Science.gov

Sample records for alpha satellite dna

  1. Locational diversity of alpha satellite DNA and intergeneric hybridization aspects in the Nomascus and Hylobates genera of small apes.

    PubMed

    Baicharoen, Sudarath; Miyabe-Nishiwaki, Takako; Arsaithamkul, Visit; Hirai, Yuriko; Duangsa-ard, Kwanruen; Siriaroonrat, Boripat; Domae, Hiroshi; Srikulnath, Kornsorn; Koga, Akihiko; Hirai, Hirohisa

    2014-01-01

    Recently, we discovered that alpha satellite DNA has unique and genus-specific localizations on the chromosomes of small apes. This study describes the details of alpha satellite localization in the genera Nomascus and Hylobates and explores their usefulness in distinguishing parental genome sets in hybrids between these genera. Fluorescence in situ hybridization was used to establish diagnostic criteria of alpha satellite DNA markers in discriminating small ape genomes. In particular we established the genus specificity of alpha satellite distribution in three species of light-cheeked gibbons (Nomascus leucogenys, N. siki, and N. gabriellae) in comparison to that of Hylobates lar. Then we determined the localization of alpha satellite DNA in a hybrid individual which resulted from a cross between these two genera. In Nomascus the alpha satellite DNA blocks were located at the centromere, telomere, and four interstitial regions. In Hylobates detectable amounts of alpha satellite DNA were seen only at centromeric regions. The differences in alpha satellite DNA locations between Nomascus and Hylobates allowed us to easily distinguish the parental chromosomal sets in the genome of intergeneric hybrid individuals found in Thai and Japanese zoos. Our study illustrates how molecular cytogenetic markers can serve as diagnostic tools to identify the origin of individuals. These molecular tools can aid zoos, captive breeding programs and conservation efforts in managing small apes species. Discovering more information on alpha satellite distribution is also an opportunity to examine phylogenetic and evolutionary questions that are still controversial in small apes.

  2. Marker chromosomes lacking {alpha}-satellite DNA: A new intriguing class of abnormalities

    SciTech Connect

    Becker, L.A.; Zinn, A.B.; Stallard, J.R.

    1994-09-01

    Recent studies have implicated {alpha}-satellite DNA as an integral part of the centromere and important for the normal segregation of chromosomes. We analyzed four supernumerary marker chromosomes in which fluorescence in situ hybridization (FISH) could detect neither pancentromeric or chromosome specific {alpha}-satellite DNA. Mosaicism of the markers existed, but each was present in the majority of cells indicating that they segregated normally. FISH with chromosome-specific libraries identified the origins of these markers as chromosomes 13 (1 case) and 15 (3 cases). High resolution analysis, combined with hybridization of a series of cosmid probes, revealed that each marker was a symmetrical duplication of the terminal long arm of the parent chromosome. Telomeric sequences were detected by FISH indicating linear structures. Breakpoint heterogeneity, as defined by cosmid probes, was demonstrated in the three cases involving chromosome 15. No pericentromeric satellite III DNA could be detected on three markers. Studies with anti-centromere antibodies are in progress to assay for centromeric antigens on the markers, as expected at functional centromeric sites. Our results demonstrate that the precise structural identification and heterogeneity of these markers can be easily elucidated using FISH with unique sequence cosmid probes. We conclude from our studies and others in the literature: (1) there is a newly defined class of markers lacking {alpha}-satellite DNA and containing duplications of terminal sequences; (2)neither {alpha}-satellite nor satellite III DNA at levels detectable by FISH is necessary for fidelity in the normal segregation of chromosomes; and (3) these markers were most likely formed by recombination of the long arms during meiosis.

  3. Tetrasomy 15q: Two marker chromosomes with no detectable alpha-satellite DNA

    SciTech Connect

    Blennow, E.; Telenius, K.; Larsson, C.; Nordenskjoeld, M. ); Vos, D. de; Carter, N.P. ); Henriksson, P.; Johansson, O. )

    1994-05-01

    Two patients with specific and similar phenotypes were both found to have an unusual marker chromosome present in 70%-80% of their lymphocytes at routine cytogenetic examination. The marker chromosomes were isolated by flow sorting and were amplified by degenerate oligonucleotide-primed PCR. These libraries and a cosmid probe located at 15q26 were used to characterize the marker chromosomes by FISH. Both marker chromosomes were found to consist of duplicated chromosome material from the distal part of chromosome 15q and were identified as inv dup(15) (qter[yields]q23::q23[yields]qter) and inv dup(15) (qter[yields]q24[yields]qter), respectively. Hence, the markers did not include any known centromere region, and no alpha-satellite DNA could be detected at the site of the primary construction. Tetrasomy 15q may be a new syndrome, associated with a specific type of marker chromosome. In addition, further analysis of this type of marker chromosome might give new insight into the structure and function of the mammalian centromere. 29 refs., 4 figs., 1 tab.

  4. In situ hybridization analysis of gibbon chromosomes suggests that amplification of alpha satellite DNA in the telomere region is confined to two of the four genera.

    PubMed

    Baicharoen, Sudarath; Arsaithamkul, Visit; Hirai, Yuriko; Hara, Toru; Koga, Akihiko; Hirai, Hirohisa

    2012-11-01

    The siamang (Symphalangus syndactylus), a species of the family Hylobatidae (gibbons), carries large blocks of constitutive heterochromatin in the telomere region of chromosomes. We recently found that alpha satellite DNA constitutes these heterochromatin blocks as a main component. Alpha satellite DNA, tandem repeat sequences of 171-bp repeat units, is a major component of centromeres in primates. In addition to the siamang, the white-cheeked gibbon (Nomascus leucogenys) was previously found to carry the alpha satellite DNA in the telomere region, although not as large a scale as the siamang. Gibbons comprise four genera: Hoolock, Hylobates, Nomascus, and Symphalangus. Here, we report that the amplification of alpha satellite DNA in the telomere region is probably confined to two genera: Nomascus and Symphalangus. We examined one species of Hoolock and four species of Hylobates and obtained evidence against such an amplification event in these species. The phylogenetic relationship of the four gibbon genera remains unclear. One simple explanation for the current distribution of the telomere region alpha satellite DNA would be that Nomascus and Symphalangus are relatively closely related and the amplification occurred in their common ancestor.

  5. Higher-order repeat structure in alpha satellite DNA is an attribute of hominoids rather than hominids.

    PubMed

    Terada, Shoko; Hirai, Yuriko; Hirai, Hirohisa; Koga, Akihiko

    2013-11-01

    Alpha satellite DNA (AS), a major DNA component of primate centromeres, is composed of a tandem array of repeat units of approximately 170 bp. The AS of hominids (family Hominidae; humans and great apes) includes sequences organized into higher-order repeat (HOR) structures, with a periodic appearance of multiple copies of the basic repeat units. Here, we identified an HOR in AS of the siamang, a small ape phylogenetically distinct from hominids but included in hominoids (superfamily Hominoidea). We sequenced long stretches of genomic DNA, and found a repetition of blocks consisting of six and four basic repeat units. Thus, AS organization into HOR is an attribute of hominoids, rather than, as currently postulated, hominids. In addition to centromeres, siamangs carry AS in terminal heterochromatin blocks, and it cannot be determined at present whether these HOR-containing AS sequences originate from the centromere or from the terminal heterochromatin. Even if the latter is the case, these sequences might affect the composition of centromeric AS by being transferred to the centromere.

  6. Cloning and comparative mapping of a human chromosome 4-specific alpha satellite DNA sequence

    SciTech Connect

    D'Aiuto, L.; Marzella, R.; Archidiacono, N.; Rocchi, M. ); Antonacci, R. )

    1993-11-01

    The authors have isolated and characterized two human alphoid DNA clones: p4n1/4 and pZ4.1. Clone p4n1/4 identifies specifically the centromeric region of chromosome 4; pZ4.1 recognizes a subset of alphoid DNA shared by chromosomes 4 and 9. The specificity was determined using fluorescence in situ hybridization experiments on metaphase spreads and Southern blotting analysis of human-hamster somatic cell hybrids. The genomic organization of both subsets was also investigated. Comparative mapping on chimpanzee and gorilla chromosomes was performed. p4n1/4 hybridizes to chimpanzee chromosomes 11 and 13, homologs of human chromosomes 9 and 2q, respectively. On gorilla metaphase spreads, p4n1/4 hybridizes exclusively to the centromeric region of chromosome 19, partially homologous to human chromosome 17. No hybridization signal was detected on chromosome 3 of both chimpanzee and gorilla, in both species homolog of human chromosome 4. Identical comparative mapping results were obtained using pZ4.1 probe, although the latter recognizes an alphoid subset distinct from the one recognized by p4n1/4. The implications of these results in the evolution of centromeric regions of primate chromosomes are discussed. 33 refs., 4 figs.

  7. Structure, organization, and sequence of alpha satellite DNA from human chromosome 17: evidence for evolution by unequal crossing-over and an ancestral pentamer repeat shared with the human X chromosome.

    PubMed

    Waye, J S; Willard, H F

    1986-09-01

    The centromeric regions of all human chromosomes are characterized by distinct subsets of a diverse tandemly repeated DNA family, alpha satellite. On human chromosome 17, the predominant form of alpha satellite is a 2.7-kilobase-pair higher-order repeat unit consisting of 16 alphoid monomers. We present the complete nucleotide sequence of the 16-monomer repeat, which is present in 500 to 1,000 copies per chromosome 17, as well as that of a less abundant 15-monomer repeat, also from chromosome 17. These repeat units were approximately 98% identical in sequence, differing by the exclusion of precisely 1 monomer from the 15-monomer repeat. Homologous unequal crossing-over is suggested as a probable mechanism by which the different repeat lengths on chromosome 17 were generated, and the putative site of such a recombination event is identified. The monomer organization of the chromosome 17 higher-order repeat unit is based, in part, on tandemly repeated pentamers. A similar pentameric suborganization has been previously demonstrated for alpha satellite of the human X chromosome. Despite the organizational similarities, substantial sequence divergence distinguishes these subsets. Hybridization experiments indicate that the chromosome 17 and X subsets are more similar to each other than to the subsets found on several other human chromosomes. We suggest that the chromosome 17 and X alpha satellite subsets may be related components of a larger alphoid subfamily which have evolved from a common ancestral repeat into the contemporary chromosome-specific subsets.

  8. DNA methylation at a bovine alpha satellite I repeat CpG site during development following fertilization and somatic cell nuclear transfer.

    PubMed

    Couldrey, Christine; Wells, David N

    2013-01-01

    Incomplete epigenetic reprogramming is postulated to contribute to the low developmental success following somatic cell nuclear transfer (SCNT). Here, we describe the epigenetic reprogramming of DNA methylation at an alpha satellite I CpG site (αsatI-5) during development of cattle generated either by artificial insemination (AI) or in vitro fertilization (IVF) and SCNT. Quantitative methylation analysis identified that SCNT donor cells were highly methylated at αsatI-5 and resulting SCNT blastocysts showed significantly more methylation than IVF blastocysts. At implantation, no difference in methylation was observed between SCNT and AI in trophoblast tissue at αsatI-5, however, SCNT embryos were significantly hyper-methylated compared to AI controls at this time point. Following implantation, DNA methylation at αsatI-5 decreased in AI but not SCNT placental tissues. In contrast to placenta, the proportion of methylation at αsatI-5 remained high in adrenal, kidney and muscle tissues during development. Differences in the average proportion of methylation were smaller in somatic tissues than placental tissues but, on average, SCNT somatic tissues were hyper-methylated at αsatI-5. Although sperm from all bulls was less methylated than somatic tissues at αsatI-5, on average this site remained hyper-methylated in sperm from cloned bulls compared with control bulls. This developmental time course confirms that epigenetic reprogramming does occur, at least to some extent, following SCNT. However, the elevated methylation levels observed in SCNT blastocysts and cellular derivatives implies that there is either insufficient time or abundance of appropriate reprogramming factors in oocytes to ensure complete reprogramming. Incomplete reprogramming at this CpG site may be a contributing factor to low SCNT success rates, but more likely represents the tip of the iceberg in terms of incompletely reprogramming. Until protocols ensure the epigenetic signature of a

  9. The evolutionary conservation of DNA polymerase. alpha

    SciTech Connect

    Miller, M.A.; Korn, D.; Wang, T.S.F. )

    1988-08-25

    The evolutionary conservation of DNA polymerase {alpha} was assessed by immunological and molecular genetic approaches. Four anti-human KB cell DNA polymerase {alpha} monoclonal antibodies were tested for their ability to recognize a phylogenetically broad array of eukaryotic DNA polymerases. While the single non-neutralizing antibody used in this study recognizes higher mammalian (human, simian, canine, and bovine) polymerases only, three neutralizing antibodies exhibit greater, but variable, extents of cross-reactivity among vertebrate species. Genomic Southern hybridization studies with the cDNA of the human DNA polymerase {alpha} catalytic polypeptide identify the existence of many consensus DNA sequences within the DNA polymerase genes of vertebrate, invertebrate, plant and unicellular organisms. These findings illustrate the differential evolutionary conservation of four unique epitopes on DNA sequences, presumably reflective of critical functional domains, in the DNA polymerase genes from a broad diversity of living forms.

  10. Physical Interactions between Mcm10, DNA, and DNA Polymerase [alpha

    SciTech Connect

    Warren, Eric M.; Huang, Hao; Fanning, Ellen; Chazin, Walter J.; Eichman, Brandt F.

    2009-10-21

    Mcm10 is an essential eukaryotic protein required for the initiation and elongation phases of chromosomal replication. Specifically, Mcm10 is required for the association of several replication proteins, including DNA polymerase {alpha} (pol {alpha}), with chromatin. We showed previously that the internal (ID) and C-terminal (CTD) domains of Mcm10 physically interact with both single-stranded (ss) DNA and the catalytic p180 subunit of pol {alpha}. However, the mechanism by which Mcm10 interacts with pol {alpha} on and off DNA is unclear. As a first step toward understanding the structural details for these critical intermolecular interactions, x-ray crystallography and NMR spectroscopy were used to map the binary interfaces between Mcm10-ID, ssDNA, and p180. The crystal structure of an Mcm10-ID {center_dot} ssDNA complex confirmed and extended our previous evidence that ssDNA binds within the oligonucleotide/oligosaccharide binding-fold cleft of Mcm10-ID. We show using NMR chemical shift perturbation and fluorescence spectroscopy that p180 also binds to the OB-fold and that ssDNA and p180 compete for binding to this motif. In addition, we map a minimal Mcm10 binding site on p180 to a small region within the p180 N-terminal domain (residues 286-310). These findings, together with data for DNA and p180 binding to an Mcm10 construct that contains both the ID and CTD, provide the first mechanistic insight into how Mcm10 might use a handoff mechanism to load and stabilize pol {alpha} within the replication fork.

  11. On the tertiary structure of satellite DNA.

    PubMed

    Beridze, T; Tsirekidze, N; Roytberg, M A

    1992-02-01

    The primary structure of the Citrus ichangensis satellite DNA repeating unit has been estimated. The repeat is 181 bp long and contains four pentanucleotides of adenine residues. Oligomer forms of the stDNA repeating unit were detected by a partial hydrolysis of the C ichangensis stDNA by BspI restriction endonuclease. Experiments on comparative mobility of oligomers in agarose and polyacrylamide gels evidenced a certain retardation of those in polyacrylamide gel indicating to a slight bend in the repeating unit. The BEN computer program [9] was employed to calculate the spatial positions of monomer and oligomer axes of the satellite DNA repeating unit of Citrus ichangensis, mouse and African green monkey, and to plot their two-dimensional projections. The bends in the monomer for higher oligomer form proved to result in a hypothetical solenoid-like structure, termed coiled double helix (CDH).

  12. The Orbital Design of Alpha Centauri Exoplanet Satellite (ACESat)

    NASA Technical Reports Server (NTRS)

    Weston, Sasha; Belikov, Rus; Bendek, Eduardo

    2015-01-01

    Exoplanet candidates discovered by Kepler are too distant for biomarkers to be detected with foreseeable technology. Alpha Centauri has high separation from other stars and is of close proximity to Earth, which makes the binary star system 'low hanging fruit' for scientists. Alpha Centauri Exoplanet Satellite (ACESat) is a mission proposed to Small Explorer Program (SMEX) that will use a coronagraph to search for an orbiting planet around one of the stars of Alpha Centauri. The trajectory design for this mission is presented here where three different trajectories are considered: Low Earth Orbit (LEO), Geosynchronous Orbit (GEO) and a Heliocentric Orbit. Uninterrupted stare time to Alpha Centauri is desirable for meeting science requirements, or an orbit that provides 90% stare time to the science target. The instrument thermal stability also has stringent requirements for proper function, influencing trajectory design.

  13. Accessory proteins for DNA polymerase alpha activity with single-strand DNA templates.

    PubMed Central

    Lamothe, P; Baril, B; Chi, A; Lee, L; Baril, E

    1981-01-01

    Three forms of DNA polymerase alpha [DNA nucleotidyltransferase (DNA-directed), EC 2.7.7.7] were partially purified from the combined nuclear extract and postmicrosomal supernatant solution of synchronized HeLa cells. These enzymes, designated DNA polymerases alpha 1, alpha 2, and alpha 3, on the basis of their order of elution from DEAE-Bio-Gel, differ in their abilities to utilize single-strand DNA templates. DNA polymerase alpha 2 has equal catalytic activities with activated and single-strand DNAs as template-primers. DNA polymerase alpha 1 has only partial catalytic activity with single-strand DNA templates, and DNA polymerase alpha 3 is essentially inactive with this template. Successive steps of hydrophobic affinity chromatography and phosphocellulose chromatography of DNA polymerase alpha 2 resolved the polymerase alpha activity and two protein factors (C1 and C2) that are required for its catalytic activity with a DNA template-primer that contains extended single-strand regions. In the absence of the factors, DNA polymerase alpha activity is measurable with activated but not single-strand DNA templates. In the presence of the C1 and C2 factors DNA polymerase alpha activity with single-strand DNA templates is restored to about 75% of the catalytic activity of DNA polymerase alpha 2 with this template. Images PMID:6946421

  14. [DNA diagnosis of alpha-herpesvirinae infection].

    PubMed

    Hondo, R; Ito, S

    2000-04-01

    Herpesviruses have a characteristic of the latency after the primary infection. Advanced study on the causal relation between the reactivation of latent virus and the appearance of the symptoms would need both of the detection of viral genome by the DNA diagnosis method and the analysis of the kinetics of the virus. We developed a new quantitative method for the detection and the titration of copy number in the viral genome using the combination of polymerase chain reaction and microplate hybridization. The availability of the method was confirmed by the several cases of alpha-herpesvirinae infections.

  15. DNA polymerase alpha and beta in the California urchin.

    PubMed Central

    Racine, F M; Morris, P W

    1978-01-01

    DNA polymerase alpha and beta were identified in the urchin, Strongylocentrotus purpuratus. The DNA polymerase beta sedimented at 3.4 S, constituted 5% of total DNA polymerase activity, and was resistant to N-ethylmaleimide and high ionic strength. The polymerase alpha sedimented at 6--8 S, was inhibited by N-ethylmalemide or 0.1 M (NH4)2SO4, and was dependent upon glycerol for preservation of activity. Both the polymerases alpha and beta were nuclear associated in embryos. The DNA polymerase alpha was markedly heterogeneous on DEAE-Sephadex ion exchange and showed three modal polymerase species. These polymerase alpha species were indistinguishable by template activity assays but the DNA polymerase associated ribonucleotidyl transferase (Biochemistry 75 : 3106-3113, 1976) was found predominantly with only one of the DNA polymerase alpha species. PMID:569291

  16. Characterization of a chromosome-specific chimpanzee alpha satellite subset: Evolutionary relationship to subsets on human chromosomes

    SciTech Connect

    Warburton, P.E.; Gosden, J.; Lawson, D.

    1996-04-15

    Alpha satellite DNA is a tandemly repeated DNA family found at the centromeres of all primate chromosomes examined. The fundamental repeat units of alpha satellite DNA are diverged 169- to 172-bp monomers, often found to be organized in chromosome-specific higher-order repeat units. The chromosomes of human (Homo sapiens (HSA)), chimpanzee (Pan troglodytes (PTR) and Pan paniscus), and gorilla (Gorilla gorilla) share a remarkable similarity and synteny. It is of interest to ask if alpha satellite arrays at centromeres of homologous chromosomes between these species are closely related (evolving in an orthologous manner) or if the evolutionary processes that homogenize and spread these arrays within and between chromosomes result in nonorthologous evolution of arrays. By using PCR primers specific for human chromosome 17-specific alpha satellite DNA, we have amplified, cloned, and characterized a chromosome-specific subset from the PTR chimpanzee genome. Hybridization both on Southern blots and in situ as well as sequence analysis show that this subset is most closely related, as expected, to sequences on HSA 17. However, in situ hybridization reveals that this subset is not found on the homologous chromosome in chimpanzee (PTR 19), but instead on PTR 12, which is homologous to HSA 2p. 40 refs., 3 figs.

  17. [Non-radioactive in situ hybridization of alpha-satellite sequences in cytogenetic diagnosis].

    PubMed

    Perfumo, C; Arslanian, A; Zara, F; Piombo, G; Pierluigi, M

    1992-01-01

    Non isotopic in situ hybridization with alpha-satellite DNA probes in the cytogenetic diagnosis. Standard banding cytogenetic techniques do not always allow to define the structure and the origin of chromosome rearrangements involving the centromere region. Non-isotopic in situ hybridization of alphoid sequences has allowed to determine the origin of the centromeres in the metaphases of 5 patients referred to us for: 2 structural rearrangements involving chromosome 21, 2 structural rearrangements involving chromosome Y and 1 reciprocal translocation involving on chromosome 20 and one chromosome 15.

  18. [Non-radioactive in situ hybridization of alpha-satellite sequences in cytogenetic diagnosis].

    PubMed

    Perfumo, C; Arslanian, A; Zara, F; Piombo, G; Pierluigi, M

    1992-01-01

    Non isotopic in situ hybridization with alpha-satellite DNA probes in the cytogenetic diagnosis. Standard banding cytogenetic techniques do not always allow to define the structure and the origin of chromosome rearrangements involving the centromere region. Non-isotopic in situ hybridization of alphoid sequences has allowed to determine the origin of the centromeres in the metaphases of 5 patients referred to us for: 2 structural rearrangements involving chromosome 21, 2 structural rearrangements involving chromosome Y and 1 reciprocal translocation involving on chromosome 20 and one chromosome 15. PMID:1465321

  19. Influence of DNA methylation on positioning and DNA flexibility of nucleosomes with pericentric satellite DNA.

    PubMed

    Osakabe, Akihisa; Adachi, Fumiya; Arimura, Yasuhiro; Maehara, Kazumitsu; Ohkawa, Yasuyuki; Kurumizaka, Hitoshi

    2015-10-01

    DNA methylation occurs on CpG sites and is important to form pericentric heterochromatin domains. The satellite 2 sequence, containing seven CpG sites, is located in the pericentric region of human chromosome 1 and is highly methylated in normal cells. In contrast, the satellite 2 region is reportedly hypomethylated in cancer cells, suggesting that the methylation status may affect the chromatin structure around the pericentric regions in tumours. In this study, we mapped the nucleosome positioning on the satellite 2 sequence in vitro and found that DNA methylation modestly affects the distribution of the nucleosome positioning. The micrococcal nuclease assay revealed that the DNA end flexibility of the nucleosomes changes, depending on the DNA methylation status. However, the structures and thermal stabilities of the nucleosomes are unaffected by DNA methylation. These findings provide new information to understand how DNA methylation functions in regulating pericentric heterochromatin formation and maintenance in normal and malignant cells.

  20. Sequence-induced curvature of Tenebrio molitor satellite DNA.

    PubMed

    Plohl, M; Borstnik, B; Ugarković, D; Gamulin, V

    1990-09-01

    Single satellite DNA constitutes about 50% of the Tenebrio molitor genome. Electrophoresis of 142 base pair long satellite monomers on nondenaturating polyacrylamide gel shows retarded mobility, a characteristic of fragments with sequence-induced DNA curvature. Migrational analysis of circularly permuted satellite monomers revealed the existence of 2 bend centers in the monomer sequence. We calculated the trajectory of DNA helix axis according to the algorithm of De Santis et al. This model predicts that T molitor naked satellite DNA forms a solenoid structure with left-handed superhelix. One turn of the superhelix has approximately 310 base pairs and a 33 nm pitch. Point mutations found in the satellite DNA (1.8%) influence bending characteristics, but do not distort the general geometry of satellite superhelix.

  1. Accuracy of DNA polymerase-alpha in copying natural DNA.

    PubMed Central

    Grosse, F; Krauss, G; Knill-Jones, J W; Fersht, A R

    1983-01-01

    The fidelity of DNA polymerase-alpha from calf thymus (9S enzyme) in copying bacteriophage phi174am16 DNA in vitro has been determined from the frequency of production of different revertants. In the self-priming reaction we were able to measure the frequencies of base pairing mismatches during the course of replication on biasing the ratios of deoxynucleoside triphosphates. The frequency of dGTP:T, dGTP:G and dATP:G mismatches were 7.6 x 10(-5), 4.4 x 10(-5) and 2.8 x 10(-5), respectively, at equal concentrations of the deoxynucleoside triphosphates. dCTP:A, dGTP:A, dCTP:T and dTTP:T mismatches were below the limit of detection (<5 x 10(-6)). A synthetic dodecamer primer with a 3' end covering the first two bases of the amber codon was used to determine the misinsertion frequency of the first nucleotide incorporated. This gave a misinsertion frequency of 1.5 x 10(-4) for the dGTP:T mismatch, which is slightly higher than that observed from the pool bias studies. Further, it showed no sensitivity to biasing the nucleotide pool, suggesting a different mechanism for the incorporation of the first nucleotide. These data do not support 'energy-relay'-like models for achieving high accuracy in eukaryotes. The observed misinsertion frequencies were corrected for mismatch repair of the heteroduplexes during the transfection experiments by parallel experiments using a mismatched primer. This was synthesized to have the same G:T mismatch as produced in the preceding experiment. PMID:11892804

  2. Organization and Molecular Evolution of CENP-A–Associated Satellite DNA Families in a Basal Primate Genome

    PubMed Central

    Lee, Hye-Ran; Hayden, Karen E.; Willard, Huntington F.

    2011-01-01

    Centromeric regions in many complex eukaryotic species contain highly repetitive satellite DNAs. Despite the diversity of centromeric DNA sequences among species, the functional centromeres in all species studied to date are marked by CENP-A, a centromere-specific histone H3 variant. Although it is well established that families of multimeric higher-order alpha satellite are conserved at the centromeres of human and great ape chromosomes and that diverged monomeric alpha satellite is found in old and new world monkey genomes, little is known about the organization, function, and evolution of centromeric sequences in more distant primates, including lemurs. Aye-Aye (Daubentonia madagascariensis) is a basal primate and is located at a key position in the evolutionary tree to study centromeric satellite transitions in primate genomes. Using the approach of chromatin immunoprecipitation with antibodies directed to CENP-A, we have identified two satellite families, Daubentonia madagascariensis Aye-Aye 1 (DMA1) and Daubentonia madagascariensis Aye-Aye 2 (DMA2), related to each other but unrelated in sequence to alpha satellite or any other previously described primate or mammalian satellite DNA families. Here, we describe the initial genomic and phylogenetic organization of DMA1 and DMA2 and present evidence of higher-order repeats in Aye-Aye centromeric domains, providing an opportunity to study the emergence of chromosome-specific modes of satellite DNA evolution in primate genomes. PMID:21828373

  3. DNA encoding an. alpha. sub 2B -adrenergic receptor

    SciTech Connect

    Weinshank, R.L.; Hartig, P.R.

    1991-10-01

    This paper describes an isolated nucleic acid molecule encoding a human alpha 2B-adrenergic receptor. This patent also describes an isolated nucleic acid molecule, wherein the isolated nucleic acid molecule is a DNA molecule and a mammalian cell comprising the DNA molecule.

  4. K{alpha} satellite transitions in elements with 12{<=}Z{<=}30 produced by electron incidence

    SciTech Connect

    Limandri, Silvina P.; Carreras, Alejo C.; Trincavelli, Jorge C.; Bonetto, Rita D.

    2010-09-15

    The emission of x-ray satellite lines in the K{alpha} region of Mg, Si, Sc, Ti, Cr, Fe, Ni, and Zn induced by electron incidence was studied by means of wavelength dispersive spectroscopy. The satellite lines studied were K{alpha}{sup '}, K{alpha}{sub 3}, K{alpha}{sub 4}, K{alpha}{sub 5}, K{alpha}{sub 6}, and two transitions denoted here as K{alpha}{sub 22} and K{alpha}{sub 12}. Energy shifts with respect to the main K{alpha}{sub 1} diagram line and transition probabilities relative to the whole K{alpha} group were determined for a number of lines through a careful spectral processing. The dependence of these parameters, as well as of the K{beta}:K{alpha} intensity ratio, on the atomic number was compared with previous experimental and theoretical determinations when available. A discussion about the different mechanisms responsible for vacancy creation involved in the production of double-ionization satellites was performed in the light of the results obtained. Finally, the behavior of the satellite intensities as a function of the incidence energy was discussed for silicon.

  5. Characterization of a satellite DNA from Antilocapra americana.

    PubMed

    Denome, R M; O'Callaghan, B; Luitjens, C; Harper, E; Bianco, R

    1994-08-01

    The nucleotide sequence of a cloned satellite DNA from Antilocapra americana (American pronghorn antelope) is presented. The 1477-bp satellite is composed of degenerate 31-bp sub-repeats which are very similar in sequence to those of the major satellite DNAs from cattle and sheep. The sub-repeat sequence is more degenerate and variable in pronghorn than it is in cattle or sheep. The sequence is organized in the pronghorn genome in multicopy tandem arrays. PMID:8056340

  6. Mechanism of release of active alpha subunit from dimeric alpha beta avian myeloblastosis virus DNA polymerase.

    PubMed Central

    Papas, T S; Marciani, D J; Samuel, K; Chirikjian, J G

    1976-01-01

    Storage of the dimeric (alphabeta) form of avian myeloblastosis virus (AMV) DNA polymerase in glycerol resulted in the release of the smaller alpha subunit, as detected by glycerol gradient sedimentation. Analysis by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of enzyme stored in glycerol showed the concomitant appearance of several polypeptides and a lowering in the level of both beta and alpha components. This reduction appears to be the result of cleavages introduced by traces of hydrolytic activity present in glycerol samples. An enhancement of alpha subunit released, as detected by activity profile, was also achieved upon direct but limited exposure of purified avian myeloblastosis virus DNA polymerase to carboxymethyl-cellulose-bound trypsin matrix. Electrophoretic analysis of digested enzyme revealed a progressive fragmentation, with simultaneous increase in the alpha subunit and decrease in the beta subunit. PMID:58080

  7. Satellite DNA in Plants: More than Just Rubbish.

    PubMed

    Garrido-Ramos, Manuel A

    2015-01-01

    For decades, satellite DNAs have been the hidden part of genomes. Initially considered as junk DNA, there is currently an increasing appreciation of the functional significance of satellite DNA repeats and of their sequences. Satellite DNA families accumulate in the heterochromatin in different parts of the eukaryotic chromosomes, mainly in pericentromeric and subtelomeric regions, but they also span the functional centromere. Tandem repeat sequences may spread from subtelomeric to interstitial loci, leading to the formation of chromosome-specific loci or to the accumulation in equilocal sites in different chromosomes. They also appear as the main components of the heterochromatin in the sex-specific region of sex chromosomes. Satellite DNA, required for chromosome organization, also plays a role in pairing and segregation. Some satellite repeats are transcribed and can participate in the formation and maintenance of heterochromatin structure and in the modulation of gene expression. In addition to the identification of the different satellite DNA families, their characteristics and location, we are interested in determining their impact on the genomes, by identifying the mechanisms leading to their appearance and amplification as well as in understanding how they change over time, the factors affecting these changes, and the influence exerted by the evolutionary history of the organisms. On the other hand, satellite DNA sequences are rapidly evolving sequences that may cause reproductive barriers between organisms and promote speciation. The accumulation of experimental data collected in recent years and the emergence of new approaches based on next-generation sequencing and high-throughput genome analysis are opening new perspectives that are changing our understanding of satellite DNA. This review examines recent data to provide a timely update on the overall information gathered about this part of the genome, focusing on the advances in the knowledge of its

  8. Satellite DNA sequences in the red kangaroo (Macropus rufus).

    PubMed

    Elizur, A; Dennis, E S; Peacock, W J

    1982-01-01

    There is a complex pattern of satellite DNA sequences in M. rufus which are revealed by addition of Ag+ or dye (Hoechst 33258) to the DNA ink Cs2SO4 or CsCl equilibrium density gradients. Six satellite DNA fractions have been isolated; these have buoyant densities in neutral CsCl of 1.692, 1.704, 1.705, 1.707 (two), 1.710 and 1.712 g/ml compared with 1.696 g/ml for the main band DNA. Each satellite accounts for 1-3% of the DNA of the genome. The satellites are located in the centromeric heterochromatin of the chromosomes, in the nucleolar organizer region and in interstitial bands on some of the autosomes, each satellite having a unique distribution. Nucleic acid hybridization showed that six of the satellite sequences are also present in the genomes of the wallaroo and the red-necked wallaby, with sequence divergences of only 1-2% relative to the sequences in the red kangaroo.

  9. Inhibition of DNA polymerase alpha by aphidicolin derivatives.

    PubMed Central

    Arabshahi, L; Brown, N; Khan, N; Wright, G

    1988-01-01

    17-Acetylaphidicolin was 10-fold weaker and two derivatives lacking hydroxyl groups at the 16 and 17 positions were 100-fold weaker than aphidicolin as inhibitors of DNA polymerase alpha from HeLa and Chinese hamster ovary cells. 17,18-Diacetyl, 3,17,18-triacetyl and 3-epi derivatives of aphidicolin were inactive. Active compounds were, like aphidicolin, competitive with dCTP and did not inhibit aphidicolin-resistant DNA polymerases. PMID:3133639

  10. Inhibition of DNA polymerase alpha by aphidicolin derivatives.

    PubMed

    Arabshahi, L; Brown, N; Khan, N; Wright, G

    1988-06-10

    17-Acetylaphidicolin was 10-fold weaker and two derivatives lacking hydroxyl groups at the 16 and 17 positions were 100-fold weaker than aphidicolin as inhibitors of DNA polymerase alpha from HeLa and Chinese hamster ovary cells. 17,18-Diacetyl, 3,17,18-triacetyl and 3-epi derivatives of aphidicolin were inactive. Active compounds were, like aphidicolin, competitive with dCTP and did not inhibit aphidicolin-resistant DNA polymerases.

  11. Heterochromatin and satellite DNA in man: properties and prospects.

    PubMed Central

    Miklos, G L; John, B

    1979-01-01

    In reviewing the properties of heterochromatin and satellite DNA in man, it is clear that the human genome does not readily lend itself to experimental tests of the postulated functions for satellite DNA. Since the spectrum of known structural properties of vertebrate and invertebrate satellite DNAs are broadly overlapping, an alternative avenue is to experimentally manipulate the heterochromatin of an organism, and then evaluate the generality of the results. When this is done in Drosophila melanogaster, the one organism where such an experimental approach is indeed possible, the results provide no support for most of the popular hypotheses concerning satellite DNA function. They do, however, reveal an important effect on the meiotic system, namely that the position of crossover events can be markedly altered in the presence of heterochromatin known to be rich in satellite DNAs. This effect is not peculiar to Drosophila, since supporting data are readily available from natural situations in both mammals and grasshoppers. In all such cases, the effects are most easily discernible where the heterochromatic blocks are substantial in size, and non-centric in location, situations which do not apply in man. The human system, however, offers other potentials. The ubiquity of naturally occurring heterochromatic polymorphisms, coupled with the extreme sensitivity of the human genome to perturbation, offers some scope for assessing the possible somatic effects of alterations in the amount of satellite DNA. PMID:111544

  12. Properties of CENP-B and its target sequence in a satellite DNA

    SciTech Connect

    Masumoto, H.; Yoda, K.; Ikeno, M.; Kitagawa, K.; Muro, Y.; Okazaki, T.

    1993-12-31

    The centromere plays an essential role in the proper segregation of eukaryotic chromosomes at mitosis and meiosis. The centromere is the multifunctional domain of chromosome responsible for sister chromatid association at the inner site and for microtubule attachment at the outer surface. It also acts as a mechanochemical motor for chromosome movement. These multiple centromere functions must, in some way, be directed by a cis-acting DNA sequence located in the centromere region. Indeed, specific centromere DNA sequences (CEN-DNA) were identified in two yeast species. In Saccharomyces cerevisiae, CEN-DNA consists of roughly 125 bp sequence composed of three conserved elements. In contrast, the centromere sequence of S. pombe is quite different from S. cerevisiae in length and sequence organization. The molecular bases for understanding the structure and function of the centromere/kinetochore domain have not been elucidated in higher eukaryotes. In mammalian cells, satellite DNA`s are localized in the centromeric heterochromatin or heterochromatic arm. In all human chromosomes, the alpha satellite or alphoid DNA family, a highly repetitive DNA composed of about 170 bp fundamental monomer repeating units, is found at the primary constriction. Its function, however, has not been established.

  13. A functional marker centromere with no detectable alpha-satellite, satellite III, or CENP-B protein: activation of a latent centromere?

    PubMed Central

    Voullaire, L E; Slater, H R; Petrovic, V; Choo, K H

    1993-01-01

    We report the investigation of an unusual human supernumerary marker chromosome 10 designated "mar del(10)." This marker is present together with two other marker chromosomes in the karyotype of a boy with mild developmental delay. It has a functional centromere at a primary constriction and is mitotically stable. Fluorescence in situ hybridization (FISH) using alpha-satellite and satellite III DNA as probes failed to detect any signal at the primary constriction site. CENP-B protein could not be demonstrated, although the presence of at least some centromeric proteins was confirmed using a CREST antiserum. Consideration of these and other cytogenetic and FISH results supports a mechanism of formation of the mar del(10) chromosome involving the activation of a latent intercalary centromere at 10q25. Images Figure 5 Figure 1 Figure 2 Figure 3 Figure 4 Figure 6 PMID:7684888

  14. A DNA primase activity associated with DNA polymerase alpha from Drosophila melanogaster embryos.

    PubMed Central

    Conaway, R C; Lehman, I R

    1982-01-01

    Preparations of DNA polymerase alpha from early embryos of Drosophila melanogaster catalyze the ATP-dependent synthesis of DNA with single-stranded M13 DNA or poly(dT) templates. In the case of M13 DNA, GTP, but not UTP or CTP, can replace ATP. The reaction is completely dependent on added template and is not inhibited by alpha-amanitin. Alkaline hydrolysis of the product synthesized in the presence of [alpha-32P]dATP and poly(dT) generates 32P-labeled 3'(2') adenylate, showing that a covalent ribo-deoxynucleotide linkage is formed. Furthermore, incorporation of ribonucleotides occurs at the 5' end of the newly synthesized polynucleotide chain. These findings are consistent with the hypothesis that a ribo-oligonucleotide primer is synthesized by primase action and subsequently elongated by DNA polymerase. Under the appropriate conditions, DNA polymerase I from Escherichia coli can elongate primers formed by primase in the presence of ATP and poly(dT). Primase activity copurifies with DNA polymerase alpha and may be part of the multisubunit polymerase molecule. Images PMID:6806812

  15. Contrasting evolution of a satellite DNA and its ancestral IGS rDNA in Phaseolus (Fabaceae).

    PubMed

    Almeida, Cícero; Fonsêca, Artur; dos Santos, Karla Galvão Bezerra; Mosiolek, Magdalena; Pedrosa-Harand, Andrea

    2012-09-01

    CC4 is a satellite DNA from common bean (Phaseolus vulgaris L.) that is similar to its intergenic spacer (IGS) rDNA. CC4 was originally hypothesized to be an old, fast evolving satellite family that has invaded common bean rDNA. To test this hypothesis and contribute to the understanding of IGS-like satellite DNA evolution, we have investigated its distribution in the genus Phaseolus and related species. CC4 was cloned and used as probe for Southern blot and FISH experiments. CC4 was observed as an independent satellite in common bean, forming two to three major and a few minor pericentromeric clusters. In Phaseolus coccineus, CC4 was present in four major clusters, also not co-localized with the 45S rDNA sites. Remarkably, in the less related species of the genus, signals were detected co-localized with the 45S rDNA sites, but co-localization was not observed in the species where CC4 is present as an independent satellite. No signal was detected in species from related genera. Altogether, the data suggest that CC4 has originated from the IGS rDNA in the P. vulgaris-P. coccineus lineage and has evolved slower than the IGS rDNA from this lineage.

  16. Contrasting evolution of a satellite DNA and its ancestral IGS rDNA in Phaseolus (Fabaceae).

    PubMed

    Almeida, Cícero; Fonsêca, Artur; dos Santos, Karla Galvão Bezerra; Mosiolek, Magdalena; Pedrosa-Harand, Andrea

    2012-09-01

    CC4 is a satellite DNA from common bean (Phaseolus vulgaris L.) that is similar to its intergenic spacer (IGS) rDNA. CC4 was originally hypothesized to be an old, fast evolving satellite family that has invaded common bean rDNA. To test this hypothesis and contribute to the understanding of IGS-like satellite DNA evolution, we have investigated its distribution in the genus Phaseolus and related species. CC4 was cloned and used as probe for Southern blot and FISH experiments. CC4 was observed as an independent satellite in common bean, forming two to three major and a few minor pericentromeric clusters. In Phaseolus coccineus, CC4 was present in four major clusters, also not co-localized with the 45S rDNA sites. Remarkably, in the less related species of the genus, signals were detected co-localized with the 45S rDNA sites, but co-localization was not observed in the species where CC4 is present as an independent satellite. No signal was detected in species from related genera. Altogether, the data suggest that CC4 has originated from the IGS rDNA in the P. vulgaris-P. coccineus lineage and has evolved slower than the IGS rDNA from this lineage. PMID:23050694

  17. Synthesis of hybrid bacterial plasmids containing highly repeated satellite DNA.

    PubMed

    Brutlag, D; Fry, K; Nelson, T; Hung, P

    1977-03-01

    Hybrid plasmid molecules containing tandemly repeated Drosophila satellite DNA were constructed using a modification of the (dA)-(dT) homopolymer procedure of Lobban and Kaiser (1973). Recombinant plasmids recovered after transformation of recA bacteria contained 10% of the amount of satellite DNA present in the transforming molecules. The cloned plasmids were not homogenous in size. Recombinant plasmids isolated from a single colony contained populations of circular molecules which varied both in the length of the satellite region and in the poly(dA)-(dt) regions linking satellite and vector. While subcloning reduced the heterogeneity of these plasmid populations, continued cell growth caused further variations in the size of the repeated regions. Two different simple sequence satellites of Drosophila melanogaster (1.672 and 1.705 g/cm3) were unstable in both recA and recBC hosts and in both pSC101 and pCR1 vectors. We propose that this recA-independent instability of tandemly repeated sequences is due to unequal intramolecular recombination events in replicating DNA molecules, a mechanism analogous to sister chromatid exchange in eucaryotes. PMID:403010

  18. Mutation and recombination in cattle satellite DNA: a feedback model for the evolution of satellite DNA repeats.

    PubMed

    Nijman, I J; Lenstra, J A

    2001-04-01

    The cattle genome contains several distinct centromeric satellites with interrelated evolutionary histories. We compared these satellites in Bovini species that diverged 0.2 to about 5 Myr ago. Quantification of hybridization signals by phosphor imaging revealed a large variation in the relative amounts of the major satellites. In the genome of water buffalo this has led to the complete deletion of satellite III. Comparative sequencing and PCR-RFLP analysis of satellites IV, 1.711a, and 1.711b from the related Bos and Bison species revealed heterogeneities in 0.5 to 2% of the positions, again with variations in the relative amounts of sequence variants. Restriction patterns generated by double digestions suggested a recombination of sequence variants. Our results are compatible with a model of the life history of satellites during which homogeneity of interacting repeat units is both cause and consequence of the rapid turnover of satellite DNA. Initially, a positive feedback loop leads to a rapid saltatory amplification of homogeneous repeat units. In the second phase, mutations inhibit the interaction of repeat units and coexisting sequence variants amplify independently. Homogenization by the spreading of one of the variants is prevented by recombination and the satellite is eventually outcompeted by another, more homogeneous tandem repeat sequence.

  19. Detection of alpha particles using DNA/Al Schottky junctions

    SciTech Connect

    Al-Ta'ii, Hassan Maktuff Jaber E-mail: vengadeshp@um.edu.my; Periasamy, Vengadesh E-mail: vengadeshp@um.edu.my; Amin, Yusoff Mohd

    2015-09-21

    Deoxyribonucleic acid or DNA can be utilized in an organic-metallic rectifying structure to detect radiation, especially alpha particles. This has become much more important in recent years due to crucial environmental detection needs in both peace and war. In this work, we fabricated an aluminum (Al)/DNA/Al structure and generated current–voltage characteristics upon exposure to alpha radiation. Two models were utilized to investigate these current profiles; the standard conventional thermionic emission model and Cheung and Cheung's method. Using these models, the barrier height, Richardson constant, ideality factor and series resistance of the metal-DNA-metal structure were analyzed in real time. The barrier height, Φ value calculated using the conventional method for non-radiated structure was 0.7149 eV, increasing to 0.7367 eV after 4 min of radiation. Barrier height values were observed to increase after 20, 30 and 40 min of radiation, except for 6, 8, and 10 min, which registered a decrease of about 0.67 eV. This was in comparison using Cheung and Cheung's method, which registered 0.6983 eV and 0.7528 eV for the non-radiated and 2 min of radiation, respectively. The barrier height values, meanwhile, were observed to decrease after 4 (0.61 eV) to 40 min (0.6945 eV). The study shows that conventional thermionic emission model could be practically utilized for estimating the diode parameters including the effect of series resistance. These changes in the electronic properties of the Al/DNA/Al junctions could therefore be utilized in the manufacture of sensitive alpha particle sensors.

  20. Detection of alpha particles using DNA/Al Schottky junctions

    NASA Astrophysics Data System (ADS)

    Al-Ta'ii, Hassan Maktuff Jaber; Periasamy, Vengadesh; Amin, Yusoff Mohd

    2015-09-01

    Deoxyribonucleic acid or DNA can be utilized in an organic-metallic rectifying structure to detect radiation, especially alpha particles. This has become much more important in recent years due to crucial environmental detection needs in both peace and war. In this work, we fabricated an aluminum (Al)/DNA/Al structure and generated current-voltage characteristics upon exposure to alpha radiation. Two models were utilized to investigate these current profiles; the standard conventional thermionic emission model and Cheung and Cheung's method. Using these models, the barrier height, Richardson constant, ideality factor and series resistance of the metal-DNA-metal structure were analyzed in real time. The barrier height, Φ value calculated using the conventional method for non-radiated structure was 0.7149 eV, increasing to 0.7367 eV after 4 min of radiation. Barrier height values were observed to increase after 20, 30 and 40 min of radiation, except for 6, 8, and 10 min, which registered a decrease of about 0.67 eV. This was in comparison using Cheung and Cheung's method, which registered 0.6983 eV and 0.7528 eV for the non-radiated and 2 min of radiation, respectively. The barrier height values, meanwhile, were observed to decrease after 4 (0.61 eV) to 40 min (0.6945 eV). The study shows that conventional thermionic emission model could be practically utilized for estimating the diode parameters including the effect of series resistance. These changes in the electronic properties of the Al/DNA/Al junctions could therefore be utilized in the manufacture of sensitive alpha particle sensors.

  1. Inhibition of DNA polymerase alpha activity by ammonium 21-tungsto-9-antimoniate (HPA23).

    PubMed

    Ono, K; Nakane, H; Matsumoto, T; Barré-Sinoussi, F; Chermann, J C

    1984-01-01

    Ammonium 21-tungsto-9-antimoniate (HPA23), an inorganic condensed ion, was shown to be a potent inhibitor for DNA polymerase alpha but not for beta. It inhibited the activity of mammalian DNA polymerase alpha in noncompetitive fashion with respect to either of deoxynucleotide substrate and template X primer, indicating the presence of a specific binding site for HPA23 on DNA polymerase alpha molecule. The Ki of the alpha polymerase for HPA23 was 24 nM. A possible interaction of HPA23 with DNA polymerase alpha is discussed.

  2. Satellite DNA derived from 5S rDNA in Physalaemus cuvieri (Anura, Leiuperidae).

    PubMed

    Vittorazzi, S E; Lourenço, L B; Del-Grande, M L; Recco-Pimentel, S M

    2011-01-01

    In the present study, we describe for the first time a family of 190-bp satellite DNA related to 5S rDNA in anurans and the existence of 2 forms of 5S rDNA, type I (201 bp) and type II (690 bp). The sequences were obtained from genomic DNA of Physalaemus cuvieri from Palmeiras, State of Bahia, Brazil. Analysis of the nucleotide sequence revealed that the satellite DNA obtained by digestion with EcoRI, called PcP190EcoRI, is 70% similar to the coding region of type I 5S rDNA and 66% similar to the coding region of type II 5S rDNA. Membrane hybridization and PCR amplification of the sequence showed that PcP190EcoRI is tandemly repeated. The satellite DNA as well as type I and type II 5S rDNA were localized in P. cuvieri chromosomes by fluorescent in situ hybridization. The PcP190EcoRI sequence was found in the centromeres of chromosomes 1-5 and in the pericentromeric region of chromosome 3. Type I 5S rDNA was detected in chromosome 3, coincident with the site of PcP190EcoRI. Type II 5S rDNA was located interstitially in the long arm of chromosome 5. None of these sequences co-localized with nucleolar organizer regions. Our data suggests that this satellite DNA originates from the 5S ribosomal multigene family, probably by gene duplication, nucleotide divergence and sequence dispersion in the genome.

  3. Correlations between the activities of DNA polymerase alpha and the glucocorticoid receptor.

    PubMed Central

    Schmidt, T J; Bollum, F J; Litwack, G

    1982-01-01

    Specific inhibitors and anti-DNA polymerase alpha IgG have been utilized to probe for similarities between cytoplasmic rat hepatic glucocorticoid receptors and DNA polymerase alpha [DNA nucleotidyltransferase (DNA-directed), EC 2.7.7.7]. Rifamycin AF/013, an inhibitor of RNA and DNA polymerase activities, significantly inhibited the binding of activated [6,7-3H]-triamcinolone acetonide (TA) receptor complexes to DNA-cellulose. beta-Lapachone, an inhibitor of DNA polymerase alpha and reverse transcriptase activities, inhibited the specific binding of [6,7-3H]TA when preincubated with unbound receptors. Aphidicolin, another DNA polymerase alpha inhibitor, failed to inhibit any of the glucocorticoid-receptor functions tested. Two specific anti-DNA polymerase alpha IgGs interfered with glucocorticoid receptor functions as measured by their ability to inhibit the binding of [6,7-3H]TA to unbound receptors (85% maximal inhibition) and, to a lesser extent, to inhibit the binding of activated [6,7-3H]TA receptor complexes to DNA-cellulose (50% maximal inhibition). The anti-DNA polymerase alpha IgG and beta-lapachone failed to affect the binding of tritiated estradiol, progesterone, or 5 alpha-dihydrotestosterone to their receptors in appropriate rat target tissues or the binding of [1,2-3H]hydrocortisone to serum transcortin. The most obvious interpretation of these data is that cytoplasmic glucocorticoid receptors and DNA polymerase alpha share antigenic determinants. An alternative interpretation is that the polyclonal anti-DNA polymerase alpha antibody contains IgG molecules raised against calf thymus cytoplasmic activated glucocorticoid-receptor complexes that copurified with DNA polymerase alpha used as the antigen. Taken collectively, however, the antibody and inhibitor data suggest a relationship between DNA polymerase alpha and the glucocorticoid receptor. PMID:6812051

  4. Sequence analysis of frog alpha B-crystallin cDNA: sequence homology and evolutionary comparison of alpha A, alpha B and heat shock proteins.

    PubMed

    Lu, S F; Pan, F M; Chiou, S H

    1995-11-22

    alpha-Crystallin is a major lens protein present in the lenses of all vertebrate species. Recent studies have revealed that bovine alpha-crystallins possess genuine chaperone activity similar to small heat-shock proteins. In order to facilitate the determination of the primary sequence of amphibian alpha B-crystallin, cDNA encoding alpha B subunit chain was amplified using a new "Rapid Amplification of cDNA Ends" (RACE) protocol of Polymerase Chain Reaction (PCR). PCR-amplified product corresponding to alpha B subunit was then subcloned into pUC18 vector and transformed into E. coli strain JM109. Plasmids purified from the positive clones were prepared for nucleotide sequencing by the automatic fluorescence-based dideoxynucleotide chain-termination method. Sequencing more than five clones containing DNA inserts coding for alpha B-crystallin subunit constructed only one complete full-length reading frame of 522 base pairs similar to that of alpha A subunit, covering a deduced protein sequence of 173 amino acids including the universal translation-initiating methionine. The frog alpha B crystallin shows 69, 66 and 56% whereas alpha A crystallin shows 83, 81 and 69% sequence similarity to the homologous chains of bovine, chicken and dogfish, respectively, revealing a more divergent structural relationship among these alpha B subunits as compared to alpha A subunits. Structural analysis and comparison of alpha A- and alpha B-crystallin subunits from eye lenses of different classes of vertebrates also shed some light on the evolutionary relatedness between alpha B/alpha A crystallins and the small heat-shock proteins.

  5. DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori

    SciTech Connect

    Kuzuhara, T. Suganuma, M.; Oka, K.; Fujiki, H.

    2007-11-03

    Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggests a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.

  6. The complete cDNA sequence of laminin alpha 4 and its relationship to the other human laminin alpha chains.

    PubMed

    Richards, A; Al-Imara, L; Pope, F M

    1996-06-15

    We previously localised the gene (LAMA4) encoding a novel laminin alpha 4 chain to chromosome 6q21. In this study, we describe the complete coding sequence and compare the protein with the other three known human laminin alpha chains. Although closely linked to LAMA2, the LAMA4 product most closely resembles laminin alpha 3, a constituent of laminin 5. Like laminin alpha 3A, the alpha 4 chain is a truncated version of the alpha 1 and alpha 2 chains, with a much reduced short arm. While the alpha 4 molecule is most similar to alpha 3, it shares some features of the C-terminal domains G4 and G5 in common with alpha 2. Unlike the LAMA3 gene, LAMA4 appears to encode only a single transcript, as determined by 5' rapid amplification of cDNA ends. The cDNA sequence encodes 1816 amino acids, which include a 24-residue signal peptide. The gene is expressed in skin, placenta, heart, lung, skeletal muscle, and pancreas. We have also shown that the mRNA can be readily reverse transcribed and amplified from cultured dermal fibroblasts. PMID:8706685

  7. Cleavage patterns of Drosophila melanogaster satellite DNA by restriction enzymes.

    PubMed Central

    Shen, C J; Wiesehahn, G; Hearst, J E

    1976-01-01

    The five satellite DNAs of Drosophila melanogaster have been isolated by the combined use of different equilibrium density gradients and hydrolyzed by seven different restriction enzymes; Hae III, Hind II + Hind III, Hinf, Hpa II, EcoR I and EcoR II. The 1.705 satellite is not hydrolyzed by any of the enzymes tested. Hae III is the only restriction enzyme that cuts the 1.672 and 1.686 satellites. The cleavage products from either of these reactions has a heterogeneous size distribution. Part of the 1.688 satellite is cut by Hae III and by Hinf into three discrete fragments with M.W. that are multiples of 2.3 X 10(5) daltons (approximately 350 base pairs). In addition, two minor bands are detected in the 1.688-Hinf products. The mole ratios of the trimer, dimer and monomer are: 1:6.30 : 63.6 for 1.688-Hae III and 1 : 22.0 : 403 for 1.688-Hinf. Circular mitochondrial DNA (rho = 1.680) is cut into discrete fragments by all of the enzymes tested and molecular weights of these fragments have been determined. Images PMID:818625

  8. Human DNA polymerase. alpha. : Predicted functional domains and relationships with viral DNA polymerases

    SciTech Connect

    Wang, T.S.F.; Wong, S.W.; Korn, D. )

    1989-01-01

    The primary sequence of human DNA polymerase {alpha} deduced from the full-length cDNA contains regions of striking similarity to sequences in replicative DNA polymerases from Escherichia coli phages PRD1 and T4, Bacillus phage {phi}19, yeast DNA polymerase I, yeast linear plasmid pGKL1, maize S1 mitochondrial DNA, herpes family viruses, vaccinia virus, and adenovirus. The conservation of these homologous regions across this vast phylogenetic expanse indicates that these prokaryotic and eukaryotic DNA polymerases may all have evolved from a common primordial gene. Based on the sequence analysis and genetic results from yeast and herpes simplex virus studies, these consensus sequences are suggested to define potential sites that subserve essential roles in the DNA polymerase reaction. Two of these conserved regions appear to participate directly in the active site required for substrate deoxynucleotide interaction. One region toward the carboxyl-terminus has the potential to be the DNA interacting domain is predicted toward the amino-terminus. The provisional assignment of these domains can be used to identify unique or dissimilar features of functionally homologous catalytic sites in viral DBA polymerases of pathogenetic significance and thereby serve to guide more rational antiviral drug design.

  9. Alpha interferon-induced antiviral response noncytolytically reduces replication defective adenovirus DNA in MDBK cells.

    PubMed

    Guo, Ju-Tao; Zhou, Tianlun; Guo, Haitao; Block, Timothy M

    2007-12-01

    Although alpha interferon (IFN-alpha) is of benefit in the treatment of viral hepatitis B, HBV replication has been refractory to the cytokine in commonly used hepatocyte-derived cell lines. In search for a cell culture system to study the mechanism by which IFN-alpha inhibits HBV replication, we infected a variety of cell lines with an adenoviral vector containing a replication competent 1.3-fold genome length HBV DNA (AdHBV) and followed by incubation with IFN-alpha. We found that IFN-alpha efficiently decreased the level of HBV DNA replicative intermediates in AdHBV infected Madin-Darby bovine kidney (MDBK) cells. Further analysis revealed, surprisingly, that IFN-alpha did not directly inhibit HBV replication, rather the amount of adenovirus DNA in the nuclei of MDBK cells was reduced. As a consequence, HBV RNA transcription and DNA replication were inhibited. Experiments with adenoviral vector expressing a green fluorescent protein (GFP) further supported the notion that IFN-alpha treatment noncytolytically eliminated adenovirus DNA, but did not kill the vector infected MDBK cells. Our data suggest that IFN-alpha-induced antiviral program is able to discriminate host cellular DNA from episomal viral DNA and might represent a novel pathway of interferon mediate innate defense against DNA virus infections.

  10. Distinct double- and single-stranded DNA binding of E. coli replicative DNA polymerase III alpha subunit.

    PubMed

    McCauley, Micah J; Shokri, Leila; Sefcikova, Jana; Venclovas, Ceslovas; Beuning, Penny J; Williams, Mark C

    2008-09-19

    The alpha subunit of the replicative DNA polymerase III of Escherichia coli is the active polymerase of the 10-subunit bacterial replicase. The C-terminal region of the alpha subunit is predicted to contain an oligonucleotide binding (OB-fold) domain. In a series of optical tweezers experiments, the alpha subunit is shown to have an affinity for both double- and single-stranded DNA, in distinct subdomains of the protein. The portion of the protein that binds to double-stranded DNA stabilizes the DNA helix, because protein binding must be at least partially disrupted with increasing force to melt DNA. Upon relaxation, the DNA fails to fully reanneal, because bound protein interferes with the reformation of the double helix. In addition, the single-stranded DNA binding component appears to be passive, as the protein does not facilitate melting but instead binds to single-stranded regions already separated by force. From DNA stretching measurements we determine equilibrium association constants for the binding of alpha and several fragments to dsDNA and ssDNA. The results demonstrate that ssDNA binding is localized to the C-terminal region that contains the OB-fold domain, while a tandem helix-hairpin-helix (HhH) 2 motif contributes significantly to dsDNA binding. PMID:18652472

  11. Restriction enzyme mapping of the DNA of Streptomyces bacteriophage B alpha and its deletion derivatives.

    PubMed

    Ishihara, H; Nakano, M M; Ogawara, H

    1982-12-01

    Cleavage analysis of actinophage B alpha DNA was done with several restriction enzymes, and a restriction map of the DNA was determined. The DNA appeared to carry cohesive ends. Deletion mutants of actinophage B alpha were isolated by five cycles of treatment with 15 mM PPi. Both mutants had deletions of 2.5 of 1.8 megadaltons near one end of the genome, and one of them lost the single EcoRI cleavage site.

  12. alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

    PubMed Central

    Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L

    1988-01-01

    An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

  13. A complex between replication factor A (SSB) and DNA helicase stimulates DNA synthesis of DNA polymerase alpha on double-stranded DNA.

    PubMed

    Zhang, S; Grosse, F

    1992-11-01

    A helicase-like DNA unwinding activity was found in highly purified fractions of the calf thymus single-stranded DNA binding protein (ctSSB), also known as replication protein A (RP-A) or replication factor A (RF-A). This activity depended on the hydrolysis of ATP or dATP, and used CTP with a lower efficiency. ctSSB promoted the homologous DNA polymerase alpha to perform DNA synthesis on double-stranded templates containing replication fork-like structures. The rate and amount of DNA synthesis was found to be dependent on the concentration of ctSSB. At a 10-fold mass excess of ctSSB over double-stranded DNA, products of 200-600 nucleotides in length were obtained. This comprises or even exceeds the length of a eukaryotic Okazaki fragment. The ctSSB-associated DNA helicase activity is most likely a distinct protein rather than an inherent property of SSB, as inferred from titration experiments between SSB and DNA. The association of a helicase with SSB and the stimulatory action of this complex to the DNA polymerase alpha-catalyzed synthesis of double-stranded DNA suggests a cooperative function of the three enzymatic activities in the process of eukaryotic DNA replication.

  14. Human cDNA clones for four species of G alpha s signal transduction protein.

    PubMed Central

    Bray, P; Carter, A; Simons, C; Guo, V; Puckett, C; Kamholz, J; Spiegel, A; Nirenberg, M

    1986-01-01

    lambda gt11 cDNA libraries derived from human brain were screened with oligonucleotide probes for recombinants that code for alpha subunits of G signal transduction proteins. Eleven alpha s clones were detected with both probes and characterized. Four types of alpha s cDNA were cloned that differ in nucleotide sequence in the region that corresponds to amino acid residues 71-88. The clones differ in the codon for alpha s amino acid residue 71 (glutamic acid or aspartic acid), the presence or absence of codons for the next 15 amino acid residues, and the presence or absence of an adjacent serine residue. S1 nuclease protection experiments revealed at least two forms of alpha s mRNA. A mechanism for generating four species of alpha s mRNA by alternative splicing of precursor RNA is proposed. Images PMID:3024154

  15. Characterization and chromosomal distribution of satellite DNA sequences of the water buffalo (Bubalus bubalis).

    PubMed

    Tanaka, K; Matsuda, Y; Masangkay, J S; Solis, C D; Anunciado, R V; Namikawa, T

    1999-01-01

    Satellite DNA sequences were isolated from the water buffalo (Bubalus bubalis) after digestion with two restriction endonucleases, BamHI and StuI. These satellite DNAs of the water buffalo were classified into two types by sequence analysis: one had an approximately 1,400 bp tandem repeat unit with 79% similarity to the bovine satellite I DNA; the other had an approximately 700 bp tandem repeat unit with 81% similarity to the bovine satellite II DNA. The chromosomal distribution of the satellite DNAs were examined in the river-type and the swamp-type buffaloes with direct R-banding fluorescence in situ hybridization. Both the buffalo satellite DNAs were localized to the centromeric regions of all chromosomes in the two types of buffaloes. The hybridization signals with the buffalo satellite I DNA on the acrocentric autosomes and X chromosome were much stronger than that on the biarmed autosomes and Y chromosome, which corresponded to the distribution of C-band-positive centromeric heterochromatin. This centromere-specific satellite DNA also existed in the interstitial region of the long arm of chromosome 1 of the swamp-type buffalo, which was the junction of the telomere-centromere tandem fusion that divided the karyotype in the two types of buffaloes. The intensity of the hybridization signals with buffalo satellite II DNA was almost the same over all the chromosomes, including the Y chromosome, and no additional hybridization signal was found in noncentromeric sites.

  16. Molecular characterization of begomoviruses and DNA satellites associated with okra leaf curl disease in Cameroon.

    PubMed

    Leke, Walter N; Sattar, Muhammad N; Ngane, Emilia B; Ngeve, Jacob M; Kvarnheden, Anders; Brown, Judith K

    2013-06-01

    Okra leaf curl disease (OLCD) is the most important viral disease of okra in West Africa. In this study, a complex of begomoviruses and associated DNA satellites were identified in symptomatic okra plants from southwestern Cameroon. Sequence analyses showed that two of the plants (Lik1 and Njo5) were infected with a begomovirus being a recombinant of cotton leaf curl Gezira virus (CLCuGeV) and okra yellow crinkle virus (OYCrV). The recombinant genome shared highest nucleotide identity with isolates of CLCuGeV at 87.8% and is therefore considered to be member of a new begomovirus species, Okra leaf curl Cameroon virus (OLCuCMV). One plant (Mue5) was infected by a begomovirus with 95.8% nucleotide identy to CLCuGeV, while in the plants Lik1, Mue1 and Njo5, a begomovirus was identified showing highest nucleotide identity at 93.7% with OYCrV. The nucleotide comparisons and phylogenetic analyses suggest that these isolates represent new Cameroonian strains of CLCuGeV and OYCrV (CLCuGeV-CM and OYCrV-CM). Mixed infection of OLCuCMV and OYCrV-CM was found in two of the plants. A betasatellite and two divergent alphasatellites were also associated with the begomoviruses. The betasatellite was identified as cotton leaf curl Gezira betasatellite (CLCuGeB) with the highest nucleotide identity at 93.3% to other African isolates of CLCuGeB. The alphasatellites, herein named Alpha-1 and Alpha-2, shared 97.3% and 95.2% identity, respectively, with cotton leaf curl Gezira alphasatellite (CLCuGeA) and okra leaf curl Burkina Faso alphasatellite (OLCuBFA). These collective results emphasize the extent of diversity among okra-infecting begomovirus-satellite complexes in western Africa.

  17. The independent evolution of two closely related satellite DNA elements in rats (Rattus).

    PubMed Central

    Witney, F R; Furano, A V

    1983-01-01

    We have identified and determined the sequence and organization of a new rat satellite DNA in Rattus rattus, the roof rat. This satellite DNA, which we call R. rattus satellite I', consists of tandem arrays of a 185 base pair (bp) repeat unit that we call a'. a' is 86% homologous to a 185 bp portion of the 370 bp repeat unit of the previously described rat satellite [Pech et al. (1979) Nucleic Acids Res. 7, 417-432] present in the common laboratory rat species, R. norvegicus. We can thereby distinguish two 185 bp portions of the satellite I 370 bp repeat unit: "a" (homologous to a') and "b". Satellite I has the structure (a,b)n, and satellite I' has the structure (a')n. Like a, a' is only about 60% homologous to b and fails to hybridize to b. Although R. norvegicus and R. rattus contain about the same total concentration of satellite sequences, R. norvegicus contains essentially only the a,b type (satellite I), whereas R. rattus contains a' type (satellite I') and lesser amounts of the a,b type (satellite I). The a,b type (satellite I) in R. rattus is very similar to that in R. norvegicus as judged both by hybridization and by the presence of all but one of the major restriction enzyme sites that characterize the R. norvegicus satellite I. In R. rattus the a' and a,b repeat units are not detectably present in the same tandem array. All of the sequence differences between a' (R. rattus) and a (R. norvegicus) can be accounted for by simple base substitutions, and the implication of this and other features of rat satellite DNA structure for satellite DNA evolution are discussed. Images PMID:6298719

  18. Molecular Analysis and Genomic Organization of Major DNA Satellites in Banana (Musa spp.)

    PubMed Central

    Čížková, Jana; Hřibová, Eva; Humplíková, Lenka; Christelová, Pavla; Suchánková, Pavla; Doležel, Jaroslav

    2013-01-01

    Satellite DNA sequences consist of tandemly arranged repetitive units up to thousands nucleotides long in head-to-tail orientation. The evolutionary processes by which satellites arise and evolve include unequal crossing over, gene conversion, transposition and extra chromosomal circular DNA formation. Large blocks of satellite DNA are often observed in heterochromatic regions of chromosomes and are a typical component of centromeric and telomeric regions. Satellite-rich loci may show specific banding patterns and facilitate chromosome identification and analysis of structural chromosome changes. Unlike many other genomes, nuclear genomes of banana (Musa spp.) are poor in satellite DNA and the information on this class of DNA remains limited. The banana cultivars are seed sterile clones originating mostly from natural intra-specific crosses within M. acuminata (A genome) and inter-specific crosses between M. acuminata and M. balbisiana (B genome). Previous studies revealed the closely related nature of the A and B genomes, including similarities in repetitive DNA. In this study we focused on two main banana DNA satellites, which were previously identified in silico. Their genomic organization and molecular diversity was analyzed in a set of nineteen Musa accessions, including representatives of A, B and S (M. schizocarpa) genomes and their inter-specific hybrids. The two DNA satellites showed a high level of sequence conservation within, and a high homology between Musa species. FISH with probes for the satellite DNA sequences, rRNA genes and a single-copy BAC clone 2G17 resulted in characteristic chromosome banding patterns in M. acuminata and M. balbisiana which may aid in determining genomic constitution in interspecific hybrids. In addition to improving the knowledge on Musa satellite DNA, our study increases the number of cytogenetic markers and the number of individual chromosomes, which can be identified in Musa. PMID:23372772

  19. Molecular analysis and genomic organization of major DNA satellites in banana (Musa spp.).

    PubMed

    Čížková, Jana; Hřibová, Eva; Humplíková, Lenka; Christelová, Pavla; Suchánková, Pavla; Doležel, Jaroslav

    2013-01-01

    Satellite DNA sequences consist of tandemly arranged repetitive units up to thousands nucleotides long in head-to-tail orientation. The evolutionary processes by which satellites arise and evolve include unequal crossing over, gene conversion, transposition and extra chromosomal circular DNA formation. Large blocks of satellite DNA are often observed in heterochromatic regions of chromosomes and are a typical component of centromeric and telomeric regions. Satellite-rich loci may show specific banding patterns and facilitate chromosome identification and analysis of structural chromosome changes. Unlike many other genomes, nuclear genomes of banana (Musa spp.) are poor in satellite DNA and the information on this class of DNA remains limited. The banana cultivars are seed sterile clones originating mostly from natural intra-specific crosses within M. acuminata (A genome) and inter-specific crosses between M. acuminata and M. balbisiana (B genome). Previous studies revealed the closely related nature of the A and B genomes, including similarities in repetitive DNA. In this study we focused on two main banana DNA satellites, which were previously identified in silico. Their genomic organization and molecular diversity was analyzed in a set of nineteen Musa accessions, including representatives of A, B and S (M. schizocarpa) genomes and their inter-specific hybrids. The two DNA satellites showed a high level of sequence conservation within, and a high homology between Musa species. FISH with probes for the satellite DNA sequences, rRNA genes and a single-copy BAC clone 2G17 resulted in characteristic chromosome banding patterns in M. acuminata and M. balbisiana which may aid in determining genomic constitution in interspecific hybrids. In addition to improving the knowledge on Musa satellite DNA, our study increases the number of cytogenetic markers and the number of individual chromosomes, which can be identified in Musa.

  20. Pyridoxal 5'-phosphate is a selective inhibitor in vivo of DNA polymerase alpha and epsilon.

    PubMed

    Mizushina, Yoshiyuki; Xu, Xianai; Matsubara, Kiminori; Murakami, Chikako; Kuriyama, Isoko; Oshige, Masahiko; Takemura, Masaharu; Kato, Norihisa; Yoshida, Hiromi; Sakaguchi, Kengo

    2003-12-26

    Vitamin B(6) compounds such as pyridoxal 5(')-phosphate (PLP), pyridoxal (PL), pyridoxine (PN), and pyridoxamine (PM), which reportedly have anti-angiogenic and anti-cancer effects, were thought to be inhibitors of some types of eukaryotic DNA polymerases. PL moderately inhibited only the activities of calf DNA polymerase alpha (pol alpha), while PN and PM had no inhibitory effects on any of the polymerases tested. On the other hand, PLP, a phosphated form of PL, was potentially a strong inhibitor of pol alpha and epsilon from phylogenetic-wide organisms including mammals, fish, insects, plants, and protists. PLP did not suppress the activities of prokaryotic DNA polymerases such as Escherichia coli DNA polymerase I and Taq DNA polymerase, or DNA-metabolic enzymes such as deoxyribonuclease I. For pol alpha and epsilon, PLP acted non-competitively with the DNA template-primer and competitively with the nucleotide substrate. Since PL was converted to PLP in vivo after being incorporated into human cancer cells, the anti-angiogenic and anti-cancer effects caused by PL must have been caused by the inhibition of pol alpha and epsilon activities after conversion to PLP.

  1. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA.

    PubMed

    Kumke, Katrin; Macas, Jiří; Fuchs, Jörg; Altschmied, Lothar; Kour, Jasmeet; Dhar, Manoj K; Houben, Andreas

    2016-01-01

    B chromosomes are supernumerary dispensable parts of the karyotype which appear in some individuals of some populations in some species. Using advanced sequencing technology, we in silico characterized the high-copy DNA composition of Plantago lagopus with and without B chromosomes. The nuclear genome (2.46 pg/2C) was found to be relatively rich in repetitive sequences, with highly and moderately repeated elements making up 68% of the genome. Besides a centromere-specific marker, we identified a B-specific satellite and a repeat enriched in polymorphic A chromosome segments. The B-specific tandem repeat PLsatB originated from sequence amplification including 5S rDNA fragments. PMID:27173804

  2. DNA-binding specificity of the Lon protease alpha-domain from Brevibacillus thermoruber WR-249.

    PubMed

    Lin, Yu-Ching; Lee, Huai-Cheng; Wang, Iren; Hsu, Chun-Hua; Liao, Jiahn-Haur; Lee, Alan Yueh-Luen; Chen, Chinpan; Wu, Shih-Hsiung

    2009-10-01

    Lon protease has been well studied in many aspects; however, the DNA-binding specificity of Lon in prokaryotes has not been clearly identified. Here we examined the DNA-binding activity of Lon protease alpha-domains from Brevibacillus thermoruber (Bt), Bacillus subtilis (Bs), and Escherichia coli (Ec). MALDI-TOF mass spectroscopy showed that the alpha-domain from Bt-Lon binds to the duplex nucleotide sequence 5'-CTGTTAGCGGGC-3' (ms1) and protected it from DNase I digestion. Surface plasmon resonance showed that the Bt-Lon alpha-domain binds with ms1 double-stranded DNA tighter than Bs- and Ec-Lon alpha-domains, whereas the Bt-Lon alpha-domain has dramatically lower affinity for double-stranded DNA with 0 and 50% identity to the ms1 binding sequence. Our results indicated that Bt-Lon alpha-domain plays a critical role with ms1 sequence in the DNA-binding specificity.

  3. Satellite DNA as a driver of population divergence in the red flour beetle Tribolium castaneum.

    PubMed

    Feliciello, Isidoro; Akrap, Ivana; Brajković, Josip; Zlatar, Ivo; Ugarković, Đurđica

    2014-12-19

    Tandemly repeated satellite DNAs are among most rapidly evolving sequences in eukaryotic genome, usually differing significantly among closely related species. By inducing changes in heterochromatin and/or centromere, satellite DNAs are expected to drive population and species divergence. However, despite high evolutionary dynamics, divergence of satellite DNA profiles at the level of natural population which precedes and possibly triggers speciation process is not readily detected. Here, we characterize minor TCAST2 satellite DNA of the red flour beetle Tribolium castaneum and follow its dynamics among wild-type strains originating from diverse geographic locations. The investigation revealed presence of three distinct subfamilies of TCAST2 satellite DNA which differ in monomer size, genome organization, and subfamily specific mutations. Subfamilies Tcast2a and Tcast2b are tandemly arranged within pericentromeric heterochromatin whereas Tcast2c is preferentially dispersed within euchromatin of all chromosomes. Among strains, TCAST2 subfamilies are conserved in sequence but exhibit a significant content variability. This results in overrepresentation or almost complete absence of particular subfamily in some strains and enables discrimination between strains. It is proposed that homologous recombination, probably stimulated by environmental stress, is responsible for the emergence of TCAST2 satellite subfamilies, their copy number variation and dispersion within genome. The results represent the first evidence for the existence of population-specific satellite DNA profiles. Partial organization of TCAST2 satellite DNA in the form of single repeats dispersed within euchromatin additionally contributes to the genome divergence at the population level.

  4. Satellite DNA as a Driver of Population Divergence in the Red Flour Beetle Tribolium castaneum

    PubMed Central

    Feliciello, Isidoro; Akrap, Ivana; Brajković, Josip; Zlatar, Ivo; Ugarković, Đurđica

    2015-01-01

    Tandemly repeated satellite DNAs are among most rapidly evolving sequences in eukaryotic genome, usually differing significantly among closely related species. By inducing changes in heterochromatin and/or centromere, satellite DNAs are expected to drive population and species divergence. However, despite high evolutionary dynamics, divergence of satellite DNA profiles at the level of natural population which precedes and possibly triggers speciation process is not readily detected. Here, we characterize minor TCAST2 satellite DNA of the red flour beetle Tribolium castaneum and follow its dynamics among wild-type strains originating from diverse geographic locations. The investigation revealed presence of three distinct subfamilies of TCAST2 satellite DNA which differ in monomer size, genome organization, and subfamily specific mutations. Subfamilies Tcast2a and Tcast2b are tandemly arranged within pericentromeric heterochromatin whereas Tcast2c is preferentially dispersed within euchromatin of all chromosomes. Among strains, TCAST2 subfamilies are conserved in sequence but exhibit a significant content variability. This results in overrepresentation or almost complete absence of particular subfamily in some strains and enables discrimination between strains. It is proposed that homologous recombination, probably stimulated by environmental stress, is responsible for the emergence of TCAST2 satellite subfamilies, their copy number variation and dispersion within genome. The results represent the first evidence for the existence of population-specific satellite DNA profiles. Partial organization of TCAST2 satellite DNA in the form of single repeats dispersed within euchromatin additionally contributes to the genome divergence at the population level. PMID:25527837

  5. A novel nanometric DNA thin film as a sensor for alpha radiation

    NASA Astrophysics Data System (ADS)

    Kulkarni, Atul; Kim, Byeonghoon; Dugasani, Sreekantha Reddy; Joshirao, Pranav; Kim, Jang Ah; Vyas, Chirag; Manchanda, Vijay; Kim, Taesung; Park, Sung Ha

    2013-06-01

    The unexpected nuclear accidents have provided a challenge for scientists and engineers to develop sensitive detectors, especially for alpha radiation. Due to the high linear energy transfer value, sensors designed to detect such radiation require placement in close proximity to the radiation source. Here we report the morphological changes and optical responses of artificially designed DNA thin films in response to exposure to alpha radiation as observed by an atomic force microscope, a Raman and a reflectance spectroscopes. In addition, we discuss the feasibility of a DNA thin film as a radiation sensing material. The effect of alpha radiation exposure on the DNA thin film was evaluated as a function of distance from an 241Am source and exposure time. Significant reflected intensity changes of the exposed DNA thin film suggest that a thin film made of biomolecules can be one of promising candidates for the development of online radiation sensors.

  6. A novel nanometric DNA thin film as a sensor for alpha radiation

    PubMed Central

    Kulkarni, Atul; Kim, Byeonghoon; Dugasani, Sreekantha Reddy; Joshirao, Pranav; Kim, Jang Ah; Vyas, Chirag; Manchanda, Vijay; Kim, Taesung; Park, Sung Ha

    2013-01-01

    The unexpected nuclear accidents have provided a challenge for scientists and engineers to develop sensitive detectors, especially for alpha radiation. Due to the high linear energy transfer value, sensors designed to detect such radiation require placement in close proximity to the radiation source. Here we report the morphological changes and optical responses of artificially designed DNA thin films in response to exposure to alpha radiation as observed by an atomic force microscope, a Raman and a reflectance spectroscopes. In addition, we discuss the feasibility of a DNA thin film as a radiation sensing material. The effect of alpha radiation exposure on the DNA thin film was evaluated as a function of distance from an 241Am source and exposure time. Significant reflected intensity changes of the exposed DNA thin film suggest that a thin film made of biomolecules can be one of promising candidates for the development of online radiation sensors. PMID:23792924

  7. A viral satellite DNA vector-induced transcriptional gene silencing via DNA methylation of gene promoter in Nicotiana benthamiana.

    PubMed

    Ju, Zheng; Wang, Lei; Cao, Dongyan; Zuo, Jinhua; Zhu, Hongliang; Fu, Daqi; Luo, Yunbo; Zhu, Benzhong

    2016-09-01

    Virus-induced gene silencing (VIGS) has been widely used for plant functional genomics study at the post-transcriptional level using various DNA or RNA viral vectors. However, while virus-induced transcriptional gene silencing (VITGS) via DNA methylation of gene promoter was achieved using several plant RNA viral vectors, it has not yet been done using a satellite DNA viral vector. In this study, a viral satellite DNA associated with tomato yellow leaf curl China virus (TYLCCNV), which has been modified as a VIGS vector in previous research, was developed as a VITGS vector. Firstly, the viral satellite DNA VIGS vector was further optimized to a more convenient p1.7A+2mβ vector with high silencing efficiency of the phytoene desaturase (PDS) gene in Nicotiana benthamiana plants. Secondly, the constructed VITGS vector (TYLCCNV:35S), which carried a portion of the cauliflower mosaic virus 35S promoter, could successfully induce heritable transcriptional gene silencing (TGS) of the green fluorescent protein (GFP) gene in the 35S-GFP transgenic N. benthamiana line 16c plants. Moreover, bisulfite sequencing results revealed higher methylated cytosine residues at CG, CHG and CHH sites of the 35S promoter sequence in TYLCCNV:35S-inoculated plants than in TYLCCNV-inoculated line 16c plants (control). Overall, these results demonstrated that the viral satellite DNA vector could be used as an effective VITGS vector to study DNA methylation in plant genomes. PMID:27422476

  8. Correlated variation and population differentiation in satellite DNA abundance among lines of Drosophila melanogaster.

    PubMed

    Wei, Kevin H-C; Grenier, Jennifer K; Barbash, Daniel A; Clark, Andrew G

    2014-12-30

    Tandemly repeating satellite DNA elements in heterochromatin occupy a substantial portion of many eukaryotic genomes. Although often characterized as genomic parasites deleterious to the host, they also can be crucial for essential processes such as chromosome segregation. Adding to their interest, satellite DNA elements evolve at high rates; among Drosophila, closely related species often differ drastically in both the types and abundances of satellite repeats. However, due to technical challenges, the evolutionary mechanisms driving this rapid turnover remain unclear. Here we characterize natural variation in simple-sequence repeats of 2-10 bp from inbred Drosophila melanogaster lines derived from multiple populations, using a method we developed called k-Seek that analyzes unassembled Illumina sequence reads. In addition to quantifying all previously described satellite repeats, we identified many novel repeats of low to medium abundance. Many of the repeats show population differentiation, including two that are present in only some populations. Interestingly, the population structure inferred from overall satellite quantities does not recapitulate the expected population relationships based on the demographic history of D. melanogaster. We also find that some satellites of similar sequence composition are correlated across lines, revealing concerted evolution. Moreover, correlated satellites tend to be interspersed with each other, further suggesting that concerted change is partially driven by higher order structure. Surprisingly, we identified negative correlations among some satellites, suggesting antagonistic interactions. Our study demonstrates that current genome assemblies vastly underestimate the complexity, abundance, and variation of highly repetitive satellite DNA and presents approaches to understand their rapid evolutionary divergence.

  9. DNA damage-induced centrosome amplification occurs via excessive formation of centriolar satellites.

    PubMed

    Löffler, H; Fechter, A; Liu, F Y; Poppelreuther, S; Krämer, A

    2013-06-13

    Centrosome amplification is a frequent phenomenon in malignancies and may facilitate tumorigenesis by promoting chromosomal instability. On the other hand, a centrosome inactivation checkpoint comprising centrosome amplification leading to elimination of cells by mitotic catastrophe has been described in response to DNA damage by ionizing radiation or cytostatic drugs. So far, the exact nature of DNA damage-induced centrosome amplification, which might be overduplication or fragmentation of existing centrosomes, has been controversial. To solve this controversy, we have established a method to distinguish between these two possibilities using A549 cells expressing photoconvertible CETN2-Dendra2. In response to various DNA-damaging treatments, centrosome amplification but not fragmentation was observed. Moreover, centrosome amplification was preceded by excessive formation of centrin-containing centriolar satellites, which were identified as de novo-generated atypical centrin dots staining positive for centriolar satellite markers but negative or only weakly positive for other established centrosomal markers, and which could be verified as centriolar satellites using immunogold electron microscopy. In line with this notion, disruption of dynein-mediated recruitment of centrosomal proteins via centriolar satellites suppressed centrosome amplification after DNA damage, and excessive formation of centriolar satellites could be inhibited by interference with Chk1, a known mediator of centrosome amplification in response to DNA damage. In conclusion, we provide a model in which a Chk1-mediated DNA damage checkpoint induces excessive formation of centriolar satellites constituting assembly platforms for centrosomal proteins, which subsequently leads to centrosome amplification. PMID:22824794

  10. The CHH motif in sugar beet satellite DNA: a modulator for cytosine methylation.

    PubMed

    Zakrzewski, Falk; Schubert, Veit; Viehoever, Prisca; Minoche, André E; Dohm, Juliane C; Himmelbauer, Heinz; Weisshaar, Bernd; Schmidt, Thomas

    2014-06-01

    Methylation of DNA is important for the epigenetic silencing of repetitive DNA in plant genomes. Knowledge about the cytosine methylation status of satellite DNAs, a major class of repetitive DNA, is scarce. One reason for this is that arrays of tandemly arranged sequences are usually collapsed in next-generation sequencing assemblies. We applied strategies to overcome this limitation and quantified the level of cytosine methylation and its pattern in three satellite families of sugar beet (Beta vulgaris) which differ in their abundance, chromosomal localization and monomer size. We visualized methylation levels along pachytene chromosomes with respect to small satellite loci at maximum resolution using chromosome-wide fluorescent in situ hybridization complemented with immunostaining and super-resolution microscopy. Only reduced methylation of many satellite arrays was obtained. To investigate methylation at the nucleotide level we performed bisulfite sequencing of 1569 satellite sequences. We found that the level of methylation of cytosine strongly depends on the sequence context: cytosines in the CHH motif show lower methylation (44-52%), while CG and CHG motifs are more strongly methylated. This affects the overall methylation of satellite sequences because CHH occurs frequently while CG and CHG are rare or even absent in the satellite arrays investigated. Evidently, CHH is the major target for modulation of the cytosine methylation level of adjacent monomers within individual arrays and contributes to their epigenetic function. This strongly indicates that asymmetric cytosine methylation plays a role in the epigenetic modification of satellite repeats in plant genomes.

  11. Centromeric dodeca-satellite DNA sequences form fold-back structures.

    PubMed

    Ferrer, N; Azorín, F; Villasante, A; Gutiérrez, C; Abad, J P

    1995-01-01

    The evolutionarily conserved centromeric dodeca-satellite DNA has an asymmetric distribution of guanine and cytosine residues resulting in one strand being relatively G-rich. This dodeca-satellite G-strand contains a GGGA-tract that is similar to the homopurine tracts found in most telomeric DNA sequences. Here, we show that the dodeca-satellite G-strand forms intramolecular hairpin structures that are stabilized by the formation of non-Watson-Crick G.A pairs as well as regular Watson-Crick G.C pairs. Special stacking interactions are also likely to contribute significantly to the stability of this structure. This hairpin conformation melts at relatively high temperature, around 75 degrees C, and is detected under many different ionic and pH conditions. As judged by electron microscopy visualization, these structures can be formed in a B-DNA environment. Under the same experimental conditions, neither the C-strand nor the double-stranded dodeca-satellite DNA were found to form any unusual DNA structure. A protein activity has been detected that preferentially binds to the single-stranded dodeca-satellite C-strand. The biological relevance of these results is discussed in view of the similarities to telomeric DNA.

  12. Differentiation of cattle species in beef by PCR-RFLP of mitochondrial and satellite DNA.

    PubMed

    Verkaar, E L C; Nijman, I J; Boutaga, K; Lenstra, J A

    2002-04-01

    Methods currently used for the identification of the species origin of meat or tissue samples have not been validated for other bovine species than taurine cattle or water buffalo. These methods also do not discriminate between the different bovine species that are used as source of beef. Here, we describe two complementary methods for detection and differentiation of bovine species, which are based on mutations in mitochondrial DNA and centromeric satellite DNA, respectively. The analysis of satellite DNA is especially relevant for the identification of animals that are of hybrid origin.

  13. Inhibition of UVB induced DNA photodamage in mouse epidermis by topically applied alpha-tocopherol.

    PubMed

    McVean, M; Liebler, D C

    1997-08-01

    Ultraviolet B (UVB, 290-320 nm) exposure results in a variety of cellular insults including induction of cyclobutane pyrimidine dimers in DNA. Accumulation of these lesions can lead to mutations in critical genes and contribute to the development of nonmelanoma skin cancer. Topically applied alpha-tocopherol (vitamin E) has previously been shown to prevent the induction of skin tumors in UVB irradiated female C3H/HeNTac mice. We hypothesized that alpha-tocopherol, which absorbs strongly in the UVB, may act as a sunscreen to prevent photodamage. To explore possible mechanisms of photoprotection, we topically applied alpha-tocopherol dispersed in a neutral cream vehicle to the dorsal epidermis of female C3H/HeNTac mice and exposed them to 2.5 J/m2/s of UVB for 60 min. Immediately after exposure, we analyzed thymine dimer levels in DNA by capillary gas chromatography with electron capture detection. Epidermal DNA from mice receiving this UVB dose contained 247 +/- 42 pmol thymine dimers/micromol thymine. Topical application of alpha-tocopherol inhibited dimer formation in a dose-dependent manner. A 1% alpha-tocopherol dispersion inhibited the formation of thymine dimers to 43% of levels in vehicle controls. Several vitamin E compounds, including alpha-tocopherol acetate, alpha-tocopherol methyl ether, gamma-tocopherol, and delta-tocopherol also inhibited thymine dimer formation, but were five- to ten-fold less potent than alpha-tocopherol. A variety of commercially available sunscreens were also less potent than alpha-tocopherol in their ability to reduce dimer formation. These results suggest that DNA photoprotection is an important mechanism by which topically applied alpha-tocopherol can inhibit UVB induced skin cancer. Alpha-Tocopherol acetate, the most common form of vitamin E in commercial skin care products, conferred less protection, perhaps due to its lower absorptivity in the UVB. Our results further underscore the importance of determining which forms of

  14. High-throughput analysis of the satellitome illuminates satellite DNA evolution

    NASA Astrophysics Data System (ADS)

    Ruiz-Ruano, Francisco J.; López-León, María Dolores; Cabrero, Josefa; Camacho, Juan Pedro M.

    2016-07-01

    Satellite DNA (satDNA) is a major component yet the great unknown of eukaryote genomes and clearly underrepresented in genome sequencing projects. Here we show the high-throughput analysis of satellite DNA content in the migratory locust by means of the bioinformatic analysis of Illumina reads with the RepeatExplorer and RepeatMasker programs. This unveiled 62 satDNA families and we propose the term “satellitome” for the whole collection of different satDNA families in a genome. The finding that satDNAs were present in many contigs of the migratory locust draft genome indicates that they show many genomic locations invisible by fluorescent in situ hybridization (FISH). The cytological pattern of five satellites showing common descent (belonging to the SF3 superfamily) suggests that non-clustered satDNAs can become into clustered through local amplification at any of the many genomic loci resulting from previous dissemination of short satDNA arrays. The fact that all kinds of satDNA (micro- mini- and satellites) can show the non-clustered and clustered states suggests that all these elements are mostly similar, except for repeat length. Finally, the presence of VNTRs in bacteria, showing similar properties to non-clustered satDNAs in eukaryotes, suggests that this kind of tandem repeats show common properties in all living beings.

  15. High-throughput analysis of the satellitome illuminates satellite DNA evolution.

    PubMed

    Ruiz-Ruano, Francisco J; López-León, María Dolores; Cabrero, Josefa; Camacho, Juan Pedro M

    2016-01-01

    Satellite DNA (satDNA) is a major component yet the great unknown of eukaryote genomes and clearly underrepresented in genome sequencing projects. Here we show the high-throughput analysis of satellite DNA content in the migratory locust by means of the bioinformatic analysis of Illumina reads with the RepeatExplorer and RepeatMasker programs. This unveiled 62 satDNA families and we propose the term "satellitome" for the whole collection of different satDNA families in a genome. The finding that satDNAs were present in many contigs of the migratory locust draft genome indicates that they show many genomic locations invisible by fluorescent in situ hybridization (FISH). The cytological pattern of five satellites showing common descent (belonging to the SF3 superfamily) suggests that non-clustered satDNAs can become into clustered through local amplification at any of the many genomic loci resulting from previous dissemination of short satDNA arrays. The fact that all kinds of satDNA (micro- mini- and satellites) can show the non-clustered and clustered states suggests that all these elements are mostly similar, except for repeat length. Finally, the presence of VNTRs in bacteria, showing similar properties to non-clustered satDNAs in eukaryotes, suggests that this kind of tandem repeats show common properties in all living beings. PMID:27385065

  16. High-throughput analysis of the satellitome illuminates satellite DNA evolution

    PubMed Central

    Ruiz-Ruano, Francisco J.; López-León, María Dolores; Cabrero, Josefa; Camacho, Juan Pedro M.

    2016-01-01

    Satellite DNA (satDNA) is a major component yet the great unknown of eukaryote genomes and clearly underrepresented in genome sequencing projects. Here we show the high-throughput analysis of satellite DNA content in the migratory locust by means of the bioinformatic analysis of Illumina reads with the RepeatExplorer and RepeatMasker programs. This unveiled 62 satDNA families and we propose the term “satellitome” for the whole collection of different satDNA families in a genome. The finding that satDNAs were present in many contigs of the migratory locust draft genome indicates that they show many genomic locations invisible by fluorescent in situ hybridization (FISH). The cytological pattern of five satellites showing common descent (belonging to the SF3 superfamily) suggests that non-clustered satDNAs can become into clustered through local amplification at any of the many genomic loci resulting from previous dissemination of short satDNA arrays. The fact that all kinds of satDNA (micro- mini- and satellites) can show the non-clustered and clustered states suggests that all these elements are mostly similar, except for repeat length. Finally, the presence of VNTRs in bacteria, showing similar properties to non-clustered satDNAs in eukaryotes, suggests that this kind of tandem repeats show common properties in all living beings. PMID:27385065

  17. Isolation and characterization of human cDNA clones encoding the. alpha. and the. alpha. prime subunits of casein kinase II

    SciTech Connect

    Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs E.G. )

    1990-09-11

    Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two {alpha} or {alpha}{prime} subunits (or one of each) and two {beta} subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell {lambda}gt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5{prime} untranslated region) and followed by 871 bp (3{prime} untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5{prime} untranslated region) and followed by 550 bp (3{prime} untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of {alpha} and {alpha}{prime} subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the {alpha} and {alpha}{prime} subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II ({alpha} and {alpha}{prime}) and that the sequence of these subunits is largely conserved between the bovine and the human.

  18. a/[alpha]-control of DNA repair in the yeast Saccharomyces cerevisiae: Genetic and physiological aspects

    SciTech Connect

    Heude, M.; Fabre, F. )

    1993-03-01

    It has long been known that diploid strains of yeast are more resistant to [gamma]-rays than haploid cells, and that this is in part due to heterozygosity at the mating type (MAT) locus. It is shown here that the genetic control exerted by the MAT genes on DNA repair involves the a1 and [alpha]2 genes, in a RME1-independent way. In rad18 diploids, affected in the error-prone repair, the a/[alpha] effects are of a very large amplitude, after both UV and [gamma]-rays, and also depends on a1 and [alpha]2. The coexpression of a and [alpha] in rad18 haploids suppresses the sensitivity of a subpopulation corresponding to the G[sub 2] phase cells. Related to this, the coexpression of a and [alpha] in RAD[sup +] haploids depresses UV-induced mutagenesis in G[sub 2] cells. For srs2 null diploids, also affected in the error-prone repair pathway, we show that their G[sub 1] UV sensitivity, likely due to lethal recombinations events, is partly suppressed by MAT homozygosity. Taken together, these results led to the proposal that a1-[alpha]2 promotes a channeling of some DNA structures from the mutagenic into the recombinational process. 59 refs., 6 figs., 1 tab.

  19. a/alpha-control of DNA repair in the yeast Saccharomyces cerevisiae: genetic and physiological aspects.

    PubMed

    Heude, M; Fabre, F

    1993-03-01

    It has long been known that diploid strains of yeast are more resistant to gamma-rays than haploid cells, and that this is in part due to heterozygosity at the mating type (MAT) locus. It is shown here that the genetic control exerted by the MAT genes on DNA repair involves the a1 and alpha 2 genes, in a RME1-independent way. In rad18 diploids, affected in the error-prone repair, the a/alpha effects are of a very large amplitude, after both UV and gamma-rays, and also depends on a1 and alpha 2. The coexpression of a and alpha in rad18 haploids suppresses the sensitivity of a subpopulation corresponding to the G2 phase cells. Related to this, the coexpression of a and alpha in RAD+ haploids depresses UV-induced mutagenesis in G2 cells. For srs2 null diploids, also affected in the error-prone repair pathway, we show that their G1 UV sensitivity, likely due to lethal recombination events, is partly suppressed by MAT homozygosity. Taken together, these results led to the proposal that a1-alpha 2 promotes a channeling of some DNA structures from the mutagenic into the recombinational repair process.

  20. Satellites

    SciTech Connect

    Burns, J.A.; Matthews, M.S.

    1986-01-01

    The present work is based on a conference: Natural Satellites, Colloquium 77 of the IAU, held at Cornell University from July 5 to 9, 1983. Attention is given to the background and origins of satellites, protosatellite swarms, the tectonics of icy satellites, the physical characteristics of satellite surfaces, and the interactions of planetary magnetospheres with icy satellite surfaces. Other topics include the surface composition of natural satellites, the cratering of planetary satellites, the moon, Io, and Europa. Consideration is also given to Ganymede and Callisto, the satellites of Saturn, small satellites, satellites of Uranus and Neptune, and the Pluto-Charon system.

  1. Identification of the DNA sequences controlling the expression of the MAT alpha locus of yeast.

    PubMed Central

    Siliciano, P G; Tatchell, K

    1986-01-01

    We have excised a 28-base-pair DNA fragment from the MAT alpha intergenic region and tested its ability to direct diploid-specific transcriptional repression. This fragment (1643-1671, 5'-GCTTCCCAATGTAGAAAAGTACA-TCATA-3') lies within a region required for the normal diploid-specific repression of the MAT alpha transcripts. First, the fragment was inserted into a 53-base-pair MAT alpha deletion that expresses alpha 1 and alpha 2 constitutively. Insertion of the fragment restores proper diploid regulation to the MAT alpha transcripts: alpha 1 mRNA is strongly repressed and alpha 2 mRNA is reduced by a factor of approximately equal to 10 from its haploid level. The fragment works equally well in either orientation, and two copies of the fragment do not lead to stronger repression than a single copy. We also inserted the fragment at three sites upstream of the CYC1-lacZ fusion gene. Insertions placing the regulatory fragment between the CYC1 upstream activator sequence (UAS) and the coding region make beta-galactosidase efficiently in alpha haploids but produce 1/40th the enzyme in a/alpha diploids. This diploid-specific repression requires functional MATa-1 gene product. Insertion of the MAT fragment on the opposite side of the UAS (37 base pairs upstream of the UAS) also caused diploid repression of the fusion gene, but only by a factor of 7. When the regulatory fragment is inserted at a large distance on the far side of the UAS (375 base pairs), it has little if any effect on beta-galactosidase expression. We postulate that this sequence is the operator recognized by the diploid-specific repressor. Images PMID:3517864

  2. Chromosome localization and orientation of the simple sequence repeat of human satellite I DNA.

    PubMed

    Meyne, J; Goodwin, E H; Moyzis, R K

    1994-04-01

    The predominant chromosomal locations of human satellite I DNA were detected using fluorescent in situ hybridization (FISH). Synthetic deoxyoligonucleotides designed from consensus sequences of the simple sequence repeats of satellite 1 were used as probes. The most abundant satellite I repeat, the -A-B-A-B-A- form, is located at the pericentromeric regions of chromosomes 3, 4, 13, 14, 15, 21, and 22. The less abundant -B-B-B-form was not detected on chromosome 4, but was present at all the other locations. A variation of FISH that allows strand-specific hybridization of single-stranded probes (CO-FISH) determined that the human satellite I sequences are predominantly arranged in head-to-tail fashion along the DNA strand. PMID:8055716

  3. Nucleotide sequence of HS-beta satellite DNA from kangaroo rat Dipodomys ordii.

    PubMed

    Fry, K; Poon, R; Whitcome, P; Idriss, J; Salser, W; Mazrimas, J; Hatch, F

    1973-09-01

    The sequence of the highly repetitive satellite HS-beta DNA fraction from kangaroo rat Dipodomys ordii was determined independently by RNA and DNA sequencing techniques. A basic iterated sequence of 10 nucleotides with several mutational variations was found. Base-composition data are consistent with the proposed sequence and revealed a high content of 5-methylcytosine. DNA and RNA sequencing techniques used gave identical results, showing that the fidelity of synthesis of riboguanidine-substituted DNA under our conditions is adequate for nucleotide sequence studies.

  4. Species-specific functional interactions of DNA polymerase alpha-primase with simian virus 40 (SV40) T antigen require SV40 origin DNA.

    PubMed Central

    Schneider, C; Weisshart, K; Guarino, L A; Dornreiter, I; Fanning, E

    1994-01-01

    Physical and functional interactions of simian virus 40 (SV40) and polyomavirus large-T antigens with DNA polymerase alpha-primase were analyzed to elucidate the molecular basis for the species specificity of polymerase alpha-primase in viral DNA replication. SV40 T antigen associated more efficiently with polymerase alpha-primase in crude human extracts than in mouse extracts, while polyomavirus T antigen interacted preferentially with polymerase alpha-primase in mouse extracts. The apparent species specificity of complex formation was not observed when purified polymerase alpha-primases were substituted for the crude extracts. Several functional interactions between T antigen and purified polymerase alpha-primase, including stimulation of primer synthesis and primer elongation on M13 DNA in the presence or absence of the single-stranded DNA binding protein RP-A, also proved to be independent of the species from which polymerase alpha-primase had been purified. However, the human DNA polymerase alpha-primase was specifically required for primosome assembly and primer synthesis on SV40 origin DNA in the presence of T antigen and RP-A. Images PMID:8164673

  5. Lagging strand DNA synthesis by calf thymus DNA polymerases alpha, beta, delta and epsilon in the presence of auxiliary proteins.

    PubMed Central

    Podust, V N; Hübscher, U

    1993-01-01

    By using a defined gapped DNA substrate that mimics a lagging strand of 230 nucleotides and that contains a defined pause site, we have analyzed calf thymus DNA polymerases (pol) alpha, beta, delta, and epsilon in the presence of the three auxiliary proteins proliferating cell nuclear antigen (PCNA), replication factor C (RF-C) and replication protein A (RP-A) for their ability to complete an Okazaki fragment. Pol alpha alone could fill the gap to near completion, but was strongly stopped by the pause site. Addition of low amounts of RP-A resulted in an increased synthesis by pol alpha past the pause site. In contrast, high amounts of RP-A strongly inhibited gap filling by pol alpha. Further inhibition was evident when the two other auxiliary proteins, PCNA and RF-C, were added in addition to RP-A. Pol beta could completely fill the gap without specific pausing and also was strongly inhibited by RP-A. PCNA and RF-C had no detectable effect on pol beta. Pol delta, relied as expected, on all three auxiliary proteins for complete gap filling synthesis and could, upon longer incubation, perform a limited amount of strand displacement synthesis. Pol epsilon core enzyme was able to fill the gap completely, but like pol alpha, essentially stopped at the pause site. This pausing could only be overcome upon addition of PCNA, RF-C and E. coli single-stranded DNA binding protein. Thus pol epsilon holoenzyme preferentially synthesized to the end of the gap without pausing. Ligation of the DNA products indicated that pol beta core enzyme, pol delta and pol epsilon holoenzymes (but not pol alpha and pol epsilon core enzyme) synthesized products that were easily ligatable. Our results indicate that pol epsilon holoenzyme fills a defined lagging strand gapped template to exact completion and is able to pass a pause site. The data favour the hypothesis of Burgers (Burgers, P.M.J. (1991) J. Biol. Chem. 266, 22698-22706) that pol epsilon might be a candidate for the second

  6. Replicating satellite RNA induces sequence-specific DNA methylation and truncated transcripts in plants.

    PubMed Central

    Wang, M B; Wesley, S V; Finnegan, E J; Smith, N A; Waterhouse, P M

    2001-01-01

    Tobacco plants were transformed with a chimeric transgene comprising sequences encoding beta-glucuronidase (GUS) and the satellite RNA (satRNA) of cereal yellow dwarf luteovirus. When transgenic plants were infected with potato leafroll luteovirus (PLRV), which replicated the transgene-derived satRNA to a high level, the satellite sequence of the GUS:Sat transgene became densely methylated. Within the satellite region, all 86 cytosines in the upper strand and 73 of the 75 cytosines in the lower strand were either partially or fully methylated. In contrast, very low levels of DNA methylation were detected in the satellite sequence of the transgene in uninfected plants and in the flanking nonsatellite sequences in both infected and uninfected plants. Substantial amounts of truncated GUS:Sat RNA accumulated in the satRNA-replicating plants, and most of the molecules terminated at nucleotides within the first 60 bp of the satellite sequence. Whereas this RNA truncation was associated with high levels of satRNA replication, it appeared to be independent of the levels of DNA methylation in the satellite sequence, suggesting that it is not caused by methylation. All the sequenced GUS:Sat DNA molecules were hypermethylated in plants with replicating satRNA despite the phloem restriction of the helper PLRV. Also, small, sense and antisense approximately 22 nt RNAs, derived from the satRNA, were associated with the replicating satellite. These results suggest that the sequence-specific DNA methylation spread into cells in which no satRNA replication occurred and that this was mediated by the spread of unamplified satRNA and/or its associated 22 nt RNA molecules. PMID:11214177

  7. cDNA clone for the alpha-chain of human beta-hexosaminidase: deficiency of alpha-chain mRNA in Ashkenazi Tay-Sachs fibroblasts.

    PubMed Central

    Myerowitz, R; Proia, R L

    1984-01-01

    We have isolated a cDNA clone containing sequences complementary to mRNA encoding the alpha-chain of the lysosomal enzyme beta-hexosaminidase. RNA from a human lung fibroblast strain, IMR90, was enriched for beta-hexosaminidase messenger by polysome immunoselection with antiserum against beta-hexosaminidase A. This preparation was used to construct cDNA recombinant plasmids by the Okayama-Berg vector primer procedure. After transformation of Escherichia coli, 385 ampicillin-resistant colonies were obtained, 44 of which contained inserts in the plasmid DNA. Differential hybridization, with cDNA probes prepared from polysomal RNA enriched or depleted for beta-hexosaminidase messenger, was used to screen the recombinant plasmids for sequences encoding beta-hexosaminidase. One clone, p beta H alpha-1, containing a cDNA insert of approximately equal to 240 base pairs, was identified in this manner. The plasmid hybrid-selected a messenger from placental RNA that programed a translation system to synthesize the alpha-chain of beta-hexosaminidase. p beta H alpha-1 hybridized to an mRNA of approximately equal to 1.9 kilobases in preparations enriched separately in messenger for the alpha-chain or for both alpha- and beta-chains (by polysome immunoselection with antiserum against isolated alpha-chain or against beta-hexosaminidase A, respectively). It did not hybridize to an RNA preparation enriched for messenger of beta-chain by immunoselection with antiserum against beta-hexosaminidase B. The 1.9-kilobase mRNA was observed in poly(A)+ RNA preparations from control fibroblasts and from fibroblasts of a Tay-Sachs patient that synthesize an altered alpha-chain; however, it was not seen in similar preparations from fibroblasts of four Ashkenazi Tay-Sachs patients. Images PMID:6236461

  8. Characterization of two unrelated satellite DNA families in the Colorado potato beetle Leptinotarsa decemlineata (Coleoptera, Chrysomelidae).

    PubMed

    Lorite, Pedro; Torres, M Isabel; Palomeque, Teresa

    2013-10-01

    The Colorado potato beetle (Leptinotarsa decemlineata, family Chrysomelidae),a phytophagous insect, which feeds preferably on potatoes, constitutes a serious pest of this crop and causes extensive damage to tomatoes and egg plants. It has a remarkable ability to develop resistance quickly against insecticides and shows a diversified and flexible life history. Consequently, the control of this pest has become difficult, requiring the development of new alternative biotechnology-based strategies. Such strategies require a thorough knowledge of the beetle’s genome,including the repetitive DNA. Satellite DNA (stDNA), composed of long arrays of tandemly arranged repeat units, constitutes the major component of heterochromatin and is located mainly in centromeric and telomeric chromosomal regions. We have studied two different unrelated satellite-DNA families of which the consensus sequences were 295 and 109bp in length, named LEDE-I and LEDE-II, respectively.Both were AT-rich (70.8% and 71.6%, respectively). Predictive models of sequence-dependent DNA bending and the study of electrophoretic mobility on non-denaturing polyacrylamide gels have shown that the DNA was curved in both satellite-DNA families. Among other features, the chromosome localization of both stDNAs has been studied. In situ hybridization performed on meiotic and mitoticnuclei showed chromosomes, including the X chromosome, with zero, one, or two stDNAs. In recent years, it has been proposed that the repetitive DNA may play a key role in biological diversification processes. This is the first molecular and cytogenetic study conducted on L. decemlineata repetitive DNA and specifically on stDNA, which is one of the important constituents of eukaryotic genomes.

  9. Characterization of two unrelated satellite DNA families in the Colorado potato beetle Leptinotarsa decemlineata (Coleoptera, Chrysomelidae).

    PubMed

    Lorite, Pedro; Torres, M Isabel; Palomeque, Teresa

    2013-10-01

    The Colorado potato beetle (Leptinotarsa decemlineata, family Chrysomelidae),a phytophagous insect, which feeds preferably on potatoes, constitutes a serious pest of this crop and causes extensive damage to tomatoes and egg plants. It has a remarkable ability to develop resistance quickly against insecticides and shows a diversified and flexible life history. Consequently, the control of this pest has become difficult, requiring the development of new alternative biotechnology-based strategies. Such strategies require a thorough knowledge of the beetle’s genome,including the repetitive DNA. Satellite DNA (stDNA), composed of long arrays of tandemly arranged repeat units, constitutes the major component of heterochromatin and is located mainly in centromeric and telomeric chromosomal regions. We have studied two different unrelated satellite-DNA families of which the consensus sequences were 295 and 109bp in length, named LEDE-I and LEDE-II, respectively.Both were AT-rich (70.8% and 71.6%, respectively). Predictive models of sequence-dependent DNA bending and the study of electrophoretic mobility on non-denaturing polyacrylamide gels have shown that the DNA was curved in both satellite-DNA families. Among other features, the chromosome localization of both stDNAs has been studied. In situ hybridization performed on meiotic and mitoticnuclei showed chromosomes, including the X chromosome, with zero, one, or two stDNAs. In recent years, it has been proposed that the repetitive DNA may play a key role in biological diversification processes. This is the first molecular and cytogenetic study conducted on L. decemlineata repetitive DNA and specifically on stDNA, which is one of the important constituents of eukaryotic genomes. PMID:23448367

  10. Flavonoid glycoside: a new inhibitor of eukaryotic DNA polymerase alpha and a new carrier for inhibitor-affinity chromatography.

    PubMed

    Mizushina, Yoshiyuki; Ishidoh, Tomomi; Kamisuki, Shinji; Nakazawa, Satoshi; Takemura, Masaharu; Sugawara, Fumio; Yoshida, Hiromi; Sakaguchi, Kengo

    2003-02-01

    Two flavonoid glycosides, kaempferol 3-O-(6"-acetyl)-beta-glucopyranoside (KAG) and quercetin 3-O-(6"-acetyl)-beta-glucopyranoside (QAG), were found to be inhibitors of eukaryotic DNA polymerases from a Japanese vegetable, Petasites japonicus. These compounds inhibited the activities of mammalian replicative DNA polymerases (i.e., pol alpha, delta, and epsilon), but not other pol beta, eta, kappa, and lambda activities. KAG was a stronger inhibitor and more selective to pol alpha than QAG. The IC(50) values of KAG for pol alpha, delta, and epsilon were 41, 164, and 127 microM, respectively. The pol alpha inhibition by KAG was non-competitive with respect to both the DNA template-primer and the dNTP substrate. KAG and QAG did not influence the activities of prokaryotic DNA polymerases or other mammalian DNA metabolic enzymes such as human immunodeficiency virus type 1 reverse transcriptase, human telomerase, human DNA topoisomerase I and II, T7 RNA polymerase, and bovine deoxyribonuclease I. Therefore, we concluded that these flavonoid glycosides are moderate replicative DNA polymerase inhibitors leaning more relatively to pol alpha, and could be used as chromatographic carriers to purify the DNA polymerases rather than cytotoxic agents. We then made a KAG-conjugated column such as the epoxy-activated Sepharose 6B. In the column, pol alpha was selectively adsorbed and eluted. PMID:12565887

  11. An unusual polyanion from Physarum polycephalum that inhibits homologous DNA polymerase. alpha. in vitro

    SciTech Connect

    Fischer, H.; Erdmann, S.; Holler, E. )

    1989-06-13

    From extracts of microplasmodia of Physarum polycephalum and their culture medium, an unusual substance was isolated which inhibited homologous DNA polymerase {alpha} of this slime mold but not {beta}-like DNA polymerase and not heterologous DNA polymerases. Analysis, especially NMR spectroscopy, revealed the major component to be an anionic polyester of L-malic acid and the inhibition to be due to poly(L-malate) in binding reversibly to DNA polymerase {alpha}. The mode of inhibition is competitive with substrate DNA and follows an inhibition constant K{sub i} = 10 ng/mL. Inhibition is reversed in the presence of spermine, spermidine, poly(ethylene imine), and calf thymus histone H1. According to its ester nature, the inhibitor is slightly labile at neutral and instable at acid and alkaline conditions. Its largest size corresponds to a molecular mass of 40-50 kDa, but the bulk of the material after purification has lower molecular masses. The inhibitory activity depends on the polymer size and has a minimal size requirement.

  12. Integration of hepatitis B virus DNA in chromosome-specific satellite sequences

    SciTech Connect

    Shaul, Y.; Garcia, P.D.; Schonberg, S.; Rutter, W.J.

    1986-09-01

    The authors previously reported the cloning and detailed analysis of the integrated hepatitis B virus sequences in a human hepatoma cell line. They report here the integration of at least one of hepatitis B virus at human satellite DNA sequences. The majority of the cellular sequences identified by this satellite were organized as a multimeric composition of a 0.6-kilobase EcoRI fragment. This clone hybridized in situ almost exclusively to the centromeric heterochromatin of chromosomes 1 and 16 and to a lower extent to chromosome 2 and to the heterochromatic region of the Y chromosome. The immediate flanking host sequence appeared as a hierarchy of repeating units which were almost identical to a previously reported human satellite III DNA sequence.

  13. Anti-tumor effects of dehydroaltenusin, a specific inhibitor of mammalian DNA polymerase {alpha}

    SciTech Connect

    Maeda, Naoki; Kokai, Yasuo; Ohtani, Seiji; Sahara, Hiroeki; Kuriyama, Isoko; Kamisuki, Shinji; Takahashi, Shunya; Sakaguchi, Kengo; Sugawara, Fumio; Yoshida, Hiromi; Sato, Noriyuki; Mizushina, Yoshiyuki . E-mail: mizushin@nutr.kobegakuin.ac.jp

    2007-01-12

    In the screening of selective inhibitors of eukaryotic DNA polymerases (pols), dehydroaltenusin was found to be an inhibitor of pol {alpha} from a fungus (Alternaria tennuis). We succeeded in chemically synthesizing dehydroaltenusin, and the compound inhibited only mammalian pol {alpha} with IC{sub 50} value of 0.5 {mu}M, and did not influence the activities of other replicative pols such as pols {delta} and {epsilon}, but also showed no effect on pol {alpha} activity from another vertebrate, fish, or from a plant species. Dehydroaltenusin also had no influence on the other pols and DNA metabolic enzymes tested. The compound also inhibited the proliferation of human cancer cells with LD{sub 50} values of 38.0-44.4 {mu}M. In an in vivo anti-tumor assay on nude mice bearing solid tumors of HeLa cells, dehydroaltenusin was shown to be a promising suppressor of solid tumors. Histopathological examination revealed that increased tumor necrosis and decreased mitotic index were apparently detected by the compound in vivo. Therefore, dehydroaltenusin could be of interest as not only a mammalian pol {alpha}-specific inhibitor, but also as a candidate drug for anti-cancer treatment.

  14. Cloning and nucleotide sequence of the alpha-galactosidase cDNA from Cyamopsis tetragonoloba (guar).

    PubMed

    Overbeeke, N; Fellinger, A J; Toonen, M Y; van Wassenaar, D; Verrips, C T

    1989-11-01

    Polyadenylated mRNA was purified from the aleurone cells of Cyamopsis tetragonoloba (guar) seeds germinated for 18 h and used for the construction of a cDNA library. Clones with the alpha-galactosidase encoding gene were identified using oligo-nucleotide mixed probes based on the NH2 terminal amino acid sequence and on the sequence of an internal peptide. The nucleotide sequence of the cDNA clone showed that the enzyme is synthesized as a precursor with a 47 amino acid NH2 terminal extension. This pre-sequence most likely functions to target the protein outside the aleurone cells into the endosperm. Based upon structural features, it is proposed to divide the precursor into a pre-(signal sequence) part and a glycosylated pro-part comparable with those of the yeast mat A/alpha factor and killer factor. A comparison of the derived amino acid sequence of this alpha-galactosidase from plant origin revealed significant stretches of homology with respect to the amino acid sequences of the enzymes from Saccharomyces cerevisiae and from human origin but only to a minor extent compared with the alpha-galactosidase from Escherichia coli.

  15. Electronic Properties of DNA-Based Schottky Barrier Diodes in Response to Alpha Particles.

    PubMed

    Al-Ta'ii, Hassan Maktuff Jaber; Periasamy, Vengadesh; Amin, Yusoff Mohd

    2015-01-01

    Detection of nuclear radiation such as alpha particles has become an important field of research in recent history due to nuclear threats and accidents. In this context; deoxyribonucleic acid (DNA) acting as an organic semiconducting material could be utilized in a metal/semiconductor Schottky junction for detecting alpha particles. In this work we demonstrate for the first time the effect of alpha irradiation on an Al/DNA/p-Si/Al Schottky diode by investigating its current-voltage characteristics. The diodes were exposed for different periods (0-20 min) of irradiation. Various diode parameters such as ideality factor, barrier height, series resistance, Richardson constant and saturation current were then determined using conventional, Cheung and Cheung's and Norde methods. Generally, ideality factor or n values were observed to be greater than unity, which indicates the influence of some other current transport mechanism besides thermionic processes. Results indicated ideality factor variation between 9.97 and 9.57 for irradiation times between the ranges 0 to 20 min. Increase in the series resistance with increase in irradiation time was also observed when calculated using conventional and Cheung and Cheung's methods. These responses demonstrate that changes in the electrical characteristics of the metal-semiconductor-metal diode could be further utilized as sensing elements to detect alpha particles. PMID:26007733

  16. Electronic Properties of DNA-Based Schottky Barrier Diodes in Response to Alpha Particles

    PubMed Central

    Al-Ta’ii, Hassan Maktuff Jaber; Periasamy, Vengadesh; Amin, Yusoff Mohd

    2015-01-01

    Detection of nuclear radiation such as alpha particles has become an important field of research in recent history due to nuclear threats and accidents. In this context; deoxyribonucleic acid (DNA) acting as an organic semiconducting material could be utilized in a metal/semiconductor Schottky junction for detecting alpha particles. In this work we demonstrate for the first time the effect of alpha irradiation on an Al/DNA/p-Si/Al Schottky diode by investigating its current-voltage characteristics. The diodes were exposed for different periods (0–20 min) of irradiation. Various diode parameters such as ideality factor, barrier height, series resistance, Richardson constant and saturation current were then determined using conventional, Cheung and Cheung’s and Norde methods. Generally, ideality factor or n values were observed to be greater than unity, which indicates the influence of some other current transport mechanism besides thermionic processes. Results indicated ideality factor variation between 9.97 and 9.57 for irradiation times between the ranges 0 to 20 min. Increase in the series resistance with increase in irradiation time was also observed when calculated using conventional and Cheung and Cheung’s methods. These responses demonstrate that changes in the electrical characteristics of the metal-semiconductor-metal diode could be further utilized as sensing elements to detect alpha particles. PMID:26007733

  17. Evaluation of intra- and interspecific divergence of satellite DNA sequences by nucleotide frequency calculation and pairwise sequence comparison

    PubMed Central

    2003-01-01

    Satellite DNA sequences are known to be highly variable and to have been subjected to concerted evolution that homogenizes member sequences within species. We have analyzed the mode of evolution of satellite DNA sequences in four fishes from the genus Diplodus by calculating the nucleotide frequency of the sequence array and the phylogenetic distances between member sequences. Calculation of nucleotide frequency and pairwise sequence comparison enabled us to characterize the divergence among member sequences in this satellite DNA family. The results suggest that the evolutionary rate of satellite DNA in D. bellottii is about two-fold greater than the average of the other three fishes, and that the sequence homogenization event occurred in D. puntazzo more recently than in the others. The procedures described here are effective to characterize mode of evolution of satellite DNA. PMID:12734555

  18. Evaluation of intra- and interspecific divergence of satellite DNA sequences by nucleotide frequency calculation and pairwise sequence comparison.

    PubMed

    Kato, Mikio

    2003-01-01

    Satellite DNA sequences are known to be highly variable and to have been subjected to concerted evolution that homogenizes member sequences within species. We have analyzed the mode of evolution of satellite DNA sequences in four fishes from the genus Diplodus by calculating the nucleotide frequency of the sequence array and the phylogenetic distances between member sequences. Calculation of nucleotide frequency and pairwise sequence comparison enabled us to characterize the divergence among member sequences in this satellite DNA family. The results suggest that the evolutionary rate of satellite DNA in D. bellottii is about two-fold greater than the average of the other three fishes, and that the sequence homogenization event occurred in D. puntazzo more recently than in the others. The procedures described here are effective to characterize mode of evolution of satellite DNA. PMID:12734555

  19. Human DNA polymerase alpha gene expression is cell proliferation dependent and its primary structure is similar to both prokaryotic and eukaryotic replicative DNA polymerases.

    PubMed Central

    Wong, S W; Wahl, A F; Yuan, P M; Arai, N; Pearson, B E; Arai, K; Korn, D; Hunkapiller, M W; Wang, T S

    1988-01-01

    We have isolated cDNA clones encoding the human DNA polymerase alpha catalytic polypeptide. Studies of the human DNA polymerase alpha steady-state mRNA levels in quiescent cells stimulated to proliferate, or normal cells compared to transformed cells, demonstrate that the polymerase alpha mRNA, like its enzymatic activity and de novo protein synthesis, positively correlates with cell proliferation and transformation. Analysis of the deduced 1462-amino-acid sequence reveals six regions of striking similarity to yeast DNA polymerase I and DNA polymerases of bacteriophages T4 and phi 29, herpes family viruses, vaccinia virus and adenovirus. Three of these conserved regions appear to comprise the functional active site required for deoxynucleotide interaction. Two putative DNA interacting domains are also identified. Images PMID:3359994

  20. alpha-Melanocortin and endothelin-1 activate antiapoptotic pathways and reduce DNA damage in human melanocytes.

    PubMed

    Kadekaro, Ana Luisa; Kavanagh, Renny; Kanto, Hiromi; Terzieva, Silva; Hauser, Jennifer; Kobayashi, Nobuhiko; Schwemberger, Sandy; Cornelius, James; Babcock, George; Shertzer, Howard G; Scott, Glynis; Abdel-Malek, Zalfa A

    2005-05-15

    UV radiation is an important etiologic factor for skin cancer, including melanoma. Constitutive pigmentation and the ability to tan are considered the main photoprotective mechanism against sun-induced carcinogenesis. Pigmentation in the skin is conferred by epidermal melanocytes that synthesize and transfer melanin to keratinocytes. Therefore, insuring the survival and genomic stability of epidermal melanocytes is critical for inhibiting photocarcinogenesis, particularly melanoma, the most deadly form of skin cancer. The paracrine factors alpha-melanocortin and endothelin-1 are critical for the melanogenic response of cultured human melanocytes to UV radiation. We report that alpha-melanocortin and endothelin-1 rescued human melanocytes from UV radiation-induced apoptosis and reduced DNA photoproducts and oxidative stress. The survival effects of alpha-melanocortin and endothelin-1 were mediated by activation of the melanocortin 1 and endothelin receptors, respectively. Treatment of melanocytes with alpha-melanocortin and/or endothelin-1 before exposure to UV radiation activated the inositol triphosphate kinase-Akt pathway and increased the phosphorylation and expression of the microphthalmia-related transcription factor. Treatment with alpha-melanocortin and/or endothelin-1 enhanced the repair of cyclobutane pyrimidine dimers and reduced the levels of hydrogen peroxide induced by UV radiation. These effects are expected to reduce genomic instability and mutagenesis.

  1. Satellite DNA Modulates Gene Expression in the Beetle Tribolium castaneum after Heat Stress.

    PubMed

    Feliciello, Isidoro; Akrap, Ivana; Ugarković, Đurđica

    2015-08-01

    Non-coding repetitive DNAs have been proposed to perform a gene regulatory role, however for tandemly repeated satellite DNA no such role was defined until now. Here we provide the first evidence for a role of satellite DNA in the modulation of gene expression under specific environmental conditions. The major satellite DNA TCAST1 in the beetle Tribolium castaneum is preferentially located within pericentromeric heterochromatin but is also dispersed as single repeats or short arrays in the vicinity of protein-coding genes within euchromatin. Our results show enhanced suppression of activity of TCAST1-associated genes and slower recovery of their activity after long-term heat stress relative to the same genes without associated TCAST1 satellite DNA elements. The level of gene suppression is not influenced by the distance of TCAST1 elements from the associated genes up to 40 kb from the genes' transcription start sites, but it does depend on the copy number of TCAST1 repeats within an element, being stronger for the higher number of copies. The enhanced gene suppression correlates with the enrichment of the repressive histone marks H3K9me2/3 at dispersed TCAST1 elements and their flanking regions as well as with increased expression of TCAST1 satellite DNA. The results reveal transient, RNAi based heterochromatin formation at dispersed TCAST1 repeats and their proximal regions as a mechanism responsible for enhanced silencing of TCAST1-associated genes. Differences in the pattern of distribution of TCAST1 elements contribute to gene expression diversity among T. castaneum strains after long-term heat stress and might have an impact on adaptation to different environmental conditions. PMID:26275223

  2. Satellite DNA Modulates Gene Expression in the Beetle Tribolium castaneum after Heat Stress.

    PubMed

    Feliciello, Isidoro; Akrap, Ivana; Ugarković, Đurđica

    2015-08-01

    Non-coding repetitive DNAs have been proposed to perform a gene regulatory role, however for tandemly repeated satellite DNA no such role was defined until now. Here we provide the first evidence for a role of satellite DNA in the modulation of gene expression under specific environmental conditions. The major satellite DNA TCAST1 in the beetle Tribolium castaneum is preferentially located within pericentromeric heterochromatin but is also dispersed as single repeats or short arrays in the vicinity of protein-coding genes within euchromatin. Our results show enhanced suppression of activity of TCAST1-associated genes and slower recovery of their activity after long-term heat stress relative to the same genes without associated TCAST1 satellite DNA elements. The level of gene suppression is not influenced by the distance of TCAST1 elements from the associated genes up to 40 kb from the genes' transcription start sites, but it does depend on the copy number of TCAST1 repeats within an element, being stronger for the higher number of copies. The enhanced gene suppression correlates with the enrichment of the repressive histone marks H3K9me2/3 at dispersed TCAST1 elements and their flanking regions as well as with increased expression of TCAST1 satellite DNA. The results reveal transient, RNAi based heterochromatin formation at dispersed TCAST1 repeats and their proximal regions as a mechanism responsible for enhanced silencing of TCAST1-associated genes. Differences in the pattern of distribution of TCAST1 elements contribute to gene expression diversity among T. castaneum strains after long-term heat stress and might have an impact on adaptation to different environmental conditions.

  3. Satellite DNA Modulates Gene Expression in the Beetle Tribolium castaneum after Heat Stress

    PubMed Central

    Feliciello, Isidoro; Akrap, Ivana; Ugarković, Đurđica

    2015-01-01

    Non-coding repetitive DNAs have been proposed to perform a gene regulatory role, however for tandemly repeated satellite DNA no such role was defined until now. Here we provide the first evidence for a role of satellite DNA in the modulation of gene expression under specific environmental conditions. The major satellite DNA TCAST1 in the beetle Tribolium castaneum is preferentially located within pericentromeric heterochromatin but is also dispersed as single repeats or short arrays in the vicinity of protein-coding genes within euchromatin. Our results show enhanced suppression of activity of TCAST1-associated genes and slower recovery of their activity after long-term heat stress relative to the same genes without associated TCAST1 satellite DNA elements. The level of gene suppression is not influenced by the distance of TCAST1 elements from the associated genes up to 40 kb from the genes’ transcription start sites, but it does depend on the copy number of TCAST1 repeats within an element, being stronger for the higher number of copies. The enhanced gene suppression correlates with the enrichment of the repressive histone marks H3K9me2/3 at dispersed TCAST1 elements and their flanking regions as well as with increased expression of TCAST1 satellite DNA. The results reveal transient, RNAi based heterochromatin formation at dispersed TCAST1 repeats and their proximal regions as a mechanism responsible for enhanced silencing of TCAST1-associated genes. Differences in the pattern of distribution of TCAST1 elements contribute to gene expression diversity among T. castaneum strains after long-term heat stress and might have an impact on adaptation to different environmental conditions. PMID:26275223

  4. Urea facilitates the translocation of single-stranded DNA and RNA through the alpha-hemolysin nanopore.

    PubMed

    Japrung, Deanpen; Henricus, Marsiyana; Li, Qiuhong; Maglia, Giovanni; Bayley, Hagan

    2010-05-19

    The staphylococcal alpha-hemolysin (alphaHL) protein nanopore is under investigation as a fast, cheap detector for nucleic acid analysis and sequencing. Although discrimination of all four bases of DNA by the alphaHL pore has been demonstrated, analysis of single-stranded DNAs and RNAs containing secondary structure mediated by basepairing is prevented because these nucleic acids cannot be translocated through the pore. Here, we show that a structured 95-nucleotide single-stranded DNA and its RNA equivalent are translocated through the alphaHL pore in the presence of 4 M urea, a concentration that denatures the secondary structure of the polynucleotides. The alphaHL pore is functional even in 7 M urea, and therefore it is easily stable enough for analyses of challenging DNA and RNA species. PMID:20441749

  5. Alpha particle induced DNA damage and repair in normal cultured thyrocytes of different proliferation status.

    PubMed

    Lyckesvärd, Madeleine Nordén; Delle, Ulla; Kahu, Helena; Lindegren, Sture; Jensen, Holger; Bäck, Tom; Swanpalmer, John; Elmroth, Kecke

    2014-07-01

    Childhood exposure to ionizing radiation increases the risk of developing thyroid cancer later in life and this is suggested to be due to higher proliferation of the young thyroid. The interest of using high-LET alpha particles from Astatine-211 ((211)At), concentrated in the thyroid by the same mechanism as (131)I [1], in cancer treatment has increased during recent years because of its high efficiency in inducing biological damage and beneficial dose distribution when compared to low-LET radiation. Most knowledge of the DNA damage response in thyroid is from studies using low-LET irradiation and much less is known of high-LET irradiation. In this paper we investigated the DNA damage response and biological consequences to photons from Cobolt-60 ((60)Co) and alpha particles from (211)At in normal primary thyrocytes of different cell cycle status. For both radiation qualities the intensity levels of γH2AX decreased during the first 24h in both cycling and stationary cultures and complete repair was seen in all cultures but cycling cells exposed to (211)At. Compared to stationary cells alpha particles were more harmful for cycling cultures, an effect also seen at the pChk2 levels. Increasing ratios of micronuclei per cell nuclei were seen up to 1Gy (211)At. We found that primary thyrocytes were much more sensitive to alpha particle exposure compared with low-LET photons. Calculations of the relative biological effectiveness yielded higher RBE for cycling cells compared with stationary cultures at a modest level of damage, clearly demonstrating that cell cycle status influences the relative effectiveness of alpha particles. PMID:24769180

  6. Alpha particle induced DNA damage and repair in normal cultured thyrocytes of different proliferation status.

    PubMed

    Lyckesvärd, Madeleine Nordén; Delle, Ulla; Kahu, Helena; Lindegren, Sture; Jensen, Holger; Bäck, Tom; Swanpalmer, John; Elmroth, Kecke

    2014-07-01

    Childhood exposure to ionizing radiation increases the risk of developing thyroid cancer later in life and this is suggested to be due to higher proliferation of the young thyroid. The interest of using high-LET alpha particles from Astatine-211 ((211)At), concentrated in the thyroid by the same mechanism as (131)I [1], in cancer treatment has increased during recent years because of its high efficiency in inducing biological damage and beneficial dose distribution when compared to low-LET radiation. Most knowledge of the DNA damage response in thyroid is from studies using low-LET irradiation and much less is known of high-LET irradiation. In this paper we investigated the DNA damage response and biological consequences to photons from Cobolt-60 ((60)Co) and alpha particles from (211)At in normal primary thyrocytes of different cell cycle status. For both radiation qualities the intensity levels of γH2AX decreased during the first 24h in both cycling and stationary cultures and complete repair was seen in all cultures but cycling cells exposed to (211)At. Compared to stationary cells alpha particles were more harmful for cycling cultures, an effect also seen at the pChk2 levels. Increasing ratios of micronuclei per cell nuclei were seen up to 1Gy (211)At. We found that primary thyrocytes were much more sensitive to alpha particle exposure compared with low-LET photons. Calculations of the relative biological effectiveness yielded higher RBE for cycling cells compared with stationary cultures at a modest level of damage, clearly demonstrating that cell cycle status influences the relative effectiveness of alpha particles.

  7. Mammalian. cap alpha. -polymerase: cloning of partial complementary DNA and immunobinding of catalytic subunit in crude homogenate protein blots

    SciTech Connect

    SenGupta, D.N.; Kumar, P.; Zmudzka, B.Z.; Coughlin, S.; Vishwanatha, J.K.; Robey, F.A.; Parrott, C.; Wilson, S.H.

    1987-02-10

    A new polyclonal antibody against the ..cap alpha..-polymerase catalytic polypeptide was prepared by using homogeneous HeLa cell..cap alpha..-polymerase. The antibody neutralized ..cap alpha..-polymerase activity and was strong and specific for the ..cap alpha..-polymerase catalytic polypeptide (M/sub r/ 183,000) in Western blot analysis of crude extracts of HeLa cells. The antibody was used to screen a cDNA library of newborn rat brain poly(A+) RNA in lambdagt11. A positive phage was identified and plaque purified. This phage, designated lambdapol..cap alpha..1.2, also was found to be positive with an antibody against Drosophila ..cap alpha..-polymerase. The insert in lambdapol..cap alpha..1.2 (1183 base pairs) contained a poly(A) sequence at the 3' terminus and a short in-phase open reading frame at the 5' terminus. A synthetic oligopeptide (eight amino acids) corresponding to the open reading frame was used to raise antiserum in rabbits. Antibody affinity purified from this serum was found to be immunoreactive against purified ..cap alpha..-polymerase by enzyme-linked immunosorbent assay and was capable of immunoprecipitating ..cap alpha..-polymerase. This indicated the lambdapol..cap alpha..1.2 insert encoded an ..cap alpha..-polymerase epitope and suggested that the cDNA corresponded to an ..cap alpha..-polymerase mRNA. This was confirmed in hybrid selection experiments using pUC9 containing the cDNA insert and poly(A+) RNA from newborn rat brain; the insert hybridized to mRNA capable of encoding ..cap alpha..-polymerase catalytic polypeptides. Northern blot analysis of rat brain poly(A+) RNA revealed that this mRNA is approx.5.4 kilobases.

  8. Thiol-modulated mechanisms of the cytotoxicity of thimerosal and inhibition of DNA topoisomerase II alpha.

    PubMed

    Wu, Xing; Liang, Hong; O'Hara, Kimberley A; Yalowich, Jack C; Hasinoff, Brian B

    2008-02-01

    Thimerosal is an organic mercury compound that is widely used as a preservative in vaccines and other solution formulations. The use of thimerosal has caused concern about its ability to cause neurological abnormalities due to mercury accumulation during a normal schedule of childhood vaccinations. While the chemistry and the biological effects of methylmercury have been well-studied, those of thimerosal have not. Thimerosal reacted rapidly with cysteine, GSH, human serum albumin, and single-stranded DNA to form ethylmercury adducts that were detectable by mass spectrometry. These results indicated that thimerosal would be quickly metabolized in vivo because of its reactions with protein and nonprotein thiols. Thimerosal also potently inhibited the decatenation activity of DNA topoisomerase II alpha, likely through reaction with critical free cysteine thiol groups. Thimerosal, however, did not act as a topoisomerase II poison and the lack of cross-resistance with a K562 cell line with a decreased level of topoisomerase II alpha (K/VP.5 cells) suggested that inhibition of topoisomerase II alpha was not a significant mechanism for the inhibition of cell growth. Depletion of intracellular GSH with buthionine sulfoximine treatment greatly increased the K562 cell growth inhibitory effects of thimerosal, which showed that intracellular glutathione had a major role in protecting cells from thimerosal. Pretreatment of thimerosal with glutathione did not, however, change its K562 cell growth inhibitory effects, a result consistent with the rapid exchange of the ethylmercury adduct among various thiol-containing cellular reactants. Thimerosal-induced single and double strand breaks in K562 cells were consistent with a rapid induction of apoptosis. In conclusion, these studies have elucidated some of the chemistry and biological activities of the interaction of thimerosal with topoisomerase II alpha and protein and nonprotein thiols and with DNA.

  9. Satellite DNA from the brine shrimp Artemia affects the expression of a flanking gene in yeast.

    PubMed

    Maiorano, D; Cece, R; Badaracco, G

    1997-04-11

    We have previously revealed that in the brine shrimp Artemia franciscana an AluI DNA family of repeats, 113 bp in length, is the major component of the constitutive heterochromatin and that this repetitive DNA shows a stable curvature that confers a solenoidal geometry on the double helix in vitro. It was suggested that this particular structure may play a relevant role in determining the condensation of the heterochromatin. In this report we have cloned hexamers of highly-repetitive sequence (AluI-satellite DNA) in proximity to a yeast lacZ reporter gene on a plasmid. We find that the expression of the reporter gene is affected by the presence of this DNA in a dose- and orientation-dependent manner in the yeast, S. cerevisiae. We show that this effect is not dependent on under-replication or re-arrangements of the repetitive DNA in the cell but is due to decreased expression of the reporter gene. Our results indicate that the AluI-satellite DNA of Artemia per se is able to influence gene expression. PMID:9161405

  10. Is Radon Emission in Caves Causing Deletions in Satellite DNA Sequences of Cave-Dwelling Crickets?

    PubMed Central

    Allegrucci, Giuliana; Sbordoni, Valerio; Cesaroni, Donatella

    2015-01-01

    The most stable isotope of radon, 222Rn, represents the major source of natural radioactivity in confined environments such as mines, caves and houses. In this study, we explored the possible radon-related effects on the genome of Dolichopoda cave crickets (Orthoptera, Rhaphidophoridae) sampled in caves with different concentrations of radon. We analyzed specimens from ten populations belonging to two genetically closely related species, D. geniculata and D. laetitiae, and explored the possible association between the radioactivity dose and the level of genetic polymorphism in a specific family of satellite DNA (pDo500 satDNA). Radon concentration in the analyzed caves ranged from 221 to 26000 Bq/m3. Specimens coming from caves with the highest radon concentration showed also the highest variability estimates in both species, and the increased sequence heterogeneity at pDo500 satDNA level can be explained as an effect of the mutation pressure induced by radon in cave. We discovered a specific category of nuclear DNA, the highly repetitive satellite DNA, where the effects of the exposure at high levels of radon-related ionizing radiation are detectable, suggesting that the satDNA sequences might be a valuable tool to disclose harmful effects also in other organisms exposed to high levels of radon concentration. PMID:25822625

  11. Satellite DNA from the brine shrimp Artemia affects the expression of a flanking gene in yeast.

    PubMed

    Maiorano, D; Cece, R; Badaracco, G

    1997-04-11

    We have previously revealed that in the brine shrimp Artemia franciscana an AluI DNA family of repeats, 113 bp in length, is the major component of the constitutive heterochromatin and that this repetitive DNA shows a stable curvature that confers a solenoidal geometry on the double helix in vitro. It was suggested that this particular structure may play a relevant role in determining the condensation of the heterochromatin. In this report we have cloned hexamers of highly-repetitive sequence (AluI-satellite DNA) in proximity to a yeast lacZ reporter gene on a plasmid. We find that the expression of the reporter gene is affected by the presence of this DNA in a dose- and orientation-dependent manner in the yeast, S. cerevisiae. We show that this effect is not dependent on under-replication or re-arrangements of the repetitive DNA in the cell but is due to decreased expression of the reporter gene. Our results indicate that the AluI-satellite DNA of Artemia per se is able to influence gene expression.

  12. Is radon emission in caves causing deletions in satellite DNA sequences of cave-dwelling crickets?

    PubMed

    Allegrucci, Giuliana; Sbordoni, Valerio; Cesaroni, Donatella

    2015-01-01

    The most stable isotope of radon, 222Rn, represents the major source of natural radioactivity in confined environments such as mines, caves and houses. In this study, we explored the possible radon-related effects on the genome of Dolichopoda cave crickets (Orthoptera, Rhaphidophoridae) sampled in caves with different concentrations of radon. We analyzed specimens from ten populations belonging to two genetically closely related species, D. geniculata and D. laetitiae, and explored the possible association between the radioactivity dose and the level of genetic polymorphism in a specific family of satellite DNA (pDo500 satDNA). Radon concentration in the analyzed caves ranged from 221 to 26,000 Bq/m3. Specimens coming from caves with the highest radon concentration showed also the highest variability estimates in both species, and the increased sequence heterogeneity at pDo500 satDNA level can be explained as an effect of the mutation pressure induced by radon in cave. We discovered a specific category of nuclear DNA, the highly repetitive satellite DNA, where the effects of the exposure at high levels of radon-related ionizing radiation are detectable, suggesting that the satDNA sequences might be a valuable tool to disclose harmful effects also in other organisms exposed to high levels of radon concentration.

  13. Molecular characterization of a new begomovirus infecting Sida cordifolia and its associated satellite DNA molecules.

    PubMed

    Guo, Xiaojian; Zhou, Xueping

    2006-12-01

    Two virus isolates Hn57 and Hn60 were obtained from Sida cordifolia showing mild upward leaf-curling symptoms in Hainan province of China. Comparison of partial sequences of DNA-A like molecule confirmed the existence of a single type of begomovirus. The complete nucleotide sequence of DNA-A of Hn57 was determined to be 2757 nucleotides, with a genomic organization typical of begomoviruses. Complete sequence comparison with other reported begomoviruses revealed that Hn57 DNA-A has the highest sequence identity (71.0%) with that of Tobacco leaf curl Yunnan virus. Consequently, Hn57 was considered to be a new begomovirus species, for which the name Sida leaf curl virus (SiLCV) is proposed. In addition to DNA-A molecule, two additional circular single-stranded satellite DNA molecules corresponding to DNAbeta and DNA1 were found to be associated with SiLCV isolates. Both DNAbeta and DNA1 were approximately half the size of their cognate genomic DNA. Sequence analysis shows that DNAbeta of Hn57 and Hn60 share 93.8% nucleotide sequence identity, and they have the highest sequence identity (58.5%) with DNAbeta associated with Ageratum leaf curl disease (AJ316027). The nucleotide sequence identity between DNA1 of Hn57 and that of Hn60 was 83.8%, they share 58.2-79.3% nucleotide sequence identities in comparison with other previously reported DNAl.

  14. Action of ornithine alpha ketoglutarate on DNA synthesis by human fibroblasts

    SciTech Connect

    Vaubourdolle, M.; Salvucci, M.; Coudray-Lucas, C.; Agneray, J.; Cynober, L.; Ekindjian, O.G. )

    1990-02-01

    Ornithine alpha ketoglutarate (OKG) is largely used in clinical nutrition for its anabolic effects. However, the mechanism of its action remains questionable. We investigated the effect of OKG on the rate of DNA synthesis in human fibroblasts. The in vitro experimental procedure required to demonstrate in cell culture the anabolic effects of OKG observed in vivo was found to be glutamine-free and serum-poor medium with sparse cells. In these conditions, OKG induced a significant increase in ({sup 3}H)thymidine incorporation compared to untreated control cells. This effect was dose-dependent and was observed in all the cultures tested. Taken individually, the two constituents of OKG, i.e. alpha KG and Orn, also showed a stimulatory effect, but did not demonstrate a dose-dependent response. Concomitant analysis of extracellular amino acids showed in alpha KG-treated cultures an increase in glutamate and a decrease in aspartate, suggesting a cellular transamination of alpha KG. Glutamine, which is the preferential energetic substrate of fibroblasts, can be produced from glutamate and might play a role in the action of OKG. Moreover, OKG induced a rise in the cellular polyamine content. This, in association with the inhibitory effect on OKG action of difluoromethylornithine, a specific inhibitor of ornithine decarboxylase, suggests a link between the polyamine biosynthesis pathway and the anabolic effect of OKG.

  15. Cloning and expression of a human kidney cDNA for an /alpha//sub 2/-adrenergic receptor subtype

    SciTech Connect

    Regan, J.W.; Kobilka, T.S.; Yang-Feng, T.L.; Caron, M.G.; Lefkowitz, R.J.; Kobilka, B.K.

    1988-09-01

    An /alpha//sub 2/-adrenergic receptor subtype has been cloned from a human kidney cDNA library using the gene for the human platelet /alpha//sub 2/-adrenergic receptor as a probe. The deduced amino acid sequence resembles the human platelet /alpha//sub 2/-adrenergic receptor and is consistent with the structure of other members of he family of guanine nucleotide-binding protein-coupled receptors. The cDNA was expressed in a mammalian cell line (COS-7), and the /alpha//sub 2/-adrenergic ligand (/sup 3/H)rauwolscine was bound. Competition curve analysis with a variety of adrenergic ligands suggests that this cDNA clone represents the /alpha//sub 2/B-adrenergic receptor. The gene for this receptor is on human chromosome 4, whereas the gene for the human platelet /alpha//sub 2/-adrenergic receptor (/alpha//sub 2/A) lies on chromosome 10. This ability to express the receptor in mammalian cells, free of other adrenergic receptor subtypes, should help in developing more selective /alpha/-adrenergic ligands.

  16. K{alpha} x-ray satellite lines of Si induced in collisions with 1-3-MeV protons

    SciTech Connect

    Kavcic, Matjaz

    2003-08-01

    The K{alpha} x-ray emission spectra of Si bombarded by 1-3-MeV protons were measured with a crystal spectrometer in Johansson geometry, enabling energy resolution below the natural linewidth of the measured K{alpha} line. The K{alpha}L{sup 1} and K{alpha}L{sup 2} (K{alpha}L{sup 1,2}) x-ray satellite lines appearing in these spectra as a result of the radiative decay of atomic states with one hole in the K shell and one or two in the L subshells were precisely measured. The energies and intensities of the main components that could be resolved within the satellite lines are given. It has been demonstrated that the latter do not depend on proton energy and are essentially the same as in photon-induced spectra. The overall K{alpha}L{sup 1} satellite intensity relative to the K{alpha} diagram line has been used to deduce the L-shell ionization probabilities induced in near-central proton collisions. The experimental values were compared to the theoretical values calculated with the semiclassical approximation, with the three-body classical trajectory Monte Carlo model, and the classical binary-encounter-based geometrical model.

  17. Sanfilippo syndrome type B: cDNA and gene encoding human {alpha}-N-acetylglucosaminidase

    SciTech Connect

    Zhao, H.G.; Lopez, R.; Rennecker, J.

    1994-09-01

    Deficiency of the lysosomal enzyme {alpha}-N-acetlyglucosaminidase underlies the type B Sanfilippo syndrome (MPS III B), a mucopolysaccharide storage disease with profound neurologic deterioration. We are acquiring tools to study the molecular basis of the disorder. The enzyme was purified from bovine testis; after ConA-, DEAE- and phenyl-Sepharose chromatography, it was subjected to SDS-PAGE without preheating. Of two bands of activity detected on the gel, 170 kDa and 87 kDa, the larger one, which coincided with a well-defined Coomassie blue band, was selected for sequence analysis. Degenerate 17-base oligonucleotides, corresponding to the ends of an internal 23 amino acid sequence, were used for RT-PCR of RNA from human fibroblasts. A 41-mer was synthesized from the sequence of the RT-PCR product and used to screen a human testis cDNA library. A number of cDNA inserts were isolated, all lacking the 5{prime} end and none longer than 1.7 kb. An additional 300 bp segment has been obtained by RACE. The cDNA sequence accounts for 9 of 11 peptides, allowing for species difference. Northern analysis of fibroblast RNA with a 1.5 kb cDNA probe showed the presence of a 3 kb mRNA; marked deficiency of this mRNA in two MPS III B fibroblast lines confirmed the authenticity of the cloned cDNA. While no homologous amino acid sequence has been found in a search of GenBank, the nucleotide sequence (interrupted by 4 introns) is present in a flanking region upstream of an unrelated gene on chromosome 17q11-21 (human 17{beta}-hydroxysteroid dehydrogenase). This must therefore be the chromosomal locus of the {alpha}-N-acetylglucosaminidase gene and of MPS III B.

  18. Isolation and expression of a novel chick G-protein cDNA coding for a G alpha i3 protein with a G alpha 0 N-terminus.

    PubMed Central

    Kilbourne, E J; Galper, J B

    1994-01-01

    We have cloned cDNAs coding for G-protein alpha subunits from a chick brain cDNA library. Based on sequence similarity to G-protein alpha subunits from other eukaryotes, one clone was designated G alpha i3. A second clone, G alpha i3-o, was identical to the G alpha i3 clone over 932 bases on the 3' end. The 5' end of G alpha i3-o, however, contained an alternative sequence in which the first 45 amino acids coded for are 100% identical to the conserved N-terminus of G alpha o from species such as rat, mouse, human, bovine and hamster. Both clones were found to be expressed in all tissues studied. The unusual alpha o-alpha i3-like G-protein chimera, G alpha i3-o, was found to be expressed at significantly lower levels than G alpha i3. In vitro transcription and translation of the G alpha i3-o cDNA clone gave a protein of approx. 41 kDa which stably bound guanosine 5'-[gamma-thio]triphosphate. G alpha i3-o appears to be the first G-protein alpha subunit cloned which contains ends that are homologous to two different alpha subunit isoforms, G alpha o and G alpha i3. Images Figure 4 Figure 5 Figure 6 Figure 7 PMID:8297335

  19. A novel satellite DNA isolated in Pecten jacobaeus shows high sequence similarity among molluscs.

    PubMed

    Petraccioli, Agnese; Odierna, Gaetano; Capriglione, Teresa; Barucca, Marco; Forconi, Mariko; Olmo, Ettore; Biscotti, Maria Assunta

    2015-10-01

    The aim of this work is to investigate the sequence conservation and the evolution of repeated DNA in related species. Satellite DNA is a component of eukaryotic genomes and is made up of tandemly repeated sequences. These sequences are affected by high rates of mutation that lead to the occurrence of species-specific satellite DNAs, which are different in terms of both quantity and quality. In this work, a novel repetitive DNA family, named PjHhaI sat, is described in Pecten jacobaeus. The quantitative analyses revealed a different abundance of this element in the molluscan species investigated in agreement with the "library hypothesis" even if, in this case, at a high taxonomic level. In addition, the qualitative analysis demonstrated an astonishing sequence conservation not only among scallops but also in six other molluscan species belonging to three classes. These findings suggest that the PjHhaI sat may be considered as the most ancients of DNA described so far, which remained "frozen" during molluscan evolution. The widespread distribution of this sat DNA in molluscs as well as its long evolutionary preservation open up questions on the functional role of this element. A future challenge might be the identification of proteins or molecules which interact with the PjHhaI sat.

  20. A novel satellite DNA isolated in Pecten jacobaeus shows high sequence similarity among molluscs.

    PubMed

    Petraccioli, Agnese; Odierna, Gaetano; Capriglione, Teresa; Barucca, Marco; Forconi, Mariko; Olmo, Ettore; Biscotti, Maria Assunta

    2015-10-01

    The aim of this work is to investigate the sequence conservation and the evolution of repeated DNA in related species. Satellite DNA is a component of eukaryotic genomes and is made up of tandemly repeated sequences. These sequences are affected by high rates of mutation that lead to the occurrence of species-specific satellite DNAs, which are different in terms of both quantity and quality. In this work, a novel repetitive DNA family, named PjHhaI sat, is described in Pecten jacobaeus. The quantitative analyses revealed a different abundance of this element in the molluscan species investigated in agreement with the "library hypothesis" even if, in this case, at a high taxonomic level. In addition, the qualitative analysis demonstrated an astonishing sequence conservation not only among scallops but also in six other molluscan species belonging to three classes. These findings suggest that the PjHhaI sat may be considered as the most ancients of DNA described so far, which remained "frozen" during molluscan evolution. The widespread distribution of this sat DNA in molluscs as well as its long evolutionary preservation open up questions on the functional role of this element. A future challenge might be the identification of proteins or molecules which interact with the PjHhaI sat. PMID:25832354

  1. Concerted evolution at the population level: pupfish HindIII satellite DNA sequences.

    PubMed Central

    Elder, J F; Turner, B J

    1994-01-01

    The canonical monomers (approximately 170 bp) of an abundant (1.9 x 10(6) copies per diploid genome) satellite DNA sequence family in the genome of Cyprinodon variegatus, a "pupfish" that ranges along the Atlantic coast from Cape Cod to central Mexico, are divergent in base sequence in 10 of 12 samples collected from natural populations. The divergence involves substitutions, deletions, and insertions, is marked in scope (mean pairwise sequence similarity = 61.6%; range = 35-95.9%), is largely confined to the 3' half of the monomer, and is not correlated with the distance among collecting sites. Repetitive cloning and direct genomic sequencing experiments failed to detect intrapopulation and intraindividual variation, suggesting high levels of sequence homogeneity within populations. The satellite sequence has therefore undergone "concerted evolution," at the level of the local population. Concerted evolution has previously almost always been discussed in terms of the divergence of species or higher taxa; its intraspecific occurrence apparently has not been reported previously. The generality of the observation is difficult to evaluate, for although satellite DNAs from a large number of organisms have been studied in detail, there appear to be little or no other data on their sequence variation in natural populations. The relationship (if any) between concerted, population level, satellite DNA divergence and the extent of gene flow/genetic isolation among conspecific natural populations remains to be established. Images PMID:8302879

  2. [Transcripts of satellite DNA in blood plasma: probable markers of tumor growth].

    PubMed

    Kondratova, V N; Botezatu, I V; Shelepov, V P; Likhtenshtein, A V

    2014-01-01

    A recent study of human normal and tumor tissues revealed a high transcriptional activity of pericentromeric satellite DNA repeats (they produce half of all transcripts in tumor cells that is many times higher than in normal ones). It was found also that the two subtypes of satellite DNA (HSATII and GSATII) are transcribed reciprocally, i.e. there is a sharp prevalence of HSATII transcription in tumors, while GSATII transcription prevails in the corresponding normal tissues. As different RNAs are present in blood plasma, and some of them serve as effectivetumor markers, we attempted for the first time to evaluate satellite HSATII and GSATII RNAs in the blood plasma of healthy donors and cancer patients. The RT-PCR protocol designed for this purpose allowed us to detect transcripts of both HSATII and GSATII repeats. As it has been shown, HSATII transcripts are more abundant than GSATII ones in plasma of healthy donors and vice versa in plasma of cancer patients; these ratios being diametrically opposed to those that exist within the cells. Some suggestions concerning origins of circulating satellite RNAs and their probable role as tumor markers are discussed.

  3. Non-satellite repetitive human DNA families. Sequence properties and evidence for occurrence in chimpanzee DNA.

    PubMed

    Marx, K A

    1980-07-29

    Repetitive human DNA, fractionated on CsCl gradients following hydroxyapatite isolation, contains two complex DNA fractions, the 1.703 and 1.714 DNA families (Marx, K.A., Allen, J.R. and Hearst, J.E. (1976) Biochim. Biophys. Acta 425, 129-147). Biphasic Topt profiles, obtained in DNA excess hybridizations with cRNA tracers from each DNA family, have been shown to be the likely result of a fast kinetic component hybridizing at higher temperatures (67 degrees C peak) and this fast plus a slow kinetic component both hybridizing at lower temperatures (47 degrees C peak). Equilibrium CsCl gradient DNA-cRNA hybrid distributions support previous interpretations of the sequence composition of both DNA families. That is, the fast component is a relatively undiverged repetitive sequence of recent origin, while the slow component is a highly diverged, less thermally stabile, old primate sequence. This interpretation is further strengthened by cRNA tracer hybridization experiments in chimpanzee DNA excess where the fast component appears to be absent and the slow component present.

  4. A novel satellite DNA sequence in the Peromyscus genome (PMSat): Evolution via copy number fluctuation.

    PubMed

    Louzada, Sandra; Vieira-da-Silva, Ana; Mendes-da-Silva, Ana; Kubickova, Svatava; Rubes, Jiri; Adega, Filomena; Chaves, Raquel

    2015-11-01

    Satellite DNAs (satDNA) are tandemly arrayed repeated sequences largely present in eukaryotic genomes, which play important roles in genome evolution and function, and therefore, their analysis is vital. Here, we describe the isolation of a novel satellite DNA family (PMSat) from the rodent Peromyscus eremicus (Cricetidae, Rodentia), which is located in pericentromeric regions and exhibits a typical satellite DNA genome organization. Orthologous PMSat sequences were isolated and characterized from three species belonging to Cricetidae: Cricetus cricetus, Phodopus sungorus and Microtus arvalis. In these species, PMSat is highly conserved, with the absence of fixed species-specific mutations. Strikingly, different numbers of copies of this sequence were found among the species, suggesting evolution by copy number fluctuation. Repeat units of PMSat were also found in the Peromyscus maniculatus bairdii BioProject, but our results suggest that these repeat units are from genome regions outside the pericentromere. The remarkably high evolutionary sequence conservation along with the preservation of a few numbers of copies of this sequence in the analyzed genomes may suggest functional significance but a different sequence nature/organization. Our data highlight that repeats are difficult to analyze due to the limited tools available to dissect genomes and the fact that assemblies do not cover regions of constitutive heterochromatin.

  5. The circular dichroism properties of phi W-14 DNA containing alpha-putrescinylthymine.

    PubMed

    Spetter, S; Chen, C; Warren, R A; Hanlon, S

    1985-03-01

    The circular dichroism properties of phi W-14 DNA containing alpha-putrescinylthymine and its acetylated derivative have been examined in a number of aqueous solvents. Native phi W-14 DNA exhibits a B-type CD spectrum whose characteristics do not entirely conform to what would be expected for its GC content (51%). The conformationally sensitive positive band above 260 nm has a rotational strength greater than that normally found in prokaryotic DNAs of comparable GC content, such as Escherichia coli DNA. The rotational strength of this band in the spectrum of the heat-denatured form of phi W-14 DNA, however, is similar to that of heat denatured E. coli DNA. Abolition of the positive charge on the putrescine residues of native phi W-14 DNA by reaction with CH2O or by acetylation reduces the rotational strength to a level appropriate for its GC content. Increases in the electrolyte content of the solvent have the same effect, although the rotational strength of this band in phi W-14 DNA does not become comparable to that of E. coli DNA until 6-7 M LiCl. Titration to pH 10.6 in solvents of modest electrolyte content, however, fails to appreciably affect the CD spectral properties of either native phi W-14 DNA or the derivative in which half of the secondary and all of the primary amino groups have been acetylated. On the basis of these results we have concluded that the enhanced rotational strength of the positive band above 260 nm in the CD spectrum of phi W-14 DNA is due to a conformational difference caused by an ion-pair interaction of the positively charged primary amino groups of putrescine with the phosphate backbone. The CD spectral properties, however, reveal that these differences, averaged over the entire basepair population, appear to be relatively small. The average conformation, at least in dilute aqueous solutions, seems to be an unexceptional B variant with conformational properties which would be more appropriate for a DNA of higher CG content.

  6. Molecular Cytogenetic Mapping of Satellite DNA Sequences in Aegilops geniculata and Wheat.

    PubMed

    Koo, Dal-Hoe; Tiwari, Vijay K; Hřibová, Eva; Doležel, Jaroslav; Friebe, Bernd; Gill, Bikram S

    2016-01-01

    Fluorescence in situ hybridization (FISH) provides an efficient system for cytogenetic analysis of wild relatives of wheat for individual chromosome identification, elucidation of homoeologous relationships, and for monitoring alien gene transfers into wheat. This study is aimed at developing cytogenetic markers for chromosome identification of wheat and Aegilops geniculata (2n = 4x = 28, UgUgMgMg) using satellite DNAs obtained from flow-sorted chromosome 5Mg. FISH was performed to localize the satellite DNAs on chromosomes of wheat and selected Aegilops species. The FISH signals for satellite DNAs on chromosome 5Mg were generally associated with constitutive heterochromatin regions corresponding to C-band-positive chromatin including telomeric, pericentromeric, centromeric, and interstitial regions of all the 14 chromosome pairs of Ae. geniculata. Most satellite DNAs also generated FISH signals on wheat chromosomes and provided diagnostic chromosome arm-specific cytogenetic markers that significantly improved chromosome identification in wheat. The newly identified satellite DNA CL36 produced localized Mg genome chromosome-specific FISH signals in Ae. geniculata and in the M genome of the putative diploid donor species Ae. comosa subsp. subventricosa but not in Ae. comosa subsp. comosa, suggesting that the Mg genome of Ae. geniculata was probably derived from subsp. subventricosa.

  7. Molecular Cytogenetic Mapping of Satellite DNA Sequences in Aegilops geniculata and Wheat.

    PubMed

    Koo, Dal-Hoe; Tiwari, Vijay K; Hřibová, Eva; Doležel, Jaroslav; Friebe, Bernd; Gill, Bikram S

    2016-01-01

    Fluorescence in situ hybridization (FISH) provides an efficient system for cytogenetic analysis of wild relatives of wheat for individual chromosome identification, elucidation of homoeologous relationships, and for monitoring alien gene transfers into wheat. This study is aimed at developing cytogenetic markers for chromosome identification of wheat and Aegilops geniculata (2n = 4x = 28, UgUgMgMg) using satellite DNAs obtained from flow-sorted chromosome 5Mg. FISH was performed to localize the satellite DNAs on chromosomes of wheat and selected Aegilops species. The FISH signals for satellite DNAs on chromosome 5Mg were generally associated with constitutive heterochromatin regions corresponding to C-band-positive chromatin including telomeric, pericentromeric, centromeric, and interstitial regions of all the 14 chromosome pairs of Ae. geniculata. Most satellite DNAs also generated FISH signals on wheat chromosomes and provided diagnostic chromosome arm-specific cytogenetic markers that significantly improved chromosome identification in wheat. The newly identified satellite DNA CL36 produced localized Mg genome chromosome-specific FISH signals in Ae. geniculata and in the M genome of the putative diploid donor species Ae. comosa subsp. subventricosa but not in Ae. comosa subsp. comosa, suggesting that the Mg genome of Ae. geniculata was probably derived from subsp. subventricosa. PMID:27403741

  8. Statistical Analysis on Detecting Recombination Sites in DNASatellites Associated with Old World Geminiviruses

    PubMed Central

    Xu, Kai; Yoshida, Ruriko

    2010-01-01

    Although exchange of genetic information by recombination plays an important role in the evolution of viruses, it is not clear how it generates diversity. Understanding recombination events helps with the study of the evolution of new virus strains or new viruses. Geminiviruses are plant viruses which have ambisense single-stranded circular DNA genomes and are one of the most economically important plant viruses in agricultural production. Small circular single-stranded DNA satellites, termed DNA-β, have recently been found to be associated with some geminivirus infections. In this paper we analyze several DNA-β sequences of geminiviruses for recombination events using phylogenetic and statistical analysis and we find that one strain from ToLCMaB has a recombination pattern and is a recombinant molecule between two strains from two species, PaLCuB-[IN:Chi:05] (major parent) and ToLCB-[IN:CP:04] (minor parent). We propose that this recombination event contributed to the evolution of the strain of ToLCMaB in South India. The Hidden Markov Chain (HMM) method developed by Webb et al. (2009) estimating phylogenetic tree through out the whole alignment provide us a recombination history of these DNA-β strains. It is the first time that this statistic method has been used on DNA-β recombination study and give a clear recombination history of DNA-β recombination. PMID:21423447

  9. Formation Mechanism of alpha-Fe2O3 Nanotubes via Electrospinning and Their Adsorption Characteristics of BSA and DNA.

    PubMed

    Liu, Ruijiang; Wang, Peng; Tao, Yuting; Liu, Yifan; Shen, Xiangqian

    2016-02-01

    The alpha-Fe2O3 nanotubes with diameters of 400-700 nm have been prepared via the sol-gel assisted electrospinning and subsequent one-step heat treatment with ferric nitrate, ethanol and poly(vinyl pyrrolidone) as starting regents. The resultant alpha-Fe2O3 nanotubes were characterized by XRD, SEM, TEM, and VSM techniques. The hollow structure is mainly influenced by the water content in the gel precursor and the heating rate, and the hollow formation mechanism of alpha-Fe2O9 nanotubes is discussed. Adsorption of BSA onto the as-prepared alpha-Fe2O3 nanotubes exhibits a good capacity of 56.5 mg/g with the initial BSA concentration of 1.0 mg/mL, which demonstrates their feasibility in delivery of biomacromolecules. Subsequently, the adsorption characteristics of DNA onto the alpha-Fe2O3 nanotubes were investigated, and the adsorbance of DNA can achieve a maximum value of 4.19 microg/g when the initial DNA concentration is 50 microg/mL. The adsorption process of DNA onto alpha-Fe2O3 nanotubes can be described well by the pseudo-first-order kinetic model at room temperature according to the correlation coefficient R2 = 0.9978. PMID:27433591

  10. Formation Mechanism of alpha-Fe2O3 Nanotubes via Electrospinning and Their Adsorption Characteristics of BSA and DNA.

    PubMed

    Liu, Ruijiang; Wang, Peng; Tao, Yuting; Liu, Yifan; Shen, Xiangqian

    2016-02-01

    The alpha-Fe2O3 nanotubes with diameters of 400-700 nm have been prepared via the sol-gel assisted electrospinning and subsequent one-step heat treatment with ferric nitrate, ethanol and poly(vinyl pyrrolidone) as starting regents. The resultant alpha-Fe2O3 nanotubes were characterized by XRD, SEM, TEM, and VSM techniques. The hollow structure is mainly influenced by the water content in the gel precursor and the heating rate, and the hollow formation mechanism of alpha-Fe2O9 nanotubes is discussed. Adsorption of BSA onto the as-prepared alpha-Fe2O3 nanotubes exhibits a good capacity of 56.5 mg/g with the initial BSA concentration of 1.0 mg/mL, which demonstrates their feasibility in delivery of biomacromolecules. Subsequently, the adsorption characteristics of DNA onto the alpha-Fe2O3 nanotubes were investigated, and the adsorbance of DNA can achieve a maximum value of 4.19 microg/g when the initial DNA concentration is 50 microg/mL. The adsorption process of DNA onto alpha-Fe2O3 nanotubes can be described well by the pseudo-first-order kinetic model at room temperature according to the correlation coefficient R2 = 0.9978.

  11. Effect of alpha-ketoglutarate and oxaloacetate on brain mitochondrial DNA damage and seizures induced by kainic acid in mice.

    PubMed

    Yamamoto, Hiro-aki; Mohanan, Parayanthala V

    2003-07-20

    The effects of alpha-ketoglutarate and oxaloacetate on brain mitochondrial DNA (mtDNA) damage and seizures induced by kainic acid were examined both in vivo and in vitro. An intraperitoneal (ip) injection of kainic acid (45 mg/kg) produced broad-spectrum limbic and severe sustained seizures in all of the treated mice. The seizures were abolished when alpha-ketoglutarate (2 g/kg) or oxaloacetate (1 g/kg) was injected intraperitoneally in the animals 1 min before kainic acid administration. In addition, the administration of kainic acid caused damage to mtDNA in brain frontal and middle cortex of mice. These effects were completely abolished by the ip preinjection of alpha-ketoglutarate (2 g/kg) or oxaloacetate (1 g/kg). In vitro exposure of kainic acid (0.25, 0.5 or 1.0 mM) to brain homogenate inflicted damage to mtDNA in a concentration-dependent manner. The damage of mtDNA induced by 1.0 mM kainic acid was attenuated by the co-treatment with alpha-ketoglutarate (2.5 or 5.0 mM) or oxaloacetate (0.75 or 1.0 mM). Furthermore, in vivo and in vitro exposure of kainic acid elicited an increase in lipid peroxidation. However, the increased lipid peroxidation was completely inhibited by cotreatment of alpha-ketoglutarate or oxaloacetate. These results suggest that alpha-keto acids such as alpha-ketoglutarate and oxaloacetate play a role in the inhibition of seizures and subsequent mtDNA damage induced by the excitotoxic/neurotoxic agent, kainic acid.

  12. A satellite DNA evolutionary analysis in the North American endemic dioecious plant Rumex hastatulus (Polygonaceae).

    PubMed

    del Bosque, M E Quesada; Navajas-Pérez, R; Panero, J L; Fernández-González, A; Garrido-Ramos, M A

    2011-04-01

    We studied the evolution of RAE180 satellite DNA family in the North American endemic dioecious plant Rumex hastatulus. In this species, the Texas race is characterized by a single XX/XY sex chromosome system, whereas the North Carolina race has evolved a derived complex XX/XY(1)Y(2) sex chromosome system. RAE180 repeats were autosomic and poorly represented (2 × 10(-4)% of the genome) with no differences between individuals of different genders or different races of R. hastatulus. In fact, the sex chromosomes of the North Carolina race are still euchromatic, and they have not accumulated satellite DNA sequences, which contrasts with that occurring in the rest of dioecious XX/XY(1)Y(2) Rumex species. In R. hastatulus, we detected the existence of three RAE180 subfamilies. Notwithstanding, while in the Texas race the TX1/NC1 subfamily is the most frequent, the TX2/NC2 subfamily is the most abundant in the North Carolina race. Additionally, the third, less represented subfamily (TX3/NC3) appears currently as relict sequences in both genomes. A common feature of RAE180 satellite is the sudden replacement of one sequence variant by another in different species (or populations as in R. hastatulus races). Thus, the phylogenetic analysis of RAE180 repeats from six dioecious Rumex species supports the "library" hypothesis. According to this hypothesis, we assume that a set of divergent RAE180 variants were present in the ancestral genome of dioecious Rumex species, from which novel tandem arrays originated by the amplification of different variants in different lineages. Differential levels of RAE180 satellite DNA amplification in each lineage, at different evolutionary times, and in different chromosomal positions gave rise to differential patterns of sequence evolution.

  13. Satellite DNA sequences in the neotropical marmoset Callimico goeldii (Primates, Platyrrhini).

    PubMed

    Fanning, T G; Seuánez, H N; Forman, L

    1989-12-01

    Two families of tandemly repeated satellite DNAs were isolated from the neotropical primate Callimico goeldii (Goeldi's marmoset). One satellite, CgoA, is over 70% A + T and has a monomer length of 338 bp. The other satellite, CgoB, is 50% A + T and has a monomer length of 916 bp. Both CgoA and CgoB hybridize strongly with Callimico DNA, but not with the DNA of other new and old world primates. Based upon a neutral substitution rate of 1.5 X 10(-9)/site per year for primates, sequence data from 15 CgoA monomers indicate that the tandem array is at least 30 million years old. Since no other neotropical primate has amplified CgoA sequences, the data suggest that the ancestor of Callimico separated from the other neotropical primates at least 30 million years ago. This value is about fourfold larger than the value of 7-9 million years derived from immunological data by Sarich and Cronin (1980). Possible reasons for this discrepancy are discussed.

  14. Hyperhomocysteinemia inhibits satellite cell regenerative capacity through p38 alpha/beta MAPK signaling.

    PubMed

    Veeranki, Sudhakar; Lominadze, David; Tyagi, Suresh C

    2015-07-15

    Chronic failure in maintenance and regeneration of skeletal muscles leads to lower muscle mass (sarcopenia), muscle weakness, and poor response to injury. Evidence suggests that aberrant p38 MAPK signaling undermines the repair process after injury in aged mice. Previous studies have shown that hyperhomocysteinemia (HHcy) has been associated with muscle weakness and lower than normal body weights. However, whether or not HHcy condition also compromises skeletal muscle regenerative capabilities is not clear. In the current study, we show that CBS-/+ mice, a model for HHcy condition, exhibited compromised regenerative function and cell proliferation upon injury. However, there was no significant difference in Pax7 expression levels in the satellite cells from CBS-/+ mouse skeletal muscles. Interestingly, the satellite cells from CBS-/+ mice not only exhibited diminished in vitro proliferative capabilities, but also there was heightened oxidative stress. In addition, there was enhanced p38 MAPK activation as well as p16 and p21 expression in the CBS-/+ mouse satellite cells. Moreover, the C2C12 myoblasts also exhibited higher p38 MAPK activation and p16 expression upon treatment with homocysteine in addition to enhanced ROS presence. Tissue engraftment potential and regeneration after injury were restored to some extent upon treatment with the p38-MAPK inhibitor, SB203580, in the CBS-/+ mice. These results together suggest that HHcy-induced diminished satellite cell proliferation involves excessive oxidative stress and p38 MAPK signaling. Our study further proposes that HHcy is a potential risk factor for elderly frailty, and need to be considered as a therapeutic target while designing the alleviation interventions/postinjury rehabilitation measures for adults with HHcy.

  15. On the mechanism of amplification of satellite II DNA sequences of the domestic goat Capra hircus.

    PubMed

    Buckland, R A; Elder, J K

    1985-11-01

    appropriate conditions, it is an attractive model for explaining the production of satellite DNAs whose structure has evolved through a series of doublings, such as mouse major satellite DNA and the "alphoid" satellite sequences of primates. Other factors necessary for this model to work are generally considered to be natural components of the speciation process. It is therefore suggested that, although the saltatory model conforms most closely to the observed structure of goat satellite II, this particular satellite DNA may represent one of the few cases when the unequal crossover mechanism does not give rise to a dimeric structure.

  16. High conservation of the differentially amplified MPA2 satellite DNA family in parthenogenetic root-knot nematodes.

    PubMed

    Mestrović, Nevenka; Castagnone-Sereno, Philippe; Plohl, Miroslav

    2006-07-19

    Sequence variability and distribution of a newly characterized MPA2 satellite DNA family are described in five root-knot nematode species of the genus Meloidogyne, the mitotic parthenogens M. paranaensis, M. incognita, M. arenaria and M. javanica, and the meiotic/mitotic M. hapla (isolates A and B, respectively). The lack of distinctive mutations and the considerable contribution (40.8%) of ancestral changes disclose an ancient satellite DNA which existed in the common ancestor of extant parthenogenetic species in the same or similar form and remained preserved for a period of at least 43 My. Nonuniformly distributed polymorphic sites along the satellite monomer suggest differences in constraints acting on particular sequence segments. Sequence diversity is clearly unaffected by significant differences in genomic abundance of the MPA2 satellite DNA in the examined species. Observed results suggest that the dynamics of this satellite DNA family might be in the first instance a consequence of characteristics of its nucleotide sequence and possible constraints imposed on it. Under conditions of mitotic and meiotic parthenogenesis, slow accumulation of mutations and slow replacement of old MPA2 sequence variants with new ones may be equivalent to the dynamics of some satellite DNA sequences conserved for extremely long evolutionary periods in sexual species.

  17. Stable yeast transformants that secrete functional. cap alpha. -amylase encoded by cloned mouse pancreatic cDNA

    SciTech Connect

    Filho, S.A.; Galembeck, E.V.; Faria, J.B.; Frascino, A.C.S.

    1986-04-01

    Mouse pancreatic ..cap alpha..-amylase complementary DNA was inserted into a yeast shuttle vector after the Saccharomyces cerevisiae MF..cap alpha..1 promoter and secretion signals coding sequences. When transformed with the recombinant plasmid, S. cerevisiae cells were able to synthesize and secrete functional ..cap alpha..-amylase, efficiently hydrolyzing starch present in the culture medium. Stable amylolytic cells were obtained from different yeast strains. This work represents a significant step towards producing yeast that can convert starchy materials directly to ethanol.

  18. Characterization of RUSI, a telomere-associated satellite DNA, in the genus Rumex (Polygonaceae).

    PubMed

    Navajas-Pérez, R; Schwarzacher, T; Ruiz Rejón, M; Garrido-Ramos, M A

    2009-01-01

    A satellite-DNA family (RUSI) has been isolated and characterized in Rumexinduratus Boiss and Reuter (Polygonaceae), an Iberian endemic polygamous sorrel. The RUSI repeats are 170 bp in length and approximately 68% AT-rich containing different variants of degenerate telomere motifs--(TT)(n)AN(GG)(n) -, a typical feature of subtelomeric DNA repeats adjacent to telomeres, which have been referred to as telomere-associated sequences or TASs. In fact, fluorescent in situhybridization showed that this satellite DNA is located in subtelomeric positions of most of the chromosomes of R. induratus, with some centromeric loci. PCR and Southern-blot hybridization assays for sequence conservation in the genus Rumex, indicated that the RUSI sequences are restricted to the genomes of R. induratus and R. scutatus, both species of the section Scutati, suggesting that they are recently evolved. Sequence variation within the two species is high (mean value of sequence differences between repeats of 15% for R. induratus and 7.5% for R. scutatus) and the degree of sequence differentiation between species is low with no species-specific variants, postulated to be due to slowed rates of spreading of sequence variants by molecular homogenizing mechanisms. Characteristics of RUSI sequences are discussed in the light of their chromosomal location and analyzed for their evolutionary and phylogenetic implications.

  19. Human alpha-L-iduronidase: cDNA isolation and expression.

    PubMed Central

    Scott, H S; Anson, D S; Orsborn, A M; Nelson, P V; Clements, P R; Morris, C P; Hopwood, J J

    1991-01-01

    alpha-L-Iduronidase (IDUA; EC 3.2.1.76) is a lysosomal hydrolase in the metabolic pathway responsible for the degradation of the glycosaminoglycans heparan sulfate and dermatan sulfate. A deficiency of IDUA in humans leads to the accumulation of these glycosaminoglycans and results in the lysosomal storage disorder mucopolysaccharidosis type I. We have isolated and sequenced cDNA clones containing part of the human IDUA coding region and used PCR from reverse-transcribed RNA to obtain the full IDUA sequence. Analysis of the predicted 653-amino acid precursor protein shows that IDUA has a 26-amino acid signal peptide that is cleaved immediately prior to the amino terminus of the 74-kDa polypeptide present in human liver IDUA. The protein sequence contains six potential N-glycosylation sites. Northern blot analysis with IDUA cDNA detected only a single 2.3-kilobase mRNA species in human placental RNA; however, PCR analysis of fibroblast, liver, kidney, and placental RNA showed the existence of alternatively spliced mRNA from the IDUA gene. Southern blot analysis failed to detect major deletions or gene rearrangements in any of the 40 mucopolysaccharidosis type I patients studied. Expression of a full-length IDUA cDNA construct in Chinese hamster ovary cells produced human IDUA protein at a level 13-fold higher than, and with a specific activity comparable to, IDUA present in normal human fibroblasts. Images PMID:1946389

  20. Characterization of Non-coding DNA Satellites Associated with Sweepoviruses (Genus Begomovirus, Geminiviridae) - Definition of a Distinct Class of Begomovirus-Associated Satellites.

    PubMed

    Lozano, Gloria; Trenado, Helena P; Fiallo-Olivé, Elvira; Chirinos, Dorys; Geraud-Pouey, Francis; Briddon, Rob W; Navas-Castillo, Jesús

    2016-01-01

    Begomoviruses (family Geminiviridae) are whitefly-transmitted, plant-infecting single-stranded DNA viruses that cause crop losses throughout the warmer parts of the World. Sweepoviruses are a phylogenetically distinct group of begomoviruses that infect plants of the family Convolvulaceae, including sweet potato (Ipomoea batatas). Two classes of subviral molecules are often associated with begomoviruses, particularly in the Old World; the betasatellites and the alphasatellites. An analysis of sweet potato and Ipomoea indica samples from Spain and Merremia dissecta samples from Venezuela identified small non-coding subviral molecules in association with several distinct sweepoviruses. The sequences of 18 clones were obtained and found to be structurally similar to tomato leaf curl virus-satellite (ToLCV-sat, the first DNA satellite identified in association with a begomovirus), with a region with significant sequence identity to the conserved region of betasatellites, an A-rich sequence, a predicted stem-loop structure containing the nonanucleotide TAATATTAC, and a second predicted stem-loop. These sweepovirus-associated satellites join an increasing number of ToLCV-sat-like non-coding satellites identified recently. Although sharing some features with betasatellites, evidence is provided to suggest that the ToLCV-sat-like satellites are distinct from betasatellites and should be considered a separate class of satellites, for which the collective name deltasatellites is proposed. PMID:26925037

  1. Characterization of Non-coding DNA Satellites Associated with Sweepoviruses (Genus Begomovirus, Geminiviridae) – Definition of a Distinct Class of Begomovirus-Associated Satellites

    PubMed Central

    Lozano, Gloria; Trenado, Helena P.; Fiallo-Olivé, Elvira; Chirinos, Dorys; Geraud-Pouey, Francis; Briddon, Rob W.; Navas-Castillo, Jesús

    2016-01-01

    Begomoviruses (family Geminiviridae) are whitefly-transmitted, plant-infecting single-stranded DNA viruses that cause crop losses throughout the warmer parts of the World. Sweepoviruses are a phylogenetically distinct group of begomoviruses that infect plants of the family Convolvulaceae, including sweet potato (Ipomoea batatas). Two classes of subviral molecules are often associated with begomoviruses, particularly in the Old World; the betasatellites and the alphasatellites. An analysis of sweet potato and Ipomoea indica samples from Spain and Merremia dissecta samples from Venezuela identified small non-coding subviral molecules in association with several distinct sweepoviruses. The sequences of 18 clones were obtained and found to be structurally similar to tomato leaf curl virus-satellite (ToLCV-sat, the first DNA satellite identified in association with a begomovirus), with a region with significant sequence identity to the conserved region of betasatellites, an A-rich sequence, a predicted stem–loop structure containing the nonanucleotide TAATATTAC, and a second predicted stem–loop. These sweepovirus-associated satellites join an increasing number of ToLCV-sat-like non-coding satellites identified recently. Although sharing some features with betasatellites, evidence is provided to suggest that the ToLCV-sat-like satellites are distinct from betasatellites and should be considered a separate class of satellites, for which the collective name deltasatellites is proposed. PMID:26925037

  2. Evolutionary story of a satellite DNA from Phodopus sungorus (Rodentia, Cricetidae).

    PubMed

    Paço, Ana; Adega, Filomena; Meštrović, Nevenka; Plohl, Miroslav; Chaves, Raquel

    2014-10-21

    With the goal to contribute for the understanding of satellite DNA evolution and its genomic involvement, in this work it was isolated and characterized the first satellite DNA (PSUcentSat) from Phodopus sungorus (Cricetidae). Physical mapping of this sequence in P. sungorus showed large PSUcentSat arrays located at the heterochromatic (peri)centromeric region of five autosomal pairs and Y-chromosome. The presence of orthologous PSUcentSat sequences in the genomes of other Cricetidae and Muridae rodents was also verified, presenting however, an interspersed chromosomal distribution. This distribution pattern suggests a PSUcentSat-scattered location in an ancestor of Muridae/Cricetidae families, that assumed afterwards, in the descendant genome of P. sungorus a restricted localization to few chromosomes in the (peri)centromeric region. We believe that after the divergence of the studied species, PSUcentSat was most probably highly amplified in the (peri)centromeric region of some chromosome pairs of this hamster by recombinational mechanisms. The bouquet chromosome configuration (prophase I) possibly displays an important role in this selective amplification, providing physical proximity of centromeric regions between chromosomes with similar size and/or morphology. This seems particularly evident for the acrocentric chromosomes of P. sungorus (including the Y-chromosome), all presenting large PSUcentSat arrays at the (peri)centromeric region. The conservation of this sequence in the studied genomes and its (peri)centromeric amplification in P. sungorus strongly suggests functional significance, possibly displaying this satellite family different functions in the different genomes. The verification of PSUcentSat transcriptional activity in normal proliferative cells suggests that its transcription is not stage-limited, as described for some other satellites.

  3. Evolutionary Story of a Satellite DNA from Phodopus sungorus (Rodentia, Cricetidae)

    PubMed Central

    Paço, Ana; Adega, Filomena; Meštrović, Nevenka; Plohl, Miroslav; Chaves, Raquel

    2014-01-01

    With the goal to contribute for the understanding of satellite DNA evolution and its genomic involvement, in this work it was isolated and characterized the first satellite DNA (PSUcentSat) from Phodopus sungorus (Cricetidae). Physical mapping of this sequence in P. sungorus showed large PSUcentSat arrays located at the heterochromatic (peri)centromeric region of five autosomal pairs and Y-chromosome. The presence of orthologous PSUcentSat sequences in the genomes of other Cricetidae and Muridae rodents was also verified, presenting however, an interspersed chromosomal distribution. This distribution pattern suggests a PSUcentSat-scattered location in an ancestor of Muridae/Cricetidae families, that assumed afterwards, in the descendant genome of P. sungorus a restricted localization to few chromosomes in the (peri)centromeric region. We believe that after the divergence of the studied species, PSUcentSat was most probably highly amplified in the (peri)centromeric region of some chromosome pairs of this hamster by recombinational mechanisms. The bouquet chromosome configuration (prophase I) possibly displays an important role in this selective amplification, providing physical proximity of centromeric regions between chromosomes with similar size and/or morphology. This seems particularly evident for the acrocentric chromosomes of P. sungorus (including the Y-chromosome), all presenting large PSUcentSat arrays at the (peri)centromeric region. The conservation of this sequence in the studied genomes and its (peri)centromeric amplification in P. sungorus strongly suggests functional significance, possibly displaying this satellite family different functions in the different genomes. The verification of PSUcentSat transcriptional activity in normal proliferative cells suggests that its transcription is not stage-limited, as described for some other satellites. PMID:25336681

  4. Begomovirus-Associated Satellite DNA Diversity Captured Through Vector-Enabled Metagenomic (VEM) Surveys Using Whiteflies (Aleyrodidae).

    PubMed

    Rosario, Karyna; Marr, Christian; Varsani, Arvind; Kraberger, Simona; Stainton, Daisy; Moriones, Enrique; Polston, Jane E; Breitbart, Mya

    2016-02-02

    Monopartite begomoviruses (Geminiviridae), which are whitefly-transmitted single-stranded DNA viruses known for causing devastating crop diseases, are often associated with satellite DNAs. Since begomovirus acquisition or exchange of satellite DNAs may lead to adaptation to new plant hosts and emergence of new disease complexes, it is important to investigate the diversity and distribution of these molecules. This study reports begomovirus-associated satellite DNAs identified during a vector-enabled metagenomic (VEM) survey of begomoviruses using whiteflies collected in various locations (California (USA), Guatemala, Israel, Puerto Rico, and Spain). Protein-encoding satellite DNAs, including alphasatellites and betasatellites, were identified in Israel, Puerto Rico, and Guatemala. Novel alphasatellites were detected in samples from Guatemala and Puerto Rico, resulting in the description of a phylogenetic clade (DNA-3-type alphasatellites) dominated by New World sequences. In addition, a diversity of small (~640-750 nucleotides) satellite DNAs similar to satellites associated with begomoviruses infecting Ipomoea spp. were detected in Puerto Rico and Spain. A third class of satellite molecules, named gammasatellites, is proposed to encompass the increasing number of reported small (<1 kilobase), non-coding begomovirus-associated satellite DNAs. This VEM-based survey indicates that, although recently recovered begomovirus genomes are variations of known genetic themes, satellite DNAs hold unexplored genetic diversity.

  5. Begomovirus-Associated Satellite DNA Diversity Captured Through Vector-Enabled Metagenomic (VEM) Surveys Using Whiteflies (Aleyrodidae)

    PubMed Central

    Rosario, Karyna; Marr, Christian; Varsani, Arvind; Kraberger, Simona; Stainton, Daisy; Moriones, Enrique; Polston, Jane E.; Breitbart, Mya

    2016-01-01

    Monopartite begomoviruses (Geminiviridae), which are whitefly-transmitted single-stranded DNA viruses known for causing devastating crop diseases, are often associated with satellite DNAs. Since begomovirus acquisition or exchange of satellite DNAs may lead to adaptation to new plant hosts and emergence of new disease complexes, it is important to investigate the diversity and distribution of these molecules. This study reports begomovirus-associated satellite DNAs identified during a vector-enabled metagenomic (VEM) survey of begomoviruses using whiteflies collected in various locations (California (USA), Guatemala, Israel, Puerto Rico, and Spain). Protein-encoding satellite DNAs, including alphasatellites and betasatellites, were identified in Israel, Puerto Rico, and Guatemala. Novel alphasatellites were detected in samples from Guatemala and Puerto Rico, resulting in the description of a phylogenetic clade (DNA-3-type alphasatellites) dominated by New World sequences. In addition, a diversity of small (~640–750 nucleotides) satellite DNAs similar to satellites associated with begomoviruses infecting Ipomoea spp. were detected in Puerto Rico and Spain. A third class of satellite molecules, named gammasatellites, is proposed to encompass the increasing number of reported small (<1 kilobase), non-coding begomovirus-associated satellite DNAs. This VEM-based survey indicates that, although recently recovered begomovirus genomes are variations of known genetic themes, satellite DNAs hold unexplored genetic diversity. PMID:26848679

  6. Humidity influenced capacitance and resistance of an Al/DNA/Al Schottky diode irradiated by alpha particles

    PubMed Central

    Al-Ta’ii, Hassan Maktuff Jaber; Amin, Yusoff Mohd; Periasamy, Vengadesh

    2016-01-01

    Deoxyribonucleic acid or DNA based sensors, especially as humidity and alpha particle sensors have become quite popular in recent times due to flexible and highly optimizable nature of this fundamental biomaterial. Application of DNA electronics allow for more sensitive, accurate and effective sensors to be developed and fabricated. In this work, we examined the effect of different humidity conditions on the capacitive and resistive response of Aluminum (Al)/DNA/Al Schottky barrier structure when bombarded by time-dependent dosages of alpha particles. Based on current-voltage profiles, which demonstrated rectifying behaviours, Schottky diode parameters such as ideality factor, barrier height and series resistance was calculated. Results observed generally pointed towards a decrease in the resistance value from the pristine to the radiated structures. It was also demonstrated that under the effect of humidity, the capacitance of the DNA thin film increased from 0.05894 to 92.736 nF, with rising relative humidity level. We also observed the occurrence of the hypersensitivity phenomena after alpha irradiation between 2 to 4 min by observing a drop in the series resistance, crucial in the study of DNA damage and repair mechanisms. These observations may also suggest the exciting possibility of utilizing Al/DNA/Al Schottky diodes as potentially sensitive humidity sensors. PMID:27160654

  7. Humidity influenced capacitance and resistance of an Al/DNA/Al Schottky diode irradiated by alpha particles

    NASA Astrophysics Data System (ADS)

    Al-Ta’Ii, Hassan Maktuff Jaber; Amin, Yusoff Mohd; Periasamy, Vengadesh

    2016-05-01

    Deoxyribonucleic acid or DNA based sensors, especially as humidity and alpha particle sensors have become quite popular in recent times due to flexible and highly optimizable nature of this fundamental biomaterial. Application of DNA electronics allow for more sensitive, accurate and effective sensors to be developed and fabricated. In this work, we examined the effect of different humidity conditions on the capacitive and resistive response of Aluminum (Al)/DNA/Al Schottky barrier structure when bombarded by time-dependent dosages of alpha particles. Based on current-voltage profiles, which demonstrated rectifying behaviours, Schottky diode parameters such as ideality factor, barrier height and series resistance was calculated. Results observed generally pointed towards a decrease in the resistance value from the pristine to the radiated structures. It was also demonstrated that under the effect of humidity, the capacitance of the DNA thin film increased from 0.05894 to 92.736 nF, with rising relative humidity level. We also observed the occurrence of the hypersensitivity phenomena after alpha irradiation between 2 to 4 min by observing a drop in the series resistance, crucial in the study of DNA damage and repair mechanisms. These observations may also suggest the exciting possibility of utilizing Al/DNA/Al Schottky diodes as potentially sensitive humidity sensors.

  8. Ocean Primary Production Estimates from Terra MODIS and Their Dependency on Satellite Chlorophyll Alpha Algorithms

    NASA Technical Reports Server (NTRS)

    Essias, Wayne E.; Abbott, Mark; Carder, Kendall; Campbell, Janet; Clark, Dennis; Evans, Robert; Brown, Otis; Kearns, Ed; Kilpatrick, Kay; Balch, W.

    2003-01-01

    Simplistic models relating global satellite ocean color, temperature, and light to ocean net primary production (ONPP) are sensitive to the accuracy and limitations of the satellite estimate of chlorophyll and other input fields, as well as the primary productivity model. The standard MODIS ONPP product uses the new semi-analytic chlorophyll algorithm as its input for two ONPP indexes. The three primary MODIS chlorophyll Q estimates from MODIS, as well as the SeaWiFS 4 chlorophyll product, were used to assess global and regional performance in estimating ONPP for the full mission, but concentrating on 2001. The two standard ONPP algorithms were examined with 8-day and 39 kilometer resolution to quantify chlorophyll algorithm dependency of ONPP. Ancillary data (MLD from FNMOC, MODIS SSTD1, and PAR from the GSFC DAO) were identical. The standard MODIS ONPP estimates for annual production in 2001 was 59 and 58 GT C for the two ONPP algorithms. Differences in ONPP using alternate chlorophylls were on the order of 10% for global annual ONPP, but ranged to 100% regionally. On all scales the differences in ONPP were smaller between MODIS and SeaWiFS than between ONPP models, or among chlorophyll algorithms within MODIS. Largest regional ONPP differences were found in the Southern Ocean (SO). In the SO, application of the semi-analytic chlorophyll resulted in not only a magnitude difference in ONPP (2x), but also a temporal shift in the time of maximum production compared to empirical algorithms when summed over standard oceanic areas. The resulting increase in global ONPP (6-7 GT) is supported by better performance of the semi-analytic chlorophyll in the SO and other high chlorophyll regions. The differences are significant in terms of understanding regional differences and dynamics of ocean carbon transformations.

  9. S1 satellite DNA repetitive units display identical structure and overall variability in all Anatolian brown frog taxa.

    PubMed

    Picariello, Orfeo; Feliciello, Isidoro; Chinali, Gianni

    2016-02-01

    S1 satellite DNA from Palearctic brown frogs has a species-specific structure in all European species. We characterized S1 satellite DNA from the Anatolian brown frogs Rana macrocnemis, R. camerani, and R. holtzi in order to define their taxonomic rank and the structure of this satellite in this frog lineage. Southern blots of genomic DNA digested with KpnI, EcoRV, NdeI, NheI, or StuI produced the same pattern of satellite DNA bands. Moreover, quantitative dot blots showed that this satellite DNA accounts for 0.1 % of the genome in all taxa. Analysis of the overall genomic variability of the S1a repeat sequence in specimens from various populations demonstrated that this repetitive unit also has the same size (476 bp), the same most common sequence (MCS) and the same overall variability in all three taxa, and also in R. macrocnemis tavasensis. The S1a repetitive unit presents three deletions of 9, 8 and 1 bp compared to the 494-bp S1a repeat from European frogs. The S1a MCS has three variable positions (sequence WWTK in positions 183-186), due to the presence of two repeat subpopulations with motifs AATG and WWTT in all taxa. Unlike previously analyzed mitochondrial and nuclear sequences that show considerable variations among these taxa, no difference could be detected in the structure and variability of the S1 satellite repetitive units. This suggests that these taxa should belong to a single species. Our results indicate that this satellite DNA variety probably formed when the Anatolian lineage radiated from common ancestor about 4 mya, and since then has maintained its structure in all four taxa examined.

  10. Pericentromeric satellite repeat expansions through RNA-derived DNA intermediates in cancer

    PubMed Central

    Bersani, Francesca; Lee, Eunjung; Kharchenko, Peter V.; Xu, Andrew W.; Liu, Mingzhu; Xega, Kristina; MacKenzie, Olivia C.; Brannigan, Brian W.; Wittner, Ben S.; Jung, Hyunchul; Ramaswamy, Sridhar; Park, Peter J.; Maheswaran, Shyamala; Ting, David T.; Haber, Daniel A.

    2015-01-01

    Aberrant transcription of the pericentromeric human satellite II (HSATII) repeat is present in a wide variety of epithelial cancers. In deriving experimental systems to study its deregulation, we observed that HSATII expression is induced in colon cancer cells cultured as xenografts or under nonadherent conditions in vitro, but it is rapidly lost in standard 2D cultures. Unexpectedly, physiological induction of endogenous HSATII RNA, as well as introduction of synthetic HSATII transcripts, generated cDNA intermediates in the form of DNA/RNA hybrids. Single molecule sequencing of tumor xenografts showed that HSATII RNA-derived DNA (rdDNA) molecules are stably incorporated within pericentromeric loci. Suppression of RT activity using small molecule inhibitors reduced HSATII copy gain. Analysis of whole-genome sequencing data revealed that HSATII copy number gain is a common feature in primary human colon tumors and is associated with a lower overall survival. Together, our observations suggest that cancer-associated derepression of specific repetitive sequences can promote their RNA-driven genomic expansion, with potential implications on pericentromeric architecture. PMID:26575630

  11. Significance of satellite DNA revealed by conservation of a widespread repeat DNA sequence among angiosperms.

    PubMed

    Mehrotra, Shweta; Goel, Shailendra; Raina, Soom Nath; Rajpal, Vijay Rani

    2014-08-01

    The analysis of plant genome structure and evolution requires comprehensive characterization of repetitive sequences that make up the majority of plant nuclear DNA. In the present study, we analyzed the nature of pCtKpnI-I and pCtKpnI-II tandem repeated sequences, reported earlier in Carthamus tinctorius. Interestingly, homolog of pCtKpnI-I repeat sequence was also found to be present in widely divergent families of angiosperms. pCtKpnI-I showed high sequence similarity but low copy number among various taxa of different families of angiosperms analyzed. In comparison, pCtKpnI-II was specific to the genus Carthamus and was not present in any other taxa analyzed. The molecular structure of pCtKpnI-I was analyzed in various unrelated taxa of angiosperms to decipher the evolutionary conserved nature of the sequence and its possible functional role.

  12. Protein- and DNA-Based Active Immunotherapy Targeting Interleukin-13 Receptor Alpha2

    PubMed Central

    Gibo, Denise M.; MadhanKumar, A.B.; Cladel, Nancy M.; Christensen, Neil D.; Debinski, Waldemar

    2008-01-01

    Abstract High-grade astrocytoma (HGA) is an invariably fatal malignancy with a mean survival of 14 months despite surgery, radiation, and chemotherapy. We have found that a restricted receptor for interleukin-13 (IL-13), IL-13 receptor alpha 2 (IL13Rα2), is abundantly overexpressed in the vast majority of HGAs but is not appreciably expressed in normal tissue, with the exception of the testes. Therefore, IL-13Rα2 is a very attractive target for anti-HGA immunotherapy. In order to test protein and genetic vaccines that target IL13Rα2, we developed a G26-IL13Rα2-expressing syngeneic immunocompetent murine glioma model. Using this glioma model, mice were immunized with recombinant extracellular IL13Rα2 protein (IL13Rα2ex) or a DNA expression vector containing the gene for IL13Rα2 and were subsequently challenged with IL13Rα2(+) G26 tumors. Mice immunized with either recombinant or genetic IL13Rα2, but not mock-immunized controls, demonstrated complete protection against IL13Rα2(+) glioma growth and mortality. Of interest, only the recombinant-protein-based vaccines generated detectable anti-IL13Rα2 antibodies. These studies demonstrate the in vivo efficiency of protein- and DNA-based immunotherapy strategies that target IL13Rα2 that may play a clinical role to eradicate the residual microscopic HGA cells that inevitably cause disease recurrence and mortality. PMID:18976118

  13. Satellite DNA-like elements associated with genes within euchromatin of the beetle Tribolium castaneum.

    PubMed

    Brajković, Josip; Feliciello, Isidoro; Bruvo-Mađarić, Branka; Ugarković, Durđica

    2012-08-01

    In the red flour beetle Tribolium castaneum the major TCAST satellite DNA accounts for 35% of the genome and encompasses the pericentromeric regions of all chromosomes. Because of the presence of transcriptional regulatory elements and transcriptional activity in these sequences, TCAST satellite DNAs also have been proposed to be modulators of gene expression within euchromatin. Here, we analyze the distribution of TCAST homologous repeats in T. castaneum euchromatin and study their association with genes as well as their potential gene regulatory role. We identified 68 arrays composed of TCAST-like elements distributed on all chromosomes. Based on sequence characteristics the arrays were composed of two types of TCAST-like elements. The first type consists of TCAST satellite-like elements in the form of partial monomers or tandemly arranged monomers, up to tetramers, whereas the second type consists of TCAST-like elements embedded with a complex unit that resembles a DNA transposon. TCAST-like elements were also found in the 5' untranslated region (UTR) of the CR1-3_TCa retrotransposon, and therefore retrotransposition may have contributed to their dispersion throughout the genome. No significant difference in the homogenization of dispersed TCAST-like elements was found either at the level of local arrays or chromosomes nor among different chromosomes. Of 68 TCAST-like elements, 29 were located within introns, with the remaining elements flanked by genes within a 262 to 404,270 nt range. TCAST-like elements are statistically overrepresented near genes with immunoglobulin-like domains attesting to their nonrandom distribution and a possible gene regulatory role. PMID:22908042

  14. Satellite DNA-Like Elements Associated With Genes Within Euchromatin of the Beetle Tribolium castaneum

    PubMed Central

    Brajković, Josip; Feliciello, Isidoro; Bruvo-Mađarić, Branka; Ugarković, Đurđica

    2012-01-01

    In the red flour beetle Tribolium castaneum the major TCAST satellite DNA accounts for 35% of the genome and encompasses the pericentromeric regions of all chromosomes. Because of the presence of transcriptional regulatory elements and transcriptional activity in these sequences, TCAST satellite DNAs also have been proposed to be modulators of gene expression within euchromatin. Here, we analyze the distribution of TCAST homologous repeats in T. castaneum euchromatin and study their association with genes as well as their potential gene regulatory role. We identified 68 arrays composed of TCAST-like elements distributed on all chromosomes. Based on sequence characteristics the arrays were composed of two types of TCAST-like elements. The first type consists of TCAST satellite-like elements in the form of partial monomers or tandemly arranged monomers, up to tetramers, whereas the second type consists of TCAST-like elements embedded with a complex unit that resembles a DNA transposon. TCAST-like elements were also found in the 5′ untranslated region (UTR) of the CR1-3_TCa retrotransposon, and therefore retrotransposition may have contributed to their dispersion throughout the genome. No significant difference in the homogenization of dispersed TCAST-like elements was found either at the level of local arrays or chromosomes nor among different chromosomes. Of 68 TCAST-like elements, 29 were located within introns, with the remaining elements flanked by genes within a 262 to 404,270 nt range. TCAST-like elements are statistically overrepresented near genes with immunoglobulin-like domains attesting to their nonrandom distribution and a possible gene regulatory role. PMID:22908042

  15. Alpha fetoprotein DNA prime and adenovirus boost immunization of two hepatocellular cancer patients

    PubMed Central

    2014-01-01

    Background Alpha fetoprotein (AFP) is an oncofetal antigen over-expressed by many hepatocellular cancers (HCC). We previously demonstrated that HLA-A2-restricted epitopes derived from AFP are immunogenic in vitro and in vivo despite high circulating levels of this oncofetal antigen. In order to test a more broadly applicable, HLA-unrestricted, inexpensive, cell-free vaccine platform capable of activating tumor antigen-specific CD8+ and CD4+ T cells, we tested full length AFP in a plasmid DNA construct in combination with an AFP-expressing replication-deficient adenovirus (AdV) in a prime-boost vaccine strategy. Methods HCC patients who had an AFP+ tumor and previous treatment for HCC were screened and two patients received vaccination with three plasmid DNA injections followed by a single AdV injection, all delivered intramuscularly (i.m.). Results The vaccine was well tolerated and safe. Both patients showed immunologic evidence of immunization. The first patient had a weak AFP-specific T cell response, a strong AdV-specific cellular response and recurred with an AFP-expressing HCC at nine months. The second patient developed a strong AFP-specific CD8+ and CD4+ cellular response and an AdV neutralizing antibody response, and recurred at 18 months without an increase in serum AFP. Conclusions The AFP DNA prime-AdV boost vaccine was safe and immunogenic. Circulating anti-AdV neutralizing antibodies at baseline did not prohibit the development of AFP-specific cellular immunity. The patient who developed CD8+ and CD4+ AFP-specific T cell immunity had more favorable progression-free survival. The observations with these two patients support development of this vaccine strategy in a larger clinical trial. Trial registration ClinicalTrials.gov: NCT00093548 PMID:24708667

  16. Clusters of alpha satellite on human chromosome 21 are dispersed far onto the short arm and lack ancient layers.

    PubMed

    Ziccardi, William; Zhao, Chongjian; Shepelev, Valery; Uralsky, Lev; Alexandrov, Ivan; Andreeva, Tatyana; Rogaev, Evgeny; Bun, Christopher; Miller, Emily; Putonti, Catherine; Doering, Jeffrey

    2016-09-01

    Human alpha satellite (AS) sequence domains that currently function as centromeres are typically flanked by layers of evolutionarily older AS that presumably represent the remnants of earlier primate centromeres. Studies on several human chromosomes reveal that these older AS arrays are arranged in an age gradient, with the oldest arrays farthest from the functional centromere and arrays progressively closer to the centromere being progressively younger. The organization of AS on human chromosome 21 (HC21) has not been well-characterized. We have used newly available HC21 sequence data and an HC21p YAC map to determine the size, organization, and location of the AS arrays, and compared them to AS arrays found on other chromosomes. We find that the majority of the HC21 AS sequences are present on the p-arm of the chromosome and are organized into at least five distinct isolated clusters which are distributed over a larger distance from the functional centromere than that typically seen for AS on other chromosomes. Using both phylogenetic and L1 element age estimations, we found that all of the HC21 AS clusters outside the functional centromere are of a similar relatively recent evolutionary origin. HC21 contains none of the ancient AS layers associated with early primate evolution which is present on other chromosomes, possibly due to the fact that the p-arm of HC21 and the other acrocentric chromosomes underwent substantial reorganization about 20 million years ago. PMID:27430641

  17. alpha-MSH tripeptide analogs activate the melanocortin 1 receptor and reduce UV-induced DNA damage in human melanocytes.

    PubMed

    Abdel-Malek, Zalfa A; Ruwe, Andrew; Kavanagh-Starner, Renny; Kadekaro, Ana Luisa; Swope, Viki; Haskell-Luevano, Carrie; Koikov, Leonid; Knittel, James J

    2009-10-01

    One skin cancer prevention strategy that we are developing is based on synthesizing and testing melanocortin analogs that reduce and repair DNA damage resulting from exposure to solar ultraviolet (UV) radiation, in addition to stimulating pigmentation. Previously, we reported the effects of tetrapeptide analogs of alpha-melanocortin (alpha-MSH) that were more potent and stable than the physiological alpha-MSH, and mimicked its photoprotective effects against UV-induced DNA damage in human melanocytes. Here, we report on a panel of tripeptide analogs consisting of a modified alpha-MSH core His(6)-d-Phe(7)-Arg(8), which contained different N-capping groups, C-terminal modifications, or arginine mimics. The most potent tripeptides in activating cAMP formation and tyrosinase of human melanocytes were three analogs with C-terminal modifications. The most effective C-terminal tripeptide mimicked alpha-MSH in reducing hydrogen peroxide generation and enhancing nucleotide excision repair following UV irradiation. The effects of these three analogs required functional MC1R, as they were absent in human melanocytes that expressed non-functional receptor. These results demonstrate activation of the MC1R by tripeptide melanocortin analogs. Designing small analogs for topical delivery should prove practical and efficacious for skin cancer prevention. PMID:19558415

  18. alpha-MSH tripeptide analogs activate the melanocortin 1 receptor and reduce UV-induced DNA damage in human melanocytes.

    PubMed

    Abdel-Malek, Zalfa A; Ruwe, Andrew; Kavanagh-Starner, Renny; Kadekaro, Ana Luisa; Swope, Viki; Haskell-Luevano, Carrie; Koikov, Leonid; Knittel, James J

    2009-10-01

    One skin cancer prevention strategy that we are developing is based on synthesizing and testing melanocortin analogs that reduce and repair DNA damage resulting from exposure to solar ultraviolet (UV) radiation, in addition to stimulating pigmentation. Previously, we reported the effects of tetrapeptide analogs of alpha-melanocortin (alpha-MSH) that were more potent and stable than the physiological alpha-MSH, and mimicked its photoprotective effects against UV-induced DNA damage in human melanocytes. Here, we report on a panel of tripeptide analogs consisting of a modified alpha-MSH core His(6)-d-Phe(7)-Arg(8), which contained different N-capping groups, C-terminal modifications, or arginine mimics. The most potent tripeptides in activating cAMP formation and tyrosinase of human melanocytes were three analogs with C-terminal modifications. The most effective C-terminal tripeptide mimicked alpha-MSH in reducing hydrogen peroxide generation and enhancing nucleotide excision repair following UV irradiation. The effects of these three analogs required functional MC1R, as they were absent in human melanocytes that expressed non-functional receptor. These results demonstrate activation of the MC1R by tripeptide melanocortin analogs. Designing small analogs for topical delivery should prove practical and efficacious for skin cancer prevention.

  19. Evidence that a critical threshold of DNA polymerase-alpha activity may be required for the initiation of DNA synthesis in mammalian cell heterokaryons.

    PubMed

    Pendergrass, W R; Saulewicz, A C; Burmer, G C; Rabinovitch, P S; Norwood, T H; Martin, G M

    1982-10-01

    The specific activity of DNA polymerase (90% alpha) was determined in nine "neoplastoid" cell lines (Martin and Sprague, 1973) and in three different strains of HDF (human diploid fibroblast-like cells), all examined in logarithmic phases of growth. This was compared to the ability of each cell type to "rescue" (reinitiate DNA synthesis in) senescent HDF cells subsequent to polyethylene glycol-mediated cell fusions. A sharp "threshold" value of DNA polymerase activity was observed below which reinitiation of DNA synthesis in heterokaryons with senescent HDF does not occur. This threshold was especially obvious when the specific activity of DNA polymerase (p moles dTTP incorporated per mg protein or per cell) was divided by the percent of S-phase cells present in each culture as determined by flow microfluorometry. Our results indicate that the specific activity of DNA polymerase-alpha (or some other factor tightly coregulated with it) in "recessive" cell types (those unable to rescue senescent cells) is only about two times this theoretical "threshold" value, and that fusion of recessive cell types to senescent HDF cells reduces the specific activity in the heterokaryon to below this minimum, thus preventing the cells from entering S phase.

  20. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone

    PubMed Central

    Böhm, Markus; Hill, Helene Z.

    2016-01-01

    Alpha-melanocyte-stimulating hormone (alpha-MSH) increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA) damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation. PMID:27303631

  1. The Trypanosoma brucei DNA polymerase alpha core subunit gene is developmentally regulated and linked to a constitutively expressed open reading frame.

    PubMed Central

    Leegwater, P A; Strating, M; Murphy, N B; Kooy, R F; van der Vliet, P C; Overdulve, J P

    1991-01-01

    As an initial step towards the characterization of replicative DNA polymerases of trypanosomes, we have cloned, sequenced and examined the expression of the Trypanosoma (Trypanozoon) brucei brucei gene that encodes the DNA polymerase alpha catalytic core (pol alpha). The protein sequence contains the six conserved regions that have been recognized previously in eukaryotic and viral replicative DNA polymerases. In addition, we have identified a seventh region which appears to be conserved primarily in alpha-type DNA polymerases. The T.brucei DNA pol alpha core N-terminus is 123 and 129 amino acids smaller than that of the human and yeast homologue, respectively. The gene is separated by 386 bp from an upstream open reading frame (ORF) of 442 codons. Stable transcripts of the upstream sequence are detected in both dividing and non-dividing forms, while pol alpha transcripts are detected principally in dividing forms. Allelic copies of the T.brucei pol alpha region exhibit restriction site polymorphisms; one such sequence polymorphism affects the amino acid sequence of the T.brucei DNA pol alpha core. The T.brucei pol alpha region cross-hybridizes weakly with that of T.(Nannomonas) congolense and T.(Duttonella) vivax. Images PMID:1754381

  2. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone.

    PubMed

    Böhm, Markus; Hill, Helene Z

    2016-01-01

    Alpha-melanocyte-stimulating hormone (alpha-MSH) increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA) damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation.

  3. Subspecies of DNA polymerase alpha from calf thymus with different fidelity in copying synthetic template-primers.

    PubMed Central

    Brosius, S; Grosse, F; Krauss, G

    1983-01-01

    Three different subspecies of DNA polymerase alpha from calf thymus sedimenting at 9 S, 7 S and 5.7 S have been investigated with respect to their accuracy of in vitro DNA synthesis on poly (dA) (dT)16 and poly d(AT) as template-primers. Our results indicate that the structure of DNA polymerase alpha has a strong influence on the accuracy of DNA synthesis. The 9 S enzyme shows a misincorporation frequency of about 1:100 000. An error rate of 1:15 000 is measured for the 7 S species. The 5.7 S enzyme for which an error rate of 1:3 000 is determined, has to be considered as error prone. Lowering the rate of DNA synthesis leads to a decrease in fidelity. The single stranded DNA binding protein from E.coli increases the accuracy of the 5.7 S and the 7 S enzyme by a factor of two. Mn2+ decreases the fidelity of all three subspecies in a concentration dependent manner. PMID:6866763

  4. cDNA cloning and characterisation of an alpha-glucosidase gene from potato (Solanum tuberosum L.).

    PubMed

    Taylor, M A; George, L A; Ross, H A; Davies, H V

    1998-02-01

    Using an Arabidopsis thaliana expressed sequence tag with sequence similarity to human lysosomal alpha-glucosidase as a probe, a potato cDNA was isolated. The cDNA encodes a polypeptide with an Mr value of 105,400 and the most significant matches of the deduced amino acid sequence are with members of family 31 of glucosyl transferase. The potato cDNA was expressed in a strain of Saccharomyces cerevisiae that is deficient in maltase activity and unable to grow using maltose as a carbon source (ABYSMAL81). Expression of the potato cDNA in the mutant yeast strain restores its ability to use maltose as a carbon source for growth. Additionally, alpha-glucosidase activity could be measured in extracts of the yeast cells following complementation. A range of maltodextrins were substrates for this activity. The steady-state expression level of the potato alpha-glucosidase gene was low in most tissues examined, the highest levels occurring in sprouting tubers and source leaves.

  5. Calculation of the Electronic Parameters of an Al/DNA/p-Si Schottky Barrier Diode Influenced by Alpha Radiation

    PubMed Central

    Al-Ta’ii, Hassan Maktuff Jaber; Amin, Yusoff Mohd; Periasamy, Vengadesh

    2015-01-01

    Many types of materials such as inorganic semiconductors have been employed as detectors for nuclear radiation, the importance of which has increased significantly due to recent nuclear catastrophes. Despite the many advantages of this type of materials, the ability to measure direct cellular or biological responses to radiation might improve detector sensitivity. In this context, semiconducting organic materials such as deoxyribonucleic acid or DNA have been studied in recent years. This was established by studying the varying electronic properties of DNA-metal or semiconductor junctions when exposed to radiation. In this work, we investigated the electronics of aluminium (Al)/DNA/silicon (Si) rectifying junctions using their current-voltage (I-V) characteristics when exposed to alpha radiation. Diode parameters such as ideality factor, barrier height and series resistance were determined for different irradiation times. The observed results show significant changes with exposure time or total dosage received. An increased deviation from ideal diode conditions (7.2 to 18.0) was observed when they were bombarded with alpha particles for up to 40 min. Using the conventional technique, barrier height values were observed to generally increase after 2, 6, 10, 20 and 30 min of radiation. The same trend was seen in the values of the series resistance (0.5889–1.423 Ω for 2–8 min). These changes in the electronic properties of the DNA/Si junctions could therefore be utilized in the construction of sensitive alpha particle detectors. PMID:25730484

  6. Cytoprotection against Cr(6+)-induced DNA damage by alpha-lipoic acid: implications in reducing occupational cancer risk.

    PubMed

    Kumar, Sushil; Budhwar, Roli; Nigam, Akanksha; Priya, Shivam

    2009-11-01

    Alpha-lipoic acid (LA), the metabolic antioxidant, was evaluated for its potential to protect against Cr(6+)-induced DNA damage. Potassium dichromate was administered to Swiss albino mice orally ad libitum at the doses of 5, 10 or 25 mg/kg body weight in drinking water to set DNA damage in cells, which was characterized in mouse peripheral blood mononuclear cells and bone marrow cells using single-cell gel electrophoresis and analyses of generated comets for Tail moment, Tail DNA and Tail length. DNA damage was dose dependent. Cytoprotection by LA was remarkable. LA (5, 10 and 25 mg/kg body weight intraperitoneally) in pre-, co- and post-toxicant administration schedule abrogated DNA damage substantially in both cell types. Protection by LA was also dose dependent. LA annulled DNA damage by Cr(6+) in plasmid relaxation assay. A negligible DNA damage resulted during interaction of Cr(6+) and LA. Compared to ascorbate, LA emerged as a better antioxidant and least DNA damaging. In conclusion, our study advocated an experimental therapeutic research potential in LA against Cr(6+)-induced DNA damage for reduction of occupational cancer risk in humans. PMID:19710206

  7. Characterization of the satellite DNA Msat-160 from species of Terricola (Microtus) and Arvicola (Rodentia, Arvicolinae).

    PubMed

    Acosta, Manuel J; Marchal, Juan A; Fernández-Espartero, Cecilia; Romero-Fernández, Ismael; Rovatsos, Michail T; Giagia-Athanasopoulou, Eva B; Gornung, Ekaterina; Castiglia, Riccardo; Sánchez, Antonio

    2010-10-01

    In the subfamily Arvicolinae (Cricetidae, Rodentia) the satellite DNA Msat-160 has been so far described in only some species from the genus Microtus and in one species from another genus, Chionomys nivalis. Here we cloned and characterized this satellite in two new arvicoline species, Microtus (Terricola) savii and Arvicola amphibius (terrestris). We have also demonstrated, by PCR and FISH, its existence in the genomes of several other species from both genera. These results suggest that Msat-160 already occurred in the common ancestor of the four genera/subgenera of Arvicolinae (Microtus, Chionomys, Arvicola, and Terricola). In Arvicola and Terricola, Msat-160 showed the basic monomer length of 160 bp, although a higher-order repeat (HORs) of 640 bp could have been probably replacing the original monomeric unit in A. a. terrestris. Msat-160 was localized by FISH mostly on the pericentromeric regions of the chromosomes, but the signal intensity and the number of carrier chromosomes varied extremely even between closely related species, resulting in a species-specific pattern of chromosomal distribution of this satellite. Such a variable pattern most likely is a consequence of a rapid amplification and contraction of particular repeats in the pericentromeric regions of chromosomes. In addition, we proposed that the rapid variation of pericentromeric repeats is strictly related to the prolific species radiation and diversification of karyotypes that characterize Arvicolinae lineage. Finally, we performed phylogenetic analysis in this group of related species based on Msat-160 that results to be in agreement with previously reported phylogenies, derived from other molecular markers.

  8. A monopartite begomovirus-associated DNA beta satellite substitutes for the DNA B of a bipartite begomovirus to permit systemic infection.

    PubMed

    Saeed, Muhammad; Zafar, Yusuf; Randles, John W; Rezaian, M Ali

    2007-10-01

    DNA beta is a circular single-stranded satellite DNA which co-infects with certain monopartite helper begomoviruses to cause economically important diseases, such as cotton leaf curl disease (CLCuD). DNA beta encodes a single protein, betaC1. Tomato leaf curl New Delhi virus (ToLCNDV) is a bipartite begomovirus in which both DNA A and DNA B are required for systemic infection. Inoculation of tomato plants with ToLCNDV DNA A alone induced local but not systemic infection, whereas co-inoculation with DNA A and the DNA beta associated with CLCuD resulted in systemic infection. DNA beta containing a disrupted betaC1 open reading frame (ORF) did not mobilize DNA A systemically. Co-inoculation of plants with DNA A and a construct of the betaC1 ORF, under the control of the cauliflower mosaic virus 35S promoter, resulted in the systemic movement of DNA A. In inoculated tobacco and onion epidermal cells, betaC1 fused to GFP was localized at the cell periphery in association with punctate bodies, around and within the cell nucleus and with the endoplasmic reticulum. It is concluded that heterologous betaC1 protein can replace the movement function of the DNA B of a bipartite begomovirus. Evidence is also provided that tomato leaf curl virus-encoded C4 protein confers the same movement function to ToLCNDV DNA A. The intracellular distribution of betaC1 is consistent with the hypothesis that it has a role in transporting the DNA A from the nuclear site of replication to the plasmodesmatal exit sites of the infected cell. PMID:17872543

  9. Murine branched chain alpha-ketoacid dehydrogenase kinase; cDNA cloning, tissue distribution, and temporal expression during embryonic development.

    PubMed

    Doering, C B; Coursey, C; Spangler, W; Danner, D J

    1998-06-01

    These studies were designed to demonstrate the structural and functional similarity of murine branched chain alpha-ketoacid dehydrogenase and its regulation by the complex-specific kinase. Nucleotide sequence and deduced amino acid sequence for the kinase cDNA demonstrate a highly conserved coding sequence between mouse and human. Tissue-specific expression in adult mice parallels that reported in other mammals. Kinase expression in female liver is influenced by circadian rhythm. Of special interest is the fluctuating expression of this kinase during embryonic development against the continuing increase in the catalytic subunits of this mitochondrial complex during development. The need for regulation of the branched chain alpha-ketoacid dehydrogenase complex by kinase expression during embryogenesis is not understood. However, the similarity of murine branched chain alpha-ketoacid dehydrogenase and its kinase to the human enzyme supports the use of this animal as a model for the human system. PMID:9611264

  10. CENP-B box and pJalpha sequence distribution in human alpha satellite higher-order repeats (HOR).

    PubMed

    Rosandić, Marija; Paar, Vladimir; Basar, Ivan; Gluncić, Matko; Pavin, Nenad; Pilas, Ivan

    2006-01-01

    Using our Key String Algorithm (KSA) to analyze Build 35.1 assembly we determined consensus alpha satellite higher-order repeats (HOR) and consensus distributions of CENP-B box and pJalpha motif in human chromosomes 1, 4, 5, 7, 8, 10, 11, 17, 19, and X. We determined new suprachromosomal family (SF) assignments: SF5 for 13mer (2211 bp), SF5 for 13mer (2214 bp), SF2 for 11mer (1869 bp), SF1 for 18mer (3058 bp), SF3 for 12mer (2047 bp), SF3 for 14mer (2379 bp), and SF5 for 17mer (2896 bp) in chromosomes 4, 5, 8, 10, 11, 17, and 19, respectively. In chromosome 5 we identified SF5 13mer without any CENP-B box and pJalpha motif, highly homologous (96%) to 13mer in chromosome 19. Additionally, in chromosome 19 we identified new SF5 17mer with one CENP-B box and pJalpha motif, aligned to 13mer by deleting four monomers. In chromosome 11 we identified SF3 12mer, homologous to 12mer in chromosome X. In chromosome 10 we identified new SF1 18mer with eight CENP-B boxes in every other monomer (except one). In chromosome 4 we identified new SF5 13mer with CENP-B box in three consecutive monomers. We found four exceptions to the rule that CENP-B box belongs to type B and pJalpha motif to type A monomers. PMID:17115329

  11. Evolution of satellite DNA sequences in two tribes of Bovidae: A cautionary tale.

    PubMed

    Nieddu, Mariella; Mezzanotte, Roberto; Pichiri, Giuseppina; Coni, Pier Paolo; Dedola, Gian Luca; Dettori, Maria Luisa; Pazzola, Michele; Vacca, Giuseppe Massimo; Robledo, Renato

    2015-12-01

    Two clones, Bt1 from Bos taurus and Om1 from Ovis orientalis musimon, were used as probes for hybridization on genomic DNA and on metaphase chromosomes in members of Bovini and Caprini tribes. Bt1 and Om1 are sequences respectively belonging to the 1.715 and 1.714 DNA satellite I families. Southern blots and fluorescence in situ hybridization experiments showed completely coherent results: the Bovini probe Bt1 hybridized only to members of the Bovini tribe and not to members of Caprini. Likewise, the Caprini probe Om1 hybridized only to members of the Caprini tribe and not to members of Bovini. Hybridization signals were detected in the heterochromatic regions of every acrocentric autosome, except for two pairs of autosomes from Capra hircus that did not show hybridization to probe Om1. No signal was detected on X and Y chromosomes or on bi-armed autosomes. Remarkably, probe Om1 showed almost 100% homology with a bacterial sequence reported in Helicobacter pylori. PMID:26692159

  12. Evolution of satellite DNA sequences in two tribes of Bovidae: A cautionary tale

    PubMed Central

    Nieddu, Mariella; Mezzanotte, Roberto; Pichiri, Giuseppina; Coni, Pier Paolo; Dedola, Gian Luca; Dettori, Maria Luisa; Pazzola, Michele; Vacca, Giuseppe Massimo; Robledo, Renato

    2015-01-01

    Abstract Two clones, Bt1 from Bos taurus and Om1 from Ovis orientalis musimon, were used as probes for hybridization on genomic DNA and on metaphase chromosomes in members of Bovini and Caprini tribes. Bt1 and Om1 are sequences respectively belonging to the 1.715 and 1.714 DNA satellite I families. Southern blots and fluorescence in situ hybridization experiments showed completely coherent results: the Bovini probe Bt1 hybridized only to members of the Bovini tribe and not to members of Caprini. Likewise, the Caprini probe Om1 hybridized only to members of the Caprini tribe and not to members of Bovini. Hybridization signals were detected in the heterochromatic regions of every acrocentric autosome, except for two pairs of autosomes from Capra hircus that did not show hybridization to probe Om1. No signal was detected on X and Y chromosomes or on bi-armed autosomes. Remarkably, probe Om1 showed almost 100% homology with a bacterial sequence reported in Helicobacter pylori. PMID:26692159

  13. In silico screening for novel inhibitors of DNA polymerase III alpha subunit of Mycobacterium tuberculosis (MtbDnaE2, H37Rv).

    PubMed

    Jadaun, Alka; Sudhakar D, Raja; Subbarao, N; Dixit, Aparna

    2015-01-01

    Tuberculosis, a pandemic disease is caused by Mycobacterium tuberculosis (Mtb). DNA polymerase III encoded by DnaE2 of Mtb is specifically required for its survival in vivo, and hence can be considered to be a potential drug target. Amino acid sequence analysis of the MtbDnaE2 and its human counterpart does not show any significant similarity. Therefore, a 3D model of the MtbDnaE2 was generated using Modeller 9v10 with the template structure of E. Coli DNA polymerase III alpha subunit (2HNH_A). The generated models were validated using a number of programmes such as RAMPAGE/PROCHECK, VERIFY_3D, and ProSA. MtbDnaE2 has few conserved residues and four conserved domains similar to that present in DNA polymerase III of E. coli. In silico screening was performed with bioactive anti-tuberculosis compounds and 6-AU (a known inhibitor of DNA polymerase III of Bacillus subtilis) and its analogues against the modeled MtbDnaE2 structure. Docking was performed using GOLD v5.2 software which resulted in the identification of top ten compounds with high GOLD fitness scores and binding affinity (X-Score). To further evaluate the efficacy of these compounds, in silico ADMET analysis was performed using MedChem Designer v3. Given their high binding affinity to the targeted MtbDnaE2, which is essential for DNA replication in the Mtb and good ADMET properties, these compounds are promising candidates for further evaluation and development as anti-tubercular agents.

  14. In Silico Screening for Novel Inhibitors of DNA Polymerase III Alpha Subunit of Mycobacterium tuberculosis (MtbDnaE2, H37Rv)

    PubMed Central

    Jadaun, Alka; Sudhakar D, Raja; Subbarao, N.; Dixit, Aparna

    2015-01-01

    Tuberculosis, a pandemic disease is caused by Mycobacterium tuberculosis (Mtb). DNA polymerase III encoded by DnaE2 of Mtb is specifically required for its survival in vivo, and hence can be considered to be a potential drug target. Amino acid sequence analysis of the MtbDnaE2 and its human counterpart does not show any significant similarity. Therefore, a 3D model of the MtbDnaE2 was generated using Modeller 9v10 with the template structure of E. Coli DNA polymerase III alpha subunit (2HNH_A). The generated models were validated using a number of programmes such as RAMPAGE/PROCHECK, VERIFY_3D, and ProSA. MtbDnaE2 has few conserved residues and four conserved domains similar to that present in DNA polymerase III of E. coli. In silico screening was performed with bioactive anti-tuberculosis compounds and 6-AU (a known inhibitor of DNA polymerase III of Bacillus subtilis) and its analogues against the modeled MtbDnaE2 structure. Docking was performed using GOLD v5.2 software which resulted in the identification of top ten compounds with high GOLD fitness scores and binding affinity (X-Score). To further evaluate the efficacy of these compounds, in silico ADMET analysis was performed using MedChem Designer v3. Given their high binding affinity to the targeted MtbDnaE2, which is essential for DNA replication in the Mtb and good ADMET properties, these compounds are promising candidates for further evaluation and development as anti-tubercular agents. PMID:25811866

  15. Novel path to apoptosis: small transmembrane pores created by staphylococcal alpha-toxin in T lymphocytes evoke internucleosomal DNA degradation.

    PubMed Central

    Jonas, D; Walev, I; Berger, T; Liebetrau, M; Palmer, M; Bhakdi, S

    1994-01-01

    Peripheral-blood human T lymphocytes were treated with Staphylococcus aureus alpha-toxin. Membrane permeabilization was assessed by measuring efflux of K+ and Rb+ and influx of Na+, Ca2+, and propidium iodide. Cellular ATP and [3H]thymidine incorporation following lectin stimulation were measured as parameters for cell viability. Internucleosomal cleavage characteristic of programmed cell death was assessed by agarose gel electrophoresis and by quantifying low-molecular-weight, [3H]thymidine-labeled DNA fragments. Nanomolar concentrations of alpha-toxin evoked protracted, irreversible ATP depletion in both activated and resting T lymphocytes. Toxin-damaged cells also lost their ability to incorporate [3H]thymidine upon subsequent stimulation with phytohemagglutinin. These cells carried toxin hexamers, and their plasma membranes became permeable for monovalent ions but not for Ca2+ and propidium iodide. The permeabilization event was followed by internucleosomal DNA degradation characteristic of programmed cell death. Membranes of cells treated with high toxin doses (> 300 nM) became permeable to both Ca2+ and propidium iodide. In this case, ATP depletion occurred within minutes and no DNA degradation was observed. When cells were suspended in Na(+)-free buffer, alpha-toxin applied at low doses still bound and formed hexamers. However, these cells displayed neither DNA degradation nor loss of viability. The data indicate that formation of very small but not of large alpha-toxin pores may trigger programmed cell death in lymphocytes and that uncontrolled flux of Na+ ions may be an important event precipitating the suicide cascade. Images PMID:8132337

  16. Xenopus Cdc45-dependent loading of DNA polymerase alpha onto chromatin under the control of S-phase Cdk.

    PubMed Central

    Mimura, S; Takisawa, H

    1998-01-01

    At the onset of S phase, chromosomal replication is initiated by the loading of DNA polymerase alpha onto replication origins. However, the molecular mechanisms for controlling the initiation are poorly understood. Using Xenopus egg extract, we report here the identification of a Xenopus homolog of Cdc45, a yeast protein essential for the initiation of replication, which is shown to be an essential molecule for the initiation of replication via the loading of DNA polymerase alpha onto chromatin. XCdc45, by physically interacting with the polymerase in the extract, became associated with chromatin only after nuclear formation. During S phase, XCdc45 co-localized with the polymerase in the nuclei, and the loading of the polymerase, which depended on endogenous XCdc45, was facilitated by exogenously added recombinant XCdc45. These findings, together with the apparent requirement of S-phase-cdk activity for the loading of XCdc45, suggest that XCdc45, under the control of S-phase cdk, plays a pivotal role in the loading of DNA polymerase alpha onto chromatin. PMID:9755170

  17. [beta]-hexosaminidase isozymes from cells cotransfected with [alpha] and [beta] cDNA constructs: Analysis of the [alpha]-subunit missense mutation associated with the adult form of Tay-Sachs disease

    SciTech Connect

    Brown, C.A.; Mahuran, D.J. )

    1993-08-01

    In vitro mutagenesis and transient expression in COS cells has been used to associate a missense mutation with a clinical or biochemical phenotype. Mutations affecting the [alpha]-subunit of [beta]-hexosaminidase A ([alpha][beta]) (E.C.3.2.1.52) result in Tay-Sachs disease. Because hexosaminidase A is heterodimeric, analysis of [alpha]-chain mutations is not straightforward. The authors examine three approaches utilizing previously identified mutations affecting [alpha]-chain folding. These involve transfection of (1) the [alpha] cDNA alone; (2) a [beta] cDNA construct encoding a [beta]-subunit substituted at a position homologous to that of the [alpha]-subunit, and (3) both [alpha] and [beta] cDNAs. The latter two procedures amplified residual activity levels over that of patient samples, an effect not previously found with mutations affecting an [open quotes]active[close quotes] [alpha]Arg residue. This effect may help to discriminate between protein-folding and active-site mutations. The authors conclude that, with proper controls, the latter method of cotransfection can be used to evaluate the effects and perhaps to predict the clinical course of some [alpha]-chain mutations. Using this technique, they demonstrate that the adult-onset Tay-Sachs mutation, [alpha]Gly[yields]Ser[sup 269], does not directly affect [alpha][beta] dimerization but exerts an indirect effect on the dimer through destabilizing the folded [alpha]-subunit at physiological temperatures. Two other [alpha] mutations linked to more severe phenotypes appear to inhibit the initial folding of the subunit. 36 refs., 2 figs., 5 tabs.

  18. Cloning of the gene for the 73 kD subunit of the DNA polymerase alpha primase of Drosophila melanogaster.

    PubMed Central

    Cotterill, S; Lehman, I R; McLachlan, P

    1992-01-01

    We have isolated both cDNA and genomic clones for the 73 kDa subunit of the DNA polymerase alpha primase of Drosophila melanogaster. Analysis of these clones has identified an open reading frame of 1959 bases coding for a protein of 72.5 kDa. Northern analysis has shown the mRNA for the gene to be approximately 2.5 kb, and comparison of the cDNA and the genomic clones shows that the coding region of the gene lacks introns. The 5' end of the transcript has been mapped by primer extension, and the position of the gene in the genome mapped using in situ analysis. Computer analysis has been carried out on both coding and non coding regions of the gene. The protein sequence shows some homology to the analogous subunit in the S. cerevisiae DNA polymerase alpha, however a search of the data banks failed to reveal other homologies, or provide any clues as to the function of the protein. Analysis of the non-coding regions indicates some potential control regions for the gene. The 73 kDa protein has been overproduced, but a preliminary analysis failed to reveal any enzymatic activities. Images PMID:1508723

  19. Divergence of satellite DNA and interspersion of dispersed repeats in the genome of the wild beet Beta procumbens.

    PubMed

    Dechyeva, Daryna; Gindullis, Frank; Schmidt, Thomas

    2003-01-01

    Several repetitive sequences of the genome of Beta procumbens Chr. Sm., a wild beet species of the section Procumbentes of the genus Beta have been isolated. According to their genomic organization, the repeats were assigned to satellite DNA and families of dispersed DNA sequences. The tandem repeats are 229-246 bp long and belong to an AluI restriction satellite designated pAp11. Monomers of this satellite DNA form subfamilies which can be distinguished by the divergence or methylation of an internal restriction site. The satellite is amplified in the section Procumbentes, but is also found in species of the section Beta including cultivated beet (Beta vulgaris). The existence of the pAp11 satellite in distantly related species suggests that the AluI sequence family is an ancient component of Beta genomes and the ancestor of the diverged satellite subfamily pEV4 in B. vulgaris. Comparative fluorescent in-situ hybridization revealed remarkable differences in the chromosomal position between B. procumbens and B. vulgaris, indicating that the pAp11 and pEV4 satellites were most likely involved in the expansion or rearrangement of the intercalary B. vulgaris heterochromatin. Furthermore, we describe the molecular structure, and genomic and chromosomal organization of two repetitive DNA families which were designated pAp4 and pAp22 and are 1354 and 582 bp long, respectively. The families consist of sequence elements which are widely dispersed along B. procumbens chromosomes with local clustering and exclusion from distal euchromatic regions. FISH on meiotic chromosomes showed that both dispersed repeats are colocalized in some chromosomal regions. The interspersion of repeats of the pAp4 and pAp22 family was studied by PCR and enabled the determination of repeat flanking sequences. Sequence analysis revealed that pAp22 is either derived from or part of a long terminal repeat (LTR) of an Athila-like retrotransposon. Southern analysis and FISH with pAp4 and pAp22 showed

  20. DNA Repair, Redox Regulation and Modulation of Estrogen Receptor Alpha Mediated Transcription

    ERIC Educational Resources Information Center

    Curtis-Ducey, Carol Dianne

    2009-01-01

    Interaction of estrogen receptor [alpha] (ER[alpha]) with 17[beta]-estradiol (E[subscript 2]) facilitates binding of the receptor to estrogen response elements (EREs) in target genes, which in turn leads to recruitment of coregulatory proteins. To better understand how estrogen-responsive genes are regulated, our laboratory identified a number of…

  1. The B subunit of the DNA polymerase alpha-primase complex in Saccharomyces cerevisiae executes an essential function at the initial stage of DNA replication.

    PubMed Central

    Foiani, M; Marini, F; Gamba, D; Lucchini, G; Plevani, P

    1994-01-01

    The four-subunit DNA polymerase alpha-primase complex is unique in its ability to synthesize DNA chains de novo, and some in vitro data suggest its involvement in initiation and elongation of chromosomal DNA replication, although direct in vivo evidence for a role in the initiation reaction is still lacking. The function of the B subunit of the complex is unknown, but the Saccharomyces cerevisiae POL12 gene, which encodes this protein, is essential for cell viability. We have produced different pol12 alleles by in vitro mutagenesis of the cloned gene. The in vivo analysis of our 18 pol12 alleles indicates that the conserved carboxy-terminal two-thirds of the protein contains regions that are essential for cell viability, while the more divergent NH2-terminal portion is partially dispensable. The characterization of the temperature-sensitive pol12-T9 mutant allele demonstrates that the B subunit is required for in vivo DNA synthesis and correct progression through S phase. Moreover, reciprocal shift experiments indicate that the POL12 gene product plays an essential role at the early stage of chromosomal DNA replication, before the hydroxyurea-sensitive step. A model for the role of the B subunit in initiation of DNA replication at an origin is presented. Images PMID:8289832

  2. A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite

    PubMed Central

    1989-01-01

    We report the interaction between a human centromere antigen and an alphoid DNA, a human centromeric satellite DNA, which consists of 170- bp repeating units. A cloned alphoid DNA fragment incubated with a HeLa cell nuclear extract is selectively immunoprecipitated by the anticentromere sera from scleroderma patients. Immunoprecipitation of the DNA made by primer extension defines the 17-bp segment on the alphoid DNA that is required for formation of DNA-antigen complex. On the other hand, when proteins bound to the biotinylated alphoid DNA carrying the 17-bp motif are recovered by streptavidin agarose and immunoblotted, the 80-kD centromere antigen (CENP-B) is detected. DNA binding experiments for proteins immunoprecipitated with anticentromere serum, separated by gel electrophoresis, and transferred to a membrane strongly suggest that the 80-kD antigen specifically binds to the DNA fragment with the 17-bp motif. The 17-bp motif is termed the "CENP-B box." Alphoid monomers with the CENP-B box are found in all the known alphoid subclasses, with varying frequencies, except the one derived from the Y chromosome so far cloned. These results imply that the interaction of the 80-kD centromere antigen with the CENP-B box in the alphoid repeats may play some crucial role in the formation of specified structure and/or function of human centromere. PMID:2808515

  3. Human placental Na/sup +/, K/sup +/-ATPase. cap alpha. subunit: cDNA cloning, tissue expression, DNA polymorphism, and chromosomal localization

    SciTech Connect

    Chehab, F.F.; Kan, Y.W.; Law, M.L.; Hartz, J.; Kao, F.T.; Blostein, R.

    1987-11-01

    A 2.2-kilobase clone comprising a major portion of the coding sequence of the Na/sup +/, K/sup +/-ATPase ..cap alpha.. subunit was cloned from human placenta and its sequence was identical to that encoding the ..cap alpha.. subunit of human kidney and HeLa cells. Transfer blot analysis of the mRNA products of the Na/sup +/, K/sup +/-ATPase gene from various human tissues and cell lines revealed only one band (approx. = 4.7 kilobases) under low and high stringency washing conditions. The levels of expression in the tissues were intestine > placenta > liver > pancreas, and in the cell lines the levels were human erythroleukemia > butyrate-induced colon > colon > brain > HeLa cells. mRNA was undetectable in reticulocytes, consistent with the authors failure to detect positive clones in a size-selected ( > 2 kilobases) lambdagt11 reticulocyte cDNA library. DNA analysis revealed by a polymorphic EcoRI band and chromosome localization by flow sorting and in situ hybridization showed that the ..cap alpha.. subunit is on the short is on the short arm (band p11-p13) of chromosome 1.

  4. The structural basis for partitioning of the XRCC1/DNA ligase III-[alpha] BRCT-mediated dimer complexes

    SciTech Connect

    Cuneo, Matthew J.; Gabel, Scott A.; Krahn, Joseph M.; Ricker, Melissa A.; London, Robert E.

    2011-11-17

    The ultimate step common to almost all DNA repair pathways is the ligation of the nicked intermediate to form contiguous double-stranded DNA. In the mammalian nucleotide and base excision repair pathways, the ligation step is carried out by ligase III-{alpha}. For efficient ligation, ligase III-{alpha} is constitutively bound to the scaffolding protein XRCC1 through interactions between the C-terminal BRCT domains of each protein. Although structural data for the individual domains has been available, no structure of the complex has been determined and several alternative proposals for this interaction have been advanced. Interpretation of the models is complicated by the formation of homodimers that, depending on the model, may either contribute to, or compete with heterodimer formation. We report here the structures of both homodimer complexes as well as the heterodimer complex. Structural characterization of the heterodimer formed from a longer XRCC1 BRCT domain construct, including residues comprising the interdomain linker region, revealed an expanded heterodimer interface with the ligase III-{alpha} BRCT domain. This enhanced linker-mediated binding interface plays a significant role in the determination of heterodimer/homodimer selectivity. These data provide fundamental insights into the structural basis of BRCT-mediated dimerization, and resolve questions related to the organization of this important repair complex.

  5. The Structural Basis for Partitioning of the XRCC1/DNA Ligase III-alpha BRCT-mediated Dimer Complexes

    SciTech Connect

    M Cuneo; S Gabel; J Krahn; M Ricker; R London

    2011-12-31

    The ultimate step common to almost all DNA repair pathways is the ligation of the nicked intermediate to form contiguous double-stranded DNA. In the mammalian nucleotide and base excision repair pathways, the ligation step is carried out by ligase III-{alpha}. For efficient ligation, ligase III-{alpha} is constitutively bound to the scaffolding protein XRCC1 through interactions between the C-terminal BRCT domains of each protein. Although structural data for the individual domains has been available, no structure of the complex has been determined and several alternative proposals for this interaction have been advanced. Interpretation of the models is complicated by the formation of homodimers that, depending on the model, may either contribute to, or compete with heterodimer formation. We report here the structures of both homodimer complexes as well as the heterodimer complex. Structural characterization of the heterodimer formed from a longer XRCC1 BRCT domain construct, including residues comprising the interdomain linker region, revealed an expanded heterodimer interface with the ligase III-{alpha} BRCT domain. This enhanced linker-mediated binding interface plays a significant role in the determination of heterodimer/homodimer selectivity. These data provide fundamental insights into the structural basis of BRCT-mediated dimerization, and resolve questions related to the organization of this important repair complex.

  6. Dominant negative mutant of retinoic acid receptor alpha inhibits retinoic acid-induced P19 cell differentiation by binding to DNA.

    PubMed

    Costa, S L; McBurney, M W

    1996-05-25

    Retinoic acid (RA) is a potent inducer of P19 cell differentiation. RA activity is thought to be mediated by nuclear RA receptors (RARs), transcription factors whose activity is dependent on RA. There are three RARs called alpha, beta, and gamma. We created truncated versions of the three RARs and compared their activities as inhibitors of RA-mediated gene transcription and of P19 cell differentiation. Only mutants of the RAR alpha were inhibitory in these assays. A mutant of RAR alpha carrying a 10-amino-acid insert was able to heterodimerize with RXRbeta or with the normal RAR alpha and the inhibitory activity of this mutant was dependent on an intact DNA binding domain. We conclude that dominant negative mutants of RAR alpha act by heterodimerizing with RXRs or RARs and binding to RA response elements on DNA, thereby preventing binding of the normal receptors to those sites. PMID:8635515

  7. DNA polymerase alpha associated protein P1, a murine homolog of yeast MCM3, changes its intranuclear distribution during the DNA synthetic period.

    PubMed Central

    Kimura, H; Nozaki, N; Sugimoto, K

    1994-01-01

    We isolated a murine gene for the DNA polymerase alpha associated protein P1, which shares high homology with the budding yeast MCM3 protein, which is a member of a protein family involved in the early event of DNA replication having a putative DNA-dependent ATPase motif. Using a polyclonal anti-P1 antibody raised against a beta-galactosidase-P1 fusion protein, we identified at least two forms of P1 protein in the nucleus of a mouse cell line, an underphosphorylated form that was associated with a particular nuclear structure and a hyperphosphorylated form loosely bound to the nucleus. During progression through S phase, P1 disappeared, first from the euchromatic region, then from the heterochromatic region, apparently in parallel with temporally ordered DNA replication. Thus, it is likely that the underphosphorylated P1 is dissociated from the nuclear structure after DNA replication by cell cycle-dependent phosphorylation. This is the first direct observation of a protein whose behavior is consistent with that of a hypothetical factor which restricts the chromatin to replicate once per cell cycle in higher eukaryotes. Images PMID:7925275

  8. Acquisition of multiple nuclei and the activity of DNA polymerase alpha and reinitiation of DNA replication in terminally differentiated adult cardiac muscle cells in culture

    SciTech Connect

    Claycomb, W.C.; Bradshaw, H.D. Jr.

    1983-10-01

    Terminally differentiated ventricular cardiac muscle cells isolated from the adult rat and maintained in cell culture have been observed to acquire multiple nuclei. In one cultured myocyte as many as 10 nuclei have been counted. Apparently, these multiple nuclei are formed by DNA replication followed by karyokinesis; the cells must then fail to complete mitosis and divide. To investigate whether DNA synthesis was occurring, the cells were cultured in the presence of (3H)thymidine and then processed for autoradiography. Mononucleated, binucleated, and multinucleated cells incorporate (3H)thymidine into DNA as evidenced by the high concentration of silver grains over their nuclei. Peak periods of incorporation were observed to occur at 10- to 12-day intervals; at 11, 23, and 33 days after initially placing the cells in culture. When the cells were maintained in the presence of (3H)thymidine continuously from Day 7 to Day 17 of culture, 23% of the cells became labeled. If the cells were cultured continuously for 30 days in the presence of (3H)thymidine, from Day 10 to Day 40, 56% of the cells were labeled. Isopycnic gradient analysis indicates that this thymidine incorporation was into DNA that was being replicated semiconservatively; these experiments did not eliminate the possibility, however, that this incorporation was due to amplification of specific genes, such as those coding for the contractile proteins. The activity of DNA polymerase alpha also returns to these cells. These studies demonstrate that the terminally differentiated mammalian ventricular cardiac muscle cell, previously thought to have permanently lost the capacity to replicate DNA during early development, is able to reinitiate semiconservative DNA replication when grown in culture.

  9. DNA elements regulating alpha1-tubulin gene induction during regeneration of eukaryotic flagella.

    PubMed

    Periz, G; Keller, L R

    1997-07-01

    Eukaryotic flagella are complex organelles composed of more than 200 polypeptides. Little is known about the regulatory mechanisms governing synthesis of the flagellar protein subunits and their assembly into this complex organelle. The unicellular green alga Chlamydomonas reinhardtii is the premier experimental model system for studying such cellular processes. When acid shocked, C. reinhardtii excises its flagella, rapidly and coordinately activates transcription of a set of flagellar genes, and ultimately regenerates a new flagellar pair. To define functionally the regulatory sequences that govern induction of the set of genes after acid shock, we analyzed the alpha1-tubulin gene promoter. To simplify transcriptional analysis in vivo, we inserted the selectable marker gene ARG7 on the same plasmid with a tagged alpha1-tubulin gene and stably introduced it into C. reinhardtii cells. By deletion of various sequences, two promoter regions (-176 to -122 and -85 to -16) were identified as important for induction of the tagged alpha1-tubulin gene. Deleting the region between -176 and -122 from the transcription start site resulted in an induction level which was only 45 to 70% of that of the resident gene. Deleting the region upstream of -56 resulted in a complete loss of inducibility without affecting basal expression. The alpha1-tubulin promoter region from -85 to -16 conferred partial acid shock inducibility to an arylsulfatase (ARS) reporter gene. These results show that induction of the alpha1-tubulin gene after acid shock is a complex response that requires diverse sequence elements.

  10. DNA elements regulating alpha1-tubulin gene induction during regeneration of eukaryotic flagella.

    PubMed Central

    Periz, G; Keller, L R

    1997-01-01

    Eukaryotic flagella are complex organelles composed of more than 200 polypeptides. Little is known about the regulatory mechanisms governing synthesis of the flagellar protein subunits and their assembly into this complex organelle. The unicellular green alga Chlamydomonas reinhardtii is the premier experimental model system for studying such cellular processes. When acid shocked, C. reinhardtii excises its flagella, rapidly and coordinately activates transcription of a set of flagellar genes, and ultimately regenerates a new flagellar pair. To define functionally the regulatory sequences that govern induction of the set of genes after acid shock, we analyzed the alpha1-tubulin gene promoter. To simplify transcriptional analysis in vivo, we inserted the selectable marker gene ARG7 on the same plasmid with a tagged alpha1-tubulin gene and stably introduced it into C. reinhardtii cells. By deletion of various sequences, two promoter regions (-176 to -122 and -85 to -16) were identified as important for induction of the tagged alpha1-tubulin gene. Deleting the region between -176 and -122 from the transcription start site resulted in an induction level which was only 45 to 70% of that of the resident gene. Deleting the region upstream of -56 resulted in a complete loss of inducibility without affecting basal expression. The alpha1-tubulin promoter region from -85 to -16 conferred partial acid shock inducibility to an arylsulfatase (ARS) reporter gene. These results show that induction of the alpha1-tubulin gene after acid shock is a complex response that requires diverse sequence elements. PMID:9199320

  11. Evolutionary dynamics of two satellite DNA families in rock lizards of the genus Iberolacerta (Squamata, Lacertidae): different histories but common traits.

    PubMed

    Rojo, Verónica; Martínez-Lage, Andrés; Giovannotti, Massimo; González-Tizón, Ana M; Nisi Cerioni, Paola; Caputo Barucchi, Vincenzo; Galán, Pedro; Olmo, Ettore; Naveira, Horacio

    2015-09-01

    Satellite DNAs compose a large portion of all higher eukaryotic genomes. The turnover of these highly repetitive sequences is an important element in genome organization and evolution. However, information about the structure and dynamics of reptilian satellite DNA is still scarce. Two satellite DNA families, HindIII and TaqI, have been previously characterized in four species of the genus Iberolacerta. These families showed different chromosomal locations, abundances, and evolutionary rates. Here, we extend the study of both satellite DNAs (satDNAs) to the remaining Iberolacerta species, with the aim to investigate the patterns of variability and factors influencing the evolution of these repetitive sequences. Our results revealed disparate patterns but also common traits in the evolutionary histories of these satellite families: (i) each satellite DNA is made up of a library of monomer variants or subfamilies shared by related species; (ii) species-specific profiles of satellite repeats are shaped by expansions and/or contractions of different variants from the library; (iii) different turnover rates, even among closely related species, result in great differences in overall sequence homogeneity and in concerted or non-concerted evolution patterns, which may not reflect the phylogenetic relationships among taxa. Contrasting turnover rates are possibly related to genomic constraints such as karyotype architecture and the interspersed organization of diverging repeat variants in satellite arrays. Moreover, rapid changes in copy number, especially in the centromeric HindIII satDNA, may have been associated with chromosomal rearrangements and even contributed to speciation within Iberolacerta.

  12. Non-linearity issues and multiple ionization satellites in the PIXE portion of spectra from the Mars alpha particle X-ray spectrometer

    NASA Astrophysics Data System (ADS)

    Campbell, John L.; Heirwegh, Christopher M.; Ganly, Brianna

    2016-09-01

    Spectra from the laboratory and flight versions of the Curiosity rover's alpha particle X-ray spectrometer were fitted with an in-house version of GUPIX, revealing departures from linear behavior of the energy-channel relationships in the low X-ray energy region where alpha particle PIXE is the dominant excitation mechanism. The apparent energy shifts for the lightest elements present were attributed in part to multiple ionization satellites and in part to issues within the detector and/or the pulse processing chain. No specific issue was identified, but the second of these options was considered to be the more probable. Approximate corrections were derived and then applied within the GUAPX code which is designed specifically for quantitative evaluation of APXS spectra. The quality of fit was significantly improved. The peak areas of the light elements Na, Mg, Al and Si were changed by only a few percent in most spectra. The changes for elements with higher atomic number were generally smaller, with a few exceptions. Overall, the percentage peak area changes are much smaller than the overall uncertainties in derived concentrations, which are largely attributable to the effects of rock heterogeneity. The magnitude of the satellite contributions suggests the need to incorporate these routinely in accelerator-based PIXE using helium beams.

  13. Knockdown of {alpha}II spectrin in normal human cells by siRNA leads to chromosomal instability and decreased DNA interstrand cross-link repair

    SciTech Connect

    McMahon, Laura W.; Zhang Pan; Sridharan, Deepa M.; Lefferts, Joel A.; Lambert, Muriel W.

    2009-04-03

    Nonerythroid {alpha}-spectrin ({alpha}IISp) is a structural protein involved in repair of DNA interstrand cross-links and is deficient in cells from patients with Fanconi anemia (FA), which are defective in ability to repair cross-links. In order to further demonstrate the importance of the role that {alpha}IISp plays in normal human cells and in the repair defect in FA, {alpha}IISp was knocked down in normal cells using siRNA. Depletion of {alpha}IISp in normal cells by siRNA resulted in chromosomal instability and cellular hypersensitivity to DNA interstrand cross-linking agents. An increased number of chromosomal aberrations were observed and, following treatment with a DNA interstrand cross-linking agent, mitomycin C, cells showed decreased cell growth and survival and decreased formation of damage-induced {alpha}IISp and XPF nuclear foci. Thus depletion of {alpha}IISp in normal cells leads to a number of defects observed in FA cells, such as chromosome instability and a deficiency in cross-link repair.

  14. Construction of Plasmonic Core-Satellite Nanostructures on Substrates Based on DNA-Directed Self-Assembly as a Sensitive and Reproducible Biosensor.

    PubMed

    Zhang, Tingting; Li, He; Hou, Shengwei; Dong, Youqing; Pang, Guangsheng; Zhang, Yingwei

    2015-12-16

    We report the successful construction of plasmonic core-satellite nanostructured assemblies on two-dimensional substrates, based on a strategy of combining DNA-functionalized plasmonic nanoparticles (NPs) with the specific recognition ability toward target to enable satellite NPs to self-assemble around the core immobilized on substrates. A strongly coupled plasmonic resonance band was observed because of the close proximity between core and satellite NPs, which presented significant red-shift and enhanced extinction with respect to the local surface plasmon resonance (LSPR) band of individual core NPs on the substrate. The functionality of this core-satellite nanostructured assembly as a biosensor was further explored, and the changes in extinction intensity and the peak shift of the plasmonic coupling resonance band arising from the probe-target DNA binding event all proved to be useful criteria for target DNA detection. Moreover, high selectivity down to single-base mismatched DNA was achieved using this strongly coupled plasmonic core-satellite nanostructured assembly on a substrate. Such substrate-based detection was advantageous, and its reusability and high cycle stability were demonstrated after five cycles of disassembly and reassembly. Our work demonstrates the biosensing capacity of this DNA-functionalized plasmonic nanoassembly model system on two-dimensional substrate, which is also applicable to the detection of numerous DNA-recognized biomolecules. Likewise, the presented construction method can be extended to fabricate other compositional core-satellite nanoassemblies.

  15. Construction of Plasmonic Core-Satellite Nanostructures on Substrates Based on DNA-Directed Self-Assembly as a Sensitive and Reproducible Biosensor.

    PubMed

    Zhang, Tingting; Li, He; Hou, Shengwei; Dong, Youqing; Pang, Guangsheng; Zhang, Yingwei

    2015-12-16

    We report the successful construction of plasmonic core-satellite nanostructured assemblies on two-dimensional substrates, based on a strategy of combining DNA-functionalized plasmonic nanoparticles (NPs) with the specific recognition ability toward target to enable satellite NPs to self-assemble around the core immobilized on substrates. A strongly coupled plasmonic resonance band was observed because of the close proximity between core and satellite NPs, which presented significant red-shift and enhanced extinction with respect to the local surface plasmon resonance (LSPR) band of individual core NPs on the substrate. The functionality of this core-satellite nanostructured assembly as a biosensor was further explored, and the changes in extinction intensity and the peak shift of the plasmonic coupling resonance band arising from the probe-target DNA binding event all proved to be useful criteria for target DNA detection. Moreover, high selectivity down to single-base mismatched DNA was achieved using this strongly coupled plasmonic core-satellite nanostructured assembly on a substrate. Such substrate-based detection was advantageous, and its reusability and high cycle stability were demonstrated after five cycles of disassembly and reassembly. Our work demonstrates the biosensing capacity of this DNA-functionalized plasmonic nanoassembly model system on two-dimensional substrate, which is also applicable to the detection of numerous DNA-recognized biomolecules. Likewise, the presented construction method can be extended to fabricate other compositional core-satellite nanoassemblies. PMID:26583430

  16. [DNA depolymerase activity in rat spleen following flight on the "Kosmos-605= satellite].

    PubMed

    Makeeva, V F; Komolova, G S; Serova, L V; Belikova, E V; Egorov, I A

    1976-01-01

    The activity of enzymes involved in DNA disintegration (acid and alkaline DNA-ases) was measured in the spleen of rats flown onboard the Cosmos-605 biosatellite for 22 days. The activity of alkaline DNA-ase remained unaltered whereas that of acid DNA-ase increased more than twice. The activity of acid DNA-ase returned to the normal 26 days postflight. The study of characteristic viscosity (eta) of native and denatured DNA showed that enzyme activation was not followed by degradation changes in the DNA molecule.

  17. cDNA sequence coding for the alpha'-chain of the third complement component in the African lungfish.

    PubMed

    Sato, A; Sültmann, H; Mayer, W E; Figueroa, F; Tichy, H; Klein, J

    1999-04-01

    cDNA clones coding for almost the entire C3 alpha-chain of the African lungfish (Protopterus aethiopicus), a representative of the Sarcopterygii (lobe-finned fishes), were sequenced and characterized. From the sequence it is deduced that the lungfish C3 molecule is probably a disulphide-bonded alpha:beta dimer similar to that of the C3 components of other jawed vertebrates. The deduced sequence contains conserved sites presumably recognized by proteolytic enzymes (e.g. factor I) involved in the activation and inactivation of the component. It also contains the conserved thioester region and the putative site for binding properdin. However, the site for the interaction with complement receptor 2 and factor H are poorly conserved. Either complement receptor 2 and factor H are not present in the lungfish or they bind to different residues at the same or a different site than mammalian complement receptor 2 and factor H. The C3 alpha-chain sequences faithfully reflect the phylogenetic relationships among vertebrate classes and can therefore be used to help to resolve the long-standing controversy concerning the origin of the tetrapods. PMID:10219761

  18. Polymorphism, recombination and alternative unscrambling in the DNA polymerase alpha gene of the ciliate Stylonychia lemnae (Alveolata; class Spirotrichea).

    PubMed Central

    Ardell, David H; Lozupone, Catherine A; Landweber, Laura F

    2003-01-01

    DNA polymerase alpha is the most highly scrambled gene known in stichotrichous ciliates. In its hereditary micronuclear form, it is broken into >40 pieces on two loci at least 3 kb apart. Scrambled genes must be reassembled through developmental DNA rearrangements to yield functioning macronuclear genes, but the mechanism and accuracy of this process are unknown. We describe the first analysis of DNA polymorphism in the macronuclear version of any scrambled gene. Six functional haplotypes obtained from five Eurasian strains of Stylonychia lemnae were highly polymorphic compared to Drosophila genes. Another incompletely unscrambled haplotype was interrupted by frameshift and nonsense mutations but contained more silent mutations than expected by allelic inactivation. In our sample, nucleotide diversity and recombination signals were unexpectedly high within a region encompassing the boundary of the two micronuclear loci. From this and other evidence we infer that both members of a long repeat at the ends of the loci provide alternative substrates for unscrambling in this region. Incongruent genealogies and recombination patterns were also consistent with separation of the two loci by a large genetic distance. Our results suggest that ciliate developmental DNA rearrangements may be more probabilistic and error prone than previously appreciated and constitute a potential source of macronuclear variation. From this perspective we introduce the nonsense-suppression hypothesis for the evolution of ciliate altered genetic codes. We also introduce methods and software to calculate the likelihood of hemizygosity in ciliate haplotype samples and to correct for multiple comparisons in sliding-window analyses of Tajima's D. PMID:14704164

  19. Molecular cloning and nucleotide sequence of a full-length cDNA for human alpha enolase.

    PubMed Central

    Giallongo, A; Feo, S; Moore, R; Croce, C M; Showe, L C

    1986-01-01

    We previously purified a 48-kDa protein (p48) that specifically reacts with an antiserum directed against the 12 carboxyl-terminal amino acids of the c-myc gene product. Using an antiserum directed against the purified p48, we have cloned a cDNA from a human expression library. This cDNA hybrid-selects an mRNA that translates to a 48-kDa protein that specifically reacts with anti-p48 serum. We have isolated a full-length cDNA that encodes p48 and spans 1755 bases. The coding region is 1299 bases long; 94 bases are 5' noncoding and 359 bases are 3' noncoding. The cDNA encodes a 433 amino acid protein that is 67% homologous to yeast enolase and 94% homologous to the rat non-neuronal enolase. The purified protein has been shown to have enolase activity and has been identified to be of the alpha type by isoenzyme analysis. The transcriptional regulation of enolase expression in response to mitogenic stimulation of peripheral blood lymphocytes and in response to heat shock is also discussed. Images PMID:3529090

  20. Organization, structure, and function of 95 kb of DNA spanning the murine T-cell receptor C alpha/C delta region.

    PubMed

    Koop, B F; Wilson, R K; Wang, K; Vernooij, B; Zallwer, D; Kuo, C L; Seto, D; Toda, M; Hood, L

    1992-08-01

    We have analyzed the organization, structure, and function of the murine T-cell receptor C alpha/C delta region. This region spans 94.6 kb of DNA and contains the C alpha and C delta genes, as well as the V delta 5, J delta 2, and 50 different J alpha gene segments. Within this sequence we have identified 15 new J alpha gene segments, 40 new 5' RNA splice signals, and 40 new DNA rearrangement signals for the J alpha gene segments. The murine C alpha/C delta sequence contains an exceptionally high level of coding sequence with over 5.7% of the total sequence found in the exons. This is much more than that found in the beta-globin locus and the HPRT locus. Using the sequence data obtained from the C alpha/C delta region, we have designed simple assays to test for J alpha gene segment transcription and to determine the level of polymorphism for simple repeat sequences among different inbred strains of mice using the polymerase chain reaction. Furthermore, comparisons of this 95 kb of sequence with the available sequence from homologous regions of other species have led to the identification of a highly conserved sequence that is present throughout vertebrates and in the mouse binds lymphocyte-specific nuclear proteins. Comparisons of a 10-kb region, which includes the C alpha gene in human and mouse, average 66% sequence similarity. These studies support the contention that large-scale DNA sequencing projects of homologous regions of mouse and human will provide powerful new tools for studying the biology and evolution of loci such as the T-cell receptor and for identifying and posing new questions about the functions of conserved sequences.

  1. Crystal structure of LacI member, PurR, bound to DNA: minor groove binding by alpha helices.

    PubMed

    Schumacher, M A; Choi, K Y; Zalkin, H; Brennan, R G

    1994-11-01

    The three-dimensional structure of a ternary complex of the purine repressor, PurR, bound to both its corepressor, hypoxanthine, and the 16-base pair purF operator site has been solved at 2.7 A resolution by x-ray crystallography. The bipartite structure of PurR consists of an amino-terminal DNA-binding domain and a larger carboxyl-terminal corepressor binding and dimerization domain that is similar to that of the bacterial periplasmic binding proteins. The DNA-binding domain contains a helix-turn-helix motif that makes base-specific contacts in the major groove of the DNA. Base contacts are also made by residues of symmetry-related alpha helices, the "hinge" helices, which bind deeply in the minor groove. Critical to hinge helix-minor groove binding is the intercalation of the side chains of Leu54 and its symmetry-related mate, Leu54', into the central CpG-base pair step. These residues thereby act as "leucine levers" to pry open the minor groove and kink the purF operator by 45 degrees.

  2. A recombinant DNA vaccine protects mice deficient in the alpha/beta interferon receptor against lethal challenge with Usutu virus.

    PubMed

    Martín-Acebes, Miguel A; Blázquez, Ana-Belén; Cañas-Arranz, Rodrigo; Vázquez-Calvo, Ángela; Merino-Ramos, Teresa; Escribano-Romero, Estela; Sobrino, Francisco; Saiz, Juan-Carlos

    2016-04-19

    Usutu virus (USUV) is a mosquito-borne flavivirus whose circulation had been confined to Africa since it was first detected in 1959. However, in the last decade USUV has emerged in Europe causing episodes of avian mortality and sporadic severe neuroinvasive infections in humans. Remarkably, adult laboratory mice exhibit limited susceptibility to USUV infection, which has impaired the analysis of the immune responses, thus complicating the evaluation of virus-host interactions and of vaccine candidates against this pathogen. In this work, we showed that mice deficient in the alpha/beta interferon receptor (IFNAR (-/-) mice) were highly susceptible to USUV infection and provided a lethal challenge model for vaccine testing. To validate this infection model, a plasmid DNA vaccine candidate encoding the precursor of membrane (prM) and envelope (E) proteins of USUV was engineered. Transfection of cultured cells with this plasmid resulted in expression of USUV antigens and the assembly and secretion of small virus-like particles also known as recombinant subviral particles (RSPs). A single intramuscular immunization with this plasmid was sufficient to elicit a significant level of protection against challenge with USUV in IFNAR (-/-) mice. The characterization of the humoral response induced revealed that DNA vaccination primed anti-USUV antibodies, including neutralizing antibodies. Overall, these results probe the suitability of IFNAR (-/-) mice as an amenable small animal model for the study of USUV host virus interactions and vaccine testing, as well as the feasibility of DNA-based vaccine strategies for the control of this pathogen.

  3. Molecular cloning of the. alpha. -subunit of human prolyl 4-hydroxylase: The complete cDNA-derived amino acid sequence and evidence for alternative splicing of RNA transcripts

    SciTech Connect

    Helaakoski, T.; Vuori, K.; Myllylae, R.; Kivirikko, K.I.; Pihlajaniemi, T. )

    1989-06-01

    Prolyl 4-hydroxylase an {alpha}{sub 2}{beta}{sub 2} tetramer, catalyzes the formation of 4-hydroxyproline in collagens by the hydroxylation of proline residues in peptide linkages. The authors report here on the isolation of cDNA clones encoding the {alpha}-subunit of the enzyme from human tumor HT-1080, placenta, and fibroblast cDNA libraries. Eight overlapping clones covering almost all of the corresponding 3,000-nucleotide mRNA, including all the coding sequences, were characterized. These clones encode a polypeptide of 517 amino acid residues and a signal peptide of 17 amino acids. Previous characterization of cDNA clones for the {beta}-subunit of prolyl 4-hydroxylase has indicated that its C terminus has the amino acid sequence Lys-Asp-Gly-Leu, which, it has been suggested, is necessary for the retention of a polypeptide within the lumen of the endoplasmic reticulum. The {alpha}-subunit does not have this C-terminal sequence, and thus one function of the {beta}-subunit in the prolyl 4-hydroxylase tetramer appears to be to retain the enzyme within this cell organelle. Southern blot analyses of human genomic DNA with a cDNA probe for the {alpha}-subunit suggested the presence of only one gene encoding the two types of mRNA, which appear to result from mutually exclusive alternative splicing of primary transcripts of one gene.

  4. Stable high-copy-number integration of Aspergillus oryzae alpha-AMYLASE cDNA in an industrial baker's yeast strain.

    PubMed

    Nieto, A; Prieto, J A; Sanz, P

    1999-01-01

    The Aspergillus oryzae alpha-amylase cDNA was placed under the control of the Saccharomyces cerevisiae actin promoter (pACT1) and introduced into the ribosomal DNA locus of an industrial baker's yeast strain. To obtain a strain eligible for commercial use, we constructed an integrative cassette lacking bacterial DNA sequences but containing the alpha-amylase cDNA and ribosomal DNA sequences to target the integration to this locus. High-copy-number integrants were obtained including a defective TRP1d promoter in the integrative cassette. We selected one transformant, Rib-AMY (CECT10872), in which the multi-integrated sequences were stable even after 200 generations of growth in nonselective medium. This transformant also expressed and secreted high levels of alpha-amylase. Bread made with this strain had a higher volume, lower density, and softer crumbs than bread made with a control strain. The Rib-AMY transformant also was useful in retarding bread firming. This new strain fulfills all the requirements for commercial utilization and should reduce or eliminate the requirement for addition of exogenous alpha-amylase to the flour, reducing allergenic work-related symptoms due to this enzyme.

  5. Sequence and exon-intron organization of the DNA encoding the alpha I domain of human spectrin. Application to the study of mutations causing hereditary elliptocytosis.

    PubMed Central

    Sahr, K E; Tobe, T; Scarpa, A; Laughinghouse, K; Marchesi, S L; Agre, P; Linnenbach, A J; Marchesi, V T; Forget, B G

    1989-01-01

    We have determined the exon-intron organization and the nucleotide sequence of the exons and their flanking intronic DNA in cloned genomic DNA that encodes the first 526 amino acids of the alpha I domain of the human red cell spectrin polypeptide chain. From the gene sequence we designed oligonucleotide primers to use in the polymerase chain reaction technique to amplify the appropriate exons in DNA from individuals with three variants of hereditary elliptocytosis characterized by the presence of abnormal alpha I spectrin peptides, 46-50 and 65-68 kD in size, in partial tryptic digests of spectrin. The alpha I/68-kD abnormality resulted from a duplication of leucine codon 148 in exon 4: TTG-CTG to TTG-TTG-CTG. The alpha I/50a defect was associated in different individuals with two separate single base changes in exon 6: CTG to CCG (leucine to proline) encoding residue 254, and TCC to CCC (serine to proline) encoding residue 255. In another individual with the alpha I/50a polypeptide defect, the nucleotide sequence encoding amino acid residues 221 through 264 was normal. The alpha I/50b abnormality resulted from a single base change of CAG (glutamine) to CCG (proline) encoding residue 465 in exon 11 in two unrelated individuals. In a third individual with alpha I/50b-kD hereditary elliptocytosis, the entire exon encoding residues 445 through 490 was normal. The relationship of the alpha I domain polypeptide structure to these mutations and the organization of the gene is discussed. Images PMID:2794061

  6. Alphoid satellite DNA is tightly associated with centromere antigens in human chromosomes throughout the cell cycle

    SciTech Connect

    Masumoto, Hiroshi; Sugimoto, Kenji; Okazaki, Tuneko )

    1989-03-01

    In this study, the authors have examined a DNA element specific to the centromere domain of human chromosomes. Purified HeLa chromosomes were digested with the restriction enzyme Sau3AI and fractionated by sedimentation through a sucrose gradient. Fractions showing antigenicity to anticentromere (kinetochore) serum obtained from a scleroderma CREST patient were used to construct a DNA library. From this library they found one clone which has specifically hybridized to the centromere domain of metaphase chromosomes using a biotinylated probe DNA and FITC-conjugated avidin. The clone contained a stretch of alphoid DNA dimer. To determine precisely the relative location of the alphoid DNA stretch and the centromere antigen, a method was developed to carry out in situ hybridization of DNA and indirect immunofluorescent staining of antigen on the same cell preparation. Using this method, they have found perfect overlapping of the alphoid DNA sites with the centromere antigen in both metaphase chromosomes and nuclei at various stages in the cell cycle. They have also observed this exact correlation at the attachment sites of artificially extended sister chromatids. These results suggest the possibility that alphoid DNA repeats are a key component of kinetochore structure.

  7. Alpha-1 Antitrypsin Test

    MedlinePlus

    ... measures the level of the protein AAT in blood. Alpha-1 antitrypsin phenotype testing evaluates the amount and type of AAT being produced and compares it to normal patterns. Alpha-1 antitrypsin genotype testing ( DNA testing) can ...

  8. A Novel Sandwich Electrochemical Immunosensor Based on the DNA-Derived Magnetic Nanochain Probes for Alpha-Fetoprotein

    PubMed Central

    Gan, Ning; Jia, Liyong; Zheng, Lei

    2011-01-01

    One novel electrochemical immunosensor was constructed by immobilizing capture antibody of alpha-fetoprotein (AFP Ab1) on a nafion/nanogold-particle modified glassy carbon electrode. With a sandwich immunoassay, one DNA-derived magnetic nanoprobe, simplified as DNA/(ZMPs—HRP-AFP Ab2)n, was employed for the detection of AFP. The fabricated procedure of the proposed biosensor was characterized by cyclic voltammetry and electrochemical impedance spectroscopy. The performance and factors influencing the performance of the biosensor were also evaluated. Under optimal conditions, the developed biosensor exhibited a well-defined electrochemical behavior toward the reduction of AFP ranging from 0.01 to 200 ng/mL with a detection limit of 4 pg/mL (S/N = 3). The biosensor was applied to the determination of AFP in serum with satisfactory results. It is important to note that the sandwich nanochainmodified electro-immunosensor provided an alternative substrate for the immobilization of other tumor markers. PMID:22013390

  9. Screening and Identifying a Novel ssDNA Aptamer against Alpha-fetoprotein Using CE-SELEX

    PubMed Central

    Dong, Lili; Tan, Qiwen; Ye, Wei; Liu, Dongli; Chen, Haifeng; Hu, Hongwei; Wen, Duo; Liu, Yang; Cao, Ya; Kang, Jingwu; Fan, Jia; Guo, Wei; Wu, Weizhong

    2015-01-01

    Alpha-fetoprotein (AFP) is a liver cancer associated protein and has long been utilized as a serum tumor biomarker of disease progression. AFP is usually detected in HCC patients by an antibody based system. Recently, however, aptamers generated from systematic evolution of ligands by exponential enrichment (SELEX) were reported to have an alternative potential in targeted imaging, diagnosis and therapy. In this study, AFP-bound ssDNA aptamers were screened and identified using capillary electrophoresis (CE) SELEX technology. After cloning, sequencing and motif analysis, we successfully confirmed an aptamer, named AP273, specifically targeting AFP. The aptamer could be used as a probe in AFP immunofluorescence imaging in HepG2, one AFP positive cancer cell line, but not in A549, an AFP negative cancer cell line. More interesting, the aptamer efficiently inhibited the migration and invasion of HCC cells after in vivo transfection. Motif analysis revealed that AP273 had several stable secondary motifs in its structure. Our results indicate that CE-SELEX technology is an efficient method to screen specific protein-bound ssDNA, and AP273 could be used as an agent in AFP-based staining, diagnosis and therapy, although more works are still needed. PMID:26497223

  10. cDNA cloning and functional expression of the alpha-D-galactose-binding lectin frutalin in Escherichia coli.

    PubMed

    Oliveira, Carla; Costa, Sofia; Teixeira, José A; Domingues, Lucília

    2009-11-01

    cDNA clones encoding frutalin, the alpha-D-galactose-binding lectin expressed in breadfruit seeds (Artocarpus incisa), were isolated and sequenced. The deduced amino acid sequences indicated that frutalin may be encoded by a family of genes. The NCBI database searches revealed that the frutalin sequence is highly homologous with jacalin and mornigaG sequences. Frutalin cDNA was re-amplified and cloned into the commercial expression vector pET-25b(+) for frutalin production in Escherichia coli. An experimental factorial design was employed to maximise the soluble expression of the recombinant lectin. The results indicated that temperature, time of induction, concentration of IPTG and the interaction between the concentration of IPTG and the time of induction had the most significant effects on the soluble expression level of recombinant frutalin. The optimal culture conditions were as follows: induction with 1 mM IPTG at 22 degrees C for 20 h, yielding 16 mg/l of soluble recombinant frutalin. SDS-PAGE and Western blot analysis revealed that recombinant frutalin was successfully expressed by bacteria with the expected molecular weight (17 kDa). These analyses also showed that recombinant frutalin was mainly produced as insoluble protein. Recombinant frutalin produced by bacteria revealed agglutination properties and carbohydrate-binding specificity similar to the native breadfruit lectin.

  11. Cloning of cDNA encoding the common alpha subunit precursor molecule of pituitary glycoprotein hormones in the Australian lungfish, Neoceratodus forsteri.

    PubMed

    Arai, Y; Kubokawa, K; Ishii, S; Joss, J M

    1998-05-01

    We have isolated cDNA clones encoding a putative glycoprotein hormone alpha subunit precursor molecule from a pituitary cDNA library of the Australian lungfish (Neoceratodus forsteri) by a two-step plaque hybridization technique initially using cDNA encoding the toad glycoprotein hormone alpha subunit precursor molecule as the hybridization probe. The inserts (799 bp) of two of the isolated cDNA clones contained sequences of 5' and 3' untranslated regions, including a poly(A) stretch, and the entire coding sequence of the alpha subunit precursor molecule. The deduced amino acid sequence showed that its signal peptide consists of 24 residues and its mature protein 97 residues. In the mature protein, there is an insert of one residue (Ala) just after the 9th residue. This insert is unique to the Australian lungfish among vertebrate species studied. The amino acid sequence of the mature protein shares the common, or the same-group, amino acid residues at 9 positions with tetrapod and not actinopterygian vertebrates, while only one residue is common to some teleosts and the lungfish to the exclusion of the tetrapods. The overall sequence of the mature protein of the Australian lungfish also shares more similarity with those of tetrapods (69 to 84%) than it does with teleosts (57 to 74%). These results on the relation of the alpha subunit precursor molecule between the lungfish and other vertebrates are consistent with the recent molecular phylogenetic studies suggesting a closer relationship between lungfish and tetrapods than between lungfish and teleosts. We also found that the primary structure of the lungfish alpha subunit is slightly but significantly more similar to that of homeothermic vertebrates than to that of amphibians. This may be due to specialization of the amphibian alpha subunit molecules.

  12. Evidence for preferential repair of 3-carbethoxypsoralen plus UVA induced DNA lesions in the active MAT alpha locus in Saccharomyces cerevisiae using the UvrABC assay.

    PubMed

    Méniel, V; Brouwer, J; Averbeck, D

    1993-09-01

    The occurrence of preferential repair in Saccharomyces cerevisiae of the active MAT alpha locus compared with the inactive HML alpha locus was confirmed after 254 nm UV irradiation. Experiments carried out using the UvrABC excinuclease assay with the monofunctional furocoumarin 3-carbethoxypsoralen (3-CPs) plus UVA radiation which induce mainly monoadducts in DNA demonstrated preferential repair of the active MAT alpha locus compared with the inactive HML alpha locus in a SIR+ strain. However, as after 254 nm UV irradiation, no difference in the rate of removal of 3-CPs plus UVA induced lesions was observed between the two loci in the sir-3 mutant in which both loci are active. Thus, it appears that 3-CPs plus UVA induced monoadducts as well as pyrimidine dimers are subject to preferential repair.

  13. Characterization of a cDNA encoding a novel human Golgi alpha 1, 2-mannosidase (IC) involved in N-glycan biosynthesis.

    PubMed

    Tremblay, L O; Herscovics, A

    2000-10-13

    A human cDNA encoding a 70.9-kDa type II membrane protein with sequence similarity to class I alpha1,2-mannosidases was isolated. The enzymatic properties of the novel alpha1,2-mannosidase IC were studied by expressing its catalytic domain in Pichia pastoris as a secreted glycoprotein. alpha1,2-Mannosidase IC sequentially hydrolyzes the alpha1,2-linked mannose residues of [(3)H]mannose-labeled Man(9)GlcNAc to form [(3)H]Man(6)GlcNAc and a small amount of [(3)H]Man(5)GlcNAc. The enzyme requires calcium for activity and is inhibited by both 1-deoxymannojirimycin and kifunensine. The order of mannose removal was determined by separating oligosaccharide isomers formed from pyridylaminated Man(9)GlcNAc(2) by high performance liquid chromatography. The terminal alpha1,2-linked mannose residue from the middle branch is the last mannose removed by the enzyme. This residue is the mannose cleaved from Man(9)GlcNAc(2) by the endoplasmic reticulum alpha1, 2-mannosidase I to form Man(8)GlcNAc(2) isomer B. The order of mannose hydrolysis from either pyridylaminated Man(9)GlcNAc(2) or Man(8)GlcNAc(2) isomer B differs from that previously reported for mammalian Golgi alpha1,2-mannosidases IA and IB. The full-length alpha1,2-mannosidase IC was localized to the Golgi of MDBK and MDCK cells by indirect immunofluorescence. Northern blot analysis showed tissue-specific expression of a major transcript of 3.8 kilobase pairs. The expression pattern is different from that of human Golgi alpha1,2-mannosidases IA and IB. Therefore, the human genome contains at least three differentially regulated Golgi alpha1, 2-mannosidase genes encoding enzymes with similar, but not identical specificities. PMID:10915796

  14. RECQL5 cooperates with Topoisomerase II alpha in DNA decatenation and cell cycle progression

    PubMed Central

    Ramamoorthy, Mahesh; Tadokoro, Takashi; Rybanska, Ivana; Ghosh, Avik K.; Wersto, Robert; May, Alfred; Kulikowicz, Tomasz; Sykora, Peter; Croteau, Deborah L.; Bohr, Vilhelm A.

    2012-01-01

    DNA decatenation mediated by Topoisomerase II is required to separate the interlinked sister chromatids post-replication. SGS1, a yeast homolog of the human RecQ family of helicases interacts with Topoisomerase II and plays a role in chromosome segregation, but this functional interaction has yet to be identified in higher organisms. Here, we report a physical and functional interaction of Topoisomerase IIα with RECQL5, one of five mammalian RecQ helicases, during DNA replication. Direct interaction of RECQL5 with Topoisomerase IIα stimulates the decatenation activity of Topoisomerase IIα. Consistent with these observations, RECQL5 co-localizes with Topoisomerase IIα during S-phase of the cell cycle. Moreover, cells with stable depletions of RECQL5 display a slow proliferation rate, a G2/M cell cycle arrest and late S-phase cycling defects. Metaphase spreads generated from RECQL5-depleted cells exhibit undercondensed and entangled chromosomes. Further, RECQL5-depleted cells activate a G2/M checkpoint and undergo apoptosis. These phenotypes are similar to those observed when Topoisomerase II catalytic activity is inhibited. These results reveal an important role for RECQL5 in the maintenance of genomic stability and a new insight into the decatenation process. PMID:22013166

  15. DNA Protection against Oxidative Damage Using the Hydroalcoholic Extract of Garcinia mangostana and Alpha-Mangostin.

    PubMed

    Carvalho-Silva, Ronaldo; Pereira, Alanna Cibelle Fernandes; Dos Santos Alves, Rúbens Prince; Guecheva, Temenouga N; Henriques, João A P; Brendel, Martin; Pungartnik, Cristina; Rios-Santos, Fabrício

    2016-01-01

    Garcinia mangostana, popularly known as "mangosteen fruit," originates from Southeast Asia and came to Brazil about 80 years ago where it mainly grows in the states of Pará and Bahia. Although mangosteen or its extracts have been used for ages in Asian folk medicine, data on its potential genotoxicity is missing. We, therefore, evaluated genotoxicity/mutagenicity of hydroethanolic mangosteen extract [HEGM, 10 to 640 μg/mL] in established test assays (Comet assay, micronucleus test, and Salmonella/microsome test). In the Comet assay, HEGM-exposed human leukocytes showed no DNA damage. No significant HEGM-induced mutation in TA98 and TA100 strains of Salmonella typhimurium (with or without metabolic activation) was observed and HEGM-exposed human lymphocytes had no increase of micronuclei. However, HEGM suggested exposure concentration-dependent antigenotoxic potential in leukocytes and antioxidant potential in the yeast Saccharomyces cerevisiae. HEGM preloading effectively protected against H2O2-induced DNA damage in leukocytes (Comet assay). Preloading of yeast with HEGM for up to 4 h significantly protected the cells from lethality of chronic H2O2-exposure, as expressed in better survival. Absence of genotoxicity and demonstration of an antigenotoxic and antioxidant potential suggest that HEGM or some substances contained in it may hold promise for pharmaceutical or nutraceutical application.

  16. DNA Protection against Oxidative Damage Using the Hydroalcoholic Extract of Garcinia mangostana and Alpha-Mangostin

    PubMed Central

    Carvalho-Silva, Ronaldo; Pereira, Alanna Cibelle Fernandes; dos Santos Alves, Rúbens Prince; Guecheva, Temenouga N.; Henriques, João A. P.; Brendel, Martin; Rios-Santos, Fabrício

    2016-01-01

    Garcinia mangostana, popularly known as “mangosteen fruit,” originates from Southeast Asia and came to Brazil about 80 years ago where it mainly grows in the states of Pará and Bahia. Although mangosteen or its extracts have been used for ages in Asian folk medicine, data on its potential genotoxicity is missing. We, therefore, evaluated genotoxicity/mutagenicity of hydroethanolic mangosteen extract [HEGM, 10 to 640 μg/mL] in established test assays (Comet assay, micronucleus test, and Salmonella/microsome test). In the Comet assay, HEGM-exposed human leukocytes showed no DNA damage. No significant HEGM-induced mutation in TA98 and TA100 strains of Salmonella typhimurium (with or without metabolic activation) was observed and HEGM-exposed human lymphocytes had no increase of micronuclei. However, HEGM suggested exposure concentration-dependent antigenotoxic potential in leukocytes and antioxidant potential in the yeast Saccharomyces cerevisiae. HEGM preloading effectively protected against H2O2-induced DNA damage in leukocytes (Comet assay). Preloading of yeast with HEGM for up to 4 h significantly protected the cells from lethality of chronic H2O2-exposure, as expressed in better survival. Absence of genotoxicity and demonstration of an antigenotoxic and antioxidant potential suggest that HEGM or some substances contained in it may hold promise for pharmaceutical or nutraceutical application. PMID:27042187

  17. DNA Protection against Oxidative Damage Using the Hydroalcoholic Extract of Garcinia mangostana and Alpha-Mangostin.

    PubMed

    Carvalho-Silva, Ronaldo; Pereira, Alanna Cibelle Fernandes; Dos Santos Alves, Rúbens Prince; Guecheva, Temenouga N; Henriques, João A P; Brendel, Martin; Pungartnik, Cristina; Rios-Santos, Fabrício

    2016-01-01

    Garcinia mangostana, popularly known as "mangosteen fruit," originates from Southeast Asia and came to Brazil about 80 years ago where it mainly grows in the states of Pará and Bahia. Although mangosteen or its extracts have been used for ages in Asian folk medicine, data on its potential genotoxicity is missing. We, therefore, evaluated genotoxicity/mutagenicity of hydroethanolic mangosteen extract [HEGM, 10 to 640 μg/mL] in established test assays (Comet assay, micronucleus test, and Salmonella/microsome test). In the Comet assay, HEGM-exposed human leukocytes showed no DNA damage. No significant HEGM-induced mutation in TA98 and TA100 strains of Salmonella typhimurium (with or without metabolic activation) was observed and HEGM-exposed human lymphocytes had no increase of micronuclei. However, HEGM suggested exposure concentration-dependent antigenotoxic potential in leukocytes and antioxidant potential in the yeast Saccharomyces cerevisiae. HEGM preloading effectively protected against H2O2-induced DNA damage in leukocytes (Comet assay). Preloading of yeast with HEGM for up to 4 h significantly protected the cells from lethality of chronic H2O2-exposure, as expressed in better survival. Absence of genotoxicity and demonstration of an antigenotoxic and antioxidant potential suggest that HEGM or some substances contained in it may hold promise for pharmaceutical or nutraceutical application. PMID:27042187

  18. Synergistic effects of endothelin-1 (ET-1) and transforming growth factor alpha (TGF-alpha) or epidermal growth factor (EGF) on DNA replication and G1 to S phase transition.

    PubMed

    Yeh, Y C; Burns, E R; Yeh, J; Yeh, H W

    1991-06-01

    The cooperative cell kinetic actions of ET-1 with TGF-alpha or EGF in normal rat kidney fibroblasts (NRK-49F) and KNRK cells (Kirsten MSV transformed) were analyzed by [3H]-thymidine incorporation assay and flow cytometry. A marked synergistic effect of TGF-alpha and ET-1 (or EGF and ET-1) on DNA synthesis and G1 to S transition was observed in NRK cells; 15-20% S for TGF-alpha and 12% S for ET-1 alone but 45-50% S in combination. There was no detectable effect on cell cycle kinetics by TGF-alpha (1 ng/ml) or EGF (1 ng/ml) plus ET-1 (1 ng/ml) in KNRK cells treated for 22 hours. Insulin, insulin-like growth factor I (IGF-I), fibroblast growth factor (FGF), platelet derived growth factor (PDGF), and transforming growth factor beta (TGF-beta) were also tested and found to have no significant synergistic effects on ET-1 actions. Our findings suggest that the combination of TGF-alpha (EGF) and ET-1 is an important part of an intricate network which coordinates progression of G1 to S phase in normal cells.

  19. Chicken epidermal growth factor (EGF) receptor: cDNA cloning, expression in mouse cells, and differential binding of EGF and transforming growth factor alpha.

    PubMed Central

    Lax, I; Johnson, A; Howk, R; Sap, J; Bellot, F; Winkler, M; Ullrich, A; Vennstrom, B; Schlessinger, J; Givol, D

    1988-01-01

    The primary structure of the chicken epidermal growth factor (EGF) receptor was deduced from the sequence of a cDNA clone containing the complete coding sequence and shown to be highly homologous to the human EGF receptor. NIH-3T3 cells devoid of endogenous EGF receptor were transfected with the appropriate cDNA constructs and shown to express either chicken or human EGF receptors. Like the human EGF receptor, the chicken EGF receptor is a glycoprotein with an apparent molecular weight of 170,000. Murine EGF bound to the chicken receptor with approximately 100-fold lower affinity than to the human receptor molecule. Surprisingly, human transforming growth factor alpha (TGF-alpha) bound equally well or even better to the chicken EGF receptor than to the human EGF receptor. Moreover, TGF-alpha stimulated DNA synthesis 100-fold better than did EGF in NIH 3T3 cells that expressed the chicken EGF receptor. The differential binding and potency of mammalian EGF and TGF-alpha by the avian EGF receptor contrasts with the similar affinities of the mammalian receptor for the two growth factors. Images PMID:3260329

  20. Alpha-tocopherol modulates hydrogen peroxide-induced DNA damage and telomere shortening of human skin fibroblasts derived from differently aged individuals.

    PubMed

    Makpol, Suzana; Zainuddin, Azalina; Rahim, Norhazira Abdul; Yusof, Yasmin Anum; Ngah, Wan Zurinah

    2010-06-01

    Antioxidants such as vitamin E may act differently on skin cells depending on the age of the skin and the level of oxidative damage induced. The effects of alpha-tocopherol (ATF) on H(2)O(2)-induced DNA damage and telomere shortening of normal human skin fibroblast cells derived from young and old individual donors were determined. Fibroblasts were divided into five groups; untreated control, H(2)O(2)-induced oxidative stress, alpha-tocopherol treatment, and pre- and post-treatment with alpha-tocopherol for H(2)O(2)-induced oxidative stress. Our results showed that H(2)O(2)-induced oxidative stress increased DNA damage, shortened the telomere length and reduced the telomerase activity (p < 0.05) in fibroblasts obtained from young and old donors. Pre- and post-treatment with alpha-tocopherol protected against H(2)O(2)-induced DNA damage in fibroblasts obtained from young individuals (p = 0.005; p = 0.01, respectively). However, in fibroblasts obtained from old individuals, similar protective effects were only seen in cells pretreated with alpha-tocopherol (p = 0.05) but not in the post-treated cells. Protection against H(2)O(2)-induced telomere shortening was observed in fibroblasts obtained from both young and old donors which were pre-treated with alpha-tocopherol (p = 0.009; p = 0.008, respectively). However, similar protective effects against telomere shortening in fibroblasts obtained from both young and old donors were not observed in the post-treated fibroblasts. Protection against H(2)O(2)-induced telomerase activity loss was observed only in fibroblasts obtained from old donors which were pretreated with alpha-tocopherol (p = 0.04) but not in fibroblasts obtained from young donors. Similar protective effects against telomerase activity loss in fibroblasts obtained from both young and old donors were not observed in the post-treated fibroblasts. In conclusion, alpha-tocopherol protected against H(2)O(2)-induced telomere shortening by restoring the telomerase

  1. Cloning of the cDNA of the heme-regulated eukaryotic initiation factor 2 alpha (eIF-2 alpha) kinase of rabbit reticulocytes: homology to yeast GCN2 protein kinase and human double-stranded-RNA-dependent eIF-2 alpha kinase.

    PubMed Central

    Chen, J J; Throop, M S; Gehrke, L; Kuo, I; Pal, J K; Brodsky, M; London, I M

    1991-01-01

    We have cloned the cDNA of the heme-regulated eIF-2 alpha kinase (HRI) of rabbit reticulocytes. In vitro translation of mRNA transcribed from the HRI cDNA yields a 90-kDa polypeptide that exhibits eIF-2 alpha kinase activity and is recognized by a monoclonal antibody directed against authentic HRI. The open reading frame sequence of the HRI cDNA contains all 11 catalytic domains of protein kinases with consensus sequences of protein-serine/threonine kinases in conserved catalytic domains VI and VIII. The HRI cDNA also contains an insert of approximately 140 amino acids between catalytic domains V and VI. The HRI cDNA coding sequence has extensive homology to GCN2 protein kinase of Saccharomyces cerevisiae and to human double-stranded-RNA-dependent eIF-2 alpha kinase. This observation suggests that GCN2 protein kinase may be an eIF-2 alpha kinase in yeast. In addition, HRI has an unusually high degree of homology to three protein kinases (NimA, Wee1, and CDC2) that are involved in the regulation of the cell cycle. Images PMID:1679235

  2. Supplementation of ascorbic acid and alpha-tocopherol prevents arsenic-induced protein oxidation and DNA damage induced by arsenic in rats.

    PubMed

    Kadirvel, R; Sundaram, K; Mani, S; Samuel, S; Elango, N; Panneerselvam, C

    2007-12-01

    Contamination of arsenic in drinking water is associated with several human diseases including cancer. It has been reported that oxidative stress plays a vital role in arsenic-induced biochemical and molecular alterations. The aim of the present study was to improve the understanding of arsenic-induced oxidative damage to proteins and to DNA and the role of antioxidants such as ascorbic acid and alpha-tocopherol in alleviating arsenic-induced damages in experimental rats. A significant increase in the levels of protein oxidation, DNA strand breaks, and DNA-protein cross-links was observed in blood, liver, and kidney of rats exposed to arsenic (100 ppm in drinking water) for 30 days. Co-administration of ascorbic acid and alpha-tocopherol to arsenic-exposed rats showed a substantial reduction in the levels of arsenic-induced oxidative products of protein and DNA. The results of this study support that free radical-mediated toxic manifestations of arsenic and also suggest that ascorbic acid and alpha-tocopherol supplementation can improve the arsenic-induced molecular alterations.

  3. An ancient satellite DNA has maintained repetitive units of the original structure in most species of the living fossil plant genus Zamia.

    PubMed

    Cafasso, Donata; Chinali, Gianni

    2014-03-01

    ZpS1 satellite DNA is specific to the genus Zamia and presents repetitive units organized as long arrays and also as very short arrays dispersed in the genome. We have characterized the structure of the ZpS1 repeats in 12 species representative of the whole geographic distribution of the genus. In most species, the clone most common sequences (cMCS) were so similar that a general most common sequence (GMCS) of the ZpS1 repetitive unit in the genus could be obtained. The few partial variations from the GMCS found in cMCS of some species correspond to variable positions present in most other species, as indicated by the clone consensus sequences (cCS). Two species have an additional species-specific variety of ZpS1 satellite. The dispersed repeats were found to contain more mutations than repeats from long arrays. Our results indicate that all or most species of Zamia inherited the ZpS1 satellite from a common ancestor in Miocene and have maintained repetitive units of the original structure till present. The features of ZpS1 satellite in the genus Zamia are poorly compatible with the model of concerted evolution, but they are perfectly consistent with a new model of satellite evolution based on experimental evidences indicating that a specific amplification-substitution repair mechanism maintains the homogeneity and stability of the repeats structure in each satellite DNA originally present in a species as long as the species exists.

  4. Targeting Aberrant DNA double strand break repair in triple negative breast cancer with alpha particle emitter radiolabeled anti-EGFR antibody

    PubMed Central

    Song, Hong; Hedayati, Mohammad; Hobbs, Robert F.; Shao, Chunbo; Bruchertseifer, Frank; Morgenstern, Alfred; DeWeese, Theodore L.; Sgouros, George

    2013-01-01

    The higher potential efficacy of alpha-particle radiopharmaceutical therapy lies in the 3 to 8-fold greater biological effectiveness (RBE) of alpha particles relative to photon or beta-particle radiation. This greater RBE, however, also applies to normal tissue, thereby reducing the potential advantage of high RBE. Since alpha particles typically cause DNA double strand breaks (DSBs), targeting tumors that are defective in DSB repair effectively increases the RBE, yielding a secondary, RBE-based differentiation between tumor and normal tissue that is complementary to conventional, receptor-mediated tumor targeting. In some triple negative breast cancers (TNBC, ER−/PR−/HER-2−), germline mutation in BRCA-1, a key gene in homologous recombination (HR) DSB repair, predisposes patients to early onset of breast cancer. These patients have few treatment options once the cancer has metastasized. In this study, we investigated the efficacy of alpha particle emitter, 213Bi labeled anti-EGFR antibody, Cetuximab, in BRCA-1 defective TNBC. 213Bi-Cetuximab was found to be significantly more effective in the BRCA-1 mutated TNBC cell line HCC1937 than BRCA-1 competent TNBC cell MDA-MB-231. siRNA knockdown of BRCA-1 or DNA-PKcs, a key gene in non-homologous end joining (NHEJ) DSB repair pathway, also sensitized TNBC cells to 213Bi-Cetuximab. Furthermore, the small molecule inhibitor of DNA-PKcs, NU7441, sensitized BRCA-1 competent TNBC cells to alpha particle radiation. Immunofluorescent staining of γH2AX foci and comet assay confirmed that enhanced RBE is caused by impaired DSB repair. These data offer a novel strategy for enhancing conventional receptor-mediated targeting with an additional, potentially synergistic radiobiological targeting that could be applied to TNBC. PMID:23873849

  5. The alpha and beta subunits of phosphorylase kinase are homologous: cDNA cloning and primary structure of the beta subunit.

    PubMed Central

    Kilimann, M W; Zander, N F; Kuhn, C C; Crabb, J W; Meyer, H E; Heilmeyer, L M

    1988-01-01

    We have cloned cDNA molecules encoding the beta subunit of phosphorylase kinase (ATP:phosphorylase-b phosphotransferase; EC 2.7.1.38) from rabbit fast-twitch skeletal muscle and have determined the complete primary structure of the polypeptide by a combination of peptide and DNA sequencing. In the mature beta subunit, the initial methionine is replaced by an acetyl group. The subunit is composed of 1092 amino acids and has a calculated molecular mass of 125,205 Da. Alignment of its sequence with the alpha subunit of phosphorylase kinase reveals extensive regions of homology, but each molecule also possesses unique sequences. Two of the three phosphorylation sites known for the beta subunit and all seven phosphorylation sites known for the alpha subunit are located in these unique domains. Images PMID:3200826

  6. Stoichiometry of expressed alpha(4)beta(2)delta gamma-aminobutyric acid type A receptors depends on the ratio of subunit cDNA transfected.

    PubMed

    Wagoner, Kelly R; Czajkowski, Cynthia

    2010-05-01

    The gamma-aminobutyric acid type A receptor (GABA(A)R) is the target of many depressants, including benzodiazepines, anesthetics, and alcohol. Although the highly prevalent alphabetagamma GABA(A)R subtype mediates the majority of fast synaptic inhibition in the brain, receptors containing delta subunits also play a key role, mediating tonic inhibition and the actions of endogenous neurosteroids and alcohol. However, the fundamental properties of delta-containing GABA(A)Rs, such as subunit stoichiometry, are not well established. To determine subunit stoichiometry of expressed delta-containing GABA(A)Rs, we inserted the alpha-bungarotoxin binding site tag in the alpha(4), beta(2), and delta subunit N termini. An enhanced green fluorescent protein tag was also inserted into the beta(2) subunit to shift its molecular weight, allowing us to separate subunits using SDS-PAGE. Tagged alpha(4)beta(2)delta GABA(A)Rs were expressed in HEK293T cells using various ratios of subunit cDNA, and receptor subunit stoichiometry was determined by quantitating fluorescent alpha-bungarotoxin bound to each subunit on Western blots of surface immunopurified tagged GABA(A)Rs. The results demonstrate that the subunit stoichiometry of alpha(4)beta(2)delta GABA(A)Rs is regulated by the ratio of subunit cDNAs transfected. Increasing the ratio of delta subunit cDNA transfected increased delta subunit incorporation into surface receptors with a concomitant decrease in beta(2) subunit incorporation. Because receptor subunit stoichiometry can directly influence GABA(A)R pharmacological and functional properties, considering how the transfection protocols used affect subunit stoichiometry is essential when studying heterologously expressed alpha(4)beta(2)delta GABA(A)Rs. Successful bungarotoxin binding site tagging of GABA(A)R subunits is a novel tool with which to accurately quantitate subunit stoichiometry and will be useful for monitoring GABA(A)R trafficking in live cells.

  7. Tetris Is a Foldback Transposon that Provided the Building Blocks for an Emerging Satellite DNA of Drosophila virilis

    PubMed Central

    Dias, Guilherme B.; Svartman, Marta; Delprat, Alejandra; Ruiz, Alfredo; Kuhn, Gustavo C.S.

    2014-01-01

    Transposable elements (TEs) and satellite DNAs (satDNAs) are abundant components of most eukaryotic genomes studied so far and their impact on evolution has been the focus of several studies. A number of studies linked TEs with satDNAs, but the nature of their evolutionary relationships remains unclear. During in silico analyses of the Drosophila virilis assembled genome, we found a novel DNA transposon we named Tetris based on its modular structure and diversity of rearranged forms. We aimed to characterize Tetris and investigate its role in generating satDNAs. Data mining and sequence analysis showed that Tetris is apparently nonautonomous, with a structure similar to foldback elements, and present in D. virilis and D. americana. Herein, we show that Tetris shares the final portions of its terminal inverted repeats (TIRs) with DAIBAM, a previously described miniature inverted transposable element implicated in the generation of chromosome inversions. Both elements are likely to be mobilized by the same autonomous TE. Tetris TIRs contain approximately 220-bp internal tandem repeats that we have named TIR-220. We also found TIR-220 repeats making up longer (kb-size) satDNA-like arrays. Using bioinformatic, phylogenetic and cytogenomic tools, we demonstrated that Tetris has contributed to shaping the genomes of D. virilis and D. americana, providing internal tandem repeats that served as building blocks for the amplification of satDNA arrays. The β-heterochromatic genomic environment seemed to have favored such amplification. Our results imply for the first time a role for foldback elements in generating satDNAs. PMID:24858539

  8. Cloning and Molecular Characterization of a cDNA Clone Coding for Trichomonas vaginalis Alpha-Actinin and Intracellular Localization of the Protein

    PubMed Central

    Addis, Maria Filippa; Rappelli, Paola; Delogu, Giuseppe; Carta, Franco; Cappuccinelli, Piero; Fiori, Pier Luigi

    1998-01-01

    We have identified and sequenced a cDNA clone coding for Trichomonas vaginalis alpha-actinin. Analysis of the obtained sequence revealed that the 2,857-nucleotide-long cDNA contained an open reading frame encoding 849 amino acids which showed consistent homology with alpha-actinins of different species. Such homology was particularly significant in regions which have been reported to represent the actin-binding and Ca2+-binding domains in other alpha-actinins. The deduced protein was also characterized by the presence of a divergent central region thought to play a role in its high immunogenicity. A study of protein localization performed by immunofluorescence revealed that the protein is diffusely distributed throughout the T. vaginalis cytoplasm when the cell is pear shaped. When parasites adhere and transform into the amoeboid morphology, the protein is located only in areas close to the cytoplasmic membrane and colocalizes with actin. Concomitantly with transformation into the amoeboid morphology, alpha-actinin mRNA expression is upregulated. PMID:9746598

  9. Domain analysis of the plant DNA-binding protein GT1a: requirement of four putative alpha-helices for DNA binding and identification of a novel oligomerization region.

    PubMed Central

    Lam, E

    1995-01-01

    Light is an important environmental signal that can influence diverse developmental processes in plants. Many plant nuclear genes respond to light at the level of transcription initiation. GT-1 and GT2 are nuclear factors which interact with DNA sequences in many light-responsive gene promoters. cDNA clones which encode proteins with sequence binding specificities similar to those of these two factors have been isolated. They show significant amino acid sequence similarities within three closely spaced, putative alpha-helices that were predicted by secondary structure analysis but do not show significant homologies with any other reported DNA-binding protein. In this work, N- and C-terminal deletions of tobacco GT1a were generated by in vitro transcription and translation, and their DNA-binding activities and subunit structures were studied. The results suggest that the C-terminal domain of GT1a is critical for protein oligomerization, while a region predicted to contain four closely spaced alpha-helices is required for DNA binding. Direct chemical cross-linking and gel filtration analyses of full-length and truncated derivatives of GT1a suggest that this factor can exist in solution as a homotetramer and that oligomerization is independent of DNA binding. This study thus establishes two independent functional domains in this class of eukaryotic trans-acting factors. Possible implications of the multimeric nature of GT1a in relation to the known characteristics of light-responsive promoter architecture are discussed. PMID:7823917

  10. A partial genomic DNA clone for the alpha subunit of the mouse complement receptor type 3 and cellular adhesion molecule Mac-1.

    PubMed Central

    Sastre, L; Roman, J M; Teplow, D B; Dreyer, W J; Gee, C E; Larson, R S; Roberts, T M; Springer, T A

    1986-01-01

    A genomic clone coding for the alpha subunit of the mouse complement receptor type 3 and the cellular adhesion molecule Mac-1 has been isolated directly from a genomic library using synthetic oligonucleotide probes based on the amino-terminal amino acid sequence of the protein. The identity of the clone has been established by DNA sequencing and in vitro translation of hybrid-selected mRNA. The gene is present in a single copy in the murine genome. The region containing the amino-terminal exon has been sequenced. RNA gel blotting shows that the Mac-1 alpha-subunit mRNA is 6 kilobases in length. Mac-1 alpha-subunit mRNA is present in macrophages but not T lymphoma or L cells. During gamma interferon-stimulated maturation of the mouse premyelocytic cell line M1, Mac-1 alpha-subunit mRNA is induced. This corresponds with the tissue distribution of the Mac-1 alpha subunit, showing expression is regulated at least partially at the message level. Images PMID:2942940

  11. Physical organization of the 1.709 satellite IV DNA family in Bovini and Tragelaphini tribes of the Bovidae: sequence and chromosomal evolution.

    PubMed

    Adega, F; Chaves, R; Guedes-Pinto, H; Heslop-Harrison, J S

    2006-01-01

    Repetitive DNA in the mammalian genome is a valuable record and marker for evolution, providing information about the order and driving forces related to evolutionary events. The evolutionarily young 1.709 satellite IV DNA family is present near the centromeres of many chromosomes in the Bovidae. Here, we isolated 1.709 satellite DNA sequences from five Bovidae species belonging to Bovini: Bos taurus (BTA, cattle), Bos indicus (BIN, zebu), Bubalus bubalis (BBU, water buffalo) and Tragelaphini tribes: Taurotragus oryx (TOR, eland) and Tragelaphus euryceros (TEU, bongo). Its presence in both tribes shows the sequence predates the evolutionary separation of the two tribes (more than 10 million years ago), and primary sequence shows increasing divergence with evolutionary distance. Genome organization (Southern hybridization) and physical distribution (in situ hybridization) revealed differences in the molecular organization of these satellite DNA sequences. The data suggest that the sequences on the sex chromosomes and the autosomes evolve as relatively independent groups, with the repetitive sequences suggesting that Bovini autosomes and the Tragelaphini sex chromosomes represent the more primitive chromosome forms. PMID:16825766

  12. Physical organization of the 1.709 satellite IV DNA family in Bovini and Tragelaphini tribes of the Bovidae: sequence and chromosomal evolution.

    PubMed

    Adega, F; Chaves, R; Guedes-Pinto, H; Heslop-Harrison, J S

    2006-01-01

    Repetitive DNA in the mammalian genome is a valuable record and marker for evolution, providing information about the order and driving forces related to evolutionary events. The evolutionarily young 1.709 satellite IV DNA family is present near the centromeres of many chromosomes in the Bovidae. Here, we isolated 1.709 satellite DNA sequences from five Bovidae species belonging to Bovini: Bos taurus (BTA, cattle), Bos indicus (BIN, zebu), Bubalus bubalis (BBU, water buffalo) and Tragelaphini tribes: Taurotragus oryx (TOR, eland) and Tragelaphus euryceros (TEU, bongo). Its presence in both tribes shows the sequence predates the evolutionary separation of the two tribes (more than 10 million years ago), and primary sequence shows increasing divergence with evolutionary distance. Genome organization (Southern hybridization) and physical distribution (in situ hybridization) revealed differences in the molecular organization of these satellite DNA sequences. The data suggest that the sequences on the sex chromosomes and the autosomes evolve as relatively independent groups, with the repetitive sequences suggesting that Bovini autosomes and the Tragelaphini sex chromosomes represent the more primitive chromosome forms.

  13. The phylogenetic position of the pelobiont Mastigamoeba balamuthi based on sequences of rDNA and translation elongation factors EF-1alpha and EF-2.

    PubMed

    Arisue, Nobuko; Hashimot, Tetsuo; Lee, Jennifer A; Moore, Dorothy V; Gordon, Paul; Sensen, Christoph W; Gaasterland, Terry; Hasegawa, Masami; Müller, Miklós

    2002-01-01

    The taxonomic position and phylogenetic relationships of the Pelobionta, an amitochondriate amoeboflagellate group, are not yet completely settled. To provide more information, we obtained sequences for the large subunit rDNA gene, the gene for translation elongation factor 1alpha, and for a large part of the gene encoding translation elongation factor 2 from a representative of this group, Mastigamoeba balamuthi (formerly Phreatamoeba balamuthi). The gene for the large subunit rDNA was unusually large compared to those of other protists, a phenomenon that had previously been observed for the gene encoding the small subunit rDNA. Phylogenetic reconstruction using a maximum likelihood method was performed with these sequences, as well as the gene encoding the small subunit rDNA. When evaluated individually, the M. balamuthi genes for the small and large subunit rDNAs and elongation factor 1alpha had a most recent common ancestor with either the Mycetozoa (slime molds) or with Entamoeba histolytica. A clade formed by M. balamuthi, E. histolytica, and Mycetozoa was not rejected statistically for any of the sequences. A combined maximum likelihood analysis using 3,935 positions from all molecules suggested that these three taxonomic units form a robust clade. We were unable to resolve the closest group to this clade using the combined analysis. These findings support the notion, which had previously been proposed primarily on cytological evidence, that both M. balamuthi and E. histolytica are closely related to the Mycetozoa and that these three together represent a major eukaryotic lineage.

  14. Diagnosis of. alpha. sub 1 -antitrypsin deficiency by enzymatic amplification of human genomic DNA and direct sequencing of polymerase chain reaction products

    SciTech Connect

    Newton, C.R.; Graham, A.; Powell, S.; Gammack, A.; Riley, J.; Markham, A.F. ); Kalsheker, N. )

    1988-09-12

    The authors have compared sequencing of cloned polymerase chain reaction (PCR) products and the direct sequencing of PCR products in the examination of individuals from six families affected with {alpha}{sub 1}-antitrypsin (AAT) deficiency. In families where paternity was in question they confirmed consanguinity by DNA fingerprinting using a panel of locus-specific minisatellite probes. They demonstrate that direct sequencing of PCR amplification products is the method of choice for the absolutely specific diagnosis of AAT deficiency and can distinguish normals, heterozygotes and homozygotes in a single, rapid and facile assay. Furthermore, they demonstrate the reproducibility of the PCR and a rapid DNA isolation procedure. They have also shown that two loci can be simultaneously amplified and that the PCR product from each locus can be independently examined by direct DNA sequencing.

  15. Protective effect of nicotine through nicotinic acetylcholine receptor alpha 7 on hypoxia-induced membrane disintegration and DNA fragmentation of cultured PC12 cells.

    PubMed

    Tohgi, H; Utsugisawa, K; Nagane, Y

    2000-05-12

    To investigate the effect of nicotine on hypoxic neuronal damage, cultured PC12 cells were exposed to hypoxia for 9 h and then reoxygenated for 72 h. The cells were stained by propidium iodide (PI), a marker of cell membrane disintegration and the TUNEL method, which indicates DNA fragmentation. In control cultures, the ratio of PI-positive cells to total cells progressively increased during and after exposure to hypoxia, constituting 39% of total cells at 72 h posthypoxia. This increase in PI-positive cells was completely inhibited by nicotine until 12 h posthypoxia, and was partially and dose-dependently inhibited thereafter. The ratio of TUNEL-positive cells to total cells started to increase at 24 h posthypoxia and reached 36% at 72 h in control cultures. This ratio was also dose-dependently inhibited by nicotine. These inhibitory effects of nicotine on the increase in PI-positive and TUNEL-positive cells were abolished by the addition to the medium of alpha-bungarotoxin, an antagonistic ligand for nicotinic acetylcholine receptor (AChR) alpha7. These findings suggest that nicotine inhibits, through AChR alpha7, hypoxia-induced cell membrane disintegration and DNA fragmentation of cultured PC12 cells exposed to hypoxia.

  16. In Vitro Selection of Single-Stranded DNA Molecular Recognition Elements against S. aureus Alpha Toxin and Sensitive Detection in Human Serum

    PubMed Central

    Hong, Ka L.; Battistella, Luisa; Salva, Alysia D.; Williams, Ryan M.; Sooter, Letha J.

    2015-01-01

    Alpha toxin is one of the major virulence factors secreted by Staphylococcus aureus, a bacterium that is responsible for a wide variety of infections in both community and hospital settings. Due to the prevalence of S. aureus related infections and the emergence of methicillin-resistant S. aureus, rapid and accurate diagnosis of S. aureus infections is crucial in benefiting patient health outcomes. In this study, a rigorous Systematic Evolution of Ligands by Exponential Enrichment (SELEX) variant previously developed by our laboratory was utilized to select a single-stranded DNA molecular recognition element (MRE) targeting alpha toxin with high affinity and specificity. At the end of the 12-round selection, the selected MRE had an equilibrium dissociation constant (Kd) of 93.7 ± 7.0 nM. Additionally, a modified sandwich enzyme-linked immunosorbent assay (ELISA) was developed by using the selected ssDNA MRE as the toxin-capturing element and a sensitive detection of 200 nM alpha toxin in undiluted human serum samples was achieved. PMID:25633102

  17. Oxidative DNA damage in CD34+ myelodysplastic cells is associated with intracellular redox changes and elevated plasma tumour necrosis factor-alpha concentration.

    PubMed

    Peddie, C M; Wolf, C R; McLellan, L I; Collins, A R; Bowen, D T

    1997-12-01

    Ineffective haemopoiesis in the myelodysplastic syndromes (MDS) is mediated, at least in part, by apoptosis, though the mechanisms of apoptotic induction are unclear. Tumour necrosis factor-alpha (TNF-alpha) promotes apoptosis via intracellular oxygen free radical production, oxidation of DNA and proteins, and is increasingly implicated in the pathogenesis of MDS. Using single-cell gel electrophoresis, we have identified oxidized pyrimidine nucleotides in the progenitor-enriched bone marrow CD34+ compartment from MDS patients (P=0.039), which are absent in both CD34- MDS cells (P=0.53) and also CD34+ cells from normal subjects (P=0.55). MDS CD34+ blood cells also showed oxidized pyrimidine nucleotides compared with CD34- cells (P=0.029). Within normal subjects no differences were seen between CD34+ and CD34- bone marrow cell compartments. CD34+ bone marrow cell oxidized pyrimidines were strongly associated with elevated plasma TNF-alpha and low bone marrow mononuclear cell glutathione concentrations (5/6 patients) and the inverse relationship was also found (3/4 patients). This data implies a role for intracellular oxygen free radical production, perhaps mediated by TNF-alpha, in the pathogenesis of ineffective haemopoiesis in MDS and provides a rationale for the bone marrow stimulatory effects of antioxidants such as Amifostine in MDS.

  18. Expression levels of Protocadherin-alpha transcripts are decreased by nonsense-mediated mRNA decay with frameshift mutations and by high DNA methylation in their promoter regions.

    PubMed

    Kaneko, Ryosuke; Kawaguchi, Masahumi; Toyama, Tomoko; Taguchi, Yusuke; Yagi, Takeshi

    2009-02-01

    The mouse protocadherin (Pcdh) clusters, Pcdh-alpha, -beta, and -gamma, are located on chromosome 18. Many polymorphic variations are found in the Pcdh-alpha genes in wild-derived and laboratory mouse strains. In comparing the expression levels of Pcdh-alpha isoforms among several strains, we observed lower expression levels of Pcdh-alpha9 in BLG2 and BFM/2, and of Pcdh-alpha8 in C57BL/6 (B6) than in the other strains. For Pcdh-alpha8, high DNA methylation (72.7%) in the promoter region was found only in B6, whereas 36.4-44.3% methylation was seen in the other strains. On the other hand, the Pcdh-alpha9 DNA-methylation levels were similar (23.6-36.3%) among the strains regardless of the difference in expression levels. Interestingly, however, the Pcdh-alpha9 variable exon in both BLG2 and BFM/2 included a premature termination codon (PTC) generated by a nucleotide deletion or insertion. Treatment with emetine, a potent inhibitor of nonsense-mediated mRNA decay (NMD), increased the expression level of Pcdh-alpha9 from the BLG2-Pcdh-alpha locus. These data indicate that the transcription levels of mature Pcdh-alpha mRNAs are decreased by the DNA-methylation state of the Pcdh-alpha promoter regions and by the NMD pathway during RNA maturation. And we correct some previous data on Sugino, H., Toyama, T., Taguchi, Y., Esumi, S., Miyazaki, M., Yagi, T., (2004) Negative and positive effects of an IAP-LTR on nearby Pcdaalpha gene expression in the central nervous system and neuroblastoma cell lines, Gene 337 91-103.

  19. Molecular cloning, sequence, and expression of a human GDP-L-fucose:. beta. -D-galactoside 2-. alpha. -L-fucosyltransferase cDNA that can form the H blood group antigen

    SciTech Connect

    Larsen, R.D.; Ernst, L.K.; Nair, R.P.; Lowe, J.B. )

    1990-09-01

    The authors have previously used a gene-transfer scheme to isolate a human genomic DNA fragment that determines expression of a GDP-L-fucose:{beta}D-galactoside 2-{alpha}-L-fucosyltransferase. Although this fragment determined expression of an {alpha}(1,2)FT whose kinetic properties mirror those of the human H blood group {alpha}(1,2)FT, their precise nature remained undefined. They describe here the molecular cloning, sequence, and expression of a human of cDNA corresponding to these human genomic sequences. When expressed in COS-1 cells, the cDNA directs expression of cell surface H structures and a cognate {alpha}(1,2)FT activity with properties analogous to the human H blood group {alpha}(1,2)FT. The cDNA sequence predicts a 365-amino acid polypeptide characteristic of a type II transmembrane glycoprotein with a domain structure analogous to that of other glycosyltransferases but without significant primary sequence similarity to these or other known proteins. To directly demonstrate that the cDNA encodes an {alpha}(1,2)FT, the COOH-terminal domain predicted to be Golgi-resident was expressed in COS-1 cells as a catalytically active, secreted, and soluble protein A fusion peptide. Southern blot analysis showed that this cDNA identified DNA sequences syntenic to the human H locus on chromosome 19. These results strongly suggest that this cloned {alpha}(1,2)FT cDNA represents the product of the human H blood group locus.

  20. Ambivalent incorporation of the fluorescent cytosine analogues tC and tCo by human DNA polymerase alpha and Klenow fragment.

    PubMed

    Stengel, Gudrun; Purse, Byron W; Wilhelmsson, L Marcus; Urban, Milan; Kuchta, Robert D

    2009-08-11

    We studied the incorporation of the fluorescent cytidine analogues 1,3-diaza-2-oxophenothiazine (tC) and 1,3-diaza-2-oxophenoxazine (tCo) by human DNA polymerase alpha and Klenow fragment of DNA polymerase I (Escherichia coli). These tricyclic nucleobases possess the regular hydrogen bonding interface of cytosine but are significantly expanded in size toward the major groove. Despite the size alteration, both DNA polymerases insert dtCTP and dtCoTP with remarkable catalytic efficiency. Polymerization opposite guanine is comparable to the insertion of dCTP, while the insertion opposite adenine is only approximately 4-11 times less efficient than the formation of a T-A base pair. Both enzymes readily extend the formed tC(o)-G and tC(o)-A base pairs and can incorporate at least four consecutive nucleotide analogues. Consistent with these results, both DNA polymerases efficiently polymerize dGTP and dATP when tC and tCo are in the template strand. Klenow fragment inserts dGTP with a 4-9-fold higher probability than dATP, while polymerase alpha favors dGTP over dATP by a factor of 30-65. Overall, the properties of tC(o) as a templating base and as an incoming nucleotide are surprisingly symmetrical and may be universal for A and B family DNA polymerases. This finding suggests that the aptitude for ambivalent base pairing is a consequence of the electronic properties of tC(o). PMID:19580325

  1. Molecular studies on two variant repeat types of the common cetacean DNA satellite of the sperm whale, and the relationship between Physeteridae (sperm whales) and Ziphiidae (beaked whales).

    PubMed

    Grétarsdóttir, S; Arnason, U

    1993-03-01

    In the sperm whale (Physeter macrocephalus) two different repeat types (A and B) of the common cetacean DNA satellite were identified. The evolution of each group of repeats appears to be independent from that of the other. The sequence similarity between the two groups is less than the similarity between group A and repeats of the satellite in related whale species. The systematic relationship within and between the families Physeteridae (sperm whales) and Ziphiidae (beaked whales) was addressed by both sequence analysis of the satellite and comparisons with the families Delphinidae and Phocoenidae. The mysticete blue whale (Balaenoptera musculus) was used as an outgroup in the comparisons. The molecular phylogeny, when maximum-parsimony analysis and the neighbor-joining method were used, grouped together species of each family. At the family level the ziphiids grouped closet to the families Phocoenidae and Delphinidae. The similarities between the common cetacean satellite of the blue whale and the sperm whale were greater than those between the blue whale and the other odontocetes included, suggesting that the evolution of the satellite is slower in the sperm whale than in the other odontocetes.

  2. Protein and DNA elements involved in transactivation of the promoter of the bovine herpesvirus (BHV) 1 IE-1 transcription unit by the BHV alpha gene trans-inducing factor.

    PubMed Central

    Misra, V; Bratanich, A C; Carpenter, D; O'Hare, P

    1994-01-01

    In herpes simplex virus (HSV)-infected cells, the transcription of immediate-early (alpha) genes is regulated by a virion component, the alpha gene trans-inducing factor (alpha TIF). This protein forms a complex with cellular factors and TAATGARAT motifs present in one or more copies in the promoters of all alpha genes. We have characterized the bovine herpesvirus 1 (BHV-1) homolog of this protein. Like its HSV counterpart, the BHV alpha TIF was synthesized in the later stages of infection and could be demonstrated to be a component of purified virions. In transient expression assays, BHV alpha TIF was a strong transactivator and stimulated the activity of IE-1, the major BHV-1 alpha gene promoter, with an efficiency comparable to that of HSV alpha TIF. This stimulation was largely dependent on a TAATGAGCT sequence present in a single copy in IE-1, and BHV alpha TIF, in conjunction with cellular factors, formed a complex with oligonucleotides containing this sequence. Despite these similarities between the two alpha TIFs, our preliminary observations suggest that the proteins may activate transcription by different mechanisms. Although BHV alpha TIF strongly transactivated IE-1, it differed from its HSV counterpart in that the carboxyl terminus of BHV alpha TIF, when fused to the DNA-binding domain of GAL4, was a relatively poor stimulator of a promoter containing GAL4-binding sites. Also unlike HSV alpha TIF, removal of the carboxyl terminus of BHV alpha TIF reduced but did not eliminate the ability of the protein to transactivate IE-1. These results are discussed in view of the structural similarities and differences among the alpha TIFs of alphaherpes-viruses. Images PMID:8035488

  3. Exploring the diversity of plant DNA viruses and their satellites using vector-enabled metagenomics on whiteflies.

    PubMed

    Ng, Terry Fei Fan; Duffy, Siobain; Polston, Jane E; Bixby, Elise; Vallad, Gary E; Breitbart, Mya

    2011-04-22

    Current knowledge of plant virus diversity is biased towards agents of visible and economically important diseases. Less is known about viruses that have not caused major diseases in crops, or viruses from native vegetation, which are a reservoir of biodiversity that can contribute to viral emergence. Discovery of these plant viruses is hindered by the traditional approach of sampling individual symptomatic plants. Since many damaging plant viruses are transmitted by insect vectors, we have developed "vector-enabled metagenomics" (VEM) to investigate the diversity of plant viruses. VEM involves sampling of insect vectors (in this case, whiteflies) from plants, followed by purification of viral particles and metagenomic sequencing. The VEM approach exploits the natural ability of highly mobile adult whiteflies to integrate viruses from many plants over time and space, and leverages the capability of metagenomics for discovering novel viruses. This study utilized VEM to describe the DNA viral community from whiteflies (Bemisia tabaci) collected from two important agricultural regions in Florida, USA. VEM successfully characterized the active and abundant viruses that produce disease symptoms in crops, as well as the less abundant viruses infecting adjacent native vegetation. PCR assays designed from the metagenomic sequences enabled the complete sequencing of four novel begomovirus genome components, as well as the first discovery of plant virus satellites in North America. One of the novel begomoviruses was subsequently identified in symptomatic Chenopodium ambrosiodes from the same field site, validating VEM as an effective method for proactive monitoring of plant viruses without a priori knowledge of the pathogens. This study demonstrates the power of VEM for describing the circulating viral community in a given region, which will enhance our understanding of plant viral diversity, and facilitate emerging plant virus surveillance and management of viral diseases.

  4. Exploring the Diversity of Plant DNA Viruses and Their Satellites Using Vector-Enabled Metagenomics on Whiteflies

    PubMed Central

    Ng, Terry Fei Fan; Duffy, Siobain; Polston, Jane E.; Bixby, Elise; Vallad, Gary E.; Breitbart, Mya

    2011-01-01

    Current knowledge of plant virus diversity is biased towards agents of visible and economically important diseases. Less is known about viruses that have not caused major diseases in crops, or viruses from native vegetation, which are a reservoir of biodiversity that can contribute to viral emergence. Discovery of these plant viruses is hindered by the traditional approach of sampling individual symptomatic plants. Since many damaging plant viruses are transmitted by insect vectors, we have developed “vector-enabled metagenomics” (VEM) to investigate the diversity of plant viruses. VEM involves sampling of insect vectors (in this case, whiteflies) from plants, followed by purification of viral particles and metagenomic sequencing. The VEM approach exploits the natural ability of highly mobile adult whiteflies to integrate viruses from many plants over time and space, and leverages the capability of metagenomics for discovering novel viruses. This study utilized VEM to describe the DNA viral community from whiteflies (Bemisia tabaci) collected from two important agricultural regions in Florida, USA. VEM successfully characterized the active and abundant viruses that produce disease symptoms in crops, as well as the less abundant viruses infecting adjacent native vegetation. PCR assays designed from the metagenomic sequences enabled the complete sequencing of four novel begomovirus genome components, as well as the first discovery of plant virus satellites in North America. One of the novel begomoviruses was subsequently identified in symptomatic Chenopodium ambrosiodes from the same field site, validating VEM as an effective method for proactive monitoring of plant viruses without a priori knowledge of the pathogens. This study demonstrates the power of VEM for describing the circulating viral community in a given region, which will enhance our understanding of plant viral diversity, and facilitate emerging plant virus surveillance and management of viral

  5. Phage P4 alpha protein is multifunctional with origin recognition, helicase and primase activities.

    PubMed Central

    Ziegelin, G; Scherzinger, E; Lurz, R; Lanka, E

    1993-01-01

    alpha Protein of satellite phage P4 of Escherichia coli is multifunctional in P4 replication with three activities. First, the protein (subunit M(r) = 84,900) complexes specifically the P4 origin and the cis replication region required for replication. alpha Protein interacts with all six type I repeats (TGTTCACC) present in the origin. Second, associated with the alpha protein is a DNA helicase activity that is fueled by hydrolysis of a nucleoside 5' triphosphate. All common NTPs except UTP and dTTP can serve as cofactors. Strand separation of partial duplexes containing tailed ends that resemble a replication fork is preferred, although a preformed fork is not absolutely required for the enzyme to invade and unwind duplex DNA. alpha Protein catalyzes unwinding in the 3'-5' direction with respect to the strand it has bound. Finally, the primase activity already demonstrated for alpha protein is due to synthesis of RNA primers. In vitro, alpha protein generates di- to pentaribonucleotides on single-stranded phage fd DNA. The predominant product is the dimer pppApG, on which most of the longer oligoribonucleotides are based. Using DNA oligonucleotides of defined sequence as templates, synthesis of pppApG was also detectable. To date, among prokaryotic and eukaryotic replication systems, gp alpha is the only protein known that combines three activities on one single polypeptide chain. Images PMID:8253092

  6. Characterization and chromosomal assignment of a human cDNA encoding a protein related to the murine 102-kDa cadherin-associated protein ([alpha]-catenin)

    SciTech Connect

    Claverie, J.M. ); Hardelin, J.P.; Legouis, R.; Levilliers, J.; Petit, C. ); Bougueleret, L. ); Mattei, M.G. )

    1993-01-01

    We report the characterization of a human cDNA encompassing the complete coding region of a 945-residue putative protein (CAP-R) 80% identical to the recently described murine 102-kDa [alpha]-catenin (CAP102). The CAP-R protein mostly differs from CAP102 by the presence of a 48-residue insert. This insert exhibits similarity with a segment of the type 1 neurofibromatosis gene product. The analysis of a publicly available human [open quote]expressed sequence tag[close quotes] collection revealed the existence of another human cDNA more closely related (89% identical) to CAP 102. This strongly suggests that CAP-R is not the human homologue of the murine 102- kDa [alpha]-catenin but a new closely related gene of the vinculin family. This is further supported by the computed mutation rates falling outside the range observed for mammalian orthologous genes. Using in situ hybridization, the CAP-R gene could be mapped to the pll.l-pl2 region of human chromosome 2 and to the homologous B3-D region of mouse chromosome 6. 32 refs., 4 fig.

  7. Survival and DNA damage in Chinese hamster V79 cells exposed to alpha particles emitted by DNA-incorporated astatine-211.

    PubMed

    Walicka, M A; Vaidyanathan, G; Zalutsky, M R; Adelstein, S J; Kassis, A I

    1998-09-01

    Asynchronous Chinese hamster V79 lung fibroblasts were incubated at 37 degrees C for 30 min with the thymidine analog 5-[211At]astato-2'-deoxyuridine (211AtdU, exposure from DNA-incorporated activity) or with [211At]astatide (211At-, exposure from extracellular activity), and DNA-incorporated activity was determined. The 211AtdU content in cellular DNA increased as a function of extracellular concentration. Incorporation of 211At- was less than 1% of that of 211AtdU. After exposure, cells were frozen in the presence of 10% DMSO. One month later, survival was determined by the colony-forming assay, and DNA double-strand breaks (DSBs) were measured by the neutral elution method (pH 9.6). The survival curve for 211AtdU was biphasic (D37 = 2.8 decays per cell), reflecting killing of 211At-DNA-labeled cells and of unlabeled cells irradiated by 211At in neighboring labeled cells. The toxicity of 211At- decaying outside the cell (30-min exposure) was negligible. Analysis of the survival curve produced a D0 of 1.3 decays/cell for 211At-labeled cells. The yield of DSBs from the decay of DNA-incorporated 211At was compared with that from DNA-incorporated 125I. Each decay of 211At produced at least 10 times the number of DSBs as that obtained per 125I decay. The extreme radiotoxicity of DNA-incorporated 211AtdU seems to be associated with considerable damage to the mammalian cell genome.

  8. Development of a VIGS vector based on the β-satellite DNA associated with bhendi yellow vein mosaic virus.

    PubMed

    Jeyabharathy, C; Shakila, H; Usha, R

    2015-01-01

    Bhendi yellow vein mosaic virus (BYMV) is a monopartite begomovirus with an associated β-satellite. βC1 ORF encoded by the β-satellite is the symptom determinant and a strong suppressor of post transcriptional gene silencing. To create a virus induced gene silencing vector based upon the β-satellite associated with BYVMV the βC1 ORF was replaced with multiple cloning sites. GFP transgene and plant endogenous genes Su, PDS, PCNA and AGO1 were cloned into β-satellite based VIGS vector. GFP expression was silenced in the GFP expressing transgenic 16c Nicotiana benthamiana plants infiltrated with VIGS vector carrying GFP gene inside. N. benthamiana plants infiltrated with the VIGS vector harboring the endogenous genes Su, PDS, PCNA and AGO1 produced the phenotypic symptoms yellowing of the veins, photobleaching of the veins, stunting of the plant and upward leaf curling, respectively. Real time PCR analyses revealed a reduction in the levels of the corresponding transgene or endogenous target mRNA. The β-satellite based VIGS vector was able to silence the target genes effectively. Hence, BYVMV β-satellite based VIGS vector can be used in functional genomics studies.

  9. Reevaluation of the evolutionary position of opalinids based on 18S rDNA, and alpha- and beta-tubulin gene phylogenies.

    PubMed

    Nishi, Akane; Ishida, Ken-ichiro; Endoh, Hiroshi

    2005-06-01

    Opalinids are enigmatic endosymbiotic protists principally found in the large intestine of anuran amphibians. They are multinucleates and uniformly covered with numerous flagella (or cilia). Their appearance is somewhat similar to that of ciliates, leading to opalinid's initial classification as ciliates, or later as protociliates. However, on the basis of their monomorphic nuclei, absence of a ciliate-like life cycle characterized by conjugation, and an interkinetal fission mode, opalinids were subsequently transferred in the zooflagellates. As several common ultrastructural characteristics shared with proteromonads were elucidated, in particular of the flagellar base, such as their double-stranded flagellar helix, an alliance with proteromonads was widely accepted. Thus, opalinids are currently favored to be placed in the class Opalinea, within the heterokont kingdom Chromista. However, the question of their classification has not been fully resolved, because of a lack of molecular information. Here, we report their phylogenetic position inferred from 18S rDNA, and alpha- and beta-tubulin gene sequences. The 18S rDNA tree gives the opalinids an ancestral position in heterokonts, together with proteromonads, as suggested by the morphological studies. In great contrast, alpha- and beta-tubulin gene analyses suggest an affiliation of opalinids to alveolates, not to heterokonts. However, the AU test implies that opalinids are not closely related with any of other three phyla in the alveolates, suggesting an occupation of an ancestral position within the alveolates. Based on the present molecular information, in particular rDNA phylogeny, and the ultrastructural character of the double helix common to heterokonts, we conclude that opalinids would have a common origin with heterokonts, although analyses based on two tubulin genes do not as yet completely deny a possible placement outside heterokonts. The ambiguity of the evolutionary position shown by the discrepancy

  10. [Molecular cloning and primary structure of cDNA fragment for alpha-latrocrustatoxin from black widow spider venom].

    PubMed

    Volynskiĭ, K E; Volkova, T M; Galkina, T G; Krasnoperov, V G; Pluzhnikov, K A; Khvoshchev, M V; Grishin, E V

    1999-01-01

    A fragment of the structural gene of alpha-latrocrustotoxin, a new representative of latrotoxins from black widow spider venom, was cloned. The fragment (1191 bp) was obtained by means of PCR based on the data obtained by sequencing tryptic peptides of the toxin. The fragment codes for a 397-aa sequence. The encoded polypeptide is the C-terminal fragment of the toxin central domain that presumably contains a site responsible for the toxin species specificity. The structural similarity of this fragment to the corresponding fragments of other latrotoxins was studied.

  11. Determination of a new collagen type I alpha 2 gene point mutation which causes a Gly640 Cys substitution in osteogenesis imperfecta and prenatal diagnosis by DNA hybridisation.

    PubMed Central

    Gomez-Lira, M; Sangalli, A; Pignatti, P F; Digilio, M C; Giannotti, A; Carnevale, E; Mottes, M

    1994-01-01

    The molecular defect responsible for a sporadic case of extremely severe (type II/III) osteogenesis imperfecta was investigated. The mutation site was localised in the collagen type I pro alpha 2 mRNA molecules produced by the proband's skin fibroblasts by chemical cleavage of mismatch in heteroduplex nucleic acids. Reverse transcription-polymerase chain reaction DNA amplification, followed by cloning and sequencing, showed heterozygosity for a G to T transversion in the first nucleotide of exon 37 of the COL1A2 gene, which led to a cysteine for glycine substitution at position 640 of the triple helical domain. This newly characterised mutation is localised in a domain which contains several milder mutations, confirming that glycine substitutions within the alpha 2(I) chain do not follow a linear gradient pattern for genotype to phenotype correlations. In a subsequent pregnancy, absence of the G2327T mutation in the fetus was shown by allele specific oligonucleotide hybridisation to the trophoblast derived fibroblast mRNA after reverse transcription and in vitro amplification. (The nucleotide number assigned to the mutant base was inferred from the numbering system devised by the Osteogenesis Imperfecta Analysis Consortium (The OIAC Newsletter, 1 April 1994).) Images PMID:7891382

  12. Relationship between maternal environment and DNA methylation patterns of estrogen receptor alpha in wild Eastern Bluebird (Sialia sialis) nestlings: a pilot study.

    PubMed

    Bentz, Alexandra B; Sirman, Aubrey E; Wada, Haruka; Navara, Kristen J; Hood, Wendy R

    2016-07-01

    There is mounting evidence that, across taxa, females breeding in competitive environments tend to allocate more testosterone to their offspring prenatally and these offspring typically have more aggressive and faster-growing phenotypes. To date, no study has determined the mechanisms mediating this maternal effect's influence on offspring phenotype. However, levels of estrogen receptor alpha (ER α) gene expression are linked to differences in early growth and aggression; thus, maternal hormones may alter gene regulation, perhaps via DNA methylation, of ER α in offspring during prenatal development. We performed a pilot study to examine natural variation in testosterone allocation to offspring through egg yolks in wild Eastern Bluebirds (Sialia sialis) in varying breeding densities and percent DNA methylation of CG dinucleotides in the ER α promoter in offspring brain regions associated with growth and behavior. We hypothesized that breeding density would be positively correlated with yolk testosterone, and prenatal exposure to maternal-derived yolk testosterone would be associated with greater offspring growth and decreased ER α promoter methylation. Yolk testosterone concentration was positively correlated with breeding density, nestling growth rate, and percent DNA methylation of one out of five investigated CpG sites (site 3) in the diencephalon ER α promoter, but none in the telencephalon (n = 10). Percent DNA methylation of diencephalon CpG site 3 was positively correlated with growth rate. These data suggest a possible role for epigenetics in mediating the effects of the maternal environment on offspring phenotype. Experimentally examining this mechanism with a larger sample size in future studies may help elucidate a prominent way in which animals respond to their environment. Further, by determining the mechanisms that mediate maternal effects, we can begin to understand the potential for the heritability of these mechanisms and the impact that

  13. In vitro inhibition of promyelocytic leukemia/retinoic acid receptor-alpha (PML/RARalpha) expression and leukemogenic activity by DNA/LNA chimeric antisense oligos.

    PubMed

    Caprodossi, Sara; Galluzzi, Luca; Biagetti, Simona; Della Chiara, Giulia; Pelicci, Pier Giuseppe; Magnani, Mauro; Fanelli, Mirco

    2005-01-01

    Acute promyelocytic leukemia (APL) is a subtype of myeloid leukemia characterized by the chromosomal translocation t(15:17) that leads to the expression of promyelocytic leukemia/retinoic acid receptor-alpha (PML/ RARalpha) oncofusion protein. The block of differentiation at the promyelocytic stage of the blasts and their increased survival induced by PML/RARalpha are the principal biological features of the disease. Therapies based on pharmacological doses of retinoic acid (RA, 10(-6) M) are able to restore APL cell differentiation in most cases, but not to achieve complete hematological remission because retinoic acid resistance occurs in many patients. In order to elaborate alternative therapeutic approaches, we focused our attention on the use of antisense oligonucleotides as gene-specific drug directed to PML/RARalpha mRNA target. We used antisense molecules containing multiple locked nucleic acid (LNA) modifications. The LNAs are nucleotide analogues that are able to form duplexes with complementary DNA or RNA sequences with highly increased thermal stability and are resistant to 3'-exonuclease degradation in vitro. The DNA/LNA chimeric molecules were designed on the fusion sequence of PML and RARalpha genes to specifically target the oncofusion protein. Cell-free and in vitro experiments using U937-PR9-inducible cell line showed that DNA/LNA oligonucleotides were able to interfere with PML/RARalpha expression more efficiently than the corresponding unmodified DNA oligo. Moreover, the treatment of U937-PR9 cells with these chimeric antisense molecules was able to abrogate the block of differentiation induced by PML/RARalpha oncoprotein. These data suggest a possible application of oligonucleotides containing LNA in an antisense therapeutic strategy for APL.

  14. Relationship between maternal environment and DNA methylation patterns of estrogen receptor alpha in wild Eastern Bluebird (Sialia sialis) nestlings: a pilot study.

    PubMed

    Bentz, Alexandra B; Sirman, Aubrey E; Wada, Haruka; Navara, Kristen J; Hood, Wendy R

    2016-07-01

    There is mounting evidence that, across taxa, females breeding in competitive environments tend to allocate more testosterone to their offspring prenatally and these offspring typically have more aggressive and faster-growing phenotypes. To date, no study has determined the mechanisms mediating this maternal effect's influence on offspring phenotype. However, levels of estrogen receptor alpha (ER α) gene expression are linked to differences in early growth and aggression; thus, maternal hormones may alter gene regulation, perhaps via DNA methylation, of ER α in offspring during prenatal development. We performed a pilot study to examine natural variation in testosterone allocation to offspring through egg yolks in wild Eastern Bluebirds (Sialia sialis) in varying breeding densities and percent DNA methylation of CG dinucleotides in the ER α promoter in offspring brain regions associated with growth and behavior. We hypothesized that breeding density would be positively correlated with yolk testosterone, and prenatal exposure to maternal-derived yolk testosterone would be associated with greater offspring growth and decreased ER α promoter methylation. Yolk testosterone concentration was positively correlated with breeding density, nestling growth rate, and percent DNA methylation of one out of five investigated CpG sites (site 3) in the diencephalon ER α promoter, but none in the telencephalon (n = 10). Percent DNA methylation of diencephalon CpG site 3 was positively correlated with growth rate. These data suggest a possible role for epigenetics in mediating the effects of the maternal environment on offspring phenotype. Experimentally examining this mechanism with a larger sample size in future studies may help elucidate a prominent way in which animals respond to their environment. Further, by determining the mechanisms that mediate maternal effects, we can begin to understand the potential for the heritability of these mechanisms and the impact that

  15. Molecular cloning and characterization of satellite DNA sequences from constitutive heterochromatin of the habu snake (Protobothrops flavoviridis, Viperidae) and the Burmese python (Python bivittatus, Pythonidae).

    PubMed

    Matsubara, Kazumi; Uno, Yoshinobu; Srikulnath, Kornsorn; Seki, Risako; Nishida, Chizuko; Matsuda, Yoichi

    2015-12-01

    Highly repetitive DNA sequences of the centromeric heterochromatin provide valuable molecular cytogenetic markers for the investigation of genomic compartmentalization in the macrochromosomes and microchromosomes of sauropsids. Here, the relationship between centromeric heterochromatin and karyotype evolution was examined using cloned repetitive DNA sequences from two snake species, the habu snake (Protobothrops flavoviridis, Crotalinae, Viperidae) and Burmese python (Python bivittatus, Pythonidae). Three satellite DNA (stDNA) families were isolated from the heterochromatin of these snakes: 168-bp PFL-MspI from P. flavoviridis and 196-bp PBI-DdeI and 174-bp PBI-MspI from P. bivittatus. The PFL-MspI and PBI-DdeI sequences were localized to the centromeric regions of most chromosomes in the respective species, suggesting that the two sequences were the major components of the centromeric heterochromatin in these organisms. The PBI-MspI sequence was localized to the pericentromeric region of four chromosome pairs. The PFL-MspI and the PBI-DdeI sequences were conserved only in the genome of closely related species, Gloydius blomhoffii (Crotalinae) and Python molurus, respectively, although their locations on the chromosomes were slightly different. In contrast, the PBI-MspI sequence was also in the genomes of P. molurus and Boa constrictor (Boidae), and additionally localized to the centromeric regions of eight chromosome pairs in B. constrictor, suggesting that this sequence originated in the genome of a common ancestor of Pythonidae and Boidae, approximately 86 million years ago. The three stDNA sequences showed no genomic compartmentalization between the macrochromosomes and microchromosomes, suggesting that homogenization of the centromeric and/or pericentromeric stDNA sequences occurred in the macrochromosomes and microchromosomes of these snakes.

  16. Phylogenetic footprinting of non-coding RNA: hammerhead ribozyme sequences in a satellite DNA family of Dolichopoda cave crickets (Orthoptera, Rhaphidophoridae)

    PubMed Central

    2010-01-01

    Background The great variety in sequence, length, complexity, and abundance of satellite DNA has made it difficult to ascribe any function to this genome component. Recent studies have shown that satellite DNA can be transcribed and be involved in regulation of chromatin structure and gene expression. Some satellite DNAs, such as the pDo500 sequence family in Dolichopoda cave crickets, have a catalytic hammerhead (HH) ribozyme structure and activity embedded within each repeat. Results We assessed the phylogenetic footprints of the HH ribozyme within the pDo500 sequences from 38 different populations representing 12 species of Dolichopoda. The HH region was significantly more conserved than the non-hammerhead (NHH) region of the pDo500 repeat. In addition, stems were more conserved than loops. In stems, several compensatory mutations were detected that maintain base pairing. The core region of the HH ribozyme was affected by very few nucleotide substitutions and the cleavage position was altered only once among 198 sequences. RNA folding of the HH sequences revealed that a potentially active HH ribozyme can be found in most of the Dolichopoda populations and species. Conclusions The phylogenetic footprints suggest that the HH region of the pDo500 sequence family is selected for function in Dolichopoda cave crickets. However, the functional role of HH ribozymes in eukaryotic organisms is unclear. The possible functions have been related to trans cleavage of an RNA target by a ribonucleoprotein and regulation of gene expression. Whether the HH ribozyme in Dolichopoda is involved in similar functions remains to be investigated. Future studies need to demonstrate how the observed nucleotide changes and evolutionary constraint have affected the catalytic efficiency of the hammerhead. PMID:20047671

  17. Hypoxia-inducible factor 1 mediates hypoxia-induced cardiomyocyte lipid accumulation by reducing the DNA binding activity of peroxisome proliferator-activated receptor {alpha}/retinoid X receptor

    SciTech Connect

    Belanger, Adam J.; Luo Zhengyu; Vincent, Karen A.; Akita, Geoffrey Y.; Cheng, Seng H.; Gregory, Richard J.; Jiang Canwen

    2007-12-21

    In response to cellular hypoxia, cardiomyocytes adapt to consume less oxygen by shifting ATP production from mitochondrial fatty acid {beta}-oxidation to glycolysis. The transcriptional activation of glucose transporters and glycolytic enzymes by hypoxia is mediated by hypoxia-inducible factor 1 (HIF-1). In this study, we examined whether HIF-1 was involved in the suppression of mitochondrial fatty acid {beta}-oxidation in hypoxic cardiomyocytes. We showed that either hypoxia or adenovirus-mediated expression of a constitutively stable hybrid form (HIF-1{alpha}/VP16) suppressed mitochondrial fatty acid metabolism, as indicated by an accumulation of intracellular neutral lipid. Both treatments also reduced the mRNA levels of muscle carnitine palmitoyltransferase I which catalyzes the rate-limiting step in the mitochondrial import of fatty acids for {beta}-oxidation. Furthermore, adenovirus-mediated expression of HIF-1{alpha}/VP16 in cardiomyocytes under normoxic conditions also mimicked the reduction in the DNA binding activity of peroxisome proliferator-activated receptor {alpha} (PPAR{alpha})/retinoid X receptor (RXR), in the presence or absence of a PPAR{alpha} ligand. These results suggest that HIF-1 may be involved in hypoxia-induced suppression of fatty acid metabolism in cardiomyocytes by reducing the DNA binding activity of PPAR{alpha}/RXR.

  18. The human papillomavirus18 E7 protein inhibits CENP-C binding to α-satellite DNA.

    PubMed

    Yaginuma, Yuji; Yoshimoto, Masafumi; Eguchi, Ayami; Tokuda, Aoi; Takahashi, Shoko

    2015-07-01

    Human papillomavirus (HPV) infection leads to aneuploidy, a numerical chromosomal aberration that is caused by dysregulation of chromosomal segregation. We previously found that the E7 proteins of high-risk HPVs, but not of low-risk HPVs, could bind to centromere protein-C (CENP-C). In this study, we first found that CENP-C could bind centromere α-satellite DNAs using ChIP analysis and HA-tagged CENP-C/nuc transfected 293T cells. We then investigated if HA-CENP-C/nuc binding to α-satellite DNAs was affected by the E7 proteins of high- or low-risk HPVs. We found that transfection of the FLAG tagged HPV18 E7 inhibited the binding of HA-CENP-C/nuc to α-satellite DNAs. This finding was confirmed in HeLa S3 cells transfected with siRNA targeted to HPV18 E7 expression. We therefore speculate that altered function of kinetochores as a result of inhibition of CENP-C and α-satellite DNAs binding may be associated with the chromosomal abnormalities observed in HPV18-positive cancers.

  19. Glutamate regulates Oct-2 DNA-binding activity through alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate receptors in cultured chick Bergmann glia cells.

    PubMed

    Méndez, J Alfredo; López-Bayghen, Esther; Rojas, Fausto; Hernández, María Elena; Ortega, Arturo

    2004-02-01

    Ionotropic glutamate receptors in cerebellar Bergmann glial cells are linked to transcriptional regulation and, by these means, are thought to play an important role in plasticity, learning and memory and in several neuropathologies. Within the CNS, the transcription factors of the POU family bind their target DNA sequences after a growth factor-dependent phosphorylation-dephosphorylation cascade. Exposure of cultured Bergmann glial cells to glutamate leads to a time- and dose-dependent increase in Oct-2 DNA-binding activity. The use of specific pharmacological tools established the involvement of Ca2+-permeable alpha-amino-3-hydroxy-5-methylisoxazole-4-propionate receptors. Furthermore, the signaling cascade includes phosphatidyl inositol 3-kinase as well as protein kinase C activation. Interestingly, transcriptional as well as translational inhibitors abolish the glutamate effect, suggesting a transcriptional up-regulation of the oct-2 gene. These data demonstrate that Oct-2 expression is not restricted to neurons and further strengthen the notion that the glial glutamate receptors participate in the modulation of glutamatergic cerebellar neurotransmission.

  20. Tumor necrosis factor alpha represses bone morphogenetic protein (BMP) signaling by interfering with the DNA binding of Smads through the activation of NF-kappaB.

    PubMed

    Yamazaki, Masato; Fukushima, Hidefumi; Shin, Masashi; Katagiri, Takenobu; Doi, Takahiro; Takahashi, Tetsu; Jimi, Eijiro

    2009-12-18

    Bone morphogenetic proteins (BMPs) induce not only bone formation in vivo but also osteoblast differentiation of mesenchymal cells in vitro. Tumor necrosis factor alpha (TNFalpha) inhibits both osteoblast differentiation and bone formation induced by BMPs. However, the molecular mechanisms of these inhibitions remain unknown. In this study, we found that TNFalpha inhibited the alkaline phosphatase activity and markedly reduced BMP2- and Smad-induced reporter activity in MC3T3-E1 cells. TNFalpha had no effect on the phosphorylation of Smad1, Smad5, and Smad8 or on the nuclear translocation of the Smad1-Smad4 complex. In p65-deficient mouse embryonic fibroblasts, overexpression of p65, a subunit of NF-kappaB, inhibited BMP2- and Smad-induced reporter activity in a dose-dependent manner. Furthermore, this p65-mediated inhibition of BMP2- and Smad-responsive promoter activity was restored after inhibition of NF-kappaB by the overexpression of the dominant negative IkappaBalpha. Although TNFalpha failed to affect receptor-dependent formation of the Smad1-Smad4 complex, p65 associated with the complex. Chromatin immunoprecipitation and electrophoresis mobility shift assays revealed that TNFalpha suppressed the DNA binding of Smad proteins to the target gene. Importantly, the specific NF-kappaB inhibitor, BAY11-7082, abolished these phenomena. These results suggest that TNFalpha inhibits BMP signaling by interfering with the DNA binding of Smads through the activation of NF-kappaB.

  1. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  2. On the importance of satellite lines to the He-like alpha complex and the G ration for calcium, iron, and nickel

    SciTech Connect

    Oelgoetz, Justin R; Fontes, Christopher J; Zhang, Hong L; Nahar, Sultana N; Pradhan, Anil K

    2008-01-01

    New, more detailed calculations of the emission spectra of the He-like Ko complex of calcium, iron and nickel have been carried out using data from both distorted-wave and R-matrix calculations. The value of the GD ratio (a corrected version of the G ratio that accounts for the effect of unresolved satellite lines) is significantly enhanced at temperatures below the temperature of He-like maximum abundance. Furthermore it is shown that satellite lines are important contributors to the G D ratio at temperatures well above the temperature of maximum abundance. These new calculations demonstrate that satellite lines need to be included in models of He-like Ko spectra even at relatively high temperatures. The excellent agreement between spectra and line ratios calculated from R-matrix and distorted-wave data also confirms the validity of models based on distorted-wave data for highly charged systems, provided the effect of resonances are taken into account as independent processes.

  3. A naturally occurring defective DNA satellite associated with a monopartite begomovirus: evidence for recombination between alphasatellite and betasatellite.

    PubMed

    Huang, Changjun; Xie, Yan; Zhao, Liling; Ren, He; Li, Zhenghe

    2013-09-01

    Monopartite begomoviruses and their associated satellites form unique disease complexes that have emerged as a serious threat to agriculture worldwide. It is well known that frequent recombination contributes to the diversification and evolution of geminiviruses. In this study, we identified a novel defective satellite molecule (RecSat) in association with Tobacco leaf curl Yunnan virus (TbLCYNV) in a naturally infected tobacco plant. Sequence analysis showed that Recsat comprises 754 nucleotides in size and is a chimera involving alphasatellite and betasatellite sequences, containing both betasatellite-conserved region and alphasatellite stem-loop structure. Recombination analysis revealed that RecSat has arisen from three independent recombination events likely involving Tomato yellow leaf curl China betasatellite, Ageratum yellow vein China betasatellite and Tobacco curly shoot alphasatellite. Co-inoculation of RecSat with TbLCYNV induced symptoms indistinguishable from those induced by TbLCYNV alone in Nicotiana benthamiana. Southern blot hybridization showed that RecSat could be trans-replicated stably in N. benthamiana plants by TbLCYNV, and impaired the accumulation of helper virus and co-inoculated alphasatellite. Our results provide the first evidence for recombination between two distinct types of satellites among geminivirus complex and highlight recombination as a driving force for geminivirus evolution. PMID:24018984

  4. alpha-dl-Difluoromethylornithine, a Specific, Irreversible Inhibitor of Putrescine Biosynthesis, Induces a Phenotype in Tobacco Similar to That Ascribed to the Root-Inducing, Left-Hand Transferred DNA of Agrobacterium rhizogenes.

    PubMed

    Burtin, D; Martin-Tanguy, J; Tepfer, D

    1991-02-01

    alpha-dl-Difluoromethylarginine (DFMA) and alpha-dl-difluoromethylornithine (DFMO), specific irreversible inhibitors of putrescine biosynthesis were applied to Nicotiana tabacum var. Xanthi nc during floral induction. DFMO, but not DFMA, induced a phenotype in tobacco that resembles the transformed phenotype attributed to the root-inducing, left-hand, transferred DNA of Agrobacterium rhizogenes, including wrinkled leaves, shortened internodes, reduced apical dominance, and retarded flowering. Similar treatment of transformed plants (T phenotype) accentuated their phenotypic abnormalities. Cyclohexylammonium and methylglyoxal bis (guanylhydrazone), inhibitors of spermidine and spermine biosynthesis, produced reproductive abnormalities, but did not clearly mimic the transformed phenotype. This work strengthens the previously reported correlation between the degree of expression of the transformed phenotype due to the root-inducing, left-hand, transferred DNA and inhibition of polyamine accumulation, strongly suggesting that genes carried by the root-inducing, transferred DNA may act through interference with polyamine production via the ornithine pathway.

  5. The origin and evolution of the variability in a Y-specific satellite-DNA of Rumex acetosa and its relatives.

    PubMed

    Navajas-Pérez, Rafael; Schwarzacher, Trude; de la Herrán, Roberto; Ruiz Rejón, Carmelo; Ruiz Rejón, Manuel; Garrido-Ramos, Manuel A

    2006-03-01

    In this paper, we analyze a satellite-DNA family, the RAYSI family, which is specific of the Y chromosomes of Rumex acetosa, a dioecious plant species with a multiple sex-chromosome system in which the females are XX and the males are XY(1)Y(2). Here, we demonstrate that this satellite DNA is common to other relatives of R. acetosa, including Rumex papillaris, Rumex intermedius, Rumex thyrsoides and Rumex tuberosus that are also dioecious species with a multiple system of sex chromosomes. This satellite-DNA family is absent from the genomes of other dioecious Rumex species having an XX/XY sex-chromosome system. Our data confirm recent molecular phylogenies that support a unique origin for all dioecious species of Rumex and two separate lineages for species with single or complex sex-chromosome systems. Our data also support an accelerated degeneration of Y-chromosome in XX/XY(1)Y(2) species by the accumulation of satellite-DNA sequences. On the other hand, the particular non-recombining nature of the Y chromosomes of R. acetosa and their closest relatives lead to a particular mode of evolution of RAYSI sequences. Thus, mechanisms leading to the suppression of recombination between the Y chromosomes reduced the rate of concerted evolution and gave rise to the apparition of different RAYSI subfamilies. Thus, R. acetosa and R. intermedius have two subfamilies (the RAYSI-S and RAYSI-J subfamilies and the INT-A and INT-B subfamilies, respectively), while R. papillaris only has one, the RAYSI-J subfamily. The RAYSI-S and RAYSI-J subfamilies of R. acetosa differ in 83 fixed diagnostic sites and several diagnostic deletions while the INT-A and the INT-B of R. intermedius differ in 27 fixed diagnostic sites. Pairwise comparisons between RAYSI-S and RAYSI-J sequences or between INT-A and INT-B sequences revealed these sites to be shared mutations detectable in repeats of the same variant in same positions. Evolutionary comparisons suggest that the subfamily RAYSI-J has

  6. Genome-wide analysis of tandem repeats in Tribolium castaneum genome reveals abundant and highly dynamic tandem repeat families with satellite DNA features in euchromatic chromosomal arms.

    PubMed

    Pavlek, Martina; Gelfand, Yevgeniy; Plohl, Miroslav; Meštrović, Nevenka

    2015-12-01

    Although satellite DNAs are well-explored components of heterochromatin and centromeres, little is known about emergence, dispersal and possible impact of comparably structured tandem repeats (TRs) on the genome-wide scale. Our bioinformatics analysis of assembled Tribolium castaneum genome disclosed significant contribution of TRs in euchromatic chromosomal arms and clear predominance of satellite DNA-typical 170 bp monomers in arrays of ≥5 repeats. By applying different experimental approaches, we revealed that the nine most prominent TR families Cast1-Cast9 extracted from the assembly comprise ∼4.3% of the entire genome and reside almost exclusively in euchromatic regions. Among them, seven families that build ∼3.9% of the genome are based on ∼170 and ∼340 bp long monomers. Results of phylogenetic analyses of 2500 monomers originating from these families show high-sequence dynamics, evident by extensive exchanges between arrays on non-homologous chromosomes. In addition, our analysis shows that concerted evolution acts more efficiently on longer than on shorter arrays. Efficient genome-wide distribution of nine TR families implies the role of transposition only in expansion of the most dispersed family, and involvement of other mechanisms is anticipated. Despite similarities in sequence features, FISH experiments indicate high-level compartmentalization of centromeric and euchromatic tandem repeats.

  7. Highly species-specific centromeric repetitive DNA sequences in lizards: molecular cytogenetic characterization of a novel family of satellite DNA sequences isolated from the water monitor lizard (Varanus salvator macromaculatus, Platynota).

    PubMed

    Chaiprasertsri, Nampech; Uno, Yoshinobu; Peyachoknagul, Surin; Prakhongcheep, Ornjira; Baicharoen, Sudarath; Charernsuk, Saranon; Nishida, Chizuko; Matsuda, Yoichi; Koga, Akihiko; Srikulnath, Kornsorn

    2013-01-01

    Two novel repetitive DNA sequences, VSAREP1 and VSAREP2, were isolated from the water monitor lizard (Varanus salvator macromaculatus, Platynota) and characterized using molecular cytogenetics. The respective lengths and guanine-cytosine (GC) contents of the sequences were 190 bp and 57.5% for VSAREP1 and 185 bp and 59.7% for VSAREP2, and both elements were tandemly arrayed as satellite DNA in the genome. VSAREP1 and VSAREP2 were each located at the C-positive heterochromatin in the pericentromeric region of chromosome 2q, the centromeric region of chromosome 5, and 3 pairs of microchromosomes. This suggests that genomic compartmentalization between macro- and microchromosomes might not have occurred in the centromeric repetitive sequences of V. salvator macromaculatus. These 2 sequences did only hybridize to genomic DNA of V. salvator macromaculatus, but no signal was observed even for other squamate reptiles, including Varanus exanthematicus, which is a closely related species of V. salvator macromaculatus. These results suggest that these sequences were differentiated rapidly or were specifically amplified in the V. salvator macromaculatus genome.

  8. Anacardic acid inhibits estrogen receptor alpha-DNA binding and reduces target gene transcription and breast cancer cell proliferation

    PubMed Central

    Schultz, David J.; Wickramasinghe, Nalinie S.; Ivanova, Margarita M.; Isaacs, Susan M.; Dougherty, Susan M.; Imbert-Fernandez, Yoannis; Cunningham, Albert R.; Chen, Chunyuan; Klinge, Carolyn M.

    2010-01-01

    Anacardic acid (2-hydroxy-6-alkylbenzoic acid) is a dietary and medicinal phytochemical with established anticancer activity in cell and animal models. The mechanisms by which anacardic acid inhibits cancer cell proliferation remain undefined. Anacardic acid 24:1ω5 (AnAc 24:1ω5) was purified from geranium (Pelargonium × hortorum) and shown to inhibit the proliferation of estrogen receptor α (ERα)-positive MCF-7 and endocrine-resistant LCC9 and LY2 breast cancer cells with greater efficacy than ERα-negative primary human breast epithelial cells, MCF-10A normal breast epithelial cells, and MDA-MB-231 basal-like breast cancer cells. AnAc 24:1ω5 inhibited cell cycle progression and induced apoptosis in a cell-specific manner. AnAc 24:1ω5 inhibited estradiol (E2)-induced estrogen response element (ERE) reporter activity and transcription of the endogenous E2-target genes: pS2, cyclin D1, and cathepsin D in MCF-7 cells. AnAc 24:1ω5 did not compete with E2 for ERα or ERβ binding, nor did AnAc 24:1ω5 reduce ERα or ERβ steady state protein levels in MCF-7 cells; rather, AnAc 24:1ω5 inhibited ER-ERE binding in vitro. Virtual Screening with the molecular docking software Surflex evaluated AnAc 24:1ω5 interaction with ERα ligand binding and DNA binding domains (LBD and DBD) in conjunction with experimental validation. Molecular modeling revealed AnAc 24:1ω5 interaction with the ERα DBD but not the LBD. Chromatin immunoprecipitation (ChIP) experiments revealed that AnAc 24:1ω5 inhibited E2-ERα interaction with the endogenous pS2 gene promoter region containing an ERE. These data indicate that AnAc 24:1ω5 inhibits cell proliferation, cell cycle progression and apoptosis in an ER-dependent manner by reducing ER-DNA interaction and inhibiting ER-mediated transcriptional responses. PMID:20197399

  9. Structural bases of dimerization of yeast telomere protein Cdc13 and its interaction with the catalytic subunit of DNA polymerase [alpha

    SciTech Connect

    Sun, Jia; Yang, Yuting; Wan, Ke; Mao, Ninghui; Yu, Tai-Yuan; Lin, Yi-Chien; DeZwaan, Diane C.; Freeman, Brian C.; Lin, Jing-Jer; Lue, Neal F.; Lei, Ming

    2011-08-24

    Budding yeast Cdc13-Stn1-Ten1 (CST) complex plays an essential role in telomere protection and maintenance, and has been proposed to be a telomere-specific replication protein A (RPA)-like complex. Previous genetic and structural studies revealed a close resemblance between Stn1-Ten1 and RPA32-RPA14. However, the relationship between Cdc13 and RPA70, the largest subunit of RPA, has remained unclear. Here, we report the crystal structure of the N-terminal OB (oligonucleotide/oligosaccharide binding) fold of Cdc13. Although Cdc13 has an RPA70-like domain organization, the structures of Cdc13 OB folds are significantly different from their counterparts in RPA70, suggesting that they have distinct evolutionary origins. Furthermore, our structural and biochemical analyses revealed unexpected dimerization by the N-terminal OB fold and showed that homodimerization is probably a conserved feature of all Cdc13 proteins. We also uncovered the structural basis of the interaction between the Cdc13 N-terminal OB fold and the catalytic subunit of DNA polymerase {alpha} (Pol1), and demonstrated a role for Cdc13 dimerization in Pol1 binding. Analysis of the phenotypes of mutants defective in Cdc13 dimerization and Cdc13-Pol1 interaction revealed multiple mechanisms by which dimerization regulates telomere lengths in vivo. Collectively, our findings provide novel insights into the mechanisms and evolution of Cdc13.

  10. Cloning and expression of a cDNA encoding a new neurocalcin isoform (neurocalcin alpha) from bovine brain.

    PubMed Central

    Kato, M; Watanabe, Y; Iino, S; Takaoka, Y; Kobayashi, S; Haga, T; Hidaka, H

    1998-01-01

    Neurocalcin (NC), a neuron-specific EF-hand Ca2+-binding protein, purified from bovine brain [Terasawa, Nakano, Kobayashi and Hidaka (1992) J. Biol. Chem. 267, 19596-19599] contains multiple isoforms. We previously cloned NCdelta from bovine brain and showed high expression in neuronal tissues [Okazaki, Watanabe, Ando, Hagiwara, Terasawa and Hidaka (1992) Biochem. Biophys. Res. Commun. 185, 147-153]. We report here the molecular cloning and expression of a cDNA encoding bovine brain NCalpha. The translated bovine protein is 191 amino acids long and shares 69.1% of its amino acid sequence with NCdelta. Recombinant NCalpha migrates as a single 23 kDa band and exhibits a Ca2+-dependent mobility shift on SDS/PAGE. Analysis of fluorescence emission spectra showed the Ca2+-induced peak at 337 nm. Interestingly, the mobility shift and the fluorescence intensity at 337 nm were larger for NCalpha than for NCdelta. In Ca2+-overlay experiments, however, the apparent affinity of NCalpha for 45Ca2+ was similar to that of NCdelta. Immunohistochemical analysis revealed NCalpha expression in the granular layer of the rat cerebellar cortex whereas NCdelta was found in the Purkinje cell layer. In the rat olfactory bulb, NCalpha was located in external tufted cells, and NCdelta was found in the periglomerular cells. These data demonstrate that NC isoforms differ in their tissue distribution and conformational changes induced by Ca2+ binding. Thus differential regulation of the two NC isoforms may be involved in control of neuron function. PMID:9560316

  11. Stable transfection of protein kinase C alpha cDNA in hormone-dependent breast cancer cell lines

    PubMed Central

    Tonetti, D A; Chisamore, M J; Grdina, W; Schurz, H; Jordan, V C

    2000-01-01

    An inverse relationship between protein kinase C (PKC) activity and oestrogen receptor (ER) expression in human breast cell lines and tumours has been firmly established over the past 10 years. To determine whether specific alterations in PKC expression accompany hormone-independence, we examined the expression of PKC isozymes in the hormone-independent human breast cancer cell clones MCF-7 5C and T47D:C42 compared with their hormone-dependent counterparts, MCF-7 A4, MCF-7 WS8 and T47D:A18 respectively. Both hormone-independent cell clones exhibit elevated PKCα expression and increased basal AP-1 activity compared with the hormone-dependent cell clones. To determine whether PKCα overexpression is sufficient to mediate the hormone-independent phenotype, we stably transfected an expression plasmid containing PKCα cDNA to the T47D:A18 and MCF-7 A4 cell lines. This is the first report of PKCα transfection in T47D cells. In contrast to MCF-7 cells, T47D has the propensity to lose the ER and more readily forms tamoxifen-stimulated tumours in athymic mice. We find that in T47D:A18/PKCα clones, there is concomitant up-regulation of PKC βI and δ, whereas in the MCF-7 A4/PKCα transfectants PKC ɛ is up-regulated. In T47D:A18, but not in MCF-7 A4, PKCα stable transfection is accompanied by down-regulation of ER function whilst basal AP-1 activity is elevated. Our results suggest PKCα overexpression may play a role in growth signalling during the shift from hormone dependent to hormone-independent breast cancers. © 2000 Cancer Research Campaign PMID:10952784

  12. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  13. DNA Double Strand Breaks as Predictor of Efficacy of the Alpha-Particle Emitter Ac-225 and the Electron Emitter Lu-177 for Somatostatin Receptor Targeted Radiotherapy

    PubMed Central

    Graf, Franziska; Fahrer, Jörg; Maus, Stephan; Morgenstern, Alfred; Bruchertseifer, Frank; Venkatachalam, Senthil; Fottner, Christian; Weber, Matthias M.; Huelsenbeck, Johannes; Schreckenberger, Mathias; Kaina, Bernd; Miederer, Matthias

    2014-01-01

    Rationale Key biologic effects of the alpha-particle emitter Actinium-225 in comparison to the beta-particle emitter Lutetium-177 labeled somatostatin-analogue DOTATOC in vitro and in vivo were studied to evaluate the significance of γH2AX-foci formation. Methods To determine the relative biological effectiveness (RBE) between the two isotopes (as - biological consequence of different ionisation-densities along a particle-track), somatostatin expressing AR42J cells were incubated with Ac-225-DOTATOC and Lu-177-DOTATOC up to 48 h and viability was analyzed using the MTT assay. DNA double strand breaks (DSB) were quantified by immunofluorescence staining of γH2AX-foci. Cell cycle was analyzed by flow cytometry. In vivo uptake of both radiolabeled somatostatin-analogues into subcutaneously growing AR42J tumors and the number of cells displaying γH2AX-foci were measured. Therapeutic efficacy was assayed by monitoring tumor growth after treatment with activities estimated from in vitro cytotoxicity. Results Ac-225-DOTATOC resulted in ED50 values of 14 kBq/ml after 48 h, whereas Lu-177-DOTATOC displayed ED50 values of 10 MBq/ml. The number of DSB grew with increasing concentration of Ac-225-DOTATOC and similarly with Lu-177-DOTATOC when applying a factor of 700-fold higher activity compared to Ac-225. Already 24 h after incubation with 2.5–10 kBq/ml, Ac-225-DOTATOC cell-cycle studies showed up to a 60% increase in the percentage of tumor cells in G2/M phase. After 72 h an apoptotic subG1 peak was also detectable. Tumor uptake for both radio peptides at 48 h was identical (7.5%ID/g), though the overall number of cells with γH2AX-foci was higher in tumors treated with 48 kBq Ac-225-DOTATOC compared to tumors treated with 30 MBq Lu-177-DOTATOC (35% vs. 21%). Tumors with a volume of 0.34 ml reached delayed exponential tumor growth after 25 days (44 kBq Ac-225-DOTATOC) and after 21 days (34 MBq Lu-177-DOTATOC). Conclusion γH2AX-foci formation, triggered by beta- and

  14. Ligation of retinoic acid receptor alpha regulates negative selection of thymocytes by inhibiting both DNA binding of nur77 and synthesis of bim.

    PubMed

    Szegezdi, Eva; Kiss, Ildikó; Simon, Agnes; Blaskó, Bernadett; Reichert, Uwe; Michel, Serge; Sándor, Mátyás; Fésüs, László; Szondy, Zsuzsa

    2003-04-01

    Negative selection refers to the selective deletion of autoreactive thymocytes. Its molecular mechanisms have not been well defined. Previous studies in our laboratory have demonstrated that retinoic acids, physiological ligands for the nuclear retinoid receptors, selectively inhibit TCR-mediated death under in vitro conditions, and the inhibition is mediated via the retinoic acid receptor (RAR) alpha. The present studies were undertaken to investigate whether ligation of RARalpha leads to inhibition of TCR-mediated death in vivo and to identify the molecular mechanisms involved. Three models of TCR-mediated death were studied: anti-CD3-mediated death of thymocytes in wild-type mice, and Ag- and bacterial superantigen-driven thymocyte death in TCR-transgenic mice expressing a receptor specific for a fragment of pigeon cytochrome c in the context of the E(k) (class II MHC) molecule. Our data demonstrate that the molecular program of both anti-CD3- and Ag-driven, but not that of superantigen-mediated apoptosis involves up-regulation of nur77, an orphan nuclear receptor, and bim, a BH3-only member of the proapoptotic bcl-2 protein family, proteins previously implicated to participate in the negative selection. Ligation of RARalpha by the synthetic agonist CD336 inhibited apoptosis, DNA binding of nur77, and synthesis of bim induced by anti-CD3 or the specific Ag, but had no effect on the superantigen-driven cell death. Our data imply that retinoids are able to inhibit negative selection in vivo as well, and they interfere with multiple steps of the T cell selection signal pathway.

  15. Satellite Communication.

    ERIC Educational Resources Information Center

    Technology Teacher, 1985

    1985-01-01

    Presents a discussion of communication satellites: explains the principles of satellite communication, describes examples of how governments and industries are currently applying communication satellites, analyzes issues confronting satellite communication, links mathematics and science to the study of satellite communication, and applies…

  16. Analytical Performance of a Multiplex Real-Time PCR Assay Using TaqMan Probes for Quantification of Trypanosoma cruzi Satellite DNA in Blood Samples

    PubMed Central

    Abate, Teresa; Cayo, Nelly M.; Parrado, Rudy; Bello, Zoraida Diaz; Velazquez, Elsa; Muñoz-Calderon, Arturo; Juiz, Natalia A.; Basile, Joaquín; Garcia, Lineth; Riarte, Adelina; Nasser, Julio R.; Ocampo, Susana B.; Yadon, Zaida E.; Torrico, Faustino; de Noya, Belkisyole Alarcón; Ribeiro, Isabela; Schijman, Alejandro G.

    2013-01-01

    Background The analytical validation of sensitive, accurate and standardized Real-Time PCR methods for Trypanosoma cruzi quantification is crucial to provide a reliable laboratory tool for diagnosis of recent infections as well as for monitoring treatment efficacy. Methods/Principal Findings We have standardized and validated a multiplex Real-Time quantitative PCR assay (qPCR) based on TaqMan technology, aiming to quantify T. cruzi satellite DNA as well as an internal amplification control (IAC) in a single-tube reaction. IAC amplification allows rule out false negative PCR results due to inhibitory substances or loss of DNA during sample processing. The assay has a limit of detection (LOD) of 0.70 parasite equivalents/mL and a limit of quantification (LOQ) of 1.53 parasite equivalents/mL starting from non-boiled Guanidine EDTA blood spiked with T. cruzi CL-Brener stock. The method was evaluated with blood samples collected from Chagas disease patients experiencing different clinical stages and epidemiological scenarios: 1- Sixteen Venezuelan patients from an outbreak of oral transmission, 2- Sixty three Bolivian patients suffering chronic Chagas disease, 3- Thirty four Argentinean cases with chronic Chagas disease, 4- Twenty seven newborns to seropositive mothers, 5- A seronegative receptor who got infected after transplantation with a cadaveric kidney explanted from an infected subject. Conclusions/Significance The performing parameters of this assay encourage its application to early assessment of T. cruzi infection in cases in which serological methods are not informative, such as recent infections by oral contamination or congenital transmission or after transplantation with organs from seropositive donors, as well as for monitoring Chagas disease patients under etiological treatment. PMID:23350002

  17. DNA from Protozoan Parasites Babesia bovis, Trypanosoma cruzi, and T. brucei Is Mitogenic for B Lymphocytes and Stimulates Macrophage Expression of Interleukin-12, Tumor Necrosis Factor Alpha, and Nitric Oxide

    PubMed Central

    Shoda, Lisl K. M.; Kegerreis, Kimberly A.; Suarez, Carlos E.; Roditi, Isabel; Corral, Ricardo S.; Bertot, Gustavo M.; Norimine, Junzo; Brown, Wendy C.

    2001-01-01

    The activation of innate immune responses by genomic DNA from bacteria and several nonvertebrate organisms represents a novel mechanism of pathogen recognition. We recently demonstrated the CpG-dependent mitogenic activity of DNA from the protozoan parasite Babesia bovis for bovine B lymphocytes (W. C. Brown, D. M. Estes, S. E. Chantler, K. A. Kegerreis, and C. E. Suarez, Infect. Immun. 66:5423–5432, 1998). However, activation of macrophages by DNA from protozoan parasites has not been demonstrated. The present study was therefore conducted to determine whether DNA from the protozan parasites B. bovis, Trypanosoma cruzi, and T. brucei activates macrophages to secrete inflammatory mediators associated with protective immunity. DNA from Escherichia coli and all three parasites stimulated B-lymphocyte proliferation and increased macrophage production of interleukin-12 (IL-12), tumor necrosis factor alpha (TNF-α), and nitric oxide (NO). Regulation of IL-12 and NO production occurred at the level of transcription. The amounts of IL-12, TNF-α, and NO induced by E. coli and protozoal DNA were strongly correlated (r2 > 0.9) with the frequency of CG dinucleotides in the genome, and immunostimulation by DNA occurred in the order E. coli ≥ T. cruzi > T. brucei > B. bovis. Induction of inflammatory mediators by E. coli, T. brucei, and B. bovis DNA was dependent on the presence of unmethylated CpG dinucleotides. However, at high concentrations, E. coli and T. cruzi DNA-mediated macrophage activation was not inhibited following methylation. The recognition of protozoal DNA by B lymphocytes and macrophages may provide an important innate defense mechanism to control parasite replication and promote persistent infection. PMID:11254571

  18. Expression of ATP synthase CF1 alpha subunit gene (CTL-spn) as screened by the cDNA-SRAP approach is correlated with spininess in Carthamus tinctorius L.

    PubMed

    Guo, Dan-dan; Guo, Qing-hua; Gao, Yue; Guo, Mei-li

    2015-08-01

    The safflower floret is a traditional Chinese medicine used to promote blood circulation and remove obstruction in the channels. The spines on its bracts are considered a handicap when manual harvest is involved. In this study, cDNA-SRAP was used to systematically investigate which genes are associated with the spines. Sixty pairs of possible primer combinations were used on two cDNA pools representing spininess and spinelessness. Six transcript-derived fragments were identified, of which two with low recombination were sequenced successfully and named as GPY-1 and GPY-2. By using the RACE method, the full-length cDNA of GPY-2 is cloned and named as CTL-spn. The full-length cDNA of CTL-spn was 1 679 bp long with a 1 524 bp ORF encoding a 508 aminoacid protein. The deduced amino acid sequence of the CTL-spn gene shared a high homology (97%) with other known ATP synthase CF1 alpha subunits. Semiquantitative RT-PCR analysis revealed that the mRNA of GPY-1 and GPY-2 accumulated in only spiny lines. Considering the important role of ATP synthase CF1 alpha subunit in plants, it may directly take part in the formation process of spininess and enhancing resistance reaction of spiny safflower. Also, our results provide the important insights for breeding spineless cultivars of safflower.

  19. Expression of ATP synthase CF1 alpha subunit gene (CTL-spn) as screened by the cDNA-SRAP approach is correlated with spininess in Carthamus tinctorius L.

    PubMed

    Guo, Dan-dan; Guo, Qing-hua; Gao, Yue; Guo, Mei-li

    2015-08-01

    The safflower floret is a traditional Chinese medicine used to promote blood circulation and remove obstruction in the channels. The spines on its bracts are considered a handicap when manual harvest is involved. In this study, cDNA-SRAP was used to systematically investigate which genes are associated with the spines. Sixty pairs of possible primer combinations were used on two cDNA pools representing spininess and spinelessness. Six transcript-derived fragments were identified, of which two with low recombination were sequenced successfully and named as GPY-1 and GPY-2. By using the RACE method, the full-length cDNA of GPY-2 is cloned and named as CTL-spn. The full-length cDNA of CTL-spn was 1 679 bp long with a 1 524 bp ORF encoding a 508 aminoacid protein. The deduced amino acid sequence of the CTL-spn gene shared a high homology (97%) with other known ATP synthase CF1 alpha subunits. Semiquantitative RT-PCR analysis revealed that the mRNA of GPY-1 and GPY-2 accumulated in only spiny lines. Considering the important role of ATP synthase CF1 alpha subunit in plants, it may directly take part in the formation process of spininess and enhancing resistance reaction of spiny safflower. Also, our results provide the important insights for breeding spineless cultivars of safflower. PMID:26669008

  20. Transforming growth factor-alpha-induced transcriptional activation of the vascular permeability factor (VPF/VEGF) gene requires AP-2-dependent DNA binding and transactivation.

    PubMed Central

    Gille, J; Swerlick, R A; Caughman, S W

    1997-01-01

    The endothelial cell-specific mitogen vascular permeability factor/vascular endothelial growth factor (VPF/VEGF) represents a central regulator of cutaneous angiogenesis. Increased VPF/VEGF expression has recently been reported in psoriatic skin and healing wounds, both conditions in which transforming growth factor-alpha (TGF alpha) and its ligand, the epidermal growth factor receptor, are markedly up-regulated. Since TGF alpha strongly induces VPF/VEGF synthesis in keratinocytes, TGF alpha-mediated VPF/VEGF expression is likely to play a significant role in the initiation and maintenance of increased vascular hyperpermeability and hyperproliferation in skin biology. The objectives of the present studies were to determine the molecular mechanisms responsible for TGF alpha-induced transcriptional activation of the VPF/VEGF gene. We have identified a GC-rich TGF alpha-responsive region between -88 bp and -65 bp of the VPF/VEGF promoter that is necessary for constitutive and TGF alpha-inducible transcriptional activation. In electrophoretic mobility shift assays, this region binds Sp1-dependent protein complexes constitutively and an additional TGF alpha-inducible protein complex that is distinct from Sp1 protein. Both AP-2 and Egr-1 transcription factors were detected as components of the TGF alpha-inducible protein complex in supershift EMSA studies. In co-transfection studies, an AP-2 but not an Egr-1 expression vector activated VPF/VEGF transcription, thus indicating that AP-2 protein is functionally important in TGF alpha-induced VPF/VEGF gene expression. By clarifying regulatory mechanisms that are critical for angiogenic processes in the skin, these studies may form the basis for new therapeutic strategies to modulate VPF/VEGF expression in cutaneous inflammation and wound healing. PMID:9049304

  1. Helitrons shaping the genomic architecture of Drosophila: enrichment of DINE-TR1 in α- and β-heterochromatin, satellite DNA emergence, and piRNA expression.

    PubMed

    Dias, Guilherme B; Heringer, Pedro; Svartman, Marta; Kuhn, Gustavo C S

    2015-09-01

    Drosophila INterspersed Elements (DINEs) constitute an abundant but poorly understood group of Helitrons present in several Drosophila species. The general structure of DINEs includes two conserved blocks that may or not contain a region with tandem repeats in between. These central tandem repeats (CTRs) are similar within species but highly divergent between species. It has been assumed that CTRs have independent origins. Herein, we identify a subset of DINEs, termed DINE-TR1, which contain homologous CTRs of approximately 150 bp. We found DINE-TR1 in the sequenced genomes of several Drosophila species and in Bactrocera tryoni (Acalyptratae, Diptera). However, interspecific high sequence identity (∼ 88 %) is limited to the first ∼ 30 bp of each tandem repeat, implying that evolutionary constraints operate differently over the monomer length. DINE-TR1 is unevenly distributed across the Drosophila phylogeny. Nevertheless, sequence analysis suggests vertical transmission. We found that CTRs within DINE-TR1 have independently expanded into satellite DNA-like arrays at least twice within Drosophila. By analyzing the genome of Drosophila virilis and Drosophila americana, we show that DINE-TR1 is highly abundant in pericentromeric heterochromatin boundaries, some telomeric regions and in the Y chromosome. It is also present in the centromeric region of one autosome from D. virilis and dispersed throughout several euchromatic sites in both species. We further found that DINE-TR1 is abundant at piRNA clusters, and small DINE-TR1-derived RNA transcripts (∼25 nt) are predominantly expressed in the testes and the ovaries, suggesting active targeting by the piRNA machinery. These features suggest potential piRNA-mediated regulatory roles for DINEs at local and genome-wide scales in Drosophila.

  2. Helitrons shaping the genomic architecture of Drosophila: enrichment of DINE-TR1 in α- and β-heterochromatin, satellite DNA emergence, and piRNA expression.

    PubMed

    Dias, Guilherme B; Heringer, Pedro; Svartman, Marta; Kuhn, Gustavo C S

    2015-09-01

    Drosophila INterspersed Elements (DINEs) constitute an abundant but poorly understood group of Helitrons present in several Drosophila species. The general structure of DINEs includes two conserved blocks that may or not contain a region with tandem repeats in between. These central tandem repeats (CTRs) are similar within species but highly divergent between species. It has been assumed that CTRs have independent origins. Herein, we identify a subset of DINEs, termed DINE-TR1, which contain homologous CTRs of approximately 150 bp. We found DINE-TR1 in the sequenced genomes of several Drosophila species and in Bactrocera tryoni (Acalyptratae, Diptera). However, interspecific high sequence identity (∼ 88 %) is limited to the first ∼ 30 bp of each tandem repeat, implying that evolutionary constraints operate differently over the monomer length. DINE-TR1 is unevenly distributed across the Drosophila phylogeny. Nevertheless, sequence analysis suggests vertical transmission. We found that CTRs within DINE-TR1 have independently expanded into satellite DNA-like arrays at least twice within Drosophila. By analyzing the genome of Drosophila virilis and Drosophila americana, we show that DINE-TR1 is highly abundant in pericentromeric heterochromatin boundaries, some telomeric regions and in the Y chromosome. It is also present in the centromeric region of one autosome from D. virilis and dispersed throughout several euchromatic sites in both species. We further found that DINE-TR1 is abundant at piRNA clusters, and small DINE-TR1-derived RNA transcripts (∼25 nt) are predominantly expressed in the testes and the ovaries, suggesting active targeting by the piRNA machinery. These features suggest potential piRNA-mediated regulatory roles for DINEs at local and genome-wide scales in Drosophila. PMID:26408292

  3. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα)-encoding (GNAS) genomic imprinting domain are associated with performance traits

    PubMed Central

    2011-01-01

    Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs) spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS) domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486) were located upstream of the GNAS gene, while one SNP (rs41694646) was located in the second intron of the GNAS gene. The final SNP (rs41694656) was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646) is associated (P ≤ 0.05) with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf) and gestation length. Association (P ≤ 0.01) with direct calving difficulty (i.e. due to calf size) and maternal calving difficulty (i.e. due to the maternal pelvic width size) was also observed at the rs43101491 SNP. Following

  4. The All-Alpha Domains of Coupling Proteins from the Agrobacterium tumefaciens VirB/VirD4 and Enterococcus faecalis pCF10-Encoded Type IV Secretion Systems Confer Specificity to Binding of Cognate DNA Substrates

    PubMed Central

    Whitaker, Neal; Chen, Yuqing; Jakubowski, Simon J.; Sarkar, Mayukh K.; Li, Feng

    2015-01-01

    ABSTRACT Bacterial type IV coupling proteins (T4CPs) bind and mediate the delivery of DNA substrates through associated type IV secretion systems (T4SSs). T4CPs consist of a transmembrane domain, a conserved nucleotide-binding domain (NBD), and a sequence-variable helical bundle called the all-alpha domain (AAD). In the T4CP structural prototype, plasmid R388-encoded TrwB, the NBD assembles as a homohexamer resembling RecA and DNA ring helicases, and the AAD, which sits at the channel entrance of the homohexamer, is structurally similar to N-terminal domain 1 of recombinase XerD. Here, we defined the contributions of AADs from the Agrobacterium tumefaciens VirD4 and Enterococcus faecalis PcfC T4CPs to DNA substrate binding. AAD deletions abolished DNA transfer, whereas production of the AAD in otherwise wild-type donor strains diminished the transfer of cognate but not heterologous substrates. Reciprocal swaps of AADs between PcfC and VirD4 abolished the transfer of cognate DNA substrates, although strikingly, the VirD4-AADPcfC chimera (VirD4 with the PcfC AAD) supported the transfer of a mobilizable plasmid. Purified AADs from both T4CPs bound DNA substrates without sequence preference but specifically bound cognate processing proteins required for cleavage at origin-of-transfer sequences. The soluble domains of VirD4 and PcfC lacking their AADs neither exerted negative dominance in vivo nor specifically bound cognate processing proteins in vitro. Our findings support a model in which the T4CP AADs contribute to DNA substrate selection through binding of associated processing proteins. Furthermore, MOBQ plasmids have evolved a docking mechanism that bypasses the AAD substrate discrimination checkpoint, which might account for their capacity to promiscuously transfer through many different T4SSs. IMPORTANCE For conjugative transfer of mobile DNA elements, members of the VirD4/TraG/TrwB receptor superfamily bind cognate DNA substrates through mechanisms that are

  5. Alpha Thalassemia

    MedlinePlus

    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  6. Suppression of RNA Silencing by a Plant DNA Virus Satellite Requires a Host Calmodulin-Like Protein to Repress RDR6 Expression

    PubMed Central

    Li, Fangfang; Huang, Changjun; Li, Zhenghe; Zhou, Xueping

    2014-01-01

    In plants, RNA silencing plays a key role in antiviral defense. To counteract host defense, plant viruses encode viral suppressors of RNA silencing (VSRs) that target different effector molecules in the RNA silencing pathway. Evidence has shown that plants also encode endogenous suppressors of RNA silencing (ESRs) that function in proper regulation of RNA silencing. The possibility that these cellular proteins can be subverted by viruses to thwart host defense is intriguing but has not been fully explored. Here we report that the Nicotiana benthamiana calmodulin-like protein Nbrgs-CaM is required for the functions of the VSR βC1, the sole protein encoded by the DNA satellite associated with the geminivirus Tomato yellow leaf curl China virus (TYLCCNV). Nbrgs-CaM expression is up-regulated by the βC1. Transgenic plants over-expressing Nbrgs-CaM displayed developmental abnormities reminiscent of βC1-associated morphological alterations. Nbrgs-CaM suppressed RNA silencing in an Agrobacterium infiltration assay and, when over-expressed, blocked TYLCCNV-induced gene silencing. Genetic evidence showed that Nbrgs-CaM mediated the βC1 functions in silencing suppression and symptom modulation, and was required for efficient virus infection. Moreover, the tobacco and tomato orthologs of Nbrgs-CaM also possessed ESR activity, and were induced by betasatellite to promote virus infection in these Solanaceae hosts. We further demonstrated that βC1-induced Nbrgs-CaM suppressed the production of secondary siRNAs, likely through repressing RNA-DEPENDENT RNA POLYMERASE 6 (RDR6) expression. RDR6-deficient N. benthamiana plants were defective in antiviral response and were hypersensitive to TYLCCNV infection. More significantly, TYLCCNV could overcome host range restrictions to infect Arabidopsis thaliana when the plants carried a RDR6 mutation. These findings demonstrate a distinct mechanism of VSR for suppressing PTGS through usurpation of a host ESR, and highlight an essential

  7. Suppression of RNA silencing by a plant DNA virus satellite requires a host calmodulin-like protein to repress RDR6 expression.

    PubMed

    Li, Fangfang; Huang, Changjun; Li, Zhenghe; Zhou, Xueping

    2014-02-01

    In plants, RNA silencing plays a key role in antiviral defense. To counteract host defense, plant viruses encode viral suppressors of RNA silencing (VSRs) that target different effector molecules in the RNA silencing pathway. Evidence has shown that plants also encode endogenous suppressors of RNA silencing (ESRs) that function in proper regulation of RNA silencing. The possibility that these cellular proteins can be subverted by viruses to thwart host defense is intriguing but has not been fully explored. Here we report that the Nicotiana benthamiana calmodulin-like protein Nbrgs-CaM is required for the functions of the VSR βC1, the sole protein encoded by the DNA satellite associated with the geminivirus Tomato yellow leaf curl China virus (TYLCCNV). Nbrgs-CaM expression is up-regulated by the βC1. Transgenic plants over-expressing Nbrgs-CaM displayed developmental abnormities reminiscent of βC1-associated morphological alterations. Nbrgs-CaM suppressed RNA silencing in an Agrobacterium infiltration assay and, when over-expressed, blocked TYLCCNV-induced gene silencing. Genetic evidence showed that Nbrgs-CaM mediated the βC1 functions in silencing suppression and symptom modulation, and was required for efficient virus infection. Moreover, the tobacco and tomato orthologs of Nbrgs-CaM also possessed ESR activity, and were induced by betasatellite to promote virus infection in these Solanaceae hosts. We further demonstrated that βC1-induced Nbrgs-CaM suppressed the production of secondary siRNAs, likely through repressing RNA-DEPENDENT RNA POLYMERASE 6 (RDR6) expression. RDR6-deficient N. benthamiana plants were defective in antiviral response and were hypersensitive to TYLCCNV infection. More significantly, TYLCCNV could overcome host range restrictions to infect Arabidopsis thaliana when the plants carried a RDR6 mutation. These findings demonstrate a distinct mechanism of VSR for suppressing PTGS through usurpation of a host ESR, and highlight an essential

  8. Differential Radiosensitivity Phenotypes of DNA-PKcs Mutations Affecting NHEJ and HRR Systems following Irradiation with Gamma-Rays or Very Low Fluences of Alpha Particles

    PubMed Central

    Little, John B.; Kato, Takamitsu A.; Shih, Hung-Ying; Xie, Xian-Jin; Wilson Jr., Paul F.; Brogan, John R.; Kurimasa, Akihiro; Chen, David J.; Bedford, Joel S.; Chen, Benjamin P. C.

    2014-01-01

    We have examined cell-cycle dependence of chromosomal aberration induction and cell killing after high or low dose-rate γ irradiation in cells bearing DNA-PKcs mutations in the S2056 cluster, the T2609 cluster, or the kinase domain. We also compared sister chromatid exchanges (SCE) production by very low fluences of α-particles in DNA-PKcs mutant cells, and in homologous recombination repair (HRR) mutant cells including Rad51C, Rad51D, and Fancg/xrcc9. Generally, chromosomal aberrations and cell killing by γ-rays were similarly affected by mutations in DNA-PKcs, and these mutant cells were more sensitive in G1 than in S/G2 phase. In G1-irradiated DNA-PKcs mutant cells, both chromosome- and chromatid-type breaks and exchanges were in excess than wild-type cells. For cells irradiated in late S/G2 phase, mutant cells showed very high yields of chromatid breaks compared to wild-type cells. Few exchanges were seen in DNA-PKcs-null, Ku80-null, or DNA-PKcs kinase dead mutants, but exchanges in excess were detected in the S2506 or T2609 cluster mutants. SCE induction by very low doses of α-particles is resulted from bystander effects in cells not traversed by α-particles. SCE seen in wild-type cells was completely abolished in Rad51C- or Rad51D-deficient cells, but near normal in Fancg/xrcc9 cells. In marked contrast, very high levels of SCEs were observed in DNA-PKcs-null, DNA-PKcs kinase-dead and Ku80-null mutants. SCE induction was also abolished in T2609 cluster mutant cells, but was only slightly reduced in the S2056 cluster mutant cells. Since both non-homologous end-joining (NHEJ) and HRR systems utilize initial DNA lesions as a substrate, these results suggest the possibility of a competitive interference phenomenon operating between NHEJ and at least the Rad51C/D components of HRR; the level of interaction between damaged DNA and a particular DNA-PK component may determine the level of interaction of such DNA with a relevant HRR component. PMID:24714417

  9. Differential radiosensitivity phenotypes of DNA-PKcs mutations affecting NHEJ and HRR systems following irradiation with gamma-rays or very low fluences of alpha particles.

    PubMed

    Lin, Yu-Fen; Nagasawa, Hatsumi; Little, John B; Kato, Takamitsu A; Shih, Hung-Ying; Xie, Xian-Jin; Wilson, Paul F; Brogan, John R; Kurimasa, Akihiro; Chen, David J; Bedford, Joel S; Chen, Benjamin P C

    2014-01-01

    We have examined cell-cycle dependence of chromosomal aberration induction and cell killing after high or low dose-rate γ irradiation in cells bearing DNA-PKcs mutations in the S2056 cluster, the T2609 cluster, or the kinase domain. We also compared sister chromatid exchanges (SCE) production by very low fluences of α-particles in DNA-PKcs mutant cells, and in homologous recombination repair (HRR) mutant cells including Rad51C, Rad51D, and Fancg/xrcc9. Generally, chromosomal aberrations and cell killing by γ-rays were similarly affected by mutations in DNA-PKcs, and these mutant cells were more sensitive in G1 than in S/G2 phase. In G1-irradiated DNA-PKcs mutant cells, both chromosome- and chromatid-type breaks and exchanges were in excess than wild-type cells. For cells irradiated in late S/G2 phase, mutant cells showed very high yields of chromatid breaks compared to wild-type cells. Few exchanges were seen in DNA-PKcs-null, Ku80-null, or DNA-PKcs kinase dead mutants, but exchanges in excess were detected in the S2506 or T2609 cluster mutants. SCE induction by very low doses of α-particles is resulted from bystander effects in cells not traversed by α-particles. SCE seen in wild-type cells was completely abolished in Rad51C- or Rad51D-deficient cells, but near normal in Fancg/xrcc9 cells. In marked contrast, very high levels of SCEs were observed in DNA-PKcs-null, DNA-PKcs kinase-dead and Ku80-null mutants. SCE induction was also abolished in T2609 cluster mutant cells, but was only slightly reduced in the S2056 cluster mutant cells. Since both non-homologous end-joining (NHEJ) and HRR systems utilize initial DNA lesions as a substrate, these results suggest the possibility of a competitive interference phenomenon operating between NHEJ and at least the Rad51C/D components of HRR; the level of interaction between damaged DNA and a particular DNA-PK component may determine the level of interaction of such DNA with a relevant HRR component.

  10. FISH analysis of the arrangement of chromosomes in interphase nuclei using telomeric, centromeric, and DNA painting probes

    NASA Astrophysics Data System (ADS)

    Monajembashi, Shamci; Schmitt, Eberhard; Dittmar, Heike; Greulich, Karl-Otto

    1999-01-01

    Fluorescence in situ hybridization is used to study the arrangement of chromosomes in interphase nuclei of unsynchronized human lymphocytes. DNA probes specific for telomeric DNA, centromeric (alpha) -satellite DNA and whole chromosomes 2, 7, 9 and X are employed. It is demonstrated that the shape of the chromosome territories is variable in cycling cells, for example, close to the metaphase chromosome homologues are arranged pairwise. Furthermore, the relative arrangement of chromosome homologues to each other is not spatially defined. Also, the relative orientation of centromeres and telomeres within a chromosome domain is variable.

  11. Satellite RNAs and Satellite Viruses.

    PubMed

    Palukaitis, Peter

    2016-03-01

    Satellite RNAs and satellite viruses are extraviral components that can affect either the pathogenicity, the accumulation, or both of their associated viruses while themselves being dependent on the associated viruses as helper viruses for their infection. Most of these satellite RNAs are noncoding RNAs, and in many cases, have been shown to alter the interaction of their helper viruses with their hosts. In only a few cases have the functions of these satellite RNAs in such interactions been studied in detail. In particular, work on the satellite RNAs of Cucumber mosaic virus and Turnip crinkle virus have provided novel insights into RNAs functioning as noncoding RNAs. These effects are described and potential roles for satellite RNAs in the processes involved in symptom intensification or attenuation are discussed. In most cases, models describing these roles involve some aspect of RNA silencing or its suppression, either directly or indirectly involving the particular satellite RNA.

  12. Enhanced dendritic cell maturation by TNF-alpha or cytidine-phosphate-guanosine DNA drives T cell activation in vitro and therapeutic anti-tumor immune responses in vivo.

    PubMed

    Brunner, C; Seiderer, J; Schlamp, A; Bidlingmaier, M; Eigler, A; Haimerl, W; Lehr, H A; Krieg, A M; Hartmann, G; Endres, S

    2000-12-01

    Dendritic cells (DC) manipulated ex vivo can induce tumor immunity in experimental murine tumor models. To improve DC-based tumor vaccination, we studied whether DC maturation affects the T cell-activating potential in vitro and the induction of tumor immunity in vivo. Maturation of murine bone marrow-derived DC was induced by GM-CSF plus IL-4 alone or by further addition of TNF-alpha or a cytidine-phosphate-guanosine (CpG)-containing oligonucleotide (ODN-1826), which mimics the immunostimulatory effect of bacterial DNA. Flow cytometric analysis of costimulatory molecules and MHC class II showed that DC maturation was stimulated most by ODN-1826, whereas TNF-alpha had an intermediate effect. The extent of maturation correlated with the secretion of IL-12 and the induction of alloreactive T cell proliferation. In BALB/c mice, s.c. injection of colon carcinoma cells resulted in rapidly growing tumors. In this model, CpG-ODN-stimulated DC cocultured with irradiated tumor cells also induced prophylactic protection most effectively and were therapeutically effective when administered 3 days after tumor challenge. Thus, CpG-ODN-enhanced DC maturation may represent an efficient means to improve clinical tumor vaccination.

  13. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  14. Meteorological satellites

    NASA Technical Reports Server (NTRS)

    Allison, L. J. (Editor); Schnapf, A.; Diesen, B. C., III; Martin, P. S.; Schwalb, A.; Bandeen, W. R.

    1980-01-01

    An overview is presented of the meteorological satellite programs that have been evolving from 1958 to the present, and plans for the future meteorological and environmental satellite systems that are scheduled to be placed into service in the early 1980's are reviewed. The development of the TIROS family of weather satellites, including TIROS, ESSA, ITOS/NOAA, and the present TIROS-N (the third generation operational system) is summarized. The contribution of the Nimbus and ATS technology satellites to the development of the operational-orbiting and geostationary satellites is discussed. Included are descriptions of both the TIROS-N and the DMSP payloads currently under development to assure a continued and orderly growth of these systems into the 1980's.

  15. RADIATION SENSITIVITY & PROCESSING OF DNA DAMAGE FOLLOWING LOW DOSES OF GAMMA-RAY ALPHA PARTICLES & HZE IRRADIATION OF NORMAL DSB REPAIR DEFICIENT CELLS

    SciTech Connect

    O'Neil, Peter

    2009-05-15

    Non-homologous end joining (NHEJ) predominates in the repair of DNA double strand breaks (DSB) over homologous recombination (HR). NHEJ occurs throughout the cell cycle whereas HR occurs in late S/G2 due to the requirement of a sister chromatid (Rothkamm et al, Mol Cell Biol 23 5706-15 [2003]). To date evidence obtained with DSB repair deficient cells using pulsed-field gel electrophoresis has revealed the major pathway throughout all phases of the cell cycle for processing high dose induced DSBs is NHEJ (Wang et al, Oncogene 20 2212-24 (2001); Pluth et al, Cancer Res. 61 2649-55 [2001]). These findings however were obtained at high doses when on average >> 20-30 DSBs are formed per cell. The contribution of the repair pathways (NHEJ and HR) induced in response to DNA damage during the various phases of the cell cycle may depend upon the dose (the level of initial DSBs) especially since low levels of DSBs are induced at low dose. To date, low dose studies using NHEJ and HR deficient mutants have not been carried out to address this important question with radiations of different quality. The work presented here leads us to suggest that HR plays a relatively minor role in the repair of radiation-induced prompt DSBs. SSBs lead to the induction of DSBs which are associated specifically with S-phase cells consistent with the idea that they are formed at stalled replication forks in which HR plays a major role in repair. That DNA-PKcs is in some way involved in the repair of the precursors to replication-induced DSB remains an open question. Persistent non-DSB oxidative damage also leads to an increase in RAD51 positive DSBs. Both simple and complex non-DSB DNA damage may therefore contribute to indirect DSBs induced by ionising radiation at replication forks.

  16. Effect of DNA interaction involving antioxidative 4-aminoantipyrine incorporating mixed ligand complexes having alpha-amino acid as co-ligand

    NASA Astrophysics Data System (ADS)

    Raman, Natarajan; Sakthivel, Arunagiri; Selvaganapathy, Muthusamy; Mitu, Liviu

    2014-02-01

    Few new mixed ligand transition metal complexes of the stoichiometry [ML(A)2], where M = Co(II), Ni(II), Cu(II) and Zn(II), L = FFAP (furfurylidene-4-aminoantipyrine) and A = amino acid (glycine/alanine/valine), have been designed, synthesized and characterized. The molar conductivity of the complexes in DMF at 10-3 M concentration shows that they are non-electrolytes. The interaction of these complexes with CT-DNA indicates that the valine mixed ligand complexes are having higher binding constant than alanine and glycine mixed ligand complexes. This analysis reveals that binding constant depends on the size of the alkyl group present in the amino acid. The binding constants of valine mixed ligand complexes are in the order of 104 to 105 M-1 revealing that the complexes interact with DNA through moderate intercalation mode. The metal complexes exhibit effective cleavage of pUC19 DNA but it is not preceded via radical cleavage and superoxide anion radical. They are good antimicrobial agents than the free ligand. On comparing the IC50 values, [Ni(L)(Gly)2] is considered as a potential drug to eliminate the hydroxyl radical.

  17. Satellite myths

    NASA Astrophysics Data System (ADS)

    Easton, Roger L.; Hall, David

    2008-01-01

    Richard Corfield's article “Sputnik's legacy” (October 2007 pp23-27) states that the satellite on board the US Vanguard rocket, which exploded during launch on 6 December 1957 two months after Sputnik's successful take-off, was “a hastily put together contraption of wires and circuitry designed only to send a radio signal back to Earth”. In fact, the Vanguard satellite was developed over a period of several years and put together carefully using the best techniques and equipment available at the time - such as transistors from Bell Laboratories/Western Electric. The satellite contained not one but two transmitters, in which the crystal-controlled oscillators had been designed to measure both the temperature of the satellite shell and of the internal package.

  18. Satellite Videoconferences

    NASA Technical Reports Server (NTRS)

    1990-01-01

    NASA is helping thousands of teachers to learn more about aerospace matters, improve their classroom skills, and expand significantly the content of their aerospace education curricula by means of live educational satellite videoconferences. The 1 1/2 hour 'Update for Teachers' programs originate at Oklahoma State University (OSU) Telecommunications Center. The television signals are transmitted to the WESTAR IV communications satellite, which remits them to participating schools across the U.S. and in parts of Mexico and Canada. The schools are equipped with small home style satellite reception dishes. Education Satellite Videoconference programs are conducted four times yearly, covering a variety of aerospace subjects. Teachers can call toll-free and have questions answered after the speaker's presentations. Information about NASA educational resources and how to obtain them will be provided.

  19. Protective effect of alpha glucosyl hesperidin (G-hesperidin) on chronic vanadium induced testicular toxicity and sperm nuclear DNA damage in male Sprague Dawley rats.

    PubMed

    Vijaya Bharathi, B; Jaya Prakash, G; Krishna, K M; Ravi Krishna, C H; Sivanarayana, T; Madan, K; Rama Raju, G A; Annapurna, A

    2015-06-01

    The study was conducted to evaluate the vanadium-induced testicular toxicity and its effect on sperm parameters, sperm nuclear DNA damage and histological alterations in Sprague Dawley rats and to assess the protective effect of G-hesperidin against this damage. Treatment of rats with vanadium at a dose of 1 mg kg bw(-1) for 90 days resulted in significant reduction in serum testosterone levels, sperm count and motility. Further, a parallel increase in abnormal sperm morphology and adverse histopathological changes in testis was also associated with vanadium administration when compared to normal control. Moreover, sperm chromatin dispersion assay revealed that vanadium induces sperm nuclear DNA fragmentation. A marked increase in testicular malondialdehyde levels and decreased activity of antioxidant enzymes such as superoxide dismutase and catalase indicates vanadium-induced oxidative stress. Co-administration of G-hesperidin at a dose of 25 and 50 mg kg bw(-1) significantly attenuated the sperm parameters and histological changes by restoring the antioxidant levels in rat testis. These results suggested that vanadium exposure caused reduced bioavailability of androgens to the tissue and increased free radical formation, thereby causing structural and functional changes in spermatozoa. G-hesperidin exhibited antioxidant effect by protecting the rat testis against vanadium-induced oxidative damage, further ensures antioxidant potential of bioflavonoids.

  20. Satellite positioning

    NASA Technical Reports Server (NTRS)

    Colombo, Oscar L.; Watkins, Michael M.

    1991-01-01

    Developments in satellite positioning techniques and their applications are reviewed on the basis of the theoretical and practical work published by U.S. researchers in 1987-1990. Current techniques are classified into two main categories: satellite laser tracking and radio tracking. Particular attention is given to the Geoscience Laser Ranging System, the Lunar Laser Ranging concept; GPS ephemerides determination, fiducial networks, and reference frame; static GPS positioning; and kinematic GPS positioning.

  1. Isolation of a cDNA encoding the alpha-subunit of CAAX-prenyltransferases from Catharanthus roseus and the expression of the active recombinant protein farnesyltransferase.

    PubMed

    Courdavault, Vincent; Burlat, Vincent; St-Pierre, Benoit; Gantet, Pascal; Giglioli-Guivarc'h, Nathalie

    2005-01-01

    Crfta/ggt_Ia (AF525030), a cDNA encoding the ?-subunit of the two types of CaaX-prenyltransferase (CaaX-PTase), i.e. protein farnesyltransferase (PFT) and type I protein geranylgeranyltransferase, was cloned from Catharanthus roseus via a PCR strategy. Crfta/ggt_Ia is 1381-bp long and bears a 999-bp open reading frame encoding a protein of 332 residues (FTA) that shares 66% identity with its Lycopersicon esculentum orthologue. Southern blot analysis revealed that FTA is encoded by a single gene copy per haploid genome. Co-expression of Crfta/ggt_Ia and Crftb encoding the beta-subunit of PFT yielded purified active recombinant PFT. This enzyme is able to prenylate proteins from C. roseus, and could be used as a potent tool for prenylated protein identification.

  2. Cloning of cDNA and genomic DNA encoding human type XVIII collagen and localization of the [alpha]1 (XVIII) collagen gene to mouse chromosome 10 and human chromosome 21

    SciTech Connect

    Oh, S.P.; Warman, M.L.; Timmons, S.; Olsen, B.R.; Knoll, J.H.M. ); Seldin, M.F. ); Cheng, Sou-De )

    1994-02-01

    Types XV and XVIII collagen belong to a unique and novel subclass of the collagen superfamily for which the authors have proposed the name the MULTIPLEXIN family. Members of this class contain polypeptides with multiple triple-helical domains separated and flanked by non-triple-helical regions. In this paper, they report the isolation of human cDNAs and genomic DNAs encoding the [alpha]1 (XVIII) collagen chain. Utilizing a genomic clone as probe, they have mapped the COL18A1 gene to chromosome 21q22.3 by fluorescence in situ hybridization. In addition, using an interspecific backcross panel, they have shown that the murine Col18a1 locus is on chromosome 10, close to the loci for Col6a1 and Col6a2. 16 refs., 5 figs.

  3. Association of Satellites with a Mastrevirus in Natural Infection: Complexity of Wheat Dwarf India Virus Disease

    PubMed Central

    Kumar, Jitendra; Kumar, Jitesh; Singh, Sudhir P.

    2014-01-01

    ABSTRACT In contrast to begomoviruses, mastreviruses have not previously been shown to interact with satellites. This study reports the first identification of the association of satellites with a mastrevirus in field-grown plants. Two alphasatellite species were detected in different field samples of wheat infected with Wheat Dwarf India Virus (WDIV), a Cotton leaf curl Multan alphasatellite (CLCuMA) and a Guar leaf curl alphasatellite (GLCuA). In addition to the alphasatellites, a betasatellite, Ageratum yellow leaf curl betasatellite (AYLCB), was also identified in the wheat samples. No begomovirus was detected in the wheat samples, thus establishing association of the above-named satellites with WDIV. Agrobacterium-mediated inoculation of WDIV in wheat, in the presence of either of the alphasatellites or the betasatellite, resulted in infections inducing more severe symptoms. WDIV efficiently maintained each of the alphasatellites and the betasatellite in wheat. The satellites enhanced the level of WDIV DNA in wheat. Inoculation of the satellites isolated from wheat with various begomoviruses into Nicotiana tabacum demonstrated that these remain capable of interacting with the viruses with which they were first identified. Virus-specific small RNAs accumulated in wheat upon infection with WDIV but were lower in abundance in plants coinfected with the satellites, suggesting that both the alphasatellites and the betasatellite suppress RNA silencing. These results suggest that the selective advantage for the maintenance of the alphasatellites and the betasatellite by WDIV in the field is in overcoming RNA silencing-mediated host defense. IMPORTANCE Wheat is the most widely cultivated cereal crop in the world. A number of viruses are important pathogens of wheat, including the viruses of the genus Mastrevirus, family Geminiviridae. This study reports the association of subgenomic components, called satellites (alpha- and betasatellites), with a mastrevirus, Wheat

  4. Small satellites

    NASA Technical Reports Server (NTRS)

    Thomas, P.; Veverka, J.; Dermott, S.

    1986-01-01

    Satellites smaller than Mimas (r = 195 km) are distinguished by irregular overall shapes and by rough limb topography. Material properties and impact cratering dominate the shaping of these objects. Long fragmentation histories can produce a variety of internal structures, but so far there is no direct evidence that any small satellite is an equilibrium ellipsoid made up of noncohesive gravitationally bound rubble. One many bodies that orbit close to their primary the tidal and rotational components of surface gravity strongly affect the directions of local g and thereby affect the redistribution of regolith by mass wasting. Downslope movement of regolith is extensive on Deimos, and is probably effective on many other small satellites. It is shown that in some cases observed patterns of downslope mass wasting cold produce useful constraints on the satellite's mean density. The diversity of features seen in the few high-resolution images of small satellites currently available suggests that these objects have undergone complex histories of cratering, fragmentation, and regolith evolution.

  5. [Collection of low copy number repeats for use as probes in human DNA Mapping

    SciTech Connect

    Not Available

    1989-01-01

    To isolate novel families of repeated human sequences our basic plan is to (i) construct repeated sequence libraries, (ii) discard known repeats by hybridization and (iii) sort through the remaining clones to eliminate single copy sequences as well as known repeats that slipped through the first screening. During the previous grant period, we completed the library construction and initial screening. Six size selected sublibraries of renatured human DNA were constructed, e.g. sublibrary II contains 250 nt to 380 nt inserts. The released inserts were hybridized to Alu, L1, THE 1, [alpha] satellite and satellite M (which crosshybridizes to satellites I and H) hybridization probes. We have adopted two strategies to sort through these candidate clones.

  6. Molecular analysis of the human laminin alpha3a chain gene (LAMA3a): a strategy for mutation identification and DNA-based prenatal diagnosis in Herlitz junctional epidermolysis bullosa.

    PubMed

    Pulkkinen, L; Cserhalmi-Friedman, P B; Tang, M; Ryan, M C; Uitto, J; Christiano, A M

    1998-09-01

    Mutations in the genes (LAMA3, LAMB3, and LAMC2) encoding the subunit polypeptides of the cutaneous basement membrane zone protein laminin 5 have been reported in different forms of junctional epidermolysis bullosa (JEB), an inherited blistering skin disease. In this study, we present the complete exon-intron organization of the "a" transcript of the laminin alpha3 chain gene, LAMA3a, which is expressed primarily in the skin. We have performed fine-resolution mapping of this gene on chromosome 18q11.2 using a human-hamster radiation hybrid panel. We have also developed a mutation-detection strategy based on the exon-intron structure of LAMA3a. This strategy, based on PCR amplification of genomic sequences, followed by heteroduplex scanning and automated nucleotide sequencing, was used for successful mutation screening in a family with the lethal (Herlitz) type of JEB, and two novel LAMA3 mutations were identified in the proband. The mutations consisted of a single-base pair deletion in LAMA3a exon A11 on the paternal allele, designated 1239delC, and a two-base pair deletion in LAMA3a exon A23 on the maternal allele, designated 2959delGG. This information was also used for DNA-based prenatal testing in a subsequent pregnancy in this family. Collectively, these results attest to our expanding capability to elucidate the genetic basis of various forms of epidermolysis bullosa using molecular techniques. PMID:9759651

  7. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  8. A neuronal nicotinic acetylcholine receptor subunit (alpha 7) is developmentally regulated and forms a homo-oligomeric channel blocked by alpha-BTX.

    PubMed

    Couturier, S; Bertrand, D; Matter, J M; Hernandez, M C; Bertrand, S; Millar, N; Valera, S; Barkas, T; Ballivet, M

    1990-12-01

    cDNA and genomic clones encoding alpha 7, a novel neuronal nicotinic acetylcholine receptor (nAChR) alpha subunit, were isolated and sequenced. The mature alpha 7 protein (479 residues) has moderate homology with all other alpha and non-alpha nAChR subunits and probably assumes the same transmembrane topology. alpha 7 transcripts transiently accumulate in the developing optic tectum between E5 and E16. They are present in both the deep and the superficial layers of E12 tectum. In Xenopus oocytes, the alpha 7 protein assembles into a homo-oligomeric channel responding to acetylcholine and nicotine. The alpha 7 channel desensitizes very rapidly, rectifies strongly above -20 mV, and is blocked by alpha-bungarotoxin. A bacterial fusion protein encompassing residues 124-239 of alpha 7 binds labeled alpha-bungarotoxin. We conclude that alpha-bungarotoxin binding proteins in the vertebrate nervous system can function as nAChRs.

  9. Use of a D17Z1 oligonucleotide probe for human DNA quantitation prior to PCR analysis of polymorphic DNA markers

    SciTech Connect

    Walsh, S.; Alavaren, M.; Varlaro, J.

    1994-09-01

    The alpha-satellite DNA locus D17Z1 contains primate-specific sequences which are repeated several hundred times per chromosome 17. A probe that was designed to hybridize to a subset of the D17Z1 sequence can be used for very sensitive and specific quantitation of human DNA. Sample human genomic DNA is immobilized on nylon membrane using a slot blot apparatus, and then hybridized with a biotinylated D17Z1 oligonucleotide probe. The subsequent binding of streptavidin-horseradish peroxidase to the bound probe allows for either calorimetric (TMB) or chemiluminescent (ECL) detection. Signals obtained for sample DNAs are then compared to the signals obtained for a series of human DNA standards. For either detection method, forty samples can be quantitated in less than two hours, with a sensitivity of 150 pg. As little as 20 pg of DNA can be quantitated when using chemiluminescent detection with longer film exposures. PCR analysis of several VNTR and STR markers has indicated that optimal typing results are generally obtained within a relatively narrow range of input DNA quantities. Too much input DNA can lead to PCR artifacts such as preferential amplification of smaller alleles, non-specific amplification products, and exaggeration of the DNA synthesis slippage products that are seen with STR markers. Careful quantitation of human genomic DNA prior to PCR can avoid or minimize these problems and ultimately give cleaner, more unambiguous PCR results.

  10. Folate receptor {alpha} regulates cell proliferation in mouse gonadotroph {alpha}T3-1 cells

    SciTech Connect

    Yao, Congjun; Evans, Chheng-Orn; Stevens, Victoria L.; Owens, Timothy R.; Oyesiku, Nelson M.

    2009-11-01

    We have previously found that the mRNA and protein levels of the folate receptor alpha (FR{alpha}) are uniquely over-expressed in clinically human nonfunctional (NF) pituitary adenomas, but the mechanistic role of FR{alpha} has not fully been determined. We investigated the effect of FR{alpha} over-expression in the mouse gonadotroph {alpha}T3-1 cell line as a model for NF pituitary adenomas. We found that the expression and function of FR{alpha} were strongly up-regulated, by Western blotting and folic acid binding assay. Furthermore, we found a higher cell growth rate, an enhanced percentage of cells in S-phase by BrdU assay, and a higher PCNA staining. These observations indicate that over-expression of FR{alpha} promotes cell proliferation. These effects were abrogated in the same {alpha}T3-1 cells when transfected with a mutant FR{alpha} cDNA that confers a dominant-negative phenotype by inhibiting folic acid binding. Finally, by real-time quantitative PCR, we found that mRNA expression of NOTCH3 was up-regulated in FR{alpha} over-expressing cells. In summary, our data suggests that FR{alpha} regulates pituitary tumor cell proliferation and mechanistically may involve the NOTCH pathway. Potentially, this finding could be exploited to develop new, innovative molecular targeted treatment for human NF pituitary adenomas.

  11. Sequence of the cDNA and 5'-flanking region for human acid alpha-glucosidase, detection of an intron in the 5' untranslated leader sequence, definition of 18-bp polymorphisms, and differences with previous cDNA and amino acid sequences.

    PubMed

    Martiniuk, F; Mehler, M; Tzall, S; Meredith, G; Hirschhorn, R

    1990-03-01

    Acid maltase or acid alpha-glucosidase (GAA) is a lysosomal enzyme that hydrolyzes glycogen to glucose and is deficient in glycogen storage disease type II. Previously, we isolated a partial cDNA (1.9 kb) for human GAA; we have now used this cDNA to isolate and determine sequence in longer cDNAs from four additional independent cDNA libraries. Primer extension studies indicated that the mRNA extended approximately 200 bp 5' of the cDNA sequence obtained. Therefore, we isolated a genomic fragment containing 5' cDNA sequences that overlapped the previous cDNA sequence and extended an additional 24 bp to an initiation codon within a Kozak consensus sequence. The sequence of the genomic clone revealed an intron-exon junction 32 bp 5' to the ATG, indicating that the 5' leader sequence was interrupted by an intron. The remaining 186 bp of 5' untranslated sequence was identified approximately 3 kb upstream. The promoter region upstream from the start site of transcription was GC rich and contained areas of homology to Sp1 binding sites but no identifiable CAAT or TATA box. The combined data gave a nucleotide sequence of 2,856 bp for the coding region from the ATG to a stop codon, predicting a protein of 952 amino acids. The 3' untranslated region contained 555 bp with a polyadenylation signal at 3,385 bp followed by 16 bp prior to a poly(A) tail. This sequence of the GAA coding region differs from that reported by Hoefsloot et al. (1988) in three areas that change a total of 42 amino acids. Direct determination of the amino acid sequence in one of these areas confirmed the nucleotide sequence reported here but also disagreed with the directly determined amino acid sequence reported by Hoefsloot et al. (1988). At two other areas, changes in base pairs predicted new restriction sites that were identified in cDNAs from several independent libraries. The amino acid changes in all three ares increased the homology to rabbit-human isomaltase. Therefore, we believe that our

  12. Crystallization of hepatocyte nuclear factor 4 alpha (HNF4 alpha) in complex with the HNF1 alpha promoter element.

    PubMed

    Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G; Chi, Young-In

    2008-04-01

    Hepatocyte nuclear factor 4alpha (HNF4alpha) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4alpha cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4alpha DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1alpha. The HNF4alpha protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 A using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 A, beta = 119.36 degrees . A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants. PMID:18391435

  13. Specificity of G alpha q and G alpha 11 gene expression in platelets and erythrocytes. Expressions of cellular differentiation and species differences.

    PubMed Central

    Johnson, G J; Leis, L A; Dunlop, P C

    1996-01-01

    G alpha q and G alpha 11, members of the Gq family of G-proteins, transduce signals from receptors to the beta isoenzymes of phosphatidyl-inositol-specific phospholipase C (PI-PLC). The receptor specificity of these alpha subunits is unknown. G alpha q and G alpha 11 are ubiquitously expressed in tissues; however, there have been conflicting reports of the presence or absence of G alpha 11 protein in haematopoietic cells. Platelet thromboxane A2/prostaglandin H2 (TXA2/PGH2) receptors activate PI-PLC via G alpha q, but the role of G alpha 11 is uncertain. To define their roles in platelet activation we studied G alpha q and G alpha 11 gene expression by immunotransfer blotting and by reverse transcription of mRNA followed by PCR (RT-PCR) and direct sequencing. An antiserum specific for mouse G alpha 11 failed to identify G alpha 11 in dog or human platelets or in dog liver, a tissue known to contain G alpha 11. RT-PCR performed with gene-specific primers demonstrated G alpha q mRNA, but not G alpha 11 mRNA, in normal human and mouse platelets and in thromboxane-sensitive and thromboxane-insensitive dog platelets. Studies of mouse and dog liver and human retina confirmed that the cDNA, primers and probes used could amplify and recognize G alpha 11 in other tissues. However, species-specific oligonucleotide primers and probes were essential to demonstrate G alpha 11, but not G alpha q, mRNA. Compared with mouse cDNA, dog and human G alpha 11 cDNA had twice as many nucleotide substitutions (approx. 12% compared with approx. 6%) as G alpha q, G alpha q mRNA was also found in mature erythrocytes but G alpha 11 mRNA was not identified, whereas both G alpha q and G alpha 11 mRNAs were found in bone marrow stem cells. Therefore G alpha 11 gene expression in haematopoietic cells is linked with cellular differentiation. The lack of G alpha 11 indicates that signal transduction from platelet TXA2/PGH2 receptors to PI-PLC occurs via G alpha q, and that G alpha 11 deficiency is

  14. Chromosome-specific DNA Repeat Probes

    SciTech Connect

    Baumgartner, Adolf; Weier, Jingly Fung; Weier, Heinz-Ulrich G.

    2006-03-16

    In research as well as in clinical applications, fluorescence in situ hybridization (FISH) has gained increasing popularity as a highly sensitive technique to study cytogenetic changes. Today, hundreds of commercially available DNA probes serve the basic needs of the biomedical research community. Widespread applications, however, are often limited by the lack of appropriately labeled, specific nucleic acid probes. We describe two approaches for an expeditious preparation of chromosome-specific DNAs and the subsequent probe labeling with reporter molecules of choice. The described techniques allow the preparation of highly specific DNA repeat probes suitable for enumeration of chromosomes in interphase cell nuclei or tissue sections. In addition, there is no need for chromosome enrichment by flow cytometry and sorting or molecular cloning. Our PCR-based method uses either bacterial artificial chromosomes or human genomic DNA as templates with {alpha}-satellite-specific primers. Here we demonstrate the production of fluorochrome-labeled DNA repeat probes specific for human chromosomes 17 and 18 in just a few days without the need for highly specialized equipment and without the limitation to only a few fluorochrome labels.

  15. A new alpha chain hemoglobin variant: Hb Al-Hammadi Riyadh [alpha75(EF4)Asp-->Val (alpha2)].

    PubMed

    Burnichon, Nelly; Lacan, Philippe; Becchi, Michel; Zanella-Cleon, Isabelle; Aubry, Martine; Mowafy, Mohammed; Couprie, Nicole; Francina, Alain

    2006-01-01

    A new hemoglobin (Hb) variant in the heterozygous state, Hb Al-Hammadi Riyadh [codon 75 (GAC-->GTC); alpha75(EF4)Asp-->Val (alpha2)] corresponding to an A-->T transversion on the second exon of the alpha2-globin gene, is described. The variant was characterized by DNA sequencing and mass spectrometry (MS). The variant was found during a routine Hb analysis for anemia in a 16-month-old boy who lived in Riyadh, Kingdom of Saudi Arabia.

  16. Managing Satellites

    NASA Technical Reports Server (NTRS)

    1997-01-01

    Integral Systems, Inc.'s EPOCH 2000 forms the core of NASA's Near Earth Asteroid Rendezvous (NEAR) mission's command and control center. EPOCH 2000, which allows ground operators to monitor and control satellites over a wide area network, owes part of its heritage from work completed to support Goddard Space Flight Center. The software automates telemetry processing, commanding, anomaly detection, and archiving collected data. The NEAR spacecraft, launched in February 1996, will rendezvous in early 1999 and orbit the Asteroid Eros for a year. Integral Systems also provided Low Earth Orbit Autonomous Ground Terminals (LEO-Ts) to NASA. The LEO-T is designed to make it easier and less expensive for principal investigators to obtain telemetry, tracking and control services for their science missions. The company products have supported well over 70 satellite missions aimed at scientific research, meteorology, or communications applications.

  17. Virtual Satellite

    NASA Technical Reports Server (NTRS)

    Hammrs, Stephan R.

    2008-01-01

    Virtual Satellite (VirtualSat) is a computer program that creates an environment that facilitates the development, verification, and validation of flight software for a single spacecraft or for multiple spacecraft flying in formation. In this environment, enhanced functionality and autonomy of navigation, guidance, and control systems of a spacecraft are provided by a virtual satellite that is, a computational model that simulates the dynamic behavior of the spacecraft. Within this environment, it is possible to execute any associated software, the development of which could benefit from knowledge of, and possible interaction (typically, exchange of data) with, the virtual satellite. Examples of associated software include programs for simulating spacecraft power and thermal- management systems. This environment is independent of the flight hardware that will eventually host the flight software, making it possible to develop the software simultaneously with, or even before, the hardware is delivered. Optionally, by use of interfaces included in VirtualSat, hardware can be used instead of simulated. The flight software, coded in the C or C++ programming language, is compilable and loadable into VirtualSat without any special modifications. Thus, VirtualSat can serve as a relatively inexpensive software test-bed for development test, integration, and post-launch maintenance of spacecraft flight software.

  18. The molecular biology and biochemistry of rice endosperm. alpha. -globulin

    SciTech Connect

    Shorrosh, B.S.

    1989-01-01

    The author's first objective was to isolate a cDNA clone that encodes the rice endosperm {alpha}-globulin. Purified antibodies against a rice storage protein, {alpha}-globulin, were used to screen a {lambda}gt11 cDNA expression library constructed from immature rice seed endosperm. The cDNA insert of clone 4A1 (identified by antibody screening) was used as a probe to identify long cDNA inserts in the library. The deduced amino acid sequence of clone A3-12 cDNA insert (identified by cDNA screening) contained the amino acid sequences of three cyanogen bromide peptides fragment of {alpha}-globulin. The calculated molecular weight and amino acid composition of the deduced amino acid sequence were similar to the {alpha}-globulin protein. Northern blot analysis indicated that mRNA of one size, approximately 1.0 kb, is expressed. Southern genomic blot analysis revealed one band with EcoRI or Hind III digestion. Cell-free translation and immunoprecipitation showed that the initial translation product is approximately 2,000 daltons larger than the mature protein. The amino acid sequence of {alpha}-globulin revealed limited regions of similarities with wheat storage proteins. The author concludes that the cDNA insert in clone A3-12 contained the entire coding region of {alpha}-globulin protein and that {alpha}-globulin is encoded by a single gene. My second objective was to inhibit the degradation of {alpha}-globulin in the salt extract of rice flour. The salt extract of rice flour contained an acid protease whose optimal pH was 3 for {sup 3}H-casein hydrolysis. A polypeptide with molecular weight of 20,000 was immunologically reactive with {alpha}-globulin antibodies and is produced by limited proteolysis in the extract. Pepstatin inhibited the proteolysis of 3H-casein and slowed the proteolysis of {alpha}-globulin.

  19. The ultraviolet spectra of Alpha Aquilae and Alpha Canis Minoris

    NASA Technical Reports Server (NTRS)

    Morton, D. C.; Bruzual A., G.; Kurucz, R. L.; Spinrad, H.

    1977-01-01

    Scans of Alpha Aql (A7 IV, V) and Alpha CMi (F5 IV-V) obtained with the Copernicus satellite spectrometer over the wavelength range from 2100 to 3200 A are presented along with a spectrum of the integrated solar disk over the same range procured during a calibrated rocket flight. About 1500 fairly strong absorption lines in the Alpha CMi spectrum between 2400 and 2961 A are identified by comparison with a solar atlas and by using a theoretical spectrum synthesized from a blanketed LTE model with an effective temperature of 6500 K and a surface gravity of 10,000 cm/sec per sec. The Mg II resonance doublet at 2795.528 and 2802.704 A is found to be present in all three stars together with a discontinuity at 2635 A due to Fe II, Fe I, Cr I, and Mn II. It is concluded that the Mg II resonance lines and the 2635-A continuum break would be the best spectral features for estimating the redshift of a galaxy observed at low resolution provided the redshift is not less than about 0.75.

  20. Hemoglobin Evanston (alpha 14 Trp----Arg). An unstable alpha-chain variant expressed as alpha-thalassemia.

    PubMed Central

    Honig, G R; Shamsuddin, M; Vida, L N; Mompoint, M; Valcourt, E; Bowie, L J; Jones, E C; Powers, P A; Spritz, R A; Guis, M

    1984-01-01

    A new hematologic syndrome with phenotypic features of mild Hb H disease was identified in three children from two unrelated black American families. Erythrocytes from each of these children contained Hb H (beta 4) and Hb Barts (gamma 4), as well as a slowly migrating hemoglobin fraction that made up 7-10% of the total hemoglobin. The parents of the affected children all showed mild thalassemia-like changes, with one of the parents in each family also expressing the variant hemoglobin; in the latter individuals the mutant alpha-chains made up less than 2% of the total, and were present mainly or exclusively in combination with delta-chains in the form of a slowly migrating Hb A2. Purified Hb Evanston showed an increased oxygen affinity, but its Bohr effect, cooperativity, and 2,3-diphosphoglycerate effect were normal. The mutant hemoglobin appeared to have normal stability to heat and to isopropanol, and the stability of its alpha-chain in an extended time course synthesis study also appeared to be similar to that of alpha A. However, the results from short-term globin synthesis studies, and from mRNA translation in vitro, suggest that the two types of alpha-chains were synthesized at relatively equal rates, with a major fraction of the newly synthesized variant alpha-chains undergoing rapid catabolism. The hematologic data taken in combination with DNA hybridization and globin synthesis findings indicate that the proposita in each of these families has the genotype--, alpha A/--, alpha Ev. These observations suggest that two separate mechanisms are contributing to the alpha-thalassemia-like expression of Hb Evanston : the newly synthesized alpha EV-chains are unstable and are subject to early proteolytic destruction; and the mutant alpha-allele is linked to an alpha-globin gene deletion. Images PMID:6725558

  1. Reduction of hypoxia-induced transcription through the repression of hypoxia-inducible factor-1alpha/aryl hydrocarbon receptor nuclear translocator DNA binding by the 90-kDa heat-shock protein inhibitor radicicol.

    PubMed

    Hur, Eunseon; Kim, Hong-Hee; Choi, Su Mi; Kim, Jin Hee; Yim, Sujin; Kwon, Ho Jeong; Choi, Youngyeon; Kim, Dae Kyong; Lee, Mi-Ock; Park, Hyunsung

    2002-11-01

    Under low oxygen tension, cells increase the transcription of specific genes involved in angiogenesis, erythropoiesis, and glycolysis. Hypoxia-induced gene expression depends primarily on stabilization of the alpha subunit of hypoxia-inducible factor-1 (HIF-1alpha), which acts as a heterodimeric trans-activator with the nuclear protein known as the aryl hydrocarbon receptor nuclear translocator (Arnt). The resulting heterodimer (HIF-1alpha/Arnt) interacts specifically with the hypoxia-responsive element (HRE), thereby increasing transcription of the genes under HRE control. Our results indicate that the 90-kDa heat-shock protein (Hsp90) inhibitor radicicol reduces the hypoxia-induced expression of both endogenous vascular endothelial growth factor (VEGF) and HRE-driven reporter plasmids. Radicicol treatment (0.5 microg/ml) does not significantly change the stability of the HIF-1alpha protein and does not inhibit the nuclear localization of HIF-1alpha. However, this dose of radicicol significantly reduces HRE binding by the HIF-1alpha/Arnt heterodimer. Our results, the first to show that radicicol specifically inhibits the interaction between the HIF-1alpha/Arnt heterodimer and HRE, suggest that Hsp90 modulates the conformation of the HIF-1alpha/Arnt heterodimer, making it suitable for interaction with HRE. Furthermore, we demonstrate that radicicol reduces hypoxia-induced VEGF expression to decrease hypoxia-induced angiogenesis.

  2. Three genes for the elongation factor EF-1 alpha in Mucor racemosus.

    PubMed

    Linz, J E; Katayama, C; Sypherd, P S

    1986-02-01

    We cloned three genes from Mucor racemosus coding for protein synthesis elongation factor 1 alpha (EF-1 alpha). A 110-base-pair (bp) EF-1 alpha-specific cDNA clone was identified by hybrid-selected translation. The nucleotide sequence of the cDNA showed significant homology to a region of the Saccharomyces cerevisiae genes for EF-1 alpha (TEF1 and TEF2). The cDNA was used to isolate an 850-bp EcoRI genomic DNA fragment containing a portion of the EF-1 alpha gene. Screening of a lambda/M. racemosus genomic DNA bank with the 850-bp EcoRI probe resulted in the identification of three DNA fragments containing a common 850-bp EcoRI fragment within a short overlapping region. S1 nuclease analysis of the three EF-1 alpha DNA fragments showed that the EF-1 alpha transcript covered the short overlapping region in the clones. Restriction fragments purified from flanking regions in each clone were used to probe a HindIII digest of M. racemosus genomic DNA. Each flanking probe hybridized to one of three DNA fragments which hybridized to the 850-bp EF-1 alpha-specific probe. Nucleotide sequence data from two random "shotgun clones" of one of the three genes show good homology to two regions of S. cerevisiae TEF1. The data indicate the presence of three genes for EF-1 alpha in M. racemosus located at unique sites in the genome. PMID:2946933

  3. Meteorological satellites

    NASA Astrophysics Data System (ADS)

    1981-10-01

    Meteor-2 (second generation meteorological satellite) and an experimental satellite on which instruments are being tested and modified for the requirements of hydrometeorology and a determination of natural resources are presently operational in the U.S.S.R. Television devices with a 1-10 km terrain image resolution operating in the visible and infrared region are used to determine the space system, velocity and direction of cloud movements and provide information about the snow and ice cover, cyclones, storms, vortices in the atmosphere, and velocity and direction of wind. Images with a 50-1000 m resolution make possible geological and hydrological surveys, an evaluation of the state of vegetation and crops, detection of forest fires, determination of pollution of the atmosphere and sea and determination of optimal fishing regions in the ocean. Measurement of the intensity of atmospheric radiation in narrow infrared regions and very high frequencies allows remote evaluation of the temperature and humidity distribution in the vertical cross section of the Earth's atmosphere.

  4. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  5. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  6. Outer planet satellites

    NASA Astrophysics Data System (ADS)

    Schenk, Paul M.

    Recent findings on the outer-planet satellites are presented, with special consideration given to data on the rheologic properties of ice on icy satellites, the satellite surfaces and exogenic processes, cratering on dead cratered satellites, volcanism, and the interiors of outer-planet satellites. Particular attention is given to the state of Titan's surface and the properties of Triton, Pluto, and Charon.

  7. alpha-Hexachlorocyclohexane (alpha-HCH)

    Integrated Risk Information System (IRIS)

    alpha - Hexachlorocyclohexane ( alpha - HCH ) ; CASRN 319 - 84 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Ass

  8. Characterization, cloning, and expression of porcine alpha B crystallin.

    PubMed

    Liao, J H; Hung, C C; Lee, J S; Wu, S H; Chiou, S H

    1998-03-01

    alpha-Crystallin is a major lens protein present in the lenses of all vertebrate species. Recent studies have revealed that bovine alpha-crystallins possess genuine chaperone activity similar to small heat-shock proteins. In order to compare this chaperone-like structural protein from the eye lenses of different mammalian species, we have cloned and expressed one of the main alpha-crystallin subunits, i.e., alpha B crystallin, from the porcine lenses in order to facilitate the structure-function evaluation and comparison of this chaperonin protein. cDNA encoding alpha B subunit chain was obtained using a new "Marathon cDNA amplification" protocol of Polymerase Chain Reaction (PCR). PCR-amplified product corresponding to alpha B subunit was then ligated into pGEM-T plasmid and prepared for nucleotide sequencing by the dideoxy-nucleotide chain-termination method. Sequencing several positive clones containing DNA inserts coding for alpha B-crystallin subunit constructed only one complete full-length reading frame of 525 base pairs similar to human and bovine alpha B subunits, covering a deduced protein sequence of 175 amino acids including the universal translation-initiating methionine. The porcine alpha B crystallin shows only 3 and 7 residues difference to bovine and human alpha B crystallins respectively, revealing the close relatedness among mammalian eye lens proteins. The sequence differences between porcine and sub-mammalian species such as chicken and bullfrog are much greater, especially at the N- and C-terminal regions of these alpha B crystallins. Expression of alpha B subunit chain in E. coli vector generated a polypeptide which can cross-react with the antiserum against the native and purified alpha B subunit from the native porcine lenses albeit with a much lower activity.

  9. Satellite altimetry

    NASA Technical Reports Server (NTRS)

    Cheney, Robert E.

    1992-01-01

    Since altimetry data are not really old enough to use the term data archaeology, Mr. Cheney referred to the stewardship of these data. He noted that it is very important to document the basis for an altimetry data set as the algorithms and corrections used to arrive at the Geophysical Data Record (GDR) have been improving and are continuing to improve the precision of sea level data derived from altimetry. He noted that the GEOSAT Exact Repeat Mission (ERM) data set has recently been reprocessed by his organization in the National Ocean Service of NOAA and made available to the scientific community on CD/ROM disks by the National Oceanographic Data Center of the U.S. (NODC). The new data set contains a satellite orbit more precise by an order of magnitude together with an improved water vapor correction. A new, comprehensive GDR Handbook has also been prepared.

  10. G alpha 12 and G alpha 13 subunits define a fourth class of G protein alpha subunits.

    PubMed Central

    Strathmann, M P; Simon, M I

    1991-01-01

    Heterotrimeric guanine nucleotide-binding regulatory proteins (G proteins) are central to the signaling processes of multicellular organisms. We have explored the diversity of the G protein subunits in mammals and found evidence for a large family of genes that encode the alpha subunits. Amino acid sequence comparisons show that the different alpha subunits fall into at least three classes. These classes have been conserved in animals separated by considerable evolutionary distances; they are present in mammals, Drosophila, and nematodes. We have now obtained cDNA clones encoding two murine alpha subunits, G alpha 12 and G alpha 13, that define a fourth class. The translation products are predicted to have molecular masses of 44 kDa and to be insensitive to ADP-ribosylation by pertussis toxin. They share 67% amino acid sequence identity with each other and less than 45% identity with other alpha subunits. Their transcripts can be detected in every tissue examined, although the relative levels of the G alpha 13 message appear somewhat variable. Images PMID:1905812

  11. The distribution of alpha elements in Andromeda dwarf galaxies

    SciTech Connect

    Vargas, Luis C.; Geha, Marla C.; Tollerud, Erik J.

    2014-07-20

    We present alpha to iron abundance ratios for 226 individual red giant branch stars in nine dwarf galaxies of the Andromeda (M31) satellite system. The abundances are measured from the combined signal of Mg, Si, Ca, and Ti lines in Keck/DEIMOS medium-resolution spectra. This constitutes the first large sample of alpha abundance ratios measured in the M31 satellite system. The dwarf galaxies in our sample exhibit a variety of alpha abundance ratios, with the average values in each galaxy ranging from approximately solar ([α/Fe] ∼ + 0.0) to alpha-enhanced ([α/Fe] ∼ + 0.5). These variations do not show a correlation with internal kinematics, environment, or stellar density. We confirm radial gradients in the iron abundance of two galaxies out of the five with sufficient data (NGC 185 and And II). There is only tentative evidence for an alpha abundance radial gradient in NGC 185. We homogeneously compare our results to the Milky Way classical dwarf spheroidals, finding evidence for wider variation in average alpha abundance. In the absence of chemical abundances for the M31 stellar halo, we compare to the Milky Way stellar halo. A stellar halo comprised of disrupted M31 satellites is too metal-rich and inconsistent with the Milky Way halo alpha abundance distribution even if considering only satellites with predominantly old stellar populations. The M31 satellite population provides a second system in which to study chemical abundances of dwarf galaxies and reveals a wider variety of abundance patterns than the Milky Way.

  12. Alpha-1 antitrypsin test

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003715.htm Alpha-1 antitrypsin test To use the sharing features on this page, please enable JavaScript. Alpha-1 antitrypsin is a laboratory test to measure the ...

  13. Satellites in Education.

    ERIC Educational Resources Information Center

    Jones, David

    1988-01-01

    Describes the methods and materials used to obtain satellite pictures from weather satellites. Discusses possible physics lessons which can be done using this equipment including orbital mechanics, and how the satellite works. (CW)

  14. The Alpha Centauri System.

    ERIC Educational Resources Information Center

    Soderblom, David R.

    1987-01-01

    Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

  15. GDP-L-fucose: {beta}-D-galactoside 2-{alpha}-Lfucosyltransferases, DNA sequences encoding the same, method for producing the same and a method of genotyping a person

    SciTech Connect

    Lowe, J.B.; Lennon, G.; Rouquier, S.; Giorgi, D.; Kelly, R.J.

    1998-09-15

    The gene encoding GDP-L-fucose: {beta}-D-Galactoside 2-{alpha}-Lfucosyltransferase has been cloned, and a mutation in this gene has been found to be responsible for an individual being a non-secretor. 30 figs.

  16. GDP-L-fucose: .beta.-D-galactoside 2-.alpha.-L-fucosyltransferases, DNA sequences encoding the same, method for producing the same and a method of genotyping a person

    DOEpatents

    Lowe, John B.; Lennon, Gregory; Rouquier, Sylvie; Giorgi, Dominique; Kelly, Robert J.

    1998-01-01

    The gene encoding GDP-L-fucose: .beta.-D-Galactoside 2-.alpha.-L-fucosyltransferase has been cloned, and a mutation in this gene has been found to be responsible for an individual being a non-secretor.

  17. Human alpha 2-adrenergic receptor subtype distribution: widespread and subtype-selective expression of alpha 2C10, alpha 2C4, and alpha 2C2 mRNA in multiple tissues.

    PubMed

    Eason, M G; Liggett, S B

    1993-07-01

    At present, molecular cloning and pharmacological studies have delineated three human alpha 2-adrenergic receptor (alpha 2AR) subtypes, alpha 2C10, alpha 2C4, and alpha 2C2. Assignment of the alpha 2AR subtypes to specific functions has been limited by an unclear definition of tissue alpha 2AR expression outside of the central nervous system. It has been suggested that alpha 2C4 expression is confined to the brain, that alpha 2C2 expression is only in the liver and kidney, and that there is nearly ubiquitous expression of alpha 2C10. However, this is based on studies of a limited number of rat tissues or on studies using non-species-specific approaches. Therefore, to define alpha 2C10, alpha 2C4, and alpha 2C2 tissue expression, we used reverse transcription of total RNA isolated from 20 human tissues, followed by amplification of alpha 2AR cDNA using the polymerase chain reaction. This technique provided two advantages: high sensitivity and, with the use of subtype-specific oligonucleotide primers and probes, differentiation between the alpha 2AR subtypes. The tissues studied were aorta, vena cava, heart (epicardium and endocardium), lung, skeletal muscle, liver, pancreas (head and tail), fat (perinephric and subcutaneous), kidney (cortex and medulla), prostate, stomach, ileum, jejunum, colon, adrenal gland, and spleen. We found that the majority of these tissues expressed alpha 2C10, with the exceptions being the head of the pancreas, subcutaneous fat, colon, and spleen. In marked distinction to other studies, however, we found a prolific expression of the alpha 2C4 and alpha 2C2 subtypes. Expression of alpha 2C4 was found in all tissues with the exception of liver, fat, stomach, and colon, and a virtually ubiquitous expression of alpha 2C2 was found, with the exception of epicardium. Of all tissues studied, only colon and subcutaneous fat expressed a single alpha 2AR subtype, which was alpha 2C2. Thus, the alpha 2AR subtypes do not have a confined expression but

  18. Human alpha 2-adrenergic receptor subtype distribution: widespread and subtype-selective expression of alpha 2C10, alpha 2C4, and alpha 2C2 mRNA in multiple tissues.

    PubMed

    Eason, M G; Liggett, S B

    1993-07-01

    At present, molecular cloning and pharmacological studies have delineated three human alpha 2-adrenergic receptor (alpha 2AR) subtypes, alpha 2C10, alpha 2C4, and alpha 2C2. Assignment of the alpha 2AR subtypes to specific functions has been limited by an unclear definition of tissue alpha 2AR expression outside of the central nervous system. It has been suggested that alpha 2C4 expression is confined to the brain, that alpha 2C2 expression is only in the liver and kidney, and that there is nearly ubiquitous expression of alpha 2C10. However, this is based on studies of a limited number of rat tissues or on studies using non-species-specific approaches. Therefore, to define alpha 2C10, alpha 2C4, and alpha 2C2 tissue expression, we used reverse transcription of total RNA isolated from 20 human tissues, followed by amplification of alpha 2AR cDNA using the polymerase chain reaction. This technique provided two advantages: high sensitivity and, with the use of subtype-specific oligonucleotide primers and probes, differentiation between the alpha 2AR subtypes. The tissues studied were aorta, vena cava, heart (epicardium and endocardium), lung, skeletal muscle, liver, pancreas (head and tail), fat (perinephric and subcutaneous), kidney (cortex and medulla), prostate, stomach, ileum, jejunum, colon, adrenal gland, and spleen. We found that the majority of these tissues expressed alpha 2C10, with the exceptions being the head of the pancreas, subcutaneous fat, colon, and spleen. In marked distinction to other studies, however, we found a prolific expression of the alpha 2C4 and alpha 2C2 subtypes. Expression of alpha 2C4 was found in all tissues with the exception of liver, fat, stomach, and colon, and a virtually ubiquitous expression of alpha 2C2 was found, with the exception of epicardium. Of all tissues studied, only colon and subcutaneous fat expressed a single alpha 2AR subtype, which was alpha 2C2. Thus, the alpha 2AR subtypes do not have a confined expression but

  19. Down-regulation of stromal cell-derived factor-1alpha-induced T cell chemotaxis by a peptide based on the complementarity-determining region 1 of an anti-DNA autoantibody via up-regulation of TGF-beta secretion.

    PubMed

    Sela, Uri; Hershkoviz, Rami; Cahalon, Liora; Lider, Ofer; Mozes, Edna

    2005-01-01

    Systemic lupus erythematosus (SLE) can be induced in mice by immunizing them with a monoclonal human anti-DNA Ab that expresses a major Id, designated 16/6Id. In addition, a peptide based on the sequence of the CDR 1 (hCDR1) of the 16/6Id ameliorated the clinical manifestations of SLE in experimental models. In this study we examined the effects of treating mice with human complementary-determining region 1 (hCDR1) on the subsequent chemotaxis of T cells derived from 16/6Id-primed mice. First we demonstrated elevated levels of stromal cell-derived factor-1alpha (SDF-1alpha) in the sera of SLE-afflicted mice and in the sera and lymphoid tissues of 16/6Id-immunized BALB/c mice shortly after the immunization. We then found that administration of hCDR1 to 16/6Id-immunized mice specifically down-regulated SDF1alpha-induced T cell chemotaxis through fibronectin and collagen type I. This was accompanied by diminished SDF1-alpha-induced T cell adhesion and ERK phosphorylation. Treatment with hCDR1 up-regulated TGF-beta secretion, which, in turn, inhibited the murine T cell adhesion to and chemotaxis through fibronectin as well as their ERK phosphorylation. Thus, the secretion of TGF-beta after treatment of 16/6Id-immunized mice with hCDR1 plays an important role in the down-regulation of SDF-1alpha-mediated T cell activation and the interactions with extracellular matrix moieties observed in the present study. PMID:15611253

  20. Six HLA-D region alpha-chain genes on human chromosome 6: polymorphisms and associations of DC alpha-related sequences with DR types.

    PubMed Central

    Spielman, R S; Lee, J; Bodmer, W F; Bodmer, J G; Trowsdale, J

    1984-01-01

    Analysis of cosmid clones containing genes related to the HLA-DR alpha chain calls for at least six HLA-D region alpha-chain coding sequences in man; namely, DR alpha, DC alpha, DX alpha (very closely related to DC alpha), SB alpha 1, SB alpha 2 (two closely linked genes on the same cosmid clones), and DZ alpha. The first four genes have been described previously. SB alpha 2 and DZ alpha are recently identified genes, characterized by their unique and, from a limited study, nonpolymorphic bands when used as probes for human DNA on Southern blots. All of the genes are present in somatic cell hybrids containing a human X/6 translocation chromosome, and so they are all presumably in the HLA region. The polymorphisms in the region of the DC alpha and related DX alpha genes were studied with Southern blots of DNA from a set of mostly homozygous HLA-D-typing cell lines. With EcoRI, the band patterns for the DC alpha gene corresponded to the major cross-reactive HLA-DR serotypes associated with DC (namely MT1, -2, and -3) while the DX alpha band was invariant. Both genes were polymorphic with the enzyme Taq I. Within some DR types additional polymorphic variation was detected at the DNA level, implying the existence of subtypes. The pattern of polymorphisms for DC alpha, and to a lesser extent for DX alpha, suggests that these genes may play an important role in certain HLA-D associations with disease. Images PMID:6328517

  1. Molecular characterization of an. alpha. sub 2B -adrenergic receptor

    SciTech Connect

    Harrison, J.K.; Dewan Zeng; D'Angelo, D.D.; Tucker, A.L.; Zhihong Lu; Barber, C.M.; Lynch, K.R. )

    1990-02-26

    {alpha}{sub 2}-Adrenergic receptors comprise a heterogeneous population based on pharmacologic and molecular evidence. The authors have isolated a cDNA clone (pRNG{alpha}2) encoding a previously undescribed third subtype of an {alpha}{sub 2}-adrenergic receptor from a rat kidney cDNA library. The library was screened with an oligonucleotide encoding a highly conserved region found in all biogenic amine receptors described to date. The deduced amino acid sequence displays many features of G-protein coupled receptors with exception of the absence of the consensus N-linked glycosylation site at the amino terminus. Membranes prepared from COS-1 cells transfected with pRNG{alpha}2 display high affinity and saturable binding to {sup 3}H-rauwolscine (K{sub d}=2 nM).Competition curve data analysis shows that pRNG{alpha}2 protein binds to a variety of adrenergic drugs with the following rank order of potency: yohimbine {ge} cholorpromazine > prazosin {ge} clonidine > norepinephrine {ge} oxymetazoline. pRNG{alpha}2 RNA accumulates in both adult rat kidney and rat neonatal lung (predominant species is 4.0 kb). They conclude that pRNG{alpha}2 likely represents a cDNA for the {alpha}{sub 2B}-adrenergic receptor.

  2. Human hTM. cap alpha. gene: Expression in muscle and nonmuscle tissue

    SciTech Connect

    MacLeod, A.R.; Gooding, C.

    1988-01-01

    The authors isolated a cDNA clone from a human skeletal muscle library which contains the complete protein-coding sequence of a skeletal muscle ..cap alpha..-tropomyosin. This cDNA sequence defines a fourth human tropomyosin gene, the hTM..cap alpha.. gene, which is distinct from the hTM/sub nm/ gene encoding a closely related isoform of skeletal muscle ..cap alpha..-tropomyosin. In cultured human fibroblasts, the hTM..cap alpha.. gene encodes both skeletal-muscle- and smooth-muscle-type ..cap alpha..-tropomyosins by using an alternative mRNA-splicing mechanism.

  3. Iodine Satellite

    NASA Technical Reports Server (NTRS)

    Kamhawi, Hani; Dankanich, John; Martinez, Andres; Petro, Andrew

    2015-01-01

    The Iodine Satellite (iSat) spacecraft will be the first CubeSat to demonstrate high change in velocity from a primary propulsion system by using Hall thruster technology and iodine as a propellant. The mission will demonstrate CubeSat maneuverability, including plane change, altitude change and change in its closest approach to Earth to ensure atmospheric reentry in less than 90 days. The mission is planned for launch in fall 2017. Hall thruster technology is a type of electric propulsion. Electric propulsion uses electricity, typically from solar panels, to accelerate the propellant. Electric propulsion can accelerate propellant to 10 times higher velocities than traditional chemical propulsion systems, which significantly increases fuel efficiency. To enable the success of the propulsion subsystem, iSat will also demonstrate power management and thermal control capabilities well beyond the current state-of-the-art for spacecraft of its size. This technology is a viable primary propulsion system that can be used on small satellites ranging from about 22 pounds (10 kilograms) to more than 1,000 pounds (450 kilograms). iSat's fuel efficiency is ten times greater and its propulsion per volume is 100 times greater than current cold-gas systems and three times better than the same system operating on xenon. iSat's iodine propulsion system consists of a 200 watt (W) Hall thruster, a cathode, a tank to store solid iodine, a power processing unit (PPU) and the feed system to supply the iodine. This propulsion system is based on a 200 W Hall thruster developed by Busek Co. Inc., which was previously flown using xenon as the propellant. Several improvements have been made to the original system to include a compact PPU, targeting greater than 80 percent reduction in mass and volume of conventional PPU designs. The cathode technology is planned to enable heaterless cathode conditioning, significantly increasing total system efficiency. The feed system has been designed to

  4. Navy satellite communications

    NASA Astrophysics Data System (ADS)

    Clair, William C.

    1992-03-01

    The history, current status, and future plans of Navy satellite communications are reviewed. Particular attention is given to Fleet Satellites; the Defense Satellite Communications System; the International Maritime Satellite; Core Command and Control (Core C2), General Purpose Communications, and Navy EHF SATCOM program; and the Copernicus architecture.

  5. Tethered Communication Satellites

    NASA Technical Reports Server (NTRS)

    Von Tiesenhausen, G.

    1986-01-01

    Report describes concept for placing several communication satellites in geostationary orbit without taking up more space than assigned to single satellite. Proposed scheme eases orbital crowding more economically than space platforms. Concept requires minimal redesign of existing satellites and accommodates many satellites in just one orbital slot. System much lighter in weight than geostationary platform and easier and more economical to transport.

  6. cap alpha. -skeletal and. cap alpha. -cardiac actin genes are coexpressed in adult human skeletal muscle and heart

    SciTech Connect

    Gunning, P.; Ponte, P.; Blau, H.; Kedes, L.

    1983-11-01

    The authors determined the actin isotypes encoded by 30 actin cDNA clones previously isolated from an adult human muscle cDNA library. Using 3' untranslated region probes, derived from ..cap alpha.. skeletal, ..beta..- and ..gamma..-actin cDNAs and from an ..cap alpha..-cardiac actin genomic clone, they showed that 28 of the cDNAs correspond to ..cap alpha..-skeletal actin transcripts. Unexpectedly, however, the remaining two cDNA clones proved to derive from ..cap alpha..-cardiac actin mRNA. Sequence analysis confirmed that the two skeletal muscle ..cap alpha..-cardiac actin cDNAs are derived from transcripts of the cloned ..cap alpha..-cardiac actin gene. Comparison of total actin mRNA levels in adult skeletal muscle and adult heart revealed that the steady-state levels in skeletal muscle are about twofold greater, per microgram of total cellular RNA, than those in heart. Thus, in skeletal muscle and in heart, both of the sarcomeric actin mRNA isotypes are quite abundant transcripts. They conclude that ..cap alpha..-skeletal and ..cap alpha..-cardiac actin genes are coexpressed as an actin pair in human adult striated muscles. Since the smooth-muscle actins (aortic and stomach) and the cytoplasmic actins (..beta.. and ..gamma..) are known to be coexpressed in smooth muscle and nonmuscle cells, respectively, they postulate that coexpression of actin pairs may be a common feature of mammalian actin gene expression in all tissues.

  7. Outer planet satellites

    SciTech Connect

    Schenk, P.M. )

    1991-01-01

    Recent findings on the outer-planet satellites are presented, with special consideration given to data on the rheologic properties of ice on icy satellites, the satellite surfaces and exogenic processes, cratering on dead cratered satellites, volcanism, and the interiors of outer-planet satellites. Particular attention is given to the state of Titan's surface and the properties of Triton, Pluto, and Charon. 210 refs.

  8. A search for Lyman-alpha emission in beta Lyrae from Copernicus

    NASA Technical Reports Server (NTRS)

    Kondo, Y.; Mccluskey, G. E., Jr.

    1974-01-01

    High-resolution (0.2 A) spectrophotometric observations of the complex eclipsing binary beta Lyrae were obtained with the Princeton Telescope Spectrometer on the Copernicus satellite. We discuss the search for L-alpha emission in beta Lyrae and compare the Copernicus results with the OAO-2 observations of the same binary system. The possible L-alpha emission features observed from OAO-2 are identified as blends of the emission lines of other elements in the vicinity of L-alpha.

  9. [Interferon alpha antibodies show no cross reactions with typical autoantibodies].

    PubMed

    Görg, S; Klouche, M; Wilhelm, D; Kirchner, H

    1993-04-01

    Patients treated with natural human interferon alpha develop anti-interferon antibodies (IFN-AB) only in very rare cases. By contrast, patients with autoimmune disorders are able to generate high-titered IFN-AB against endogenous interferon alpha. One explanation for the development of auto-IFN-AB could be cross-reactivity with typical autoimmune antigens. We investigated the cross-reactivity of 3 high-titered IgG IFN-AB of female autoimmune patients (aged 32, 36, 74 years; two severe cases of SLE, one case of autoimmune thyroiditis) as well as 25 low-titered natural IgM IFN-AB of healthy blood donors (aged 19-48 years). Typical autoimmune antigens including dsDNA, ENA, as well as natural interferon beta and recombinant interferon gamma are not able to inhibit binding of IFN-AB to interferon alpha in an ELISA test system. Preincubation of sera containing either dsDNA antibodies (dsDNA-AB) (24 patients), thyroid peroxidase (TPO-AB) (9 patients) or thyroglobulin (TG-AB) (12 patients) with interferon alpha resulted in no change in the respective autoantibody titer. These data suggest that there is no cross-reactivity between IFN-alpha-AB and dsDNA-AB, TPO-AB or TG-AB. Thus, an explanation for the occurrence of IFN-AB in autoimmune disorders cannot be found in a cross-reaction between interferon alpha with typical autoimmune antigens.

  10. Determination of Alpha

    NASA Astrophysics Data System (ADS)

    Chmeissani, Mokhtar Abdallah

    The determination of the strong coupling constant alpha_ s, using Energy-Energy Correlation Asymmetry and jet mass difference with Mark II data at SLC (91 GeV) is presented. In Energy-Energy Correlation Asymmetry (EECA), we used the same systematic procedure used to determine alpha_ s with MARK II data at PEP (29 GeV). The chi^2 fit suggests that alpha_ s = 0.119 +/- 0.007(stat.) +/- 0.007(syst.). In addition, we used the EECA method to determine the QCD scale parameter Lambda_{LLA}. The chi^2 fit suggests that Lambda _{LLA} = 420 +/- 90(stat.) MeV. In the jet mass difference method, the determination of alpha_ s is based on QCD calculations up to 2nd order. We showed that in this method we are able to reproduce the value of alpha _ s from a Monte Carlo sample to a very high accuracy. The result with this method is alpha _ s = 0.134 +/- 0.085(stat.) +/- 0.004(syst.). The two values of alpha_ s presented in this work are in agreement within the error bars and in a good agreement with recent results of alpha_ s published from other e^+e^- experiments.

  11. Event counting alpha detector

    DOEpatents

    Bolton, R.D.; MacArthur, D.W.

    1996-08-27

    An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

  12. Event counting alpha detector

    DOEpatents

    Bolton, Richard D.; MacArthur, Duncan W.

    1996-01-01

    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  13. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  14. Imaging alpha particle detector

    DOEpatents

    Anderson, David F.

    1985-01-01

    A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  15. Galileo satellite antenna modeling

    NASA Astrophysics Data System (ADS)

    Steigenberger, Peter; Dach, Rolf; Prange, Lars; Montenbruck, Oliver

    2015-04-01

    The space segment of the European satellite navigation system Galileo currently consists of six satellites. Four of them belong to the first generation of In-Orbit Validation (IOV) satellites whereas the other two are Full Operational Capability (FOC) satellites. High-precision geodetic applications require detailed knowledge about the actual phase center of the satellite and receiver antenna. The deviation of this actual phase center from a well-defined reference point is described by phase center offsets (PCOs) and phase center variations (PCVs). Unfortunately, no public information is available about the Galileo satellite antenna PCOs and PCVs, neither for the IOV, nor the FOC satellites. Therefore, conventional values for the IOV satellite antenna PCOs have been adopted for the Multi-GNSS experiment (MGEX) of the International GNSS Service (IGS). The effect of the PCVs is currently neglected and no PCOs for the FOC satellites are available yet. To overcome this deficiency in GNSS observation modeling, satellite antenna PCOs and PCVs are estimated for the Galileo IOV satellites based on global GNSS tracking data of the MGEX network and additional stations of the legacy IGS network. Two completely independent solutions are computed with the Bernese and Napeos software packages. The PCO and PCV values of the individual satellites are analyzed and the availability of two different solutions allows for an accuracy assessment. The FOC satellites are built by a different manufacturer and are also equipped with another type of antenna panel compared to the IOV satellites. Signal transmission of the first FOC satellite has started in December 2014 and activation of the second satellite is expected for early 2015. Based on the available observations PCO estimates and, optionally PCVs of the FOC satellites will be presented as well. Finally, the impact of the new antenna model on the precision and accuracy of the Galileo orbit determination is analyzed.

  16. Production of alpha-amylase by yeast

    SciTech Connect

    Thomse, K.K.

    1987-01-01

    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  17. Stereo Measurements from Satellites

    NASA Technical Reports Server (NTRS)

    Adler, R.

    1982-01-01

    The papers in this presentation include: 1) 'Stereographic Observations from Geosynchronous Satellites: An Important New Tool for the Atmospheric Sciences'; 2) 'Thunderstorm Cloud Top Ascent Rates Determined from Stereoscopic Satellite Observations'; 3) 'Artificial Stereo Presentation of Meteorological Data Fields'.

  18. Satellite-Delivered Learning.

    ERIC Educational Resources Information Center

    Arnall, Gail C.

    1987-01-01

    Discusses the application of satellite information delivery to training. Describes a new trend, horizontal programming. Also discusses vertical programming and in-house production of training materials. Lists vendors of satellite-based training. (CH)

  19. Geology of icy satellites

    NASA Technical Reports Server (NTRS)

    Mckinnon, W. B.

    1985-01-01

    The geology of the major icy satellites of Jupiter, Saturn, Uranus, and Neptune is discussed in terms of the four major processes that shape icy satellite surfaces: impact cratering, volcanism, tectonism, and interactions with planetary magnetospheres and solar radiation. The role of these processes in creating the differences that exist among the satellites, in particular the orderly progression of geological properties in the Jovian satellites, is emphasized. Important questions left open after the Voyager missions are summarized.

  20. Evidence implying DNA polymerase beta function in excision repair.

    PubMed

    Siedlecki, J A; Szyszko, J; Pietrzykowska, I; Zmudzka, B

    1980-01-25

    Comparison was made of the ability of calf thymus DNA polymerases alpha and beta to replicate the following templates: native E. coli CR-34 DNA (T-DNA), calf thymus DNA activated by DNase I (act.DNA), BU-DNA (from E. coli CR-34 cells cultured on BUdR-containing medium) with damages resulting from incomplete excision repair, as well as thermally denatured act.DNA and BU-DNA (s.s.act.DNA and s.s.BU-DNA). 3H-TTP incorporation during extensive replication of act.DNA was similar for both enzymes, being, as expected, 40 times higher than for T-DNA. Likewise, the differences in the yield of the s.s.act.DNA or s.s.BU-DNA replication between both enzymes were negligible. In contrast, damaged native DNA was 6 - 30 times more extensively replicated by DNA polymerase beta than alpha. We propose that this is due to the greater ability of DNA polymerase beta compared with alpha to replicate single-stranded gaps, the presence of which is more likely in damaged BU-DNA than in T-DNA and act.DNA.

  1. Magnetospheres: Jupiter, Satellite Interactions

    NASA Astrophysics Data System (ADS)

    Neubauer, F.; Murdin, P.

    2000-11-01

    Most of the satellites of Jupiter, notably the large Galilean satellites Io, Europa, Ganymede and Callisto (see JUPITER: SATELLITES), orbit deep inside the magnetosphere of Jupiter (see JUPITER: MAGNETOSPHERE) and are therefore immersed in the flow of magnetospheric plasma (made of a mixture of electrons and ions) and subjected to an interaction with the strong Jovian magnetic field. These intera...

  2. The alpha channeling effect

    SciTech Connect

    Fisch, N. J.

    2015-12-10

    Alpha particles born through fusion reactions in a tokamak reactor tend to slow down on electrons, but that could take up to hundreds of milliseconds. Before that happens, the energy in these alpha particles can destabilize on collisionless timescales toroidal Alfven modes and other waves, in a way deleterious to energy confinement. However, it has been speculated that this energy might be instead be channeled into useful energy, so as to heat fuel ions or to drive current. Such a channeling needs to be catalyzed by waves Waves can produce diffusion in energy of the alpha particles in a way that is strictly coupled to diffusion in space. If these diffusion paths in energy-position space point from high energy in the center to low energy on the periphery, then alpha particles will be cooled while forced to the periphery. The energy from the alpha particles is absorbed by the wave. The amplified wave can then heat ions or drive current. This process or paradigm for extracting alpha particle energy collisionlessly has been called alpha channeling. While the effect is speculative, the upside potential for economical fusion is immense. The paradigm also operates more generally in other contexts of magnetically confined plasma.

  3. [Chromosomal localization and evolutionary age of satellite DNAs of Mustelidae].

    PubMed

    Lushnikova, T P; Grafodatskiĭ, A S; Romashchenko, A G; Radzhabli, S I

    1988-12-01

    DNA reassociation kinetics were studied in the European mink (Mustela lutreola), the American mink (M. vison), the marbled polecat (Vormela peregusna). Variation in DNA quantity and heterochromatin amount occurs in connection with changes in the size of all kinetic fractions. Moderately repetitive genome component is the most variable in these three species. Cryptic CsCl satellite of the stoat (M. erminea), Ag+/Cs2SO4 satellites of the M. vison, V. peregusna were used for in situ homo- and heterologous hybridizations. Satellite DNAs revealed may be classified for the evolution age and chromosomal location type. More ancient satellite DNAs were dispersed in carnivors or mammalian genomes. Mustelids' specific satellites are concentrated in heterochromatic chromosome regions. The evolutionary implications of these findings are discussed. PMID:3250906

  4. Mitochondrial DNA in yeast and some mammalian species.

    PubMed

    Corneo, G; Moore, C; Sanadi, D R; Grossman, L I; Marmur, J

    1966-02-11

    Yeast DNA, in a cesium chloride density gradient, shows a minor or satellite band with a density lower than that of the main nuclear component. The DNA isolated from purified mitochondria of yeasts corresponds in density to this satellite band. In solution, this DNA more easily undergoes renaturation as compared to DNA from cell nuclei. The ease of this renaturation is presumably due to a homogeneity greater than that of nuclear DNA. Mitochondrial DNA isolated from several mammalian species has the same or higher density than nuclear DNA, but differs in its ready renaturability.

  5. The G protein alpha o subunit alters morphology, growth kinetics, and phospholipid metabolism of somatic cells.

    PubMed Central

    Bloch, D B; Bonventre, J V; Neer, E J; Seidman, J G

    1989-01-01

    The physiological role of the alpha o subunit of guanine nucleotide-binding (G) protein was investigated with a murine adrenal cell line (Y1) transfected with a rat alpha o cDNA cloned in a retroviral expression vector. The parental cell line lacked detectable alpha o subunit. Expression of the alpha o cDNA in transfected cell lines was confirmed by Western blot (immunoblot) analysis. The rat alpha o subunit interacted with murine beta and gamma subunits and associated with cell membranes. Y1 cells containing large amounts of alpha o subunit had altered cellular morphology and reduced rate of cell division. In addition, GTP-gamma S-stimulated release of arachidonic acid from these cells was significantly increased compared with that in control cells. The alpha o subunit appears directly or indirectly to regulate cellular proliferation, morphology, and phospholipid metabolism. Images PMID:2511433

  6. Survey: National Environmental Satellite Service

    NASA Technical Reports Server (NTRS)

    1977-01-01

    The national Environmental Satellite Service (NESS) receives data at periodic intervals from satellites of the Synchronous Meteorological Satellite/Geostationary Operational Environmental Satellite series and from the Improved TIROS (Television Infrared Observational Satellite) Operational Satellite. Within the conterminous United States, direct readout and processed products are distributed to users over facsimile networks from a central processing and data distribution facility. In addition, the NESS Satellite Field Stations analyze, interpret, and distribute processed geostationary satellite products to regional weather service activities.

  7. Fundamentals of satellite navigation

    NASA Astrophysics Data System (ADS)

    Stiller, A. H.

    The basic operating principles and capabilities of conventional and satellite-based navigation systems for air, sea, and land vehicles are reviewed and illustrated with diagrams. Consideration is given to autonomous onboard systems; systems based on visible or radio beacons; the Transit, Cicada, Navstar-GPS, and Glonass satellite systems; the physical laws and parameters of satellite motion; the definition of time in satellite systems; and the content of the demodulated GPS data signal. The GPS and Glonass data format frames are presented graphically, and tables listing the GPS and Glonass satellites, their technical characteristics, and the (past or scheduled) launch dates are provided.

  8. alpha-thalassemia mutations in Khuzestan Province, Southwest Iran.

    PubMed

    Zandian, Khodamorad; Nateghi, Jamal; Keikhaie, Bijan; Pedram, Mohammad; Hafezi-Nejad, Nima; Hadavi, Valeh; Oberkanins, Christian; Azarkeivan, Azita; Law, Hai-Yang; Najmabadi, Hossein

    2008-01-01

    Although alpha-thalassemia (alpha-thal) is the most common hereditary hemoglobin (Hb) disorder in Iran, no comprehensive data are so far available on the prevalence of the disease in the province of Khuzestan in Southwest Iran. This study investigates the spectrum of alpha-thal mutations in this region. One hundred and twenty-one subjects from Khuzestan Province, Iran, were initially tested for the three most common Iranian alpha-thal mutations (- alpha3.7, -alpha4.2, and --MED) by gap-polymerase chain reaction (gap-PCR). Reverse hybridization test strips and DNA sequencing were used to identify additional alpha-globin mutations. A total of 131 mutated alpha-globin alleles were identified in these patients. Of the 13 mutations that were detected in Khuzestan Province, Iran, the - alpha3.7 single gene deletion was the most frequently identified variant, representing 62.6% of the total; we also observed significant numbers of individuals with compound heterozygous mutations. On the basis of our results, we strongly recommend screening for the most common mutations to improve the molecular diagnosis of anemia in this region.

  9. 3D timelapse analysis of muscle satellite cell motility.

    PubMed

    Siegel, Ashley L; Atchison, Kevin; Fisher, Kevin E; Davis, George E; Cornelison, D D W

    2009-10-01

    Skeletal muscle repair and regeneration requires the activity of satellite cells, a population of myogenic stem cells scattered throughout the tissue and activated to proliferate and differentiate in response to myotrauma or disease. While it seems likely that satellite cells would need to navigate local muscle tissue to reach damaged areas, relatively little data on such motility exist, and most studies have been with immortalized cell lines. We find that primary satellite cells are significantly more motile than myoblast cell lines, and that adhesion to laminin promotes primary cell motility more than fourfold over other substrates. Using timelapse videomicroscopy to assess satellite cell motility on single living myofibers, we have identified a requirement for the laminin-binding integrin alpha 7 beta 1 in satellite cell motility, as well as a role for hepatocyte growth factor in promoting directional persistence. The extensive migratory behavior of satellite cells resident on muscle fibers suggests caution when determining, based on fixed specimens, whether adjacent cells are daughters from the same mother cell. We also observed more persistent long-term contact between individual satellite cells than has been previously supposed, potential cell-cell attractive and repulsive interactions, and migration between host myofibers. Based on such activity, we assayed for expression of "pathfinding" cues, and found that satellite cells express multiple guidance ligands and receptors. Together, these data suggest that satellite cell migration in vivo may be more extensive than currently thought, and could be regulated by combinations of signals, including adhesive haptotaxis, soluble factors, and guidance cues.

  10. Alpha One Foundation

    MedlinePlus

    ... related programs More News Our Number One Goal: Find a cure for Alpha-1. Website Sponsors Helpful Links 3300 Ponce de Leon Blvd. Coral Gables, FL 33134 Phone: (877) 228-7321 Email: info@alphaone.org Copyright ...

  11. Geosynchronous satellite collision avoidance

    NASA Technical Reports Server (NTRS)

    Fraser, W.

    1985-01-01

    The increases in the number of satellite systems, the growing dependency on these systems, and the potentially hazardous conjunctions in space, dictates careful management of satellite positions. The potential for satellite collision increases as more objects are placed in orbit. At geosynchronous altitudes active satellites maintain fixed longitudinal station-keeping control while inactive satellites and debris generally drift around the globe or oscillate about two geopotential stable points. Portions of the total objects in geosynchronous orbit are tracked by ground stations while a significant number of additional pieces of space debris regularly pass through geosynchronous orbit altitudes. The probability of an operational satellite colliding with another satellite or a piece of space debris will increase in the number of space objects, their sizes, and on-orbit lifetimes.

  12. Replication bypass and mutagenic effect of alpha-deoxyadenosine site-specifically incorporated into single-stranded vectors.

    PubMed Central

    Shimizu, H; Yagi, R; Kimura, Y; Makino, K; Terato, H; Ohyama, Y; Ide, H

    1997-01-01

    alpha-2'-Deoxyadenosine (alpha) is a major adenine lesion produced by gamma-ray irradiation of DNA under anoxic conditions. In this study, single-stranded recombinant M13 vectors containing alpha were constructed and transfected into Escherichia coli to assess lethal and mutagenic effects of this lesion. The data for alpha were further compared with those obtained with M13 vectors containing normal A or a model abasic site (F) at the same site. The transfection assay revealed that alpha constituted a moderate block to DNA replication. The in vivo replication capacity to pass through alpha was approximately 20% relative to normal A, but 20-fold higher than that of F constituting an almost absolute replication block. Similar data were obtained by in vitro replication of oligonucleotide templates containing alpha or F by E.coli DNA polymerase I. The mutagenic consequence of replicating M13 DNA containing alpha was analyzed by direct DNA sequencing of progeny phage. Mutagenesis was totally targeted at the site of alpha introduced into the vector. Mutation was exclusively a single nucleotide deletion and no base substitutions were detected. The deletion frequency associated alpha was dependent on the 3'-nearest neighbor base: with the 3'-nearest neighbor base T mutation (deletion) frequency was 26%, whereas 1% with the 3'-nearest neighbor base G. A possible mechanism of the single nucleotide deletion associated with alpha is discussed on the basis of the misinsertion-strand slippage model. PMID:9016601

  13. Xenopus laevis alpha and beta thyroid hormone receptors.

    PubMed Central

    Yaoita, Y; Shi, Y B; Brown, D D

    1990-01-01

    The Xenopus laevis genome encodes two genes for the alpha (TR alpha) and two genes for the beta (TR beta) thyroid hormone receptors. The two TR alpha genes closely resemble their rat, human, and chicken counterparts. No alternatively spliced TR alpha cDNA clones were found in the 5' untranslated region (5' UTR). In contrast, complex alternative splicing of TR beta mRNA occurs within the 5' UTR as well as possible alternative transcriptional start sites. As many as eight exons encoding mainly the 5' UTR are alternatively spliced, giving rise to at least two amino termini for each of the two TR beta proteins. The 5' UTR of transcripts from both TR alpha and TR beta genes contain multiple AUG sequences with short open reading frames suggesting translational control mechanisms might play a role in expression of TR genes. Images PMID:2402492

  14. Potential use of buccal smears for rapid diagnosis of autosomal trisomy or chromosomal sex in newborn infants using DNA probes

    SciTech Connect

    Harris, C.; Clark, K.; Lazarski, K.; Wilkerson, C.; Meisner, L. |

    1994-12-01

    Buccal smears from 3 women and 1 man were probed with alpha satellite DNA probes for chromosomes 8, 18, X, and Y. Buccal smears were also collected from an adolescent phenotypic female with uterine agenesis, as well as from newborn infants with suspected trisomy 18 and trisomy 21. The clinical cases were confirmed with conventional cytogenetic studies of peripheral lymphocytes. Overall probe efficiency at detecting expected chromosome number in interphase cells was found to be 71% {+-} 6.8%. Higher than expected n-1 signal numbers may be due to karyopyknotic intermediate epithelial cells present in all collected samples. Overall probe efficiency was found to be consistent using alpha satellite and cosmid probes, both of which accurately reflected the modal copy number of the target chromosomes. False trisomy was less than 1%. This study suggests DNA probes can be used in buccal smears for rapid diagnosis of trisomies and chromosomal sex in newborns, but because of high rates of false hydropoploid signals, probed buccal smear specimens may not be accurate at diagnosing mosaicism. 9 refs., 2 figs., 1 tab.

  15. Diversity of Dicotyledenous-Infecting Geminiviruses and Their Associated DNA Molecules in Southern Africa, Including the South-West Indian Ocean Islands

    PubMed Central

    Rey, Marie E. C.; Ndunguru, Joseph; Berrie, Leigh C.; Paximadis, Maria; Berry, Shaun; Cossa, Nurbibi; Nuaila, Valter N.; Mabasa, Ken G.; Abraham, Natasha; Rybicki, Edward P.; Martin, Darren; Pietersen, Gerhard; Esterhuizen, Lindy L.

    2012-01-01

    The family Geminiviridae comprises a group of plant-infecting circular ssDNA viruses that severely constrain agricultural production throughout the temperate regions of the world, and are a particularly serious threat to food security in sub-Saharan Africa. While geminiviruses exhibit considerable diversity in terms of their nucleotide sequences, genome structures, host ranges and insect vectors, the best characterised and economically most important of these viruses are those in the genus Begomovirus. Whereas begomoviruses are generally considered to be either monopartite (one ssDNA component) or bipartite (two circular ssDNA components called DNA-A and DNA-B), many apparently monopartite begomoviruses are associated with additional subviral ssDNA satellite components, called alpha- (DNA-αs) or betasatellites (DNA-βs). Additionally, subgenomic molecules, also known as defective interfering (DIs) DNAs that are usually derived from the parent helper virus through deletions of parts of its genome, are also associated with bipartite and monopartite begomoviruses. The past three decades have witnessed the emergence and diversification of various new begomoviral species and associated DI DNAs, in southern Africa, East Africa, and proximal Indian Ocean islands, which today threaten important vegetable and commercial crops such as, tobacco, cassava, tomato, sweet potato, and beans. This review aims to describe what is known about these viruses and their impacts on sustainable production in this sensitive region of the world. PMID:23170182

  16. Diversity of dicotyledenous-infecting geminiviruses and their associated DNA molecules in southern Africa, including the South-west Indian ocean islands.

    PubMed

    Rey, Marie E C; Ndunguru, Joseph; Berrie, Leigh C; Paximadis, Maria; Berry, Shaun; Cossa, Nurbibi; Nuaila, Valter N; Mabasa, Ken G; Abraham, Natasha; Rybicki, Edward P; Martin, Darren; Pietersen, Gerhard; Esterhuizen, Lindy L

    2012-09-01

    The family Geminiviridae comprises a group of plant-infecting circular ssDNA viruses that severely constrain agricultural production throughout the temperate regions of the world, and are a particularly serious threat to food security in sub-Saharan Africa. While geminiviruses exhibit considerable diversity in terms of their nucleotide sequences, genome structures, host ranges and insect vectors, the best characterised and economically most important of these viruses are those in the genus Begomovirus. Whereas begomoviruses are generally considered to be either monopartite (one ssDNA component) or bipartite (two circular ssDNA components called DNA-A and DNA-B), many apparently monopartite begomoviruses are associated with additional subviral ssDNA satellite components, called alpha- (DNA-αs) or betasatellites (DNA-βs). Additionally, subgenomic molecules, also known as defective interfering (DIs) DNAs that are usually derived from the parent helper virus through deletions of parts of its genome, are also associated with bipartite and monopartite begomoviruses. The past three decades have witnessed the emergence and diversification of various new begomoviral species and associated DI DNAs, in southern Africa, East Africa, and proximal Indian Ocean islands, which today threaten important vegetable and commercial crops such as, tobacco, cassava, tomato, sweet potato, and beans. This review aims to describe what is known about these viruses and their impacts on sustainable production in this sensitive region of the world.

  17. Evidence for a temperature rise in the outer layers of alpha Lyrae, from Copernicus observations of Lyman-alpha

    NASA Technical Reports Server (NTRS)

    Praderie, F.; Simonneau, E.; Snow, T. P., Jr.

    1975-01-01

    Copernicus satellite observations of the Ly-alpha profiles in alpha Lyrae (Vega) are used to determine whether classical radiative-equilibrium LTE model atmospheres can fit the thermal structure in the outer layers of that star. Two plane-parallel LTE model photospheres of alpha Lyrae are considered: a line-blanketed radiative-equilibrium model with an effective temperature of 9650 K and log g of 4.05, and the same model with a temperature of 9500 K and log g of 4.0. The profiles of the Ly-alpha wings are computed, and it is found that classical LTE models are unable to predict either the observed violet wing or the red wing longwards of 1239 A, regardless of the line source function. It is concluded that the electron temperature must increase outwards over the surface value reached in radiative equilibrium.

  18. Comments on satellite meteorology from geostationary satellites

    NASA Technical Reports Server (NTRS)

    Vonderhaar, T. H.

    1982-01-01

    Examples of the use of geostationary satellites in meteorology are given. Studies of the rate of change of cumulus clouds and cloud systems and wind parameter determination from cloud motions are reviewed. Computer processed imagery products are also discussed.

  19. Alpha Particle Diagnostic

    SciTech Connect

    Fisher, Ray, K.

    2009-05-13

    The study of burning plasmas is the next frontier in fusion energy research, and will be a major objective of the U.S. fusion program through U.S. collaboration with our international partners on the ITER Project. For DT magnetic fusion to be useful for energy production, it is essential that the energetic alpha particles produced by the fusion reactions be confined long enough to deposit a significant fraction of their initial ~3.5 MeV energy in the plasma before they are lost. Development of diagnostics to study the behavior of energetic confined alpha particles is a very important if not essential part of burning plasma research. Despite the clear need for these measurements, development of diagnostics to study confined the fast confined alphas to date has proven extremely difficult, and the available techniques remain for the most part unproven and with significant uncertainties. Research under this grant had the goal of developing diagnostics of fast confined alphas, primarily based on measurements of the neutron and ion tails resulting from alpha particle knock-on collisions with the plasma deuterium and tritium fuel ions. One of the strengths of this approach is the ability to measure the alphas in the hot plasma core where the interesting ignition physics will occur.

  20. Radioimmunoassay of leukocyte (alpha) interferon and its application to some clinical conditions

    SciTech Connect

    Bernier, J.; Reuter, A.; Vrindts-Gevaert, Y.; Franchimont, P.

    1984-07-01

    A radioimmunoassay for human leukocyte interferon alpha (alpha IFN) has been developed, using tracer produced by recombinant DNA (IFLrA) and polyclonal rabbit antiserum against partially purified leukocyte IFN (PP alpha IFN). Sensitivity was 4 units/ml using sequential saturation. Only lymphoblastoid IFN showed complete cross reactivity. Serum alpha IFN concentrations were measured in normal subjects and in patients with acute viral infection, bone and joint diseases, and malignancies. Some cases in the first two groups of patients had significantly elevated serum levels compared with controls. The pharmacokinetics of alpha IFN were studied in treated cancerous patients. Radioimmunoassay and biological assay gave similar and closely correlated results.

  1. CCAAT/enhancer binding protein alpha regulates p21 protein and hepatocyte proliferation in newborn mice.

    PubMed Central

    Timchenko, N A; Harris, T E; Wilde, M; Bilyeu, T A; Burgess-Beusse, B L; Finegold, M J; Darlington, G J

    1997-01-01

    CCAAT/enhancer binding protein alpha (C/EBP alpha) is expressed at high levels in quiescent hepatocytes and in differentiated adipocytes. In cultured cells, C/EBP alpha inhibits cell proliferation in part via stabilization of the p21 protein. The role of C/EBP alpha in regulating hepatocyte proliferation in vivo is presented herein. In C/EBP alpha knockout newborn mice, p21 protein levels are reduced in the liver, and the fraction of hepatocytes synthesizing DNA is increased. Greater than 30% of the hepatocytes in C/EBP alpha knockout animals continue to proliferate at day 17 of postnatal life when cell division in wild-type littermates is low (3%). p21 protein levels are relatively high in wild-type neonates but undetectable in C/EBP alpha knockout mice. The reduction of p21 protein in the highly proliferating livers that lack C/EBP alpha suggests that p21 is responsible for C/EBP alpha-mediated control of liver proliferation in newborn mice. During rat liver regeneration, the amounts of both C/EBP alpha and p21 proteins are decreased before DNA synthesis (6 to 12 h) and then return to presurgery levels at 48 h. Although C/EBP alpha controls p21 protein levels, p21 mRNA is not influenced by C/EBP alpha in liver. Using coimmunoprecipitation and a mammalian two-hybrid assay system, we have shown the interaction of C/EBP alpha and p21 proteins. Study of p21 stability in liver nuclear extracts showed that C/EBP alpha blocks proteolytic degradation of p21. Our data demonstrate that C/EBP alpha regulates hepatocyte proliferation in newborn mice and that in liver, the level of p21 protein is under posttranscriptional control, consistent with the hypothesis that protein-protein interaction with C/EBP alpha determines p21 levels. PMID:9372966

  2. Satellite services system overview

    NASA Technical Reports Server (NTRS)

    Rysavy, G.

    1982-01-01

    The benefits of a satellite services system and the basic needs of the Space Transportation System to have improved satellite service capability are identified. Specific required servicing equipment are discussed in terms of their technology development status and their operative functions. Concepts include maneuverable television systems, extravehicular maneuvering unit, orbiter exterior lighting, satellite holding and positioning aid, fluid transfer equipment, end effectors for the remote manipulator system, teleoperator maneuvering system, and hand and power tools.

  3. Hb Mizuho or alpha 2 beta (2)68(E12)Leu----Pro in a Caucasian boy with high levels of Hb F; identification by sequencing of amplified DNA.

    PubMed

    Keeling, M M; Bertolone, S J; Baysal, E; Gu, Y C; Cepreganova, B; Wilson, J B; Huisman, T H

    1991-01-01

    Hb Mizuho, an unstable beta chain variant with a Leu----Pro substitution at position beta 68, was observed in a young Caucasian boy from Kentucky. Identification was made by sequence analyses of amplified DNA and by hybridization of amplified DNA with specific probes. The patient had high Hb F levels up to the present age of nearly 5 years; this high Hb F might in part be responsible for his condition which was considerably milder than that seen in the two patients described in earlier reports. The increased gamma chain synthesis may be due to special characteristics of the beta-globin gene cistron which are comparable to those observed in sickle cell anemia patients with a relatively mild disease. PMID:1726094

  4. Binding of receptor-recognized forms of alpha2-macroglobulin to the alpha2-macroglobulin signaling receptor activates phosphatidylinositol 3-kinase.

    PubMed

    Misra, U K; Pizzo, S V

    1998-05-29

    Ligation of the alpha2-macroglobulin (alpha2M) signaling receptor by receptor-recognized forms of alpha2M (alpha2M*) initiates mitogenesis secondary to increased intracellular Ca2+. We report here that ligation of the alpha2M signaling receptor also causes a 1. 5-2.5-fold increase in wortmannin-sensitive phosphatidylinositol 3-kinase (PI3K) activity as measured by the quantitation of phosphatidylinositol 3,4,5-trisphosphate (PIP3). PIP3 formation was alpha2M* concentration-dependent with a maximal response at approximately 50 pM ligand concentration. The peak formation of PIP3 occurred at 10 min of incubation. The alpha2M receptor binding fragment mutant K1370R which binds to the alpha2M signaling receptor activating the signaling cascade, increased PIP3 formation by 2-fold. The mutant K1374A, which binds very poorly to the alpha2M signaling receptor, did not cause any increase in PIP3 formation. alpha2M*-induced DNA synthesis was inhibited by wortmannin. 1, 2Bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acetoxymethylester a chelator of intracellular Ca2+, drastically reduced alpha2M*-induced increases in PIP3 formation. We conclude that PI3K is involved in alpha2M*-induced mitogenesis in macrophages and intracellular Ca2+ plays a role in PI3K activation. PMID:9593670

  5. Impaired coactivator activity of the Gly{sub 482} variant of peroxisome proliferator-activated receptor {gamma} coactivator-1{alpha} (PGC-1{alpha}) on mitochondrial transcription factor A (Tfam) promoter

    SciTech Connect

    Choi, Yon-Sik; Hong, Jung-Man; Lim, Sunny; Ko, Kyung Soo; Pak, Youngmi Kim . E-mail: ymkimpak@amc.seoul.kr

    2006-06-09

    Mitochondrial dysfunction may cause diabetes or insulin resistance. Peroxisome proliferation-activated receptor-{gamma} (PPAR-{gamma}) coactivator-1 {alpha} (PGC-1{alpha}) increases mitochondrial transcription factor A (Tfam) resulting in mitochondrial DNA content increase. An association between a single nucleotide polymorphism (SNP), G1444A(Gly482Ser), of PGC-1{alpha} coding region and insulin resistance has been reported in some ethnic groups. In this study, we investigated whether a change of glycine to serine at codon 482 of PGC-1{alpha} affected the Tfam promoter activity. The cDNA of PGC-1{alpha} variant bearing either glycine or serine at 482 codon was transfected into Chang human hepatocyte cells. The PGC-1{alpha} protein bearing glycine had impaired coactivator activity on Tfam promoter-mediated luciferase. We analyzed the PGC-1{alpha} genotype G1444A and mitochondrial DNA (mtDNA) copy number from 229 Korean leukocyte genomic DNAs. Subjects with Gly/Gly had a 20% lower amount of peripheral blood mtDNA than did subjects with Gly/Ser and Ser/Ser (p < 0.05). No correlation was observed between diabetic parameters and PGC-1{alpha} genotypes in Koreans. These results suggest that PGC-1{alpha} variants with Gly/Gly at 482nd amino acid may impair the Tfam transcription, a regulatory function of mitochondrial biogenesis, resulting in dysfunctional mtDNA replication.

  6. A new alpha-globin variant with increased oxygen affinity in a Swiss family: Hb Frauenfeld [alpha 138(H21)Ser-->Phe, TCC>TTC (alpha 2)].

    PubMed

    Hochuli, Michel; Zurbriggen, Karin; Schmid, Marlis; Speer, Oliver; Rochat, Philippe; Frauchiger, Beat; Kleinert, Peter; Schmugge, Markus; Troxler, Heinz

    2009-01-01

    A new alpha-globin mutation [alpha 138(H21)Ser-->Phe] was found in a 55-year-old male proband with an erythrocytosis known since his youth. Cation exchange high performance liquid chromatography (HPLC) revealed an additional peak eluting slightly before Hb A indicating the presence of a variant. The peak area of the variant was approximately one-third that of Hb A suggesting an alpha-globin variant. Matrix-assisted laser desorption ionization-time-of-flight mass spectrometry analysis confirmed the mutation at the protein level. The variant is also detectable with isoelectric focusing and reversed phase HPLC. DNA analysis revealed a heterozygous sequence mutation at codon 138 of the alpha2 gene. A C>T transition at the second nucleotide of the codon indicated a Ser-->Phe exchange. The variant showed increased oxygen affinity and was named Hb Frauenfeld.

  7. Satellite Antenna Systems

    NASA Technical Reports Server (NTRS)

    1997-01-01

    Through the Technology Affiliates Program at the Jet Propulsion Laboratory, the ACTS antenna system was transferred from experimental testing status to commercial development with KVH Industries, Inc. The ACTS design enables mobile satellite antennas to remain pointed at the satellite, regardless of the motion or vibration on which it is mounted. KVH's first product based on the ACTS design is a land-mobile satellite antenna system that will enable direct broadcast satellite television aboard moving trucks, recreational vehicles, trains, and buses. Future products could include use in broadcasting, emergency medical and military vehicles.

  8. Satellite communication antenna technology

    NASA Technical Reports Server (NTRS)

    Mittra, R. (Editor); Imbriale, W. A. (Editor); Maanders, E. J. (Editor)

    1983-01-01

    A general overview of current technology in the field of communication satellite antennas is presented. Among the topics discussed are: the design of multiple beam systems; frequency reuse; and polarization control of antenna measurements. Consideration is also given to: contour beam synthesis; dual shaped reflector synthesis; beam shaping; and offset reflector design. The applications of the above technologies to present and future generations of communications satellites is considered, with emphasis given to such systems as: the Intelsats; the Defense Satellite Communications System, (DSCS-III); Satellite Business System (SBS), and Comstar.

  9. Satellite networks for education

    NASA Technical Reports Server (NTRS)

    Singh, J. P.; Morgan, R. P.; Rosenbaum, F. J.

    1972-01-01

    Satellite based educational networking is discussed with particular attention given to the potential uses of communications satellites to help meet educational needs in the United states. Four major subject areas were covered; (1) characteristics and structure of networks, (2) definition of pressures within educational establishment that provide motivation for various types of networks, (3) examination of current educational networking status for educational radio and television, instructional television fixed services, inter- and intra-state educational communication networks, computer networks, and cable television for education, and (4) identification of possible satellite based educational telecommunication services and three alternatives for implementing educational satellite systems.

  10. DNA probe for lactobacillus delbrueckii

    SciTech Connect

    Delley, M.; Mollet, B.; Hottinger, H. )

    1990-06-01

    From a genomic DNA library of Lactobacillus delbrueckii subsp. bulgaricus, a clone was isolated which complements a leucine auxotrophy of an Escherichia coli strain (GE891). Subsequent analysis of the clone indicated that it could serve as a specific DNA probe. Dot-blot hybridizations with over 40 different Lactobacillus strains showed that this clone specifically recognized L. delbrueckii subsp. delbrueckii, bulgaricus, and lactis. The sensitivity of the method was tested by using an {alpha}-{sup 32}P-labeled probe.

  11. Far-Infrared and Millimeter Continuum Studies of K-Giants: Alpha Boo and Alpha Tau

    NASA Technical Reports Server (NTRS)

    Cohen, Martin; Carbon, Duane F.; Welch, William J.; Lim, Tanya; Forster, James R.; Goorvitch, David; Thigpen, William (Technical Monitor)

    2002-01-01

    We have imaged two normal, non-coronal, infrared-bright K-giants, alpha Boo and alpha Tau, in the 1.4-millimeter and 2.8-millimeter continuum using BIMA. These stars have been used as important absolute calibrators for several infrared satellites. Our goals are: (1) to probe the structure of their upper photospheres; (2) to establish whether these stars radiate as simple photospheres or possess long-wavelength chromospheres; and (3) to make a connection between millimeter-wave and far-infrared absolute flux calibrations. To accomplish these goals we also present ISO Long Wavelength Spectrometer (LWS) measurements of both these K-giants. The far-infrared and millimeter continuum radiation is produced in the vicinity of the temperature minimum in a Boo and a Tau, offering a direct test of the model photospheres and chromospheres for these two cool giants. We find that current photospheric models predict fluxes in reasonable agreement with those observed for those wavelengths which sample the upper photosphere, namely less than or equal to 170 micrometers in alpha Tau and less than or equal to 125 micrometers in alpha Boo. It is possible that alpha Tau is still radiative as far as 0.9 - 1.4 millimeters. We detect chromospheric radiation from both stars by 2.8 millimeters (by 1.4 millimeters in alpha Boo), and are able to establish useful bounds on the location of the temperature minimum. An attempt to interpret the chromospheric fluxes using the two-component "bifurcation model" proposed by Wiedemann et al. (1994) appears to lead to a significant contradiction.

  12. Systemic Targeted Alpha Radiotherapy for Cancer

    PubMed Central

    Allen, BJ

    2013-01-01

    Background: The fundamental principles of internal targeted alpha therapy forcancer were established many decades ago.The high linear energy transfer (LET) ofalpha radiation to the targeted cancer cellscauses double strand breaks in DNA. Atthe same time, the short range radiation spares adjacent normal tissues. This targeted approach complements conventional external beam radiotherapy and chemotherapy. Such therapies fail on several fronts, such as lack of control of some primary cancers (e.g. glioblastoma multiforme) and to inhibit the development of lethal metastaticcancer after successful treatment of the primary cancer. Objective: This review charts the developing role of systemic high LET, internalradiation therapy. Method: Targeted alpha therapy is a rapidly advancing experimental therapy thatholds promise to deliver high cytotoxicity to targeted cancer cells. Initially thoughtto be indicated for leukemia and micrometastases, there is now evidence that solidtumors can also be regressed. Results: Alpha therapy may be molecular or physiological in its targeting. Alphaemitting radioisotopes such as Bi-212, Bi-213, At-211 and Ac-225 are used to labelmonoclonal antibodies or proteins that target specific cancer cells. Alternatively, Radium-233 is used for palliative therapy of breast and prostate cancers because of its bone seeking properties. Conclusion: Preclinical studies and clinical trials of alpha therapy are discussedfor leukemia, lymphoma, melanoma, glioblastoma multiforme, bone metastases, ovarian cancer, pancreatic cancer and other cancers. PMID:25505750

  13. Cytokine therapeutics: lessons from interferon alpha.

    PubMed Central

    Gutterman, J U

    1994-01-01

    Cytokines are soluble proteins that allow for communication between cells and the external environment. Interferon (IFN) alpha, the first cytokine to be produced by recombinant DNA technology, has emerged as an important regulator of growth and differentiation, affecting cellular communication and signal transduction pathways as well as immunological control. This review focuses on the biological and clinical activities of the cytokine. Originally discovered as an antiviral substance, the efficacy of IFN-alpha in malignant, viral, immunological, angiogenic, inflammatory, and fibrotic diseases suggests a spectrum of interrelated pathophysiologies. The principles learned from in vivo studies will be discussed, particularly hairy cell leukemia, chronic myelogenous leukemia, certain angiogenic diseases, and hepatitis. After the surprising discovery of activity in a rare B-cell neoplasm, IFN-alpha emerged as a prototypic tumor suppressor protein that represses the clinical tumorigenic phenotype in some malignancies capable of differentiation. Regulatory agencies throughout the world have approved IFN-alpha for treatment of 13 malignant and viral disorders. The principles established with this cytokine serve as a paradigm for future development of natural proteins for human disease. PMID:8108387

  14. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  15. Transforming growth factor alpha may be a physiological regulator of liver regeneration by means of an autocrine mechanism.

    PubMed Central

    Mead, J E; Fausto, N

    1989-01-01

    We investigated whether transforming growth factor alpha (TGF-alpha) is involved in hepatocyte growth responses both in vivo and in culture. During liver regeneration after partial hepatectomy in rats, TGF-alpha mRNA increased; it reached a maximum (approximately 9-fold higher than normal) at the peak of DNA synthesis. The message and the peptide were localized in hepatocytes and found in higher amounts in hepatocytes obtained from regenerating liver. TGF-alpha caused a 13-fold elevation of DNA synthesis in hepatocytes in primary culture and was slightly more effective than epidermal growth factor. TGF-beta blocked TGF-alpha stimulation when added either simultaneously with TGF-alpha or a day later. TGF-alpha message increased in hepatocytes stimulated to undergo DNA synthesis by TGF-alpha or epidermal growth factor, and the peptide was detected in the culture medium by RIA. In the regenerating liver, the increase in TGF-alpha mRNA during the first day after partial hepatectomy coincided with an increase in epidermal growth factor/TGF-alpha receptor mRNA and a decrease (already reported) in the number of these receptors. We conclude that TGF-alpha may function as a physiological inducer of hepatocyte DNA synthesis during liver regeneration by means of an autocrine mechanism and that its stimulatory effects in this growth process are balanced by the inhibitory action of TGF-beta 1. Images PMID:2922399

  16. Bipolar cells of the chick retina containing alpha-bungarotoxin-sensitive nicotinic acetylcholine receptors.

    PubMed

    Hamassaki-Britto, D E; Brzozowska-Prechtl, A; Karten, H J; Lindstrom, J M

    1994-01-01

    Two cDNA clones for nicotinic acetylcholine receptor (nAChR) subunits sensitive to alpha-bungarotoxin (alpha-Bgt) have been isolated, the so-called alpha-Bgt binding proteins alpha 1 (or alpha 7 nAChR subunit) and alpha 2 (or alpha 8 nAChR subunit). Immunohistochemical experiments have shown that both alpha 7 and alpha 8 subunits, as well as subunits insensitive to alpha-Bgt (beta 2 and alpha 3), are present in amacrine and ganglion cells of the chick retina. However, only the alpha 8 subunit was observed in presumptive bipolar cells. The present study investigated in detail the pattern of distribution of the bipolar cells containing the alpha 8 nAChR subunit and its relation to the pattern of distribution of bipolar cells immunoreactive to protein kinase C (PKC). Presumptive alpha 8- and PKC-like immunoreactive (alpha 8-LI and PKC-LI) bipolar cells were observed sending their dendrites to the outer plexiform layers and their axons to the inner plexiform layer. Whereas alpha 8-LI bipolar cells corresponded to 40-53% of the whole population of bipolar cells, PKC-LI bipolar cells represented only 6-8% of the same population. The soma sizes of the alpha 8-LI bipolar cells were slightly smaller (mean +/- S.D.; 4.9 +/- 0.8 microns) than the soma sizes of the PKC-LI bipolar cells (5.4 +/- 0.9 microns). Double-labeling experiments indicated that probably all PKC-LI bipolar cells also contain alpha 8-LI. This indicates that two distinct groups of cholinoceptive bipolar cells exist in the chick retina, one that contains PKC-LI, and another one that does not.

  17. Portable alpha spectrometer.

    PubMed

    Martín Sánchez, A; de la Torre Pérez, J

    2012-09-01

    Many portable devices have been designed to detect γ-rays or alpha and beta particles. Most of the α-particle detectors give the total count as a result, without identifying the radionuclides existing in the sample. The development of a device allowing rapid and straightforward α-particle spectrometry would be very useful for detecting the radioactive contents of unknown samples. This work describes the construction of a portable device using silicon semiconductor detectors designed to rapidly detect and possibly identify alpha-emitting radionuclides.

  18. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  19. Analysis of the largest tandemly repeated DNA families in the human genome

    PubMed Central

    Warburton, Peter E; Hasson, Dan; Guillem, Flavia; Lescale, Chloe; Jin, Xiaoping; Abrusan, Gyorgy

    2008-01-01

    Background Tandemly Repeated DNA represents a large portion of the human genome, and accounts for a significant amount of copy number variation. Here we present a genome wide analysis of the largest tandem repeats found in the human genome sequence. Results Using Tandem Repeats Finder (TRF), tandem repeat arrays greater than 10 kb in total size were identified, and classified into simple sequence e.g. GAATG, classical satellites e.g. alpha satellite DNA, and locus specific VNTR arrays. Analysis of these large sequenced regions revealed that several "simple sequence" arrays actually showed complex domain and/or higher order repeat organization. Using additional methods, we further identified a total of 96 additional arrays with tandem repeat units greater than 2 kb (the detection limit of TRF), 53 of which contained genes or repeated exons. The overall size of an array of tandem 12 kb repeats which spanned a gap on chromosome 8 was found to be 600 kb to 1.7 Mbp in size, representing one of the largest non-centromeric arrays characterized. Several novel megasatellite tandem DNA families were observed that are characterized by repeating patterns of interspersed transposable elements that have expanded presumably by unequal crossing over. One of these families is found on 11 different chromosomes in >25 arrays, and represents one of the largest most widespread megasatellite DNA families. Conclusion This study represents the most comprehensive genome wide analysis of large tandem repeats in the human genome, and will serve as an important resource towards understanding the organization and copy number variation of these complex DNA families. PMID:18992157

  20. A Survey of Geosynchronous Satellite Glints

    NASA Astrophysics Data System (ADS)

    Vrba, F.; Hutter, D.; Shankland, P.; Armstrong, J.; Schmitt, H.; Hindsley, R.; Divittorio, M.; Benson, J.

    Artificial satellites have characteristic diffuse reflected-light signatures as they are illuminated at varying phase angles by the Sun and are viewed at differing orientations by an observer. At times of favorable alignment between the satellite, observer and Sun, specular reflection off of relatively flat surfaces, such as solar panels, can cause brief increases in reflected light of several hundred times that of the nominal diffuse signature. Such events are commonly referred to as "glints". In the case of geosynchronous satellites, favorable glint alignments are due to changes in the Sun-Vehicle-Observer angle which are primarily due to the apparent motion of the Sun as the observer-satellite vector remains nearly stationary. These occur near in time to the vernal and autumnal equinoxes. While the most favorable geosynchronous satellite glint alignments are precluded by the fact that the satellites are at that time most likely to be in Earth shadow, observations of several glints have been reported in the literature. While such studies note the peak brightnesses, durations, and phase angles of individual glints, to our knowledge, no extended study of geosynchronous glint characteristics exists. Beginning with the autumnal equinox glint season of 2007 we have built on our earlier studies using the U.S. Naval Observatory, Flagstaff Station 40-inch Ritchey telescope to provide near-real-time astrometric and photometric information for use by the Navy Prototype Optical Interferometer (NPOI) team in its efforts to obtain interferometric fringes of geosynchronous satellites during a glint episode. The combined observations culminated in successful fringe measurements of DirecTV-9S during the vernal equinox 2008 and 2009 seasons (see Armstrong, et al. 2009, this conference). For our 40-inch telescope observations we used an LN2-cooled 2048x2048 CCD with standard R-band and H-alpha photometric filters, covering an area of the sky of approximately 22x22 arcmin with each

  1. DNA methylation and mRNA expression profiles in bovine oocytes derived from prepubertal and adult donors.

    PubMed

    Diederich, Mike; Hansmann, Tamara; Heinzmann, Julia; Barg-Kues, Brigitte; Herrmann, Doris; Aldag, Patrick; Baulain, Ulrich; Reinhard, Richard; Kues, Wilfried; Weissgerber, Christian; Haaf, Thomas; Niemann, Heiner

    2012-09-01

    The developmental capacity of oocytes from prepubertal cattle is reduced compared with their adult counterparts, and epigenetic mechanisms are thought to be involved herein. Here, we analyzed DNA methylation in three developmentally important, nonimprinted genes (SLC2A1, PRDX1, ZAR1) and two satellite sequences, i.e. 'bovine testis satellite I' (BTS) and 'Bos taurus alpha satellite I' (BTαS). In parallel, mRNA expression of the genes was determined by quantitative real-time PCR. Oocytes were retrieved from prepubertal calves and adult cows twice per week over a 3-week period by ultrasound-guided follicular aspiration after treatment with FSH and/or IGF1. Both immature and in vitro matured prepubertal and adult oocytes showed a distinct hypomethylation profile of the three genes without differences between the two types of donors. The methylation status of the BTS sequence changed according to the age and treatment while the methylation status of BTαS sequence remained largely unchanged across the different age and treatment groups. Relative transcript abundance of the selected genes was significantly different in immature and in vitro matured oocytes; only minor changes related to origin and treatment were observed. In conclusion, methylation levels of the investigated satellite sequences were high (>50%) in all groups and showed significant variation depending on the age, treatment, or in vitro maturation. To what extent this is involved in the acquisition of developmental competence of bovine oocytes needs further study. PMID:22733804

  2. Communications technology satellite

    NASA Technical Reports Server (NTRS)

    1976-01-01

    A description of the Communications Technology Satellite (CTS), its planned orbit, its experiments, and associated ground facilities was given. The communication experiments, to be carried out by a variety of groups in both the United States and Canada, include tele-education, tele-medicine, community interaction, data communications and broadcasting. A historical summary of communications satellite development was also included.

  3. Satellite Teleconference Final Report.

    ERIC Educational Resources Information Center

    Elgin Community Coll., IL.

    The vocational education satellite teleconference project accomplished two goals: (1) identified, acquired, copied, and distributed to the Illinois Vocational Curriculum Center 100 marketing or training videotapes for staff development and classroom use; and (2) provided from 15-25 variable time (1- to 3-hour) satellite teleconferences in four…

  4. Communication satellite technology trends

    NASA Technical Reports Server (NTRS)

    Cuccia, Louis

    1986-01-01

    A chronology of space-Earth interconnectivity is presented. The Advanced Communications Technology Satellite (ACTS) system, Land Mobile Satellite, space-Earth antennas, impact of antenna size on coverage, intersatellite links are outlined. This presentation is represented by graphs and charts only.

  5. Satellites in Schools.

    ERIC Educational Resources Information Center

    Underwood, C. I.; And Others

    1987-01-01

    Discusses the use of satellite data in physics classrooms. Describes the apparatus that can be used to collect and analyze data. Provides examples of how telemetry data transmitted by the satellite UoSAT-2 can be used not only in teaching physics, but also in geography, mathematics, and information technology. (TW)

  6. Signals from Communications Satellites.

    ERIC Educational Resources Information Center

    Thomsen, Volker

    1996-01-01

    Discusses the Doppler effect for relative motion between a source of waves and an observer and the orbital dynamics of communications satellites. Presents preliminary calculations of the satellite's altitude and linear velocity using only the concepts of the Doppler shift and the mechanics of motion in a circular path. (JRH)

  7. Audio direct broadcast satellites

    NASA Astrophysics Data System (ADS)

    Miller, J. E.

    1983-05-01

    Satellite sound broadcasting is, as the name implies, the use of satellite techniques and technology to broadcast directly from space to low-cost, consumer-quality receivers the types of sound programs commonly received in the AM and FM broadcast bands. It would be a ubiquitous service available to the general public in the home, in the car, and out in the open.

  8. Seminar by Satellite

    ERIC Educational Resources Information Center

    Hart, Peter J.

    1978-01-01

    Seminars on curriculum development transmitted by satellite are operated by the University of the South Pacific, Suva. The satellite was launched in 1966 by NASA, which has permitted educational broadcasting. Ground stations have been set up in eight countries that support the university. Practical aspects of transmission are outlined. (SW)

  9. Audio direct broadcast satellites

    NASA Technical Reports Server (NTRS)

    Miller, J. E.

    1983-01-01

    Satellite sound broadcasting is, as the name implies, the use of satellite techniques and technology to broadcast directly from space to low-cost, consumer-quality receivers the types of sound programs commonly received in the AM and FM broadcast bands. It would be a ubiquitous service available to the general public in the home, in the car, and out in the open.

  10. Characterization of the bovine C alpha gene.

    PubMed Central

    Brown, W R; Rabbani, H; Butler, J E; Hammarström, L

    1997-01-01

    The complete genomic sequence of a bovine C alpha gene is reported here. The genomic sequence was obtained from a C alpha phage clone that had been cloned from a genomic EMBL4 phage vector library. The C alpha sequence had previously been expressed as a chimeric antibody and identified as IgA using IgA-specific antibodies. Intron/exon boundaries were determined by comparison of the genomic sequence with an expressed bovine C alpha sequence obtained from spleen by reverse transcription-polymerase chain reaction (RT-PCR). Analysis of 50 Swedish bovine genomic DNA samples using genomic blots and five different restriction enzymes failed to detect evidence of polymorphism. However, PstI digests of Brown Swiss DNA showed a restriction fragment length polymorphism (RFLP), suggesting that at least two allelic variants of bovine IgA exist. Comparison of the deduced amino acid sequence of bovine IgA with sequences available for other species indicated that the highest homology was with that of swine, another artiodactyl. This was the highest homology observed for all mammalian IgA compared except for that between IgA1 and IgA2 in humans. Bovine IgA shares with rabbit IgA3 and IgA4, an additional N-linked glycosylation site at position 282. However, the collective data indicate that cattle are like swine and rodents and unlike rabbits in having a single locus of the gene encoding IgA of this species. Images Figure 4 PMID:9203958

  11. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  12. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  13. [Forced Oscillations of DNA Bases].

    PubMed

    Yakushevich, L V; Krasnobaeva, L A

    2016-01-01

    This paper presents the results of the studying of forced angular oscillations of the DNA bases with the help of the mathematical model consisting of two coupled nonlinear differential equations that take into account the effects of dissipation and the influence of an external periodic field. The calculation results are illustrated for sequence of gene encoding interferon alpha 17 (IFNA 17).

  14. [Forced Oscillations of DNA Bases].

    PubMed

    Yakushevich, L V; Krasnobaeva, L A

    2016-01-01

    This paper presents the results of the studying of forced angular oscillations of the DNA bases with the help of the mathematical model consisting of two coupled nonlinear differential equations that take into account the effects of dissipation and the influence of an external periodic field. The calculation results are illustrated for sequence of gene encoding interferon alpha 17 (IFNA 17). PMID:27192830

  15. Satellites and the ISDN

    NASA Astrophysics Data System (ADS)

    Lewis, J.

    1983-12-01

    The potential role of satellites in an integrated services digital network (ISDN) is discussed in the light of recent CCITT studies. Present satellite digital-communication techniques are reviewed, and the changes introduced by ISDN development and by the competition of long-distance optical-fiber networks are characterized. CCITT standards on error performance (e.g., bit-error rate less than 10 to the -6th for at least 98 percent of the worst month), availability, and synchronization are summarized and compared with currently applied satellite standards. Since the potential for improvements in transmission quality and delay in satellite systems is limited, it is recommended that satellite planning concentrate on transparency enhancement (including speech processing, frame-format modification, and forward error correction) to accommodate ISDN.

  16. Molecular cloning and characterization of Hymenolepis diminuta alpha-tubulin gene.

    PubMed

    Mohajer-Maghari, Behrokh; Amini-Bavil-Olyaee, Samad; Webb, Rodney A; Coe, Imogen R

    2007-02-01

    To isolate a full-length alpha-tubulin cDNA from an eucestode, Hymenolepis diminuta, a lambda phage cDNA library was constructed. The alpha-tubulin gene was cloned, sequenced and characterized. The H. diminuta alpha-tubulin consisted of 450 amino acids. This protein contained putative sites for all posttranslational modifications as detyrosination/tyrosination at the carboxyl-terminal of protien, phosphorylation at residues R79 and K336, glycylation/glutamylation at residue G445 and acetylation at residue K40. Comparisons of H. diminuta alpha-tubulin with all full-length alpha-tubulin proteins revealed that H. diminuta alpha-tubulin possesses 10 distinctive residues, which are not found in any other alpha-tubulins. Phylogenetic analysis showed that H. diminuta alpha-tubulin has grouped in a separated branch adjacent eucestode and trematodes branch with 92% bootstrap value (1000 replicates). In conclusion, this is the first report of H. diminuta cDNA library construction, cloning and characterization of H. diminuta alpha-tubulin gene.

  17. Sequential activation of alpha-actin genes during avian cardiogenesis: vascular smooth muscle alpha-actin gene transcripts mark the onset of cardiomyocyte differentiation

    PubMed Central

    1988-01-01

    The expression of cytoplasmic beta-actin and cardiac, skeletal, and smooth muscle alpha-actins during early avian cardiogenesis was analyzed by in situ hybridization with mRNA-specific single-stranded DNA probes. The cytoplasmic beta-actin gene was ubiquitously expressed in the early chicken embryo. In contrast, the alpha-actin genes were sequentially activated in avian cardiac tissue during the early stages of heart tube formation. The accumulation of large quantities of smooth muscle alpha-actin transcripts in epimyocardial cells preceded the expression of the sarcomeric alpha-actin genes. The accumulation of skeletal alpha-actin mRNAs in the developing heart lagged behind that of cardiac alpha-actin by several embryonic stages. At Hamburger- Hamilton stage 12, the smooth muscle alpha-actin gene was selectively down-regulated in the heart such that only the conus, which subsequently participates in the formation of the vascular trunks, continued to express this gene. This modulation in smooth muscle alpha- actin gene expression correlated with the beginning of coexpression of sarcomeric alpha-actin transcripts in the epimyocardium and the onset of circulation in the embryo. The specific expression of the vascular smooth muscle alpha-actin gene marks the onset of differentiation of cardiac cells and represents the first demonstration of coexpression of both smooth muscle and striated alpha-actin genes within myogenic cells. PMID:3204121

  18. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.

    1998-08-19

    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  19. G alpha 12/13 basally regulates p53 through Mdm4 expression.

    PubMed

    Kim, Mi-Sung; Lee, Sang Min; Kim, Won Dong; Ki, Sung Hwan; Moon, Aree; Lee, Chang Ho; Kim, Sang Geon

    2007-05-01

    G alpha(12/13), which belongs to the G alpha(12) family, participates in the regulation of diverse physiologic processes. In view of the control of G alpha(12/13) in cell proliferation, this study investigated the role of G alpha(12/13) in the regulation of p53 and mdm4. Immunoblotting and immunocytochemistry revealed that p53 was expressed in control embryonic fibroblasts and was largely localized in the nuclei. G alpha(12) deficiency decreased p53 levels and its DNA binding activity, accompanying p21 repression with Bcl(2) induction, whereas G alpha(13) deficiency exerted weak effects. G alpha(12) or G alpha(13) deficiency did not change p53 mRNA expression. ERK1/2 or Akt was not responsible for p53 repression due to G alpha(12) deficiency. Mdm4, a p53-stabilizing protein, was repressed by G alpha(12) deficiency and to a lesser extent by G alpha(13) deficiency, whereas mdm2, PTEN, beta-catenin, ATM, and Chk2 were unaffected. p53 accumulation by proteasomal inhibition during G alpha(12) deficiency suggested the role of G alpha(12) in p53 stabilization. Constitutively active G alpha(12) (G alpha(12)QL) or G alpha(13) (G alpha(13)QL) promoted p53 accumulation with mdm4 induction in MCF10A cells. p53 accumulation by mdm4 overexpression, but no mdm4 induction by p53 overexpression, and small interfering RNA knockdown verified the regulatory role of mdm4 for p53 downstream of G alpha(12/13). In control or G alpha(12)/G alpha(13)-deficient cells, genotoxic stress led to p53 accumulation. At concentrations increasing the flow cytometric pre-G(1) phase, doxorubicin or etoposide treatment caused serine phosphorylations in G alpha(12)-/- or G alpha(12/13)-/- cells, but did not induce mdm4. G alpha(12/13)QL transfection failed to phosphorylate p53 at serines. Our results indicate that G alpha(12/13) regulate basal p53 levels via mdm4, which constitutes a cell signaling pathway distinct from p53 phosphorylations elicited by genotoxic stress.

  20. Novel P2 promoter-derived HNF4{alpha} isoforms with different N-terminus generated by alternate exon insertion

    SciTech Connect

    Huang, Jianmin; Levitsky, Lynne L.; Rhoads, David B.

    2009-04-15

    Hepatocyte nuclear factor 4{alpha} (HNF4{alpha}) is a critical transcription factor for pancreas and liver development and functions in islet {beta} cells to maintain glucose homeostasis. Mutations in the human HNF4A gene lead to maturity onset diabetes of the young (MODY1) and polymorphisms are associated with increased risk for type 2 diabetes mellitus (T2DM). Expression of six HNF4{alpha} variants, three each from two developmentally regulated promoters, has been firmly established. We have now detected a new set of HNF4{alpha} variants designated HNF4{alpha}10-12 expressed from distal promoter P2. These variants, generated by inclusion of previously undetected exon 1E (human = 222 nt, rodent = 136 nt) following exon 1D have an altered N-terminus but identical remaining reading frame. HNF4{alpha}10-{alpha}12 are expressed in pancreatic islets (and liver) and exhibit transactivation potentials similar to the corresponding {alpha}7-{alpha}9 isoforms. DNA-binding analyses implied much higher protein levels of HNF4{alpha}10-{alpha}12 in liver than expected from the RT-PCR data. Our results provide evidence for a more complex expression pattern of HNF4{alpha} than previously appreciated. We recommend inclusion of exon 1E and nearby DNA sequences in screening for HNF4{alpha} mutations and polymorphisms in genetic analyses of MODY1 and T2DM.

  1. Expression of human. alpha. -fetoprotein in yeast

    SciTech Connect

    Yamamoto, Ritsu; Sakamoto, Takashi; Nishi, Shinzo; Sakai, Masaharu; Morinaga, Tomonori; Tamaoki, Taiki Univ. of Calgary, Alberta )

    1990-01-01

    Human {alpha}-fetoprotein (AFP) was expressed in Saccharomyces cerevisiae, with a plasmid containing the cDNA sequence for human AFP fused with the rat AFP signal peptide. The recombinant AFP was purified from the yeast lysate by DEAE-cellulose and immunoaffinity chromatography. The amino acid composition and the molecular weight of the recombinant AFP were similar to those of hepatoma AFP. N-terminal amino acids sequence analysis indicated that the signal peptide had been processed. The recombinant and hepatoma AFP reacted identically in Ouchterlony immunodiffusion and radioimmunoassay tests. These observations indicated that the yeast recombinant protein had the properties of native AFP.

  2. Resolution of the discrepancy between Balmer alpha emission rates, the solar Lyman beta flux, and models of geocoronal hydrogen concentration

    NASA Technical Reports Server (NTRS)

    Levasseur, A.-C.; Meier, R. R.; Tinsley, B. A.

    1976-01-01

    New satellite Balmer alpha measurements and solar Lyman beta flux and line profile measurements, together with new measurements of the zodiacal light intensity used in correcting both ground and satellite Balmer alpha measurements for the effects of the Fraunhofer line in the zodiacal light, have been used in a reevaluation of the long-standing discrepancy between ground-based Balmer alpha emission rates and other geocoronal hydrogen parameters. The solar Lyman beta line center flux is found to be (4.1 plus or minus 1.3) billion photons per sq cm per sec per angstrom at S(10.7) equals 110 and, together with a current hydrogen model which has 92,000 atoms per cu cm at 650 km for T(inf) equals 950 K, gives good agreement between calculated Balmer alpha emission rates and the ground-based and satellite measurements.

  3. Transit satellite system timing capabilities

    NASA Technical Reports Server (NTRS)

    Finsod, T. D.

    1978-01-01

    Current time transfer capabilities of the Transit Satellite System are reviewed. Potential improvements in the changes in equipment and operational procedures using operational satellites are discussed.

  4. Satellite Services Workshop, Volume 1

    NASA Technical Reports Server (NTRS)

    1982-01-01

    Key issues associated with the orbital servicing of satellites are examined including servicing spacecraft and equipment, servicing operations, economics, satellite design, docking and berthing, and fluid management.

  5. {alpha}-Decay half-lives, {alpha}-capture, and {alpha}-nucleus potential

    SciTech Connect

    Denisov, V. Yu. Khudenko, A.A.

    2009-11-15

    {alpha}-Decay half-lives and {alpha}-capture cross sections are evaluated in the framework of a unified model for {alpha}-decay and {alpha}-capture. In this model {alpha}-decay and {alpha}-capture are considered as penetration of the {alpha}-particle through the potential barrier formed by the nuclear, Coulomb, and centrifugal interactions between the {alpha}-particle and nucleus. The spins and parities of the parent and daughter nuclei as well as the quadrupole and hexadecapole deformations of the daughter nuclei are taken into account for evaluation of the {alpha}-decay half-lives. The {alpha}-decay half-lives for 344 nuclei and the {alpha}-capture cross sections of {sup 40}Ca, {sup 44}Ca, {sup 59}Co, {sup 208}Pb, and {sup 209}Bi agree well with the experimental data. The evaluated {alpha}-decay half-lives within the range of 10{sup -9}{<=}T{sub 1/2}{<=}10{sup 38} s for 1246 {alpha}-emitters are tabulated.

  6. Swedish small satellites

    NASA Astrophysics Data System (ADS)

    Lundahl, K.; von Scheele, F.

    2004-11-01

    In 1986 the first Swedish small satellite VIKING was launched on the Ariane 1 rocket together with the French remote sensing satellite SPOT-1. This paper describes the development of Swedish small satellites in an international framework. The satellites have delivered excellent scientific data to a low cost by using e.g. streamlined project organisations, competitive procurement programs and piggy-back launch opportunities. The first micro satellite Astrid-1 was launched in January 1995 and was followed by the launch of Astrid-2 in December 1998. The capable Odin small satellite was launched in February 2001. SSC was also contracted for ESA's SMART-1 probe destined to the Moon. SMART-1, launched in September 2003, is used for both research and as a technology demonstrator for future projects. Future proposed projects include micro and small satellites for climate research as the Atmosphere and Climate Explorer Plus (ACE+), the Stratosphere-Troposphere Exchange And climate Monitor (STEAM) and PRISMA, a technology demonstrator for formation flying, new propulsion system and commercial development methods.

  7. A High-Throughput Screen for Alpha Particle Radiation Protectants

    PubMed Central

    Seideman, Jonathan H.; Shum, David; Djaballah, Hakim

    2010-01-01

    Abstract Alpha-particle-emitting elements are of increasing importance as environmental and occupational carcinogens, toxic components of radiation dispersal devices and accidents, and potent therapeutics in oncology. Alpha particle radiation differs from radiations of lower linear energy transfer in that it predominantly damages DNA via direct action. Because of this, radical scavengers effective for other radiations have had only limited effect in mitigating alpha particle toxicity. We describe here a simple assay and a pilot screen of 3,119 compounds in a high-throughput screen (HTS), using the alpha-particle-emitting isotope, 225Ac, for the discovery of compounds that might protect mammalian cells from alpha particles through novel mechanisms. The assay, which monitored the viability of a myeloid leukemic cell line upon alpha particle exposure, was robust and reproducible, yielding a Z' factor of 0.66 and a signal-to-noise ratio of nearly 10 to 1. Surprisingly, 1 compound emerged from this screen, epoxy-4,5-α-dihydroxysantonin (EDHS), that showed considerable protective activity. While the value of EDHS remains to be determined, its discovery is a proof of concept and validation of the utility of this HTS methodology. Further application of the described assay could yield compounds useful in minimizing the toxicity and carcinogenesis associated with alpha particle exposure. PMID:20658946

  8. Transcriptional regulation of human retinoic acid receptor-alpha (RAR-{alpha}) by Wilms` tumour gene product

    SciTech Connect

    Goodyer, P.R.; Torban, E.; Dehbi, M.

    1994-09-01

    The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-length WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.

  9. Trypanosoma cruzi elongation factor 1-alpha: nuclear localization in parasites undergoing apoptosis.

    PubMed

    Billaut-Mulot, O; Fernandez-Gomez, R; Loyens, M; Ouaissi, A

    1996-09-26

    The cloning and sequencing of the gene coding for Trypanosoma cruzi elongation factor 1 alpha (TcEF-1 alpha) was performed by screening a T. cruzi genomic library with a probe obtained through the polymerase chain reaction (PCR) amplification of T. cruzi DNA using two oligonucleotides deduced from the sequence of T. brucei EF-1 alpha. Southern blot analysis of T. cruzi digested genomic DNA and Northern blot hybridized with the labeled probe revealed that one copy of TcEF-1 alpha exist in the genome of the parasite. Indirect immunofluorescence technique using anti-EF-1 alpha antibodies and epimastigotes harvested after different days of in vitro culture showed that EF-1 alpha is localised in the cytoplasm of the parasites from the exponential growth phase. Surprisingly, during the stationary phase (ageing parasites), EF-1 alpha was found in the nucleus. Furthermore, treatment of parasites with the antibiotic drug geneticin (G418) which induces the death of epimastigotes by apoptosis showed selective localization of EF-1 alpha in the nucleus of dying parasites. This observation supports the notion already reported in the case of mammalian cells that EF-1 alpha could participate in the transcription processes and possibly in the case of T. cruzi, in the expression regulation of genes involved in the control of cell death. The possible transfection and genomic manipulation of T. cruzi may provide a model to study the role of TcEF-1 alpha in this phenomenon. PMID:8863724

  10. Extended atmospheres of outer planet satellites and comets

    NASA Technical Reports Server (NTRS)

    Smyth, W. H.; Combi, M. R.

    1985-01-01

    Model analysis of the extended atmospheres of outer planet satellites and comets are discussed. Understanding the neutral hydrogen distribution in the Saturn system concentrated on assessing the spatial dependence of the lifetime of hydrogen atoms and on obtaining appropriately sorted Lyman ALPHA data from the Voyager 1 UVS instrument. Progress in the area of the extended cometary atmospheres included analysis of Pioneer Venus Layman alpha observations of Comet P/Encke with the fully refined hydrogen cloud model, development of the basic carbon and oxygen models, and planning for the Pioneer Venus UVS observations of Comets P/Giacobini-Zinner and P/Halley.

  11. Simultaneous quantification of GABAergic 3alpha,5alpha/3alpha,5beta neuroactive steroids in human and rat serum.

    PubMed

    Porcu, Patrizia; O'Buckley, Todd K; Alward, Sarah E; Marx, Christine E; Shampine, Lawrence J; Girdler, Susan S; Morrow, A Leslie

    2009-01-01

    The 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone enhance GABAergic neurotransmission and produce inhibitory neurobehavioral and anti-inflammatory effects. Despite substantial information on the progesterone derivative (3alpha,5alpha)-3-hydroxypregnan-20-one (3alpha,5alpha-THP, allopregnanolone), the physiological significance of the other endogenous GABAergic neuroactive steroids has remained elusive. Here, we describe the validation of a method using gas chromatography-mass spectrometry to simultaneously identify serum levels of the eight 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone. The method shows specificity, sensitivity and enhanced throughput compared to other methods already available for neuroactive steroid quantification. Administration of pregnenolone to rats and progesterone to women produced selective effects on the 3alpha,5alpha- and 3alpha,5beta-reduced neuroactive steroids, indicating differential regulation of their biosynthetic pathways. Pregnenolone administration increased serum levels of 3alpha,5alpha-THP (+1488%, p<0.001), (3alpha,5alpha)-3,21-dihydroxypregnan-20-one (3alpha,5alpha-THDOC, +205%, p<0.01), (3alpha,5alpha)-3-hydroxyandrostan-17-one (3alpha,5alpha-A, +216%, p<0.001), (3alpha,5alpha,17beta)-androstane-3,17-diol (3alpha,5alpha-A-diol, +190%, p<0.01). (3alpha,5beta)-3-hydroxypregnan-20-one (3alpha,5beta-THP) and (3alpha,5beta)-3-hydroxyandrostan-17-one (3alpha,5beta-A) were not altered, while (3alpha,5beta)-3,21-dihydroxypregnan-20-one (3alpha,5beta-THDOC) and (3alpha,5beta,17beta)-androstane-3,17-diol (3alpha,5beta-A-diol) were increased from undetectable levels to 271+/-100 and 2.4+/-0.9 pg+/-SEM, respectively (5/8 rats). Progesterone administration increased serum levels of 3alpha,5alpha-THP (+1806%, p<0.0001), 3alpha,5beta-THP (+575%, p<0.001), 3alpha,5alpha

  12. Skeletal muscle satellite cells

    NASA Technical Reports Server (NTRS)

    Schultz, E.; McCormick, K. M.

    1994-01-01

    Evidence now suggests that satellite cells constitute a class of myogenic cells that differ distinctly from other embryonic myoblasts. Satellite cells arise from somites and first appear as a distinct myoblast type well before birth. Satellite cells from different muscles cannot be functionally distinguished from one another and are able to provide nuclei to all fibers without regard to phenotype. Thus, it is difficult to ascribe any significant function to establishing or stabilizing fiber type, even during regeneration. Within a muscle, satellite cells exhibit marked heterogeneity with respect to their proliferative behavior. The satellite cell population on a fiber can be partitioned into those that function as stem cells and those which are readily available for fusion. Recent studies have shown that the cells are not simply spindle shaped, but are very diverse in their morphology and have multiple branches emanating from the poles of the cells. This finding is consistent with other studies indicating that the cells have the capacity for extensive migration within, and perhaps between, muscles. Complexity of cell shape usually reflects increased cytoplasmic volume and organelles including a well developed Golgi, and is usually associated with growing postnatal muscle or muscles undergoing some form of induced adaptive change or repair. The appearance of activated satellite cells suggests some function of the cells in the adaptive process through elaboration and secretion of a product. Significant advances have been made in determining the potential secretion products that satellite cells make. The manner in which satellite cell proliferative and fusion behavior is controlled has also been studied. There seems to be little doubt that cellcell coupling is not how satellite cells and myofibers communicate. Rather satellite cell regulation is through a number of potential growth factors that arise from a number of sources. Critical to the understanding of this form

  13. Satellite Breakup Risk Mitigation

    NASA Technical Reports Server (NTRS)

    Leleux, Darrin P.; Smith, Jason T.

    2006-01-01

    Many satellite breakups occur as a result of an explosion of stored energy on-board spacecraft or rocket-bodies. These breakups generate a cloud of tens or possibly hundreds of thousands of debris fragments which may pose a transient elevated threat to spaceflight crews and vehicles. Satellite breakups pose a unique threat because the majority of the debris fragments are too small to be tracked from the ground. The United States Human Spaceflight Program is currently implementing a risk mitigation strategy that includes modeling breakup events, establishing action thresholds, and prescribing corresponding mitigation actions in response to satellite breakups.

  14. Probability of satellite collision

    NASA Technical Reports Server (NTRS)

    Mccarter, J. W.

    1972-01-01

    A method is presented for computing the probability of a collision between a particular artificial earth satellite and any one of the total population of earth satellites. The collision hazard incurred by the proposed modular Space Station is assessed using the technique presented. The results of a parametric study to determine what type of satellite orbits produce the greatest contribution to the total collision probability are presented. Collision probability for the Space Station is given as a function of Space Station altitude and inclination. Collision probability was also parameterized over miss distance and mission duration.

  15. JOI reaffirms satellite plan

    NASA Astrophysics Data System (ADS)

    Katzoff, Judith A.

    A recent report by the Satellite Planning Committee of Joint Oceanographic Institutions, Inc. (JOI), Washington, D.C., underscored the need for the four oceanographic satellite missions that have been proposed for the next decade to be carried out as planned and firmly on schedule. In reaffirming the need for the missions, the committee said that many important types of long-term global data auoui ihe oceans can be gathered only by research satellites. The potential benefits to vital national activities such as trade, fisheries, national defense, and waste disposal will be well worth the missions' cost, they added.

  16. Amino-acid substitution in alpha-spectrin commonly coinherited with nondominant hereditary spherocytosis.

    PubMed

    Tse, W T; Gallagher, P G; Jenkins, P B; Wang, Y; Benoit, L; Speicher, D; Winkelmann, J C; Agre, P; Forget, B G; Marchesi, S L

    1997-03-01

    Nondominant hereditary spherocytosis (ndHS) is a disorder characterized in some patients by severe hemolytic anemia and marked deficiency of erythrocyte spectrin. This report describes the identification of a variant spectrin chain, alpha-spectrin Bughill or alpha(BH), that is associated with this disorder in a number of patients. Tryptic maps of spectrin from affected individuals revealed an acidic shift in isoelectric point of the alphaII domain peptides at 46 kD and 35 kD. A point mutation at codon 970 of the alpha-spectrin gene (GCT-->GAT), that changes the encoded amino acid from an alanine to an aspartic acid, was identified in genomic DNA of affected patients. The alpha(BH) variant was present in 8 patients with ndHS from five different kindreds but was absent in 4 patients from two other kindreds. The 8 ndHS patients with the alpha(BH) variant appeared to be homozygous for the alpha(BH) variant by analysis of peptide maps of limited tryptic digests of erythrocyte spectrin. However, following genomic DNA analysis, only 2 of these patients were true homozygotes, whereas 6 were found to be doubly heterozygous for the alpha(BH) allele and a second, presumably abnormal, alpha-spectrin gene. These results suggest that, in these 6 patients, the second alpha-spectrin allele is in fact associated with one or more genetic defect(s), causing decreased accumulation of alpha-spectrin. The pattern of transmission of the alpha(BH) allele in certain families suggests that the alpha(BH) amino-acid substitution is not itself responsible for ndHS but is more likely a polymorphic variant that, in some but not all cases, is in linkage disequilibrium with another uncharacterized alpha-spectrin gene defect that itself is a cause of ndHS. PMID:9067503

  17. Simultaneous satellite and riometer studies. [for solar cosmic ray events

    NASA Technical Reports Server (NTRS)

    Baker, M. B.; Masley, A. J.; Satterblom, P. R.

    1974-01-01

    The expected 30 and 50 MHz riometer absorption was calculated for the 7 June, 25 September and 2 November 1969 solar events using data from the McDonnell Douglas charged particle experiment on the polar orbiting OGO-6 Satellite. Excellent agreement was found between measured polar cap riometer absorption during the events and absorption calculated from detailed particle data obtained on the satellite passing over the riometer. Electrons are found to contribute the greater part of the 30 MHz absorption before the peak of the 2 November 1969 event; at all other times protons produce most of the absorption. The alpha-particle contribution is negligible in all cases.

  18. Overview of commercial satellite communications

    NASA Astrophysics Data System (ADS)

    Beakley, G. W.

    1984-07-01

    A brief history of communications satellites is presented, taking into account the launching of Sputnik 1 in October 1957, the Explorer 1 in January of 1958, the launch of the Score as the world's first active communications satellite in December 1958, the Communications Satellite Act in 1962, and the launch of 'Early Bird' in 1964. The Intelsat satellites are considered along with maritime satellite communications, the U.S. domestic satellite systems, Alaskan satellite communications, cable television, broadcast TV stations, print media, the hotel/motel industry as a large market for satellite communications terminals, the opening of a minicable and satellite master antenna TV market for TV receive-only systems, and business telecommunications earth terminals. Attention is also given to future directions regarding satellite positions, the concept of 'video-plus', and direct broadcast satellites.

  19. In vitro and in vivo gene delivery mediated by Lactosylated dendrimer/alpha-cyclodextrin conjugates (G2) into hepatocytes.

    PubMed

    Arima, Hidetoshi; Yamashita, Shogo; Mori, Yoshimasa; Hayashi, Yuya; Motoyama, Keiichi; Hattori, Kenjiro; Takeuchi, Tomoko; Jono, Hirofumi; Ando, Yukio; Hirayama, Fumitoshi; Uekama, Kaneto

    2010-08-17

    The purpose of this study is to evaluate in vitro and in vivo gene delivery efficiency of polyamidoamine (PAMAM) starburst dendrimer (generation 2, G2) conjugates with alpha-cyclodextrin (alpha-CDE (G2)) bearing lactose (Lac-alpha-CDE) with various degrees of substitution of the lactose moiety (DSL) as a novel hepatocyte-selective carrier in hepatocytes. Lac-alpha-CDE (DSL 2.6) was found to have much higher gene transfer activity than dendrimer, alpha-CDE, Lac-alpha-CDE (DSL 1.2, 4.6, 6.2 and 10.2) and lactosylated dendrimer (Lac-dendrimer, DSL 2.4) in HepG2 cells, which are dependent on the expression of cell-surface asialoglycoprotein receptor (ASGP-R), reflecting the cellular association of the plasmid DNA (pDNA) complexes. The physicochemical properties of pDNA complex with Lac-alpha-CDE (DSL 2.6) were almost comparable to that with alpha-CDE. Lac-alpha-CDE (DSL 2.6) provided negligible cytotoxicity up to a charge ratio of 150 in HepG2 cells. Lac-alpha-CDE (DSL 2.6) provided gene transfer activity higher than jetPEI-Hepatocyte to hepatocytes with much less changes of blood chemistry values 12h after intravenous administration in mice. These results suggest the potential use of Lac-alpha-CDE (DSL 2.6) as a non-viral vector for gene delivery toward hepatocytes.

  20. Cloning and biologic activities of a bovine interferon-alpha isolated from the epithelium of a rotavirus-infected calf.

    PubMed

    Chaplin, P J; Entrican, G; Gelder, K I; Collins, R A

    1996-01-01

    A cDNA encoding a distinct bovine (Bo) interferon (IFN) alpha, designated BoIFN-alpha E, was generated from gut epithelial cells isolated from a rotavirus-infected calf. The BoIFN-alpha E cDNA sequence shared a greater than 90% identity with the other BoIFN-alpha subtypes. The cDNA encoding BoIFN-alpha E has been expressed in insect cells using the baculovirus Autographa californica nuclear polyhedrosis virus (AcMNPV) as a vector. Insect cells infected with recombinant virus secreted a protein with a relative molecular mass of 19,500 into the culture medium not observed in cells infected with wild-type AcMNPV. Supernatants harvested from cultures of insect cells infected with the recombinant AcMNPV encoding IFN-alpha E inhibited the replication of Semliki Forest virus in a bovine cell line and typically showed 10(6) dilution units/ml of antiviral activity. However, differences were observed between the activities of recombinant BoIFN-alpha E and BoIFN-alpha 1 1 on the proliferation of WC1+ gamma/delta T cells. Purified ( > 99%) WC1+ gamma/delta T cells failed to proliferate to IFN-alpha 1 1 or concanavalin A and IFN-alpha E acted as a weak proliferative signal to these cells, demonstrating a functional difference between two closely related BoIFN-alpha subtypes. PMID:8640447

  1. Circular DNA Molecules in the Genus Drosophila

    PubMed Central

    Travaglini, E. C.; Schultz, J.

    1972-01-01

    The satellite DNA's from the embryos of five species of Drosophila (D. melanogaster, D. simulans, D. nasuta, D. virilis and D. hydei) have been analyzed for the presence of closed circular duplex DNA molecules, as determined by CsCl-EBr gradients. Circular DNA molecules were found in every species but D. melanogaster. Analyses of cell fractions from adult Drosophila and organ fractions from Drosophila larvae show that fractions containing mitochondria are highly enriched in these molecules. PMID:4643820

  2. Orbit determination accuracies using satellite-to-satellite tracking

    NASA Technical Reports Server (NTRS)

    Vonbun, F. O.; Argentiero, P. D.; Schmid, P. E.

    1977-01-01

    The uncertainty in relay satellite sate is a significant error source which cannot be ignored in the reduction of satellite-to-satellite tracking data. Based on simulations and real data reductions, it is numerically impractical to use simultaneous unconstrained solutions to determine both relay and user satellite epoch states. A Bayesian or least squares estimation technique with an a priori procedure is presented which permits the adjustment of relay satellite epoch state in the reduction of satellite-to-satellite tracking data without the numerical difficulties introduced by an ill-conditioned normal matrix.

  3. Meteorological satellite accomplishments

    NASA Technical Reports Server (NTRS)

    Allison, L. J.; Arking, A.; Bandeen, W. R.; Shenk, W. E.; Wexler, R.

    1974-01-01

    The various types of meteorological satellites are enumerated. Vertical sounding, parameter extraction technique, and both macroscale and mesoscale meteorological phenomena are discussed. The heat budget of the earth-atmosphere system is considered, along with ocean surface and hydrology.

  4. Domestic Communication Satellites

    ERIC Educational Resources Information Center

    Horowitz, Andrew

    1974-01-01

    A discussion of the Federal Communications Commission's new policy on domestic satellites in light of our 1) military and economic history; 2) corporate interests; 3) citizen surveillance; and 4) media control. (HB)

  5. AUSSAT mobile satellite services

    NASA Technical Reports Server (NTRS)

    Nowland, Wayne L.; Wagg, Michael; Simpson, Daniel

    1988-01-01

    An overview of AUSSAT's planned mobile satellite system is given. The development program which is being undertaken to achieve the 1992 service date is described. Both business and technical aspects of the development program are addressed.

  6. Weather, land satellite sale

    NASA Astrophysics Data System (ADS)

    Richman, Barbara T.

    President Ronald Reagan announced on March 8 plans to sell to private industry the nation's land and meteorological remote-sensing satellites, including the responsibility for any future ocean-observing systems. According to the plan, the private firm successful in its bid to buy the five satellites would sell back to the government the data received by the satellites. The Reagan administration says the sale will save money and will put activities appropriate for commercial ventures into the commercial sector. Response to the announcement from scientists and congressmen has been anything but dulcet; one senator, in fact, charges that the Commerce Department and the corporation most likely to purchase the satellites are engaged in a ‘sweetheart deal.’

  7. Aiming a Satellite Dish.

    ERIC Educational Resources Information Center

    Zebrowski, Ernest, Jr.

    1988-01-01

    Develops a pair of equations for calculating the elevation and azimuth angles for the various satellites. Uses 3-dimensional vector difference calculations. Provides a practical example, figures, and table. (YP)

  8. Speckle imaging of satellites

    SciTech Connect

    Fitch, J.P.; Lawrence, T.W.; Goodman, D.M.; Johansson, E.M.

    1991-12-01

    We performed a series of experiments using the Air Force Optical Station`s 1.6 m telescope and a bare CCD detector to capture speckle images of various satellites. The speckle images were processed with bispectral techniques for recovering image Fourier phase as well as projection onto convex sets for recovering image Fourier magnitude from the projected autocorrelation. Results of imaging point stars and binaries are shown as a baseline assessment of our technique. We have reconstructed high quality images of numerous satellites and will show reconstructions of a very familiar satellite: the Hubble Space Telescope. To our knowledge, this is the first demonstration of the use of bare CCDs for speckle imaging of relatively bright objects such as artificial satellites. 8 refs.

  9. Speckle imaging of satellites

    SciTech Connect

    Fitch, J.P.; Lawrence, T.W.; Goodman, D.M.; Johansson, E.M.

    1991-12-01

    We performed a series of experiments using the Air Force Optical Station's 1.6 m telescope and a bare CCD detector to capture speckle images of various satellites. The speckle images were processed with bispectral techniques for recovering image Fourier phase as well as projection onto convex sets for recovering image Fourier magnitude from the projected autocorrelation. Results of imaging point stars and binaries are shown as a baseline assessment of our technique. We have reconstructed high quality images of numerous satellites and will show reconstructions of a very familiar satellite: the Hubble Space Telescope. To our knowledge, this is the first demonstration of the use of bare CCDs for speckle imaging of relatively bright objects such as artificial satellites. 8 refs.

  10. Trends In Satellite Communication

    NASA Technical Reports Server (NTRS)

    Poley, William A.; Stevens, Grady H.; Stevenson, Steven M.; Lekan, Jack; Arth, Clifford H.; Hollansworth, James E.; Miller, Edward F.

    1988-01-01

    Report assesses trends in satellite communication from present to year 2010. Examines restrictions imposed by limited spectrum resource and technology needs created by trends. Personal communications, orbiting switchboards, and videophones foreseen.

  11. Characterization and genetic analysis of bovine alpha S1-casein I variant.

    PubMed

    Lühken, G; Caroli, A; Ibeagha-Awemu, E M; Erhardt, G

    2009-08-01

    The aim of this study was to identify the molecular genetic origin underlying the I variant of alpha(s1)-casein and to develop a DNA-based test for this polymorphism as a tool for genetic analyses independent of milk sample testing. All coding exons and flanking regions of the alpha(s1)-casein gene were sequenced in DNA samples from cattle of known alpha(s1)-casein genotypes (BI, CI, II, CC), determined by isoelectric focusing of milk samples. A nucleotide substitution (A>T) in exon 11 (g.19836A>T) leads to the exchange of Glu with Asp at amino acid position 84 of the mature protein (p.Glu84Asp) and perfectly co-segregated with the presence of the alpha(s1)-casein I variant in the milk of the analysed animals. Genotyping of a total of 680 DNA samples from 31 Bos taurus and Bos indicus cattle breeds and from Bos grunniens, Bison bison and Bison bonasus by restriction fragment length polymorphism analysis revealed the occurrence of Asp at position 84 at low frequencies in Bos taurus and Bos indicus breeds and established its origin from the alpha(s1)-casein C variant (p.Glu192Gly). Ten different intragenic haplotypes in the gene region from intron 8 to intron 12 were observed by sequencing, of which two occurred in Bison bison and one in Bison bonasus only. Using available casein gene complex information, an association of Asp at position 84 to beta-casein A(2) and kappa-casein B was shown in the Bos indicus breed Banyo Gudali. Taken together, we can postulate that the alpha(s1)-casein variant I is caused by a non-synonymous nucleotide substitution in exon 11 of the gene and that it originated within Bos indicus and spread to Bos taurus subsequently.

  12. Cloning and expression of a rat brain. alpha. sub 2B -adrenergic receptor

    SciTech Connect

    Flordellis, C.S.; Handy, D.E.; Bresnahan, M.R.; Zannis, V.I.; Gavras, H. )

    1991-02-01

    The authors isolated a cDNA clone (RB{alpha}{sub 2B}) and its homologous gene (GR{alpha}{sub 2B}) encoding an {alpha}{sub 2B}-adrenergic receptor subtype by screening a rat brain cDNA and a rat genomic library. Nucleotide sequence analysis showed that both clones code for a protein of 458 amino acids, which is 87% homologous to the human kidney glycosylated adrenergic receptor ({alpha}{sub 2}-C4) and divergent from the rat kidney nonglycosylated {alpha}{sub 2B} subtype (RNG{alpha}{sub 2}). Transient expression of RB{alpha}{sub 2B} in COS-7 cells resulted in high-affinity saturable binding for ({sup 3}H)rauwolscine and a high receptor number in the membranes of transfected COS-7 cells. Pharmacological analysis demonstrated that the expressed receptor bound adrenergic ligands with the following order of potency: rauwolscine {gt} yohimbine {gt} prazosin {gt} oxymetazoline, with a prazosin-to-oxymetazoline K{sub i} ratio of 0.34. This profile is characteristic of the {alpha}{sub 2B}-adrenergic receptor subtype. Blotting analysis of rat brain mRNA gave one major and two minor mRNA species, and hybridization with strand-specific probes showed that both DNA strands of GR{alpha}{sub 2B} may be transcriptionally active. These findings show that rat brain expresses an {alpha}{sub 2B}-adrenergic receptor subtype that is structurally different from the rat kidney nonglycosylated {alpha}{sub 2B} subtype. Thus the rat expresses at least two divergent {alpha}{sub 2B}-adrenergic receptors.

  13. Epos TCS Satellite Data

    NASA Astrophysics Data System (ADS)

    Manunta, Michele; Mandea, Mioara; Fernández-Turiel, José Luis; Stramondo, Salvatore; Wright, Tim; Walter, Thomas; Bally, Philippe; Casu, Francesco; Zeni, Giovanni; Buonanno, Sabatino; Zinno, Ivana; Tizzani, Pietro; Castaldo, Raffaele; Ostanciaux, Emilie; Diament, Michel; Hooper, Andy; Maccaferri, Francesco; Lanari, Riccardo

    2016-04-01

    TCS Satellite Data is devoted to provide Earth Observation (EO) services, transversal with respect to the large EPOS community, suitable to be used in several application scenarios. In particular, the main goal is to contribute with mature services that have already well demonstrated their effectiveness and relevance in investigating the physical processes controlling earthquakes, volcanic eruptions and unrest episodes as well as those driving tectonics and Earth surface dynamics. The TCS Satellite Data will provide two kinds of services: satellite products/services, and Value-added satellite products/services. The satellite products/services are composed of three (EPOSAR, GDM and COMET) well-identified and partly already operational elements for delivering Level 1 products. Such services will be devoted to the generation of SAR interferograms, DTM and ground displacement maps through the exploitation of different advanced EO techniques for InSAR and optical data analysis. The Value-added satellite products/services are composed of 4 elements (EPOSAR, 3D-Def, Mod and COMET) of Level 2 and 3 products. Such services integrate satellite and in situ measurements and observations to retrieve information on source mechanism, such as the geometry (spatial location, depth, volume changes) and the physical parameters of the deformation sources, through the exploitation of modelling approaches. The TCS Satellite Data will provide products in two different processing and delivery modes: 1- surveillance mode - routinely product generation; 2- on demand mode - product generation performed on demand by the user. Concerning the surveillance mode, the goal is providing continuous satellite measurements in areas of particular interest from a geophysical perspective (supersites). The objective is the detection of displacement patterns changing along time and their geophysical explanation. This is a valid approach for inter-seismic movements and volcanic unrest, post-seismic and post

  14. Distinct and overlapping ligand specificities of the alpha 3A beta 1 and alpha 6A beta 1 integrins: recognition of laminin isoforms.

    PubMed Central

    Delwel, G O; de Melker, A A; Hogervorst, F; Jaspars, L H; Fles, D L; Kuikman, I; Lindblom, A; Paulsson, M; Timpl, R; Sonnenberg, A

    1994-01-01

    The ligand specificity of the alpha 3A beta 1 integrin was analyzed using K562 cells transfected with full-length alpha 3A cDNA and was compared with that of alpha 6A beta 1 in similarly transfected K562 cells. Clones were obtained that showed comparable surface expression of either alpha 3A beta 1 or alpha 6A beta 1 integrins. Those expressing alpha 3A beta 1 attached to and spread on immunopurified human kalinin and cellular matrices containing human kalinin, which is a particular isoform of laminin. In addition, alpha 3A transfectants adhered to bovine kidney laminins possessing a novel A chain variant. Binding to kalinin was blocked by a monoclonal antibody against the A chain constituent of kalinin and adhesion to both kalinin and kidney laminins by anti-alpha 3 and beta 1 monoclonal antibodies. The alpha 3A transfected cells bound more strongly to kalinin and bovine kidney laminins after treatment with the beta 1 stimulatory antibody TS2/16. A distinctly weaker and activation-dependent adhesion of alpha 3A transfectants was observed on human placental laminins possessing the Am chain variant (merosin), and no adhesion occurred on bovine heart laminins and murine EHS tumor laminin. Further inactive substrates were fibronectin, nidogen, and collagen types IV and VI, indicating that the alpha 3A beta 1 integrin is a much less promiscuous receptor than thought before. By contrast, alpha 6A transfected cells adhered to all laminin isoforms when stimulated with TS2/16. Adhesion also occurred only on bovine kidney laminins in the absence of TS2/16. These results demonstrate that both alpha 3A beta 1 and alpha 6A beta 1 integrins are typical laminin receptors but that their affinity and activation dependence for binding to various laminin isoforms differ considerably. Images PMID:8019006

  15. Satellite Applications for Public Service: Project Summaries.

    ERIC Educational Resources Information Center

    Lauffer, Sandra; And Others

    Summaries of 18 different projects involving the use of satellite communications are presented in this report, including PEACESAT Education and Communication Experiments, USP Network Satellite Communication Project, Project Satellite, Satellite Instructional Television Experiment (SITE), Appalachian Education Satellite Program, Alaska Education…

  16. Immunogenicity of a DNA-launched replicon-based canine parvovirus DNA vaccine expressing VP2 antigen in dogs.

    PubMed

    Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K

    2012-10-01

    A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine.

  17. Direct Broadcasting Satellites in Japan.

    ERIC Educational Resources Information Center

    Maeda, Jiro

    The development and use of broadcasting satellites in Japan are discussed in this paper. The paper describes the medium-scale experimental broadcasting satellite, YURI, launched by NASA in 1978, and reports that experiments with YURI in the areas of basic technologies in the broadcasting satellite system, experiments on satellite control…

  18. Satellite Technologies in the Classroom.

    ERIC Educational Resources Information Center

    Portz, Stephen M.

    1999-01-01

    Focuses on ways of using satellite imagery obtained from the Internet, to enhance classroom learning. Discusses satellite deployment; classroom applications, including infrared imagery, high-resolution photography, and global positioning satellites; and use of satellite data for hands-on activities, including cartography, city and community…

  19. Molecular cloning of the. cap alpha. subunit of human and guinea pig leukocyte adhesion glycoprotein Mo1: Chromosomal localization and homology to the. cap alpha. subunits of integrins

    SciTech Connect

    Arnaout, M.A.; Remold-O'Donnell, E.; Pierce, M.W.; Harris, P.; Tenen, D.G.

    1988-04-01

    The cell surface-glycoprotein Mo1 is a member of the family of leukocyte cell adhesion molecules (Leu-CAMs) that includes lymphocyte function-associated antigen 1 (LFA-1) and p150,95. Each Leu-CAM is a heterodimer with a distinct ..cap alpha.. subunit noncovalently associated with a common ..beta.. subunit. The authors describe the isolation and analysis of two partial cDNA clones encoding the ..cap alpha.. subunit of the Leu-CAM Mo1 in humans and guinea pigs. A monoclonal antibody directed against an epitope in the carboxyl-terminal portion of the guinea pig ..cap alpha.. chain was used for immunoscreening a lambdagt11 expression library. The sequence of a 378-base-pair insert from one immunoreactive clone revealed a single continuous open reading frame encoding 126 amino acids including a 26-amino acid tryptic peptide isolated from the purified guinea pig ..cap alpha.. subunit. A cDNA clone of identical size was isolated from a human monocyte/lymphocyte cDNA library by using the guinea pig clone as a probe. The human clone also encoded a 126-amino acid peptide including the sequence of an additional tryptic peptide present in purified human Mo1..cap alpha.. chain. Southern analysis of DNA from hamster-human hybrids localized the human Mo1..cap alpha.. chain to chromosome 16, which has been shown to contain the gene for the ..cap alpha.. chain of lymphocyte function-associated antigen 1. These data suggest that the ..cap alpha.. subunits of Leu-CAMs evolved by gene duplication from a common ancestral gene and strengthen the hypothesis that the ..cap alpha.. subunits of these heterodimeric cell adhesion molecules on myeloid and lymphoid cells, platelets, and fibroblasts are evolutionary related.

  20. Localization of a highly divergent mammalian testicular alpha tubulin that is not detectable in brain.

    PubMed Central

    Hecht, N B; Distel, R J; Yelick, P C; Tanhauser, S M; Driscoll, C E; Goldberg, E; Tung, K S

    1988-01-01

    Sequence analysis of a mouse testicular alpha-tubulin partial cDNA, pRD alpha TT1, reveals an isotype that differs from both the somatic and the predominant testicular alpha tubulins at approximately 30% of the 212 amino acid residues determined. Although this mouse testicular cDNA retains the highly conserved sequence, Glu-Gly-Glu-Glu, found in the carboxyl termini of many alpha tubulins, the protein extends substantially beyond this sequence and does not terminate with a C-terminal tyrosine. Using rabbit antiserum prepared to a novel synthetic peptide predicted from this mouse testis alpha-tubulin cDNA, we have have detected by immunoblot and indirect immunofluorescence an antigenic epitope present in testicular alpha tubulin that is not detectable in brain alpha tubulins. We find that the antiserum specifically binds to the manchettes and meiotic spindles of the mouse testis but not with neural fibers or tubulin extracts of the adult mouse brain. These results demonstrate that at least one of the multiple alpha-tubulin isotypes of the mammalian testis is expressed and used in male germ cells but not in the brain. Images PMID:3352610

  1. Hepatic expression of tumour necrosis factor-alpha in chronic hepatitis B virus infection.

    PubMed Central

    Hussain, M J; Lau, J Y; Williams, R; Vergani, D

    1994-01-01

    AIM--To determine the hepatic expression of tumour necrosis factor-alpha (TNF alpha) in patients with chronic hepatitis B virus (HBV) infection. METHODS--Frozen liver biopsy sections from 19 patients with chronic HBV infection were studied, 12 of whom were HBeAg positive and 10 serum HBV DNA positive. Hepatic expression of TNF alpha was determined using immunohistochemistry. RESULTS--Only infiltrating mononuclear cells showed immunoreactive staining for TNF alpha (median 2, range 0-3; n = 19) which appeared as diffuse positive staining material in the cytoplasm. Patients with active liver disease, assessed histologically and biochemically, had a higher level of expression, both in the number of TNF alpha positive cells and the proportion of TNF alpha positive infiltrating mononuclear cells. There was no correlation between the expression of TNF alpha and serological parameters of viral infection (HBeAg and HBV DNA status and HBV DNA concentrations). CONCLUSION--Hepatic expression of TNF alpha is increased in chronic HBV infection and is related to the activity of liver disease and not to the level of HBV replication. Images PMID:7876386

  2. Z-DNA binding protein from chicken blood nuclei

    NASA Technical Reports Server (NTRS)

    Herbert, A. G.; Spitzner, J. R.; Lowenhaupt, K.; Rich, A.

    1993-01-01

    A protein (Z alpha) that appears to be highly specific for the left-handed Z-DNA conformer has been identified in chicken blood nuclear extracts. Z alpha activity is measured in a band-shift assay by using a radioactive probe consisting of a (dC-dG)35 oligomer that has 50% of the deoxycytosines replaced with 5-bromodeoxycytosine. In the presence of 10 mM Mg2+, the probe converts to the Z-DNA conformation and is bound by Z alpha. The binding of Z alpha to the radioactive probe is specifically blocked by competition with linear poly(dC-dG) stabilized in the Z-DNA form by chemical bromination but not by B-form poly(dC-dG) or boiled salmon-sperm DNA. In addition, the binding activity of Z alpha is competitively blocked by supercoiled plasmids containing a Z-DNA insert but not by either the linearized plasmid or by an equivalent amount of the parental supercoiled plasmid without the Z-DNA-forming insert. Z alpha can be crosslinked to the 32P-labeled brominated probe with UV light, allowing us to estimate that the minimal molecular mass of Z alpha is 39 kDa.

  3. DNA methyltransferase 1/3a overexpression in sporadic breast cancer is associated with reduced expression of estrogen receptor-alpha/breast cancer susceptibility gene 1 and poor prognosis.

    PubMed

    Yu, Zhaojin; Xiao, Qinghuan; Zhao, Lin; Ren, Jie; Bai, Xuefeng; Sun, Mingli; Wu, Huizhe; Liu, Xiaojian; Song, Zhiguo; Yan, Yuanyuan; Mi, Xiaoyi; Wang, Enhua; Jin, Feng; Wei, Minjie

    2015-09-01

    DNA methyltransferases (DNMTs), including DNMT1, 3a, and 3b, play an important role in the progression of many malignant tumors. However, it remains unclear whether expression of DNMTs is associated with the development of breast cancer. This study aimed to explore the clinical significance of DNMT proteins in sporadic breast cancer. We investigated the expression of DNMT1, 3a, and 3b in 256 breast cancer and 36 breast fibroadenoma, using immunohistochemistry. The expression of DNMT1 and 3a was significantly higher in breast cancer than in fibroadenoma. In breast cancer, the expression of DNMT1 was significantly correlated with lymph node metastasis (P = 0.020), and the expression of DNMT3a and 3b was significantly correlated with advanced clinical stages (P = 0.046 and 0.012, respectively). Overexpression of DNMT1/3a was correlated with promoter hypermethylation and reduced expression of ERα and BRCA1. The expression levels of DNMT1 or DNMT3a were associated with a significantly shorter DFS or OS in a subgroup of breast cancer patients (patients with the age ≤50 years old, ERα-negative status, or HER2-postive status). The expression of DNMT1 or a combined expression of DNMT1 and 3a was associated with poor prognosis in patients who received chemotherapy and endocrine therapy, but not in patients who received chemotherapy alone. These findings suggest that DNMT1 and 3a may be involved in the progression and prognosis of sporadic breast cancer.

  4. Satellite Communications for ATM

    NASA Technical Reports Server (NTRS)

    Shamma, Mohammed A.

    2003-01-01

    This presentation is an overview on Satellite Communication for the Aeronautical Telecommunication Management (ATM) research. Satellite Communications are being considered by the FAA and NASA as a possible alternative to the present and future ground systems supporting Air Traffic Communications. The international Civil Aviation Organization (ICAO) have in place Standards and Recommended Practices (SARPS) for the Aeronautical Mobile Satellite Services (AMSS) which is mainly derived from the pre-existing Inmarsat service that has been in service since the 1980s. The Working Group A of the Aeronautical Mobile Communication Panel of ICAO has also been investigating SARPS for what is called the Next Generation Satellite Service (NGSS) which conforms less to the Inmarsat based architecture and explores wider options in terms of satellite architectures. Several designs are being proposed by Firms such as Boeing, ESA, NASA that are geared toward full or secondary usage of satellite communications for ATM. Satellite communications for ATM can serve several purposes ranging from primary usage where ground services would play a minimal backup role, to an integrated solution where it will be used to cover services, or areas that are less likely to be supported by the proposed and existing ground infrastructure. Such Integrated roles can include usage of satellite communications for oceanic and remote land areas for example. It also can include relieving the capacity of the ground network by providing broadcast based services of Traffic Information Services messages (TIS-B), or Flight Information Services (FIS-B) which can take a significant portion of the ground system capacity. Additionally, satellite communication can play a backup role to support any needs for ground replacement, or additional needed capacity even after the new digital systems are in place. The additional bandwidth that can be provided via satellite communications can also open the door for many new

  5. 5 alpha-reductase inhibitors and prostatic disease.

    PubMed

    Schröder, F H

    1994-08-01

    5 alpha-Reductase inhibitors are a new class of substances with very specific effects on type I and type II 5 alpha R which may be of use in the treatment of skin disease, such as male pattern baldness, male acne and hirsutism, as well as prostatic hyperplasia and prostate cancer. At least two types of 5 alpha R inhibitors with a different pH optimum have been described. cDNA encoding for both the type I and the type II enzyme has been cloned. Most of the orally effective 5 alpha R inhibitors belong to the class of 4-azasteroids. The radical substituted in the 17 position of the steroid ring seems to be related to species specific variations and to the types of 5 alpha R enzymes in different species and organ systems. 5 alpha R inhibitors lead to a decrease of plasma DHT by about 65% while there is a slight rise in plasma testosterone. The decrease of tissue DHT in the ventral prostate of the intact rat, the dog and in humans is more pronounced and amounts to about 85%. There is a reciprocal rise of tissue T in these systems. The application of an inhibitor of 5 alpha R type II leads to a shrinkage of BPH in men by about 30%. In the rat a similar shrinkage accompanied by a significant decrease of total organ DNA occurs. This decrease, however, is not as pronounced as can be achieved with castration.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7522999

  6. Lyman-alpha observations of Comet Kohoutek 1973 XII with Copernicus

    NASA Technical Reports Server (NTRS)

    Drake, J. F.; Jenkins, E. B.; Bertaux, J. L.; Festou, M.; Keller, H. U.

    1976-01-01

    Comet Kohoutek 1973 XII was observed with a telescope-spectrometer on the Copernicus satellite on six occasions over a 1-month period starting on January 29, 1974. Positive detection of the cometary Ly-alpha emission profile was obtained on January 29 and February 2. Earlier observations of the geocoronal Ly-alpha emission profile allowed an instrumental intensity calibration and confirmation of the computed instrumental profile for an extended source at the Ly-alpha wavelength. After allowing for broadening by the instrument, a hydrogen-outflow velocity of about 10.6 km/s is derived from the width of the Ly-alpha emission on January 29. The intensity calibration combined with an appropriate cometary model led to cometary water-production rates for January 29 and February 2. Only upper limits were obtained for Ly-alpha on and after February 14. Searches for OH and D led to negative results.

  7. DNA polymerases delta and epsilon are required for chromosomal replication in Saccharomyces cerevisiae.

    PubMed Central

    Budd, M E; Campbell, J L

    1993-01-01

    Three DNA polymerases, alpha, delta, and epsilon are required for viability in Saccharomyces cerevisiae. We have investigated whether DNA polymerases epsilon and delta are required for DNA replication. Two temperature-sensitive mutations in the POL2 gene, encoding DNA polymerase epsilon, have been identified by using the plasmid shuffle technique. Alkaline sucrose gradient analysis of DNA synthesis products in the mutant strains shows that no chromosomal-size DNA is formed after shift of an asynchronous culture to the nonpermissive temperature. The only DNA synthesis observed is a reduced quantity of short DNA fragments. The DNA profiles of replication intermediates from these mutants are similar to those observed with DNA synthesized in mutants deficient in DNA polymerase alpha under the same conditions. The finding that DNA replication stops upon shift to the nonpermissive temperature in both DNA polymerase alpha- and DNA polymerase epsilon- deficient strains shows that both DNA polymerases are involved in elongation. By contrast, previous studies on pol3 mutants, deficient in DNA polymerase delta, suggested that there was considerable residual DNA synthesis at the nonpermissive temperature. We have reinvestigated the nature of DNA synthesis in pol3 mutants. We find that pol3 strains are defective in the synthesis of chromosomal-size DNA at the restrictive temperature after release from a hydroxyurea block. These results demonstrate that yeast DNA polymerase delta is also required at the replication fork. PMID:8417347

  8. Interaction of polyalanine alpha-helix with carbon nanotube.

    PubMed

    Balamurugan, K; Subramanian, V

    2011-02-01

    The application of carbon nanotubes (CNT) in the area of biology such as Drug delivery vehicle and Biosensors calls for the basic understanding of the CNT's with biological macromolecules like proteins, DNA, Carbohydrates and lipids. CNT is known to be highly hydrophobic in nature. Our study reveals that the inherent hydrophobic nature of CNT is capable of disturbing the alpha-helical protein secondary structure. Thus our study provides mechanistic understanding of the loss in the alpha-helicity of the proteins in the presence of CNT. Our study reveals that the nanomaterials should be suitably modified for biological applications.

  9. Domain structure of phage P4 alpha protein deduced by mutational analysis.

    PubMed Central

    Ziegelin, G; Linderoth, N A; Calendar, R; Lanka, E

    1995-01-01

    Bacteriophage P4 DNA replication depends on the product of the alpha gene, which has origin recognition ability, DNA helicase activity, and DNA primase activity. One temperature-sensitive and four amber mutations that eliminate DNA replication in vivo were sequenced and located in the alpha gene. Sequence analysis of the entire gene predicted a domain structure for the alpha polypeptide chain (777 amino acid residues, M(r) 84,900), with the N terminus providing the catalytic activity for the primase and the middle part providing that for the helicase/nucleoside triphosphatase. This model was confirmed experimentally in vivo and in vitro. In addition, the ori DNA recognition ability was found to be associated with the C-terminal third of the alpha polypeptide chain. The type A nucleotide-binding site is required for P4 replication in vivo, as shown for alpha mutations at G-506 and K-507. In the absence of an active DnaG protein, the primase function is also essential for P4 replication. Primase-null and helicase-null mutants retain the two remaining activities functionally in vitro and in vivo. The latter was demonstrated by trans complementation studies, indicating the assembly of active P4 replisomes by a primase-null and a helicase-null mutant. PMID:7635818

  10. High performance satellite networks

    NASA Astrophysics Data System (ADS)

    Helm, Neil R.; Edelson, Burton I.

    1997-06-01

    The high performance satellite communications networks of the future will have to be interoperable with terrestrial fiber cables. These satellite networks will evolve from narrowband analogue formats to broadband digital transmission schemes, with protocols, algorithms and transmission architectures that will segment the data into uniform cells and frames, and then transmit these data via larger and more efficient synchronous optional (SONET) and asynchronous transfer mode (ATM) networks that are being developed for the information "superhighway". These high performance satellite communications and information networks are required for modern applications, such as electronic commerce, digital libraries, medical imaging, distance learning, and the distribution of science data. In order for satellites to participate in these information superhighway networks, it is essential that they demonstrate their ability to: (1) operate seamlessly with heterogeneous architectures and applications, (2) carry data at SONET rates with the same quality of service as optical fibers, (3) qualify transmission delay as a parameter not a problem, and (4) show that satellites have several performance and economic advantages over fiber cable networks.

  11. Satellite altimeter calibration techniques

    NASA Technical Reports Server (NTRS)

    Kolenkiewicz, R.; Martin, C. F.

    1990-01-01

    This paper examines calibration techniques which can most effectively satisfy the requirements of future satellites carrying high-accuracy radar altimeters, such as the ESA ERS-1 and the NASA/CNES Topex/Poseidon satellites scheduled for launch during the next five years. The calibration accuracies and the advantages and disadvantages of the four currently proposed calibration techniques for over-water calibration are discussed: (1) a tide gauge on a tower at-sea and a nearby laser, (2) a laser and a tide gauge on an island with an offshore satellite pass and a geoid tie between the satellite ground track and the laser, (3) a tide gauge on a tower at-sea with satellite positioning from multiple lasers and a GPS, and (4) a laser and a tide gauge on a tower at-sea. Error budgets for these techniques, developed on the basis of state-of-the-art tracking systems, were found to have one sigma height uncertainties in the 2.8 to 4.9 cm range.

  12. Comparing Two Satellite Sensors

    NASA Technical Reports Server (NTRS)

    2002-01-01

    This pair of images shows the same area of South Africa's Kruger National Park taken by different satellite sensors only minutes apart. The top image is from the Enhanced Thematic Mapper plus (ETM+) aboard Landsat 7, the latest in a long line of high-resolution remote sensing satellites begun in 1972 with the Earth Resources Technology Satellite (ERTS), later renamed Landsat-1. The bottom image was acquired by the Advanced Land Imager (ALI) aboard Earth Observer-1 (EO-1), an instrument designed to test new technologies that will continue the observations begun by the Landsat satellites. Future instruments like the ALI will be much smaller and less expensive than the ETM+, enabling NASA and the United States Geological Survey (USGS) to continue exploring the surface of the Earth. Both images above are false color composites combining short wave infrared (1.65 um), near infrared (.79 um), and green (.57 um) wavelengths as red, green, and blue, respectively. Dense vegetation appears green. The similarity of the images demonstrates the ability of the ALI to produce data that can be compared with the 29-year archive of Landsat data. Several NASA field campaigns conducted in Kruger National Park provided ground-based data needed to evaluate measurements from each of the satellite sensors. For more information, read the EO-1 fact sheet and the Landsat-7 fact sheet. Images courtesy Landsat 7 Science Team

  13. Satellite altimeter calibration techniques

    NASA Astrophysics Data System (ADS)

    Kolenkiewicz, R.; Martin, C. F.

    This paper examines calibration techniques which can most effectively satisfy the requirements of future satellites carrying high-accuracy radar altimeters, such as the ESA ERS-1 and the NASA/CNES Topex/Poseidon satellites scheduled for launch during the next five years. The calibration accuracies and the advantages and disadvantages of the four currently proposed calibration techniques for over-water calibration are discussed: (1) a tide gauge on a tower at-sea and a nearby laser, (2) a laser and a tide gauge on an island with an offshore satellite pass and a geoid tie between the satellite ground track and the laser, (3) a tide gauge on a tower at-sea with satellite positioning from multiple lasers and a GPS, and (4) a laser and a tide gauge on a tower at-sea. Error budgets for these techniques, developed on the basis of state-of-the-art tracking systems, were found to have one sigma height uncertainties in the 2.8 to 4.9 cm range.

  14. International communications via satellite

    NASA Astrophysics Data System (ADS)

    McLucas, J. L.

    The evolution of communications satellite systems is traced in terms of technical capabilities and technological advances. The Communications Act of 1962 led to the establishment of INTELSAT on an international basis in 1964. The original 19 signatory nations has grown to over 100, and over 800 ground relay stations have been built. The INTELSAT system comprises spacecraft over the Atlantic, Pacific, and Indian Oceans and handles 2/3 of the world's international electronic communications and all transoceanic television. The 1965 Early Bird satellite had a 240 two-way telephone link capacity and weighed 38 kg, while the Intelsat V satellites, of which there will be nine, have increased the capacity to 20,000 voice circuits and Intelsat VI will double the number by 1993. Increasing demand for satellite communications links is driving the design and development of space platforms for multiple missions of communications, meteorological studies, and on-board switching and data processing in excess of current multiple satellite systems.

  15. Isolation and characterization of the human G sub s. alpha. gene

    SciTech Connect

    Kozasa, Tohru; Itoh, Hiroshi; Tsukamoto, Toshihiko; Kaziro, Yoshito )

    1988-04-01

    The gene for G{sub s}{alpha} (the {alpha} subunit of the guanine nucleotide-binding protein G{sub s}) was isolated from human genomic libraries using rat G{sub s}{alpha} cDNA as a probe. Comparison of the nucleotide sequence of the human gene with that of the rat cDNA revealed that the human G{sub s}{alpha} gene spans {approx}20 kilobases and is composed of 13 exons and 12 introns. Genomic Southern blot analysis suggests that the human haploid genome contains a single G{sub s}{alpha} gene. Previous reports indicated the presence of multiple species of G{sub s}{alpha} cDNA. The structure of the human G{sub s}{alpha} gene suggests that four types of G{sub s}{alpha} mRNAs may be generated from a single G{sub s}{alpha} gene by alternate use of exon 3 and/or of two 3{prime} splice sites of intron 3, where an unusual splice junction sequence (TG) instead of the consensus (AG) is used. S1 nuclease mapping analysis of human G{sub s}{alpha} mRNA identified multiple transcriptional initiation sites. The promoter region of the human G{sub s}{alpha} gene has extremely high G+C content (85%). It contains 4 GC boxes, but no typical TATA or CAAT box sequence. In the 5{prime} flanking region, there are several blocks of sequences that are similar to the sequences of the 5{prime} flanking region of the human cKi-ras2 gene.

  16. Murine elongation factor 1 alpha (EF-1 alpha) is posttranslationally modified by novel amide-linked ethanolamine-phosphoglycerol moieties. Addition of ethanolamine-phosphoglycerol to specific glutamic acid residues on EF-1 alpha

    SciTech Connect

    Whiteheart, S.W.; Shenbagamurthi, P.; Chen, L.; Cotter, R.J.; Hart, G.W. )

    1989-08-25

    Elongation Factor 1 alpha (EF-1 alpha), an important eukaryotic translation factor, transports charged aminoacyl-tRNA from the cytosol to the ribosomes during poly-peptide synthesis. Metabolic radiolabeling with ({sup 3}H) ethanolamine shows that, in all cells examined, EF-1 alpha is the major radiolabeled protein. Radiolabeled EF-1 alpha has an apparent Mr = 53,000 and a basic isoelectric point. It is cytosolic and does not contain N-linked oligosaccharides. Trypsin digestion of murine EF-1 alpha generated two major ({sup 3}H)ethanolamine-labeled peptides. Three peptides were sequenced and were identical to two distinct regions of the human EF-1 alpha protein. Blank sequencing cycles coinciding with glutamic acid in the human cDNA-derived sequence were also found to release ({sup 3}H)ethanolamine, and compositional analysis of these peptides confirmed the presence of glutamic acid. Dansylation analysis demonstrates that the amine group of the ethanolamine is blocked. These results indicate that EF-1 alpha is posttranslationally modified by the covalent attachment of ethanolamine via an amide bond to at least two specific glutamic acid residues (Glu-301 and Glu-374). The hydroxyl group of the attached ethanolamine was shown by mass spectrometry and compositional analysis, to be further modified by the addition of a phosphoglycerol unit. This novel posttranslational modification may represent an important alteration of EF-1 alpha, comparable to the regulatory effects of posttranslational methylation of EF-1 alpha lysine residues.

  17. Proteinaceous alpha-amylase inhibitors.

    PubMed

    Svensson, Birte; Fukuda, Kenji; Nielsen, Peter K; Bønsager, Birgit C

    2004-02-12

    Proteins that inhibit alpha-amylases have been isolated from plants and microorganisms. These inhibitors can have natural roles in the control of endogenous alpha-amylase activity or in defence against pathogens and pests; certain inhibitors are reported to be antinutritional factors. The alpha-amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha-amylases in complex with inhibitors from five families. These structures indicate major diversity but also some similarity in the structural basis of alpha-amylase inhibition. Mutational analysis of the mechanism of inhibition was performed in a few cases and various protein engineering and biotechnological approaches have been outlined for exploitation of the inhibitory function. PMID:14871655

  18. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W.; Allander, Krag S.; Bounds, John A.

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  19. Background canceling surface alpha detector

    DOEpatents

    MacArthur, D.W.; Allander, K.S.; Bounds, J.A.

    1996-06-11

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

  20. Impacts of satellite galaxies on the redshift-space distortions

    SciTech Connect

    Hikage, Chiaki; Yamamoto, Kazuhiro E-mail: kazuhiro@hiroshima-u.ac.jp

    2013-08-01

    We study the impacts of the satellite galaxies on the redshift-space distortions. In our multipole power spectrum analysis of the luminous red galaxies (LRGs) samples of the Sloan digital sky survey (SDSS), we have clearly detected the non-zero signature of the hexadecapole and tetrahexadecapole spectrum, which almost disappears in the power spectrum with the sample of the brightest LRGs only. We thus demonstrate that the satellite LRGs in multiple systems make a significant contribution to the multipole power spectrum though its fraction is small. The behavior can be understood by a simple halo model, in which the one-halo term, describing the Finger of God (FoG) effect from the satellite galaxies, makes the dominant contribution to the higher multipole spectra. We demonstrate that the small-scale information of higher multipole spectrum is useful for calibrating the satellite FoG effect and improves the measurement of the cosmic growth rate dramatically. We further demonstrate that the fiber collision in the galaxy survey influences the one-halo term and the higher multipole spectra, because the number of satellite galaxies in the halo occupation distribution (HOD) is changed. We also discuss about the impact of satellite galaxies on future high-redshift surveys targeting the H-alpha emitters.

  1. Dielectronic satellite spectra of hydrogen-like titanium (Ti XXII)

    SciTech Connect

    Bitter, M.; von Goeler, S.; Cohen, S.; Hill, K.W.; Sesnic, S.; Tenney, F.; Timberlake, J.; Safronova, U.I.; Vainshtein, L.A.; Dubau, J.

    1983-07-01

    High resolution spectra of the Ly ..cap alpha../sub 1/ and Ly ..cap alpha../sub 2/ lines of hydrogenlike titanium, TiXXII, and the associated dielectronic satellites which are due to transitions 1snl-2pnl with n greater than or equal to 2, have been observed from tokamak discharges with auxiliary ion cyclotron heating (ICRH) with central electron temperatures of 2 keV and central electron densities of 8 x 10/sup 13/ cm/sup -3/ on the Princeton Large Torus (PLT). The data have been used for a detailed comparison with theoretical predictions based on the Z - expansion method and Hartree - Fock calculations. The results obtained with the Z - expansion method are in excellent agreement with the observed spectral data except for minor discrepancies between the theoretical and experimental wavelengths of 0.0003 A for the n = 2 satellites and of 0.0001 A for the separation of the Ly ..cap alpha../sub 1/ and Ly ..cap alpha../sub 2/ lines. Very good agreement with the experimental data is also obtained for the results from the Hartree - Fock calculations though somewhat larger discrepancies (approx. = 0.0009 A) exist between experimental and theoretical wavelengths which are systematically too small. The observed spectra are used for diagnosis of the central ion and electron temperatures of the PLT discharges and for a measurement of the dielectronic recombination rate coefficient of TiXXII.

  2. Long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.

    1993-02-02

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  3. Lorentz violation and {alpha} decay

    SciTech Connect

    Altschul, Brett

    2009-01-01

    Relating the effective Lorentz violation coefficients for composite particles to the coefficients for their constituent fields is a challenging problem. We calculate the Lorentz violation coefficients relevant to the dynamics of an {alpha} particle in terms of proton and neutron coefficients. The {alpha}-particle coefficients would lead to anisotropies in the {alpha} decays of nuclei, and because the decay process involves quantum tunneling, the effects of any Lorentz violations could be exponentially enhanced.

  4. Long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; Wolf, Michael A.; McAtee, James L.; Unruh, Wesley P.; Cucchiara, Alfred L.; Huchton, Roger L.

    1993-01-01

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  5. Absence of genotoxicity of potato alkaloids alpha-chaconine, alpha-solanine and solanidine in the Ames Salmonella and adult and foetal erythrocyte micronucleus assays.

    PubMed

    Friedman, M; Henika, P R

    1992-08-01

    To assess whether reported toxicities of potato-derived glycoalkaloids could be the result of interactions with cellular DNA, the genotoxic effects of alpha-solanine, alpha-chaconine and solanidine were studied, using the Ames test (Salmonella strains TA98 and TA100), the mouse peripheral blood micronucleus test and the mouse transplacental micronucleus test. The Ames test for mutagenicity with alpha-solanine was weakly positive in TA100 with S-9 activation (29 revertants per millimole per plate). However, pooled data from duplicate tests gave a negative effect. Pooled data from two experiments with alpha-chaconine gave a weak positive response in TA98 without microsomes (17 revertants per millimole per plate). The micronucleus tests for clastogenicity using male mouse and foetal blood were negative. The absence of mutagenicity and clastogenicity suggests lack of damage to intracellular DNA for potato alkaloid toxicity.

  6. Alpha 2 adrenergic receptors in hyperplastic human prostate: identification and characterization using (/sup 3/H) rauwolscine

    SciTech Connect

    Shapiro, E.; Lepor, H.

    1986-05-01

    (/sup 3/H)Rauwolscine ((/sup 3/H)Ra), a selective ligand for the alpha 2 adrenergic receptor, was used to identify and characterize alpha 2 adrenergic receptors in prostate glands of men with benign prostatic hyperplasia. Specific binding of (/sup 3/H)Ra to prostatic tissue homogenates was rapid and readily reversible by addition of excess unlabelled phentolamine. Scatchard analysis of saturation experiments demonstrates a single, saturable class of high affinity binding sites (Bmax = 0.31 +/- 0.04 fmol./microgram. DNA, Kd = 0.9 +/- 0.11 nM.). The relative potency of alpha adrenergic drugs (clonidine, alpha-methylnorepinephrine and prazosin) in competing for (/sup 3/H)Ra binding sites was consistent with the order predicted for an alpha 2 subtype. The role of alpha 2 adrenergic receptors in normal prostatic function and in men with bladder outlet obstruction secondary to BPH requires further investigation.

  7. Satellite failures revisited

    NASA Astrophysics Data System (ADS)

    Balcerak, Ernie

    2012-12-01

    In January 1994, the two geostationary satellites known as Anik-E1 and Anik-E2, operated by Telesat Canada, failed one after the other within 9 hours, leaving many northern Canadian communities without television and data services. The outage, which shut down much of the country's broadcast television for hours and cost Telesat Canada more than $15 million, generated significant media attention. Lam et al. used publicly available records to revisit the event; they looked at failure details, media coverage, recovery effort, and cost. They also used satellite and ground data to determine the precise causes of those satellite failures. The researchers traced the entire space weather event from conditions on the Sun through the interplanetary medium to the particle environment in geostationary orbit.

  8. Artificial gravity experiment satellites

    NASA Astrophysics Data System (ADS)

    Harada, Tadashi

    1992-07-01

    An overview of the conceptual study of an artificial gravity experiment satellite based on the assumption of a launch by the H-2 launch vehicle with a target launch date in the Year 2000 is presented. While many satellites provided with artificial gravity have been reported in relation to a manned Mars exploration spacecraft mission, the review has been conducted on missions and test subjects only for experimental purposes. Mission requirements were determined based on the results of reviews on the mission, test subjects, and model missions. The system baseline and development plan were based on the results of a study on conceptual structure and scale of the system, including measures to generate artificial gravity. Approximate scale of the system and arm length, mission orbit, visibility of the operation orbit from ground stations in Japan, and satellite attitude on the mission orbit are outlined.

  9. The Clementine satellite

    SciTech Connect

    Not Available

    1994-06-01

    The first US satellite to the Moon in more than two decades was launched from Vandenberg Air Force Base (Santa Barbara County), California, on January 25, 1994. The satellite was named Clementine because it carried only enough fuel to complete its mission before it was [open quotes]lost and gone forever.[close quotes] The Clementine satellite tested 23 advanced technologies during its mission for the Ballistic Missile Defense Organization. In fulfilling its scientific goals, Clementine provided a wealth of information relevant to the mineralogy of the lunar surface. Using six on-board cameras designed and built at the Laboratory, Clementine mapped the entire surface of the Moon at resolutions never before attained. Clementine also provided range data that will be used to construct a relief map of the lunar surface.

  10. Brazilian Small Satellites

    NASA Astrophysics Data System (ADS)

    Carvalho, Himilcon

    Brazilian experience with micro scientific satellites began in 1995 with the SACI project that comprised 2 scientific satellites that carried onboard experiments from Brazil, Japan and US. The first one failed after launch (1998) and the second was lost during the second launch attempt of the Brazilian national launcher, VLS, in1999. Started by 1997, the French-Brazilian Microsatellite Project comprised a set of 9 experiments from French and Brazilian scientists. The project was terminated by the French side in 2002. Currently, there are two ongoing science projects, MIRAX (devoted to X-Ray astronomy) and EQUARS (to study the higher atmosphere). These projects include experiments from US, Netherlands, Japan, Canada, and Brazil, with launch scheduled to 2011 or 2012. This paper presents a brief summary of the history of the development of these satellites along with some highlights on the Brazilian Space Program.

  11. AVS on satellite

    NASA Astrophysics Data System (ADS)

    Zhao, Haiwu; Wang, Guozhong; Hou, Gang

    2005-07-01

    AVS is a new digital audio-video coding standard established by China. AVS will be used in digital TV broadcasting and next general optical disk. AVS adopted many digital audio-video coding techniques developed by Chinese company and universities in recent years, it has very low complexity compared to H.264, and AVS will charge very low royalty fee through one-step license including all AVS tools. So AVS is a good and competitive candidate for Chinese DTV and next generation optical disk. In addition, Chinese government has published a plan for satellite TV signal directly to home(DTH) and a telecommunication satellite named as SINO 2 will be launched in 2006. AVS will be also one of the best hopeful candidates of audio-video coding standard on satellite signal transmission.

  12. ESA's satellite communications programme

    NASA Astrophysics Data System (ADS)

    Bartholome, P.

    1985-02-01

    The developmental history, current status, and future plans of the ESA satellite-communications programs are discussed in a general survey and illustrated with network diagrams and maps. Consideration is given to the parallel development of national and European direct-broadcast systems and telecommunications networks, the position of the European space and electronics industries in the growing world market, the impact of technological improvements (both in satellite systems and in ground-based networks), and the technological and commercial advantages of integrated space-terrestrial networks. The needs for a European definition of the precise national and international roles of satellite communications, for maximum speed in implementing such decisions (before the technology becomes obsolete), and for increased cooperation and standardization to assure European equipment manufacturers a reasonable share of the market are stressed.

  13. Uranus satellites - Surface properties

    NASA Technical Reports Server (NTRS)

    Veverka, J.; Brown, R. H.; Bell, Jeffrey F.

    1991-01-01

    The post-Voyager knowledge of the photometric, colorimetric, spectral, and thermal properties of the Uranian satellites is reviewed, focusing on such fundamental physical properties as albedo, color, and surface texture. While albedo variations of at least a factor of 2 exist, color differences are almost absent (Miranda) or subdued (Oberon). In the case of Titania, the strong opposition effect reported by ground-based observers was confirmed by Voyager. Voyager did not observe the opposition parts of the phase curves of the other satellites. Voyager thermal observations of Ariel and Miranda suggest that both have highly porous regoliths, thermophysically similar to those of Jupiter's icy satellites. At the time of the flyby (south pole facing the sun), maximum surface temperatures reached or exceeded 85 K, but nighttime polar temperatures are predicted to drop to 20 to 30 K because each pole spends about 40 yr in darkness. Ground-based spectroscopy identified water ice as an important surface constituent.

  14. Modeling Solar Lyman Alpha Irradiance

    NASA Technical Reports Server (NTRS)

    Pap, J.; Hudson, H. S.; Rottman, G. J.; Willson, R. C.; Donnelly, R. F.; London, J.

    1990-01-01

    Solar Lyman alpha irradiance is estimated from various solar indices using linear regression analyses. Models developed with multiple linear regression analysis, including daily values and 81-day running means of solar indices, predict reasonably well both the short- and long-term variations observed in Lyman alpha. It is shown that the full disk equivalent width of the He line at 1083 nm offers the best proxy for Lyman alpha, and that the total irradiance corrected for sunspot effect also has a high correlation with Lyman alpha.

  15. ISS Update: Alpha Magnetic Spectrometer

    NASA Video Gallery

    NASA Public Affairs Officer Kelly Humphries interviews Trent Martin, Johnson Space Center project manager for the Alpha Magnetic Spectrometer (AMS) aboard the International Space Station. Questions...

  16. Molecular cloning and sequence determination of cDNAs for alpha subunits of the guanine nucleotide-binding proteins Gs, Gi, and Go from rat brain.

    PubMed Central

    Itoh, H; Kozasa, T; Nagata, S; Nakamura, S; Katada, T; Ui, M; Iwai, S; Ohtsuka, E; Kawasaki, H; Suzuki, K

    1986-01-01

    We have cloned cDNAs encoding alpha subunits of the guanine nucleotide-binding proteins Gs, Gi, and Go and determined their nucleotide sequences. Purified preparations of Gi and Go alpha subunits (Gi alpha and Go alpha) from rat brain were completely digested with trypsin, and peptides were subjected to amino acid sequence analysis. By screening of a c<