detect 0.0157 kBq to 0.1572 kBq of radio activity by radioactive aerosols generated from (Th(NO{sub 3}){sub 4} ⋅ 5H{sub 2}O) at 0.1 ml/min flow rate. The proposed instrument will be helpful to monitor radioactive aerosols in/around a nuclear facility, building construction sites, mines, and granite polishing factories.

  18. Fluorescence Quenching of Alpha-Fetoprotein by Gold Nanoparticles: Effect of Dielectric Shell on Non-Radiative Decay.

    PubMed

    Zhu, Jian; Li, Jian-Jun; Wang, A-Qing; Chen, Yu; Zhao, Jun-Wu

    2010-06-15

    Fluorescence quenching spectrometry was applied to study the interactions between gold colloidal nanoparticles and alpha-fetoprotein (AFP). Experimental results show that the gold nanoparticles can quench the fluorescence emission of adsorbed AFP effectively. Furthermore, the intensity of fluorescence emission peak decreases monotonously with the increasing gold nanoparticles content. A mechanism based on surface plasmon resonance-induced non-radiative decay was investigated to illuminate the effect of a dielectric shell on the fluorescence quenching ability of gold nanoparticles. The calculation results show that the increasing dielectric shell thickness may improve the monochromaticity of fluorescence quenching. However, high energy transfer efficiency can be obtained within a wide wavelength band by coating a thinner dielectric shell.

  19. Tissue distribution and radiation dosimetry of astatine-211-labeled chimeric 81C6, an alpha-particle-emitting immunoconjugate.

    PubMed

    Zalutsky, M R; Stabin, M G; Larsen, R H; Bigner, D D

    1997-04-01

    A paired-label study was performed in athymic mice bearing subcutaneous D-54 MG human glioma xenografts to compare the localization of human/mouse anti-tenascin chimeric antibody 81C6 labeled by reaction with N-succinimidyl 3-[211At]astatobenzoate and N-succinimidyl 3-[131I]iodobenzoate. Over the 48-h observation period, the distribution of 211At- and 131I-labeled antibody were quite similar in tumor and normal tissues except stomach. These data were used to calculate human radiation doses for both intravenously and intrathecal administered 211At-labeled chimeric 81C6 using a quality factor of 5 for alpha-emissions.

  20. Plasminogen activator inhibitor-I-related regulation of procollagen I ({alpha}{sub 1} and {alpha}{sub 2}) by antitransforming growth factor-{beta}{sub 1} treatment during radiation-impaired wound healing

    SciTech Connect

    Schultze-Mosgau, Stefan; Thorwarth, Michael; Roedel, Franz; Melnychenko, Ivan; Grabenbauer, Gerhard G.; Amann, Kerstin; Wehrhan, Falk

    2006-01-01

    Purpose: Plasminogen activator inhibitor (PAI)-1 mediates transforming growth factor-{beta}{sub 1} (TGF-{beta}{sub 1})-related signaling by stimulating collagen Type I synthesis in radiation-impaired wound healing. The regulation of {alpha}(I)-procollagen is contradictory in fibroblasts of different fibrotic lesions. It is not known whether anti-TGF-{beta}{sub 1} treatment specifically inhibits {alpha}(I)-procollagen synthesis. We used an experimental wound healing study to address anti-TGF-{beta}{sub 1}-associated influence on {alpha}(I)-procollagen synthesis. Methods and Materials: A free flap was transplanted into the preirradiated (40 Gy) or nonirradiated neck region of Wistar rats: Group 1 (n = 8) surgery alone; Group 2 (n = 14) irradiation and surgery; Group 3 (n = 8) irradiation and surgery and anti-TGF-{beta}{sub 1} treatment. On the 14th postoperative day, skin samples were processed for fibroblast culture, in situ hybridization for TGF-{beta}{sub 1}, immunohistochemistry, and immunoblotting for PAI-1, {alpha}{sub 1}/{alpha}{sub 2}(I)-procollagen. Results: Anti-TGF-{beta}{sub 1} significantly reduced TGF-{beta}{sub 1} mRNA (p < 0.05) and PAI-1 expression (p < 0.05). Anti-TGF-{beta}{sub 1} treatment in vivo significantly reduced {alpha}{sub 1}(I)-procollagen protein (p < 0.05) and the number of expressing cells (p < 0.05) in contrast to significantly increased (p < 0.05) {alpha}{sub 2}(I)-procollagen expression. Conclusion: These results emphasize anti-TGF-{beta}{sub 1} treatment to reduce radiation-induced fibrosis by decreasing {alpha}{sub 1}(I)-procollagen synthesis in vivo. {alpha}{sub 1}(I)-procollagen and {alpha}{sub 2}(I)-procollagen might be differentially regulated by anti-TGF-{beta}{sub 1} treatment. Increased TGF-{beta} signaling in irradiated skin fibroblasts seemed to be reversible, as shown by a reduction in PAI-1 expression after anti-TGF-{beta}{sub 1} treatment.

  1. The 27-day versus 13.5-day variations in the solar Lyman-alpha radiation and the radio wave absorption in the lower ionosphere over Europe

    NASA Technical Reports Server (NTRS)

    Delamorena, B. A.; Lastovicka, Jan; Rapoport, Z. TS.; Alberca, L.

    1989-01-01

    In order to clarify the question of solar periods in absorption, the pattern was studied of the solar Lyman-alpha radiation (the principal ionizing agent of the lower ionosphere) and of the radio wave absorption at five widely spaced places in Europe. When the solar Lyman-alpha flux variability is very well developed, then it dominates in the lower ionospheric variability. The most pronounced Lyman-alpha variation on time scale day-month is the solar rotation variation (about 27 days). When the Lyman-alpha variability is developed rather poorly, as it is typical for periods dominated by the 13.5 day variability, then the lower ionospheric variability appears to be dominated by variations of meteorological origin. The conclusions hold for all five widely spaced placed in Europe.

  2. International comparison of cave radon concentrations identifying the potential alpha radiation risks to British cave users

    SciTech Connect

    Hyland, R.; Gunn, J.

    1994-08-01

    Elevated concentrations of {sup 222}Rn have been recorded in many limestone caves throughout the world. As prolonged exposure to high radon concentrations has been linked to cancer and tumors, particularly of the lung, a national survey of radon in British caves was undertaken. Passive radon detectors were exposed at 250 sites in 47 caves over four 7-d sampling periods. Mean concentrations ranging from 454-8,868 Bq m{sup {minus}3} were recorded. In one system, in the Peak District, radon concentrations of 155,000 Bq m{sup {minus}3} were recorded. The results indicate that the potential radiation dose from a single 4-h trip could exceed the national average annual background radiation dose (for the UK) from radon of 1.25 mSv. 18 refs., 3 tabs.

  3. Tumorigenic action of beta, proton, alpha and electron radiation on the rat skin

    SciTech Connect

    Burns, F.J.

    1980-01-01

    Rat skin is utilized as a model system for studying dose and time related aspects of the oncogenic action of ionizing radiation, ultraviolet light and polycyclic aromatic hydrocarbons. Molecular lesions in the DNA of the epidermis, including strand breaks and thymine dimers, are measured and compared to the temporal and dose related aspects of tumor induction. The induction and repair kinetics of molecular lesions are compared to split dose recovery as modified by sensitizers and type of radition of oncogenic damage.

  4. Genomic Profiling of a Human Leukemic Monocytic Cell-Line (THP-1) Exposed to Alpha Particle Radiation

    PubMed Central

    Chauhan, Vinita; Howland, Matthew

    2012-01-01

    This study examined alpha (α-) particle radiation effects on global changes in gene expression in human leukemic monocytic cells (THP-1) for the purposes of mining for candidate biomarkers that could be used for the development of a biological assessment tool. THP-1 cells were exposed to α-particle radiation at a dose range of 0 to 1.5 Gy. Twenty-four hours and three days after exposure gene expression was monitored using microarray technology. A total of 16 genes were dose responsive and classified as early onset due to their expression 24 h after exposure. Forty-eight transcripts were dose responsive and classified as late-onset as they were expressed 72 h after exposure. Among these genes, 6 genes were time and dose responsive and validated further using alternate technology. These transcripts were upregulated and associated with biological processes related to immune function, organelle stability and cell signalling/communication. This panel of genes merits further validation to determine if they are strong candidate biomarkers indicative of α-particle exposure. PMID:23097634

  5. Alpha Lipoic Acid Attenuates Radiation-Induced Thyroid Injury in Rats

    PubMed Central

    Jung, Jung Hwa; Jung, Jaehoon; Kim, Soo Kyoung; Woo, Seung Hoon; Kang, Ki Mun; Jeong, Bae-Kwon; Jung, Myeong Hee; Kim, Jin Hyun; Hahm, Jong Ryeal

    2014-01-01

    Exposure of the thyroid to radiation during radiotherapy of the head and neck is often unavoidable. The present study aimed to investigate the protective effect of α-lipoic acid (ALA) on radiation-induced thyroid injury in rats. Rats were randomly assigned to four groups: healthy controls (CTL), irradiated (RT), received ALA before irradiation (ALA + RT), and received ALA only (ALA, 100 mg/kg, i.p.). ALA was treated at 24 h and 30 minutes prior to irradiation. The neck area including the thyroid gland was evenly irradiated with 2 Gy per minute (total dose of 18 Gy) using a photon 6-MV linear accelerator. Greater numbers of abnormal and unusually small follicles in the irradiated thyroid tissues were observed compared to the controls and the ALA group on days 4 and 7 after irradiation. However, all pathologies were decreased by ALA pretreatment. The quantity of small follicles in the irradiated rats was greater on day 7 than day 4 after irradiation. However, in the ALA-treated irradiated rats, the numbers of small and medium follicles were significantly decreased to a similar degree as in the control and ALA-only groups. The PAS-positive density of the colloid in RT group was decreased significantly compared with all other groups and reversed by ALA pretreatment. The high activity index in the irradiated rats was lowered by ALA treatment. TGF-ß1 immunoreactivity was enhanced in irradiated rats and was more severe on the day 7 after radiation exposure than on day 4. Expression of TGF-ß1 was reduced in the thyroid that had undergone ALA pretreatment. Levels of serum pro-inflammatory cytokines (TNF-α, IL-1ß and IL-6) did not differ significantly between the all groups. This study provides that pretreatment with ALA decreased the severity of radiation-induced thyroid injury by reducing inflammation and fibrotic infiltration and lowering the activity index. Thus, ALA could be used to ameliorate radiation-induced thyroid injury. PMID:25401725

  6. Modification of radiation-induced brain injury by alpha-difluoromethylornithine.

    PubMed

    Gobbel, G T; Marton, L J; Lamborn, K; Seilhan, T M; Fike, J R

    1991-12-01

    The effect of alpha-difluoromethylornithine (DFMO) on 125I-induced brain injury was investigated in a dog model. Cerebrospinal putrescine levels were reduced from baseline levels 1-2 weeks after irradiation in animals treated with 125I and DFMO, while putrescine levels were elevated in 125I and saline-treated animals. In addition, the time course of changes in the volumes of edema, necrosis, and tissue showing evidence of blood-brain barrier breakdown was altered significantly by DFMO treatment. The most significant alterations occurred 2-4 weeks after irradiation, at which times the average volumes of damage in DFMO-treated animals were reduced compared to saline-treated animals. The time course of alterations in blood-to-brain transfer, brain-to-blood transfer, and vascularity following irradiation was also altered by DFMO treatment. Analysis of variance demonstrated a strong relationship of blood-to-brain transfer and vascularity to volume of edema, suggesting that the effect of DFMO on edema may be partially mediated by its effects on blood-brain barrier breakdown.

  7. Note: Application of laser produced plasma K{alpha} x-ray probe in radiation biology

    SciTech Connect

    Nishikino, Masaharu; Hasegawa, Noboru; Ishino, Masahiko; Kawachi, Tetsuya; Sato, Katsutoshi; Numasaki, Hodaka; Teshima, Tetruki; Ohshima, Shinsuke; Okano, Yasuaki; Nishimura, Hiroaki

    2010-02-15

    A dedicated radiation biology x-ray generation and exposure system has been developed. 8.0 keV in energy x-ray pulses generated with a femtosecond-laser pulse was used to irradiate sample cells through a custom-made culture dish with a silicon nitride membrane. The x-ray irradiation resulted in DNA double-strand breaks in the nucleus of a culture cell that were similar to those obtained with a conventional x-ray source, thus demonstrating the feasibility of radiobiological studies utilizing a single burst of x-rays focused on single cell specimens.

  8. Isotope effect in the photochemical decomposition of CO{sub 2} (ice) by Lyman-{alpha} radiation

    SciTech Connect

    Yuan Chunqing; Yates, John T. Jr.

    2013-04-21

    The photochemical decomposition of CO{sub 2}(ice) at 75 K by Lyman-{alpha} radiation (10.2 eV) has been studied using transmission infrared spectroscopy. An isotope effect in the decomposition of the CO{sub 2} molecule in the ice has been discovered, favoring {sup 12}CO{sub 2} photodecomposition over {sup 13}CO{sub 2} by about 10%. The effect is caused by electronic energy transfer from the excited CO{sub 2} molecule to the ice matrix, which favors quenching of the heavier electronically-excited {sup 13}CO{sub 2} molecule over {sup 12}CO{sub 2}. The effect is similar to the Menzel-Gomer-Redhead isotope effect in desorption from adsorbed molecules on surfaces when electronically excited. An enhancement of the rate of formation of lattice-trapped CO and CO{sub 3} species is observed for the photolysis of the {sup 12}CO{sub 2} molecule compared to the {sup 13}CO{sub 2} molecule in the ice. Only 0.5% of the primary photoexcitation results in O-CO bond dissociation to produce trapped-CO and trapped-CO{sub 3} product molecules and the majority of the electronically-excited CO{sub 2} molecules return to the ground state. Here either vibrational relaxation occurs (majority process) or desorption of CO{sub 2} occurs (minority process) from highly vibrationally-excited CO{sub 2} molecules in the ice. The observation of the {sup 12}C/{sup 13}C isotope effect in the Lyman-{alpha} induced photodecomposition of CO{sub 2} (ice) suggests that over astronomical time scales the isotope enrichment effect may distort historical information derived from isotope ratios in space wherever photochemistry can occur.

  9. Utility of Normal Tissue-to-Tumor {alpha}/{beta} Ratio When Evaluating Isodoses of Isoeffective Radiation Therapy Treatment Plans

    SciTech Connect

    Gay, Hiram A.; Jin Jianyue; Chang, Albert J.; Ten Haken, Randall K.

    2013-01-01

    Purpose: To achieve a better understanding of the effect of the number of fractions on normal tissue sparing for equivalent tumor control in radiation therapy plans by using equivalent biologically effective dose (BED) isoeffect calculations. Methods and Materials: The simple linear quadratic (LQ) model was assumed to be valid up to 10 Gy per fraction. Using the model, we formulated a well-known mathematical equality for the tumor prescription dose and probed and solved a second mathematical problem for normal tissue isoeffect. That is, for a given arbitrary relative isodose distribution (treatment plan in percentages), 2 isoeffective tumor treatment regimens (N fractions of the dose D and n fractions of the dose d) were denoted, which resulted in the same BED (corresponding to 100% prescription isodose). Given these situations, the LQ model was further exploited to mathematically establish a unique relative isodose level, z (%), for the same arbitrary treatment plan, where the BED to normal tissues was also isoeffective for both fractionation regimens. Results: For the previously stated problem, the relative isodose level z (%), where the BEDs to the normal tissue were also equal, was defined by the normal tissue {alpha}/{beta} ratio divided by the tumor {alpha}/{beta} times 100%. Fewer fractions offers a therapeutic advantage for those portions of the normal tissue located outside the isodose surface, z, whereas more fractions offer a therapeutic advantage for those portions of the normal tissue within the isodose surface, z. Conclusions: Relative isodose-based treatment plan evaluations may be useful for comparing isoeffective tumor regimens in terms of normal tissue effects. Regions of tissues that would benefit from hypofractionation or standard fractionation can be identified.

  10. Real-time, automated characterization of surfaces for alpha and beta radiation

    SciTech Connect

    Egidi, P.V.; Flynn, C.R.; Blair, M.S.; Selfridge, R.J.

    1997-12-31

    A new data collection system, called ABACUS{trademark}, has been developed that automates and expedites the collection, conversion, and reporting of radiological survey data of surfaces. Field testing of the system by Oak Ridge National Laboratory/Environmental Technology Section is currently underway. Preliminary results are presented. The system detects, discriminates, and separately displays the results for alpha and beta contamination scans on floors and walls with a single pass. Fixed-position static counting is also possible for quantitative measuring. The system is currently configured with five 100 cm{sup 2} dual-phosphor plastic scintillation detectors mounted in a lightweight aluminum fixture that holds the detectors in a fixed array. ABACUS{trademark} can be configured with other detectors if desired. Ratemeter/scalars traditionally coupled to individual detectors have been replaced by a single unit that houses the power supply and discriminator circuit boards to support up to five detectors. The system is designed to be used by a single operator. Each detector`s position and data are transmitted once per second and recorded on a nearby laptop computer. The data are converted to appropriate units, color-coded, and mapped to display graphically the findings for each detector in real-time. Reports can be generated immediately following the survey. Survey data can be exported in a variety of formats. Benefits of ABACUS{trademark} are: (1) immediate feedback to decision makers using the observational approach to characterization or remediation, (2) thorough documentation of survey results, (3) increased statistical confidence in scans by recording counts every second, (4) reduced paperwork and elimination of transcription errors, and (5) time and cost savings for collection, conversion, mapping, evaluating, and reporting data over traditional methods.

  11. Low-dose radiation pretreatment improves survival of human ceiling culture-derived proliferative adipocytes (ccdPAs) under hypoxia via HIF-1 alpha and MMP-2 induction

    SciTech Connect

    Adachi, Naoki; Kubota, Yoshitaka; Kosaka, Kentarou; Akita, Shinsuke; Sasahara, Yoshitarou; Kira, Tomoe; Kuroda, Masayuki; Mitsukawa, Nobuyuki; Bujo, Hideaki; Satoh, Kaneshige

    2015-08-07

    Poor survival is a major problem of adipocyte transplantation. We previously reported that VEGF and MMPs secreted from transplanted adipocytes are essential for angiogenesis and adipogenesis. Pretreatment with low-dose (5 Gy) radiation (LDR) increased VEGF, MMP-2, and HIF-1 alpha mRNA expression in human ceiling culture-derived proliferative adipocytes (hccdPAs). Gene expression after LDR differed between adipose-derived stem cells (hASCs) and hccdPAs. Pretreatment with LDR improved the survival of hccdPAs under hypoxia, which is inevitable in the early stages after transplantation. Upregulation of VEGF and MMP-2 after LDR in hccdPAs is mediated by HIF-1 alpha expression. Our results suggest that pretreatment with LDR may improve adipocyte graft survival in a clinical setting through upregulation of VEGF and MMP-2 via HIF-1 alpha. - Highlights: • Ceiling culture-derived proliferative adipocytes (ccdPAs) react to radiation. • Low-dose radiation (LDR) pretreatment improves survival of ccdPAs under hypoxia. • Gene expression after LDR differs between ccdPAs and adipose-derived stem cells. • LDR-induced increase in MMP-2 and VEGF is dependent on HIF-1 alpha induction. • LDR pretreatment may improve the adipocyte graft survival rate in clinical settings.

  12. Radiation and functional diversification of alpha keratins during early vertebrate evolution.

    PubMed

    Vandebergh, Wim; Bossuyt, Franky

    2012-03-01

    The conquest of land was arguably one of the most fundamental ecological transitions in vertebrates and entailed significant changes in skin structure and appendages to cope with the new environment. In extant tetrapods, the rigidity of the integument is largely created by type I and type II keratins, which are structural proteins essential in forming a strong cytoplasmic network. It is expected that such proteins have undergone fundamental changes in both stem and crown tetrapods. Here, we integrate genomic, phylogenetic, and expression data in a comprehensive study on the early evolution and functional diversification of tetrapod keratins. Our analyses reveal that all type I and type II tetrapod keratins evolved from only two genes that were present in the ancestor of extant vertebrates. Subsequently, the water-to-land transition in the stem lineage of tetrapods was associated with a major radiation and functional diversification of keratin genes. These duplications acquired functions that serve rigidity in integumental hard structures and were the prime for subsequent independent keratin diversification in tetrapod lineages. PMID:22046002

  13. Lyman-alpha radiative transfer during the epoch of reionization: contribution to 21-cm signal fluctuations

    NASA Astrophysics Data System (ADS)

    Semelin, B.; Combes, F.; Baek, S.

    2007-11-01

    During the epoch of reionization, Ly-α photons emitted by the first stars can couple the neutral hydrogen spin temperature to the kinetic gas temperature, providing an opportunity to observe the gas in emission or absorption in the 21-cm line. Given the bright foregrounds, it is particularly important to determine the fluctuation signature of the signal precisely, so as to be able to extract it by its correlation power. LICORICE is a Monte-Carlo radiative transfer code, coupled to the dynamics via an adaptative Tree-SPH code. We present here the Ly-α part of the implementation and validate it through three classical tests. Unlike previous works, we do not assume that P_α, the number of scatterings of Ly-α photons per atom per second, is proportional to the Ly-α background flux, but take the scatterings in the Ly-α line wings into account. The latter have the effect of steepening the radial profile of P_α around each source, and re-inforce the contrast of the fluctuations. In the particular geometry of cosmic filaments of baryonic matter, Ly-α photons are scattered out of the filament, and the large-scale structure of P_α is significantly anisotropic. This could have strong implications for the possible detection of the 21-cm signal.

  14. The Influence of the Photoionizing Radiation Spectrum on Metal-Line Ratios in Ly(alpha) Forest Clouds

    NASA Technical Reports Server (NTRS)

    Giroux, Mark L.; Shull, J. Michael

    1997-01-01

    Recent measurements of Si IV/C IV ratios in the high-redshift Ly(alpha) forest (Songaila & Cowie, AJ, 112, 335 (1996a); Savaglio et at., A&A (in press) (1997)) have opened a new window on chemical enrichment and the first generations of stars. However, the derivation of accurate Si/C abundances requires reliable ionization corrections, which are strongly dependent on the spectral shape of the metagalactic ionizing background and on the 'local effects' of hot stars in nearby galaxies. Recent models have assumed power-law quasar ionizing backgrounds plus a decrement at 4 Ryd to account for He II attenuation in intervening clouds. However, we show that realistic ionizing backgrounds based on cosmological radiative transfer models produce more complex ionizing spectra between 1-5 Ryd that are critical to interpreting ions of Si and C. We also make a preliminary investigation of the effects of He II ionization front nonoverlap. Because the attenuation and reemission by intervening clouds enhance Si IV relative to C the observed high Si IV/C IV ratios do not require an unrealistic Si overproduction (Si/C greater than or equal to 3 (Si/C)(solar mass)). If the ionizing spectrum is dominated by 'local effects' from massive stars, even larger Si IV/C IV ratios are possible. However, unless stellar radiation dominates quasars by more than a factor of 10, we confirm the evidence for some Si overproduction by massive stars; values Si/C approx. 2(Si/C)(solar mass) fit the measurements better than solar abundances. Ultimately, an adequate interpretation of the ratios of C IV, Si IV, and C II may require hot, collisionally ionized gas in a multiphase medium.

  15. Remote diagnostic of the hydrogen wall through measurements of the backscattered solar Lyman alpha radiation by Voyager 1/UVS in 1993-2003

    NASA Astrophysics Data System (ADS)

    Katushkina, O. A.; Quémerais, E.; Izmodenov, V. V.; Alexashov, D. B.; Sandel, B. R.

    2016-01-01

    We perform a new analysis of the Lyman alpha data obtained by Voyager 1 during the spatial scans in 1993-2003 while Voyager 1 was at 53-88 AU from the Sun. These data are the important source of information on the hydrogen distribution in the outer heliosphere. A sophisticated global kinetic-MHD model of the heliospheric interface and a radiative transfer model are used for the analysis. It is shown for the first time that the ratio of the Lyman alpha intensities detected in the downwind and upwind lines of sight in the outer heliosphere is sensitive to the configuration (peak value and location) of the hydrogen wall. The hydrogen wall is a source of Doppler-shifted backscattered Lyman alpha photons, so it can be seen from inside the heliosphere. Therefore, Voyager 1/ultraviolet spectrometer (UVS) Lyman alpha data can be used for remote sensing of the hydrogen wall. We show that our current global model of the outer heliosphere, which is consistent with many other measurements including Lyman alpha data from both Voyager 1 and 2 in 1980-1993, provides a systematically larger downwind to upwind intensity ratio compared with the UVS data in 1993-2003. In order to decrease the ratio, a higher and/or closer hydrogen wall is needed.

  16. The protective effects of ambroxol on radiation lung injury and influence on production of transforming growth factor beta1 and tumor necrosis factor alpha.

    PubMed

    Xia, De-Hong; Xi, Lei; Xv, Chen; Mao, Wei-Dong; Shen, Wei-Sheng; Shu, Zhong-Qin; Yang, Hong-Zhi; Dai, Min

    2010-09-01

    The aim of this article was to investigate the effect of ambroxol on radiation lung injury and the expression of transforming growth factor beta(1) (TGF-beta(1)), as well as tumor necrosis factor alpha (TNF-alpha) in plasma. Totally, 120 patients with locally advanced lung cancer in radiotherapy were randomized into treatment and control groups. Patients in the treatment group took ambroxol orally at a dosage of 90 mg, three times per day for 3 months from the beginning of radiotherapy. The expression of TGF-beta(1) and TNF-alpha in plasma was analyzed. The clinical symptoms and lung diffusing capacity were monitored using high resolving power computed tomography. The level of TGF-beta(1) in the control group was increased (11.8 +/- 5.5 ng/ml), whereas in ambroxol-treated patients, the increase was not significant (5.6 +/- 2.6 ng/ml, P < 0.001). Radiotherapy-induced elevation of TNF-alpha levels, seen in control patients, was also abolished after treatment with ambroxol (5.1 +/- 1.0 vs. 2.4 +/- 0.8 ng/ml, P < 0.001). In the treatment group, carbon monoxide diffusion capacity was not significantly decreased at 6, 12, and 18 months post-radiotherapy, compared with the control group (P < 0.05). Ambroxol decreased the expression of TGF-beta(1) and TNF-alpha, and minimized the diminishment of lung diffusion capacity after radiotherapy.

  17. Development of a personal dosimetry system based on optically stimulated luminescence of alpha-Al2O3:C for mixed radiation fields.

    PubMed

    Lee, S Y; Lee, K J

    2001-04-01

    To develop a personal optically stimulated luminescence (OSL) dosimetry system for mixed radiation fields using alpha-Al2O3:C, a discriminating badge filter system was designed by taking advantage of its optically stimulable properties and energy dependencies. This was done by designing a multi-element badge system for powder layered alpha-Al2O3:C material and an optical reader system based on high-intensity blue light-emitting diode (LED). The design of the multielement OSL dosimeter badge system developed allows the measurement of a personal dose equivalent value Hp(d) in mixed radiation fields of beta and gamma. Dosimetric properties of the personal OSL dosimeter badge system investigated here were the dose response, energy response and multi-readability. Based on the computational simulations and experiments of the proposed dosimeter design, it was demonstrated that a multi-element dosimeter system with an OSL technology based on alpha-Al2O3:C is suitable to obtain personal dose equivalent information in mixed radiation fields. PMID:11225704

  18. Multipurpose Radiation Resistant Semiconductor Detectors for Alpha, Neutron & Low Energy Gamma Ray Measurements at High Temperatures in High-Intensity Gamma Ray

    SciTech Connect

    Ruddy, Frank H.

    2005-06-01

    Work scheduled under year two of DOE Grant DE-FG02-04ER63734 is on schedule and all year-two milestones have or will be met. Results to date demonstrate that unprecedented silicon carbide (SiC) energy resolution has been obtained, and that SiC detectors may achieve energy resolution that exceeds that obtainable with the best silicon alpha spectrometers. Fast-neutron energy spectrometry measurements indicate that recoil-ion energy spectrometry should be possible with SiC detectors. Furthermore, SiC detectors have been demonstrated to perform well even after gamma-ray exposures of 1.E09 Rad. This result and the previously demonstrated capability of SiC detectors to operate in elevated-temperature environments are very promising for potential DOE EMSP applications. A new class of multipurpose, radiation-resistant semiconductor detectors that can be used in elevated-temperature and high-radiation environments is being developed under this grant. These detectors, based on silicon carbide (SiC) semiconductor are designed to have larger active volumes than previously available SiC detectors, and are being tested for their response to alpha particles, X-rays and low energy gamma rays, and fast neutrons. Specifically, SiC radiation detectors with larger areas and 100-micrometer thick active regions have been designed and manufactured according to detector-design specifications. Detectors based on a Schottky diode design were specified in order to minimize the effects of the detector entrance window on alpha particle measurements. During manufacture of the Schottky diodes, the manufacturer also provided a set of large-volume SiC p-i-n diodes for testing Extensive alpha particle measurements have been carried out to test and quantify the response of the SiC Schottky diodes. Exposures to 148-Gd, 213-Po, 217-At, 221-Fr, 225-Ac, 237-Np, 238-Pu, 240-Pu, and 242-Pu sources were used to obtain detailed alpha response data in the alpha energy range from 3182.787 keV to 8375.9 ke

  19. Dosimetric properties of alpha-Al(2)O(3):C exposed to ionizing and non-ionizing radiation

    NASA Astrophysics Data System (ADS)

    Colyott, Leslie Edward

    Scope and method of study. The trapping states of Czochralski-grown α-Al2O3:C were studied using a variety of experimental techniques, including thermoluminescence (TL), phototransferred thermoluminescence (PTTL) and optical absorption measurements. The focus was placed upon those states responsible for the dosimetric behavior of the α- Al2O3:C, following exposure to various forms of ionizing and non-ionizing radiation. Findings and conclusions. The most effective wavelengths for PTTL are in the short wavelength visible to UV range. The phototransfer processes are complex and appear to involve both electrons and holes. PTTL data suggest that the fading is due to the optical stimulation of charge from the traps into the delocalized bands. At short wavelengths the phototransfer of charge from deep traps into the dosimetry traps must be considered and, thus, the exact wavelength dependence is governed by the radiation and thermal history of the sample. The dose dependence of the TL peak suggests an overlap of several peaks resulting from an array of closely spaced energy levels. A dosimeter which measures the integrated ultraviolet-B (UVB) exposure in air or in water was developed as an application of the PTTL properties of α- Al2O3:C. This dosimeter exploits the increased phototransfer efficiency of α- Al2O3:C to light in the UVB region of the spectrum to produce a near-linear dynamic range of over three decades of UVB exposure. TL and PTTL signals are analyzed, using an algorithm which assumes that a distribution of trapping levels are responsible for the observed TL signals. The signals are deconvolved into unique distribution signatures, which enable the discrimination between irradiations due to gamma/beta, alpha and neutrons. Experiments involving the high temperature anneal of α-Al2O3:C powder in an oxygen atmosphere suggest a diffusion of oxygen vacancies out of the crystal lattice under these conditions, resulting in a decrease in F- and F+- centers. TL

  20. Mutations of the human interferon alpha-2b (hIFNα-2b) gene in low-dose natural terrestrial ionizing radiation exposed dwellers.

    PubMed

    Shahid, Saman; Mahmood, Nasir; Chaudhry, Muhammad Nawaz; Ahmad, Nauman

    2015-12-01

    Natural terrestrial ionizing radiations emerge from uranium deposits and can impact human tissues by affecting DNA bases which constitute genes. Human interferon alpha-2b (hIFNα-2b) gene synthesizes a protein which exhibits anticancerous, immunomodulatory, anti-proliferative and antiviral properties. This research aimed to find out hIFNα-2b gene mutations for those residents who were chronically exposed to low-dose natural terrestrial ionizing radiations. The gene amplifications was done through PCR technique and gene mutations were identified by bioinformatics in order to conclude as to how mutations identified in hIFNα-2b gene sequences will lead to alterations in the hIFNα-2b protein in radiation exposed residents. The range of radiation dose exposure was 0.4383-4.55832 (mSv/y) for the selected radiation exposed locations which were having uranium mineralization. Mutations (24%) in hIFNα-2b gene shows that some of the radiation exposed inhabitants were having a modulated immune response. The CBC (Complete Blood Count) parameters: WBC (White Blood Cells), MCH (Mean Corpuscular Hemoglobin), MCHC (MCH Concentration) and PLT (Platelets) on average were below the normal range in 24% radiation exposed subjects who were having hIFNα-2b gene mutations. Immunomodulation is observed by the mixed trend of either lymphocytosis or lymphopenia and neutropenia or neutrophilia in the exposed population. Thus, a radioactive exposure from uranium can affect the immune system and can induce mutations.

  1. Alpha particles as radiopharmaceuticals in the treatment of bone metastases: mechanism of action of radium-223 chloride (Alpharadin) and radiation protection.

    PubMed

    Cheetham, Philippa J; Petrylak, Daniel P

    2012-04-01

    Approximately 85% to 90% of men with castration-resistant prostate cancer (CRPC) have radiological evidence of bone metastases. To date, however, therapies to manage bone metastases have been primarily palliative. Among CRPC patients with bone metastases, there is a significant unmet need for active antitumor treatment options that are highly efficacious and have a favorable safety profile. This article will present current information about alpha-pharmaceuticals, a new class of targeted cancer therapy for the treatment of patients with CRPC and bone metastases. It will review preclinical and clinical studies of the experimental radiopharmaceutical radium-223 chloride (Alpharadin), a first-in-class, highly targeted and well-tolerated alpha-pharmaceutical under development to improve survival in patients with bone metastases from advanced prostate cancer. Alpharadin kills cancer cells via alpha radiation from the decay of radium-223, a calcium mimetic that naturally self-targets to bone metastases. The mechanism of action of Alpharadin and specifics of administration, radiation protection, and patient management will be discussed.

  2. HYDRODYNAMIC AND RADIATIVE MODELING OF TEMPORAL H{alpha} EMISSION V/R VARIATIONS CAUSED BY DISCONTINUOUS MASS TRANSFER IN BINARIES

    SciTech Connect

    Chadima, Pavel; Harmanec, Petr; Wolf, Marek; Firt, Roman; Ruzdjak, Domagoj; Bozic, Hrvoje; Koubsky, Pavel

    2011-07-15

    H{alpha} emission V/R variations caused by discontinuous mass transfer in interacting binaries with a rapidly rotating accreting star are modeled qualitatively for the first time. The program ZEUS-MP was used to create a non-linear three-dimensional hydrodynamical model of a development of a blob of gaseous material injected into an orbit around a star. It resulted in the formation of an elongated disk with a slow prograde revolution. The LTE radiative transfer program SHELLSPEC was used to calculate the H{alpha} profiles originating in the disk for several phases of its revolution. The profiles have the form of a double emission and exhibit V/R and radial velocity variations. However, these variations should be a temporal phenomenon since imposing a viscosity in the given model would lead to a circularization of the disk and fading-out of the given variations.

  3. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W.; Allander, Krag S.; Bounds, John A.

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  4. Background canceling surface alpha detector

    DOEpatents

    MacArthur, D.W.; Allander, K.S.; Bounds, J.A.

    1996-06-11

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

  5. Heating and ionization of stellar chromospheres by nonthermal proton beams: Implications for impulsive phase, redshifted Lyman-alpha radiation in stellar flares

    NASA Technical Reports Server (NTRS)

    Brosius, Jeffrey W.; Robinson, Richard D.; Maran, Stephen P.

    1995-01-01

    We investigate the physical basis for the timescale of impulsive-phase, redshifted Lyman-alpha emission in stellar flares on the assumption that it is determined by energy losses in a nonthermal proton beam that is penetrating the chromosphere from above. The temporal evolution of ionization and heating in representative model chromospheres subjected to such beams is calculated. The treatment of 'stopping' of beam protons takes into account their interactions with (1) electrons bound in neutral hydrogen, (2) nuclei of neutral hydrogen, (3) free electrons, and (4) ambient thermal protons. We find that, for constant incident beam flux, the system attains an equilibrium with the beam energy input to the chromosphere balanced by radiative losses. In equilibrium, the beam penetration depth is constant, and erosion of the chromosphere ceases. If the redshifted, impulsive-phase stellar flare Lyman-alpha emission is produced by downstreaming hydrogen formed through charge exchange between beam protons and ambient hydrogen, then the emission should end when the beam no longer reaches neutral hydrogen. The durations of representative emission events calculated on this assumption range from 0.1 to 14 s. The stronger the beam, the shorter the timescale over which the redshifted Lyman-alpha emission can be observed.

  6. X-radiation /E greater than 10 keV/, H-alpha and microwave emission during the impulsive phase of solar flares.

    NASA Technical Reports Server (NTRS)

    Vorpahl, J. A.

    1972-01-01

    A study has been made of the variation in hard (E greater than 10 keV) X-radiation, H-alpha and microwave emission during the impulsive phase of solar flares. Analysis shows that the rise-time in the 20-30-keV X-ray spike depends on the electron hardness. The impulsive phase is also marked by an abrupt, very intense increase in H-alpha emission in one or more knots of the flare. Properties of these H-alpha kernels include: (1) a luminosity several times greater than the surrounding flare, (2) an intensity rise starting about 20-30 sec before, peaking about 20-25 sec after, and lasting about twice as long as the hard spike, (3) a location lower in the chromosphere than the remaining flare, (4) essentially no expansion prior to the hard spike, and (5) a position within 6000 km of the boundary separating polarities, usually forming on both sides of the neutral line near both feet of the same tube of force. Correspondingly, impulsive microwave events are characterized by: (1) great similarity in burst structure with 20-32 keV X-rays but only above 5000 MHz, (2) typical low frequency burst cutoff between 1400-3800 MHz, and (3) maximum emission above 7500 MHz.

  7. Evaluation of internal alpha-particle radiation exposure and subsequent fertility among a cohort of women formerly employed in the radium dial industry

    SciTech Connect

    Schieve, L.A.; Davis, F.; Freels, S.

    1997-02-01

    This study examined the effect of internal exposure to {alpha}-particle radiation on subsequent fertility among women employed in radium dial industry prior to 1930, when appreciable amounts of radium were often ingested through the practice of pointing the paint brush with the lips. The analysis was limited to women for whom a radium body burden measurement had been obtained and who were married prior to age 45 (n = 603). Internal radiation dose to the ovary was calculated based on initial intakes of radium-226 and radium-228, average ovarian mass, number and energy of {alpha} particles emitted, fraction of energy absorbed within the ovary, effective retention integrals and estimated photon irradiation. Time between marriage and pregnancy, number of pregnancies and number of live births served as surrogates for fertility. Radiation appeared to have no effect on fertility at estimated cumulative ovarian dose equivalents below 5 Sv; above this dose, however, statistically significant declines in both number of pregnancies and live births were observed. These trends persisted after multivariable adjustment for potential confounding variables and after exclusion of subjects contributing a potential classification or selection bias to the study. Additionally, the high-dose group experienced fewer live births than would have been expected based on population rates. There were no differences in time to first pregnancy between high- and low-dose groups. These results are consistent with earlier studies of {gamma}-ray exposures and suggest that exposure to high doses of radiation from internally deposited radium reduces fertility rather than inducing sterility. 42 refs., 5 tabs.

  8. Evaluation of internal alpha radiation exposure and subsequent infertility among a cohort of women formerly employed in the radium dial industry.

    SciTech Connect

    Schieve, L. A.; Davis, F.; Roeske, J.; Handler, A.; Freels, S.; Stinchcomb, T.; Keane, A.; Environmental Research; Univ. of Illinois at Chicago; Univ. of Chicago; DePaul Univ.

    1997-02-01

    This study examined the effect of internal exposure to {alpha}-particle radiation on subsequent fertility among women employed in the radium dial industry prior to 1930, when appreciable amounts of radium were often ingested through the practice of pointing the paint brush with the lips. The analysis was limited to women for whom a radium body burden measurement had been obtained and who were married prior to age 45 (n=603). Internal radiation dose to the ovary was calculated based on initial intakes of radium-226 and radium-228, average ovarian mass, number and energy of {alpha} particles emitted, fraction of energy absorbed with in the ovary, effective retention integrals and estimated photon irradiation. Time between marriage and pregnancy, number of pregnancies and number of live births served as surrogates for fertility. Radiation appeared to have no effect on fertility at estimated cumulative ovarian dose equivalents below 5 Sv; above this dose, however, statistically significant declines in both number of pregnancies and live births were observed. These trends persisted after multivariable adjustment for potential confounding variables and after exclusion of subjects contributing a potential classification or selection bias to the study. Additionally, the high-dose group experienced fewer live births than would have been expected based on population rates. There were no differences in time to first pregnancy between high- and low-dose groups. These results are consistent with earlier studies of {gamma}-ray exposures and suggest that exposure to high doses of radiation from internally deposited radium reduces fertility rather than inducing sterility.

  9. Evaluation of internal alpha-particle radiation exposure and subsequent fertility among a cohort of women formerly employed in the radium dial industry.

    PubMed

    Schieve, L A; Davis, F; Roeske, J; Handler, A; Freels, S; Stinchcomb, T; Keane, A

    1997-02-01

    This study examined the effect of internal exposure to alpha-particle radiation on subsequent fertility among women employed in the radium dial industry prior to 1930, when appreciable amounts of radium were often ingested through the practice of pointing the paint brush with the lips. The analysis was limited to women for whom a radium body burden measurement had been obtained and who were married prior to age 45 (n = 603). Internal radiation dose to the ovary was calculated based on initial intakes of radium-226 and radium-228, average ovarian mass, number and energy of alpha particles emitted, fraction of energy absorbed within the ovary, effective retention integrals and estimated photon irradiation. Time between marriage and pregnancy, number of pregnancies and number of live births served as surrogates for fertility. Radiation appeared to have no effect on fertility at estimated cumulative ovarian dose equivalents below 5 Sv; above this dose, however, statistically significant declines in both number of pregnancies and live births were observed. These trends persisted after multivariable adjustment for potential confounding variables and after exclusion of subjects contributing a potential classification or selection bias to the study. Additionally, the high-dose group experienced fewer live births than would have been expected based on population rates. There were no differences in time to first pregnancy between high- and low-dose groups. These results are consistent with earlier studies of gamma-ray exposures and suggest that exposure to high doses of radiation from internally deposited radium reduces fertility rather than inducing sterility. PMID:9008216

  10. Do the various radiations present in BNCT act synergistically? Cell survival experiments in mixed alpha-particle and gamma-ray fields.

    PubMed

    Phoenix, Ben; Green, Stuart; Hill, Mark A; Jones, Bleddyn; Mill, Andrew; Stevens, David L

    2009-07-01

    In many radiotherapy situations patients are exposed to mixed field radiation. In particular in BNCT, as with all neutron beam exposures, a significant fraction of the dose is contributed by low LET gamma ray photons. The components of such a mixed field may show a synergistic interaction and produce a greater cell kill effect than would be anticipated from the independent action of the different radiation types. Such a synergy would have important implications for treatment planning and in the interpretation of clinical results. An irradiation setup has been created at the Medical Research Council in Harwell to allow simultaneous irradiation of cells by cobalt-60 gamma rays and plutonium-238 alpha-particles. The setup allows for variation of dose and dose rates for both sources along with variation of the alpha particle energy. A series of cell survival assays for this mixed field have been carried out using V79-4 cells and compared to exposures to the individual components of the field under identical conditions. In the experimental setup described no significant synergistic effect was observed.

  11. Multipurpose Radiation Resistant Semiconductor Detectors for Alpha, Neutron & Low Energy Gamma Ray Measurements at High Temperatures in High-Intensity Gamma Ray

    SciTech Connect

    Ruddy, Frank H.

    2005-06-01

    Work scheduled under year two of DOE Grant DE-FG02-04ER63734 is on schedule and all year-two milestones have or will be met. Results to date demonstrate that unprecedented silicon carbide (SiC) energy resolution has been obtained, and that SiC detectors may achieve energy resolution that exceeds that obtainable with the best silicon alpha spectrometers. Fast-neutron energy spectrometry measurements indicate that recoil-ion energy spectrometry should be possible with SiC detectors. Furthermore, SiC detectors have been demonstrated to perform well even after gamma-ray exposures of 1.E09 Rad. This result and the previously demonstrated capability of SiC detectors to operate in elevated-temperature environments are very promising for potential DOE EMSP applications. A new class of multipurpose, radiation-resistant semiconductor detectors that can be used in elevated-temperature and high-radiation environments is being developed under this grant. These detectors, based on silicon carbide (SiC) semiconductor are designed to have larger active volumes than previously available SiC detectors, and are being tested for their response to alpha particles, X-rays and low energy gamma rays, and fast neutrons.

  12. Event counting alpha detector

    DOEpatents

    Bolton, R.D.; MacArthur, D.W.

    1996-08-27

    An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

  13. Event counting alpha detector

    DOEpatents

    Bolton, Richard D.; MacArthur, Duncan W.

    1996-01-01

    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  14. Multipurpose Radiation Resistant Semiconductor Detectors for Alpha, Neutron & Low Energy Gamma Ray Measurements at High Temperatures in High-Intensity Gamma Ray

    SciTech Connect

    Ruddy, Frank H.

    2005-06-01

    Work scheduled under year two of DOE Grant DE-FG02-04ER63734 is on schedule and all year-two milestones have or will be met. Results to date demonstrate that unprecedented silicon carbide (SiC) energy resolution has been obtained, and that SiC detectors may achieve energy resolution that exceeds that obtainable with the best silicon alpha spectrometers. Fast-neutron energy spectrometry measurements indicate that recoil-ion energy spectrometry should be possible with SiC detectors. Furthermore, SiC detectors have been demonstrated to perform well even after gamma-ray exposures of 1.E09 Rad. This result and the previously demonstrated capability of SiC detectors to operate in elevated-temperature environments are very promising for potential DOE EMSP applications. A new class of multipurpose, radiation-resistant semiconductor detectors that can be used in elevated-temperature and high-radiation environments is being developed under this grant. These detectors, based on silicon carbide (SiC) semiconductor are designed to have larger active volumes than previously available SiC detectors, and are being tested for their response to alpha particles, X-rays and low energy gamma rays, and fast neutrons. Specifically, SiC radiation detectors with larger areas and 100-micrometer thick active regions have been designed and manufactured according to detector-design specifications. Detectors based on a Schottky diode design were specified in order to minimize the effects of the detector entrance window on alpha particle measurements. During manufacture of the Schottky diodes, the manufacturer also provided a set of large-volume SiC p-i-n diodes for testing Extensive alpha particle measurements have been carried out to test and quantify the response of the SiC Schottky diodes. Exposures to 148-Gd, 213-Po, 217-At, 221-Fr, 225-Ac, 237-Np, 238-Pu, 240-Pu, and 242-Pu sources were used to obtain detailed alpha response data in the alpha energy range from 3182.787 keV to 8375.9 ke

  15. Regulation of ionizing radiation-induced adhesion of breast cancer cells to fibronectin by alpha5beta1 integrin.

    PubMed

    Lee, Shin Hee; Cheng, Huiwen; Yuan, Ye; Wu, Shiyong

    2014-06-01

    Ionizing radiation (IR) is commonly used for cancer therapy, however, its potential influence on cancer metastatic potential remains controversial. In this study, we elucidated the role of integrins in regulation of IR-altered adhesion between breast cancer cells and extracellular matrix (ECM) proteins, which is a key step in the initial phase of metastasis. Our data suggest that the extent of effect that ionizing radiation had on cell adhesion depended on the genetic background of the breast cancer cells. Ionizing radiation was a better adhesion inducer for p53-mutated cells, such as MDA-MB-231 cells, than for p53 wild-type cells, such as MCF-7 cells. While IR-induced adhesions between MDA-MB-231 cells to fibronectin, laminin, collagen I and collagen IV, only blocking of the adhesion between α5β1 integrin and fibronectin using anti-α5β1 integrin antibody could completely inhibit the radiation-induced adhesion of the cells. A soluble Arg-Gly-Asp peptide, the binding motif for fibronectin binding integrins, could also reduce the adhesion of the cells to fibronectin with or without ionizing radiation exposure. The inhibition of the cell-fibronectin interaction also affected, but did not always correlate with, transwell migration of the cancer cells. In addition, our data showed that the total expression of α5 integrin and surface expression of α5β1 integrin were increased in the cells treated with ionizing radiation. The increased surface expression of α5β1 integrin, along with the adhesion between the cells and fibronectin, could be inhibited by both ataxia telangiectasia mutated (ATM) and Rad3-related (ATR) kinase inhibitors. These results suggested that ATM/ATR-mediated surface expression of α5β1 integrin might play a central role in regulation of ionizing radiation-altered adhesion. PMID:24785587

  16. A Polypodium leucotomos extract inhibits solar-simulated radiation-induced TNF-alpha and iNOS expression, transcriptional activation and apoptosis.

    PubMed

    Jańczyk, Agnieska; Garcia-Lopez, M Angeles; Fernandez-Peñas, Pablo; Alonso-Lebrero, Jose Luis; Benedicto, Ignacio; López-Cabrera, Manuel; Gonzalez, Salvador

    2007-10-01

    In this report, we have examined the molecular basis of the photoprotective effect of a hydrophilic extract of the fern Polypodium leucotomos (PL) in vitro, using a solar simulator as the source of UV radiation (SSR). We found that pretreatment of human keratinocytes with PL inhibited SSR-mediated increase of tumor necrosis factor (TNF)-alpha and also abrogated nitric oxide (NO) production. Consistent with this, PL blocked the induction of inducible nitric oxide synthase (iNOS) elicited by SSR. In addition, PL inhibited the SSR-mediated transcriptional activation of NF-kappaB and AP1. Finally, we demonstrated that pretreatment with PL exerted a cytoprotective effect against SSR-induced damage, resulting in increased cell survival. Together, these data postulate a multifactor mechanism of protection not exclusively reliant on the antioxidant capability of PL, and strengthen the basic knowledge on the photoprotective effect of this botanical agent.

  17. Observation of beam-induced changes in the polarization of Balmer-{alpha} radiation emitted following beam--tilted-foil transmission

    SciTech Connect

    Harper, D.L.; Albridge, R.G.; Tolk, N.H.; Qi, W.; Allred, D.D.; Knight, L.V.

    1995-12-01

    Measurements of the circular polarization of Balmer-{alpha} radiation emitted by excited hydrogen atoms, following the transmission of (20--50)-keV protons through thin, tilted amorphous carbon foils, exhibit markedly unexpected behavior as a function of exposure of the foil to the proton beam. Specifically, the circular polarization changes from an initially well understood tilt-angle dependence to a behavior which, for low tilt angles, gives the {ital opposite} {ital handedness} {ital of} {ital circular} {ital polarization} from that predicted. In addition, the degree of alignment, indicated by the linear Stokes parameter {ital M}/{ital I}, is enhanced also as a function of dose. These changes in the tilt-angle dependence of the Stokes parameters have been systematically correlated with beam-induced graphitization of the foil, which is observed to occur from Raman measurements.

  18. Molecular stress response in the CNS of mice after systemic exposureto interferon-alpha, ionizing radiation and ketamine

    SciTech Connect

    Lowe, Xiu R.; Marchetti, Francesco; Lu, Xiaochen; Wyrobek, Andrew J.

    2009-03-03

    We previously showed that the expression of troponin T1 (Tnnt 1) was induced in the central nervous system (CNS) of adultmice 30 min after treatment with ketamine, a glutamate N-methyl-D-aspartic acid (NMDA) receptor antagonist. We hypothesized that Tnnt 1 expression may be an early molecular biomarker of stress response in the CNS of mice. To further evaluate this hypothesis, we investigated the regional expression of Tnnt 1 in the mouse brain using RNA in situ hybridization 4 h after systemic exposure to interferon-a (IFN-a) and gamma ionizing radiation, both of which have be associated with wide ranges of neuropsychiatric complications. Adult B6C3F1 male mice were treated with either human IFN-a (a single i.p. injection at 1 x 105 IU/kg) or whole body gamma-radiation (10 cGy or 2 Gy). Patterns of Tnnt 1 transcript expression were compared in various CNS regions after IFN-a, radiation and ketamine treatments (previous study). Tnnt 1 expression was consistently induced in pyramidal neurons of cerebral cortex and hippocampus after all treatment regimens including 10 cGy of ionizing radiation. Regional expression of Tnnt 1 was induced in Purkinje cells of cerebellum after ionizing radiation and ketamine treatment; but not after IFN-a treatment. None of the three treatments induced Tnnt 1 expression in glial cells. The patterns of Tnnt 1 expression in pyramidal neurons of cerebral cortex andhippocampus, which are both known to play important roles in cognitive function, memory and emotion, suggest that the expression of Tnnt 1 may be an early molecular biomarker of induced CNS stress.

  19. SM22{alpha}-induced activation of p16{sup INK4a}/retinoblastoma pathway promotes cellular senescence caused by a subclinical dose of {gamma}-radiation and doxorubicin in HepG2 cells

    SciTech Connect

    Kim, Tae Rim; Lee, Hee Min; Lee, So Yong; Kim, Eun Jin; Kim, Kug Chan; Paik, Sang Gi; Cho, Eun Wie; Kim, In Gyu

    2010-09-10

    Research highlights: {yields} SM22{alpha} overexpression in HepG2 cells leads cells to a growth arrest state, and the treatment of a subclinical dose of {gamma}-radiation or doxorubicin promotes cellular senescence. {yields} SM22{alpha} overexpression elevates p16{sup INK4a} followed by pRB activation, but there are no effects on p53/p21{sup WAF1/Cip1} pathway. {yields} SM22{alpha}-induced MT-1G activates p16{sup INK4a}/pRB pathway, which promotes cellular senescence by damaging agents. -- Abstract: Smooth muscle protein 22-alpha (SM22{alpha}) is known as a transformation- and shape change-sensitive actin cross-linking protein found in smooth muscle tissue and fibroblasts; however, its functional role remains uncertain. We reported previously that SM22{alpha} overexpression confers resistance against anti-cancer drugs or radiation via induction of metallothionein (MT) isozymes in HepG2 cells. In this study, we demonstrate that SM22{alpha} overexpression leads cells to a growth arrest state and promotes cellular senescence caused by treatment with a subclinical dose of {gamma}-radiation (0.05 and 0.1 Gy) or doxorubicin (0.01 and 0.05 {mu}g/ml), compared to control cells. Senescence growth arrest is known to be controlled by p53 phosphorylation/p21{sup WAF1/Cip1} induction or p16{sup INK4a}/retinoblastoma protein (pRB) activation. SM22{alpha} overexpression in HepG2 cells elevated p16{sup INK4a} followed by pRB activation, but did not activate the p53/p21{sup WAF1/Cip1} pathway. Moreover, MT-1G, which is induced by SM22{alpha} overexpression, was involved in the activation of the p16{sup INK4a}/pRB pathway, which led to a growth arrest state and promoted cellular senescence caused by damaging agents. Our findings provide the first demonstration that SM22{alpha} modulates cellular senescence caused by damaging agents via regulation of the p16{sup INK4a}/pRB pathway in HepG2 cells and that these effects of SM22{alpha} are partially mediated by MT-1G.

  20. Multipurpose Radiation Resistant Semiconductor Detectors for Alpha, Neutron & Low Energy Gamma Ray Measurements at High Temperatures in High-Intensity Gamma Ray

    SciTech Connect

    Ruddy, Frank H

    2005-06-01

    Work scheduled under year two of DOE Grant DE-FG02-04ER63734 is on schedule and all year-two milestones have or will be met. Results to date demonstrate that unprecedented silicon carbide (SiC) energy resolution has been obtained, and that SiC detectors may achieve energy resolution that exceeds that obtainable with the best silicon alpha spectrometers. Fast-neutron energy spectrometry measurements indicate that recoil-ion energy spectrometry should be possible with SiC detectors. Furthermore, SiC detectors have been demonstrated to perform well even after gamma-ray exposures of 1.E09 Rad. This result and the previously demonstrated capability of SiC detectors to operate in elevated-temperature environments are very promising for potential DOE EMSP applications. A new class of multipurpose, radiation-resistant semiconductor detectors that can be used in elevated-temperature and high-radiation environments is being developed under this grant.

  1. Efficacy of Topical Alpha Ointment (Containing Natural Henna) Compared to Topical Hydrocortisone (1%) in the Healing of Radiation-Induced Dermatitis in Patients with Breast Cancer: A Randomized Controlled Clinical Trial

    PubMed Central

    Ansari, Mansour; Dehsara, Farzin; Mosalaei, Ahmad; Omidvari, Shapour; Ahmadloo, Niloofar; Mohammadianpanah, Mohammad

    2013-01-01

    Background: This two-arm, randomized clinical study aimed to compare efficacy between topical Alpha ointment and topical hydrocortisone cream (1%) in the healing of radiation-induced dermatitis in breast cancer patients. Methods: The inclusion criteria comprised newly pathologically proven, locally advanced breast cancer (treated with modified radical mastectomy followed by sequential adjuvant treatments, including chest wall radiotherapy [45-50.4 Gy]) and grade 2 and/or 3 chest wall dermatitis. The exclusion criteria were comprised of any underlying disease or medications interfering with the wound healing process, previous history of chest wall radiotherapy, and concurrent use of chemotherapy. Sixty eligible patients were randomly assigned to use either topical Alpha ointment (study arm, n=30) or topical hydrocortisone cream (1%) (control arm, n=30) immediately after receiving a total dose of 45-50 Gy chest wall radiotherapy. Results: The mean radiation dose was 49.1 Gy in the control arm and 48.8 Gy in the study arm. The mean dermatitis area was 13.54 cm2 in the control arm and 17.02 cm2 in the study arm. Topical Alpha ointment was more effective on the healing of radiation-induced dermatitis than was topical hydrocortisone cream (1%) (P=0.001). This effect was significant in the second week (P=0.007). In addition, Alpha ointment decreased the patients’ complaints such as pain (P<0.001), pruritus (P=0.009), and discharge (P=0.010) effectively and meaningfully. Conclusion: Topical Alpha ointment was more effective on the healing of radiation-induced dermatitis than was topical hydrocortisone cream (1%) in our patients with breast cancer. Trial Registration Numbers: IRCT201206099979N1, ACTRN12612000837820 PMID:24293782

  2. Long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.

    1993-02-02

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  3. Long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; Wolf, Michael A.; McAtee, James L.; Unruh, Wesley P.; Cucchiara, Alfred L.; Huchton, Roger L.

    1993-01-01

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  4. Lyman-alpha radiation of a probing metastable hydrogen beam to measure electric fields in diluted fluids and plasmas

    NASA Astrophysics Data System (ADS)

    Doveil, Fabrice

    2012-10-01

    The interaction between a metastable H(2s) atomic hydrogen beam and an external electric field leads to the emission of the Lyman-α line. It originates in the Stark mixing of the near-degenerate 2s1/2 and 2p1/2 levels separated by the Lamb shift [1]. The quenched radiation proportional to the square of the electric field amplitude is recovered in vacuum by using such an atomic probe beam. For larger electric field, saturation is observed and related to the beam finite transit time. We also observe the strong enhancement of the signal when the field is oscillating at the Lamb shift frequency. This technique is applied in a plasma, offering an alternative way to measure weak electric fields by direct and non-intrusive means [2]. [4pt] This work was inspired by late Prof. R.A. Stern to whom it is dedicated. It was done in collaboration with L. Ch'erigier-Kovacic. It was the subject of A. Lejeune's PhD thesis and was supported by a grant from Ministère de la Recherche. The author acknowledges the help of G. Bachet and G. Prasad for the conception and construction of the experimental set-up. [4pt] [1] W.E. Lamb, Jr., Rep. Prog. Phys. 14, 19 (1951)[0pt] [2] A. Lejeune, L. Ch'erigier-Kovacic, F. Doveil, Appl. Phys. Lett. 99, 181502 (2011)

  5. Does the Iron K and Alpha: Line of Active Galactic Nuclei Arise from the Cerenkov Line-like Radiation?

    NASA Technical Reports Server (NTRS)

    You, J. H.; Liu, D. B.; Chen, W. P.; Chen, L.; Zhang, S. N.

    2003-01-01

    When thermal relativistic electrons with isotropic distribution of velocities move in a gas region or impinge upon the surface of a cloud that consists of a dense gas or doped dusts, the Cerenkov effect produces peculiar atomic or ionic emission lines, which is known as the Cerenkov line - like radiation. This newly recognized emission mechanism may find wide applications in high-energy astrophysics. In this paper we tentatively adopt this new line emission mechanism to discuss the origin of the iron Kα feature of active galactic nuclei (AGNs). The motivation of this research is to attempt a solution to a problem encountered by the "disk fluorescence line" model, i.e. , the lack of temporal response of the observed iron Kα line flux to the changes of the X-ray continuum flux. If the Cerenkov line emission is indeed responsible significant ly for the iron Kα feature, the conventional scenario around the central supermassive black holes of AGNs would need to be modified to accomodate more energetic, more violent, and much denser environments than previously thought.

  6. Epidermal Platelet-activating Factor Receptor Activation and Ultraviolet B Radiation Result in Synergistic Tumor Necrosis Factor-alpha Production

    PubMed Central

    Wolverton, Jay E.; Al-Hassani, Mohammed; Yao, Yongxue; Zhang, Qiwei; Travers, Jeffrey B.

    2010-01-01

    Ultraviolet B radiation (UVB) is a potent stimulator of epidermal cytokine production which has been implicated in photoaggravated dermatoses. In addition to cytokines such as tumor necrosis factor-α (TNF-α), UVB generates bioactive lipids including platelet-activating factor (PAF). Our previous studies have demonstrated that UVB-mediated production of keratinocyte TNF-α is in part due to PAF. The current studies use a human PAF-receptor (PAF-R) negative epithelial cell line transduced with PAF-Rs and PAF–R-deficient mice to demonstrate that activation of the epidermal PAF-R along with UVB irradiation results in a synergistic production of TNF-α. It should be noted that PAF-R effects are mimicked by the protein kinase C (PKC) agonist phorbol myristic acetate, and are inhibited by pharmacological antagonists of the PKC gamma isoenzyme. These studies suggest that concomitant PAF-R activation and UVB irradiation results in a synergistic production of the cytokine TNF-α which is mediated in part via PKC. These studies provide a novel potential mechanism for photosensitivity responses. PMID:19769579

  7. Alpha particle emitters in medicine

    SciTech Connect

    Fisher, D.R.

    1989-09-01

    Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ({sup 211}At) and natural bismuth-212 ({sup 212}Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ({sup 223}Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs.

  8. Ultraviolet radiation-induced tumor necrosis factor alpha, which is linked to the development of cutaneous SCC, modulates differential epidermal microRNAs expression

    PubMed Central

    Singh, Ashok; Willems, Estelle; Singh, Anupama; Hafeez, Bilal Bin; Ong, Irene M.; Mehta, Suresh L.; Verma, Ajit Kumar

    2016-01-01

    Chronic exposure to ultraviolet radiation (UVR) is linked to the development of cutaneous squamous cell carcinoma (SCC), a non-melanoma form of skin cancer that can metastasize. Tumor necrosis factor-alpha (TNFα), a pro-inflammatory cytokine, is linked to UVR-induced development of SCC. To find clues about the mechanisms by which TNFα may promote UVR-induced development of SCC, we investigated changes in the expression profiling of microRNAs (miRNA), a novel class of short noncoding RNAs, which affects translation and stability of mRNAs. In this experiment, TNFα knockout (TNFα KO) mice and their wild type (WT) littermates were exposed to acute UVR (2.0 kJ/m2) and the expression profiling of epidermal miRNA was determined 4hr post UVR exposure. TNFα deletion in untreated WT mice resulted in differential expression (log fold change>1) of seventeen miRNA. UVR exposure in WT mice induced differential expression of 22 miRNA. However, UVR exposure in TNFα KO mice altered only two miRNAs. Four miRNA, were differentially expressed between WT+UVR and TNFα KO+UVR groups. Differentially expressed selected miRNAs were further validated using real time PCR. Few of the differentially expressed miRNAs (miR-31-5p, miR-196a-5p, miR-127-3p, miR-206-3p, miR-411-5p, miR-709, and miR-322-5p) were also observed in UVR-induced SCC. Finally, bio-informatics analysis using DIANA, MIRANDA, Target Scan, and miRDB algorithms revealed a link with major UVR-induced pathways (MAPK, PI3K-Akt, transcriptional mis-regulation, Wnt, and TGF-beta). PMID:26918454

  9. Monte Carlo simulation of age-dependent radiation dose from alpha- and beta-emitting radionuclides to critical trabecular bone and bone marrow targets

    NASA Astrophysics Data System (ADS)

    Dant, James T.; Richardson, Richard B.; Nie, Linda H.

    2013-05-01

    Alpha (α) particles and low-energy beta (β) particles present minimal risk for external exposure. While these particles can induce leukemia and bone cancer due to internal exposure, they can also be beneficial for targeted radiation therapies. In this paper, a trabecular bone model is presented to investigate the radiation dose from bone- and marrow-seeking α and β emitters to different critical compartments (targets) of trabecular bone for different age groups. Two main issues are addressed with Monte Carlo simulations. The first is the absorption fractions (AFs) from bone and marrow to critical targets within the bone for different age groups. The other issue is the application of 223Ra for the radiotherapy treatment of bone metastases. Both a static model and a simulated bone remodeling process are established for trabecular bone. The results show significantly lower AFs from radionuclide sources in the bone volume to the peripheral marrow and the haematopoietic marrow for adults than for newborns and children. The AFs from sources on the bone surface and in the bone marrow to peripheral marrow and haematopoietic marrow also varies for adults and children depending on the energy of the particles. Regarding the use of 223Ra as a radionuclide for the radiotherapy of bone metastases, the simulations show a significantly higher dose from 223Ra and its progeny in forming bone to the target compartment of bone metastases than that from two other more commonly used β-emitting radiopharmaceuticals, 153Sm and 89Sr. There is also a slightly lower dose from 223Ra in forming bone to haematopoietic marrow than that from 153Sm and 89Sr. These results indicate a higher therapy efficiency and lower marrow toxicity from 223Ra and its progeny. In conclusion, age-related changes in bone dimension and cellularity seem to significantly affect the internal dose from α and β emitters in the bone and marrow to critical targets, and 223Ra may be a more efficient

  10. Radiation

    NASA Video Gallery

    Outside the protective cocoon of Earth's atmosphere, the universe is full of harmful radiation. Astronauts who live and work in space are exposed not only to ultraviolet rays but also to space radi...

  11. Studies on the effect of electron beam radiation on the molecular structure of ultra-high molecular weight polyethylene under the influence of alpha-tocopherol with respect to its application in medical implants.

    PubMed

    Parth, M; Aust, N; Lederer, K

    2002-10-01

    Ultra-high molecular weight polyethylene (UHMW-PE) is being used successfully for articulating surfaces in joint endoprostheses, especially for cups of total hip endoprostheses. Sintered specimens containing various amounts of alpha-tocopherol (vitamin E) as a biocompatible stabilizer, were irradiated in nitrogen atmosphere as well as in air with various dosages of electron beam radiation. Size exclusion chromatography (SEC) was used to analyze the soluble fractions of the UHMW-PE samples according to their molecular weight distribution prior to and after irradiation. In nitrogen atmosphere the radiation-induced crosslinking showed to be dependent on the added amount of alpha-tocopherol in the sintered specimens. With an increasing content of alpha-tocopherol, the stabilizer acted as a scavenger for free radicals. Thus, the crosslinking was more and more hindered. The same effect was observed on the samples irradiated in air, where, in addition to the crosslinking process, oxidative molecular degradation occurred. The highest extent of crosslinked material was yielded with unstabilized samples in nitrogen atmosphere. PMID:15348184

  12. Relative Biologic Effects of Low-Dose-Rate {alpha}-Emitting {sup 227}Th-Rituximab and {beta}-Emitting {sup 90}Y-Tiuexetan-Ibritumomab Versus External Beam X-Radiation

    SciTech Connect

    Dahle, Jostein Bruland, Oyvind S.; Larsen, Roy H.

    2008-09-01

    Purpose: To determine the relative biologic effects (RBE) of {alpha}-particle radiation from {sup 227}Th-rituximab and of {beta}-radiation from {sup 90}Y-tiuexetan-ibritumomab (Zevalin) compared with external beam X-radiation in the Raji lymphoma xenograft model. Methods and Materials: Radioimmunoconjugates were administered intravenously in nude mice with Raji lymphoma xenografts at different levels of activity. Absorbed dose to tumor was estimated by separate biodistribution experiments for {sup 227}Th-rituximab and Zevalin. Tumor growth was measured two to three times per week after injection or X-radiation. Treatment-induced increase in growth delay to reach tumor volumes of 500 and 1,000 mm{sup 3}, respectively, was used as an end point. Results: The absorbed radiation dose-rate in tumor was slightly more than 0.1 Gy/d for the first week following injection of {sup 227}Th-rituximab, and thereafter gradually decreased to 0.03 Gy/d at 21 days after injection. For treatment with Zevalin the maximum dose-rate in tumor was achieved already 6 h after injection (0.2 Gy/d), and thereafter decreased to 0.01 Gy/d after 7 days. The relative biologic effect was between 2.5 and 7.2 for {sup 227}Th-rituximab and between 1 and 1.3 for Zevalin. Conclusions: Both at low doses and low-dose-rates, the {sup 227}Th-rituximab treatment was more effective per absorbed radiation dose unit than the two other treatments. The considerable effect at low doses suggests that the best way to administer low-dose-rates, {alpha}-emitting radioimmunoconjugates is via multiple injections.

  13. Alpha Thalassemia

    MedlinePlus

    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  14. Confirmation of a Low {alpha}/{beta} Ratio for Prostate Cancer Treated by External Beam Radiation Therapy Alone Using a Post-Treatment Repeated-Measures Model for PSA Dynamics

    SciTech Connect

    Proust-Lima, Cecile; Taylor, Jeremy M.G.; Secher, Solene; Sandler, Howard; Kestin, Larry; Pickles, Tom; Bae, Kyoungwha; Allison, Roger; Williams, Scott

    2011-01-01

    Purpose: To estimate the {alpha}/{beta} ratio of prostate cancer treated with external beam radiation only by use of a model of long-term prostate-specific antigen (PSA) dynamics. Methods and Materials: Repeated measures of PSA from 5,093 patients from 6 institutions treated for localized prostate cancer by external beam radiation therapy (EBRT) without planned androgen deprivation were analyzed. A biphasic linear mixed model described the post-treatment evolution of PSA, rather than a conventional model of time to biochemical recurrence. The model was adjusted for standard prognostic factors (T stage, initial PSA level, and Gleason score) and cohort-specific effects. The radiation dose fractionation effect was estimated from the long-term rate of rise of PSA level. Results: Adjusted for other factors, total dose of EBRT and sum of squared doses per fraction were associated with long-term rate of change of PSA level (p = 0.0017 and p = 0.0003, respectively), an increase of each being associated with a lower rate of rise. The {alpha}/{beta} ratio was estimated at 1.55 Gy (95% confidence band, 0.46-4.52 Gy). This estimate was robust to adjustment of the linear mixed model. Conclusions: By analysis of a large EBRT-only cohort along with a method that uses all the repeated measures of PSA after the end of treatment, a low and precise {alpha}/{beta} was estimated. These data support the use of hypofractionation at fractional doses up to 2.8 Gy but cannot presently be assumed to accurately represent higher doses per fraction.

  15. Technical evaluation of the prototype ORNL alpha radiation detector/probe with the AN/PDR-77 RADIAC set. Technical report, Nov 91-Jan 92

    SciTech Connect

    Basso, M.J.; Kaplowitz, I.A.

    1992-06-01

    A new alpha particle detector, designed and fabricated by the Oak Ridge National Laboratory (ORNL) was procured and technically evaluated by the U.S. Army. Two of the three detectors procured were tested under guidelines obtained from U.S. Army requirements for an alpha detector probe. The probes represent the state-of-the-art in alpha particle detector design and fabrication affording ruggedness in design, accuracy at low count rates(+ or - 10%) below 30 CPM, excellent operating temperature (-30 to 60 deg C), and insensitivity to gamma rays (CS-137) up to 2 R/hr. Its unique feature centers on the solid state construction of the alpha detector which is composed of a transparent epoxy having embedded silver actuated zinc sulfide as the scintillator. A flat light pipe coupled to a photomultiplier tube provides the light sensing design. Test results indicate a drop in response as one approaches the edge of the detector face due to the geometry of a flat light pipe design, suggesting a redesign from a flat geometry to one having a cone shape.

  16. Nanoscale mechanical properties of polymer composites: Changes in elastic modulus and measurement of ion penetration depth due to {alpha}-radiation

    SciTech Connect

    Chien, Allen T.; Felter, Tom; LeMay, James D.; Balooch, Mehdi

    2000-04-01

    The local mechanical properties of silica-reinforced silicone composites were investigated using a modified atomic force microscopy technique. Elastic modulus measurements (1.5{+-}0.1 MPa) are consistent with bulk measurements (1.9 MPa), and changes in the modulus at the surface of the composite samples (E=1.5 to 3.5 MPa) were observed as a result of {alpha}-irradiation (dose=1.7x10{sup 10} to 2.0x10{sup 12} {alpha}/cm{sup 2}). The sensitivity of the technique was demonstrated by a detectable change in modulus at even the small dose of 1.7x10{sup 10} {alpha}/cm{sup 2}. The penetration depth of the {alpha}-particles into the material, estimated to be 22{+-}2 {mu}m from the sample edge, was determined by cross-section depth profiling; and modeling of the ion penetration depth using transport of ions in matter codes (24.4{+-}0.4 {mu}m) closely matched experimental observations. (c) 2000 Materials Research Society.

  17. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  18. Study of radiation effects on the cell structure and evaluation of the dose delivered by x-ray and {alpha}-particles microscopy

    SciTech Connect

    Kosior, Ewelina; Cloetens, Peter; Deves, Guillaume; Ortega, Richard; Bohic, Sylvain

    2012-12-24

    Hard X-ray fluorescence microscopy and magnified phase contrast imaging are combined to study radiation effects on cells. Experiments were performed on freeze-dried cells at the nano-imaging station ID22NI of the European synchrotron radiation facility. Quantitative phase contrast imaging provides maps of the projected mass and is used to evaluate the structural changes due to irradiation during X-ray fluorescence experiments. Complementary to phase contrast imaging, scanning transmission ion microscopy is performed and doses of all the experiments are compared. We demonstrate the sensitivity of the proposed approach to study radiation-induced damage at the sub-cellular level.

  19. In vitro effects of infrared A radiation on the synthesis of MMP-1, catalase, superoxide dismutase and GADD45 alpha protein.

    PubMed

    Costa, Adilson; Eberlin, Samara; Clerici, Stefano P; Abdalla, Beatrice M Z

    2015-01-01

    Harmful influences in the process of photoaging and skin damage are associated with infrared A (IRA) radiation, such as, disturbance of dermal extracellular matrix by up regulation of matrix metalloproteinase-1 (MMP1). Furthermore, DNA damage, induction of cytotoxicity and oxidative stress by decreasing natural antioxidant ability has been reported after acute exposure to IRA. The present study provides additional evidence that IRA radiation response in human skin fibroblasts produces deleterious effects to the cell, such as accelerating aging and weakening of their antioxidant defense mechanism. Human skin fibroblasts were exposed to a non-cytotoxic dose of IRA radiation and cultured for different periods for further collection of cell-free supernatants and lysates, and quantification of MMP-1, catalase, superoxide dismutase, and GADD45a. Our results corroborate previous published data and strongly indicate a negative impact of IRA radiation on the skin physiological by mechanisms involving reduced endogenous antioxidant enzymatic defense, increased MMP-1 and decreased repair process of DNA by reducing GADD45a protein, in cultured human fibroblasts. From a clinical perspective, IRA radiation acts by mechanisms distinct from those observed in ultraviolet radiation indicating the need for developing and making available cosmetics for skin care with properties beyond protection exerted by traditional sunscreens. PMID:26490662

  20. In vitro effects of infrared A radiation on the synthesis of MMP-1, catalase, superoxide dismutase and GADD45 alpha protein.

    PubMed

    Costa, Adilson; Eberlin, Samara; Clerici, Stefano P; Abdalla, Beatrice M Z

    2015-01-01

    Harmful influences in the process of photoaging and skin damage are associated with infrared A (IRA) radiation, such as, disturbance of dermal extracellular matrix by up regulation of matrix metalloproteinase-1 (MMP1). Furthermore, DNA damage, induction of cytotoxicity and oxidative stress by decreasing natural antioxidant ability has been reported after acute exposure to IRA. The present study provides additional evidence that IRA radiation response in human skin fibroblasts produces deleterious effects to the cell, such as accelerating aging and weakening of their antioxidant defense mechanism. Human skin fibroblasts were exposed to a non-cytotoxic dose of IRA radiation and cultured for different periods for further collection of cell-free supernatants and lysates, and quantification of MMP-1, catalase, superoxide dismutase, and GADD45a. Our results corroborate previous published data and strongly indicate a negative impact of IRA radiation on the skin physiological by mechanisms involving reduced endogenous antioxidant enzymatic defense, increased MMP-1 and decreased repair process of DNA by reducing GADD45a protein, in cultured human fibroblasts. From a clinical perspective, IRA radiation acts by mechanisms distinct from those observed in ultraviolet radiation indicating the need for developing and making available cosmetics for skin care with properties beyond protection exerted by traditional sunscreens.

  1. Development of new analytical method based on beta-alpha coincidence method for selective measurement of 214Bi-214Po-application to dust filter used in radiation management.

    PubMed

    Sanada, Yukihisa; Tanabe, Yoichiro; Iijima, Nobuo; Momose, Takumaro

    2011-07-01

    The radionuclide pair (214)Bi and (214)Po which belongs to the uranium series interferes with airborne radionuclide measurement needed for the radiation management of a nuclear facility. Time intervals between (214)Bi (β) and (214)Po (α) are much shorter than artificial radionuclides due to the short half-life of (214)Po (164 μs). The purpose of this study is to develop of a new analytical method (time interval analysis: TIA) based on the beta-alpha coincidence method for selective measurement of (214)Bi-(214)Po. The developed method was applied to an actual dust-filter measurement. The TIA system was highly effective in measuring of the filter with background subtraction. PMID:21531747

  2. Bremsstrahlung in {alpha} Decay Reexamined

    SciTech Connect

    Boie, H.; Scheit, H.; Jentschura, U. D.; Koeck, F.; Lauer, M.; Schwalm, D.; Milstein, A. I.; Terekhov, I. S.

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the {alpha} decay of {sup 210}Po has been performed, which allows us to follow the photon spectra up to energies of {approx}500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the {alpha} particle and the emitted photon.

  3. NACA Physicist Studying Alpha Rays

    NASA Technical Reports Server (NTRS)

    1957-01-01

    NACA Physicits studying Alpha Rays in a continuous cloud chamber. A cloud chamber is used by Lewis scientists to obtain information aimed at minimizing undesirable effects of radiation on nuclear-powered aircraft components. Here, alpha particles from a polonium source emit in a flower-like pattern at the cloud chamber's center. The particles are made visible by means of alcohol vapor diffusing from an area at room temperature to an area at minus -78 deg. Centigrade. Nuclear-powered aircraft were never developed and aircraft nuclear propulsion systems were canceled in the early 1960s.

  4. Bremsstrahlung in alpha decay reexamined.

    PubMed

    Boie, H; Scheit, H; Jentschura, U D; Köck, F; Lauer, M; Milstein, A I; Terekhov, I S; Schwalm, D

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the alpha decay of (210)Po has been performed, which allows us to follow the photon spectra up to energies of approximately 500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the alpha particle and the emitted photon.

  5. Radioimmunotherapy with alpha-particle emitting radionuclides.

    PubMed

    Zalutsky, M R; Pozzi, O R

    2004-12-01

    An important consideration in the development of effective strategies for radioimmunotherapy is the nature of the radiation emitted by the radionuclide. Radionuclides decaying by the emission of alpha-particles offer the possibility of matching the cell specific reactivity of monoclonal antibodies with radiation with a range of only a few cell diameters. Furthermore, alpha-particles have important biological advantages compared with external beam radiation and beta-particles including a higher biological effectiveness, which is nearly independent of oxygen concentration, dose rate and cell cycle position. In this review, the clinical settings most likely to benefit from alpha-particle radioimmunotherapy will be discussed. The current status of preclinical and clinical research with antibodies labeled with 3 promising alpha-particle emitting radionuclides - (213)Bi, (225)Ac, and (211)At - also will be summarized.

  6. Radioimmunotherapy with alpha-particle emitting radionuclides.

    PubMed

    Zalutsky, M R; Pozzi, O R

    2004-12-01

    An important consideration in the development of effective strategies for radioimmunotherapy is the nature of the radiation emitted by the radionuclide. Radionuclides decaying by the emission of alpha-particles offer the possibility of matching the cell specific reactivity of monoclonal antibodies with radiation with a range of only a few cell diameters. Furthermore, alpha-particles have important biological advantages compared with external beam radiation and beta-particles including a higher biological effectiveness, which is nearly independent of oxygen concentration, dose rate and cell cycle position. In this review, the clinical settings most likely to benefit from alpha-particle radioimmunotherapy will be discussed. The current status of preclinical and clinical research with antibodies labeled with 3 promising alpha-particle emitting radionuclides - (213)Bi, (225)Ac, and (211)At - also will be summarized. PMID:15640792

  7. Localized External Beam Radiation Therapy (EBRT) to the Pelvis Induces Systemic IL-1Beta and TNF-Alpha Production: Role of the TNF-Alpha Signaling in EBRT-Induced Fatigue.

    PubMed

    McDonald, Tasha L; Hung, Arthur Y; Thomas, Charles R; Wood, Lisa J

    2016-01-01

    Prostate cancer patients undergoing localized external beam radiation therapy (EBRT) can experience a progressive increase in fatigue, which can affect physical functioning and quality of life. The purpose of this study was to develop a mouse EBRT prostate cancer treatment model with which to determine the role of pro-inflammatory cytokines in the genesis of EBRT-related fatigue. We assessed voluntary wheel-running activity (VWRA) as a proxy for fatigue, food intake and body weight in male C57BL/6 mice undergoing EBRT to the pelvis. In the first experiment, anesthetized male C57BL/6 mice underwent fractionated EBRT to the pelvis for a total dose of 68.2 Gy, thereby mimicking a clinically relevant therapeutic dose and frequency. The day after the last treatment, levels of IL-1β and TNF-α in plasma along with mRNA levels in liver, colon and whole brain were measured. EBRT-induced fatigue resulted in reduced body weight, diminished food intake, and increased plasma and tissue levels of IL-1β and TNF-α. In a follow-up experiment, we used TNF-α-deficient mice to further delineate the role of TNF-α signaling in EBRT-induced sickness behavior. EBRT-induced changes in fatigue, food intake and body weight were no different between TNF-α deficient mice and their wild-type counterparts. Taken together our data demonstrate that a clinically relevant localized irradiation of the pelvis induces a systemic IL-1β and TNF-α response and sickness behavior in mice, but the TNF-α signaling pathway alone does not independently mediate these effects.

  8. Polarization of Lyman-Alpha Radiation from Atomic Hydrogen Excited by Electron Impact form Near Threshold to 1800 eV

    NASA Technical Reports Server (NTRS)

    James, G. K.; Slevin, J. A.; Dziczek, D.; McConkey, J. W.; Bray, Igor

    1998-01-01

    The polarization of Lyman-a radiation, produced by electron-impact excitation of atomic hydrogen, has been measured over the extended energy range from near threshold to 1800 eV. Measurements were obtained in a crossed-beam experiment using a silica-reflection linear polarization analyzer in tandem with a vacuum-ultraviolet monochromator to isolate the emitted line radiation. Comparison with various theoretical calculations shows that the present experimental results are in good agreement with theory over the entire range of electron-impact energies and, in particular, are in excellent agreement with theoretical convergent-close-coupling (CCC) calculations performed in the present work. Our polarization data are significantly different from the previous experimental measurements of Ott, Kauppila, and Fite.

  9. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  10. Solvent effects on the synthesis of ion-exchange membranes by radiation-induced graft polymerization of methyl. cap alpha. ,. beta. ,. beta. -trifluoroacrylate. [Freon 113

    SciTech Connect

    Omichi, H.; Okamoto, J.

    1982-06-01

    Methyl ..cap alpha..,..beta..,..beta..-trifluoroacrylate (MTFA) was grafted onto polyethylene (PE) film and fluorine-containing films to make ion-exchange membranes. In the case of PE the grafting yield was not influenced by the presence of trifluorotrichloroethane (Freon 113) in the reaction mixture, while the presence of methanol decreased the grafting yield. The transversal distribution of graft chains in the film observed by electron-probe x-ray microanalysis showed that when the grafting was carried out in the presence of Freon the amount of graft chains in the central part of PE film was much larger than that at the film surface and that the grafts obtained in the absence of Freon were located mainly at the film surface. The electric resistance of the graft PE film obtained in the presence of Freon decreased more than that of the one obtained in the absence of Freon. The weight loss of the graft films in H/sub 2/O/sub 2/ solution was negligibly small.

  11. RADIATION SENSITIVITY & PROCESSING OF DNA DAMAGE FOLLOWING LOW DOSES OF GAMMA-RAY ALPHA PARTICLES & HZE IRRADIATION OF NORMAL DSB REPAIR DEFICIENT CELLS

    SciTech Connect

    O'Neil, Peter

    2009-05-15

    Non-homologous end joining (NHEJ) predominates in the repair of DNA double strand breaks (DSB) over homologous recombination (HR). NHEJ occurs throughout the cell cycle whereas HR occurs in late S/G2 due to the requirement of a sister chromatid (Rothkamm et al, Mol Cell Biol 23 5706-15 [2003]). To date evidence obtained with DSB repair deficient cells using pulsed-field gel electrophoresis has revealed the major pathway throughout all phases of the cell cycle for processing high dose induced DSBs is NHEJ (Wang et al, Oncogene 20 2212-24 (2001); Pluth et al, Cancer Res. 61 2649-55 [2001]). These findings however were obtained at high doses when on average >> 20-30 DSBs are formed per cell. The contribution of the repair pathways (NHEJ and HR) induced in response to DNA damage during the various phases of the cell cycle may depend upon the dose (the level of initial DSBs) especially since low levels of DSBs are induced at low dose. To date, low dose studies using NHEJ and HR deficient mutants have not been carried out to address this important question with radiations of different quality. The work presented here leads us to suggest that HR plays a relatively minor role in the repair of radiation-induced prompt DSBs. SSBs lead to the induction of DSBs which are associated specifically with S-phase cells consistent with the idea that they are formed at stalled replication forks in which HR plays a major role in repair. That DNA-PKcs is in some way involved in the repair of the precursors to replication-induced DSB remains an open question. Persistent non-DSB oxidative damage also leads to an increase in RAD51 positive DSBs. Both simple and complex non-DSB DNA damage may therefore contribute to indirect DSBs induced by ionising radiation at replication forks.

  12. Targeted therapy using alpha emitters.

    PubMed

    Vaidyanathan, G; Zalutsky, M R

    1996-10-01

    Radionuclides such as 211At and 212Bi which decay by the emission of alpha-particles are attractive for certain applications of targeted radiotherapy. The tissue penetration of 212Bi and 211At alpha-particles is equivalent to only a few cell diameters, offering the possibility of combining cell-specific targeting with radiation of similar range. Unlike the beta-particles emitted by radionuclides such as 131I and 90Y, alpha-particles are radiation of high linear energy transfer and thus greater biological effectiveness. Several approaches have been explored for targeted radiotherapy with 212Bi- and 211At-labelled substances including colloids, monoclonal antibodies, metabolic precursors, receptor-avid ligands and other lower molecular weight molecules. An additional agent which exemplifies the promise of alpha-emitting radiopharmaceuticals is meta-[211At]astatobenzylguanidine. The toxicity of this compound under single-cell conditions, determined both by [3H]thymidine incorporation and by limiting dilution clonogenic assays, for human neuroblastoma cells is of the order of 1000 times higher than that of meta-[131I] iodobenzylguanidine. For meta-[211At] astatobenzylguanidine, the Do value was equivalent to only 6-7 211At atoms bound per cell. These results suggest that meta-[211At] astatobenzylguanidine might be valuable for the targeted radiotherapy of micrometastatic neuroblastomas.

  13. Alpha/Beta Ratio for Normal Lung Tissue as Estimated From Lung Cancer Patients Treated With Stereotactic Body and Conventionally Fractionated Radiation Therapy

    SciTech Connect

    Scheenstra, Alize E.H.; Rossi, Maddalena M.G.; Belderbos, José S.A.; Damen, Eugène M.F.; Lebesque, Joos V.; Sonke, Jan-Jakob

    2014-01-01

    Purpose: To estimate the α/β ratio for which the dose-dependent lung perfusion reductions for stereotactic body radiation therapy (SBRT) and conventionally fractionated radiation therapy (CFRT) are biologically equivalent. Methods and Materials: The relations between local dose and perfusion reduction 4 months after treatment in lung cancer patients treated with SBRT and CFRT were scaled according to the linear-quadratic model using α/β ratios from 0 Gy to ∞ Gy. To test for which α/β ratio both treatments have equal biological effect, a 5-parameter logistic model was optimized for both dose–effect relationships simultaneously. Beside the α/β ratio, the other 4 parameters were d{sub 50}, the steepness parameter k, and 2 parameters (M{sub SBRT} and M{sub CFRT}) representing the maximal perfusion reduction at high doses for SBRT and CFRT, respectively. Results: The optimal fitted model resulted in an α/β ratio of 1.3 Gy (0.5-2.1 Gy), M{sub SBRT} = 42.6% (40.4%-44.9%), M{sub CFRT} = 66.9% (61.6%-72.1%), d{sub 50} = 35.4 Gy (31.5-9.2 Gy), and k = 2.0 (1.7-2.3). Conclusions: An equal reduction of lung perfusion in lung cancer was observed in SBRT and CFRT if local doses were converted by the linear-quadratic model with an α/β ratio equal to 1.3 Gy (0.5-2.1 Gy)

  14. Irradiation of human skin by short wavelength ultraviolet radiation (100--290 nm) (u.v.C): increased concentrations of arachidonic acid and prostaglandines E2 and F2alpha.

    PubMed

    Camp, R D; Greaves, M W; Hensby, C N; Plummer, N A; Warin, A P

    1978-08-01

    1. Human abdominal skin was irradiated with six times the minimal erythema dose of ultraviolet C (100--290 nm) radiation. Erythema appeared at 3 h, was of moderate degree by 6 h and was maximal at 12--24 h. It was reduced at 48 h and by 72 h had disappeared. 2. A suction bulla technique was used for the recovery of exudate from normal and inflamed skin at 6, 18, 24 and 48 h after irradiation. 3. Prostaglandin-like activity, estimated by bioassay, showed maximum increase at 18 h, when erythema was also maximum. PGF 2alpha, measured by both radioimmunoassay and by combined gas-liquid chromatography--gas spectrometry, followed a similar time course then fell to normal, or near normal, levels at 48 h. 4. Prostaglandin E2 and arachidonic acid concentrations, measured by gas chromatography--mass spectrometry, were maximally raised at 18--24 h. At 48 h, when some erythema was still present, though reduced, prostaglandin E2 concentrations were still raised above control values. 5. The results provide direct evidence in support of the view that the erythma following irradiation of human skin by u.v.C involves activation of arachidonic acid metabolism. However, the relationship between the erythema and increased prostaglandin activity is not fully understood.

  15. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  16. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  17. alpha-Hexachlorocyclohexane (alpha-HCH)

    Integrated Risk Information System (IRIS)

    alpha - Hexachlorocyclohexane ( alpha - HCH ) ; CASRN 319 - 84 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Ass

  18. Alpha-1 Antitrypsin Test

    MedlinePlus

    ... measures the level of the protein AAT in blood. Alpha-1 antitrypsin phenotype testing evaluates the amount and type of AAT being produced and compares it to normal patterns. Alpha-1 antitrypsin genotype testing ( DNA testing) can ...

  19. Alpha-1 antitrypsin test

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003715.htm Alpha-1 antitrypsin test To use the sharing features on this page, please enable JavaScript. Alpha-1 antitrypsin is a laboratory test to measure the ...

  20. Performance of an in-situ alpha spectrometer.

    PubMed

    Pöllänen, R

    2016-03-01

    Equipment was recently developed for detecting alpha particles from flat and smooth surfaces with good energy resolution at ambient air pressure. In this work, the detection efficiencies were determined using different extended-area sources emitting alpha and beta radiation and a mixed nuclide point source emitting alpha radiation. Beta particles are of importance because they can also be detected. Counts originating from alpha and beta particles are mainly at different energies, which make their separation possible. An efficiency of 0.14 was determined for an extended-area (>30cm(2)) homogeneous source emitting alpha radiation at the energy of 5-6MeV, whereas for the beta emitters the efficiencies were 0.07-0.19 depending on the beta-particle emission energies. The use of a collimator reduces the detection efficiencies by a factor of up to ten. PMID:26688356

  1. The Alpha Centauri System.

    ERIC Educational Resources Information Center

    Soderblom, David R.

    1987-01-01

    Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

  2. Effects of excitation laser wavelength on Ly-{alpha} and He-{alpha} line emission from nitrogen plasmas

    SciTech Connect

    Harilal, S. S.; Miloshevsky, G. V.; Sizyuk, T.; Hassanein, A.

    2013-01-15

    Laser-produced nitrogen plasmas emitting radiation at 2.48 nm (Ly-{alpha}) and 2.88 nm (He-{alpha}) are considered potential efficient sources for water-window (WW) microscopy. The atomic and optical properties of nitrogen plasma and influence of the laser wavelength on the line emission in the WW range are investigated. It is found that the optimal temperatures for maximum emission from Ly-{alpha} and He-{alpha} spectral lines are 40-60 eV and 80-100 eV, respectively. The WW line emission and the conversion efficiency (CE) are estimated for three distinct Nd:YAG laser wavelengths (1064 nm, 532 nm, and 266 nm). The calculated CEs are compared with experimentally observed CE values. It is found that 1064 nm wavelength provides the highest CE from laser to Ly-{alpha} and He-{alpha} radiation.

  3. Plutonium radiation surrogate

    DOEpatents

    Frank, Michael I.

    2010-02-02

    A self-contained source of gamma-ray and neutron radiation suitable for use as a radiation surrogate for weapons-grade plutonium is described. The source generates a radiation spectrum similar to that of weapons-grade plutonium at 5% energy resolution between 59 and 2614 keV, but contains no special nuclear material and emits little .alpha.-particle radiation. The weapons-grade plutonium radiation surrogate also emits neutrons having fluxes commensurate with the gamma-radiation intensities employed.

  4. Continuous coherent Lyman- alpha excitation of atomic hydrogen.

    PubMed

    Eikema, K S; Walz, J; Hänsch, T W

    2001-06-18

    The 1S-2P transition in atomic hydrogen has been observed for the first time with almost natural linewidth. We employ a unique source of continuous coherent Lyman- alpha radiation based on four-wave mixing in mercury. The output of the source has been improved 40-fold to yield 20 nW. This demonstration shows that laser cooling and detection with continuous Lyman- alpha radiation has excellent prospects for future experiments with antihydrogen.

  5. Continuous Coherent Lyman-{alpha} Excitation of Atomic Hydrogen

    SciTech Connect

    Eikema, K. S. E.; Walz, J.; Hansch, T. W.

    2001-06-18

    The 1S{minus}2P transition in atomic hydrogen has been observed for the first time with almost natural linewidth. We employ a unique source of continuous coherent Lyman-{alpha} radiation based on four-wave mixing in mercury. The output of the source has been improved 40-fold to yield 20nW. This demonstration shows that laser cooling and detection with continuous Lyman-{alpha} radiation has excellent prospects for future experiments with antihydrogen.

  6. Predicted and observed early effects of combined alpha and beta lung irradiation

    SciTech Connect

    Scott, B.R.; Hahn, F.F.; Snipes, M.B.; Newton, G.J.; Eidson, A.F.; Mauderly, J.L.; Boecker, B.B. )

    1990-12-01

    The nonstochastic radiobiological effects of combined alpha and beta irradiation of the lungs of rats from inhaled radionuclides were studied. Both respiratory functional morbidity at 18 mo and mortality from radiation pneumonitis within 18 mo after exposure were examined for rats exposed to the beta-emitter 147Pm, the alpha-emitter 238Pu, or both combined. The results were used to validate hazard-function models that were developed (1) for respiratory functional morbidity at 18 mo and (2) for lethality from radiation pneumonitis within 18 mo. Both models were found to adequately predict the experimental observations for chronic alpha plus beta irradiation of the lung. Based on this 18-mo study, a relative biological effectiveness of approximately seven was obtained for 238Pu alpha radiation compared to 147Pm beta radiation for both respiratory functional morbidity and lethality from radiation pneumonitis. However, the relative biological effectiveness for the alpha radiation is likely to increase with longer follow-up.

  7. Crystallization of hepatocyte nuclear factor 4 alpha (HNF4 alpha) in complex with the HNF1 alpha promoter element.

    PubMed

    Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G; Chi, Young-In

    2008-04-01

    Hepatocyte nuclear factor 4alpha (HNF4alpha) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4alpha cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4alpha DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1alpha. The HNF4alpha protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 A using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 A, beta = 119.36 degrees . A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants. PMID:18391435

  8. Fan-less long range alpha detector

    DOEpatents

    MacArthur, Duncan W.; Bounds, John A.

    1994-01-01

    A fan-less long range alpha detector which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces.

  9. Fan-less long range alpha detector

    DOEpatents

    MacArthur, D.W.; Bounds, J.A.

    1994-05-10

    A fan-less long range alpha detector is disclosed which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces. 2 figures.

  10. HETDEX: Evolution of Lyman Alpha Emitters

    NASA Astrophysics Data System (ADS)

    Blanc, Guillermo A.; Gebhardt, K.; Hill, G. J.; Gronwall, C.; Ciardullo, R.; Finkelstein, S.; Gawiser, E.; HETDEX Collaboration

    2012-01-01

    The Hobby Eberly Telescope Dark Energy Experiment (HETDEX) will produce a sample of 800,000 Lyman Alpha Emitters (LAEs) over the 1.9Alpha photon escape fraction. Our results show a strong evolution in the Lyman Alpha escape fraction with redshift, most likely associated with the buildup of dust in the ISM. Dust is shown to be the main parameter setting the escape of Lyman Alpha photons. The observed relation between E(B-V) and the escape fraction indicates that radiative transfer effects in LAEs promote the escape of Lyman Alpha photons, but only up to the point of them suffering similar amounts of extinction as continuum photons. Enhancement of the Lyman Alpha EW (e.g. due to the presence of a clumpy medium) seems not to be a common process in these objects. We also discuss the potential of the full HETDEX sample to study the evolution of LAE properties.

  11. Technical Equivalency Documentation for a New Alpha Spectroscopy System

    SciTech Connect

    Hickman, D P; Fisher, S K; Zeman, R A; Hann, P R

    2005-04-05

    The response of a new Canberra{trademark} Alpha Analyst (Chamber No.'s 101-124) used by the Hazards Control, Radiation Safety Section, WBC/Spectroscopy Team has been studied with respect to an existing Canberra system. The existing Canberra system consists of thirty six Model 7401 alpha spectrometry chambers (Chamber No.'s 1-36) and has been DOELAP qualified for the routine Alpha Spectroscopy program used in LLNL's in vitro bioassay program. The new Alpha Analyst system is an automated system that is controlled by the same software and computer system as that used for the existing Canberra system. This document compares results from the existing Alpha System with the newer Alpha Analyst system.

  12. Evidence for a temperature rise in the outer layers of alpha Lyrae, from Copernicus observations of Lyman-alpha

    NASA Technical Reports Server (NTRS)

    Praderie, F.; Simonneau, E.; Snow, T. P., Jr.

    1975-01-01

    Copernicus satellite observations of the Ly-alpha profiles in alpha Lyrae (Vega) are used to determine whether classical radiative-equilibrium LTE model atmospheres can fit the thermal structure in the outer layers of that star. Two plane-parallel LTE model photospheres of alpha Lyrae are considered: a line-blanketed radiative-equilibrium model with an effective temperature of 9650 K and log g of 4.05, and the same model with a temperature of 9500 K and log g of 4.0. The profiles of the Ly-alpha wings are computed, and it is found that classical LTE models are unable to predict either the observed violet wing or the red wing longwards of 1239 A, regardless of the line source function. It is concluded that the electron temperature must increase outwards over the surface value reached in radiative equilibrium.

  13. Determination of Alpha

    NASA Astrophysics Data System (ADS)

    Chmeissani, Mokhtar Abdallah

    The determination of the strong coupling constant alpha_ s, using Energy-Energy Correlation Asymmetry and jet mass difference with Mark II data at SLC (91 GeV) is presented. In Energy-Energy Correlation Asymmetry (EECA), we used the same systematic procedure used to determine alpha_ s with MARK II data at PEP (29 GeV). The chi^2 fit suggests that alpha_ s = 0.119 +/- 0.007(stat.) +/- 0.007(syst.). In addition, we used the EECA method to determine the QCD scale parameter Lambda_{LLA}. The chi^2 fit suggests that Lambda _{LLA} = 420 +/- 90(stat.) MeV. In the jet mass difference method, the determination of alpha_ s is based on QCD calculations up to 2nd order. We showed that in this method we are able to reproduce the value of alpha _ s from a Monte Carlo sample to a very high accuracy. The result with this method is alpha _ s = 0.134 +/- 0.085(stat.) +/- 0.004(syst.). The two values of alpha_ s presented in this work are in agreement within the error bars and in a good agreement with recent results of alpha_ s published from other e^+e^- experiments.

  14. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  15. Imaging alpha particle detector

    DOEpatents

    Anderson, David F.

    1985-01-01

    A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  16. A practical alpha particle irradiator for studying internal alpha particle exposure.

    PubMed

    Lee, Ki-Man; Lee, Ui-Seob; Kim, Eun-Hee

    2016-09-01

    An alpha particle irradiator has been built in the Radiation Bioengineering Laboratory at Seoul National University (SNU) to investigate the cellular responses to alpha emissions from radon and the progeny. This irradiator is designed to have the energy of alpha particles entering target cells similar to that of alpha emissions from the radon progeny Po-218 and Po-214 residing in the human respiratory tract. For the SNU alpha particle irradiator, an irradiation system is equipped with cell dishes of 4µm thick Mylar bottom and a special setup of cells on slide for gamma-H2AX assay. Dose calibration for the alpha particle irradiator was performed by dual approaches, detection and computer simulation, in consideration of the source-to-target distance (STD) and the size of a cell dish. The uniformity of dose among cells in a dish is achieved by keeping the STD and the size of cell dish in certain ranges. The performance of the SNU alpha particle irradiator has been proven to be reliable through the gamma-H2AX assay with the human lung epithelial cells irradiated. PMID:27475622

  17. Far-Infrared and Millimeter Continuum Studies of K-Giants: Alpha Boo and Alpha Tau

    NASA Technical Reports Server (NTRS)

    Cohen, Martin; Carbon, Duane F.; Welch, William J.; Lim, Tanya; Forster, James R.; Goorvitch, David; Thigpen, William (Technical Monitor)

    2002-01-01

    We have imaged two normal, non-coronal, infrared-bright K-giants, alpha Boo and alpha Tau, in the 1.4-millimeter and 2.8-millimeter continuum using BIMA. These stars have been used as important absolute calibrators for several infrared satellites. Our goals are: (1) to probe the structure of their upper photospheres; (2) to establish whether these stars radiate as simple photospheres or possess long-wavelength chromospheres; and (3) to make a connection between millimeter-wave and far-infrared absolute flux calibrations. To accomplish these goals we also present ISO Long Wavelength Spectrometer (LWS) measurements of both these K-giants. The far-infrared and millimeter continuum radiation is produced in the vicinity of the temperature minimum in a Boo and a Tau, offering a direct test of the model photospheres and chromospheres for these two cool giants. We find that current photospheric models predict fluxes in reasonable agreement with those observed for those wavelengths which sample the upper photosphere, namely less than or equal to 170 micrometers in alpha Tau and less than or equal to 125 micrometers in alpha Boo. It is possible that alpha Tau is still radiative as far as 0.9 - 1.4 millimeters. We detect chromospheric radiation from both stars by 2.8 millimeters (by 1.4 millimeters in alpha Boo), and are able to establish useful bounds on the location of the temperature minimum. An attempt to interpret the chromospheric fluxes using the two-component "bifurcation model" proposed by Wiedemann et al. (1994) appears to lead to a significant contradiction.

  18. Microdosimetry for Targeted Alpha Therapy of Cancer

    PubMed Central

    Huang, Chen-Yu; Guatelli, Susanna; Oborn, Bradley M.; Allen, Barry J.

    2012-01-01

    Targeted alpha therapy (TAT) has the advantage of delivering therapeutic doses to individual cancer cells while reducing the dose to normal tissues. TAT applications relate to hematologic malignancies and now extend to solid tumors. Results from several clinical trials have shown efficacy with limited toxicity. However, the dosimetry for the labeled alpha particle is challenging because of the heterogeneous antigen expression among cancer cells and the nature of short-range, high-LET alpha radiation. This paper demonstrates that it is inappropriate to investigate the therapeutic efficacy of TAT by macrodosimetry. The objective of this work is to review the microdosimetry of TAT as a function of the cell geometry, source-target configuration, cell sensitivity, and biological factors. A detailed knowledge of each of these parameters is required for accurate microdosimetric calculations. PMID:22988479

  19. The alpha channeling effect

    SciTech Connect

    Fisch, N. J.

    2015-12-10

    Alpha particles born through fusion reactions in a tokamak reactor tend to slow down on electrons, but that could take up to hundreds of milliseconds. Before that happens, the energy in these alpha particles can destabilize on collisionless timescales toroidal Alfven modes and other waves, in a way deleterious to energy confinement. However, it has been speculated that this energy might be instead be channeled into useful energy, so as to heat fuel ions or to drive current. Such a channeling needs to be catalyzed by waves Waves can produce diffusion in energy of the alpha particles in a way that is strictly coupled to diffusion in space. If these diffusion paths in energy-position space point from high energy in the center to low energy on the periphery, then alpha particles will be cooled while forced to the periphery. The energy from the alpha particles is absorbed by the wave. The amplified wave can then heat ions or drive current. This process or paradigm for extracting alpha particle energy collisionlessly has been called alpha channeling. While the effect is speculative, the upside potential for economical fusion is immense. The paradigm also operates more generally in other contexts of magnetically confined plasma.

  20. Study of the angular-dependence of the L-alpha and L-beta radiation produced by 0-15 kev photons incident on Au targets of various thicknesses

    NASA Astrophysics Data System (ADS)

    Requena, Sebastian; Williams, Scott

    2011-03-01

    We report the results of experiments involving the L-alpha and L-beta x-ray lines produced by 0-15 keV bremsstrahlung incident on gold targets of various thicknesses at forward-scattered angles ranging from 20 to 160 degrees. Previous reports [1, 2] have shown the L-beta peaks to be isotropic and the L-alpha peaks to be anisotropic due to the symmetry/asymmetry associated with the orbital being filled during the transition. The relative intensities are compared to the predictions of the Monte Carlo code, PENELOPE.

  1. A model for the disc Lyman alpha emission of Uranus

    SciTech Connect

    Jaffel, L.B.; Vidal-Madjar, A. ); Prange, R.; Emerich, C. ); McConnell, J.C. )

    1991-06-01

    A new efficient radiative transfer algorithm for inhomogeneous atmospheres has been used to simulate the limb to limb Lyman {alpha} reflectivities observed with the Voyager ultraviolet spectrometer during the flyby of Uranus. It was shown that complete frequency redistribution should be adequate to describe the disc emissions. The model atmosphere used was derived using a combination of Voyager measurements and modeling. Atomic H densities calculated had sources derivable directly from solar FUV and EUV fluxes. To fit the observations, four contributions are evaluated: (1) the resonance scattering of solar Lyman {alpha} radiation, (2) Rayleigh-Raman scattering of solar Lyman {alpha} radiation, (3) the resonance scattering of interplanetary Lyman {alpha} radiation, and (4) a possible internal source of unknown origin. From comparison with the observations, and provided that the published Voyager calibrations are correct, it is shown that only atmospheres with low eddy diffusion coefficients (K{sub H}{le}100 cm{sup 2} s{sup {minus}1}) and an internal source could simulate both the shape and the strength of the measured disc emission. The main results are then that the direct solar Lyman {alpha} scattering contribution (type 1 plus type 2) is of the order of 760 R, the scattering of interplanetary Lyman {alpha} contributes about 320 R, and a small additional internal source providing about 100-500 R is needed to match the measurements. Further, the analysis of the disc intensities suggests that there is no strong variation of K with latitude.

  2. Systemic Targeted Alpha Radiotherapy for Cancer

    PubMed Central

    Allen, BJ

    2013-01-01

    Background: The fundamental principles of internal targeted alpha therapy forcancer were established many decades ago.The high linear energy transfer (LET) ofalpha radiation to the targeted cancer cellscauses double strand breaks in DNA. Atthe same time, the short range radiation spares adjacent normal tissues. This targeted approach complements conventional external beam radiotherapy and chemotherapy. Such therapies fail on several fronts, such as lack of control of some primary cancers (e.g. glioblastoma multiforme) and to inhibit the development of lethal metastaticcancer after successful treatment of the primary cancer. Objective: This review charts the developing role of systemic high LET, internalradiation therapy. Method: Targeted alpha therapy is a rapidly advancing experimental therapy thatholds promise to deliver high cytotoxicity to targeted cancer cells. Initially thoughtto be indicated for leukemia and micrometastases, there is now evidence that solidtumors can also be regressed. Results: Alpha therapy may be molecular or physiological in its targeting. Alphaemitting radioisotopes such as Bi-212, Bi-213, At-211 and Ac-225 are used to labelmonoclonal antibodies or proteins that target specific cancer cells. Alternatively, Radium-233 is used for palliative therapy of breast and prostate cancers because of its bone seeking properties. Conclusion: Preclinical studies and clinical trials of alpha therapy are discussedfor leukemia, lymphoma, melanoma, glioblastoma multiforme, bone metastases, ovarian cancer, pancreatic cancer and other cancers. PMID:25505750

  3. Diamond detector for alpha-particle spectrometry.

    PubMed

    Dueñas, J A; de la Torre Pérez, J; Martín Sánchez, A; Martel, I

    2014-08-01

    An artificially grown high purity diamond was used as a detector for alpha-particle spectrometry. Diamond detectors can match the performance of silicon detectors employed in standard continuous air monitoring systems. Its radiation hardness and electronic properties make them ideal to work under extreme condition such as high temperature and ambient lights. A 50 μm thickness single-crystal diamond detector has been compared with a 300 μm passivated implanted planar silicon detector, under ambient conditions.

  4. Alpha One Foundation

    MedlinePlus

    ... related programs More News Our Number One Goal: Find a cure for Alpha-1. Website Sponsors Helpful Links 3300 Ponce de Leon Blvd. Coral Gables, FL 33134 Phone: (877) 228-7321 Email: info@alphaone.org Copyright ...

  5. Alpha Particle Diagnostic

    SciTech Connect

    Fisher, Ray, K.

    2009-05-13

    The study of burning plasmas is the next frontier in fusion energy research, and will be a major objective of the U.S. fusion program through U.S. collaboration with our international partners on the ITER Project. For DT magnetic fusion to be useful for energy production, it is essential that the energetic alpha particles produced by the fusion reactions be confined long enough to deposit a significant fraction of their initial ~3.5 MeV energy in the plasma before they are lost. Development of diagnostics to study the behavior of energetic confined alpha particles is a very important if not essential part of burning plasma research. Despite the clear need for these measurements, development of diagnostics to study confined the fast confined alphas to date has proven extremely difficult, and the available techniques remain for the most part unproven and with significant uncertainties. Research under this grant had the goal of developing diagnostics of fast confined alphas, primarily based on measurements of the neutron and ion tails resulting from alpha particle knock-on collisions with the plasma deuterium and tritium fuel ions. One of the strengths of this approach is the ability to measure the alphas in the hot plasma core where the interesting ignition physics will occur.

  6. Equilibrium slab models of Lyman-alpha clouds

    NASA Technical Reports Server (NTRS)

    Charlton, Jane C.; Salpeter, Edwin E.; Hogan, Craig J.

    1993-01-01

    Solutions for the equilibrium configuration of a slab with ionizing radiation incident equally from both sides are explored. Radiation effects (photoionization, Ly-alpha photon trapping, and mock gravity) as well as external pressure and self gravity (with and without dark matter) are included. The general formalism is applied to structure growth on small scales at very high z due to mock gravity on dust. Emphasis is placed on the application of slab models at z of less than 5, particularly those that may correspond to Ly-alpha forest, Lyman limit, and damped Ly-alpha systems. The regime with a dominant outward force contributed by trapping of Ly-alpha photons is discussed. General expressions are given for the equilibrium, including dark matter, assuming various relationships between the density of the dark matter halo and the total gas column density.

  7. Approximate formulation of redistribution in the Ly-alpha, Ly-beta, H-alpha system

    NASA Technical Reports Server (NTRS)

    Cooper, J.; Ballagh, R. J.; Hubeny, I.

    1989-01-01

    Simple approximate formulas are given for the coupled redistribution of Ly-alpha, Ly-beta, and H-alpha, by using well-defined approximations to an essentially exact formulation. These formulas incorporate all the essential physics including Raman scattering, lower state radiative decay, and correlated terms representing emission during a collision which must be retained in order that the emission coefficients are properly behaved in the line wings. Approximate expressions for the appropriate line broadening parameters are collected. Finally, practical expressions for the source functions are given. These are formulated through newly introduced nonimpact redistribution functions, which are shown to be reasonably approximated by existing (ordinary and generalized) redistribution functions.

  8. Alpha contamination assessment for D&D activities: Technology overview

    SciTech Connect

    Conaway, J.G.; Rawool-Sullivan, M.W.; MacArthur, D.W.

    1996-02-01

    Instruments based on the principle of Long-Range Alpha Detection (LRAD) detect the ions created in ambient air by Ionizing radiation, particularly alpha radiation, interacting with air molecules. Using either an electrostatic field or forced convection, these ions can be transported to a detection grid where the ions produce a small current that is measured with a sensitive electrometer. LRAD-based instruments can give separate, simultaneous measurements of alpha-emitting solids and inert radioactive gases such as radon. LRAD-based instruments assess surface contamination on an entire object or large surface area in a single, rapid measurement, including relatively inaccessible areas such as interior surfaces of pipes and process equipment. The LRAD concept is well proven and has been developed into a range of different radiation detection devices. This paper presents an overview of the technology, while several associated papers explore specific applications in greater detail.

  9. Device for uniform. cap alpha. irradiation of solid powders

    SciTech Connect

    Orlenev, P.O.; Mel'nikov, P.V.

    1988-08-01

    A device for uniform irradiation of solid powders by alpha particles is described. Uniformity of irradiation is achieved by regular stirring of the specimen on the surface of the alpha source. Polonium 210 serves as the alpha source. A method is described that reduces by a factor of approx. 3 the error in determination of the dose absorbed by a powdered specimen and eliminates irradiation nonuniformity. The effect of heterogeneity saturation on measurements of the radiation properties of the electron-hole centers was checked by study of the dose dependencies of Al/sup 3+/-O/sup -/ and D' centers in quartz.

  10. Single and double grid long-range alpha detectors

    DOEpatents

    MacArthur, Duncan W.; Allander, Krag S.

    1993-01-01

    Alpha particle detectors capable of detecting alpha radiation from distant sources. In one embodiment, a voltage is generated in a single electrically conductive grid while a fan draws air containing air molecules ionized by alpha particles through an air passage and across the conductive grid. The current in the conductive grid can be detected and used for measurement or alarm. Another embodiment builds on this concept and provides an additional grid so that air ions of both polarities can be detected. The detector can be used in many applications, such as for pipe or duct, tank, or soil sample monitoring.

  11. Single and double grid long-range alpha detectors

    DOEpatents

    MacArthur, D.W.; Allander, K.S.

    1993-03-16

    Alpha particle detectors capable of detecting alpha radiation from distant sources. In one embodiment, a voltage is generated in a single electrically conductive grid while a fan draws air containing air molecules ionized by alpha particles through an air passage and across the conductive grid. The current in the conductive grid can be detected and used for measurement or alarm. Another embodiment builds on this concept and provides an additional grid so that air ions of both polarities can be detected. The detector can be used in many applications, such as for pipe or duct, tank, or soil sample monitoring.

  12. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  13. Beam dynamics of CANDLE storage ring low alpha operation

    NASA Astrophysics Data System (ADS)

    Sargsyan, A.; Amatuni, G.; Sahakyan, V.; Tsakanov, V.; Zanyan, G.

    2015-10-01

    The generation of the coherent THz radiation and short pulse synchrotron radiation in dedicated electron storage rings requires the study of non-standard magnetic lattices which provide low momentum compaction factor (alpha) of the ring. In the present paper two low alpha operation lattices based on modification of the original beam optics and implementation of inverse bend magnets are studied for CANDLE storage ring. For considered cases an analysis of transverse and longitudinal beam dynamics is given and the feasibility of lattices is discussed.

  14. Portable alpha spectrometer.

    PubMed

    Martín Sánchez, A; de la Torre Pérez, J

    2012-09-01

    Many portable devices have been designed to detect γ-rays or alpha and beta particles. Most of the α-particle detectors give the total count as a result, without identifying the radionuclides existing in the sample. The development of a device allowing rapid and straightforward α-particle spectrometry would be very useful for detecting the radioactive contents of unknown samples. This work describes the construction of a portable device using silicon semiconductor detectors designed to rapidly detect and possibly identify alpha-emitting radionuclides.

  15. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  16. E-PERM alpha surface monitor

    SciTech Connect

    Fricke, V.

    1999-12-16

    Innovative Technology Summary Reports are designed to provide potential users with the information they need to quickly determine if a technology would apply to a particular environmental management problem. They are also designed for readers who may recommend that a technology be considered by prospective users. Each report describes a technology, system, or process that has been developed and tested with funding from DOE's Office of Science and Technology (OST). The E-PERM{reg{underscore}sign} Alpha Surface Monitor is an integrating electret ion chamber innovative technology used to measure alpha radiation on surfaces of materials. The technology is best used on surfaces with low contamination levels such as areas with potential for free release, but can also be used in areas with higher levels of contamination. Measurement accuracy and production of the E-PERM {reg{underscore}sign} Alpha Surface Monitor compared favorably with the baseline technology. The innovative technology cost is approximately 28% higher than the baseline with an average unit cost per reading costing %6.04 vs. $4.36; however, the flexibility of the E-PERM{reg{underscore}sign} Alpha Surface Monitor may offer advantages in ALARA, reduction of operator error, waste minimization, and measurement accuracy.

  17. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  18. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  19. New interpretations of extraterrestrial Lyman-alpha observations.

    NASA Technical Reports Server (NTRS)

    Blum, P. W.; Fahr, H. J.

    1972-01-01

    The solar Lyman-alpha radiation pressure affects the orbits and the velocities of the interstellar particles entering the solar system. This leads to enhanced particle losses in the heliosphere, since particles spend a longer time crossing it. This causes a stronger decrease of the density with decreasing distances from the sun than had been calculated without accounting for the radiation pressure. Furthermore, the emission pattern of the solar Lyman-alpha radiation is anisotropic and rotates with the sun in a 27-day period. This causes a temporal change in the location of the intensity extrema. At the same time it produces hydrogen density anisotropies with extrema deviating in their directions from those which had been calculated without consideration of the radiation pressure.

  20. RADIATION COUNTER

    DOEpatents

    Goldsworthy, W.W.

    1958-02-01

    This patent relates to a radiation counter, and more particularly, to a scintillation counter having high uniform sensitivity over a wide area and capable of measuring alpha, beta, and gamma contamination over wide energy ranges, for use in quickly checking the contami-nation of personnel. Several photomultiplier tubes are disposed in parallel relationship with a light tight housing behind a wall of scintillation material. Mounted within the housing with the photomultipliers are circuit means for producing an audible sound for each pulse detected, and a range selector developing a voltage proportional to the repetition rate of the detected pulses and automatically altering its time constant when the voltage reaches a predetermined value, so that manual range adjustment of associated metering means is not required.

  1. Realizing the potential of the Actinium-225 radionuclide generator in targeted alpha-particle therapy applications

    PubMed Central

    Miederer, Matthias; Scheinberg, David A.; McDevitt, Michael R.

    2013-01-01

    Alpha particle-emitting isotopes have been proposed as novel cytotoxic agents for augmenting targeted therapy. Properties of alpha particle radiation such as their limited range in tissue of a few cell diameters and their high linear energy transfer leading to dense radiation damage along each alpha track are promising in the treatment of cancer, especially when single cells or clusters of tumor cells are targeted. Actinium-225 (225Ac) is an alpha particle-emitting radionuclide that generates 4 net alpha particle isotopes in a short decay chain to stable 209Bi, and as such can be described as an alpha particle nanogenerator. This article reviews the literature pertaining to the research, development, and utilization of targeted 225Ac to potently and specifically affect cancer. PMID:18514364

  2. Realizing the potential of the Actinium-225 radionuclide generator in targeted alpha particle therapy applications.

    PubMed

    Miederer, Matthias; Scheinberg, David A; McDevitt, Michael R

    2008-09-01

    Alpha particle-emitting isotopes have been proposed as novel cytotoxic agents for augmenting targeted therapy. Properties of alpha particle radiation such as their limited range in tissue of a few cell diameters and their high linear energy transfer leading to dense radiation damage along each alpha track are promising in the treatment of cancer, especially when single cells or clusters of tumor cells are targeted. Actinium-225 (225 Ac) is an alpha particle-emitting radionuclide that generates 4 net alpha particle isotopes in a short decay chain to stable 209 Bi, and as such can be described as an alpha particle nanogenerator. This article reviews the literature pertaining to the research, development, and utilization of targeted 225 Ac to potently and specifically affect cancer.

  3. Realizing the potential of the Actinium-225 radionuclide generator in targeted alpha particle therapy applications.

    PubMed

    Miederer, Matthias; Scheinberg, David A; McDevitt, Michael R

    2008-09-01

    Alpha particle-emitting isotopes have been proposed as novel cytotoxic agents for augmenting targeted therapy. Properties of alpha particle radiation such as their limited range in tissue of a few cell diameters and their high linear energy transfer leading to dense radiation damage along each alpha track are promising in the treatment of cancer, especially when single cells or clusters of tumor cells are targeted. Actinium-225 (225 Ac) is an alpha particle-emitting radionuclide that generates 4 net alpha particle isotopes in a short decay chain to stable 209 Bi, and as such can be described as an alpha particle nanogenerator. This article reviews the literature pertaining to the research, development, and utilization of targeted 225 Ac to potently and specifically affect cancer. PMID:18514364

  4. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.

    1998-08-19

    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  5. {alpha}-Decay half-lives, {alpha}-capture, and {alpha}-nucleus potential

    SciTech Connect

    Denisov, V. Yu. Khudenko, A.A.

    2009-11-15

    {alpha}-Decay half-lives and {alpha}-capture cross sections are evaluated in the framework of a unified model for {alpha}-decay and {alpha}-capture. In this model {alpha}-decay and {alpha}-capture are considered as penetration of the {alpha}-particle through the potential barrier formed by the nuclear, Coulomb, and centrifugal interactions between the {alpha}-particle and nucleus. The spins and parities of the parent and daughter nuclei as well as the quadrupole and hexadecapole deformations of the daughter nuclei are taken into account for evaluation of the {alpha}-decay half-lives. The {alpha}-decay half-lives for 344 nuclei and the {alpha}-capture cross sections of {sup 40}Ca, {sup 44}Ca, {sup 59}Co, {sup 208}Pb, and {sup 209}Bi agree well with the experimental data. The evaluated {alpha}-decay half-lives within the range of 10{sup -9}{<=}T{sub 1/2}{<=}10{sup 38} s for 1246 {alpha}-emitters are tabulated.

  6. Simultaneous quantification of GABAergic 3alpha,5alpha/3alpha,5beta neuroactive steroids in human and rat serum.

    PubMed

    Porcu, Patrizia; O'Buckley, Todd K; Alward, Sarah E; Marx, Christine E; Shampine, Lawrence J; Girdler, Susan S; Morrow, A Leslie

    2009-01-01

    The 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone enhance GABAergic neurotransmission and produce inhibitory neurobehavioral and anti-inflammatory effects. Despite substantial information on the progesterone derivative (3alpha,5alpha)-3-hydroxypregnan-20-one (3alpha,5alpha-THP, allopregnanolone), the physiological significance of the other endogenous GABAergic neuroactive steroids has remained elusive. Here, we describe the validation of a method using gas chromatography-mass spectrometry to simultaneously identify serum levels of the eight 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone. The method shows specificity, sensitivity and enhanced throughput compared to other methods already available for neuroactive steroid quantification. Administration of pregnenolone to rats and progesterone to women produced selective effects on the 3alpha,5alpha- and 3alpha,5beta-reduced neuroactive steroids, indicating differential regulation of their biosynthetic pathways. Pregnenolone administration increased serum levels of 3alpha,5alpha-THP (+1488%, p<0.001), (3alpha,5alpha)-3,21-dihydroxypregnan-20-one (3alpha,5alpha-THDOC, +205%, p<0.01), (3alpha,5alpha)-3-hydroxyandrostan-17-one (3alpha,5alpha-A, +216%, p<0.001), (3alpha,5alpha,17beta)-androstane-3,17-diol (3alpha,5alpha-A-diol, +190%, p<0.01). (3alpha,5beta)-3-hydroxypregnan-20-one (3alpha,5beta-THP) and (3alpha,5beta)-3-hydroxyandrostan-17-one (3alpha,5beta-A) were not altered, while (3alpha,5beta)-3,21-dihydroxypregnan-20-one (3alpha,5beta-THDOC) and (3alpha,5beta,17beta)-androstane-3,17-diol (3alpha,5beta-A-diol) were increased from undetectable levels to 271+/-100 and 2.4+/-0.9 pg+/-SEM, respectively (5/8 rats). Progesterone administration increased serum levels of 3alpha,5alpha-THP (+1806%, p<0.0001), 3alpha,5beta-THP (+575%, p<0.001), 3alpha,5alpha

  7. RADIATION DOSIMETER AND DOSIMETRIC METHODS

    DOEpatents

    Taplin, G.V.

    1958-10-28

    The determination of ionizing radiation by means of single fluid phase chemical dosimeters of the colorimetric type is presented. A single fluid composition is used consisting of a chlorinated hydrocarbon, an acidimetric dye, a normalizer and water. Suitable chlorinated hydrocarbons are carbon tetrachloride, chloroform, trichloroethylene, trichlorethane, ethylene dichioride and tetracbloroethylene. Suitable acidimetric indicator dyes are phenol red, bromcresol purple, and creosol red. Suitable normallzers are resorcinol, geraniol, meta cresol, alpha -tocopberol, and alpha -naphthol.

  8. Preliminary Assessment of the Functional Fitness of Alpha Emitter At-211 for Radiotherapy

    SciTech Connect

    Eremenko, D. O.; Fotina, O. V.; Platonov, S. Yu.; Subbotina, E. A.; Yuminov, O. A.; Pankratova, T. V.; Sirotkina, E. B.; Tultaev, A. V.

    2010-01-05

    The functional fitness of the alpha-emitter At-211 for radiotherapy of the thyroid gland cancer is evaluated. Radiation doses are calculated using the MIRD method and previously obtained pharmacokinetic data for At-211 in isotonic solution.

  9. Early and continuing effects of combined alpha and beta irradiation of the lung:

    SciTech Connect

    Scott, B.R.; Hahn, F.F.; Snipes, M.B.; Newton, G.J.; Eidson, A.F.; Mauderly, J.L.; Boecker, B.B.

    1988-03-01

    This report summarizes an inhalation exposure experiment that concerns early and continuing effects of combined alpha and beta irradiation of the lung of rats. Both morbidity at 18 months and mortality within 18 months after exposure were examined for rats exposed to the beta-emitter /sup 147/Pm, the alpha-emitter /sup 238/Pu, or both combined. The results were used to validate hazard-function models that were developed (1)for pulmonary functional morbidity at 18 months and (2) for lethality from radiation pneumonitis and pulmonary fibrosis within 18 months. Both models were found to adequately predict the experimental observations after combined chronic alpha and beta irradiation of the lung. A relative biological effectiveness of approximately 7 was obtained for /sup 238/Pu alpha radiation compared to /sup 147/Pm beta radiation for both pulmonary functional morbidity and lethality from radiation pneumonitis and pulmonary fibrosis. 12 refs., 16 figs., 11 tabs.

  10. Preliminary Assessment of the Functional Fitness of Alpha Emitter At-211 for Radiotherapy

    NASA Astrophysics Data System (ADS)

    Eremenko, D. O.; Fotina, O. V.; Pankratova, T. V.; Platonov, S. Yu.; Sirotkina, E. B.; Subbotina, E. A.; Yuminov, O. A.; Tultaev, A. V.

    2010-01-01

    The functional fitness of the alpha-emitter At-211 for radiotherapy of the thyroid gland cancer is evaluated. Radiation doses are calculated using the MIRD method and previously obtained pharmacokinetic data for At-211 in isotonic solution.

  11. Actinium-225 in targeted alpha-particle therapeutic applications.

    PubMed

    Scheinberg, David A; McDevitt, Michael R

    2011-10-01

    Alpha particle-emitting isotopes are being investigated in radioimmunotherapeutic applications because of their unparalleled cytotoxicity when targeted to cancer and their relative lack of toxicity towards untargeted normal tissue. Actinium- 225 has been developed into potent targeting drug constructs and is in clinical use against acute myelogenous leukemia. The key properties of the alpha particles generated by 225Ac are the following: i) limited range in tissue of a few cell diameters; ii) high linear energy transfer leading to dense radiation damage along each alpha track; iii) a 10 day halflife; and iv) four net alpha particles emitted per decay. Targeting 225Ac-drug constructs have potential in the treatment of cancer.

  12. Actinium-225 in targeted alpha-particle therapeutic applications.

    PubMed

    Scheinberg, David A; McDevitt, Michael R

    2011-10-01

    Alpha particle-emitting isotopes are being investigated in radioimmunotherapeutic applications because of their unparalleled cytotoxicity when targeted to cancer and their relative lack of toxicity towards untargeted normal tissue. Actinium- 225 has been developed into potent targeting drug constructs and is in clinical use against acute myelogenous leukemia. The key properties of the alpha particles generated by 225Ac are the following: i) limited range in tissue of a few cell diameters; ii) high linear energy transfer leading to dense radiation damage along each alpha track; iii) a 10 day halflife; and iv) four net alpha particles emitted per decay. Targeting 225Ac-drug constructs have potential in the treatment of cancer. PMID:22202153

  13. K alpha line emission during solar X-ray bursts

    NASA Technical Reports Server (NTRS)

    Phillips, K. J. H.; Neupert, W. M.

    1973-01-01

    Calculations of K alpha line emission from S, Ar, Ca and Fe are presented. It is reported that on the basis of data for hard X-ray bursts, the flux during most impulsive, non-thermal events is likely to be weak, though for a few strong bursts, a flux of approximately 100 photons/cm/s may be expected. The amount of S K alpha emission particularly is sensitively dependent on the value of the lower energy bound of the non-thermal electron distribution, offering a possible means of determining this. Thermal K alpha emission is only significant for Fe ions. The calculated thermal K alpha radiation is much less than that observed during an intense soft X-ray burst. It is concluded that a detailed temperature structure for the emission source is required in order to explain the discrepancy.

  14. Autoradiography Imaging in Targeted Alpha Therapy with Timepix Detector

    PubMed Central

    AL Darwish, Ruqaya; Staudacher, Alexander Hugo; Bezak, Eva; Brown, Michael Paul

    2015-01-01

    There is a lack of data related to activity uptake and particle track distribution in targeted alpha therapy. These data are required to estimate the absorbed dose on a cellular level as alpha particles have a limited range and traverse only a few cells. Tracking of individual alpha particles is possible using the Timepix semiconductor radiation detector. We investigated the feasibility of imaging alpha particle emissions in tumour sections from mice treated with Thorium-227 (using APOMAB), with and without prior chemotherapy and Timepix detector. Additionally, the sensitivity of the Timepix detector to monitor variations in tumour uptake based on the necrotic tissue volume was also studied. Compartmental analysis model was used, based on the obtained imaging data, to assess the Th-227 uptake. Results show that alpha particle, photon, electron, and muon tracks were detected and resolved by Timepix detector. The current study demonstrated that individual alpha particle emissions, resulting from targeted alpha therapy, can be visualised and quantified using Timepix detector. Furthermore, the variations in the uptake based on the tumour necrotic volume have been observed with four times higher uptake for tumours pretreated with chemotherapy than for those without chemotherapy. PMID:25688285

  15. Autoradiography imaging in targeted alpha therapy with Timepix detector.

    PubMed

    A L Darwish, Ruqaya; Staudacher, Alexander Hugo; Bezak, Eva; Brown, Michael Paul

    2015-01-01

    There is a lack of data related to activity uptake and particle track distribution in targeted alpha therapy. These data are required to estimate the absorbed dose on a cellular level as alpha particles have a limited range and traverse only a few cells. Tracking of individual alpha particles is possible using the Timepix semiconductor radiation detector. We investigated the feasibility of imaging alpha particle emissions in tumour sections from mice treated with Thorium-227 (using APOMAB), with and without prior chemotherapy and Timepix detector. Additionally, the sensitivity of the Timepix detector to monitor variations in tumour uptake based on the necrotic tissue volume was also studied. Compartmental analysis model was used, based on the obtained imaging data, to assess the Th-227 uptake. Results show that alpha particle, photon, electron, and muon tracks were detected and resolved by Timepix detector. The current study demonstrated that individual alpha particle emissions, resulting from targeted alpha therapy, can be visualised and quantified using Timepix detector. Furthermore, the variations in the uptake based on the tumour necrotic volume have been observed with four times higher uptake for tumours pretreated with chemotherapy than for those without chemotherapy.

  16. Autoradiography imaging in targeted alpha therapy with Timepix detector.

    PubMed

    A L Darwish, Ruqaya; Staudacher, Alexander Hugo; Bezak, Eva; Brown, Michael Paul

    2015-01-01

    There is a lack of data related to activity uptake and particle track distribution in targeted alpha therapy. These data are required to estimate the absorbed dose on a cellular level as alpha particles have a limited range and traverse only a few cells. Tracking of individual alpha particles is possible using the Timepix semiconductor radiation detector. We investigated the feasibility of imaging alpha particle emissions in tumour sections from mice treated with Thorium-227 (using APOMAB), with and without prior chemotherapy and Timepix detector. Additionally, the sensitivity of the Timepix detector to monitor variations in tumour uptake based on the necrotic tissue volume was also studied. Compartmental analysis model was used, based on the obtained imaging data, to assess the Th-227 uptake. Results show that alpha particle, photon, electron, and muon tracks were detected and resolved by Timepix detector. The current study demonstrated that individual alpha particle emissions, resulting from targeted alpha therapy, can be visualised and quantified using Timepix detector. Furthermore, the variations in the uptake based on the tumour necrotic volume have been observed with four times higher uptake for tumours pretreated with chemotherapy than for those without chemotherapy. PMID:25688285

  17. Brackett-alpha line profiles of young stellar objects

    NASA Technical Reports Server (NTRS)

    Persson, S. E.; Geballe, T. R.; Mcgregor, P. J.; Edwards, S.; Lonsdale, C. J.

    1984-01-01

    Profiles of the Br-alpha line of H I at a velocity resolution of 45 km/s are presented for the compact imbedded infrared objects BN, S106/IRS 3, GLS 490, GL 961, GL 989, Mon. R2/IRS 2, and for the visible objects LkH-alpha 101, T Tau, and R Mon. A proportionality obtained between Br-alpha luminosity and bolometric luminosity is shown to extend over three orders of magnitude, supporting the idea that the physical conditions and gas motions in the circumstellar envelopes of stellar objects are closely related over a wide range of luminosities. The Br-alpha line strengths are compared to radio continuum flux densities in the context of stellar wind models. Momentum deposition rates deduced from Br-alpha or radio continuum fluxes are consistent with those available in the radiation fields, which appear capable of driving the ionized gas outflows in the vicinity of the core sources. The results of a comparison of the H-alpha and Br-alpha profiles for T Tau are discussed.

  18. Basic physics and biology of radiation therapy.

    PubMed

    Crocker, I R; Popowski, Y

    1997-06-01

    The therapeutic use of ionizing radiation followed shortly after the discovery of X-rays by Roentgen in 1895. The radiobiological principles that underlie the clinical use of ionizing radiation have been ablated slowly over the past century. Ionizing radiation, which is used therapeutically for benign and malignant conditions, is characterized by the localized release of large amounts of energy. These radiations may be electromagnetic (X- or gamma rays) or particulate (electrons, protons, alpha particles, neutrons, etc.). In this paper we will review some basic radiation physics and radiation biology principles which might be unfamiliar to the interventional cardiologist interested in this evolving application of radiation to prevent restenosis. PMID:9546997

  19. Alpha Hydroxy Acids

    MedlinePlus

    ... AHAs, topically applied in a cream, on the sensitivity of human skin to ultraviolet (UV) radiation with ... AHAs to the skin results in increased UV sensitivity. After four weeks of AHA application, volunteers' sensitivity ...

  20. H{alpha} ABSORPTION IN TRANSITING EXOPLANET ATMOSPHERES

    SciTech Connect

    Christie, Duncan; Arras, Phil; Li Zhiyun E-mail: pla7y@virginia.edu

    2013-08-01

    Absorption of stellar H{alpha} by the upper atmosphere of the planet HD 189733b has recently been detected by Jensen et al. Motivated by this observation, we have developed a model for atomic hydrogen in the n = 2 state and compared the resulting H{alpha} line profile to the observations. The model atmosphere is in hydrostatic balance, as well as thermal and photoionization equilibrium. Collisional and radiative transitions are included in the determination of the n = 2 state level population. We find that H{alpha} absorption is dominated by an optical depth {tau} {approx} 1 shell, composed of hydrogen in the metastable 2s state that is located below the hydrogen ionization layer. The number density of the 2s state within the shell is found to vary slowly with radius, while that of the 1s state falls rapidly. Thus while the Ly{alpha} absorption, for a certain wavelength, occurs inside a relatively well defined impact parameter, the contribution to H{alpha} absorption is roughly uniform over the entire atomic hydrogen layer. The model can approximately reproduce the observed Ly{alpha} and H{alpha} integrated transit depths for HD 189733b by using an ionization rate enhanced over that expected for the star by an order of magnitude. For HD 209458b, we are unable to explain the asymmetric H{alpha} line profile observed by Jensen et al., as the model produces a symmetric line profile with transit depth comparable to that of HD 189733b. In an appendix, we study the effect of the stellar Ly{alpha} absorption on the net cooling rate.

  1. An alpha/beta/gamma health physics instrument with pulse-shape discrimination

    SciTech Connect

    McElhaney, S.A.; Chiles, M.M.; Ramsey, J.A.

    1990-01-01

    A recent breakthrough in alpha scintillation detector design supports the feasibility of extending this new technology to the development of a monolithic alpha/beta/gamma ({alpha}/{beta}/{gamma}) scintillation detector. The new scintillator is physically robust and chemically resistant to environmental conditions encountered in radiation monitoring, and yet inexpensive to manufacture. The use of pulse-shape discrimination electronics allows pulses from each scintillator to be separated for particle identification. An {alpha}/{beta}/{gamma} detector has a wide variety of possible applications including laundry monitoring, wastewater monitoring, air sampling, and health physics instrumentation. 2 refs., 1 fig.

  2. Proteinaceous alpha-amylase inhibitors.

    PubMed

    Svensson, Birte; Fukuda, Kenji; Nielsen, Peter K; Bønsager, Birgit C

    2004-02-12

    Proteins that inhibit alpha-amylases have been isolated from plants and microorganisms. These inhibitors can have natural roles in the control of endogenous alpha-amylase activity or in defence against pathogens and pests; certain inhibitors are reported to be antinutritional factors. The alpha-amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha-amylases in complex with inhibitors from five families. These structures indicate major diversity but also some similarity in the structural basis of alpha-amylase inhibition. Mutational analysis of the mechanism of inhibition was performed in a few cases and various protein engineering and biotechnological approaches have been outlined for exploitation of the inhibitory function. PMID:14871655

  3. Lorentz violation and {alpha} decay

    SciTech Connect

    Altschul, Brett

    2009-01-01

    Relating the effective Lorentz violation coefficients for composite particles to the coefficients for their constituent fields is a challenging problem. We calculate the Lorentz violation coefficients relevant to the dynamics of an {alpha} particle in terms of proton and neutron coefficients. The {alpha}-particle coefficients would lead to anisotropies in the {alpha} decays of nuclei, and because the decay process involves quantum tunneling, the effects of any Lorentz violations could be exponentially enhanced.

  4. Radiation monitor for liquids

    DOEpatents

    Koster, J.E.; Bolton, R.D.

    1999-03-02

    A radiation monitor for use with liquids that utilizes air ions created by alpha radiation emitted by the liquids as its detectable element. A signal plane, held at an electrical potential with respect to ground, collects these air ions. A guard plane or guard rings is used to limit leakage currents. In one embodiment, the monitor is used for monitoring liquids retained in a tank. Other embodiments monitor liquids flowing through a tank, and bodies of liquids, such as ponds, lakes, rivers and oceans. 4 figs.

  5. Radiation monitor for liquids

    DOEpatents

    Koster, James E.; Bolton, Richard D.

    1999-01-01

    A radiation monitor for use with liquids that utilizes air ions created by alpha radiation emitted by the liquids as its detectable element. A signal plane, held at an electrical potential with respect to ground, collects these air ions. A guard plane or guard rings is used to limit leakage currents. In one embodiment, the monitor is used for monitoring liquids retained in a tank. Other embodiments monitor liquids flowing through a tank, and bodies of liquids, such as ponds, lakes, rivers and oceans.

  6. Amorphous silicon radiation detectors

    DOEpatents

    Street, R.A.; Perez-Mendez, V.; Kaplan, S.N.

    1992-11-17

    Hydrogenated amorphous silicon radiation detector devices having enhanced signal are disclosed. Specifically provided are transversely oriented electrode layers and layered detector configurations of amorphous silicon, the structure of which allow high electric fields upon application of a bias thereby beneficially resulting in a reduction in noise from contact injection and an increase in signal including avalanche multiplication and gain of the signal produced by incoming high energy radiation. These enhanced radiation sensitive devices can be used as measuring and detection means for visible light, low energy photons and high energy ionizing particles such as electrons, x-rays, alpha particles, beta particles and gamma radiation. Particular utility of the device is disclosed for precision powder crystallography and biological identification. 13 figs.

  7. Amorphous silicon radiation detectors

    DOEpatents

    Street, Robert A.; Perez-Mendez, Victor; Kaplan, Selig N.

    1992-01-01

    Hydrogenated amorphous silicon radiation detector devices having enhanced signal are disclosed. Specifically provided are transversely oriented electrode layers and layered detector configurations of amorphous silicon, the structure of which allow high electric fields upon application of a bias thereby beneficially resulting in a reduction in noise from contact injection and an increase in signal including avalanche multiplication and gain of the signal produced by incoming high energy radiation. These enhanced radiation sensitive devices can be used as measuring and detection means for visible light, low energy photons and high energy ionizing particles such as electrons, x-rays, alpha particles, beta particles and gamma radiation. Particular utility of the device is disclosed for precision powder crystallography and biological identification.

  8. Modeling Solar Lyman Alpha Irradiance

    NASA Technical Reports Server (NTRS)

    Pap, J.; Hudson, H. S.; Rottman, G. J.; Willson, R. C.; Donnelly, R. F.; London, J.

    1990-01-01

    Solar Lyman alpha irradiance is estimated from various solar indices using linear regression analyses. Models developed with multiple linear regression analysis, including daily values and 81-day running means of solar indices, predict reasonably well both the short- and long-term variations observed in Lyman alpha. It is shown that the full disk equivalent width of the He line at 1083 nm offers the best proxy for Lyman alpha, and that the total irradiance corrected for sunspot effect also has a high correlation with Lyman alpha.

  9. ISS Update: Alpha Magnetic Spectrometer

    NASA Video Gallery

    NASA Public Affairs Officer Kelly Humphries interviews Trent Martin, Johnson Space Center project manager for the Alpha Magnetic Spectrometer (AMS) aboard the International Space Station. Questions...

  10. Imaging of alpha emitters in a field environment

    NASA Astrophysics Data System (ADS)

    Sand, Johan; Ihantola, Sakari; Peräjärvi, Kari; Nicholl, Adrian; Hrnecek, Erich; Toivonen, Harri; Toivonen, Juha

    2015-05-01

    Cameras sensitive to ultraviolet light can be applied to detection of surface contamination induced by alpha particle emitters. When absorbed in air, alpha particles excite nitrogen molecules and the radiative relaxation creates a faint light emission. This radioluminescence can be used for detection purposes, provided that background lighting levels are low. In this work, three low-light sensitive camera technologies (CCD, EMCCD and ICCD) were utilized in a nuclear facility, and their performance in detecting alpha emitters was investigated. The results show that low readout noise is essential for the detection of radioluminescence, as it allows short exposure times to be used. The ICCD camera was found to perform slightly better than the EMCCD camera in the field, while both enable the detection of MBq level alpha activities in 100 s in the test configuration (camera-target distance 0.5 m). Overall, the cameras and techniques used in this study are shown to be effective in detecting alpha emitters in a standard glovebox. This technology can be applied to nuclear security, safety and safeguards, when stand-off detection of alpha emitters is required.

  11. Hydrogen Balmer alpha intensity distributions and line profiles from multiple scattering theory using realistic geocoronal models

    NASA Technical Reports Server (NTRS)

    Anderson, D. E., Jr.; Meier, R. R.; Hodges, R. R., Jr.; Tinsley, B. A.

    1987-01-01

    The H Balmer alpha nightglow is investigated by using Monte Carlo models of asymmetric geocoronal atomic hydrogen distributions as input to a radiative transfer model of solar Lyman-beta radiation in the thermosphere and atmosphere. It is shown that it is essential to include multiple scattering of Lyman-beta radiation in the interpretation of Balmer alpha airglow data. Observations of diurnal variation in the Balmer alpha airglow showing slightly greater intensities in the morning relative to evening are consistent with theory. No evidence is found for anything other than a single sinusoidal diurnal variation of exobase density. Dramatic changes in effective temperature derived from the observed Balmer alpha line profiles are expected on the basis of changing illumination conditions in the thermosphere and exosphere as different regions of the sky are scanned.

  12. Resting alpha activity predicts learning ability in alpha neurofeedback

    PubMed Central

    Wan, Feng; Nan, Wenya; Vai, Mang I.; Rosa, Agostinho

    2014-01-01

    Individuals differ in their ability to learn how to regulate the brain activity by neurofeedback. This study aimed to investigate whether the resting alpha activity can predict the learning ability in alpha neurofeedback. A total of 25 subjects performed 20 sessions of individualized alpha neurofeedback and the learning ability was assessed by three indices respectively: the training parameter changes between two periods, within a short period and across the whole training time. It was found that the resting alpha amplitude measured before training had significant positive correlations with all learning indices and could be used as a predictor for the learning ability prediction. This finding would help the researchers in not only predicting the training efficacy in individuals but also gaining further insight into the mechanisms of alpha neurofeedback. PMID:25071528

  13. Relative biological effectiveness for induction of cancer by protracted alpha versus beta internal irradiation

    SciTech Connect

    Raabe, O.G.

    1996-06-01

    Three-dimensional dose-rate/time/ response mathematical surfaces describe radiation effects in lifetime studies of beagles after Intake by injection or inhalation of selected radionuclides (including {alpha}-emitters {sup 226}Ra, {sup 239}Pu, {sup 238}Pu, and {sup 241}Am and {Beta}-emitters {sup 90}Sr, {sup 91}Y, and {sup 144}Ce) and in people after intake of {sup 226}Ra. For each effect t{sub m}=K{sub m}d{sup -s}, where t{sub m} is the median elapsed time to death with the specified effect after intake, d is the time-weighted average absorbed radiation dose-rate to the target organ, K{sub m} is the median distribution coefficient, and s is the negative slope parameter. Using maximum likelihood survival regression methods, for fatal cancer induction s was found to be one-third for {alpha} radiation and two-thirds for {beta} radiation. Because the slopes of the response curves for high LET {alpha} emitters differ from those for the low LET {Beta} emitters, the observed relative biological effectiveness, RBE({alpha}/{beta}), varies as a function of time-weighted average dose rate. At high dose rates, this radiation-induced cancer RBE({alpha}/{beta}) is small, but as dose rate goes down, the radiation-induced cancer RBE({alpha}/{beta}) rises without limit; actually the RBE({beta}/{alpha}) for producing radiation-induced cancer approaches zero. For example, for {sup 239}Pu dioxide in lung at 0.1 Gy d{sup -1} vs. {sup 90}Sr, the RBE({alpha}/{beta})=5, while at 1 mGy d{sup -1}, RBE({alpha}/{Beta})=50. The bone cancer RBE({alpha}/{beta})=l at 0.16 Gy d{sup -1} but RBE({alpha}/{beta})=30 at 1 mGy d{sup -1} for {sup 226}Ra/{sup 90}Sr in bone. Since {sup 238}Pu and {sup 239}Pu are about 10 times more effective than {sup 226}Ra in producing bone cancer, the apparent RBE({alpha}/{beta})=300 for plutonium in bone at 1 mG d{sup -1}.

  14. Alpha Magnetic Spectrometer

    NASA Astrophysics Data System (ADS)

    Ting, Samuel

    2012-07-01

    The Alpha Magnetic Spectrometer (AMS) is a precision particle physics magnetic spectrometer designed to measure electrons, positrons, gamma rays and various nuclei and anti-nuclei from the cosmos up to TeV energy ranges. AMS weighs 7.5 tons and measures 5 meters by 4 meters by 3 meters. It contains 300,000 channels of electronics and 650 onboard microprocessors. It was delivered to the International Space Station onboard space shuttle Endeavour and installed on May 19, 2011. Since that time, more than 14 billion cosmic ray events have been collected. All the detectors function properly. At this moment, we are actively engaged in data analysis. AMS is an international collaboration involving 16 countries and 60 institutes. It took 16 years to construct and test. AMS is the only major physical science experiment on the International Space Station and will continue to collect data over the entire lifetime of the Space Station (10-20 years).

  15. Microscopic cluster model of {alpha}+n, {alpha}+p, {alpha}+ {sup 3}He, and {alpha}+{alpha} elastic scattering from a realistic effective nuclear interaction

    SciTech Connect

    Dohet-Eraly, J.; Baye, D.

    2011-07-15

    An effective nucleon-nucleon interaction adapted to cluster-model calculations of collisions is derived from the realistic Argonne potential AV18 with the unitary correlation operator method. The unitary correlation is determined from the {alpha}+{alpha} elastic phase shifts calculated in a cluster approach by the generator coordinate method coupled with the microscopic R-matrix method. With this interaction, the elastic phase shifts for the {alpha}+n, {alpha}+p, and {alpha}+{sup 3}He collisions are calculated within the same model. Without further adjustment, a good agreement with experimental data is obtained with a small model space.

  16. A comparison of the alpha and gamma radiolysis of CMPO

    SciTech Connect

    Bruce J. Mincher; Stephen P. Mezyk; Gary Groenewold; Gracy Elias

    2011-06-01

    The radiation chemistry of CMPO has been investigated using a combination of irradiation and analytical techniques. The {alpha}-, and {gamma}-irradiation of CMPO resulted in identical degradation rates (G-value, in {mu}mol Gy{sup -1}) for both radiation types, despite the difference in their linear energy transfer (LET). Similarly, variations in {gamma}-ray dose rates did not affect the degradation rate of CMPO. The solvent extraction behavior was different for the two radiation types, however. Gamma-irradiation resulted in steadily increasing distribution ratios for both forward and stripping extractions, with respect to increasing absorbed radiation dose. This was true for samples irradiated as a neat organic solution, or irradiated in contact with the acidic aqueous phase. In contrast, {alpha}-irradiated samples showed a rapid drop in distribution ratios for forward and stripping extractions, followed by essentially constant distribution ratios at higher absorbed doses. These differences in extraction behavior are reconciled by mass spectrometric examination of CMPO decomposition products under the different irradiation sources. Irradiation by {gamma}-rays resulted in the rupture of phosphoryl-methylene bonds with the production of phosphinic acid products. These species are expected to be complexing agents for americium that would result in higher distribution ratios. Irradiation by {alpha}-sources appeared to favor rupture of carbamoyl-methylene bonds with the production of less deleterious acetamide products.

  17. Detection of alpha particles using DNA/Al Schottky junctions

    SciTech Connect

    Al-Ta'ii, Hassan Maktuff Jaber E-mail: vengadeshp@um.edu.my; Periasamy, Vengadesh E-mail: vengadeshp@um.edu.my; Amin, Yusoff Mohd

    2015-09-21

    Deoxyribonucleic acid or DNA can be utilized in an organic-metallic rectifying structure to detect radiation, especially alpha particles. This has become much more important in recent years due to crucial environmental detection needs in both peace and war. In this work, we fabricated an aluminum (Al)/DNA/Al structure and generated current–voltage characteristics upon exposure to alpha radiation. Two models were utilized to investigate these current profiles; the standard conventional thermionic emission model and Cheung and Cheung's method. Using these models, the barrier height, Richardson constant, ideality factor and series resistance of the metal-DNA-metal structure were analyzed in real time. The barrier height, Φ value calculated using the conventional method for non-radiated structure was 0.7149 eV, increasing to 0.7367 eV after 4 min of radiation. Barrier height values were observed to increase after 20, 30 and 40 min of radiation, except for 6, 8, and 10 min, which registered a decrease of about 0.67 eV. This was in comparison using Cheung and Cheung's method, which registered 0.6983 eV and 0.7528 eV for the non-radiated and 2 min of radiation, respectively. The barrier height values, meanwhile, were observed to decrease after 4 (0.61 eV) to 40 min (0.6945 eV). The study shows that conventional thermionic emission model could be practically utilized for estimating the diode parameters including the effect of series resistance. These changes in the electronic properties of the Al/DNA/Al junctions could therefore be utilized in the manufacture of sensitive alpha particle sensors.

  18. Detection of alpha particles using DNA/Al Schottky junctions

    NASA Astrophysics Data System (ADS)

    Al-Ta'ii, Hassan Maktuff Jaber; Periasamy, Vengadesh; Amin, Yusoff Mohd

    2015-09-01

    Deoxyribonucleic acid or DNA can be utilized in an organic-metallic rectifying structure to detect radiation, especially alpha particles. This has become much more important in recent years due to crucial environmental detection needs in both peace and war. In this work, we fabricated an aluminum (Al)/DNA/Al structure and generated current-voltage characteristics upon exposure to alpha radiation. Two models were utilized to investigate these current profiles; the standard conventional thermionic emission model and Cheung and Cheung's method. Using these models, the barrier height, Richardson constant, ideality factor and series resistance of the metal-DNA-metal structure were analyzed in real time. The barrier height, Φ value calculated using the conventional method for non-radiated structure was 0.7149 eV, increasing to 0.7367 eV after 4 min of radiation. Barrier height values were observed to increase after 20, 30 and 40 min of radiation, except for 6, 8, and 10 min, which registered a decrease of about 0.67 eV. This was in comparison using Cheung and Cheung's method, which registered 0.6983 eV and 0.7528 eV for the non-radiated and 2 min of radiation, respectively. The barrier height values, meanwhile, were observed to decrease after 4 (0.61 eV) to 40 min (0.6945 eV). The study shows that conventional thermionic emission model could be practically utilized for estimating the diode parameters including the effect of series resistance. These changes in the electronic properties of the Al/DNA/Al junctions could therefore be utilized in the manufacture of sensitive alpha particle sensors.

  19. Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

    PubMed

    Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

    2006-01-01

    The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

  20. Genetics Home Reference: alpha-mannosidosis

    MedlinePlus

    ... Me Understand Genetics Home Health Conditions alpha-mannosidosis alpha-mannosidosis Enable Javascript to view the expand/collapse boxes. Download PDF Open All Close All Description Alpha-mannosidosis is a rare inherited disorder that causes ...

  1. Radiation enteritis

    MedlinePlus

    Radiation enteropathy; Radiation-induced small bowel injury; Post-radiation enteritis ... Radiation therapy uses high-powered x-rays, particles, or radioactive seeds to kill cancer cells. The therapy ...

  2. KNK437, abrogates hypoxia-induced radioresistance by dual targeting of the AKT and HIF-1{alpha} survival pathways

    SciTech Connect

    Oommen, Deepu; Prise, Kevin M.

    2012-05-11

    Highlights: Black-Right-Pointing-Pointer KNK437, a benzylidene lactam compound, is a novel radiosensitizer. Black-Right-Pointing-Pointer KNK437 inhibits AKT signaling and abrogates the accumulation of HIF-1{alpha} under hypoxia. Black-Right-Pointing-Pointer KNK437 abrogates hypoxia induced resistance to radiation. -- Abstract: KNK437 is a benzylidene lactam compound known to inhibit stress-induced synthesis of heat shock proteins (HSPs). HSPs promote radioresistance and play a major role in stabilizing hypoxia inducible factor-1{alpha} (HIF-1{alpha}). HIF-1{alpha} is widely responsible for tumor resistance to radiation under hypoxic conditions. We hypothesized that KNK437 sensitizes cancer cells to radiation and overrides hypoxia-induced radioresistance via destabilizing HIF-1{alpha}. Treatment of human cancer cells MDA-MB-231 and T98G with KNK437 sensitized them to ionizing radiation (IR). Surprisingly, IR did not induce HSPs in these cell lines. As hypothesized, KNK437 abrogated the accumulation of HIF-1{alpha} in hypoxic cells. However, there was no induction of HSPs under hypoxic conditions. Moreover, the proteosome inhibitor MG132 did not restore HIF-1{alpha} levels in KNK437-treated cells. This suggested that the absence of HIF-1{alpha} in hypoxic cells was not due to the enhanced protein degradation. HIF-1{alpha} is mainly regulated at the level of post-transcription and AKT is known to modulate the translation of HIF-1{alpha} mRNA. Interestingly, pre-treatment of cells with KNK437 inhibited AKT signaling. Furthermore, down regulation of AKT by siRNA abrogated HIF-1{alpha} levels under hypoxia. Interestingly, KNK437 reduced cell survival in hypoxic conditions and inhibited hypoxia-induced resistance to radiation. Taken together, these data suggest that KNK437 is an effective radiosensitizer that targets multiple pro-survival stress response pathways.

  3. Alpha-particle spectrometer experiment

    NASA Technical Reports Server (NTRS)

    Gorenstein, P.; Bjorkholm, P.

    1972-01-01

    Mapping the radon emanation of the moon was studied to find potential areas of high activity by detection of radon isotopes and their daughter products. It was felt that based on observation of regions overflown by Apollo spacecraft and within the field of view of the alpha-particle spectrometer, a radon map could be constructed, identifying and locating lunar areas of outgassing. The basic theory of radon migration from natural concentrations of uranium and thorium is discussed in terms of radon decay and the production of alpha particles. The preliminary analysis of the results indicates no significant alpha emission.

  4. Preparation of alpha sources using magnetohydrodynamic electrodeposition for radionuclide metrology.

    PubMed

    Panta, Yogendra M; Farmer, Dennis E; Johnson, Paula; Cheney, Marcos A; Qian, Shizhi

    2010-02-01

    Expanded use of nuclear fuel as an energy resource and terrorist threats to public safety clearly require the development of new state-of-the-art technologies and improvement of safety measures to minimize the exposure of people to radiation and the accidental release of radiation into the environment. The precision in radionuclide metrology is currently limited by the source quality rather than the detector performance. Electrodeposition is a commonly used technique to prepare massless radioactive sources. Unfortunately, the radioactive sources prepared by the conventional electrodeposition method produce poor resolution in alpha spectrometric measurements. Preparing radioactive sources with better resolution and higher yield in the alpha spectrometric range by integrating magnetohydrodynamic convection with the conventional electrodeposition technique was proposed and tested by preparing mixed alpha sources containing uranium isotopes ((238)U, (234)U), plutonium ((239)Pu), and americium ((241)Am) for alpha spectrometric determination. The effects of various parameters such as magnetic flux density, deposition current and time, and pH of the sample solution on the formed massless radioactive sources were also experimentally investigated.

  5. Alpha, beta, or gamma: where does all the diversity go?

    NASA Technical Reports Server (NTRS)

    Sepkoski, J. J. Jr; Sepkoski JJ, J. r. (Principal Investigator)

    1988-01-01

    Global taxonomic richness is affected by variation in three components: within-community, or alpha, diversity, between-community, or beta, diversity; and between-region, or gamma, diversity. A data set consisting of 505 faunal lists distributed among 40 stratigraphic intervals and six environmental zones was used to investigate how variation of alpha and beta diversity influenced global diversity through the Paleozoic, and especially during the Ordovician radiations. As first shown by Bambach (1977), alpha diversity increased by 50 to 70 percent in offshore marine environments during the Ordovician and then remained essentially constant of the remainder of the Paleozoic. The increase is insufficient, however, to account for the 300 percent rise observed in global generic diversity. It is shown that beta diversity among level, soft-bottom communities also increased significantly during the early Paleozoic. This change is related to enhanced habitat selection, and presumably increased overall specialization, among diversifying taxa during the Ordovician radiations. Combined with alpha diversity, the measured change in beta diversity still accounts for only about half of the increase in global diversity. Other sources of increase are probably not related to variation in gamma diversity but rather to appearance and/or expansion of organic reefs, hardground communities, bryozoan thickets, and crinoid gardens during the Ordovician.

  6. Quality factors for alpha particles emitted in tissue

    NASA Technical Reports Server (NTRS)

    Borak, Thomas B.; Chatterjee, A. (Principal Investigator)

    2002-01-01

    A concept of a mean or dose averaged quality factor was defined in ICRP Publication 26 using relationships for quality factor as a function of LET. The concept of radiation weighting factors, wR, was introduced in ICRP Publication 60 in 1990. These are meant to be generalized factors that modify absorbed dose to reflect the risk of stochastic effects as a function of the quality of the radiation incident on the body or emitted by radioactivity within the body. The values of wr are equal to 20 for all alpha particles externally or internally emitted. This note compares the dose averaged quality factor for alpha particles originating in tissue using the old and revised recommendations for quality factor as a function of LET. The dose averaged quality factor never exceeds 20 using the old recommendations and is never less than 20 with the revised recommendations.

  7. Radiation physics, biophysics, and radiation biology

    SciTech Connect

    Hall, E.J.; Zaider, M.

    1993-05-01

    Research at the Center for Radiological Research is a multidisciplenary blend of physics, chemistry and biology aimed at understanding the mechanisms involved in the health problems resulting from human exposure to ionizing radiations. The focus is increased on biochemistry and the application of the techniques of molecular biology to the problems of radiation biology. Research highlights of the program from the past year are described. A mathematical model describing the production of single-strand and double-strand breaks in DNA as a function radiation quality has been completed. For the first time Monte Carlo techniques have been used to obtain directly the spatial distribution of DNA moieties altered by radiation. This information was obtained by including the transport codes a realistic description of the electronic structure of DNA. We have investigated structure activity relationships for the potential oncogenicity of a new generation of bioreductive drugs that function as hypoxic cytotoxins. Experimental and theoretical investigation of the inverse dose rate effect, whereby medium LET radiations actually produce an c effect when the dose is protracted, is now at a point where the basic mechanisms are reasonably understood and the complex interplay between dose, dose rate and radiation quality which is necessary for the effect to be present can now be predicted at least in vitro. In terms of early radiobiological damage, a quantitative link has been established between basic energy deposition and locally multiply damaged sites, the radiochemical precursor of DNA double strand breaks; specifically, the spatial and energy deposition requirements necessary to form LMDs have been evaluated. For the first time, a mechanically understood biological fingerprint'' of high-LET radiation has been established. Specifically measurement of the ratio of inter-to intra-chromosomal aberrations produces a unique signature from alpha-particles or neutrons.

  8. MEASUREMENT OF SURFACE ALPHA CONTAMINATION USING ELECTRET ION CHAMBERS

    SciTech Connect

    M.A. Ebadian, Ph.D.

    1999-01-01

    Electret ion chambers (EICs) are known to be inexpensive, reliable, passive, integrating devices used for measurement of ionizing radiation. Their application for measurement of alpha contamination on surfaces was recently realized. This two-year project deals with the evaluation of electret ion chambers with different types of electrets and chambers for measurement of surface alpha contamination, their demonstration at U.S. Department of Energy (DOE) sites, a cost-benefit comparison with the existing methods, and the potential deployment at DOE sites. During the first year (FY98) of the project, evaluation of the EICS was completed. It was observed that EICS could be used for measurement of free release level of alpha contamination for transuranics (100 dpm/100 cm{sup 2} fixed). DOE sites, where demonstration of EIC technology for surface alpha contamination measurements could be performed, were also identified. During FY99, demonstration and deployment of EICS at DOE sites are planned. A cost-benefit analysis of the EIC for surface alpha contamination measurement will also be performed.

  9. Clearings in Ly-alpha forests

    NASA Astrophysics Data System (ADS)

    Kovner, Israel; Rees, Martin J.

    1989-10-01

    At sufficient resolution, QSO spectra can be examined for patches of reduced H I column density in Ly-alpha clouds. Statistics of these clearings can constrain the fraction of the ionizing background contributed by compact sources and (possibly) their lifetimes and beaming. This is demonstrated first in a simple Euclidean setup and then in a model which takes into account the expansion of the universe and the cosmological evolution of the factors involved. The expected number of clearings in a Ly-alpha forest extending back to the formation epoch of compact sources of ionizing radiation (CSIRs) is about 1/4, if the CSIRs are important ionizing agents, and if the transience of CSIRs is unimportant. The particular properties of the CSIR population, e.g., their luminosity function, have little importance. However, expected number of clearings can be much larger if the CSIR lifetimes are short compared to the light crossing times of the domains of dominance, or if the CSIRs turned on sharply at a time when the ionization rate due to competing processes was low.

  10. alpha-Melanocortin and endothelin-1 activate antiapoptotic pathways and reduce DNA damage in human melanocytes.

    PubMed

    Kadekaro, Ana Luisa; Kavanagh, Renny; Kanto, Hiromi; Terzieva, Silva; Hauser, Jennifer; Kobayashi, Nobuhiko; Schwemberger, Sandy; Cornelius, James; Babcock, George; Shertzer, Howard G; Scott, Glynis; Abdel-Malek, Zalfa A

    2005-05-15

    UV radiation is an important etiologic factor for skin cancer, including melanoma. Constitutive pigmentation and the ability to tan are considered the main photoprotective mechanism against sun-induced carcinogenesis. Pigmentation in the skin is conferred by epidermal melanocytes that synthesize and transfer melanin to keratinocytes. Therefore, insuring the survival and genomic stability of epidermal melanocytes is critical for inhibiting photocarcinogenesis, particularly melanoma, the most deadly form of skin cancer. The paracrine factors alpha-melanocortin and endothelin-1 are critical for the melanogenic response of cultured human melanocytes to UV radiation. We report that alpha-melanocortin and endothelin-1 rescued human melanocytes from UV radiation-induced apoptosis and reduced DNA photoproducts and oxidative stress. The survival effects of alpha-melanocortin and endothelin-1 were mediated by activation of the melanocortin 1 and endothelin receptors, respectively. Treatment of melanocytes with alpha-melanocortin and/or endothelin-1 before exposure to UV radiation activated the inositol triphosphate kinase-Akt pathway and increased the phosphorylation and expression of the microphthalmia-related transcription factor. Treatment with alpha-melanocortin and/or endothelin-1 enhanced the repair of cyclobutane pyrimidine dimers and reduced the levels of hydrogen peroxide induced by UV radiation. These effects are expected to reduce genomic instability and mutagenesis.

  11. Alpha--College for Exploring

    ERIC Educational Resources Information Center

    Leppert, William; Koenig, Joan

    1976-01-01

    Describes Alpha, the experimental college of individualized instruction at the College of DuPage (Illinois). At this college, students design their own curricula and work in an open classroom situation, and teachers start with students instead of subjects. (DC)

  12. Genetics Home Reference: alpha thalassemia

    MedlinePlus

    ... in each cell. Each copy is called an allele. For each gene, one allele is inherited from a person's father, and the ... person's mother. As a result, there are four alleles that produce alpha-globin. The different types of ...

  13. Detecting Alpha-1 Antitrypsin Deficiency.

    PubMed

    Stoller, James K

    2016-08-01

    Alpha-1 antitrypsin deficiency is a widely underrecognized condition, with evidence of persisting long diagnostic delays and patients' frequent need to see multiple physicians before initial diagnosis. Reasons for underrecognition include inadequate understanding of alpha-1 antitrypsin deficiency by physicians and allied health care providers; failure to implement available, guideline-based practice recommendations; and the belief that effective therapy is unavailable. Multiple studies have described both the results of screening and targeted detection of individuals with alpha-1 antitrypsin deficiency, with both varying strategies employed to identify at-risk individuals and varying results of testing. Also, various strategies to enhance detection of affected individuals have been examined, including use of the electronic medical record to prompt testing and empowerment of allied health providers, especially respiratory therapists, to promote testing for alpha-1 antitrypsin deficiency. Such efforts are likely to enhance detection with the expected result that the harmful effects of delayed diagnosis can be mitigated. PMID:27564667

  14. Alpha Magnetic Spectrometer (AMS) Overview

    NASA Video Gallery

    The Alpha Magnetic Spectrometer (AMS) is flying to the station on STS-134. The AMS experiment is a state-of-the-art particle physics detector being operated by an international team composed of 60 ...

  15. Synthesis and herbicidal activity of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives.

    PubMed

    Xu, Han; Zou, Xiao-Mao; Zhu, You-Quan; Liu, Bin; Tao, Han-Lin; Hu, Xu-Hong; Song, Hai-Bin; Hu, Fang-Zhong; Wang, Yong; Yang, Hua-Zheng

    2006-06-01

    A series of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives was synthesised. Herbicidal activities of the two intermediate compounds and 15 pyridazinone derivatives were evaluated through barnyardgrass and rape cup tests and Spirodela polyrrhiza (L.) Schleiden tests. Selected compounds were also evaluated under greenhouse conditions. Bleaching activities were observed at 10 microg ml(-1) and some compounds exhibited herbicidal activities at a rate of 300 g ha(-1). The relationship between crystal structures and herbicidal activities is discussed through a comparison of two compounds (5a and 5f). PMID:16602079

  16. Alpha decay in electron surrounding

    SciTech Connect

    Igashov, S. Yu.; Tchuvil’sky, Yu. M.

    2013-12-15

    The influence of atomic electron shells on the constant of alpha decay of heavy and mediummass nuclei was considered in detail. A method for simultaneously taking into account the change in the potential-barrier shape and the effect of reflection of a diverging Coulomb wave in the classically allowed region was developed. The ratios of decay probabilities per unit time for a bare nucleus and the respective neutral atom were found for some alpha-decaying isotopes.

  17. Modeling of hot Jupiter H alpha transmission spectral line

    NASA Astrophysics Data System (ADS)

    Huang, Chenliang; Arras, Phil; Christie, Duncan

    2016-01-01

    The upper atmosphere of hot Jupiters is subject to the strong stellar radiation field of the host star, which can heat and ionize the gas, as well as excite atoms to higher energy levels. For planets near the parent star, a thick layer of atomic hydrogen may be present, which has now been observed through both Lyman alpha and H alpha absorption of starlight during transit. Motivated by these observations, we revisit the calculations of Christie et al to study the hydrogen level populations in detail, including radiative (de-)excitation, collisional (de-)excitation, collisional ell-mixing processes up to n = 6 states, as well as radiative ionization, recombination and collisional ionization processes. Using theHD 189733b thermal and photoionization equilibrium hydrostatic balance atmosphere model of Christie et al, we find that the 2s state population is dominated by a) creation and destruction channels via np states (n > 2), which was not considered previously, and b) 2s to 2p collisional ℓ-mixing process, which was treated incorrectly. I will show our modeling of H alpha transit depth observation with new level populations module.

  18. A phoswich detector for simultaneous alpha-gamma spectroscopy

    NASA Astrophysics Data System (ADS)

    Moghadam, S. Rajabi; Feghhi, S. A. H.; Safari, M. J.

    2015-11-01

    Phoswich detectors are of value for radiation spectroscopy, especially in cases where a low-cost solution for a mixed radiation field is desired. Meanwhile, simultaneous spectroscopy of alpha particles and gamma-rays has many applications in quantification and distinguishing the alpha-emitting radionuclides which usually occur in the analysis of environmental solid samples. Here, we have developed a system for detection of radioactive actinides (e.g., 241Am) based on the alpha-gamma coincidence technique. The underlying concept, is to assemble two appropriately selected scintillators (i.e., a fast and a slow one) together with a discriminating unit for analysis of their data. Detailed Monte Carlo simulation procedure has been developed using the GEANT4 toolkit to design and find enough knowledge about the response of the system in the studied radiation field. Various comparisons were made between experimental and simulation data which showed appropriate agreement between them. The calibration was performed and the MDA was estimated as 60 mBq for the phoswich system.

  19. Lyman-Alpha aurora

    SciTech Connect

    Durrance, S.T.; Clarke, J.T.

    1984-10-01

    The existence of intense and variable H Ly a emission from Uranus is demonstrated utilizing the monochromatic imaging capabilities of the International Ultraviolet Explorer satellite. A series of 14 observations, using the IUE short wavelength spectrograph in low dispersion and covering the period from 3 March 1982 through 2 September 1983, shows the disk averaged Ly a brightness of Uranus to vary between 690 and 2230 Rayleighs. Model calculations indicates that 400 R of this emission can be attributed to resonant scattering of solar Ly a radiation. An upper limit of 100 R is obtained for the Raman scattering of solar Ly a by H2 (1280 A). This implies that 300 R is contributed to the planetary Ly a emission by Rayleigh scattering. In addition to being unexpectedly strong, the Uranian Ly a emission has been observed to vary by a factor of two in one 24 hr period and by about 50% in one 5 hr period.

  20. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  1. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  2. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  3. Binding of actin to lens alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    Actin has been coupled to a cyanogen bromide-activated Sepharose 4B column, then tested for binding to alpha, beta, and gamma crystallin preparations from the bovine lens. Alpha, but not beta or gamma, crystallins bound to the actin affinity column in a time dependent and saturable manner. Subfractionation of the alpha crystallin preparation into the alpha-A and alpha-B species, followed by incubation with the affinity column, demonstrated that both species bound approximately the same. Together, these studies demonstrate a specific and saturable binding of lens alpha-A and alpha-B with actin.

  4. Alpha-beta monitoring system based on pair of simultaneous Multi-Wire Proportional Counters

    NASA Astrophysics Data System (ADS)

    Wengrowicz, U.; Amidan, D.; Orion, I.

    2016-08-01

    A new approach for a simultaneous alpha-beta Multi-wire Proportional Counter (MWPC) is presented. The popular approach for alpha-beta monitoring systems consists of a large area MWPC using noble gas flow such as Argon Methane. This method of measurement is effective but requires large-scale and expensive maintenance due to the needs of gas flow control and periodic replacements. In this work, a pair of simultaneous MWPCs for alpha-beta measuring is presented. The developed detector consists of a sealed gas MWPC sensor for beta particles, behind a free air alpha sensor. This approach allows effective simultaneous detection and discrimination of both alpha and beta radiation without the maintenance cost noble gas flow required for unsealed detectors.

  5. AXUV bolometer and Lyman-{alpha} camera systems on the TCV tokamak

    SciTech Connect

    Degeling, A.W.; Weisen, H.; Zabolotsky, A.; Duval, B.P.; Pitts, R.A.; Wischmeier, M.; Lavanchy, P.; Marmillod, Ph.; Pochon, G.

    2004-10-01

    A set of seven twin slit cameras, each containing two 20-element linear absolute extreme ultraviolet photodiode arrays, has been installed on the Tokamak a Configuration Variable. One array in each camera will operate as a bolometer and the second as a Lyman-alpha (L{sub {alpha}}) emission monitor for estimating the recycled neutral flux. The camera configuration was optimized by simulations of tomographic reconstructions of the expected L{sub {alpha}} emission. The diagnostic will provide spatial and temporal resolution (10 {mu}s) of the radiated power and the L{sub {alpha}} emission that is considerably higher than previously achieved. This optimism is justified by extensive experience with prototype systems, which include first measurements of L{sub {alpha}} light from the divertor.

  6. Assessment of alpha activity of building materials commonly used in West Bengal, India.

    PubMed

    Ghosh, Dipak; Deb, Argha; Bera, Sukumar; Sengupta, Rosalima; Patra, Kanchan Kumar

    2008-02-01

    This paper, reports for the first time, an extensive study of alpha activity of all widely used building materials (plaster of Paris, stone chips, marble, white cement, mosaic stone, limestone, sand, granite, cement brick, asbestos, red brick, cement tile, ceramic tile and ceramics) in West Bengal, India. The alpha activities have been measured using Solid State Nuclear Track Detector (SSNTD), a very sensitive detector for alpha particles. The samples were collected from local markets of Kolkata. The measured average alpha activities ranged from 22.7+/-2.5 to 590.6+/-16.8Bqkg(-1). The alpha activity of ceramic tiles was highest and provides additional data to estimate the effect of environmental radiation exposure on human health.

  7. [Alpha-Synuclein in blood and cerebrospinal fluid of patients with alpha-synucleinopathy].

    PubMed

    Ono, Kenjiro; Yamada, Masahito

    2014-03-01

    Alpha-Synuclein protein(alphaS) aggregates from a monomer to assemblies such as oligomers, protofibrils, and mature fibrils. The early intermediate aggregate, that is, the oligomer, has been reported to be the most toxic species. We recently reported that melatonin inhibits alphaS aggregation, including protofibril and oligomer formations. While the alphaS concentration in cerebrospinal fluid was reported to significantly decrease in patients with Parkinson's disease (PD) and dementia with Lewy bodies, there have been reports that the alphaS oligomer concentration was elevated in the cerebrospinal fluid of PD patients. Moreover, it was reported that the alphaS oligomer concentration was also elevated in the blood of PD patients. Further studies may establish alphaS in cerebrospinal fluid and blood as a biomarker of alpha-synucleinopathies, including PD.

  8. HUBBLE SPACE TELESCOPE IMAGING OF Ly{alpha} EMISSION AT z {approx} 4.4

    SciTech Connect

    Finkelstein, Steven L.; Finkelstein, Keely D.; Cohen, Seth H.; Windhorst, Rogier A.; Malhotra, Sangeeta; Rhoads, James E.; Ryan, Russell E.; Hathi, Nimish P.; McCarthy, Patrick J.; Anderson, Jay; Grogin, Norman A.; Koekemoer, Anton M.; Mutchler, Max; Bond, Howard E.; O'Connell, Robert W.; Balick, Bruce; Calzetti, Daniela; Disney, Michael J.; Dopita, Michael A.; Frogel, Jay A.

    2011-07-01

    We present the highest redshift detections of resolved Ly{alpha} emission, using Hubble Space Telescope (HST)/Advanced Camera for Surveys F658N narrowband-imaging data taken in parallel with the Wide Field Camera 3 Early Release Science program in the GOODS Chandra Deep Field-South. We detect Ly{alpha} emission from three spectroscopically confirmed z = 4.4 Ly{alpha} emitting galaxies (LAEs), more than doubling the sample of LAEs with resolved Ly{alpha} emission. Comparing the light distribution between the rest-frame ultraviolet continuum and narrowband images, we investigate the escape of Ly{alpha} photons at high redshift. While our data do not support a positional offset between the Ly{alpha} and rest-frame ultraviolet (UV) continuum emission, the half-light radius in one out of the three galaxies is significantly (>1{sigma}) larger in Ly{alpha} than in the rest-frame UV continuum. Stacking the three LAEs in both the narrowband and UV continuum images, we find that the Ly{alpha} light appears larger than the rest-frame UV at 4.2{sigma} significance. This Ly{alpha} flux detected with HST is a factor of 4-10 less than observed in similar filters from the ground. These results together imply that the Ly{alpha} emission is not strictly confined to its indigenous star-forming regions. Rather, for at least one object the Ly{alpha} emission is more extended, with the missing HST flux possibly existing in a diffuse outer halo. This suggests that the radiative transfer of Ly{alpha} photons in high-redshift LAEs is complicated, with the interstellar-medium geometry and/or outflows playing a significant role in galaxies at these redshifts.

  9. Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...

  10. Simple experimental method for alpha particle range determination in lead iodide films

    SciTech Connect

    Dmitriev, Yuri; Bennett, Paul R.; Cirignano, Leonard J.; Klugerman, Mikhail; Shah, Kanai S.

    2007-05-15

    An experimental method for determining the range of alpha particles in films based on I-V{sub s} analysis has been suggested. The range of 5.5 MeV alpha particles in PbI{sub 2} films determined by this technique is 30{+-}5 {mu}m, and this value is in agreement with the value calculated by SRIM (the stopping and range of ions in matter), r=24 {mu}m in PbI{sub 2}. More than 100 I-V{sub s} of PbI{sub 2} films with different thicknesses and quality have been analyzed, and the influence of alpha particle radiation on PbI{sub 2} I-V{sub s} curves has been studied. Developed analytical methods (dependence of current density on electric field and conception of surface defects) were used, and the method limitations are discussed. It was shown that I-V{sub s} demonstrate the tendency to obey Ohm's law under alpha radiation. On the other hand, dark conductivity of the lead iodide films shows a typical impure character that can lead to an overestimation of the alpha particles' range in PbI{sub 2} films. After films were exposed to alpha radiation, the dark resistivity and I-V shape of some films improved. Also, a weak decrease of the charge carrier concentration, due to a decrease of the ''surface defect'' concentration (''surface refining''), was registered after successive measurements of I-V{sub s}.

  11. Measurement of natural radioactivity in chemical fertilizer and agricultural soil: evidence of high alpha activity.

    PubMed

    Ghosh, Dipak; Deb, Argha; Bera, Sukumar; Sengupta, Rosalima; Patra, Kanchan Kumar

    2008-02-01

    People are exposed to ionizing radiation from the radionuclides that are present in different types of natural sources, of which phosphate fertilizer is one of the most important sources. Radionuclides in phosphate fertilizer belonging to 232Th and 238U series as well as radioisotope of potassium (40K) are the major contributors of outdoor terrestrial natural radiation. The study of alpha activity in fertilizers, which is the first ever in West Bengal, has been performed in order to determine the effect of the use of phosphate fertilizers on human health. The data have been compared with the alpha activity of different types of chemical fertilizers. The measurement of alpha activity in surface soil samples collected from the cultivated land was also performed. The sampling sites were randomly selected in the cultivated land in the Midnapore district, which is the largest district in West Bengal. The phosphate fertilizer is widely used for large agricultural production, mainly potatoes. The alpha activities have been measured using solid-state nuclear track detectors (SSNTD), a very sensitive detector for alpha particles. The results show that alpha activity of those fertilizer and soil samples varies from 141 Bq/kg to 2,589 Bq/kg and from 109 Bq/kg to 660 Bq/kg, respectively. These results were used to estimate environmental radiation exposure on human health contributed by the direct application of fertilizers.

  12. A DETECTION OF H{alpha} IN AN EXOPLANETARY EXOSPHERE

    SciTech Connect

    Jensen, Adam G.; Redfield, Seth; Endl, Michael; Cochran, William D.; Koesterke, Lars; Barman, Travis E-mail: sredfield@wesleyan.edu E-mail: wdc@astro.as.utexas.edu E-mail: barman@lowell.edu

    2012-06-01

    We report on a search for H{alpha} absorption in four exoplanets. Strong features at H{alpha} are observed in the transmission spectra of both HD 189733b and HD 209458b. We attempt to characterize and remove the effects of stellar variability in HD 189733b, and along with an empirical Monte Carlo test the results imply a statistically significant transit-dependent feature of (- 8.72 {+-} 1.48) Multiplication-Sign 10{sup -4} integrated over a 16 A band relative to the adjacent continuum. We interpret this as the first detection of this line in an exoplanetary atmosphere. A previous detection of Ly{alpha} in HD 189733b's atmosphere allows us to calculate an excitation temperature for hydrogen, T{sub exc} = 2.6 Multiplication-Sign 10{sup 4} K. This calculation depends significantly on certain simplifying assumptions. We explore these assumptions and argue that T{sub exc} is very likely much greater than the radiative equilibrium temperature (the temperature the planet is assumed to be at based on stellar radiation and the planetary distance) of HD 189733b. A large T{sub exc} implies a very low density that is not in thermodynamic equilibrium with the planet's lower atmosphere. We argue that the n = 2 hydrogen required to cause H{alpha} absorption in the atmosphere is created as a result of the greater UV flux at HD 189733b, which has the smallest orbit and most chromospherically active central star in our sample. Though the overall integration of HD 209458b's transmission spectrum over a wide band is consistent with zero, it contains a dramatic, statistically significant feature in the transmission spectrum with reflectional symmetry. We discuss possible physical processes that could cause this feature. Our remaining two targets (HD 147506b and HD 149026b) do not show any clear features, so we place upper limits on their H{alpha} absorption levels.

  13. Radiation Therapy

    MedlinePlus

    Radiation therapy is a cancer treatment. It uses high doses of radiation to kill cancer cells and stop them from ... half of all cancer patients receive it. The radiation may be external, from special machines, or internal, ...

  14. Radiation Therapy

    MedlinePlus

    ... people who have radiation therapy may feel more tired than usual, not feel hungry, or lose their ... of radiation therapy include: Fatigue. Fatigue, or feeling tired, is the most common side effect of radiation ...

  15. Radiation therapy

    MedlinePlus

    ... Because radiation is most harmful to quickly growing cells, radiation therapy damages cancer cells more than normal cells. ... cells from growing and dividing, and leads to cell death. Radiation therapy is used to fight many types of ...

  16. Workshop on Precision Measurements of $\\alpha_s$

    SciTech Connect

    Bethke, Siegfried; Hoang, Andre H.; Kluth, Stefan; Schieck, Jochen; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS

    2011-10-01

    These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

  17. Characterization of irradiated blends of alpha-tocopherol and UHMWPE.

    PubMed

    Oral, Ebru; Greenbaum, Evan S; Malhi, Arnaz S; Harris, William H; Muratoglu, Orhun K

    2005-11-01

    Adhesive/abrasive wear in ultra-high molecular weight polyethylene (UHMWPE) has been minimized by radiation cross-linking. Irradiation is followed by melting to eliminate residual free radicals and avoid long-term oxidative embrittlement. However, post-irradiation melting reduces the crystallinity of the polymer and hence its strength and fatigue resistance. We proposed an alternative to post-irradiation melting to be the incorporation of the antioxidant alpha-tocopherol into UHMWPE prior to consolidation. alpha-Tocopherol is known to react with oxygen and oxidized lipids, stabilizing them against further oxidative degradation reactions. We blended GUR 1050 UHMWPE resin powder with alpha-tocopherol at 0.1 and 0.3 wt% and consolidated these blends. Then we gamma-irradiated these blends to 100-kGy. We characterized the effect of alpha-tocopherol on the cross-linking efficiency, oxidative stability, wear behavior and mechanical properties of the blends. (I) The cross-link density of virgin, 0.1 and 0.3 wt% alpha-tocopherol blended, 100-kGy irradiated UHMWPEs were 175+/-19, 146+/-4 and 93+/-4 mol/m3, respectively. (II) Maximum oxidation indices for 100-kGy irradiated UHMWPE previously blended with 0, 0.1 and 0.3 wt% alpha-tocopherol that were subjected to accelerated aging at 80 degrees C in air for 5 weeks were 3.32, 0.09, and 0.05, respectively. (III) The pin-on-disc wear rates of 100-kGy irradiated UHMWPE previously blended with 0.1 and 0.3 wt% alpha-tocopherol that were subjected to accelerated aging at 80 degrees C in air for 5 weeks were 2.10+/-0.17 and 5.01+/-0.76 mg/million cycles, respectively. (IV) Both accelerated aged, alpha-tocopherol-blended 100-kGy irradiated UHMWPEs showed higher ultimate tensile strength, higher yield strength, and lower elastic modulus when compared to 100-kGy irradiated, virgin UHMWPE. These results showed that alpha-tocopherol-blended 100-kGy irradiated UHMWPEs were not cross-linked to the same extent as the 100-kGy irradiated

  18. Three-loop reducible radiative photon contributions to Lamb shift and hyperfine splitting

    SciTech Connect

    Eides, Michael I.; Shelyuto, Valery A.

    2004-08-01

    Corrections of order {alpha}{sup 3}(Z{alpha}){sup 5}m to the Lamb shift and corrections of order {alpha}{sup 3}(Z{alpha})E{sub F} to the hyperfine splitting, generated by insertion of the three-loop one-particle reducible diagrams with radiative photons in the electron line, are calculated. The calculations are performed in the Yennie gauge.

  19. Atmospheric radiation

    SciTech Connect

    Harshvardhan, M.R. )

    1991-01-01

    Studies of atmospheric radiative processes are summarized for the period 1987-1990. Topics discussed include radiation modeling; clouds and radiation; radiative effects in dynamics and climate; radiation budget and aerosol effects; and gaseous absorption, particulate scattering and surface reflection. It is concluded that the key developments of the period are a defining of the radiative forcing to the climate system by trace gases and clouds, the recognition that cloud microphysics and morphology need to be incorporated not only into radiation models but also climate models, and the isolation of a few important unsolved theoretical problems in atmospheric radiation.

  20. The radiation chemistry of CMPO: Part 2. Alpha radiolysis

    SciTech Connect

    Bruce J. Mincher; Stephen P. Mezyk; Gary S. Groenewold; Christian Ekberg; Gunnar Skarnemark; Jay A. LaVerne; Mikael Nilsson; Jeremy Pearson; Nicholas C. Schmitt; Richard D. Tillotson; Lonnie G. Olson; Gracy Elias

    2014-01-01

    Octylphenyl-N,N-diisobutylcarbamoylmethylphosphine oxide (CMPO) dissolved in dodecane was subjected to a-irradiation using a He-ion beam, 244 Cm isotopic a-rays, and He and Li ions created by the n,a reaction of 10B in a nuclear reactor. Post-irradiation samples were analyzed for the radiolytically-induced decrease in CMPO concentration, the appearance of degradation products, and their Am solvent extraction distribution ratios. The –G CMPO-value for the radiolytic degradation of CMPO was found to be very low compared to values previously reported for ?-irradiation. Additionally, isotopic irradiation to absorbed a-doses as high as 600 kGy in aerated solution had no effect on Am solvent extraction or stripping. The main CMPO radiolysis products identified in He-ion beam irradiated samples by ESI-MS include amides, an acidic amide, and amines produced by bond rupture on either side of the CMPO carbonyl group. Deaerated samples irradiated using the reactor in the absence of an aqueous phase, or with a dilute nitric acid aqueous phase showed small but measurable decreases in CMPO concentration with increasing absorbed doses. Higher concentrations of nitric acid resulted in lower decomposition rates for the CMPO. The radio-protection by dissolved oxygen and nitric acid previously found for ?-irradiated CMPO also occurs for a-irradiation. This suggests that similar free-radical mechanisms operate in the high-LET system, but with lower degradation yields due to the lower overall radical concentrations produced.

  1. Venus Lyman-Alpha a Morphological and Radiative Transfer Analysis

    NASA Astrophysics Data System (ADS)

    Colwell, William Bradford

    The Venus Lyman-α corona is caused by resonance scattering of the solar 1215.67A Lyman-α line by hydrogen atoms in the Venus upper atmosphere. The atmospheric atomic hydrogen content is probed remotely via Lyman-α observations. On 10 February 1990 the Galileo spacecraft flew by Venus, obtaining a series of Venus scans with the Ultraviolet Spectrometer Experiment. The Pioneer Venus Orbiter Ultraviolet Spectrometer obtained Venus Lyman-α images approximately weekly throughout its 14-year mission (1978-1992), spanning the 11-year solar cycle. I analyze the data using a two-dimensional non-isothermal complete-frequency-redistribution multiple scattering code modified from the LYAB code provided by James Bishop for the Earth corona. I employ the VTS3 neutral thermosphere model (Hedin et al., J. Geophys. Res., 88, 73, 1983), and calculate diffusive profiles for the vertical distribution of atomic hydrogen, characterized by hydrogen number density n0 and vertical flux φ0 at the exobase (Paxton et al., J. Geophys. Res., 193, 1766, 1988). The flux parameter controls the hydrogen amount in the lower thermosphere and the exobase density controls the amount in the upper thermosphere and exosphere. I determine the parameter values which best fit the data for selected segments of the sunlit disk, taking advantage of the almost linear relationship between the PV Langmuir probe photoelectron current and measured solar Lyman-α output. I find an equatorial minimum of hydrogen and evidence for a polar hood of enhanced hydrogen abundance. The pre-dawn bulge enhancement near the dawn terminator extends to high latitudes (>60o). All features examined persist throughout solar cycle and increase in hydrogen abundance with solar activity. The parameters I determine agree with the work of Paxton et al. and with densities derived from in situ measurement by Brinton et al. (Geophys. Res. Ler., 7, 865, 1980). Both parameters increase with solar activity and there is evidence suggesting solar cycle phase dependence. Dayside hydrogen density increases with latitude and decreases with local solar time. A search for small scale (1000 km) features produced a null result.

  2. Reconstruction of radiating sound fields using minimum energy method.

    PubMed

    Bader, Rolf

    2010-01-01

    A method for reconstructing a pressure field at the surface of a radiating body or source is presented using recording data of a microphone array. The radiation is assumed to consist of many spherical radiators, as microphone positions are present in the array. These monopoles are weighted using a parameter alpha, which broadens or narrows the overall radiation directivity as an effective and highly intuitive parameter of the radiation characteristics. A radiation matrix is built out of these weighted monopole radiators, and for different assumed values of alpha, a linear equation solver reconstructs the pressure field at the body's surface. It appears that from these many arbitrary reconstructions, the correct one minimizes the reconstruction energy. The method is tested, localizing the radiation points of a Balinese suling flute, reconstructing complex radiation from a duff frame drum, and determining the radiation directivity for the first seven modes of an Usbek tambourine. Stability in terms of measurement noise is demonstrated for the plain method, and additional highly effective algorithm is added for a noise level up to 0 dB. The stability of alpha in terms of minimal reconstruction energy is shown over the whole range of possible values for alpha. Additionally, the treatment of unwanted room reflections is discussed, still leading to satisfactory results in many cases. PMID:20058977

  3. alpha-Thalassemia caused by an unstable alpha-globin mutant.

    PubMed Central

    Liebhaber, S A; Kan, Y W

    1983-01-01

    In a previous study, molecular cloning of the alpha-globin genes from a patient with nondeletion Hb-H disease (genotype--/alpha alpha) showed that a single nucleotide mutation (CTG to CCG) in one of the genes resulted in a leucine to proline substitution. This paper describes the approach we used to detect the abnormal alpha-globin chain. The chain was identified using a cell-free translation system. It turned over rapidly both in vitro and in vivo in the patient's reticulocytes. The unusual feature of this unstable alpha-globin is that the alpha-globin deficiency causes alpha-thalassemia. Simple heterozygotes for this lesion (alpha Pro alpha/alpha alpha) resemble alpha-thalassemia carriers and do not exhibit the hemolytic anemia usually associated with unstable hemoglobins. Images PMID:6826718

  4. H/sub. cap alpha. / laser fluorescence diagnostic on the Tara Tandem Mirror experiment

    SciTech Connect

    Guss, W.C.; Yao, X.Z.; Pocs, L.; Mahon, R.; Casey, J.; Post, R.S.

    1988-08-01

    A laser fluorescence diagnostic has been used for measuring the neutral hydrogen density in the central cell of the Tara thermal barrier tandem mirror. Experiments have been performed using laser-induced, resonance fluorescence detection of H/sub ..cap alpha../ (6563-A) radiation. Measurements were made at a number of radial positions with 1-cm resolution, from the magnetic axis to near the plasma limiter. Stray laser light contributions to the signal were eliminated with a double-pulse technique. For comparison, the chord-averaged plasma H/sub ..cap alpha../ radiation was analyzed under the identical conditions for which laser fluorescence data were taken.

  5. Test chamber for alpha spectrometry

    DOEpatents

    Larsen, Robert P.

    1977-01-01

    Alpha emitters for low-level radiochemical analysis by measurement of alpha spectra are positioned precisely with respect to the location of a surface-barrier detector by means of a chamber having a removable threaded planchet holder. A pedestal on the planchet holder holds a specimen in fixed engagement close to the detector. Insertion of the planchet holder establishes an O-ring seal that permits the chamber to be pumped to a desired vacuum. The detector is protected against accidental contact and resulting damage.

  6. ON THE (NON-)ENHANCEMENT OF THE Ly{alpha} EQUIVALENT WIDTH BY A MULTIPHASE INTERSTELLAR MEDIUM

    SciTech Connect

    Laursen, Peter; Duval, Florent; Oestlin, Goeran

    2013-04-01

    It has been suggested that radiative transfer effects may explain the unusually high equivalent widths (EWs) of the Ly{alpha} line, observed occasionally from starburst galaxies, especially at high redshifts. If the dust is locked up inside high-density clouds dispersed in an empty intercloud medium, the Ly{alpha} photons could scatter off of the surfaces of the clouds, effectively having their journey confined to the dustless medium. The continuum radiation, on the other hand, does not scatter, and would thus be subject to absorption inside the clouds. This scenario is routinely invoked when Ly{alpha} EWs higher than what is expected theoretically are observed, although the ideal conditions under which the results are derived usually are not considered. Here we systematically examine the relevant physical parameters in this idealized framework, testing whether any astrophysically realistic scenarios may lead to such an effect. It is found that although clumpiness indeed facilitates the escape of Ly{alpha}, it is highly unlikely that any real interstellar media should result in a preferential escape of Ly{alpha} over continuum radiation. Other possible causes are discussed, and it is concluded that the observed high EWs are more likely to be caused by cooling radiation from cold accretion and/or anisotropic escape of the Ly{alpha} radiation.

  7. Relative biological effectiveness of alpha particles at radon exposure.

    PubMed

    Zhukovsky, M; Bastrikova, N; Vasilyev, A

    2015-06-01

    The relative biological effectiveness (RBE) of alpha particles at radon exposure is estimated by comparison of radiation risks at external gamma exposure and radon exposure in different situations. For external gamma exposure, the BEIR VII model of radiation risk assessment was used. For occupational and indoor radon exposure, models such as BEIR VI, WISMUT, Tomasek's and combined miners population were considered. It was demonstrated that RBE values are strongly dependent on models of radiation risk assessment used for RBE calculation, sex of exposed peoples and age at the exposure. The average values of RBE in dependence on model of risk assessment choice are in the range from 1.5 to 12.0 for males and in the range from 0.34 to 2.7 for females.

  8. Relative biological effectiveness of alpha particles at radon exposure.

    PubMed

    Zhukovsky, M; Bastrikova, N; Vasilyev, A

    2015-06-01

    The relative biological effectiveness (RBE) of alpha particles at radon exposure is estimated by comparison of radiation risks at external gamma exposure and radon exposure in different situations. For external gamma exposure, the BEIR VII model of radiation risk assessment was used. For occupational and indoor radon exposure, models such as BEIR VI, WISMUT, Tomasek's and combined miners population were considered. It was demonstrated that RBE values are strongly dependent on models of radiation risk assessment used for RBE calculation, sex of exposed peoples and age at the exposure. The average values of RBE in dependence on model of risk assessment choice are in the range from 1.5 to 12.0 for males and in the range from 0.34 to 2.7 for females. PMID:25979745

  9. Gold Coated Lanthanide Phosphate Nanoparticles for Targeted Alpha Generator Radiotherapy

    SciTech Connect

    McLaughlin, Mark F; Woodward, Jonathan; Boll, Rose Ann; Wall, Jonathan; Rondinone, Adam Justin; Kennel, Steve J; Mirzadeh, Saed; Robertson, David J.

    2013-01-01

    Targeted radiotherapies maximize cytotoxicty to cancer cells. In vivo generators such as 225Ac, which emits four particles in its decay chain, can significantly amplify the radiation dose delivered to the target site. However, renal dose from unbound 213Bi escaping during the decay process limits the dose of 225Ac that can be administered. Traditional chelating moieties are unable to sequester the radioactive daughters because of the high recoil energy from alpha particle emission. To counter this, we demonstrate that an engineered multilayered nanoparticle-antibody conjugate can both deliver radiation and contain the decay daughters of the in vivo -generator 225Ac while targeting biologically relevant receptors. These multi-shell nanoparticles combine the radiation resistance of crystalline lanthanide phosphate to encapsulate and contain 225Ac and its radioactive decay daughters, the magnetic properties of gadolinium phosphate for easy separation, and established surface chemistry of gold for attachment of nanoparticles to targeting antibodies.

  10. The effect of alpha-tocopherol on the oxidation and free radical decay in irradiated UHMWPE.

    PubMed

    Oral, Ebru; Rowell, Shannon L; Muratoglu, Orhun K

    2006-11-01

    We developed a radiation cross-linked ultra-high molecular weight polyethylene (UHMWPE) stabilized with alpha-tocopherol (Vitamin E) as a bearing material in total joint replacements. The stabilizing effect of alpha-tocopherol on free radical reactions in UHMWPE is not well understood. We investigated the effect of alpha-tocopherol on the oxidation and transformation of residual free radicals during real-time aging of alpha-tocopherol-doped, irradiated UHMWPE (alphaTPE) and irradiated UHMWPE (control). Samples were aged at 22 degrees C (room temperature) in air, at 40 degrees C in air and at 40 degrees C in water for 7 months. During the first month, alphaTPE showed some oxidation at the surface, which stayed constant thereafter. Control exhibited substantial oxidation in the subsurface region, which increased with time. The alkyl/allyl free radicals transformed to oxygen centered ones in both materials; this transformation occurred faster in alpha-TPE. In summary, the real-time oxidation behavior of alpha-TPE was consistent with that observed using accelerated aging methods. This new UHMWPE is oxidation resistant and is expected to maintain its properties in the long term.

  11. Pelvic radiation - discharge

    MedlinePlus

    Radiation of the pelvis - discharge; Cancer treatment - pelvic radiation; Prostate cancer - pelvic radiation; Ovarian cancer - pelvic radiation; Cervical cancer - pelvic radiation; Uterine cancer - pelvic radiation; Rectal cancer - ...

  12. Alpha Coincidence Detection for the Assay of Actinides

    SciTech Connect

    Warren, Glen A.; Dion, Michael P.; Miller, Brian W.; Tatishvili, Gocha

    2013-11-15

    Abstract – Interferences in both decay counting and mass counting techniques limit their application for some environmental monitoring applications. For example, 238U interferes with 238Pu in mass spectrometry measurements, while in conventional alpha spectroscopy measurements it is nearly impossible to separate 238Pu from 241Am and 239Pu from 240Pu. These interferences are typically resolved by using chemical separation and/or different measurement techniques for different isotopes. We are investigating radiation detector concepts to simultaneously assay these four isotopes with minimal sample preparation by exploiting radiation signatures measured in coincidence with the typical alpha decays of these isotopes. Particles in coincidence with the alpha decay include conversion electrons, gamma rays, x-rays, and Auger electrons. Each decay has a unique energy distribution enabling the separation of the isotopes. We are exploring two basic detector concepts to achieve these goals: a silicon-based design and a gas-detector design. The silicon system provides the potential for higher energy resolution at the cost of lower efficiency compared to a gas detector. In this paper, we will describe our evaluation of the different detector concepts, which will include detection efficiency, ability to resolve the isotopes, sample preparation and equipment requirements.

  13. THE FORMATION OF THE H{alpha} LINE IN THE SOLAR CHROMOSPHERE

    SciTech Connect

    Leenaarts, J.; Carlsson, M.; Rouppe van der Voort, L. E-mail: mats.carlsson@astro.uio.no

    2012-04-20

    We use state-of-the-art radiation-MHD simulations and three-dimensional (3D) non-LTE radiative transfer computations to investigate H{alpha} line formation in the solar chromosphere and apply the results of this investigation to develop the potential of H{alpha} as a diagnostic of the chromosphere. We show that one can accurately model H{alpha} line formation assuming statistical equilibrium and complete frequency redistribution provided the computation of the model atmosphere included non-equilibrium ionization of hydrogen and the Ly{alpha} and Ly{beta} line profiles are described by Doppler profiles. We find that 3D radiative transfer is essential in modeling hydrogen lines due to the low photon destruction probability in H{alpha}. The H{alpha} opacity in the upper chromosphere is mainly sensitive to the mass density and only weakly sensitive to the temperature. We find that the H{alpha} line-core intensity is correlated with the average formation height: The larger the average formation height is, the lower the intensity will be. The line-core width is a measure of the gas temperature in the line-forming region. The fibril-like dark structures seen in H{alpha} line-core images computed from our model atmosphere are tracing magnetic field lines. These structures are caused by field-aligned ridges of enhanced chromospheric mass density that raise their average formation height, and therefore make them appear dark against their deeper-formed surroundings. We compare with observations, and find that the simulated line-core widths are very similar to the observed ones, without the need for additional microturbulence.

  14. Alternative methods for degradation studies by alpha radiolysis: tributyl phosphate and CMPO

    SciTech Connect

    Pearson, J.; Nilsson, M.; Miller, G.E.

    2013-07-01

    Solvent extraction separation processes used in the recycling of used nuclear fuel are susceptible to radiolytic damage from radioactive isotopes present in used fuel. Studying the respective effects on matter of both low linear energy transfer (LET) radiation such as gamma radiation and high LET such as alpha radiation will allow for accurate prediction and modeling of process performance losses with respect to dose. The effects of gamma radiation on solvent extraction ligands have been more extensively studied than the effects of alpha radiation due to the inherent difficulty in producing a sufficient and confluent dose of alpha particles within a sample without leaving the sample contaminated with long lived radioactive isotopes. We have developed a method for studying the effects of high LET radiation in situ via {sup 10}B activation and the high LET particles that result from the {sup 10}B(n,a){sup 7}Li reaction which follows. In this study we applied this method to organic solutions of tributyl phosphate (TBP) and CMPO (compound octylphenyl-N, N-diisobutyl-carbamoyl methyl phosphine oxide) representing the PUREX and TRUEX processes respectively. Rates of degradation of TBP and CMPO and their respective degradation products in the presence of both high and low LET radiation are presented and compared to values reported in the literature. Preliminary data appears to show decreased degradation of CMPO in the presence of an aqueous acidic phase, which agrees with other studies performed on TBP solutions. (authors)

  15. Three-Dimensional Conformal Radiotherapy in Prostate Cancer Patients: Rise in Interleukin 6 (IL-6) but not IL-2, IL-4, IL-5, Tumor Necrosis Factor-{alpha}, MIP-1-{alpha}, and LIF Levels

    SciTech Connect

    Oliveira Lopes, Carlos; Callera, Fernando

    2012-03-15

    Purpose: To investigate the effect of radiotherapy (RT) on serum levels of interleukin-2 (IL-2), IL-4, IL-5, IL-6, tumor necrosis factor alpha (TNF-{alpha}), macrophage inflammatory protein-1-alpha (MIP-1-{alpha}) and leukemia inhibitory factor (LIF) in patients with prostate cancer. Methods and Materials: Forty eight patients with prostate cancer received three-dimensional conformal blocking radiation therapy with a linear accelerator. IL-2, IL-4, IL-5, IL-6, TNF-{alpha}, MIP-1-{alpha}, and LIF levels were measured by the related immunoassay kit 1 day before the beginning of RT and during RT at days 15 and 30. Results: The mean IL-2 values were elevated before and during the RT in contrast with those of IL-4, IL-5, IL-6, TNF-{alpha}, MIP-1-{alpha}, and LIF, which were within the normal range under the same conditions. Regarding markers IL-2, IL-4, IL-5, TNF-{alpha}, MIP-1-{alpha}, and LIF, comparisons among the three groups (before treatment and 15 and 30 days during RT) did not show significant differences. Although values were within the normal range, there was a significant rise in IL-6 levels at day 15 of RT (p = 0.0049) and a decline at day 30 to levels that were similar to those observed before RT. Conclusions: IL-6 appeared to peak after 15 days of RT before returning to pre-RT levels. In contrast, IL-2, IL-4, IL-5, TNF-{alpha}, MIP-1-{alpha}, and LIF levels were not sensitive to irradiation. The increased levels of IL-6 following RT without the concurrent elevation of other cytokines involved in the acute phase reaction did not suggest a classical inflammatory response to radiation exposure. Further studies should be designed to elucidate the role of IL-6 levels in patients with prostate cancer treated with RT.

  16. Alcoholism, Alpha Production, and Biofeedback

    ERIC Educational Resources Information Center

    Jones, Frances W.; Holmes, David S.

    1976-01-01

    Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater…

  17. Meet the Alpha-Pets.

    ERIC Educational Resources Information Center

    Zitlaw, Jo Ann Bruce; Frank, Cheryl Standish

    1985-01-01

    "Alpha-Pets" are the focal point of an integrated, multidisciplinary curriculum. Each pet is featured for a week in a vocabulary-rich story and introduces related activities beginning with the featured letter, such as the four food groups during Freddie Fish's week or universe during Ulysses Unicorn's week. (MT)

  18. Alpha proton x ray spectrometer

    NASA Technical Reports Server (NTRS)

    Rieder, Rudi; Waeke, H.; Economou, T.

    1994-01-01

    Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

  19. Postnatal changes of nicotinic acetylcholine receptor alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits genes expression in rat brain.

    PubMed

    Zhang, X; Liu, C; Miao, H; Gong, Z H; Nordberg, A

    1998-10-01

    Postnatal changes of nicotinic acetylcholine receptor (nAChR) alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits mRNAs were investigated in rat brain using ribonuclease protection assay. Multiple developmental patterns were observed: (1) transient expression during the first few postnatal weeks; alpha 2 in the hippocampus and brain stem, alpha 3 in the striatum, cerebellum and cortex, alpha 4 in the hippocampus, striatum and cerebellum, alpha 7 in the cerebellum and beta 2 in the striatum. (2) Constant expression across development; alpha 2 and alpha 3 in the thalamus, alpha 4 in the cortex, thalamus and brain stem, alpha 7 in the thalamus and brain stem and beta 2 in all brain regions except striatum. (3) Non-detection across development; alpha 2 in the cortex, striatum and cerebellum. (4) Increase with age; alpha 7 in the cortex and hippocampus. (5) Bell-shaped development; alpha 7 in the striatum. Postnatal changes of nAChR isoforms in different brain regions of rat were investigated by receptor binding assays. The developmental patterns of [3H]epibatidine and (-)-[3H]nicotine binding sites were similar to each other in each brain region, but different from that of [3H] alpha-bungarotoxin binding sites. No obvious correlation was observed between the developmental patterns of [3H] alpha-bungarotoxin, [3H]epibatidine and (-)-[3H]nicotine binding sites and corresponding subunits mRNAs. These results indicate that multiple mechanisms are involved in changes of gene expression of nAChRs subunits in the brain of developing rats.

  20. Development of a three-layer phoswich alpha-beta-gamma imaging detector

    NASA Astrophysics Data System (ADS)

    Yamamoto, Seiichi; Ishibashi, Hiroyuki

    2015-06-01

    For radiation monitoring at the sites of such nuclear power plant accidents as Fukushima Daiichi, radiation detectors are needed not only for gamma photons but also for alpha and beta particles because some nuclear fission products emit beta particles and gamma photons and some nuclear fuels contain plutonium that emits alpha particles. In some applications, imaging detectors are required to detect the distribution of plutonium particles that emit alpha particles and radiocesium in foods that emits beta particles and gamma photons. To solve these requirements, we developed an imaging detector that can measure the distribution of alpha and beta particles as well as gamma photons. The imaging detector consists of three-layer scintillators optically coupled to each other and to a position sensitive photomultiplier tube (PSPMT). The first layer, which is made of a thin plastic scintillator (decay time: ~5 ns), detects alpha particles. The second layer, which is made of a thin Gd2SiO5 (GSO) scintillator with 1.5 mol% Ce (decay time: 35 ns), detects beta particles. The third layer made of a thin GSO scintillator with 0.4 mol% Ce (decay time: 70 ns) detects gamma photons. Using pulse shape discrimination, the images of these layers can be separated. The position information is calculated by the Anger principle from 8×8 anode signals from the PSPMT. The images for the alpha and beta particles and the gamma photons are individually formed by the pulse shape discriminations for each layer. We detected alpha particle images in the first layer and beta particle images in the second layer. Gamma photon images were detected in the second and third layers. The spatial resolution for the alpha and beta particles was ~1.25 mm FWHM and less than 2 mm FWHM for the gamma photons. We conclude that our developed alpha-beta-gamma imaging detector is promising for imaging applications not only for the environmental monitoring of radionuclides but also for medical and molecular imaging.

  1. Radiative-recoil corrections in muonium. Selection of graphs

    SciTech Connect

    Karshenboim, S.G.; Shelyuto, V.A.; Eides, M.I.

    1988-09-01

    A study is made of all graphs containing radiative insertions in the electron line which lead to corrections of the orders ..cap alpha..(Z..cap alpha..)E/sub F/ and ..cap alpha..(Z..cap alpha..)(m/M)E/sub F/ to the hyperfine splitting in muonium. A simple gauge-invariant set of graphs corresponding to these corrections is obtained, a procedure for calculating them is studied, and it is shown that the anomalous magnetic moment does not lead to such corrections.

  2. Coexistence of {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in {sup 10}Be

    SciTech Connect

    Itagaki, N.; Ito, M.; Milin, M.; Hashimoto, T.; Ishiyama, H.; Miyatake, H.

    2008-06-15

    The coexistence of the {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in the excited states of {sup 10}Be has been discussed. In the previous analysis, all the low-lying states of {sup 10}Be were found to be well described by the motion of the two valence neutrons around two {alpha} clusters. However, the {alpha}+t+t cluster structure was found to coexist with the {alpha}+{alpha}+n+n structure around E{sub x}=15 MeV, close to the corresponding threshold. We have introduced a microscopic model to solve the coupling effect between these two configurations. The K=0 and K=1 states are generated from the {alpha}+t+t configurations due to the spin coupling of two triton clusters. The present case of {sup 10}Be is one of the few examples in which completely different configurations of triton-type ({alpha}+t+t three-center) and {alpha}-type ({alpha}+{alpha}+n+n two-center) clusters coexist in a single nucleus in the same energy region.

  3. A synopsis of collective alpha effects and implications for ITER

    SciTech Connect

    Sigmar, D.J.

    1990-10-01

    This paper discusses the following: Alpha Interaction with Toroidal Alfven Eigenmodes; Alpha Interaction with Ballooning Modes; Alpha Interaction with Fishbone Oscillations; and Implications for ITER.

  4. Alpha-ray spectrometry at high temperature by using a compound semiconductor detector.

    PubMed

    Ha, Jang Ho; Kim, Han Soo

    2013-11-01

    The use of conventional radiation detectors in harsh environments is limited by radiation damage to detector materials and by temperature constraints. We fabricated a wide-band gap semiconductor radiation detector based on silicon carbide. All the detector components were considered for an application in a high temperature environment like a nuclear reactor core. The radiation response, especially to alpha particles, was measured using an (241)Am source at variable operating voltages at room temperature in the air. The temperature on detector was controlled from 30°C to 250°C. The alpha-particle spectra were measured at zero bias operation. Even though the detector is operated at high temperature, the energy resolution as a function of temperature is almost constant within 3.5% deviation.

  5. Carbon stars with alpha-C:H emission

    NASA Technical Reports Server (NTRS)

    Gerbault, Florence; Goebel, John H.

    1989-01-01

    Many carbon stars in the IRS low resolution spectra (LRS) catalog were found which display emission spectra that compare favorable with the absorption spectrum of alpha-C:H. These stars have largely been classified as 4X in the LRS which has led to their interpretation by others in terms of displaying a mixture of the UIRF's 8.6 micron band and SiC at 11.5 microns. It was also found that many of these stars have a spectral upturn at 20+ microns which resembles the MgS band seen in carbon stars and planetary nebulae. It was concluded that this group of carbon stars will evolve into planetary nebulae like NGC 7027 and IC 418. In the presence of hard ultraviolet radiation the UIRF's will light up and be displayed as narrow emission bands on top of the broad alpha-C:H emission bands.

  6. Lyman-alpha observations of Comet West /1975n/

    NASA Technical Reports Server (NTRS)

    Opal, C. B.; Carruthers, G. R.

    1977-01-01

    The rate of hydrogen production of Comet West is studied through rocket observation of solar Lyman-alpha radiation resonantly scattered by the escaping hydrogen atoms. Two sets of Lyman-alpha exposure sequences are used to obtain computer-smoothed brightness contour (isophote) maps covering a density range of 100:1. A simple radial outflow model is applied to the contour maps to determine the rate of hydrogen production (3.2 by 10 to the 30th power atoms/sec.) Discrepancies between the observed shape of the outer isophotes and predicted models may be explained by optical depth effects, or by the presence of small pieces of the comet's nucleus distributed along the orbit. Hydrogen, carbon, and oxygen production for Comet West and Comet Kohoutek are compared; differences may be accounted for by variations in the composition or evolution of the two comets.

  7. Genetics Home Reference: 5-alpha reductase deficiency

    MedlinePlus

    ... gene provides instructions for making an enzyme called steroid 5-alpha reductase 2. This enzyme is involved ... external genitalia. Mutations in the SRD5A2 gene prevent steroid 5-alpha reductase 2 from effectively converting testosterone ...

  8. What Causes Alpha-1 Antitrypsin Deficiency?

    MedlinePlus

    ... from the NHLBI on Twitter. What Causes Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency is an inherited disease. "Inherited" ... have AAT deficiency inherit two faulty AAT genes, one from each parent. These genes tell cells in ...

  9. How Is Alpha-1 Antitrypsin Deficiency Treated?

    MedlinePlus

    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Treated? Alpha-1 antitrypsin (AAT) deficiency has no cure, but its ... of these treatments are the same as the ones used for a lung disease called COPD (chronic ...

  10. Q (Alpha) Function and Squeezing Effect

    NASA Technical Reports Server (NTRS)

    Yunjie, Xia; Xianghe, Kong; Kezhu, Yan; Wanping, Chen

    1996-01-01

    The relation of squeezing and Q(alpha) function is discussed in this paper. By means of Q function, the squeezing of field with gaussian Q(alpha) function or negative P(a)function is also discussed in detail.

  11. Association of actin with alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Boyle, D.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The alpha crystallins are cytosolic proteins that co-localize and co-purify with actin-containing microfilaments. Affinity column chromatography employing both covalently-coupled actin or alpha crystallin was used to demonstrate specific and saturable binding of actin with alpha crystallin. This conclusion was confirmed by direct visualization of alpha aggregates bound to actin polymerized in vitro. The significance of this interaction in relation to the functional properties of these two polypeptides will be discussed.

  12. Alpha particle spectra and microdosimetry of radon daughters

    SciTech Connect

    Caswell, R.S.; Coyne, J.J.

    1992-12-31

    We are interested in understanding the physics of the process by which radon-daughter alpha particles irradiate cells, leading to the induction of cancer. We are focusing initially on two aspects: the alpha spectra incident upon cells, which are needed for input to biophysical models of cancer induction; and microdosimetric spectra and parameters which give information on radiation quality. Adapting an analytical method previously developed for neutron radiation, we have calculated the alpha-particle slowing-down spectra (the spectra incident upon cells) and, subsequently, the microdosimetric spectra and parameters for various cell nuclei or site diameters. Results will be presented from three modes of program operation. MODE 1 is for the thin, plane source of radon-daughter activity adjacent to the epithelium. MODE 2 is for the thick source layer (the mucous-serous layer) adjacent to the epithelium. MODE4 is for cylindrical airways of various radii, lined by the mucous-serous layer. MODE 1 is most useful for understanding the problem; MODE 4 is most anatomically relevant. MODE 3 is not discussed in this paper. Alpha-particle spectra and microdosimetric spectra and parameters are studied as a function of cell depth, {sup 218}Po/{sup 214}Po ratio, airway radius, and cell nucleus or the site size. Also available from the calculation is mean dose as a function of depth below the airway surface. The results described here are available on personal computer diskettes. We are beginning to compare our studies with the calculations of other workers and plan to extend the calculations to the nanometer target level.

  13. Whole-body irradiation transiently diminishes the adrenocorticotropin response to recombinant human interleukin-1{alpha}

    SciTech Connect

    Perlstein, R.S.; Mehta, N.R.; Neta, R.; Whitnall, M.H.; Mougey, E.H.

    1995-03-01

    Recombinant human interleukin-1{alpha} (rhIL-1{alpha}) has significant potential as a radioprotector and/or treatment for radiation-induced hematopoietic injury. Both IL-1 and whole-body ionizing irradiation acutely stimulate the hypothalamic-pituitary-adrenal axis. We therefore assessed the interaction of whole-body irradiation and rhIL-1{alpha} in altering the functioning of the axis in mice. Specifically, we determined the adrenocorticotropin (ACTH) and corticosterone responses to rhIL-1{alpha} administered just before and hours to days after whole-body or sham irradiation. Our results indicate that whole-body irradiation does not potentiate the rhIL-1{alpha}-induced increase in ACTH levels at the doses used. In fact, the rhIL-1{alpha}-induced increase in plasma ACTH is transiently impaired when the cytokine is administered 5 h after, but not 1 h before, exposure to whole-body irradiation. The ACTH response may be inhibited by elevated corticosterone levels after whole-body irradiation, or by other radiation-induced effects on the pituitary gland and hypothalamus. 36 refs., 3 figs.

  14. The ultraviolet spectra of Alpha Aquilae and Alpha Canis Minoris

    NASA Technical Reports Server (NTRS)

    Morton, D. C.; Bruzual A., G.; Kurucz, R. L.; Spinrad, H.

    1977-01-01

    Scans of Alpha Aql (A7 IV, V) and Alpha CMi (F5 IV-V) obtained with the Copernicus satellite spectrometer over the wavelength range from 2100 to 3200 A are presented along with a spectrum of the integrated solar disk over the same range procured during a calibrated rocket flight. About 1500 fairly strong absorption lines in the Alpha CMi spectrum between 2400 and 2961 A are identified by comparison with a solar atlas and by using a theoretical spectrum synthesized from a blanketed LTE model with an effective temperature of 6500 K and a surface gravity of 10,000 cm/sec per sec. The Mg II resonance doublet at 2795.528 and 2802.704 A is found to be present in all three stars together with a discontinuity at 2635 A due to Fe II, Fe I, Cr I, and Mn II. It is concluded that the Mg II resonance lines and the 2635-A continuum break would be the best spectral features for estimating the redshift of a galaxy observed at low resolution provided the redshift is not less than about 0.75.

  15. Effectiveness of Alpha Biofeedback Therapy: Negative Results.

    ERIC Educational Resources Information Center

    Watson, Charles G.; Herder, Joseph

    1980-01-01

    Assessed the utility of alpha biofeedback training in the treatment of patients (N=66). Biofeedback and placebo biofeedback groups were given alpha or mock-alpha training sessions. Improvement on 54 variables was compared to that of no-treatment controls. Only a chance number of significant changes appeared among the groups. (Author)

  16. Recent Results on the CKM Angle Alpha

    SciTech Connect

    Mihalyi, A.; /Wisconsin U., Madison

    2005-10-18

    The method to measure the CKM angle {alpha} and the modes sensitive to it are discussed. It is shown that the B {yields} {rho}{rho} decays provide the most stringent constraint on {alpha}, which is found to be {alpha} = 96{sup o} {+-} 10{sup o}(stat) {+-} 4{sup o}(syst){+-} 13{sup o}(penguin).

  17. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  18. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  19. LOGNORMAL INTENSITY DISTRIBUTION OF THE FAR-ULTRAVIOLET CONTINUUM BACKGROUND SHORTWARD OF Ly{alpha}

    SciTech Connect

    Seon, Kwang-Il

    2013-07-20

    The diffuse far-ultraviolet (FUV) continuum radiation 'longward' of Ly{alpha} (1216 A) is well known to correlate with the dust emission at 100 {mu}m. However, it has been claimed that the FUV continuum background 'shortward' of Ly{alpha} shows very weak or no correlation with the 100 {mu}m emission. In this paper, the observational data of the diffuse FUV radiation by the Far Ultraviolet Spectroscopic Explorer (FUSE) are reexamined in order to investigate the correlation between the diffuse FUV radiation shortward of Ly{alpha} and the 100 {mu}m emission. Large fluctuations were confirmed in the linear-linear correlation plots, but good correlations were found in the log-log plots. The large fluctuations in the linear-linear plots, and thus poor correlations, between the FUV and 100 {mu}m intensities were attributed to the lognormal property of the FUV intensity distribution. The standard deviation of the intensity distribution of the FUV radiation shortward of Ly{alpha} was found to be {sigma}{sub logI} = 0.16-0.25. The result is consistent with that obtained not only for the FUV radiation longward of 1216 A but also with the dust column density measurements of various molecular clouds. This implies that most of the diffuse FUV radiation shortward of Ly{alpha} is dust-scattered light in the turbulent interstellar medium. The diffuse FUV data obtained from the Voyager missions were also investigated. However, much wider random fluctuations were found compared with the FUSE data, which is most likely due to the systematic difficulties in data reduction of the Voyager data.

  20. Space Radiation

    NASA Technical Reports Server (NTRS)

    Wu, Honglu

    2006-01-01

    Astronauts receive the highest occupational radiation exposure. Effective protections are needed to ensure the safety of astronauts on long duration space missions. Increased cancer morbidity or mortality risk in astronauts may be caused by occupational radiation exposure. Acute and late radiation damage to the central nervous system (CNS) may lead to changes in motor function and behavior, or neurological disorders. Radiation exposure may result in degenerative tissue diseases (non-cancer or non-CNS) such as cardiac, circulatory, or digestive diseases, as well as cataracts. Acute radiation syndromes may occur due to occupational radiation exposure.

  1. 6 alpha-Fluoro- and 6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione: synthesis and evaluation of activity and kinetics of their C-22 epimers.

    PubMed

    Thalén, B A; Axelsson, B I; Andersson, P H; Brattsand, R L; Nylander, B; Wickström, L I

    1998-01-01

    It is generally accepted that the anti-inflammatory effect of glucocorticosteroids cannot be separated from their adverse effects at the receptor level. However, modification of the pharmacokinetics through structural alterations could provide steroids with a better therapeutic index than those currently used. Thus, new 16 alpha,17 alpha-acetals between butyraldehyde and 6 alpha-fluoro- or 6 alpha,9 alpha-difluoro-16 alpha-hydroxycortisol were synthesized and studied. Acetalization of the corresponding 16 alpha,17 alpha-diols or transacetalization of their 16 alpha,17 alpha-acetonides in dioxane produced mixtures of C-22 epimers, which were resolved by preparative chromatography. Alternatively, an efficient method was used to produce the 22R-epimer stereoselectively through performing the acetalization and transacetalization in a hydrocarbon with an inert material present. The C-22 configuration of (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione was unambiguously established by single crystal X-ray diffraction. The present compounds, especially the 22R-epimer just mentioned, bind to the rat thymus glucocorticoid receptor with high potency. The C-22 epimers of the 6 alpha,9 alpha-difluoro derivatives showed a 10-fold higher biotransformation rate than the budesonide 22R-epimer when incubated with human liver S9 subcellular fraction. The high receptor affinity in combination with the high biotransformation rate indicates that (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione may be an improved 16 alpha,17 alpha-acetal glucocorticosteroid for therapy of inflammatory diseases, in which the mucous membranes are involved, such as those in the intestinal tract as well in the respiratory tract. PMID:9437793

  2. First fast-ion D-alpha (FIDA) measurements and simulations on C-2U

    NASA Astrophysics Data System (ADS)

    Bolte, N. G.; Gupta, D.; Stagner, L.; Onofri, M.; Dettrick, S.; Granstedt, E. M.; Petrov, P.

    2016-11-01

    The first measurements of fast-ion D-alpha (FIDA) radiation have been acquired on C-2U, Tri Alpha Energy's advanced, beam-driven field-reversed configuration (FRC). These measurements are also forward modeled by FIDASIM. This is the first measurement and simulation of FIDA carried out on an FRC topology. FIDA measurements are made of Doppler-shifted Balmer-alpha light from neutralized fast ions using a bandpass filter and photomultiplier tube. One adjustable line-of-sight measured signals at eight locations and eight times during the FRC lifetime over 26 discharges. Filtered signals include only the highest energy ions (>6 keV) and share some salient features with the FIDASIM result. Highly Doppler-shifted beam radiation is also measured with a high-speed camera and is spatially well-correlated with FIDASIM.

  3. The {alpha}-particle imaging of a compressed core of microtargets in a pinhole camera with a regular multi-pinhole diaphragm

    SciTech Connect

    Suslov, N A

    2000-08-31

    The {alpha}-particle imaging of a compressed core of microtargets using a multi-pinhole regular diaphragm is proposed. The image reconstruction technique is described. The results of the {alpha}-particle imaging of a compressed core of microtargets obtained at the 'Iskra-4' laser facility are reported. (interaction of laser radiation with matter. laser plasma)

  4. [The radioprotective and antioxidant properties of solubilized alpha-tocopherol acetate].

    PubMed

    Samoĭlov, A V; Seĭfulla, R D; Kamaev, N O; Lukoianova, T I; Gukasov, V M; Belous, M V

    1992-01-01

    A single intravenous administration of solubilized alpha-tocopherol acetate in a dose of 1 mg/kg to CBA x C57Bl x F1 male mice 3 and 24 hours before radiation was demonstrated to increase 30-day survival rates in the animals. Oily alpha-tocopherol acetate had the identical effects when the agent was intramuscularly given in a dose of 10 mg/kg. There was a rise in peripheral leukocyte counts 0.5 hour after solubilized alpha-tocopherol acetate administration. The antioxidative activity of the solubilized agent was 3.3 times as high as that the routine agent when attacking Tween 80. The higher radioprotective activity of solubilized alpha-tocopherol acetate is accounted for by its enhanced bioavailability, antioxidative activity and effects on the factors of nonspecific body's resistance.

  5. Optical properties of alpha spodumene: Orientation of its principal optical axes

    NASA Astrophysics Data System (ADS)

    Souza, S. O.; Lima, A. F.; Lalic, M. V.

    2009-05-01

    We studied the orientation of the three orthogonal principal optical axes of the alpha spodumene crystal. This orientation is determined relative to the crystallographic axes, and expressed as function of the incident radiation wavelength in ultraviolent region. The calculations were performed by density functional theory based, full potential augmented plane wave method.

  6. Alpha voltaic batteries and methods thereof

    NASA Technical Reports Server (NTRS)

    Raffaelle, Ryne P. (Inventor); Jenkins, Phillip (Inventor); Wilt, David (Inventor); Scheiman, David (Inventor); Chubb, Donald (Inventor); Castro, Stephanie (Inventor)

    2011-01-01

    An alpha voltaic battery includes at least one layer of a semiconductor material comprising at least one p/n junction, at least one absorption and conversion layer on the at least one layer of semiconductor layer, and at least one alpha particle emitter. The absorption and conversion layer prevents at least a portion of alpha particles from the alpha particle emitter from damaging the p/n junction in the layer of semiconductor material. The absorption and conversion layer also converts at least a portion of energy from the alpha particles into electron-hole pairs for collection by the one p/n junction in the layer of semiconductor material.

  7. THE LYMAN ALPHA REFERENCE SAMPLE: EXTENDED LYMAN ALPHA HALOS PRODUCED AT LOW DUST CONTENT

    SciTech Connect

    Hayes, Matthew; Oestlin, Goeran; Duval, Florent; Guaita, Lucia; Melinder, Jens; Sandberg, Andreas; Schaerer, Daniel; Verhamme, Anne; Orlitova, Ivana; Mas-Hesse, J. Miguel; Oti-Floranes, Hector; Adamo, Angela; Atek, Hakim; Cannon, John M.; Herenz, E. Christian; Kunth, Daniel; Laursen, Peter

    2013-03-10

    We report on new imaging observations of the Lyman alpha emission line (Ly{alpha}), performed with the Hubble Space Telescope, that comprise the backbone of the Lyman alpha Reference Sample. We present images of 14 starburst galaxies at redshifts 0.028 < z < 0.18 in continuum-subtracted Ly{alpha}, H{alpha}, and the far ultraviolet continuum. We show that Ly{alpha} is emitted on scales that systematically exceed those of the massive stellar population and recombination nebulae: as measured by the Petrosian 20% radius, R{sub P20}, Ly{alpha} radii are larger than those of H{alpha} by factors ranging from 1 to 3.6, with an average of 2.4. The average ratio of Ly{alpha}-to-FUV radii is 2.9. This suggests that much of the Ly{alpha} light is pushed to large radii by resonance scattering. Defining the Relative Petrosian Extension of Ly{alpha} compared to H{alpha}, {xi}{sub Ly{alpha}} = R {sup Ly{alpha}}{sub P20}/R {sup H{alpha}}{sub P20}, we find {xi}{sub Ly{alpha}} to be uncorrelated with total Ly{alpha} luminosity. However, {xi}{sub Ly{alpha}} is strongly correlated with quantities that scale with dust content, in the sense that a low dust abundance is a necessary requirement (although not the only one) in order to spread Ly{alpha} photons throughout the interstellar medium and drive a large extended Ly{alpha} halo.

  8. TCAD simulation for alpha-particle spectroscopy using SIC Schottky diode.

    PubMed

    Das, Achintya; Duttagupta, Siddhartha P

    2015-12-01

    There is a growing requirement of alpha spectroscopy in the fields context of environmental radioactive contamination, nuclear waste management, site decommissioning and decontamination. Although silicon-based alpha-particle detection technology is mature, high leakage current, low displacement threshold and radiation hardness limits the operation of the detector in harsh environments. Silicon carbide (SiC) is considered to be excellent material for radiation detection application due to its high band gap, high displacement threshold and high thermal conductivity. In this report, an alpha-particle-induced electron-hole pair generation model for a reverse-biased n-type SiC Schottky diode has been proposed and verified using technology computer aided design (TCAD) simulations. First, the forward-biased I-V characteristics were studied to determine the diode ideality factor and compared with published experimental data. The ideality factor was found to be in the range of 1.4-1.7 for a corresponding temperature range of 300-500 K. Next, the energy-dependent, alpha-particle-induced EHP generation model parameters were optimised using transport of ions in matter (TRIM) simulation. Finally, the transient pulses generated due to alpha-particle bombardment were analysed for (1) different diode temperatures (300-500 K), (2) different incident alpha-particle energies (1-5 MeV), (3) different reverse bias voltages of the 4H-SiC-based Schottky diode (-50 to -250 V) and (4) different angles of incidence of the alpha particle (0°-70°).The above model can be extended to other (wide band-gap semiconductor) device technologies useful for radiation-sensing application.

  9. TCAD simulation for alpha-particle spectroscopy using SIC Schottky diode.

    PubMed

    Das, Achintya; Duttagupta, Siddhartha P

    2015-12-01

    There is a growing requirement of alpha spectroscopy in the fields context of environmental radioactive contamination, nuclear waste management, site decommissioning and decontamination. Although silicon-based alpha-particle detection technology is mature, high leakage current, low displacement threshold and radiation hardness limits the operation of the detector in harsh environments. Silicon carbide (SiC) is considered to be excellent material for radiation detection application due to its high band gap, high displacement threshold and high thermal conductivity. In this report, an alpha-particle-induced electron-hole pair generation model for a reverse-biased n-type SiC Schottky diode has been proposed and verified using technology computer aided design (TCAD) simulations. First, the forward-biased I-V characteristics were studied to determine the diode ideality factor and compared with published experimental data. The ideality factor was found to be in the range of 1.4-1.7 for a corresponding temperature range of 300-500 K. Next, the energy-dependent, alpha-particle-induced EHP generation model parameters were optimised using transport of ions in matter (TRIM) simulation. Finally, the transient pulses generated due to alpha-particle bombardment were analysed for (1) different diode temperatures (300-500 K), (2) different incident alpha-particle energies (1-5 MeV), (3) different reverse bias voltages of the 4H-SiC-based Schottky diode (-50 to -250 V) and (4) different angles of incidence of the alpha particle (0°-70°).The above model can be extended to other (wide band-gap semiconductor) device technologies useful for radiation-sensing application. PMID:25634901

  10. Subjective pain perception mediated by alpha rhythms.

    PubMed

    Peng, Weiwei; Babiloni, Claudio; Mao, Yanhui; Hu, Yong

    2015-07-01

    Suppression of spontaneous alpha oscillatory activities, interpreted as cortical excitability, was observed in response to both transient and tonic painful stimuli. The changes of alpha rhythms induced by pain could be modulated by painful sensory inputs, experimental tasks, and top-down cognitive regulations such as attention. The temporal and spatial characteristics, as well as neural functions of pain induced alpha responses, depend much on how these factors contribute to the observed alpha event-related desynchronization/synchronization (ERD/ERS). How sensory-, task-, and cognitive-related changes of alpha oscillatory activities interact in pain perception process is reviewed in the current study, and the following conclusions are made: (1) the functional inhibition hypothesis that has been proposed in auditory and visual modalities could be applied also in pain modality; (2) the neural functions of pain induced alpha ERD/ERS were highly dependent on the cortical regions where it is observed, e.g., somatosensory cortex alpha ERD/ERS in pain perception for painful stimulus processing; (3) the attention modulation of pain perception, i.e., influences on the sensory and affective dimensions of pain experience, could be mediated by changes of alpha rhythms. Finally, we propose a model regarding the determinants of pain related alpha oscillatory activity, i.e., sensory-discriminative, affective-motivational, and cognitive-modulative aspects of pain experience, would affect and determine pain related alpha oscillatory activities in an integrated way within the distributed alpha system. PMID:26026894

  11. Radiation Exposure

    MedlinePlus

    Radiation is energy that travels in the form of waves or high-speed particles. It occurs naturally in sunlight. Man-made radiation is used in X-rays, nuclear weapons, nuclear power plants and cancer treatment. If you are exposed to small amounts of radiation over a ...

  12. On the polarization of Alpha Orionis

    NASA Technical Reports Server (NTRS)

    Doherty, L. R.

    1986-01-01

    Much of the complex behavior of the polarization observed in the M2 supergiant Alpha Ori can be explained in terms of the combined effects of Rayleigh scattering in the photosphere and scattering by circumstellar dust in the presence of one or more photospheric hot spots. The ad hoc scattering layer of electrons which Schwarz and Clarke employed in their models reported in 1984 can be avoided, eliminating the conflict with the much lower column densities found in other studies of the extended chromosphere of this star. The transfer of polarized continuum radiation in cool model atmospheres has been treated fully. Under conditions of optimal spot area and location on the disk and large temperature differences (up to 1000 K) between the spot and normal photosphere, it is possible to get a net polarization up to about 0.3 percent in the blue in the direct starlight. The effects of spot limb darkening on the polarization of scattered spot light have been evaluated. Narrow-band observations that include molecular bands are encouraged for their diagnostic value.

  13. Three-loop radiative-recoil corrections to hyperfine splitting generated by one-loop fermion factors

    SciTech Connect

    Eides, Michael I.; Grotch, Howard; Shelyuto, Valery A.

    2004-10-01

    We consider three-loop radiative-recoil corrections to hyperfine splitting in muonium generated by diagrams with one-loop radiative photon insertions both in the electron and muon lines. An analytic result for these nonlogarithmic corrections of order {alpha}(Z{sup 2}{alpha})(Z{alpha})(m/M)E{sub F} is obtained. This result constitutes a next step in the implementation of the program of reduction of the theoretical uncertainty of hyperfine splitting below 10 Hz.

  14. Radiation-induced cardiovascular effects

    NASA Astrophysics Data System (ADS)

    Tapio, Soile

    Recent epidemiological studies indicate that exposure to ionising radiation enhances the risk of cardiovascular mortality and morbidity in a moderate but significant manner. Our goal is to identify molecular mechanisms involved in the pathogenesis of radiation-induced cardiovascular disease using cellular and mouse models. Two radiation targets are studied in detail: the vascular endothelium that plays a pivotal role in the regulation of cardiac function, and the myocardium, in particular damage to the cardiac mitochondria. Ionising radiation causes immediate and persistent alterations in several biological pathways in the endothelium in a dose- and dose-rate dependent manner. High acute and cumulative doses result in rapid, non-transient remodelling of the endothelial cytoskeleton, as well as increased lipid peroxidation and protein oxidation of the heart tissue, independent of whether exposure is local or total body. Proteomic and functional changes are observed in lipid metabolism, glycolysis, mitochondrial function (respiration, ROS production etc.), oxidative stress, cellular adhesion, and cellular structure. The transcriptional regulators Akt and PPAR alpha seem to play a central role in the radiation-response of the endothelium and myocardium, respectively. We have recently started co-operation with GSI in Darmstadt to study the effect of heavy ions on the endothelium. Our research will facilitate the identification of biomarkers associated with adverse cardiac effects of ionising radiation and may lead to the development of countermeasures against radiation-induced cardiac damage.

  15. Radiation Proctopathy

    PubMed Central

    Grodsky, Marc B.; Sidani, Shafik M.

    2015-01-01

    Radiation therapy is a widely utilized treatment modality for pelvic malignancies, including prostate cancer, rectal cancer, and cervical cancer. Given its fixed position in the pelvis, the rectum is at a high risk for injury secondary to ionizing radiation. Despite advances made in radiation science, up to 75% of the patients will suffer from acute radiation proctitis and up to 20% may experience chronic symptoms. Symptoms can be variable and include diarrhea, bleeding, incontinence, and fistulization. A multitude of treatment options exist. This article summarizes the latest knowledge relating to radiation proctopathy focusing on the vast array of treatment options. PMID:26034407

  16. Radiation proctopathy.

    PubMed

    Grodsky, Marc B; Sidani, Shafik M

    2015-06-01

    Radiation therapy is a widely utilized treatment modality for pelvic malignancies, including prostate cancer, rectal cancer, and cervical cancer. Given its fixed position in the pelvis, the rectum is at a high risk for injury secondary to ionizing radiation. Despite advances made in radiation science, up to 75% of the patients will suffer from acute radiation proctitis and up to 20% may experience chronic symptoms. Symptoms can be variable and include diarrhea, bleeding, incontinence, and fistulization. A multitude of treatment options exist. This article summarizes the latest knowledge relating to radiation proctopathy focusing on the vast array of treatment options. PMID:26034407

  17. Synthesis of 16 alpha-3H androgen and estrogen substrates for 16 alpha-hydroxylase.

    PubMed

    Cantineau, R; Kremers, P; De Graeve, J; Cornelis, A; Laszlo, P; Gielen, J E; Lambotte, R

    1981-02-01

    The synthesis of 16 alpha-3H androgens and estrogens is described. 1-(3H)-Acetic acid in the presence of zinc dust reacts with 16 alpha-bromo-17-ketosteroids to produce 16 alpha-3H-17-ketosteroids. This chemical reaction was used to prepare 16 alpha-3H-dehydroepiandrosterone (I) and 16 alpha-3H-estrone acetate (XI) from 16 alpha-bromo-dehydroepiandrosterone (X) and from 16 alpha-bromo-estrone acetate (XII), respectively. Using appropriate microbiological techniques, it was possible to convert these radiolabelled substrates into 16 alpha-3H-androstenedione (II) and 16 alpha-3H-estradiol-17 beta (VII). 16 alpha-3H-Estrone (VI) was obtained by the chemical hydrolysis of 16 alpha-3H-estrone acetate. The label distribution as determined by microbiological 16 alpha-hydroxylations indicated a specific labelling of 77% for androgens and 65% for estrogens in the 16 alpha position. These substrates can be used for measuring the 16 alpha hydroxylase activity, an important step in the biosynthesis of estriol (VIII) and estetrol (IX). PMID:7013160

  18. Nuclear radiation-warning detector that measures impedance

    SciTech Connect

    Savignac, Noel Felix; Gomez, Leo S; Yelton, William Graham; Robinson, Alex; Limmer, Steven

    2013-06-04

    This invention is a nuclear radiation-warning detector that measures impedance of silver-silver halide on an interdigitated electrode to detect light or radiation comprised of alpha particles, beta particles, gamma rays, X rays, and/or neutrons. The detector is comprised of an interdigitated electrode covered by a layer of silver halide. After exposure to alpha particles, beta particles, X rays, gamma rays, neutron radiation, or light, the silver halide is reduced to silver in the presence of a reducing solution. The change from the high electrical resistance (impedance) of silver halide to the low resistance of silver provides the radiation warning that detected radiation levels exceed a predetermined radiation dose threshold.

  19. A study of presynaptic alpha2-autoreceptors in alpha2A/D-, alpha2B- and alpha2C-adrenoceptor-deficient mice.

    PubMed

    Trendelenburg, A U; Klebroff, W; Hein, L; Starke, K

    2001-08-01

    The function of presynaptic alpha2-autoreceptors was studied in the hippocampus, occipito-parietal cortex, atria and vas deferens of NMRI mice, mice in which the alpha2A/D-, the alpha2B- or alpha2c-adrenoceptor gene had been disrupted (alpha2A/DKO, alpha2BKO and alpha2CKO, respectively), and the wildtype mice from which the knockout animals had been generated. Tissue pieces were preincubated with 3H-noradrenaline and then superfused and stimulated electrically. The alpha2-adrenoceptor agonist medetomidine reduced the electrically evoked overflow of tritium in all tissues from all mouse strains (stimulation with single pulses or single high-frequency pulse trains, called POPs, i.e. pulse patterns leading to minimal autoinhibition). The effects of medetomidine did not differ in NMRI, wildtype, alpha2BKO and alpha2CKO mice but were greatly reduced in alpha2A/DKO brain preparations and to a lesser extent in alpha2A/DKO atria and vasa deferentia. Six drugs were tested as antagonists against medetomidine. Their pKd values indicated that the hippocampal and occipito-parietal alpha2-autoreceptors in NMRI and wildtype mice were alpha2D (the rodent variant of the alpha2A/D-adrenoceptor) whereas the atrial and vas deferens alpha2-autoreceptors in NMRI and wildtype mice could not be identified with a single alpha2 subtype. Deletion of the alpha2A/D gene changed the pKd values in all tissues so that they now reflected alpha2C properties, whereas deletion of the alpha2C gene changed the pKd values in atria and vasa deferentia so that they now had alpha2D properties (as they had in NMRI and wildtype brain preparations). Autoinhibition by released noradrenaline was created using trains of up to 64 pulses or up to 4 POPs, and the overflow-enhancing effect of the alpha2 antagonist rauwolscine was determined. Results did not differ, irrespective of whether preparations were obtained from NMRI, wildtype, alpha2BKO or alpha2CKO mice: the overflow of tritium elicited by p pulses or POPs

  20. High gas flow alpha detector

    DOEpatents

    Bolton, Richard D.; Bounds, John A.; Rawool-Sullivan, Mohini W.

    1996-01-01

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors.

  1. High gas flow alpha detector

    DOEpatents

    Bolton, R.D.; Bounds, J.A.; Rawool-Sullivan, M.W.

    1996-05-07

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors. 4 figs.

  2. Computation of Cosmic Ray Ionization and Dose at Mars: a Comparison of HZETRN and Planetocosmics for Proton and Alpha Particles

    NASA Technical Reports Server (NTRS)

    Gronoff, Guillaume; Norman, Ryan B.; Mertens, Christopher J.

    2014-01-01

    The ability to evaluate the cosmic ray environment at Mars is of interest for future manned exploration. To support exploration, tools must be developed to accurately access the radiation environment in both free space and on planetary surfaces. The primary tool NASA uses to quantify radiation exposure behind shielding materials is the space radiation transport code, HZETRN. In order to build confidence in HZETRN, code benchmarking against Monte Carlo radiation transport codes is often used. This work compares the dose calculations at Mars by HZETRN and the Geant4 application Planetocosmics. The dose at ground and the energy deposited in the atmosphere by galactic cosmic ray protons and alpha particles has been calculated for the Curiosity landing conditions. In addition, this work has considered Solar Energetic Particle events, allowing for the comparison of varying input radiation environments. The results for protons and alpha particles show very good agreement between HZETRN and Planetocosmics.

  3. Radiation Chemistry

    NASA Astrophysics Data System (ADS)

    Wojnárovits, L.

    Ionizing radiation causes chemical changes in the molecules of the interacting medium. The initial molecules change to new molecules, resulting in changes of the physical, chemical, and eventually biological properties of the material. For instance, water decomposes to its elements H2 and O2. In polymers, degradation and crosslinking take place. In biopolymers, e.g., DNS strand breaks and other alterations occur. Such changes are to be avoided in some cases (radiation protection), however, in other cases they are used for technological purposes (radiation processing). This chapter introduces radiation chemistry by discussing the sources of ionizing radiation (radionuclide sources, machine sources), absorption of radiation energy, techniques used in radiation chemistry research, and methods of absorbed energy (absorbed dose) measurements. Radiation chemistry of different classes of inorganic (water and aqueous solutions, inorganic solids, ionic liquids (ILs)) and organic substances (hydrocarbons, halogenated compounds, polymers, and biomolecules) is discussed in concise form together with theoretical and experimental backgrounds. An essential part of the chapter is the introduction of radiation processing technologies in the fields of polymer chemistry, food processing, and sterilization. The application of radiation chemistry to nuclear technology and to protection of environment (flue gas treatment, wastewater treatment) is also discussed.

  4. Reliability of {alpha}{sub 1} and {alpha}{sub 2} from lattice codes

    SciTech Connect

    Ng, K.Y.

    1996-10-01

    Whether the higher-order terms in the momentum-compaction factor, {alpha}{sub 1} and {alpha}{sub 2}, can be obtained reliably from lattice codes is an important issue for some quasi-isochronous rings. A FODO lattice consisting of thin quadrupoles, dipoles filling all spaces, and two families of thin sextupoles is solved and {alpha}{sub 1} and {alpha}{sub 2} are derived analytically. We find accurate agreement with SYNCH is examined. Some methods of measurement of {alpha}{sub 1} and {alpha}{sub 2} are discussed.

  5. alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

    PubMed Central

    Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L

    1988-01-01

    An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

  6. Acoustic heating of the chromosphere and cool corona in the F star alpha Canis Minoris (Procyon)

    NASA Technical Reports Server (NTRS)

    Mullan, D. J.; Cheng, Q. Q.

    1994-01-01

    We report on a hydrodynamical model of acoustic wave energy deposition in the atmosphere of the F star Procyon. The model treats radiative losses in the photosphere by solving the continuum radiative transfer (RT) problem; it treats radiative losses in the chromosphere by solving the RT equation in two representative strong lines (Mg II k and Lyman alpha); and it includes optically thin emission from the corona. We find a temperature minimum of 4440 K and a transition region at a height of 3500-4000 km above the photosphere. Our acoustic model accounts for the reported fluxes of Mg II and Lyman alpha emission lines, as well as for the X-ray flux from the cool (T less than 1 MK) coronal component reported by Lemen et al. (1989). The differential emission measure distribution in our model agrees quite well with empirical results of Jordan et al. (1986).

  7. New Methods for Targeted Alpha Radiotherapy

    NASA Astrophysics Data System (ADS)

    Robertson, J. David

    2014-03-01

    multilayered nanoparticle-antibody conjugate can deliver multiple α radiations from the in vivo α-generator 225Ac at biologically relevant receptor sites. The nanoparticles retained over 90% of the 221Fr daughter over the course of three weeks in in vitro experiments. In in vivo experiments, approximately 90% of the 213Bi was retained in the target tissue 24 hours after injection of the antibody labeled nanoparticle. An overview of the development and application of this promising, new approach to targeted alpha therapy will be presented.

  8. High-Dispersion Observations of Alpha Bootis

    NASA Astrophysics Data System (ADS)

    Ayres, Thomas R.

    Investigating the late phases of the life of a star is central to an understanding of stellar structure and evolution, and the aping of stellar magnetic activity. For yellow dwarf stars like the Sun, the advanced stages of their life cycle are represented by old red giants like Arcturus (alpha Bootis, K2 III). I propose, therefore, to undertake the most detailed spectroscopic study of Arcturus yet attempted with the International Ultraviolet Explorer. The study includes a 24-hour superexposure of the farultraviolet (1150-2000 A) region, obtained with collaborators in the U.K., and a uniformly high signalto-noise map of the 2750-2900 A region of the middle ultraviolet. The IUE observations will be coordinated with ground-based high-resolution spectroscopy of the Ca I, Ca II and H-alpha lines of the optical region. The SWP superexposure will be utilized to search for bands of the carbon monoxide 4th positive system, which have been identified in low dispersion spectra but are not seen in the existing 8-hour SWP echelle exposure, and to detect, or set harder upper limits on, highexcitation emission lines like C II 1336, Si IV 1394, and C IV 1548, which are diagnostics for the presence of hot plasma (T>2_10^4 K) in the outer atmosphere of the red giant. The strength of the farultraviolet ionic emission lines can be used to constrain the competing models to explain the structure of red giant chromospheres, coronae and winds, while the fluoresced molecular features can be used to probe the coolest layers of the red giant photosphere, which are radiatively pumped from above by the strong chromospheric emissions of O I 1305 triplet) and C I (1657 multiplet). The high quality map of the middle ultraviolet region can be utilized to study the strong chromospheric emission cores and faint inner damping wings of the Mg II resonance lines, and the weak emission core of the neutral magnesium resonance line at 2852 A. These spectra can he applied to a number of problems ranging

  9. Radiation chemistry of amino acids, peptides and proteins in relation to the radiation sterilization of high-protein foods

    SciTech Connect

    Garrison, W. M.

    1981-12-01

    An important source of information on the question of whether or not toxic or other deleterious substances are formed in the radiation sterilization of foods is the chemical study of reaction products and reaction mechanisms in the radiolysis of individual food components. The present evaluation of the radiation chemistry of amino acids, peptides, and proteins outlines the various radiation-induced processes which lead to amino acid degradation and to the synthesis of amino acid derivatives of higher molecular weight. Among the latter are the ..cap alpha..,..cap alpha..'-diamino dicarboxylic acids which are formed as major products in the radiolysis of peptides both in aqueous solution and in the solid state. The ..cap alpha..,..cap alpha..'-diamino acids are of particular interest as irradiation products because they represent a class of compounds not normally encountered in plant and animal protein sources. Such compounds have, however, been isolated from certain types of bacteria and bacterial products. All of the available data strongly suggest that the ..cap alpha..,..cap alpha..'-diamino acids are produced in significant yield in the radiation sterilization of high protein foods. The importance of initiating extensive chemical and biological studies of these and of other high molecular weight products in irradiated food is emphasized.

  10. Nonequilibrium radiative properties in fluctuating plasmas1

    SciTech Connect

    Rosmej, F. B.; Lisitsa, V. S.

    2011-06-15

    A general kinetic model was developed to simulate the radiative properties of nonstationary fluctuating plasmas and characterize the relationship between the nonstationary fluctuation time and the atomic relaxation times. The developed theory is applied to the radiative line emission in the case of instabilities in tokamaks. It is shown by exact time dependent simulations that involve explicitly LSJ-split excited states that the radiation emission in fluctuating plasma can be larger than in the corresponding stationary limits. For regular fluctuations like the sawtooth activity, also the startup phase of sawtooth activity can lead to higher emission compared to the time dependent regular phase. It is demonstrated that the sawtooth crash can be almost exactly followed by resonance line emission like H-like Lyman-alpha and He-like Helium-alpha of, e.g., argon impurity ions, whereas the effective charge state distribution lags seriously behind.

  11. Influencia atmosférica en la rotación terrestre

    NASA Astrophysics Data System (ADS)

    Fernández, L. I.; Arias, E. F.; Brunini, C. A.

    Las observaciones de los parámetros de la orientación terrestre han alcanzado en estos últimos años una exactitud sin precedentes gracias al uso de modernas técnicas de geodesia espacial. Estudios previos han establecido que las variaciones en la rotación terrestre con períodos iguales o menores que dos años obedecen a cambios en la circulación atmosférica global. Para estos períodos puede comprobarse que existe un gran acuerdo entre las fluctuaciones de la longitud del día (LOD) y los cambios del momento angular atmosférico terrestre (AAM). Sin embargo, no existe un acuerdo general acerca de las causas que provocan las variaciones de largo período de la rotación de la Tierra, también conocidas como ``variaciones decenales''. En nuestro análisis examinamos las correlaciones entre las variaciones de los valores de LOD y las fluctuaciones en la componente polar del momento angular atmosférico terrestre. Con este propósito utilizamos los siguientes juegos de datos: las series de AAM, estimado siguiendo la definición de Barnes et al.(1983) para 2825 días provientes del National Meteorological Center (NMC) y del European Centre for Medium Range Weather Forecast (ECMWF); y las series de LOD que contienen valores alisados espaciados a intervalos de un día elaborados por el International Earth Rotation Service (IERS). Mostraremos que para los cambios anuales e interanuales en la rotación de la Tierra la influencia atmosférica es asombrosa, mientras que, tanto en las escalas temporales más grandes y como en las más pequeñas, ambas series, geodésica y atmosférica, parecen diverger aún cuando poseemos observaciones obtenidas con las técnicas más modernas al presente.

  12. New analysis of the Voyager UVS H Lyman-alpha emission of Saturn

    NASA Technical Reports Server (NTRS)

    Jaffel, L. Ben; Prange, R.; Sandel, B. R.; Yelle, R. V.; Emerich, C.; Feng, D.; Hall, D. T.

    1995-01-01

    The limb to limb Lyman-alpha reflectivities observed with the Voyager ultraviolet spectrometer (UVS) instruments during the fly-by of Saturn are reanalyzed using a revised H Lyman-alpha sensitivity for the Voyager 1 instrument. The new sensitivity reconciles the measured intensities to those of Voyager 2 and gives a coherent set of data. To fit the UV airglow observations, four sources are considered: (1) H resonance and H2 Rayleigh scattering of solar Lyman-alpha radiation, (2) the interplanetary Lyman-alpha radiation, (3) a possible internal source of unknown origin, (4) the possibility of atmospheric turbulence recently proposed to explain the Lyman-alpha bulge of Jupiter. The analysis supports neither a dominant collisional excitation source for the UV emissions nor the presence of strong atmospheric turbulence. The best fit, in terms of brightness but also in terms of shape of the limb to limb profile (that is to say independent on the absolute calibrations), is obtained for pure resonance and Rayleigh scattering of solar and interstellar wind line in an atmosphere enriched in atomic hydrogen up to three times the standard model. Influx of water from the rings of Saturn may provide a means for producing such enhanced H densities in the upper atmosphere.

  13. Effects of chronic internal alpha irradiation on physiology, growth and reproductive success of Daphnia magna.

    PubMed

    Alonzo, F; Gilbin, R; Bourrachot, S; Floriani, M; Morello, M; Garnier-Laplace, J

    2006-12-01

    Daphnids were chronically exposed to waterborne Am-241, an alpha-emitting radionuclide, ranging in concentration from 0.4 to 40 Bq ml(-1). Am-241 amounts were monitored in the medium, daphnid tissues and cuticles. Corresponding average dose rates of 0.02, 0.11 and 0.99 mGy h(-1) were calculated for whole organisms with internal alpha-radiation contributing 99% of total dose rates. Effects of internal alpha irradiation on respiration and ingestion rates, adult, egg and neonate individual dry masses, fecundity and larval resistance to starvation were examined in 23-day experiments. Daphnids showed increased respiratory demand after 23 days at the highest dose rate, suggesting increased metabolic cost of maintenance due to coping with alpha radiological stress. Although no effect was detected on ingestion rates between contaminated and control daphnids, exposure to dose rates of 0.11 mGy h(-1) or higher, resulted in a significant 15% reduction in body mass. Fecundity remained unchanged over the 23-day period, but individual masses of eggs and neonates were significantly smaller compared to the control. This suggested that increased metabolic expenditure in chronically alpha-radiated daphnids came at the expense of their energy investment per offspring. As a consequence, neonates showed significantly reduced resistance to starvation at every dose rate compared to the control. Our observations are discussed in comparison with literature results reported for cadmium, a chemical toxicant which affects feeding activity and strongly reduces individual energy uptake.

  14. Effects of interferon-alpha (IFN-alpha) administration on leucocytes in healthy humans.

    PubMed

    Corssmit, E P; Heijligenberg, R; Hack, C E; Endert, E; Sauerwein, H P; Romijn, J A

    1997-02-01

    Plasma concentrations of IFN-alpha are increased in several inflammatory conditions. Several lines of evidence indicate that IFN-alpha has anti-inflammatory properties. To study the effects of IFN-alpha on leucocyte subsets and activation and on cytokines, we administered IFN-alpha (rhIFN-alpha2b; 5 x 10(6) U/m2) to eight healthy human subjects in a randomized controlled cross-over study and analysed changes in circulating leucocytes and parameters for neutrophil and monocyte activation. After administration of IFN-alpha, neutrophil counts increased, monocyte counts decreased transiently, whereas the number of lymphocytes, basophils and eosinophils showed a sustained decrease. IFN-alpha administration was also associated with neutrophil activation, reflected in an increase in the plasma concentrations of elastase-alpha1-antitrypsin complexes and lactoferrin. Serum neopterin, a marker for monocyte activation, was significantly increased 10 h after administration of IFN-alpha. IFN-alpha significantly increased plasma concentrations of IL-6, IL-8 and IL-10. Although IL-1 and tumour necrosis factor (TNF) remained undetectable, plasma concentrations of soluble TNF receptors p55 and p75 increased after IFN-alpha administration. We conclude that IFN-alpha induces multiple alterations in the distribution and functional properties of leucocytes. IFN-alpha exerts pro- as well as anti-inflammatory effects within the cytokine network.

  15. Beta/alpha continuous air monitor

    DOEpatents

    Becker, G.K.; Martz, D.E.

    1988-06-27

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

  16. Beta/alpha continuous air monitor

    DOEpatents

    Becker, Gregory K.; Martz, Dowell E.

    1989-01-01

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinguishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts.

  17. Radiator technology

    NASA Technical Reports Server (NTRS)

    Juhasz, Albert J.

    1993-01-01

    Radiator technology is discussed in the context of the Civilian Space Technology Initiative's (CSTI's) high capacity power-thermal management project. The CSTI project is a subset of a project to develop a piloted Mars nuclear electric propulsion (NEP) vehicle. The following topics are presented in vugraph form: advanced radiator concepts; heat pipe codes and testing; composite materials; radiator design and integration; and surface morphology.

  18. Hawking radiation

    NASA Astrophysics Data System (ADS)

    Parentani, Renaud; Spindel, Philippe

    2011-12-01

    Hawking radiation is the thermal radiation predicted to be spontaneously emitted by black holes. It arises from the steady conversion of quantum vacuum fluctuations into pairs of particles, one of which escaping at infinity while the other is trapped inside the black hole horizon. It is named after the physicist Stephen Hawking who derived its existence in 1974. This radiation reduces the mass of black holes and is therefore also known as black hole evaporation.

  19. Photoelectron Emission and Lyman Alpha Measurements by the CHAMPS Rockets

    NASA Astrophysics Data System (ADS)

    Sternovsky, Z.; Robertson, S. H.; Dickson, S.; Gausa, M. A.; Friedrich, M.; Horanyi, M.

    2012-12-01

    The daytime CHAMPS (CHarge And mass of Meteoritic smoke ParticleS) sounding rocket carried a suit of instruments for the monitoring of photoemission current and Lyman alpha flux as a function of altitude. The results show that photoemission is significant down to 60-75 km altitude, depending on the photo-emitting surface. Lyman alpha was detected to about 65 km altitude. The daytime CHAMPS rocket launched on 13 October 13:50 UT from the Andøya Rocket Range, Norway. The CHAMPS instruments detected layers of particles, probably of meteoric origin, charged both positive and negative in the 63-93 km altitude range. The CHAMPS payloads were also designed to characterize the plasma environment and thus also carried Faraday rotation antennas and electron and ion probes. Solar UV plays an important role in charge balance for both the rocket body and meteoric smoke particles. Photoelectron emission was monitored by a set of three detectors consisting of an emitting surface (Platinum, Aluminum and Zirconium) biased at -10 V and placed behind a fine grid. The Al and Zr surfaces produced similar signals with photoemission measureable above 75 km altitude. The Pt surface emitted photoelectrons even below 60 km altitude. The different behavior of Pt can possibly be due to exposure to atomic oxygen, though further analysis is necessary. The solar Lyman alpha radiation was measured by a UV photodiode placed behind a pair or filters to reduce the contribution to the signal from visible light. Lyman alpha was detected down to 65 km altitude, which confirms that photo-detachment and photoelectric charging needs to be considered for the charge balance of particle layers in the mesosphere region. All instruments were calibrated at the facilities of the Laboratory for Atmospheric and Space Physics at the University of Colorado.

  20. SU-E-J-03: A Comprehensive Comparison Between Alpha and Beta Emitters for Cancer Radioimmunotherapy

    SciTech Connect

    Huang, C.Y.; Guatelli, S; Oborn, B; Allen, B

    2014-06-01

    Purpose: The purpose of this study is to perform a comprehensive comparison of the therapeutic efficacy and cytotoxicity of alpha and beta emitters for Radioimmunotherapy (RIT). For each stage of cancer development, specific models were built for the separate objectives of RIT to be addressed:a) kill isolated cancer cells in transit in the lymphatic and vascular circulation,b) regress avascular cell clusters,c) regress tumor vasculature and tumors. Methods: Because of the nature of short range, high LET alpha and long energy beta radiation and heterogeneous antigen expression among cancer cells, the microdosimetric approach is essential for the RIT assessment. Geant4 based microdosimetric models are developed for the three different stages of cancer progression: cancer cells, cell clusters and tumors. The energy deposition, specific energy resulted from different source distribution in the three models was calculated separately for 4 alpha emitting radioisotopes ({sup 211}At, {sup 213}Bi, {sup 223}Ra and {sup 225}Ac) and 6 beta emitters ({sup 32}P, {sup 33}P, {sup 67}Cu, {sup 90}Y, {sup 131}I and {sup 177}Lu). The cell survival, therapeutic efficacy and cytotoxicity are determined and compared between alpha and beta emitters. Results: We show that internal targeted alpha radiation has advantages over beta radiation for killing isolated cancer cells, regressing small cell clusters and also solid tumors. Alpha particles have much higher dose specificity and potency than beta particles. They can deposit 3 logs more dose than beta emitters to single cells and solid tumor. Tumor control probability relies on deep penetration of radioisotopes to cancer cell clusters and solid tumors. Conclusion: The results of this study provide a quantitative understanding of the efficacy and cytotoxicity of RIT for each stage of cancer development.

  1. Hemoglobin Evanston (alpha 14 Trp----Arg). An unstable alpha-chain variant expressed as alpha-thalassemia.

    PubMed Central

    Honig, G R; Shamsuddin, M; Vida, L N; Mompoint, M; Valcourt, E; Bowie, L J; Jones, E C; Powers, P A; Spritz, R A; Guis, M

    1984-01-01

    A new hematologic syndrome with phenotypic features of mild Hb H disease was identified in three children from two unrelated black American families. Erythrocytes from each of these children contained Hb H (beta 4) and Hb Barts (gamma 4), as well as a slowly migrating hemoglobin fraction that made up 7-10% of the total hemoglobin. The parents of the affected children all showed mild thalassemia-like changes, with one of the parents in each family also expressing the variant hemoglobin; in the latter individuals the mutant alpha-chains made up less than 2% of the total, and were present mainly or exclusively in combination with delta-chains in the form of a slowly migrating Hb A2. Purified Hb Evanston showed an increased oxygen affinity, but its Bohr effect, cooperativity, and 2,3-diphosphoglycerate effect were normal. The mutant hemoglobin appeared to have normal stability to heat and to isopropanol, and the stability of its alpha-chain in an extended time course synthesis study also appeared to be similar to that of alpha A. However, the results from short-term globin synthesis studies, and from mRNA translation in vitro, suggest that the two types of alpha-chains were synthesized at relatively equal rates, with a major fraction of the newly synthesized variant alpha-chains undergoing rapid catabolism. The hematologic data taken in combination with DNA hybridization and globin synthesis findings indicate that the proposita in each of these families has the genotype--, alpha A/--, alpha Ev. These observations suggest that two separate mechanisms are contributing to the alpha-thalassemia-like expression of Hb Evanston : the newly synthesized alpha EV-chains are unstable and are subject to early proteolytic destruction; and the mutant alpha-allele is linked to an alpha-globin gene deletion. Images PMID:6725558

  2. Radiation effects in the lung

    SciTech Connect

    Coggle, J.E.; Lambert, B.E.; Moores, S.R.

    1986-12-01

    This article outlines the principles of radiobiology that can explain the time of onset, duration, and severity of the complex reactions of the lung to ionizing radiation. These reactions have been assayed biochemically, cell kinetically, physiologically, and pathologically. Clinical and experimental data are used to describe the acute and late reactions of the lung to both external and internal radiation including pneumonitis, fibrosis and carcinogenesis. Acute radiation pneumonitis, which can be fatal, develops in both humans and animals within 6 months of exposure to doses greater than or equal to 8 Gy of low LET radiation. It is divisible into a latent period lasting up to 4 weeks; an exudative phase (3-8 weeks) and with an acute pneumonitic phase between 2 and 6 months. There is much evidence to suggest that pneumonitis is an epithelial reaction and some evidence to suggest that this early damage may not be predictive of late fibrosis. However, despite detailed work on collagen metabolism, the pathogenesis of radiation fibrosis remains unknown. The data on radiation-induced pulmonary cancer, both in man and experimental animals from both external and internal irradiation following the inhalation of both soluble and insoluble alpha and beta emitting radionuclides are reviewed. 312 references. (Abstract Truncated)

  3. Teaching calculus with Wolfram|Alpha

    NASA Astrophysics Data System (ADS)

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-12-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to Wolfram|Alpha in our differential and integral calculus labs, together with the positive results from our experience. We also discuss the current limitations of Wolfram|Alpha, including a discussion on why we still use a CAS for our multivariate calculus labs.

  4. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H

    1996-01-01

    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  5. Prospects for alpha particle studies on TFTR

    SciTech Connect

    Zweben, S.J.

    1987-05-01

    TFTR is expected to produce approximately 5 MW of alpha heating during the D/T Q approx. = 1 phase of operation in 1990. At that point the collective confinement properties and the heating effects of alpha particles become accessible for study for the first time. This paper outlines the potential performance of TFTR with respect to alpha particle production, the diagnostics which will be available for alpha particle measurements, and the physics issues which can be studied both before and during D/T operation.

  6. 5 alpha-reductase deficiency without hypospadias.

    PubMed Central

    Ng, W K; Taylor, N F; Hughes, I A; Taylor, J; Ransley, P G; Grant, D B

    1990-01-01

    A boy aged 4 with penoscrotal hypospadias and his brother aged 12 with micropenis had typical changes of homozygous 5 alpha-reductase deficiency. After three injections of chorionic gonadotrophin there was a trivial rise in plasma dihydrotestosterone with a normal increase in plasma testosterone. Urine steroid chromatography showed abnormally high 5 beta: 5 alpha ratios and 5 alpha-reductase activity was appreciably reduced in genital skin fibroblasts. The results indicate that 5 alpha-reductase deficiency is not invariably associated with genital ambiguity. PMID:2248513

  7. The Ly(alpha) Line Profiles of Ultraluminous Infrared Galaxies: Fast Winds and Lyman Continuum Leakage

    NASA Technical Reports Server (NTRS)

    Martin, Crystal L.; Dijkstra, Mark; Henry, Alaina L.; Soto, Kurt T.; Danforth, Charles W.; Wong, Joseph

    2015-01-01

    We present new Hubble Space Telescope Cosmic Origins Spectrograph far-ultraviolet (far-UV) spectroscopy and Keck Echellete optical spectroscopy of 11 ultraluminous infrared galaxies (ULIRGs), a rare population of local galaxies experiencing massive gas inflows, extreme starbursts, and prominent outflows. We detect Ly(alpha) emission from eight ULIRGs and the companion to IRAS09583+4714. In contrast to the P Cygni profiles often seen in galaxy spectra, the Ly(alpha) profiles exhibit prominent, blueshifted emission out to Doppler shifts exceeding -1000 km/s in three H II-dominated and two AGN-dominated ULIRGs. To better understand the role of resonance scattering in shaping the Ly(alpha) line profiles, we directly compare them to non-resonant emission lines in optical spectra. We find that the line wings are already present in the intrinsic nebular spectra, and scattering merely enhances the wings relative to the line core. The Ly(alpha) attenuation (as measured in the COS aperture) ranges from that of the far-UV continuum to over 100 times more. A simple radiative transfer model suggests the Ly(alpha) photons escape through cavities which have low column densities of neutral hydrogen and become optically thin to the Lyman continuum in the most advanced mergers. We show that the properties of the highly blueshifted line wings on the Ly(alpha) and optical emission-line profiles are consistent with emission from clumps of gas condensing out of a fast, hot wind. The luminosity of the Ly(alpha) emission increases nonlinearly with the ULIRG bolometric luminosity and represents about 0.1-1% of the radiative cooling from the hot winds in the H II-dominated ULIRGs.

  8. Effects of alpha-particles on survival and chromosomal aberrations in human mammary epithelial cells

    NASA Technical Reports Server (NTRS)

    Durante, M.; Grossi, G. F.; Gialanella, G.; Pugliese, M.; Nappo, M.; Yang, T. C.

    1995-01-01

    We have studied the radiation responses of a human mammary epithelial cell line, H184B5 F5-1 M/10. This cell line was derived from primary mammary cells after treatment with chemicals and heavy ions. The F5-1 M/10 cells are immortal, density-inhibited in growth, and non-tumorigenic in athymic nude mice and represent an in vitro model of the human epithelium for radiation studies. Because epithelial cells are the target of alpha-particles emitted from radon daughters, we concentrated our studies on the efficiency of alpha-particles. Confluent cultures of M/10 cells were exposed to accelerated alpha-particles [beam energy incident at the cell monolayer = 3.85 MeV, incident linear energy transfer (LET) in cell = 109 keV/microns] and, for comparison, to 80 kVp x-rays. The following endpoints were studied: (1) survival, (2) chromosome aberrations at the first postirradiation mitosis, and (3) chromosome alterations at later passages following irradiation. The survival curve was exponential for alpha-particles (D0 = 0.73 +/- 0.04 Gy), while a shoulder was observed for x-rays (alpha/beta = 2.9 Gy; D0 = 2.5 Gy, extrapolation number 1.6). The relative biological effectiveness (RBE) of high-LET alpha-particles for human epithelial cell killing was 3.3 at 37% survival. Dose-response curves for the induction of chromosome aberrations were linear for alpha-particles and linearquadratic for x-rays. The RBE for the induction of chromosome aberrations varied with the type of aberration scored and was high (about 5) for chromosome breaks and low (about 2) for chromosome exchanges.(ABSTRACT TRUNCATED AT 250 WORDS).

  9. Delamination and adhesive wear behavior of alpha-tocopherol-stabilized irradiated ultrahigh-molecular-weight polyethylene.

    PubMed

    Wannomae, Keith K; Christensen, Steven D; Micheli, Brad R; Rowell, Shannon L; Schroeder, Dave W; Muratoglu, Orhun K

    2010-06-01

    Wear and delamination of conventional ultrahigh-molecular-weight polyethylene (UHMWPE) components used in total knee arthroplasty can compromise long-term performance. Radiation cross-linking and melt-annealing reduced wear and increased delamination resistance of UHMWPE. An alternative material is the alpha-tocopherol-stabilized irradiated UHMWPE (alphaTPE), with improved mechanical and fatigue properties vs irradiated and melted UHMWPE. We studied the wear and delamination resistance of alphaTPE and conventional UHMWPE (direct compression molded GUR 1050 and Himont 1900) under reciprocating unidirectional motion. Wear resistance was improved, and no delamination was observed in alphaTPE. Accelerated aging did not alter the wear and delamination behavior of alphaTPE. The GUR 1050 UHMWPE showed delamination and pitting when subjected to unidirectional reciprocating motion after accelerated aging. Himont 1900 UHMWPE showed no delamination when subjected to unidirectional reciprocating motion after accelerated aging. alpha-Tocopherol-stabilized irradiated UHMWPE is advanced for use in total knee arthroplasty due to its high resistance to wear, delamination, and oxidation.

  10. Effect of quench on alpha/beta pulse shape discrimination of liquid scintillation cocktails.

    PubMed

    DeVol, Timothy A; Theisen, Christopher D; DiPrete, David P

    2007-05-01

    The objectives of this paper are (1) to illustrate that knowledge of the external quench parameter is insufficient to properly setup a pulse shape discriminating liquid scintillation counter (LSC) for quantitative measurement, (2) to illustrate dependence on pulse shape discrimination on the radionuclide (more than just radiation and energy), and (3) to compare the pulse shape discrimination (PSD) of two commercial instruments. The effects various quenching agents, liquid scintillation cocktails, radionuclides, and LSCs have on alpha/beta pulse shape discriminating liquid scintillation counting were quantified. Alpha emitting radionuclides (239)Pu and (241)Am and beta emitter (90)Sr/(90)Y were investigated to quantify the nuclide dependence on alpha/beta pulse shape discrimination. Also, chemical and color quenching agents, nitromethane, nitric acid, and yellow dye impact on alpha/beta pulse shape discrimination using PerkinElmer Optiphase "HiSafe" 2 and 3, and Ultima Gold AB liquid scintillation cocktails were determined. The prepared samples were counted on the PerkinElmer Wallac WinSpectral 1414 alpha/beta pulse shape discriminating LSC. It was found that for the same level of quench, as measured by the external quench parameter, different quench agents influenced the pulse shape discrimination and the pulse shape discrimination parameters differently. The radionuclide also affects alpha/beta pulse shape discrimination. By comparison with the PerkinElmer Tri-carb 3150 TR/AB, the Wallac 1414 exhibited better pulse shape discrimination capability under the same experimental conditions. PMID:17440321

  11. A Critical Review of Alpha Radionuclide Therapy-How to Deal with Recoiling Daughters?

    PubMed

    de Kruijff, Robin M; Wolterbeek, Hubert T; Denkova, Antonia G

    2015-01-01

    This review presents an overview of the successes and challenges currently faced in alpha radionuclide therapy. Alpha particles have an advantage in killing tumour cells as compared to beta or gamma radiation due to their short penetration depth and high linear energy transfer (LET). Touching briefly on the clinical successes of radionuclides emitting only one alpha particle, the main focus of this article lies on those alpha-emitting radionuclides with multiple alpha-emitting daughters in their decay chain. While having the advantage of longer half-lives, the recoiled daughters of radionuclides like 224Ra (radium), 223Ra, and 225Ac (actinium) can do significant damage to healthy tissue when not retained at the tumour site. Three different approaches to deal with this problem are discussed: encapsulation in a nano-carrier, fast uptake of the alpha emitting radionuclides in tumour cells, and local administration. Each approach has been shown to have its advantages and disadvantages, but when larger activities need to be used clinically, nano-carriers appear to be the most promising solution for reducing toxic effects, provided there is no accumulation in healthy tissue. PMID:26066613

  12. A Critical Review of Alpha Radionuclide Therapy—How to Deal with Recoiling Daughters?

    PubMed Central

    de Kruijff, Robin M.; Wolterbeek, Hubert T.; Denkova, Antonia G.

    2015-01-01

    This review presents an overview of the successes and challenges currently faced in alpha radionuclide therapy. Alpha particles have an advantage in killing tumour cells as compared to beta or gamma radiation due to their short penetration depth and high linear energy transfer (LET). Touching briefly on the clinical successes of radionuclides emitting only one alpha particle, the main focus of this article lies on those alpha-emitting radionuclides with multiple alpha-emitting daughters in their decay chain. While having the advantage of longer half-lives, the recoiled daughters of radionuclides like 224Ra (radium), 223Ra, and 225Ac (actinium) can do significant damage to healthy tissue when not retained at the tumour site. Three different approaches to deal with this problem are discussed: encapsulation in a nano-carrier, fast uptake of the alpha emitting radionuclides in tumour cells, and local administration. Each approach has been shown to have its advantages and disadvantages, but when larger activities need to be used clinically, nano-carriers appear to be the most promising solution for reducing toxic effects, provided there is no accumulation in healthy tissue. PMID:26066613

  13. Tumor vascular disruption using various radiation types

    PubMed Central

    2014-01-01

    The feasibility of disrupting a tumor’s vascular structure with various radiation types and radionuclides is investigated. Calculated absorbed dose profiles for photons and 4He ions suggest that low-energy beta-gamma and alpha emitting radionuclides can deposit sufficient absorbed dose to disrupt a tumor’s vascular structure while minimizing the dose outside the blood vessel. Candidate radionuclides uniformly distributed in microspheres are theoretically investigated with respect to their vascular disruption potential and to offer an alternative to 90Y microsphere therapy. Requisite activities of candidate low-energy beta-gamma and alpha emitting radionuclides to facilitate vascular disruption are calculated. PMID:24749005

  14. Synthesis of anticholinergic agents: N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate salts.

    PubMed

    Oroshnik, W; Soldati, G

    1978-05-01

    The synthesis of a new anticholinergic agent, N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate, obtained by reacting N-methyl-4-piperidinyl alpha-cyclopentylmandelate with benzoyl chloride in the presence of methyllithium, is reported. This material may be useful as an antiperspirant.

  15. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  16. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  17. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  18. Resting-State Alpha in Autism Spectrum Disorder and Alpha Associations with Thalamic Volume

    ERIC Educational Resources Information Center

    Edgar, J. Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D.; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M.; Qasmieh, Saba; Levy, Susan E.; Schultz, Robert T.; Roberts, Timothy P. L.

    2015-01-01

    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha…

  19. Understanding Radiation.

    ERIC Educational Resources Information Center

    Department of Energy, Washington, DC. Nuclear Energy Office.

    Radiation is a natural energy force that has been a part of the environment since the Earth was formed. It takes various forms, none of which can be smelled, tasted, seen, heard, or felt. Nevertheless, scientists know what it is, where it comes from, how to measure and detect it, and how it affects people. Cosmic radiation from outer space and…

  20. Radiation detector

    DOEpatents

    Fultz, B.T.

    1980-12-05

    Apparatus is provided for detecting radiation such as gamma rays and x-rays generated in backscatter Moessbauer effect spectroscopy and x-ray spectrometry, which has a large window for detecting radiation emanating over a wide solid angle from a specimen and which generates substantially the same output pulse height for monoenergetic radiation that passes through any portion of the detection chamber. The apparatus includes a substantially toroidal chamber with conductive walls forming a cathode, and a wire anode extending in a circle within the chamber with the anode lying closer to the inner side of the toroid which has the least diameter than to the outer side. The placement of the anode produces an electric field, in a region close to the anode, which has substantially the same gradient in all directions extending radially from the anode, so that the number of avalanche electrons generated by ionizing radiation is independent of the path of the radiation through the chamber.

  1. Radiation detector

    DOEpatents

    Fultz, Brent T.

    1983-01-01

    Apparatus is provided for detecting radiation such as gamma rays and X-rays generated in backscatter Mossbauer effect spectroscopy and X-ray spectrometry, which has a large "window" for detecting radiation emanating over a wide solid angle from a specimen and which generates substantially the same output pulse height for monoenergetic radiation that passes through any portion of the detection chamber. The apparatus includes a substantially toroidal chamber with conductive walls forming a cathode, and a wire anode extending in a circle within the chamber with the anode lying closer to the inner side of the toroid which has the least diameter than to the outer side. The placement of the anode produces an electric field, in a region close to the anode, which has substantially the same gradient in all directions extending radially from the anode, so that the number of avalanche electrons generated by ionizing radiation is independent of the path of the radiation through the chamber.

  2. Diffuse radiation

    NASA Technical Reports Server (NTRS)

    1981-01-01

    A diffuse celestial radiation which is isotropic at least on a course scale were measured from the soft X-ray region to about 150 MeV, at which energy the intensity falls below that of the galactic emission for most galactic latitudes. The spectral shape, the intensity, and the established degree of isotropy of this diffuse radiation already place severe constraints on the possible explanations for this radiation. Among the extragalactic theories, the more promising explanations of the isotropic diffuse emission appear to be radiation from exceptional galaxies from matter antimatter annihilation at the boundaries of superclusters of galaxies of matter and antimatter in baryon symmetric big bang models. Other possible sources for extragalactic diffuse gamma radiation are discussed and include normal galaxies, clusters of galaxies, primordial cosmic rays interacting with intergalactic matter, primordial black holes, and cosmic ray leakage from galaxies.

  3. High-alpha space trucks

    SciTech Connect

    Cook, L.M.; Ball, J.

    1997-01-01

    Vertically-landing Reusable Launch Vehicles (RLVs) are the best hope of building a true {open_quotes}Space Truck{close_quotes} with current technology. Because they do not require a low angle-of-attack (AOA, or alpha) horizontal landing, they can be designed to operate exclusively at very high angles-of-attack. This offers savings in vehicle dry weight and complexity, which can be traded for significantly heavier payload, more ascent velocity, or extra design margin. The price for abandoning low angle-of-attack flight is reduced crossrange. To quantify the potential weight reduction, a trade study was performed to determine the relationship between a vehicle{close_quote}s maximum crossrange (angle-of-attack) and it{close_quote}s dry weight (payload margin). At the study conclusion, three vertically-landing (VL) vehicles provided multiple points on a payload weight vs. maximum crossrange curve, showing significant payload increases as crossrange is sacrificed. This is primarily the result of being able to simplify the structure, fly a cooler entry trajectory, and be aerodynamically stable through the entire flight. This reduces subsystem requirements and complexity, enhancing reliability. Further benefits are realized in reduced landing propellant requirements and simplifying or eliminating the {open_quotes}rotation{close_quotes} maneuver. This paper also suggests unique operability solutions that adapt high-alpha vehicles to traditional high-crossrange missions such as the polar {open_quotes}once-around{close_quotes} flight, and proposes a small scale drop-test program to prove the subsonic and landing portion of the flight envelope. {copyright} {ital 1997 American Institute of Physics.}

  4. Six mouse alpha-tubulin mRNAs encode five distinct isotypes: testis-specific expression of two sister genes.

    PubMed Central

    Villasante, A; Wang, D; Dobner, P; Dolph, P; Lewis, S A; Cowan, N J

    1986-01-01

    Five mouse alpha-tubulin isotypes are described, each distinguished by the presence of unique amino acid substitutions within the coding region. Most, though not all of these isotype-specific amino acids, are clustered at the carboxy terminus. One of the alpha-tubulin isotypes described is expressed exclusively in testis and is encoded by two closely related genes (M alpha 3 and M alpha 7) which have homologous 3' untranslated regions but which differ at multiple third codon positions and in their 5' untranslated regions. We show that a subfamily of alpha-tubulin genes encoding the same testis-specific isotype also exists in humans. Thus, we conclude that the duplication event leading to a pair of genes encoding a testis-specific alpha-tubulin isotype predated the mammalian radiation, and both members of the duplicated sequence have been maintained since species divergence. A second alpha-tubulin gene, M alpha 6, is expressed ubiquitously at a low level, whereas a third gene, M alpha 4, is unique in that it does not encode a carboxy-terminal tyrosine residue. This gene yields two transcripts: a 1.8-kilobase (kb) mRNA that is abundant in muscle and a 2.4-kb mRNA that is abundant in testis. Whereas the 1.8-kb mRNA encodes a distinct alpha-tubulin isotype, the 2.4-kb mRNA is defective in that the methionine residue required for translational initiation is missing. Patterns of developmental expression of the various alpha-tubulin isotypes are presented. Our data support the view that individual tubulin isotypes are capable of conferring functional specificity on different kinds of microtubules. Images PMID:3785200

  5. Arrangements of alpha-globin gene cluster in Taiwan.

    PubMed

    Peng, H W; Choo, K B; Ho, C H; Yen, M S; Liung, W Y; Lin, C K; Yang, Z L; Ng, H T; Ching, K N; Han, S H

    1989-01-01

    In a gene mapping study on 217 newborn babies in Taiwan with alpha- and zeta-globin probes, we have observed 4 cases (1.84%) of alpha-thalassemia-2 heterozygotes (zeta zeta-alpha/zeta zeta alpha alpha) without increased levels of hemoglobin (Hb) Bart's in the cord blood. Eleven subjects (5.07%) were found to have the South East Asian alpha-thalassemia-1 haplotype (zeta zeta--SEA/zeta zeta alpha alpha) with increased Hb Bart's levels ranging from 2.2 to 9%. One case, with Hb Bart's level of 14% in the cord blood, was found to have the genotype of zeta zeta--SEA/zeta zeta alpha alpha T (0.46%). Four heterozygotes (1.84%) were found with the triple alpha gene anti-rightward arrangement (zeta zeta alpha alpha alpha 3.7/zeta zeta alpha alpha). Twenty-one heterozygotes (9.68%) were found to have the triple zeta-globin gene arrangement (zeta zeta zeta alpha alpha/zeta zeta alpha alpha). A new triple zeta-globin gene variant with a BamHI polymorphism was also observed in this study.

  6. Alpha Biofeedback Conditioning and Retarded Subjects.

    ERIC Educational Resources Information Center

    Martin, Walter; And Others

    1981-01-01

    An experimental group of three institutionalized severely retarded adult males received binary tone feedback for alpha production while a control group (3) followed identical procedures without feedback. Analysis revealed significant difference between groups in alpha percentage increase over baseline, encouraging research on applications for…

  7. Elementary Processes Underlying Alpha Channeling in Tokamaks

    SciTech Connect

    NM.J. Fisch

    2012-06-15

    Alpha channeling in tokamaks is speculative, but also extraordinarily attractive. Waves that can accomplish this effect have been identified. Key aspects of the theory now enjoy experimental confirmation. This paper will review the elementary processes of wave-particle interactions in plasma that underlie the alpha channeling effect

  8. Alpha-1 Antitrypsin Deficiency (Inherited Emphysema)

    MedlinePlus

    ... 1 protein in the blood with normal alpha-1 antitrypsin from healthy plasma donors. It is given in a vein (IV). The dose is adjusted based on body weight. This treatment is often given once a week. There are three ... the management of Alpha-1 related emphysema includes: • Exercise and a healthy lifestyle ...

  9. Psychiatric Symptoms in Alpha-Mannosidosis

    ERIC Educational Resources Information Center

    Malm, D.; Pantel, J.; Linaker, O. M.

    2005-01-01

    Alpha-mannosidosis is characterized by mild to moderate intellectual disability (ID), moderate to severe neurosensory hearing loss, frequent infections, psychomotor disturbances and skeletal dysmorphism. For the first time, a panel of nine alpha-mannosidosis patients with psychiatric symptoms is presented. The clinical picture has several…

  10. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  11. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  12. Remote Associates Test and Alpha Brain Waves

    ERIC Educational Resources Information Center

    Haarmann, Henk J.; George, Timothy; Smaliy, Alexei; Dien, Joseph

    2012-01-01

    Previous studies found that performance on the remote associates test (RAT) improves after a period of incubation and that increased alpha brain waves over the right posterior brain predict the emergence of RAT insight solutions. We report an experiment that tested whether increased alpha brain waves during incubation improve RAT performance.…

  13. Atypical Alpha Asymmetry in Adults with ADHD

    ERIC Educational Resources Information Center

    Hale, T. Sigi; Smalley, Susan L.; Hanada, Grant; Macion, James; McCracken, James T.; McGough, James J.; Loo, Sandra K.

    2009-01-01

    Introduction: A growing body of literature suggests atypical cerebral asymmetry and interhemispheric interaction in ADHD. A common means of assessing lateralized brain function in clinical populations has been to examine the relative proportion of EEG alpha activity (8-12 Hz) in each hemisphere (i.e., alpha asymmetry). Increased rightward alpha…

  14. Commentary on Coefficient Alpha: A Cautionary Tale

    ERIC Educational Resources Information Center

    Green, Samuel B.; Yang, Yanyun

    2009-01-01

    The general use of coefficient alpha to assess reliability should be discouraged on a number of grounds. The assumptions underlying coefficient alpha are unlikely to hold in practice, and violation of these assumptions can result in nontrivial negative or positive bias. Structural equation modeling was discussed as an informative process both to…

  15. Teaching Calculus with Wolfram|Alpha

    ERIC Educational Resources Information Center

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-01-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to…

  16. Coefficient Alpha Bootstrap Confidence Interval under Nonnormality

    ERIC Educational Resources Information Center

    Padilla, Miguel A.; Divers, Jasmin; Newton, Matthew

    2012-01-01

    Three different bootstrap methods for estimating confidence intervals (CIs) for coefficient alpha were investigated. In addition, the bootstrap methods were compared with the most promising coefficient alpha CI estimation methods reported in the literature. The CI methods were assessed through a Monte Carlo simulation utilizing conditions…

  17. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  18. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  19. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  20. Inhibitory spectrum of alpha 2-plasmin inhibitor.

    PubMed

    Saito, H; Goldsmith, G H; Moroi, M; Aoki, N

    1979-04-01

    alpha 2-Plasmin inhibitor (alpha 2PI) has been recently characterized as a fast-reacting inhibitor of plasmin in human plasma and appears to play an important role in the regulation of fibrinolysis in vivo. We have studied the effect of purified alpha 2PI upon various proteases participating in human blood coagulation and kinin generation. At physiological concentration (50 microgram/ml), alpha 2PI inhibited the clot-promoting and prekallikrein-activating activity of Hageman factor fragments, the amidolytic, kininogenase, and clot-promoting activities of plasma kallikrein, and the clot-promoting properties of activated plasma thromboplastin antecedent (PTA, Factor XIa) and thrombin. alpha 2PI had minimal inhibitory effect on surface-bound activated PTA and activated Stuart factor (Factor Xa). alpha 2PI did not inhibit the activity of activated Christmas factor (Factor IXa) or urinary kallikrein. Heparin (1.5-2.0 units/ml) did not enhance the inhibitory function of alpha 2PI. These results suggest that, like other plasma protease inhibitors, alpha 2PI possesses a broad in vitro spectrum of inhibitory properties.

  1. Effect of Alpha-Particle Irradiation on Brain Glycogen in the Rat

    NASA Technical Reports Server (NTRS)

    Wolfe, L. S.; Klatzo, Igor; Miquel, Jaime; Tobias, Cornelius; Haymaker, Webb

    1962-01-01

    The studies of Klatzo, Miquel, Tobias and Haymaker (1961) have shown that one of the earliest and most sensitive indications of the effects of alpha-particle irradiation on rat bran is the appearance of glycogen granules mainly in the neuroglia of the exposed area of the brain. Periodic acid-Schiff (PAS) positive, alpha-amylase soluble granules were demonstrated within 12 hr after irradiation, preceding by approximately 36 hr the first microscopically detectable vascular permeability disturbances, as shown by the fluorescein labeled serum protein technique. These studies suggested that the injurious effects of alpha-particle energy were on cellular elements primarily, according to the physical properties and distribution of the radiation in the tissue, and that the vascular permeability disturbances played a secondary role in pathogenesis. The purpose of this study was to correlate the histochemical observations on glycogen with a quantitative assessment of the glycogen in the irradiated brain tissue. It is felt that such a study may contribute to the understanding of radiation injury at the molecular level. A practical aspect of this problem is that the information on biological radiation effects due to accelerated particles from the cyclotron source, is employed in this study, is applicable to radiation from cosmic particles both in free space and entrapped in the Van Allen belts.

  2. Suppression of hepatic prostaglandin F2 alpha in rats by dietary alpha-tocopherol acetate is independent of total hepatic alpha-tocopherol.

    PubMed

    Duitsman, P K; Chen, H W; Cook, L R; Hendrich, S

    1992-09-01

    Groups of eight weanling female F344/N rats were fed semipurified diets that supplied 0, 50, 500, 5000, or 15,000 mg alpha-tocopherol acetate/kg diet, with and without 0.05% phenobarbital (PB) for 9 weeks. Both plasma and hepatic alpha-tocopherol levels, measured by HPLC, strongly correlated with alpha-tocopherol intake (r greater than 0.73, p less than 0.0001). Phenobarbital both depleted hepatic alpha-tocopherol and increased plasma alpha-tocopherol significantly. Although treatment with PB for 9 weeks significantly increased GST activity, PB did not affect hepatic prostaglandin (PG)F2 alpha status, as determined by radioimmunoassay. PGF2 alpha was significantly greater (by 52%) in rats fed no alpha-tocopherol than in rats fed 15,000 mg alpha-tocopherol acetate/kg diet. Hepatic PGF2 alpha status was correlated inversely but weakly with dietary alpha-tocopherol (r = -0.24, p less than 0.05). Hepatic PGF2 alpha status was not correlated with hepatic or plasma alpha-tocopherol status. This finding suggests either that there is a small depletion-resistant subcellular alpha-tocopherol pool which regulates PGF2 alpha production or that alpha-tocopherol alters PGF2 alpha production in vivo by an indirect mechanism.

  3. Local Structure and Vibrational Properties of alpha-Pu, alpha-U, and the alpha-U Charge Density Wave

    SciTech Connect

    Nelson, E J; Allen, P G; Blobaum, K M; Wall, M A; Booth, C H

    2004-08-10

    The local atomic environment and vibrational properties of atoms in monoclinic pure {alpha}-plutonium as well as orthorhombic pure {alpha}-uranium and its low-temperature charge-density-wave (CDW) modulation are examined by extended x-ray absorption fine structure spectroscopy (EXAFS). Pu L{sub III}-edge and U L{sub III}-edge EXAFS data measured at low temperatures verify the crystal structures of {alpha}-U and {alpha}-Pu samples previously determined by x-ray diffraction and neutron scattering. Debye-Waller factors from temperature-dependent EXAFS measurements are fit with a correlated Debye model. The observed Pu-Pu bond correlated Debye temperature of {theta}{sub cD}({alpha}-Pu) = 162 {+-} 5 K for the pure {alpha}-Pu phase agrees with our previous measurement of the correlated Debye temperature of the gallium-containing {alpha}'-Pu phase in a mixed phase 1.9 at% Ga-doped {alpha}'-Pu/{delta}-Pu alloy. The temperature dependence of the U-U nearest neighbor Debye-Waller factor exhibits a sharp discontinuity in slope near T{sub CDW} = 43 K, the transition temperature at which the charge-density wave (CDW) in {alpha}-U condenses from a soft phonon mode along the (100) direction. Our measurement of the CDW using EXAFS is the first observation of the structure of the CDW in polycrystalline {alpha}-U. The different temperature dependence of the Debye-Waller factor for T < T{sub CDW} can be modeled by the change in bond length distributions resulting from condensation of the charge density wave. For T > T{sub CDW}, the observed correlated Debye temperature of {theta}{sub cD}({alpha}-U) = 199 {+-} 3 K is in good agreement with other measurements of the Debye temperature for polycrystalline {alpha}-U. CDW structural models fit to the {alpha}-U EXAFS data support a squared CDW at the lowest temperatures, with a displacement amplitude of {var_epsilon} = 0.05 {+-} 0.02 {angstrom}.

  4. Improved peak shape fitting in alpha spectra.

    PubMed

    Pommé, S; Caro Marroyo, B

    2015-02-01

    Peak overlap is a recurrent issue in alpha-particle spectrometry, not only in routine analyses but also in the high-resolution spectra from which reference values for alpha emission probabilities are derived. In this work, improved peak shape formulae are presented for the deconvolution of alpha-particle spectra. They have been implemented as fit functions in a spreadsheet application and optimum fit parameters were searched with built-in optimisation routines. Deconvolution results are shown for a few challenging spectra with high statistical precision. The algorithm outperforms the best available routines for high-resolution spectrometry, which may facilitate a more reliable determination of alpha emission probabilities in the future. It is also applicable to alpha spectra with inferior energy resolution. PMID:25497323

  5. Homomers of alpha 8 and alpha 7 subunits of nicotinic receptors exhibit similar channel but contrasting binding site properties.

    PubMed

    Gerzanich, V; Anand, R; Lindstrom, J

    1994-02-01

    alpha 8 subunits of alpha-bungarotoxin-sensitive chick neuronal nicotinic acetylcholine receptors expressed in Xenopus oocytes from cRNA are shown to form homomeric, acetylcholine-gated, rapidly desensitizing, inwardly rectifying, Ca(2+)-permeable cation channels similar to those of alpha 7 homomers. alpha 8 forms oligomers of several sizes, of which < 14% are expressed on the oocyte surface, which is less efficient than for alpha 7 homomers. alpha 8 homomers are more sensitive to agonists but less sensitive to antagonists than are alpha 7 homomers, and some agonists for alpha 8 homomers are partial agonists or antagonists for alpha 7 homomers. The pharmacological properties of homomers of alpha 8 and alpha 7 subunits generally reflect those of native alpha 8 and alpha 7 receptors.

  6. Catalytic Mechanism of Human Alpha-galactosidase

    SciTech Connect

    Guce, A.; Clark, N; Salgado, E; Ivanen, D; Kulinskaya, A; Brumer, H; Garman, S

    2010-01-01

    The enzyme {alpha}-galactosidase ({alpha}-GAL, also known as {alpha}-GAL A; E.C. 3.2.1.22) is responsible for the breakdown of {alpha}-galactosides in the lysosome. Defects in human {alpha}-GAL lead to the development of Fabry disease, a lysosomal storage disorder characterized by the buildup of {alpha}-galactosylated substrates in the tissues. {alpha}-GAL is an active target of clinical research: there are currently two treatment options for Fabry disease, recombinant enzyme replacement therapy (approved in the United States in 2003) and pharmacological chaperone therapy (currently in clinical trials). Previously, we have reported the structure of human {alpha}-GAL, which revealed the overall structure of the enzyme and established the locations of hundreds of mutations that lead to the development of Fabry disease. Here, we describe the catalytic mechanism of the enzyme derived from x-ray crystal structures of each of the four stages of the double displacement reaction mechanism. Use of a difluoro-{alpha}-galactopyranoside allowed trapping of a covalent intermediate. The ensemble of structures reveals distortion of the ligand into a {sup 1}S{sub 3} skew (or twist) boat conformation in the middle of the reaction cycle. The high resolution structures of each step in the catalytic cycle will allow for improved drug design efforts on {alpha}-GAL and other glycoside hydrolase family 27 enzymes by developing ligands that specifically target different states of the catalytic cycle. Additionally, the structures revealed a second ligand-binding site suitable for targeting by novel pharmacological chaperones.

  7. Sumoylation and the function of CCAAT enhancer binding protein alpha (C/EBP alpha).

    PubMed

    Khanna-Gupta, Arati

    2008-01-01

    CCAAT enhancer binding protein alpha (C/EBP alpha) is the founding member of a family of basic region/leucine zipper (bZIP) transcription factors and is a master regulator of granulopoiesis. It is expressed at high levels throughout myeloid differentiation and binds to the promoters of multiple myeloid-specific genes at different stages of myeloid maturation. Profound hematopoietic abnormalities occur in mice nullizygous for C/EBP alpha including a selective early block in the differentiation of granulocytes. Mutations in C/EBP alpha are present in a subset of patients with AML presenting with a normal karyotype. These mutations can result in the expression of a 30 kDa dominant negative C/EBP alpha isoform, which contributes to loss of C/EBP alpha function. The molecular basis for this observation remains unknown. In addition to phosphorylation, C/EBP alpha is modified, post-translationally by a small ubiquitin-related modifier (SUMO) at a lysine residue (K159), which lies within the growth inhibitory region of the C/EBP alpha protein. Sumoylation at K159 in the C/EBP alpha protein prevents association of the SWI/SNF chromatin remodeling complex with C/EBP alpha, thereby hampering transactivation. In this review, the functional implications of post-translational modification, particularly sumoylation, of C/EBP alpha in normal granulopoiesis and leukemia are considered. PMID:18406180

  8. Folate receptor {alpha} regulates cell proliferation in mouse gonadotroph {alpha}T3-1 cells

    SciTech Connect

    Yao, Congjun; Evans, Chheng-Orn; Stevens, Victoria L.; Owens, Timothy R.; Oyesiku, Nelson M.

    2009-11-01

    We have previously found that the mRNA and protein levels of the folate receptor alpha (FR{alpha}) are uniquely over-expressed in clinically human nonfunctional (NF) pituitary adenomas, but the mechanistic role of FR{alpha} has not fully been determined. We investigated the effect of FR{alpha} over-expression in the mouse gonadotroph {alpha}T3-1 cell line as a model for NF pituitary adenomas. We found that the expression and function of FR{alpha} were strongly up-regulated, by Western blotting and folic acid binding assay. Furthermore, we found a higher cell growth rate, an enhanced percentage of cells in S-phase by BrdU assay, and a higher PCNA staining. These observations indicate that over-expression of FR{alpha} promotes cell proliferation. These effects were abrogated in the same {alpha}T3-1 cells when transfected with a mutant FR{alpha} cDNA that confers a dominant-negative phenotype by inhibiting folic acid binding. Finally, by real-time quantitative PCR, we found that mRNA expression of NOTCH3 was up-regulated in FR{alpha} over-expressing cells. In summary, our data suggests that FR{alpha} regulates pituitary tumor cell proliferation and mechanistically may involve the NOTCH pathway. Potentially, this finding could be exploited to develop new, innovative molecular targeted treatment for human NF pituitary adenomas.

  9. Alpha1 and Alpha2 Integrins Mediate Invasive Activity of Mouse Mammary Carcinoma Cells through Regulation of Stromelysin-1 Expression

    SciTech Connect

    Lochter, Andre; Navre, Marc; Werb, Zena; Bissell, Mina J

    1998-06-29

    Tumor cell invasion relies on cell migration and extracellular matrix proteolysis. We investigated the contribution of different integrins to the invasive activity of mouse mammary carcinoma cells. Antibodies against integrin subunits {alpha}6 and {beta}1, but not against {alpha}1 and {alpha}2, inhibited cell locomotion on a reconstituted basement membrane in two-dimensional cell migration assays, whereas antibodies against {beta}1, but not against a6 or {alpha}2, interfered with cell adhesion to basement membrane constituents. Blocking antibodies against {alpha}1 integrins impaired only cell adhesion to type IV collagen. Antibodies against {alpha}1, {alpha}2, {alpha}6, and {beta}1, but not {alpha}5, integrin subunits reduced invasion of a reconstituted basement membrane. Integrins {alpha}1 and {alpha}2, which contributed only marginally to motility and adhesion, regulated proteinase production. Antibodies against {alpha}1 and {alpha}2, but not {alpha}6 and {beta}1, integrin subunits inhibited both transcription and protein expression of the matrix metalloproteinase stromelysin-1. Inhibition of tumor cell invasion by antibodies against {alpha}1 and {alpha}2 was reversed by addition of recombinant stromelysin-1. In contrast, stromelysin-1 could not rescue invasion inhibited by anti-{alpha}6 antibodies. Our data indicate that {alpha}1 and {alpha}2 integrins confer invasive behavior by regulating stromelysin-1 expression, whereas {alpha}6 integrins regulate cell motility. These results provide new insights into the specific functions of integrins during tumor cell invasion.

  10. G alpha 12 and G alpha 13 subunits define a fourth class of G protein alpha subunits.

    PubMed Central

    Strathmann, M P; Simon, M I

    1991-01-01

    Heterotrimeric guanine nucleotide-binding regulatory proteins (G proteins) are central to the signaling processes of multicellular organisms. We have explored the diversity of the G protein subunits in mammals and found evidence for a large family of genes that encode the alpha subunits. Amino acid sequence comparisons show that the different alpha subunits fall into at least three classes. These classes have been conserved in animals separated by considerable evolutionary distances; they are present in mammals, Drosophila, and nematodes. We have now obtained cDNA clones encoding two murine alpha subunits, G alpha 12 and G alpha 13, that define a fourth class. The translation products are predicted to have molecular masses of 44 kDa and to be insensitive to ADP-ribosylation by pertussis toxin. They share 67% amino acid sequence identity with each other and less than 45% identity with other alpha subunits. Their transcripts can be detected in every tissue examined, although the relative levels of the G alpha 13 message appear somewhat variable. Images PMID:1905812

  11. Sensitivity to alpha-amylcinnamic aldehyde and alpha-amylcinnamic alcohol.

    PubMed

    Guin, J D; Haffley, P

    1983-01-01

    Sensitivity to alpha-amylcinnamic aldehyde (alpha-AcAld) is apparently uncommon, but, like allergy to alpha-amylcinnamic alcohol (alpha-AcAlc), it often accompanies allergy to the perfume in Mycolog cream. Although alpha-AcAlc is a known ingredient, alpha-AcAld is not. However, gas-liquid chromatographic analysis shows alpha-AcAld to be present. Of fourteen persons sensitive to either chemical, ten reacted to both. Of these, one man and three women were markedly sensitive, and all three women had chronic recalcitrant vulvar eczema. That condition might have been the cause as well as the result of sensitization, but reexposure to a suspected product reproduced the eruption in both persons tested. Its use with other potent sensitizers, e.g., ethylenediamine, to treat irritations and chronic eczemas in an area of high absorption may partly explain development of allergy to a relatively weak sensitizer.

  12. Effect of UVB on hydrolysis of alpha-tocopherol acetate to alpha-tocopherol in mouse skin.

    PubMed

    Kramer-Stickland, K; Liebler, D C

    1998-08-01

    We have assessed the hydrolysis of alpha-tocopherol acetate (alpha-TAc) to the active antioxidant alpha-tocopherol (alpha-TH) in mouse epidermis and in supernatant from epidermal homogenates. Topically administered alpha-TH prevents UVB photocarcinogenesis in C3H mice, whereas alpha-TAc does not. Hydrolysis in skin was monitored in mice treated topically with deuterium labeled alpha-TAc (d3-alpha-TAc). Epidermal samples were isolated from mice and analyzed for endogenous (d0-alpha-TAc) and d3-alpha-TH by gas chromatography-mass spectrometry. Within 24 h, the levels of d3-alpha-TH increased up to 10-fold over endogenous d0-alpha-TH levels; however, in mice irradiated with UVB prior to the application of d3-alpha-TAc, levels of d3-alpha-TH increased up to 30-40-fold over endogenous d0-alpha-TH. This enhancement of alpha-TAc hydrolysis increased with increasing UVB dose. Prior UVB exposure may increase hydrolysis of alpha-TAc by increasing epidermal esterase activity. Nonspecific esterase activity was measured in the 2000 x g supernatant from epidermis of unirradiated and irradiated mice. Alpha-napthyl acetate, a nonspecific esterase substrate, was converted to alpha-napthol in supernatants from unirradiated mice. Hydrolysis to alpha-napthol increased approximately 3-fold in supernatants from irradiated mice. Hydrolysis of alpha-TAc to alpha-TH also occurred in supernatant from unirradiated mice, and this hydrolysis increased approximately 3-fold in supernatant from irradiated animals. These data indicate that nonspecific esterase activity was increased by UVB in the skin, that alpha-TAc is converted to alpha-TH in the homogenate fraction containing nonspecific esterase, and that UVB exposure modulates the metabolism of alpha-TAc to alpha-TH in vivo.

  13. Radiation dosimeter

    DOEpatents

    Fox, Richard J.

    1983-01-01

    A radiation detector readout circuit is provided which produces a radiation dose-rate readout from a detector even though the detector output may be highly energy dependent. A linear charge amplifier including an output charge pump circuit amplifies the charge signal pulses from the detector and pumps the charge into a charge storage capacitor. The discharge rate of the capacitor through a resistor is controlled to provide a time-dependent voltage which when integrated provides an output proportional to the dose-rate of radiation detected by the detector. This output may be converted to digital form for readout on a digital display.

  14. Radiation dosimeter

    DOEpatents

    Fox, R.J.

    1981-09-01

    A radiation detector readout circuit is provided which produces a radiation dose-rate readout from a detector even through the detector output may be highly energy dependent. A linear charge amplifier including an output charge pump circuit amplifies the charge signal pulses from the detector and pumps the charge into a charge storage capacitor. The discharge rate of the capacitor through a resistor is controlled to provide a time-dependent voltage which when integrated provides an output proportional to the dose-rate of radiation detected by the detector. This output may be converted to digital form for readout on a digital display.

  15. Radiation Hydrodynamics

    SciTech Connect

    Castor, J I

    2003-10-16

    The discipline of radiation hydrodynamics is the branch of hydrodynamics in which the moving fluid absorbs and emits electromagnetic radiation, and in so doing modifies its dynamical behavior. That is, the net gain or loss of energy by parcels of the fluid material through absorption or emission of radiation are sufficient to change the pressure of the material, and therefore change its motion; alternatively, the net momentum exchange between radiation and matter may alter the motion of the matter directly. Ignoring the radiation contributions to energy and momentum will give a wrong prediction of the hydrodynamic motion when the correct description is radiation hydrodynamics. Of course, there are circumstances when a large quantity of radiation is present, yet can be ignored without causing the model to be in error. This happens when radiation from an exterior source streams through the problem, but the latter is so transparent that the energy and momentum coupling is negligible. Everything we say about radiation hydrodynamics applies equally well to neutrinos and photons (apart from the Einstein relations, specific to bosons), but in almost every area of astrophysics neutrino hydrodynamics is ignored, simply because the systems are exceedingly transparent to neutrinos, even though the energy flux in neutrinos may be substantial. Another place where we can do ''radiation hydrodynamics'' without using any sophisticated theory is deep within stars or other bodies, where the material is so opaque to the radiation that the mean free path of photons is entirely negligible compared with the size of the system, the distance over which any fluid quantity varies, and so on. In this case we can suppose that the radiation is in equilibrium with the matter locally, and its energy, pressure and momentum can be lumped in with those of the rest of the fluid. That is, it is no more necessary to distinguish photons from atoms, nuclei and electrons, than it is to distinguish

  16. Radiation-induced myelomatosis.

    PubMed

    Cuzick, J

    1981-01-22

    It is well known that radiation can cause myeloid leukemia. However, no excess of chronic lymphocytic leukemia has been observed. Myelomatosis, like chronic lymphocytic leukemia, is a tumor of B lymphocytes. To determine whether this disease has a radiogenic origin, we surveyed all cohorts of persons exposed to radiation for which data on cancer-related mortality are available. An excess of myeloma was found in most cohorts. However, a striking deficit was found in two groups irradiated intensely for uterine neoplasms (three cases observed, 10.71 expected; P = 0.012). All other groups combined had a highly significant excess (50 observed, 22.21 expected; P = 2 X 10(-7)). The largest relative risk appeared among persons receiving internal doses of alpha-particles (14 observed, 3.24 expected; P = 2 X 10(-5)), but a significant excess (13 observed, 6.33 expected; P = 0.026) was also found in patients receiving only therapeutic or diagnostic gamma-rays or x-rays. Most cases occurred 15 to 25 years after exposure. PMID:7442744

  17. Mapping High-Velocity H-alpha and Lyman-alpha Emission from Supernova 1987A

    NASA Technical Reports Server (NTRS)

    France, Kevin; McCray, Richard; Fransson, Claes; Larsson, Josefin; Frank, Kari A.; Burrows, David N.; Challis, Peter; Kirshner, Robert P.; Chevalier, Roger A.; Garnavich, Peter; Heng, Kevin; Lawrence, Stephen S.; Lundqvist, Peter; Smith, Nathan; Sonneborn, George

    2015-01-01

    We present new Hubble Space Telescope images of high-velocity H-alpha and Lyman-alpha emission in the outer debris of SN 1987A. The H-alpha images are dominated by emission from hydrogen atoms crossing the reverse shock. For the first time we observe emission from the reverse shock surface well above and below the equatorial ring, suggesting a bipolar or conical structure perpendicular to the ring plane. Using the H-alpha imaging, we measure the mass flux of hydrogen atoms crossing the reverse shock front, in the velocity intervals (-7,500 < V(sub obs) < -2,800 km/s) and (1,000 < V(sub obs) < 7,500 km/s), ?M(sub H) = 1.2 × 10(exp -3) M/ y. We also present the first Lyman-alpha imaging of the whole remnant and new Chandra X-ray observations. Comparing the spatial distribution of the Lyman-alpha and X-ray emission, we observe that the majority of the high-velocity Lyman-alpha emission originates interior to the equatorial ring. The observed Lyman-alpha/H-alpha photon ratio, R(L-alpha/H-alpha) approx. = 17, is significantly higher than the theoretically predicted ratio of approx. = 5 for neutral atoms crossing the reverse shock front. We attribute this excess to Lyman-alpha emission produced by X-ray heating of the outer debris. The spatial orientation of the Lyman-alpha and X-ray emission suggests that X-ray heating of the outer debris is the dominant Lyman-alpha production mechanism in SN 1987A at this phase in its evolution.

  18. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].

    PubMed

    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo

    2004-10-01

    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples.

  19. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].

    PubMed

    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo

    2004-10-01

    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples. PMID:15678944

  20. Rejection of Alpha Surface Background in Non-scintillating Bolometric Detectors: The ABSuRD Project

    NASA Astrophysics Data System (ADS)

    Biassoni, M.; Brofferio, C.; Bucci, C.; Canonica, L.; di Vacri, M. L.; Gorla, P.; Pavan, M.; Yeh, M.

    2016-08-01

    Due to their excellent energy resolution values and the vast choice of possible materials, bolometric detectors are currently widely used in the physics of rare events. A limiting aspect for bolometers rises from their inability to discriminate among radiation types or surface from bulk events. It has been demonstrated that the main limitation to sensitivity for purely bolometric detectors is represented by surface alpha contaminations, causing a continuous background that cannot be discriminated. A new scintillation-based technique for the rejection of surface alpha background in non-scintillating bolometric experiments is proposed in this work. The idea is to combine a scintillating and a high sensitivity photon detector with a non-scintillating absorber. We present results showing the possibility to reject events due to alpha decay at or nearby the surface of the crystal.

  1. Cosmological behavior of a parity and charge-parity violating varying alpha theory

    SciTech Connect

    Maity, Debaprasad; Chen, Pisin

    2011-04-15

    In this paper we construct a phenomenological model in which the time variation of the fine-structure constant, {alpha}, is induced by a parity and charge-parity (PCP) violating interaction. Such a PCP violation in the photon sector has a distinct physical origin from that in the conventional models of this kind. We calculate the cosmological birefringence so induced in our model and show that it in turn produces a new nonvanishing multipole moment correlation between the temperature and the polarization anisotropies in the CMB spectrum. We have also calculated the amount of optical rotation due to a strong background magnetic field and the effect of our new PCP violating term on the variation of {alpha} during the cosmic evolution. We found that only in the radiation dominated era can the contribution of the new PCP violating term to the variation of {alpha} be nonvanishing.

  2. A new alpha chain hemoglobin variant: Hb Al-Hammadi Riyadh [alpha75(EF4)Asp-->Val (alpha2)].

    PubMed

    Burnichon, Nelly; Lacan, Philippe; Becchi, Michel; Zanella-Cleon, Isabelle; Aubry, Martine; Mowafy, Mohammed; Couprie, Nicole; Francina, Alain

    2006-01-01

    A new hemoglobin (Hb) variant in the heterozygous state, Hb Al-Hammadi Riyadh [codon 75 (GAC-->GTC); alpha75(EF4)Asp-->Val (alpha2)] corresponding to an A-->T transversion on the second exon of the alpha2-globin gene, is described. The variant was characterized by DNA sequencing and mass spectrometry (MS). The variant was found during a routine Hb analysis for anemia in a 16-month-old boy who lived in Riyadh, Kingdom of Saudi Arabia.

  3. Genetics Home Reference: mucolipidosis III alpha/beta

    MedlinePlus

    ... Health Conditions mucolipidosis III alpha/beta mucolipidosis III alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis III alpha/beta is a slowly progressive disorder that affects ...

  4. Genetics Home Reference: mucolipidosis II alpha/beta

    MedlinePlus

    ... Health Conditions mucolipidosis II alpha/beta mucolipidosis II alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis II alpha/beta (also known as I-cell disease) is ...

  5. 24xi-Methyl 5 alpha-cholestane-3 alpha,6 beta,9 alpha,25-tetrol 24-monoacetate, a novel polyhydroxylated steroid from the soft coral Sarcophyton tortuosum.

    PubMed

    Su, J Y; Peng, T S; Long, K H; Zeng, L M

    1986-01-01

    A novel polyhydroxylated steroid, named sartortuosterol A, with rare 3 alpha- and 6-hydroxyl groups, was isolated from the South China Sea soft coral Sarcophyton tortuosum Tixier-Durivault, and its structure was established as 24xi-methyl 5 alpha-cholestane-3 alpha, 6 beta, 9 alpha,25-tetrol 25-monoacetate from spectroscopic data and chemical conversions.

  6. Healthful radiation.

    PubMed

    Agard, E T

    1997-01-01

    This title of this article sounds paradoxical to most people because the general public is not fully aware of the many benefits radiation has brought to people's healthcare. Radiation has provided the most effective means of noninvasive diagnosis of many diseases, thus reducing the need for exploratory surgery, at significantly reduced risks. Furthermore, radiotherapy has been effective in treating many diseases without surgical removal of the diseased part. The breast is one excellent example of the benefits of radiation in both diagnosis and treatment with preservation. Yet the public still regards radiation as mysterious and dangerous, while trained experts regard it as beneficial with manageable risks. This article suggests ways of presenting this material to the public in a manner that is interesting and informative. PMID:8972833

  7. Radiation sickness

    MedlinePlus

    ... process so that they do not cause radiation injury to others. This may complicate the first aid and resuscitation process. Check the person's breathing and pulse. Start CPR , if necessary. Remove the person's clothing and place ...

  8. Healthful radiation

    SciTech Connect

    Agard, E.T.

    1997-01-01

    This title of this article sounds paradoxical to most people because the general public is not fully aware of the many benefits radiation has brought to people`s healthcare. Radiation has provided the most effective means of noninvasive diagnosis of many diseases, thus reducing the need for exploratory surgery, at significantly reduced risks. Furthermore, radiotherapy has been effective in treating many diseases without surgical removal of the diseased part. The breast is one excellent example of the benefits of radiation in both diagnosis and treatment with preservation. Yet the public still regards radiation as mysterious and dangerous, while trained experts regard it as beneficial with manageable risks. This article suggests ways of presenting this material to the public in a manner that is interesting and informative. 11 refs.

  9. Radiation Therapy

    MedlinePlus

    ... Radiation (also called x-rays, gamma rays, or photons) either kills tumor cells directly or interferes with ... treatment per day, five days a week, for two to seven weeks. Potiential Side Effects Most people ...

  10. Development of a silicon carbide radiation detector

    SciTech Connect

    Ruddy, F.H.; Dulloo, A.R.; Seidel, J.G.; Seshadri, S.; Rowland, L.B.

    1998-06-01

    The radiation detection properties of semiconductor detectors made of 4H silicon carbide were evaluated. Both Schottky and p-n junction devices were tested. Exposure to alpha particles from a {sup 238}Pu source led to robust signals from the detectors. The resolution of the Schottky SiC detector was 5.8% (FWHM) at an energy of 294 keV, while that of the p-n junction was 6.6% (FWHM) at 260 keV. No effect of temperature in the range of 22 to 89 C was observed on the characteristics of the {sup 238}Pu alpha-induced signal from the SiC detector. In addition, testing in a gamma field of 10,000 rad-Si h{sup {minus}1} showed that the alpha-induced signal was separable from the gamma signal.

  11. Alpha particles induce pan-nuclear phosphorylation of H2AX in primary human lymphocytes mediated through ATM.

    PubMed

    Horn, Simon; Brady, Darren; Prise, Kevin

    2015-10-01

    The use of high linear energy transfer radiations in the form of carbon ions in heavy ion beam lines or alpha particles in new radionuclide treatments has increased substantially over the past decade and will continue to do so due to the favourable dose distributions they can offer versus conventional therapies. Previously it has been shown that exposure to heavy ions induces pan-nuclear phosphorylation of several DNA repair proteins such as H2AX and ATM in vitro. Here we describe similar effects of alpha particles on ex vivo irradiated primary human peripheral blood lymphocytes. Following alpha particle irradiation pan-nuclear phosphorylation of H2AX and ATM, but not DNA-PK and 53BP1, was observed throughout the nucleus. Inhibition of ATM, but not DNA-PK, resulted in the loss of pan-nuclear phosphorylation of H2AX in alpha particle irradiated lymphocytes. Pan-nuclear gamma-H2AX signal was rapidly lost over 24h at a much greater rate than foci loss. Surprisingly, pan-nuclear gamma-H2AX intensity was not dependent on the number of alpha particle induced double strand breaks, rather the number of alpha particles which had traversed the cell nucleus. This distinct fluence dependent damage signature of particle radiation is important in both the fields of radioprotection and clinical oncology in determining radionuclide biological dosimetry and may be indicative of patient response to new radionuclide cancer therapies.

  12. Radiation Transport

    SciTech Connect

    Urbatsch, Todd James

    2015-06-15

    We present an overview of radiation transport, covering terminology, blackbody raditation, opacities, Boltzmann transport theory, approximations to the transport equation. Next we introduce several transport methods. We present a section on Caseology, observing transport boundary layers. We briefly broach topics of software development, including verification and validation, and we close with a section on high energy-density experiments that highlight and support radiation transport.

  13. Radiation Sensor

    NASA Technical Reports Server (NTRS)

    1986-01-01

    Claypack is a cost-effective portable system developed by Barringer Research Ltd. for rapid on-site analysis of clay minerals. It is an adaptation of a hand-held rationing radiometer. By measuring the intensity of reflected radiation, the device discriminates among different minerals present in a sample. It simultaneously analyzes radiation intensities in two separate bands of the spectrum, and calculates the ratio of one to the other. The "reflectance ratio" is computer processed and displayed in digital form.

  14. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed. PMID:7162915

  15. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed.

  16. Radiation enteritis.

    PubMed

    Harb, Ali H; Abou Fadel, Carla; Sharara, Ala I

    2014-01-01

    Radiation enteritis continues to be a major health concern in recipients of radiation therapy. The incidence of radiation enteritis is expected to continue to rise during the coming years paralleling the unprecedented use of radiotherapy in pelvic cancers. Radiation enteritis can present as either an acute or chronic syndrome. The acute form presents within hours to days of radiation exposure and typically resolves within few weeks. The chronic form may present as early as 2 months or as long as 30 years after exposure. Risk factors can be divided into patient and treatment-related factors. Chronic radiation enteritis is characterized by progressive obliterative endarteritis with exaggerated submucosal fibrosis and can manifest by stricturing, formation of fistulae, local abscesses, perforation, and bleeding. In the right clinical context, diagnosis can be confirmed by cross-sectional imaging, flexible or video capsule endoscopy. Present treatment strategies are directed primarily towards symptom relief and management of emerging complications. Recently, however, there has been a shift towards rational drug design based on improved understanding of the molecular basis of disease in an effort to limit the fibrotic process and prevent organ damage.

  17. Applying alpha-channeling to mirror machines

    SciTech Connect

    Zhmoginov, A. I.; Fisch, N. J.

    2012-05-15

    The {alpha}-channeling effect entails the use of radio-frequency waves to expel and cool high-energetic {alpha} particles born in a fusion reactor; the device reactivity can then be increased even further by redirecting the extracted energy to fuel ions. Originally proposed for tokamaks, this technique has also been shown to benefit open-ended fusion devices. Here, the fundamental theory and practical aspects of {alpha} channeling in mirror machines are reviewed, including the influence of magnetic field inhomogeneity and the effect of a finite wave region on the {alpha}-channeling mechanism. For practical implementation of the {alpha}-channeling effect in mirror geometry, suitable contained weakly damped modes are identified. In addition, the parameter space of candidate waves for implementing the {alpha}-channeling effect can be significantly extended through the introduction of a suitable minority ion species that has the catalytic effect of moderating the transfer of power from the {alpha}-channeling wave to the fuel ions.

  18. A search for antihelium in primary cosmic radiation.

    NASA Technical Reports Server (NTRS)

    Evenson, P.

    1972-01-01

    A search for anti-alpha-particles in the primary cosmic radiation has been carried out, and a new upper limit for these particles in the range 0.2-4.3 GeV per nucleon has been obtained. At the 95 per cent confidence level the upper limit is found to be 0.14 per cent of the alpha-particle flux. The instrument used for this purpose is a magnetic spectrometer employing spark chambers for determining particle trajectories and time-of-flight measurement for the rejection of upward-moving particles. Implications of these results for various models of the sources of cosmic radiation are discussed.

  19. Aiming Optimum Space Radiation Protection using Regolith.

    NASA Astrophysics Data System (ADS)

    Masuda, Daisuke; Nagamatsu, Aiko; Indo, Hiroko; Iwashita, Yoichiro; Suzuki, Hiromi; Shimazu, Toru; Yano, Sachiko; Tanigaki, Fumiaki; Ishioka, Noriaki; Mukai, Chiaki; Majima, Hideyuki J.

    Radiation protection of space radiation is very important factor in manned space activity on the moon. At the construction of lunar base, low cost radiation shielding would be achieved using regolith that exists on the surface of the moon. We studied radiation shielding ability of regolith as answer the question, how much of depth would be necessary to achieve minimum radiation protection. We estimated the shielding ability of regolith against each atomic number of space radiation particles. Using stopping power data of ICRU REPORT49 and 73, we simulated the approximate expression (function of the energy of the atomic nucleus as x and the atomic number as Z) of the stopping power for the space proton particle (nucleus of H) against silicon dioxide (SiO2), aluminum oxide (Al2O3), and iron (Fe), which are the main components of regolith. Based on the expression, we applied the manipulation to the other particles of space radiation to up to argon particle (Ar). These simulated expressions complied well the data of ICRU REPORT49 and 73 except alpha particle (nucleus of He). The simulation values of stop-ping power of ten elements from potassium to nickel those we had no data in ICRU REPORT were further simulated. Using the obtained expressions, the relationship between the radiation absorbed dose and depth of a silicon dioxide was obtained. The space radiation relative dose with every depth in the moon could be estimated by this study.

  20. Enhanced production of low energy electrons by alpha particle impact.

    PubMed

    Kim, Hong-Keun; Titze, Jasmin; Schöffler, Markus; Trinter, Florian; Waitz, Markus; Voigtsberger, Jörg; Sann, Hendrik; Meckel, Moritz; Stuck, Christian; Lenz, Ute; Odenweller, Matthias; Neumann, Nadine; Schössler, Sven; Ullmann-Pfleger, Klaus; Ulrich, Birte; Fraga, Rui Costa; Petridis, Nikos; Metz, Daniel; Jung, Annika; Grisenti, Robert; Czasch, Achim; Jagutzki, Ottmar; Schmidt, Lothar; Jahnke, Till; Schmidt-Böcking, Horst; Dörner, Reinhard

    2011-07-19

    Radiation damage to living tissue stems not only from primary ionizing particles but to a substantial fraction from the dissociative attachment of secondary electrons with energies below the ionization threshold. We show that the emission yield of those low energy electrons increases dramatically in ion-atom collisions depending on whether or not the target atoms are isolated or embedded in an environment. Only when the atom that has been ionized and excited by the primary particle impact is in immediate proximity of another atom is a fragmentation route known as interatomic Coulombic decay (ICD) enabled. This leads to the emission of a low energy electron. Over the past decade ICD was explored in several experiments following photoionization. Most recent results show its observation even in water clusters. Here we show the quantitative role of ICD for the production of low energy electrons by ion impact, thus approaching a scenario closer to that of radiation damage by alpha particles: We choose ion energies on the maximum of the Bragg peak where energy is most efficiently deposited in tissue. We compare the electron production after colliding He(+) ions on isolated Ne atoms and on Ne dimers (Ne(2)). In the latter case the Ne atom impacted is surrounded by a most simple environment already opening ICD as a deexcitation channel. As a consequence, we find a dramatically enhanced low energy electron yield. The results suggest that ICD may have a significant influence on cell survival after exposure to ionizing radiation.

  1. Alpha particle induced DNA damage and repair in normal cultured thyrocytes of different proliferation status.

    PubMed

    Lyckesvärd, Madeleine Nordén; Delle, Ulla; Kahu, Helena; Lindegren, Sture; Jensen, Holger; Bäck, Tom; Swanpalmer, John; Elmroth, Kecke

    2014-07-01

    Childhood exposure to ionizing radiation increases the risk of developing thyroid cancer later in life and this is suggested to be due to higher proliferation of the young thyroid. The interest of using high-LET alpha particles from Astatine-211 ((211)At), concentrated in the thyroid by the same mechanism as (131)I [1], in cancer treatment has increased during recent years because of its high efficiency in inducing biological damage and beneficial dose distribution when compared to low-LET radiation. Most knowledge of the DNA damage response in thyroid is from studies using low-LET irradiation and much less is known of high-LET irradiation. In this paper we investigated the DNA damage response and biological consequences to photons from Cobolt-60 ((60)Co) and alpha particles from (211)At in normal primary thyrocytes of different cell cycle status. For both radiation qualities the intensity levels of γH2AX decreased during the first 24h in both cycling and stationary cultures and complete repair was seen in all cultures but cycling cells exposed to (211)At. Compared to stationary cells alpha particles were more harmful for cycling cultures, an effect also seen at the pChk2 levels. Increasing ratios of micronuclei per cell nuclei were seen up to 1Gy (211)At. We found that primary thyrocytes were much more sensitive to alpha particle exposure compared with low-LET photons. Calculations of the relative biological effectiveness yielded higher RBE for cycling cells compared with stationary cultures at a modest level of damage, clearly demonstrating that cell cycle status influences the relative effectiveness of alpha particles. PMID:24769180

  2. Alpha particle induced DNA damage and repair in normal cultured thyrocytes of different proliferation status.

    PubMed

    Lyckesvärd, Madeleine Nordén; Delle, Ulla; Kahu, Helena; Lindegren, Sture; Jensen, Holger; Bäck, Tom; Swanpalmer, John; Elmroth, Kecke

    2014-07-01

    Childhood exposure to ionizing radiation increases the risk of developing thyroid cancer later in life and this is suggested to be due to higher proliferation of the young thyroid. The interest of using high-LET alpha particles from Astatine-211 ((211)At), concentrated in the thyroid by the same mechanism as (131)I [1], in cancer treatment has increased during recent years because of its high efficiency in inducing biological damage and beneficial dose distribution when compared to low-LET radiation. Most knowledge of the DNA damage response in thyroid is from studies using low-LET irradiation and much less is known of high-LET irradiation. In this paper we investigated the DNA damage response and biological consequences to photons from Cobolt-60 ((60)Co) and alpha particles from (211)At in normal primary thyrocytes of different cell cycle status. For both radiation qualities the intensity levels of γH2AX decreased during the first 24h in both cycling and stationary cultures and complete repair was seen in all cultures but cycling cells exposed to (211)At. Compared to stationary cells alpha particles were more harmful for cycling cultures, an effect also seen at the pChk2 levels. Increasing ratios of micronuclei per cell nuclei were seen up to 1Gy (211)At. We found that primary thyrocytes were much more sensitive to alpha particle exposure compared with low-LET photons. Calculations of the relative biological effectiveness yielded higher RBE for cycling cells compared with stationary cultures at a modest level of damage, clearly demonstrating that cell cycle status influences the relative effectiveness of alpha particles.

  3. Diagnostics for PLX-alpha

    NASA Astrophysics Data System (ADS)

    Gilmore, Mark; Hsu, Scott

    2015-11-01

    The goal of the Plasma Liner eXperiment PLX-alpha at Los Alamos National Laboratory is to establish the viability of creating a spherically imploding plasma liner for MIF and HED applications, using a spherical array of supersonic plasma jets launched by innovative contoured-gap coaxial plasma guns. PLX- α experiments will focus in particular on establishing the ram pressure and uniformity scalings of partial and fully spherical plasma liners. In order to characterize these parameters experimentally, a suite of diagnostics is planned, including multi-camera fast imaging, a 16-channel visible interferometer (upgraded from 8 channels) with reconfigurable, fiber-coupled front end, and visible and VUV high-resolution and survey spectroscopy. Tomographic reconstruction and data fusion techniques will be used in conjunction with interferometry, imaging, and synthetic diagnostics from modeling to characterize liner uniformity in 3D. Diagnostic and data analysis design, implementation, and status will be presented. Supported by the Advanced Research Projects Agency - Energy - U.S. Department of Energy.

  4. Lyman Alpha Spicule Observatory (LASO)

    NASA Technical Reports Server (NTRS)

    Chamberlin, Phillip C.

    2011-01-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe smallscale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mAngstroms (33mAngstroms pixels) across a broad 20Angstrom spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-a emission at 1216Angstroms. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  5. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail

    2011-01-01

    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  6. Lyman Alpha Spicule Observatory (LASO)

    NASA Astrophysics Data System (ADS)

    Chamberlin, Phillip C.; Allred, J.; Airapetian, V.; Gong, Q.; Fontenla, J.; McIntosh, S.; de Pontieu, B.

    2011-05-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe small-scale eruptive events called "Rapid Blue-shifted Events” (RBEs), the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1” pixels) over a 2'x2' field of view with high spectral resolution of 66mÅ (33mÅ pixels) across a broad 20Å spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-α emission at 1216Å. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  7. Lyman Alpha Spicule Observatory (LASO)

    NASA Astrophysics Data System (ADS)

    Chamberlin, P. C.; Allred, J. C.; Airapetian, V.; Gong, Q.; Mcintosh, S. W.; De Pontieu, B.; Fontenla, J. M.

    2011-12-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe small-scale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mÅ (33mÅ pixels) across a broad 20Å spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-α emission at 1216Å. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  8. Divergence of human [alpha]-chain constant region gene sequences: A novel recombinant [alpha]2 gene

    SciTech Connect

    Chintalacharuvu, K. R.; Morrison, S.L. ); Raines, M. )

    1994-06-01

    IgA is the major Ig synthesized in humans and provides the first line of defense at the mucosal surfaces. The constant region of IgA heavy chain is encoded by the [alpha] gene on chromosome 14. Previous studies have indicated the presence of two [alpha] genes, [alpha]1 and [alpha]2 existing in two allotypic forms, [alpha]2 m(1) and [alpha]2 m(2). Here the authors report the cloning and complete nucleotide sequence determination of a novel human [alpha] gene. Nucleotide sequence comparison with the published [alpha] sequences suggests that the gene arose as a consequence of recombination or gene conversion between the two [alpha]2 alleles. The authors have expressed the gene as a chimeric protein in myeloma cells indicating that it encodes a functional protein. The novel IgA resembles IgA2 m(2) in that disulfide bonds link H and L chains. This novel recombinant gene provides insights into the mechanisms of generation of different constant regions and suggests that within human populations, multiple alleles of [alpha] may be present providing IgAs of different structures.

  9. Fibrinogen {alpha} genes: Conservation of bipartite transcripts and carboxy-terminal-extended {alpha} subunits in vertebrates

    SciTech Connect

    Fu, Y.; Cao, Y.; Hertzberg, K.M.; Grieninger, G.

    1995-11-01

    All three well-studied subunits of the clotting protein fibrinogen ({alpha}, {beta}, {gamma}) share N-terminal structural homologies, but until recently only the {beta} and {gamma} chains were recognized as having similar globular C-termini. With the discovery of an extra exon in the human fibrinogen {alpha} gene (exon VI), a minor form of the {alpha} subunit ({alpha}{sub E}) with an extended {beta}- and {gamma}-like C-terminus has been identified. In the present study, the polymerase chain reaction has been used to identify sequences that encode counterparts to {alpha}{sub E} in chicken, rabbit, rat, and baboon. The basic six-exon structure of the fibrinogen {alpha} genes is shown to be conserved among mammals and birds, as are the intron positions. Bipartite transcripts - still bearing an intron prior to the last exon - are found among the products of the various vertebrate fibrinogen {alpha} genes. The last exon represents the largest conserved segment of the gene and, in each species examined, encodes exactly 236 amino acids. The C-termini of these {alpha}{sub E} chains align without a single gap and are between 76 and 99% identical. Since the exon VI-encoded domain of {alpha}{sub E} is as well conserved as the corresponding regions of the {beta} and {gamma} chains, it follows that it is equally important and that {alpha}{sub E}-fibrinogen plays a vital, if as-yet unrecognized physiological role. 21 refs., 7 figs., 1 tab.

  10. Variable displacement alpha-type Stirling engine

    NASA Astrophysics Data System (ADS)

    Homutescu, V. M.; Bălănescu, D. T.; Panaite, C. E.; Atanasiu, M. V.

    2016-08-01

    The basic design and construction of an alpha-type Stirling engine with on load variable displacement is presented. The variable displacement is obtained through a planar quadrilateral linkage with one on load movable ground link. The physico-mathematical model used for analyzing the variable displacement alpha-type Stirling engine behavior is an isothermal model that takes into account the real movement of the pistons. Performances and power adjustment capabilities of such alpha-type Stirling engine are calculated and analyzed. An exemplification through the use of the numerical simulation was performed in this regard.

  11. Alpha spectral analysis via artificial neural networks

    SciTech Connect

    Kangas, L.J.; Hashem, S.; Keller, P.E.; Kouzes, R.T.; Troyer, G.L.

    1994-10-01

    An artificial neural network system that assigns quality factors to alpha particle energy spectra is discussed. The alpha energy spectra are used to detect plutonium contamination in the work environment. The quality factors represent the levels of spectral degradation caused by miscalibration and foreign matter affecting the instruments. A set of spectra was labeled with a quality factor by an expert and used in training the artificial neural network expert system. The investigation shows that the expert knowledge of alpha spectra quality factors can be transferred to an ANN system.

  12. Determining cellular role of G alpha 12.

    PubMed

    Dermott, Jonathan M; Dhanasekaran, N

    2002-01-01

    Using the expression strategies described here, we have demonstrated a model system whereby the sequential signaling events involved in cell proliferation and subsequent transformation regulated by G alpha 12 can be investigated. The model system presented here can also be used to study the temporal interrelationships between small GTPases, kinases, and other signaling proteins involved in G alpha 12-signaling pathways. Further analyses using this model system and the strategies presented here should provide valuable clues in defining the signaling network regulated by G alpha 12 in stimulating cell proliferation and oncogenic transformation. PMID:11771390

  13. Alpha-particle emissivity screening of materials used for semiconductor manufacturing

    NASA Astrophysics Data System (ADS)

    Gordon, Michael; Rodbell, Kenneth

    2015-03-01

    Single-Event Upsets (SEU's) in semiconductor memory and logic devices continue to be a reliability issue in modern CMOS devices. SEU's result from deposited charge in the Si devices caused by the passage of ionizing radiation. With technology scaling, the device area decreases, but the critical charge required to flip bits decreases as well. The interplay between both determines how the SEU rate scales with shrinking device geometries and dimensions. In order to minimize the alpha-particle component of SEU, the radiation in the device environment has to be at the Ultra-Low Alpha (ULA) activity levels, e.g. less than 2 α/khr-cm2. Most detectors have background levels that are significantly larger than that level which makes making these measurements difficult and time consuming. A new class of alpha particle detector, utilizing pulse shape discrimination, is now available which allows one to make measurements quickly with ultra-low detector background. This talk will discuss what is involved in making alpha particle measurements of materials in the ULA activity levels, in terms of calibration, radon adsorption mitigation, the time required for obtaining reasonable statistics and comparisons to other detectors.

  14. The luminescence characteristics of CsI(Na) crystal under {alpha} and X/{gamma} excitation

    SciTech Connect

    Liu Jinliang; Liu Fang; Ouyang Xiaoping; Liu Bin; Chen Liang; Ruan Jinlu; Zhang Zhongbing; Liu Jun

    2013-01-14

    In this paper, we study the effective decay time characteristic of CsI(Na) crystal under {sup 239}Pu alpha particle and {sup 137}Cs gamma-ray excitation using a single photon counting decay time measurement system. The measurement system employs a silicon optical fiber to couple and transit single photon. The slow decay time component of CsI(Na) crystal is 460-550 ns. We observe a 15 ns fast decay component under alpha particle excitation. In addition, we find that the primary stage of the falling edge in the decay time curve is non-exponential and drops rapidly when CsI(Na) crystal is excited by {sup 239}Pu alpha particles. Since the high density of self-trapped-excitons (STEs) is produced in alpha particle excitation process, we propose that the fast falling edge is corresponding to the quenching process of STEs which transit with non-radiation in the case of high excitation density. To prove this proposal, we excited the CsI(Na) crystal with sub-nanosecond intensive pulsed X-ray radiation. Our X-ray impinging results show that the fast falling edge also exists under low energy (average 100 keV) bremsstrahlung X-ray excitation.

  15. High Energy K(alpha) Radiography Using High-intensity, Short-pulse Lasers

    SciTech Connect

    Park, H; Izumi, N; Key, M H; King, J A; Koch, J A; Landen, O L; Patel, P K; Price, D F; Remington, B A; Robey, H F; Snavely, R A; Tabak, M; Town, R J; Wickersham, J E; Stoeckl, C; Storm, M; Theobald, W; Chambers, D M; Eagelton, R; Goldsack, T; Clarke, R J; Heathcote, R; Giraldez, E; Nikroo, A; Steinman, D A; Stephens, R B; Zhang, B B

    2005-11-16

    We have performed experiments using Callisto, the Vulcan 100 TW and the Vulcan Petawatt high intensity lasers to understand the characteristics of high energy, K{alpha} x-ray sources and to implement workable radiography solutions at 20-100 keV. Our measurements show that the K{alpha} size from a simple foil target is larger than 60 {micro}m, far larger than the experiment resolution requirement. The total K{alpha} yield is independent of target thicknesses verifying that refluxing plays a major role in photon generation. Smaller radiating volumes emit brighter K{alpha} radiation. 1-D radiography experiments using small-edge-on foils resolved 10 {micro}m features with high contrast. We tested a variety of small volume 2-D point sources such as cones, wires, and embedded wires, measuring photon yields and comparing our measurements with predictions from hybrid-PIC LSP simulations. In addition to high-energy, high-resolution backlighters, future experiments will also need imaging detectors and diagnostic tools that are workable in the 20-100 keV energy range. An initial look at some of these detector issues is also presented.

  16. High-energy K{alpha} radiography using high-intensity, short-pulse lasers

    SciTech Connect

    Park, H.-S.; Chung, H.-K.; Izumi, N.; Key, M.H.; King, J.A.; Koch, J.A.; Landen, O.L.; Patel, P.K.; Price, D.F.; Remington, B.A.; Robey, H.F.; Snavely, R.A.; Tabak, M.; Town, R.P.J.; Wickersham, J.E.; Chambers, D.M.; Eagleton, R.; Goldsack, T.; Clarke, R.J.; Heathcote, R.

    2006-05-15

    The characteristics of 22-40 keV K{alpha} x-ray sources are measured. These high-energy sources are produced by 100 TW and petawatt high-intensity lasers and will be used to develop and implement workable radiography solutions to probe high-Z and dense materials for the high-energy density experiments. The measurements show that the K{alpha} source size from a simple foil target is larger than 60 {mu}m, too large for most radiography applications. The total K{alpha} yield is independent of target thicknesses, verifying that refluxing plays a major role in photon generation. Smaller radiating volumes emit brighter K{alpha} radiation. One-dimensional radiography experiments using small-edge-on foils resolved 10 {mu}m features with high contrast. Experiments were performed to test a variety of small volume two-dimensional point sources such as cones, wires, and embedded wires, measured photon yields, and compared the measurements with predictions from hybrid-particle-in-cell simulations. In addition to high-energy, high-resolution backlighters, future experiments will also need imaging detectors and diagnostic tools that are workable in the high-energy range. An initial look at some of these detector issues is also presented.

  17. Relative biological effectiveness of alpha-particle emitters in vivo at low doses

    SciTech Connect

    Howell, R.W.; Azure, M.T.; Narra, V.R.; Rao, D.V. )

    1994-03-01

    The therapeutic potential of radionuclides that emit [alpha] particles, as well as their associated health hazards, have attracted considerable attention. The [sup 224]Ra daughters [sup 212]Pb and [sup 212]Bi, by virtue of their radiation properties which involve emission of [alpha] and [beta] particles in their decay to stable [sup 208]Pb, have been proposed as candidates for radioimmunotherapy. Using mouse testes as the experimental model and testicular spermhead survival as the biological end point, the present work examines the radiotoxicity of [sup 212]Pb and its daughters. When [sup 212]Pb, in equilibrium with its daughters [sup 212]Bi, [sup 212]Po and [sup 208]Tl, was administered directly into the testis, the dose required to achieve 37% survival (D[sub 37]) was 0.143 [+-] 0.014 Gy and the corresponding RBE of the mixed radiation field was 4.7 when compared to the D[sub 37] for acute external 120 kVp X rays. This datum, in conjunction with our earlier results for [sup 210]Po, was used to obtain an RBE-LET relationship for [alpha] particles emitted by tissue-incorporated radionuclides: RBE[sub [alpha

  18. Low-redshift Lyman-alpha absorption lines and the dark matter halos of disk galaxies

    NASA Technical Reports Server (NTRS)

    Maloney, Philip

    1992-01-01

    Ultraviolet observations of the low-redshift quasar 3C 273 using the Hubble Space Telescope have revealed many more Lyman-alpha absorption lines than would be expected from extrapolation of the absorption systems seen toward QSOs at z about 2. It is shown here that these absorption lines can plausibly be produced by gas at large radii in the disks of spiral and irregular galaxies; the gas is confined by the dark matter halos and ionized and heated by the extragalactic radiation field. This scenario does not require the extragalactic ionizing radiation field to decline as rapidly with decreasing z as the QSO emissivity. Observations of Ly-alpha absorption through the halos of known galaxies at low redshift will constrain both the extragalactic background and the properties of galactic halos.

  19. RETROSPECTIVE METHOD VALIDATION AND UNCERTAINTY ESTIMATION FOR ACTINIDES DETERMINATION IN EXCRETA BY ALPHA SPECTROMETRY.

    PubMed

    Hernández, C; Sierra, I

    2016-09-01

    Two essential technical requirements of ISO 17025 guide for accreditation of testing and calibration laboratories are the validation of methods and the estimation of all sources of uncertainty that may affect the analytical result. Bioelimination Laboratory from Radiation Dosimetry Service of CIEMAT (Spain) uses alpha spectrometry to quantify alpha emitters (Pu, Am, Th, U and Cm isotopes) in urine and faecal samples from workers exposed to internal radiation. Therefore and as a step previous to achieving the ISO 17025 accreditation, the laboratory has performed retrospective studies based on the obtained results in the past few years to validate the analytical method. Uncertainty estimation was done identifying and quantifying all the contributions, and finally the overall combined standard uncertainty was calculated. PMID:26424133

  20. Ionizing Radiation and Its Risks

    PubMed Central

    Goldman, Marvin

    1982-01-01

    Penetrating ionizing radiation fairly uniformly puts all exposed molecules and cells at approximately equal risk for deleterious consequences. Thus, the original deposition of radiation energy (that is, the dose) is unaltered by metabolic characteristics of cells and tissue, unlike the situation for chemical agents. Intensely ionizing radiations, such as neutrons and alpha particles, are up to ten times more damaging than sparsely ionizing sources such as x-rays or gamma rays for equivalent doses. Furthermore, repair in cells and tissues can ameliorate the consequences of radiation doses delivered at lower rates by up to a factor of ten compared with comparable doses acutely delivered, especially for somatic (carcinogenic) and genetic effects from x- and gamma-irradiation exposure. Studies on irradiated laboratory animals or on people following occupational, medical or accidental exposures point to an average lifetime fatal cancer risk of about 1 × 10-4 per rem of dose (100 per 106 person-rem). Leukemia and lung, breast and thyroid cancer seem more likely than other types of cancer to be produced by radiation. Radiation exposures from natural sources (cosmic rays and terrestrial radioactivity) of about 0.1 rem per year yield a lifetime cancer risk about 0.1 percent of the normally occurring 20 percent risk of cancer death. An increase of about 1 percent per rem in fatal cancer risk, or 200 rem to double the “background” risk rate, is compared with an estimate of about 100 rem to double the genetic risk. Newer data suggest that the risks for low-level radiation are lower than risks estimated from data from high exposures and that the present 5 rem per year limit for workers is adequate. PMID:6761969

  1. Targeted alpha therapy using short-lived alpha-particles and the promise of nanobodies as targeting vehicle

    PubMed Central

    Dekempeneer, Yana; Keyaerts, Marleen; Krasniqi, Ahmet; Puttemans, Janik; Muyldermans, Serge; Lahoutte, Tony; D’huyvetter, Matthias; Devoogdt, Nick

    2016-01-01

    ABSTRACT Introduction: The combination of a targeted biomolecule that specifically defines the target and a radionuclide that delivers a cytotoxic payload offers a specific way to destroy cancer cells. Targeted radionuclide therapy (TRNT) aims to deliver cytotoxic radiation to cancer cells and causes minimal toxicity to surrounding healthy tissues. Recent advances using α-particle radiation emphasizes their potential to generate radiation in a highly localized and toxic manner because of their high level of ionization and short range in tissue. Areas covered: We review the importance of targeted alpha therapy (TAT) and focus on nanobodies as potential beneficial vehicles. In recent years, nanobodies have been evaluated intensively as unique antigen-specific vehicles for molecular imaging and TRNT. Expert opinion: We expect that the efficient targeting capacity and fast clearance of nanobodies offer a high potential for TAT. More particularly, we argue that the nanobodies’ pharmacokinetic properties match perfectly with the interesting decay properties of the short-lived α-particle emitting radionuclides Astatine-211 and Bismuth-213 and offer an interesting treatment option particularly for micrometastatic cancer and residual disease. PMID:27145158

  2. Radiation enteritis and radiation scoliosis

    SciTech Connect

    Shah, M.; Eng, K.; Engler, G.L.

    1980-09-01

    Any patient with radiation scoliosis should be suspected of having a visceral lesion as well. Chronic radiation enteritis may be manifested by intestinal obstruction, fistulas, perforation, and hemorrhage. Intestinal obstruction is the most common complication, and must be differentiated from postoperative cast or from spinal-traction syndrome. Obstruction that does not respond promptly to conservative measures must be treated surgically. Irradiated bowel is ischemic, and necrosis with spontaneous perforation can only be avoided with early diagnosis and surgical intervention.

  3. Structure, stability and folding of the alpha-helix.

    PubMed

    Doig, A J; Andrew, C D; Cochran, D A; Hughes, E; Penel, S; Sun, J K; Stapley, B J; Clarke, D T; Jones, G R

    2001-01-01

    Pauling first described the alpha-helix nearly 50 years ago, yet new features of its structure continue to be discovered, using peptide model systems, site-directed mutagenesis, advances in theory, the expansion of the Protein Data Bank and new experimental techniques. Helical peptides in solution form a vast number of structures, including fully helical, fully coiled and partly helical. To interpret peptide results quantitatively it is essential to use a helix/coil model that includes the stabilities of all these conformations. Our models now include terms for helix interiors, capping, side-chain interactions, N-termini and 3(10)-helices. The first three amino acids in a helix (N1, N2 and N3) and the preceding N-cap are unique, as their amide NH groups do not participate in backbone hydrogen bonding. We surveyed their structures in proteins and measured their amino acid preferences. The results are predominantly rationalized by hydrogen bonding to the free NH groups. Stabilizing side-chain-side-chain energies, including hydrophobic interactions, hydrogen bonding and polar/non-polar interactions, were measured accurately in helical peptides. Helices in proteins show a preference for having approximately an integral number of turns so that their N- and C-caps lie on the same side. There are also strong periodic trends in the likelihood of terminating a helix with a Schellman or alpha L C-cap motif. The kinetics of alpha-helix folding have been studied with stopped-flow deep ultraviolet circular dichroism using synchrotron radiation as the light source; this gives a far superior signal-to-noise ratio than a conventional instrument. We find that poly(Glu), poly(Lys) and alanine-based peptides fold in milliseconds, with longer peptides showing a transient overshoot in helix content.

  4. Radiation Oncology Treatment Team

    MedlinePlus

    ... Upper GI What is Radiation Therapy? Find a Radiation Oncologist Last Name: Facility: City: State: Zip Code: ... who specializes in using radiation to treat cancer . Radiation Oncologists Radiation oncologists are the doctors who will ...

  5. Radiation Therapy (For Parents)

    MedlinePlus

    ... 5 Things to Know About Zika & Pregnancy Radiation Therapy KidsHealth > For Parents > Radiation Therapy Print A A ... many questions and concerns about it. About Radiation Therapy In radiation therapy, high-energy radiation from X- ...

  6. Brain radiation - discharge

    MedlinePlus

    Radiation - brain - discharge; Cancer-brain radiation; Lymphoma - brain radiation; Leukemia - brain radiation ... Decadron) while you are getting radiation to the brain. It may make you hungrier, cause leg swelling ...

  7. The feasibility of 225Ac as a source of alpha-particles in radioimmunotherapy.

    PubMed

    Geerlings, M W; Kaspersen, F M; Apostolidis, C; van der Hout, R

    1993-02-01

    This paper proposes the utilization of 225Ac for the alpha-radioimmunotherapy of cancer. The isotope decays with a radioactive half-life of 10 days into a cascade of short-lived alpha- and beta-emitting isotopes. In addition, when indicated by the pharmacokinetic requirements of particular clinical applications, 213Bi, with a radioactive half-life of 47 min, can be chosen as an alternative source of alpha-particles in radioimmunotherapy. This isotope is the last alpha emitter in the 225Ac decay-cascade and can be extracted from a 225Ac source at the bedside of the patient. 225Ac can quasi ad infinitum be obtained from one of its precursors, 229Th, which can be made available by various means. The indications for the use of alpha-particles as an alternative to more traditional classes of radiation are derived from the particle-kinetic characteristics and the radioactive half-life of their source isotope, as well as from the properties of the target-selective carrier moiety for the source isotope. It may be expected that useful applications, complementary to and/or in conjunction with other means of therapy will be identified.

  8. Radiation effects in the lung.

    PubMed Central

    Coggle, J E; Lambert, B E; Moores, S R

    1986-01-01

    This article outlines the principles of radiobiology that can explain the time of onset, duration, and severity of the complex reactions of the lung to ionizing radiation. These reactions have been assayed biochemically, cell kinetically, physiologically, and pathologically. Clinical and experimental data are used to describe the acute and late reactions of the lung to both external and internal radiation including pneumonitis, fibrosis and carcinogenesis. Acute radiation pneumonitis, which can be fatal, develops in both humans and animals within 6 months of exposure to doses greater than or equal to 8 Gy of low LET radiation. It is divisible into a latent period lasting up to 4 weeks; an exudative phase (3-8 weeks) and with an acute pneumonitic phase between 2 and 6 months. The latter is an inflammatory reaction with intra-alveolar and septal edema accompanied by epithelial and endothelial desquamation. The critical role of type II pneumonocytes is discussed. One favored hypothesis suggests that the primary response of the lung is an increase in microvascular permeability. The plasma proteins overwhelm the lymphatic and other drainage mechanisms and this elicits the secondary response of type II cell hyperplasia. This, in its turn, produces an excess of surfactant that ultimately causes the fall in compliance, abnormal gas exchange values, and even respiratory failure. The inflammatory early reaction may progress to chronic fibrosis. There is much evidence to suggest that pneumonitis is an epithelial reaction and some evidence to suggest that this early damage may not be predictive of late fibrosis. However, despite detailed work on collagen metabolism, the pathogenesis of radiation fibrosis remains unknown. The data on radiation-induced pulmonary cancer, both in man and experimental animals from both external and internal irradiation following the inhalation of both soluble and insoluble alpha and beta emitting radionuclides are reviewed. Emphasis is placed on

  9. Permeation study of five formulations of alpha-tocopherol acetate through human cadaver skin.

    PubMed

    Mahamongkol, Hansa; Bellantone, Robert A; Stagni, Grazia; Plakogiannis, Fotios M

    2005-01-01

    Alpha-tocopherol (AT) is the vitamin E homologue with the highest in vivo biological activity. AT protects against the carcinogenic and mutagenic activity of ionizing radiation and chemical agents, and possibly against UV-induced cutaneous damage. For stability consideration, alpha-tocopherol is usually used as its prodrug ester, alpha-tocopherol acetate (ATA), which once absorbed into the skin is hydrolyzed to alpha-tocopherol, the active form. The objective of this research was to characterize in vitro the permeation properties of ATA from various solutions and gel formulations. Permeation studies were conducted using modified Franz diffusion cells and human cadaver skin as the membrane. Specifically, 5% (w/w) alpha-tocopherol acetate was formulated in the following vehicles: ethanol, isopropyl myristate, light mineral oil, 1% Klucel gel in ethanol, and 3% Klucel gel in ethanol (w/w). The receiver temperature was 37 degrees C. Samples from the receiver were collected at 2, 4, 6, 8, 12, 24, 30, 36, and 48 hours and analyzed by HPLC for concentrations of alpha-tocopherol acetate and alpha-tocopherol. The permeabilities of ATA through human cadaver skin were 1.0x10(-4), 1.1x10(-2), 1.4x10(-4), 2.1x10(-4), and 4.7x10(-4) cm/h for the ethanol solution, isopropyl myristate solution, light mineral oil solution, 1% Klucel gel, and 3% Klucel gel, respectively. The results show that the formulation had relatively minor effects on the permeability coefficients of ATA through cadaver skin in all cases except for the isopropyl myristate solution.

  10. Lyman alpha initiated winds in late-type stars

    NASA Technical Reports Server (NTRS)

    Haisch, B. M.; Van Der Hucht, K. A.; Linsky, J. L.

    1979-01-01

    One of the first major results of the IUE survey of late-type stars was the discovery of a sharp division in the HR diagram between stars with solar type spectra (chromosphere and transition region lines) and those with non-solar type spectra (only chromosphere lines). This result is especially interesting in view of observational evidence for mass loss from G and K giants and super-giants discussed recently by both Reimers and Stencel. In the present paper models of both hot coronae and cool wind flows are calculated using stellar model chromospheres as starting points for stellar wind calculations in order to investigate the possibility of having a 'supersonic transition locus' in the HR diagram dividing hot coronae from cool winds. It is concluded from these models that the Lyman-alpha flux may play an important role in determining the location of a stellar wind critical point. The interaction of Lyman-alpha radiation pressure with Alfven waves in producing strong, low temperature stellar winds in the star Arcturus is investigated.

  11. Radiation cataract.

    PubMed

    Kleiman, N J

    2012-01-01

    Until very recently, ocular exposure guidelines were based on the assumption that radiation cataract is a deterministic event requiring threshold doses generally greater than 2 Gy. This view was, in part, based on older studies which generally had short follow-up periods, failed to take into account increasing latency as dose decreased, had relatively few subjects with doses below a few Gy, and were not designed to detect early lens changes. Newer findings, including those in populations exposed to much lower radiation doses and in subjects as diverse as astronauts, medical workers, atomic bomb survivors, accidentally exposed individuals, and those undergoing diagnostic or radiotherapeutic procedures, strongly suggest dose-related lens opacification at significantly lower doses. These observations resulted in a recent re-evaluation of current lens occupational exposure guidelines, and a proposed lowering of the presumptive radiation cataract threshold to 0.5 Gy/year and the occupational lens exposure limit to 20 mSv/year, regardless of whether received as an acute, protracted, or chronic exposure. Experimental animal studies support these conclusions and suggest a role for genotoxicity in the development of radiation cataract. Recent findings of a low or even zero threshold for radiation-induced lens opacification are likely to influence current research efforts and directions concerning the cellular and molecular mechanisms underlying this pathology. Furthermore, new guidelines are likely to have significant implications for occupational and/or accidental exposure, and the need for occupational eye protection (e.g. in fields such as interventional medicine).

  12. Effect of alpha-radiolysis on TRUEX-NPH solvent

    SciTech Connect

    Buchholz, B.A.; Nunez, L.; Vandegrift, G.F.

    1994-10-01

    An unexpectedly high degradation of the TRUEX (TRansUranic EXtraction) solvent occurred during the treatment of waste solutions from the New Brunswick Laboratory. The waste solutions treated contained approximately 1 g/L of Pu-239 and 20 mg/L of Am-241. Earlier studies of {alpha}-radiolysis using carbon tetrachloride (CCl{sub 4}) rather than normal paraffinic hydrocarbons (NPH) as a diluent indicated greater resistance to radiation damage than observed. For this study, the TRUEX-NPH solvent was loaded with Am-241 in nitric acid, irradiated with doses up to 3.5 Mrad, and monitored for decline in extraction capability as a function of absorbed dose. Results of this study are being used to improve the Generic TRUEX Model (GTM), a thermodynamic model that permits flowsheet design for solvent extraction processing.

  13. Pulsar H(alpha) Bowshocks probe Neutron Star Physics

    NASA Astrophysics Data System (ADS)

    Romani, Roger W.

    2014-08-01

    We propose a KOALA/AAOmega study of southern pulsar bow shocks. These rare, Balmer-dominated, non-radiative shocks provide an ideal laboratory to study the interaction of the relativistic pulsar wind with the ISM. We will cover H(alpha) at high spectral resolution to measure the kinematics of the upstream ISM and the post-shock flow, while the blue channel measures the Balmer decrement and probes for a faint cooling component. These data, with MHD models, allow us to extract the 3D flow geometry and the orientation and asymmetry of the pulsar wind. These data can also measure the pulsar spindown power, thus estimating the neutron star moment of inertia and effecting a fundamental test of dense matter physics.

  14. Spacelab Lyman Alpha-White Light Coronagraph Program

    NASA Technical Reports Server (NTRS)

    Kohl, J. L.

    1986-01-01

    The Spacelab Lyman Alpha Coronagraph (SLAC) of the Smithsonian Astrophysical Observatory (SAO) and the White Light Coronagraph (WLC) to be provided by the High Altitude Observatory (HAO) are two separate coronagraphs which would be operated in a joint fashion during Spacelab missions to be flown by the Space Shuttle. The two instruments would be used to perform joint observations of solar coronal structures from 1.2 to 8.0 solar radii from sun-center in vacuum ultraviolet and visible radiations. Temperatures, densities, and flow velocities throughout the solar wing acceleration region of the inner solar corona were measured. The Phase I Definition activity resulted in the successful definition and preliminary design of the experiment/instrumentation subsystem and associated software, ground support equipment and interfaces to the extended required to accurately estimate the scope of the investigation and prepare an Investigational Development Plan; the performance of the necessary functional, operations, and safety analyses necessary to complete the Experiment Requirements document.

  15. Lyman-alpha emission from nonthermal proton beams

    NASA Technical Reports Server (NTRS)

    Orrall, F. Q.; Zirker, J. B.

    1976-01-01

    Nonthermal fast protons penetrating an atmosphere containing neutral hydrogen will produce some nonthermal fast neutrals which will radiate Doppler-shifted photons. The hydrogen line profiles observed from such an atmosphere will thus have nonthermal, partially polarized wings that contain information on the flux, energy spectrum, and direction of the incident proton beam. This paper develops the theory of this effect and applies it to proton beams from impulsive solar flares impacting on the sun's atmosphere. Calculations of the L-alpha profile from the region of impact have been made for the Vernazza-Avrett-Loeser solar atmosphere assuming proton energy fluxes and power-law spectra similar to those inferred for the electron beams believed responsible for hard X-ray bursts. The resulting profiles show that the effect should be detectable and that it could serve as a diagnostic for flare protons near their place of origin on the sun.

  16. A model for the disc Lyman alpha emission of Uranus

    NASA Technical Reports Server (NTRS)

    Ben Jaffel, L.; Prange, R.; Emerich, C.; Vidal-Madjar, A.; Mcconnell, J. C.

    1991-01-01

    A new efficient radiative transfer algorithm for nonhomogeneous model atmospheres has been applied to the Uranian atmosphere. The contribution of the scatter solar Lyman-alpha to the Uranain emission is of the order of 300 R, and the Rayleigh contribution may reach 450 R for small values of the eddy diffusion coefficient (EDC). The total solar contribution may then reach about 750 R for a solar flux of 2.5 x 10 to the 11th photons/sq cm/s/A. A level of up to 400 R is confirmed in some directions for the interstellar wind contribution. The values of the atmospheric EDC necessary to mimic the observations are 50-100 sq cm/s. A small additional source located on the dayside Uranian atmosphere seems necessary correctly to fit the shape of the limb to limb intensity variation, especially near the limbs. Its contribution to the emergent intensity would range from 100 to 500 R.

  17. Lyman-Alpha Observations of High Radial Velocity Stars

    NASA Astrophysics Data System (ADS)

    Bookbinder, Jay

    1990-12-01

    H I LYMAN -ALPHA (LY-A) IS ONE OF THE MOST IMPORTANT LINES EMITTED BY PLASMA IN THE TEMPERATURE RANGE OF 7000 TO 10 TO THE FIFTH POWER K IN LATE-TYPE STARS. IT IS A MAJOR COMPONENT OF THE TOTAL RADIATIVE LOSS RATE, AND IT PLAYS A CRUCIAL ROLE IN DETERMINING THE ATMOSPHERIC STRUCTURE AND IN FLUORESCING OTHER UV LINES. YET IT IS ALSO THE LEAST STUDIED MAJOR LINE IN THE FAR UV, BECAUSE MOST OF THE LINE FLUX IS ABSORBED BY THE ISM ALONG THE LINE OF SIGHT AND BECAUSE IT IS STRONGLY COMTAMINATED BY THE GEOCORONAL BACKGROUND. A KNOWLEDGE OF THE Ly-A PROFILE IS ALSO IMPORTANT FOR STUDIES OF DEUTERIUM IN THE INTERSTELLAR MEDIUM. BY OBSERVING HIGH RADIAL VELOCITY STARS WE WILL OBTAIN FOR THE FIRST TIME HIGH RESOLUTION SPECTRA OF THE CORE OF A STELLAR H I LYMAN-A EMISSION LINE PROFILE.

  18. Production of tumor necrosis factor alpha, interleukin-1 alpha, and interleukin-6 during murine coccidioidomycosis.

    PubMed Central

    Cox, R A; Magee, D M

    1995-01-01

    The proinflammatory cytokines tumor necrosis factor alpha (TNF-alpha), interleukin-1 alpha (IL-1 alpha), and interleukin-6 (IL-6) were induced in mice infected with Coccidioides immitis. Analyses of the cytokine profiles of two inbred mouse strains which differ in their susceptibility to pulmonary challenge with C. immitis revealed higher levels of IL-6 in lungs from DBA/2 mice (resistant strain) than in those from BALB/c mice (susceptible strain) beginning at day 6 and continuing through day 15 postinfection. Spleen cells from both mouse strains secreted TNF-alpha, IL-1 alpha, and IL-6 in vitro in response to stimulation with killed spherules but differed in that spleen cells from the resistant strain produced increased levels of these cytokines earlier after pulmonary challenge and at increased levels throughout the course of the disease. PMID:7558338

  19. Influence of fast alpha diffusion and thermal alpha buildup on tokamak reactor performance

    SciTech Connect

    Uckan, N.A.; Tolliver, J.S.; Houlberg, W.A.; Attenberger, S.E.

    1987-11-01

    The effect of fast alpha diffusion and thermal alpha accumulation on the confinement capability of a candidate Engineering Test Reactor (ETR) plasma (Tokamak Ignition/Burn Experimental Reactor (TIBER-II)) in achieving ignition and steady-state driven operation has been assessed using both global and 1-1/2-D transport models. Estimates are made of the threshold for radial diffusion of fast alphas and thermal alpha buildup. It is shown that a relatively low level of radial transport, when combined with large gradients in the fast alpha density, leads to a significant radial flow with a deleterious effect on plasma performance. Similarly, modest levels of thermal alpha concentration significantly influence the ignition and steady-state burn capability. 23 refs., 9 figs., 4 tabs.

  20. Alpha Coincidence Spectroscopy studied with GEANT4

    SciTech Connect

    Dion, Michael P.; Miller, Brian W.; Tatishvili, Gocha; Warren, Glen A.

    2013-11-02

    Abstract The high-energy side of peaks in alpha spectra, e.g. 241Am, as measured with a silicon detector has structure caused mainly by alpha-conversion electron and to some extent alphagamma coincidences. We compare GEANT4 simulation results to 241Am alpha spectroscopy measurements with a passivated implanted planar silicon detector. A large discrepancy between the measurements and simulations suggest that the GEANT4 photon evaporation database for 237Np (daughter of 241Am decay) does not accurately describe the conversion electron spectrum and therefore was found to have large discrepancies with experimental measurements. We describe how to improve the agreement between GEANT4 and alpha spectroscopy for actinides of interest by including experimental measurements of conversion electron spectroscopy into the photon evaporation database.