Cloning and characterization of the rat HIF-1 alpha prolyl-4-hydroxylase-1 gene.

PubMed

Cobb, Ronald R; McClary, John; Manzana, Warren; Finster, Silke; Larsen, Brent; Blasko, Eric; Pearson, Jennifer; Biancalana, Sara; Kauser, Katalin; Bringmann, Peter; Light, David R; Schirm, Sabine

2005-08-01

Prolyl-4-hydroxylase domain-containing enzymes (PHDs) mediate the oxygen-dependent regulation of the heterodimeric transcription factor hypoxia-inducible factor-1 (HIF-1). Under normoxic conditions, one of the subunits of HIF-1, HIF-1alpha, is hydroxylated on specific proline residues to target HIF-1alpha for degradation by the ubiquitin-proteasome pathway. Under hypoxic conditions, the hydroxylation by the PHDs is attenuated by lack of the oxygen substrate, allowing HIF-1 to accumulate, translocate to the nucleus, and mediate HIF-mediated gene transcription. In several mammalian species including humans, three PHDs have been identified. We report here the cloning of a full-length rat cDNA that is highly homologous to the human and murine PHD-1 enzymes and encodes a protein that is 416 amino acids long. Both cDNA and protein are widely expressed in rat tissues and cell types. We demonstrate that purified and crude baculovirus-expressed rat PHD-1 exhibits HIF-1alpha specific prolyl hydroxylase activity with similar substrate affinities and is comparable to human PHD-1 protein.

The alpha subunit of the epithelial sodium channel in the mouse: developmental regulation of its expression.

PubMed

Dagenais, A; Kothary, R; Berthiaume, Y

1997-09-01

Sodium reabsorption by the amiloride-sensitive sodium channel of epithelial cells plays a crucial role in the management of ionic composition and fluid volume in the body. In the respiratory system, sodium transport is involved in the clearance of pulmonary edema and of liquid secreted during fetal life at birth. We have cloned a partial cDNA of the alpha subunit of the mouse amiloride-sensitive sodium channel (alpha mENaC). In the region of comparison, the mouse alpha subunit shows 92% identity at the DNA level and 95% identity at the amino acid level with the rat sequence. The kidneys, lungs, and distal colon are major sites of expression of a 3.5-kb alpha mENaC mRNA. During mouse development, alpha mENaC transcripts appear late during gestation (d 17.5) and are expressed continuously thereafter. In the distal colon, a short 1.2-kb mRNA deleted of the 5' part of the transcript is detected during gestation and is replaced gradually by the mature 3.5-kb transcript after birth. Alpha mENaC and alpha1 Na+-K+-ATPase mRNAs have an expression profile that is modulated similarly during development for a given tissue. The expression of alpha mENaC transcripts increases transiently in the lungs at birth (2.5-fold), as for alpha1 Na+-K+-ATPase mRNAs (1.5-fold), suggesting that the expression of several components of the sodium transport system is modulated in the lungs at that time. In the kidney, there is no significant increase of alpha mENaC and alpha1 Na+-K+-ATPase mRNAs in newborns.

Proteolytic processing of endogenous and recombinant beta 4 integrin subunit

PubMed Central

1992-01-01

The alpha 6 beta 4 integrin is a receptor involved in the interaction of epithelial cells with basement membranes. This integrin is unique among the known integrins in that its beta 4 subunit has a large cytoplasmic domain. The function of this cytoplasmic domain is not known. In this paper we show that the beta 4 subunit undergoes proteolytic processing in cultured cells and provide evidence that this also happens in tissues. Immunoprecipitation experiments indicated that the cytoplasmic domain of beta 4 is susceptible to a calcium-dependent protease present in cellular extracts. In vitro assays with purified calpain showed that this enzyme can cleave beta 4 at two distinct sites in the cytoplasmic domain, generating truncated molecules of 165 and 130 kD. Immunoblotting experiments performed on cultured epithelial cells using an antibody to a peptide modeled after the COOH-terminus of the beta 4 subunit showed 70-kD fragments and several fragments of molecular masses between 185 and 115 kD. Similar fragments were detected in CHO cells transfected with the full-length beta 4 cDNA, but not in control transfected cells or in cells transfected with a mutant cDNA lacking the epitope of the cytoplasmic peptide antibody. The sizes of the fragments indicated that both the intracellular and extracellular domains of beta 4 are proteolytically processed. To examine the processing of the beta 4 subunit in epithelial tissues in vivo, human skin frozen sections were stained with antibodies to the ectodomain or the cytoplasmic domain of beta 4. The distinct staining patterns obtained with the two types of antibodies provided evidence that beta 4 is proteolytically processed in vivo in skin. Analogous experiments performed on sections of the cornea suggested that beta 4 is not proteolytically processed at a detectable level in this tissue. Thus, cleavage of the beta 4 subunit occurs in a tissue-specific fashion. These results suggest a potential mechanism of modulating the activities of the alpha 6 beta 4 integrin. PMID:1500432

Effect of metal ions on the activity of casein kinase II from Xenopus laevis.

PubMed

Gatica, M; Hinrichs, M V; Jedlicki, A; Allende, C C; Allende, J E

1993-01-04

Casein kinase II purified from the nuclei of Xenopus laevis oocytes as well as the recombinant alpha and beta subunits of the X. laevis CKII, produced in E. coli from the cloned cDNA genes, were tested with different divalent metal ions. The enzyme from both sources was active with either Mg2+, Mn2+, or Co2+. Optimal concentrations were 7-10 mM for Mg2+, 0.5-0.7 mM for Mn2+ and 1-2 mM for Co2+. In the presence of Mn2+ or Co2+ the enzyme used GTP more efficiently than ATP as a phosphate donor while the reverse was true in the presence of Mg2+. The apparent Km values for both nucleotide triphosphates were greatly decreased in the presence of Mn2+ as compared with Mg2+. Addition of Zn2+ (above 150 microM) to an assay containing the optimal Mg2+ ion concentration caused strong inhibition of both holoenzyme and alpha subunit. Inhibition of the holoenzyme by 400 microM Ni2+ could be reversed by high concentrations of Mg2+ but no reversal of this inhibition was observed with the alpha subunit.

Mutations in the PCCA gene encoding the {alpha} subunit of propionyl-CoA carboxylase in patients with propionic acidemia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Campeau, E.; Leon-Del-Rio, A.; Gravel, R.A.

Propionic acidemia is a rare autosomal recessive disorder characterized by a deficiency of the mitochondrial biotin-dependent enzyme, propionyl-CoA carboxylase (PCC). PCC has the structure {alpha}{sub 4}{beta}{sub 4}, with the {alpha} subunit containing the biotin prosthetic group. This study is concerned with defining the spectrum of mutations occurring in the PCCA gene encoding the {alpha} subunit. Mutations were initially assigned to this gene through complementation experiments done after somatic fusion of patient fibroblasts. The analyses were performed on PCR-amplified reverse transcripts of fibroblast RNA. The mutations were identified by single strand conformational polymorphism analysis and direct sequencing of PCR products. Threemore » candidate disease-causing mutations and one DNA polymorphism were identified in the {alpha} subunit sequence in different patients: (1) a 3 bp deletion {triangle}CTG{sub 2058-2060}, which eliminates Cys687 near the biotin binding site (Lys669); (2) T{sub 611}{r_arrow}A which converts Met204 to Lys in a highly conserved region matching that of an ATP binding site; (3) An {approximately}50 bp deletion near the 3{prime} end of the cDNA which likely corresponds to the loss of an exon due to a splicing defect; and (4) a 3 bp insertion, +CAG{sub 2203}, located downstream of the stop codon, which is likely a DNA polymorphism. In order to determine the effect of the Cys687 deletion on the biotinylation of PCC, we expressed the mutation in a 67 amino acid C-terminal fragment of the PCC {alpha} subunit in E. coli in which biotinylation is directed by the bacterial biotin ligase. While the mutant peptide was expressed at about half-normal levels, the biotinylation of the peptide that was present was reduced to only {approximately}20% normal. We suggest, therefore, that the absence of PCC activity due to {triangle}Cys687 results at least in part from defective biotinylation of an unstable protein.« less

Characterization of two forms of mouse salivary androgen-binding protein (ABP): implications for evolutionary relationships and ligand-binding function.

PubMed

Karn, Robert C; Laukaitis, Christina M

2003-06-17

Mouse salivary androgen-binding protein (ABP) is a member of the secretoglobin family produced in the submaxillary glands of house mice (Mus musculus). We report the cDNA sequences and amino acid sequences of the beta and gamma subunits of ABP from a mouse cDNA library, identifying the two subunits by their pIs and molecular weights. An anomalously high molecular weight of the alpha subunit is likely due to glycosylation at a single site. A phylogenetic comparison of the three subunits of ABP with the chains of other mammalian secretoglobins shows that ABP is most closely related to mouse lachrymal protein and to the major cat allergen Fel dI. An evaluation of the most conserved residues in ABP and the other secretoglobins, in light of structural data reported by others [Callebaut, I., Poupon, A., Bally, R., Demaret, J.-P., Housset, D., Delettre, J., Hossenlopp, P., and Mornon, J.-P. (2000) Ann. N.Y. Acad. Sci. 923, 90-112; Pattabiraman, N., Matthews, J., Ward, K., Mantile-Selvaggi, G., Miele, L., and Mukherjee, A. (2000) Ann. N.Y. Acad. Sci. 923, 113-127], allows us to draw conclusions about the critical residues important in ligand binding by the two different ABP dimers and to assess the importance of ligand binding in the function of the molecule. In addition to the cDNAs, which represent those of the musculus subspecies of Mus musculus, we also report the coding regions of the beta and gamma subunit cDNAs from two other mouse inbred strains which represent the other two subspecies: M. musculus domesticus and M. musculus castaneus. The high nonsynonymous/synonymous substitution rate ratios (K(a)/K(s)) for both the beta and gamma subunits suggest that these two proteins are evolving under strong directional selection, as has been reported for the alpha subunit [Hwang, J., Hofstetter, J., Bonhomme, F., and Karn, R. (1997) J. Hered. 88, 93-97; Karn, R., and Clements, M. (1999) Biochem. Genet. 37, 187-199].

Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

PubMed Central

LaPolla, R J; Mayne, K M; Davidson, N

1984-01-01

A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

Isolation and characterization of cDNA clones for human erythrocyte beta-spectrin.

PubMed Central

Prchal, J T; Morley, B J; Yoon, S H; Coetzer, T L; Palek, J; Conboy, J G; Kan, Y W

1987-01-01

Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical alpha (Mr 240,000) and beta (Mr 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. We report here the isolation and characterization of a human erythroid-specific beta-spectrin cDNA clone that encodes parts of the beta-9 through beta-12 repeat segments. This cDNA was used as a hybridization probe to assign the beta-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte beta-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the beta-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities. Images PMID:3478706

A double mutation in exon 6 of the [beta]-hexosaminidase [alpha] subunit in a patient with the B1 variant of Tay-Sachs disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ainsworth, P.J.; Coulter-Mackie, M.B.

1992-10-01

The B1 variant form of Tay-Sachs disease is enzymologically unique in that the causative mutation(s) appear to affect the active site in the [alpha] subunit of [beta]-hexosaminidase A without altering its ability to associate with the [beta] subunit. Most previously reported B1 variant mutations were found in exon 5 within codon 178. The coding sequence of the [alpha] subunit gene of a patient with the B1 variant form was examined with a combination of reverse transcription of mRNA to cDNA, PCR, and dideoxy sequencing. A double mutation in exon 6 has been identified: a G[sub 574][yields]C transversion causing a val[submore » 192][yields]leu change and a G[sub 598][yields] A transition resulting in a val[sub 200][yields]met alteration. The amplified cDNAs were otherwise normal throughout their sequence. The 574 and 598 alterations have been confirmed by amplification directly from genomic DNA from the patient and her mother. Transient-expression studies of the two exon 6 mutations (singly or together) in COS-1 cells show that the G[sub 574][yields]C change is sufficient to cause the loss of enzyme activity. The biochemical phenotype of the 574 alteration in transfection studies is consistent with that expected for a B1 variant mutation. As such, this mutation differs from previously reported B1 variant mutations, all of which occur in exon 5. 31 refs., 2 figs., 2 tabs.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petroulakis, E.; Cao, Z.; Salo, T.

Mutations in the HEXA gene that encodes the {alpha}-subunit of the heterodimeric lysosomal enzyme {beta}-hexosaminidase A, or Hex A ({alpha}{beta}), cause G{sub M2} gangliosidosis, type 1. The infantile form (Tay-Sachs disease) results when there is no residual Hex A activity, while less severe and more variable clinical phenotypes result when residual Hex A activity is present. A non-Jewish male who presented with an acute psychotic episode at age 16 was diagnosed with a subacute encephalopathic form of G{sub M2} gangliosidosis. At age 19, chronic psychosis with intermittent acute exacerbations remains the most disabling symptom in this patient and his affectedmore » brother although both exhibit some ataxia and moderately severe dysarthria. We have found a 4 bp insertion (+TATC 1278) associated with infantile Tay-Sachs disease on one allele; no previously identified mutation was found on the second allele. SSCP analysis detected a shift in exon 13 and sequencing revealed a G1422C mutation in the second allele that results in a Trp474Cys substitution. The presence of the mutation was confirmed by the loss of HaeIII and ScrFI sites in exon 13 PCR products from the subjects and their father. The mutation was introduced into the {alpha}-subunit cDNA and Hex S ({alpha}{alpha}) and Hex A ({alpha}{beta}) were transiently expressed in monkey COS-7 cells. The Trp474Cys mutant protein had approximately 5% and 12% of wild-type Hex S and Hex A activity, respectively. Western blot analysis revealed a small amount of residual mature {alpha}-subunit and a normal level of precursor protein. We conclude that the Trp474Cys mutation is the cause of the Hex A deficiency associated with a subacute (juvenile-onset) phenotype in this patient. Like other mutations in exon 13 of HEXA, it appears to affect intracellular processing. Studies of the defect in intracellular processing are in progress.« less

The alpha subunit of Go interacts with promyelocytic leukemia zinc finger protein and modulates its functions.

PubMed

Won, Jung Hee; Park, Jung Sik; Ju, Hyun Hee; Kim, Soyeon; Suh-Kim, Haeyoung; Ghil, Sung Ho

2008-05-01

Heterotrimeric GTP-binding proteins (G proteins) mediate signal transduction generated by neurotransmitters and hormones. Go, a member of the Go/Gi family, is the most abundant heterotrimeric G protein in the brain. Most mechanistic analyses on Go activation demonstrate that its action is mediated by the Gbetagamma dimer; downstream effectors for its alpha subunit (Goalpha) have not been clearly defined. Here, we employ the yeast two-hybrid system to screen for Goalpha-interacting partners in a cDNA library from human fetal brain. The transcription factor promyelocytic leukemia zinc finger protein (PLZF) specifically bound to Goalpha. Interactions between PLZF and Goalpha were confirmed using in vitro and in vivo affinity binding assays. Activated Goalpha interacted directly with PLZF, and enhanced its function as a transcriptional and cell growth suppressor. Notably, PLZF activity was additionally promoted by the Go/ialpha-coupled cannabinoid receptor (CB) in HL60 cells endogenously expressing CB and PLZF. These results collectively suggest that Goalpha modulates the function of PLZF via direct interactions. Our novel findings provide insights into the diverse cellular roles of Goalpha and its coupled receptor.

[Cloning of cDNA for RNA polymerase subunit from the fission yeast Schizosaccharomyces pombe by heterospecific complementation in Saccharomyces cerevisiae].

PubMed

Shpakovskiĭ, G V; Lebedenko, E N; Thuriaux, P

1997-02-01

The rpb10 cDNA of the fission yeast Schizosaccharomyces pombe, encoding one of the five small subunits common to all three nuclear DNA-dependent RNA polymerases, was isolated from an expression cDNA library by two independent approaches: PCR-based screening and direct suppression by means of heterospecific complementation of a temperature-sensitive mutant defective in the corresponding gene of Saccharomyces cerevisiae. The cloned Sz. pombe cDNA encodes a protein Rpb10 of 71 amino acids with an M of 8,275 Da, sharing 51 amino acids (71% identity) with the subunit ABC10 beta of RNA polymerases I-III from S. cerevisiae. All eukaryotic members of this protein family have the same general organization featuring two highly conserved motifs (RCFT/SCGK and RYCCRRM) around an atypical zinc finger and an additional invariant HVDLIEK motif toward the C-terminal end. The last motif is only characteristics for homologs from eukaryotes. In keeping with this remarkable structural conservation, the Sz. pombe cDNA also fully complemented a S. cerevisiae deletion mutant lacking subunit ABC10 beta (null allele rpb10-delta 1::HIS3).

Molecular cloning and developmental expression of the catalytic and 65-kDa regulatory subunits of protein phosphatase 2A in Drosophila.

PubMed Central

Mayer-Jaekel, R E; Baumgartner, S; Bilbe, G; Ohkura, H; Glover, D M; Hemmings, B A

1992-01-01

cDNA clones encoding the catalytic subunit and the 65-kDa regulatory subunit of protein phosphatase 2A (PR65) from Drosophila melanogaster have been isolated by homology screening with the corresponding human cDNAs. The Drosophila clones were used to analyze the spatial and temporal expression of the transcripts encoding these two proteins. The Drosophila PR65 cDNA clones contained an open reading frame of 1773 nucleotides encoding a protein of 65.5 kDa. The predicted amino acid sequence showed 75 and 71% identity to the human PR65 alpha and beta isoforms, respectively. As previously reported for the mammalian PR65 isoforms, Drosophila PR65 is composed of 15 imperfect repeating units of approximately 39 amino acids. The residues contributing to this repeat structure show also the highest sequence conservation between species, indicating a functional importance for these repeats. The gene encoding Drosophila PR65 was located at 29B1,2 on the second chromosome. A major transcript of 2.8 kilobase (kb) encoding the PR65 subunit and two transcripts of 1.6 and 2.5 kb encoding the catalytic subunit could be detected throughout Drosophila development. All of these mRNAs were most abundant during early embryogenesis and were expressed at lower levels in larvae and adult flies. In situ hybridization of different developmental stages showed a colocalization of the PR65 and catalytic subunit transcripts. The mRNA expression is high in the nurse cells and oocytes, consistent with a high equally distributed expression in early embryos. In later embryonal development, the expression remains high in the nervous system and the gonads but the overall transcript levels decrease. In third instar larvae, high levels of mRNA could be observed in brain, imaginal discs, and in salivary glands. These results indicate that protein phosphatase 2A transcript levels change during development in a tissue and in a time-specific manner. Images PMID:1320961

Molecular cloning and characterization of ADP-glucose pyrophosphorylase cDNA clones isolated from pea cotyledons.

PubMed

Burgess, D; Penton, A; Dunsmuir, P; Dooner, H

1997-02-01

Three ADP-glucose pyrophosphorylase (ADPG-PPase) cDNA clones have been isolated and characterized from a pea cotyledon cDNA library. Two of these clones (Psagps1 and Psagps2) encode the small subunit of ADPG-PPase. The deduced amino acid sequences for these two clones are 95% identical. Expression of these two genes differs in that the Psagps2 gene shows comparatively higher expression in seeds relative to its expression in other tissues. Psagps2 expression also peaks midway through seed development at a time in which Psagps1 transcripts are still accumulating. The third cDNA isolated (Psagp11) encodes the large subunit of ADPG-PPase. It shows greater selectivity in expression than either of the small subunit clones. It is highly expressed in sink organs (seed, pod, and seed coat) and undetectable in leaves.

Assembly of the stator in Escherichia coli ATP synthase. Complexation of alpha subunit with other F1 subunits is prerequisite for delta subunit binding to the N-terminal region of alpha

PubMed Central

Senior, Alan E.; Muharemagi, Alma; Wilke-Mounts, Susan

2008-01-01

Alpha subunit of Escherichia coli ATP synthase was expressed with a C-terminal 6-His tag and purified. Pure alpha was monomeric, competent in nucleotide binding, and had normal N-terminal sequence. In F1-subunit dissociation/reassociation experiments it supported full reconstitution of ATPase, and reassociated complexes were able to bind to F1-depleted membranes with restoration of ATP-driven proton pumping. Therefore interaction between the stator delta subunit and the N-terminal residue 1-22 region of alpha occurred normally when pure alpha was complexed with other F1 subunits. On the other hand, three different types of experiment showed that no interaction occurred between pure delta and isolated alpha subunit. Unlike in F1, the N-terminal region of isolated alpha was not susceptible to trypsin cleavage. Therefore, during assembly of ATP synthase, complexation of alpha subunit with other F1 subunits is prerequisite for delta subunit binding to the N-terminal region of alpha. We suggest that the N-terminal 1-22 residues of alpha are sequestered in isolated alpha until released by binding of beta to alpha subunit. This prevents 1/1 delta/alpha complexes from forming, and provides a satisfactory explanation of the stoichiometry of one delta per three alpha seen in the F1 sector of ATP synthase, assuming that steric hindrance prevents binding of more than one delta to the alpha3/beta3 hexagon. The cytoplasmic fragment of the b subunit (bsol) did not bind to isolated alpha. It might also be that complexation of alpha with beta subunits is prerequisite for direct binding of stator b subunit to the F1-sector. PMID:17176112

A yeast-based genetic screening to identify human proteins that increase homologous recombination.

PubMed

Collavoli, Anita; Comelli, Laura; Rainaldi, Giuseppe; Galli, Alvaro

2008-05-01

To identify new human proteins implicated in homologous recombination (HR), we set up 'a papillae assay' to screen a human cDNA library using the RS112 strain of Saccharomyces cerevisiae containing an intrachromosomal recombination substrate. We isolated 23 cDNAs, 11 coding for complete proteins and 12 for partially deleted proteins that increased HR when overexpressed in yeast. We characterized the effect induced by the overexpression of the complete human proteasome subunit beta 2, the partially deleted proteasome subunits alpha 3 and beta 8, the ribosomal protein L12, the brain abundant membrane signal protein (BASP1) and the human homologue to v-Ha-RAS (HRAS), which elevated HR by 2-6.5-fold over the control. We found that deletion of the RAD52 gene, which has a key role in most HR events, abolished the increase of HR induced by the proteasome subunits and HRAS; by contrast, the RAD52 deletion did not affect the high level of HR due to BASP1 and RPL12. This suggests that the proteins stimulated yeast HR via different mechanisms. Overexpression of the complete beta 2 human proteasome subunit or the partially deleted alpha 3 and beta 8 subunits increased methyl methanesulphonate (MMS) resistance much more in the rad52 Delta mutant than in the wild-type. Overexpression of RPL12 and BASP1 did not affect MMS resistance in both the wild-type and the rad52 Delta mutant, whereas HRAS decreased MMS resistance in the rad52 Delta mutant. The results indicate that these proteins may interfere with the pathway(s) involved in the repair of MMS-induced DNA damage. Finally, we provide further evidence that yeast is a helpful tool to identify human proteins that may have a regulatory role in HR.

Multiple alpha subunits of integrin are involved in cell-mediated responses of the Manduca immune system.

PubMed

Zhuang, Shufei; Kelo, Lisha; Nardi, James B; Kanost, Michael R

2008-01-01

The cell-mediated responses of the insect innate immune system-phagocytosis, nodulation, encapsulation-involve multiple cell adhesion molecules of hemocyte surfaces. A hemocyte-specific (HS) integrin and a member of the immunoglobulin (Ig) superfamily (neuroglian) are involved in the encapsulation response of hemocytes in Manduca sexta. In addition, two new integrin alpha (alpha) subunits have been found on these hemocytes. The alpha2 subunit is mainly expressed in epidermis and Malphigian tubules, whereas the alpha3 subunit is primarily expressed on hemocytes and fat body cells. Of the three known alpha subunits, the alpha1 subunit found in HS integrin is the predominant subunit of hemocytes. Cell adhesion assays indicate that alpha2 belongs to the integrin family with RGD-binding motifs, confirming the phylogenetic analysis of alpha subunits based on the amino-acid sequence alignment of different alpha subunits. Double-stranded RNAs (dsRNAs) targeting each of these three integrin alpha subunits not only specifically decreased transcript expression of each alpha subunit in hemocytes, but also abolished the cell-mediated encapsulation response of hemocytes to foreign surfaces. The individual alpha subunits of M. sexta integrins, like their integrin counterparts in mammalian immune systems, have critical, individual roles in cell-substrate and cell-cell interactions during immune responses.

[Three regions of Rpb10 mini-subunit of nuclear RNA polymerases are strictly conserved in all eukaryotes].

PubMed

Shpakovskiĭ, G V; Lebedenko, E N

1996-12-01

The rpb10+ cDNA from the fission yeast Schizosaccharomyces pombe was cloned using two independent approaches (PCR and genetic suppression). The cloned cDNA encoded the Rpb10 subunit common for all three RNA polymerases. Comparison of the deduced amino acid sequence of the Sz. pombe Rbp10 subunit (71 amino acid residues) with those of the homologous subunits of RNA polymerases I, II, and III from Saccharomyces cerevisiae and Home sapiens revealed that heptapeptides RCFT/SCGK (residues 6-12), RYCCRRM (residues 43-49), and HVDLIEK (residues 53-59) were evolutionarily the most conserved structural motifs of these subunits. It is shown that the Rbp10 subunit from Sz. pombe can substitute its homolog (ABC10 beta) in the baker's yeast S. cerevisiae.

The mongoose acetylcholine receptor alpha-subunit: analysis of glycosylation and alpha-bungarotoxin binding.

PubMed

Asher, O; Jensen, B S; Lupu-Meiri, M; Oron, Y; Fuchs, S

1998-04-17

The mongoose AChR alpha-subunit has been cloned and shown to be highly homologous to other AChR alpha-subunits, with only six differences in amino acid residues at positions that are conserved in animal species that bind alpha-bungarotoxin (alpha-BTX). Four of these six substitutions cluster in the ligand binding site, and one of them, Asn-187, forms a consensus N-glycosylation site. The mongoose glycosylated alpha-subunit has a higher apparent molecular mass than that of the rat glycosylated alpha-subunit, probably resulting from the additional glycosylation at Asn-187 of the mongoose subunit. The in vitro translated mongoose alpha-subunit, in a glycosylated or non-glycosylated form, does not bind alpha-BTX, indicating that lack of alpha-BTX binding can be achieved also in the absence of glycosylation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Greene, T.W.; Chantler, S.E.; Kahn, M.L.

ADPglucose pyrophosphorylase (glucose-1-phosphate adenylytransferase; AD P:{alpha}-D-glucose-1-phosphate adenylyltransferase, EC 2.7.7.27) catalyzes a key regulatory step in {alpha}-glucan synthesis in bacteria and higher plants. We have previously shown that the expression of the cDNA sequences of the potato tuber large (LS) and small (SS) subunits yielded a functional heterotetrameric enzyme capable of complementing a mutation in the single AGP (glgC) structural gene of Escherichia coli. This heterologous complementation provides a powerful genetic approach to obtain biochemical information on the specific roles of LS and SS in enzyme function. By mutagenizing the LS cDNA with hydroxylamine and then coexpressing with wild-type SS inmore » an E. coli glgC{sup {minus}} strain, >350 mutant colonies were identified that were impaired in glycogen production. One mutant exhibited enzymatic and antigen levels comparable to the wild-type recombinant enzyme but required 45-fold greater levels of the activator 3-phosphoglycerate for maximum activity. Sequence analysis identified a single nucleotide change that resulted in the change of Pro-52 to Leu. This heterologous genetic system provides and efficient means to identify residues important for catalysis and allosteric functioning and should lead to novel approaches to increase plant productivity. 31 refs., 4 figs., 1 tab.« less

Identification of functional domains within the alpha and beta subunits of beta-hexosaminidase A through the expression of alpha-beta fusion proteins.

PubMed

Tse, R; Wu, Y J; Vavougios, G; Hou, Y; Hinek, A; Mahuran, D J

1996-08-20

There are three human beta-hexosaminidase isozymes which are composed of all possible dimeric combinations of an alpha and/or a beta subunit; A (alpha beta), and B (beta beta), and S (alpha alpha). The amino acid sequences of the two subunits are 60% identical. The homology between the two chains varies with the middle > the carboxy-terminal > > the amino-terminal portions. Although dimerization is required for activity, each subunit contains its own active site and differs in its substrate specificity and thermal stability. The presence of the beta subunit in hexosaminidase A also influences the substrate specificity of the alpha subunit; e.g., in vivo only the A heterodimer can hydrolyze GM2 ganglioside. In this report, we localize functional regions in the two subunits by cellular expression of alpha/beta fusion proteins joined at adjacently aligned residues. First, a chimeric alpha/beta chain was made by replacing the least well-conserved amino-terminal section of the beta chain with the corresponding alpha section. The biochemical characteristics of this protein were nearly identical to hexosaminidase B. Therefore, the most dissimilar regions in the subunits are not responsible for their dissimilar biochemical properties. A second fusion protein was made that also included the more homologous middle section of the alpha chain. This protein expressed the substrate specificity unique to isozymes containing an alpha subunit (A and S). We conclude that the region responsible for the ability of the alpha subunit to bind negatively charged substrates is located within residues alpha 132-283. Interestingly, the remaining carboxy-terminal section from the beta chain, beta 316-556, was sufficient to allow this chimera to hydrolyze GM2 ganglioside with 10% the specific activity of heterodimeric hexosaminidase A. Thus, the carboxy-terminal section of each subunit is likely involved in subunit-subunit interactions.

Assembly of the epithelial Na+ channel evaluated using sucrose gradient sedimentation analysis.

PubMed

Cheng, C; Prince, L S; Snyder, P M; Welsh, M J

1998-08-28

Three subunits, alpha, beta, and gamma, contribute to the formation of the epithelial Na+ channel. To investigate the oligomeric assembly of the channel complex, we used sucrose gradient sedimentation analysis to determine the sedimentation properties of individual subunits and heteromultimers comprised of multiple subunits. When the alpha subunit was expressed alone, it first formed an oligomeric complex with a sedimentation coefficient of 11 S, and then generated a higher order multimer of 25 S. In contrast, individual beta and gamma subunits predominately assembled into 11 S complexes. We obtained similar results with expression in cells and in vitro. When we co-expressed beta with alpha or with alpha plus gamma, the beta subunit assembled into a 25 S complex. Glycosylation of the alpha subunit was not required for assembly into a 25 S complex. We found that the alpha subunit formed intra-chain disulfide bonds. Although such bonds were not required to generate an oligomeric complex, under nonreducing conditions the alpha subunit formed a complex that migrated more homogeneously at 25 S. This suggests that intra-chain disulfide bonds may stabilize the complex. These data suggest that the epithelial Na+ channel subunits form high order oligomeric complexes and that the alpha subunit contains the information that facilitates such formation. Interestingly, the ability of the alpha, but not the beta or gamma, subunit to assemble into a 25 S homomeric complex correlates with the ability of these subunits to generate functional channels when expressed alone.

Nicotinic acetylcholine receptor alpha5 subunits modulate oxotremorine-induced salivation and tremor.

PubMed

Wang, Ningshan; Orr-Urtreger, Avi; Chapman, Joab; Rabinowitz, Ruth; Korczyn, Amos D

2004-07-15

Neuronal nicotinic acetylcholine receptors (nAChRs) are composed of 12 subunits (alpha2-alpha10 and beta2-beta4). alpha5 Subunits, expressed throughout the central nervous system (CNS) and the autonomic nervous system (ANS), possess unique pharmacological properties. The effects of oxotremorine (OXO) on autonomic functions and tremor were examined in mice lacking alpha5 nAChR subunits (alpha5-/-) and compared with those in wild-type (WT) control mice. The alpha5-/- mice showed significantly increased salivation and tremor responses to OXO. The hypothermia, bradycardia and defecation induced by OXO were of similar magnitudes in the two mouse strains. The enhanced OXO effects in alpha5-/- mice indicate inhibitory effects of alpha5 subunits in autonomic ganglia, and support the participation of these subunits in cholinergic transmission in autonomic ganglia.

Sequence of the cDNA of a human dihydrodiol dehydrogenase isoform (AKR1C2) and tissue distribution of its mRNA.

PubMed Central

Shiraishi, H; Ishikura, S; Matsuura, K; Deyashiki, Y; Ninomiya, M; Sakai, S; Hara, A

1998-01-01

Human liver contains three isoforms (DD1, DD2 and DD4) of dihydrodiol dehydrogenase with 20alpha- or 3alpha-hydroxysteroid dehydrogenase activity; the dehydrogenases belong to the aldo-oxo reductase (AKR) superfamily. cDNA species encoding DD1 and DD4 have been identified. However, four cDNA species with more than 99% sequence identity have been cloned and are compatible with a partial amino acid sequence of DD2. In this study we have isolated a cDNA clone encoding DD2, which was confirmed by comparison of the properties of the recombinant and hepatic enzymes. This cDNA showed differences of one, two, four and five nucleotides from the previously reported four cDNA species for a dehydrogenase of human colon carcinoma HT29 cells, human prostatic 3alpha-hydroxysteroid dehydrogenase, a human liver 3alpha-hydroxysteroid dehydrogenase-like protein and chlordecone reductase-like protein respectively. Expression of mRNA species for the five similar cDNA species in 20 liver samples and 10 other different tissue samples was examined by reverse transcriptase-mediated PCR with specific primers followed by diagnostic restriction with endonucleases. All the tissues expressed only one mRNA species corresponding to the newly identified cDNA for DD2: mRNA transcripts corresponding to the other cDNA species were not detected. We suggest that the new cDNA is derived from the principal gene for DD2, which has been named AKR1C2 by a new nomenclature for the AKR superfamily. It is possible that some of the other cDNA species previously reported are rare allelic variants of this gene. PMID:9716498

Molecular cloning and characterization of Hymenolepis diminuta alpha-tubulin gene.

PubMed

Mohajer-Maghari, Behrokh; Amini-Bavil-Olyaee, Samad; Webb, Rodney A; Coe, Imogen R

2007-02-01

To isolate a full-length alpha-tubulin cDNA from an eucestode, Hymenolepis diminuta, a lambda phage cDNA library was constructed. The alpha-tubulin gene was cloned, sequenced and characterized. The H. diminuta alpha-tubulin consisted of 450 amino acids. This protein contained putative sites for all posttranslational modifications as detyrosination/tyrosination at the carboxyl-terminal of protien, phosphorylation at residues R79 and K336, glycylation/glutamylation at residue G445 and acetylation at residue K40. Comparisons of H. diminuta alpha-tubulin with all full-length alpha-tubulin proteins revealed that H. diminuta alpha-tubulin possesses 10 distinctive residues, which are not found in any other alpha-tubulins. Phylogenetic analysis showed that H. diminuta alpha-tubulin has grouped in a separated branch adjacent eucestode and trematodes branch with 92% bootstrap value (1000 replicates). In conclusion, this is the first report of H. diminuta cDNA library construction, cloning and characterization of H. diminuta alpha-tubulin gene.

alpha-Mannosidosis in the guinea pig: cloning of the lysosomal alpha-mannosidase cDNA and identification of a missense mutation causing alpha-mannosidosis.

PubMed

Berg, Thomas; Hopwood, John J

2002-03-16

alpha-Mannosidosis is a lysosomal storage disorder caused by deficient activity of the lysosomal alpha-mannosidase. We report here the sequencing and expression of the lysosomal alpha-mannosidase cDNA from normal and alpha-mannosidosis guinea pigs. The amino acid sequence of the guinea pig enzyme displayed 82-85% identity to the lysosomal alpha-mannosidase in other mammals. The cDNA of the alpha-mannosidosis guinea pig contained a missense mutation, 679C>T, leading to substitution of arginine by tryptophan at amino acid position 227 (R227W). The R227W allele segregated with the alpha-mannosidosis genotype in the guinea pig colony and introduction of R227W into the wild-type sequence eliminated the production of recombinant alpha-mannosidase activity in heterologous expression studies. Furthermore, the guinea pig mutation has been found in human patients. Our results strongly indicate that the 679C>T mutation causes alpha-mannosidosis and suggest that the guinea pig will be an excellent model for investigation of pathogenesis and evaluation of therapeutic strategies for human alpha-mannosidosis.

Function of Several Critical Amino Acids in Human Pyruvate Dehydrogenase Revealed by Its Structure

NASA Technical Reports Server (NTRS)

Korotchkina, Lioubov G.; Ciszak, E.; Patel, M.

2004-01-01

Pyruvate dehydrogenase (E1), an alpha 2 beta 2 tetramer, catalyzes the oxidative decarboxylation of pyruvate and reductive acetylation of lipoyl moieties of the dihydrolipoamide acetyltransferase. The roles of beta W135, alpha P188, alpha M181, alpha H15 and alpha R349 of E1 determined by kinetic analysis were reassessed by analyzing the three-dimensional structure of human E1. The residues identified above are found to play a structural role rather than being directly involved in catalysis: beta W135 is the center residue in the hydrophobic interaction between beta and beta' subunits; alpha P188 and alpha M181 are critical for the conformation of the TPP-binding motif and interaction between alpha and beta subunits; alpha H15, is necessary for the organization of the N-terminus of alpha and alpha'; subunits and alpha R349 supports the interaction of the C-terminus of the alpha subunits with the beta subunits. Analysis of several critical E1 residues confirms the importance of residues distant from the active site for subunit interactions and enzyme function.

The delta-subunit of murine guanine nucleotide exchange factor eIF-2B. Characterization of cDNAs predicts isoforms differing at the amino-terminal end.

PubMed

Henderson, R A; Krissansen, G W; Yong, R Y; Leung, E; Watson, J D; Dholakia, J N

1994-12-02

Protein synthesis in mammalian cells is regulated at the level of the guanine nucleotide exchange factor, eIF-2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. We have isolated and sequenced cDNA clones encoding the delta-subunit of murine eIF-2B. The cDNA sequence encodes a polypeptide of 544 amino acids with molecular mass of 60 kDa. Antibodies against a synthetic polypeptide of 30 amino acids deduced from the cDNA sequence specifically react with the delta-subunit of mammalian eIF-2B. The cDNA-derived amino acid sequence shows significant homology with the yeast translational regulator Gcd2, supporting the hypothesis that Gcd2 may be the yeast homolog of the delta-subunit of mammalian eIF-2B. Primer extension studies and anchor polymerase chain reaction analysis were performed to determine the 5'-end of the transcript for the delta-subunit of eIF-2B. Results of these experiments demonstrate two different mRNAs for the delta-subunit of eIF-2B in murine cells. The isolation and characterization of two different full-length cDNAs also predicts the presence of two alternate forms of the delta-subunit of eIF-2B in murine cells. These differ at their amino-terminal end but have identical nucleotide sequences coding for amino acids 31-544.

A tolerance gene for prenylated flavonoid encodes a 26S proteasome regulatory subunit in Sophora flavescens.

PubMed

Shitan, Nobukazu; Kamimoto, Yoshihisa; Minami, Shota; Kubo, Mizuki; Ito, Kozue; Moriyasu, Masataka; Yazaki, Kazufumi

2011-01-01

Yeast functional screening with a Sophora flavescens cDNA library was performed to identify the genes involved in the tolerant mechanism to the self-producing prenylated flavonoid sophoraflavanone G (SFG). One cDNA, which conferred SFG tolerance, encoded a regulatory particle triple-A ATPase 2 (SfRPT2), a member of the 26S proteasome subunit. The yeast transformant of SfRPT2 showed reduced SFG accumulation in the cells.

The morphological and chemical characteristics of striatal neurons immunoreactive for the alpha1-subunit of the GABA(A) receptor in the rat.

PubMed

Waldvogel, H J; Kubota, Y; Trevallyan, S C; Kawaguchi, Y; Fritschy, J M; Mohler, H; Faull, R L

1997-10-01

The distribution, morphology and chemical characteristics of neurons immunoreactive for the alpha1-subunit of the GABA(A) receptor in the striatum of the basal ganglia in the rat brain were investigated at the light, confocal and electron microscope levels using single, double and triple immunohistochemical labelling techniques. The results showed that alpha1-subunit immunoreactive neurons were sparsely distributed throughout the rat striatum. Double and triple labelling results showed that all the alpha1-subunit-immunoreactive neurons were positive for glutamate decarboxylase and immunoreactive for the beta2,3 and gamma2 subunits of the GABA(A) receptor. Three types of alpha1-subunit-immunoreactive neurons were identified in the striatum on the basis of cellular morphology and chemical characteristics. The most numerous alpha1-subunit-immunoreactive neurons were medium-sized, aspiny neurons with a widely branching dendritic tree. They were parvalbumin-negative and were located mainly in the dorsolateral regions of the striatum. Electron microscopy showed that these neurons had an indented nuclear membrane, typical of striatal interneurons, and were surrounded by small numbers of axon terminals which established alpha1-subunit-immunoreactive synaptic contacts with the soma and dendrites. These cells were classified as type 1 alpha1-subunit-immunoreactive neurons and comprised 75% of the total population of alpha1-subunit-immunoreactive neurons in the striatum. The remaining alpha1-subunit-immunoreactive neurons comprised of a heterogeneous population of large-sized neurons localized in the ventral and medial regions of the striatum. The most numerous large-sized cells were parvalbumin-negative, had two to three relatively short branching dendrites and were designated type 2 alpha1-subunit-immunoreactive neurons. Electron microscopy showed that the type 2 neurons were characterized by a highly convoluted nuclear membrane and were sparsely covered with small axon terminals. The type 2 neurons comprised 20% of the total population of alpha1-subunit-immunoreactive neurons. The remaining large-sized alpha1-immunoreactive cells were designated type 3 cells; they were positive for parvalbumin and were distinguished by long branching dendrites extending dorsally for 600-800 microm into the striatum. These neurons comprised 5% of the total population of alpha1-subunit-immunoreactive neurons and were surrounded by enkephalin-immunoreactive terminals. Electron microscopy showed that the alpha1-subunit type 3 neurons had an indented nuclear membrane and were densely covered with small axon terminals which established alpha1-subunit-immunoreactive symmetrical synaptic contacts with the soma and dendrites. These results provide a detailed characterization of the distribution, morphology and chemical characteristics of the alpha1-subunit-immunoreactive neurons in the rat striatum and suggest that the type 1 and type 2 neurons comprise of separate populations of striatal interneurons while the type 3 neurons may represent the large striatonigral projection neurons described by Bolam et al. [Bolam J. P., Somogyi P., Totterdell S. and Smith A. D. (1981) Neuroscience 6, 2141-2157.].

Beta3 subunits promote expression and nicotine-induced up-regulation of human nicotinic alpha6* nicotinic acetylcholine receptors expressed in transfected cell lines.

PubMed

Tumkosit, Prem; Kuryatov, Alexander; Luo, Jie; Lindstrom, Jon

2006-10-01

Nicotinic acetylcholine receptors (AChRs) containing alpha6 subunits are typically found at aminergic nerve endings where they play important roles in nicotine addiction and Parkinson's disease. alpha6* AChRs usually contain beta3 subunits. beta3 subunits are presumed to assemble only in the accessory subunit position within AChRs where they do not participate in forming acetylcholine binding sites. Assembly of subunits in the accessory position may be a critical final step in assembly of mature AChRs. Human alpha6 AChRs subtypes were permanently transfected into human tsA201 human embryonic kidney (HEK) cell lines. alpha6beta2beta3 and alpha6beta4beta3 cell lines were found to express much larger amounts of AChRs and were more sensitive to nicotine-induced increase in the amount of AChRs than were alpha6beta2 or alpha6beta4 cell lines. The increased sensitivity to nicotine-induced up-regulation was due not to a beta3-induced increase in affinity for nicotine but probably to a direct effect on assembly of AChR subunits. HEK cells express only a small amount of mature alpha6beta2 AChRs, but many of these subunits are on the cell surface. This contrasts with Xenopus laevis oocytes, which express a large amount of incorrectly assembled alpha6beta2 subunits that bind cholinergic ligands but form large amorphous intracellular aggregates. Monoclonal antibodies (mAbs) were made to the alpha6 and beta3 subunits to aid in the characterization of these AChRs. The alpha6 mAbs bind to epitopes C-terminal of the extracellular domain. These data demonstrate that both cell type and the accessory subunit beta3 can play important roles in alpha6* AChR expression, stability, and up-regulation by nicotine.

Alteration of GABAergic synapses and gephyrin clusters in the thalamic reticular nucleus of GABAA receptor alpha3 subunit-null mice.

PubMed

Studer, Remo; von Boehmer, Lotta; Haenggi, Tatjana; Schweizer, Claude; Benke, Dietmar; Rudolph, Uwe; Fritschy, Jean-Marc

2006-09-01

Multiple GABAA-receptor subtypes are assembled from alpha, beta and gamma subunit variants. GABAA receptors containing the alpha3 subunit represent a minor population with a restricted distribution in the CNS. In addition, they predominate in monoaminergic neurons and in the nucleus reticularis thalami (nRT), suggesting a role in the regulation of cortical function and sleep. Mice with a targeted deletion of the alpha3 subunit gene (alpha3(0/0)) are viable and exhibit a subtle behavioural phenotype possibly related to dopaminergic hyperfunction. Here, we investigated immunohistochemically the consequences of the loss of alpha3 subunit for maturation of GABAA receptors and formation of GABAergic synapses in the nRT. Throughout postnatal development, the regional distribution of the alpha1, alpha2, or alpha5 subunit was unaltered in alpha3(0/0) mice and the prominent alpha3 subunit staining of nRT neurons in wildtype mice was not replaced. Subcellularly, as seen by double immunofluorescence, the alpha3 and gamma2 subunit were clustered at postsynaptic sites in the nRT of adult wildtype mice along with the scaffolding protein gephyrin. In alpha3(0/0) mice, gamma2 subunit clustering was disrupted and gephyrin formed large aggregates localized at the cell surface, but unrelated to postsynaptic sites, indicating that nRT neurons lack postsynaptic GABAA receptors in mutant mice. Furthermore, GABAergic terminals were enlarged and reduced in number, suggesting a partial deficit of GABAergic synapses. Therefore, GABAA receptors are required for gephyrin clustering and long-term synapse maintenance. The absence of GABAA-mediated transmission in the nRT may have a significant impact on the function of the thalamo-cortical loop of alpha3(0/0) mice.

Isolation of human hexosaminidase. cap alpha. cDNA and expression of. cap alpha. chains in E. coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiktorowicz, J.E.; Whitman, J.M.

1986-05-01

Pooled antisera against homogeneous, glutaraldehyde cross-linked hexosaminidase (hex) A was adsorbed with E. coli lysate insolubilized on Sepharose 4B. Aliquots of a human liver lambdagtll cDNA library (50,000-100,000 pfu) were plated on E. coli Y1090. Expression of cloned cDNA, after sufficient plaque growth at 42/sup 0/, was accomplished by induction with isopropylthiogalactoside soaked nitrocellulose filters. Identification of hex cDNA clones was performed by incubation of the filters with purified antisera. Protein A labelled with I-125 was used to develop the reactive plaques. Positive plaques, identified by autoradiography, were picked, replated at a lower density, and rescreened. This was repeated severalmore » more times until all plaques yielded positive signals. Identification of the clones as containing ..cap alpha.. or ..beta.. cDNA was accomplished by replating the purified phage and rescreening the plaques with anti-hex B antiserum preadsorbed with E. coli lysate. According to this protocol several hex ..cap alpha.. clones have been identified. While these clones generate ..beta..-galactosidase: hex ..cap alpha.. fusion proteins, these findings suggest that in the future it may be possible to obtain large quantities of unmodified hex ..cap alpha.. and ..beta.. polypeptides from E. coli for the study of the structural and enzymatic properties of these polypeptides and for diagnostic purposes in the GM2 gangliosidoses.« less

Differential regulation of thyrotropin subunit apoprotein and carbohydrate biosynthesis by thyroid hormone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taylor, T.; Weintraub, B.D.

1985-04-01

The regulation of TSH apoprotein and carbohydrate biosynthesis by thyroid hormone was studied by incubating pituitaries from normal and hypothyroid (3 weeks post-thyroidectomy) rats in medium containing (/sup 14/C)alanine and (/sup 3/H) glucosamine. After 6 h, samples were sequentially treated with anti-TSH beta to precipitate TSH and free TSH beta, anti-LH beta to clear the sample of LH and free LH beta, then anti-LH alpha to precipitate free alpha-subunit. Total proteins were acid precipitated. All precipitates were subjected to electrophoresis on sodium dodecyl sulfate-polyacrylamide gels, which were then sliced and assayed by scintillation spectrometry. In hypothyroid pituitaries plus medium, (/supmore » 14/C)alanine incorporation in combined and free beta-subunits was 26 times normal and considerably greater than the 3.4-fold increase seen in total protein; combined and free alpha-subunits showed no specific increase in apoprotein synthesis. (/sup 3/H)Glucosamine incorporation in combined alpha- and beta-subunits in hypothyroid samples was 13 and 21 times normal, respectively, and was greater than the 1.9-fold increase in total protein; free alpha-subunit showed no specific increase in carbohydrate synthesis. The glucosamine to alanine ratio, reflecting relative glycosylation of newly synthesized molecules, was increased in hypothyroidism for combined alpha-subunits, but not for combined beta-subunits, free alpha-subunits, or total proteins. In summary, short term hypothyroidism selectively stimulated TSH beta apoprotein synthesis and carbohydrate synthesis of combined alpha- and beta-subunits. Hypothyroidism also increased the relative glycosylation of combined alpha-subunit. Thus, thyroid hormone deficiency appears to alter the rate-limiting step in TSH assembly (i.e. beta-subunit synthesis) as well as the carbohydrate structure of TSH, which may play important roles in its biological function.« less

Vacuolar H[sup +]-ATPase 69-kilodalton catalytic subunit cDNA from developing cotton (Gossypium hirsutum) ovules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilkins, T.A.

1993-06-01

This study investigates the molecular events of vacuole ontogeny in rapidly elongated cotton plant cells. Within the DNA coding region, the cotton and carrot cDNA clones exhibit 82.2% nucleotide sequence homology; at the amino acid level cotton and carrot catalytic subunits exhibited 95.7% identity and 2.1% amino acid similarity. When aligned with the analogous sequences from yeast, the cotton protein shared only 60.5% amino acid identity and 12.7% similarity. 10 refs., 1 tab.

Cloning and characterization of two novel zebrafish P2X receptor subunits.

PubMed

Diaz-Hernandez, Miguel; Cox, Jane A; Migita, Keisuke; Haines, William; Egan, Terrance M; Voigt, Mark M

2002-07-26

In this report we describe the cloning and characterization of two P2X receptor subunits cloned from the zebrafish (Danio rerio). Primary sequence analysis suggests that one cDNA encodes an ortholog of the mammalian P2X(4) subunit and the second cDNA encodes the ortholog of the mammalian P2X(5) subunit. The zP2X(4) subunit forms a homo-oligomeric receptor that displays a low affinity for ATP (EC(50)=274+/-48 microM) and very low affinity (EC(50)>500 microM) for other purinergic ligands such as alphabetameATP, suramin, and PPADS. As seen with the mammalian orthologs, the zP2X(5) subunit forms a homo-oligomeric receptor that yields very small whole-cell currents (<20pA), making determination of an EC(50) problematic. Both subunit genes were physically mapped onto the zebrafish genome using radiation hybrid analysis of the T51 panel, with the zp2x4 localized to LG21 and zp2x5 to LG5.

In cellulo examination of a beta-alpha hybrid construct of beta-hexosaminidase A subunits, reported to interact with the GM2 activator protein and hydrolyze GM2 ganglioside.

PubMed

Sinici, Incilay; Yonekawa, Sayuri; Tkachyova, Ilona; Gray, Steven J; Samulski, R Jude; Wakarchuk, Warren; Mark, Brian L; Mahuran, Don J

2013-01-01

The hydrolysis in lysosomes of GM2 ganglioside to GM3 ganglioside requires the correct synthesis, intracellular assembly and transport of three separate gene products; i.e., the alpha and beta subunits of heterodimeric beta-hexosaminidase A, E.C. # 3.2.1.52 (encoded by the HEXA and HEXB genes, respectively), and the GM2-activator protein (GM2AP, encoded by the GM2A gene). Mutations in any one of these genes can result in one of three neurodegenerative diseases collectively known as GM2 gangliosidosis (HEXA, Tay-Sachs disease, MIM # 272800; HEXB, Sandhoff disease, MIM # 268800; and GM2A, AB-variant form, MIM # 272750). Elements of both of the hexosaminidase A subunits are needed to productively interact with the GM2 ganglioside-GM2AP complex in the lysosome. Some of these elements have been predicted from the crystal structures of hexosaminidase and the activator. Recently a hybrid of the two subunits has been constructed and reported to be capable of forming homodimers that can perform this reaction in vivo, which could greatly simplify vector-mediated gene transfer approaches for Tay-Sachs or Sandhoff diseases. A cDNA encoding a hybrid hexosaminidase subunit capable of dimerizing and hydrolyzing GM2 ganglioside could be incorporated into a single vector, whereas packaging both subunits of hexosaminidase A into vectors, such as adeno-associated virus, would be impractical due to size constraints. In this report we examine the previously published hybrid construct (H1) and a new more extensive hybrid (H2), with our documented in cellulo (live cell- based) assay utilizing a fluorescent GM2 ganglioside derivative. Unfortunately when Tay-Sachs cells were transfected with either the H1 or H2 hybrid construct and then were fed the GM2 derivative, no significant increase in its turnover was detected. In vitro assays with the isolated H1 or H2 homodimers confirmed that neither was capable of human GM2AP-dependent hydrolysis of GM2 ganglioside.

In Cellulo Examination of a Beta-Alpha Hybrid Construct of Beta-Hexosaminidase A Subunits, Reported to Interact with the GM2 Activator Protein and Hydrolyze GM2 Ganglioside

PubMed Central

Sinici, Incilay; Yonekawa, Sayuri; Tkachyova, Ilona; Gray, Steven J.; Samulski, R. Jude; Wakarchuk, Warren; Mark, Brian L.; Mahuran, Don J.

2013-01-01

The hydrolysis in lysosomes of GM2 ganglioside to GM3 ganglioside requires the correct synthesis, intracellular assembly and transport of three separate gene products; i.e., the alpha and beta subunits of heterodimeric beta-hexosaminidase A, E.C. # 3.2.1.52 (encoded by the HEXA and HEXB genes, respectively), and the GM2-activator protein (GM2AP, encoded by the GM2A gene). Mutations in any one of these genes can result in one of three neurodegenerative diseases collectively known as GM2 gangliosidosis (HEXA, Tay-Sachs disease, MIM # 272800; HEXB, Sandhoff disease, MIM # 268800; and GM2A, AB-variant form, MIM # 272750). Elements of both of the hexosaminidase A subunits are needed to productively interact with the GM2 ganglioside-GM2AP complex in the lysosome. Some of these elements have been predicted from the crystal structures of hexosaminidase and the activator. Recently a hybrid of the two subunits has been constructed and reported to be capable of forming homodimers that can perform this reaction in vivo, which could greatly simplify vector-mediated gene transfer approaches for Tay-Sachs or Sandhoff diseases. A cDNA encoding a hybrid hexosaminidase subunit capable of dimerizing and hydrolyzing GM2 ganglioside could be incorporated into a single vector, whereas packaging both subunits of hexosaminidase A into vectors, such as adeno-associated virus, would be impractical due to size constraints. In this report we examine the previously published hybrid construct (H1) and a new more extensive hybrid (H2), with our documented in cellulo (live cell- based) assay utilizing a fluorescent GM2 ganglioside derivative. Unfortunately when Tay-Sachs cells were transfected with either the H1 or H2 hybrid construct and then were fed the GM2 derivative, no significant increase in its turnover was detected. In vitro assays with the isolated H1 or H2 homodimers confirmed that neither was capable of human GM2AP-dependent hydrolysis of GM2 ganglioside. PMID:23483939

Purification and characterization of the glycoprotein hormone. cap alpha. -subunit-like material secreted by HeLa cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cox, G.S.; Rimerman, R.A.

1988-08-23

The protein secreted by HeLa cells that cross-reacts with antiserum developed against the ..cap alpha..-subunit of human chorionic gonadotropin (hCG) has been purified approximately 30,000-fold from concentrated culture medium by organic solvent fractionation followed by ion exchange, gel filtration, and lectin affinity chromatography. The final preparation had a specific activity (by RIA) of 6.8 x 10/sup 5/ ng of ..cap alpha../mg of protein and appeared homogeneous by electrophoresis on reducing/denaturing polyacrylamide gels (SDS-PAGE). Amino acid analysis indicated that HeLa-..cap alpha.. had a composition very similar to that of the urinary hCG ..cap alpha..-subunit. However, comparison of hCG-..cap alpha.. and HeLa-..capmore » alpha.. demonstrated that the tumor-associated subunit was not identical with its normal counterpart. The purified tumor protein had an apparent molecular weight greater than that of the urinary ..cap alpha..-subunit when analyzed by SDS-PAGE, and this difference was even greater when a partially purified preparation was examined by an immunoblot technique (Western). Isoelectric focusing of the HeLa and hCG subunits demonstrated that the tumor protein had a lower pI. Immunoprecipitation and electrophoresis of ..cap alpha..-subunit from HeLa cultures labeled with (/sup 3/H)fucose indicated that the tumor subunit was fucosylated, whereas analysis of hCG-..cap alpha.. hydrosylates by HPLC confirmed previous reports that the placental subunit does not contain fucose. The results indicate that, regardless of whether or not a single ..cap alpha..-subunit gene is being expressed in both normal and neoplastic tissues, posttranslational modifications lead to a highly altered subunit in the tumor. The differences observed may be useful in diagnosing neoplastic vs hyperplastic conditions and may lend insight into the mechanism of ectopic hormone production by tumors.« less

cDNA cloning and characterization of Type I procollagen alpha1 chain in the skate Raja kenojei.

PubMed

Hwang, Jae-Ho; Yokoyama, Yoshihiro; Mizuta, Shoshi; Yoshinaka, Reiji

2006-05-01

A full-length cDNA of the Type I procollagen alpha1 [pro-alpha1(I)] chain (4388 bp), coding for 1463 amino acid residues in the total length, was determined by RACE PCR using a cDNA library constructed from 4-week embryo of the skate Raja kenojei. The helical region of the skate pro-alpha1(I) chain consisted of 1014 amino acid residues - the same as other fibrillar collagen alpha chains from higher vertebrates. Comparison on denaturation temperatures of Type I collagens from the skate, rainbow trout (Oncorhynchus mykiss) and rat (Rattus norvegicus) revealed that the number of Gly-Pro-Pro and Gly-Gly in the alpha1(I) chains could be directly related to the thermal stability of the helix. The expression property of the skate pro-alpha1(I) chain mRNA and phylogenetic analysis with other vertebrate pro-alpha1(I) chains suggested that skate pro-alpha1(I) chain could be a precursor form of the skate Type I collagen alpha1 chain. The present study is the first evidence for the primary structure of full-length pro-alpha1(I) chain in an elasmobranch.

Structural Studies of Human Pyruvate Dehydrogenase

NASA Technical Reports Server (NTRS)

Ciszak, Ewa; Korotchkina, Lioubov G.; Dominiak, Paulina; Sidhu, Sukhdeep; Patel, Mulchand S.; Curreri, Peter A. (Technical Monitor)

2002-01-01

Human pyruvate dehydrogenase (E1) catalyzes the irreversible decarboxylation of pyruvate in the presence of Mg(2+) and thiamin pyrophosphate (TPP) followed by the rate-limiting reductive acetylation of the lipoyl moiety linked to dihydrolipoamide acetyltransferase. The three-dimensional structure of human E1 is elucidated using the methods of macromolecular X-ray crystallography. The structure is an alpha, alpha', beta and beta' tetramer with the protein units being in the tetrahedral arrangement. Each 361-residue alpha-subunit and 329-residue beta-subunit is composed of a beta-sheet core surrounded by alpha-helical domains. Each subunit is in extensive contact with all the three subunits involving TPP and magnesium cofactors, and potassium ions. The two binding sites for TPP are at the alpha-beta' and alpha'-beta interfaces, each involving a magnesium ion and Phe6l, His63, Tyr89, and Met200 from the alpha-subunit (or alpha'-subunit), and Met81 Phe85, His128 from the beta-subunit (or beta'-subunit). K+ ions are nestled between two beta-sheets and the end of an alpha-helix in each beta-subunit, where they are coordinated by four carbonyl oxygen groups from Ile12, Ala160, Asp163, and Asnl65, and a water molecule. The catalytic C2 carbon of thiazolium ring in this structure forms a 3.2 A contact with a water molecule involved in a series of H-bonds with other water molecules, and indirectly with amino acids including those involved in the catalysis and regulation of the enzyme.

Specific antibodies against Go isoforms reveal the early expression of the Go2 alpha subunit and appearance of Go1 alpha during neuronal differentiation.

PubMed

Rouot, B; Charpentier, N; Chabbert, C; Carrette, J; Zumbihl, R; Bockaert, J; Homburger, V

1992-02-01

We have previously identified two isoforms of Go alpha in membranes of N1E-115 neuroblastoma cells, using an antibody raised against the purified Go alpha subunit; one isoform of the Go alpha subunit (pI 5.80) is present in undifferentiated cells, whereas a more acidic isoform (pI 5.55) appears during differentiation [J. Neurochem. 54:1310-1320 (1990)]. Recently, the Go alpha gene has been shown to encode, by alternative splicing, two polypeptides, Go1 alpha and Go2 alpha, which differ only in their carboxyl-terminal part. To determine unambiguously whether the two Go alpha subunits detected in neuroblastoma cells were actually the products of different mRNAs, rabbit polyclonal antibodies were generated against synthetic peptides (amino acids 291-302) of both sequences. Specificity of the two affinity-purified antipeptide antibodies was assessed on Western blots by comparing their immunoreactivities with those of other G alpha antibodies. On a blotted mixture of purified brain guanine nucleotide-binding proteins, the anti-alpha o1 and anti-alpha o2 peptide antibodies only recognized the 39-kDa Go alpha subunit. Furthermore, the immunological recognition of brain membranes from 15-day-old mouse fetuses by antipeptide antibodies could be specifically blocked by addition of the corresponding antigen. When membrane proteins from differentiated neuroblastoma cells and mouse fetus brain were blotted after two-dimensional gel electrophoresis, the anti-alpha o1 and anti-alpha o2 peptide antibodies labeled a 39-kDa subunit focused at a pI value of 5.55 or 5.80, respectively. Study of the ontogenesis of both Go alpha subunits revealed the predominance of Go2 alpha in the frontal cortex at day 15 of gestation. Thereafter, there was a progressive decline of the Go2 alpha polypeptide to a very low level, concomitant with an increase in the Go1 alpha protein, which plateaued about 15 days after birth to a level 8 times higher than at gestational day 15. Similarly, on neuroblastoma cells, the Go2 alpha subunit was almost exclusively present in undifferentiated cells, and differentiation induced the appearance of the Go1 alpha subunit, with a reduction in the amount of Go2 alpha polypeptide. Thus, the evolution of the two Go alpha subunits during cell differentiation, unambiguously identified with specific antibodies, suggests that neuronal differentiation is responsible for the on/off switch of the expression of the Go alpha isoforms and indicates that Go1 alpha, rather than Go2 alpha, is involved in neurotransmission.

Identification of an active acidic residue in the catalytic site of beta-hexosaminidase.

PubMed

Tse, R; Vavougios, G; Hou, Y; Mahuran, D J

1996-06-11

Human beta-hexosaminidases A and B (EC 3.2.1.52) are dimeric lysosomal glycosidases composed of evolutionarily related alpha and/or beta subunits. Both isozymes hydrolyze terminal beta-linked GalNAc or GlcNAc residues from numerous artificial and natural substrates; however, in vivo GM2 ganglioside is a substrate for only the heterodimeric A isozyme. Thus, mutations in either gene encoding its alpha or beta subunits can result in GM2 ganglioside storage and Tay-Sachs or Sandhoff disease, respectively. All glycosyl hydrolases ae believed to have one or more acidic residues in their catalytic site. We demonstrate that incubation of hexosaminidase with a chemical modifier specific for carboxyl side chains produces a time-dependent loss of activity, and that this effect can be blocked by the inclusion of a strong competitive inhibitor in the reaction mix. We hypothesized that the catalytic acid residue(s) should be located in a region of overall homology and be invariant within the aligned deduced primary sequences of the human alpha and beta subunits, as well as hexosaminidases from other species, including bacteria. Such a region is encoded by exons 5-6 of the HEXA and HEXB genes. This region includes beta Arg211 (invariant in 15 sequences), which we have previously shown to be an active residue. This region also contains two invariant and one conserved acidic residues. A fourth acidic residue, Asp alpha 258, beta 290, in exon 7 was also investigated because of its association with the B1 variant of Tay-Sachs disease. Conservative substitutions were made at each candidate residue by in vitro mutagenesis of a beta cDNA, followed by cellular expression. Of these, only the beta Asp196Asn substitution decreased the kcat (350-910-fold) without any noticeable effect on the K(m). Mutagenesis of either beta Asp240 or beta Asp290 to Asn decreased kcat by 10- or 1.4-fold but also raised the K(m) of the enzyme 11- of 3-fold, respectively. The above results strongly suggest that beta Asp196 is a catalytic acid residue in beta-hexosaminidase.

Expression Profile of the Integrin Receptor Subunits in the Guinea Pig Sclera.

PubMed

Wang, Kevin K; Metlapally, Ravikanth; Wildsoet, Christine F

2017-06-01

The ocular dimensional changes in myopia reflect increased scleral remodeling, and in high myopia, loss of scleral integrity leads to biomechanical weakening and continued scleral creep. As integrins, a type of cell surface receptors, have been linked to scleral remodeling, they represent potential targets for myopia therapies. As a first step, this study aimed to characterize the integrin subunits at the messenger RNA level in the sclera of the guinea pig, a more recently added but increasingly used animal model for myopia research. Primers for α and β integrin subunits were designed using NCBI/UCSC Genome Browser and Primer3 software tools. Total RNA was extracted from normal scleral tissue and isolated cultured scleral fibroblasts, as well as liver and lung, as reference tissues, all from guinea pig. cDNA was produced by reverse transcription, PCR was used to amplify products of predetermined sizes, and products were sequenced using standard methods. Guinea pig scleral tissue expressed all known integrin alpha subunits except αD and αE. The latter integrin subunits were also not expressed by cultured guinea pig scleral fibroblasts; however, their expression was confirmed in guinea pig liver. In addition, isolated cultured fibroblasts did not express integrin subunits αL, αM, and αX. This difference between results for cultured cells and intact sclera presumably reflects the presence in the latter of additional cell types. Both guinea pig scleral tissue and isolated scleral fibroblasts expressed all known integrin beta subunits. All results were verified through sequencing. The possible contributions of integrins to scleral remodeling make them plausible targets for myopia prevention. Data from this study will help guide future ex vivo and in vitro studies directed at understanding the relationship between scleral integrins and ocular growth regulation in the guinea pig model for myopia.

A dynamic alpha-beta inter-subunit agonist signaling complex is a novel feedback mechanism for regulating L-type Ca2+ channel opening.

PubMed

Zhang, Rong; Dzhura, Igor; Grueter, Chad E; Thiel, William; Colbran, Roger J; Anderson, Mark E

2005-09-01

L-type Ca2+ channels are macromolecular protein complexes in neurons and myocytes that open in response to cell membrane depolarization to supply Ca2+ for regulating gene transcription and vesicle secretion and triggering cell contraction. L-type Ca2+ channels include a pore-forming alpha and an auxiliary beta subunit, and alpha subunit openings are regulated by cellular Ca2+ through a mechanism involving the Ca2+-sensing protein calmodulin (CaM) and CaM binding motifs in the alpha subunit cytoplasmic C terminus. Here we show that these CaM binding motifs are "auto-agonists" that increase alpha subunit openings by binding the beta subunit. The CaM binding domains are necessary and sufficient for the alpha subunit C terminus to bind the beta subunit in vitro, and excess CaM blocks this interaction. Addition of CaM binding domains to native cardiac L-type Ca2+ channels in excised cell membrane patches increases openings, and this agonist effect is prevented by excess CaM. Recombinant LTCC openings are also increased by exogenous CaM binding domains by a mechanism requiring the beta subunit, and excess CaM blocks this effect. Thus, the bifunctional ability of the alpha subunit CaM binding motifs to competitively associate with the beta subunit or CaM provides a novel paradigm for feedback control of cellular Ca2+ entry.

Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.

PubMed

Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M

2008-07-01

Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.

[Change of chart genes expression in small intestines of mouse induced by electromagnetic pulse irradiation].

PubMed

Ren, Dongqing; Jin, Juan; Li, Xiaojuan; Zeng, Guiying

2008-01-01

To explore the bio-effects of electromagnetic pulse(EMP) on mouse small intestines induced by means of gene chip. Twelve BALB/c mice were randomly assigned to the normal control group and the EMP group with 6 in each group. The EMP group was irradiated with 200 kV/m, 200 pulses EMP. 18 hours after the irradiation, the mice were sacrificed and their jejunum of small intestines were eviscerated. The fluorescent cDNA probes labeled with Cy3 and Cy5 were prepared from RNA extracted from the intestines of the two groups. Probes of the two groups were then hybridized against cDNA gene chip, the fluorescent signals were scanned with a scanner and the results were analyzed by computer. Compared with the control, 56 genes in gene expression profile were altered. The expression levels of 37 genes were up-regulated distinctly while 19 genes were down-regulated significantly. Among the 56 genes, 19 were reported with known or inferred functions, 12 up-regulated genes were catenin alpha 1 (alpha-catenin), ly-6 alloantigen(Ly-6E), fructose-6-phosphate transaminase (GF6P), ribosomal protein S17 (rpS17), small proline-rich protein 2A (Sprr2a), glandular kallikrein27 (GK27), lipoxygenase-3, aldo-keto reductase (Akr1c12), GSG1, amylase 2 (Amy2),elastase 2, p6-5 gene and 7 down-regulated genes were junctional adhesion molecule (Jam), protein arginine methyltransferase (Carm1),NNP-1, 2-5 A synthetase L2,Mlark gene, ATP synthase alpha subunit, uncoupling protein-2 (Ucp2) gene; the other 37 were reported with unknown functions. EMP irradiation could induce specific expressions of some genes in mouse small intestines and most of these genes were up-regulated ones.

Expression of the leukemia-associated CBF{beta}/SMMHC chimeric gene causes transformation of 3T3 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hajra, A.; Liu, P.; Collins, E.S.

1994-09-01

A pericentric inversion of chromosome 16 (inv(16)(p13;q22)) is consistently seen in acute myeloid leukemia of the M4Eo subtype. This inversion fuses almost the entire coding region of the gene encoding of the {beta} subunit of the heterodimeric transcription factor CBF/PEBP2 to the region of the MYH11 gene encoding the rod domain for the smooth muscle myosin heavy chain (SMMHC). To investigate the biological properties of the CBF{beta}/SMMHC fusion protein, we have generated 3T3 cell lines that stably express the CBF{beta}/SMMHC chimeric cDNA or the normal, nonchimeric CBF{beta} and SMMHC cDNAs. 3T3 cells expressing CBF{beta}/SMMHC acquire a transformed phenotype, as indicatedmore » by altered cell morphology, formation of foci, and growth in soft agar. Cells constitutively overexpressing the normal CBF{beta} cDNA or the rod region of SMMHC remain nontransformed. Western blot analysis using antibodies to CBF{beta} and the SMMHC rod demonstrates that stably transfected cells express the appropriate chimeric or normal protein. Electrophoretic mobility shift assays reveal that cells transformed by the chimeric cDNA do not have a CBF-DNA complex of the expected mobility, but instead contain a large complex with CBF DNA-binding activity that fails to migrate out of the gel wells. In order to define the regions of CBF{beta}/SMMHC necessary for 3T3 transformation, we have stably transfected cells with mutant CBF{beta}/SMMHC cDNAs containing various deletions of the coding region. Analysis of these cell lines indicates that the transformation property of CBF{beta}/SMMHC requires regions of CBF{beta} known to be necessary for association with the DNA-binding CBF{alpha} subunit, and also requires an intact SMMHC carboxyl terminus, which is necessary for formation of the coiled coil domain of the myosin rod.« less

Na+/K+-ATPase α-subunit in swimming crab Portunus trituberculatus: molecular cloning, characterization, and expression under low salinity stress

NASA Astrophysics Data System (ADS)

Han, Xiaolin; Liu, Ping; Gao, Baoquan; Wang, Haofeng; Duan, Yafei; Xu, Wenfei; Chen, Ping

2015-07-01

Na+/K+-ATPases are membrane-associated enzymes responsible for the active transport of Na+ and K+ ions across cell membranes, generating chemical and electrical gradients. These enzymes' α-subunit provides catalytic function, binding and hydrolyzing ATP, and itself becoming phosphorylated during the transport cycle. In this study, Na+/K+-ATPase α-subunit cDNA was cloned from gill tissue of the swimming crab Portunus trituberculatus by reverse-transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end methods. Analysis of the nucleotide sequence revealed that the cDNA had a full-length of 3 833 base pairs (bp), with an open reading frame of 3 120 bp, 5' untranslated region (UTR) of 317 bp, and 3' UTR of 396 bp. The sequence encoded a 1 039 amino acid protein with a predicted molecular weight of 115.57 kDa and with estimated pI of 5.21. It was predicted here to possess all expected features of Na+/K+-ATPase members, including eight transmembrane domains, putative ATP-binding site, and phosphorylation site. Comparison of amino acid sequences showed that the P. trituberculatus α-subunit possessed an overall identity of 75%-99% to that of other organisms. Phylogenetic analysis revealed that this α-subunit was in the same category as those of crustaceans. Quantitative real-time RT-PCR analysis indicated that this α-subunit's transcript were most highly expressed in gill and lowest in muscle. RT-PCR analysis also revealed that α-subunit expression in crab gill decreased after 2 and 6 h, but increased after 12, 24, 48, and 72 h. In addition, α-subunit expression in hepatopancreas of crab decreased after 2-72 h. These facts indicated that the crab's Na+/K+-ATPase α-subunit was potentially involved in the observed acute response to low salinity stress.

Distribution of alpha3, alpha5 and alpha(v) integrin subunits in mature and immature human oocytes.

PubMed

Capmany, G; Mart, M; Santaló, J; Bolton, V N

1998-10-01

The distribution of three integrin subunits, alpha3, alpha5 and alpha(v), in immature and mature human oocytes has been examined using immunofluorescence and confocal microscopy. The results demonstrate that both alpha5 and alpha(v) are present at the germinal vesicle stage, while alpha3 was only detected in oocytes after germinal vesicle breakdown, in metaphase I and II stage oocytes. The cortical concentration of integrin subunits alpha3 and alpha5 is consistent with their localization in the oolemma. In contrast, the homogeneous distribution of alpha(v) throughout the oocyte suggests the existence of cytoplasmic reservoirs of this protein in the oocyte.

[Cloning of Chinese Banna minipig inbred-line alpha1,3-galactosyltransferase gene and construction of its recombinant eukaryotic expression vector].

PubMed

Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu

2009-04-01

This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.

A kinetic comparison of the processing and secretion of the alpha beta dimer and the uncombined alpha and beta subunits of chorionic gonadotropin synthesized by human choriocarcinoma cells.

PubMed

Peters, B P; Krzesicki, R F; Hartle, R J; Perini, F; Ruddon, R W

1984-12-25

Human choriocarcinoma cells (JAR) synthesize the alpha and beta subunits of the glycoprotein hormone chorionic gonadotropin (hCG) (R.W. Ruddon, C.A. Hanson, A. H. Bryan, G.J. Putterman, E.L. White, F. Perini, K. S. Meade, and P.H. Aldenderfer (1980) J. Biol. Chem. 255, 1000-1007). In addition to the hCG dimer (alpha beta), JAR cells secrete uncombined alpha and beta subunits into the culture medium (L.A. Cole, R.J. Hartle, J.A. Laferla, and R.W. Ruddon (1983) Endocrinology 113, 1176-1178). Pulse-chase studies with [35S]methionine or [3H]mannose were carried out in order to compare free alpha, free beta, and the alpha beta dimer with regard to the kinetics of synthesis, N-linked oligosaccharide processing, and secretion and to determine the kinetics of alpha-beta subunit combination. A panel of three antisera was used to immunoprecipitate directly the free subunits and the alpha beta dimer sequentially from the same cell lysates and culture media. The alpha subunit of hCG was synthesized in a slight molar excess (1.2-1.5-fold) over the beta subunit, and alpha beta dimer was rapidly formed by combination of the intracellular alpha and beta precursors. Dimer formation was already apparent in JAR cells following a 10-min biosynthetic labeling incubation with [35S]methionine. The combination of subunits ceased by 30 min of chase even though 51% of alpha and 44% of beta remained free within the cells. Combination of the alpha and beta precursors had occurred before their N-linked oligosaccharides were processed beyond the Man8GlcNAc2 structure. The initial trimming of glucosyl and mannosyl units from the high-mannose oligosaccharides of the hCG precursors occurred more rapidly for free alpha and CG-alpha than for free beta and CG-beta. JAR cells accumulated alpha precursors bearing mostly Man8GlcNAc2 units and beta precursors bearing Man8GlcNAc2 units that represent the substrates of the rate-limiting step in the secretory pathway. In spite of the fact that their N-linked oligosaccharides were trimmed at different rates, free alpha, free beta, and alpha beta dimer were all secreted into the medium at the same rate, with a half-time of 35 min. The secreted hCG forms were stable in the chase medium between 4 and 8h, indicating that extracellular degradation, combination of free subunits to form dimer, or dissociation of dimer to form free subunits did not occur.(ABSTRACT TRUNCATED AT 400 WORDS)

Construction and characterization of the hetero-oligomer of the group II chaperonin from the hyperthermophilic archaeon, Thermococcus sp. strain KS-1.

PubMed

Sahlan, Muhamad; Kanzaki, Taro; Yohda, Masafumi

2009-05-01

The hyperthermophilic archaeon Thermococcus sp. strain KS-1 (T. KS-1) expresses two different chaperonin subunits, alpha and beta, for the folding of its proteins. The composition of the subunits in the hexadecameric double ring changes with temperature. The content of the beta subunit significantly increases according to the increase in temperature. The homo-oligomer of the beta subunit, Cpn beta, is more thermostable than that of the alpha subunit, Cpn alpha. Since Cpn alpha and Cpn beta also have different protein folding activities and interactions with prefoldin, the hetero-oligomer is thought to exhibit different characteristics according to the content of subunits. The hetero-oligomer of the T. KS-1 chaperonin has not been studied, however, because the alpha and beta subunits form hetero-oligomers of varying compositions when they are expressed simultaneously. In this study, we characterized the T. KS-1 chaperonin hetero-oligomer, Cpn alphabeta, containing both alpha and beta in the alternate order, which was constructed by the expression of alpha and beta subunits in a coordinated fashion and protease digestion. Cpn alphabeta protected citrate synthase from thermal aggregation, promoted the folding of acid-denatured GFP in an ATP-dependent manner, and exhibited an ATP-dependent conformational change. The yield of refolded GFP generated by Cpn alphabeta was almost equivalent to that generated by Cpn beta but lower than that generated by Cpn alpha. In contrast, Cpn alphabeta exhibited almost the same level of thermal stability as Cpn alpha, which was lower than that of Cpn beta. The affinity of Cpn alphabeta to prefoldin was found to be between those of Cpn alpha and Cpn beta, as expected.

The electrophoretically 'slow' and 'fast' forms of the alpha 2-macroglobulin molecule.

PubMed Central

Barrett, A J; Brown, M A; Sayers, C A

1979-01-01

alpha 2-Macroglobulin (alpha 2M) was isolated from human plasma by a four-step procedure: poly(ethylene glyco) fractionation, gel chromatography, euglobulin precipitation and immunoadsorption. No contaminants were detected in the final preparations by electrophoresis or immunoprecipitation. The protein ran as a single slow band in gel electrophoresis, and was designated 'S-alpha 2M'. S-alpha 2M bound about 2 mol of trypsin/mol. Treatment of S-alpha 2M with a proteinase or ammonium salts produced a form of the molecule more mobile in electrophoresis, and lacking proteinase-binding activity (F-alpha 2M). The electrophoretic mobility of the F-alpha 2M resulting from reaction with NH4+ salts was identical with that of proteinase complexes. We attribute the change in electrophoretic mobility of the alpha 2M to a conformation change, but there was no evidence of a change in pI or Strokes radius. Electrophoresis of S-alpha 2M in the presence of sodium dodecylsulphate gave results consistent with the view that the alpha 2M molecule is a tetramer of identical subunits, assembled as a non-covalent pair of disulphide-linked dimers. Some of the subunits seemed to be 'nicked' into two-thires-length and one-third-length chains, however. This was not apparent with F-alpha 2M produced by ammonium salts. F-alpha 2M produced by trypsin showed two new bands attributable to cleavage of the subunit polypeptide chain near the middle. Immunoassays of F-alpha 2M gave 'rockets' 12-29% lower than those with S-alpha 2M. The nature of the interactions between subunits in S-alpha 2M and F-alpha 2M was investigated by treating each form with glutaraldehyde before electrophoresis in the presence of sodium dodecyl sulphate. A much greater degree of cross-linking was observed with the F-alpha 2M, indicating that the subunits interact most closely in this form of the molecule. Exposure of S-alpha 2M to 3 M-urea or pH3 resulted in dissociation to the disulphide-bonded half-molecules; these did not show the proteinase-binding activity characteristic of the intact alpha 2M. F-alpha 2M was less easily dissociated than was S-alpha 2M. S-alpha 2M was readily dissociated to the quarter-subunits by mild reduction, with the formation of 3-4 new thiol groups per subunit. Inact reactive alpha 2M could then be regenerated in high yield by reoxidation of the subunits. F-alpha 2M formed by reaction with a proteinase or ammonium salts was not dissociated under the same conditions, although the interchain disulphide bonds were reduced. If the thiol groups of the quarter-subunits of S-alpha 2M were blocked by carboxymethylation, oxidative reassociation did not occur. Nevertheless treatment of these subunits with methylammonium salts or a proteinase caused the reassembly of half-molecules and intact (F-) tetramers. It is emphasized that F-alpha 2M does not have the properties of a denatured form of the protein... Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:91367

Inactivation of chloroplast H(+)-ATPase by modification of Lys beta 359, Lys alpha 176 and Lys alpha 266.

PubMed

Horbach, M; Meyer, H E; Bickel-Sandkötter, S

1991-09-01

Treatment of isolated, latent chloroplast ATPase with pyridoxal-5-phosphate (pyridoxal-P) in presence of Mg2+ causes inhibition of dithiothreitol-activated plus heat-activated ATP hydrolysis. The amount of [3H]pyridoxal-P bound to chloroplast coupling factor 1 (CF1) was estimated to run up to 6 +/- 1 pyridoxal-P/enzyme, almost equally distributed between the alpha- and beta-subunits. Inactivation, however, is complete after binding of 1.5-2 pyridoxal-P/CF1, suggesting that two covalently modified lysines prevent the activation of the enzyme. ADP as well as ATP in presence of Mg2+ protects the enzyme against inactivation and concomittantly prevents incorporation of a part of the 3H-labeled pyridoxal-P into beta- and alpha-subunits. Phosphate prevents labeling of the alpha-subunit, but has only a minor effect on protection against inactivation. The data indicate a binding site at the interface between the alpha- and beta-subunits. Cleavage of the pyridoxal-P-labeled subunits with cyanogen bromide followed by sequence analysis of the labeled peptides led to the detection of Lys beta 359, Lys alpha 176 and Lys alpha 266, which are closely related to proposed nucleotide-binding regions of the alpha- and beta-subunits.

Characterization and charge distribution of the asparagine-linked oligosaccharides on secreted mouse thyrotropin and free alpha-subunits

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gesundheit, N.; Gyves, P.W.; DeCherney, G.S.

1989-06-01

Mouse hemipituitaries in vitro secrete TSH, composed of an alpha-beta heterodimer, as well as excess (free) alpha-subunits. By dual metabolic labeling with (35S)sulfate and (3H)mannose, we have characterized oligosaccharides from secreted TSH alpha, TSH beta, and free alpha-subunits released from the apoprotein by enzymatic deglycosylation. Oligosaccharides from each subunit displayed a distinct anion exchange HPLC profile due to a specific pattern of sialylation and sulfation. Six species were obtained from TSH alpha (with two glycosylation sites), including neutral oligosaccharides as well as those with one or two negative charges. For TSH beta (with one glycosylation site) at least eight oligosaccharidemore » species were noted, representing nearly every permutation of sialylation and sulfation; approximately 30% contained three or more negative charges. Analysis of (3H)mannose-labeled oligosaccharides on Concanavalin-A-agarose showed 85% binding for those from TSH alpha, 70% for free alpha, and 50% for those from TSH beta. These data demonstrate that oligosaccharides from secreted TSH beta were more sialylated and sulfated, consistent with a more complex branching pattern, than those from TSH alpha. Oligosaccharides from free alpha-subunit were more sialylated than those from TSH alpha, and the net negative charge was intermediate between those of TSH alpha and TSH beta. Although great microheterogeneity is present even at the single glycosylation site on the beta-subunit of secreted TSH, a pattern of sialylation and sulfation could be discerned.« less

Assignment of Etfdh, Etfb, and Etfa to chromosomes 3, 7, and 13: The mouse homologs of genes respondible for glutaric acidemia type II in human

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, R.A.; Dowler, L.L.; Angeloni, S.V.

Electron transfer flavoprotein (composed of {alpha} and {beta} subunits) is an obligatory electron acceptor for several dehydrogenases and is located in the mitochondrial matrix. Electrons accepted by electron transfer flavo-protein (ETF) are transferred to the main mitochondrial respiratory chain by the way of ETF dehydrogenase (ETFDH). In humans, deficiency of ETF or ETFDH leads to glutaric acidemia type II, an inherited metabolic disorder that can be fatal in its neonatal form and is characterized by severe hypoketotic hypoglycemia and acidosis. We used cDNA probes for the Etfdh, Etfb, and Etfa genes to determine localization of these mouse genes to chromosomesmore » 3, 7, and 13. 18 refs., 3 figs.« less

The alpha2-delta protein: an auxiliary subunit of voltage-dependent calcium channels as a recognized drug target.

PubMed

Thorpe, Andrew J; Offord, James

2010-07-01

Currently, there are two drugs on the market, gabapentin (Neurontin) and pregabalin (Lyrica), that are proposed to exert their therapeutic effect through binding to the alpha2-delta subunit of voltage-sensitive calcium channels. This activity was unexpected, as the alpha2-delta subunit had previously been considered not to be a pharmacological target. In this review, the role of the alpha2-delta subunits is discussed and the mechanism of action of the alpha2-delta ligands in vitro and in vivo is summarized. Finally, new insights into the mechanism of drugs that bind to this protein are discussed.

Cross-linking of hCG to luteal receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ji, T.H.; Ji, I.

1985-01-01

Photoaffinity labeling of the lutropin/choriogonadotropin (LH/hCG) receptor system on porcine granulosa cells has demonstrated that both the ..cap alpha.. and ..beta.. subunits of hCG directly photoaffinity label the hormone receptor. Three new bands appear on SDS-PAGE as a consequence of photoaffinity labeling by each subunit: the molecular weights of the three bands (106K, 88K, and 83K) produced by the subunit are larger by approximately 10K than those of the three bands (96K, 76K, and 73K) labeled by the ..cap alpha.. subunit. Although it could be a coincidence that the molecular weight of the ..beta.. subunit is approximately 10K larger thanmore » that of the ..cap alpha.. subunit, the similarity in these differences suggests the possibility that both the ..cap alpha.. and ..beta.. subunits have labeled the same polypeptides.« less

Spontaneous quaternary and tertiary T-R transitions of human hemoglobin in molecular dynamics simulation.

PubMed

Hub, Jochen S; Kubitzki, Marcus B; de Groot, Bert L

2010-05-06

We present molecular dynamics simulations of unliganded human hemoglobin (Hb) A under physiological conditions, starting from the R, R2, and T state. The simulations were carried out with protonated and deprotonated HC3 histidines His(beta)146, and they sum up to a total length of 5.6 micros. We observe spontaneous and reproducible T-->R quaternary transitions of the Hb tetramer and tertiary transitions of the alpha and beta subunits, as detected from principal component projections, from an RMSD measure, and from rigid body rotation analysis. The simulations reveal a marked asymmetry between the alpha and beta subunits. Using the mutual information as correlation measure, we find that the beta subunits are substantially more strongly linked to the quaternary transition than the alpha subunits. In addition, the tertiary populations of the alpha and beta subunits differ substantially, with the beta subunits showing a tendency towards R, and the alpha subunits showing a tendency towards T. Based on the simulation results, we present a transition pathway for coupled quaternary and tertiary transitions between the R and T conformations of Hb.

Alpha subunit of glycoprotein hormones in the sera of acromegalic patients and its mRNA in the tumors.

PubMed

Machiavelli, G A; Artese, R; Benencia, H; Bruno, O; Guerra, L; Basso, A; Burdman, J A

1999-04-01

Within a population of 16 pituitary adenomas we found high levels of glycoprotein alpha subunits in the sera of patients with somatotrophic tumors. This finding was correlated with the presence of mRNA alpha subunit in these tumors indicating the adenomas themselves as the origin of the circulating alpha-subunit. Synthesis of these two hormones, which are chemically very different, by the same tumor cells indicates a high degree of differentiation of these cells. We are unable at this time to conclusively correlate differentiation of these tumors aggressively.

Mechanism of repression of the inhibin alpha-subunit gene by inducible 3',5'-cyclic adenosine monophosphate early repressor.

PubMed

Burkart, Anna D; Mukherjee, Abir; Mayo, Kelly E

2006-03-01

The rodent ovary is regulated throughout the reproductive cycle to maintain normal cyclicity. Ovarian follicular development is controlled by changes in gene expression in response to the gonadotropins FSH and LH. The inhibin alpha-subunit gene belongs to a group of genes that is positively regulated by FSH and negatively regulated by LH. Previous studies established an important role for inducible cAMP early repressor (ICER) in repression of alpha-inhibin. These current studies investigate the mechanisms of repression by ICER. It is not clear whether all four ICER isoforms expressed in the ovary can act as repressors of the inhibin alpha-subunit gene. EMSAs demonstrate binding of all isoforms to the inhibin alpha-subunit CRE (cAMP response element), and transfection studies demonstrate that all isoforms can repress the inhibin alpha-subunit gene. Repression by ICER is dependent on its binding to DNA as demonstrated by mutations to ICER's DNA-binding domain. These mutational studies also demonstrate that repression by ICER is not dependent on heterodimerization with CREB (CRE-binding protein). Competitive EMSAs show that ICER effectively competes with CREB for binding to the inhibin alpha CRE in vitro. Chromatin immunoprecipitation assays demonstrate a replacement of CREB dimers bound to the inhibin alpha CRE by ICER dimers in ovarian granulosa cells in response to LH signaling. Thus, there is a temporal association of transcription factors bound to the inhibin alpha-CRE controlling inhibin alpha-subunit gene expression.

Coexpression of alpha and beta subunits of the rod cyclic GMP-gated channel restores native sensitivity to cyclic AMP: role of D604/N1201.

PubMed Central

Pagès, F; Ildefonse, M; Ragno, M; Crouzy, S; Bennett, N

2000-01-01

Coexpression of the betawt and alphawt subunits of the bovine rod channel restores two characteristics of the native channels: higher sensitivity to cAMP and potentiation of cGMP-induced currents by low cAMP concentrations. To test whether the increased sensitivity to cAMP is due to the uncharged nature of the asparagine residue (N1201) situated in place of aspartate D604 in the beta subunit as previously suggested (, Neuron. 15:619-625), we compared currents from wild-type (alphawt and alphawt/betawt) and from mutated channels (alphaD604N, alphaD604N/betawt, and alphawt/betaN1201D). The results show that the sensitivity to cAMP and cAMP potentiation is partly but not entirely determined by the charge of residue 1201 in the beta subunit. The D604N mutation in the alpha subunit and, to a lesser extent, coexpression of the betawt subunit with the alphawt subunit reduce the open probability for cGMP compared to that of the alphawt channel. Interpretation of the data with the MWC allosteric model (model of Monod, Wyman, Changeux;, J. Mol. Biol. 12:88-118) suggests that the D604N mutation in the alpha subunits and coassembly of alpha and beta subunits alter the free energy of gating by cAMP more than that of cAMP binding. PMID:10692312

Synthesis of prolyl 4-hydroxylase alpha subunit and type IV collagen in hemocytic granular cells of silkworm, Bombyx mori: Involvement of type IV collagen in self-defense reaction and metamorphosis.

PubMed

Adachi, Takahiro; Tomita, Masahiro; Yoshizato, Katsutoshi

2005-04-01

The present study shows that hemocytic granular cells synthesize and secrete type IV collagen (ColIV) in the silkworm Bombyx mori (B. mori) and suggests that these cells play roles in the formation of basement membrane, the encapsulation of foreign bodies, and the metamorphic remodeling of the gut. The full- and partial-length cDNA of B. mori prolyl 4-hydroxylase alpha subunit (BmP4Halpha) and B. mori ColIV (BmColIV) were cloned, respectively. In situ hybridization and immunocytochemistry on larval tissues and cells identified hemocytic granular cells as the cells that express mRNAs and proteins of both BmP4Halpha and BmColIV. Immunohistochemistry and immunocytochemistry demonstrated that BmColIV was present in the basement membrane and in the secretory granules of granular cells, respectively. Granular cells in culture secreted BmColIV without accompanying the degranulation and discharged it from the granules when the cells were degranulated. Nylon threads were inserted into the hemocoel of larvae. Granular cells concentrated around the nylon threads and encapsulated them as a self-defense reaction. BmColIV was found to be a component of the capsules. Furthermore, the present study showed that actively BmColIV-expressing granular cells accumulated around the midgut epithelium and formed BmColIV-rich thick basal lamina-like structures there in larval to pupal metamorphosis.

Rates of processing of the high mannose oligosaccharide units at the three glycosylation sites of mouse thyrotropin and the two sites of free alpha-subunits.

PubMed

Miura, Y; Perkel, V S; Magner, J A

1988-09-01

We have determined the structures of high mannose (Man) oligosaccharide units at individual glycosylation sites of mouse TSH. Mouse thyrotropic tumor tissue was incubated with D-[2-3H]Man with or without [14C]tyrosine ([14C] Tyr) for 2, 3, or 6 h, and for a 3-h pulse followed by a 2-h chase. TSH heterodimers or free alpha-subunits were obtained from homogenates using specific antisera. After reduction and alkylation, subunits were treated with trypsin. The tryptic fragments were then loaded on a reverse phase HPLC column to separate tryptic fragments bearing labeled oligosaccharides. The N-linked oligosaccharides were released with endoglycosidase-H and analyzed by paper chromatography. Man9GlcNac2 and Man8GlcNac2 units predominated at each time point and at each specific glycosylation site, but the processing of high Man oligosaccharides differed at each glycosylation site. The processing at Asn23 of TSH beta-subunits was slower than that at Asn56 or Asn82 of alpha-subunits. The processing at Asn82 was slightly faster than that at Asn56 for both alpha-subunits of TSH heterodimers and free alpha-subunits. The present study demonstrates that the early processing of oligosaccharides differs at the individual glycosylation sites of TSH and free alpha-subunits, perhaps because of local conformational differences.

GTP analogues promote release of the alpha subunit of the guanine nucleotide binding protein, Gi2, from membranes of rat glioma C6 BU1 cells.

PubMed Central

Milligan, G; Mullaney, I; Unson, C G; Marshall, L; Spiegel, A M; McArdle, H

1988-01-01

The major pertussis-toxin-sensitive guanine nucleotide-binding protein of rat glioma C6 BU1 cells corresponded immunologically to Gi2. Antibodies which recognize the alpha subunit of this protein indicated that it has an apparent molecular mass of 40 kDa and a pI of 5.7. Incubation of membranes of these cells with guanosine 5'-[beta gamma-imido]triphosphate, or other analogues of GTP, caused release of this polypeptide from the membrane in a time-dependent manner. Analogues of GDP or of ATP did not mimic this effect. The GTP analogues similarly caused release of the alpha subunit of Gi2 from membranes of C6 cells in which this G-protein had been inactivated by pretreatment with pertussis toxin. The beta subunit was not released from the membrane under any of these conditions, indicating that the release process was a specific response to the dissociation of the G-protein after binding of the GTP analogue. Similar nucleotide profiles for release of the alpha subunits of forms of Gi were noted for membranes of both the neuroblastoma x glioma hybrid cell line NG108-15 and of human platelets. These data provide evidence that: (1) pertussis-toxin-sensitive G-proteins, in native membranes, do indeed dissociate into alpha and beta gamma subunits upon activation; (2) the alpha subunit of 'Gi-like' proteins need not always remain in intimate association with the plasma membrane; and (3) the alpha subunit of Gi2 can still dissociate from the beta/gamma subunits after pertussis-toxin-catalysed ADP-ribosylation. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 8. PMID:3140801

Integrin distributions in renal cell carcinomas of various grades of malignancy.

PubMed Central

Korhonen, M.; Laitinen, L.; Ylänne, J.; Koukoulis, G. K.; Quaranta, V.; Juusela, H.; Gould, V. E.; Virtanen, I.

1992-01-01

We studied 41 renal cell carcinomas, classified according to histologic grades G1 through G3, by indirect immunofluorescence microscopy using a panel of monoclonal antibodies (MAb) against various integrin subunits, and the basement membrane (BM) components laminin and collagen type IV. Selected cases also were immunostained using the avidin-biotin-complex method. The alpha 3 and beta 1 integrin subunits were detected in tumor cells of all the carcinomas. All G1 carcinomas, like normal tubular epithelial cells, expressed the alpha 6 subunit, whereas it was lacking in 20% and 40% of G2 and G3 carcinomas, respectively. Furthermore, when alpha 6 was expressed, a lack of basally polarized organization of the subunit, coupled with disorganization of the BM components, correlated with histologic grade. Another feature that appeared to characterize the more anaplastic tumors was their high level (80%) of the alpha v subunit expression as compared with its absence in the G1 carcinomas. Stromal myofibroblasts, identified by double-labeling with anti-myosin, were often characterized by the expression of the alpha 1, alpha 3, alpha 5 and beta 1 subunits. These results indicate that changes in integrin expression in renal cell carcinomas may be correlated with their degree of histologic malignancy. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:1443050

Reactivation of the chloroplast CF1-ATPase beta subunit by trace amounts of the CF1 alpha subunit suggests a chaperonin-like activity for CF1 alpha.

PubMed

Avni, A; Avital, S; Gromet-Elhanan, Z

1991-04-25

Incubation of tobacco and lettuce thylakoids with 2 M LiCl in the presence of MgATP removes the beta subunit from their CF1-ATPase (CF1 beta) together with varying amounts of the CF1 alpha subunit (CF1 alpha). These 2 M LiCl extracts, as with the one obtained from spinach thylakoids (Avital, S., and Gromet-Elhanan, Z. (1991) J. Biol. Chem. 266, 7067-7072), could form active hybrid ATPases when reconstituted into inactive beta-less Rhodospirillum rubrum chromatophores. Pure CF1 beta fractions that have been isolated from these extracts could not form such active hybrids by themselves, but could do so when supplemented with trace amounts (less than 5%) of CF1 alpha. A mitochondrial F1-ATPase alpha subunit was recently reported to be a heat-shock protein, having two amino acid sequences that show a highly conserved identity with sequences found in molecular chaperones (Luis, A. M., Alconada, A., and Cuezva, J. M. (1990) J. Biol. Chem. 265, 7713-7716). These sequences are also conserved in CF1 alpha isolated from various plants, but not in F1 beta subunits. The above described reactivation of CF1 beta by trace amounts of CF1 alpha could thus be due to a chaperonin-like function of CF1 alpha, which involves the correct, active folding of isolated pure CF1 beta.

Structural and molecular characterization of the prefoldin beta subunit from Thermococcus strain KS-1.

PubMed

Kida, Hiroshi; Sugano, Yuri; Iizuka, Ryo; Fujihashi, Masahiro; Yohda, Masafumi; Miki, Kunio

2008-11-14

Prefoldin (PFD) is a heterohexameric molecular chaperone that is found in eukaryotic cytosol and archaea. PFD is composed of alpha and beta subunits and forms a "jellyfish-like" structure. PFD binds and stabilizes nascent polypeptide chains and transfers them to group II chaperonins for completion of their folding. Recently, the whole genome of Thermococcus kodakaraensis KOD1 was reported and shown to contain the genes of two alpha and two beta subunits of PFD. The genome of Thermococcus strain KS-1 also possesses two sets of alpha (alpha1 and alpha2) and beta subunits (beta1 and beta2) of PFD (TsPFD). However, the functions and roles of each of these PFD subunits have not been investigated in detail. Here, we report the crystal structure of the TsPFD beta1 subunit at 1.9 A resolution and its functional analysis. TsPFD beta1 subunits form a tetramer with four coiled-coil tentacles resembling the jellyfish-like structure of heterohexameric PFD. The beta hairpin linkers of beta1 subunits assemble to form a beta barrel "body" around a central fourfold axis. Size-exclusion chromatography and multi-angle light-scattering analyses show that the beta1 subunits form a tetramer at pH 8.0 and a dimer of tetramers at pH 6.8. The tetrameric beta1 subunits can protect against aggregation of relatively small proteins, insulin or lysozyme. The structural and biochemical analyses imply that PFD beta1 subunits act as molecular chaperones in living cells of some archaea.

Molecular cloning of the alpha subunit of complement component C8 (CpC8α) of whitespotted bamboo shark (Chiloscyllium plagiosum).

PubMed

Wang, Ying; Zhang, Mengmeng; Wang, Conghui; Ye, Boping; Hua, Zichun

2013-12-01

Complement-mediated cytolysis is the important effect of immune response, which results from the assembly of terminal complement components (C5b-9). Among them, α subunit of C8 (C8α) is the first protein that traverses the lipid bilayer, and then initiates the recruitment of C9 molecules to form pore on target membranes. In this article, a full-length cDNA of C8α (CpC8α) is identified from the whitespotted bamboo shark (Chiloscyllium plagiosum) by RACE. The CpC8α cDNA is 2183 bp in length, encoding a protein of 591 amino acids. The deduced CpC8α exhibits 89%, 49% and 44% identity with nurse shark, frog and human orthologs, respectively. Sequence alignment indicates that the C8α is well conserved during the evolution process from sharks to mammals, with the same modular architecture as well as the identical cysteine composition in the mature protein. Phylogenetic analysis places CpC8α and nurse shark C8α in cartilaginous fish clade, in parallel with the teleost taxa, to form the C8α cluster with higher vertebrates. Hydrophobicity analysis also indicates a similar hydrophobicity of CpC8α to mammals. Finally, expression analysis revealed CpC8α transcripts were constitutively highly expressed in shark liver, with much less expression in other tissues. The well conserved structure and properties suggests an analogous function of CpC8α to mammalian C8α, though it remains to be confirmed by further study. Copyright © 2013 Elsevier Ltd. All rights reserved.

Characterization of the translation products of the major mRNA species from rabbit lactating mammary glands and construction of bacterial recombinants containing casein and alpha-lactalbumin complementary DNA.

PubMed Central

Suard, Y M; Tosi, M; Kraehenbuhl, J P

1982-01-01

Total cytoplasmic polyadenylated RNA from lactating rabbit mammary glands was analysed on methylmercury hydroxide-agarose gels. The size of the most abundant mRNA species ranged between 0.5 and 5.0 kb (kilobases), with major bands at 0.55, 0.84, 0.92, 1.18 and 2.4 kb and discrete minor bands of 1.5, 1.7, 3.0 and 3.9 kb. Translation in vitro of total mRNA with [3H]leucine or [35S]methionine as precursor yielded four major bands with apparent Mr values of 16 000, 25 000, 26 000 and 29 000. The four protein bands were identified by immunoprecipitation by using specific antisera as alpha-lactalbumin and x-, kappa- and alpha-caseins, respectively. Labelling with (35S]cysteine followed by immunoprecipitation with anti-transferrin or anti-alpha-lactalbumin sera allowed the identification of two whey proteins. Translated transferrin was resolved as an 80 000-dalton band and alpha-lactalbumin appeared as a 16 000-dalton protein. A library of recombinant plasmids containing cDNA (complementary DNA) sequences representing cytoplasmic polyadenylated RNA was used to isolate clones for the major rabbit caseins and alpha-lactalbumin. A preliminary characterization of these cDNA clones was achieved by colony hybridization with enriched RNA fractions as probes. Positive clones were identified by use of hybrid-promoted translation in vitro and immunoprecipitation of the translation products. The corresponding mRNA species were further identified by hybridizing RNA blots with radioactively labelled cDNA clones. We present the restriction map of alpha-casein and kappa-casein cDNA clones. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:6123313

Genetic ablation of the alpha 6-integrin subunit in Tie1Cre mice enhances tumour angiogenesis.

PubMed

Germain, Mitchel; De Arcangelis, Adèle; Robinson, Stephen D; Baker, Marianne; Tavora, Bernardo; D'Amico, Gabriela; Silva, Rita; Kostourou, Vassiliki; Reynolds, Louise E; Watson, Alan; Jones, J Louise; Georges-Labouesse, Elisabeth; Hodivala-Dilke, Kairbaan

2010-02-01

Laminins are expressed highly in blood vessel basement membranes and have been implicated in angiogenesis. alpha6beta1- and alpha6beta4-integrins are major receptors for laminins in endothelial cells, but the precise role of endothelial alpha6-integrin in tumour angiogenesis is not clear. We show that blood vessels in human invasive ductal carcinoma of the breast have decreased expression of the alpha6-integrin-subunit when compared with normal breast tissue. These data suggest that a decrease in alpha6-integrin-subunit expression in endothelial cells is associated with tumour angiogenesis. To test whether the loss of the endothelial alpha6-integrin subunit affects tumour growth and angiogenesis, we generated alpha6fl/fl-Tie1Cre+ mice and showed that endothelial deletion of alpha6-integrin is sufficient to enhance tumour size and tumour angiogenesis in both murine B16F0 melanoma and Lewis cell lung carcinoma. Mechanistically, endothelial alpha6-integrin deficiency elevated significantly VEGF-mediated angiogenesis both in vivo and ex vivo. In particular, alpha6-integrin-deficient endothelial cells displayed increased levels of VEGF-receptor 2 (VEGFR2) and VEGF-mediated downstream ERK1/2 activation. By developing the first endothelial-specific alpha6-knockout mice, we show that the expression of the alpha6-integrin subunit in endothelial cells acts as a negative regulator of angiogenesis both in vivo and ex vivo. Copyright 2009 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Electrophysiological and biochemical evidence that DEG/ENaC cation channels are composed of nine subunits.

PubMed

Snyder, P M; Cheng, C; Prince, L S; Rogers, J C; Welsh, M J

1998-01-09

Members of the DEG/ENaC protein family form ion channels with diverse functions. DEG/ENaC subunits associate as hetero- and homomultimers to generate channels; however the stoichiometry of these complexes is unknown. To determine the subunit stoichiometry of the human epithelial Na+ channel (hENaC), we expressed the three wild-type hENaC subunits (alpha, beta, and gamma) with subunits containing mutations that alter channel inhibition by methanethiosulfonates. The data indicate that hENaC contains three alpha, three beta, and three gamma subunits. Sucrose gradient sedimentation of alphahENaC translated in vitro, as well as alpha-, beta-, and gammahENaC coexpressed in cells, was consistent with complexes containing nine subunits. FaNaCh and BNC1, two related DEG/ENaC channels, produced complexes of similar mass. Our results suggest a novel nine-subunit stoichiometry for the DEG/ENaC family of ion channels.

Murine recessive hereditary spherocytosis, sph/sph, is caused by a mutation in the erythroid alpha-spectrin gene.

PubMed

Wandersee, N J; Birkenmeier, C S; Gifford, E J; Mohandas, N; Barker, J E

2000-01-01

Spectrin, a heterodimer of alpha- and beta-subunits, is the major protein component of the red blood cell membrane skeleton. The mouse mutation, sph, causes an alpha-spectrin-deficient hereditary spherocytosis with the severe phenotype typical of recessive hereditary spherocytosis in humans. The sph mutation maps to the erythroid alpha-spectrin locus, Spna1, on Chromosome 1. Scanning electron microscopy, osmotic gradient ektacytometry, cDNA cloning, RT-PCR, nucleic acid sequencing, and Northern blot analyses were used to characterize the wild type and sph alleles of the Spna1 locus. Our results confirm the spherocytic nature of sph/sph red blood cells and document a mild spherocytic transition in the +/sph heterozygotes. Sequencing of the full length coding region of the Spna1 wild type allele from the C57BL/6J strain of mice reveals a 2414 residue deduced amino acid sequence that shows the typical 106-amino-acid repeat structure previously described for other members of the spectrin protein family. Sequence analysis of RT-PCR clones from sph/sph alpha-spectrin mRNA identified a single base deletion in repeat 5 that would cause a frame shift and premature termination of the protein. This deletion was confirmed in sph/sph genomic DNA. Northern blot analyses of the distribution of Spna1 mRNA in non-erythroid tissues detects the expression of 8, 2.5 and 2.0 kb transcripts in adult heart. These results predict the heart as an additional site where alpha-spectrin mutations may produce a phenotype and raise the possibility that a novel functional class of small alpha-spectrin isoforms may exist.

Functional characterization of recombinant prefoldin complexes from a hyperthermophilic archaeon, Thermococcus sp. strain KS-1.

PubMed

Iizuka, Ryo; Sugano, Yuri; Ide, Naoki; Ohtaki, Akashi; Yoshida, Takao; Fujiwara, Shinsuke; Imanaka, Tadayuki; Yohda, Masafumi

2008-03-28

Prefoldin is a heterohexameric molecular chaperone complex that is found in the eukaryotic cytosol and also in archaea. It captures a nonnative protein and subsequently delivers it to a group II chaperonin for proper folding. Archaeal prefoldin is a heterocomplex containing two alpha subunits and four beta subunits with the structure of a double beta-barrel assembly, with six long coiled coils protruding from it like a jellyfish with six tentacles. We have studied the protein folding mechanism of group II chaperonin using those of Thermococcus sp. strain KS-1 (T. KS-1) because they exhibit high protein folding activity in vitro. We have also demonstrated functional cooperation between T. KS-1 chaperonins and prefoldin from Pyrococcus horikoshii OT3. Recent genome analysis has shown that Thermococcus kodakaraensis KOD1 contains two pairs of prefoldin subunit genes, correlating with the existence of two different chaperonin subunits. In this study, we characterized four different recombinant prefoldin complexes composed of two pairs of prefoldin subunits (alpha1, alpha2, beta1, and beta2) from T. KS-1. All of them (alpha1-beta1, alpha2-beta1, alpha1-beta2, and alpha2-beta2) exist as alpha(2)beta(4) heterohexamers and can protect several proteins from forming aggregates with different activities. We have also compared the collaborative activity between the prefoldin complexes and the cognate chaperonins. Prefoldin complexes containing the beta1 subunit interacted with the chaperonins more strongly than those with the beta2 subunit. The results suggest that Thermococcus spp. express different prefoldins for different substrates or conditions as chaperonins.

Recombination and mutation of class II histocompatibility genes in wild mice.

PubMed

Wakeland, E K; Darby, B R

1983-12-01

We have compared the tryptic peptide fingerprints of the A alpha, A beta, E alpha, and E beta subunits encoded by four wild-derived H-2 complexes expressing A molecules closely related to Ak. The A molecules encoded by these Ak-related mice have A alpha and A beta subunits that differ from A alpha k and A beta k by less than 10% of their tryptic peptides. Comparisons among the four wild-derived A molecules suggested that these contemporary A alpha and A beta alleles arose by sequential mutational events from common ancestor A alpha and A beta alleles. These results suggest that A alpha and A beta may co-evolve as an A beta A alpha gene duplex in wild mice. Tryptic peptide fingerprint comparisons of the E beta gene linked to these Ak-related A beta A alpha gene duplexes indicate that two encode E beta d-like subunits, whereas another encodes an E beta s-like subunit. These results strongly suggest that the A beta A alpha duplex and E beta recombine in wild mouse populations. The significantly different evolutionary patterns exhibited by the class II genes encoding A vs E molecules are discussed.

Quantitative RT-PCR for inhibin/activin subunits: measurements of rat hypothalamic and ovarian inhibin/activin subunit mRNAs during the estrous cycle.

PubMed

Murata, T; Takizawa, T; Funaba, M; Fujimura, H; Murata, E; Takahashi, M; Torii, K

1997-02-01

Inhibins (alpha-beta(A) and alpha-beta(B)) and activins (beta(A)-beta(A), beta(A)-beta(B) and beta(B)-beta(B)) were originally isolated from ovarian follicular fluids as FSH secretion modifiers. Inhibin/activin subunits, alpha, beta(A) and beta(B), are widely distributed in several tissues, including gonads and brain, and inhibins and activins have been reported to be involved in ovarian or hypothalamic functions. In this study, we established and employed a competitive RT-PCR assay system for rat inhibin/activin subunits by capillary electrophoresis to determine rat hypothalamic and ovarian inhibin/activin subunit mRNA levels during the estrous cycle. Linearity of standards for alpha, beta(A), and beta(B) subunit assays were between 0.01-0.3 amol, 0.003-0.09 amol and 0.002-0.02 amol of each fragment DNA as a standard, respectively. Hypothalamic beta(A) subunit mRNA during the estrous morning (1000 h) tended to be increased compared with that of the proestrous evening (1700 h), although they were not significantly different. Ovarian alpha subunit mRNA levels tended to be increased during the proestrous morning (1000 h) and were significantly increased in the proestrous evening (1700 h), compared with diestrus and estrus (P < 0.05). Ovarian beta(A) subunit mRNA was also significantly higher in the proestrous evening, compared with diestrus and estrus (P < 0.05), but in the case of beta(B) subunit mRNA there was no difference among diestrus, proestrus and estrus. We thus established a sensitive competitive RT-PCR system for the measurement of inhibin/activin alpha, beta(A) and beta(B) subunits, and this assay system would be helpful for the study of inhibin/activin action in brain and other tissues where these factors are expressed at low levels.

Unexpected high digestion rate of cooked starch by the Ct-Maltase-Glucoamylase small intestine mucosal alpha-glucosidase subunit

USDA-ARS?s Scientific Manuscript database

For starch digestion to glucose, two luminal alpha-amylases and four gut mucosal alpha-glucosidase subunits are employed. The aim of this research was to investigate, for the first time, direct digestion capability of individual mucosal alpha-glucosidases on cooked (gelatinized) starch. Gelatinized ...

Characterization of inhibin forms and their measurement by an inhibin alpha-subunit ELISA in serum from postmenopausal women with ovarian cancer.

PubMed

Robertson, D M; Stephenson, T; Pruysers, E; McCloud, P; Tsigos, A; Groome, N; Mamers, P; Burger, H G

2002-02-01

The aim of this study was to characterize the molecular wt forms of inhibins A and B and its free alpha-subunit present in serum from women with ovarian cancer as a basis for developing improved monoclonal antibody-based inhibin assays for monitoring ovarian cancer. Three new inhibin alpha-subunit (alphaC) ELISAs were developed using monoclonal antibodies directed to three nonoverlapping peptide regions of the alphaC region of the inhibin alpha-subunit. To characterize serum inhibin molecular wt forms present in women with ovarian cancer, existing inhibin immunoassays (inhibin A, inhibin B, and pro-alphaC) and the new alphaC ELISAs were applied to sera from women with granulosa cell tumors and mucinous carcinomas previously fractionated using a combined immunoaffinity chromatography, preparative SDS-PAGE, and electroelution procedure. The distribution and molecular size of dimeric inhibins and alpha-subunit detected were consistent with known mol wt forms of inhibins A and B and inhibin alpha-subunit and their precursor forms present in serum and follicular fluid from healthy women. The alphaC ELISAs recognized all known forms of inhibin and the free inhibin alpha-subunit, although differences between alphaC ELISAs were observed in their ability to detect high mol wt forms. To assess which of the alphaC ELISAs was preferred in application to ovarian cancer, the alphaC ELISAs were applied to serum from a range of normal postmenopausal women (n = 61) and postmenopausal women (n = 152) with ovarian (serous, mucinous, endometrioid, clear cell carcinomas, and granulosa cell tumors) and nonovarian (breast and colon) cancers. Despite differences in their ability to detect high mol wt forms of inhibin, the alphaC ELISAs showed similar sensitivity (i.e. proportion of cancer patients correctly detected) and specificity (proportion of controls correctly detected) indexes in the detection of mucinous carcinomas (84% and 95%) and granulosa cell tumors (100% and 95%) compared with earlier inhibin RIA or polyclonal antibody-based immunofluorometric assays. A combination of the alphaC ELISAs with the CA125 assay, an ovarian tumor marker that has a high sensitivity and specificity for other ovarian cancers (serous, clear cell, and endometrioid), resulted in an increase in sensitivity/specificity indexes (95% and 95%) for the all ovarian cancer group. These new monoclonal antibody-based inhibin alphaC ELISAs now provide practical and sensitive assays suitable for evaluation as diagnostic tests for monitoring ovarian cancers.

beta subunits influence the biophysical and pharmacological differences between P- and Q-type calcium currents expressed in a mammalian cell line.

PubMed

Moreno, H; Rudy, B; Llinás, R

1997-12-09

Human epithelial kidney cells (HEK) were prepared to coexpress alpha1A, alpha2delta with different beta calcium channel subunits and green fluorescence protein. To compare the calcium currents observed in these cells with the native neuronal currents, electrophysiological and pharmacological tools were used conjointly. Whole-cell current recordings of human epithelial kidney alpha1A-transfected cells showed small inactivating currents in 80 mM Ba2+ that were relatively insensitive to calcium blockers. Coexpression of alpha1A, betaIb, and alpha2delta produced a robust inactivating current detected in 10 mM Ba2+, reversibly blockable with low concentration of omega-agatoxin IVA (omega-Aga IVA) or synthetic funnel-web spider toxin (sFTX). Barium currents were also supported by alpha1A, beta2a, alpha2delta subunits, which demonstrated the slowest inactivation and were relatively insensitive to omega-Aga IVA and sFTX. Coexpression of beta3 with the same combination as above produced inactivating currents also insensitive to low concentration of omega-Aga IVA and sFTX. These data indicate that the combination alpha1A, betaIb, alpha2delta best resembles P-type channels given the rate of inactivation and the high sensitivity to omega-Aga IVA and sFTX. More importantly, the specificity of the channel blocker is highly influenced by the beta subunit associated with the alpha1A subunit.

GABAA receptor subunit gene expression in human prefrontal cortex: comparison of schizophrenics and controls

NASA Technical Reports Server (NTRS)

Akbarian, S.; Huntsman, M. M.; Kim, J. J.; Tafazzoli, A.; Potkin, S. G.; Bunney, W. E. Jr; Jones, E. G.; Bloom, F. E. (Principal Investigator)

1995-01-01

The prefrontal cortex of schizophrenics is hypoactive and displays changes related to inhibitory, GABAergic neurons, and GABAergic synapses. These changes include decreased levels of glutamic acid decarboxylase (GAD), the enzyme for GABA synthesis, upregulation of muscimol binding, and downregulation of benzodiazepine binding to GABAA receptors. Studies in the visual cortex of nonhuman primates have demonstrated that gene expression for GAD and for several GABAA receptor subunit polypeptides is under control of neuronal activity, raising the possibility that similar mechanisms in the hypoactive prefrontal cortex of schizophrenics may explain the abnormalities in GAD and in GABAA receptor regulation. In the present study, which is the first of its type on human cerebral cortex, levels of mRNAs for six GABAA receptor subunits (alpha 1, alpha 2, alpha 5, beta 1, beta 2, gamma 2) and their laminar expression patterns were analyzed in the prefrontal cortex of schizophrenics and matched controls, using in situ hybridization histochemistry and densitometry. Three types of laminar expression pattern were observed: mRNAs for the alpha 1, beta 2, and gamma 2 subunits, which are the predominant receptor subunits expressed in the mature cortex, were expressed at comparatively high levels by cells of all six cortical layers, but most intensely by cells in lower layer III and layer IV. mRNAs for the alpha 2, alpha 5, and beta 1 subunits were expressed at lower levels; alpha 2 and beta 1 were expressed predominantly by cells in layers II, III, and IV; alpha 5 was expressed predominantly in layers IV, V, and VI. There were no significant changes in overall mRNA levels for any of the receptor subunits in the prefrontal cortex of schizophrenics, and the laminar expression pattern of all six receptor subunit mRNAs did not differ between schizophrenics and controls. Because gene expression for GABAA receptor subunits is not consistently altered in the prefrontal cortex of schizophrenics, the previously reported upregulation of muscimol binding sites and downregulation of benzodiazepine binding sites in the prefrontal and adjacent cingulate cortex of schizophrenics are possibly due to posttranscriptional modifications of mRNAs and their translated polypeptides.

Casein expression in cytotoxic T lymphocytes.

PubMed Central

Grusby, M J; Mitchell, S C; Nabavi, N; Glimcher, L H

1990-01-01

A cDNA that expresses a mRNA restricted to cytotoxic T lymphocytes (CTL) and mammary tissue has been isolated and characterized. The deduced amino acid sequence from this cDNA shows extensive homology with the previously reported amino acid sequence for rat alpha-casein. Indeed, the presence of a six-residue-repeated motif that is specific for rodent alpha-caseins strongly supports the identification of this cDNA as mouse alpha-casein. Northern (RNA) blot analysis of many hematopoietic cell types revealed that this gene is restricted to CTL, being expressed in four of six CTL lines examined. Furthermore, CTL that express this gene were also found to express other members of the casein gene family, such as beta- and kappa-casein. These results suggest that caseins may be important in CTL function, and their potential role in CTL-mediated lysis is discussed. Images PMID:2395885

Maple syrup urine disease: The E1{beta} gene of human branched-chain {alpha}-ketoacid dehydrogenase complex has 11 rather than 10 exons, and the 3{prime} UTR in one of the two E1{beta} mRNAs arises from intronic sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chuang, J.L.; Chuang, D.T.; Cox, R.P.

1996-06-01

Maple syrup urine disease (MSUD) or branched-chain ketoaciduria is caused by a deficiency in the mitochondrial branched-chain {alpha}-ketoacid dehydrogenase (BCKAD) complex. The clinical manifestations are characterized by accumulation of branched chain amino and {alpha}-ketoacids, which leads to severe cerebral edema with seizures, ketoacidosis, and mental retardation. The BCKAD complex comprises three catalytic components, i.e., a decarboxylase (E1) consisting of two E1{alpha} (M{sub r} = 46,000) and two E1{Beta} (M{sub r} = 37,500) subunits, a transacylase (E2) that contains 24 lipoic acid-bearing subunits, and a dehydrogenase (E3), which is a homodimeric flavoprotein. MSUD is genetically heterogeneous, since mutations in the E1{alpha}more » subunit (type IA MSUD), the E1{Beta} subunit (type IB), the E2 subunit (type II) and the E3 subunit (type III) have been described. The functional consequences of certain mutations in the BCKAD complex have been studied. 23 refs., 3 figs.« less

Reverse-phase HPLC analysis of human alpha crystallin.

PubMed

Swamy, M S; Abraham, E C

1991-03-01

A rapid and highly sensitive reverse-phase HPLC (RP-HPLC) method was used to separate crystallin subunits from human alpha crystallin. Three distinct peaks were separated; by electrophoretic and immunological analyses the first and second peaks were identified as alpha B and alpha A respectively. On the other hand, peak 3 appeared to be a modified form of alpha crystallin. The ratio of alpha A and alpha B proteins was 3:1 in 1 day old lenses which gradually changed to 2:1 in 17 year old lenses and to 1:1 in the 50 and 82 year old whole lenses and 82 year old lens cortex, with a concomitant increase in the modified alpha, suggesting that alpha A subunits are relatively more involved in aggregation. Analysis of the 82 year old lens nucleus also supported this conclusion. The RP-HPLC analysis of the HMW aggregate fraction showed substantial enrichment of the modified alpha. The alpha A and alpha B subunits independently reassociated to form polymeric alpha crystallin whereas the modified alpha reassociated to form HMW aggregates as shown by molecular sieve HPLC. Hence it appears that the HMW aggregate peak was constituted by modified alpha crystallin. Only in the peak 3 material the 280 nm absorbance was about 2-fold higher than what was expected from the actual protein content. The data suggest that the changes induced by post-translational modifications may have some role in the formation of modified alpha. The present RP-HPLC method is useful in separating these modified alpha from the unmodified alpha A and alpha B subunits.

Further studies on the quaternary structure of yeast casein kinase II.

PubMed

Szyszka, R; Lopaczyński, W; Gałasiński, W; Grankowski, N; Gasior, E

1986-01-01

Casein kinase type II were isolated by the same procedure, from rat liver, human placenta, Querin carcinoma and yeast, and characterized. The mammalian enzymes were composed of three subunits alpha, alpha' and beta, whereas yeast kinase was composed of two subunits alpha and alpha'. It was shown that the catalytic activity, substrate and phosphate donor specificity, sensitivity to heparin and spermine were the same for all the kinases tested. The results give additional support to the suggestion [1] that the beta subunit is not required for optimal activity and specificity of yeast casein kinase II. The quaternary structure of the yeast enzyme of a molecular weight of approximately 150 000 is proposed as alpha2 alpha'2.

Calmodulin-dependent gating of Ca(v)1.2 calcium channels in the absence of Ca(v)beta subunits.

PubMed

Ravindran, Arippa; Lao, Qi Zong; Harry, Jo Beth; Abrahimi, Parwiz; Kobrinsky, Evgeny; Soldatov, Nikolai M

2008-06-10

It is generally accepted that to generate calcium currents in response to depolarization, Ca(v)1.2 calcium channels require association of the pore-forming alpha(1C) subunit with accessory Ca(v)beta and alpha(2)delta subunits. A single calmodulin (CaM) molecule is tethered to the C-terminal alpha(1C)-LA/IQ region and mediates Ca2+-dependent inactivation of the channel. Ca(v)beta subunits are stably associated with the alpha(1C)-interaction domain site of the cytoplasmic linker between internal repeats I and II and also interact dynamically, in a Ca2+-dependent manner, with the alpha(1C)-IQ region. Here, we describe a surprising discovery that coexpression of exogenous CaM (CaM(ex)) with alpha(1C)/alpha(2)delta in COS1 cells in the absence of Ca(v)beta subunits stimulates the plasma membrane targeting of alpha(1C), facilitates calcium channel gating, and supports Ca2+-dependent inactivation. Neither real-time PCR with primers complementary to monkey Ca(v)beta subunits nor coimmunoprecipitation analysis with exogenous alpha(1C) revealed an induction of endogenous Ca(v)beta subunits that could be linked to the effect of CaM(ex). Coexpression of a calcium-insensitive CaM mutant CaM(1234) also facilitated gating of Ca(v)beta-free Ca(v)1.2 channels but did not support Ca2+-dependent inactivation. Our results show there is a functional matchup between CaM(ex) and Ca(v)beta subunits that, in the absence of Ca(v)beta, renders Ca2+ channel gating facilitated by CaM molecules other than the one tethered to LA/IQ to support Ca2+-dependent inactivation. Thus, coexpression of CaM(ex) creates conditions when the channel gating, voltage- and Ca2+-dependent inactivation, and plasma-membrane targeting occur in the absence of Ca(v)beta. We suggest that CaM(ex) affects specific Ca(v)beta-free conformations of the channel that are not available to endogenous CaM.

Complete primary structure of rainbow trout type I collagen consisting of alpha1(I)alpha2(I)alpha3(I) heterotrimers.

PubMed

Saito, M; Takenouchi, Y; Kunisaki, N; Kimura, S

2001-05-01

The subunit compositions of skin and muscle type I collagens from rainbow trout were found to be alpha1(I)alpha2(I)alpha3(I) and [alpha1(I)](2)alpha2(I), respectively. The occurrence of alpha3(I) has been observed only for bonyfish. The skin collagen exhibited more susceptibility to both heat denaturation and MMP-13 digestion than the muscle counterpart; the former had a lower denaturation temperature by about 0.5 degrees C than the latter. The lower stability of skin collagen, however, is not due to the low levels of imino acids because the contents of Pro and Hyp were almost constant in both collagens. On the other hand, some cDNAs coding for the N-terminal and/or a part of triple-helical domains of proalpha(I) chains were cloned from the cDNA library of rainbow trout fibroblasts. These cDNAs together with the previously cloned collagen cDNAs gave information about the complete primary structure of type I procollagen. The main triple-helical domain of each proalpha(I) chain had 338 uninterrupted Gly-X-Y triplets consisting of 1014 amino acids and was unique in its high content of Gly-Gly doublets. In particular, the bonyfish-specific alpha(I) chain, proalpha3(I) was characterized by the small number of Gly-Pro-Pro triplets, 19, and the large number of Gly-Gly doublets, 38, in the triple-helical domain, compared to 23 and 22, respectively, for proalpha1(I). The small number of Gly-Pro-Pro and the large number of Gly-Gly in proalpha3(I) was assumed to partially loosen the triple-helical structure of skin collagen, leading to the lower stability of skin collagen mentioned above. Finally, phylogenetic analyses revealed that proalpha3(I) had diverged from proalpha1(I). This study is the first report of the complete primary structure of fish type I procollagen.

The alpha subunit of Go modulates cell proliferation and differentiation through interactions with Necdin.

PubMed

Ju, Hyunhee; Lee, Sujin; Kang, Sunghak; Kim, Sung-Soo; Ghil, Sungho

2014-07-10

Heterotrimeric GTP-binding proteins (G-proteins) play an important role in mediating signal transduction generated by neurotransmitters or hormones. Go, a member of the Gi/Go subfamily, is the most abundant G-protein found in the brain. Recently, the alpha subunit of Go (Gαo) was characterized as an inducer of neuronal differentiation. However, its underlying molecular mechanisms have remained unclear to date, since the downstream effectors of Gαo are ambiguous. A neurally differentiated embryonal carcinoma-derived protein (Necdin) was isolated as an interacting partner for Gαo from a mouse brain cDNA library using yeast two-hybrid screening. Interactions between the proteins were confirmed with several affinity binding assays, both in vitro and in vivo. Necdin interacted directly and preferentially with activated Gαo, compared to wild-type protein. Interestingly, Gαo did not interact with Gαi, despite high sequence homology between the two proteins. We subsequently analyzed whether Gαo modulates the cellular activities of Necdin. Notably, expression of Gαo significantly augmented Necdin-mediated cellular responses, such as proliferation and differentiation. Moreover, activation of type 1 cannabinoid receptor (CB1R), a Gi/oα-coupled receptor, augmented cell growth suppression, which was mediated by Gαo and Necdin in U87MG cells containing CB1R, Gαo, and Necdin as normal components. These results collectively suggest that Necdin is a candidate downstream effector for Gαo. Our findings provide novel insights into the cellular roles of Gαo and its coupled receptor.

Did Androgen-Binding Protein Paralogs Undergo Neo- and/or Subfunctionalization as the Abp Gene Region Expanded in the Mouse Genome?

PubMed Central

Karn, Robert C.; Chung, Amanda G.; Laukaitis, Christina M.

2014-01-01

The Androgen-binding protein (Abp) region of the mouse genome contains 30 Abpa genes encoding alpha subunits and 34 Abpbg genes encoding betagamma subunits, their products forming dimers composed of an alpha and a betagamma subunit. We endeavored to determine how many Abp genes are expressed as proteins in tears and saliva, and as transcripts in the exocrine glands producing them. Using standard PCR, we amplified Abp transcripts from cDNA libraries of C57BL/6 mice and found fifteen Abp gene transcripts in the lacrimal gland and five in the submandibular gland. Proteomic analyses identified proteins corresponding to eleven of the lacrimal gland transcripts, all of them different from the three salivary ABPs reported previously. Our qPCR results showed that five of the six transcripts that lacked corresponding proteins are expressed at very low levels compared to those transcripts with proteins. We found 1) no overlap in the repertoires of expressed Abp paralogs in lacrimal gland/tears and salivary glands/saliva; 2) substantial sex-limited expression of lacrimal gland/tear expressed-paralogs in males but no sex-limited expression in females; and 3) that the lacrimal gland/tear expressed-paralogs are found exclusively in ancestral clades 1, 2 and 3 of the five clades described previously while the salivary glands/saliva expressed-paralogs are found only in clade 5. The number of instances of extremely low levels of transcription without corresponding protein production in paralogs specific to tears and saliva suggested the role of subfunctionalization, a derived condition wherein genes that may have been expressed highly in both glands ancestrally were down-regulated subsequent to duplication. Thus, evidence for subfunctionalization can be seen in our data and we argue that the partitioning of paralog expression between lacrimal and salivary glands that we report here occurred as the result of adaptive evolution. PMID:25531410

Did androgen-binding protein paralogs undergo neo- and/or Subfunctionalization as the Abp gene region expanded in the mouse genome?

PubMed

Karn, Robert C; Chung, Amanda G; Laukaitis, Christina M

2014-01-01

The Androgen-binding protein (Abp) region of the mouse genome contains 30 Abpa genes encoding alpha subunits and 34 Abpbg genes encoding betagamma subunits, their products forming dimers composed of an alpha and a betagamma subunit. We endeavored to determine how many Abp genes are expressed as proteins in tears and saliva, and as transcripts in the exocrine glands producing them. Using standard PCR, we amplified Abp transcripts from cDNA libraries of C57BL/6 mice and found fifteen Abp gene transcripts in the lacrimal gland and five in the submandibular gland. Proteomic analyses identified proteins corresponding to eleven of the lacrimal gland transcripts, all of them different from the three salivary ABPs reported previously. Our qPCR results showed that five of the six transcripts that lacked corresponding proteins are expressed at very low levels compared to those transcripts with proteins. We found 1) no overlap in the repertoires of expressed Abp paralogs in lacrimal gland/tears and salivary glands/saliva; 2) substantial sex-limited expression of lacrimal gland/tear expressed-paralogs in males but no sex-limited expression in females; and 3) that the lacrimal gland/tear expressed-paralogs are found exclusively in ancestral clades 1, 2 and 3 of the five clades described previously while the salivary glands/saliva expressed-paralogs are found only in clade 5. The number of instances of extremely low levels of transcription without corresponding protein production in paralogs specific to tears and saliva suggested the role of subfunctionalization, a derived condition wherein genes that may have been expressed highly in both glands ancestrally were down-regulated subsequent to duplication. Thus, evidence for subfunctionalization can be seen in our data and we argue that the partitioning of paralog expression between lacrimal and salivary glands that we report here occurred as the result of adaptive evolution.

Atomic force microscopy of ionotropic receptors bearing subunit-specific tags provides a method for determining receptor architecture

NASA Astrophysics Data System (ADS)

Neish, Calum S.; Martin, Ian L.; Davies, Martin; Henderson, Robert M.; Edwardson, J. Michael

2003-08-01

We have developed an atomic force microscopy (AFM)-based method for the determination of the subunit architecture of ionotropic receptors, and tested the method using the GABAA receptor as a model system. The most common form of the GABAA receptor probably consists of 2alpha1-, 2beta2- and 1gamma2-subunits. We show here that the arrangement of subunits around the central Cl- ion channel can be deduced by AFM of receptors tagged with subunit-specific antibodies. Transfection of cells with DNA encoding alpha1-, beta2- and gamma2-subunits resulted in the production of receptors containing all three subunits, as judged by both immunoblot analysis and the binding of [3H]-Ro15-1788, a specific radioligand for the GABAA receptor. A His6-tag on the alpha1-subunit was used to purify the receptor from membrane fractions of transfected cells. After incubation with anti-His6 immunoglobulin G, some receptors became tagged with either one or two antibody molecules. AFM analysis of complexes containing two bound antibodies showed that the most common angle between the two tags was 135°, close to the value of 144° expected if the two alpha-subunits are separated by a third subunit. This method is applicable to the complete elucidation of the subunit arrangement around the GABAA receptor rosette, and can also be applied to other ionotropic receptors.

The H,K-ATPase beta-subunit can act as a surrogate for the beta-subunit of Na,K-pumps.

PubMed

Horisberger, J D; Jaunin, P; Reuben, M A; Lasater, L S; Chow, D C; Forte, J G; Sachs, G; Rossier, B C; Geering, K

1991-10-15

Na,K-ATPase and H,K-ATPase are the only members of the P-type ATPases in which a glycosylated beta-subunit is part of the purified active enzyme. In this study, we have followed the synthesis and the posttranslational processing of the beta-subunit of H,K-ATPase (beta HK) in Xenopus oocytes injected with beta HK cRNA and have tested whether it can act as a surrogate for the beta-subunit of Na,K-ATPase (beta NaK) to support the functional expression of Na,K-pumps. In Xenopus oocytes, beta HK is processed from an Endo H-sensitive 51-kDa coreglycosylated form to an Endo H-resistant 71-kDa fully glycosylated form. Similar to beta NaK, beta HK can stabilize and increase the trypsin resistance of alpha-subunits of Na,K-ATPase (alpha NaK). Finally, expression of beta HK together with alpha NaK leads to an increased number of ouabain binding sites at the plasma membrane accompanied by an increased Rb+ uptake and Na,K-pump current. Our data suggest that beta HK, similar to beta NaK, can assemble to alpha NaK, support the structural maturation and the intracellular transport of catalytic alpha NaK, and ultimately form active alpha NaK-beta HK complexes with Na,K-pump transport properties.

A Novel Di-Leucine Motif at the N-Terminus of Human Organic Solute Transporter Beta Is Essential for Protein Association and Membrane Localization.

PubMed

Xu, Shuhua; Soroka, Carol J; Sun, An-Qiang; Backos, Donald S; Mennone, Albert; Suchy, Frederick J; Boyer, James L

2016-01-01

The heteromeric membrane protein Organic Solute Transporter alpha/beta is the major bile acid efflux transporter in the intestine. Physical association of its alpha and beta subunits is essential for their polarized basolateral membrane localization and function in the transport of bile acids and other organic solutes. We identified a highly conserved acidic dileucine motif (-EL20L21EE) at the extracellular amino-tail of organic solute transporter beta from multiple species. To characterize the role of this protein interacting domain in the association of the human beta and alpha subunits and in membrane localization of the transporter, Leu20 and Leu21 on the amino-tail of human organic solute transporter beta were replaced with alanines by site-directed mutagenesis. Co-immunoprecipitation study in HEK293 cells demonstrated that substitution of the leucine residues with alanines prevented the interaction of the human beta mutant with the alpha subunit. Membrane biotinylation demonstrated that the LL/AA mutant eliminated membrane expression of both subunits. Computational-based modelling of human organic solute transporter beta suggested that the LL/AA mutation substantially alters both the structure and lipophilicity of the surface, thereby not only affecting the interaction with the alpha subunit but also possibly impacting the capacity of the beta subunit to traffick through the cell and interact with the membrane. In summary, our findings indicate that the dileucine motif in the extracellular N-terminal region of human organic solute transporter beta subunit plays a critical role in the association with the alpha subunit and in its polarized plasma membrane localization.

Hantaan virus nucleocapsid protein binds to importin alpha proteins and inhibits tumor necrosis factor alpha-induced activation of nuclear factor kappa B.

PubMed

Taylor, Shannon L; Frias-Staheli, Natalia; García-Sastre, Adolfo; Schmaljohn, Connie S

2009-02-01

Hantaviruses such as Hantaan virus (HTNV) and Andes virus cause two human diseases, hemorrhagic fever with renal syndrome and hantavirus pulmonary syndrome, respectively. For both, disease pathogenesis is thought to be immunologically mediated and there have been numerous reports of patients with elevated levels of proinflammatory and inflammatory cytokines, including tumor necrosis factor alpha (TNF-alpha), in their sera. Multiple viruses have developed evasion strategies to circumvent the host cell inflammatory process, with one of the most prevalent being the disruption of nuclear factor kappa B (NF-kappaB) activation. We hypothesized that hantaviruses might also moderate host inflammation by interfering with this pathway. We report here that the nucleocapsid (N) protein of HTNV was able to inhibit TNF-alpha-induced activation of NF-kappaB, as measured by a reporter assay, and the activation of endogenous p65, an NF-kappaB subunit. Surprisingly, there was no defect in the degradation of the inhibitor of NF-kappaB (IkappaB) protein, nor was there any alteration in the level of p65 expression in HTNV N-expressing cells. However, immunofluorescence antibody staining demonstrated that cells expressing HTNV N protein and a green fluorescent protein-p65 fusion had limited p65 nuclear translocation. Furthermore, we were able to detect an interaction between HTNV N protein and importin alpha, a nuclear import molecule responsible for shuttling NF-kappaB to the nucleus. Collectively, our data suggest that HTNV N protein can sequester NF-kappaB in the cytoplasm, thus inhibiting NF-kappaB activity. These findings, which were obtained using cells transfected with cDNA representing the HTNV N gene, were confirmed using HTNV-infected cells.

PKA modulation of Kv4.2-encoded A-type potassium channels requires formation of a supramolecular complex.

PubMed

Schrader, Laura A; Anderson, Anne E; Mayne, Amber; Pfaffinger, Paul J; Sweatt, John David

2002-12-01

A-type channels, encoded by the pore-forming alpha-subunits of the Kv4.x family, are particularly important in regulating membrane excitability in the CNS and the heart. Given the key role of modulation of A currents by kinases, we sought to investigate the protein structure-function relationships underlying the regulation of these currents by PKA. We have previously shown the existence of two PKA phosphorylation sites in the Kv4.2 sequence; therefore, we focused this study on the Kv4.2 primary subunit. In the present studies we made the surprising finding that PKA phosphorylation of the Kv4.2 alpha-subunit is necessary but not sufficient for channel modulation; channel modulation by PKA required the presence of an ancillary subunit, the K+ channel interacting protein (KChIP3). Therefore, these findings indicate a surprising complexity to kinase regulation of A currents, in that an interaction of two separate molecular events, alpha-subunit phosphorylation and the association of an ancillary subunit (KChIP3), are necessary for phosphorylation-dependent regulation of Kv4.2-encoded A channels by PKA. Overall, our studies indicate that PKA must of necessity act on a supramolecular complex of pore-forming alpha-subunits plus ancillary subunits to alter channel properties.

Multi site polyadenylation and transcriptional response to stress of a vacuolar type H+-ATPase subunit A gene in Arabidopsis thaliana

PubMed Central

Magnotta, Scot M; Gogarten, Johann Peter

2002-01-01

Background Vacuolar type H+-ATPases play a critical role in the maintenance of vacuolar homeostasis in plant cells. V-ATPases are also involved in plants' defense against environmental stress. This research examined the expression and regulation of the catalytic subunit of the vacuolar type H+-ATPase in Arabidopsis thaliana and the effect of environmental stress on multiple transcripts generated by this gene. Results Evidence suggests that subunit A of the vacuolar type H+-ATPase is encoded by a single gene in Arabidopsis thaliana. Genome blot analysis showed no indication of a second subunit A gene being present. The single gene identified was shown by whole RNA blot analysis to be transcribed in all organs of the plant. Subunit A was shown by sequencing the 3' end of multiple cDNA clones to exhibit multi site polyadenylation. Four different poly (A) tail attachment sites were revealed. Experiments were performed to determine the response of transcript levels for subunit A to environmental stress. A PCR based strategy was devised to amplify the four different transcripts from the subunit A gene. Conclusions Amplification of cDNA generated from seedlings exposed to cold, salt stress, and etiolation showed that transcript levels for subunit A of the vacuolar type H+-ATPase in Arabidopsis were responsive to stress conditions. Cold and salt stress resulted in a 2–4 fold increase in all four subunit A transcripts evaluated. Etiolation resulted in a slight increase in transcript levels. All four transcripts appeared to behave identically with respect to stress conditions tested with no significant differential regulation. PMID:11985780

Inactivation properties of voltage-gated K+ channels altered by presence of beta-subunit.

PubMed

Rettig, J; Heinemann, S H; Wunder, F; Lorra, C; Parcej, D N; Dolly, J O; Pongs, O

1994-05-26

Structural and functional diversity of voltage-gated Kv1-type potassium channels in rat brain is enhanced by the association of two different types of subunits, the membrane-bound, poreforming alpha-subunits and a peripheral beta-subunit. We have cloned a beta-subunit (Kv beta 1) that is specifically expressed in the rat nervous system. Association of Kv beta 1 with alpha-subunits confers rapid A-type inactivation on non-inactivating Kv1 channels (delayed rectifiers) in expression systems in vitro. This effect is mediated by an inactivating ball domain in the Kv beta 1 amino terminus.

The sodium pump alpha1 subunit as a potential target to combat apoptosis-resistant glioblastomas.

PubMed

Lefranc, Florence; Kiss, Robert

2008-03-01

To review the involvement of the ion transporter Na+/K+-ATPase (NaK) in the migration and proliferation of glioma cells. Preliminary studies indicate that NaK alpha1 subunits seem to be upregulated in a proportion of glioblastomas but not in normal brain tissues. The present review focuses on (1) the natural resistance of migrating malignant glioma cells to apoptosis, (2) autophagic cell death as an alternative to combat malignant gliomas, (3) the fact that reducing the levels of malignant glioma cell motility can restore proapoptotic drug sensitivity,and (4) on the observation that inhibiting the NaK activity reduces both glioma cell proliferation and migration. The natural ligands of the NaK are the cardiotonic steroids. A hemisynthetic derivative of 2"-oxovoruscharin (UNBS1450), a novel cardenolide, displays unique structural features, making its binding affinity to NaK alpha subunits (including alpha1) 10 to 100 times higher than that of other cardenolides. UNBS1450 markedly decreases intracellular ATP concentration in glioma cells, disorganizes the actin cytoskeleton, and leads to autophagic cell death in NaK alpha1 over-expressing glioma cells. Glioblastoma patients who do not respond to chemotherapy and whose tumors over-express NaK alpha1 subunits could benefit from a treatment using ligands with marked binding affinity for the NaK alpha1 subunit.

Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

PubMed

Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

2000-05-31

cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

Synthetic. cap alpha. subunit peptide 125-147 of human nicotinic acetylcholine receptor induces antibodies to native receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCormick, D.J.; Griesmann, G.E.; Huang, Z.

1986-03-05

A synthetic peptide corresponding to residues 125-147 of the Torpedo acetylcholine receptor (AChR) ..cap alpha.. subunit proved to be a major antigenic region of the AChR. Rats inoculated with 50 ..mu..g of peptide (T ..cap alpha.. 125-147) developed T cell immunity and antibodies to native AChR and signs of experimental autoimmune myasthenia gravis. They report the synthesis and preliminary testing of a disulfide-looped peptide comprising residues 125-147 of the human AChR ..cap alpha.. subunit. Peptide H ..cap alpha.. 125-147 differs from T ..cap alpha.. 125-147 at residues 139 (Glu for Gln) and 143 (Ser for Thr). In immunoprecipitation assays, antibodiesmore » to Torpedo AChR bound /sup 125/I-labelled H..cap alpha.. 125-147 antibody bound H..cap alpha.. 125-147, but monoclonal antibodies to an immunodominant region of native AChR bound neither H..cap alpha.. 125-147 nor T ..cap alpha.. 125-147. Rats immunized with H ..cap alpha.. 125-147 produced anti-mammalian muscle AChR antibodies that induced modulation of AChRs from cultured human myotubes. Thus, region 125-147 of the human AChR ..cap alpha.. subunit is extracellular in muscle, and is both antigenic and immunogenic. It remains to be determined whether or not autoantibodies to this region may in part cause the weakness or myasthenia gravis in man.« less

Neuroblastoma differentiation involves the expression of two isoforms of the alpha-subunit of Go.

PubMed

Brabet, P; Pantaloni, C; Rodriguez, M; Martinez, J; Bockaert, J; Homburger, V

1990-04-01

The regulation of GTP-binding proteins (G proteins) was examined during the course of differentiation of neuroblastoma N1E-115 cells. N1E-115 cell membranes possess three Bordetella pertussis toxin (PTX) substrates assigned to alpha-subunits (G alpha) of Go (a G protein of unknown function) and "Gi (a G protein inhibitory to adenylate cyclase)-like" proteins and one substrate of Vibrio cholerae toxin corresponding to an alpha-subunit of Gs (a G protein stimulatory to adenylate cyclase). In undifferentiated cells, only one form of Go alpha was found, having a pI of 5.8 Go alpha content increased by approximately twofold from the undifferentiated state to 96 h of cell differentiation. This is mainly due to the appearance of another Go alpha form having a pI of 5.55. Both Go alpha isoforms have similar sizes on sodium dodecyl sulfate-polyacrylamide gels, are recognized by polyclonal antibodies to bovine brain Go alpha, are ADP-ribosylated by PTX, and are covalently myristylated in whole N1E-115 cells. In addition, immunofluorescent staining of N1E-115 cells with Go alpha antibodies revealed that association of Go alpha with the plasma membrane appears to coincide with the expression of the most acidic isoform and morphological cell differentiation. In contrast, the levels of both Gi alpha and Gs alpha did not significantly change, whereas that of the common beta-subunit increased by approximately 30% over the same period. These results demonstrate specific regulation of the expression of Go alpha during neuronal differentiation.

Chaperones of F[subscript 1]-ATPase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ludlam, Anthony; Brunzelle, Joseph; Pribyl, Thomas

2009-09-25

Mitochondrial F{sub 1}-ATPase contains a hexamer of alternating {alpha} and {beta} subunits. The assembly of this structure requires two specialized chaperones, Atp11p and Atp12p, that bind transiently to {beta} and {alpha}. In the absence of Atp11p and Atp12p, the hexamer is not formed, and {alpha} and {beta} precipitate as large insoluble aggregates. An early model for the mechanism of chaperone-mediated F{sub 1} assembly (Wang, Z. G., Sheluho, D., Gatti, D. L., and Ackerman, S. H. (2000) EMBO J. 19, 1486--1493) hypothesized that the chaperones themselves look very much like the {alpha} and {beta} subunits, and proposed an exchange of Atp11pmore » for {alpha} and of Atp12p for {beta}; the driving force for the exchange was expected to be a higher affinity of {alpha} and {beta} for each other than for the respective chaperone partners. One important feature of this model was the prediction that as long as Atp11p is bound to {beta} and Atp12p is bound to {alpha}, the two F{sub 1} subunits cannot interact at either the catalytic site or the noncatalytic site interface. Here we present the structures of Atp11p from Candida glabrata and Atp12p from Paracoccus denitrificans, and we show that some features of the Wang model are correct, namely that binding of the chaperones to {alpha} and {beta} prevents further interactions between these F1 subunits. However, Atp11p and Atp12p do not resemble {alpha} or {beta}, and it is instead the F{sub 1} {gamma} subunit that initiates the release of the chaperones from {alpha} and {beta} and their further assembly into the mature complex.« less

A cross-linking study of the Ca2+, Mg2+-activated adenosine triphosphatase of Escherichia coli.

PubMed

Bragg, P D; Hou, C

1980-05-01

The solubilized Ca2+,Mg2+-activated adenosine triphosphatase of Escherichia coli is composed of five subunits designated alpha, beta, gamma, delta and epsilon in order of decreasing molecular weight. The subunit structure of the enzyme has been investigated by the use of the cleavable cross-linking agents dithiobis(succinimidyl propionate), methyl-4-mercaptobutyrimidate, dimethyl-3,3'-dithiobispropionimidate, disuccinimidyl tartarate, and cupric 1,10-phenanthrolinate. The products of cross-linking were analyzed by two different two-dimensional gel electrophoresis systems. The following cross-linked subunit dimers were observed: alpha 2, beta 2, alpha beta, alpha delta, beta gamma, beta delta, beta epsilon and gamma epsilon. These results, together with other published data, are discussed in relation to a model of the arrangement of the subunits in the ATPase molecule.

Hydrogen bonds between the alpha and beta subunits of the F1-ATPase allow communication between the catalytic site and the interface of the beta catch loop and the gamma subunit.

PubMed

Boltz, Kathryn W; Frasch, Wayne D

2006-09-19

F(1)-ATPase mutations in Escherichia coli that changed the strength of hydrogen bonds between the alpha and beta subunits in a location that links the catalytic site to the interface between the beta catch loop and the gamma subunit were examined. Loss of the ability to form the hydrogen bonds involving alphaS337, betaD301, and alphaD335 lowered the k(cat) of ATPase and decreased its susceptibility to Mg(2+)-ADP-AlF(n) inhibition, while mutations that maintain or strengthen these bonds increased the susceptibility to Mg(2+)-ADP-AlF(n) inhibition and lowered the k(cat) of ATPase. These data suggest that hydrogen bonds connecting alphaS337 to betaD301 and betaR323 and connecting alphaD335 to alphaS337 are important to transition state stabilization and catalytic function that may result from the proper alignment of catalytic site residues betaR182 and alphaR376 through the VISIT sequence (alpha344-348). Mutations betaD301E, betaR323K, and alphaR282Q changed the rate-limiting step of the reaction as determined by an isokinetic plot. Hydrophobic mutations of betaR323 decreased the susceptibility to Mg(2+)-ADP-AlF(n)() inhibition and lowered the number of interactions required in the rate-limiting step yet did not affect the k(cat) of ATPase, suggesting that betaR323 is important to transition state formation. The decreased rate of ATP synthase-dependent growth and decreased level of lactate-dependent quenching observed with alphaD335, betaD301, and alphaE283 mutations suggest that these residues may be important to the formation of an alternative set of hydrogen bonds at the interface of the alpha and beta subunits that permits the release of intersubunit bonds upon the binding of ATP, allowing gamma rotation in the escapement mechanism.

Geranyl diphosphate synthase large subunit, and methods of use

DOEpatents

Croteau, Rodney B.; Burke, Charles C.; Wildung, Mark R.

2001-10-16

A cDNA encoding geranyl diphosphate synthase large subunit from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase large subunit). In another aspect, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase large subunit. In yet another aspect, the present invention provides isolated, recombinant geranyl diphosphate synthase protein comprising an isolated, recombinant geranyl diphosphate synthase large subunit protein and an isolated, recombinant geranyl diphosphate synthase small subunit protein. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase.

Complementary DNA sequences encoding the multimammate rat MHC class II DQ alpha and beta chains and cross-species sequence comparison in rodents.

PubMed

de Bellocq, J Goüy; Leirs, H

2009-09-01

Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.

Computer modeling of siRNA knockdown effects indicates an essential role of the Ca2+ channel alpha2delta-1 subunit in cardiac excitation-contraction coupling.

PubMed

Tuluc, Petronel; Kern, Georg; Obermair, Gerald J; Flucher, Bernhard E

2007-06-26

L-type Ca(2+) currents determine the shape of cardiac action potentials (AP) and the magnitude of the myoplasmic Ca(2+) signal, which regulates the contraction force. The auxiliary Ca(2+) channel subunits alpha(2)delta-1 and beta(2) are important regulators of membrane expression and current properties of the cardiac Ca(2+) channel (Ca(V)1.2). However, their role in cardiac excitation-contraction coupling is still elusive. Here we addressed this question by combining siRNA knockdown of the alpha(2)delta-1 subunit in a muscle expression system with simulation of APs and Ca(2+) transients by using a quantitative computer model of ventricular myocytes. Reconstitution of dysgenic muscle cells with Ca(V)1.2 (GFP-alpha(1C)) recapitulates key properties of cardiac excitation-contraction coupling. Concomitant depletion of the alpha(2)delta-1 subunit did not perturb membrane expression or targeting of the pore-forming GFP-alpha(1C) subunit into junctions between the outer membrane and the sarcoplasmic reticulum. However, alpha(2)delta-1 depletion shifted the voltage dependence of Ca(2+) current activation by 9 mV to more positive potentials, and it slowed down activation and inactivation kinetics approximately 2-fold. Computer modeling revealed that the altered voltage dependence and current kinetics exert opposing effects on the function of ventricular myocytes that in total cause a 60% prolongation of the AP and a 2-fold increase of the myoplasmic Ca(2+) concentration during each contraction. Thus, the Ca(2+) channel alpha(2)delta-1 subunit is not essential for normal Ca(2+) channel targeting in muscle but is a key determinant of normal excitation and contraction of cardiac muscle cells, and a reduction of alpha(2)delta-1 function is predicted to severely perturb normal heart function.

Combining suppressive subtractive hybridization and cDNA microarrays to identify dietary phosphorus-responsive genes of the rainbow trout (Oncorhynchus mykiss) kidney.

PubMed

Lake, Jennifer; Gravel, Catherine; Koko, Gabriel Koffi D; Robert, Claude; Vandenberg, Grant W

2010-03-01

Phosphorus (P)-responsive genes and how they regulate renal adaptation to phosphorous-deficient diets in animals, including fish, are not well understood. RNA abundance profiling using cDNA microarrays is an efficient approach to study nutrient-gene interactions and identify these dietary P-responsive genes. To test the hypothesis that dietary P-responsive genes are differentially expressed in fish fed varying P levels, rainbow trout were fed a practical high-P diet (R20: 0.96% P) or a low-P diet (R0: 0.38% P) for 7 weeks. The differentially-expressed genes between dietary groups were identified and compared from the kidney by combining suppressive subtractive hybridization (SSH) with cDNA microarray analysis. A number of genes were confirmed by real-time PCR, and correlated with plasma and bone P concentrations. Approximately 54 genes were identified as potential dietary P-responsive after 7 weeks on a diet deficient in P according to cDNA microarray analysis. Of 18 selected genes, 13 genes were confirmed to be P-responsive at 7 weeks by real-time PCR analysis, including: iNOS, cytochrome b, cytochrome c oxidase subunit II , alpha-globin I, beta-globin, ATP synthase, hyperosmotic protein 21, COL1A3, Nkef, NDPK, glucose phosphate isomerase 1, Na+/H+ exchange protein and GDP dissociation inhibitor 2. Many of these dietary P-responsive genes responded in a moderate way (R0/R20 ratio: <2-3 or >0.5) and in a transient manner to dietary P limitation. In summary, renal adaptation to dietary P deficiency in trout involves changes in the expression of several genes, suggesting a profile of metabolic stress, since many of these differentially-expressed candidates are associated with the cellular adaptative responses. Crown Copyright 2009. Published by Elsevier Inc. All rights reserved.

Transcriptional regulation of human retinoic acid receptor-alpha (RAR-{alpha}) by Wilms` tumour gene product

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goodyer, P.R.; Torban, E.; Dehbi, M.

1994-09-01

The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-lengthmore » WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.« less

Some properties and cDNA cloning of proteinaceous toxins from two species of lionfish (Pterois antennata and Pterois volitans).

PubMed

Kiriake, Aya; Shiomi, Kazuo

2011-11-01

Lionfish, members of the genera Pterois, Parapterois and Dendrochirus, are well known to be venomous, having venomous glandular tissues in dorsal, pelvic and anal spines. The lionfish toxins have been shown to cross-react with the stonefish toxins by neutralization tests using the commercial stonefish antivenom, although their chemical properties including structures have been little characterized. In this study, an antiserum against neoverrucotoxin, the stonefish Synanceia verrucosa toxin, was first raised in a guinea pig and used in immunoblotting and inhibition immunoblotting to confirm that two species of Pterois lionfish (P. antennata and P. volitans) contain a 75kDa protein (corresponding to the toxin subunit) cross-reacting with neoverrucotoxin. Then, the amino acid sequences of the P. antennata and P. volitans toxins were successfully determined by cDNA cloning using primers designed from the highly conserved sequences of the stonefish toxins. Notably, either α-subunits (699 amino acid residues) or β-subunits (698 amino acid residues) of the P. antennata and P. volitans toxins share as high as 99% sequence identity with each other. Furthermore, both α- and β-subunits of the lionfish toxins exhibit high sequence identity (70-80% identity) with each other and also with the β-subunits of the stonefish toxins. As reported for the stonefish toxins, the lionfish toxins also contain a B30.2/SPRY domain (comprising nearly 200 amino acid residues) in the C-terminal region of each subunit. Copyright © 2011 Elsevier Ltd. All rights reserved.

A recombinant tail-less integrin beta 4 subunit disrupts hemidesmosomes, but does not suppress alpha 6 beta 4-mediated cell adhesion to laminins

PubMed Central

1995-01-01

To examine the function of the alpha 6 beta 4 integrin we have determined its ligand-binding ability and overexpressed two potentially dominant negative mutant beta 4 subunits, lacking either the cytoplasmic or extracellular domain, in bladder epithelial 804G cells. The results of cell adhesion and radioligand-binding assays showed that alpha 6 beta 4 is a receptor for several laminin isoforms, including laminin 1, 2, 4, and 5. Overexpression of the tail-less or head-less mutant beta 4 subunit did not suppress alpha 6 beta 4-mediated adhesion to laminins, as both types of transfectants adhered to these ligands in the presence of blocking anti-beta 1 antibodies as well as the controls. However, immunofluorescence experiments indicated that the endogenous alpha 6 beta 4 integrin and other hemidesmosomal markers were not concentrated in hemidesmosomes in cells overexpressing tail- less beta 4, while the distribution of these molecules was not altered in cells overexpressing the head-less subunit. Electron microscopic studies confirmed that cells overexpressing tail-less beta 4 had a drastically reduced number of hemidesmosomes, while cells expressing the head-less subunit had a normal number of these structures. Thus, expression of a tail-less, but not a head-less mutant beta 4 subunit leads to a dominant negative effect on hemidesmosome assembly without suppressing initial adhesion to laminins. We conclude that the alpha 6 beta 4 integrin binds to several laminins and plays an essential role in the assembly and/or stability of hemidesmosomes, that alpha 6 beta 4- mediated adhesion and hemidesmosome assembly have distinct requirements, and that it is possible to use a dominant negative approach to selectively interfere with a specific function of an integrin. PMID:7721947

Cloning, sequence, and expression of a blood group B active recombinant alpha-D-galactosidase from pinto bean (Phaseolus vulgaris).

PubMed

Davis, M O; Hata, D J; Johnson, S A; Jones, D E; Harmata, M A; Evans, M L; Walker, J C; Smith, D S

1997-07-01

A cDNA encoding pinto bean alpha-D-galactosidase [E.C. 3.2.1.22] was obtained by amplification of cDNA using highly conserved sequences found in eucaryotic alpha-D-galactosidases. Subsequently a full length Phaseolus cDNA clone was obtained that is 1537 nt long and contains untranslated 5' and 3' sequences. The nucleotide sequence of the cDNA has a high degree of homology with other eucaryotic alpha-D-galactosidase genes. The recombinant alpha-D-galactosidase (rGal) was expressed in Escherichia coli and purified by ion exchange and affinity chromatography. Purified rGal was homogeneous by SDS-PAGE and had relative masses of 40.1 and 45.4 kDa under nonreducing and reducing conditions, respectively. The N-terminal sequence of the expressed protein contained the sequence GNGLGQTPPMG corresponding to that deduced from the cDNA sequence. The native molecular weight for rGal was determined to be 32.18 kDa by Sephacryl S-200 chromatography. The specific activity of the rGal was 349 mu moles of PNP-alpha-D-galactopyranoside hydrolyzed per mg of pure rGal per min. rGal was highly specific for alpha-D-galactosyl residues and degraded B oligosaccharide. No detectable hemagglutinin or protease activity was present in the preparations. Furthermore, rGal was active against the blood group B antigen on native human erythrocytes in cell suspension assays. The only detectable RBC phenotypic change was loss of the B and P1 epitopes. Recombinant Phaseolus vulgaris alpha-D-galactosidase may have useful biotechnical applications in the potential mass production of enzymatically converted, universally transfusable type O RBCs. alpha-D-galactosidase [E.C. 3.2.1.22] has been purified from a variety of procaryotic and eucaryotic species. Most alpha-D-galactosidases have similar low molecular weight substrate specificities, but activity against high molecular weight substrates is variable. Terminal alpha-D-galactoside residues are present in glycoproteins and glycolipids. Some alpha-D-galactosidases have activity against alpha-D-galactosyl residues on cell membrane glycoconjugates. Glycosidases with this property are useful for carbohydrate structural studies and biotechnical applications. Enzymes free of other glycosidase activities with activity near neutral pH are particularly useful for membrane modification studies on native cells. Complex sugar chains in glycolipids and glycoproteins have often been implicated in the growth and development of eucaryotes. In particular, complex sugar chains play an important role in the recognition of self in the immune system. Some alpha-D-galactosidases can modify certain carbohydrate membrane epitopes, thereby modulating the immune response. For example, the blood group B epitope expressed on erythrocytes contains a terminal alpha-D-galactosyl residue. Individuals lacking this antigen produce naturally occurring complement fixing antibodies to the B epitope. Hydrolysis of this terminal saccharide destroys the antigenic activity of the B determinant producing H antigen (blood type O) on erythrocytes. Only rare individuals produce clinically significant antibodies to the H antigen, and therefore, type O red blood cells are "universally" compatible and in great demand. Dhar purified alpha-D-galactosidase isozymes from Phaseolus vulgaris and characterized their activity. To our knowledge, our laboratory, in a brief report, is the first to describe the cloning of the gene and the use of recombinant enzyme for seroconverting blood type B to O cells. This paper describes the cloning, sequence, expression, purification, and characterization of recombinant alpha-D-galactosidase. Activity of the recombinant enzyme on the native human erythrocyte blood group B epitope is shown.

Subunit assembly of hemoglobin: an important determinant of hematologic phenotype.

PubMed

Bunn, H F

1987-01-01

Hemoglobin's physiologic properties depend on the orderly assembly of its subunits in erythropoietic cells. The biosynthesis of alpha- and beta-globin polypeptide chains is normally balanced. Heme rapidly binds to the globin subunit, either during translation or shortly thereafter. The formation of the alpha beta-dimer is facilitated by electrostatic attraction of a positively charged alpha-subunit to a negatively charged beta-subunit. The alpha beta-dimer dissociates extremely slowly. The difference between the rate of dissociation of alpha beta- and alpha gamma-dimers with increasing pH explains the well-known alkaline resistance of Hb F. Two dimers combine to form the functioning alpha 2 beta 2-tetramer. This model of hemoglobin assembly explains the different levels of positively charged and negatively charged mutant hemoglobins that are encountered in heterozygotes and the effect of alpha-thalassemia and heme deficiency states in modifying the level of the variant hemoglobin as well as Hb A2. Electrostatic interactions also affect the binding of hemoglobin to the cytoplasmic surface of the red cell membrane and may underlie the formation of target cells. Enhanced binding of positively charged variants such as S and C trigger a normally dormant pathway for potassium and water loss. Thus, the positive charge on beta c is responsible for the two major contributors to the pathogenesis of Hb SC disease: increased proportion of Hb S and increased intracellular hemoglobin concentration. It is likely that electrostatic interactions play an important role in the assembly of a number of other multisubunit macromolecules, including membrane receptors, cytoskeletal proteins, and DNA binding proteins.

The primary and subunit structure of a novel type killer toxin produced by a halotolerant yeast, Pichia farinosa.

PubMed

Suzuki, C; Nikkuni, S

1994-01-28

A halotolerant yeast, Pichia farinosa KK1 strain, produces a unique killer toxin termed SMK toxin (salt-mediated killer toxin) which shows its maximum killer activity in the presence of 2 M NaCl. The toxin consists of two distinct subunits, alpha and beta, which are tightly linked without a disulfide bond under acidic conditions, even in the presence of 6 M urea. Under neutral conditions, however, the alpha subunit precipitates, resulting in the dissociation of the subunits and the loss of killer activity. The nucleotide sequence of the SMK1 gene predicts a 222 amino acid preprotoxin with a typical signal sequence, the hydrophobic alpha, an interstitial gamma polypeptide with a putative glycosylation site, and the hydrophilic beta. Amino acid sequence analyses of peptide fragments including the carboxyl-terminal peptides fragments including the carboxyl-terminal peptides from each subunit suggest that the alpha and beta subunits consist of amino acid residues 19-81 and 146-222 of the preprotoxin, respectively, and the molecular weight of the mature alpha beta dimer is 14,214. The KEX2-like endopeptidase and KEX1-like carboxypeptidase may be involved in the stepwise processing of the SMK preprotoxin. The maturation process and the functions of the SMK toxin are compared with the K1 toxin of Saccharomyces cerevisiae.

Homologous kappa-neurotoxins exhibit residue-specific interactions with the alpha 3 subunit of the nicotinic acetylcholine receptor: a comparison of the structural requirements for kappa-bungarotoxin and kappa-flavitoxin binding.

PubMed

McLane, K E; Weaver, W R; Lei, S; Chiappinelli, V A; Conti-Tronconi, B M

1993-07-13

kappa-Flavotoxin (kappa-FTX), a snake neurotoxin that is a selective antagonist of certain neuronal nicotinic acetylcholine receptors (AChRs), has recently been isolated and characterized [Grant, G. A., Frazier, M. W., & Chiappinelli, V. A. (1988) Biochemistry 27, 1532-1537]. Like the related snake toxin kappa-bungarotoxin (kappa-BTX), kappa-FTX binds with high affinity to alpha 3 subtypes of neuronal AChRs, even though there are distinct sequence differences between the two toxins. To further characterize the sequence regions of the neuronal AChR alpha 3 subunit involved in formation of the binding site for this family of kappa-neurotoxins, we investigated kappa-FTX binding to overlapping synthetic peptides screening the alpha 3 subunit sequence. A sequence region forming a "prototope" for kappa-FTX was identified within residues alpha 3 (51-70), confirming the suggestions of previous studies on the binding of kappa-BTX to the alpha 3 subunit [McLane, K. E., Tang, F., & Conti-Tronconi, B. M. (1990) J. Biol. Chem. 265, 1537-1544] and alpha-bungarotoxin to the Torpedo AChR alpha subunit [Conti-Tronconi, B. M., Tang, F., Diethelm, B. M., Spencer, S. R., Reinhardt-Maelicke, S., & Maelicke, A. (1990) Biochemistry 29, 6221-6230] that this sequence region is involved in formation of a cholinergic site. Single residue substituted analogues, where each residue of the sequence alpha 3 (51-70) was sequentially replaced by a glycine, were used to identify the amino acid side chains involved in the interaction of this prototope with kappa-FTX.(ABSTRACT TRUNCATED AT 250 WORDS)

Transduction of beta3 integrin subunit cDNA confers on human keratinocytes the ability to adhere to gelatin.

PubMed

Kubo, Miyoko; Clark, Richard A F; Katz, Anne B; Taichman, Lorne B; Jin, Zaishun; Zhao, Ying; Moriguchi, Takahiko

2007-04-01

alphavbeta3 is a multiligand integrin receptor that interacts with fibrinogen (FG), fibrin (FB), fibronectin (FN), vitronectin (VN), and denatured collagen. We previously reported that cultured normal human keratinocytes, like in vivo keratinocytes, do not express alphavbeta3 on the cell surface, and do not adhere to and migrate on FG and FB. Furthermore, we reported that human keratinocytes transduced with beta3 integrin subunit cDNA by a retrovirus-mediated transduction method express alphavbeta3 on the cell surface and adhere to FG, FB, FN, and VN significantly compared with beta-galactosidase (beta-gal) cDNA-transduced keratinocytes (control). In this study, we determined whether these beta3 integrin subunit cDNA-transduced keratinocytes or normal human keratinocytes adhere to denatured collagen (gelatin) using a 1 h cell adhesion assay. beta3 cDNA-transduced keratinocytes adhered to gelatin, whereas no significant adhesion was observed with the control cells (beta-gal cDNA-transduced keratinocytes and normal human keratinocytes). The adhesion to gelatin was inhibited by LM609, a monoclonal antibody to alphavbeta3, and RGD peptides but not by normal mouse IgG1 nor RGE peptides. Thus, transduction of beta3 integrin subunit cDNA confers on human keratinocytes the ability to adhere to denatured collagen (gelatin) as well as to FG, FB, VN, and FN. Otherwise, normal human keratinocytes do not adhere to gelatin. These data support the idea that beta3 cDNA-transduced human keratinocytes can be a good material for cultured epithelium to achieve better take rate with acute or chronic wounds, in which FG, FB, and denatured collagen are abundantly present.

Expression of the alpha and beta subunits of Ca2+/calmodulin kinase II in the cerebellum of jaundiced Gunn rats during development: a quantitative light microscopic analysis.

PubMed

Conlee, J W; Shapiro, S M; Churn, S B

2000-04-01

The homozygous (jj) jaundiced Gunn rat model for hyperbilirubinemia displays pronounced cerebellar hypoplasia. To examine the cellular mechanisms involved in bilirubin toxicity, this study focused on the effect of hyperbilirubinemia on calcium/calmodulin-dependent kinase II (CaM kinase II). CaM kinase II is a neuronally enriched enzyme which performs several important functions. Immunohistochemical analysis of alternating serial sections were performed using monoclonal antibodies for the alpha and beta subunits of CaM kinase II. Measurements were made of the total numbers of stained cells in each of the deep cerebellar nuclei and of Purkinje and granule cell densities in cerebellar lobules II, VI, and IX. The beta subunit was present in Purkinje cells and deep cerebellar nuclei of both groups at all ages, but only granule cells which had migrated through the Purkinje cell layer showed staining for beta subunit; external granule cells were completely negative. Many Purkinje cells had degenerated in the older animals, and the percent of granule cells stained for beta subunit was significantly reduced. The alpha subunit was found exclusively in Purkinje cells, although its appearance was delayed in the jaundiced animals. Sulfadimethoxine was administered to some jj rats 24 h or 15 days prior to sacrifice to increase brain bilirubin concentration. Results showed that bilirubin exposure modulated both alpha and beta CaM kinase II subunit expression in selective neuronal populations, but sulfadimethoxine had no acute effect on enzyme immunoreactivity. Thus, developmental expression of the alpha and beta subunits of CaM kinase II was affected by chronic bilirubin exposure during early postnatal development of jaundiced Gunn rats.

Molecular analysis of nicotinic receptor expression in autism.

PubMed

Martin-Ruiz, C M; Lee, M; Perry, R H; Baumann, M; Court, J A; Perry, E K

2004-04-07

Autism is a developmental disorder of unknown aetiopathology and lacking any specific pharmacological therapeutic intervention. Neurotransmitters such as serotonin, gamma-aminobutyric acid (GABA) and acetylcholine have been implicated. Abnormalities in nicotinic acetylcholine receptors have been identified including cortical loss of binding to the alpha4/beta2 subtype and increase in cerebellar alpha7 binding. Receptor expression (mRNA) has not so far been systematically examined. This study aims to further explore the role of nicotinic receptors in autism by analysing nicotinic receptor subunit mRNA in conjunction with protein levels and receptor binding in different brain areas. Quantitative RT-PCR for alpha4, alpha7 and beta2 subunit mRNA expression levels; alpha3, alpha4, alpha7 and beta2 subunit protein expression immunochemistry and specific radioligand receptor binding were performed in adult autism and control brain samples from cerebral cortex and cerebellum. Alpha4 and beta2 protein expression and receptor binding density as well as alpha4 mRNA levels were lower in parietal cortex in autism, while alpha7 did not change for any of these parameters. In cerebellum, alpha4 mRNA expression was increased, whereas subunit protein and receptor levels were decreased. Alpha7 receptor binding in cerebellum was increased alongside non-significant elevations in mRNA and protein expression levels. No significant changes were found for beta2 in cerebellum. The data obtained, using complementary measures of receptor expression, indicate that reduced gene expression of the alpha4beta2 nicotinic receptor in the cerebral cortex is a major feature of the neurochemical pathology of autism, whilst post-transcriptional abnormalities of both this and the alpha7 subtype are apparent in the cerebellum. The findings point to dendritic and/or synaptic nicotinic receptor abnormalities that may relate to disruptions in cerebral circuitry development.

Exercise increases the plasma membrane content of the Na+ -K+ pump and its mRNA in rat skeletal muscles.

PubMed

Tsakiridis, T; Wong, P P; Liu, Z; Rodgers, C D; Vranic, M; Klip, A

1996-02-01

Muscle fibers adapt to ionic challenges of exercise by increasing the plasma membrane Na+-K+ pump activity. Chronic exercise training has been shown to increase the total amount of Na+-K+ pumps present in skeletal muscle. However, the mechanism of adaptation of the Na+-K+ pump to an acute bout of exercise has not been determined, and it is not known whether it involves alterations in the content of plasma membrane pump subunits. Here we examine the effect of 1 h of treadmill running (20 m/min, 10% grade) on the subcellular distribution and expression of Na+-K+ pump subunits in rat skeletal muscles. Red type I and IIa (red-I/IIa) and white type IIa and IIb (white-IIa/IIb) hindlimb muscles from resting and exercised female Sprague-Dawley rats were removed for subcellular fractionation. By homogenization and gradient centrifugation, crude membranes and purified plasma membranes were isolated and subjected to gel electrophoresis and immunoblotting by using pump subunit-specific antibodies. Furthermore, mRNA was isolated from specific red type I (red-I) and white type IIb (white-IIb) muscles and subjected to Northern blotting by using subunit-specific probes. In both red-I/IIa and white-IIa/IIb muscles, exercise significantly raised the plasma membrane content of the alpha1-subunit of the pump by 64 +/- 24 and 55 +/- 22%, respectively (P < 0.05), and elevated the alpha2-polypeptide by 43 +/- 22 and 94 +/- 39%, respectively (P < 0.05). No significant effect of exercise could be detected on the amount of these subunits in an internal membrane fraction or in total membranes. In addition, exercise significantly increased the alpha1-subunit mRNA in red-I muscle (by 50 +/- 7%; P < 0.05) and the beta2-subunit mRNA in white-IIb muscles (by 64 +/- 19%; P < 0.01), but the alpha2- and beta1-mRNA levels were unaffected in this time period. We conclude that increased presence of alpha1- and alpha2-polypeptides at the plasma membrane and subsequent elevation of the alpha1- and beta2-subunit mRNAs may be mechanisms by which acute exercise regulates the Na+-K+ pump of skeletal muscle.

Cloning and purification of alpha-neurotoxins from king cobra (Ophiophagus hannah).

PubMed

He, Ying-Ying; Lee, Wei-Hui; Zhang, Yun

2004-09-01

Thirteen complete and three partial cDNA sequences were cloned from the constructed king cobra (Ophiophagus hannah) venom gland cDNA library. Phylogenetic analysis of nucleotide sequences of king cobra with those from other snake venoms revealed that obtained cDNAs are highly homologous to snake venom alpha-neurotoxins. Alignment of deduced mature peptide sequences of the obtained clones with those of other reported alpha-neurotoxins from the king cobra venom indicates that our obtained 16 clones belong to long-chain neurotoxins (seven), short-chain neurotoxins (seven), weak toxin (one) and variant (one), respectively. Up to now, two out of 16 newly cloned king cobra alpha-neurotoxins have identical amino acid sequences with CM-11 and Oh-6A/6B, which have been characterized from the same venom. Furthermore, five long-chain alpha-neurotoxins and two short-chain alpha-neurotoxins were purified from crude venom and their N-terminal amino acid sequences were determined. The cDNAs encoding the putative precursors of the purified native peptide were also determined based on the N-terminal amino acid sequencing. The purified alpha-neurotoxins showed different lethal activities on mice.

Chemical cross-linking of the urease complex from Helicobacter pylori and analysis by Fourier transform ion cyclotron resonance mass spectrometry and molecular modeling

NASA Astrophysics Data System (ADS)

Carlsohn, Elisabet; Ångström, Jonas; Emmett, Mark R.; Marshall, Alan G.; Nilsson, Carol L.

2004-05-01

Chemical cross-linking of proteins is a well-established method for structural mapping of small protein complexes. When combined with mass spectrometry, cross-linking can reveal protein topology and identify contact sites between the peptide surfaces. When applied to surface-exposed proteins from pathogenic organisms, the method can reveal structural details that are useful in vaccine design. In order to investigate the possibilities of applying cross-linking on larger protein complexes, we selected the urease enzyme from Helicobacter pylori as a model. This membrane-associated protein complex consists of two subunits: [alpha] (26.5 kDa) and [beta] (61.7 kDa). Three ([alpha][beta]) heterodimers form a trimeric ([alpha][beta])3 assembly which further associates into a unique dodecameric 1.1 MDa complex composed of four ([alpha][beta])3 units. Cross-linked peptides from trypsin-digested urease complex were analyzed by Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS) and molecular modeling. Two potential cross-linked peptides (present in the cross-linked sample but undetectable in [alpha], [beta], and native complex) were assigned. Molecular modeling of urease [alpha][beta] complex and trimeric urease units ([alpha][beta])3 revealed a linkage site between the [alpha]-subunit and the [beta]-subunit, and an internal cross-linkage in the [beta]-subunit.

A novel mutation in the alpha-helix 1 of the C subunit of the F(1)/F(0) ATPase responsible for optochin resistance of a Streptococcus pneumoniae clinical isolate.

PubMed

Cogné, N; Claverys, J; Denis, F; Martin, C

2000-10-01

Previously reported mutations involved in optochin resistance of Streptococcus pneumoniae clinical isolates changed residues 48, 49 or 50, in the transmembrane alpha-helix 2 of the F(1)/F(0) ATPase subunit. We report here an unusual mutation which changes the sequence of the transmembrane alpha-helix 1 of the AtpC subunit. This mutation involves a Gly to Ser substitution resulting from a G to A transition at codon 14 of the atpC gene.

Na(+)-K (+) pump location and translocation during muscle contraction in rat skeletal muscle.

PubMed

Kristensen, Michael; Rasmussen, Martin Krøyer; Juel, Carsten

2008-08-01

Muscle contraction may up-regulate the number of Na(+)-K(+) pumps in the plasma membrane by translocation of subunits. Since there is still controversy about where this translocation takes place from and if it takes place at all, the present study used different techniques to characterize the translocation. Electrical stimulation and biotin labeling of rat muscle revealed a 40% and 18% increase in the amounts of the Na(+)-K(+) pump alpha(2) subunit and caveolin-3 (Cav-3), respectively, in the sarcolemma. Exercise induced a 36% and 19% increase in the relative amounts of the alpha(2) subunit and Cav-3, respectively, in an outer-membrane-enriched fraction and a 41% and 17% increase, respectively, in sarcolemma giant vesicles. The Na(+)-K(+) pump activity measured with the 3-O-MFPase assay was increased by 37% in giant vesicles from exercised rats. Immunoprecipitation with Cav-3 antibody showed that 17%, 11% and 14% of the alpha(1) subunits were associated with Cav-3 in soleus, extensor digitorum longus, and mixed muscles, respectively. For the alpha(2), the corresponding values were 17%, 5% and 16%. In conclusion; muscle contraction induces translocation of the alpha subunits, which is suggested to be caused partly by structural changes in caveolae and partly by translocation from an intracellular pool.

Characterization of the human pH- and PKA-activated ClC-2G(2 alpha) Cl- channel.

PubMed

Sherry, A M; Stroffekova, K; Knapp, L M; Kupert, E Y; Cuppoletti, J; Malinowska, D H

1997-08-01

A ClC-2G(2 alpha) Cl- channel was identified to be present in human lung and stomach, and a partial cDNA for this Cl- channel was cloned from a human fetal lung library. A full-length expressible human ClC-2G(2 alpha) cDNA was constructed by ligation of mutagenized expressible rabbit ClC-2G(2 alpha) cDNA with the human lung ClC-2G(2 alpha) cDNA, expressed in oocytes, and characterized at the single-channel level. Adenosine 3',5'-cyclic monophosphate-dependent protein kinase (PKA) treatment increased the probability of opening of the channel (Po). After PKA activation, the channel exhibited a linear (r = 0.99) current-voltage curve with a slope conductance of 22.1 +/- 0.8 pS in symmetric 800 mM tetraethylammonium chloride (TEACl; pH 7.4). Under fivefold gradient conditions of TEACl, a reversal potential of +21.5 +/- 2.8 mV was measured demonstrating anion-to-cation discrimination. As previously demonstrated for the rabbit ClC-2G(2 alpha) Cl- channel, the human analog, hClC-2G(2 alpha), was active at pH 7.4 as well as when the pH of the extracellular face of the channel (trans side of the bilayer; pHtrans) was asymmetrically reduced to pH 3.0. The extent of PKA activation was dependent on pHtrans. With PKA treatment, Po increased fourfold with a pHtrans of 7.4 and eightfold with a pHtrans of 3.0. Effects of sequential PKA addition followed by pHtrans reduction on the same channel suggested that the PKA- and pH-dependent increases in channel Po were separable and cumulative. Northern analysis showed ClC-2G(2 alpha) mRNA to be present in human adult and fetal lung and adult stomach, and quantitative reverse transcriptase-polymerase chain reaction showed this channel to be present in the adult human lung and stomach at about one-half the level found in fetal lung. The findings of the present study suggest that the ClC-2G(2 alpha) Cl- channel may play an important role in Cl- transport in the fetal and adult human lung.

PCR amplification and sequences of cDNA clones for the small and large subunits of ADP-glucose pyrophosphorylase from barley tissues.

PubMed

Villand, P; Aalen, R; Olsen, O A; Lüthi, E; Lönneborg, A; Kleczkowski, L A

1992-06-01

Several cDNAs encoding the small and large subunit of ADP-glucose pyrophosphorylase (AGP) were isolated from total RNA of the starchy endosperm, roots and leaves of barley by polymerase chain reaction (PCR). Sets of degenerate oligonucleotide primers, based on previously published conserved amino acid sequences of plant AGP, were used for synthesis and amplification of the cDNAs. For either the endosperm, roots and leaves, the restriction analysis of PCR products (ca. 550 nucleotides each) has revealed heterogeneity, suggesting presence of three transcripts for AGP in the endosperm and roots, and up to two AGP transcripts in the leaf tissue. Based on the derived amino acid sequences, two clones from the endosperm, beps and bepl, were identified as coding for the small and large subunit of AGP, respectively, while a leaf transcript (blpl) encoded the putative large subunit of AGP. There was about 50% identity between the endosperm clones, and both of them were about 60% identical to the leaf cDNA. Northern blot analysis has indicated that beps and bepl are expressed in both the endosperm and roots, while blpl is detectable only in leaves. Application of the PCR technique in studies on gene structure and gene expression of plant AGP is discussed.

Interaction of the alpha-subunit of Escherichia coli RNA polymerase with DNA: rigid body nature of the protein-DNA contact.

PubMed

Heyduk, E; Baichoo, N; Heyduk, T

2001-11-30

The alpha-subunit of Escherichia coli RNA polymerase plays an important role in the activity of many promoters by providing a direct protein-DNA contact with a specific sequence (UP element) located upstream of the core promoter sequence. To obtain insight into the nature of thermodynamic forces involved in the formation of this protein-DNA contact, the binding of the alpha-subunit of E. coli RNA polymerase to a fluorochrome-labeled DNA fragment containing the rrnB P1 promoter UP element sequence was quantitatively studied using fluorescence polarization. The alpha dimer and DNA formed a 1:1 complex in solution. Complex formation at 25 degrees C was enthalpy-driven, the binding was accompanied by a net release of 1-2 ions, and no significant specific ion effects were observed. The van't Hoff plot of temperature dependence of binding was linear suggesting that the heat capacity change (Deltac(p)) was close to zero. Protein footprinting with hydroxyradicals showed that the protein did not change its conformation upon protein-DNA contact formation. No conformational changes in the DNA molecule were detected by CD spectroscopy upon protein-DNA complex formation. The thermodynamic characteristics of the binding together with the lack of significant conformational changes in the protein and in the DNA suggested that the alpha-subunit formed a rigid body-like contact with the DNA in which a tight complementary recognition interface between alpha-subunit and DNA was not formed.

Structure of the beta 2 homodimer of bacterial luciferase from Vibrio harveyi: X-ray analysis of a kinetic protein folding trap.

PubMed Central

Thoden, J. B.; Holden, H. M.; Fisher, A. J.; Sinclair, J. F.; Wesenberg, G.; Baldwin, T. O.; Rayment, I.

1997-01-01

Luciferase, as isolated from Vibrio harveyi, is an alpha beta heterodimer. When allowed to fold in the absence of the alpha subunit, either in vitro or in vivo, the beta subunit of enzyme will form a kinetically stable homodimer that does not unfold even after prolonged incubation in 5 M urea at pH 7.0 and 18 degrees C. This form of the beta subunit, arising via kinetic partitioning on the folding pathway, appears to constitute a kinetically trapped alternative to the heterodimeric enzyme (Sinclair JF, Ziegler MM, Baldwin TO. 1994. Kinetic partitioning during protein folding yields multiple native states. Nature Struct Biol 1: 320-326). Here we describe the X-ray crystal structure of the beta 2 homodimer of luciferase from V. harveyi determined and refined at 1.95 A resolution. Crystals employed in the investigational belonged to the orthorhombic space group P2(1)2(1)2(1) with unit cell dimensions of a = 58.8 A, b = 62.0 A, and c = 218.2 A and contained one dimer per asymmetric unit. Like that observed in the functional luciferase alpha beta heterodimer, the major tertiary structural motif of each beta subunit consists of an (alpha/beta)8 barrel (Fisher AJ, Raushel FM, Baldwin TO, Rayment I. 1995. Three-dimensional structure of bacterial luciferase from Vibrio harveyi at 2.4 A resolution. Biochemistry 34: 6581-6586). The root-mean-square deviation of the alpha-carbon coordinates between the beta subunits of the hetero- and homodimers is 0.7 A. This high resolution X-ray analysis demonstrated that "domain" or "loop" swapping has not occurred upon formation of the beta 2 homodimer and thus the stability of the beta 2 species to denaturation cannot be explained in such simple terms. In fact, the subunit:subunit interfaces observed in both the beta 2 homodimer and alpha beta heterodimer are remarkably similar in hydrogen-bonding patterns and buried surface areas. PMID:9007973

Phenotypic consequences of deletion of the {gamma}{sub 3}, {alpha}{sub 5}, or {beta}{sub 3} subunit of the type A {gamma}-aminobutyric acid receptor in mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Culia, C.T.; Stubbs, L.J.; Montgomery, C.S.

1994-03-29

Three genes (Gabrg3, Gabra5, and Gabrb3) encoding the {gamma}{sub 3}, {alpha}{sub 5}, and {beta}{sub 3} subunits of the type A {gamma}-aminobutyric acid receptor, respectively, are known to map near the pink-eyed dilution (p) locus in mouse chromosome 7. This region shares homology with a segment of human chromosome 15 that is implicated in Angelman syndrome, an inherited neurobehavioral disorder. By mapping Gabrg3-Gabra5-Gabrb3-telomere. Like Gabrb3, neither the Gabra5 nor Gabrg3 gene is functionally imprinted in adult mouse brain. Mice deleted for all three subunits die at birth with a cleft palate, although there are rare survivors ({approximately} 5%) that do notmore » have a cleft palate but do exhibit a neurological abnormality characterized by tremor, jerky gait, and runtiness. The authors have previously suggested that deficiency of the {beta}{sub 3} subunit may be responsible for the clefting defect. Most notably, however, in this report they describe mice carrying two overlapping, complementing p deletions that fail to express the {gamma}{sub 3} transcript, as well as mice from another line that express neither the {gamma}{sub 3} nor {alpha}{sub 5} transcripts. Surprisingly, mice from both of these lines are phenotypically normal and do not exhibit any of the neurological symptoms characteristic of the rare survivors that are deleted for all three ({gamma}{sub 3}, {alpha}{sub 5}, and {beta}{sub 3}) subunits. These mice therefore provide a whole-organism type A {gamma}-aminobutyric-acid receptor background that is devoid of any receptor subtypes that normally contain the {gamma}{sub 3} and/or {alpha}{sub 5} subunits. The absence of an overt neurological phenotype in mice lacking the {gamma}{sub 3} and/or {alpha}{sub 5} subunits also suggests that mutations in these genes are unlikely to provide useful animal models for Angelman syndrome in humans.« less

Studies on G-protein alpha.betagamma heterotrimer formation reveal a putative S-prenyl-binding site in the alpha subunit.

PubMed Central

Dietrich, Alexander; Scheer, Alexander; Illenberger, Daria; Kloog, Yoel; Henis, Yoav I; Gierschik, Peter

2003-01-01

The alpha and betagamma subunits of heterotrimeric G-proteins contain specific lipid modifications, which are required for their biological function. However, the relevance of these modifications to the interactions within the heterotrimeric G-protein is not fully understood. In order to explore the role of the S-prenyl moiety of the isoprenylated betagamma dimer of retinal transducin, betagamma(t), in the formation of the heterotrimeric complex with the corresponding N-acylated alpha subunit, alpha(t), we employed purified fully processed subunits, which are soluble in aqueous solutions without detergents. Pertussis-toxin-mediated [(32)P]ADP-ribosylation of alpha(t) is strongly stimulated (approximately 10-fold) in the presence of betagamma(t) and can thus serve as a measure for heterotrimer formation. Using this assay, preincubation of alpha(t) with S-prenyl analogues containing farnesyl or geranylgeranyl moieties was found to inhibit heterotrimer formation in a dose-dependent manner. The inhibition was competitive and reversible, as indicated by its reversal upon increase of the betagamma(t) dimer concentration or by removal of the S-prenyl analogue using gel filtration. The competitive nature of the inhibition is supported by the marked attenuation of the inhibition when the S-prenyl analogue was added to alpha(t) together with or after betagamma(t). The inhibition does not involve interaction with the alpha(t) acyl group, since an S-prenyl analogue inhibited the [(32)P]ADP-ribosylation of an unlipidated alpha(t) mutant. These data suggest the existence of a hitherto unrecognized S-prenyl-binding site in alpha(t), which is critical for its interaction with prenylated betagamma(t). PMID:12952523

Creatine kinase and alpha-actin mRNA levels decrease in diabetic rat hearts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popovich, B.; Barrieux, A.; Dillmann, W.H.

1987-05-01

Diabetic cardiomyopathy is associated with cardiac atrophy and isoenzyme redistribution. To determine if tissue specific changes occur in mRNAs coding for ..cap alpha..-actin and creatine kinase (CK), they performed RNA blot analysis. Total ventricular RNA from control (C) and 4 wk old diabetic (D) rats were hybridized with /sup 32/P cDNA probes for ..cap alpha..-actin and CK. A tissue independent cDNA probe, CHOA was also used. Signal intensity was quantified by photodensitometry. D CK mRNA was 47 +/- 16% lower in D vs C. Insulin increases CK mRNA by 20% at 1.5 hs, and completely reverses the deficit after 4more » wks. D ..cap alpha..-actin mRNA is 66 +/- 18% lower in D vs C. Insulin normalized ..cap alpha..-actin mRNA by 5 hs. CHOA mRNA is unchanged in D vs C, but D + insulin CHOA mRNA is 30 +/- 2% lower than C. In rats with diabetic cardiomyopathy, muscle specific CK and ..cap alpha..-actin mRNAs are decreased. Insulin treatment reverses these changes.« less

Novel Tay-Sachs disease mutations from China.

PubMed

Akalin, N; Shi, H P; Vavougios, G; Hechtman, P; Lo, W; Scriver, C R; Mahuran, D; Kaplan, F

1992-01-01

We describe three HEXA mutations associated with infantile Tay-Sachs disease (TSD) in three unrelated nonconsanguineous Chinese families. Novel mutations were found in two of these families. The third is a previously reported mutation (G-->A transition at nt 1444) (Nakano et al., 1988). Direct sequencing of PCR products identified a novel insertion of an A after nt 547 in family 1. This change generates an early termination codon 6 bp downstream from the insertion site. Allele-specific oligonucleotide hybridization confirmed homozygosity in the proband. Single strand conformational polymorphism analysis and direct sequencing of amplified exon 13 revealed a T-->C transition at nt 1453 with the corresponding amino acid substitution W485R in the second family. This mutation creates an Fnu4HI restriction site. The proband is homozygous for this allele. When the site-specific mutagenized alpha cDNA carrying the T-->C transition at nt 1453 was expressed in COS 1 cells hexosaminidase S activity was not detectable above background. A G-->A transition at nt 1444 (exon 13) corresponding to the E482K substitution was found in the third family. This mutation occurs at a CpG dinucleotide. It has been reported in an Italian TSD proband and causes defective intracellular transport of the alpha-subunit from the rough endoplasmic reticulum to the Golgi apparatus.

Cold-adapted tubulins in the glacier ice worm, Mesenchytraeus solifugus.

PubMed

Tartaglia, Lawrence J; Shain, Daniel H

2008-11-01

Glacier ice worms, Mesenchytraeus solifugus and related species, are the only known annelids that survive obligately in glacier ice and snow. One fundamental component of cold temperature adaptation is the ability to polymerize tubulin, which typically depolymerizes at low physiological temperatures (e.g., <10 degrees C) in most temperate species. In this study, we isolated two alpha-tubulin (Msalpha1, Msalpha2) and two beta-tubulin (Msbeta1, Msbeta2) subunits from an ice worm cDNA library, and compared their predicted amino acid sequences with homologues from other cold-adapted organisms (e.g., Antarctic fish, ciliate) in an effort to identify species-specific amino acid substitutions that contribute to cold temperature-dependent tubulin polymerization. Our comparisons and predicted protein structures suggest that ice worm-specific amino acid substitutions stabilize lateral contact associations, particularly between beta-tubulin protofilaments, but these substitutions occur at different positions in comparison with other cold-adapted tubulins. The ice worm tubulin gene family appears relatively small, comprising one primary alpha- and one primary beta-tubulin monomers, though minor isoforms and pseudogenes were identified. Our analyses suggest that variation occurs in the strategies (i.e., species-specific amino acid substitutions, gene number) by which cold-adapted taxa have evolved the ability to polymerize tubulin at low physiological temperatures.

Structural integration in hypoxia-inducible factors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Dalei; Potluri, Nalini; Lu, Jingping

The hypoxia-inducible factors (HIFs) coordinate cellular adaptations to low oxygen stress by regulating transcriptional programs in erythropoiesis, angiogenesis and metabolism. These programs promote the growth and progression of many tumours, making HIFs attractive anticancer targets. Transcriptionally active HIFs consist of HIF-alpha and ARNT (also called HIF-1 beta) subunits. Here we describe crystal structures for each of mouse HIF-2 alpha-ARNT and HIF-1 alpha-ARNT heterodimers in states that include bound small molecules and their hypoxia response element. A highly integrated quaternary architecture is shared by HIF-2 alpha-ARNT and HIF-1 alpha-ARNT, wherein ARNT spirals around the outside of each HIF-alpha subunit. Five distinctmore » pockets are observed that permit small-molecule binding, including PAS domain encapsulated sites and an interfacial cavity formed through subunit heterodimerization. The DNA-reading head rotates, extends and cooperates with a distal PAS domain to bind hypoxia response elements. HIF-alpha mutations linked to human cancers map to sensitive sites that establish DNA binding and the stability of PAS domains and pockets.« less

The carboxyl-terminal region is a determinant for the intracellular behavior of the chorionic gonadotropin beta subunit: effects on the processing of the Asn-linked oligosaccharides.

PubMed

Muyan, M; Boime, I

1998-05-01

The placental hormone human CG (hCG) consists of two noncovalently linked alpha- and beta-subunits similar to the other glycoprotein hormones LH, FSH, and TSH. These heterodimers share a common alpha subunit but differ in their structurally distinct beta subunits. The CGbeta subunit is distinguished among the beta subunits by the presence of a C-terminal extension with four serine-linked oligosaccharides (carboxyl terminal peptide or CTP). In previous studies we observed that deleting this sequence decreased assembly of the truncated CGbeta subunit (CGbeta114) with the alpha-subunit and increased the heterogeneity of the secreted forms of the uncombined subunit synthesized in transfected Chinese hamster ovary (CHO) cells. The latter result was attributed to alterations in the processing of the two N-linked oligosaccharides. To examine at what step this heterogeneity occurs, the CGbeta and CGbeta114 genes were transfected into wild-type and mutant CHO cell lines that are defective in the late steps of the N-linked carbohydrate-processing pathway. We show here that removal of the CTP alters the processing of the core mannosyl unit of the subunit to complex forms at both glycosylation sites and that the oligosaccharides contain polylactosamine. Although it has been presumed that there is little intramolecular interaction between the CTP and the proximal domains of the subunit, our data suggest that the CTP sequence participates in the folding of the newly synthesized subunit, which is manifest by the posttranslational changes observed here.

Role of mp 17O Seprase in Breast Cancer.

DTIC Science & Technology

1998-07-01

identical subunits of MT 97 kDa. Recent evidence indicated that the Seprase subunit is identical to Fibroblast Activation Protein a ( FAPa ). To characterize...and define the role of this molecule in cancer, human Seprase/ FAPa cDNA was cloned and stable transfected in two human epithelial carcinoma cell lines...SW-13 and MCF-7. Unexpectedly, overexpression of Seprase/ FAPa has no apparent effect on the proliferation, matrix adhesion and matrigel invasion of

Calcium/calmodulin-dependent kinase II phosphorylation of the GABAA receptor alpha1 subunit modulates benzodiazepine binding.

PubMed

Churn, Severn B; Rana, Aniruddha; Lee, Kangmin; Parsons, J Travis; De Blas, Angel; Delorenzo, Robert J

2002-09-01

gamma-Aminobutyric acid (GABA) is the primary neurotransmitter that is responsible for the fast inhibitory synaptic transmission in the central nervous system. A major post-translational mechanism that can rapidly regulate GABAAR function is receptor phosphorylation. This study was designed to test the effect of endogenous calcium and calmodulin-dependent kinase II (CaM kinase II) activation on both allosteric modulator binding and GABAA receptor subunit phosphorylation. Endogenous CaM kinase II activity was stimulated, and GABAA receptors were subsequently analyzed for bothallosteric modulator binding properties and immunoprecipitated and analyzed for subunit phosphorylation levels. A significant increase in allosteric-modulator binding of the GABAAR was observed under conditions maximal for CaM kinase II activation. In addition, CaM kinase II activation resulted in a direct increase in phosphorylation of the GABAA receptor alpha1 subunit. The data suggest that the CaM kinase II-dependent phosphorylation of the GABAA receptor alpha1 subunit modulated allosteric modulator binding to the GABAA receptor.

Molecular cloning of the cDNA encoding laccase from Trametes versicolor and heterologous expression in Pichia methanolica.

PubMed

Guo, Mei; Lu, Fuping; Pu, Jun; Bai, Dongqing; Du, Lianxiang

2005-11-01

A cDNA encoding for laccase was isolated from the ligninolytic fungus Trametes versicolor by RNA-PCR. The cDNA corresponds to the gene Lcc1, which encodes a laccase isoenzyme of 498 amino acid residues preceded by a 22-residue signal peptide. The Lcc1 cDNA was cloned into the vectors pMETA and pMETalphaA and expressed in Pichia methanolica. The laccase activity obtained with the Saccharomyces cerevisiae alpha-factor signal peptide was found to be twofold higher than that obtained with the native secretion signal peptide. The extracellular laccase activity in recombinants with the alpha-factor signal peptide was 9.79 U ml(-1). The presence of 0.2 mM copper was necessary for optimal activity of laccase. The expression level was favoured by lower cultivation temperature. The identity of the recombinant protein was further confirmed by immunodetection using Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form.

Cloning and sequence analysis of a full-length cDNA of SmPP1cb encoding turbot protein phosphatase 1 beta catalytic subunit

NASA Astrophysics Data System (ADS)

Qi, Fei; Guo, Huarong; Wang, Jian

2008-02-01

Reversible protein phosphorylation, catalyzed by protein kinases and phosphatases, is an important and versatile mechanism by which eukaryotic cells regulate almost all the signaling processes. Protein phosphatase 1 (PP1) is the first and well-characterized member of the protein serine/threonine phosphatase family. In the present study, a full-length cDNA encoding the beta isoform of the catalytic subunit of protein phosphatase 1(PP1cb), was for the first time isolated and sequenced from the skin tissue of flatfish turbot Scophthalmus maximus, designated SmPP1cb, by the rapid amplification of cDNA ends (RACE) technique. The cDNA sequence of SmPP1cb we obtained contains a 984 bp open reading frame (ORF), flanked by a complete 39 bp 5' untranslated region and 462 bp 3' untranslated region. The ORF encodes a putative 327 amino acid protein, and the N-terminal section of this protein is highly acidic, Met-Ala-Glu-Gly-Glu-Leu-Asp-Val-Asp, a common feature for PP1 catalytic subunit but absent in protein phosphatase 2B (PP2B). And its calculated molecular mass is 37 193 Da and pI 5.8. Sequence analysis indicated that, SmPP1cb is extremely conserved in both amino acid and nucleotide acid levels compared with the PP1cb of other vertebrates and invertebrates, and its Kozak motif contained in the 5'UTR around ATG start codon is GXXAXXGXX ATGG, which is different from mammalian in two positions A-6 and G-3, indicating the possibility of different initiation of translation in turbot, and also the 3'UTR of SmPP1cb is highly diverse in the sequence similarity and length compared with other animals, especially zebrafish. The cloning and sequencing of SmPP1cb gene lays a good foundation for the future work on the biological functions of PP1 in the flatfish turbot.

Ada protein-RNA polymerase sigma subunit interaction and alpha subunit-promoter DNA interaction are necessary at different steps in transcription initiation at the Escherichia coli Ada and aidB promoters.

PubMed

Landini, P; Bown, J A; Volkert, M R; Busby, S J

1998-05-22

The methylated form of the Ada protein (meAda) binds the ada and aidB promoters between 60 and 40 base pairs upstream from the transcription start and activates transcription of the Escherichia coli ada and aidB genes. This region is also a binding site for the alpha subunit of RNA polymerase and resembles the rrnB P1 UP element in A/T content and location relative to the core promoter. In this report, we show that deletion of the C-terminal domain of the alpha subunit severely decreases meAda-independent binding of RNA polymerase to ada and aidB, affecting transcription initiation at these promoters. We provide evidence that meAda activates transcription by direct interaction with the C-terminal domain of RNA polymerase sigma70 subunit (amino acids 574-613). Several negatively charged residues in the sigma70 C-terminal domain are important for transcription activation by meAda; in particular, a glutamic acid to valine substitution at position 575 has a dramatic effect on meAda-dependent transcription. Based on these observations, we propose that the role of the alpha subunit at ada and aidB is to allow initial binding of RNA polymerase to the promoters. However, transcription initiation is dependent on meAda-sigma70 interaction.

Control of the synthesis and subcellular targeting of the two GDH genes products in leaves and stems of Nicotiana plumbaginifolia and Arabidopsis thaliana.

PubMed

Fontaine, Jean-Xavier; Saladino, Francesca; Agrimonti, Caterina; Bedu, Magali; Tercé-Laforgue, Thérèse; Tétu, Thierry; Hirel, Bertrand; Restivo, Francesco M; Dubois, Frédéric

2006-03-01

Although the physiological role of the enzyme glutamate dehydrogenase which catalyses in vitro the reversible amination of 2-oxoglutarate to glutamate remains to be elucidated, it is now well established that in higher plants the enzyme preferentially occurs in the mitochondria of phloem companion cells. The Nicotiana plumbaginifolia and Arabidopis thaliana enzyme is encoded by two distinct genes encoding either an alpha- or a beta-subunit. Using antisense plants and mutants impaired in the expression of either of the two genes, we showed that in leaves and stems both the alpha- and beta-subunits are targeted to the mitochondria of the companion cells. In addition, we found in both species that there is a compensatory mechanism up-regulating the expression of the alpha-subunit in the stems when the expression of the beta-subunit is impaired in the leaves, and of the beta-subunit in the leaves when the expression of the alpha-subunit is impaired in the stems. When one of the two genes encoding glutamate dehydrogenase is ectopically expressed, the corresponding protein is targeted to the mitochondria of both leaf and stem parenchyma cells and its production is increased in the companion cells. These results are discussed in relation to the possible signalling and/or physiological function of the enzyme which appears to be coordinated in leaves and stems.

Subunits of the Snf1 kinase heterotrimer show interdependence for association and activity.

PubMed

Elbing, Karin; Rubenstein, Eric M; McCartney, Rhonda R; Schmidt, Martin C

2006-09-08

The Snf1 kinase and its mammalian orthologue, the AMP-activated protein kinase (AMPK), function as heterotrimers composed of a catalytic alpha-subunit and two non-catalytic subunits, beta and gamma. The beta-subunit is thought to hold the complex together and control subcellular localization whereas the gamma-subunit plays a regulatory role by binding to and blocking the function of an auto-inhibitory domain (AID) present in the alpha-subunit. In addition, catalytic activity requires phosphorylation by a distinct upstream kinase. In yeast, any one of three Snf1-activating kinases, Sak1, Tos3, or Elm1, can fulfill this role. We have previously shown that Sak1 is the only Snf1-activating kinase that forms a stable complex with Snf1. Here we show that the formation of the Sak1.Snf1 complex requires the beta- and gamma-subunits in vivo. However, formation of the Sak1.Snf1 complex is not necessary for glucose-regulated phosphorylation of the Snf1 activation loop. Snf1 kinase purified from cells lacking the beta-subunits do not contain any gamma-subunit, indicating that the Snf1 kinase does not form a stable alphagamma dimer in vivo. In vitro kinase assays using purified full-length and truncated Snf1 proteins demonstrate that the kinase domain, which lacks the AID, is significantly more active than the full-length Snf1 protein. Addition of purified beta- and gamma-subunits could stimulate the kinase activity of the full-length alpha-subunit but only when all three subunits were present, suggesting an interdependence of all three subunits for assembly of a functional complex.

Thylakoid membrane protein topography: transmembrane orientation of the chloroplast cytochrome b-559 psbE gene product.

PubMed

Tae, G S; Black, M T; Cramer, W A; Vallon, O; Bogorad, L

1988-12-27

Protease accessibility and antibody to a COOH-terminal peptide were used as probes for the in situ topography of the Mr 10,000 psbE gene product (alpha subunit) of the chloroplast cytochrome b-559. Exposure of thylakoid membranes to trypsin or Staphylococcus aureus V8 protease cleaved the alpha subunit to a slightly smaller polypeptide (delta Mr approximately -1000) as detected on Western blots, without loss of reactivity to COOH-terminal antibody. The disappearance of the parent Mr 10,000 polypeptide from thylakoids in the presence of trypsin correlated with the appearance of the smaller polypeptide with delta Mr = -750, the conversion having a half-time of approximately 15 min. Exposure of inside-out vesicles to trypsin resulted in almost complete loss of reactivity to the antibody, showing that the COOH terminus is exposed on the lumenal side of the membrane. Removal of the extrinsic polypeptides of the oxygen-evolving complex resulted in an increase of the accessibility of the alpha subunit to trypsin. These data establish that the alpha subunit of cytochrome b-559 crosses the membrane once, as predicted from its single, 26-residue, hydrophobic domain. The NH2 terminus of the alpha polypeptide is on the stromal side of the membrane, where it is accessible, most likely at Arg-7 or Glu-6/Asp-11, to trypsin or V8 protease, respectively. As a consequence of this orientation, the single histidine residue in the alpha subunit is located on the stromal side of the hydrophobic domain.(ABSTRACT TRUNCATED AT 250 WORDS)

Molecular basis of maple syrup urine disease: Novel mutations at the E1[alpha] locus that impair E1([alpha][sub 2][beta][sub 2]) assembly or decrease steady-state E1[alpha] mRNA levels of branched-chain [alpha]-keto acid dehydrogenase complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chuang, J.L.; Fisher, C.R.; Chuang, D.T.

1994-08-01

The authors report the occurrence of three novel mutations in the E1[alpha] (BCKDHA) locus of the branched-chain [alpha]-keto acid dehydrogenase (BCKAD) complex that cause maple syrup urine disease (MSUD). An 8-bp deletion in exon 7 is present in one allele of a compound-heterozygous patient (GM-649). A single C nucleotide insertion in exon 2 occurs in one allele of an intermediate-MSUD patient (Lo). The second allele of patient Lo carries an A-to-G transition in exon 9 of the E1[alpha] gene. This missense mutation changes Tyr-368 to Cys (Y368C) in the E1[alpha] subunit. Both the 8-bp deletion and the single C insertionmore » generate a downstream nonsense codon. Both mutations appear to be associated with a low abundance of the mutant E1[alpha] mRNA, as determined by allele-specific oligonucleotide probing. Transfection studies strongly suggest that the Y368C substitution in the E1[alpha] subunit impairs its proper assembly with the normal E1[beta]. Unassembled as well as misassembled E1[alpha] and E1[beta] subunits are degraded in the cell. 32 refs., 8 figs.« less

Transgenic Over Expression of Nicotinic Receptor Alpha 5, Alpha 3, and Beta 4 Subunit Genes Reduces Ethanol Intake in Mice

PubMed Central

Gallego, Xavier; Ruiz, Jessica; Valverde, Olga; Molas, Susanna; Robles, Noemí; Sabrià, Josefa; Crabbe, John C.; Dierssen, Mara

2012-01-01

Abuse of alcohol and smoking are extensively co-morbid. Some studies suggest partial commonality of action of alcohol and nicotine mediated through nicotinic acetylcholine receptors (nAChRs). We tested mice with transgenic over expression of the alpha 5, alpha 3, beta 4 receptor subunit genes, which lie in a cluster on human chromosome 15, that were previously shown to have increased nicotine self-administration, for several responses to ethanol. Transgenic and wild-type mice did not differ in sensitivity to several acute behavioral responses to ethanol. However, transgenic mice drank less ethanol than wild-type in a two-bottle (ethanol vs. water) preference test. These results suggest a complex role for this receptor subunit gene cluster in the modulation of ethanol’s as well as nicotine’s effects. PMID:22459873

Cytokine gene signatures in neural tissue of horses with equine protozoal myeloencephalitis or equine herpes type 1 myeloencephalopathy.

PubMed

Pusterla, N; Wilson, W D; Conrad, P A; Barr, B C; Ferraro, G L; Daft, B M; Leutenegger, C M

2006-09-09

This study was designed to determine the relative levels of gene transcription of selected pathogens and cytokines in the brain and spinal cord of 12 horses with equine protozoal myeloencephalitis (EPM), 11 with equine herpesvirus type 1 (EHV-1) myeloencephalopathy, and 12 healthy control horses by applying a real time pcr to the formalin-fixed and paraffin-embedded tissues. Total rna was extracted from each tissue, transcribed to complementary dna (cDNA) and assayed for Sarcocystis neurona, Neospora hughesi, EHV-1, equine GAPDH (housekeeping gene), tumour necrosis factor (TNF)-alpha, interferon (IFN)-gamma, interleukin (IL)-1beta, IL-2, IL-4, IL-6, IL-8, IL-10 AND IL-12 p40. S neurona cdna was detected in the neural tissue from all 12 horses with EPM, and two of them also had amplifiable cDNA of N hughesi. The relative levels of transcription of protozoal cdna ranged from 1 to 461 times baseline (mean 123). All the horses with ehv-1 myeloencephalopathy had positive viral signals by PCR with relative levels of transcription ranging from 1 to 1618 times baseline (mean 275). All the control horses tested negative for S neurona, N hughesi and EHV-1 cdna. The cytokine profiles of each disease indicated a balance between pro- and anti-inflammatory markers. In the horses with epm the pro-inflammatory Th1 cytokines (IL-8, TNF-alpha and IFN-gamma) were commonly expressed but the anti-inflammatory Th2 cytokines (IL-4, IL-6 AND IL-10) were absent or rare. In the horses with ehv-1 the proinflammatory cytokine IL-8 was commonly expressed, but IL-10 and IFN-gamma were not, and TNF-alpha was rare. Tissue from the control horses expressed only the gene GAPDH.

Loss of tumorigenic potential by human lung tumor cells in the presence of antisense RNA specific to the ectopically synthesized alpha subunit of human chorionic gonadotropin.

PubMed

Rivera, R T; Pasion, S G; Wong, D T; Fei, Y B; Biswas, D K

1989-06-01

A clonal strain of human lung tumor cells in culture (ChaGo), derived from a bronchogenic carcinoma, synthesizes and secretes large amounts of alpha (alpha) and a comparatively lower level of beta (beta) subunit of the glycoprotein hormone, human chorionic gonadotropin (HCG). ChaGo cells lost their characteristic anchorage-independent growth phenotype in the presence of anti-alpha-HCG antibody. The effect of the antibody was partially reversed by addition of alpha-HCG to the culture medium. ChaGo cells were transfected with an expression vector (pRSV-anti-alpha-HCG), that directs synthesis of RNA complementary to alpha-HCG mRNA. The transfectants produced alpha-HCG antisense RNA which was associated with the reduced level of alpha-HCG. Transfectants also displayed several altered phenotypic properties, including altered morphology, less mitosis, reduced growth rate, loss of anchorage-independent growth, and loss of tumorigenicity in nude mice. Treatment of transfectants with 8,bromo-cAMP resulted in increased accumulation of alpha-HCG mRNA, no change in the level of alpha-HCG antisense RNA, release of the inhibition of [3H]thymidine incorporation, and restoration of anchorage-independent growth phenotype. The overexpression of c-myc, observed in ChaGo cells, was unaffected by the reduced level of alpha-HCG. These results suggest that ectopic synthesis of the alpha subunit of HCG plays a functional role in the transformation of these human lung cells.

Chimeras of the integrin beta subunit mid-region reveal regions required for heterodimer formation and for activation.

PubMed

Hyland, R H; Douglass, W A; Tan, S M; Law, S K

2001-01-01

A central region of the beta2 integrin subunit, RN (residues D300 to C459), was replaced by the equivalent sequences from beta1 and beta7 to give the chimeras beta2RN1 and beta2RN7. Whilst the former construct failed to form heterodimer at the cell surface with alphaL, the later of these could be expressed together with the alphaL subunit to form a variant LFA-1. Based on recent modelling work, the RN region consists of two parts, one is the C-terminal end of the putative A-domain (RB, residues D300 to A359), and the other the mid-region (BN, residues Y360 to C459). Chimeras exchanging the two component regions were made. Of the four resultant chimeras, only the beta2RB1 chimera failed to support LFA-1 expression. Thus the beta1 specific residues of this region affect the interaction with the alphaL subunit. Whereas the alphaL/beta2RB7 LFA-1 variant is wildtype like with respect to ICAM-1 adhesion, the alphaLbeta2BN1 and alphaLbeta2BN7, as well as the alphaLbeta2RN7, variants are more adhesive than the wildtype. These results suggest that an authentic beta2 mid-region is, in part, required for maintaining the LFA-1 in a resting state.

Decreased agonist sensitivity of human GABA(A) receptors by an amino acid variant, isoleucine to valine, in the alpha1 subunit.

PubMed

Westh-Hansen, S E; Rasmussen, P B; Hastrup, S; Nabekura, J; Noguchi, K; Akaike, N; Witt, M R; Nielsen, M

1997-06-25

Recombinant human GABA(A) receptors were investigated in vitro by coexpression of cDNAs coding for alpha1, beta2, and gamma2 subunits in the baculovirus/Sf-9 insect cell system. We report that a single amino acid exchange (isoleucine 121 to valine 121) in the N-terminal, extracellular part of the alpha1 subunit induces a marked decrease in agonist GABA(A) receptor ligand sensitivity. The potency of muscimol and GABA to inhibit the binding of the GABA(A) receptor antagonist [3H]SR 95531 (2-(3-carboxypropyl)-3-amino-6-(4-methoxyphenyl)pyridazinium bromide) was higher in receptor complexes of alpha1(ile 121) beta2gamma2 than in those of alpha1(val 121) beta2gamma2 (IC50 values were 32-fold and 26-fold lower for muscimol and GABA, respectively). The apparent affinity of the GABA(A) receptor antagonist bicuculline methiodide to inhibit the binding of [3H]SR 95531 did not differ between the two receptor complex variants. Electrophysiological measurements of GABA induced whole-cell Cl- currents showed a ten-fold decrease in the GABA(A) receptor sensitivity of alpha1 (val 121) beta2gamma2 as compared to alpha1(ile 121) beta2gamma2 receptor complexes. Thus, a relatively small change in the primary structure of the alpha1 subunit leads to a decrease selective for GABA(A) receptor sensitivity to agonist ligands, since no changes were observed in a GABA(A) receptor antagonist affinity and benzodiazepine receptor binding.

Cloning, expression, and mapping of allergenic determinants of alphaS1-casein, a major cow's milk allergen.

PubMed

Schulmeister, Ulrike; Hochwallner, Heidrun; Swoboda, Ines; Focke-Tejkl, Margarete; Geller, Beate; Nystrand, Mats; Härlin, Annika; Thalhamer, Josef; Scheiblhofer, Sandra; Keller, Walter; Niggemann, Bodo; Quirce, Santiago; Ebner, Christoph; Mari, Adriano; Pauli, Gabrielle; Herz, Udo; Valenta, Rudolf; Spitzauer, Susanne

2009-06-01

Milk is one of the first components introduced into human diet. It also represents one of the first allergen sources, which induces IgE-mediated allergies in childhood ranging from gastrointestinal, skin, and respiratory manifestations to severe life-threatening manifestations, such as anaphylaxis. Here we isolated a cDNA coding for a major cow's milk allergen, alphaS1-casein, from a bovine mammary gland cDNA library with allergic patients' IgE Abs. Recombinant alphaS1-casein was expressed in Escherichia coli, purified, and characterized by circular dichroism as a folded protein. IgE epitopes of alphaS1-casein were determined with recombinant fragments and synthetic peptides spanning the alphaS1-casein sequence using microarrayed components and sera from 66 cow's milk-sensitized patients. The allergenic activity of ralphaS1-casein and the alphaS1-casein-derived peptides was determined using rat basophil leukemia cells transfected with human FcepsilonRI, which had been loaded with the patients' serum IgE. Our results demonstrate that ralphaS1-casein as well as alphaS1-casein-derived peptides exhibit IgE reactivity, but mainly the intact ralphaS1-casein induced strong basophil degranulation. These results suggest that primarily intact alphaS1-casein or larger IgE-reactive portions thereof are responsible for IgE-mediated symptoms of food allergy. Recombinant alphaS1-casein as well as alphaS1-casein-derived peptides may be used in clinical studies to further explore pathomechanisms of food allergy as well as for the development of new diagnostic and therapeutic strategies for milk allergy.

Crystal structure of heterotetrameric sarcosine oxidase from Corynebacterium sp. U-96

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ida, Koh; E-mail: idakoh@sci.kitasato-u.ac.jp; Moriguchi, Tomotaka

2005-07-29

Sarcosine oxidase from Corynebacterium sp. U-96 is a heterotetrameric enzyme. Here we report the crystal structures of the enzyme in complex with dimethylglycine and folinic acid. The {alpha} subunit is composed of two domains, contains NAD{sup +}, and binds folinic acid. The {beta} subunit contains dimethylglycine, FAD, and FMN, and these flavins are approximately 10 A apart. The {gamma} subunit is in contact with two domains of {alpha} subunit and has possibly a folate-binding structure. The {delta} subunit contains a single atom of zinc and has a Cys{sub 3}His zinc finger structure. Based on the structures determined and on themore » previous works, the structure-function relationship on the heterotetrameric sarcosine oxidase is discussed.« less

Crystal structure of the bacterial luciferase/flavin complex provides insight into the function of the beta subunit.

PubMed

Campbell, Zachary T; Weichsel, Andrzej; Montfort, William R; Baldwin, Thomas O

2009-07-07

Bacterial luciferase from Vibrio harveyi is a heterodimer composed of a catalytic alpha subunit and a homologous but noncatalytic beta subunit. Despite decades of enzymological investigation, structural evidence defining the active center has been elusive. We report here the crystal structure of V. harveyi luciferase bound to flavin mononucleotide (FMN) at 2.3 A. The isoalloxazine ring is coordinated by an unusual cis-Ala-Ala peptide bond. The reactive sulfhydryl group of Cys106 projects toward position C-4a, the site of flavin oxygenation. This structure also provides the first data specifying the conformations of a mobile loop that is crystallographically disordered in both prior crystal structures [(1995) Biochemistry 34, 6581-6586; (1996) J. Biol. Chem. 271, 21956 21968]. This loop appears to be a boundary between solvent and the active center. Within this portion of the protein, a single contact was observed between Phe272 of the alpha subunit, not seen in the previous structures, and Tyr151 of the beta subunit. Substitutions at position 151 on the beta subunit caused reductions in activity and total quantum yield. Several of these mutants were found to have decreased affinity for reduced flavin mononucleotide (FMNH(2)). These findings partially address the long-standing question of how the beta subunit stabilizes the active conformation of the alpha subunit, thereby participating in the catalytic mechanism.

The Val192Leu mutation in the alpha-subunit of beta-hexosaminidase A is not associated with the B1-variant form of Tay-Sachs disease.

PubMed Central

Hou, Y.; Vavougios, G.; Hinek, A.; Wu, K. K.; Hechtman, P.; Kaplan, F.; Mahuran, D. J.

1996-01-01

Substitution mutations adversely affecting the alpha-subunit of beta-hexosaminidase A (alphabeta) (EC 3.2.1.52) result in Tay-Sachs disease. The majority affect the initial folding of the pro-alpha chain in the endoplasmic reticulum, resulting in its retention and degradation. A much less common occurrence is a mutation that specifically affects an "active-site" residue necessary for substrate binding and/or catalysis. In this case, hexosaminidase A is present in the lysosome, but it lacks all alpha-specific activity. This biochemical phenotype is referred to as the "B1-variant form" of Tay-Sachs disease. Kinetic analysis of suspected B1-variant mutations is complex because hexosaminidase A is heterodimeric and both subunits possess similar active sites. In this report, we examine a previously identified B1-variant mutation, alpha-Val192Leu. Chinese hamster ovary cells were permanently cotransfected with an alpha-cDNA-construct encoding the substitution and a mutant beta-cDNA (beta-Arg211Lys), encoding a beta-subunit that is inactive but normal in all other respects. We were surprised to find that the Val192Leu substitution, produced a pro-alpha chain that did not form alpha-beta dimers and was not transported to the lysosome. Finally, we reexamined the hexosaminidase activity and protein levels in the fibroblasts from the original patient. These data were also not consistent with the biochemical phenotype of the B1 variant of Tay-Sachs disease previously reported to be present. Thus, we conclude that the Val192Leu substitution does not specifically affect the alpha-active site. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:8659543

The Val192Leu mutation in the alpha-subunit of beta-hexosaminidase A is not associated with the B1-variant form of Tay-Sachs disease.

PubMed

Hou, Y; Vavougios, G; Hinek, A; Wu, K K; Hechtman, P; Kaplan, F; Mahuran, D J

1996-07-01

Substitution mutations adversely affecting the alpha-subunit of beta-hexosaminidase A (alphabeta) (EC 3.2.1.52) result in Tay-Sachs disease. The majority affect the initial folding of the pro-alpha chain in the endoplasmic reticulum, resulting in its retention and degradation. A much less common occurrence is a mutation that specifically affects an "active-site" residue necessary for substrate binding and/or catalysis. In this case, hexosaminidase A is present in the lysosome, but it lacks all alpha-specific activity. This biochemical phenotype is referred to as the "B1-variant form" of Tay-Sachs disease. Kinetic analysis of suspected B1-variant mutations is complex because hexosaminidase A is heterodimeric and both subunits possess similar active sites. In this report, we examine a previously identified B1-variant mutation, alpha-Val192Leu. Chinese hamster ovary cells were permanently cotransfected with an alpha-cDNA-construct encoding the substitution and a mutant beta-cDNA (beta-Arg211Lys), encoding a beta-subunit that is inactive but normal in all other respects. We were surprised to find that the Val192Leu substitution, produced a pro-alpha chain that did not form alpha-beta dimers and was not transported to the lysosome. Finally, we reexamined the hexosaminidase activity and protein levels in the fibroblasts from the original patient. These data were also not consistent with the biochemical phenotype of the B1 variant of Tay-Sachs disease previously reported to be present. Thus, we conclude that the Val192Leu substitution does not specifically affect the alpha-active site.

Epidermal growth factor system is a physiological regulator of development of the mouse fetal submandibular gland and regulates expression of the alpha6-integrin subunit.

PubMed

Kashimata, M; Gresik, E W

1997-02-01

Epidermal growth factor (EGF) and transforming growth factor-alpha (TGF-alpha) regulate branching morphogenesis of fetal mouse submandibular gland (SMG) rudiments in vitro. The EGF system (EGF, TGF-alpha, and their shared receptor, EGFR) also regulates expression of integrins and their ligands in the extracellular matrix. We show here that inhibition of EGFR tyrosine-kinase activity by a tyrphostin retards in vitro development of SMGs. Using total RNA isolated from pooled SMGs taken from intact mouse fetuses, mRNA transcripts for EGF, TGF-alpha, and EGFR were detected by reverse transcription-polymerase chain reaction (RT-PCR), and age-dependent variations in the levels of these mRNA were quantitatively determined by nuclease protection assays. These findings suggest that the EGF system is operative in the in vivo development of this gland. alpha6-Integrin subunit was localized by immunofluorescence at the basal surface of epithelial cells. Branching morphogenesis of cultured SMG rudiments was inhibited by anti-alpha6 antibodies. Synthesis of alpha6-subunit in cultured SMGs, detected by metabolic labeling and immunoprecipitation, was increased by EGF and drastically reduced by tyrphostin. RT-PCR revealed that mRNAs for alpha6- and beta1- and beta4-integrin subunits are expressed at all ages between embryonic day 13 and postnatal day 7. These findings suggest that 1) the EGF system is a physiologic regulator of development of fetal mouse SMG, and 2) one mechanism by which it acts may be by regulating expression of integrins, which in turn control interaction of epithelial cells with the extracellular matrix.

Secondary reduction of alpha7B integrin in laminin alpha2 deficient congenital muscular dystrophy supports an additional transmembrane link in skeletal muscle.

PubMed

Cohn, R D; Mayer, U; Saher, G; Herrmann, R; van der Flier, A; Sonnenberg, A; Sorokin, L; Voit, T

1999-03-01

The integrins are a large family of heterodimeric transmembrane cellular receptors which mediate the association between the extracellular matrix (ECM) and cytoskeletal proteins. The alpha7beta1 integrin is a major laminin binding integrin in skeletal and cardiac muscle and is thought to be involved in myogenic differentiation and migration processes. The main binding partners of the alpha7 integrin are laminin-1 (alpha1-beta1-gamma1), laminin-2 (alpha2-beta1-gamma1) and laminin-4 (alpha2-beta2-gamma1). Targeted deletion of the gene for the alpha7 integrin subunit (ITGA7) in mice leads to a novel form of muscular dystrophy. In the present study we have investigated the expression of two alternative splice variants, the alpha7B and beta1D integrin subunits, in normal human skeletal muscle, as well as in various forms of muscular dystrophy. In normal human skeletal muscle the expression of the alpha7 integrin subunit appeared to be developmentally regulated: it was first detected at 2 years of age. In contrast, the beta1D integrin could be detected in immature and mature muscle in the sarcolemma of normal fetal skeletal muscle at 18 weeks gestation. The expression of alpha7B integrin was significantly reduced at the sarcolemma in six patients with laminin alpha2 chain deficient congenital muscular dystrophy (CMD) (age >2 years). However, this reduction was not correlated with the amount of laminin alpha2 chain expressed. In contrast, the expression of the laminin alpha2 chain was not altered in the skeletal muscle of the alpha7 knock-out mice. These data argue in favor that there is not a tight correlation between the expression of the alpha7 integrin subunit and that of the laminin alpha2 chain in either human or murine dystrophic muscle. Interestingly, in dystrophinopathies (Duchenne and Becker muscular dystrophy; DMD/BMD) expression of alpha7B was upregulated irrespective of the level of dystrophin expression as shown by a strong sarcolemmal staining pattern even in young boys (age <2 years). The expression of the beta1D integrin subunit was not altered in any of our patients with different types of muscular dystrophy. In contrast, sarcolemmal expression of beta1D integrin was significantly reduced in the alpha7 integrin knock-out mice, whereas the expression of the components of the DGC was not altered. The secondary loss of alpha7B in laminin alpha2 chain deficiency defines a biochemical change in the composition of the plasma membrane resulting from a primary protein deficiency in the basal lamina. These findings, in addition to the occurrence of a muscular dystrophy in alpha7 deficient mice, implies that the alpha7B integrin is an important laminin receptor within the plasma membrane which plays a significant role in skeletal muscle function and stability.

In vivo mechanism-based inactivation of S-adenosylmethionine decarboxylases from Escherichia coli, Salmonella typhimurium, and Saccharomyces cerevisiae.

PubMed

Li, Y F; Hess, S; Pannell, L K; White Tabor, C; Tabor, H

2001-09-11

S-adenosylmethionine decarboxylase (AdoMetDC), a key enzyme in the biosynthesis of spermidine and spermine, is first synthesized as a proenzyme, which is cleaved posttranslationally to form alpha and beta subunits. The alpha subunit contains a covalently bound pyruvoyl group derived from serine that is essential for activity. With the use of an Escherichia coli overexpression system, we have purified AdoMetDCs encoded by the E. coli, Saccharomyces cerevisiae, and Salmonella typhimurium genes. Unexpectedly we found by mass spectrometry that these enzymes had been modified posttranslationally in vivo by a mechanism-based "suicide" inactivation. A large percentage of the alpha subunit of each enzyme had been modified in vivo to give peaks with masses m/z = 57 +/- 1 and m/z = 75 +/- 1 daltons higher than the parent peak. AdoMetDC activity decreased markedly during overexpression concurrently with the increase of the additional peaks for the alpha subunit. Sequencing of a tryptic fragment by tandem mass spectrometry showed that Cys-140 was modified with a +75 +/- 1 adduct, which is probably derived from the reaction product. Comparable modification of the alpha subunit was also observed in in vitro experiments after incubation with the substrate or with the reaction product, which is consistent with the in vitro alkylation of E. coli AdoMetDC reported by Diaz and Anton [Diaz, E. & Anton, D. L. (1991) Biochemistry 30, 4078-4081].

Crystallographic structure of human beta-hexosaminidase A: interpretation of Tay-Sachs mutations and loss of GM2 ganglioside hydrolysis.

PubMed

Lemieux, M Joanne; Mark, Brian L; Cherney, Maia M; Withers, Stephen G; Mahuran, Don J; James, Michael N G

2006-06-16

Lysosomal beta-hexosaminidase A (Hex A) is essential for the degradation of GM2 gangliosides in the central and peripheral nervous system. Accumulation of GM2 leads to severely debilitating neurodegeneration associated with Tay-Sachs disease (TSD), Sandoff disease (SD) and AB variant. Here, we present the X-ray crystallographic structure of Hex A to 2.8 A resolution and the structure of Hex A in complex with NAG-thiazoline, (NGT) to 3.25 A resolution. NGT, a mechanism-based inhibitor, has been shown to act as a chemical chaperone that, to some extent, prevents misfolding of a Hex A mutant associated with adult onset Tay Sachs disease and, as a result, increases the residual activity of Hex A to a level above the critical threshold for disease. The crystal structure of Hex A reveals an alphabeta heterodimer, with each subunit having a functional active site. Only the alpha-subunit active site can hydrolyze GM2 gangliosides due to a flexible loop structure that is removed post-translationally from beta, and to the presence of alphaAsn423 and alphaArg424. The loop structure is involved in binding the GM2 activator protein, while alphaArg424 is critical for binding the carboxylate group of the N-acetyl-neuraminic acid residue of GM2. The beta-subunit lacks these key residues and has betaAsp452 and betaLeu453 in their place; the beta-subunit therefore cleaves only neutral substrates efficiently. Mutations in the alpha-subunit, associated with TSD, and those in the beta-subunit, associated with SD are discussed. The effect of NGT binding in the active site of a mutant Hex A and its effect on protein function is discussed.

Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

PubMed Central

Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

1985-01-01

The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

Low concentrations of ethanol do not affect radioligand binding to the delta-subunit-containing GABAA receptors in the rat brain.

PubMed

Mehta, Ashok K; Marutha Ravindran, C R; Ticku, Maharaj K

2007-08-24

In the present study, we investigated the co-localization pattern of the delta subunit with other subunits of GABA(A) receptors in the rat brain using immunoprecipitation and Western blotting techniques. Furthermore, we investigated whether low concentrations of ethanol affect the delta-subunit-containing GABA(A) receptor assemblies in the rat brain using radioligand binding to the rat brain membrane homogenates as well as to the immunoprecipitated receptor assemblies. Our results revealed that delta subunit is not co-localized with gamma(2) subunit but it is associated with the alpha(1), alpha(4) or alpha(6), beta(2) and/or beta(3) subunit(s) of GABA(A) receptors in the rat brain. Ethanol (1-50 mM) neither affected [(3)H]muscimol (3 nM) binding nor diazepam-insensitive [(3)H]Ro 15-4513 (2 nM) binding in the rat cerebellum and cerebral cortex membranes. However, a higher concentration of ethanol (500 mM) inhibited the binding of these radioligands to the GABA(A) receptors partially in the rat cerebellum and cerebral cortex. Similarly, ethanol (up to 50 mM) did not affect [(3)H]muscimol (15 nM) binding to the immunoprecipitated delta-subunit-containing GABA(A) receptor assemblies in the rat cerebellum and hippocampus but it inhibited the binding partially at a higher concentration (500 mM). These results suggest that the native delta-subunit-containing GABA(A) receptors do not play a major role in the pharmacology of clinically relevant low concentrations of ethanol.

Expression of bitter taste receptors of the T2R family in the gastrointestinal tract and enteroendocrine STC-1 cells.

PubMed

Wu, S Vincent; Rozengurt, Nora; Yang, Moon; Young, Steven H; Sinnett-Smith, James; Rozengurt, Enrique

2002-02-19

Although a role for the gastric and intestinal mucosa in molecular sensing has been known for decades, the initial molecular recognition events that sense the chemical composition of the luminal contents has remained elusive. Here we identified putative taste receptor gene transcripts in the gastrointestinal tract. Our results, using reverse transcriptase-PCR, demonstrate the presence of transcripts corresponding to multiple members of the T2R family of bitter taste receptors in the antral and fundic gastric mucosa as well as in the lining of the duodenum. In addition, cDNA clones of T2R receptors were detected in a rat gastric endocrine cell cDNA library, suggesting that these receptors are expressed, at least partly, in enteroendocrine cells. Accordingly, expression of multiple T2R receptors also was found in STC-1 cells, an enteroendocrine cell line. The expression of alpha subunits of G proteins implicated in intracellular taste signal transduction, namely Galpha(gust), and Galpha(t)-(2), also was demonstrated in the gastrointestinal mucosa as well as in STC-1 cells, as revealed by reverse transcriptase-PCR and DNA sequencing, immunohistochemistry, and Western blotting. Furthermore, addition of compounds widely used in bitter taste signaling (e.g., denatonium, phenylthiocarbamide, 6-n-propil-2-thiouracil, and cycloheximide) to STC-1 cells promoted a rapid increase in intracellular Ca(2+) concentration. These results demonstrate the expression of bitter taste receptors of the T2R family in the mouse and rat gastrointestinal tract.

The Helicoverpa zea (Boddie) (Lepidoptera: Noctuidae) voltage-gated sodium channel and mutations associated with pyrethroid resistance in field-collected adult males.

PubMed

Hopkins, B W; Pietrantonio, P V

2010-05-01

Helicoverpa zea is one of the most costly insect pests of food and fiber crops throughout the Americas. Pyrethroid insecticides are widely applied for its control as they are effective and relatively inexpensive; however, resistance to pyrethroids threatens agricultural systems sustainability because alternative insecticides are often more expensive or less effective. Although pyrethroid resistance has been identified in this pest since 1990, the mechanisms of resistance have not yet been elucidated at the molecular level. Pyrethroids exert their toxicity by prolonging the open state of the voltage-gated sodium channel. Here we report the cDNA sequence of the H. zea sodium channel alpha-subunit homologous to the para gene from Drosophila melanogaster. In field-collected males which were resistant to cypermethrin as determined by the adult vial test, we identify known resistance-conferring mutations L1029H and V421M, along with two novel mutations at the V421 residue, V421A and V421G. An additional mutation, I951V, may be the first example of a pyrethroid resistance mutation caused by RNA editing. Identification of the sodium channel cDNA sequence will allow for testing hypotheses on target-site resistance for insecticides acting on this channel through modeling and expression studies. Understanding the mechanisms responsible for resistance will greatly improve our ability to identify and predict resistance, as well as preserve susceptibility to pyrethroid insecticides. Copyright 2010 Elsevier Ltd. All rights reserved.

Isolated spinach ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit .sup..epsilon. N-methyltransferase and method of inactivating ribulose-1,5-bisphosphatase carboxylase/oxygenase large subunit .sup..epsilon. N-methyltransferase activity

DOEpatents

Houtz, Robert L.

1999-01-01

The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS) .sup..epsilon. N-methyltransferase (protein methylase III or Rubisco LSMT) from a plant which has a des(methyl) lysyl residue in the LS is disclosed. In addition, the full-length cDNA clones for Rubisco LSMT are disclosed. Transgenic plants and methods of producing same which have the Rubisco LSMT gene inserted into the DNA are also provided. Further, methods of inactivating the enzymatic activity of Rubisco LSMT are also disclosed.

Progesterone modulation of alpha5 nAChR subunits influences anxiety-related behavior during estrus cycle.

PubMed

Gangitano, D; Salas, R; Teng, Y; Perez, E; De Biasi, M

2009-06-01

Smokers often report an anxiolytic effect of cigarettes. In addition, stress-related disorders such as anxiety, post-traumatic stress syndrome and depression are often associated with chronic nicotine use. To study the role of the alpha5 nicotinic acetylcholine receptor subunit in anxiety-related responses, control and alpha5 subunit null mice (alpha5(-/-)) were subjected to the open field activity (OFA), light-dark box (LDB) and elevated plus maze (EPM) tests. In the OFA and LDB, alpha5(-/-) behaved like wild-type controls. In the EPM, female alpha5(-/-) mice displayed an anxiolytic-like phenotype, while male alpha5(-/-) mice were undistinguishable from littermate controls. We studied the hypothalamus-pituitary-adrenal axis by measuring plasma corticosterone and hypothalamic corticotropin-releasing factor. Consistent with an anxiolytic-like phenotype, female alpha5(-/-) mice displayed lower basal corticosterone levels. To test whether gonadal steroids regulate the expression of alpha5, we treated cultured NTera 2 cells with progesterone and found that alpha5 protein levels were upregulated. In addition, brain levels of alpha5 mRNA increased upon progesterone injection into ovariectomized wild-type females. Finally, we tested anxiety levels in the EPM during the estrous cycle. The estrus phase (when progesterone levels are low) is anxiolytic-like in wild-type mice, but no cycle-dependent fluctuations in anxiety levels were found in alpha5(-/-) females. Thus, alpha5-containing neuronal nicotinic acetylcholine receptors may be mediators of anxiogenic responses, and progesterone-dependent modulation of alpha5 expression may contribute to fluctuations in anxiety levels during the ovarian cycle.

Photoaffinity labeling of the Torpedo californica nicotinic acetylcholine receptor with an aryl azide derivative of phosphatidylserine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blanton, M.P.; Wang, H.H.

1990-02-06

A photoactivatable analogue of phosphatidylserine, {sup 125}I-labeled 4-azidosalicylic acid-phosphatidylserine ({sup 125}I ASA-PS), was used to label both native acetylcholine receptor (AchR)-rich membranes from Torpedo californica and AchR membranes affinity purified from Torpedo reconstituted into asolectin vesicles. The radioiodinated arylazido group attaches directly to the phospholipid head group and thus probes for regions of the AchR structure in contact with the negatively charged head group of phosphatidylserine. All four subunits of the AchR incorporated the label, with the {alpha} subunit incorporating approximately twice as much as each of the other subunits on a per mole basis. The regions of the AchRmore » {alpha} subunit that incorporated {sup 125}I ASA-PS were mapped by Staphylococcus aureus V8 protease digestion. The majority of label incorporated into fragments representing a more complete digestion of the {alpha} subunit was localized to 11.7- and 10.1-kDa V8 cleavage fragments, both beginning at Asn-339 and of sufficient length to contain the hydrophobic region M4. An 18.7-kDa fragment beginning at Ser-173 and of sufficient length to contain the hydrophobic regions M1, M2, and M3 was also significantly labeled. In contrast, V8 cleavage fragments representing roughly a third of the amino-terminal portion of the {alpha} subunit incorporated little or no detectable amount of probe.« less

Glycosylation and processing of high-mannose oligosaccharides of thyroid-stimulating hormone subunits: comparison to nonsecretory cell glycoproteins.

PubMed

Ronin, C; Stannard, B S; Rosenbloom, I L; Magner, J A; Weintraub, B D

1984-09-25

Thyroid-stimulating hormone (TSH) subunit glycosylation was compared to that of total cell glycoproteins in mouse thyrotropic tumors. Lipid-linked oligosaccharides, total cell glycoproteins, and TSH subunits were labeled with either [3H]mannose, [3H]galactose, or [3H]glucose in pulse and pulse-chase experiments. The various oligosaccharides were isolated respectively by lipid extraction and mild acid hydrolysis, by selective immunoprecipitation, or by acid precipitation followed by trypsin and endoglycosidase H treatment. The nature of the oligosaccharides was assessed by their migration in paper chromatography, their relative incorporation of different precursors, and also their resistance to alpha-mannosidase. At 60 min, lipid-linked oligosaccharides were found to be composed of Glc3-2Man9GlcNAc2, Man9-8GlcNAc2, and Man5GlcNAc2. At 10 or 60 min of labeling, total cell proteins contained Glc3Man9GlcNAc2, Glc1Man9GlcNAc2, Man9GlcNAc2, Glc1Man8GlcNAc2, Man8GlcNAc2, and Man7GlcNAc2. The largest oligosaccharide, Glc3Man9GlcNAc2, had an unusually long half-life of about 2 h. In contrast, no Glc3Man9GlcNAc2 was found either on TSH + alpha subunits or on free beta subunits isolated either by immunoprecipitation or by sodium dodecyl sulfate gel electrophoresis. Instead, primarily Man9GlcNAc2 was found after a 10-min pulse both on TSH + alpha subunits and on beta subunits. When the pulse was followed by a chase up to 2 h, there was a progressive increase in Man8GlcNAc2 in higher amounts on TSH + alpha-subunit carbohydrate chains than on beta subunits.(ABSTRACT TRUNCATED AT 250 WORDS)

The NH2-terminal php domain of the alpha subunit of the Escherichia coli replicase binds the epsilon proofreading subunit.

PubMed

Wieczorek, Anna; McHenry, Charles S

2006-05-05

The alpha subunit of the replicase of all bacteria contains a php domain, initially identified by its similarity to histidinol phosphatase but of otherwise unknown function (Aravind, L., and Koonin, E. V. (1998) Nucleic Acids Res. 26, 3746-3752). Deletion of 60 residues from the NH2 terminus of the alpha php domain destroys epsilon binding. The minimal 255-residue php domain, estimated by sequence alignment with homolog YcdX, is insufficient for epsilon binding. However, a 320-residue segment including sequences that immediately precede the polymerase domain binds epsilon with the same affinity as the 1160-residue full-length alpha subunit. A subset of mutations of a conserved acidic residue (Asp43 in Escherichia coli alpha) present in the php domain of all bacterial replicases resulted in defects in epsilon binding. Using sequence alignments, we show that the prototypical gram+ Pol C, which contains the polymerase and proofreading activities within the same polypeptide chain, has an epsilon-like sequence inserted in a surface loop near the center of the homologous YcdX protein. These findings suggest that the php domain serves as a platform to enable coordination of proofreading and polymerase activities during chromosomal replication.

Identification of amino acids in the nicotinic acetylcholine receptor agonist binding site and ion channel photolabeled by 4-[(3-trifluoromethyl)-3H-diazirin-3-yl]benzoylcholine, a novel photoaffinity antagonist.

PubMed

Chiara, David C; Trinidad, Jonathan C; Wang, Dong; Ziebell, Michael R; Sullivan, Deirdre; Cohen, Jonathan B

2003-01-21

[(3)H]4-[(3-trifluoromethyl)-3H-diazirin-3-yl]benzoylcholine (TDBzcholine) was synthesized and used as a photoaffinity probe to map the orientation of an aromatic choline ester within the agonist binding sites of the Torpedo nicotinic acetylcholine receptor (nAChR). TDBzcholine acts as a nAChR competitive antagonist that binds at equilibrium with equal affinity to both agonist sites (K(D) approximately 10 microM). Upon UV irradiation (350 nm), nAChR-rich membranes equilibrated with [(3)H]TDBzcholine incorporate (3)H into the alpha, gamma, and delta subunits in an agonist-inhibitable manner. The specific residues labeled by [(3)H]TDBzcholine were determined by N-terminal sequence analysis of subunit fragments produced by enzymatic cleavage and purified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and/or reversed-phase high-performance liquid chromatography. For the alpha subunit, [(3)H]TDBzcholine photoincorporated into alphaCys-192, alphaCys-193, and alphaPro-194. For the gamma and delta subunits, [(3)H]TDBzcholine incorporated into homologous leucine residues, gammaLeu-109 and deltaLeu-111. The photolabeling of these amino acids suggests that when the antagonist TDBzcholine occupies the agonist binding sites, the Cys-192-193 disulfide and Pro-194 from the alpha subunit Segment C are oriented toward the agonist site and are in proximity to gammaLeu-109/deltaLeu-111 in Segment E, a conclusion consistent with the structure of the binding site in the molluscan acetylcholine binding protein, a soluble protein that is homologous to the nAChR extracellular domain.

Integrin alphaIIb-subunit cytoplasmic domain mutations demonstrate a requirement for tyrosine phosphorylation of beta3-subunits in actin cytoskeletal organization.

PubMed

Yamodo, Innocent H; Blystone, Scott D

2004-01-01

Using truncated or mutated alphaIIb integrin cytoplasmic domains fused to the alphaV extracellular domain and expressed with the beta3 integrin subunit, we demonstrate that the double mutation of proline residues 998 and 999 to alanine (PP998/999AA), previously shown to disturb the C-terminal conformation of the alphaIIb integrin cytoplasmic domain, prevents tyrosine phosphorylation of beta3 integrin induced by Arg-Gly-Asp peptide ligation. This mutation also inhibits integrin mediated actin assembly and cell adhesion to vitronectin. In contrast, progressive truncation of the alphaIIb-subunit cytoplasmic domain did not reproduce these effects. Interestingly, the PP998/999AA mutations of alphaIIb did not affect beta3 tyrosine phosphorylation, cell adhesion, or actin polymerization induced by manganese. Exogenous addition of manganese was sufficient to rescue beta3 phosphorylation, cell adhesion, and actin assembly in cells expressing the PP998/999AA mutation when presented with a vitronectin substrate. Further, induction of the high affinity conformation of this mutant beta3 integrin by incubation with either Arg-Gly-Asp peptide or exogenous manganese was equivalent. These results suggest that the extracellular structure of beta3 integrins in the high affinity conformation is not directly related to the structure of the cytoplasmic face of the integrin. Moreover, the requirement for beta3 phosphorylation is demonstrated without mutation of the beta3 subunit. In support of our previous hypothesis of a role for beta3 phosphorylation in adhesion, these studies demonstrate a strong correlation between beta3 tyrosine phosphorylation and assembly of a cytoskeleton competent to support firm cell adhesion.

Transgenic over expression of nicotinic receptor alpha 5, alpha 3, and beta 4 subunit genes reduces ethanol intake in mice.

PubMed

Gallego, Xavier; Ruiz-Medina, Jessica; Valverde, Olga; Molas, Susanna; Robles, Noemí; Sabrià, Josefa; Crabbe, John C; Dierssen, Mara

2012-05-01

Abuse of alcohol and smoking are extensively co-morbid. Some studies suggest partial commonality of action of alcohol and nicotine mediated through nicotinic acetylcholine receptors (nAChRs). We tested mice with transgenic over expression of the alpha 5, alpha 3, beta 4 receptor subunit genes, which lie in a cluster on human chromosome 15, that were previously shown to have increased nicotine self-administration, for several responses to ethanol. Transgenic and wild-type mice did not differ in sensitivity to several acute behavioral responses to ethanol. However, transgenic mice drank less ethanol than wild-type in a two-bottle (ethanol vs. water) preference test. These results suggest a complex role for this receptor subunit gene cluster in the modulation of ethanol's as well as nicotine's effects. Copyright © 2012. Published by Elsevier Inc.

Molecular Cloning, Characterization, and Expression Analysis of a Prolyl 4-Hydroxylase from the Marine Sponge Chondrosia reniformis.

PubMed

Pozzolini, Marina; Scarfì, Sonia; Mussino, Francesca; Ferrando, Sara; Gallus, Lorenzo; Giovine, Marco

2015-08-01

Prolyl 4-hydroxylase (P4H) catalyzes the hydroxylation of proline residues in collagen. P4H has two functional subunits, α and β. Here, we report the cDNA cloning, characterization, and expression analysis of the α and β subunits of the P4H derived from the marine sponge Chondrosia reniformis. The amino acid sequence of the α subunit is 533 residues long with an M r of 59.14 kDa, while the β subunit counts 526 residues with an M r of 58.75 kDa. Phylogenetic analyses showed that αP4H and βP4H are more related to the mammalian sequences than to known invertebrate P4Hs. Western blot analysis of sponge lysate protein cross-linking revealed a band of 240 kDa corresponding to an α2β2 tetramer structure. This result suggests that P4H from marine sponges shares the same quaternary structure with vertebrate homologous enzymes. Gene expression analyses showed that αP4H transcript is higher in the choanosome than in the ectosome, while the study of factors affecting its expression in sponge fragmorphs revealed that soluble silicates had no effect on the αP4H levels, whereas ascorbic acid strongly upregulated the αP4H mRNA. Finally, treatment with two different tumor necrosis factor (TNF)-alpha inhibitors determined a significant downregulation of αP4H gene expression in fragmorphs demonstrating, for the first time in Porifera, a positive involvement of TNF in sponge matrix biosynthesis. The molecular characterization of P4H genes involved in collagen hydroxylation, including the mechanisms that regulate their expression, is a key step for future recombinant sponge collagen production and may be pivotal to understand pathological mechanisms related to extracellular matrix deposition in higher organisms.

Atrial natriuretic peptide regulates lipid mobilization and oxygen consumption in human adipocytes by activating AMPK

DOE Office of Scientific and Technical Information (OSTI.GOV)

Souza, Sandra C.; Chau, Mary D.L.; Yang, Qing

2011-07-08

Highlights: {yields} Treatment of differentiated human adipocytes with atrial natriuretic peptide (ANP) increased lipolysis and oxygen consumption by activating AMP-activated protein kinase (AMPK). {yields} ANP stimulated lipid mobilization by selective activation of the alpha2 subunit of AMPK and increased energy utilization through activation of both the alpha1 and alpha2 subunits of AMPK. {yields} ANP enhanced adipocyte mitochondrial oxidative capacity as evidenced by induction of oxidative mitochondrial genes and increase in oxygen consumption. {yields} Exposure of human adipocytes to fatty acids and (TNF{alpha}) induced insulin resistance and decreased expression of mitochondrial genes which was restored to normal by ANP. -- Abstract:more » Atrial natriuretic peptide (ANP) has been shown to regulate lipid and carbohydrate metabolism providing a possible link between cardiovascular function and metabolism by mediating the switch from carbohydrate to lipid mobilization and oxidation. ANP exerts a potent lipolytic effect via cGMP-dependent protein kinase (cGK)-I mediated-stimulation of AMP-activated protein kinase (AMPK). Activation of the ANP/cGK signaling cascade also promotes muscle mitochondrial biogenesis and fat oxidation. Here we demonstrate that ANP regulates lipid metabolism and oxygen utilization in differentiated human adipocytes by activating the alpha2 subunit of AMPK. ANP treatment increased lipolysis by seven fold and oxygen consumption by two fold, both of which were attenuated by inhibition of AMPK activity. ANP-induced lipolysis was shown to be mediated by the alpha2 subunit of AMPK as introduction of dominant-negative alpha2 subunit of AMPK attenuated ANP effects on lipolysis. ANP-induced activation of AMPK enhanced mitochondrial oxidative capacity as evidenced by a two fold increase in oxygen consumption and induction of mitochondrial genes, including carnitine palmitoyltransferase 1A (CPT1a) by 1.4-fold, cytochrome C (CytC) by 1.3-fold, and peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} (PGC-1{alpha}) by 1.4-fold. Treatment of human adipocytes with fatty acids and tumor necrosis factor {alpha} (TNF{alpha}) induced insulin resistance and down-regulation of mitochondrial genes, which was restored by ANP treatment. These results show that ANP regulates lipid catabolism and enhances energy dissipation through AMPK activation in human adipocytes.« less

Molecular basis and function of voltage-gated K+ channels in pulmonary arterial smooth muscle cells.

PubMed

Yuan, X J; Wang, J; Juhaszova, M; Golovina, V A; Rubin, L J

1998-04-01

K(+)-channel activity-mediated alteration of the membrane potential and cytoplasmic free Ca2+ concentration ([Ca2+]cyt) is a pivotal mechanism in controlling pulmonary vasomotor tone. By using combined approaches of patch clamp, imaging fluorescent microscopy, and molecular biology, we examined the electrophysiological properties of K+ channels and the role of different K+ currents in regulating [Ca2+]cyt and explored the molecular identification of voltage-gated K+ (KV)- and Ca(2+)-activated K+ (KCa)-channel genes expressed in pulmonary arterial smooth muscle cells (PASMC). Two kinetically distinct KV currents [IK(V)], a rapidly inactivating (A-type) and a noninactivating delayed rectifier, as well as a slowly activated KCa current [IK(Ca)] were identified. IK(V) was reversibly inhibited by 4-aminopyridine (5 mM), whereas IK(Ca) was significantly inhibited by charybdotoxin (10-20 nM). K+ channels are composed of pore-forming alpha-subunits and auxiliary beta-subunits. Five KV-channel alpha-subunit genes from the Shaker subfamily (KV1.1, KV1.2, KV1.4, KV1.5, and KV1.6), a KV-channel alpha-subunit gene from the Shab subfamily (KV2.1), a KV-channel modulatory alpha-subunit (KV9.3), and a KCa-channel alpha-subunit gene (rSlo), as well as three KV-channel beta-subunit genes (KV beta 1.1, KV beta 2, and KV beta 3) are expressed in PASMC. The data suggest that 1) native K+ channels in PASMC are encoded by multiple genes; 2) the delayed rectifier IK(V) may be generated by the KV1.1, KV1.2, KV1.5, KV1.6, KV2.1, and/or KV2.1/KV9.3 channels; 3) the A-type IK(V) may be generated by the KV1.4 channel and/or the delayed rectifier KV channels (KV1 subfamily) associated with beta-subunits; and 4) the IK(Ca) may be generated by the rSlo gene product. The function of the KV channels plays an important role in the regulation of membrane potential and [Ca2+]cyt in PASMC.

Molecular analysis and functional expression of the human type E neuronal Ca2+ channel alpha 1 subunit.

PubMed

Schneider, T; Wei, X; Olcese, R; Costantin, J L; Neely, A; Palade, P; Perez-Reyes, E; Qin, N; Zhou, J; Crawford, G D

1994-01-01

A human brain alpha 1 Ca2+ channel subunit was cloned and expressed in Xenopus laevis oocytes. The open reading frame, encoding 2,312 amino acids, has high homology to the marine ray doe-1, the rat E-type, and the rabbit brain BII alpha 1 subunits. The amino and carboxy termini of this human.E-type alpha 1 subunit (alpha 1E) are most similar to the rabbit BII-1 splice variant, the remainder being colinear with the BII alpha 1 with the exception of two insertions, one of 43 amino acids in the C-terminus and another of 7 amino acids, found also in the rat alpha 1E, between domains II and III. Two potential Ca2+ binding sites are predicted from its primary structure. The expression of inward Ba2+ currents reveals voltage-dependent activation and inactivation measured by the cut-open oocyte vaseline-gap technique, with kinetics that correspond to that of a high-voltage-activated neuronal Ca2+ channel, and pharmacologic properties that resemble those of some low-voltage-activated neuronal Ca2+ currents. The human alpha 1E currents are insensitive to omega-conotoxin-GVIA (1 microM), omega-agatoxin-IVA (200 nM), a synthetic funnel web spider toxin (FTX, 20 microM), and Bay-K8644 (0.5 microM); they are inhibited 20% by high concentrations of methoxyverapamil and diltiazem, 65% by 0.1% crude funnel web spider venom and 100% by Ni2+ (IC50 = 30 nM). Single-channel records show a complex activity pattern with several apparent conductance states, the largest having a conductance of 14 pS.

Topological dispositions of lysine. alpha. 380 and lysine. gamma. 486 in the acetylcholine receptor from Torpedo californica

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dwyer, B.P.

1991-04-23

The locations have been determined, with respect to the plasma membrane, of lysine {alpha}380 and lysine {gamma}486 in the {alpha} subunit and the {gamma} subunit, respectively, of the nicotinic acetylcholine receptor from Torpedo californica. Immunoadsorbents were constructed that recognize the carboxy terminus of the peptide GVKYIAE released by proteolytic digestion from positions 378-384 in the amino acid sequence of the {alpha} subunit of the acetylcholine receptor and the carboxy terminus of the peptide KYVP released by proteolytic digestion from positions 486-489 in the amino acid sequence of the {gamma} subunit. They were used to isolate these peptides from proteolytic digestsmore » of polypeptides from the acetylcholine receptor. Sealed vesicles containing the native acetylcholine receptor were labeled with pyridoxal phosphate and sodium ({sup 3}H)-borohydride. The effect of saponin on the incorporation of pyridoxamine phosphate into lysine {alpha}380 and lysine {gamma}486 from the acetylcholine receptor in these vesicles was assessed with the immunoadsorbents. The conclusions that follow from these results are that lysine {alpha}380 is on the inside surface of a vesicle and lysine {gamma}486 is on the outside surface. Because a majority (85%) of the total binding sites for {alpha}-bungarotoxin bind the toxin in the absence of saponin, the majority of the vesicles are right side out with the inside of the vesicle corresponding to the cytoplasmic surface and the outside of the vesicle corresponding to the extracytoplasmic, synaptic surface. Because lysine {alpha}380 and lysine {gamma}486 lie on opposite sides of the membrane, a membrane-spanning segment must be located between the two positions occupied by these two amino acids in the common sequence of a polypeptide of the acetylcholine receptor.« less

A reduction in hippocampal GABAA receptor alpha5 subunits disrupts the memory for location of objects in mice.

PubMed

Prut, L; Prenosil, G; Willadt, S; Vogt, K; Fritschy, J-M; Crestani, F

2010-07-01

The memory for location of objects, which binds information about objects to discrete positions or spatial contexts of occurrence, is a form of episodic memory particularly sensitive to hippocampal damage. Its early decline is symptomatic for elderly dementia. Substances that selectively reduce alpha5-GABA(A) receptor function are currently developed as potential cognition enhancers for Alzheimer's syndrome and other dementia, consistent with genetic studies implicating these receptors that are highly expressed in hippocampus in learning performance. Here we explored the consequences of reduced GABA(A)alpha5-subunit contents, as occurring in alpha5(H105R) knock-in mice, on the memory for location of objects. This required the behavioral characterization of alpha5(H105R) and wild-type animals in various tasks examining learning and memory retrieval strategies for objects, locations, contexts and their combinations. In mutants, decreased amounts of alpha5-subunits and retained long-term potentiation in hippocampus were confirmed. They exhibited hyperactivity with conserved circadian rhythm in familiar actimeters, and normal exploration and emotional reactivity in novel places, allocentric spatial guidance, and motor pattern learning acquisition, inhibition and flexibility in T- and eight-arm mazes. Processing of object, position and context memories and object-guided response learning were spared. Genotype difference in object-in-place memory retrieval and in encoding and response learning strategies for object-location combinations manifested as a bias favoring object-based recognition and guidance strategies over spatial processing of objects in the mutants. These findings identify in alpha5(H105R) mice a behavioral-cognitive phenotype affecting basal locomotion and the memory for location of objects indicative of hippocampal dysfunction resulting from moderately decreased alpha5-subunit contents.

Stress and transcriptional regulation of tick ferritin HC.

PubMed

Mulenga, A; Simser, J A; Macaluso, K R; Azad, A F

2004-08-01

We previously identified a partial Dermacentor variabilis cDNA encoding ferritin HC (HC) subunit homolog (DVFER) that was differentially upregulated in Rickettsia montanensis infected ticks (Mulenga et al., 2003a). We have used rapid amplification of cDNA ends to clone full-length DVFER cDNA and its apparent ortholog from the wood tick, D. andersoni (DAFER), both of which show high sequence similarity to vertebrate than insect ferritin. Both DVFER and DAFER contain the stem-loop structure of a putative iron responsive element in the 5' untranslated region (nucleotide positions, 16-42) and the feroxidase centre loop typical for vertebrate ferritin HC subunits. Quantitative Western and Northern blotting analyses of protein and RNA from unfed and partially fed whole tick as well as dissected tick tissues demonstrated that DVFER is constitutively and ubiquitously expressed. Based on densitometric analysis of detected protein and mRNA bands, DVFER is predominantly expressed in the midgut, and to a lesser extent in the salivary glands, ovary and fatbody. Sham treatment (mechanical injury) and Escherichia coli challenge of D. variabilis ticks stimulated statistically significant (approximately 1.5- and approximately 3.0-fold, respectively) increases in DVFER mRNA abundance over time point matched naive control ticks. These data suggest that DVFER mRNA is nonspecifically up regulated in response to mechanical injury or bacterial infection induced stress.

Oligomeric properties of alpha-dendrotoxin-sensitive potassium ion channels purified from bovine brain.

PubMed

Parcej, D N; Scott, V E; Dolly, J O

1992-11-17

Neuronal acceptors for alpha-dendrotoxin (alpha-DTX) have recently been purified from mammalian brain and shown to consist of two classes of subunit, a larger (approximately 78,000 M(r)) protein (alpha) whose N-terminal sequence is identical to that of a cloned, alpha-DTX-sensitive K+ channel, and a novel M(r) 39,000 (beta) polypeptide of unknown function. However, little information is available regarding the oligomeric composition of these native molecules. By sedimentation analysis of alpha-DTX acceptors isolated from bovine cortex, two species have been identified. A minority of these oligomers contain only the larger protein, while the vast majority possess both subunits. Based on accurate determination of the molecular weights of these two forms it is proposed that alpha-DTX-sensitive K+ channels exist as alpha 4 beta 4 complexes because this combination gives the best fit to the experimental data.

The plastid ribosomal proteins. Identification of all the proteins in the 30 S subunit of an organelle ribosome (chloroplast).

PubMed

Yamaguchi, K; von Knoblauch, K; Subramanian, A R

2000-09-15

Identification of all the protein components of a plastid (chloroplast) ribosomal 30 S subunit has been achieved, using two-dimensional gel electropholesis, high performance liquid chromatography purification, N-terminal sequencing, polymerase chain reaction-based screening of cDNA library, nucleotide sequencing, and mass spectrometry (electrospray ionization, matrix-assisted laser desorption/ionization time-of-flight, and reversed-phase HPLC coupled with electrospray ionization mass spectrometry). 25 proteins were identified, of which 21 are orthologues of all Escherichia coli 30 S ribosomal proteins (S1-S21), and 4 are plastid-specific ribosomal proteins (PSRPs) that have no homologues in the mitochondrial, archaebacterial, or cytosolic ribosomal protein sequences in data bases. 12 of the 25 plastid 30 S ribosomal proteins (PRPs) are encoded in the plastid genome, whereas the remaining 13 are encoded by the nuclear genome. Post-translational transit peptide cleavage sites for the maturation of the 13 cytosolically synthesized PRPs, and post-translational N-terminal processing in the maturation of the 12 plastid synthesized PRPs are described. Post-translational modifications in several PRPs were observed: alpha-N-acetylation of S9, N-terminal processings leading to five mature forms of S6 and two mature forms of S10, C-terminal and/or internal modifications in S1, S14, S18, and S19, leading to two distinct forms differing in mass and/or charge (the corresponding modifications are not observed in E. coli). The four PSRPs in spinach plastid 30 S ribosomal subunit (PSRP-1, 26.8 kDa, pI 6.2; PSRP-2, 21.7 kDa, pI 5.0; PSRP-3, 13.8 kDa, pI 4.9; PSRP-4, 5.2 kDa, pI 11.8) comprise 16% (67.6 kDa) of the total protein mass of the 30 S subunit (429.3 kDa). PSRP-1 and PSRP-3 show sequence similarities with hypothetical photosynthetic bacterial proteins, indicating their possible origins in photosynthetic bacteria. We propose the hypothesis that PSRPs form a "plastid translational regulatory module" on the 30 S ribosomal subunit structure for the possible mediation of nuclear factors on plastid translation.

Proliferation of NS0 cells in protein-free medium: the role of cell-derived proteins, known growth factors and cellular receptors.

PubMed

Spens, Erika; Häggström, Lena

2009-05-20

NS0 cells proliferate without external supply of growth factors in protein-free media. We hypothesize that the cells produce their own factors to support proliferation. Understanding the mechanisms behind this autocrine regulation of proliferation may open for the novel approaches to improve animal cell processes. The following proteins were identified in NS0 conditioned medium (CM): cyclophilin A, cyclophilin B (CypB), cystatin C, D-dopachrome tautomerase, IL-25, isopentenyl-diphosphate delta-isomerase, macrophage migration inhibitory factor (MIF), beta(2)-microglobulin, Niemann pick type C2, secretory leukocyte protease inhibitor, thioredoxin-1, TNF-alpha, tumour protein translationally controlled 1 and ubiquitin. Further, cDNA microarray analysis indicated that the genes for IL-11, TNF receptor 6, TGF-beta receptor 1 and the IFN-gamma receptor were transcribed. CypB, IFN-alpha/beta/gamma, IL-11, IL-25, MIF, TGF-beta and TNF-alpha as well as the known growth factors EGF, IGF-I/II, IL-6, leukaemia inhibitory factor and oncostatin M (OSM) were excluded as involved in autocrine regulation of NS0 cell proliferation. The receptors for TGF-beta, IGF and OSM are however present in NS0 cell membranes since TGF-beta(1) caused cell death, and IGF-I/II and OSM improved cell growth. Even though no ligand was found, the receptor subunit gp130, active in signal transduction of the IL-6 like proteins, was shown to be essential for NS0 cells as demonstrated by siRNA gene silencing.

Extrinsic factors regulate partial agonist efficacy of strychnine-sensitive glycine receptors

PubMed Central

Farroni, Jeffrey S; McCool, Brian A

2004-01-01

Background Strychnine-sensitive glycine receptors in many adult forebrain regions consist of alpha2 + beta heteromeric channels. This subunit composition is distinct from the alpha1 + beta channels found throughout the adult spinal cord. Unfortunately, the pharmacology of forebrain alpha2beta receptors are poorly defined compared to 'neonatal' alpha2 homomeric channels or 'spinal' alpha1beta heteromers. In addition, the pharmacologic properties of native alpha2beta glycine receptors have been generally distinct from receptors produced by heterologous expression. To identify subtype-specific pharmacologic tools for the forebrain alpha2beta receptors, it is important to identify a heterologous expression system that closely resembles these native glycine-gated chloride channels. Results While exploring pharmacological properties of alpha2beta glycine receptors compared to alpha2-homomers, we found that distinct heterologous expression systems appeared to differentially influence partial agonist pharmacology. The β-amino acid taurine possessed 30–50% efficacy for alpha2-containing receptor isoforms when expressed in HEK 293 cells. However, taurine efficacy was dramatically reduced in L-cell fibroblasts. Similar results were obtained for β-alanine. The efficacy of these partial agonists was also strongly reduced by the beta subunit. There were no significant differences in apparent strychnine affinity values calculated from concentration-response data between expression systems or subunit combinations. Nor did relative levels of expression correlate with partial agonist efficacy when compared within or between several different expression systems. Finally, disruption of the tubulin cytoskeleton reduced the efficacy of partial agonists in a subunit-dependent, but system-independent, fashion. Conclusions Our results suggest that different heterologous expression systems can dramatically influence the agonist pharmacology of strychnine-sensitive glycine receptors. In the systems examine here, these effects are independent of both absolute expression level and any system-related alterations in the agonist binding site. We conclude that complex interactions between receptor composition and extrinsic factors may play a significant role in determining strychnine-sensitive glycine receptor partial agonist pharmacology. PMID:15301692

Extrinsic factors regulate partial agonist efficacy of strychnine-sensitive glycine receptors.

PubMed

Farroni, Jeffrey S; McCool, Brian A

2004-08-09

Strychnine-sensitive glycine receptors in many adult forebrain regions consist of alpha2 + beta heteromeric channels. This subunit composition is distinct from the alpha1 + beta channels found throughout the adult spinal cord. Unfortunately, the pharmacology of forebrain alpha2beta receptors are poorly defined compared to 'neonatal' alpha2 homomeric channels or 'spinal' alpha1beta heteromers. In addition, the pharmacologic properties of native alpha2beta glycine receptors have been generally distinct from receptors produced by heterologous expression. To identify subtype-specific pharmacologic tools for the forebrain alpha2beta receptors, it is important to identify a heterologous expression system that closely resembles these native glycine-gated chloride channels. While exploring pharmacological properties of alpha2beta glycine receptors compared to alpha2-homomers, we found that distinct heterologous expression systems appeared to differentially influence partial agonist pharmacology. The beta-amino acid taurine possessed 30-50% efficacy for alpha2-containing receptor isoforms when expressed in HEK 293 cells. However, taurine efficacy was dramatically reduced in L-cell fibroblasts. Similar results were obtained for beta-alanine. The efficacy of these partial agonists was also strongly reduced by the beta subunit. There were no significant differences in apparent strychnine affinity values calculated from concentration-response data between expression systems or subunit combinations. Nor did relative levels of expression correlate with partial agonist efficacy when compared within or between several different expression systems. Finally, disruption of the tubulin cytoskeleton reduced the efficacy of partial agonists in a subunit-dependent, but system-independent, fashion. Our results suggest that different heterologous expression systems can dramatically influence the agonist pharmacology of strychnine-sensitive glycine receptors. In the systems examine here, these effects are independent of both absolute expression level and any system-related alterations in the agonist binding site. We conclude that complex interactions between receptor composition and extrinsic factors may play a significant role in determining strychnine-sensitive glycine receptor partial agonist pharmacology.

The Val{sup 192}Leu mutation in the {alpha}-subunit of {beta}-hexosaminidase A is not associated with the B1-variant form of Tay-Sachs disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hou, Y.; Vavougios, G.; Hinek, A.

1996-07-01

Substitution mutations adversely affecting the {alpha}-subunit of {beta}-hexosaminidase A ({alpha}{beta}) (EC 3.2.1.52) result in Tay-Sachs disease. The majority affect the initial folding of the pro-{alpha} chain in the endoplasmic reticulum, resulting in its retention and degradation. A much less common occurrence is a mutation that specifically affects an {open_quotes}active-site{close_quotes} residue necessary for substrate binding and/or catalysis. In this case, hexosaminidase A is present in the lysosome, but it lacks all {alpha}-specific activity. This biochemical phenotype is referred to as the {open_quotes}B1-variant form{close_quotes} of Tay-Sachs disease. Kinetic analysis of suspected B1-variant mutations is complex because hexosaminidase A is heterodimeric and bothmore » subunits possess similar active sites. In this report, we examine a previously identified B1-variant mutation, {alpha}-Val{sup 192}Leu. Chinese hamster ovary cells were permanently cotransfected with an {alpha}-cDNA-construct encoding the substitution and a mutant {beta}-cDNA ({beta}-Arg{sup 211}Lys), encoding a {beta}-subunit that is inactive but normal in all other respects. We were surprised to find that the Val{sup 192}Leu substitution produced a pro-{alpha} chain that did not form {alpha}-{beta} dimers and was not transported to the lysosome. Finally, we reexamined the hexosaminidase activity and protein levels in the fibroblasts from the original patient. These data were also not consistent with the biochemical phenotype of the B1 variant of Tay-Sachs disease previously reported to be present. Thus, we conclude that the Val{sup 192}Leu substitution does not specifically affect the {alpha}-active site. 23 refs., 4 figs., 2 tabs.« less

Immunohistochemical analyses of alpha1 and alpha3 Na+/K+-ATPase subunit expression in medulloblastomas.

PubMed

Suñol, Mariona; Cusi, Victoria; Cruz, Ofelia; Kiss, Robert; Lefranc, Florence

2011-03-01

The levels of expression of the α1 and α3 subunits of the Na(+)/K(+)-ATPase (the NaK sodium pump) in medulloblastomas are unclear. This study investigated the expression of the NaK subunits using immunohistochemical methods in 29 medulloblastomas including 23 classic, three large-cell/anaplastic and three nodular/desmoplastic medulloblastomas, as well as in three atypical teratoid/rhabdoid tumors (AT/RTs). There was overexpression of the α1 or α3 NaK subunits in more than half of the medulloblastomas and atypical AT/RTs, with about one-third of these tumours displaying overexpression of both subunits. These preliminary data suggest that targeting these subunits in AT/RTs and medulloblastomas that overexpress these proteins may lead to therapeutic benefit. These findings warrant confirmation in larger numbers of patients than those used in this study. Moreover, it should be determined whether inhibition of the α1/α3 NaK subunits can be integrated into the risk stratification schemes already in use for medulloblastoma patients.

Use of polyclonal and monoclonal antibodies to study hCG-receptor interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Milius, R.P.

1985-01-01

Although the glycoprotein hormones lutropin (LH), follitropin (FSH), and thyrotropin (TSH) bind to different receptors, each contains an identical alpha subunit. Specificity is somehow endowed by theta subunits which are distinct for each hormone. Human choriogonadotropin (hCG) is a natural LH analog that contains a beta subunit nearly identical to that of LH. The roles of these subunits in the recognition and high affinity binding of hCG to receptor was examined. Polyclonal and monoclonal antibodies specific for the individual subunits of hCG were used to probe the hormone-receptor interaction. Conformation-specific and sequence-specific antibodies were examined for their abilities to bindmore » Triton X-100-solubilized /sup 125/I-hCG-receptor complex and to inhibit hormone binding to crude rat ovarian membranes containing receptor. Even though the immunoreactive sites are not located on the receptor binding surface of the beta subunit, most, but not all, of these polyclonal and monoclonal antibodies were able to inhibit /sup 125/I-hCG binding to receptor. Although the inhibition of binding may be due to steric interference due to the size of the antibody molecules, a two-step model for hCG binding to receptor is presented that also explains these results. In this model, the beta subunit initially binds with the receptor with a highly specific but low affinity interaction. This activates a site for the high affinity binding of the alpha subunit and stabilization of the complex. This is an attractive model as it may be applied to other glycoprotein hormones sharing an alpha subunit.« less

Characterization of rat leydig cell gonadotropin receptor structure by affinity cross-linking

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Q.Y.; Hwang, J.; Menon, K.M.J.

1986-05-01

The gonadotropin receptor from rat leydig cell has been characterized with respect to binding kinetics and physiological regulation. The present study was intended to examine the structure of the receptor. Leydig cell suspension was prepared by either collagenase digestion or by mechanical disruption of the testis. The cells were incubated with /sup 125/I-hCG and the unreacted hCG was removed by centrifugation. The /sup 125/I-hCG was then covalently linked to the cell surface receptor using cleavable (dithiobis (succinimidyl propionate)) and non-cleavable (disuccinimidyl suberate) cross-linking reagents. The extracted cross-linked membrane proteins were resolved on SDS-polyacrylamide gels under reducing and non-reducing conditions andmore » subjected to autoradiographic analysis. Under non-reducing conditions, two labeled species with M/sub r/ = 87,000 and 120,000 were detected. However, only one labeled band was detected under reducing conditions with M/sub r/ = 64,000. The binding of /sup 125/I-hCG to the receptor was inhibited by hCG and LH, but not by a number of peptides and proteins. The data suggest that hCG receptor in leydig cell is an oligomeric complex consisting of four subunits, ..cap alpha cap alpha beta gamma... The ..beta.. and ..gamma.. subunits are each linked to an ..cap alpha.. subunit through disulfide linkage and the hormone binds to each ..cap alpha.. subunit. The two dimers formed (..cap alpha beta cap alpha gamma..) are associated by noncovalent interactions.« less

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

PubMed Central

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

[Tonoplast transport and salt tolerance in plants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taiz, L.

1993-01-01

We have showed that the tonoplast V-ATPase could be specifically inhibited by antisense DNA to the catalytic (A) subunit; that cell expansion was inhibited in carrot transformants deficient in the enzyme and have provided evidence for at least two different isoforms of the A subunit which are Golgi- and tonoplast-specific. These findings prompted a search for sequences of the isoforms of the A subunit in carrot. We have cloned and sequenced 1.0--1.5 kb fragments of three different genes for the catalytic subunit, the fragments differ greatly in their introns, but have nearly identical exons. We are using PCR to amplifymore » and subclone carrot seedling cDNA. Thus far two bands have been amplified and are currently being subcloned for sequencing.« less

[Tonoplast transport and salt tolerance in plants]. Progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taiz, L.

1993-04-01

We have showed that the tonoplast V-ATPase could be specifically inhibited by antisense DNA to the catalytic (A) subunit; that cell expansion was inhibited in carrot transformants deficient in the enzyme and have provided evidence for at least two different isoforms of the A subunit which are Golgi- and tonoplast-specific. These findings prompted a search for sequences of the isoforms of the A subunit in carrot. We have cloned and sequenced 1.0--1.5 kb fragments of three different genes for the catalytic subunit, the fragments differ greatly in their introns, but have nearly identical exons. We are using PCR to amplifymore » and subclone carrot seedling cDNA. Thus far two bands have been amplified and are currently being subcloned for sequencing.« less

Marked differences between metalloproteases meprin A and B in substrate and peptide bond specificity.

PubMed

Bertenshaw, G P; Turk, B E; Hubbard, S J; Matters, G L; Bylander, J E; Crisman, J M; Cantley, L C; Bond, J S

2001-04-20

Meprin A and B are highly regulated, secreted, and cell-surface metalloendopeptidases that are abundantly expressed in the kidney and intestine. Meprin oligomers consist of evolutionarily related alpha and/or beta subunits. The work herein was carried out to identify bioactive peptides and proteins that are susceptible to hydrolysis by mouse meprins and kinetically characterize the hydrolysis. Gastrin-releasing peptide fragment 14-27 and gastrin 17, regulatory molecules of the gastrointestinal tract, were found to be the best peptide substrates for meprin A and B, respectively. Peptide libraries and a variety of naturally occurring peptides revealed that the meprin beta subunit has a clear preference for acidic amino acids in the P1 and P1' sites of substrates. The meprin alpha subunit selected for small (e.g. serine, alanine) or hydrophobic (e.g. phenylalanine) residues in the P1 and P1' sites, and proline was the most preferred amino acid at the P2' position. Thus, although the meprin alpha and beta subunits share 55% amino acid identity within the protease domain and are normally localized at the same tissue cell surfaces, they have very different substrate and peptide bond specificities indicating different functions. Homology models of the mouse meprin alpha and beta protease domains, based on the astacin crystal structure, revealed active site differences that can account for the marked differences in substrate specificity of the two subunits.

Pituitary transcription factor Prop-1 stimulates porcine pituitary glycoprotein hormone alpha subunit gene expression.

PubMed

Sato, Takanobu; Kitahara, Kousuke; Susa, Takao; Kato, Takako; Kato, Yukio

2006-10-01

Recently, we have reported that a Prophet of Pit-1 homeodomain factor, Prop-1, is a novel transcription factor for the porcine follicle-stimulating hormone beta subunit (FSHbeta) gene. This study subsequently aimed to examine the role of Prop-1 in the gene expression of two other porcine gonadotropin subunits, pituitary glycoprotein hormone alpha subunit (alphaGSU), and luteinizing hormone beta subunit (LHbeta). A series of deletion mutants of the porcine alphaGSU (up to -1059 bp) and LHbeta (up to -1277 bp) promoters were constructed in the reporter vector, fused with the secreted alkaline phosphatase gene (pSEAP2-Basic). Transient transfection studies using GH3 cells were carried out to estimate the activation of the porcine alphaGSU and LHbeta promoters by Prop-1, which was found to activate the alphaGSU promoter of -1059/+12 bp up to 11.7-fold but not the LHbeta promoter. Electrophoretic mobility shift assay and DNase I footprinting analysis revealed that Prop-1 binds to six positions, -1038/-1026, -942/-928, -495/-479, -338/-326, -153/-146, and -131/-124 bp, that comprise the A/T cluster. Oligonucleotides of six Prop-1 binding sites were directly connected to the minimum promoter of alphaGSU, fused in the pSEAP2-Basic vector, followed by transfecting GH3 cells to determine the cis-acting activity. Finally, we concluded that at least five Prop-1 binding sites are the cis-acting elements for alphaGSU gene expression. The present results revealed a notable feature of the proximal region, where three Prop-1-binding sites are close to and/or overlap the pituitary glycoprotein hormone basal element, GATA-binding element, and junctional regulatory element. To our knowledge, this is the first demonstration of the role of Prop-1 in the regulation of alphaGSU gene expression. These results, taken together with our previous finding that Prop-1 is a transcription factor for FSHbeta gene, confirm that Prop-1 modulates the synthesis of FSH at the transcriptional level. On the other hand, the defects of Prop-1 are known to cause dwarfism and combined pituitary hormone deficiency accompanying hypogonadism. Accordingly, the present observations provide a novel view to understand the hypogonadism caused by Prop-1 defects at the molecular level through the regulatory mechanism of alphaGSU and FSHbeta gene expressions.

Identity of the segment of human complement C8 recognized by complement regulatory protein CD59.

PubMed

Lockert, D H; Kaufman, K M; Chang, C P; Hüsler, T; Sodetz, J M; Sims, P J

1995-08-25

CD59 antigen is a membrane glycoprotein that inhibits the activity of the C5b-9 membrane attack complex (MAC), thereby protecting human cells from lysis by human complement. The inhibitory function of CD59 derives from its capacity to interact with both the C8 and C9 components of MAC, preventing assembly of membrane-inserted C9 polymer. MAC-inhibitory activity of CD59 is species-selective and is most effective when both C8 and C9 derive from human or other primate plasma. Rabbit C8 and C9, which can substitute for human C8 and C9 in MAC, mediate virtually unrestricted lysis of human cells expressing CD59. In order to identify the segment of human C8 that is recognized by CD59, recombinant peptides containing human or rabbit C8 sequence were expressed in Escherichia coli and purified. CD59 was found to specifically bind to a peptide corresponding to residues 334-385 of the human C8 alpha-subunit, and to require a disulfide bond between Cys345 and Cys369. No specific binding was observed to the corresponding sequence from rabbit C8 alpha (residues 334-386). To obtain functional evidence that this segment of human C8 alpha is selectively recognized by CD59, recombinant C8 proteins were prepared by co-transfecting COS-7 cells with human/rabbit chimeras of the C8 alpha cDNA, and cDNAs encoding the C8 beta and C8 gamma chains. Hemolytic activity of MAC formed with chimeric C8 was analyzed using target cells reconstituted with CD59. These experiments confirmed that CD59 recognizes a conformationally sensitive epitope that is within a segment of human C8 alpha internal to residues 320-415. Our data also suggest that optimal interaction of CD59 with this segment of human C8 alpha is influenced by N-terminal flanking sequence in C8 alpha and by human C8 beta, but is unaffected by C8 gamma.

5-Fluoroindole Resistance Identifies Tryptophan Synthase Beta Subunit Mutants in Arabidopsis Thaliana

PubMed Central

Barczak, A. J.; Zhao, J.; Pruitt, K. D.; Last, R. L.

1995-01-01

A study of the biochemical genetics of the Arabidopsis thaliana tryptophan synthase beta subunit was initiated by characterization of mutants resistant to the inhibitor 5-fluoroindole. Thirteen recessive mutations were recovered that are allelic to trp2-1, a mutation in the more highly expressed of duplicate tryptophan synthase beta subunit genes (TSB1). Ten of these mutations (trp2-2 through trp2-11) cause a tryptophan requirement (auxotrophs), whereas three (trp2-100 through trp2-102) remain tryptophan prototrophs. The mutations cause a variety of changes in tryptophan synthase beta expression. For example, two mutations (trp2-5 and trp2-8) cause dramatically reduced accumulation of TSB mRNA and immunologically detectable protein, whereas trp2-10 is associated with increased mRNA and protein. A correlation exists between the quantity of mutant beta and wild-type alpha subunit levels in the trp2 mutant plants, suggesting that the synthesis of these proteins is coordinated or that the quantity or structure of the beta subunit influences the stability of the alpha protein. The level of immunologically detectable anthranilate synthase alpha subunit protein is increased in the trp2 mutants, suggesting the possibility of regulation of anthranilate synthase levels in response to tryptophan limitation. PMID:7635295

Molecular characterization of the alpha subunit of complement component C8 (GcC8alpha) in the nurse shark (Ginglymostoma cirratum).

PubMed

Aybar, Lydia; Shin, Dong-Ho; Smith, Sylvia L

2009-09-01

Target cell lysis by complement is achieved by the assembly and insertion of the membrane attack complex (MAC) composed of glycoproteins C5b through C9. The lytic activity of shark complement involves functional analogues of mammalian C8 and C9. Mammalian C8 is composed of alpha, beta, and gamma subunits. The subunit structure of shark C8 is not known. This report describes a 2341 nucleotide sequence that translates into a polypeptide of 589 amino acid residues, orthologue to mammalian C8alpha and has the same modular architecture with conserved cysteines forming the peptide bond backbone. The C8gamma-binding cysteine is conserved in the perforin-like domain. Hydrophobicity profile indicates the presence of hydrophobic residues essential for membrane insertion. It shares 41.1% and 47.4% identity with human and Xenopus C8alpha respectively. Southern blot analysis showed GcC8alpha exists as a single copy gene expressed in most tissues except the spleen with the liver being the main site of synthesis. Phylogenetic analysis places it in a clade with C8alpha orthologs and as a sister taxa to the Xenopus. 2009 Elsevier Ltd.

Proinflammatory cytokines cause FAT10 upregulation in cancers of liver and colon.

PubMed

Lukasiak, S; Schiller, C; Oehlschlaeger, P; Schmidtke, G; Krause, P; Legler, D F; Autschbach, F; Schirmacher, P; Breuhahn, K; Groettrup, M

2008-10-09

The mRNA of the ubiquitin-like modifier FAT10 has been reported to be overexpressed in 90% of hepatocellular carcinoma (HCC) and in over 80% of colon, ovary and uterus carcinomas. Elevated FAT10 expression in malignancies was attributed to transcriptional upregulation upon the loss of p53. Moreover, FAT10 induced chromosome instability in long-term in vitro culture, which led to the hypothesis that FAT10 might be involved in carcinogenesis. In this study we show that interferon (IFN)-gamma and tumor necrosis factor (TNF)-alpha synergistically upregulated FAT10 expression in liver and colon cancer cells 10- to 100-fold. Real-time RT-PCR revealed that FAT10 mRNA was significantly overexpressed in 37 of 51 (72%) of human HCC samples and in 8 of 15 (53%) of human colon carcinomas. The FAT10 cDNA sequences in HCC samples were not mutated and intact FAT10 protein was detectable. FAT10 expression in both cancer tissues correlated with expression of the IFN-gamma- and TNF-alpha-dependent proteasome subunit LMP2 strongly suggesting that proinflammatory cytokines caused the joint overexpression of FAT10 and LMP2. NIH3T3 transformation assays revealed that FAT10 had no transforming capability. Taken together, FAT10 qualifies as a marker for an interferon response in HCC and colon carcinoma but is not significantly overexpressed in cancers lacking a proinflammatory environment.

Extensive alternative splicing and dual promoter usage generate Tcf-1 protein isoforms with differential transcription control properties.

PubMed Central

Van de Wetering, M; Castrop, J; Korinek, V; Clevers, H

1996-01-01

Previously, we reported the isolation of cDNA clones representing four alternative splice forms of TCF-1, a T-cell-specific transcription factor. In the present study, Western blotting (immunoblotting) yielded a multitude of TCF-1 proteins ranging from 25-55 kDa, a pattern not simply explained from the known splice alternatives. Subsequent cDNA cloning, PCR amplification, and analysis by rapid amplification of 5' cDNA ends revealed (i) the presence of an alternative upstream promoter, which extended the known N terminus by 116 amino acids, (ii) the presence of four alternative exons, and (iii) the existence of a second reading frame in the last exon encoding an extended C terminus. Inclusion of the extended N terminus into the originally reported protein resulted in a striking similarity to the lymphoid factor Lef-1. Several of the TCF-1 isoforms, although less potent, mimicked Lef-1 in transactivating transcription through the T-cell receptor alpha-chain (TCR-alpha) enhancer. These data provide a molecular basis for the complexity of the expressed TCF-1 proteins and establish the existence of functional differences between these isoforms. Furthermore, the functional redundancy between Tcf-1 and Lef-1 explains the apparently normal TCR-alpha expression in single Tcf-1 or Lef-1 knockout mice despite the firm in vitro evidence for the importance of the Tcf/Lef site in the TCR-alpha enhancer. PMID:8622675

Structure of Glycerol Dehydratase Reactivase: A New Type of Molecular Chaperone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liao, Der-Ing; Reiss, Lisa; Turner, Jr., Ivan

2010-03-08

The function of glycerol dehydratase (GDH) reactivase is to remove damaged coenzyme B{sub 12} from GDH that has suffered mechanism-based inactivation. The structure of GDH reactivase from Klebsiella pneumoniae was determined at 2.4 {angstrom} resolution by the single isomorphous replacement with anomalous signal (SIR/AS) method. Each tetramer contains two elongated 63 kDa {alpha} subunits and two globular 14 kDa {beta} subunits. The {alpha} subunit contains structural features resembling both GroEL and Hsp70 groups of chaperones, and it appears chaperone like in its interactions with ATP. The fold of the {beta} subunit resembles that of the {beta} subunit of glycerol dehydratase,more » except that it lacks some coenzyme B12 binding elements. A hypothesis for the reactivation mechanism of reactivase is proposed based on these structural features.« less

Integrative Approach for Computationally Inferring Interactions between the Alpha and Beta Subunits of the Calcium-Activated Potassium Channel (BK): a Docking Study

PubMed Central

González, Janneth; Gálvez, Angela; Morales, Ludis; Barreto, George E.; Capani, Francisco; Sierra, Omar; Torres, Yolima

2013-01-01

Three-dimensional models of the alpha- and beta-1 subunits of the calcium-activated potassium channel (BK) were predicted by threading modeling. A recursive approach comprising of sequence alignment and model building based on three templates was used to build these models, with the refinement of non-conserved regions carried out using threading techniques. The complex formed by the subunits was studied by means of docking techniques, using 3D models of the two subunits, and an approach based on rigid-body structures. Structural effects of the complex were analyzed with respect to hydrogen-bond interactions and binding-energy calculations. Potential interaction sites of the complex were determined by referencing a study of the difference accessible surface area (DASA) of the protein subunits in the complex. PMID:23492851

Expression of glutathione peroxidase I gene in selenium-deficient rats.

PubMed Central

Reddy, A P; Hsu, B L; Reddy, P S; Li, N Q; Thyagaraju, K; Reddy, C C; Tam, M F; Tu, C P

1988-01-01

We have characterized a cDNA pGPX1211 encoding rat glutathione peroxidase I. The selenocysteine in the protein corresponded to a TGA codon in the coding region of the cDNA, similar to earlier findings in mouse and human genes, and a gene encoding the formate dehydrogenase from E. coli, another selenoenzyme. The rat GSH peroxidase I has a calculated subunit molecular weight of 22,155 daltons and shares 95% and 86% sequence homology with the mouse and human subunits, respectively. The 3'-noncoding sequence (greater than 930 bp) in pGPX1211 is much longer than that of the human sequences. We found that glutathione peroxidase I mRNA, but not the polypeptide, was expressed under nutritional stress of selenium deficiency where no glutathione peroxidase I activity can be detected. The failure of detecting any apoprotein for the glutathione peroxidase I under selenium deficiency and results published from other laboratories supports the proposal that selenium may be incorporated into the glutathione peroxidase I co-translationally. Images PMID:2838821

Two subunits of the 55 K porcine zona pellucida glycoprotein family are immunologically distinct

DOE Office of Scientific and Technical Information (OSTI.GOV)

Subramanian, M.G.; Yurewicz, E.C.; Sacco, A.G.

1986-03-01

The 55K glycoprotein family (ZP3) of the porcine zona pellucida is comprised of two subunits of 46 K and 45 K which can be resolved by endo-..beta..-galactosidase digestion of ZP3 followed by reversed phase HPLC on Vydac C4 resin. Gel electrophoresis revealed that the 46 K component (EBDG..cap alpha..) is approx. 95% pure and the 45 K component (EBGD..beta..) is 100% pure. In the present study, these two subunits were evaluated immunologically by RIA. Under similar reaction protocols (chloramine-T iodination procedure) comparable specific activities were obtained for EBGD..cap alpha.. (33.06 +/- 7.5 ..mu..ci/..mu..gm), EBGD..beta.. (30.45 +/- 1.6) and ZP3 (26.3more » +/- 1.3). Antibody (Ab) titration studies revealed that EBGD..cap alpha.. and ..beta.. are potent immunogens and /sup 125/I-EBGD..cap alpha.. showed minimal cross reactivity to EBGD..beta..-Ab (8% bound at 1:500 dilution), whereas, /sup 125/I-EBGD..beta.. showed a greater degree of cross reactivity to EBGD..cap alpha..-Ab (23% bound at 1:500 dilution). Maximum binding for the two labeled antigens against homologous Abs (1:500) was > 60%. Dose response studies revealed that in the /sup 125/I-EBGD..cap alpha.. vs EBGD..cap alpha.. -Ab system, the 50% intercept was 3.25 +/- 0.32 ng for EBGD..cap alpha.. and 472.43 +/- 30.26 ng for EBGD..beta.. (p < 0.01), whereas, in the /sup 125/I-EBGD..beta.. vs EBGD..beta..-Ab system the 50% intercept was 3.51 +/- 0.58 for EBGD..beta.. and 166.77 +/- 49.20 for EBGD..cap alpha.. (p < 0.01). No significant differences were observed in the slopes of the dose response curves. It is concluded that the two subunits of ZP3 possess distinct immunologic characteristics as evaluated by RIA.« less

Expression and kinetic properties of a recombinant 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzyme of human liver.

PubMed

Deyashiki, Y; Tamada, Y; Miyabe, Y; Nakanishi, M; Matsuura, K; Hara, A

1995-08-01

Human liver cytosol contains multiple forms of 3 alpha-hydroxysteroid dehydrogenase and dihydrodiol dehydrogenase with hydroxysteroid dehydrogenase activity, and multiple cDNAs for the enzymes have been cloned from human liver cDNA libraries. To understand the relationship of the multiple enzyme froms to the genes, a cDNA, which has been reported to code for an isoenzyme of human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase, was expressed in Escherichia coli. The recombinant enzyme showed structural and functional properties almost identical to those of the isoenzyme purified from human liver. In addition, the recombinant isoenzyme efficiently reduced 5 alpha-dihydrotestosterone and 5 beta-dihydrocortisone, the known substrates of human liver 3 alpha-hydroxysteroid dehydrogenase and chlordecone reductase previously purified, which suggests that these human liver enzymes are identical. Furthermore, the steady-state kinetic data for NADP(+)-linked (S)-1-indanol oxidation by the recombinant isoenzyme were consistent with a sequential ordered mechanism in which NADP+ binds first. Phenolphthalein inhibited this isoenzyme much more potently than it did the other human liver dihydrodiol dehydrogenases, and was a competitive inhibitor (Ki = 20 nM) that bound to the enzyme-NADP+ complex.

Characterization of class II alpha genes and DLA-D region allelic associations in the dog.

PubMed

Sarmiento, U M; Storb, R F

1988-10-01

Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the alpha genes of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (BamHI, EcoRI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I and Bgl II), separated by agarose gel electrophoresis and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabelled HLA cDNA probes corresponding to DQ, DP, DZ and DR alpha genes. Clear evidence was obtained for the canine homologues of DQ and DR alpha genes with simple bi- or tri-allelic polymorphism respectively. Evidence for a single, nonpolymorphic DP alpha gene was also obtained. However, the presence of a DZ alpha gene could not be clearly demonstrated in canine genomic DNA. This report extends our previous RFLP analysis documenting polymorphism of DLA class II beta genes in the same panel of homozygous typing cell dogs, and provides the basis for DLA-D genotyping at a population level. This study also characterizes the RFLP-defined preferential allelic associations across the DLA-D region in nine different homozygous typing cell specificities.

Three-dimensional structure of holo 3 alpha,20 beta-hydroxysteroid dehydrogenase: a member of a short-chain dehydrogenase family.

PubMed Central

Ghosh, D; Weeks, C M; Grochulski, P; Duax, W L; Erman, M; Rimsay, R L; Orr, J C

1991-01-01

The x-ray structure of a short-chain dehydrogenase, the bacterial holo 3 alpha,20 beta-hydroxysteroid dehydrogenase (EC 1.1.1.53), is described at 2.6 A resolution. This enzyme is active as a tetramer and crystallizes with four identical subunits in the asymmetric unit. It has the alpha/beta fold characteristic of the dinucleotide binding region. The fold of the rest of the subunit, the quaternary structure, and the nature of the cofactor-enzyme interactions are, however, significantly different from those observed in the long-chain dehydrogenases. The architecture of the postulated active site is consistent with the observed stereospecificity of the enzyme and the fact that the tetramer is the active form. There is only one cofactor and one substrate-binding site per subunit; the specificity for both 3 alpha- and 20 beta-ends of the steroid results from the binding of the steroid in two orientations near the same cofactor at the same catalytic site. Images PMID:1946424

Expression of membrane-bound and cytosolic guanylyl cyclases in the rat inner ear.

PubMed

Seebacher, T; Beitz, E; Kumagami, H; Wild, K; Ruppersberg, J P; Schultz, J E

1999-01-01

Membrane-bound guanylyl cyclases (GCs) are peptide hormone receptors whereas the cytosolic isoforms are receptors for nitric oxide. In the inner ear, the membrane-bound GCs may be involved in the regulation of fluid homeostasis and the cytosolic forms possibly play a role in signal processing and regulation of local blood flow. In this comprehensive study, we examined, qualitatively and quantitatively, the transcription pattern of all known GC isoforms in the inner ear from rat by RT-PCR. The tissues used were endolymphatic sac, stria vascularis, organ of Corti, organ of Corti outer hair cells, cochlear nerve, Reissner's membrane, vestibular dark cells, and vestibular sensory cells. We show that multiple particulate (GC-A, GC-B, GC-D, GC-E, GC-F and GC-G) and several subunits of the heterodimeric cytosolic GCs (alpha1, alpha2, beta1 and beta2) are expressed, albeit at highly different levels. GC-C was not found. GC-A and the soluble subunits alpha1 and beta1 were transcribed ubiquitously. GC-B was present in all tissues except stria vascularis, which contained GC-A and traces of GC-E and GC-G. GC-B was by far the predominant membrane-bound isoform in the organ of Corti (86%), Reissner's membrane (75%) and the vestibulum (80%). Surprisingly, GC-E, a retinal isoform, was detected in significant amounts in the cochlear nerve (8%) and in the organ of Corti (4%). Although the cytosolic GC is a heterodimer composed of an alpha and a beta subunit, the mRNA transcription of these subunits was not stoichiometric. Particularly in the vestibulum, the transcription of the beta1 subunits was at least four-fold higher than of the alpha1 subunit. The data are compatible with earlier suggestions that membrane receptor GCs may be involved in the control of inner ear electrolyte and fluid composition whereas NO-stimulated GC isoforms mainly participate in the regulation of blood flow and supporting cell physiology.

Generation and characterization of anti-MUC4 monoclonal antibodies reactive with normal and cancer cells in humans.

PubMed

Moniaux, Nicolas; Varshney, Grish Chandra; Chauhan, Subhash Chand; Copin, Marie Christine; Jain, Maneesh; Wittel, Uwe A; Andrianifahanana, Mahefatiana; Aubert, Jean-Pierre; Batra, Surinder Kumar

2004-02-01

We have previously cloned the full-length cDNA (approximately 28 Kb) and established the complete genomic organization (25 exons/introns over 100 kb) of the human MUC4 mucin. This large molecule is predicted to protrude over 2 microm above the cell surface, in which MUC4alpha is an extracellular mucin-type glycoprotein subunit and MUC4beta is the transmembrane subunit. Over two thirds of the encoded protein sequence consists of 16-amino-acid tandem repeats (TR), which are flanked by unique sequences. In this study we generated and characterized monoclonal antibodies (MAbs) directed against the TR region of MUC4. Mice were immunized with a KLH-conjugated MUC4 TR peptide, STGDTTPLPVTDTSSV. Several clones were purified by three rounds of limited dilutions and stable clones presenting a sustained antibody production were selected for subsequent characterization. Antibodies were tested for their reactivity and specificity to recognize the MUC4 peptide and further screened by enzyme-linked immunosorbent assay (ELISA) and Western blotting analyses. One of the MAbs (8G7) was strongly reactive against the MUC4 peptide and with native MUC4 from human tissues or pancreatic cancer cells in Western blotting, immunohistochemistry, and confocal analysis. Anti-MUC4 MAb may represent a powerful tool for the study of MUC4 function under normal and pathological conditions and for diagnosis of solid tumors including those in the breast, pancreas, lungs, and ovaries.

Highly conserved small subunit residues influence rubisco large subunit catalysis.

PubMed

Genkov, Todor; Spreitzer, Robert J

2009-10-30

The chloroplast enzyme ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco) catalyzes the rate-limiting step of photosynthetic CO(2) fixation. With a deeper understanding of its structure-function relationships and competitive inhibition by O(2), it may be possible to engineer an increase in agricultural productivity and renewable energy. The chloroplast-encoded large subunits form the active site, but the nuclear-encoded small subunits can also influence catalytic efficiency and CO(2)/O(2) specificity. To further define the role of the small subunit in Rubisco function, the 10 most conserved residues in all small subunits were substituted with alanine by transformation of a Chlamydomonas reinhardtii mutant that lacks the small subunit gene family. All the mutant strains were able to grow photosynthetically, indicating that none of the residues is essential for function. Three of the substitutions have little or no effect (S16A, P19A, and E92A), one primarily affects holoenzyme stability (L18A), and the remainder affect catalysis with or without some level of associated structural instability (Y32A, E43A, W73A, L78A, P79A, and F81A). Y32A and E43A cause decreases in CO(2)/O(2) specificity. Based on the x-ray crystal structure of Chlamydomonas Rubisco, all but one (Glu-92) of the conserved residues are in contact with large subunits and cluster near the amino- or carboxyl-terminal ends of large subunit alpha-helix 8, which is a structural element of the alpha/beta-barrel active site. Small subunit residues Glu-43 and Trp-73 identify a possible structural connection between active site alpha-helix 8 and the highly variable small subunit loop between beta-strands A and B, which can also influence Rubisco CO(2)/O(2) specificity.

Topographic antigenic determinants recognized by monoclonal antibodies on human choriogonadotropin beta-subunit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bidart, J.M.; Troalen, F.; Salesse, R.

1987-06-25

We describe a first attempt to study the antibody-combining sites recognized by monoclonal antibodies raised against the beta-subunit of human choriogonadotropin (hCG). Two groups of antibodies were first defined by their ability to recognize only the free beta-subunit or the free and combined subunit. Antibodies FBT-11 and FBT-11-L bind only to hCG beta-subunit but not to hCG, whereas antibodies FBT-10 and D1E8 bind to both the beta-subunit and the hormone. In both cases, the antigenic determinants were localized to the core of the protein (residues 1-112), indicating the weak immunogenicity of the specific carboxyl-terminal extension of hCG-beta. Nine synthetic peptidesmore » spanning different regions of hCG-beta and lutropin-beta were assessed for their capacity to inhibit antibody binding. A synthetic peptide inclusive of the NH2-terminal region (residues 1-7) of the hCG beta-subunit was found to inhibit binding to the radiolabeled subunit of a monoclonal antibody specific for free hCG-beta (FBT-11). Further delineation of the antigenic site recognized by this antibody provided evidence for the involvement of fragment 82-92. Moreover, monoclonal antibody FBT-11 inhibited the recombination of hCG-beta to hCG-alpha, indicating that its antigenic determinant might be located nearby or in the hCG-beta portion interacting with the alpha-subunit. Binding of monoclonal antibody FBT-10, corresponding to the second antigenic determinant, was weakly inhibited by fragment 82-105 and did not impair the recombination of the hCG beta-subunit to the hCG alpha-subunit. Its combining site appeared to be located in a region of the intact native choriogonadotropin present at the surface of the hormone-receptor complex.« less

An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

PubMed

Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

2012-07-01

cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

A mutation in the insulin receptor gene that impairs transport of the receptor to the plasma membrane and causes insulin-resistant diabetes.

PubMed Central

Accili, D; Frapier, C; Mosthaf, L; McKeon, C; Elbein, S C; Permutt, M A; Ramos, E; Lander, E; Ullrich, A; Taylor, S I

1989-01-01

Insulin binds to a receptor on the cell surface, thereby triggering a biological response within the target cell. Mutations in the insulin receptor gene can render the cell resistant to the biological action of insulin. We have studied a family in which two sisters have a genetic form of insulin-resistant diabetes mellitus. The technique of homozygosity mapping has been used to demonstrate that the mutation causing diabetes in this consanguineous family is genetically linked to the insulin receptor gene. The two insulin-resistant sisters are homozygous for a mutation encoding substitution of valine for phenylalanine at position 382 in the alpha-subunit of the insulin receptor. Transfection of mutant insulin receptor cDNA into NIH3T3 cells demonstrated that the Val382 mutation impaired post-translational processing and retarded transport of the insulin receptor to the plasma membrane. Thus, the mutation causes insulin resistance by decreasing the number of insulin receptors on the surface of the patients' cells. Images PMID:2573522

The alpha subunit of the Saccharomyces cerevisiae oligosaccharyltransferase complex is essential for vegetative growth of yeast and is homologous to mammalian ribophorin I

PubMed Central

1995-01-01

Oligosaccharyltransferase mediates the transfer of a preassembled high mannose oligosaccharide from a lipid-linked oligosaccharide donor to consensus glycosylation acceptor sites in newly synthesized proteins in the lumen of the rough endoplasmic reticulum. The Saccharomyces cerevisiae oligosaccharyltransferase is an oligomeric complex composed of six nonidentical subunits (alpha-zeta), two of which are glycoproteins (alpha and beta). The beta and delta subunits of the oligosaccharyltransferase are encoded by the WBP1 and SWP1 genes. Here we describe the functional characterization of the OST1 gene that encodes the alpha subunit of the oligosaccharyltransferase. Protein sequence analysis revealed a significant sequence identity between the Saccharomyces cerevisiae Ost1 protein and ribophorin I, a previously identified subunit of the mammalian oligosaccharyltransferase. A disruption of the OST1 locus was not tolerated in haploid yeast showing that expression of the Ost1 protein is essential for vegetative growth of yeast. An analysis of a series of conditional ost1 mutants demonstrated that defects in the Ost1 protein cause pleiotropic underglycosylation of soluble and membrane-bound glycoproteins at both the permissive and restrictive growth temperatures. Microsomal membranes isolated from ost1 mutant yeast showed marked reductions in the in vitro transfer of high mannose oligosaccharide from exogenous lipid-linked oligosaccharide to a glycosylation site acceptor tripeptide. Microsomal membranes isolated from the ost1 mutants contained elevated amounts of the Kar2 stress-response protein. PMID:7860628

Spacing requirements for interactions between the C-terminal domain of the alpha subunit of Escherichia coli RNA polymerase and the cAMP receptor protein.

PubMed Central

Lloyd, G S; Busby, S J; Savery, N J

1998-01-01

During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538

Solution structure of {alpha}-conotoxin PIA, a novel antagonist of {alpha}6 subunit containing nicotinic acetylcholine receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chi, Seung-Wook; Lee, Si-Hyung; Kim, Do-Hyoung

2005-12-30

{alpha}-Conotoxin PIA is a novel nicotinic acetylcholine receptor (nAChR) antagonist isolated from Conus purpurascens that targets nAChR subtypes containing {alpha}6 and {alpha}3 subunits. {alpha}-conotoxin PIA displays 75-fold higher affinity for rat {alpha}6/{alpha}3{beta}2{beta}3 nAChRs than for rat {alpha}3{beta}2 nAChRs. We have determined the three-dimensional structure of {alpha}-conotoxin PIA by nuclear magnetic resonance spectroscopy. The {alpha}-conotoxin PIA has an '{omega}-shaped' overall topology as other {alpha}4/7 subfamily conotoxins. Yet, unlike other neuronally targeted {alpha}4/7-conotoxins, its N-terminal tail Arg{sup 1}-Asp{sup 2}-Pro{sup 3} protrudes out of its main molecular body because Asp{sup 2}-Pro{sup 3}-Cys{sup 4}-Cys{sup 5} forms a stable type I {beta}-turn. In addition, amore » kink introduced by Pro{sup 15} in the second loop of this toxin provides a distinct steric and electrostatic environment from those in {alpha}-conotoxins MII and GIC. By comparing the structure of {alpha}-conotoxin PIA with other functionally related {alpha}-conotoxins we suggest structural features in {alpha}-conotoxin PIA that may be associated with its unique receptor recognition profile.« less

Alpha4 containing nicotinic receptors are positioned to mediate postsynaptic effects on serotonin neurons in the rat dorsal raphe nucleus

PubMed Central

Commons, Kathryn G.

2008-01-01

Nicotinic acetylcholine receptors containing the alpha4 and beta2 subunits constitute the most abundant high-affinity binding site of nicotine in the brain and are critical for the addictive qualities of nicotine. Serotonin neurotransmission is thought to be an important contributor to nicotine addiction. Therefore in this study it was examined how alpha4-containing receptors are positioned to modulate the function of serotonin neurons using ultrastructural analysis of immunolabeling for the alpha4 receptor subunit in the dorsal raphe nucleus (DR), a primary source of forebrain serotonin in the rat. Of 150 profiles labeled for the alpha4 subunit, 140 or 93% consisted of either soma or dendrites, these were often small-caliber (distal) dendrites <1.5 um in diameter (63/150 or 42%). The majority (107/150 or 71%) of profiles containing labeling for alpha4 were dually labeled for the synthetic enzyme for serotonin, tryptophan hydroxylase (TPH). Within dendrites immunogold labeling for alpha4 was present on the plasma membrane or near postsynaptic densities. However, labeling for alpha4 was commonly localized to the cytoplasmic compartment often associated with smooth endoplasmic reticulum, plausibly representing receptors in transit to or from the plasma membrane. Previous studies have suggested that nicotine presynaptically regulates activity onto serotonin neurons, however alpha4 immunolabeling was detected in only 10 axons in the DR or 7% of profiles sampled. This finding suggest that alpha4 containing receptors are minor contributors to presynaptic regulation of synaptic activity onto serotonin neurons, but rather alpha4 containing receptors are positioned to influence serotonin neurons directly at postsynaptic sites. PMID:18403129

Steady-state levels of G-protein beta-subunit expression are regulated by treatment of cells with bacterial toxins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watkins, D.C.; Northup, J.K.; Malbon, C.C.

1987-05-01

Cultures of 3T3-L1 cells were incubated with either 10 ng/ml cholera toxin or 10 ng/ml pertussis toxin from 4 days prior to the initiation of differentiation and throughout the subsequent incubation. Toxin concentrations were sufficient to completely prevent the labelling of alpha-subunits with (/sup 32/P)NAD/sup +/ and pertussis toxin and to prevent by more than 90% the labelling with (/sup 32/P)NAD/sup +/ and cholera toxin in membranes prepared from these cells. Neither toxin prevented the differentiation to the adipocyte phenotype. Neither toxin prevented the increases in the relative amounts of G-proteins which occur upon differentiation. Both toxins dramatically decreased themore » amount of beta-subunits. As measured by quantitative immunoblotting with antisera specific for both the 35 kDa and 36 kDa beta-subunits, levels of beta-subunit were decreased by more than 50% of steady-state level of control cells. Thus, bacterial toxins which modifies G-protein alpha-subunits are capable of modulating the levels of beta-subunits in vivo. The basis for the regulation of G-protein subunit expression by bacterial toxins is under study.« less

Interactions between the cyclic AMP receptor protein and the alpha subunit of RNA polymerase at the Escherichia coli galactose operon P1 promoter.

PubMed

Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S

1994-10-25

DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1.

Interactions between the cyclic AMP receptor protein and the alpha subunit of RNA polymerase at the Escherichia coli galactose operon P1 promoter.

PubMed Central

Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S

1994-01-01

DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1. Images PMID:7971267

The Relative Abundance and Transcriptional Activity of Marine Sponge-Associated Microorganisms Emphasizing Groups Involved in Sulfur Cycle.

PubMed

Jensen, Sigmund; Fortunato, Sofia A V; Hoffmann, Friederike; Hoem, Solveig; Rapp, Hans Tore; Øvreås, Lise; Torsvik, Vigdis L

2017-04-01

During the last decades, our knowledge about the activity of sponge-associated microorganisms and their contribution to biogeochemical cycling has gradually increased. Functional groups involved in carbon and nitrogen metabolism are well documented, whereas knowledge about microorganisms involved in the sulfur cycle is still limited. Both sulfate reduction and sulfide oxidation has been detected in the cold water sponge Geodia barretti from Korsfjord in Norway, and with specimens from this site, the present study aims to identify extant versus active sponge-associated microbiota with focus on sulfur metabolism. Comparative analysis of small subunit ribosomal RNA (16S rRNA) gene (DNA) and transcript (complementary DNA (cDNA)) libraries revealed profound differences. The transcript library was predominated by Chloroflexi despite their low abundance in the gene library. An opposite result was found for Acidobacteria. Proteobacteria were detected in both libraries with representatives of the Alpha- and Gammaproteobacteria related to clades with presumably thiotrophic bacteria from sponges and other marine invertebrates. Sequences that clustered with sponge-associated Deltaproteobacteria were remotely related to cultivated sulfate-reducing bacteria. The microbes involved in sulfur cycling were identified by the functional gene aprA (adenosine-5'-phosphosulfate reductase) and its transcript. Of the aprA sequences (DNA and cDNA), 87 % affiliated with sulfur-oxidizing bacteria. They clustered with Alphaproteobacteria and with clades of deep-branching Gammaproteobacteria. The remaining sequences clustered with sulfate-reducing Archaea of the phylum Euryarchaeota. These results indicate an active role of yet uncharacterized Bacteria and Archaea in the sponge's sulfur cycle.

Functional integrins from normal and glycosylation-deficient baby hamster kidney cells. Terminal processing of asparagine-linked oligosaccharides is not correlated with fibronectin-binding activity.

PubMed

Koyama, T; Hughes, R C

1992-12-25

We have examined the properties of the alpha 5 beta 1 integrin of baby hamster kidney (BHK) cells, a ricin-resistant variant Ric14 lacking N-acetylglucosaminyl transferase I, and hence unable to complete assembly of hybrid- or complex-type N-glycans, and BHK cells treated with 1-deoxymannojirimycin (dMM), an inhibitor of Golgi mannosidases involved in the initial processing of N-glycan precursors. Comparable amounts of alpha 5 beta 1 integrin were isolated from these cells by chromatography of detergent extracts on a fibronectin cell-binding fragment affinity column and elution with EDTA. The alpha 5 beta 1 integrin obtained from normal BHK cells by fibronectin affinity chromatography contained mainly endoglycosidase H-resistant oligosaccharides, whereas in RicR14 cells or dMM-treated BHK cells these were entirely endoglycosidase H-sensitive. Analysis of lactoperoxidase labeled or long term biosynthetically 35S-labeled proteins from cultures of normal or glycosylation deficient cells showed similar steady state levels of alpha 5 beta 1 integrin and expression at the cell surface. Pulse-chase experiments in normal BHK cells showed rapid conversion of the alpha 5 subunit into a mature form containing oligosaccharides resistant to endoglycosidase H and slower maturation of a precursor beta 1 subunit, as in other cell types. In Ric14 cells the precursor beta 1 subunit was found to carry glycans larger than the fully processed Man5GlcNAc2 glycan of the mature subunit, indicating that the bulk precursor pool had not been translocated into the cis-Golgi compartment containing mannosidase I. We conclude that in BHK cells terminal oligosaccharide processing of alpha 5 beta 1 integrin subunits is not required for dimer formation, surface expression, and fibronectin binding, and that expression of the glycosylation defect of Ric14 cells on the alpha 5 beta 1 integrin does not account for the reduced adhesiveness of these cells on fibronectin compared with normal and dMM-treated BHK cells.

Use of a purified and functional recombinant calcium-channel beta4 subunit in surface-plasmon resonance studies.

PubMed Central

Geib, Sandrine; Sandoz, Guillaume; Mabrouk, Kamel; Matavel, Alessandra; Marchot, Pascale; Hoshi, Toshinori; Villaz, Michel; Ronjat, Michel; Miquelis, Raymond; Lévêque, Christian; de Waard, Michel

2002-01-01

Native high-voltage-gated calcium channels are multi-subunit complexes comprising a pore-forming subunit Ca(v) and at least two auxiliary subunits alpha(2)delta and beta. The beta subunit facilitates cell-surface expression of the channel and contributes significantly to its biophysical properties. In spite of its importance, detailed structural and functional studies are hampered by the limited availability of native beta subunit. Here, we report the purification of a recombinant calcium-channel beta(4) subunit from bacterial extracts by using a polyhistidine tag. The purified protein is fully functional since it binds on the alpha1 interaction domain, its main Ca(v)-binding site, and regulates the activity of P/Q calcium channel expressed in Xenopus oocytes in a similar way to the beta(4) subunit produced by cRNA injection. We took advantage of the functionality of the purified material to (i) develop an efficient surface-plasmon resonance assay of the interaction between two calcium channel subunits and (ii) measure, for the first time, the affinity of the recombinant His-beta(4) subunit for the full-length Ca(v)2.1 channel. The availability of this purified material and the development of a surface-plasmon resonance assay opens two immediate research perspectives: (i) drug screening programmes applied to the Ca(v)/beta interaction and (ii) crystallographic studies of the calcium-channel beta(4) subunit. PMID:11988102

Oxygen binding by alpha(Fe2+)2beta(Ni2+)2 hemoglobin crystals.

PubMed Central

Bruno, S.; Bettati, S.; Manfredini, M.; Mozzarelli, A.; Bolognesi, M.; Deriu, D.; Rosano, C.; Tsuneshige, A.; Yonetani, T.; Henry, E. R.

2000-01-01

Oxygen binding by hemoglobin fixed in the T state either by crystallization or by encapsulation in silica gels is apparently noncooperative. However, cooperativity might be masked by different oxygen affinities of alpha and beta subunits. Metal hybrid hemoglobins, where the noniron metal does not bind oxygen, provide the opportunity to determine the oxygen affinities of alpha and beta hemes separately. Previous studies have characterized the oxygen binding by alpha(Ni2+)2beta(Fe2+)2 crystals. Here, we have determined the three-dimensional (3D) structure and oxygen binding of alpha(Fe2+)2beta(Ni2+)2 crystals grown from polyethylene glycol solutions. Polarized absorption spectra were recorded at different oxygen pressures with light polarized parallel either to the b or c crystal axis by single crystal microspectrophotometry. The oxygen pressures at 50% saturation (p50s) are 95 +/- 3 and 87 +/- 4 Torr along the b and c crystal axes, respectively, and the corresponding Hill coefficients are 0.96 +/- 0.06 and 0.90 +/- 0.03. Analysis of the binding curves, taking into account the different projections of the alpha hemes along the optical directions, indicates that the oxygen affinity of alpha1 hemes is 1.3-fold lower than alpha2 hemes. Inspection of the 3D structure suggests that this inequivalence may arise from packing interactions of the Hb tetramer within the monoclinic crystal lattice. A similar inequivalence was found for the beta subunits of alpha(Ni2+)2beta(Fe2+)2 crystals. The average oxygen affinity of the alpha subunits (p50 = 91 Torr) is about 1.2-fold higher than the beta subunits (p50 = 110 Torr). In the absence of cooperativity, this heterogeneity yields an oxygen binding curve of Hb A with a Hill coefficient of 0.999. Since the binding curves of Hb A crystals exhibit a Hill coefficient very close to unity, these findings indicate that oxygen binding by T-state hemoglobin is noncooperative, in keeping with the Monod, Wyman, and Changeux model. PMID:10794410

Mutations affecting two adjacent amino acid residues in the alpha subunit of RNA polymerase block transcriptional activation by the bacteriophage P2 Ogr protein.

PubMed Central

Ayers, D J; Sunshine, M G; Six, E W; Christie, G E

1994-01-01

The bacteriophage P2 ogr gene product is a positive regulator of transcription from P2 late promoters. The ogr gene was originally defined by compensatory mutations that overcame the block to P2 growth imposed by a host mutation, rpoA109, in the gene encoding the alpha subunit of RNA polymerase. DNA sequence analysis has confirmed that this mutation affects the C-terminal region of the alpha subunit, changing a leucine residue at position 290 to a histidine (rpoAL290H). We have employed a reporter plasmid system to screen other, previously described, rpoA mutants for effects on activation of a P2 late promoter and have identified a second allele, rpoA155, that blocks P2 late transcription. This mutation lies just upstream of rpoAL290H, changing the leucine residue at position 289 to a phenylalanine (rpoAL289F). The effect of the rpoAL289F mutation is not suppressed by the rpoAL290H-compensatory P2 ogr mutation. P2 ogr mutants that overcome the block imposed by rpoAL289F were isolated and characterized. Our results are consistent with a direct interaction between Ogr and the alpha subunit of RNA polymerase and support a model in which transcription factor contact sites within the C terminus of alpha are discrete and tightly clustered. PMID:8002564

Spectral and Temporal Properties of the Alpha and Beta Subunits and (alpha Beta) Monomer Isolated from Nostoc SP. Using Picosecond Laser Spectroscopy.

NASA Astrophysics Data System (ADS)

Dagen, Aaron J.

1985-12-01

The fluorescence decay profiles, relative quantum yield and transmission of the (alpha), (beta) and ((alpha)(beta)) complexes from phycoerythrin isolated from the photosynthetic antenna system of Nostoc sp. and measured by single picosecond laser spectroscopic techniques is studied. The fluorescence decay profiles of all three complexes are found to be intensity independent for the intensity range investigated ((TURN)4 x 10('13) to (TURN)4 x 10('15) photons-cm('-2) per pulse). The apparent decrease in the relative quantum yield of all three complexes as intensity increases is offset by a corresponding increase in the relative transmission. This evidence, along with the intensity independent fluorescence kinetics, suggests that exciton annihilation is absent in these complexes. The decay profiles are fit to models assuming energy transfer amongst fluorescing chromophores. The intraprotein transfer rate is found to be 100 ps in the (alpha) subunit, 666 ps in the (beta) subunit. Constraining these rates to be identical in the monomer results in explaining the monomer kinetics by an increase in the nonradiative rate of the f(,(beta)) chromophore, an apparent result of aggregation effects.

Spectral and temporal properties of the alpha and beta subunits and (alpha beta) monomer isolated from Nostoc sp. using picosecond laser spectroscopy

NASA Astrophysics Data System (ADS)

Dagen, A. J.

1985-12-01

The fluorescence decay profiles, relative quantum yield and transmission of the alpha, beta and (alpha beta) complexes from phycoerythrin isolated from the photosynthetic antenna system of Nostoc sp. and measured by single picosecond laser spectroscopic techniques is studied. The fluorescence decay profiles of all three complexes are found to be intensity independent for the intensity range investigated (approx. 4x10 to the 13th power to 4x10 to the 15th power photons/sq cm per pulse). The apparent decrease in the relative quantum yield of all three complexes as intensity increases is offset by a corresponding increase in the relative transmission. This evidence, along with the intensity independent fluorescence kinetics, suggests that exciton annihilation is absent in these complexes. The decay profiles are fit to models assuming energy transfer amongst fluorescing chromophores. The intraprotein transfer rate is found to be 100 ps in the alpha subunit, 666 ps in the beta subunit. Constraining these rates to be identical in the monomer results in explaining the monomer kinetics by an increase in the nonradiative rate of the f beta chromophore, an apparent result of aggregation effects.

Nicotinic receptor abnormalities in the cerebellar cortex in autism.

PubMed

Lee, M; Martin-Ruiz, C; Graham, A; Court, J; Jaros, E; Perry, R; Iversen, P; Bauman, M; Perry, E

2002-07-01

Autism is a common developmental disorder associated with structural and inferred neurochemical abnormalities of the brain. Cerebellar abnormalities frequently have been identified, based on neuroimaging or neuropathology. Recently, the cholinergic neurotransmitter system has been implicated on the basis of nicotinic receptor loss in the cerebral cortex. Cerebellar cholinergic activities were therefore investigated in autopsy tissue from a series of autistic individuals. The presynaptic cholinergic enzyme, choline acetyltransferase, together with nicotinic and muscarinic receptor subtypes were compared in the cerebellum from age-matched mentally retarded autistic (eight), normal control (10) and non-autistic mentally retarded individuals (11). The nicotinic receptor binding the agonist epibatidine (the high affinity receptor subtype, consisting primarily of alpha3 and alpha4, together with beta2 receptor subunits) was significantly reduced by 40-50% in the granule cell, Purkinje and molecular layers in the autistic compared with the normal group (P < 0.05). There was an opposite increase (3-fold) in the nicotinic receptor binding alpha-bungarotoxin (to the alpha7 subunit) which reached significance in the granule cell layer (P < 0.05). These receptor changes were paralleled by a significant reduction (P < 0.05) and non-significant increase, respectively, of alpha4 and alpha7 receptor subunit immunoreactivity measured using western blotting. Immunohistochemically loss of alpha(4 )reactivity was apparent from Purkinje and the other cell layers, with increased alpha7 reactivity in the granule cell layer. There were no significant changes in choline acetyltransferase activity, or in muscarinic M1 and M2 receptor subtypes in autism. In the non-autistic mentally retarded group, the only significant abnormality was a reduction in epibatidine binding in the granule cell and Purkinje layers. In two autistic cases examined histologically, Purkinje cell loss was observed in multiple lobules throughout the vermis and hemispheres. This was more severe in one case with epilepsy, which also showed vermis folial malformation. The case with less severe Purkinje cell loss also showed cerebellar white matter thinning and demyelination. These findings indicate a loss of the cerebellar nicotinic alpha4 receptor subunit in autism which may relate to the loss of Purkinje cells, and a compensatory increase in the alpha7 subunit. It remains to be determined how these receptor abnormalities are involved in neurodevelopment in autism and what is the relationship to mental function. Since nicotinic receptor agonists enhance attentional function and also induce an elevation in the high affinity receptor, nicotinic therapy in autism may be worth considering.

Altered expression of extracellular matrix molecules and their receptors in chronic pancreatitis and pancreatic adenocarcinoma in comparison with normal pancreas.

PubMed

Shimoyama, S; Gansauge, F; Gansauge, S; Oohara, T; Beger, H G

1995-12-01

The aim of this study was to elucidate the expression and distribution patterns of both integrins and extracellular matrix (ECM) molecules in chronic pancreatitis (CP) and pancreatic adenocarcinoma (PC) compared with normal pancreas (NP). Expression of nine alpha-subunits (alpha 2-alpha 6, alpha V, alpha L, alpha M, and alpha X), four beta-subunits (beta 1, beta 3-beta 5), and four ECM molecules (type IV collagen, laminin, fibronectin, and vitronectin) was investigated immunohistochemically. In CP, all integrins except alpha V showed nearly the same staining patterns compared with NP. Some acinar cells in CP expressed alpha V. Whereas alpha 2, alpha 3, and alpha 6 expression was stronger and diffuse, no alpha 5 expression was seen in PC. Basement membrane (BM) showed continuous staining in CP, whereas it showed discontinuous/absent staining in PC with antitype IV collagen, laminin, and vitronectin antibodies. Some carcinoma cells showed reverse correlation between alpha 2, alpha 3, and alpha 6 expression and type IV collagen and laminin expression. Fibronectin showed diffuse stromal expression in CP and PC. Some acinar cells or duct cells in CP carcinoma cells in PC showed intracellular VN expression. These results suggest that these integrins and ECM molecules are involved in inflammatory and malignant processes in pancreas.

Characterization of a novel isoform of alpha-nascent polypeptide-associated complex as IgE-defined autoantigen.

PubMed

Mossabeb, Roschanak; Seiberler, Susanne; Mittermann, Irene; Reininger, Renate; Spitzauer, Susanne; Natter, Susanne; Verdino, Petra; Keller, Walter; Kraft, Dietrich; Valenta, Rudolf

2002-10-01

The nascent polypeptide-associated complex is required for intracellular translocation of newly synthesized polypeptides in eukaryotic cells. It may also act as a transcriptional coactivator in humans and various eukaryotic organisms and binds to nucleic acids. Recently, we provided evidence that a component of nascent polypeptide-associated complex, alpha-nascent polypeptide-associated complex, represents an IgE-reactive autoantigen for atopic dermatitis patients. By oligonucleotide screening we isolated a complete cDNA coding for a so far unknown alpha-nascent polypeptide-associated complex isoform from a human epithelial cDNA library. Southern blot hybridization experiments provided further evidence that alpha-nascent polypeptide-associated complex is encoded by a gene family. Recombinant alpha-nascent polypeptide-associated complex was expressed in Escherichia coli as a soluble, His-tagged protein, and purified via nickel affinity chromatography. By circular dichroism analysis it is demonstrated that purified recombinant alpha-nascent polypeptide-associated complex represents a folded protein of mixed alpha-helical and beta-sheet conformation with unusual high thermal stability and remarkable refolding capacity. Complete recombinant alpha-nascent polypeptide-associated complex (215 amino acids) and its 86 amino acid C-terminal fragment specifically bound IgE autoantibodies. Recombinant alpha-nascent polypeptide-associated complex also inhibited IgE binding to natural alpha-nascent polypeptide-associated complex, demonstrating the presence of common IgE epitopes between the recombinant and natural protein. Furthermore, recombinant alpha-nascent polypeptide-associated complex induced specific lymphoproliferative responses in peripheral blood mononuclear cells of a sensitized atopic dermatitis patient. As has been proposed for environmental allergens it is possible that T cell responses to IgE-defined autoantigens may contribute to the chronic skin manifestations in atopic dermatitis.

The construction, identification and partial characterization of plasmids containing guinea-pig milk protein complementary DNA sequences.

PubMed Central

Craig, R K; Hall, L; Parker, D; Campbell, P N

1981-01-01

A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038

Cloning and developmental expression of pea ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit N-methyltransferase

DOEpatents

Houtz, Robert L.

1998-01-01

The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS) .epsilon.N-methyltransferase (protein methylase III or Rubisco LSMT) is disclosed. This enzyme catalyzes methylation of the .epsilon.-amine of lysine-14 in the large subunit of Rubisco. In addition, a full-length cDNA clone for Rubisco LSMT is disclosed. Transgenic plants and methods of producing same which (1) have the Rubisco LSMT gene inserted into the DNA, and (2) have the Rubisco LSMT gene product or the action of the gene product deleted from the DNA are also provided. Further, methods of using the gene to selectively deliver desired agents to a plant are also disclosed.

Cloning and developmental expression of pea ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit epsilon N-methyltransferase

DOEpatents

Houtz, Robert L.

1999-01-01

The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS) .sup..epsilon. N-methyltransferase (protein methylase III or Rubisco LSMT) is disclosed. This enzyme catalyzes methylation of the .epsilon.-amine of lysine-14 in the large subunit of Rubisco. In addition, a full-length cDNA clone for Rubisco LSMT is disclosed. Transgenic plants and methods of producing same which (1) have the Rubisco LSMT gene inserted into the DNA, and (2) have the Rubisco LSMT gene product or the action of the gene product deleted from the DNA are also provided. Further, methods of using the gene to selectively deliver desired agents to a plant are also disclosed.

Cloning and developmental expression of pea ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit N-methyltransferase

DOEpatents

Houtz, R.L.

1998-03-03

The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS) {epsilon}N-methyltransferase (protein methylase III or Rubisco LSMT) is disclosed. This enzyme catalyzes methylation of the {epsilon}-amine of lysine-14 in the large subunit of Rubisco. In addition, a full-length cDNA clone for Rubisco LSMT is disclosed. Transgenic plants and methods of producing same which (1) have the Rubisco LSMT gene inserted into the DNA, and (2) have the Rubisco LSMT gene product or the action of the gene product deleted from the DNA are also provided. Further, methods of using the gene to selectively deliver desired agents to a plant are also disclosed. 5 figs.

Cloning and developmental expression of pea ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit epsilon N-methyltransferase

DOEpatents

Houtz, R.L.

1999-02-02

The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS){sup {epsilon}}N-methyltransferase (protein methylase III or Rubisco LSMT) is disclosed. This enzyme catalyzes methylation of the {epsilon}-amine of lysine-14 in the large subunit of Rubisco. In addition, a full-length cDNA clone for Rubisco LSMT is disclosed. Transgenic plants and methods of producing same which (1) have the Rubisco LSMT gene inserted into the DNA, and (2) have the Rubisco LSMT gene product or the action of the gene product deleted from the DNA are also provided. Further, methods of using the gene to selectively deliver desired agents to a plant are also disclosed. 8 figs.

Studies of the Outer Membrane Proteins of Campylobacter Jejuni for Vaccine Development

DTIC Science & Technology

1991-11-26

Mycobacterium tuberculosis, and M.leprae (66%) and mitochondrial protein p1 precursor of human and Chinese hamster cells (64%), and rubisco subunit binding...175) SAWG--DIgNIISDAP’KXVGRXgVITVK (202) 64% Rubisco subunit binding-protein alpha subunit of wheat (151) SAGN--OELIZGANADAIDOGPOVVLStE (178) 57

ENU mutagenesis identifies mice with cardiac fibrosis and hepatic steatosis caused by a mutation in the mitochondrial trifunctional protein beta-subunit.

PubMed

Kao, Hsiao-Jung; Cheng, Ching-Feng; Chen, Yen-Hui; Hung, Shuen-Iu; Huang, Cheng-Chih; Millington, David; Kikuchi, Tateki; Wu, Jer-Yuarn; Chen, Yuan-Tsong

2006-12-15

Using the metabolomics-guided screening coupled to N-ethyl-N-nitrosourea-mediated mutagenesis, we identified mice that exhibited elevated levels of long-chain acylcarnitines. Whole genome homozygosity mapping with 262 SNP markers mapped the disease gene to chromosome 5 where candidate genes Hadha and Hadhb, encoding the mitochondria trifunctional protein (MTP) alpha- and beta-subunits, respectively, are located. Direct sequencing revealed a normal alpha-subunit, but detected a nucleotide T-to-A transversion in exon 14 (c.1210T>A) of beta-subunit (Hadhb) which resulted in a missense mutation of methionine to lysine (M404K). Western blot analysis showed a significant reduction of both the alpha- and beta-subunits, consistent with reduced enzyme activity in both the long-chain 3-hydroxyacyl-CoA dehydrogenase and the long-chain 3-ketoacyl-CoA thiolase activities. These mice had a decreased weight gain and cardiac arrhythmias which manifested from a prolonged PR interval to a complete atrio-ventricular dissociation, and died suddenly between 9 and 16 months of age. Histopathological studies showed multifocal cardiac fibrosis and hepatic steatosis. This mouse model will be useful to further investigate the mechanisms underlying arrhythmogenesis relating to lipotoxic cardiomyopathy and to investigate pathophysiology and treatment strategies for human MTP deficiency.

Astrocytes express specific variants of CaM KII delta and gamma, but not alpha and beta, that determine their cellular localizations.

PubMed

Vallano, M L; Beaman-Hall, C M; Mathur, A; Chen, Q

2000-04-01

Multiple isoforms of type II Ca(2+)-calmodulin-dependent kinase (CaM KII) are composed of two major neuron-specific subunits, designated alpha and beta, and two less well-characterized subunits that are also expressed in non-neuronal tissues, designated delta and gamma. Regulated expression of these 4 gene products, and several variants produced by alternative splicing, shows temporal and regional specificity and influences intracellular targeting. We used immunoblotting and RT-PCR to analyze subunit and variant expression and distribution in cultured cerebellar astrocytes and neurons, and whole cerebellar cortex from rodent brain. The data indicate that: (i) astrocytes express a single splice variant of delta, namely delta(2); (ii) like neurons, astrocytes express two forms of CaM KII gamma; gamma(B) and gamma(A); (iii) these CaM KII variants are enriched in the supernate fraction in astrocytes, and the particulate fraction in neurons; (iv) unlike neurons, astrocytes do not express detectable levels of alpha or beta subunits or their respective splice variants. The results indicate that neurons and astrocytes express distinct CaM KII subunits and variants that localize to distinct subcellular compartments and, by inference, exert distinct cellular functions. Copyright 2000 Wiley-Liss, Inc.

Constitutive Activation of the G-Protein Subunit G[alpha]s within Forebrain Neurons Causes PKA-Dependent Alterations in Fear Conditioning and Cortical "Arc" mRNA Expression

ERIC Educational Resources Information Center

Kelly, Michele P.; Cheung, York-Fong; Favilla, Christopher; Siegel, Steven J.; Kanes, Stephen J.; Houslay, Miles D.; Abel, Ted

2008-01-01

Memory formation requires cAMP signaling; thus, this cascade has been of great interest in the search for cognitive enhancers. Given that medications are administered long-term, we determined the effects of chronically increasing cAMP synthesis in the brain by expressing a constitutively active isoform of the G-protein subunit G[alpha]s…

Integrin alpha 3 beta 1 participates in the phagocytosis of extracellular matrix molecules by human breast cancer cells.

PubMed

Coopman, P J; Thomas, D M; Gehlsen, K R; Mueller, S C

1996-11-01

The mechanisms and receptors involved in phagocytosis by nonhematopoietic cells are not well understood. The involvement of the alpha 3 beta 1 integrin in phagocytosis of the extracellular matrix by human breast cancer cells was studied. The possible role of this integrin was suggested since alpha 3 and beta 1 but not alpha 2 subunits are concentrated at membrane sites where local degradation of fluorescently labeled gelatin occurs. Strikingly, anti-alpha 3 integrin monoclonal antibodies (mAbs) stimulate the phagocytosis of fluorescently labeled gelatin films, gelatin beads, and Matrigel films in a quantitative phagocytosis assay. Stimulation of the gelatin uptake by the anti-alpha 3 mAb is dose responsive, saturable, and time dependent. Antibodies against other integrin subunits have a lower stimulatory effect (anti-beta 1) or no significant effect (anti-alpha 2, -alpha 5, -alpha 6, and -alpha v) on gelatin phagocytosis. The synthetic HGD-6 human laminin peptide that binds specifically the alpha 3 beta 1 integrin, but not the scrambled HSGD-6 control peptide, also markedly stimulates gelatin uptake in a dose-responsive way. Furthermore, the stimulatory effects of the HGD-6 peptide and the anti-alpha 3 mAb are additive, suggesting that they might promote phagocytosis in different ways. Other laminin (YIGSR, IKVAV) and fibronectin (GRGDS) peptides have no effect on gelatin phagocytosis. Immunofluorescence shows that the alpha 3 and the beta 1, but not the alpha 2 integrin subunit, concentrate into patches on the cell surface after treatment with their respective mAbs. And, both gelatin and the alpha 3 beta 1 but not the alpha 2 beta 1 integrin are cointernalized and routed to acidic vesicles such as lysosomes. In conclusion, we demonstrate that human breast cancer cells locally degrade and phagocytose the extracellular matrix and show for the first time that the alpha 3 beta 1 integrin participates in this phagocytosis. We hypothesize that the anti-alpha 3 antibodies and the laminin peptide HGD-6 activate the alpha 3 beta 1 integrin, which results in a downstream signaling cascade stimulating phagocytosis.

Activation and inhibition of mouse muscle and neuronal nicotinic acetylcholine receptors expressed in Xenopus oocytes.

PubMed

Papke, Roger L; Wecker, Lynn; Stitzel, Jerry A

2010-05-01

Transgenic mouse models with nicotinic acetylcholine receptor (nAChR) knockouts and knockins have provided important insights into the molecular substrates of addiction and disease. However, most studies of heterologously expressed neuronal nAChR have used clones obtained from other species, usually human or rat. In this work, we use mouse clones expressed in Xenopus oocytes to provide a relatively comprehensive characterization of the three primary classes of nAChR: muscle-type receptors, heteromeric neuronal receptors, and homomeric alpha7-type receptors. We evaluated the activation of these receptor subtypes with acetylcholine and cytisine-related compounds, including varenicline. We also characterized the activity of classic nAChR antagonists, confirming the utility of mecamylamine and dihydro-beta-erythroidine as selective antagonists in mouse models of alpha3beta4 and alpha4beta2 receptors, respectively. We also conducted an in-depth analysis of decamethonium and hexamethonium on muscle and neuronal receptor subtypes. Our data indicate that, as with receptors cloned from other species, pairwise expression of neuronal alpha and beta subunits in oocytes generates heterogeneous populations of receptors, most likely caused by variations in subunit stoichiometry. Coexpression of the mouse alpha5 subunit had varying effects, depending on the other subunits expressed. The properties of cytisine-related compounds are similar for mouse, rat, and human nAChR, except that varenicline produced greater residual inhibition of mouse alpha4beta2 receptors than with human receptors. We confirm that decamethonium is a partial agonist, selective for muscle-type receptors, but also note that it is a nondepolarizing antagonist for neuronal-type receptors. Hexamethonium was a relatively nonselective antagonist with mixed competitive and noncompetitive activity.

A conformational switch in the inhibitory gamma-subunit of PDE6 upon enzyme activation by transducin.

PubMed

Granovsky, A E; Artemyev, N O

2001-11-06

In response to light, a photoreceptor G protein, transducin, activates cGMP-phosphodiesterase (PDE6) by displacing the inhibitory gamma-subunits (Pgamma) from the enzyme's catalytic sites. Evidence suggests that the activation of PDE6 involves a conformational change of the key inhibitory C-terminal domain of Pgamma. In this study, the C-terminal region of Pgamma, Pgamma-73-85, has been targeted for Ala-scanning mutagenesis to identify the point-to-point interactions between Pgamma and the PDE6 catalytic subunits and to probe the nature of the conformational change. Pgamma mutants were tested for their ability to inhibit PDE6 and a chimeric PDE5-conePDE6 enzyme containing the Pgamma C-terminus-binding site of cone PDE. This analysis has revealed that in addition to previously characterized Ile86 and Ile87, important inhibitory contact residues of Pgamma include Asn74, His75, and Leu78. The patterns of mutant PDE5-conePDE6 enzyme inhibition suggest the interaction between the PgammaAsn74/His75 sequence and Met758 of the cone PDE6alpha' catalytic subunit. This interaction, and the interaction between the PgammaIle86/Ile87 and PDE6alpha'Phe777/Phe781 residues, is most consistent with an alpha-helical structure of the Pgamma C-terminus. The analysis of activation of PDE6 enzymes containing Pgamma mutants with Ala-substituted transducin-contact residues demonstrated the critical role of PgammaLeu76. Accordingly, we hypothesize that the initial step in PDE6 activation involves an interaction of transducin-alpha with PgammaLeu76. This interaction introduces a bend into the alpha-helical structure of the Pgamma C-terminus, allowing transducin-alpha to further twist the C-terminus thereby uncovering the catalytic pocket of PDE6.

UBXD4, a UBX-containing protein, regulates the cell surface number and stability of alpha3-containing nicotinic acetylcholine receptors.

PubMed

Rezvani, Khosrow; Teng, Yanfen; Pan, Yaping; Dani, John A; Lindstrom, Jon; García Gras, Eduardo A; McIntosh, J Michael; De Biasi, Mariella

2009-05-27

Adaptor proteins are likely to modulate spatially and temporally the trafficking of a number of membrane proteins, including neuronal nicotinic acetylcholine receptors (nAChRs). A yeast two-hybrid screen identified a novel UBX-containing protein, UBXD4, as one of the cytosolic proteins that interact directly with the alpha3 and alpha4 nAChR subunits. The function of UBX-containing proteins is largely unknown. Immunoprecipitation and confocal microscopy confirmed the interaction of UBXD4 with alpha3-containing nAChRs (alpha3* nAChRs) expressed in HEK293 cells, PC12 cells, and rat cortical neurons. Overexpression of UBXD4 in differentiated PC12 cells (dPC12) increased nAChR cell surface expression, especially that of the alpha3beta2 subtype. These findings were corroborated by electrophysiology, immunofluorescent staining, and biotinylation of surface receptors. Silencing of UBXD4 led to a significant reduction of alpha3* nAChRs in rat cortical neurons and dPC12 cells. Biochemical and immunofluorescence studies of endogenous UBXD4 showed that the protein is located in both the ER and cis-Golgi compartments. Our investigations also showed that the alpha3 subunit is ubiquitinated and that UBXD4 can interfere with its ubiquitination and consequent degradation by the proteasome. Our data suggest that UBXD4 modulates the distribution of alpha3* nAChRs between specialized intracellular compartments and the plasma membrane. This effect is achieved by controlling the stability of the alpha3 subunit and, consequently, the number of receptors at the cell surface.

Molecular cloning of pituitary glycoprotein alpha-subunit and follicle stimulating hormone and chorionic gonadotropin beta-subunits from New World squirrel monkey and owl monkey.

PubMed

Scammell, Jonathan G; Funkhouser, Jane D; Moyer, Felricia S; Gibson, Susan V; Willis, Donna L

2008-02-01

The goal of this study was to characterize the gonadotropins expressed in pituitary glands of the New World squirrel monkey (Saimiri sp.) and owl monkey (Aotus sp.). The various subunits were amplified from total RNA from squirrel monkey and owl monkey pituitary glands by reverse transcription-polymerase chain reaction and the deduced amino acid sequences compared to those of other species. Mature squirrel monkey and owl monkey glycoprotein hormone alpha-polypeptides (96 amino acids in length) were determined to be 80% homologous to the human sequence. The sequences of mature beta subunits of follicle stimulating hormone (FSHbeta) from squirrel monkey and owl monkey (111 amino acids in length) are 92% homologous to human FSHbeta. New World primate glycoprotein hormone alpha-polypeptides and FSHbeta subunits showed conservation of all cysteine residues and consensus N-linked glycosylation sites. Attempts to amplify the beta-subunit of luteinizing hormone from squirrel monkey and owl monkey pituitary glands were unsuccessful. Rather, the beta-subunit of chorionic gonadotropin (CG) was amplified from pituitaries of both New World primates. Squirrel monkey and owl monkey CGbeta are 143 and 144 amino acids in length and 77% homologous with human CGbeta. The greatest divergence is in the C terminus, where all four sites for O-linked glycosylation in human CGbeta, responsible for delayed metabolic clearance, are predicted to be absent in New World primate CGbetas. It is likely that CG secreted from pituitary of New World primates exhibits a relatively short half-life compared to human CG.

ADP binding to TF1 and its subunits induces ultraviolet spectral changes.

PubMed

Hisabori, T; Yoshida, M; Sakurai, H

1986-09-01

Adenine nucleotide binding sites on the coupling factor ATPase of thermophilic bacterium PS3 (TF1) were investigated by UV spectroscopy and by equilibrium dialysis. When ADP was mixed with TF1 in the presence and in the absence of Mg2+, an UV absorbance change was induced (t1/2 approximately 1 min) with a peak at about 278 nm and a trough at about 250 nm. Similar spectral changes were induced by ADP with the isolated beta subunits in the presence and in the absence of Mg2+, and with the isolated alpha subunits in the presence of Mg2+ although the magnitudes of the changes were different. From equilibrium dialysis measurement we identified two classes of nucleotide binding sites in TF1 in the presence of Mg2+, three high-affinity sites (Kd = 61 nM) and three low-affinity sites (Kd = 87 microM). In the absence of Mg2+, TF1 has one high-affinity site (Kd less than 10 nM) and five low-affinity sites (Kd = 100 microM). Moreover, we found a single Mg2+-dependent ADP binding site on the isolated alpha subunit and a single Mg2+-independent ADP binding site on the isolated beta subunit. From the above observations, we concluded that the three Mg2+-dependent high-affinity sites for ADP are located on the alpha subunit in TF1 and that the single high-affinity site is located on one of the beta subunits in TF1 in the absence of Mg2+.

Alpha1B-adrenoceptor signaling and cell motility: GTPase function of Gh/transglutaminase 2 inhibits cell migration through interaction with cytoplasmic tail of integrin alpha subunits.

PubMed

Kang, Sung Koo; Yi, Kye Sook; Kwon, Nyoun Soo; Park, Kwang-Hyun; Kim, Uh-Hyun; Baek, Kwang Jin; Im, Mie-Jae

2004-08-27

A multifunctional enzyme, G(h), is a GTP-binding protein that couples to the alpha(1B)-adrenoreceptor and stimulates phospholipase C-delta1 but also displays transglutaminase 2 (TG2) activity. G(h)/TG2 has been implicated to play a role in cell motility. In this study we have examined which function of G(h)/TG2 is involved in this cellular response and the molecular basis. Treatment of human aortic smooth muscle cell with epinephrine inhibits migration to fibronectin and vitronectin, and the inhibition is blocked by the alpha(1)-adrenoreceptor antagonist prazosin or chloroethylclonidine. Up-regulation or overexpression of G(h)/TG2 in human aortic smooth muscle cells, DDT1-MF2, or human embryonic kidney cells, HEK 293 cells, results in inhibition of the migratory activity, and stimulation of the alpha(1B)-adrenoreceptor with the alpha(1) agonist further augments the inhibition of migration of human aortic smooth muscle cells and DDT1-MF2. G(h)/TG2 is coimmunoprecipitated by an integrin alpha(5) antibody and binds to the cytoplasmic tail peptide of integrins alpha(5), alpha(v), and alpha(IIb) subunits in the presence of guanosine 5'-3-O-(thio)triphosphate (GTPgammaS). Mutation of Lys-Arg residues in the GFFKR motif, present in the alpha(5)-tail, significantly reduces the binding of GTPgammaS-G(h)/TG2. Moreover, the motif-containing integrin alpha(5)-tail peptides block G(h)/TG2 coimmunoprecipitation and reverse the inhibition of the migratory activity of HEK 293 cells caused by overexpression G(h)/TG2. These results provide evidence that G(h) function initiates the modulation of cell motility via association of GTP-bound G(h)/TG2 with the GFFKR motif located in integrin alpha subunits.

Suppression of the heterotrimeric G protein causes abnormal morphology, including dwarfism, in rice

PubMed Central

Fujisawa, Yukiko; Kato, Teruhisa; Ohki, Shizuka; Ishikawa, Atsushi; Kitano, Hidemi; Sasaki, Takuji; Asahi, Tadashi; Iwasaki, Yukimoto

1999-01-01

Transgenic rice containing an antisense cDNA for the α subunit of rice heterotrimeric G protein produced little or no mRNA for the subunit and exhibited abnormal morphology, including dwarf traits and the setting of small seeds. In normal rice, the mRNA for the α subunit was abundant in the internodes and florets, the tissues closely related to abnormality in the dwarf transformants. The position of the α-subunit gene was mapped on rice chromosome 5 by mapping with the restriction fragment length polymorphism. The position was closely linked to the locus of a rice dwarf mutant, Daikoku dwarf (d-1), which is known to exhibit abnormal phenotypes similar to those of the transformants that suppressed the endogenous mRNA for the α subunit by antisense technology. Analysis of the cDNAs for the α subunits of five alleles of Daikoku dwarf (d-1), ID-1, DK22, DKT-1, DKT-2, and CM1361–1, showed that these dwarf mutants had mutated in the coding region of the α-subunit gene. These results show that the G protein functions in the formation of normal internodes and seeds in rice. PMID:10377457

Somato-synaptic variation of GABA(A) receptors in cultured murine cerebellar granule cells: investigation of the role of the alpha6 subunit.

PubMed

Mellor, J R; Wisden, W; Randall, A D

2000-07-10

Electrophysiological investigation of cultured cerebellar murine granule cells revealed differences between the GABA(A) receptors at inhibitory synapses and those on the cell body. Specifically, mIPSCs decayed more rapidly than cell body receptors deactivated, the mean single channel conductance at the synapse (32 pS) was greater than that at cell body (21 pS) and only cell body receptors were sensitive to Zn(2+) (150 microM), which depressed response amplitude by 82+/-5% and almost doubled the rate of channel deactivation. The GABA(A) receptor alpha6 subunit is selectively expressed in cerebellar granule cells. Although concentrated at synapses, it is also found on extrasynaptic membranes. Using a mouse line (Deltaalpha6lacZ) lacking this subunit, we investigated its role in the somato-synaptic differences in GABA(A) receptor function. All differences between cell body and synaptic GABA(A) receptors observed in wild-type (WT) granule cells persisted in Deltaalpha6lacZ cells, thus demonstrating that they are not specifically due to the cellular distribution of the alpha6 subunit. However, mIPSCs from WT and Deltaalpha6lacZ cells differed in both their kinetics (faster decay in WT cells) and underlying single channel conductance (32 pS WT, 25 pS Deltaalpha6lacZ). This provides good evidence for a functional contribution of the alpha6 subunit to postsynaptic GABA(A) receptors in these cells. Despite this, deactivation kinetics of mIPSCs in WT and Deltaalpha6lacZ granule cells exhibited similar benzodiazepene (BDZ) sensitivity. This suggests that the enhanced BDZ-induced ataxia seen in Deltaalpha6lacZ mice may reflect physiological activity at extrasynaptic receptors which, unlike those at synapses, display differential BDZ-sensitivity in WT and Deltaalpha6lacZ granule cells (Jones, A.M., Korpi, E.R., McKernan, R.M., Nusser, Z., Pelz, R., Makela, R., Mellor, J.R., Pollard, S., Bahn, S., Stephenson, F.A., Randall, A.D., Sieghart, W., Somogyi, P., Smith, A.J.H., Wisden, W., 1997. Ligand-gated ion channel partnerships: GABA(A) receptor alpha(6) subunit inactivation inhibits delta subunit expression. Journal of Neuroscience 17, 1350-1362).

The Aged Microenvironment Influences Prostate Carcinogenesis

DTIC Science & Technology

2009-12-01

Pcdhb4 protocadherin beta 4 NM_053129 -2.3 BC068157 cDNA sequence BC068157 NM_207203 -2.3 Bub1 budding uninhibited by benzimidazoles 1 NM_009772...protein phosphatase 2, regulatory subunit B NM_028392 -2.1 Bub3 budding uninhibited by benzimidazoles 3 AK083742 -2.1 Kif4 kinesin family member 4

Differentiation to adipocytes in accompanied by an increase in the amounts of Gi- and Go-proteins in 3T3-L1 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watkins, D.C.; Northup, J.K.; Malbon, C.C.

Treatment of cultures of 3T3-L1 cells with methylisobutyl-xanthine and dexamethasone has been shown to result in accumulation of lipid and conversion to the morphology of adipocytes in more than 90% of the cells. The status of the stimulatory (Gs), inhibitory (Gi) and Go-proteins during the course of 3T3-L1 differentiation was examined. The amount of alpha subunit of Gs (..cap alpha..Gs), assayed by radiolabeling in the presence of cholera toxin and (/sup 32/P)NAD/sup +/, increased upon differentiation as previously described by others. The amounts of ..cap alpha..Gi and ..cap alpha..Go assayed by radiolabeling in the presence of pertussis toxin and (/supmore » 32/P)NAD/sup +/ increased 3-fold upon differentiation. Immunoblots of cell membranes subjected to gel electrophoresis in sodium dodecyl sulfate were probed with two rabbit antisera raised against bovine brain ..cap alpha..Go and with one raised against the..beta..-subunit of the bovine rod-outer-segment G-protein, referred to as transducin. The immunoblotting data confirm the increase upon differentiation of ..cap alpha..Go and also demonstrate an increase in the amount of the ..beta..-subunit. Thus differentiation of 3T3-L1 cells is accompanied by dramatic changes in the complexion of G-proteins in the membranes.« less

Expression of {beta}{sub 1} integrins in human endometrial stromal and decidual cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shiokawa, Shigetatsu; Yoshimura, Yasunori; Nakamura, Yukio

The present study was undertaken to investigate the expression of {beta}{sub 1} integrins in human endometrium and decidua using flow cytometry, immunohistochemistry, and immunoprecipitation. Fluorescence-activated flow cytometry demonstrated the greater expression of the {beta}{sub 1}, {alpha}{sub 1}, {alpha}{sub 2}, and {alpha}{sub 5} subunits of the {beta}{sub 1} integrin family in cultured stromal cells from the midsecretory phase, than in those of the early proliferative phase. The addition of estradiol (E{sub 2}) and progesterone (P) to cultured stromal cells in the early proliferative phase increased the expression of {beta}{sub 1} integrins in vitro. Flow cytometry also demonstrated the expression of themore » {beta}{sub 1}, {alpha}{sub 1}, {alpha}{sub 2}, {alpha}{sub 3}, {alpha}{sub 5}, and {alpha}{sub 6} subunits of {beta}{sub 1} integrin family in cultured decidual cells, and the enriched-fraction of prolactin (PRL)-producing decidual cells isolated by Percoll gradients showed high levels of {beta}{sub 1} integrins expression. Immunohistochemistry confirmed the {beta}{sub 1} integrin cell surface phenotypes in cultured decidual cells observed by flow cytometry. In summary, the present study demonstrated that endometrial stromal and decidual cells expressed {beta}{sub 1} integrin subunits at their surfaces. The expression exhibited a variability throughout the menstrual cycles, being predominantly detected in the secretory phase, and was maintained highly in the decidua. Thus, {beta}{sub 1} integrins in human endometrium and decidua may be important in mediating the organization of extracellular matrix proteins derived from embryos during the early stage of implantation. 43 refs., 7 figs., 2 tabs.« less

Identification and characterization of the DNA replication origin recognition complex gene family in the silkworm Bombyx mori.

PubMed

Yang, Hui-Peng; Luo, Su-Juan; Li, Yi-Nü; Zhang, Yao-Zhou; Zhang, Zhi-Fang

2011-10-01

The ORC (origin recognition complex) binds to the DNA replication origin and recruits other replication factors to form the pre-replication complex. The cDNA and genomic sequences of all six subunits of ORC in Bombyx mori (BmORC1-6) were determined by RACE (rapid amplification of cDNA ends) and bioinformatic analysis. The conserved domains were identified in BmOrc1p-6p and the C-terminal of BmOrc6p features a short sequence that may be specific for Lepidoptera. As in other organisms, each of the six BmORC subunits had evolved individually from ancestral genes in early eukaryotes. During embryo development, the six genes were co-regulated, but different ratios of the abundance of mRNAs were observed in 13 tissues of the fifth instar day-6 larvae. Infection by BmNPV (B. mori nucleopolyhedrovirus) initially decreased and then increased the abundance of BmORC. We suggest that some of the BmOrc proteins may have additional functions and that BmOrc proteins participate in the replication of BmNPV.

Isolated spinach ribulose-1,5-bisphosphate carboxylase/oxgenase large subunit .epsilon. n-methyltransferase and method of inactivating ribulose-1,5-bishosphatase .epsilon. n-methyltransferase activity

DOEpatents

Houtz, Robert L.

2001-01-01

The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS) .sup..epsilon. N-methyltansferase (protein methylase III or Rubisco LSMT) from a plant which has a des(methyl) lysyl residue in the LS is disclosed. In addition, the full-length cDNA clones for Rubisco LSMT are disclosed. Transgenic plants and methods of producing same which have the Rubisco LSMT gene inserted into the DNA are also provided. Further, methods of inactivating the enzymatic activity of Rubisco LSMT are also disclosed.

Differences in cholinergic responses from outer hair cells of rat and guinea pig.

PubMed

Chen, C; LeBlanc, C; Bobbin, R P

1996-09-01

A cholinergic receptor on outer hair cells (OHC) in guinea pig cochlea induces a K+ current when it is activated by acetylcholine and suberyldicholine but not by nicotine or muscarine (Bobbin, 1995). This unusual receptor may contain an alpha 9-subunit. However, the pharmacology of the alpha 9-subunit cloned from rat and expressed in Xenopus oocytes does not completely match that obtained for the ACh receptor in guinea pig OHCs. The response to 1,1-dimethyl-4-phenylpiperazinium (DMPP) is large in guinea pig OHCs and small in oocytes containing receptors of the alpha 9-subunit. Therefore, we compared the effects of cholinergic receptor agonists in rat and guinea pig OHCs using the whole-cell variant of the patch-clamp technique. ACh caused the largest outward K+ current in OHCs from both rat and guinea pig. Carbachol- and suberyldicholine-induced responses were similar in magnitude in OHCs of rat and guinea pig. However, DMPP produced a small response in OHCs from rat and a large response in OHCs from guinea pig. At a concentration of 100 microM, muscarine, oxotremorine M, nicotine and cytisine induced little response in guinea pig OHCs and none in rat OHCs. Results suggest that the ACh receptor on rat OHCs is similar to the alpha 9-subunit-containing receptor expressed in oocytes but different from the ACh receptor on guinea pig OHCs.

The structure of the protein phosphatase 2A PR65/A subunit reveals the conformation of its 15 tandemly repeated HEAT motifs.

PubMed

Groves, M R; Hanlon, N; Turowski, P; Hemmings, B A; Barford, D

1999-01-08

The PR65/A subunit of protein phosphatase 2A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit, generating functionally diverse heterotrimers. Mutations of the beta isoform of PR65 are associated with lung and colon tumors. The crystal structure of the PR65/Aalpha subunit, at 2.3 A resolution, reveals the conformation of its 15 tandemly repeated HEAT sequences, degenerate motifs of approximately 39 amino acids present in a variety of proteins, including huntingtin and importin beta. Individual motifs are composed of a pair of antiparallel alpha helices that assemble in a mainly linear, repetitive fashion to form an elongated molecule characterized by a double layer of alpha helices. Left-handed rotations at three interrepeat interfaces generate a novel left-hand superhelical conformation. The protein interaction interface is formed from the intrarepeat turns that are aligned to form a continuous ridge.

Identification of the electron transfer flavoprotein as an upregulated enzyme in the benzoate utilization of Desulfotignum balticum.

PubMed

Habe, Hiroshi; Kobuna, Akinori; Hosoda, Akifumi; Kosaka, Tomoyuki; Endoh, Takayuki; Tamura, Hiroto; Yamane, Hisakazu; Nojiri, Hideaki; Omori, Toshio; Watanabe, Kazuya

2009-07-01

Desulfotignum balticum utilizes benzoate coupled to sulfate reduction. Two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) analysis was conducted to detect proteins that increased more after growth on benzoate than on butyrate. A comparison of proteins on 2D gels showed that at least six proteins were expressed. The N-terminal sequences of three proteins exhibited significant identities with the alpha and beta subunits of electron transfer flavoprotein (ETF) from anaerobic aromatic-degraders. By sequence analysis of the fosmid clone insert (37,590 bp) containing the genes encoding the ETF subunits, we identified three genes, whose deduced amino acid sequences showed 58%, 74%, and 62% identity with those of Gmet_2267 (Fe-S oxidoreductase), Gmet_2266 (ETF beta subunit), and Gmet_2265 (ETF alpha subunit) respectively, which exist within the 300-kb genomic island of aromatic-degradation genes from Geobacter metallireducens GS-15. The genes encoding ETF subunits found in this study were upregulated in benzoate utilization.

Binding-dependent disorder-order transition in PKI alpha: a fluorescence anisotropy study.

PubMed

Hauer, J A; Taylor, S S; Johnson, D A

1999-05-25

The conformational flexibility of peptidyl ligands may be an essential element of many peptide-macromolecular interactions. Consequently, the alpha-carbonyl backbone flexibility of the 8 kDa protein kinase inhibitor (PKI alpha) peptide of cAMP-dependent protein kinase (cAPK) free in solution and bound to cAPK was assessed by time-resolved fluorescence anisotropy. Specifically, three full-length, single-site PKI alpha mutants (V3C, S28C, and S59C) were prepared, and fluorescein iodoacetamide (FI) was selectively conjugated to the side chains of each substituted cysteine. The time-resolved anisotropy decay profiles of the labeled mutants were well fit to a model-free nonassociative biexponential equation. Free in solution, the three labeled proteins had very similar anisotropy decays arising primarily from local alpha-carbonyl backbone movements. Only a small fraction of the anisotropy decay was associated with slower, whole-body tumbling, confirming that PKI alpha is highly disordered at all three locations. Complexation of the mutants with the catalytic (C) subunit of cAPK decreased the rate of whole-body tumbling for all three mutants. The effects on the rapid decay processes, however, were dependent upon the site of conjugation. The anisotropy decay profiles of both FI-V3C- and FI-S28C-PKI alpha were associated with significantly reduced contributions from the fast decay processes, while that of FI-S59C-PKI alpha was largely unaffected by binding to the C-subunit. The results suggest that the cAPK-binding domain of PKI alpha extends from the its N-terminus to residues beyond Ser28 but does not include the segment around Ser59, which is still part of a highly flexible domain when bound to the C-subunit.

Binding Linkage in a Telomere DNA–Protein Complex at the Ends of Oxytricha nova Chromosomes

PubMed Central

Buczek, Pawel; Orr, Rochelle S.; Pyper, Sean R.; Shum, Mili; Ota, Emily Kimmel Irene; Gerum, Shawn E.; Horvath, Martin P.

2005-01-01

Alpha and beta protein subunits of the telomere end binding protein from Oxytricha nova (OnTEBP) combine with telomere single strand DNA to form a protective cap at the ends of chromosomes. We tested how protein–protein interactions seen in the co-crystal structure relate to DNA binding through use of fusion proteins engineered as different combinations of domains and subunits derived from OnTEBP. Joining alpha and beta resulted in a protein that bound single strand telomere DNA with high affinity (KD-DNA=1.4 nM). Another fusion protein, constructed without the C-terminal protein–protein interaction domain of alpha, bound DNA with 200-fold diminished affinity (KD-DNA=290 nM) even though the DNA-binding domains of alpha and beta were joined through a peptide linker. Adding back the alpha C-terminal domain as a separate protein restored high-affinity DNA binding. The binding behaviors of these fusion proteins and the native protein subunits are consistent with cooperative linkage between protein-association and DNA-binding equilibria. Linking DNA–protein stability to protein–protein contacts at a remote site may provide a trigger point for DNA–protein disassembly during telomere replication when the single strand telomere DNA must exchange between a very stable OnTEBP complex and telomerase. PMID:15967465

Neuronal nicotinic acetylcholine receptor subunits in autism: an immunohistochemical investigation in the thalamus.

PubMed

Ray, M A; Graham, A J; Lee, M; Perry, R H; Court, J A; Perry, E K

2005-08-01

The cholinergic system has been implicated in the development of autism on the basis of neuronal nicotinic acetylcholine receptor (nAChR) losses in cerebral and cerebellar cortex. In the present study, the first to explore nAChRs in the thalamus in autism, alpha4, alpha7 and beta2 nAChR subunit expression in thalamic nuclei of adult individuals with autism (n=3) and age-matched control cases (n=3) was investigated using immunochemical methods. Loss of alpha7- and beta2- (but not alpha4-) immunoreactive neurons occurred in the paraventricular nucleus (PV) and nucleus reuniens in autism. Preliminary results indicated glutamic acid decarboxylase immunoreactivity occurred at a low level in PV, co-expressed with alpha7 in normal and autistic cases and was not reduced in autism. This suggested loss of neuronal alpha7 in autism is not caused by loss of GABAergic neurons. These findings indicate nicotinic abnormalities that occur in the thalamus in autism which may contribute to sensory or attentional deficits.

Mapping of the acetylcholine binding site of the nicotinic acetylcholine receptor: ( sup 3 H)nicotine as an agonist photoaffinity label

DOE Office of Scientific and Technical Information (OSTI.GOV)

Middleton, R.E.; Cohen, J.B.

1991-07-16

The agonist ({sup 3}H)nicotine was used as a photoaffinity label for the acetylcholine binding sties on the Torpedo nicotinic acetylcholine receptor (AChR). ({sup 3}H)Nicotine binds at equilibrium with K{sub eq} = 0.6 {mu}M to the agonist binding sites. Irradiation with 254-nm light of AChR-rich membranes equilibrated with ({sup 3}H)nicotine resulted in covalent incorporation into the {alpha}- and {gamma}-subunits, which was inhibited by agonists and competitive antagonists but not by noncompetitive antagonists. Inhibition of labeling by d-tubocurarine demonstrated that the {alpha}-subunit was labeled via both agonist sites but the {gamma}-subunit was labeled only via the site that binds d-tubocurarine with highmore » affinity. Chymotryptic digestion of the {alpha}-subunit confirmed that Try-198 was the principal amino acid labeled by ({sup 3}H)nicotine. This confirmation required a novel radiosequencing strategy employing o-phthalaldehyde ({sup 3}H)Nicotine, which is the first photoaffinity agonist used, labels primarily Tyr-198 in contrast to competitive antagonist affinity labels, which label primarily Tyr-190 and Cys-192/Cys-193.« less

Hyperthyroidism secondary to a pituitary adenoma secreting TSH, FSH, alpha-subunit and GH.

PubMed

Patrick, A W; Atkin, S L; MacKenzie, J; Foy, P M; White, M C; MacFarlane, I A

1994-02-01

A 51-year-old man had been treated for hyperthyroidism with antithyroid drugs for 8 years. He was then found to have a large pituitary adenoma with biochemical evidence of overproduction of TSH, FSH and alpha-subunit. Subsequent immunocytochemical and tissue culture studies confirmed secretion of these hormones. In addition, the tumour stained for GH and was capable of GH production in vitro. This combination of hormones produced by a pituitary adenoma has not been previously reported.

MtGimC, a novel archaeal chaperone related to the eukaryotic chaperonin cofactor GimC/prefoldin.

PubMed

Leroux, M R; Fändrich, M; Klunker, D; Siegers, K; Lupas, A N; Brown, J R; Schiebel, E; Dobson, C M; Hartl, F U

1999-12-01

Group II chaperonins in the eukaryotic and archaeal cytosol assist in protein folding independently of the GroES-like cofactors of eubacterial group I chaperonins. Recently, the eukaryotic chaperonin was shown to cooperate with the hetero-oligomeric protein complex GimC (prefoldin) in folding actin and tubulins. Here we report the characterization of the first archaeal homologue of GimC, from Methanobacterium thermoautotrophicum. MtGimC is a hexamer of 87 kDa, consisting of two alpha and four beta subunits of high alpha-helical content that are predicted to contain extended coiled coils and represent two evolutionarily conserved classes of Gim subunits. Reconstitution experiments with MtGimC suggest that two subunits of the alpha class (archaeal Gimalpha and eukaryotic Gim2 and 5) form a dimer onto which four subunits of the beta class (archaeal Gimbeta and eukaryotic Gim1, 3, 4 and 6) assemble. MtGimalpha and beta can form hetero-complexes with yeast Gim subunits and MtGimbeta partially complements yeast strains lacking Gim1 and 4. MtGimC is a molecular chaperone capable of stabilizing a range of non-native proteins and releasing them for subsequent chaperonin-assisted folding. In light of the absence of Hsp70 chaperones in many archaea, GimC may fulfil an ATP-independent, Hsp70-like function in archaeal de novo protein folding.

MtGimC, a novel archaeal chaperone related to the eukaryotic chaperonin cofactor GimC/prefoldin.

PubMed Central

Leroux, M R; Fändrich, M; Klunker, D; Siegers, K; Lupas, A N; Brown, J R; Schiebel, E; Dobson, C M; Hartl, F U

1999-01-01

Group II chaperonins in the eukaryotic and archaeal cytosol assist in protein folding independently of the GroES-like cofactors of eubacterial group I chaperonins. Recently, the eukaryotic chaperonin was shown to cooperate with the hetero-oligomeric protein complex GimC (prefoldin) in folding actin and tubulins. Here we report the characterization of the first archaeal homologue of GimC, from Methanobacterium thermoautotrophicum. MtGimC is a hexamer of 87 kDa, consisting of two alpha and four beta subunits of high alpha-helical content that are predicted to contain extended coiled coils and represent two evolutionarily conserved classes of Gim subunits. Reconstitution experiments with MtGimC suggest that two subunits of the alpha class (archaeal Gimalpha and eukaryotic Gim2 and 5) form a dimer onto which four subunits of the beta class (archaeal Gimbeta and eukaryotic Gim1, 3, 4 and 6) assemble. MtGimalpha and beta can form hetero-complexes with yeast Gim subunits and MtGimbeta partially complements yeast strains lacking Gim1 and 4. MtGimC is a molecular chaperone capable of stabilizing a range of non-native proteins and releasing them for subsequent chaperonin-assisted folding. In light of the absence of Hsp70 chaperones in many archaea, GimC may fulfil an ATP-independent, Hsp70-like function in archaeal de novo protein folding. PMID:10581246

Crystal Structure of Human [Beta]-Hexosaminidase B: Understanding the Molecular Basis of Sandhoff and Tay-Sachs Disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mark, Brian L.; Mahuran, Don J.; Cherney, Maia M.

2010-12-01

In humans, two major {beta}-hexosaminidase isoenzymes exist: Hex A and Hex B. Hex A is a heterodimer of subunits {alpha} and {beta} (60% identity), whereas Hex B is a homodimer of {beta}-subunits. Interest in human {beta}-hexosaminidase stems from its association with Tay-Sachs and Sandhoff disease; these are prototypical lysosomal storage disorders resulting from the abnormal accumulation of G{sub M2}-ganglioside (G{sub M2}). Hex A degrades G{sub M2} by removing a terminal N-acetyl-D-galactosamine ({beta}-GalNAc) residue, and this activity requires the G{sub M2}-activator, a protein which solubilizes the ganglioside for presentation to Hex A. We present here the crystal structure of human Hexmore » B, alone (2.4 {angstrom}) and in complex with the mechanistic inhibitors GalNAc-isofagomine (2.2 {angstrom}) or NAG-thiazoline (2.5 {angstrom}). From these, and the known X-ray structure of the G{sub M2}-activator, we have modeled Hex A in complex with the activator and ganglioside. Together, our crystallographic and modeling data demonstrate how {alpha} and {beta}-subunits dimerize to form either Hex A or Hex B, how these isoenzymes hydrolyze diverse substrates, and how many documented point mutations cause Sandhoff disease ({beta}-subunit mutations) and Tay-Sachs disease ({alpha}-subunit mutations).« less

O-linked oligosaccharides on insulin receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Collier, E.; Gorden, P.

1991-02-01

The insulin receptor, an integral membrane glycoprotein, is synthesized as a single-chain precursor that is cleaved to produce two mature subunits, both of which contain N-linked oligosaccharide chains and covalently linked fatty acids. We report that the beta-subunit also contains O-linked oligosaccharides. The proreceptor, alpha-subunit, and beta-subunit were labeled with (3H)mannose and (3H)galactose in the presence or absence of an inhibitor of O-linked glycosylation. Tryptic peptides from each component were separated by reverse-phase high-performance liquid chromatography. N- and O-linked oligosaccharide chains were identified on these peptides by specific enzymatic digestions. The proreceptor and alpha-subunit contained only N-linked oligosaccharides, whereas themore » beta-subunit contained both N- and O-linked oligosaccharides. The O-linked oligosaccharide chains were attached to a single tryptic fraction of the beta-subunit, which also contained N-linked chains. This fraction was further localized to the NH2-terminal tryptic peptide of the beta-subunit by specific immunoprecipitation with an anti-peptide antibody with specificity for this region. Binding of insulin and autophosphorylation of the beta-subunit were not dependent on O-linked glycosylation, because cells grown in the presence of the inhibitor exhibited a normal dose response to insulin. Therefore, the insulin receptor contains O-linked oligosaccharides on the NH2-terminal tryptic peptide of the beta-subunit, and these O-linked oligosaccharides are not necessary to the binding or autophosphorylation function of the receptor.« less

Affective and cognitive effects of global deletion of alpha3-containing gamma-aminobutyric acid-A receptors.

PubMed

Fiorelli, Roberto; Rudolph, Uwe; Straub, Carolin J; Feldon, Joram; Yee, Benjamin K

2008-09-01

Gamma-aminobutyric acid (GABA)A receptors characterized by the presence of the alpha3 subunit are the major GABAA receptor subtype expressed in brain stem monoaminergic nuclei. These alpha3-GABAA receptors are therefore in a unique position to regulate monoaminergic functions. To characterize the functional properties of alpha3-GABAA receptors, we present a preliminary assessment of the expression of affective and cognitive behaviour in male mice with a targeted deletion of the Gabra3 gene encoding the alpha3 subunit [alpha3 knockout (KO) mice] on a C57BL/6Jx129X1/SvJ F1 hybrid genetic background. The alpha3 KO mice did not exhibit any gross change of anxiety-like behaviour or spontaneous locomotor behaviour. In the Porsolt forced swim test for potential antidepressant activity, alpha3 KO mice exhibited reduced floating and enhanced swimming behaviour relative to wild-type controls. Performance on a two-choice sucrose preference test, however, revealed no evidence for an increase in sucrose preference in the alpha3 KO mice that would have substantiated a potential phenotype for depression-related behaviour. In contrast, a suggestion of an enhanced negative contrast effect was revealed in a one-bottle sucrose consumption test across different sucrose concentrations. These affective phenotypes were accompanied by alterations in the balance between conditioned responding to the discrete conditioned stimulus and to the context, and a suggestion of faster extinction, in the Pavlovian conditioned freezing paradigm. Spatial learning in the water maze reference memory test, however, was largely unchanged in the alpha3 KO mice, except for a trend of preservation during reversal learning. The novel phenotypes following global deletion of the GABAA receptor alpha3 subunit identified here provided relevant insights, in addition to our earlier study, into the potential behavioural relevance of this specific receptor subtypes in the modulation of both affective and cognitive functions.

Agonist- and subunit-dependent potentiation of glutamate receptors by a nootropic drug aniracetam.

PubMed

Tsuzuki, K; Takeuchi, T; Ozawa, S

1992-11-01

GluR1 and GluR2 cDNAs encoding non-NMDA subtypes of glutamate receptor were isolated from a rat brain cDNA library by Boulter et al. (Science, 249 (1990) 1033-1037). Functional receptors activated by kainate, alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) and glutamate were expressed in Xenopus oocytes injected with GluR1, GluR2 or a mixture of GluR1 and GluR2 RNAs. In GluR1-expressed oocytes, 1 mM aniracetam potentiated AMPA-induced currents by 99 +/- 10% (mean +/- S.E.M., n = 5) and glutamate-induced currents by 140 +/- 8% (n = 4), but little affected kainate-induced currents. Aniracetam was effective from a concentration of 0.1 mM, and it exhibited more conspicuous effects with the increase of the dose. In oocytes injected with GluR1 plus GluR2 RNAs, aniracetam more markedly potentiated current responses to AMPA and glutamate than those in oocytes injected with GluR1 RNA alone. For example, 1 mM aniracetam potentiated AMPA-induced currents by 396 +/- 76% (n = 4) and glutamate-induced currents by 970 +/- 65% (n = 5) in oocytes injected with 10% GluR1 and 90% GluR2 RNAs. In these oocytes, however, the potentiation of kainate-induced currents by 1 mM aniracetam was only 8 +/- 5% (n = 4). Thus, we conclude that the potentiation of the AMPA/kainate receptor by aniracetam depends on both species of agonists and subunit composition of the receptor.

Contribution of oligosaccharides to protection of the H,K-ATPase beta-subunit against trypsinolysis.

PubMed

Crothers, James M; Asano, Shinji; Kimura, Tohru; Yoshida, Ayumi; Wong, Aline; Kang, Jung Wook; Forte, John G

2004-08-01

The proton-pumping H+,K+-adenosinetriphosphatase (H,K-ATPase), responsible for acid secretion by the gastric parietal cell, faces a harshly acidic environment, with some pepsin from neighboring chief cells, at its luminal surface. Its large catalytic alpha-subunit is mostly oriented cytoplasmically. The smaller beta-subunit (HKbeta), is mainly extracellular, with one transmembrane domain and a small cytoplasmic domain. Seven N-linked oligosaccharides in the extracellular domain of HKbeta are thought to contribute to protection of the H,K-ATPase, since previous work has shown that their complete removal, by peptide N-glycosidase F (PNGase F), greatly increased susceptibility of HKbeta to proteolysis. The possibility of graded protection by different numbers of oligosaccharides was investigated here with the use of mutant HKbeta cDNA, having various N-glycosylation sites mutated (Asn to Gln), transfected into HEK-293 cells. Membrane preparations, two days after transfection, were solubilized in 1% Triton X-100 and subjected to trypsinolysis (pH 8, 37 degrees C, trypsin:protein 1:10-1:25). Relative amounts of HKbeta remaining after 20 min trypsin were determined, after sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and probing of Western blots with an antibody to the HKbeta extracellular domain, by chemiluminescent development of blots and densitometry of resulting films. Maturely glycosylated HKbeta was made significantly more susceptible to trypsin than wild type when at least five oligosaccharides were deleted, while the high-mannose form (pre-beta), from the endoplasmic reticulum, became significantly more susceptible than wild-type pre-beta with removal of only two or more oligosaccharides. For each mutant, and wild type, pre-beta was consistently more susceptible than the mature form. While the number, and kind, of oligosaccharides seem to affect protection for HKbeta against trypsinolysis, other aspects of protein maturation, including proper folding of peptide domains and possible subtle alterations of conformation during Golgi processing, are also likely to contribute to this protection. Copyright 2004 Wiley-VCH Verlag GmbH and Co.

Functional characterization of mongoose nicotinic acetylcholine receptor alpha-subunit: resistance to alpha-bungarotoxin and high sensitivity to acetylcholine.

PubMed

Asher, O; Lupu-Meiri, M; Jensen, B S; Paperna, T; Fuchs, S; Oron, Y

1998-07-24

The mongoose is resistant to snake neurotoxins. The mongoose muscle nicotinic acetylcholine receptor (AChR) alpha-subunit contains a number of mutations in the ligand-binding domain and exhibits poor binding of alpha-bungarotoxin (alpha-BTX). We characterized the functional properties of a hybrid (alpha-mongoose/beta gamma delta-rat) AChR. Hybrid AChRs, expressed in Xenopus oocytes, respond to acetylcholine with depolarizing current, the mean maximal amplitude of which was greater than that mediated by the rat AChR. The IC50 of alpha-BTX to the hybrid AChR was 200-fold greater than that of the rat, suggesting much lower affinity for the toxin. Hybrid AChRs exhibited an apparent higher rate of desensitization and higher affinity for ACh (EC50 1.3 vs. 23.3 microM for the rat AChR). Hence, changes in the ligand-binding domain of AChR not only affect the binding properties of the receptor, but also result in marked changes in the characteristics of the current.

Immunological studies on the structure and function of the nicotinic acetylcholine receptor in mammalian muscle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gu, Y.

1989-01-01

The specificity of the antibodies in the serum of a patient with myasthenia gravis for a the {alpha}-bungarotoxin binding sites of the acetylcholine receptor (AChR) was examined using AChRs in the C2 mouse muscle cell line as a model. The antibodies were shown to be specific for one of the two toxin-binding sites. The effect of the antibodies in this myasthenic serum on the functional response of the receptor to cholinergic agonists was also examined using carbamylcholine-induced {sup 22}Na uptake into C2 myotubes as a measured of the receptor function. Antibodies specific for the {gamma}, {delta}, and {epsilon} subunit, respectively,more » of mammalian muscle AChRs were developed using subunit-specific synthetic peptides as antigens. Using these antibodies and monoclonal antibodies for other subunits as probes, I have identified four ({alpha}, {beta}, {gamma}, and {delta}) subunits of mammalian muscle AChRs on immunoblots. When AChRs from embryonic, neonatal, normal and denervated adult muscles were compared on immunoblots, the {alpha}, {beta}, and {delta} subunits were identical in all four receptor preparations, with or without endoglycosidase digestion. The spatial and temporal distribution of the {gamma}- and {epsilon}- AChRs in developing and in denervated muscles corresponds to the distribution of AChRs with slow and fast channels, respectively, and that the development changes in the channel properties of the receptor arise from a change in the subunit composition of the receptor, in which the {gamma} is replaced by {epsilon}.« less

Polysome Immunoselection Combined with cDNA Cloning to Obtain Specific Genes from Chlamydomonas reinhardtii

DTIC Science & Technology

1989-02-05

speclficlty of an avallable antitody (IgG) aginst the ribulose bisphosphate carboxylase sma"Ll subunit ( RUBISCO SSU). First, polysomal poly A+) RNA was...Lnlunopreclpitated by the antibody is the same size as the precursor of the RUBISCO S&U ,Fig. ,. When intact polysones were added to the wheat germ

Human brain nicotinic receptors, their distribution and participation in neuropsychiatric disorders.

PubMed

Graham, A J; Martin-Ruiz, C M; Teaktong, T; Ray, M A; Court, J A

2002-08-01

Mapping of nicotinic acetylcholine receptor (nAChR) subtypes and subunits in human brain is far from complete, however it is clear that multiple subunits are present (including alpha3, alpha4, alpha5, alpha6 and alpha7, beta2, alpha3 and beta4) and that these receptors are not solely distributed on neurones, but also on cerebral vasculature and astrocytes. It is important to elucidate subunit composition of receptors associated with different cell types and pathways within the human CNS in terms of potential nicotinic therapy for a range of both developmental and age-related disorders in which nAChR attenuation occurs. Reductions in nAChRs are reported in Alzheimer's and Parkinson's diseases, dementia with Lewy bodies, schizophrenia and autism, but may not be associated with reduced cortical cholinergic innervation observed in vascular dementia or occur at an early stage in Down's syndrome. Changes in nAChR expression in neuropsychiatric disorders appear to be brain region and subtype specific and have been shown in some instances to be associated with pathology and symptomatology. It is likely that deficits in alpha4-containing receptors predominate in cortical areas in Alzheimer's disease and autism, whereas reduction of alpha7 receptors may be more important in schizophrenia. Changes in astrocytic and vascular nAChR expression in neurodegenerative diseases should also be considered. Studies using both animal models and human autopsy tissue suggest that nAChRs can play a role in neuroprotection against age-related pathology. It is possible that the development of nAChR subtype specific drugs may lead to advances in therapy for both age-related and psychiatric disorders.

Recovery of infectious pariacoto virus from cDNA clones and identification of susceptible cell lines.

PubMed

Johnson, K N; Ball, L A

2001-12-01

Pariacoto virus (PaV) is a nodavirus that was recently isolated in Peru from the Southern armyworm, Spodoptera eridania. Virus particles are non enveloped and about 30 nm in diameter and have T=3 icosahedral symmetry. The 3.0-A crystal structure shows that about 35% of the genomic RNA is icosahedrally ordered, with the RNA forming a dodecahedral cage of 25-nucleotide (nt) duplexes that underlie the inner surface of the capsid. The PaV genome comprises two single-stranded, positive-sense RNAs: RNA1 (3,011 nt), which encodes the 108-kDa catalytic subunit of the RNA-dependent RNA polymerase, and RNA2 (1,311 nt), which encodes the 43-kDa capsid protein precursor alpha. In order to apply molecular genetics to the structure and assembly of PaV, we identified susceptible cell lines and developed a reverse genetic system for this virus. Cell lines that were susceptible to infection by PaV included those from Spodoptera exigua, Helicoverpa zea and Aedes albopictus, whereas cells from Drosophila melanogaster and Spodoptera frugiperda were refractory to infection. To recover virus from molecular clones, full-length cDNAs of PaV RNAs 1 and 2 were cotranscribed by T7 RNA polymerase in baby hamster kidney cells that expressed T7 RNA polymerase. Lysates of these cells were infectious both for cultured cells from Helicoverpa zea (corn earworm) and for larvae of Galleria mellonella (greater wax moth). The combination of infectious cDNA clones, cell culture infectivity, and the ability to produce milligram amounts of virus allows the application of DNA-based genetic methods to the study of PaV structure and assembly.

Gene expression profiles in chondrosarcoma cells subjected to cyclic stretching and hydrostatic pressure. A cDNA array study.

PubMed

Karjalainen, Hannu M; Sironen, Reijo K; Elo, Mika A; Kaarniranta, Kai; Takigawa, Masaharu; Helminen, Heikki J; Lammi, Mikko J

2003-01-01

Mechanical forces have a profound effect on cartilage tissue and chondrocyte metabolism. Strenuous loading inhibits the cellular metabolism, while optimal level of loading at correct frequency raises an anabolic response in chondrocytes. In this study, we used Atlas Human Cancer cDNA array to investigate mRNA expression profiles in human chondrosarcoma cells stretched 8% for 6 hours at a frequency of 0.5 Hz. In addition, cultures were exposed to continuous and cyclic (0.5 Hz) 5 MPa hydrostatic pressure. Cyclic stretch had a more profound effect on the gene expression profiles than 5 MPa hydrostatic pressure. Several genes involved with the regulation of cell cycle were increased in stretched cells, as well as mRNAs for PDGF-B, glucose-1-phosphate uridylyltransferase, Tiam1, cdc37 homolog, Gem, integrin alpha6, and matrix metalloproteinase-3. Among down-regulated genes were plakoglobin, TGF-alpha, retinoic acid receptor-alpha and Wnt8b. A smaller number of changes was detected after pressure treatments. Plakoglobin was increased under cyclic and continuous 5 MPa hydrostatic pressure, while mitogen-activated protein kinase-9, proliferating cell nuclear antigen, Rad6, CD9 antigen, integrins alphaE and beta8, and vimentin were decreased. Cyclic and continuous pressurization induces a number of specific changes. In conclusion, a different set of genes were affected by three different types of mechanical stimuli applied on chondrosarcoma cells.

The selective phosphorylation of a guanine nucleotide-binding regulatory protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carlson, K.E.

1989-01-01

Receptor-activated signal transduction pathways regulate the responsiveness of cells to external stimuli. These transduction pathways themselves are subject to regulation, most commonly by phosphorylation. Guanine nucleotide-binding regulatory proteins (G Proteins), as requisite signal transducing elements for many plasma membrane receptors, are considered likely targets for regulation by phosphorylation. Protein kinase C (PKC) has been shown to phosphorylate the {alpha} subunit of G{sub i} and other G proteins in solution. However, the occurrence of the phosphorylation of G{sub 1} within intact cells in response to activation of PKC has not been rigorously demonstrated. In this thesis, the extent to which themore » {alpha} subunits of G{sub i} undergo phosphorylation within human platelets in response to activation of PKC was examined by means of radiolabeling and immunoprecipitation. Incubation of platelets with phorbol-12-myristate-13-acetate (PMA), a potent activator of PKC, promoted the phosphorylation of several proteins within saponin-permeabilized and intact platelets incubated with ({gamma}{sup 32}P)ATP and ({sup 32}P)H{sub 3}PO{sub 4}, respectively. None of the phosphoproteins, however, were precipitated by either of two antisera containing antibodies differing in specificities for epitopes within G{sub i{alpha}}-despite precipitation of a substantial fraction of the subunit itself. In contrast, other antisera, containing antibodies specific for the recently describe G{sub z{alpha}}, or antibodies for both G{sub z{alpha}} and G{sub i{alpha}}, precipitated a 40-kDa phosphoprotein.« less

Decreased enzyme activity and contents of hepatic branched-chain alpha-keto acid dehydrogenase complex subunits in a rat model for type 2 diabetes mellitus.

PubMed

Bajotto, Gustavo; Murakami, Taro; Nagasaki, Masaru; Sato, Yuzo; Shimomura, Yoshiharu

2009-10-01

The mitochondrial branched-chain alpha-keto acid dehydrogenase complex (BCKDC) is responsible for the committed step in branched-chain amino acid catabolism. In the present study, we examined BCKDC regulation in Otsuka Long-Evans Tokushima Fatty (OLETF) rats both before (8 weeks of age) and after (25 weeks of age) the onset of type 2 diabetes mellitus. Long-Evans Tokushima Otsuka (LETO) rats were used as controls. Plasma branched-chain amino acid and branched-chain alpha-keto acid concentrations were significantly increased in young and middle-aged OLETF rats. Although the hepatic complex was nearly 100% active in all animals, total BCKDC activity and protein abundance of E1alpha, E1beta, and E2 subunits were markedly lower in OLETF than in LETO rats at 8 and 25 weeks of age. In addition, hepatic BCKDC activity and protein amounts were significantly decreased in LETO rats aged 25 weeks than in LETO rats aged 8 weeks. In skeletal muscle, E1beta and E2 proteins were significantly reduced, whereas E1alpha tended to increase in OLETF rats. Taken together, these results suggest that (1) whole-body branched-chain alpha-keto acid oxidation capacity is extremely reduced in OLETF rats independently of diabetes development, (2) the aging process decreases BCKDC activity and protein abundance in the liver of normal rats, and (3) differential posttranscriptional regulation for the subunits of BCKDC may exist in skeletal muscle.

SH2 domains of the p85 alpha subunit of phosphatidylinositol 3-kinase regulate binding to growth factor receptors.

PubMed Central

McGlade, C J; Ellis, C; Reedijk, M; Anderson, D; Mbamalu, G; Reith, A D; Panayotou, G; End, P; Bernstein, A; Kazlauskas, A

1992-01-01

The binding of cytoplasmic signaling proteins such as phospholipase C-gamma 1 and Ras GTPase-activating protein to autophosphorylated growth factor receptors is directed by their noncatalytic Src homology region 2 (SH2) domains. The p85 alpha regulatory subunit of phosphatidylinositol (PI) 3-kinase, which associates with several receptor protein-tyrosine kinases, also contains two SH2 domains. Both p85 alpha SH2 domains, when expressed individually as fusion proteins in bacteria, bound stably to the activated beta receptor for platelet-derived growth factor (PDGF). Complex formation required PDGF stimulation and was dependent on receptor tyrosine kinase activity. The bacterial p85 alpha SH2 domains recognized activated beta PDGF receptor which had been immobilized on a filter, indicating that SH2 domains contact autophosphorylated receptors directly. Several receptor tyrosine kinases within the PDGF receptor subfamily, including the colony-stimulating factor 1 receptor and the Steel factor receptor (Kit), also associate with PI 3-kinase in vivo. Bacterially expressed SH2 domains derived from the p85 alpha subunit of PI 3-kinase bound in vitro to the activated colony-stimulating factor 1 receptor and to Kit. We infer that the SH2 domains of p85 alpha bind to high-affinity sites on these receptors, whose creation is dependent on receptor autophosphorylation. The SH2 domains of p85 are therefore primarily responsible for the binding of PI 3-kinase to activated growth factor receptors. Images PMID:1372092

cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.

MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the ..beta..-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonalmore » monospecific antibody. Single-stranded (/sup 32/P)labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting.« less

Biosynthesis and processing of platelet GPIIb-IIIa in human megakaryocytes.

PubMed

Duperray, A; Berthier, R; Chagnon, E; Ryckewaert, J J; Ginsberg, M; Plow, E; Marguerie, G

1987-06-01

Platelet membrane glycoprotein IIb-IIIa forms a calcium-dependent heterodimer and constitutes the fibrinogen receptor on stimulated platelets. GPIIb is a two-chain protein containing disulfide-linked alpha and beta subunits. GPIIIa is a single chain protein. These proteins are synthesized in the bone marrow by megakaryocytes, but the study of their synthesis has been hampered by the difficulty in obtaining enriched population of megakaryocytes in large numbers. To examine the biosynthesis and processing of GPIIb-IIIa, purified human megakaryocytes were isolated from liquid cultures of cryopreserved leukocytes stem cell concentrates from patients with chronic myelogenous leukemia. Immunoprecipitation of [35S]methionine pulse-chase-labeled cell extracts by antibodies specific for the alpha or beta subunits of GPIIb indicated that GPIIb was derived from a precursor of Mr 130,000 that contains the alpha and beta subunits. This precursor was converted to GPIIb with a half-life of 4-5 h. No precursor form of GPIIIa was detected. The glycosylation of GPIIb-IIIa was examined in megakaryocytes by metabolic labeling in the presence of tunicamycin, monensin, or treatment with endoglycosidase H. The polypeptide backbones of the GPIIb and the GPIIIa have molecular masses of 120 and 90 kD, respectively. High-mannose oligosaccharides are added to these polypeptide backbones co-translationally. The GPIIb precursor is then processed with conversion of high-mannose to complex type carbohydrates yielding the mature subunits GPIIb alpha (Mr 116,000) and GPIIb beta (Mr 25,000). No posttranslational processing of GPIIIa was detected.

Platelet cytosolic 44-kDa protein is a substrate of cholera toxin-induced ADP-ribosylation and is not recognized by antisera against the. alpha. subunit of the stimulatory guanine nucleotide-binding regulatory protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Molina Y Vedia, L.M.; Reep, B.R.; Lapetina, E.G.

1988-08-01

ADP-ribosylation induced by cholera toxin and pertussis toxin was studied in particulate and cytosolic fractions of human platelets. Platelets were disrupted by a cycle of freezing and thawing in the presence of a hyposmotic buffer containing protease inhibitors. In both fractions, the A subunit of cholera toxin ADP-ribosylates two proteins with molecular masses of 42 and 44 kDa, whereas pertussis toxin ADP-ribosylates a 41-kDa polypeptide. Two antisera against the {alpha} subunit of the stimulatory guanine nucleotide-binding regulatory protein recognize only the 42-kDa polypeptide. Cholera toxin-induced ADP-ribosylation of the 42- and 44-kDa proteins is reduced by pretreatment of platelets with iloprost,more » a prostacyclin analog. The 44-kDa protein, which is substrate of cholera toxin, could be extracted completely from the membrane and recovered in the cytosolic fraction when the cells were disrupted by Dounce homogenization and the pellet was extensively washed. A 44-kDa protein can also be labeled with 8-azidoguanosine 5{prime}-({alpha}-{sup 32}P)triphosphate in the cytosol and membranes. These finding indicate that cholera and pertussis toxins produced covalent modifications of proteins present in particulate and cytosolic platelet fractions. Moreover, the 44-kDa protein might be an {alpha} subunit of a guanine nucleotide-binding regulatory protein that is not recognized by available antisera.« less

CK2(beta)tes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster.

PubMed

Kalmykova, Alla I; Shevelyov, Yuri Y; Polesskaya, Oksana O; Dobritsa, Anna A; Evstafieva, Alexandra G; Boldyreff, Brigitte; Issinger, Olaf-Georg; Gvozdev, Vladimir A

2002-03-01

An earlier described CK2(beta)tes gene of Drosophila melanogaster is shown to encode a male germline specific isoform of regulatory beta subunit of casein kinase 2. Western-analysis using anti-CK2(beta)tes Ig revealed CK2(beta)tes protein in Drosophila testes extract. Expression of a CK2(beta)tes-beta-galactosidase fusion protein driven by the CK2(beta)tes promoter was found in transgenic flies at postmitotic stages of spermatogenesis. Examination of biochemical characteristics of a recombinant CK2(beta)tes protein expressed in Escherichia coli revealed properties similar to those of CK2beta: (a) CK2(beta)tes protein stimulates CK2alpha catalytic activity toward synthetic peptide; (b) it inhibits phosphorylation of calmodulin and mediates stimulation of CK2alpha by polylysine; (c) it is able to form (CK2(beta)tes)2 dimers, as well as (CK2alpha)2(CK2(beta)tes)2 tetramers. Using the yeast two-hybrid system and coimmunoprecipitation analysis of protein extract from Drosophila testes, we demonstrated an association between CK2(beta)tes and CK2alpha. Northern-analysis has shown that another regulatory (beta') subunit found recently in D. melanogaster genome is also testis-specific. Thus, we describe the first example of two tissue-specific regulatory subunits of CK2 which might serve to provide CK2 substrate recognition during spermatogenesis.

Organocatalytic sequential alpha-amination-Horner-Wadsworth-Emmons olefination of aldehydes: enantioselective synthesis of gamma-amino-alpha,beta-unsaturated esters.

PubMed

Kotkar, Shriram P; Chavan, Vilas B; Sudalai, Arumugam

2007-03-15

A novel and highly enantioselective method for the synthesis of gamma-amino-alpha,beta-unsaturated esters via tandem alpha-amination-Horner-Wadsworth-Emmons (HWE) olefination of aldehydes is described. The one-pot assembly has been demonstrated for the construction of functionalized chiral 2-pyrrolidones, subunits present in several alkaloids. [structure: see text

Sequencing and characterization of asclepain f: the first cysteine peptidase cDNA cloned and expressed from Asclepias fruticosa latex.

PubMed

Trejo, Sebastián A; López, Laura M I; Caffini, Néstor O; Natalucci, Claudia L; Canals, Francesc; Avilés, Francesc X

2009-07-01

Asclepain f is a papain-like protease previously isolated and characterized from latex of Asclepias fruticosa. This enzyme is a member of the C1 family of cysteine proteases that are synthesized as preproenzymes. The enzyme belongs to the alpha + beta class of proteins, with two disulfide bridges (Cys22-Cys63 and Cys56-Cys95) in the alpha domain, and another one (Cys150-Cys201) in the beta domain, as was determined by molecular modeling. A full-length 1,152 bp cDNA was cloned by RT-RACE-PCR from latex mRNA. The sequence was predicted as an open reading frame of 340 amino acid residues, of which 16 residues belong to the signal peptide, 113 to the propeptide and 211 to the mature enzyme. The full-length cDNA was ligated to pPICZalpha vector and expressed in Pichia pastoris. Recombinant asclepain f showed endopeptidase activity on pGlu-Phe-Leu-p-nitroanilide and was identified by PMF-MALDI-TOF MS. Asclepain f is the first peptidase cloned and expressed from mRNA isolated from plant latex, confirming the presence of the preprocysteine peptidase in the latex.

Thyroid hormone is essential for pituitary somatotropes and lactotropes.

PubMed

Stahl, J H; Kendall, S K; Brinkmeier, M L; Greco, T L; Watkins-Chow, D E; Campos-Barros, A; Lloyd, R V; Camper, S A

1999-04-01

Mice homozygous for a disruption in the alpha-subunit essential for TSH, LH, and FSH activity (alphaGsu-/-) exhibit hypothyroidism and hypogonadism similar to that observed in TSH receptor-deficient hypothyroid mice (hyt) and GnRH-deficient hypogonadal mutants (hpg). Although the five major hormone-producing cells of the anterior pituitary are present in alphaGsu-/- mice, the relative proportions of each cell type are altered dramatically. Thyrotropes exhibit hypertrophy and hyperplasia, and somatotropes and lactotropes are underrepresented. The size and number of gonadotropes in alphaGsu mutants are not remarkable in contrast to the hypertrophy characteristic of gonadectomized animals. The reduction in lactotropes is more severe in alphaGsu mutants (13-fold relative to wild-type) than in hyt or hpg mutants (4.5- and 1.5-fold, respectively). In addition, T4 replacement therapy of alphaGsu mutants restores lactotropes to near-normal levels, illustrating the importance of T4, but not alpha-subunit, for lactotrope proliferation and function. T4 replacement is permissive for gonadotrope hypertrophy in alphaGsu mutants, consistent with the role for T4 in the function of gonadotropes. This study reveals the importance of thyroid hormone in developing the appropriate proportions of anterior pituitary cell types.

The over-expression of the β2 catalytic subunit of the proteasome decreases homologous recombination and impairs DNA double-strand break repair in human cells.

PubMed

Collavoli, Anita; Comelli, Laura; Cervelli, Tiziana; Galli, Alvaro

2011-01-01

By a human cDNA library screening, we have previously identified two sequences coding two different catalytic subunits of the proteasome which increase homologous recombination (HR) when overexpressed in the yeast Saccharomyces cerevisiae. Here, we investigated the effect of proteasome on spontaneous HR and DNA repair in human cells. To determine if the proteasome has a role in the occurrence of spontaneous HR in human cells, we overexpressed the β2 subunit of the proteasome in HeLa cells and determined the effect on intrachromosomal HR. Results showed that the overexpression of β2 subunit decreased HR in human cells without altering the cell proteasome activity and the Rad51p level. Moreover, exposure to MG132 that inhibits the proteasome activity reduced HR in human cells. We also found that the expression of the β2 subunit increases the sensitivity to the camptothecin that induces DNA double-strand break (DSB). This suggests that the β2 subunit has an active role in HR and DSB repair but does not alter the intracellular level of the Rad51p.

The Over-expression of the β2 Catalytic Subunit of the Proteasome Decreases Homologous Recombination and Impairs DNA Double-Strand Break Repair in Human Cells

PubMed Central

Collavoli, Anita; Comelli, Laura; Cervelli, Tiziana; Galli, Alvaro

2011-01-01

By a human cDNA library screening, we have previously identified two sequences coding two different catalytic subunits of the proteasome which increase homologous recombination (HR) when overexpressed in the yeast Saccharomyces cerevisiae. Here, we investigated the effect of proteasome on spontaneous HR and DNA repair in human cells. To determine if the proteasome has a role in the occurrence of spontaneous HR in human cells, we overexpressed the β2 subunit of the proteasome in HeLa cells and determined the effect on intrachromosomal HR. Results showed that the overexpression of β2 subunit decreased HR in human cells without altering the cell proteasome activity and the Rad51p level. Moreover, exposure to MG132 that inhibits the proteasome activity reduced HR in human cells. We also found that the expression of the β2 subunit increases the sensitivity to the camptothecin that induces DNA double-strand break (DSB). This suggests that the β2 subunit has an active role in HR and DSB repair but does not alter the intracellular level of the Rad51p. PMID:21660142

Functional Analysis of a Wheat AGPase Plastidial Small Subunit with a Truncated Transit Peptide.

PubMed

Yang, Yang; Gao, Tian; Xu, Mengjun; Dong, Jie; Li, Hanxiao; Wang, Pengfei; Li, Gezi; Guo, Tiancai; Kang, Guozhang; Wang, Yonghua

2017-03-01

ADP-glucose pyrophosphorylase (AGPase), the key enzyme in starch synthesis, consists of two small subunits and two large subunits with cytosolic and plastidial isoforms. In our previous study, a cDNA sequence encoding the plastidial small subunit (TaAGPS1b) of AGPase in grains of bread wheat ( Triticum aestivum L.) was isolated and the protein subunit encoded by this gene was characterized as a truncated transit peptide (about 50% shorter than those of other plant AGPS1bs). In the present study, TaAGPS1b was fused with green fluorescent protein (GFP) in rice protoplast cells, and confocal fluorescence microscopy observations revealed that like other AGPS1b containing the normal transit peptide, TaAGPS1b-GFP was localized in chloroplasts. TaAGPS1b was further overexpressed in a Chinese bread wheat cultivar, and the transgenic wheat lines exhibited a significant increase in endosperm AGPase activities, starch contents, and grain weights. These suggested that TaAGPS1b subunit was targeted into plastids by its truncated transit peptide and it could play an important role in starch synthesis in bread wheat grains.

Steroid withdrawal in the mouse results in anxiogenic effects of 3alpha,5beta-THP: a possible model of premenstrual dysphoric disorder.

PubMed

Smith, Sheryl S; Ruderman, Yevgeniy; Frye, Cheryl; Homanics, Gregg; Yuan, Maoli

2006-06-01

3alpha-OH-5alpha[beta]-pregnan-20-one (THP) is a positive modulator of the GABAA receptor (GABAR), which underlies its reported anxiolytic effect. However, there are conditions such as premenstrual dysphoric disorder (PMDD) where increases in THP levels can be associated with adverse mood. In order to test for conditions where THP might be anxiogenic, we developed a mouse model of THP withdrawal. Because delta-containing GABAR are highly sensitive to THP modulation, results were compared in wild-type and delta knockout mice. Finasteride, a 5alpha-reductase blocker, was administered for 3 days to female wild-type or delta knockout mice. Then, animals were tested in the elevated plus maze, following acute administration of THP, lorazepam, flumazenil, or 4,5,6,7-tetrahydroisoxazolo[5,4-c]pyridin-3-ol (THIP), and results compared to vehicle-injected controls. CA1 hippocampal GABAR alpha4 subunit levels were assessed by Western blot. After THP withdrawal, THP produced anxiogenic effects, decreasing open arm entries on the elevated plus maze, following a brief shock, in contrast to its expected anxiolytic effects. As we have shown in rats, THP withdrawal also resulted in increased expression of the alpha4 subunit in mouse CA1 hippocampus. As expected for increases in alpha4-containing GABAR, THP withdrawn mice were relatively insensitive to the benzodiazepine (BDZ) lorazepam and had atypical responses to the BDZ antagonist flumazenil when tested on the plus maze. In contrast, they showed a greater anxiolytic response to THIP, which has greater efficacy at alpha4betadelta than other GABAR. Although THP withdrawal in delta knockout mice also increased the alpha4 GABAR subunit, the anxiogenic effects of THP and the anxiolytic effects of THIP were not observed, implicating alpha4betadelta GABAR in these effects. Based on these behavioral and pharmacological findings, we suggest that THP withdrawal in the mouse may serve as a rodent model of PMDD.

Improved purification of brine-shrimp (Artemia saline) (Na+ + K+)-activated adenosine triphosphatase and amino-acid and carbohydrate analyses of the isolated subunits.

PubMed Central

Peterson, G L; Hokin, L E

1980-01-01

Purification of the (Na+ + K+)-activated ATPase has been improved 2-fold the respect to both purity and yield over the previous method [Peterson, Ewing, Hootman & Conte (1978) J. Biol. Chem. 253, 4762-4770] by using Lubrol WX and non-denaturing concentrations of sodium dodecyl sulphate (SDS). The enzyme was purified 200-fold over the homogenate. The preparation had a specific activity of about 600 mumol of Pi/h per mg of protein, and was about 60% pure according to quantification of Coomassie Blue-stained SDS/polyacrylamide gels. The yield of purified enzyme was about 10 mg of protein per 100g of dry brine-shrimp (Artemia salina) cysts. The method is highly suitable for purification either on a small scale (10-25g of dry cysts) or on a large scale (900g of dry cysts) and methods are described for both. The large (Na+ + K+)-activated ATPase subunit (alpha-subunit) was isolated in pure form by SDS-gel filtration on Bio-Gel A 1.5m. The small subunit (beta-subunit) was eluted with other contaminating proteins on the Bio-Gel column, but was isolated in pure form by extraction from SDS/polyacrylamide gels. The amino acid and carbohydrate compositions of both subunits are reported. The alpha-subunit contained 5.2% carbohydrate by weight, and the beta-subunit 9.2%. Sialic acid was absent from both subunits. Images Fig. 3. Fig. 4. PMID:6272692

Modulation of Ca(v)3.1 T-type Ca2+ channels by the ran binding protein RanBPM.

PubMed

Kim, Taehyun; Kim, Sunoh; Yun, Hyung-Mun; Chung, Kwang Chul; Han, Ye Sun; Shin, Hee-Sup; Rhim, Hyewhon

2009-01-02

In order to study the currently unknown cellular signaling pathways of Ca(v)3.1 T-type Ca(2+) channels (Ca(v)3.1 channels), we performed a yeast two-hybrid screening using intracellular domains of Ca(v)3.1 alpha1 subunit as bait. After screening the human brain cDNA library, several proteins, including RanBPM, were identified as interacting with Ca(v)3.1 channels. RanBPM was found to bind to the cytoplasmic intracellular loop between transmembrane domains I and II of Ca(v)3.1 channels. Using whole-cell patch-clamp techniques, we found that Ca(v)3.1 currents were increased by the expression of RanBPM in HEK293/Ca(v)3.1 cells. We next examined whether RanBPM affected the biophysical properties and plasma membrane expression of Ca(v)3.1 channels. Furthermore, we showed that the PKC activator inhibited Ca(v)3.1 currents, an effect that was abolished by the expression of RanBPM. These results suggest that RanBPM could be a key regulator of Ca(v)3.1 channel-mediated signaling pathways.

Integrin expression and integrin-mediated adhesion in vitro of human multipotent stromal cells (MSCs) to endothelial cells from various blood vessels.

PubMed

Semon, Julie A; Nagy, Lauren H; Llamas, Claire B; Tucker, H Alan; Lee, Ryang Hwa; Prockop, Darwin J

2010-07-01

Multipotent mesenchymal stromal cells (MSCs) home to damaged tissue by processes partly regulated by integrins. Integrin subunits expressed by MSCs were identified by flow cytometry (FC), immunocytochemistry (IC), and a panel of integrin-binding antibodies. In subconfluent cultures, over 80% of MSCs expressed integrin subunits beta1, beta2, and alpha3, 20%-55% expressed alpha1, alpha2, alpha4, alpha5, alpha6, and alphaV, and about 10% expressed beta3 when assayed by FC. None of the cells expressed significant levels of 13 other integrins as assayed by FC, but seven of the 13 integrins were detected by IC: beta5, alpha7, alpha8, alpha9, alpha11, alphaX, and alphaD. Expression of some integrins changed with MSC confluency: integrins beta3, alpha1, alpha3, alpha5, and alphaV increased, and alpha6 decreased. Furthermore, alpha4 was the only integrin to vary among preparations of MSCs from different donors. The results resolved some discrepancies in the literature concerning integrin expression by MSCs. We also investigated the role of specific integrins in MSC adhesion to endothelial cells (ECs) from the pulmonary artery (HPAEC), cardiac-derived microvasculature (HMVEC-C), and umbilical veins (HUVEC). In experiments with blocking antibodies to beta integrins, anti-beta5 reduced MSC adhesion to all types of ECs, anti-beta1 to both HUVEC and HPAEC, anti-beta3 to HUVEC, and anti-beta2 to HMVEC-C. With blocking antibodies to alpha integrins, anti-alphaX reduced adhesion to HPAEC and HMVEC-C, anti-alphaV to HPAEC, and both anti-alpha7 and anti-alphaD to HMVEC-C. Thus, MSCs use diverse integrins to adhere to EC from various blood vessels in vitro.

Cloning and functional expression of the small subunit of acetolactate synthase from Nicotiana plumbaginifolia.

PubMed

Hershey, H P; Schwartz, L J; Gale, J P; Abell, L M

1999-07-01

Acetolactate synthase (ALS) is the first committed step of branched-chain amino acid biosynthesis in plants and bacteria. The bacterial holoenzyme has been well characterized and is a tetramer of two identical large subunits (LSUs) of 60 kDa and two identical small subunits (SSUs) ranging in molecular mass from 9 to 17 kDa depending on the isozyme. The enzyme from plants is much less well characterized. Attempts to purify the protein have yielded an enzyme which appears to be an oligomer of LSUs, with the potential existence of a SSU for the plant enzyme remaining a matter of considerable speculation. We report here the discovery of a cDNA clone that encodes a SSU of plant ALS based upon the homology of the encoded peptide with various bacterial ALS SSUs. The plant ALS SSU is more than twice as large as any of its prokaryotic homologues and contains two domains that each encode a full-length copy of the prokaryotic SSU polypeptide. The cDNA clone was used to express Nicotiana plumbaginifolia SSU in Escherichia coli. Mixing a partially purified preparation of this SSU with the LSU of ALS from either N. plumbaginifolia or Arabidopsis thaliana results in both increased specific activity and increased stability of the enzymic activity. These results are consistent with those observed for the bacterial enzyme in similar experiments and represent the first functional demonstration of the existence of a SSU for plant ALS.

Ca2+ signalling, voltage-gated Ca2+ channels and praziquantel in flatworm neuromusculature.

PubMed

Greenberg, R M

2005-01-01

Transient changes in calcium (Ca2+) levels regulate a wide variety of cellular processes, and cells employ both intracellular and extracellular sources of Ca2+ for signalling. Praziquantel, the drug of choice against schistosomiasis, disrupts Ca2+ homeostasis in adult worms. This review will focus on voltage-gated Ca2+ channels, which regulate levels of intracellular Ca2+ by coupling membrane depolarization to entry of extracellular Ca2+. Ca2+ channels are members of the ion channel superfamily and represent essential components of neurons, muscles and other excitable cells. Ca2+ channels are membrane protein complexes in which the pore-forming alpha1 subunit is modulated by auxiliary subunits such as beta and alpha2delta. Schistosomes express two Ca2+ channel beta subunit subtypes: a conventional subtype similar to beta subunits found in other vertebrates and invertebrates and a novel variant subtype with unusual structural and functional properties. The variant schistosome beta subunit confers praziquantel sensitivity to an otherwise praziquantel-insensitive mammalian Ca2+ channel, implicating it as a mediator of praziquantel action.

The general mitochondrial processing peptidase from potato is an integral part of cytochrome c reductase of the respiratory chain.

PubMed Central

Braun, H P; Emmermann, M; Kruft, V; Schmitz, U K

1992-01-01

The major mitochondrial processing activity removing presequences from nuclear encoded precursor proteins is present in the soluble fraction of fungal and mammalian mitochondria. We found that in potato, this activity resides in the inner mitochondrial membrane. Surprisingly, the proteolytic activity co-purifies with cytochrome c reductase, a protein complex of the respiratory chain. The purified complex is bifunctional, as it has the ability to transfer electrons from ubiquinol to cytochrome c and to cleave off the presequences of mitochondrial precursor proteins. In contrast to the nine subunit fungal complex, cytochrome c reductase from potato comprises 10 polypeptides. Protein sequencing of peptides from individual subunits and analysis of corresponding cDNA clones reveals that subunit III of cytochrome c reductase (51 kDa) represents the general mitochondrial processing peptidase. Images PMID:1324169

Developmentally-regulated sodium channel subunits are differentially sensitive to {alpha}-cyano containing pyrethroids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meacham, Connie A.; Brodfuehrer, Peter D.; Watkins, Jennifer A.

2008-09-15

Juvenile rats have been reported to be more sensitive to the acute neurotoxic effects of the pyrethroid deltamethrin than adults. While toxicokinetic differences between juveniles and adults are documented, toxicodynamic differences have not been examined. Voltage-gated sodium channels, the primary targets of pyrethroids, are comprised of {alpha} and {beta} subunits, each of which have multiple isoforms that are expressed in a developmentally-regulated manner. To begin to test whether toxicodynamic differences could contribute to age-dependent deltamethrin toxicity, deltamethrin effects were examined on sodium currents in Xenopus laevis oocytes injected with different combinations of rat {alpha} (Na{sub v}1.2 or Na{sub v}1.3) andmore » {beta} ({beta}{sub 1} or {beta}{sub 3}) subunits. Deltamethrin induced tail currents in all isoform combinations and increased the percent of modified channels in a concentration-dependent manner. Effects of deltamethrin were dependent on subunit combination; Na{sub v}1.3-containing channels were modified to a greater extent than were Na{sub v}1.2-containing channels. In the presence of a {beta} subunit, deltamethrin effects were significantly greater, an effect most pronounced for Na{sub v}1.3 channels; Na{sub v}1.3/{beta}{sub 3} channels were more sensitive to deltamethrin than Na{sub v}1.2/{beta}{sub 1} channels. Na{sub v}1.3/{beta}{sub 3} channels are expressed embryonically, while the Na{sub v}1.2 and {beta}{sub 1} subunits predominate in adults, supporting the hypothesis for age-dependent toxicodynamic differences. Structure-activity relationships for sensitivity of these subunit combinations were examined for other pyrethroids. Permethrin and tetramethrin did not modify currents mediated by either subunit combination. Cypermethrin, {beta}-cyfluthrin, esfenvalerate and fenpropathrin all modified sodium channel function; effects were significantly greater on Na{sub v}1.3/{beta}{sub 3} than on Na{sub v}1.2/{beta}{sub 1} channels. These data demonstrate a greater sensitivity of Na{sub v}1.3 vs Na{sub v}1.2 channels to deltamethrin and other cyano-containing pyrethroids, particularly in the presence of a {beta} subunit.« less

Identification and transcription profiling of NDUFS8 in Aedes taeniorhynchus (Diptera:Culididae): developmental regulation and environmental response

USDA-ARS?s Scientific Manuscript database

The cDNA of a NADH dehydrogenase -ubiquinone Fe-S protein 8 subunit (NDUFS8) gene from Aedes (Ochlerotatus) taeniorhynchus Wiedemann has been cloned and sequenced. The full-length mRNA sequence (824 bp) of AetNDUFS8 encodes an open reading region of 651 bp (i.e., 217 amino acids). To detect whether ...

A xyloglucan oligosaccharide-active, transglycosylating beta-D-glucosidase from the cotyledons of nasturtium (Tropaeolum majus L) seedlings--purification, properties and characterization of a cDNA clone.

PubMed

Crombie, H J; Chengappa, S; Hellyer, A; Reid, J S

1998-07-01

A beta-D-glucosidase has been purified to apparent homogeneity from the cotyledons of germinated nasturtium (Tropaeolum majus L.) seedlings during the mobilization of the xyloglucan stored in the cotyledonary cell walls. The purified protein (Mr 76, 000; a glycoprotein; pl > 9.5; apparent pH optimum 4.5; temperature optimum 30 degrees C) catalysed the hydrolysis of p-nitrophenyl-beta-D-glucopyranoside, cello-oligosaccharides, beta-linked glucose disaccharides, and certain xyloglucan oligosaccharides. Glucose disaccharides with different linkages were hydrolysed at different rates [(1-->3) > (1-->4) > (1-->2) > (1-->6)] with significant transglycosylation occurring in the early stages of the reaction. Cello-oligosaccharide hydrolysis was also accompanied by extensive transglycosylation to give transitory accumulations of higher oligosaccharides. At least some of the glycosyl linkages formed during transglycosylation were (1-->6)-beta. Xyloglucan oligosaccharides xylose-substituted at the non-reducing terminal glucose residue (XXXG, XXLG, XLXG and XLLG, where G is an unsubstituted glucose residue, X is a xylose-substituted glucose residue, and L is a galactosylxylose-substituted glucose residue) were not hydrolysed. Some xyloglucan oligosaccharides with an unsubstituted non-reducing terminal glucose residue (GXXG, GXLG and GXG) were hydrolysed, but others (GLXG and GLLG) were not. This indicated steric hindrance by L but not X substitution at the glucose residue next to the one at the non-reducing end of the oligosaccharide. Hydrolysis of xyloglucan oligosaccharides was not accompanied by transglycosylation. Natural xyloglucan subunit oligosaccharides (XXXG, XXLG, XLXG, XLLG) were totally degraded to their monosaccharide components when treated with nasturtium beta-D-galactosidase. (Edwards et al (1988) J. Biol. Chem. 263, 4333-4337), followed by alternations of nasturtium xyloglucan-specific alpha-xylosidase (Fanutti et al (1991) Planta 184, 137-147) and this enzyme. Several extensively overlapping cDNA clones were obtained by RT-PCR and by screening cDNA libraries. A composite, full-length DNA had an open reading frame of 1962 bp, encoding a polypeptide of 654 amino acids, including all N-terminal and internal sequences obtained from the purified beta-glucosidase protein, and a motif resembling plant signal sequences thought to direct proteins to the cell wall. Database searches revealed homology with beta-glucosidases from several sources (plant, bacteria, yeast), notably with glycosylhydrolases of 'Family 3', according to the classification of Henrissat (Henrissat (1991) Biochem. J. 280, 309-316). There was strong sequence homology with a beta-glucan exo-hydrolase from barley (Hrmova et al. (1996) J. Biol. Chem. 271, 5277-5286). The nasturtium beta-glucosidase is ascribed a role in xyloglucan mobilization, and its interaction with the alpha-xylosidase and the beta-galactosidase is modelled.

A synthetic peptide derived from A1 module in CRD4 of human TNF receptor-1 inhibits binding and proinflammatory effect of human TNF-alpha.

PubMed

Cao, Yingnan; Wang, Zhaohe; Bu, Xianzhang; Tang, Shu; Mei, Zhengrong; Liu, Peiqing

2009-06-01

Tumour necrosis factor alpha (TNF-alpha) is a proinflammatory cytokine, which has been shown to be a causative factor in rheumatoid arthritis, inflammatory bowel disease and septic shock. Proinflammatory effect of TNF-alpha is activated mainly through human TNF receptor-1 (TNF-R1). However, the role of the fourth cystein-rich domain (CRD4) of TNF-R1 extracellular portion in the interaction of TNF-alpha with TNF-R1 is still unclear. In the present study, binding activity of TNF-alpha to TNF-R1 and protein levels of IkappaB-alpha and nuclear transcription factor kappa B (NF-kappaB) p65 subunit in HeLa cells were measured using enzyme-linked immunosorbent assay (ELISA) and western-blot analysis. Pep 3 (LRENECVS) which was derived from the hydrophilic region of A1 module in CRD4 remarkably inhibited the binding of TNF-alpha to TNF-R1, and also reversed TNF-alpha-induced degradation of IkappaB-alpha and nuclear translocation of NF-kappaB p65 subunit in HeLa cells. Our results confirmed that the hydrophilic region of A1 module in CRD4 participated in the interaction of TNF-alpha with TNF-R1, and demonstrated the potential of small-molecule TNF-alpha extracellular inhibitors targeting at A1 module in CRD4 of TNF-R1 in suppressing proinflammatory effect of TNF-alpha.

Modulation of epithelial sodium channel trafficking and function by sodium 4-phenylbutyrate in human nasal epithelial cells.

PubMed

Prulière-Escabasse, Virginie; Planès, Carole; Escudier, Estelle; Fanen, Pascale; Coste, André; Clerici, Christine

2007-11-23

Sodium 4-phenylbutyrate (4-PBA) has been shown to correct the cellular trafficking of several mutant or nonmutant plasma membrane proteins such as cystic fibrosis transmembrane conductance regulator through the expression of 70-kDa heat shock proteins. The objective of the study was to determine whether 4-PBA may influence the functional expression of epithelial sodium channels (ENaC) in human nasal epithelial cells (HNEC). Using primary cultures of HNEC, we demonstrate that 4-PBA (5 mm for 6 h) markedly stimulated amiloride-sensitive sodium channel activity and that this was related to an increased abundance of alpha-, beta-, and gamma-ENaC subunits in the apical membrane. The increase in ENaC cell surface expression (i) was due to insertion of newly ENaC subunits as determined by brefeldin A experiments and (ii) was not associated with cell surface retention of ENaC subunits because endocytosis of ENaC subunits was unchanged. In addition, we find that ENaC co-immunoprecipitated with the heat shock protein constitutively expressed Hsc70, that has been reported to modulate ENaC trafficking, and that 4-PBA decreased Hsc70 protein level. Finally, we report that in cystic fibrosis HNEC obtained from two cystic fibrosis patients, 4-PBA increased functional expression of ENaC as demonstrated by the increase in amiloride-sensitive sodium transport and in alpha-, beta-, and gamma-ENaC subunit expression in the apical membrane. Our results suggest that in HNEC, 4-PBA increases the functional expression of ENaC through the insertion of new alpha-, beta-, and gamma-ENaC subunits into the apical membrane and also suggest that 4-PBA could modify ENaC trafficking by reducing Hsc70 protein expression.

The Kv7.2/Kv7.3 heterotetramer assembles with a random subunit arrangement.

PubMed

Stewart, Andrew P; Gómez-Posada, Juan Camilo; McGeorge, Jessica; Rouhani, Maral J; Villarroel, Alvaro; Murrell-Lagnado, Ruth D; Edwardson, J Michael

2012-04-06

Voltage-gated K(+) channels composed of Kv7.2 and Kv7.3 are the predominant contributors to the M-current, which plays a key role in controlling neuronal activity. Various lines of evidence have indicated that Kv7.2 and Kv7.3 form a heteromeric channel. However, the subunit stoichiometry and arrangement within this putative heteromer are so far unknown. Here, we have addressed this question using atomic force microscopy imaging of complexes between isolated Kv7.2/Kv7.3 channels and antibodies to epitope tags on the two subunits, Myc on Kv7.2 and HA on Kv7.3. Initially, tsA 201 cells were transiently transfected with equal amounts of cDNA for the two subunits. The heteromer was isolated through binding of either tag to immunoaffinity beads and then decorated with antibodies to the other tag. In both cases, the distribution of angles between pairs of bound antibodies had two peaks, at around 90° and around 180°, and in both cases the 90° peak was about double the size of the 180° peak. These results indicate that the Kv7.2/Kv7.3 heteromer generated by cells expressing approximately equal amounts of the two subunits assembles as a tetramer with a predominantly 2:2 subunit stoichiometry and with a random subunit arrangement. When the DNA ratio for the two subunits was varied, copurification experiments indicated that the subunit stoichiometry was variable and not fixed at 2:2. Hence, there are no constraints on either the subunit stoichiometry or the subunit arrangement.

The alpha-spectrin gene is on chromosome 1 in mouse and man.

PubMed

Huebner, K; Palumbo, A P; Isobe, M; Kozak, C A; Monaco, S; Rovera, G; Croce, C M; Curtis, P J

1985-06-01

By using alpha-spectrin cDNA clones of murine and human origin and somatic cell hybrids segregating either mouse or human chromosomes, the gene for alpha-spectrin has been mapped to chromosome 1 in both species. This assignment of the mouse alpha-spectrin gene to mouse chromosome 1 by DNA hybridization strengthens the previous identification of the alpha-spectrin locus in mouse with the sph locus, which previously was mapped by linkage analysis to mouse chromosome 1, distal to the Pep-3 locus. By in situ hybridization to human metaphase chromosomes, the human alpha-spectrin gene has been localized to 1q22-1q25; interestingly, the locus for a non-Rh-linked form of elliptocytosis has been provisionally mapped to band 1q2 by family linkage studies.

Unsaturated free fatty acids increase benzodiazepine receptor agonist binding depending on the subunit composition of the GABAA receptor complex.

PubMed

Witt, M R; Westh-Hansen, S E; Rasmussen, P B; Hastrup, S; Nielsen, M

1996-11-01

It has been shown previously that unsaturated free fatty acids (FFAs) strongly enhance the binding of agonist benzodiazepine receptor ligands and GABAA receptor ligands in the CNS in vitro. To investigate the selectivity of this effect, recombinant human GABAA/benzodiazepine receptor complexes formed by different subunit compositions (alpha x beta y gamma 2, x = 1, 2, 3, and 5; y = 1, 2, and 3) were expressed using the baculovirus-transfected Sf9 insect cell system. At 10(-4) M, unsaturated FFAs, particularly arachidonic (20:4) and docosahexaenoic (22:6) acids, strongly stimulated (> 200% of control values) the binding of [3H]flunitrazepam ([3H]FNM) to the alpha 3 beta 2 gamma 2 receptor combination in whole cell preparations. No effect or small increases in levels of unsaturated FFAs on [3H]FNM binding to alpha 1 beta x gamma 2 and alpha 2 beta x gamma 2 receptor combinations were observed, and weak effects (130% of control values) were detected using the alpha 5 beta 2 gamma 2 receptor combination. The saturated FFAs, stearic and palmitic acids, were without effect on [3H]FNM binding to any combination of receptor complexes. The hydroxylated unsaturated FFAs, ricinoleic and ricinelaidic acids, were shown to decrease the binding of [3H]FNM only if an alpha 1 beta 2 gamma 2 receptor combination was used. Given the heterogeneity of the GABAA/ benzodiazepine receptor subunit distribution in the CNS, the effects of FFAs on the benzodiazepine receptor can be assumed to vary at both cellular and regional levels.

Regulation of acetylcholine receptor alpha subunit variants in human myasthenia gravis. Quantification of steady-state levels of messenger RNA in muscle biopsy using the polymerase chain reaction.

PubMed Central

Guyon, T; Levasseur, P; Truffault, F; Cottin, C; Gaud, C; Berrih-Aknin, S

1994-01-01

Myasthenia gravis (MG) is an autoimmune disease mediated by auto-antibodies that attack the nicotinic acetylcholine receptor (AChR). To elucidate the molecular mechanisms underlying the decrease in AChR levels at the neuromuscular junction, we investigated the regulation of AChR expression by analyzing mRNA of the two AChR alpha subunit isoforms (P3A+ and P3A-) in muscle samples from myasthenic patients relative to controls. We applied a quantitative method based on reverse transcription of total RNA followed by polymerase chain reaction (PCR), using an internal standard we constructed by site-directed mutagenesis. An increased expression of mRNA coding for the alpha subunit of the AChR isoforms was observed in severely affected patients (P < 0.003 versus controls) but not in moderately affected patients, independently of the anti-AChR antibody titer. Study of mRNA precursor levels indicates a higher expression in severely affected patients compared to controls, suggesting an enhanced rate of transcription of the message coding for the alpha subunit isoforms in these patients. We have also reported that mRNA encoding both isoforms are expressed at an approximate 1:1 ratio in controls and in patients. We have thus identified a new biological parameter correlated with disease severity, and provide evidence of a compensatory mechanism to balance the loss of AChR in human myasthenia gravis, which is probably triggered only above a certain degree of AChR loss. Images PMID:8040257

Site directed mutagenesis of the heme axial ligands of cytochrome b559 affects the stability of the photosystem II complex.

PubMed Central

Pakrasi, H B; De Ciechi, P; Whitmarsh, J

1991-01-01

Cytochrome (cyt) b559, an integral membrane protein, is an essential component of the photosystem II (PSII) complex in the thylakoid membranes of oxygenic photosynthetic organisms. Cyt b559 has two subunits, alpha and beta, each with one predicted membrane spanning alpha-helical domain. The heme cofactor of this cytochrome is coordinated between two histidine residues. Each of the two subunit polypeptides of cyt b559 has one His residue. To investigate the influence of these His residues on the structure of cyt b559 and the PSII complex, we used a site directed mutagenesis approach to replace each His residue with a Leu residue. Introduction of these missense mutations in the transformable unicellular cyanobacterium, Synechocystis 6803, resulted in complete loss of PSII activity. Northern blot analysis showed that these mutations did not affect the stability of the polycistronic mRNA that encompasses both the psbE and the psbF genes, encoding the alpha and the beta subunits, respectively. Moreover, both of the single His mutants showed the presence of the alpha subunit which was 1.5 kd smaller than the same polypeptide in wild type cells. A secondary effect of such a structural change was that D1 and D2, two proteins that form the catalytic core (reaction center) of PSII, were also destabilized. Our results demonstrate that proper axial coordination of the heme cofactor in cyt b559 is important for the structural integrity of the reaction center of PSII. Images PMID:1904816

Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki

A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less

Inhibitory function of adapter-related protein complex 2 alpha 1 subunit in the process of nuclear translocation of human immunodeficiency virus type 1 genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kitagawa, Yukiko; Department of Oral and Maxillofacial Surgery II, Osaka University, Osaka 565-0871; Kameoka, Masanori

2008-03-30

The transfection of human cells with siRNA against adapter-related protein complex 2 alpha 1 subunit (AP2{alpha}) was revealed to significantly up-regulate the replication of human immunodeficiency virus type 1 (HIV-1). This effect was confirmed by cell infection with vesicular stomatitis virus G protein-pseudotyped HIV-1 as well as CXCR4-tropic and CCR5-tropic HIV-1. Viral adsorption, viral entry and reverse transcription processes were not affected by cell transfection with siRNA against AP2{alpha}. In contrast, viral nuclear translocation as well as the integration process was significantly up-regulated in cells transfected with siRNA against AP2{alpha}. Confocal fluorescence microscopy revealed that a subpopulation of AP2{alpha} wasmore » not only localized in the cytoplasm but was also partly co-localized with lamin B, importin {beta} and Nup153, implying that AP2{alpha} negatively regulates HIV-1 replication in the process of nuclear translocation of viral DNA in the cytoplasm or the perinuclear region. We propose that AP2{alpha} may be a novel target for disrupting HIV-1 replication in the early stage of the viral life cycle.« less

Lactobacillus cypricasei Lawson et al. 2001 is a later heterotypic synonym of Lactobacillus acidipiscis Tanasupawat et al. 2000.

PubMed

Naser, Sabri M; Vancanneyt, Marc; Hoste, Bart; Snauwaert, Cindy; Swings, Jean

2006-07-01

The applicability of a multilocus sequence analysis (MLSA)-based identification system for lactobacilli was evaluated. Two housekeeping genes that code for the phenylalanyl-tRNA synthase alpha-subunit (pheS) and RNA polymerase alpha-subunit (rpoA) were sequenced and analysed for members of the Lactobacillus salivarius species group. The type strains of Lactobacillus acidipiscis and Lactobacillus cypricasei were investigated further using a third gene that encodes the alpha-subunit of ATP synthase (atpA). The MLSA data revealed close relatedness between L. acidipiscis and L. cypricasei, with 99.8-100 % pheS, rpoA and atpA gene sequence similarities. Comparison of the 16S rRNA gene sequences of the type strains of the two species confirmed the close relatedness (99.8 % gene sequence similarity) between the two taxa. Similar phenotypes and high DNA-DNA binding values in the range of 84 to 97.5 % confirmed that L. acidipiscis and L. cypricasei are synonymous species. On the basis of the present study, it is proposed that Lactobacillus cypricasei is a later heterotypic synonym of Lactobacillus acidipiscis.

Selective labelling of diazepam-insensitive GABAA receptors in vivo using [3H]Ro 15-4513.

PubMed

Pym, Luanda J; Cook, Susan M; Rosahl, Thomas; McKernan, Ruth M; Atack, John R

2005-11-01

Classical benzodiazepines (BZs), such as diazepam, bind to GABAA receptors containing alpha1, alpha2, alpha3 or alpha5 subunits that are therefore described as diazepam-sensitive (DS) receptors. However, the corresponding binding site of GABAA receptors containing either an alpha4 or alpha6 subunit do not bind the classical BZs and are therefore diazepam-insensitive (DIS) receptors; a difference attributable to a single amino acid (histidine in alpha1, alpha2, alpha3 and alpha5 subunits and arginine in alpha4 and alpha6). Unlike classical BZs, the imidazobenzodiazepines Ro 15-4513 and bretazenil bind to both DS and DIS populations of GABAA receptors. In the present study, an in vivo assay was developed using lorazepam to fully occupy DS receptors such that [3H]Ro 15-4513 was then only able to bind to DIS receptors. When dosed i.v., [3H]Ro 15-4513 rapidly entered and was cleared from the brain, with approximately 70% of brain radioactivity being membrane-bound. Essentially all membrane binding to DS+DIS receptors could be displaced by unlabelled Ro 15-4513 or bretazenil, with respective ID50 values of 0.35 and 1.2 mg kg(-1). A dose of 30 mg kg(-1) lorazepam was used to block all DS receptors in a [3H]Ro 15-1788 in vivo binding assay. When predosed in a [3H]Ro 15-4513 binding assay, lorazepam blocked [3H]Ro 15-4513 binding to DS receptors, with the remaining binding to DIS receptors accounting for 5 and 23% of the total (DS plus DIS) receptors in the forebrain and cerebellum, respectively. The in vivo binding of [3H]Ro 15-4513 to DIS receptors in the presence of lorazepam was confirmed using alpha1H101R knock-in mice, in which alpha1-containing GABAA receptors are rendered diazepam insensitive by mutation of the histidine that confers diazepam sensitivity to arginine. In these mice, and in the presence of lorazepam, there was an increase of in vivo [3H]Ro 15-4513 binding in the forebrain and cerebellum from 4 and 15% to 36 and 59% of the total (i.e. DS plus DIS) [3H]Ro 15-4513 binding observed in the absence of lorazepam.

Regulation of gene expression by dietary Ca2+ in kidneys of 25-hydroxyvitamin D3-1 alpha-hydroxylase knockout mice.

PubMed

Hoenderop, Joost G J; Chon, Helena; Gkika, Dimitra; Bluyssen, Hans A R; Holstege, Frank C P; St-Arnaud, Rene; Braam, Branko; Bindels, Rene J M

2004-02-01

Pseudovitamin D deficiency rickets (PDDR) is an autosomal disease, characterized by undetectable levels of 1,25-dihydroxyvitamin D3 (1,25(OH)2D3), rickets and secondary hyperparathyroidism. Mice in which the 25-hydroxyvitamin D3-1 alpha-hydroxylase (1 alpha-OHase) gene was inactivated, presented the same clinical phenotype as patients with PDDR. cDNA Microarray technology was used on kidneys of 1 alpha-OHase knockout mice to study the expression profile of renal genes in this Ca2+-related disorder. Genome wide molecular events that occur during the rescue of these mice by high dietary Ca2+ intake were studied by the use of 15K cDNA microarray chips. 1 alpha-OHase knockout mice fed a normal Ca2+ diet developed severe hypocalcemia, rickets and died with an average life span of 12 +/- 2 weeks. Intriguingly, 1 alpha-OHase-/- mice supplemented with an enriched Ca2+ diet were normocalcemic and not significantly different from wild-type mice. Inactivation of the 1 alpha-OHase gene resulted in a significant regulation of +/- 1000 genes, whereas dietary Ca2+ supplementation of the 1 alpha-OHase-/- mice revealed +/- 2000 controlled genes. Interestingly, 557 transcripts were regulated in both situations implicating the involvement in the dietary Ca2+-mediated rescue mechanism of the 1 alpha-OHase-/- mice. Conspicuous regulated genes encoded for signaling molecules like the PDZ-domain containing protein channel interacting protein, FK binding protein type 4, kinases, and importantly Ca2+ transporting proteins including the Na+-Ca2+ exchanger, calbindin-D28K and the Ca2+ sensor calmodulin. Dietary Ca2+ intake normalized disturbances in the Ca2+ homeostasis due to vitamin D deficiency that were accompanied by the regulation of a subset of renal genes, including well-known renal Ca2+ transport protein genes, but also genes not previously identified as playing a role in renal Ca2+ handling.

alpha 4 beta 2 subunit combination specific pharmacology of neuronal nicotinic acetylcholine receptors in N1E-115 neuroblastoma cells.

PubMed

Zwart, R; Abraham, D; Oortgiesen, M; Vijverberg, H P

1994-08-22

Pharmacological characteristics of native neuronal nicotinic acetylcholine receptor-mediated ion currents in mouse N1E-115 neuroblastoma cells have been investigated by superfusion of voltage clamped cells with known concentrations of the agonists acetylcholine, nicotine and cytisine, and the antagonists alpha-bungarotoxin and neuronal bungarotoxin. The sensitivity of the nicotinic acetylcholine receptor for agonists followed the agonist potency rank-order: nicotine approximately acetylcholine > cytisine. The EC50 values of acetylcholine and nicotine are 78 microM and 76 microM, respectively. Equal concentrations of acetylcholine and nicotine induce inward currents with approximately the same peak amplitude whereas cytisine induces much smaller inward currents. Acetylcholine-induced currents are unaffected by high concentrations of alpha-bungarotoxin. Conversely, at 10 and 90 nM neuronal bungarotoxin reduces the amplitude of the 1 mM acetylcholine-induced inward current to 47% and 11% of control values, respectively. Both the agonist potency rank-order and the differential sensitivity to snake toxins of nicotinic receptors in N1E-115 cells are consistent with the known pharmacological profile of alpha 4 beta 2 nicotinic receptors expressed in Xenopus oocytes and distinct from those of all other nicotinic acetylcholine receptors of known functional subunit compositions. All data indicate that the native nicotinic acetylcholine receptor in N1E-115 cells is an assembly of alpha 4 and beta 2 subunits, the putative major subtype of nicotinic acetylcholine receptor in the brain.

Linkage of genes for laminin B1 and B2 subunits on chromosome 1 in mouse.

PubMed

Elliott, R W; Barlow, D; Hogan, B L

1985-08-01

We have used cDNA clones for the B1 and B2 subunits of laminin to find restriction fragment length DNA polymorphisms for the genes encoding these polypeptides in the mouse. Three alleles were found for LamB2 and two for LamB1 among the inbred mouse strains. The segregation of these polymorphisms among recombinant inbred strains showed that these genes are tightly linked in the central region of mouse Chromosome 1 between Sas-1 and Ly-m22, 7.4 +/- 3.2 cM distal to the Pep-3 locus. There is no evidence in the mouse for pseudogenes for these proteins.

Expression of functional receptors by the human γ-aminobutyric acid A γ2 subunit

PubMed Central

Martínez-Torres, Ataúlfo; Miledi, Ricardo

2004-01-01

γ-Aminobutyric acid A (GABAA) receptors are heteromeric membrane proteins formed mainly by various combinations of α, β, and γ subunits; and it is commonly thought that the γ2 subunit alone does not form functional receptors. In contrast, we found that cDNA encoding the γ2L subunit of the human GABAA receptor, injected alone into Xenopus oocytes, expressed functional GABA receptors whose properties were investigated by using the two-microelectrode voltage-clamp technique. GABA elicited desensitizing membrane currents that recovered after a few minutes' wash. Repetitive applications of GABA induced a “run-up” of GABA currents that nearly doubled the amplitude of the first response. The GABA currents inverted direction at about -30 mV, indicating that they are carried mainly by Cl- ions. The homomeric γ2L receptors were also activated by β-alanine > taurine > glycine, and, like some types of heteromeric GABAA receptors, the γ2L receptors were blocked by bicuculline and were potentiated by pentobarbital and flunitrazepam. These results indicate that the human γ2L subunit is capable of forming fully functional GABA receptors by itself in Xenopus oocytes and suggest that the roles proposed for the various subunits that make up the heteromeric GABAA receptors in situ require further clarification. PMID:14981251

Cyclophilin B Interacts with Sodium-Potassium ATPase and Is Required for Pump Activity in Proximal Tubule Cells of the Kidney

PubMed Central

Suñé, Guillermo; Sarró, Eduard; Puigmulé, Marta; López-Hellín, Joan; Zufferey, Madeleine; Pertel, Thomas; Luban, Jeremy; Meseguer, Anna

2010-01-01

Cyclophilins (Cyps), the intracellular receptors for Cyclosporine A (CsA), are responsible for peptidyl-prolyl cis-trans isomerisation and for chaperoning several membrane proteins. Those functions are inhibited upon CsA binding. Albeit its great benefits as immunosuppressant, the use of CsA has been limited by undesirable nephrotoxic effects, including sodium retention, hypertension, hyperkalemia, interstial fibrosis and progressive renal failure in transplant recipients. In this report, we focused on the identification of novel CypB-interacting proteins to understand the role of CypB in kidney function and, in turn, to gain further insight into the molecular mechanisms of CsA-induced toxicity. By means of yeast two-hybrid screens with human kidney cDNA, we discovered a novel interaction between CypB and the membrane Na/K-ATPase β1 subunit protein (Na/K-β1) that was confirmed by pull-down, co-immunoprecipitation and confocal microscopy, in proximal tubule-derived HK-2 cells. The Na/K-ATPase pump, a key plasma membrane transporter, is responsible for maintenance of electrical Na+ and K+ gradients across the membrane. We showed that CypB silencing produced similar effects on Na/K-ATPase activity than CsA treatment in HK-2 cells. It was also observed an enrichment of both alpha and beta subunits in the ER, what suggested a possible failure on the maturation and routing of the pump from this compartment towards the plasma membrane. These data indicate that CypB through its interaction with Na/K-β1 might regulate maturation and trafficking of the pump through the secretory pathway, offering new insights into the relationship between cyclophilins and the nephrotoxic effects of CsA. PMID:21085665

Cyclophilin B interacts with sodium-potassium ATPase and is required for pump activity in proximal tubule cells of the kidney.

PubMed

Suñé, Guillermo; Sarró, Eduard; Puigmulé, Marta; López-Hellín, Joan; Zufferey, Madeleine; Pertel, Thomas; Luban, Jeremy; Meseguer, Anna

2010-11-10

Cyclophilins (Cyps), the intracellular receptors for Cyclosporine A (CsA), are responsible for peptidyl-prolyl cis-trans isomerisation and for chaperoning several membrane proteins. Those functions are inhibited upon CsA binding. Albeit its great benefits as immunosuppressant, the use of CsA has been limited by undesirable nephrotoxic effects, including sodium retention, hypertension, hyperkalemia, interstial fibrosis and progressive renal failure in transplant recipients. In this report, we focused on the identification of novel CypB-interacting proteins to understand the role of CypB in kidney function and, in turn, to gain further insight into the molecular mechanisms of CsA-induced toxicity. By means of yeast two-hybrid screens with human kidney cDNA, we discovered a novel interaction between CypB and the membrane Na/K-ATPase β1 subunit protein (Na/K-β1) that was confirmed by pull-down, co-immunoprecipitation and confocal microscopy, in proximal tubule-derived HK-2 cells. The Na/K-ATPase pump, a key plasma membrane transporter, is responsible for maintenance of electrical Na+ and K+ gradients across the membrane. We showed that CypB silencing produced similar effects on Na/K-ATPase activity than CsA treatment in HK-2 cells. It was also observed an enrichment of both alpha and beta subunits in the ER, what suggested a possible failure on the maturation and routing of the pump from this compartment towards the plasma membrane. These data indicate that CypB through its interaction with Na/K-β1 might regulate maturation and trafficking of the pump through the secretory pathway, offering new insights into the relationship between cyclophilins and the nephrotoxic effects of CsA.

Molecular characterization of hypoxia and hypoxia-inducible factor 1 alpha (HIF-1α) from Taiwan voles (Microtus kikuchii).

PubMed

Jiang, Yi-Fan; Chou, Chung-Hsi; Lin, En-Chung; Chiu, Chih-Hsien

2011-02-01

Hypoxia-inducible factor 1 (HIF-1) is a transcription factor that senses and adapts cells to hypoxic environmental conditions. HIF-1 is composed of an oxygen-regulated α subunit (HIF-1α) and a constitutively expressed β subunit (HIF-1β). Taiwan voles (Microtus kikuchii) are an endemic species in Taiwan, found only in mountainous areas greater than 2000m above sea level. In this study, the full-length HIF-1α cDNA was cloned and sequenced from liver tissues of Taiwan voles. We found that HIF-1α of Taiwan voles had high sequence similarity to HIF-1α of other species. Sequence alignment of HIF-1α functional domains indicated basic helix-loop-helix (bHLH), PER-ARNT-SIM (PAS) and C-terminal transactivation (TAD-C) domains were conserved among species, but sequence variations were found between the oxygen-dependent degradation domains (ODDD). To measure Taiwan vole HIF-1α responses to hypoxia, animals were challenged with cobalt chloride, and HIF-1α mRNA and protein expression in brain, lung, heart, liver, kidney, and muscle was assessed by quantitative RT-PCR and Western blot analysis. Upon induction of hypoxic stress with cobalt chloride, an increase in HIF-1α mRNA levels was detected in lung, heart, kidney, and muscle tissue. In contrast, protein expression levels showed greater variation between individual animals. These results suggest that the regulation of HIF-1α may be important to the Taiwan vole under cobalt chloride treatments. But more details regarding the evolutionary effect of environmental pressure on HIF-1α primary sequence, HIF-1α function and regulation in Taiwan voles remain to be identified. Copyright © 2010 Elsevier Inc. All rights reserved.

Two ways of legumin-precursor processing in conifers. Characterization and evolutionary relationships of Metasequoia cDNAs representing two divergent legumin gene subfamilies.

PubMed

Häger, K P; Wind, C

1997-06-15

Subunit monomers and oligomers of crystalloid-type legumins are major components of SDS-soluble fractions from Metasequoia glyptostroboides (Dawn redwood, Taxodiaceae) seed proteins. The subunits are made up of disulfide linked alpha-polypeptides and beta-polypeptides with molecular masses of 33 kDa and 23-25 kDa, respectively. Unusually for legumins, those from Metasequoia are glycosylated and the carbohydrate moieties are residing in the C-terminal region of the respective beta-polypeptides. A Metasequoia endosperm cDNA library has been constructed and legumin-encoding transcripts representing two divergent gene subfamilies have been characterized. Intersubfamily comparisons reveal 75% identity at the amino acid level and the values range from 53-35% when the legumin precursors deduced were compared with those from angiosperms. The predicted sequences together with data from amino acid sequencing prove that post-translational processing of Metasequoia prolegumins is directed to two different processing sites, each of them specific for one of the legumin subfamilies. The sites involved differ in their relative position and in the junction to be cleaved: Metasequoia legumin precursors MgLeg18 and MgLeg26 contain the conventional post-translational Asn-Gly processing site, which is generally regarded as highly conserved. In contrast, the MgLeg4 precursor is lacking this site and post-translational cleavage is directed to an unusual Asn-Thr processing site located in its hypervariable region, causing N-terminal extension of the beta-polypeptide relative to those hitherto known. Evidence is given that the unusual variant of processing also occurs in other conifers. Phylogenetic analysis reveals the precursors concerned as representatives of a distinct legumin subfamily, originating from duplication of an ancestral gene prior to or at the beginning of Taxodiaceae diversification.

Expression of A-type K channel alpha subunits Kv 4.2 and Kv 4.3 in rat spinal lamina II excitatory interneurons and colocalization with pain-modulating molecules.

PubMed

Huang, Hsin-Yi; Cheng, Jen-Kun; Shih, Yang-Hsin; Chen, Pei-Hsuan; Wang, Chin-Lin; Tsaur, Meei-Ling

2005-09-01

Voltage-gated K(+) channel alpha subunits Kv 4.2 and Kv 4.3 are the major contributors of somatodendritic A-type K(+) currents in many CNS neurons. A recent hypothesis suggests that Kv 4 subunits may be involved in pain modulation in dorsal horn neurons. However, whether Kv 4 subunits are expressed in dorsal horn neurons remains unknown. Using immunohistochemistry, we found that Kv 4.2 and Kv 4.3 immunoreactivity was concentrated in the superficial dorsal horn, mainly in lamina II. Both Kv 4.2 and Kv 4.3 appeared on many rostrocaudally orientated dendrites, whereas Kv 4.3 could be also detected from certain neuronal somata. Kv 4.3(+) neurons were a subset of excitatory inerneurons with calretinin(+)/calbindin(-)/PKCgamma(-) markers, and a fraction of them expressed micro-opioid receptors. Kv 4.3(+) neurons also expressed ERK 2 and mGluR 5, which are molecules related to the induction of central sensitization, a mechanism mediating nociceptive plasticity. Together with the expression of Kv 4.3 in VR 1(+) DRG neurons, our data suggest that Kv C4 subunits could be involved in pain modulation.

Intrasteric control of AMPK via the gamma1 subunit AMP allosteric regulatory site.

PubMed

Adams, Julian; Chen, Zhi-Ping; Van Denderen, Bryce J W; Morton, Craig J; Parker, Michael W; Witters, Lee A; Stapleton, David; Kemp, Bruce E

2004-01-01

AMP-activated protein kinase (AMPK) is a alphabetagamma heterotrimer that is activated in response to both hormones and intracellular metabolic stress signals. AMPK is regulated by phosphorylation on the alpha subunit and by AMP allosteric control previously thought to be mediated by both alpha and gamma subunits. Here we present evidence that adjacent gamma subunit pairs of CBS repeat sequences (after Cystathionine Beta Synthase) form an AMP binding site related to, but distinct from the classical AMP binding site in phosphorylase, that can also bind ATP. The AMP binding site of the gamma(1) CBS1/CBS2 pair, modeled on the structures of the CBS sequences present in the inosine monophosphate dehydrogenase crystal structure, contains three arginine residues 70, 152, and 171 and His151. The yeast gamma homolog, snf4 contains a His151Gly substitution, and when this is introduced into gamma(1), AMP allosteric control is substantially lost and explains why the yeast snf1p/snf4p complex is insensitive to AMP. Arg70 in gamma(1) corresponds to the site of mutation in human gamma(2) and pig gamma(3) genes previously identified to cause an unusual cardiac phenotype and glycogen storage disease, respectively. Mutation of any of AMP binding site Arg residues to Gln substantially abolishes AMP allosteric control in expressed AMPK holoenzyme. The Arg/Gln mutations also suppress the previously described inhibitory properties of ATP and render the enzyme constitutively active. We propose that ATP acts as an intrasteric inhibitor by bridging the alpha and gamma subunits and that AMP functions to derepress AMPK activity.

Human endomembrane H+ pump strongly resembles the ATP-synthetase of Archaebacteria.

PubMed Central

Südhof, T C; Fried, V A; Stone, D K; Johnston, P A; Xie, X S

1989-01-01

Preparations of mammalian H+ pumps that acidify intracellular vesicles contain eight or nine polypeptides, ranging in size from 116 to 17 kDa. Biochemical analysis indicates that the 70- and 58-kDa polypeptides are subunits critical for ATP hydrolysis. The amino acid sequences of the major catalytic subunits (58 and 70 kDa) of the endomembrane H+ pump are unknown from animal cells. We report here the complete sequence of the 58-kDa subunit derived from a human kidney cDNA clone and partial sequences of the 70- and 58-kDa subunits purified from clathrin-coated vesicles of bovine brain. The amino acid sequences of both proteins strongly resemble the sequences of the corresponding subunits of the vacuolar H+ pumps of Archaebacteria, plants, and fungi. The archaebacterial enzyme is believed to use a H+ gradient to synthesize ATP. Thus, a common ancestral protein has given rise to a H+ pump that synthesizes ATP in one organism and hydrolyzes it in another and is highly conserved from prokaryotes to humans. The same pump appears to mediate the acidification of intracellular organelles, including coated vesicles, lysosomes, and secretory granules, as well as extracellular fluids such as urine. PMID:2527371

Relative changes in the abundance of branchial Na(+)/K(+)-ATPase alpha-isoform-like proteins in marine euryhaline milkfish (Chanos chanos) acclimated to environments of different salinities.

PubMed

Tang, Cheng-Hao; Chiu, Yu-Huei; Tsai, Shu-Chuan; Lee, Tsung-Han

2009-08-01

Previous studies revealed that upon salinity challenge, milkfish (Chanos chanos), the euryhaline teleost, exhibited adaptive changes in branchial Na(+)/K(+)-ATPase (NKA) activity with different Na(+) and K(+) affinities. Since alteration of activity and ion-affinity may be influenced by changes in different isoforms of NKA alpha-subunit (i.e., the catalytic subunit), it is, thus, intriguing to compare the patterns of protein abundance of three major NKA alpha-isoform-like proteins (i.e., alpha1, alpha2, and alpha3) in the gills of euryhaline milkfish following salinity challenge. The protein abundance of three NKA alpha-isoform-like proteins in gills of milkfish reared in seawater (SW), fresh water (FW), as well as hypersaline water (HSW, 60 per thousand) were analyzed by immunoblotting. In the acclimation experiments, the SW group revealed significantly higher levels of NKA alpha1- and alpha3-like proteins than the FW or HSW group. Time-course experiments on milkfish that were transferred from SW to HSW revealed the abundance of branchial NKA alpha1-like and alpha3-like proteins decreased significantly after 96 and 12 hr, respectively, and no significant difference was found in NKA alpha2-like protein. Furthermore, when fish were transferred from SW to FW, the amounts of NKA alpha1- and alpha3-like proteins was significantly decreased after 96 hr. Taken together, acute and chronic changes in the abundance of branchial NKA alpha1- and alpha3-like proteins may fulfill the requirements of altering NKA activity with different Na(+) or K(+) affinity for euryhaline milkfish acclimated to environments of various salinities. 2009 Wiley-Liss, Inc.

Teaching Glycoproteins with a Classical Paper: Knowledge and Methods in the Course of an Exciting Discovery--The story of Discovering HK-ATPase [Beta]-Subunit

ERIC Educational Resources Information Center

Zhu, Lixin

2008-01-01

To integrate research into the teaching of glycoproteins, the story of discovering hydrogen-potassium ATPase (HK-ATPase) [beta] subunit is presented in a way covering all the important teaching points. The interaction between the HK-ATPase [alpha] subunit and a glycoprotein of 60-80 kDa was demonstrated to support the existence of the [beta]…

Effects of preventing O-glycosylation on the secretion of human chorionic gonadotropin in Chinese hamster ovary cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matzuk, M.M.; Krieger, M.; Corless, C.L.

1987-09-01

Human chorionic gonadotropin (hCG) is a member of a family of heterodimeric glycoprotein hormones that have a common ..cap alpha.. subunit but differ in their hormone-specific ..beta..-subunits. The ..beta.. subunit of hCG (hCG..beta..) is unique among the ..beta.. subunits in that it contains four mucin-like O-linked oligosaccharides attached to a carboxyl-terminal extension. To study the effects of O-glycosylation on the secretion and assembly of hCG, expression vectors containing either hCG..beta.. gene alone or together with the hCG..cap alpha.. gene were transfected into a mutant Chinese hamster ovary cell line, 1d1D, which exhibits a reversible defect in O-glycosylation. The results revealmore » that hCG..beta.. can be secreted normally in the absence of its O-linked oligosaccharides. hCG..beta.. devoid of O-linked carbohydrate can also combine efficiently with hCG..cap alpha.. and be secreted as an intact dimer. The authors conclude that in Chinese hamster ovary cells, the hCG..beta.. O-linked chains play no role in the assembly and secretion of hCG. The normal and O-linked oligosaccharide-deficient forms of hCG secreted by these cells should prove useful in examining the role of O-linked chains on the biological function of hCG.« less

The human interleukin-1 alpha gene is located on the long arm of chromosome 2 at band q13.

PubMed

Lafage, M; Maroc, N; Dubreuil, P; de Waal Malefijt, R; Pébusque, M J; Carcassonne, Y; Mannoni, P

1989-01-01

Interleukin-1 alpha (IL-1 alpha) and interleukin-1 beta (IL-1 beta) are two biochemically distinct, but distantly related, polypeptidic cytokines that play a key role in inflammation, immunologic reactions, and tissue repair. Recently, it has been shown that IL-1 alpha is identical to hematopoietin 1, which was described as a hematopoietic growth factor acting on early progenitor cells in synergy with other hematopoietic growth factors. In this report we discuss our use of in situ hybridization on human prometaphase cells with a human IL-1 alpha cDNA probe to localize the human IL-1 alpha gene on the proximal part of the long arm of chromosome 2 at band q13, in the same chromosomal region as the IL-1 beta gene.

The alpha-spectrin gene is on chromosome 1 in mouse and man.

PubMed Central

Huebner, K; Palumbo, A P; Isobe, M; Kozak, C A; Monaco, S; Rovera, G; Croce, C M; Curtis, P J

1985-01-01

By using alpha-spectrin cDNA clones of murine and human origin and somatic cell hybrids segregating either mouse or human chromosomes, the gene for alpha-spectrin has been mapped to chromosome 1 in both species. This assignment of the mouse alpha-spectrin gene to mouse chromosome 1 by DNA hybridization strengthens the previous identification of the alpha-spectrin locus in mouse with the sph locus, which previously was mapped by linkage analysis to mouse chromosome 1, distal to the Pep-3 locus. By in situ hybridization to human metaphase chromosomes, the human alpha-spectrin gene has been localized to 1q22-1q25; interestingly, the locus for a non-Rh-linked form of elliptocytosis has been provisionally mapped to band 1q2 by family linkage studies. Images PMID:2987946

Purification of an eight subunit RNA polymerase I complex in Trypanosoma brucei.

PubMed

Nguyen, Tu N; Schimanski, Bernd; Zahn, André; Klumpp, Birgit; Günzl, Arthur

2006-09-01

Trypanosoma brucei harbors a unique multifunctional RNA polymerase (pol) I which transcribes, in addition to ribosomal RNA genes, the gene units encoding the major cell surface antigens variant surface glycoprotein and procyclin. In consequence, this RNA pol I is recruited to three structurally different types of promoters and sequestered to two distinct nuclear locations, namely the nucleolus and the expression site body. This versatility may require parasite-specific protein-protein interactions, subunits or subunit domains. Thus far, data mining of trypanosomatid genomes have revealed 13 potential RNA pol I subunits which include two paralogous sets of RPB5, RPB6, and RPB10. Here, we analyzed a cDNA library prepared from procyclic insect form T. brucei and found that all 13 candidate subunits are co-expressed. Moreover, we PTP-tagged the largest subunit TbRPA1, tandem affinity-purified the enzyme complex to homogeneity, and determined its subunit composition. In addition to the already known subunits RPA1, RPA2, RPC40, 1RPB5, and RPA12, the complex contained RPC19, RPB8, and 1RPB10. Finally, to evaluate the absence of RPB6 in our purifications, we used a combination of epitope-tagging and reciprocal coimmunoprecipitation to demonstrate that 1RPB6 but not 2RPB6 binds to RNA pol I albeit in an unstable manner. Collectively, our data strongly suggest that T. brucei RNA pol I binds a distinct set of the RPB5, RPB6, and RPB10 paralogs.

Differential expression of extracellular matrix molecules and the alpha 6-integrins in the normal and neoplastic prostate.

PubMed Central

Knox, J. D.; Cress, A. E.; Clark, V.; Manriquez, L.; Affinito, K. S.; Dalkin, B. L.; Nagle, R. B.

1994-01-01

The epithelial basal lamina composition and integrin expression profile of normal and neoplastic human prostate was characterized using immunohistochemical analysis of frozen samples. The major components of the basal lamina surrounding normal acini were laminin, type IV collagen, entactin, and type VII collagen with variable amounts of tenascin. The basal lamina of neoplastic acini had a similar composition, except for the loss of type VII collagen, which was observed in all grades of carcinoma. The basal cells of the normal prostate express the alpha 6-, beta 1-, and beta 4-integrin subunits, suggesting that both the alpha 6 beta 1- and alpha 6 beta 4-integrin complexes are formed. In prostate carcinoma there is a complete loss of beta 4 expression and the alpha 6- and beta 1-integrin subunits, which are restricted to the basal and basal lateral surfaces of basal cells, are distributed diffusely throughout the cytoplasmic membrane. The differential expression of type VII collagen and beta 4 are discussed in relationship to their possible role in tumor progression. Images Figure 1 Figure 2 Figure 3 PMID:8030747

Targeted deletion of the GABRA2 gene encoding alpha2-subunits of GABA(A) receptors facilitates performance of a conditioned emotional response, and abolishes anxiolytic effects of benzodiazepines and barbiturates.

PubMed

Dixon, C I; Rosahl, T W; Stephens, D N

2008-07-01

Mice with point-mutated alpha2 GABA(A) receptor subunits (rendering them diazepam insensitive) are resistant to the anxiolytic-like effects of benzodiazepines (BZs) in the conditioned emotional response (CER) test, but show normal anxiolytic effects of a barbiturate. We investigated the consequence of deleting the alpha2-subunit on acquisition of the CER with increasing intensity of footshock, and on the anxiolytic efficacy of a benzodiazepine, diazepam, and a barbiturate, pentobarbital. alpha2 knockout (KO) and wildtype (WT) mice were trained in a conditioned emotional response (CER) task, in which lever pressing for food on a variable interval (VI) schedule was suppressed during the presentation of a compound light/tone conditioned stimulus (CS+) that predicted footshock. The ability of diazepam and of pentobarbital to reduce suppression during the CS+ was interpreted as an anxiolytic response. There were no differences between the genotypes in shock sensitivity, as assessed by their flinch responses to increasing levels of shock. However, alpha2 KO mice showed a greater suppression of lever pressing than WT littermates in the presence of a compound cue signalling footshock. Diazepam (0, 0.5, 1 and 2 mg/kg) induced a dose-dependent anxiolytic-like effect in WT mice but no such effect was seen in KO mice. Similarly, although pentobarbital (20 mg/kg) reduced the ability of the CS+ to reduce lever pressing rates in WT mice, this effect was not seen in the KO. These findings suggest that alpha2-containing GABA(A) receptors mediate the anxiolytic effects of barbiturates, as well as benzodiazepines, and that they may be involved in neuronal circuits underlying conditioned anxiety.

Differential roles of the glycogen-binding domains of beta subunits in regulation of the Snf1 kinase complex.

PubMed

Mangat, Simmanjeet; Chandrashekarappa, Dakshayini; McCartney, Rhonda R; Elbing, Karin; Schmidt, Martin C

2010-01-01

Members of the AMP-activated protein kinase family, including the Snf1 kinase of Saccharomyces cerevisiae, are activated under conditions of nutrient stress. AMP-activated protein kinases are heterotrimeric complexes composed of a catalytic alpha subunit and regulatory beta and gamma subunits. In this study, the role of the beta subunits in the regulation of Snf1 activity was examined. Yeasts express three isoforms of the AMP-activated protein kinase consisting of Snf1 (alpha), Snf4 (gamma), and one of three alternative beta subunits, either Sip1, Sip2, or Gal83. The Gal83 isoform of the Snf1 complex is the most abundant and was analyzed in the greatest detail. All three beta subunits contain a conserved domain referred to as the glycogen-binding domain. The deletion of this domain from Gal83 results in a deregulation of the Snf1 kinase, as judged by a constitutive activity independent of glucose availability. In contrast, the deletion of this homologous domain from the Sip1 and Sip2 subunits had little effect on Snf1 kinase regulation. Therefore, the different Snf1 kinase isoforms are regulated through distinct mechanisms, which may contribute to their specialized roles in different stress response pathways. In addition, the beta subunits are subjected to phosphorylation. The responsible kinases were identified as being Snf1 and casein kinase II. The significance of the phosphorylation is unclear since the deletion of the region containing the phosphorylation sites in Gal83 had little effect on the regulation of Snf1 in response to glucose limitation.

Both α and β Subunits of Human Choriogonadotropin Photoaffinity Label the Hormone Receptor

NASA Astrophysics Data System (ADS)

Ji, Inhae; Ji, Tae H.

1981-09-01

It has been shown that a photoactivable derivative of human choriogonadotropin (hCG) labels the lutropin receptor on porcine granulosa cells [Ji, I. & Ji, T. H. (1980) Proc. Natl. Acad. Sci. USA 77, 7167-7170]. In an attempt to identify which of the hCG subunits labeled the receptor, three sets of different hCG derivatives were prepared. In the first set, hCG was coupled to the N-hydroxysuccinimide ester of 4-azidobenzoylglycine and radioiodinated. In the second set, only one of the subunits was radioiodinated, but both subunits were allowed to react with the reagent. In the third set, both the reagent and [125I]iodine were coupled to only one of the subunits. The binding activity of each hormone derivative was comparable to that of 125I-labeled hCG. After binding of these hormone derivatives to the granulosa cell surface, they were photolyzed. After solubilization, autoradiographs of sodium dodecyl sulfate/polyacrylamide gels of each sample revealed a number of labeled bands; the hCG derivatives containing 125I-labeled alpha subunit produced four bands (molecular weights 120,000 +/- 6,000, 96,000 +/- 5,000, 76,000 +/- 4,000, and 73,000 +/- 4,000) and those containing 125I-labeled beta subunit produced three bands (molecular weights 106,000 +/- 6,000, 88,000 +/- 5,000, and 83,000 +/- 4,000). Results were the same when the hormone-receptor complexes were solubilized in 0.5% Triton X-100 and then photolyzed or when the hormone was derivatized with a family of reagents having arms of various lengths. We conclude that both the alpha subunit and the beta subunit of hCG photoaffinity labeled certain membrane polypeptides and that these polypeptides are related to the hormone receptor.

Effect of alternative glycosylation on insulin receptor processing.

PubMed

Hwang, J B; Frost, S C

1999-08-06

The mature insulin receptor is a cell surface heterotetrameric glycoprotein composed of two alpha- and two beta-subunits. In 3T3-L1 adipocytes as in other cell types, the receptor is synthesized as a single polypeptide consisting of uncleaved alpha- and beta-subunits, migrating as a 190-kDa glycoprotein. To examine the importance of N-linked glycosylation on insulin receptor processing, we have used glucose deprivation as a tool to alter protein glycosylation. Western blot analysis shows that glucose deprivation led to a time-dependent accumulation of an alternative proreceptor of 170 kDa in a subcellular fraction consistent with endoplasmic reticulum localization. Co-precipitation assays provide evidence that the alternative proreceptor bound GRP78, an endoplasmic reticulum molecular chaperone. N-Glycosidase F treatment shows that the alternative proreceptor contained N-linked oligosaccharides. Yet, endoglycosidase H insensitivity indicates an aberrant oligosaccharide structure. Using pulse-chase methodology, we show that the synthetic rate was similar between the normal and alternative proreceptor. However, the normal proreceptor was processed into alpha- and beta-subunits (t((1)/(2)) = 1.3 +/- 0.6 h), while the alternative proreceptor was degraded (t((1)/(2)) = 5.1 +/- 0.6 h). Upon refeeding cells that were initially deprived of glucose, the alternative proreceptor was processed to a higher molecular weight form and gained sensitivity to endoglycosidase H. This "intermediate" form of the proreceptor was also degraded, although a small fraction escaped degradation, resulting in cleavage to the alpha- and beta-subunits. These data provide evidence for the first time that glucose deprivation leads to the accumulation of an alternative proreceptor, which can be post-translationally glycosylated with the readdition of glucose inducing both accelerated degradation and maturation.

KChIPs and Kv4 alpha subunits as integral components of A-type potassium channels in mammalian brain.

PubMed

Rhodes, Kenneth J; Carroll, Karen I; Sung, M Amy; Doliveira, Lisa C; Monaghan, Michael M; Burke, Sharon L; Strassle, Brian W; Buchwalder, Lynn; Menegola, Milena; Cao, Jie; An, W Frank; Trimmer, James S

2004-09-08

Voltage-gated potassium (Kv) channels from the Kv4, or Shal-related, gene family underlie a major component of the A-type potassium current in mammalian central neurons. We recently identified a family of calcium-binding proteins, termed KChIPs (Kv channel interacting proteins), that bind to the cytoplasmic N termini of Kv4 family alpha subunits and modulate their surface density, inactivation kinetics, and rate of recovery from inactivation (An et al., 2000). Here, we used single and double-label immunohistochemistry, together with circumscribed lesions and coimmunoprecipitation analyses, to examine the regional and subcellular distribution of KChIPs1-4 and Kv4 family alpha subunits in adult rat brain. Immunohistochemical staining using KChIP-specific monoclonal antibodies revealed that the KChIP polypeptides are concentrated in neuronal somata and dendrites where their cellular and subcellular distribution overlaps, in an isoform-specific manner, with that of Kv4.2 and Kv4.3. For example, immunoreactivity for KChIP1 and Kv4.3 is concentrated in the somata and dendrites of hippocampal, striatal, and neocortical interneurons. Immunoreactivity for KChIP2, KChIP4, and Kv4.2 is concentrated in the apical and basal dendrites of hippocampal and neocortical pyramidal cells. Double-label immunofluorescence labeling revealed that throughout the forebrain, KChIP2 and KChIP4 are frequently colocalized with Kv4.2, whereas in cortical, hippocampal, and striatal interneurons, KChIP1 is frequently colocalized with Kv4.3. Coimmunoprecipitation analyses confirmed that all KChIPs coassociate with Kv4 alpha subunits in brain membranes, indicating that KChIPs 1-4 are integral components of native A-type Kv channel complexes and are likely to play a major role as modulators of somatodendritic excitability.

Regulation of nicotinic acetylcholine receptor phosphorylation in rat myotubes by forskolin and cAMP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miles, K.; Anthony, D.T.; Rubin, L.L.

1987-09-01

The nicotinic acetylcholine receptor (Ac-ChoR) from rat myotubes prelabeled in culture with (/sup 32/P)orthophosphate was isolated by acetylcholine affinity chromatography followed by immunoaffinity chromatography. Under basal conditions, the nicotinic AcChoR was shown to be phosphorylated in situ on the ..beta.. and delta subunits. Regulation of AcChoR phosphorylation by cAMP-dependent protein kinase was explored by the addition of forskolin or cAMP analogues to prelabeled cell cultures. Forskolin, an activator of adenylate cyclase, stimulated the phosphorylation of the delta subunit 20-fold over basal phosphorylation and induced phosphorylation of the ..cap alpha.. subunit. The effect of forskolin was dose dependent with a half-maximalmore » response at 8 ..mu..M in the presence of 35 ..mu..M Ro 20-1724, a phosphodiesterase inhibitor. Stimulation of delta subunit phosphorylation was almost maximal within 5 min, whereas stimulation of ..cap alpha.. subunit phosphorylation was not maximal until 45 min after forskolin treatment. Stimulation of AcChoR phosphorylation by 8-benzylthioadenosine 3',5'-cyclic monophosphate was identical to that obtained by forskolin. Two-dimensional thermolytic phosphopeptide maps of the delta subunit revealed a single major phosphopeptide. These results correlate closely with the observed effects of forskolin on AcChoR desensitization in muscle and suggest that cAMP-dependent phosphorylation of the delta subunit increases the rate of AcChoR desensitization in rat myotubes.« less

The α6 nicotinic acetylcholine receptor subunit of Frankliniella occidentalis is not involved in resistance to spinosad.

PubMed

Hou, Wenjie; Liu, Qiulei; Tian, Lixia; Wu, Qingjun; Zhang, Youjun; Xie, Wen; Wang, Shaoli; Miguel, Keri San; Funderburk, Joe; Scott, Jeffrey G

2014-05-01

Insects evolve resistance which constrains the sustainable use of insecticides. Spinosyns, a class of environmentally-friendly macrolide insecticides, is not an exception. The mode of inheritance and the mechanisms of resistance to spinosad (the most common spinosyn insecticide) in Frankliniella occidentalis (Western flower thrips, WFT) were investigated in this study. Resistance (170,000-fold) was autosomal and completely recessive. Recent studies showed that deletion of the nicotinic acetylcholine receptor α6 subunit gene resulted in strains of Drosophila melanogaster, Plutella xylostella and Bactrocera dorsalis that are resistant to spinosad, indicating that nAChRα6 subunit maybe important for the toxic action of this insecticide. Conversely, a G275E mutation of this subunit in F. occidentalis was recently proposed as the mechanism of resistance to spinosad. We cloned and characterized nAChRα6 from three susceptible and two spinosad resistant strains from China and the USA. The Foα6 cDNA is 1873bp and the open reading frame is 1458bp which encodes 485 amino acid residues with a predicted molecular weight of 53.5-kDa, the 5' and 3' UTRs are 121 and 294bp, respectively. There was no difference in the cDNA sequence between the resistant and susceptible thrips, suggesting the G275E mutation does not confer resistance in these populations. Ten isoforms of Foα6, arising from alternative splicing, were isolated and did not differ between the spinosad-susceptible and resistant strains. Quantitative real time PCR analysis showed Foα6 was highly expressed in the first instar larva, pupa and adult, and the expression levels were 3.67, 2.47, 1.38 times that of the second instar larva. The expression level was not significantly different between the susceptible and resistant strains. These results indicate that Foα6 is not involved in resistance to spinosad in F. occidentalis from China and the USA. Copyright © 2014 Elsevier Inc. All rights reserved.

Complex alternative splicing of acetylcholinesterase transcripts in Torpedo electric organ; primary structure of the precursor of the glycolipid-anchored dimeric form.

PubMed Central

Sikorav, J L; Duval, N; Anselmet, A; Bon, S; Krejci, E; Legay, C; Osterlund, M; Reimund, B; Massoulié, J

1988-01-01

In this paper, we show the existence of alternative splicing in the 3' region of the coding sequence of Torpedo acetylcholinesterase (AChE). We describe two cDNA structures which both diverge from the previously described coding sequence of the catalytic subunit of asymmetric (A) forms (Schumacher et al., 1986; Sikorav et al., 1987). They both contain a coding sequence followed by a non-coding sequence and a poly(A) stretch. Both of these structures were shown to exist in poly(A)+ RNAs, by S1 mapping experiments. The divergent region encoded by the first sequence corresponds to the precursor of the globular dimeric form (G2a), since it contains the expected C-terminal amino acids, Ala-Cys. These amino acids are followed by a 29 amino acid extension which contains a hydrophobic segment and must be replaced by a glycolipid in the mature protein. Analyses of intact G2a AChE showed that the common domain of the protein contains intersubunit disulphide bonds. The divergent region of the second type of cDNA consists of an adjacent genomic sequence, which is removed as an intron in A and Ga mRNAs, but may encode a distinct, less abundant catalytic subunit. The structures of the cDNA clones indicate that they are derived from minor mRNAs, shorter than the three major transcripts which have been described previously (14.5, 10.5 and 5.5 kb). Oligonucleotide probes specific for the asymmetric and globular terminal regions hybridize with the three major transcripts, indicating that their size is determined by 3'-untranslated regions which are not related to the differential splicing leading to A and Ga forms. Images PMID:3181125

Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

PubMed Central

Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.

1994-01-01

The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934

Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

PubMed

Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L

1994-05-01

The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.

Molecular cloning of a cDNA encoding the glycoprotein of hen oviduct microsomal signal peptidase.

PubMed Central

Newsome, A L; McLean, J W; Lively, M O

1992-01-01

Detergent-solubilized hen oviduct signal peptidase has been characterized previously as an apparent complex of a 19 kDa protein and a 23 kDa glycoprotein (GP23) [Baker & Lively (1987) Biochemistry 26, 8561-8567]. A cDNA clone encoding GP23 from a chicken oviduct lambda gt11 cDNA library has now been characterized. The cDNA encodes a protein of 180 amino acid residues with a single site for asparagine-linked glycosylation that has been directly identified by amino acid sequence analysis of a tryptic-digest peptide containing the glycosylated site. Immunoblot analysis reveals cross-reactivity with a dog pancreas protein. Comparison of the deduced amino acid sequence of GP23 with the 22/23 kDa glycoprotein of dog microsomal signal peptidase [Shelness, Kanwar & Blobel (1988) J. Biol. Chem. 263, 17063-17070], one of five proteins associated with this enzyme, reveals that the amino acid sequences are 90% identical. Thus the signal peptidase glycoprotein is as highly conserved as the sequences of cytochromes c and b from these same species and is likely to be found in a similar form in many, if not all, vertebrate species. The data also show conclusively that the dog and avian signal peptidases have at least one protein subunit in common. Images Fig. 1. PMID:1546959

Isolation and Characterization of the PKAr Gene From a Plant Pathogen, Curvularia lunata.

PubMed

Liu, T; Ma, B C; Hou, J M; Zuo, Y H

2014-09-01

By using EST database from a full-length cDNA library of Curvularia lunata, we have isolated a 2.9 kb cDNA, termed PKAr. An ORF of 1,383 bp encoding a polypeptide of 460 amino acids with molecular weight 50.1 kDa, (GeneBank Acc. No. KF675744) was cloned. The deduced amino acid sequence of the PKAr shows 90 and 88 % identity with cAMP-dependent protein kinase A regulatory subunit from Alternaria alternate and Pyrenophora tritici-repentis Pt-1C-BFP, respectively. Database analysis revealed that the deduced amino acid sequence of PKAr shares considerable similarity with that of PKA regulatory subunits in other organisms, particularly in the conserved regions. No introns were identified within the 1,383 bp of ORF compared with PKAr genomic DNA sequence. Southern blot indicated that PKAr existed as a single copy per genome. The mRNA expression level of PKAr in different development stages were demonstrated using real-time quantitative PCR. The results showed that the level of PKAr expression was highest in vegetative growth mycelium, which indicated it might play an important role in the vegetative growth of C. lunata. These results provided a fundamental supporting research on the function of PKAr in plant pathogen, C. lunata.

Intron loss from the NADH dehydrogenase subunit 4 gene of lettuce mitochondrial DNA: evidence for homologous recombination of a cDNA intermediate.

PubMed

Geiss, K T; Abbas, G M; Makaroff, C A

1994-04-01

The mitochondrial gene coding for subunit 4 of the NADH dehydrogenase complex I (nad4) has been isolated and characterized from lettuce, Lactuca sativa. Analysis of nad4 genes in a number of plants by Southern hybridization had previously suggested that the intron content varied between species. Characterization of the lettuce gene confirms this observation. Lettuce nad4 contains two exons and one group IIA intron, whereas previously sequenced nad4 genes from turnip and wheat contain three group IIA introns. Northern analysis identified a transcript of 1600 nucleotides, which represents the mature nad4 mRNA and a primary transcript of 3200 nucleotides. Sequence analysis of lettuce and turnip nad4 cDNAs was used to confirm the intron/exon border sequences and to examine RNA editing patterns. Editing is observed at the 5' and 3' ends of the lettuce transcript, but is absent from sequences that correspond to exons two, three and the 5' end of exon four in turnip and wheat. In contrast, turnip transcripts are highly edited in this region, suggesting that homologous recombination of an edited and spliced cDNA intermediate was involved in the loss of introns two and three from an ancestral lettuce nad4 gene.

The 60 kDa heat shock proteins in the hyperthermophilic archaeon Sulfolobus shibatae.

PubMed

Kagawa, H K; Osipiuk, J; Maltsev, N; Overbeek, R; Quaite-Randall, E; Joachimiak, A; Trent, J D

1995-11-10

One of the most abundant proteins in the hyperthermophilic archaeon Sulfolobus shibatae is the 59 kDa heat shock protein (TF55) that is believed to form a homo-oligomeric double ring complex structurally similar to the bacterial chaperonins. We discovered a second protein subunit in the S. shibatae ring complex (referred to as alpha) that is stoichiometric with TF55 (renamed beta). The gene and flanking regions of alpha were cloned and sequenced and its inferred amino acid sequence has 54.4% identity and 74.4% similarity to beta. Transcription start sites for both alpha and beta were mapped and three potential transcription regulatory regions were identified. Northern analyses of cultures shifted from normal growth temperatures (70 to 75 degrees C) to heat shock temperatures (85 to 90 degrees C) indicated that the levels of alpha and beta mRNAs increased during heat shock, but at all temperatures their relative proportions remained constant. Monitoring protein synthesis by autoradiography of total proteins from cultures pulse labeled with L(-)[35S]methionine at normal and heat shock temperatures indicated significant increases in alpha and beta synthesis during heat shock. Under extreme heat shock conditions (> or = 90 degrees C) alpha and beta appeared to be the only two proteins synthesized. The purified alpha and beta subunits combined to form high molecular mass complexes with similar mobilities on native polyacrylamide gels to the complexes isolated directly from cells. Equal proportions of the two subunits gave the greatest yield of the complex, which we refer to as a "rosettasome". It is argued that the rosettasome consists of two homo-oligomeric rings; one of alpha and the other of beta. Polyclonal antibodies against alpha and beta from S. shibatae cross-reacted with proteins of similar molecular mass in 10 out of the 17 archaeal species tested, suggesting that the two rosettasome proteins are highly conserved among the archaea. The archaeal sequences were aligned with bacterial and eukaryotic chaperonins to generate a phylogenetic tree. The tree reveals the close relationship between the archaeal rosettasomes and the eukaryotic TCP1 protein family and the distant relationship to the bacterial GroEL/HSP60 proteins.

NMR Studies of the C-Terminus of alpha4 Reveal Possible Mechanism of Its Interaction with MID1 and Protein Phosphatase 2A

PubMed Central

Du, Haijuan; Massiah, Michael A.

2011-01-01

Alpha4 is a regulatory subunit of the protein phosphatase family of enzymes and plays an essential role in regulating the catalytic subunit of PP2A (PP2Ac) within the rapamycin-sensitive signaling pathway. Alpha4 also interacts with MID1, a microtubule-associated ubiquitin E3 ligase that appears to regulate the function of PP2A. The C-terminal region of alpha4 plays a key role in the binding interaction of PP2Ac and MID1. Here we report on the solution structure of a 45-amino acid region derived from the C-terminus of alpha4 (alpha45) that binds tightly to MID1. In aqueous solution, alpha45 has properties of an intrinsically unstructured peptide although chemical shift index and dihedral angle estimation based on chemical shifts of backbone atoms indicate the presence of a transient α-helix. Alpha45 adopts a helix-turn-helix HEAT-like structure in 1% SDS micelles, which may mimic a negatively charged surface for which alpha45 could bind. Alpha45 binds tightly to the Bbox1 domain of MID1 in aqueous solution and adopts a structure consistent with the helix-turn-helix structure observed in 1% SDS. The structure of alpha45 reveals two distinct surfaces, one that can interact with a negatively charged surface, which is present on PP2A, and one that interacts with the Bbox1 domain of MID1. PMID:22194938

Tryptophan W207 in transducin T alpha is the fluorescence sensor of the G protein activation switch and is involved in the effector binding.

PubMed Central

Faurobert, E; Otto-Bruc, A; Chardin, P; Chabre, M

1993-01-01

We have produced a recombinant transducin alpha subunit (rT alpha) in sf9 cells, using a baculovirus system. Deletion of the myristoylation site near the N-terminal increased the solubility and allowed the purification of rT alpha. When reconstituted with excess T beta gamma on retinal membrane, rT alpha displayed functional characteristics of wild-type T alpha vis à vis its coupled receptor, rhodopsin and its effector, cGMP phosphodiesterase (PDE). We further mutated a tryptophan, W207, which is conserved in all G proteins and is suspected to elicit the fluorescence change correlated to their activation upon GDP/GTP exchange or aluminofluoride (AlFx) binding. [W207F]T alpha mutant displayed high affinity receptor binding and underwent a conformational switch upon receptor-catalysed GTP gamma S binding or upon AlFx binding, but this did not elicit any fluorescence change. Thus W207 is the only fluorescence sensor of the switch. Upon the switch the mutant remained unable to activate the PDE. To characterize better its effector-activating interaction we measured the affinity of [W207F]T alpha GDP-AlFx for PDE gamma, the effector subunit that binds most tightly to T alpha. [W207F]T alpha still bound in an activation-dependent way to PDE gamma, but with a 100-fold lower affinity than rT alpha. This suggests that W207 contributes to the G protein effector binding. Images PMID:8223434

Minoxidil specifically decreases the expression of lysine hydroxylase in cultured human skin fibroblasts.

PubMed Central

Hautala, T; Heikkinen, J; Kivirikko, K I; Myllylä, R

1992-01-01

The levels of lysine hydroxylase protein and the levels of the mRNAs for lysine hydroxylase and the alpha- and beta-subunits of proline 4-hydroxylase were measured in cultured human skin fibroblasts treated with 1 mM-minoxidil. The data demonstrate that minoxidil decreases the amount of lysine hydroxylase protein, this being due to a decrease in the level of lysine hydroxylase mRNA. The effect of minoxidil appears to be highly specific, as no changes were observed in the amounts of mRNAs for the alpha- and beta-subunits of proline 4-hydroxylase. Images Fig. 1. Fig. 2. Fig. 3. PMID:1314568

Modulation of A-type potassium channels by a family of calcium sensors.

PubMed

An, W F; Bowlby, M R; Betty, M; Cao, J; Ling, H P; Mendoza, G; Hinson, J W; Mattsson, K I; Strassle, B W; Trimmer, J S; Rhodes, K J

2000-02-03

In the brain and heart, rapidly inactivating (A-type) voltage-gated potassium (Kv) currents operate at subthreshold membrane potentials to control the excitability of neurons and cardiac myocytes. Although pore-forming alpha-subunits of the Kv4, or Shal-related, channel family form A-type currents in heterologous cells, these differ significantly from native A-type currents. Here we describe three Kv channel-interacting proteins (KChIPs) that bind to the cytoplasmic amino termini of Kv4 alpha-subunits. We find that expression of KChIP and Kv4 together reconstitutes several features of native A-type currents by modulating the density, inactivation kinetics and rate of recovery from inactivation of Kv4 channels in heterologous cells. All three KChIPs co-localize and co-immunoprecipitate with brain Kv4 alpha-subunits, and are thus integral components of native Kv4 channel complexes. The KChIPs have four EF-hand-like domains and bind calcium ions. As the activity and density of neuronal A-type currents tightly control responses to excitatory synaptic inputs, these KChIPs may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium.

N-Glycosylation of the alpha subunit does not influence trafficking or functional activity of the human organic solute transporter alpha/beta

PubMed Central

Soroka, Carol J; Xu, Shuhua; Mennone, Albert; Lam, Ping; Boyer, James L

2008-01-01

Background The organic solute transporter (OSTα-OSTβ) is a heteromeric transporter that is expressed on the basolateral membrane of epithelium in intestine, kidney, liver, testis and adrenal gland and facilitates efflux of bile acids and other steroid solutes. Both subunits are required for plasma membrane localization of the functional transporter but it is unclear how and where the subunits interact and whether glycosylation is required for functional activity. We sought to examine these questions for the human OSTα-OSTβ transporter using the human hepatoma cell line, HepG2, and COS7 cells transfected with constructs of human OSTα-FLAG and OSTβ-Myc. Results Tunicamycin treatment demonstrated that human OSTα is glycosylated. In COS7 cells Western blotting identified the unglycosylated form (~31 kD), the core precursor form (~35 kD), and the mature, complex glycoprotein (~40 kD). Immunofluorescence of both cells indicated that, in the presence of OSTβ, the alpha subunit could still be expressed on the plasma membrane after tunicamycin treatment. Furthermore, the functional uptake of 3H-estrone sulfate was unchanged in the absence of N-glycosylation. Co-immunoprecipitation indicates that the immature form of OSTα interact with OSTβ. However, immunoprecipitation of OSTβ using an anti-Myc antibody did not co-precipitate the mature, complex glycosylated form of OSTα, suggesting that the primary interaction occurs early in the biosynthetic pathway and may be transient. Conclusion In conclusion, human OSTα is a glycoprotein that requires interaction with OSTβ to reach the plasma membrane. However, glycosylation of OSTα is not necessary for interaction with the beta subunit or for membrane localization or function of the heteromeric transporter. PMID:18847488

YC-1 BINDING TO THE BETA SUBUNIT OF SOLUBLE GUANYLYL CYCLASE OVERCOMES ALLOSTERIC INHIBITION BY THE ALPHA SUBUNIT

PubMed Central

Purohit, Rahul; Fritz, Bradley G.; The, Juliana; Issaian, Aaron; Weichsel, Andrzej; David, Cynthia L.; Campbell, Eric; Hausrath, Andrew C.; Rassouli-Taylor, Leida; Garcin, Elsa D.; Gage, Matthew J.; Montfort, William R.

2014-01-01

Soluble guanylate cyclase (sGC) is a heterodimeric heme protein and the primary nitric oxide receptor. NO binding stimulates cyclase activity, leading to regulation of cardiovascular physiology and making sGC an attractive target for drug discovery. YC-1 and related compounds stimulate sGC both independently and synergistically with NO and CO binding; however, where the compounds bind and how they work remains unknown. Using linked-equilibria binding measurements, surface plasmon resonance, and domain truncations in Manduca sexta and bovine sGC, we demonstrate that YC-1 binds near or directly to the heme-containing domain of the beta subunit. In the absence of CO, YC-1 binds with Kd = 9–21 μM, depending on construct. In the presence of CO, these values decrease to 0.6–1.1 μM. Pfizer compound 25 bound ~10-fold weaker than YC-1 in the absence of CO whereas compound BAY 41–2272 bound particularly tightly in the presence of CO (Kd = 30–90 nM). Additionally, we found that CO binding is much weaker to heterodimeric sGC proteins (Kd = 50–100 μM) than to the isolated heme domain (Kd = 0.2 μM for Manduca beta H-NOX/PAS). YC-1 greatly enhanced CO binding to heterodimeric sGC, as expected (Kd = ~1 μM). These data indicate the alpha subunit induces a heme pocket conformation with lower affinity for CO and NO. YC-1 family compounds bind near the heme domain, overcoming the alpha subunit effect and inducing a heme pocket conformation with high affinity. We propose this high-affinity conformation is required for the full-length protein to achieve high catalytic activity. PMID:24328155

The presence of both negative and positive elements in the 5'-flanking sequence of the rat Na,K-ATPase alpha 3 subunit gene are required for brain expression in transgenic mice.

PubMed Central

Pathak, B G; Neumann, J C; Croyle, M L; Lingrel, J B

1994-01-01

The Na,K-ATPase is an integral plasma membrane protein consisting of alpha and beta subunits, each of which has discrete isoforms expressed in a tissue-specific manner. Of the three functional alpha isoform genes, the one encoding the alpha 3 isoform is the most tissue-restricted in its expression, being found primarily in the brain. To identify regions of the alpha 3 isoform gene that are involved in directing expression in the brain, a 1.6 kb 5'-flanking sequence was attached to a reporter gene, chloramphenicol acetyltransferase (CAT). The alpha 3-CAT chimeric gene construct was microinjected into fertilized mouse eggs, and transgenic mice were produced. Analysis of adult transgenic mice from different lines revealed that the transgene is expressed primarily in the brain. To further delineate regions that are needed for conferring expression in this tissue, systematic deletions of the 5'-flanking sequence of the alpha 3-CAT fusion constructs were made and analyzed, again using transgenic mice. The results from these analyses indicate that DNA sequences required for mediating brain-specific expression of the alpha 3 isoform gene are present within 210 bp upstream of the transcription initiation site. alpha 3-CAT promoter constructs containing scanning mutations in this region were also assayed in transgenic mice. These studies have identified both a functional neural-restrictive silencer element as well as a positively acting cis element. Images PMID:7984427

Three alpha-subunits of heterotrimeric G proteins and an adenylyl cyclase have distinct roles in fruiting body development in the homothallic fungus Sordaria macrospora.

PubMed

Kamerewerd, Jens; Jansson, Malin; Nowrousian, Minou; Pöggeler, Stefanie; Kück, Ulrich

2008-09-01

Sordaria macrospora, a self-fertile filamentous ascomycete, carries genes encoding three different alpha-subunits of heterotrimeric G proteins (gsa, G protein Sordaria alpha subunit). We generated knockout strains for all three gsa genes (Deltagsa1, Deltagsa2, and Deltagsa3) as well as all combinations of double mutants. Phenotypic analysis of single and double mutants showed that the genes for Galpha-subunits have distinct roles in the sexual life cycle. While single mutants show some reduction of fertility, double mutants Deltagsa1Deltagsa2 and Deltagsa1Deltagsa3 are completely sterile. To test whether the pheromone receptors PRE1 and PRE2 mediate signaling via distinct Galpha-subunits, two recently generated Deltapre strains were crossed with all Deltagsa strains. Analyses of the corresponding double mutants revealed that compared to GSA2, GSA1 is a more predominant regulator of a signal transduction cascade downstream of the pheromone receptors and that GSA3 is involved in another signaling pathway that also contributes to fruiting body development and fertility. We further isolated the gene encoding adenylyl cyclase (AC) (sac1) for construction of a knockout strain. Analyses of the three DeltagsaDeltasac1 double mutants and one Deltagsa2Deltagsa3Deltasac1 triple mutant indicate that SAC1 acts downstream of GSA3, parallel to a GSA1-GSA2-mediated signaling pathway. In addition, the function of STE12 and PRO41, two presumptive signaling components, was investigated in diverse double mutants lacking those developmental genes in combination with the gsa genes. This analysis was further completed by expression studies of the ste12 and pro41 transcripts in wild-type and mutant strains. From the sum of all our data, we propose a model for how different Galpha-subunits interact with pheromone receptors, adenylyl cyclase, and STE12 and thus cooperatively regulate sexual development in S. macrospora.

Crystal Structure of the MACPF Domain of Human Complement Protein C8[alpha] in Complex with the C8[gamma] Subunit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Slade, Daniel J.; Lovelace, Leslie L.; Chruszcz, Maksymilian

2010-03-04

Human C8 is one of five complement components (C5b, C6, C7, C8, and C9) that assemble on bacterial membranes to form a porelike structure referred to as the 'membrane attack complex' (MAC). C8 contains three genetically distinct subunits (C8{alpha}, C8{beta}, C8{gamma}) arranged as a disulfide-linked C8{alpha}-{gamma} dimer that is noncovalently associated with C8{beta}. C6, C7 C8{alpha}, C8{beta}, and C9 are homologous. All contain N- and C-terminal modules and an intervening 40-kDa segment referred to as the membrane attack complex/perforin (MACPF) domain. The C8{gamma} subunit is unrelated and belongs to the lipocalin family of proteins that display a {beta}-barrel fold andmore » generally bind small, hydrophobic ligands. Several hundred proteins with MACPF domains have been identified based on sequence similarity; however, the structure and function of most are unknown. Crystal structures of the secreted bacterial protein Plu-MACPF and the human C8{alpha} MACPF domain were recently reported and both display a fold similar to those of the bacterial pore-forming cholesterol-dependent cytolysins (CDCs). In the present study, we determined the crystal structure of the human C8{alpha} MACPF domain disulfide-linked to C8{gamma} ({alpha}MACPF-{gamma}) at 2.15 {angstrom} resolution. The {alpha}MACPF portion has the predicted CDC-like fold and shows two regions of interaction with C8{gamma}. One is in a previously characterized 19-residue insertion (indel) in C8{alpha} and fills the entrance to the putative C8{gamma} ligand-binding site. The second is a hydrophobic pocket that makes contact with residues on the side of the C8{gamma} {beta}-barrel. The latter interaction induces conformational changes in {alpha}MACPF that are likely important for C8 function. Also observed is structural conservation of the MACPF signature motif Y/W-G-T/S-H-F/Y-X{sub 6}-G-G in {alpha}MACPF and Plu-MACPF, and conservation of several key glycine residues known to be important for refolding and pore formation by CDCs.« less

Targeted overexpression of calcitonin in gonadotrophs of transgenic mice leads to chronic hypoprolactinemia.

PubMed

Yuan, Ren; Kulkarni, Trupti; Wei, Fu; Shah, Girish V

2005-01-14

It was previously shown that calcitonin-like pituitary peptide (pit-CT) is synthesized and secreted by gonadotrophs, and pit-CT inhibits PRL gene transcription and lactotroph cell proliferation. Present studies examined long-term consequences of pit-CT overexpression on the functioning of mouse anterior pituitary (AP) gland. Targeted overexpression of pit-CT in gonadotrophs of mouse pituitaries was achieved by generating mice overexpressing bovine luteinizing hormone (LH)-alpha subunit promoter-pit-CT cDNA transgene. Transgenic (pit-CT+) mice displayed chronic but selective overexpression of pit-CT in gonadotrophs. The mice also displayed a dramatic decline in PRL gene expression as assessed by PRL mRNA abundance, PRL immunohistochemistry (IHC) and serum PRL levels. LH secretion in pit-CT+ mice was also reduced, without any change in FSH secretion. Reproductive abnormalities such as prolonged estrous cycles, reduced pregnancy rate, delivery of smaller litters, increased neonatal mortality and deficient lactation were also observed. Administration of PRL during early pregnancy significantly increased the pregnancy rate and neonatal survival of newborns. These results demonstrate that overexpression of pit-CT leads to chronic hypoprolactinemia and reproductive dysfunction in female mice, and reinforces the possibility that gonadotroph-derived pit-CT is an important paracrine regulator of lactotroph function.

Structural basis for the mechanism and substrate specificity of glycocyamine kinase, a phosphagen kinase family member

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lim, Kap; Pullalarevu, Sadhana; Surabian, Karen Talin

2010-03-12

Glycocyamine kinase (GK), a member of the phosphagen kinase family, catalyzes the Mg{sup 2+}-dependent reversible phosphoryl group transfer of the N-phosphoryl group of phosphoglycocyamine to ADP to yield glycocyamine and ATP. This reaction helps to maintain the energy homeostasis of the cell in some multicelullar organisms that encounter high and variable energy turnover. GK from the marine worm Namalycastis sp. is heterodimeric, with two homologous polypeptide chains, {alpha} and {beta}, derived from a common pre-mRNA by mutually exclusive N-terminal alternative exons. The N-terminal exon of GK{beta} encodes a peptide that is different in sequence and is 16 amino acids longermore » than that encoded by the N-terminal exon of GK{alpha}. The crystal structures of recombinant GK{alpha}{beta} and GK{beta}{beta} from Namalycastis sp. were determined at 2.6 and 2.4 {angstrom} resolution, respectively. In addition, the structure of the GK{beta}{beta} was determined at 2.3 {angstrom} resolution in complex with a transition state analogue, Mg{sup 2+}-ADP-NO{sub 3}{sup -}-glycocyamine. Consistent with the sequence homology, the GK subunits adopt the same overall fold as that of other phosphagen kinases of known structure (the homodimeric creatine kinase (CK) and the monomeric arginine kinase (AK)). As with CK, the GK N-termini mediate the dimer interface. In both heterodimeric and homodimeric GK forms, the conformations of the two N-termini are asymmetric, and the asymmetry is different than that reported previously for the homodimeric CKs from several organisms. The entire polypeptide chains of GK{alpha}{beta} are structurally defined, and the longer N-terminus of the {beta} subunit is anchored at the dimer interface. In GK{beta}{beta} the 24 N-terminal residues of one subunit and 11 N-terminal residues of the second subunit are disordered. This observation is consistent with a proposal that the GK{alpha}{beta} amino acids involved in the interface formation were optimized once a heterodimer emerged as the physiological form of the enzyme. As a consequence, the homodimer interface (either solely {alpha} or solely {beta} chains) has been corrupted. In the unbound state, GK exhibits an open conformation analogous to that observed with ligand-free CK or AK. Upon binding the transition state analogue, both subunits of GK undergo the same closure motion that clasps the transition state analogue, in contrast to the transition state analogue complexes of CK, where the corresponding transition state analogue occupies only one subunit, which undergoes domain closure. The active site environments of the GK, CK, and AK at the bound states reveal the structural determinants of substrate specificity. Despite the equivalent binding in both active sites of the GK dimer, the conformational asymmetry of the N-termini is retained. Thus, the coupling between the structural asymmetry and negative cooperativity previously proposed for CK is not supported in the case of GK.« less

Functions and ATP-binding responses of the twelve histidine residues in the TF1-ATPase beta subunit.

PubMed

Tozawa, K; Yagi, H; Hisamatsu, K; Ozawa, K; Yoshida, M; Akutsu, H

2001-10-01

The C2 proton signals of all (twelve) histidine residues of the TF1 beta subunit in the 1H-NMR spectrum have been identified and assigned by means of pH change experiments and site-directed substitution of histidines by glutamines. pH and ligand titration experiments were carried out for these signals. Furthermore, the ATPase activity of the reconstituted alpha3beta3gamma complex was examined for the twelve mutant beta subunits. Two of three conserved histidines, namely, His-119 and 324, were found to be important for expression of the ATPase activity. The former fixes the N-terminal domain to the central domain. His-324 is involved in the formation of the interface essential for the alpha3beta3gamma complex assembly. The other conserved residue, His-363, showed a very low pK(a), suggesting that it is involved in the tertiary structure formation. On the binding of a nucleotide, only the signals of His-173, 179, 200, and 324 shifted. These histidines are located in the hinge region, and its proximity, of the beta subunit. This observation provided further support for the conformational change of the beta monomer from the open to the closed form on the binding of a nucleotide proposed by us [Yagi et al. (1999) Biophys. J. 77, 2175-2183]. This conformational change should be one of the essential driving forces in the rotation of the alpha3beta3gamma complex.

Binding symmetry of extracellular divalent cations to conduction pore studied using tandem dimers of a CNG channel.

PubMed

Kwon, Ryuk-Jun; Ha, Tal Soo; Kim, Wonjae; Park, Chul-Seung

2002-11-08

Cyclic nucleotide-gated (CNG) channels are composed of the tetramer of alpha-subunit alone or alpha- and beta-subunits. The alpha-subunits of these channels have a conserved glutamate (Glu) residue within the pore-forming region and the residue determines the selectivity as well as the affinity for the extracellular divalent cations. Using the high-affinity mutant (E363D) of bovine retinal CNG channel in which the Glu at position 363 was replaced to Asp, we constructed tandem dimers and investigated the binding characteristics of divalent cations to the site. The gating and permeation characteristics of individual homomeric tandem dimers are indistinguishable to those of homo-tetramers formed by parental monomers. The heteromeric tandem dimers showed the binding affinity for Sr(2+) identical to the geometric mean of the affinities for two parent channels, indicating the energy additive and thus the simultaneous interaction. On the other hand, the binding affinity for Mg(2+) followed the harmonic mean of those parent channels indicating that Mg(2+) interacts more strongly with the subunit bearing Asp residue at the position. Thus the results strongly suggest that the Glu363 residues in the CNG channel pore be flexible enough to adapt different binding symmetries for different divalent cations. Moreover, the simultaneous interaction between the four Glu residues and Sr(2+) provides an important structural constraint to the CNG channel outer vestibule of unknown structure.

Cytochrome b in human complex II (succinate-ubiquinone oxidoreductase): cDNA cloning of the components in liver mitochondria and chromosome assignment of the genes for the large (SDHC) and small (SDHD) subunits to 1q21 and 11q23.

PubMed

Hirawake, H; Taniwaki, M; Tamura, A; Kojima, S; Kita, K

1997-01-01

Complex II (succinate-ubiquinone oxidoreductase) is an important enzyme complex in both the tricarboxylic acid cycle and the aerobic respiratory chains of mitochondria in eukaryotic cells and prokaryotic organisms. In this study, the amino acid sequences of the large (cybL) and small (cybS) subunits of cytochrome b in human liver complex II were deduced from cDNAs isolated by homology probing with mixed primers for the polymerase chain reaction. The mature cybL and cybS contain 140 and 103 amino acids, respectively, and show little similarity to the amino acid sequences of the subunits from other species in contrast to the highly conserved features of the flavoprotein (Fp) subunit and iron-sulfur protein (Ip) subunit. From hydrophobicity analysis, both cybL and cybS appear to have three transmembrane segments, indicating their role as membrane-anchors for the enzyme complex. Histidine residues, which are possible heme axial ligands in cytochrome b of complex II, were found in the second transmembrane segment of each subunit. The genes for cybL (SDHC) and cybS (SDHD) were mapped to chromosome 1q21 and 11q23, respectively by fluorescent in situ hybridization (FISH).

Luminal Starch Substrate "Brake" on Maltase-Glucoamylase Activity Is Located within the Glucoamylase Subunit

USDA-ARS?s Scientific Manuscript database

The detailed mechanistic aspects for the final starch digestion process leading to effective alpha-glucogenesis by the 2 mucosal alpha-glucosidases, human sucrase-isomaltase complex (SI) and human maltase-glucoamylase (MGAM), are poorly understood. This is due to the structural complexity and vast v...

Glycine Receptors Containing α2 or α3 Subunits Regulate Specific Ethanol-Mediated Behaviors

PubMed Central

Blednov, Yuri A.; Benavidez, Jillian M.; Black, Mendy; Leiter, Courtney R.; Osterndorff-Kahanek, Elizabeth

2015-01-01

Glycine receptors (GlyRs) are broadly expressed in the central nervous system. Ethanol enhances the function of brain GlyRs, and the GlyRα1 subunit is associated with some of the behavioral actions of ethanol, such as loss of righting reflex. The in vivo role of GlyRα2 and α3 subunits in alcohol responses has not been characterized despite high expression levels in the nucleus accumbens and amygdala, areas that are important for the rewarding properties of drugs of abuse. We used an extensive panel of behavioral tests to examine ethanol actions in mice lacking Glra2 (the gene encoding the glycine receptor alpha 2 subunit) or Glra3 (the gene encoding the glycine receptor alpha 3 subunit). Deletion of Glra2 or Glra3 alters specific ethanol-induced behaviors. Glra2 knockout mice demonstrate reduced ethanol intake and preference in the 24-hour two-bottle choice test and increased initial aversive responses to ethanol and lithium chloride. In contrast, Glra3 knockout mice show increased ethanol intake and preference in the 24-hour intermittent access test and increased development of conditioned taste aversion to ethanol. Mutants and wild-type mice consumed similar amounts of ethanol in the limited access drinking in the dark test. Other ethanol effects, such as anxiolysis, motor incoordination, loss of righting reflex, and acoustic startle response, were not altered in the mutants. The behavioral changes in mice lacking GlyRα2 or α3 subunits were distinct from effects previously observed in mice with knock-in mutations in the α1 subunit. We provide evidence that GlyRα2 and α3 subunits may regulate ethanol consumption and the aversive response to ethanol. PMID:25678534

AlphaII-spectrin interacts with Tes and EVL, two actin-binding proteins located at cell contacts.

PubMed

Rotter, Björn; Bournier, Odile; Nicolas, Gael; Dhermy, Didier; Lecomte, Marie-Christine

2005-06-01

The spectrin-based membrane skeleton, a multi-protein scaffold attached to diverse cellular membranes, is presumed to be involved in the stabilization of membranes, the establishment of membrane domains as well as in vesicle trafficking and nuclear functions. Spectrin tetramers made of alpha- and beta-subunits are linked to actin microfilaments, forming a network that binds a multitude of proteins. The most prevalent alpha-spectrin subunit in non-erythroid cells, alphaII-spectrin, contains two particular spectrin repeats in its central region, alpha9 and alpha10, which host an Src homology 3 domain, a tissue-specific spliced sequence of 20 residues, a calmodulin-binding site and major cleavage sites for caspases and calpains. Using yeast two-hybrid screening of kidney libraries, we identified two partners of the alpha9-alpha10 repeats: the potential tumour suppressor Tes, an actin-binding protein mainly located at focal adhesions; and EVL (Ena/vasodilator-stimulated phosphoprotein-like protein), another actin-binding protein, equally recruited at focal adhesions. Interactions between spectrin and overexpressed Tes and EVL were confirmed by co-immunoprecipitation. In vitro studies showed that the interaction between Tes and spectrin is mediated by a LIM (Lin-11, Isl-1 and Mec3) domain of Tes and by the alpha10 repeat of alphaII-spectrin whereas EVL interacts with the Src homology 3 domain located within the alpha9 repeat. Moreover, we describe an in vitro interaction between Tes and EVL, and a co-localization of these two proteins at focal adhesions. These interactions between alphaII-spectrin, Tes and EVL indicate new functions for spectrin in actin dynamics and focal adhesions.

Molecular cloning of two human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzymes that are identical with chlordecone reductase and bile-acid binder.

PubMed Central

Deyashiki, Y; Ogasawara, A; Nakayama, T; Nakanishi, M; Miyabe, Y; Sato, K; Hara, A

1994-01-01

Human liver contains two dihydrodiol dehydrogenases, DD2 and DD4, associated with 3 alpha-hydroxysteroid dehydrogenase activity. We have raised polyclonal antibodies that cross-reacted with the two enzymes and isolated two 1.2 kb cDNA clones (C9 and C11) for the two enzymes from a human liver cDNA library using the antibodies. The clones of C9 and C11 contained coding sequences corresponding to 306 and 321 amino acid residues respectively, but lacked 5'-coding regions around the initiation codon. Sequence analyses of several peptides obtained by enzymic and chemical cleavages of the two purified enzymes verified that the C9 and C11 clones encoded DD2 and DD4 respectively, and further indicated that the sequence of DD2 had at least additional 16 residues upward from the N-terminal sequence deduced from the cDNA. There was 82% amino acid sequence identity between the two enzymes, indicating that the enzymes are genetic isoenzymes. A computer-based comparison of the cDNAs of the isoenzymes with the DNA sequence database revealed that the nucleotide and amino acid sequences of DD2 and DD4 are virtually identical with those of human bile-acid binder and human chlordecone reductase cDNAs respectively. Images Figure 1 PMID:8172617

Genomic structure of rat 3alpha-hydroxysteroid/dihydrodiol dehydrogenase (3alpha-HSD/DD, AKR1C9).

PubMed

Lin, H K; Hung, C F; Moore, M; Penning, T M

1999-11-01

Rat liver 3alpha-hydroxysteroid/dihydrodiol dehydrogenase (3alpha-HSD/DD) is a member of the aldo-keto reductase (AKR) superfamily. It is involved in the inactivation of steroid hormones and the metabolic activation of polycyclic aromatic hydrocarbons (PAH) by converting trans-dihydrodiols into reactive and redox-active o-quinones. The structure of the 5'-flanking region of the gene and factors involved in the constitutive and regulated expression of this gene have been reported [H.-K. Lin, T.M. Penning, Cloning, sequencing, and functional analysis of the 5'-flanking region of the rat 3alpha-hydroxysteroid/dihydrodiol dehydrogenase gene, Cancer Res. 55 (1995) 4105-4113]. We now describe the complete genomic structure of the rat type 1 3alpha-HSD/DD gene. Charon 4A and P1 genomic clones contained at least three rat genes (type 1, type 2 and type 3 3alpha-HSD/DD) each of which encoded for the same open reading frame (ORF) but differed in their exon-intron organization. 5'-RACE confirmed that the type 1 3alpha-HSD/DD gene encodes for the dominant transcript in rat liver and it was the regulation of this gene that was previously studied. The rat type 1 3alpha-HSD/DD gene is 30 kb in length and consists of nine exons and eight introns. Exon 9 encodes +931 to 966 bp of the ORF and the 1292 bp 3'-UTR implicated in mRNA stability. This genomic structure is nearly identical to the homologous human genes, type 1 3alpha-HSD (chlordecone reductase/DD4, AKR1C4), type 2 3alpha-HSD (AKR1C3) and type 3 3alpha-HSD (bile-acid binding protein, AKR1C2) genes. Three different cDNA's containing identical ORFs for 3alpha-HSD have been reported suggesting that all three genes may be expressed in rat liver. Using 5' primers corresponding to the 5'-UTR's of the three different cDNA's only one PCR fragment was obtained and corresponded to the type 1 3alpha-HSD/DD gene. These data suggested that the type 2 and type 3 3alpha-HSD/DD genes are not abundantly expressed in rat liver. It is unknown whether the type 2 and type 3 3alpha-HSD/DD genes represent pseudo-genes or whether they represent genes that are differentially expressed in other rat tissues.

Identification of target genes responsive to JP-8 exposure in the rat central nervous system.

PubMed

Lin, B; Ritchie, G D; Rossi, J; Pancrazio, J J

2001-06-01

Concern for the health risk associated with occupational exposure to jet fuel has emerged in the Department of Defense. Jet propulsion fuel-8 (JP-8) is the fuel used in most US and North Atlantic Treaty Organization (NATO) jet aircraft, and will be the predominant fuel both for military land vehicles and aircraft into the twenty-first century. JP-8 exhibits reduced volatility and lower benzene content as compared to JP-4, the predominant military aircraft fuel before 1992, possibly suggesting greater occupational exposure safety. However, the higher rates of occupational exposure through fueling and maintenance of increasingly larger numbers of aircraft/vehicles raise concerns with respect to toxicity. Clinical studies of workers experiencing long-term exposure to certain jet fuels demonstrated deficits in CNS function, including fatigue, neurobehavioral changes, psychiatric disorders, and abnormal electroencephalogram (EEG). In the present study, cDNA nylon arrays (Atlas Rat 1.2 Array, Clontech Laboratories, Palo Alto, CA) were utilized to measure changes in gene expression in whole brain tissue of rats exposed repeatedly to JP-8, under conditions that simulated possible real-world occupational exposure (6 h/day for 91 days) to JP-8 vapor at 1,000 mg/m3. Gene expression analysis of the exposure group compared to the control group revealed a modulation of several genes, including glutathione S-transferase Yb2 subunit (GST Yb2); cytochrome P450 IIIAl (CYP3A1); glucose-dependent insulinotropic peptide (GIP); alpha1-proteinase inhibitor (alpha1-AT); polyubiquitin; GABA transporter 3 (GAT-3); and plasma membrane Ca2+-transporting ATPase (brain isoform 2) (PMCA2). The implications of these vapor-induced changes in gene expression are discussed.

Dietary phenolic compounds selectively inhibit the individual subunits of maltase-glucoamylase and sucrase-isomaltase with the potential of modulating glucose release

USDA-ARS?s Scientific Manuscript database

In this study, it was hypothesized that dietary phenolic compounds selectively inhibit the individual C- and N-terminal (Ct, Nt) subunits of the two small intestinal alpha-glucosidases, maltase-glucoamylase (MGAM) and sucrase-isomaltase (SI), for a modulated glycemic carbohydrate digestion. The inhi...

Isolation of a candidate human telomerase catalytic subunit gene, which reveals complex splicing patterns in different cell types.

PubMed

Kilian, A; Bowtell, D D; Abud, H E; Hime, G R; Venter, D J; Keese, P K; Duncan, E L; Reddel, R R; Jefferson, R A

1997-11-01

Telomerase is a multicomponent reverse transcriptase enzyme that adds DNA repeats to the ends of chromosomes using its RNA component as a template for synthesis. Telomerase activity is detected in the germline as well as the majority of tumors and immortal cell lines, and at low levels in several types of normal cells. We have cloned a human gene homologous to a protein from Saccharomyces cerevisiae and Euplotes aediculatus that has reverse transcriptase motifs and is thought to be the catalytic subunit of telomerase in those species. This gene is present in the human genome as a single copy sequence with a dominant transcript of approximately 4 kb in a human colon cancer cell line, LIM1215. The cDNA sequence was determined using clones from a LIM1215 cDNA library and by RT-PCR, cRACE and 3'RACE on mRNA from the same source. We show that the gene is expressed in several normal tissues, telomerase-positive post-crisis (immortal) cell lines and various tumors but is not expressed in the majority of normal tissues analyzed, pre-crisis (non-immortal) cells and telomerase-negative immortal (ALT) cell lines. Multiple products were identified by RT-PCR using primers within the reverse transcriptase domain. Sequencing of these products suggests that they arise by alternative splicing. Strikingly, various tumors, cell lines and even normal tissues (colonic crypt and testis) showed considerable differences in the splicing patterns. Alternative splicing of the telomerase catalytic subunit transcript may be important for the regulation of telomerase activity and may give rise to proteins with different biochemical functions.

Concholepas concholepas Ferritin H-like subunit (CcFer): Molecular characterization and single nucleotide polymorphism associated to innate immune response.

PubMed

Chávez-Mardones, Jacqueline; Valenzuela-Muñoz, Valentina; Núñez-Acuña, Gustavo; Maldonado-Aguayo, Waleska; Gallardo-Escárate, Cristian

2013-09-01

Ferritin has been identified as the principal protein of iron storage and iron detoxification, playing a pivotal role for the cellular homeostasis in living organisms. However, recent studies in marine invertebrates have suggested its association with innate immune system. In the present study, one Ferritin subunit was identified from the gastropod Concholepas concholepas (CcFer), which was fully characterized by Rapid Amplification of cDNA Ends technique. Simultaneously, a challenge test was performed to evaluate the immune response against Vibrio anguillarum. The full length of cDNA Ccfer was 1030 bp, containing 513 bp of open reading frame that encodes to 170 amino acid peptide, which was similar to the Ferritin H subunit described in vertebrates. Untranslated Regions (UTRs) were identified with a 5'UTR of 244 bp that contains iron responsive element (IRE), and a 3'UTR of 273 bp. The predicted molecular mass of deduced amino acid of CcFer was 19.66 kDa and isoelectric point of 4.92. Gene transcription analysis revealed that CcFer increases against infections with V. anguillarum, showing a peak expression at 6 h post-infection. Moreover, a single nucleotide polymorphism was detected at -64 downstream 5'UTR sequence (SNP-64). Quantitative real time analysis showed that homozygous mutant allele (TT) was significantly associated with higher expression levels of the challenged group compared to wild (CC) and heterozygous (CT) variants. Our findings suggest that CcFer is associated to innate immune response in C. concholepas and that the presence of SNPs may involve differential transcriptional expression of CcFer. Copyright © 2013 Elsevier Ltd. All rights reserved.

Molecular characterization of two ferritins of the scallop Argopecten purpuratus and gene expressions in association with early development, immune response and growth rate.

PubMed

Coba de la Peña, Teodoro; Cárcamo, Claudia B; Díaz, María I; Brokordt, Katherina B; Winkler, Federico M

2016-08-01

Ferritin is involved in several iron homoeostasis processes in molluscs. We characterized two ferritin homologues and their expression patterns in association with early development, growth rate and immune response in the scallop Argopecten purpuratus, a species of economic importance for Chile and Peru. Two ferritin subunits (Apfer1 and Apfer2) were cloned. Apfer1 cDNA is a 792bp clone containing a 516bp open reading frame (ORF) that corresponds to a novel ferritin subunit in A. purpuratus. Apfer2 cDNA is a 681bp clone containing a 522bp ORF that corresponds to a previously sequenced EST. A putative iron responsive element (IRE) was identified in the 5'-untranslated region of both genes. The deduced protein sequences of both cDNAs possessed the motifs and domains characteristic of functional ferritin subunits. Both genes showed differential expression patterns at tissue-specific and early development stage levels. Apfer1 expression level increased 40-fold along larval developmental stages, decreasing markedly after larval settlement. Apfer1 expression in mantle tissue was 2.8-fold higher in fast-growing than in slow-growing scallops. Apfer1 increased 8-fold in haemocytes 24h post-challenge with the bacterium Vibrio splendidus. Apfer2 expression did not differ between fast- and slow-growing scallops or in response to bacterial challenge. These results suggest that Apfer1 and Apfer2 may be involved in iron storage, larval development and shell formation. Apfer1 expression may additionally be involved in immune response against bacterial infections and also in growth; and thus would be a potential marker for immune capacity and for fast growth in A. purpuratus. Copyright © 2016 Elsevier Inc. All rights reserved.

Self-assembly of proglycinin and hybrid proglycinin synthesized in vitro from cDNA

PubMed Central

Dickinson, Craig D.; Floener, Liliane A.; Lilley, Glenn G.; Nielsen, Niels C.

1987-01-01

An in vitro system was developed that results in the self-assembly of subunit precursors into complexes that resemble those found naturally in the endoplasmic reticulum. Subunits of glycinin, the predominant seed protein of soybeans, were synthesized from modified cDNAs using a combination of the SP6 transcription and the rabbit reticulocyte translation systems. Subunits produced from plasmid constructions that encoded either Gy4 or Gy5 gene products, but modified such that their signal sequences were absent, self-assembled into trimers equivalent in size to those precursors found in the endoplasmic reticulum. In contrast, proteins synthesized in vitro from Gy4 constructs failed to self-assemble when the signal sequence was left intact (e.g., preproglycinin) or when the coding sequence was modified to remove 27 amino acids from an internal hydrophobic region, which is highly conserved among the glycinin subunits. Various hybrid subunits were also produced by trading portions of Gy4 and Gy5 cDNAs and all self-assembled in our system. The in vitro assembly system provides an opportunity to study the self-assembly of precursors and to probe for regions important for assembly. It will also be helpful in attempts to engineer beneficial nutritional changes into this important food protein. Images PMID:16593868

Evolutionary relationships of lactate dehydrogenases (LDHs) from mammals, birds, an amphibian, fish, barley, and bacteria: LDH cDNA sequences from Xenopus, pig, and rat.

PubMed Central

Tsuji, S; Qureshi, M A; Hou, E W; Fitch, W M; Li, S S

1994-01-01

The nucleotide sequences of the cDNAs encoding LDH (EC 1.1.1.27) subunits LDH-A (muscle), LDH-B (liver), and LDH-C (oocyte) from Xenopus laevis, LDH-A (muscle) and LDH-B (heart) from pig, and LDH-B (heart) and LDH-C (testis) from rat were determined. These seven newly deduced amino acid sequences and 22 other published LDH sequences, and three unpublished fish LDH-A sequences kindly provided by G. N. Somero and D. A. Powers, were used to construct the most parsimonious phylogenetic tree of these 32 LDH subunits from mammals, birds, an amphibian, fish, barley, and bacteria. There have been at least six LDH gene duplications among the vertebrates. The Xenopus LDH-A, LDH-B, and LDH-C subunits are most closely related to each other and then are more closely related to vertebrate LDH-B than LDH-A. Three fish LDH-As, as well as a single LDH of lamprey, also seem to be more related to vertebrate LDH-B than to land vertebrate LDH-A. The mammalian LDH-C (testis) subunit appears to have diverged very early, prior to the divergence of vertebrate LDH-A and LDH-B subunits, as reported previously. Images PMID:7937776

Molecular characterization of four beta-tubulin genes from dinitroaniline susceptible and resistant biotypes of Eleusine indica.

PubMed

Yamamoto, E; Baird, W V

1999-01-01

Dinitroaniline herbicides are antimicrotubule drugs that bind to tubulins and inhibit polymerization. As a result of repeated application of dinitroaniline herbicides, resistant biotypes of goosegrass (Eleusine indica) developed in previously susceptible wild-type populations. We have previously reported that alpha-tubulin missense mutations correlate with dinitroaniline response phenotypes (Drp) (Plant Cell 10: 297-308, 1998). In order to ascertain associations of other tubulins with dinitroaniline resistance, four beta-tubulin cDNA classes (designated TUB1, TUB2, TUB3, and TUB4) were isolated from dinitroaniline-susceptible and -resistant biotypes. Sequence analysis of the four beta-tubulin cDNA classes identified no missense mutations. Identified nucleotide substitutions did not result in amino acid replacements. These results suggest that the molecular basis of dinitroaniline resistance in goosegrass differs from those of colchicine/dinitroaniline cross-resistant Chlamydomonas reinhardtii and benzimidazole-resistant fungi and yeast. Expression of the four beta-tubulins was highest in inflorescences. This is in contrast to alpha-tubulin TUA1 that is expressed predominantly in roots. Collectively, these results imply that beta-tubulin genes are not associated with dinitroaniline resistance in goosegrass. Phylogenetic analysis of the four beta-tubulins, together with three alpha-tubulins, suggests that the resistant biotype developed independently in multiple locations rather than spreading from one location.

cDNA cloning, functional expression and antifungal activities of a dimeric plant defensin SPE10 from Pachyrrhizus erosus seeds.

PubMed

Song, Xiaomin; Wang, Jing; Wu, Fang; Li, Xu; Teng, Maikun; Gong, Weimin

2005-01-01

SPE10 is an antifungal protein isolated from the seeds of Pachyrrhizus erosus. cDNA encoding a 47 amino acid peptide was cloned by RT-PCR and the gene sequence proved SPE10 to be a new member of plant defensin family. The synthetic cDNA with codons preferred in yeast was cloned into the pPIC9 plasmid directly in-frame with the secretion signal alpha-mating factor, and highly expressed in methylotrophic Pichia pastoris. Activity assays showed the recombinant SPE10 inhibited specifically the growth of several pathogenic fungi as native SPE10. Circular dichroism and fluorescence spectroscopy analysis indicated that the native and recombinant protein should have same folding, though there are eight cystein residues in the sequence. Several evidence suggested SPE10 should be the first dimeric plant defensin reported so far.

Differential processing of the two subunits of human choriogonadotropin (hCG) by granulosa cells. I. Preparation and characterization of selectively labeled hCG

DOE Office of Scientific and Technical Information (OSTI.GOV)

Landefeld, T.D.; Byrne, M.D.; Campbell, K.L.

1981-12-01

The alpha- and beta-subunits of hCG were radioiodinated and recombined with unlabeled complementary subunits. The resultant recombined hormones, selectively labeled in either the alpha- or beta-subunit, were separated from unrecombined subunit by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, extracted with Triton X-100, and characterized by binding analysis. The estimates of maximum binding (active fraction) of the two resultant selectively labeled, recombined hCG preparations, determined with excess receptor were 0.41 and 0.59. These values are similar to those obtained when hCG is labeled as an intact molecule. The specific activities of the recombined preparations were estimated by four different methods, and themore » resulting values were used in combination with the active fraction estimates to determine the concentrations of active free and bound hormone. Binding analyses were run using varying concentrations of both labeled and unlabeled hormone. Estimates of the equilibrium dissociation binding constant (Kd) and receptor capacity were calculated in three different ways. The mean estimates of capacity (52.6 and 52.7 fmol/mg tissue) and Kd (66.6 and 65.7 pM) for the two preparations were indistinguishable. Additionally, these values were similar to values reported previously for hCG radioiodinated as an intact molecule. The availability of well characterized, selectively labeled hCG preparations provides new tools for studying the mechanism of action and the target cell processing of the subunits of this hormone.« less

Unprecedented genomic diversity of AhR1 and AhR2 genes in Atlantic salmon (Salmo salar L.).

PubMed

Hansson, Maria C; Wittzell, Håkan; Persson, Kerstin; von Schantz, Torbjörn

2004-06-24

Aryl hydrocarbon receptor (AhR) genes encode proteins involved in mediating the toxic responses induced by several environmental pollutants. Here, we describe the identification of the first two AhR1 (alpha and beta) genes and two additional AhR2 (alpha and beta) genes in the tetraploid species Atlantic salmon (Salmo salar L.) from a cosmid library screening. Cosmid clones containing genomic salmon AhR sequences were isolated using a cDNA clone containing the coding region of the Atlantic salmon AhR2gamma as a probe. Screening revealed 14 positive clones, from which four were chosen for further analyses. One of the cosmids contained genomic AhR sequences that were highly similar to the rainbow trout (Oncorhynchus mykiss) AhR2alpha and beta genes. SMART RACE amplified two complete, highly similar but not identical AhR type 2 sequences from salmon cDNA, which from phylogenetic analyses were determined as the rainbow trout AhR2alpha and beta orthologs. The salmon AhR2alpha and beta encode proteins of 1071 and 1058 residues, respectively, and encompass characteristic AhR sequence elements like a basic-helix-loop-helix (bHLH) and two PER-ARNT-SIM (PAS) domains. Both genes are transcribed in liver, spleen and muscle tissues of adult salmon. A second cosmid contained partial sequences, which were identical to the previously characterized AhR2gamma gene. The last two cosmids contained partial genomic AhR sequences, which were more similar to other AhR type 1 fish genes than the four characterized salmon AhR2 genes. However, attempts to amplify the corresponding complete cDNA sequences of the inserts proved very difficult, suggesting that these genes are non-functional or very weakly transcribed in the examined tissues. Phylogenetic analyses of the conserved regions did, however, clearly indicate that these two AhRs belong to the AhR type 1 clade and have been assigned as the Atlantic salmon AhR1alpha and AhR1beta genes. Taken together, these findings demonstrate that multiple AhR genes are present in Atlantic salmon genome, which likely is a consequence of previous genome duplications in the evolutionary past of salmonids. Plausible explanations for the high incidence of AhR genes in fish and more specifically in salmonids, like rapid divergences in specialized functions, are discussed.

The role of nicotinic receptor alpha 7 subunits in nicotine discrimination.

PubMed

Stolerman, I P; Chamberlain, S; Bizarro, L; Fernandes, C; Schalkwyk, L

2004-03-01

The subtypes of nicotinic receptors at which the behavioural effects of nicotine originate are not fully understood. The experiments described here use mice lacking the alpha7 subunit of nicotinic receptors to investigate the role of alpha7-containing receptors in nicotine discrimination. Wild-type and alpha7-knockout mice were trained in a two-lever nicotine discrimination procedure using a tandem schedule of food reinforcement. Mutant mice exhibited baseline rates of lever-pressing as low as 52.2% of rates in wild-type controls (n=21-24). Mutant and wild-type mice acquired discrimination of nicotine (0.4 or 0.8 mg/kg) at a similar rate (n=10-12) and reached similar final levels of accuracy (71.9 +/- 4.4% and 90.8 +/- 3.1% after 60 training sessions for 0.4 and 0.8 mg/kg training doses, respectively, in mutant mice, as compared with 75.0 +/- 6.5% and 87.6 +/- 4.8% for wild types). The genotypes exhibited similar steep dose-response curves for nicotine discrimination. In both genotypes, dose-response curves for mice trained with 0.8 mg/kg of nicotine were displaced three- to four-fold to the right as compared with those for the mice trained with the smaller dose. The predominant effect of nicotine on the overall rate of responding was a reduction at the largest doses tested and there was no difference between the genotypes. The results suggest that nicotinic receptors containing the alpha7 subunit do not contribute to the discriminative stimulus or response-rate-depressant effects of nicotine, although they may regulate baseline rates of operant responding.

The effects of brefeldin-A on the high mannose oligosaccharides of mouse thyrotropin, free alpha-subunits, and total glycoproteins.

PubMed

Perkel, V S; Liu, A Y; Miura, Y; Magner, J A

1988-07-01

We have studied the effects of Brefeldin-A (BFA) on the processing of high mannose (Man) oligosaccharides of TSH. BFA is a drug that inhibits the intracellular translocation of newly synthesized glycoproteins and causes dilatation of the rough endoplasmic reticulum (RER) as well as mild swelling of the Golgi apparatus. Mouse pituitary thyrotropic tumor tissue was incubated with [3H]Man for a 2-h pulse, with and without a 3-h chase; BFA (5 micrograms/ml) was included during selected pulse and selected chase incubations. TSH and free alpha-subunits were obtained from detergent lysates of tissue by immunoprecipitation using specific antisera. Total glycoproteins were obtained by trichloroacetic acid precipitation. Endoglycosidase-H-released [3H]oligosaccharides were analyzed by paper chromatography. BFA inhibited carbohydrate processing of TSH, free alpha-subunits, and total glycoproteins, resulting in the accumulation of Man8GlcNAc2, Man7GlcNAc2, Man6GlcNAc2, and Man5GlcNAc2, especially during the chase period. Subcellular fractions enriched in RER, heavy (proximal) Golgi, and light (distal) Golgi were prepared by centrifugation in discontinuous sucrose gradients. [3H]Man-labeled oligosaccharides of TSH and total glycoproteins in the subcellular fractions were analyzed. In contrast to oligosaccharides with eight or nine Man residues found in control incubations, BFA caused the accumulation of oligosaccharides containing five to eight Man residues. These BFA-induced oligosaccharide alterations began in the RER and proximal Golgi with the 2-h pulse and extended into the distal Golgi during the chase incubations. Thus, BFA blocks the normal intracellular transport and processing of TSH, free alpha-subunits, and total glycoproteins within thyrotrophs, causing species with smaller than normal high Man oligosaccharides to appear in subcellular compartments as early as the RER. The translocation block between RER and Golgi produced by BFA may prevent the processing of Man8GlcNAc2 to Man5GlcNAc2 by Golgi (alpha,1-2)mannosidase I, yet the species retained within the RER may be subject to ongoing processing by endoplasmic reticulum (alpha,1-2)mannosidase, resulting in the accumulation of Man5-8GlcNAc2 within the RER.

Eukaryotic polypeptide elongation system and its sensitivity to the inhibitory substances of plant origin.

PubMed

Gałasiński, W

1996-05-01

The structural and functional characteristics of the elongation system (ribosomes and elongation factors) are presented. The immunochemical and diagnostic meaning of the ribosome investigations is considered. Evidence of the participation of ribosomes in the first step of protein glycosylation is presented. The heterogeneous elongation factor eEF-1, isolated from Guerin epithelioma, can be separated into three fractions: one of them functionally corresponds to EF-1 alpha, the second on to EF-1 beta gamma, and the third is an unidentified, active aggregate named EF-1B, which contains the subunit forms EF-1 alpha and EF-1 beta gamma, and other polypeptides showing protein kinase activity. The aggregate EF-1B can be autophosphorylated, while the subunit forms EF-1 alpha and EF-1 beta gamma can neither become autophosphorylated nor phosphorylate other polypeptides. The subunit form EF-beta gamma consists from two polypeptides of 32 and 51 kDa, corresponding to other eukaryotic beta and gamma polypeptides, respectively. EF-1 beta gamma is thermostable and protects against thermal inactivation of EF-1 alpha in the EF-1 alpha-EF-1 beta gamma complex. Pure eEF-2 preparations isolated from normal and neoplastic tissues show different structural features. The existence of eEF-2 in multiple forms, differing in molecular mass, have been found. The eEF-2 with molecular weight of about 100 kDa can be phosphorylated, while eEF-2 of about 65 kDa was not phosphorylated by protein kinase eEF-2. The phosphorylated eEF-2 lost its activity, and this effect was reversed by dephosphorylation. The eEF-2 (65 kDa) was isolated from the active polyribosomes, and it may directly participate in the translocation step of the peptide elongation. It was noted that the components of elongation system can be inhibited, in separate steps, by the substances isolated from various sources of plant origin. Alkaloids emetine and cepheline, cardiac remedy digoxin, saponin glycoside, and its aglycon directly inactivated ribosomes. Quercetin inhibited eEF-1 activity by directly influencing its subunit form EF-1 alpha. eEF-2 was shown to be a target site of the inhibitory action of the glycoside isolated from Melissa officinalis leaves.

IGF-1-dependent subunit communication of the IGF-1 holoreceptor: Interactions between. alpha. beta. heterodimeric receptor halves

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilden, P.A.; Treadway, J.L.; Morrison, B.D.

1989-12-12

Examination of {sup 125}I-IGF-1 affinity cross-linking and {beta}-subunit autophosphorylation has indicated that IGF-1 induces a covalent association of isolated {alpha}{beta} heterodimeric IGF-1 receptors into an {alpha}{sub 2}{beta}{sub 2} heterotetrameric state, in a similar manner to that observed for the insulin receptor. The formation of the {alpha}{sub 2}{beta}{sub 2} heterotetrameric IGF-1 receptor complex from the partially purified {alpha}{beta} heterodimers was time dependent with half-maximal formation in approximately 30 min at saturating IGF-1 concentrations. The IGF-1-dependent association of the partially purified {alpha}{beta} heterodimers into an {alpha}{sub 2}{beta}{sub 2} heterotetrameric state was specific for the IGF-1 receptors since IGF-1 was unable to stimulatemore » the protein kinase activity of the purified {alpha}{beta} heterodimeric insulin receptor complex. Incubation of the {alpha}{sub 2}{beta}{sub 2} heterotetrameric IGF-1 holoreceptor with the specific sulfhydryl agent iodoacetamide (IAN) did not alter {sup 125}I-IGF-1 binding or IGF-1 stimulation of protein kinase activity. However, IAN treatment of the {alpha}{beta} heterodimeric IGF-1 receptors inhibited the IGF-1 dependent covalent formation of the disulfide-linked {alpha}{sub 2}{beta}{sub 2} heterotetrameric complex. These data indicate that IGF-1 induces the covalent association of isolated {alpha}{beta} heterodimeric IGF-1 receptor complexes into a disulfide-linked {alpha}{sub 2}{beta}{sub 2} heterotetrameric state whereas Mn/MgATP induces a noncovalent association. Therefore, unlike the insulin receptor in which noncovalent association is sufficient for kinase activation, only the covalent assembly of the IGF-1 receptor {alpha}{beta} heterodimers into the {alpha}{sub 2}{beta}{sub 2} heterotetrameric holoreceptor complex is associated with ligand-stimulated protein kinase activation.« less

Absence of integrin alpha 7 causes a novel form of muscular dystrophy.

PubMed

Mayer, U; Saher, G; Fässler, R; Bornemann, A; Echtermeyer, F; von der Mark, H; Miosge, N; Pöschl, E; von der Mark, K

1997-11-01

Integrin alpha 7 beta 1 is a specific cellular receptor for the basement membrane protein laminin-1 (refs 1,2), as well as for the laminin isoforms -2 and -4 (ref. 3). The alpha 7 subunit is expressed mainly in skeletal and cardiac muscle and has been suggested to be involved in differentiation and migration processes during myogenesis. Three cytoplasmic and two extracellular splice variants that have been described are developmentally regulated and expressed in different sites in the muscle. In adult muscle, the alpha 7A and alpha 7B subunits are concentrated in myotendinous junctions but can also be detected in neuromuscular junctions and along the sarcolemmal membrane. To study the potential involvement of alpha 7 integrin, during myogenesis and its role in muscle integrity and function, we generated a null allele of the alpha 7 gene (Itga7) in the germline of mice by homologous recombination in embryonic stem (ES) cells. Surprisingly, mice homozygous for the mutation are viable and fertile, indicating that the alpha 7 beta 1 integrin is not essential for myogenesis. However, histological analysis of skeletal muscle revealed typical symptoms of a progressive muscular dystrophy starting soon after birth, but with a distinct variability in different muscle types. The observed histopathological changes strongly indicate an impairment of function of the myotendinous junctions. These findings demonstrate that alpha 7 beta 1 integrin represents an indispensable linkage between the muscle fibre and the extracellular matrix that is independent of the dystrophin-dystroglycan complex-mediated interaction of the cytoskeleton with the muscle basement membrane.

Molecular cloning and characterization of G alpha proteins from the western tarnished plant bug, Lygus hesperus

USDA-ARS?s Scientific Manuscript database

The G-alpha subunits of heterotrimeric G proteins play critical roles in the activation of diverse signal transduction cascades. However, the role of these genes in chemosensation remains to be fully elucidated. To initiate a comprehensive survey of signal transduction genes, we used homology-base...

Interferon Antagonism as a Common Virulence Factor of Hemorrhagic Fever Viruses

DTIC Science & Technology

2008-02-01

S. Prehn , A. Leutz, H. Haller, and E. Hartmann. 1997. Cloning of two novel human importin-alpha subunits and analysis of the expression pattern of...the importin-alpha protein family. FEBS Lett 417:104-8. 12. Kohler, M., C. Speck, M. Christiansen, F. R. Bischoff, S. Prehn , H. Haller, D. Gorlich

Identification of a novel bursicon-regulated transcriptional regulator, md133790, in house fly Musca domestica

USDA-ARS?s Scientific Manuscript database

Bursicon is a neuropeptide that regulates cuticle sclerotization (hardening and tanning) and wing expansion in insects via a G-protein coupled receptor. The peptide consists of alpha and beta subunits. In the present study, we cloned bursicon alpha and beta genes in the house fly Musca domestica us...

Definition of the mutation responsible for maple syrup urine disease in Poll Shorthorns and genotyping Poll Shorthorns and Poll Herefords for maple syrup urine disease alleles.

PubMed

Dennis, J A; Healy, P J

1999-08-01

The organisation of the E1alpha subunit of bovine branched-chain alpha-keto acid dehydrogenase gene was established. c DNA was cloned from Poll Shorthorn x Poll Hereford calves affected with Maple Syrup Urine Disease to identify the mutation responsible for the disease in Poll Shorthorns. Clones containing the c DNA sequences inherited from the Poll Shorthorn sire of the affected calves were identified. Paternal clones were sequenced and a cytidine to thymidine transition was found at nucleotide 1380. The mutation is predicted to substitute leucine in place of a highly conserved proline at codon 372. A polymerase chain reaction procedure was developed for detection of the 1380C-->T mutation in genomic DNA. Three Poll Shorthorn parents of affected calves and three affected Poll Shorthorn x Poll Hereford calves were heterozygous and an affected Poll Shorthorn calf was homozygous for this mutation. An improved polymerase chain reaction procedure was also devised to genotype Poll Herefords for the 248C-->T mutation. The procedures will facilitate disease prevention programs and assist in differential diagnosis of conditions in new-born calves that present with a rapid onset of progressive neurological disease and are characterised histologically by 'status spongiosus'. Maple Syrup Urine Disease (MSUD) is an autosomal recessive defect reported in humans (Danner and Elsas 1989), and in Poll Hereford (PH) and Poll Shorthorn (PS) calves (Harper et al 1986, Healy et al 1992). The clinical, biochemical and pathological manifestations of the disease are identical in the two breeds of cattle, and are characterised by the rapid onset of progressive neurological disease, leading to death within a few days of birth. The disease is caused by a deficiency of activity of the mitochondrial enzyme branched-chain alpha-keto acid dehydrogenase (BCKADH). This deficiency leads to elevated concentrations, in blood and tissues, of branched chain alpha-keto acids and their precursors, the branched chain amino acids, valine, leucine and isoleucine. BCKADH consists of four subunits E1alpha, E1beta, E2 and E3 that are encoded by separate genes, and MSUD may result from deficiency of any of the subunits. In PH s, the disease in caused by premature termination of translation, of the E1alpha subunit, that is induced by a cytidine to thymidine transition exon 2 (248C-->T), that converts the glutamine codon -6 to a stop codon (Q-6ST; Zhang et al 1990). We have shown that MSUD -affected PSxPH calves are heterozygous at the PH locus, illustrating molecular heterogeneity exists for bovine MSUD (Healy and Dennis 1994a). The fact that these crossbred calves are affected, indicates the PS, like the PH mutation, resides in the E1alpha subunit. Copyright 1999 Harcourt Publishers Ltd.

Nucleotide sequences of bovine alpha S1- and kappa-casein cDNAs.

PubMed Central

Stewart, A F; Willis, I M; Mackinlay, A G

1984-01-01

The nucleotide sequences corresponding to bovine alpha S1- and kappa-casein mRNAs are presented. An unusual alpha S1-casein cDNA has been characterised whose 5' end commences upstream from its putative TATA box. The alpha S1-casein mRNA is compared to rat alpha-casein mRNA and two components of divergence are identified. Firstly, the two sequences have diverged at a high point mutation rate and the rate of amino acid replacement by this mechanism is at least as great as the rate of divergence of any other part of the mRNAs. Secondly, the protein coding sequence has been subjected to several insertion/deletion events, one of which may be an example of exon shuffling . The kappa-casein mRNA sequence verifies the proposition that it has arisen from a different ancestral gene to the other caseins. Images PMID:6328443

Short communication: molecular characterization of dog and cat p65 subunits of NF-kappaB.

PubMed

Ishikawa, Shingo; Takemitsu, Hiroshi; Li, Gebin; Mori, Nobuko; Yamamoto, Ichiro; Arai, Toshiro

2015-04-01

Nuclear factor kappa B (NF-κB) plays an important role in the immune system. The p65 subunit is an important part of NF-κB unit, and studies of dog and cat p65 subunits of NF-κB (dp65 and cp65) are important in understanding their immune function. In this study, we described the molecular characterization of dp65 and cp65. The dp65 and cp65 complementary DNA encoded 542 and 555 amino acids, respectively, showing a high sequence homology with the mammalian p65 subunit (>87.5%). Quantitative polymerase chain reaction revealed that the p65 messenger RNA is highly expressed in the dog stomach and cat heart and adipose tissue. Functional NF-κB promoter-luciferase reporter vectors revealed that our isolated dp65 and cp65 cDNA encodes a functionally active protein. Transiently expressed dp65 and cp65 up-regulated pro-inflammatory cytokine expression levels in dog and cat, respectively. These findings suggest that dp65 and cp65 play important roles in regulating immune function. Copyright © 2015 Elsevier Ltd. All rights reserved.

A functional thyrotropin- and growth hormone-secreting pituitary adenoma with a ultrastructurally monomorphic feature: a case study.

PubMed

Ozawa, Y; Kameya, T; Kasuga, A; Naritaka, H; Kanda, N; Maruyama, H; Saruta, T

1998-04-01

A 38-yr-old female with a TSH- and GH-secreting pituitary adenoma is described, who had both overt symptoms, hyperthyroidism and acromegaly. Her serum TSH was not suppressed despite high concentrations of free T3 and free T4, and her alpha-subunit/TSH molar ratio was high. Her serum GH was consistently high, and was not suppressed by an oral glucose tolerance test. Preoperative testing revealed that, although the TSH response was impaired, TSH, alpha-subunit and GH were increased by TRH injection, and that these hormones were reduced by bromocriptine or somatostatin analog. Although she did not have hyperprolactinemia, the in vitro culture and immunohistochemical studies revealed that the adenoma cells produced and released PRL, in addition to TSH, alpha-subunit and GH. Immunohistochemical studies showed the presence of GH in the cytoplasm of many adenoma cells. TSH beta-positive adenoma cells were less frequently seen than GH-positive adenoma cells. No cells showed the coexistence of GH and TSH beta, and a few cells were positive for PRL. By electron microscopy, the adenoma was found to be composed of a single cell type resembling thyrotrophs, and did not have any characteristics of somatotrophs. This case was considered to be of interest, because the adenoma was ultrastructurally monomorphous, but immunohistochemically polymorphous.

Molecular structure of P2X receptors.

PubMed

Egan, Terrance M; Cox, Jane A; Voigt, Mark M

2004-01-01

P2X receptors are ligand-gated ion channels that transduce many of the physiological effects of extracellular ATP. There has been a dramatic increase in awareness of these receptors over the past 5 or so years, in great part due to their molecular cloning and characterization. The availability of cDNA clones for the various subunits has led to rapid progress in identifying their tissue-specific expression, resulting in new ideas concerning the functional roles these receptors might play in physiological and pathophysiological processes. In addition, molecular approaches have yielded much information regarding the structure and function of the receptor proteins themselves. In this review we seek to review recent findings concerning the molecular determinants of receptor-channel function, with particular focus on ligand binding and gating, ion selectivity, and subunit assembly.

Oligomeric status of the dihydropyridine receptor in aged skeletal muscle.

PubMed

Ryan, M; Carlson, B M; Ohlendieck, K

2000-10-01

A prominent feature of aging is represented by a decrease in muscle mass and strength. Abnormalities in Ca2+ -regulatory membrane complexes are involved in many muscular disorders. In analogy, we determined potential age-related changes in a key component of excitation-contraction coupling, the dihydropyridine receptor. Immunoblotting of the microsomal fraction from aged rabbit muscle revealed a drastic decline in the voltage-sensing alpha1-subunit of this transverse-tubular receptor, but only marginally altered expression of its auxiliary alpha(2)-subunit and the Na+/K+ -ATPase. A shift to slower fibre type characteristics was indicated by an age-related increase in the slow calsequestrin isoform. Chemical crosslinking analysis showed that the triad receptor complex has a comparable tendency of protein-protein interactions in young and aged muscles. Hence, a reduced expression and not modified oligomerization of the principal dihydropyridine receptor subunit might be involved in triggering impaired triadic signal transduction and abnormal Ca2+ -homeostasis resulting in a progressive functional decline of skeletal muscles. Copyright 2001 Academic Press.

Targeting mechanisms of high voltage-activated Ca2+ channels.

PubMed

Herlitze, Stefan; Xie, Mian; Han, Jing; Hümmer, Alexander; Melnik-Martinez, Katya V; Moreno, Rosa L; Mark, Melanie D

2003-12-01

Functional voltage-dependent Ca2+ channel complexes are assembled by three to four subunits: alpha1, beta, alpha2delta subunits (C. Leveque et al., 1994, J. Biol Chem. 269, 6306-6312; M. W. McEnery et al., 1991, Proc. Natl. Acad. Sci. U.S.A. 88, 11095-11099) and at least in muscle cells also y subunits (B. M. Curtis and W. A. Catterall, 1984, Biochemistry 23, 2113-2118). Ca2+ channels mediate the voltage-dependent Ca2+ influx in subcellular compartments, triggering such diverse processes as neurotransmitter release, dendritic action potentials, excitation-contraction, and excitation-transcription coupling. The targeting of biophysically defined Ca2+ channel complexes to the correct subcellular structures is, thus, critical to proper cell and physiological functioning. Despite their importance, surprisingly little is known about the targeting mechanisms by which Ca2+ channel complexes are transported to their site of function. Here we summarize what we know about the targeting of Ca2+ channel complexes through the cell to the plasma membrane and subcellular structures.

High energy phosphate transfer by NDPK B/Gbetagammacomplexes--an alternative signaling pathway involved in the regulation of basal cAMP production.

PubMed

Hippe, Hans-Joerg; Wieland, Thomas

2006-08-01

The activation of heterotrimeric G proteins induced by G protein coupled receptors (GPCR) is generally believed to occur by a GDP/GTP exchange at the G protein alpha -subunit. Nevertheless, nucleoside diphosphate kinase (NDPK) and the beta-subunit of G proteins (Gbeta) participate in G protein activation by phosphate transfer reactions leading to the formation of GTP from GDP. Recent work elucidated the role of these reactions. Apparently, the NDPK isoform B (NDPK B) forms a complex with Gbetagamma dimers in which NDPK B acts as a histidine kinase phosphorylating Gbeta at His266. Out of this high energetic phosphoamidate bond the phosphate can be transferred specifically onto GDP. The formed GTP binds to the G protein alpha-subunit and thus activates the respective G protein. Evidence is presented, that this process occurs independent of the classical GPCR-induced GTP/GTP exchange und thus contributes, e.g. to the regulation of basal cAMP synthesis in cells.

The proteasomal subunit Rpn6 is a molecular clamp holding the core and regulatory subcomplexes together

PubMed Central

Pathare, Ganesh Ramnath; Nagy, István; Bohn, Stefan; Unverdorben, Pia; Hubert, Agnes; Körner, Roman; Nickell, Stephan; Lasker, Keren; Sali, Andrej; Tamura, Tomohiro; Nishioka, Taiki; Förster, Friedrich; Baumeister, Wolfgang; Bracher, Andreas

2012-01-01

Proteasomes execute the degradation of most cellular proteins. Although the 20S core particle (CP) has been studied in great detail, the structure of the 19S regulatory particle (RP), which prepares ubiquitylated substrates for degradation, has remained elusive. Here, we report the crystal structure of one of the RP subunits, Rpn6, and we describe its integration into the cryo-EM density map of the 26S holocomplex at 9.1 Å resolution. Rpn6 consists of an α-solenoid-like fold and a proteasome COP9/signalosome eIF3 (PCI) module in a right-handed suprahelical configuration. Highly conserved surface areas of Rpn6 interact with the conserved surfaces of the Pre8 (alpha2) and Rpt6 subunits from the alpha and ATPase rings, respectively. The structure suggests that Rpn6 has a pivotal role in stabilizing the otherwise weak interaction between the CP and the RP. PMID:22187461

Tobacco components stimulate Akt-dependent proliferation and NFkappaB-dependent survival in lung cancer cells.

PubMed

Tsurutani, Junji; Castillo, S Sianna; Brognard, John; Granville, Courtney A; Zhang, Chunyu; Gills, Joell J; Sayyah, Jacqueline; Dennis, Phillip A

2005-07-01

Retrospective studies have shown that patients with tobacco-related cancers who continue to smoke after their diagnoses have lower response rates and shorter median survival compared with patients who stop smoking. To provide insight into the biologic basis for these clinical observations, we tested whether two tobacco components, nicotine or the tobacco-specific carcinogen, 4-(methylnitrosoamino)-1-(3-pyridyl)-1-butanone (NNK), could activate the Akt pathway and increase lung cancer cell proliferation and survival. Nicotine or NNK, rapidly and potently, activated Akt in non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC) cells. Nicotinic activation of Akt increased phosphorylation of multiple downstream substrates of Akt in a time-dependent manner, including GSK-3, FKHR, tuberin, mTOR and S6K1. Since nicotine or NNK bind to cell surface nicotinic acetylcholine receptors (nAchR), we used RT-PCR to assess expression of nine alpha and three beta nAchR subunits in five NSCLC cell lines and two types of primary lung epithelial cells. NSCLC cells express multiple nAchR subunits in a cell line-specific manner. Agonists of alpha3/alpha4 or alpha7 subunits activated Akt in a time-dependent manner, suggesting that tobacco components utilize these subunits to activate Akt. Cellular outcomes after nicotine or NNK administration were also assessed. Nicotine or NNK increased proliferation of NSCLC cells in an Akt-dependent manner that was closely linked with changes in cyclin D1 expression. Despite similar induction of proliferation, only nicotine decreased apoptosis caused by serum deprivation and/or chemotherapy. Protection conferred by nicotine was NFkappaB-dependent. Collectively, these results identify tobacco component-induced, Akt-dependent proliferation and NFkappaB-dependent survival as cellular processes that could underlie the detrimental effects of smoking in cancer patients.

Short-term hyperthyroidism modulates adenosine receptors and catalytic activity of adenylate cyclase in adipocytes.

PubMed Central

Rapiejko, P J; Malbon, C C

1987-01-01

The effects of short-term hyperthyroidism in vivo on the status of the components of the fat-cell hormone-sensitive adenylate cyclase were investigated. The number of beta-adrenergic receptors was elevated by about 25% in membranes of fat-cells isolated from hyperthyroid rats as compared with euthyroid rats, but their affinity for radioligand was unchanged. Membranes of hyperthyroid-rat fat-cells displayed less than 65% of the normal complement of receptors for [3H]cyclohexyladenosine. The affinity of the receptors for this ligand was normal. In contrast with the marked increase in the amounts of the alpha-subunits of the guanine nucleotide-binding proteins Gi (Mr 41,000) and Go (Mr 39,000) observed in the hypothyroid state [Malbon, Rapiejko & Mangano (1985) J. Biol. Chem. 260, 2558-2564], the amounts of alpha-Gi, alpha-Go as well as alpha-Gs subunits [Mr 42,000 (major) and 46,000/48,000 (minor)] were not changed by hyperthyroidism. Adenylate cyclase activity in response to forskolin, guanosine 5'-[gamma-thio]triphosphate or isoprenaline, in contrast, was decreased by 30-50% in fat-cell membranes from hyperthyroid rats. Fat-cells isolated from hyperthyroid rats accumulated cyclic AMP to less than 50% of the extent in their euthyroid counterparts in the presence of adenosine deaminase and either adrenaline or forskolin, suggesting a decrease in the amount or activity of the catalytic subunit of adenylate cyclase. In the absence of exogenous adenosine deaminase, cyclic AMP accumulation in response to adrenaline was elevated rather than decreased in fat-cells from hyperthyroid rats. The inhibitory influence of adenosine is apparently limited in the hyperthyroid state by the decreased complement of inhibitory R-site purinergic receptors in these fat-cells. Short-term hyperthyroidism modulates the fat-cell adenylate cyclase system at the receptor level (beta-receptor number increased, R-site purinergic-receptor number decreased) and the catalytic subunit of adenylate cyclase. Images Fig. 2. PMID:3036073

The gene for human U2 snRNP auxiliary factor small 35-kDa subunit (U2AF1) maps to the progressive myoclonus epilepsy (EPM1) critical region on chromosome 21q22.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lalioti, M.D.; Rossier, C.; Antonarakis, S.E.

1996-04-15

We used targeted exon trapping to clone portions of genes from human chromosome 21q22.3. One trapped sequence showed complete homology with the cDNA of human U2AF{sup 35} (M96982; HGM-approved nomenclature U2AF1), which encodes for the small 35-kDa subunit of the U2 snRNP auxiliary factor. Using the U2AF1 cDNA as a probe, we mapped this gene to cosmid Q15D2, a P1, and YAC 350F7 of the Chumakov et al. contig, close to the cystathionine-{beta}-synthase gene (CBS) on 21q22.3. This localization was confirmed by PCR using oligonucleotides from the 3{prime} UTR and by FISH. As U2AF1 associated with a number of differentmore » factors during mRNA splicing, overexpression in trisomy 21 individuals could contribute to some Down syndrome phenotypes by interfering with the splicing process. Furthermore, because this gene maps in the critical region for the progressive myoclonus epilepsy I locus (EPM1), mutation analysis will be carried out in patients to evaluate the potential role of U2AF1 as a candidate for EPM1. 24 refs., 1 fig.« less

Proteinaceous toxins from three species of scorpaeniform fish (lionfish Pterois lunulata, devil stinger Inimicus japonicus and waspfish Hypodytes rubripinnis): close similarity in properties and primary structures to stonefish toxins.

PubMed

Kiriake, Aya; Suzuki, Yasuko; Nagashima, Yuji; Shiomi, Kazuo

2013-08-01

The crude toxins from three species of venomous fish (lionfish Pterois lunulata, devil stinger Inimicus japonicus and waspfish Hypodytes rubripinnis) belonging to the order Scorpaeniformes exhibited mouse-lethal, hemolytic, edema-forming and nociceptive activities. In view of the antigenic cross-reactivity with the stonefish toxins, the primary structures of the stonefish toxin-like toxins from the three scorpaeniform fish were determined by cDNA cloning using primers designed from the highly conserved sequences of the stonefish toxins. Based on the data obtained in gel filtration, immunoblotting and cDNA cloning, each toxin was judged to be a 160 kDa heterodimer composed of 80 kDa α- and β-subunits. The three scorpaeniform fish toxins contain a B30.2/SPRY domain (∼200 amino acid residues) in the C-terminal region of each subunit, as reported for the toxins from two species of lionfish and two species of stonefish. With respect to the amino acid sequence similarity, the scorpaeniform fish toxins are divided into the following two groups: toxins from three species of lionfish and those from devil stinger, two species of stonefish and waspfish. The phylogenetic tree generated also clearly supports the classification of the toxins. Copyright © 2013 Elsevier Ltd. All rights reserved.

The bark of Robinia pseudoacacia contains a complex mixture of lectins.Characterization of the proteins and the cDNA clones.

PubMed Central

Van Damme, E J; Barre, A; Smeets, K; Torrekens, S; Van Leuven, F; Rougé, P; Peumans, W J

1995-01-01

Two lectins were isolated from the inner bark of Robinia pseudoacacia (black locust). The first (and major) lectin (called RPbAI) is composed of five isolectins that originate from the association of 31.5- and 29-kD polypeptides into tetramers. In contrast, the second (minor) lectin (called RPbAII) is a hometetramer composed of 26-kD subunits. The cDNA clones encoding the polypeptides of RPbAI and RPbAII were isolated and their sequences determined. Apparently all three polypeptides are translated from mRNAs of approximately 1.2 kb. Alignment of the deduced amino acid sequences of the different clones indicates that the 31.5- and 29-kD RPbAI polypeptides show approximately 80% sequence identity and are homologous to the previously reported legume seed lectins, whereas the 26-kD RPbAII polypeptide shows only 33% sequence identity to the previously described legume lectins. Modeling the 31.5-kD subunit of RPbAI predicts that its three-dimensional structure is strongly related to the three-dimensional models that have been determined thus far for a few legume lectins. Southern blot analysis of genomic DNA isolated from Robinia has revealed that the Robinia bark lectins are the result of the expression of a small family of lectin genes. PMID:7716244

Arabidopsis cop8 and fus4 mutations define the same gene that encodes subunit 4 of the COP9 signalosome.

PubMed Central

Serino, G; Tsuge, T; Kwok, S; Matsui, M; Wei, N; Deng, X W

1999-01-01

The pleiotropic constitutive photomorphogenic/deetiolated/fusca (cop/det/fus) mutants of Arabidopsis exhibit features of light-grown seedlings when grown in the dark. Cloning and biochemical analysis of COP9 have revealed that it is a component of a multiprotein complex, the COP9 signalosome (previously known as the COP9 complex). Here, we compare the immunoaffinity and the biochemical purification of the COP9 signalosome from cauliflower and confirm its eight-subunit composition. Molecular cloning of subunit 4 of the complex revealed that it is a proteasome-COP9 complex-eIF3 domain protein encoded by a gene that maps to chromosome 5, near the chromosomal location of the cop8 and fus4 mutations. Genetic complementation tests showed that the cop8 and fus4 mutations define the same locus, now designated as COP8. Molecular analysis of the subunit 4-encoding gene in both cop8 and fus4 mutants identified specific molecular lesions, and overexpression of the subunit 4 cDNA in a cop8 mutant background resulted in complete rescue of the mutant phenotype. Thus, we conclude that COP8 encodes subunit 4 of the COP9 signalosome. Examination of possible molecular interactions by using the yeast two-hybrid assay indicated that COP8 is capable of strong self-association as well as interaction with COP9, FUS6/COP11, FUS5, and Arabidopsis JAB1 homolog 1, the latter four proteins being previously defined subunits of the Arabidopsis COP9 signalosome. A comparative sequence analysis indicated that COP8 is highly conserved among multicellular eukaryotes and is also similar to a subunit of the 19S regulatory particle of the 26S proteasome. PMID:10521526

Cloning and characterization of a Candida albicans maltase gene involved in sucrose utilization.

PubMed Central

Geber, A; Williamson, P R; Rex, J H; Sweeney, E C; Bennett, J E

1992-01-01

In order to isolate the structural gene involved in sucrose utilization, we screened a sucrose-induced Candida albicans cDNA library for clones expressing alpha-glucosidase activity. The C. albicans maltase structural gene (CAMAL2) was isolated. No other clones expressing alpha-glucosidase activity. were detected. A genomic CAMAL2 clone was obtained by screening a size-selected genomic library with the cDNA clone. DNA sequence analysis reveals that CAMAL2 encodes a 570-amino-acid protein which shares 50% identity with the maltase structural gene (MAL62) of Saccharomyces carlsbergensis. The substrate specificity of the recombinant protein purified from Escherichia coli identifies the enzyme as a maltase. Northern (RNA) analysis reveals that transcription of CAMAL2 is induced by maltose and sucrose and repressed by glucose. These results suggest that assimilation of sucrose in C. albicans relies on an inducible maltase enzyme. The family of genes controlling sucrose utilization in C. albicans shares similarities with the MAL gene family of Saccharomyces cerevisiae and provides a model system for studying gene regulation in this pathogenic yeast. Images PMID:1400249

Inefficiency in GM2 ganglioside elimination by human lysosomal beta-hexosaminidase beta-subunit gene transfer to fibroblastic cell line derived from Sandhoff disease model mice.

PubMed

Itakura, Tomohiro; Kuroki, Aya; Ishibashi, Yasuhiro; Tsuji, Daisuke; Kawashita, Eri; Higashine, Yukari; Sakuraba, Hitoshi; Yamanaka, Shoji; Itoh, Kohji

2006-08-01

Sandhoff disease (SD) is an autosomal recessive GM2 gangliosidosis caused by the defect of lysosomal beta-hexosaminidase (Hex) beta-subunit gene associated with neurosomatic manifestations. Therapeutic effects of Hex subunit gene transduction have been examined on Sandhoff disease model mice (SD mice) produced by the allelic disruption of Hexb gene encoding the murine beta-subunit. We demonstrate here that elimination of GM2 ganglioside (GM2) accumulated in the fibroblastic cell line derived from SD mice (FSD) did not occur when the HEXB gene only was transfected. In contrast, a significant increase in the HexB (betabeta homodimer) activity toward neutral substrates, including GA2 (asialo-GM2) and oligosaccharides carrying the terminal N-acetylglucosamine residues at their non-reducing ends (GlcNAc-oligosaccharides) was observed. Immunoblotting with anti-human HexA (alphabeta heterodimer) serum after native polyacrylamide gel electrophoresis (Native-PAGE) revealed that the human HEXB gene product could hardly form the chimeric HexA through associating with the murine alpha-subunit. However, co-introduction of the HEXA encoding the human alpha-subunit and HEXB genes caused significant corrective effect on the GM2 degradation by producing the human HexA. These results indicate that the recombinant human HexA could interspeciesly associate with the murine GM2 activator protein to degrade GM2 accumulated in the FSD cells. Thus, therapeutic effects of the recombinant human HexA isozyme but not human HEXB gene product could be evaluated by using the SD mice.

Transfer in SDS of biotinylated proteins from acrylamide gels to an avidin-coated membrane filter.

PubMed

Karlin, Arthur; Wang, Chaojian; Li, Jing; Xu, Qiang

2004-06-01

Avidin was covalently linked to aldehyde-derivatized polyethersulfone membrane filters. These filters were used in Western blot analysis of proteins reacted with biotinylation reagents and electrophoresed in sodium dodecyl sulfate (SDS) on polyacrylamide gels. Electrophoretic transfer from the gels to these filters was in 0.1% SDS, in which the covalently bound avidin retained its biotin-binding capacity. We compared Western blots on avidin-coated membrane filters of biotinylated and nonbiotinylated forms of mouse immunoglobulin G (IgG), mouse IgG heavy chain, muscle-type acetylcholine receptor alpha subunit, and fused alpha and beta subunits of receptor. Biotinylated proteins were captured with high specificity compared to their nonbiotinylated counterparts and sensitively detected on the avidin-coated membranes.

The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

PubMed

Chan, Y L; Paz, V; Olvera, J; Wool, I G

1993-04-30

The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

Memory in aged mice is rescued by enhanced expression of the GluN2B subunit of the NMDA receptor

PubMed Central

Brim, B. L.; Haskell, R.; Awedikian, R.; Ellinwood, N.M.; Jin, L.; Kumar, A.; Foster, T.C.; Magnusson, K.

2012-01-01

The GluN2B subunit of the N-methyl-D-aspartate (NMDA) receptor shows age-related declines in expression across the frontal cortex and hippocampus. This decline is strongly correlated to age-related memory declines. This study was designed to determine if increasing GluN2B subunit expression in the frontal lobe or hippocampus would improve memory in aged mice. Mice were injected bilaterally with either the GluN2B vector, containing cDNA specific for the GluN2B subunit and enhanced Green Fluorescent Protein (eGFP); a control vector or vehicle. Spatial memory, cognitive flexibility, and associative memory were assessed using the Morris water maze. Aged mice, with increased GluN2B subunit expression, exhibited improved long-term spatial memory, comparable to young mice. However, memory was rescued on different days in the Morris water maze; early for hippocampal GluN2B subunit enrichment and later for the frontal lobe. A higher concentration of the GluN2B antagonist, Ro 25-6981, was required to impair long-term spatial memory in aged mice with enhanced GluN2B expression, as compared to aged controls, suggesting there was an increase in the number of GluN2B-containing NMDA receptors. In addition, hippocampal slices from aged mice with increased GluN2B subunit expression exhibited enhanced NMDA receptor-mediated excitatory post-synaptic potentials (EPSP). Treatment with Ro 25-6981 showed that a greater proportion of the NMDA receptor-mediated EPSP was due to the GluN2B subunit in these animals, as compared to aged controls. These results suggest that increasing the production of the GluN2B subunit in aged animals enhances memory and synaptic transmission. Therapies that enhance GluN2B subunit expression within the aged brain may be useful for ameliorating age-related memory declines. PMID:23103326

All human Na(+)-K(+)-ATPase alpha-subunit isoforms have a similar affinity for cardiac glycosides.

PubMed

Wang, J; Velotta, J B; McDonough, A A; Farley, R A

2001-10-01

Three alpha-subunit isoforms of the sodium pump, which is the receptor for cardiac glycosides, are expressed in human heart. The aim of this study was to determine whether these isoforms have distinct affinities for the cardiac glycoside ouabain. Equilibrium ouabain binding to membranes from a panel of different human tissues and cell lines derived from human tissues was compared by an F statistic to determine whether a single population of binding sites or two populations of sites with different affinities would better fit the data. For all tissues, the single-site model fit the data as well as the two-site model. The mean equilibrium dissociation constant (K(d)) for all samples calculated using the single-site model was 18 +/- 6 nM (mean +/- SD). No difference in K(d) was found between nonfailing and failing human heart samples, although the maximum number of binding sites in failing heart was only approximately 50% of the number of sites in nonfailing heart. Measurement of association rate constants and dissociation rate constants confirmed that the binding affinities of the different human alpha-isoforms are similar to each other, although calculated K(d) values were lower than those determined by equilibrium binding. These results indicate both that the affinity of all human alpha-subunit isoforms for ouabain is similar and that the increased sensitivity of failing human heart to cardiac glycosides is probably due to a reduction in the number of pumps in the heart rather than to a selective inhibition of a subset of pumps with different affinities for the drugs.

Direct interaction of the inhibitory gamma-subunit of Rod cGMP phosphodiesterase (PDE6) with the PDE6 GAFa domains.

PubMed

Muradov, Khakim G; Granovsky, Alexey E; Schey, Kevin L; Artemyev, Nikolai O

2002-03-26

Retinal rod and cone cGMP phosphodiesterases (PDE6 family) function as the effector enzyme in the vertebrate visual transduction cascade. The activity of PDE6 catalytic subunits is controlled by the Pgamma-subunits. In addition to the inhibition of cGMP hydrolysis at the catalytic sites, Pgamma is known to stimulate a noncatalytic binding of cGMP to the regulatory GAFa-GAFb domains of PDE6. The latter role of Pgamma has been attributed to its polycationic region. To elucidate the structural basis for the regulation of cGMP binding to the GAF domains of PDE6, a photoexcitable peptide probe corresponding to the polycationic region of Pgamma, Pgamma-21-45, was specifically cross-linked to rod PDE6alphabeta. The site of Pgamma-21-45 cross-linking was localized to Met138Gly139 within the PDE6alpha GAFa domain using mass spectrometric analysis. Chimeras between PDE5 and cone PDE6alpha', containing GAFa and/or GAFb domains of PDE6alpha' have been generated to probe a potential role of the GAFb domains in binding to Pgamma. Analysis of the inhibition of the PDE5/PDE6alpha' chimeras by Pgamma supported the role of PDE6 GAFa but not GAFb domains in the interaction with Pgamma. Our results suggest that a direct binding of the polycationic region of Pgamma to the GAFa domains of PDE6 may lead to a stabilization of the noncatalytic cGMP-binding sites.

Calcium mobilization elicited by two types of nicotinic acetylcholine receptors in mouse substantia nigra pars compacta.

PubMed

Tsuneki, H; Klink, R; Léna, C; Korn, H; Changeux, J P

2000-07-01

Nicotinic acetylcholine receptors (nAChRs) are expressed in the midbrain ascending dopaminergic system, a target of many addictive drugs. Here we assessed the intracellular Ca2+ level by imaging fura-2-loaded cells in substantia nigra pars compacta in mouse brain slices, and we examined the influence on this level of prolonged exposures to nicotine using mice lacking the nAChR beta2-subunit. In control cells, superfusion with nicotine (10-100 microM) caused a long-lasting rise of intracellular Ca2+ level which depended on extracellular Ca2+. This nicotinic response was almost completely absent in beta2-/- mutant mice, leaving a small residual response to a high concentration (100 microM) of nicotine which was inhibited by the alpha7-subunit-selective antagonist, methyllycaconitine. Conversely, the alpha7-subunit-selective agonist choline (10 mM) caused a methyllycaconitine-sensitive increase in intracellular Ca2+ level both in wild-type and beta2-/- mutant mice. Nicotine-elicited Ca2+ mobilization was reduced by the Na+ channel blocker tetrodotoxin (TTX) and by T-type Ca2+ channel blocking agents, whereas the choline-elicited Ca2+ increase was insensitive to TTX. Neither nicotine nor choline produced Ca2+ increase following inhibition of the release of Ca2+ from intracellular stores by dantrolene. These results demonstrate that in nigral dopaminergic neurons, nicotine can elicit Ca2+ mobilization via activation of two distinct nAChR subtypes: that of beta2-subunit-containing nAChR followed by activation of Na+ channel and T-type Ca2+ channels, and/or activation of alpha7-subunit-containing nAChR. The Ca2+ influx due to nAChR activation is subsequently amplified by the recruitment of intracellular Ca2+ stores. This Ca2+ mobilization may possibly contribute to the long-term effects of nicotine on the dopaminergic system.

Ca2+ permeability through rat cloned alpha9-containing nicotinic acetylcholine receptors.

PubMed

Fucile, Sergio; Sucapane, Antonietta; Eusebi, Fabrizio

2006-04-01

We investigated the functional properties of rat alpha9 and alpha9alpha10 nicotinic acetylcholine receptors (nAChRs) expressed by transient transfection in the rat GH4C1 cell line, using both Ca(2+) imaging and whole-cell recording. Acute applications of ACh generated short-delay fast-rising and quick-decaying Ca(2+) transients, suppressed in Ca(2+)-free medium and invariably accompanied by the activation of whole-cell inward currents. The mean amplitude of ACh-induced currents was as small as -16 pA in alpha9 subunit cDNA-transfected GH4C1 cells (alpha9-GH4C1), while they were much larger (range: -150 to -300 pA) in alpha9alpha10 subunit cDNAs-transfected GH4C1 cells (alpha9alpha10-GH4C1). Currents were not activated by nicotine, were blocked by methyllycaconitine and were ACh concentration-dependent. Because the Ca(2+) permeability of alpha9-containing nAChRs has been estimated in immortalized cochlear UB/OC-2 mouse cells, we also characterized the ACh-induced responses in these cells. Unlike alpha9- and alpha9alpha10-GH4C1 cells, UB/OC-2 cells responded to ACh with both long-delay methyllycaconitine-insensitive whole-cell currents and long-lasting Ca(2+) transients, the latter being detected in the absence of Ca(2+) in the extracellular medium and being suppressed by the Ca(2+)-ATPase inhibitor thapsigargin, known to deplete IP(3)-sensitive stores. These results indicated the involvement of muscarinic nAChRs and the lack of functional ACh-gated receptor channels in UB/OC-2 cells. Thus, we measured the fractional Ca(2+) current (P(f), i.e. the percentage of total current carried by Ca(2+) ions) in alpha9alpha10-GH4C1, obtaining a P(f) value of 22 +/- 4%; this is the largest value estimated to date for a ligand-gated receptor channel. The physiological role played by Ca(2+) entry through alpha9-containing nAChRs gated by ACh is discussed.

Functional conservation of RNA polymerase II in fission and budding yeasts.

PubMed

Shpakovski, G V; Gadal, O; Labarre-Mariotte, S; Lebedenko, E N; Miklos, I; Sakurai, H; Proshkin, S A; Van Mullem, V; Ishihama, A; Thuriaux, P

2000-02-04

The complementary DNAs of the 12 subunits of fission yeast (Schizosaccharomyces pombe) RNA polymerase II were expressed from strong promoters in Saccharomyces cerevisiae and tested for heterospecific complementation by monitoring their ability to replace in vivo the null mutants of the corresponding host genes. Rpb1 and Rpb2, the two largest subunits and Rpb8, a small subunit shared by all three polymerases, failed to support growth in S. cerevisiae. The remaining nine subunits were all proficient for heterospecific complementation and led in most cases to a wild-type level of growth. The two alpha-like subunits (Rpb3 and Rpb11), however, did not support growth at high (37 degrees C) or low (25 degrees C) temperatures. In the case of Rpb3, growth was restored by increasing the gene dosage of the host Rpb11 or Rpb10 subunits, confirming previous evidence of a close genetic interaction between these three subunits. Copyright 2000 Academic Press.

Modal gating of muscle nicotinic acetylcholine receptors

NASA Astrophysics Data System (ADS)

Vij, Ridhima

Many ion channels exhibit multiple patterns of kinetic activity in single-channel currents. This behavior is rare in WT mouse muscle nicotinic acetylcholine receptors (AChRs), where A2C↔A2O gating events are well-described by single exponentials. Also, single-channel open probability (PO) is essentially homogeneous at a given agonist concentration in the WT receptors. Here I report that perturbations of almost all the residues in loop C (alpha188-alpha199, at the agonist binding site) generate heterogeneity in PO ('modes'). Such unsettled activity was apparent with an alanine substitution at all positions in loop C (except alphaY190 and alphaY198) and with different side chain substitutions at alphaP197 for both adult- and fetal-type AChRs. I used single channel electrophysiology along with site-directed mutagenesis to study modal gating in AChRs consequent to mutations/deletions in loop C. The multiple patterns of kinetic activity arose from the difference in agonist affinity rather than in intrinsic AChR gating. Out of the four different agonists used to study the modal behavior, acetylcholine (ACh) showed a higher degree of kinetic heterogeneity compared to others. The time constant for switching between modes was long (~mins), suggesting that they arise from alternative, stable protein conformations. By studying AChRs having only 1 functional binding site, I attempted to find the source of the affinity difference, which was traced mainly to the alphadelta agonist site. Affinity at the neurotransmitter binding site is mainly determined by a core of five aromatic residues (alphaY93, alphaW149, alphaY190, alphaY198 and deltaW57). Phenylalanine substitutions at all aromatic residues except alphaY93 resulted in elimination of modes. Modes were also eliminated by alanine mutation at deltaW57 on the complementary side but not at other aromatics. Also, by substituting four gamma subunit residues into the delta subunit on the complementary beta sheet, I found that modes were reduced. Based on our results, we propose that WT loop C has an important role in determining resting affinity, in part by making stable interactions with the complementary surface of the alphadelta binding pocket. We suggest a possible structural basis for the fluctuations caused by loop C perturbations and propose that at the alphadelta agonist binding site, both loop C and the complementary subunit surface can adopt alternative conformations and interact with each other with respect to the aromatic core, to cause the variations in affinity.

Localization of yeast RNA polymerase I core subunits by immunoelectron microscopy.

PubMed Central

Klinger, C; Huet, J; Song, D; Petersen, G; Riva, M; Bautz, E K; Sentenac, A; Oudet, P; Schultz, P

1996-01-01

Immunoelectron microscopy was used to determine the spatial organization of the yeast RNA polymerase I core subunits on a three-dimensional model of the enzyme. Images of antibody-labeled enzymes were compared with the native enzyme to determine the localization of the antibody binding site on the surface of the model. Monoclonal antibodies were used as probes to identify the two largest subunits homologous to the bacterial beta and beta' subunits. The epitopes for the two monoclonal antibodies were mapped using subunit-specific phage display libraries, thus allowing a direct correlation of the structural data with functional information on conserved sequence elements. An epitope close to conserved region C of the beta-like subunit is located at the base of the finger-like domain, whereas a sequence between conserved regions C and D of the beta'-like subunit is located in the apical region of the enzyme. Polyclonal antibodies outlined the alpha-like subunit AC40 and subunit AC19 which were found co-localized also in the apical region of the enzyme. The spatial location of the subunits is correlated with their biological activity and the inhibitory effect of the antibodies. Images PMID:8887555

Molecular cloning of rock bream (Oplegnathus fasciatus) tumor necrosis factor-alpha and its effect on the respiratory burst activity of phagocytes.

PubMed

Kim, Min Sun; Hwang, Yoon Jung; Yoon, Ki Joon; Zenke, Kosuke; Nam, Yoon Kwon; Kim, Sung Koo; Kim, Ki Hong

2009-11-01

Rock bream (Oplegnathus fasciatus) tumor necrosis factor-alpha (rbTNF-alpha) gene was cloned, recombinantly produced, and the effect of the recombinant rbTNF-alpha on the respiratory burst activity of rock bream phagocytes was analyzed. Structurally, genomic DNA of rbTNF-alpha was comprised with four exons and three introns, and deduced amino acid sequence of its cDNA possessed the TNF family signature, a transmembrane domain, a protease cleavage site, and two cysteine residues, which are the typical characteristics of TNF-alpha gene in mammals and fish. The chemiluminescent (CL) response of rock bream phagocytes was significantly enhanced by pre-incubation with recombinant rbTNF-alpha, when opsonized zymosan was used as a stimulant of the respiratory burst. However, CL enhancing effect of the recombinant rbTNF-alpha was very weak when the respiratory burst activity of phagocytes was triggered with phorbol-12-myristate-13-acetate (PMA) instead of zymosan. These results suggest that rock bream TNF-alpha might have an ability to prime the respiratory burst activity of phagocytes against receptor-mediated phagocytosis inducing stimulants, such as zymosan, but have little ability against stimulants not accompanying receptor-mediated phagocytosis.

Behavior of a cloned murine interferon alpha/beta receptor expressed in homospecific or heterospecific background.

PubMed

Uzé, G; Lutfalla, G; Bandu, M T; Proudhon, D; Mogensen, K E

1992-05-15

A murine interferon (IFN) alpha/beta receptor was cloned from the IFN-sensitive L1210 cell line on the basis of its homology with the human receptor. A combination of methods that includes the screening of random-primed and oligo(dT)-primed cDNA libraries and polymerase chain reactions with a single-side specificity was used. At the amino acid level, the murine IFN-alpha/beta shows 46% identity with its human counterpart. Both human WISH cells presenting a low sensitivity to mouse IFN and a murine L1210 mutant subline that does not express the receptor have been stably transfected with the murine IFN-alpha/beta receptor. Whereas transfected human cells became sensitive to a limited number of mouse IFN-alpha/beta subtypes, the transfected murine L1210 mutant was found to be fully complemented and became sensitive to all mouse IFN-alpha/beta subtypes tested, including those that were not active on transfected human cells. These results strongly suggest that the receptor described here is implicated in the mediation of the activities of all murine IFN-alpha/beta subtypes.

Escaping introns in COI through cDNA barcoding of mushrooms: Pleurotus as a test case.

PubMed

Avin, Farhat A; Subha, Bhassu; Tan, Yee-Shin; Braukmann, Thomas W A; Vikineswary, Sabaratnam; Hebert, Paul D N

2017-09-01

DNA barcoding involves the use of one or more short, standardized DNA fragments for the rapid identification of species. A 648-bp segment near the 5' terminus of the mitochondrial cytochrome c oxidase subunit I (COI) gene has been adopted as the universal DNA barcode for members of the animal kingdom, but its utility in mushrooms is complicated by the frequent occurrence of large introns. As a consequence, ITS has been adopted as the standard DNA barcode marker for mushrooms despite several shortcomings. This study employed newly designed primers coupled with cDNA analysis to examine COI sequence diversity in six species of Pleurotus and compared these results with those for ITS. The ability of the COI gene to discriminate six species of Pleurotus , the commonly cultivated oyster mushroom, was examined by analysis of cDNA. The amplification success, sequence variation within and among species, and the ability to design effective primers was tested. We compared ITS sequences to their COI cDNA counterparts for all isolates. ITS discriminated between all six species, but some sequence results were uninterpretable, because of length variation among ITS copies. By comparison, a complete COI sequences were recovered from all but three individuals of Pleurotus giganteus where only the 5' region was obtained. The COI sequences permitted the resolution of all species when partial data was excluded for P. giganteus . Our results suggest that COI can be a useful barcode marker for mushrooms when cDNA analysis is adopted, permitting identifications in cases where ITS cannot be recovered or where it offers higher resolution when fresh tissue is. The suitability of this approach remains to be confirmed for other mushrooms.

Molecular cloning and characterization of an acetylcholinesterase cDNA in the brown planthopper, Nilaparvata lugens.

PubMed

Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

2010-01-01

A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain.

Molecular basis for zinc potentiation at strychnine-sensitive glycine receptors.

PubMed

Miller, Paul S; Da Silva, Helena M A; Smart, Trevor G

2005-11-11

The divalent cation Zn(2+) is a potent potentiator at the strychnine-sensitive glycine receptor (GlyR). This occurs at nanomolar concentrations, which are the predicted endogenous levels of extracellular neuronal Zn(2+). Using structural modeling and functional mutagenesis, we have identified the molecular basis for the elusive Zn(2+) potentiation site on GlyRs and account for the differential sensitivity of GlyR alpha(1) and GlyR alpha(2) to Zn(2+) potentiation. In addition, juxtaposed to this Zn(2+) site, which is located externally on the N-terminal domain of the alpha subunit, another residue was identified in the nearby Cys loop, a region that is critical for receptor gating in all Cys loop ligand-gated ion channels. This residue acted as a key control element in the allosteric transduction pathway for Zn(2+) potentiation, enabling either potentiation or overt inhibition of receptor activation depending upon the moiety resident at this location. Overall, we propose that Zn(2+) binds to a site on the extracellular outer face of the GlyR alpha subunit and exerts its positive allosteric effect via an interaction with the Cys loop to increase the efficacy of glycine receptor gating.

Class IA phosphoinositide 3-kinase regulates heart size and physiological cardiac hypertrophy.

PubMed

Luo, Ji; McMullen, Julie R; Sobkiw, Cassandra L; Zhang, Li; Dorfman, Adam L; Sherwood, Megan C; Logsdon, M Nicole; Horner, James W; DePinho, Ronald A; Izumo, Seigo; Cantley, Lewis C

2005-11-01

Class I(A) phosphoinositide 3-kinases (PI3Ks) are activated by growth factor receptors, and they regulate, among other processes, cell growth and organ size. Studies using transgenic mice overexpressing constitutively active and dominant negative forms of the p110alpha catalytic subunit of class I(A) PI3K have implicated the role of this enzyme in regulating heart size and physiological cardiac hypertrophy. To further understand the role of class I(A) PI3K in controlling heart growth and to circumvent potential complications from the overexpression of dominant negative and constitutively active proteins, we generated mice with muscle-specific deletion of the p85alpha regulatory subunit and germ line deletion of the p85beta regulatory subunit of class I(A) PI3K. Here we show that mice with cardiac deletion of both p85 subunits exhibit attenuated Akt signaling in the heart, reduced heart size, and altered cardiac gene expression. Furthermore, exercise-induced cardiac hypertrophy is also attenuated in the p85 knockout hearts. Despite such defects in postnatal developmental growth and physiological hypertrophy, the p85 knockout hearts exhibit normal contractility and myocardial histology. Our results therefore provide strong genetic evidence that class I(A) PI3Ks are critical regulators for the developmental growth and physiological hypertrophy of the heart.

Proteomics of a new esophageal cancer cell line established from Persian patient.

PubMed

Moghanibashi, Mehdi; Jazii, Ferdous Rastgar; Soheili, Zahra-Soheila; Zare, Maryam; Karkhane, Aliasghar; Parivar, Kazem; Mohamadynejad, Parisa

2012-05-25

Although the highest incidence of esophageal squamous cell carcinoma (ESCC) has repeatedly been reported from Persia (Iran), nevertheless the so far proteomic published reports were limited to one study on tissue specimens. Here we report the proteome of a newly established cell line from Persian ESCC patients and compare it with the normal primary cell proteome. Among polypeptides, whose expression was different in cell line sixteen polypeptides were identified by MALDI/TOF/TOF spectrometry. S100-A8 protein, annexin A1, annexin A2, regulatory subunit of calpain, subunit alpha type-3 of proteasome and glutamate dehydrogenase 1 were proteins down-regulated in cell line while peroxiredoxin-5, non-muscle myosin light polypeptide 6, keratin 1, annexin A4, keratin 8, tropomyosin 3, stress-induced-phosphoprotein 1 and albumin were found to be subject of up-regulation in cell line compared to the primary normal cells. The proteomic results were further verified by western blotting and RT-PCR on annexin A1 and keratin 8. In addition, among the aforementioned proteins, glutamate dehydrogenase 1, regulatory subunit of calpain, subunit alpha of type-3 proteasome and annexin A4 are proteins whose deregulation in ESCC is reported for the first time by this study. Copyright © 2012 Elsevier B.V. All rights reserved.

Cloning and characterization of p52, the fifth subunit of the core of the transcription/DNA repair factor TFIIH.

PubMed Central

Marinoni, J C; Roy, R; Vermeulen, W; Miniou, P; Lutz, Y; Weeda, G; Seroz, T; Gomez, D M; Hoeijmakers, J H; Egly, J M

1997-01-01

TFIIH is a multiprotein factor involved in transcription and DNA repair and is implicated in DNA repair/transcription deficiency disorders such as xeroderma pigmentosum, Cockayne syndrome and trichothiodystrophy. Eight out of the nine genes encoding the subunits forming TFIIH have already been cloned. We report here the identification, cDNA cloning and gene structure of the 52 kDa polypeptide and its homology with the yeast counterpart TFB2. This protein, along with p89/XPB, p62, p44 and p34, forms the core of TFIIH. Moreover, using in vitro reconstituted transcription and nucleotide excision repair (NER) assays and microinjection experiments, we demonstrate that p52 is directly involved in both transcription and DNA repair mechanisms in vitro and in vivo. PMID:9118947

Purification and characterization of a casein kinase 2-type protein kinase from pea nuclei

NASA Technical Reports Server (NTRS)

Li, H.; Roux, S. J.

1992-01-01

Almost all the polyamine-stimulated protein kinase activity associated with the chromatin fraction of nuclei purified from etiolated pea (Pisum sativum L.) plumules is present in a single enzyme that can be extracted from chromatin by 0.35 molar NaCl. This protein kinase can be further purified over 2000-fold by salt fractionation and anion-exchange and casein-agarose column chromatography, after which it is more than 90% pure. The purified kinase has a specific activity of about 650 nanomoles per minute per milligram protein in the absence of polyamines, with either ATP or GTP as phosphoryl donor. Spermidine can stimulate its activity fourfold, with half-maximal activation at about 2 millimolar. Spermine and putrescine also stimulate activity, although somewhat less effectively. This kinase has a tetrameric alpha 2 beta 2 structure with a native molecular weight of 130,000, and subunit molecular weights of 36,000 for the catalytic subunit (alpha) and 29,000 for the regulatory subunit (beta). In western blot analyses, only the alpha subunit reacts strongly with polyclonal antibodies to a Drosophila casein kinase II. The pea kinase can use casein and phosvitin as artificial substrates, phosphorylating both the serine and threonine residues of casein. It has a pH optimum near 8.0, a Vmax of 1.5 micromoles per minute per milligram protein, and a Km for ATP of approximately 75 micromolar. Its activity can be almost completely inhibited by heparin at 5 micrograms per milliliter, but is relatively insensitive to concentrations of staurosporine, K252a, and chlorpromazine that strongly antagonize Ca(2+) -regulated protein kinases. These results are discussed in relation to recent findings that casein kinase 2-type kinases may phosphorylate trans-acting factors that bind to light-regulated promoters in plants.

The disaggregation theory of signal transduction revisited: further evidence that G proteins are multimeric and disaggregate to monomers when activated.

PubMed

Jahangeer, S; Rodbell, M

1993-10-01

We have compared the sedimentation rates on sucrose gradients of the heterotrimeric GTP-binding regulatory (G) proteins Gs, G(o), Gi, and Gq extracted from rat brain synaptoneurosomes with Lubrol and digitonin. The individual alpha and beta subunits were monitored with specific antisera. In all cases, both subunits cosedimented, indicating that the subunits are likely complexed as heterotrimers. When extracted with Lubrol all of the G proteins sedimented with rates of about 4.5 S (consistent with heterotrimers) whereas digitonin extracted 60% of the G proteins with peaks at 11 S; 40% pelleted as larger structures. Digitonin-extracted Gi was cross-linked by p-phenylenedimaleimide, yielding structures too large to enter polyacrylamide gels. No cross-linking of Lubrol-extracted Gi occurred. Treatment of the membranes with guanosine 5'-[gamma-thio]triphosphate and Mg2+ yielded digitonin-extracted structures with peak sedimentation values of 8.5 S--i.e., comparable to that of purified G(o) in digitonin and considerably larger than the Lubrol-extracted 2S structures representing the separated alpha and beta gamma subunits formed by the actions of guanosine 5'-[gamma-thio]triphosphate. It is concluded that the multimeric structures of G proteins in brain membranes are at least partially preserved in digitonin and that activation of these structures in membranes yields monomers of G proteins rather than the disaggregated products (alpha and beta gamma complexes) observed in Lubrol. It is proposed that hormones and GTP affect the dynamic interplay between multimeric G proteins and receptors in a fashion analogous to the actions of ATP on the dynamic interactions between myosin and actin filaments. Signal transduction is mediated by activated monomers released from the multimers during the activation process.

The disaggregation theory of signal transduction revisited: further evidence that G proteins are multimeric and disaggregate to monomers when activated.

PubMed Central

Jahangeer, S; Rodbell, M

1993-01-01

We have compared the sedimentation rates on sucrose gradients of the heterotrimeric GTP-binding regulatory (G) proteins Gs, G(o), Gi, and Gq extracted from rat brain synaptoneurosomes with Lubrol and digitonin. The individual alpha and beta subunits were monitored with specific antisera. In all cases, both subunits cosedimented, indicating that the subunits are likely complexed as heterotrimers. When extracted with Lubrol all of the G proteins sedimented with rates of about 4.5 S (consistent with heterotrimers) whereas digitonin extracted 60% of the G proteins with peaks at 11 S; 40% pelleted as larger structures. Digitonin-extracted Gi was cross-linked by p-phenylenedimaleimide, yielding structures too large to enter polyacrylamide gels. No cross-linking of Lubrol-extracted Gi occurred. Treatment of the membranes with guanosine 5'-[gamma-thio]triphosphate and Mg2+ yielded digitonin-extracted structures with peak sedimentation values of 8.5 S--i.e., comparable to that of purified G(o) in digitonin and considerably larger than the Lubrol-extracted 2S structures representing the separated alpha and beta gamma subunits formed by the actions of guanosine 5'-[gamma-thio]triphosphate. It is concluded that the multimeric structures of G proteins in brain membranes are at least partially preserved in digitonin and that activation of these structures in membranes yields monomers of G proteins rather than the disaggregated products (alpha and beta gamma complexes) observed in Lubrol. It is proposed that hormones and GTP affect the dynamic interplay between multimeric G proteins and receptors in a fashion analogous to the actions of ATP on the dynamic interactions between myosin and actin filaments. Signal transduction is mediated by activated monomers released from the multimers during the activation process. Images Fig. 1 Fig. 2 PMID:8415607

Dendritic mRNA targeting and translation.

PubMed

Kindler, Stefan; Kreienkamp, Hans-Jürgen

2012-01-01

Selective targeting of specific mRNAs into neuronal dendrites and their locally regulated translation at particular cell contact sites contribute to input-specific synaptic plasticity. Thus, individual synapses become decision-making units, which control gene expression in a spatially restricted and nucleus-independent manner. Dendritic targeting of mRNAs is achieved by active, microtubule-dependent transport. For this purpose, mRNAs are packaged into large ribonucleoprotein (RNP) particles containing an array of trans-acting RNA-binding proteins. These are attached to molecular motors, which move their RNP cargo into dendrites. A variety of proteins may be synthesized in dendrites, including signalling and scaffold proteins of the synapse and neurotransmitter receptors. In some cases, such as the alpha subunit of the calcium/calmodulin-dependent protein kinase II (αCaMKII) and the activity-regulated gene of 3.1 kb (Arg3.1, also referred to as activity-regulated cDNA, Arc), their local synthesis at synapses can modulate long-term changes in synaptic efficiency. Local dendritic translation is regulated by several signalling cascades including Akt/mTOR and Erk/MAP kinase pathways, which are triggered by synaptic activity. More recent findings show that miRNAs also play an important role in protein synthesis at synapses. Disruption of local translation control at synapses, as observed in the fragile X syndrome (FXS) and its mouse models and possibly also in autism spectrum disorders, interferes with cognitive abilities in mice and men.

Pharmacological Cyclophilin Inhibitors Prevent Intoxication of Mammalian Cells with Bordetella pertussis Toxin.

PubMed

Ernst, Katharina; Eberhardt, Nina; Mittler, Ann-Katrin; Sonnabend, Michael; Anastasia, Anna; Freisinger, Simon; Schiene-Fischer, Cordelia; Malešević, Miroslav; Barth, Holger

2018-05-01

The Bordetella pertussis toxin (PT) is one important virulence factor causing the severe childhood disease whooping cough which still accounted for approximately 63,000 deaths worldwide in children in 2013. PT consists of PTS1, the enzymatically active (A) subunit and a non-covalently linked pentameric binding/transport (B) subunit. After endocytosis, PT takes a retrograde route to the endoplasmic reticulum (ER), where PTS1 is released into the cytosol. In the cytosol, PTS1 ADP-ribosylates inhibitory alpha subunits of trimeric GTP-binding proteins (Giα) leading to increased cAMP levels and disturbed signalling. Here, we show that the cyclophilin (Cyp) isoforms CypA and Cyp40 directly interact with PTS1 in vitro and that Cyp inhibitors cyclosporine A (CsA) and its tailored non-immunosuppressive derivative VK112 both inhibit intoxication of CHO-K1 cells with PT, as analysed in a morphology-based assay. Moreover, in cells treated with PT in the presence of CsA, the amount of ADP-ribosylated Giα was significantly reduced and less PTS1 was detected in the cytosol compared to cells treated with PT only. The results suggest that the uptake of PTS1 into the cytosol requires Cyps. Therefore, CsA/VK112 represent promising candidates for novel therapeutic strategies acting on the toxin level to prevent the severe, life-threatening symptoms caused by PT.

Expression of the pituitary transcription factor Ptx-1, but not that of the trans-activating factor prop-1, is reduced in human corticotroph adenomas and is associated with decreased alpha-subunit secretion.

PubMed

Skelly, R H; Korbonits, M; Grossman, A; Besser, G M; Monson, J P; Geddes, J F; Burrin, J M

2000-07-01

We have studied the expression of the pituitary transcription factors Ptx-1 and Prop-1 in a series of 34 pituitary adenomas fully characterized for in vitro hormone secretion and histological staining. In studies involving mammalian cell lines, the pituitary transcription factor Ptx-1 has been shown to be a pituitary hormone panactivator, whereas more recent studies have shown that it plays an important role in alpha-subunit gene expression. Its expression has not been examined previously in human pituitary adenomas characterized by in vitro hormone secretory profiles. Of the 34 pituitary adenomas studied, Ptx-1 expression was reduced by more than 50% compared to that of the housekeeping gene human glyceraldehyde-3-phosphate dehydrogenase in the 6 corticotroph adenomas, which also had significantly reduced alpha-subunit production (all 6 tumors secreting < or =0.5 ng/24 h). Mutations of the pituitary transcription factor Prop-1, which is responsible for the syndrome of Ames dwarfism in mice, are being increasingly recognized as a cause of combined pituitary hormone deficiency in humans, although ACTH deficiency has been described only once. Prop-1 expression was detected in all 34 pituitary adenomas, including 6 corticotroph adenomas and 5 gonadotroph adenomas. The expression of Prop-1 has not been described previously in these cell phenotypes.

Molecular characterization of a gene POLR2H encoded an essential subunit for RNA polymerase II from the Giant Panda (Ailuropoda Melanoleuca).

PubMed

Du, Yu-Jie; Hou, Yi-Ling; Hou, Wan-Ru

2013-02-01

The Giant Panda is an endangered and valuable gene pool in genetic, its important functional gene POLR2H encodes an essential shared peptide H of RNA polymerases. The genomic DNA and cDNA sequences were cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) adopting touchdown-PCR and reverse transcription polymerase chain reaction (RT-PCR), respectively. The length of the genomic sequence of the Giant Panda is 3,285 bp, including five exons and four introns. The cDNA fragment cloned is 509 bp in length, containing an open reading frame of 453 bp encoding 150 amino acids. Alignment analysis indicated that both the cDNA and its deduced amino acid sequence were highly conserved. Protein structure prediction showed that there was one protein kinase C phosphorylation site, four casein kinase II phosphorylation sites and one amidation site in the POLR2H protein, further shaping advanced protein structure. The cDNA cloned was expressed in Escherichia coli, which indicated that POLR2H fusion with the N-terminally His-tagged form brought about the accumulation of an expected 20.5 kDa polypeptide in line with the predicted protein. On the basis of what has already been achieved in this study, further deep-in research will be conducted, which has great value in theory and practical significance.

The identification of cellular targets of 17β estradiol using a lytic (T7) cDNA phage display approach.

PubMed

Van Dorst, Bieke; Mehta, Jaytry; Rouah-Martin, Elsa; De Coen, Wim; Blust, Ronny; Robbens, Johan

2011-02-01

To unravel the mechanism of action of chemical compounds, it is crucial to know their cellular targets. A novel in vitro tool that can be used as a fast, simple and cost effective alternative is cDNA phage display. This tool is used in our study to select cellular targets of 17β estradiol (E2). It was possible to select two potential cellular targets of E2 out of the T7 Select™ Human Breast cDNA phage library. The selected cellular targets, autophagy/beclin-1 regulator 1 (beclin 1) and ATP synthase F(0) subunit 6 (ATP6) have so far been unknown as binding proteins of E2. To confirm the E2 binding properties of these selected proteins, surface plasmon resonance (SPR) was used. With SPR the K(d) values were determined to be 0.178±0.031 and 0.401±0.142 nM for the ATP6 phage and beclin 1 phage, respectively. These K(d) values in the low nM range verify that the selected cellular proteins are indeed binding proteins for E2. The selection and identification of these two potential cellular targets of E2, can enhance our current understanding of its mechanism of action. This illustrates the potential of lytic (T7) cDNA phage display in toxicology, to provide important information about cellular targets of chemical compounds. Copyright © 2010 Elsevier Ltd. All rights reserved.

T-cell receptor accessory and co-receptor molecules in channel catfish

USDA-ARS?s Scientific Manuscript database

T cell receptor (TCR) associated invariant chains CD3gamma/delta,epsilon, and zeta as well as TCR co-receptors CD8alpha and CD8beta were isolated from the channel catfish, Ictalurus punctatus, at both the gene and cDNA levels. All of catfish CD3 sequences encode for proteins that resemble their resp...

Isolation and characterization of a presynaptic neurotoxin, P-elapitoxin-Bf1a from Malaysian Bungarus fasciatus venom.

PubMed

Rusmili, Muhamad Rusdi Ahmad; Yee, Tee Ting; Mustafa, Mohd Rais; Hodgson, Wayne C; Othman, Iekhsan

2014-10-01

Presynaptic neurotoxins are one of the major components in Bungarus venom. Unlike other Bungarus species that have been studied, β-bungarotoxin has never been isolated from Bungarus fasciatus venom. It was hypothesized that the absence of β-bungarotoxin in this species was due to divergence during evolution prior to evolution of β-bungarotoxin. In this study, we have isolated a β-bungarotoxin isoform we named P-elapitoxin-Bf1a by using gel filtration, cation-exchange and reverse-phase chromatography from Malaysian B. fasciatus venom. The toxin consists of two heterogeneous subunits, subunit A and subunit B. LCMS/MS data showed that subunit A was homologous to acidic phospholipase A2 subunit A3 from Bungarus candidus and B. multicinctus venoms, whereas subunit B was homologous with subunit B1 from B. fasciatus venom that was previously detected by cDNA cloning. The toxin showed concentration- and time-dependent reduction of indirect-twitches without affecting contractile responses to ACh, CCh or KCl at the end of experiment in the chick biventer preparation. Toxin modification with 4-BPB inhibited the neurotoxic effect suggesting the importance of His-48. Tissue pre-incubation with monovalent B. fasciatus (BFAV) or neuro-polyvalent antivenom (NPV), at the recommended titer, was unable to inhibit the twitch reduction induced by the toxin. This study indicates that Malaysian B. fasciatus venom has a unique β-bungarotoxin isoform which was not neutralized by antivenoms. This suggests that there might be other presynaptic neurotoxins present in the venom and there is a variation in the enzymatic neurotoxin composition in venoms from different localities. Copyright © 2014 Elsevier Inc. All rights reserved.

Resistance of alpha-crystallin quaternary structure to UV irradiation.

PubMed

Krivandin, A V; Muranov, K O; Yakovlev, F Yu; Poliansky, N B; Wasserman, L A; Ostrovsky, M A

2009-06-01

The damaging effect of UV radiation (lambda > 260 nm) on bovine alpha-crystallin in solution was studied by small-angle X-ray scattering, gel permeation chromatography, electrophoresis, absorption and fluorescence spectroscopy, and differential scanning calorimetry. The results obtained show that damage to even a large number of subunits within an alpha-crystallin oligomer does not cause significant rearrangement of its quaternary structure, aggregation of oligomers, or the loss of their solubility. Due to the high resistance of its quaternary structure, alpha-crystallin is able to prevent aggregation of destabilized proteins (especially of gamma- and beta-crystallins) and so to maintain lens transparency throughout the life of an animal (the chaperone-like function of alpha-crystallin).

Structural characterization by NMR of the natively unfolded extracellular domain of beta-dystroglycan: toward the identification of the binding epitope for alpha-dystroglycan.

PubMed

Bozzi, Manuela; Bianchi, Marzia; Sciandra, Francesca; Paci, Maurizio; Giardina, Bruno; Brancaccio, Andrea; Cicero, Daniel O

2003-11-25

Dystroglycan (DG) is an adhesion molecule playing a crucial role for tissue stability during both early embriogenesis and adulthood and is composed by two tightly interacting subunits: alpha-DG, membrane-associated and highly glycosylated, and the transmembrane beta-DG. Recently, by solid-phase binding assays and NMR experiments, we have shown that the C-terminal domain of alpha-DG interacts with a recombinant extracellular fragment of beta-DG (positions 654-750) independently from glycosylation and that the linear binding epitope is located between residues 550 and 565 of alpha-DG. In order to elucidate which moieties of beta-DG are specifically involved in the complex with alpha-DG, the ectodomain has been recombinantly expressed and purified in a labeled ((13)C,(15)N) form and studied by multidimensional NMR. Although it represents a natively unfolded protein domain, we obtained an almost complete backbone assignment. Chemical shift index, (1)H-(15)N heteronuclear single-quantum coherence and nuclear Overhauser effect (HSQC-NOESY) spectra and (3)J(HN,H)(alpha) coupling constant values confirm that this protein is highly disordered, but (1)H-(15)N steady-state NOE experiments indicate that the protein presents two regions of different mobility. The first one, between residues 659 and 722, is characterized by a limited degree of mobility, whereas the C-terminal portion, containing about 30 amino acids, is highly flexible. The binding of beta-DG(654-750) to the C-terminal region of the alpha subunit, alpha-DG(485-620), has been investigated, showing that the region of beta-DG(654-750) between residues 691 and 719 is involved in the interaction.

Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

PubMed

Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

2008-11-21

Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

A G protein alpha null mutation confers prolificacy potential in maize

DOE PAGES

Urano, Daisuke; Jackson, David; Jones, Alan M.

2015-05-06

Plasticity in plant development is controlled by environmental signals through largely unknown signalling networks. Signalling coupled by the heterotrimeric G protein complex underlies various developmental pathways in plants. The morphology of two plastic developmental pathways, root system architecture and female inflorescence formation, was quantitatively assessed in a mutant compact plant 2 (ct2) lacking the alpha subunit of the heterotrimeric G protein complex in maize. The ct2 mutant partially compensated for a reduced shoot height by increased total leaf number, and had far more ears, even in the presence of pollination signals. Lastly, the maize heterotrimeric G protein complex is importantmore » in some plastic developmental traits in maize. In particular, the maize Gα subunit is required to dampen the overproduction of female inflorescences.« less

[The alpha2delta subunit of the voltage-dependent calcium channel. A new pharmaceutical target for psychiatry and neurology].

PubMed

Wedekind, D; Bandelow, B

2005-07-01

Calcium channel blockers are substances used for treating high blood pressure and coronary heart disease. New medications have been developed that modulate calcium channels but also show promise in psychiatric and neurologic applications. Gabapentin and pregabalin bind to a subunit of calcium channels--the alpha2delta receptors--thereby reducing calcium influx to neurons. As a result, less glutamate is released from nerve endings that use excitatory amino acids as transmitters. This in turn reduces substance P-related activation of AMPA heteroreceptors on noradrenergic synapses, total transmitter release, and finally neuronal activity. That mechanism is the probable explanation for gabapentin's and pregabalin's usefulness in the treatment of neuropathic pain but also their possible anticonvulsive and anxiolytic effects.

Conversion of human choriogonadotropin into a follitropin by protein engineering

DOE Office of Scientific and Technical Information (OSTI.GOV)

Campbell, R.K.; Dean-Emig, D.M.; Moyle, W.R.

1991-02-01

Human reproduction is dependent upon the action of follicle-stimulating hormone (hFSH), luteinizing hormone (hLH), and chorionic gonadotropin (hCG). While the {alpha} subunits of these heterodimeric proteins can be interchanged without effect on receptor-binding specificity, their {beta} subunits differ and direct hormone binding to either LH/CG or FSH receptors. Previous studies employing chemical modifications of the hormones, monoclonal antibodies, or synthetic peptides have implicated hCG {beta}-subunit residues between Cys-38 and Cys-57 and corresponding regions of hLH{beta} and hFSH{beta} in receptor recognition and activation. Since the {beta} subunits of hCG or hLH and hFSH exhibit very little sequence similarity in this region,more » the authors postulated that these residues might contribute to hormone specificity. To test this hypothesis the authors constructed chimeric hCG/hFSH {beta} subunits, coexpressed them with the human {alpha} subunit, and examined their ability to interact with LH and FSH receptors and hormone-specific monoclonal antibodies. Surprisingly, substitution of hFSH{beta} residues 33-52 for hCG{beta} residues 39-58 had no effect on receptor binding or stimulation. However, substitution of hFSH{beta} residues 88-108 in place of the carboxyl terminus of hCG{beta} (residues 94-145) resulted in a hormone analog identical to hFSH in its ability to bind and stimulate FSH receptors. The altered binding specificity displayed by this analog is not attributable solely to the replacement of hCG{beta} residues 108-145 or substitution of residues in the determinant loop located between hCD{beta} residues 93 and 100.« less

Unanticipated region- and cell-specific downregulation of individual KChIP auxiliary subunit isotypes in Kv4.2 knock-out mouse brain.

PubMed

Menegola, Milena; Trimmer, James S

2006-11-22

Kv4 family voltage-gated potassium channel alpha subunits and Kv channel-interacting protein (KChIP) and dipeptidyl aminopeptidase-like protein subunits comprise somatodendritic A-type channels in mammalian neurons. Recently, a mouse was generated with a targeted deletion of Kv4.2, a Kv4 alpha subunit expressed in many but not all mammalian brain neurons. Kv4.2-/- mice are grossly indistinguishable from wild-type (WT) littermates. Here we used immunohistochemistry to analyze expression of component Kv4 and KChIP subunits of A-type channels in WT and Kv4.2-/- brains. We found that the expression level, and cellular and subcellular distribution of the other prominent brain Kv4 family member Kv4.3, was indistinguishable between WT and Kv4.2-/- samples. However, we found unanticipated regional and cell-specific decreases in expression of KChIPs. The degree of altered expression of individual KChIP isoforms in different regions and neurons precisely follows the level of Kv4.2 normally found at those sites and presumably their extent of association of these KChIPs with Kv4.2. The dramatic effects of Kv4.2 deletion on KChIP expression suggest that, in addition to previously characterized effects of KChIPs on the functional properties, trafficking, and turnover rate of Kv4 channels, Kv4:KChIP association may confer reciprocal Kv4.2-dependent effects on KChIPs. The impact of Kv4.2 deletion on KChIP expression also supports the major role of KChIPs as auxiliary subunits of Kv4 channels.

Secretion of alpha 2-plasmin inhibitor is impaired by amino acid deletion in a small region of the molecule.

PubMed

Toyota, S; Hirosawa, S; Aoki, N

1994-02-01

Alpha 2-plasmin inhibitor (alpha 2PI) deficiency Okinawa results from defective secretion of the inhibitor from the liver and appears to be a direct consequence of the deletion of Glu137 in the amino acid sequence of alpha 2PI. To examine the effects of replacing the amino acid occupying position 137 or deleting its neighboring amino acid on alpha 2PI secretion, we used oligonucleotide-directed mutagenesis of alpha 2PI cDNA to change the codon specifying Glu137 or delete a codon specifying its neighboring amino acid. The effects were determined by pulse-chase experiments and by enzyme-linked immunosorbent assay of media from transiently transfected COS-7 cells. Replacement of Glu137 with an amino acid other than Cys had little effect on alpha 2PI secretion. In contrast, deletion of an amino acid in a region spanning a sequence of less than 30 amino acids including positions 127 and 137 severely impaired the secretion. The results suggest that structural integrity of the region, rather than its component amino acids, is important for the intracellular transport and secretion of alpha 2PI.

The interaction of methanol dehydrogenase and cytochrome cL in the acidophilic methylotroph Acetobacter methanolicus.

PubMed Central

Chan, H T; Anthony, C

1991-01-01

The quinoprotein methanol dehydrogenase (MDH) of Acetobacter methanolicus has an alpha 2 beta 2 structure. By contrast with other MDHs, the beta-subunit (approx. 8.5 kDa) does not contain the five lysine residues previously proposed to be involved in ionic interactions with the electron acceptor cytochrome cL. That electrostatic interactions are involved was confirmed by the demonstration that methanol:cytochrome cL oxidoreductase activity was inhibited by high ionic strength (I), the strength of interaction being inversely related to the square root of I. Specific modifiers of arginine residues on MDH inhibited this reaction but not the dye-linked MDH activity. Modification of lysine residues on MDH that altered its charge had no effect on the dye-linked activity but inhibited reaction with cytochrome cL. When the charge was retained on modification of lysine residues, little effect on either activity was observed. Cross-linking experiments confirmed that lysine residues on the alpha-subunit, but not the beta-subunit, are involved in the 'docking' process between the proteins. Images Fig. 4. PMID:1660263

Effects of troxerutin on cognitive deficits and glutamate cysteine ligase subunits in the hippocampus of streptozotocin-induced type 1 diabetes mellitus rats.

PubMed

Zhang, Songyun; Li, Hongyan; Zhang, Lihui; Li, Jie; Wang, Ruiying; Wang, Mian

2017-02-15

Increasing evidence demonstrates an association between diabetes and hippocampal neuron damage. This study aimed to determine the effects of troxerutin on cognitive deficits and glutamate cysteine ligase subunits (GCLM and GCLC) in the hippocampus of streptozotocin-induced type 1 diabetes mellitus (T1DM) rats. At 12weeks after streptozotocin injection, T1DM rats were randomly divided into 4 groups (n=15 each group) to receive no treatment (T1DM), saline (T1DM+saline), alpha-lipoic acid (T1DM+alpha-lipoic acid), and troxerutin (T1DM+troxerutin), respectively, for 6weeks. Meanwhile, 10 control animals (NC group) were assessed in parallel. Learning performance was evaluated by the Morris water maze. After treatment, hippocampi were collected for pathological examination by hematoxylin and eosin (H&E) staining. Next, hippocampal superoxide dismutase (SOD) activity, and malondialdehyde (MDA) and glutathione (GSH) levels were assessed. Finally, glutamate cysteine ligase catalytic (GCLC) and glutamate cysteine ligase modifier (GCLM) subunit mRNA and protein levels were quantified by reverse transcription polymerase chain reaction (RT-PCR) and Western blot, respectively. Compared with T1DM and T1DM+saline groups, escape latency was overtly reduced in T1DM+alpha-lipoic acid and T1DM+troxerutin groups. Significantly increased GCLM and GCLC mRNA levels, GCLC protein amounts, SOD activity, and GSH levels, and reduced MDA amounts were observed in T1DM+alpha-lipoic acid and T1DM+troxerutin groups. In T1DM and T1DM+saline groups, H&E staining showed less pyramidal cells in the hippocampus, with disorganized layers, karyopyknosis, decreased endochylema, and cavitation, effects relieved in T1DM+alpha-lipoic acid and T1DM+troxerutin groups. Troxerutin alleviates oxidative stress and promotes learning in streptozotocin-induced T1DM rats, a process involving GCLC expression. Copyright © 2016 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feng,L.; Gell, D.; Zhou, S.

Hemoglobin A (HbA), the oxygen delivery system in humans, comprises two alpha and two beta subunits. Free alpha-hemoglobin (alphaHb) is unstable, and its precipitation contributes to the pathophysiology of beta thalassemia. In erythrocytes, the alpha-hemoglobin stabilizing protein (AHSP) binds alphaHb and inhibits its precipitation. The crystal structure of AHSP bound to Fe(II)-alphaHb reveals that AHSP specifically recognizes the G and H helices of alphaHb through a hydrophobic interface that largely recapitulates the alpha1-beta1 interface of hemoglobin. The AHSP-alphaHb interactions are extensive but suboptimal, explaining why beta-hemoglobin can competitively displace AHSP to form HbA. Remarkably, the Fe(II)-heme group in AHSP boundmore » alphaHb is coordinated by the distal but not the proximal histidine. Importantly, binding to AHSP facilitates the conversion of oxy-alphaHb to a deoxygenated, oxidized [Fe(III)], nonreactive form in which all six coordinate positions are occupied. These observations reveal the molecular mechanisms by which AHSP stabilizes free alphaHb.« less

Induction of experimental bone metastasis in mice by transfection of integrin alpha 4 beta 1 into tumor cells.

PubMed Central

Matsuura, N.; Puzon-McLaughlin, W.; Irie, A.; Morikawa, Y.; Kakudo, K.; Takada, Y.

1996-01-01

Cell adhesion receptors (eg, integrins and CD44) play an important role in invasion and metastasis during tumor progression. The increase in integrin alpha 4 beta 1 expression on primary melanomas has been reported to significantly correlate with the development of metastases. alpha 4 beta 1 is a cell surface heterodimer that mediates cell-cell and cell-extracellular matrix interactions through adhesion to vascular cell adhesion molecule (VCAM)-1 and to the IIICS region of fibronectin. To test the effects of alpha 4 beta 1 expression on tumor cell metastasis, Chinese hamster ovary cells were transfected with human alpha 4 cDNA. Whereas alpha 4-negative Chinese hamster ovary cells developed only pulmonary metastasis, alpha 4-positive Chinese hamster ovary cells developed bone and pulmonary metastasis in 3 to 4 weeks when injected intravenously into nude mice. Bone metastasis was inhibited by antibody against alpha 4 or VCAM-1. Expression of alpha 3 beta 1, alpha 6 beta 1, or alpha V beta 1 did not induce bone metastasis. Expression of alpha 4 beta 1 also induced bone metastasis in K562 human erythroleukemia cells injected into SCID mice. These results demonstrate that alpha 4 beta 1 can induce tumor cell trafficking to bone, probably via interaction with VCAM-1 that is constitutively expressed on bone marrow stromal cells. Images Figure 1 Figure 3 PMID:8546226

Folate receptor {alpha} regulates cell proliferation in mouse gonadotroph {alpha}T3-1 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yao, Congjun; Evans, Chheng-Orn; Stevens, Victoria L.

We have previously found that the mRNA and protein levels of the folate receptor alpha (FR{alpha}) are uniquely over-expressed in clinically human nonfunctional (NF) pituitary adenomas, but the mechanistic role of FR{alpha} has not fully been determined. We investigated the effect of FR{alpha} over-expression in the mouse gonadotroph {alpha}T3-1 cell line as a model for NF pituitary adenomas. We found that the expression and function of FR{alpha} were strongly up-regulated, by Western blotting and folic acid binding assay. Furthermore, we found a higher cell growth rate, an enhanced percentage of cells in S-phase by BrdU assay, and a higher PCNAmore » staining. These observations indicate that over-expression of FR{alpha} promotes cell proliferation. These effects were abrogated in the same {alpha}T3-1 cells when transfected with a mutant FR{alpha} cDNA that confers a dominant-negative phenotype by inhibiting folic acid binding. Finally, by real-time quantitative PCR, we found that mRNA expression of NOTCH3 was up-regulated in FR{alpha} over-expressing cells. In summary, our data suggests that FR{alpha} regulates pituitary tumor cell proliferation and mechanistically may involve the NOTCH pathway. Potentially, this finding could be exploited to develop new, innovative molecular targeted treatment for human NF pituitary adenomas.« less

Occurrence of two different forms of protocatechuate 3,4-dioxygenase in a Moraxella sp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sterjiades, R.; Pelmont, J.

1989-02-01

Two alternative forms of protocatechuate 3,4-dioxygenase (PCase) have been purified from Moraxella sp. strain GU2, a bacterium that is able to grow on guaiacol or various other phenolic compounds as the sole source of carbon and energy. One of these forms (PCase-P) was induced by protocatechuate and had an apparent molecular weight of 220,000. The second form (PCase-G) was induced by guaiacol or other phenolic compounds, such as 2-ethoxyphenol or 4-hydroxybenzoate. It appeared to be smaller (M{sub r} 158,000), and its turnover number was about double that of the former enzyme. Both dioxygenases had similar properties and were built frommore » the association of equal amounts of nonidentical subunits, {alpha} and {beta}, which were estimated to have molecular weights of 29,500 and 25,500, respectively. The ({alpha}{beta}){sub 3} and ({alpha}{beta}){sub 4} structures were suggested for PCases G and P, respectively. On the basis of two-dimensional gel electrophoresis, the {alpha} and {beta} polypeptides of PCase-G differed from those of PCase-P. Amino acid analysis supported this conclusion. Both PCases, however, had several other properties in common. It is proposed that both isoenzymes were generated from different sets of {alpha} and {beta} subunits, and the significance of these data is discussed.« less

beta'-COP, a novel subunit of coatomer.

PubMed Central

Stenbeck, G; Harter, C; Brecht, A; Herrmann, D; Lottspeich, F; Orci, L; Wieland, F T

1993-01-01

Several lines of evidence favour the hypothesis that intracellular biosynthetic protein transport in eukaryotes is mediated by non-clathrin-coated vesicles (for a review see Rothman and Orci, 1992). The vesicles have been isolated and a set of their surface proteins has been characterized as coat proteins (COPs). These COPs exist in the cytosol as a preformed complex, the coatomer, which was prior to this study known to contain six subunits: four (alpha-, beta-, gamma- and delta-COP) with molecular weights between 160 and 58 kDa, and two additional proteins of approximately 36 and 20 kDa, epsilon- and xi-COP. Here we describe a novel subunit of the coatomer complex, beta'-COP. This subunit occurs in amounts stoichiometric to the established COPs both in the coatomer and in nonclathrin-coated vesicles and shows homology to the beta-subunits of trimeric G proteins. Images PMID:8334999

Cloning and expressions of peroxisome proliferator activated receptor alpha1 and alpha2 (PPARα1 and PPARα2) in loach (Misgurnus anguillicaudatus) and in response to different dietary fatty acids.

PubMed

Liang, Xiao; Gao, Jian; Li, Dapeng; Cao, Xiaojuan

2016-12-02

Peroxisome proliferator activated receptor alpha1 and alpha2 (PPARα1 and PPARα2) were investigated in loach (Misgurnus anguillicaudatus) by RACE (rapid amplification of cDNA ends) and qPCR (real-time quantitative PCR) for the first time. The cDNA sequences of PPARα1 and PPARα2 were 2042bp and 2407bp, respectively encoding 467 and 465 amino acids. Sequence alignments of deduced amino acids showed significant homology between the two subtypes of PPARα, indicating 70% identity. The two genes revealed sensible changes in transcriptions during early life stages of the loach, and the highest transcriptions of the two genes both appeared at some day after hatching. PPARα1 predominantly expressed in liver, while PPARα2 markedly expressed in heart. The expression regulation of PPARα1 and PPARα2 in response to dietary fatty acids was determined in livers of loaches fed with diets containing fish oil (FO group) and soybean oil (SO group) for 75 days. The expression level of PPARα1 in FO group was significantly higher than those in SO group (P < 0.01), while the expression level of PPARα2 in FO group was also significantly higher than those in SO group (P < 0.05). There was no significant difference in the expression level between PPARα1 and PPARα2 in SO group, whereas significant difference in FO group. These indicated that lipid resources could regulate the expressions of these two genes in the loach. Our results will provide opportunities to better understand the functional characterization of PPARα1 and PPARα2 in further studies. Copyright © 2016 Elsevier Inc. All rights reserved.

Cloning of the cDNA for a hematopoietic cell-specific protein related to CD20 and the {beta} subunit of the high-affinity IgE receptor: Evidence for a family of proteins with four membrane-spanning regions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adra, C.N.; Morrison, P.; Lim, B.

1994-10-11

The authors report the cloning of the cDNA for a human gene whose mRNA is expressed specifically in hematopoietic cells. A long open reading frame in the 1.7-kb mRNA encodes a 214-aa protein of 25 kDa with four hydrophobic regions consistent with a protein that traverses the membrane four times. To reflect the structure and expression of this gene in diverse hematopoietic lineages of lymphoid and myeloid origin, the authors named the gene HTm{sub 4}. The protein is about 20% homologous to two other {open_quotes}four-transmembrane{close_quotes} proteins; the B-cell-specific antigen CD20 and the {beta} subunit of the high-affinity receptor for IgE,more » Fc{sub {epsilon}}RI{beta}. The highest homologies among the three proteins are found in the transmembrane domains, but conserved residues are also recognized in the inter-transmembrane domains and in the N and C termini. Using fluorescence in situ hybridization, they localized HTm{sub 4} to human chromosome 11q12-13.1, where the CD20 and Fc{sub {epsilon}}RI{beta} genes are also located. Both the murine homologue for CD20, Ly-44, and the murine Fc{sub {epsilon}}RI{beta} gene map to the same region in murine chromosome 19. The authors propose that the HTm{sub 4}, CD20, and Fc{sub {epsilon}}RI{beta} genes evolved from the same ancestral gene to form a family of four-transmembrane proteins. It is possible that other related members exist. Similar to CD20 and Fc{sub {epsilon}}RI{beta}, it is likely that Htm{sub 4} has a role in signal transduction and, like Fc{sub {epsilon}}RI{beta}, might be a subunit associated with receptor complexes.« less

Molecular cloning, phylogenetic analysis, and expression profiling of endoplasmic reticulum molecular chaperone BiP genes from bread wheat (Triticum aestivum L.).

PubMed

Zhu, Jiantang; Hao, Pengchao; Chen, Guanxing; Han, Caixia; Li, Xiaohui; Zeller, Friedrich J; Hsam, Sai L K; Hu, Yingkao; Yan, Yueming

2014-10-01

The endoplasmic reticulum chaperone binding protein (BiP) is an important functional protein, which is involved in protein synthesis, folding assembly, and secretion. In order to study the role of BiP in the process of wheat seed development, we cloned three BiP homologous cDNA sequences in bread wheat (Triticum aestivum), completed by rapid amplification of cDNA ends (RACE), and examined the expression of wheat BiP in wheat tissues, particularly the relationship between BiP expression and the subunit types of HMW-GS using near-isogenic lines (NILs) of HMW-GS silencing, and under abiotic stress. Sequence analysis demonstrated that all BiPs contained three highly conserved domains present in plants, animals, and microorganisms, indicating their evolutionary conservation among different biological species. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) revealed that TaBiP (Triticum aestivum BiP) expression was not organ-specific, but was predominantly localized to seed endosperm. Furthermore, immunolocalization confirmed that TaBiP was primarily located within the protein bodies (PBs) in wheat endosperm. Three TaBiP genes exhibited significantly down-regulated expression following high molecular weight-glutenin subunit (HMW-GS) silencing. Drought stress induced significantly up-regulated expression of TaBiPs in wheat roots, leaves, and developing grains. The high conservation of BiP sequences suggests that BiP plays the same role, or has common mechanisms, in the folding and assembly of nascent polypeptides and protein synthesis across species. The expression of TaBiPs in different wheat tissue and under abiotic stress indicated that TaBiP is most abundant in tissues with high secretory activity and with high proportions of cells undergoing division, and that the expression level of BiP is associated with the subunit types of HMW-GS and synthesis. The expression of TaBiPs is developmentally regulated during seed development and early seedling growth, and under various abiotic stresses.

The gene for fibroblast activation protein {alpha} (FAP), a putative cell surface-bound serine protease expressed in cancer stroma and wound healing, maps to chromosome band 2q23

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mathew, S.; Murty, V.V.V.S.; Chaganti, R.S.K.

The human fibroblast activation protein {alpha} (FAP{alpha}) is an inducible cell surface glycoprotein of M{sub r} 95,000 recognized by a number of monoclonal antibodies (mAbs), including the prototype mAb F19. Immunohistochemical studies have shown that FAP{alpha} expression in vivo is tightly regulated, with transient expression in some fetal mesenchymal tissues but absence of expression in most normal adult tissues. Reexpression of FAP{alpha} is observed in the reactive stromal fibroblasts of several common types of epithelial cancers, including >90% of breast, colorectal, and lung carcinomas and healing wounds. Cloning and sequence analysis of an FAP{alpha}-specific cDNA has revealed that the moleculemore » is encoded by a novel gene, FAP, which shows sequence similarity to members of the serine protease family of integral membrane proteins, namely dipeptidyl peptidase IV (DPPIV, also known as lymphocyte activation antigen, CD26, or adenosine dearoinase binding protein) and DPPX, a DPPIV-related molecule of unknown function. 15 refs., 1 fig.« less

Analysis of the interaction mode between hyperthermophilic archaeal group II chaperonin and prefoldin using a platform of chaperonin oligomers of various subunit arrangements.

PubMed

Sahlan, Muhamad; Kanzaki, Taro; Zako, Tamotsu; Maeda, Mizuo; Yohda, Masafumi

2010-09-01

Prefoldin is a co-chaperone that captures an unfolded protein substrate and transfers it to the group II chaperonin for completion of protein folding. Group II chaperonin of a hyperthermophilic archaeon, Thermococcus strain KS-1, interacts and cooperates with archaeal prefoldins. Although the interaction sites within chaperonin and prefoldin have been analyzed, the binding mode between jellyfish-like hexameric prefoldin and the double octameric ring group II chaperonin remains unclear. As prefoldin binds the chaperonin beta subunit more strongly than the alpha subunit, we analyzed the binding mode between prefoldin and chaperonin in the context of Thermococcus group II chaperonin complexes of various subunit compositions and arrangements. The oligomers exhibited various affinities for prefoldins according to the number and order of subunits. Binding affinity increased with the number of Cpnbeta subunits. Interestingly, chaperonin complexes containing two beta subunits adjacently exhibited stronger affinities than other chaperonin complexes containing the same number of beta subunits. The result suggests that all four beta tentacles of prefoldin interact with the helical protrusions of CPN in the PFD-CPN complex as the previously proposed model that two adjacent PFD beta subunits seem to interact with two CPN adjacent subunits. Copyright © 2010 Elsevier B.V. All rights reserved.

Chronic lithium treatment up-regulates cell surface Na(V)1.7 sodium channels via inhibition of glycogen synthase kinase-3 in adrenal chromaffin cells: enhancement of Na(+) influx, Ca(2+) influx and catecholamine secretion after lithium withdrawal.

PubMed

Yanagita, Toshihiko; Maruta, Toyoaki; Nemoto, Takayuki; Uezono, Yasuhito; Matsuo, Kiyotaka; Satoh, Shinya; Yoshikawa, Norie; Kanai, Tasuku; Kobayashi, Hideyuki; Wada, Akihiko

2009-09-01

In cultured bovine adrenal chromaffin cells expressing Na(V)1.7 isoform of voltage-dependent Na(+) channels, we have previously reported that lithium chloride (LiCl) inhibits function of Na(+) channels independent of glycogen synthase kinase-3 (GSK-3) (Yanagita et al., 2007). Here, we further examined the effects of chronic lithium treatment on Na(+) channels. LiCl treatment (1-30 mM, > or = 12 h) increased cell surface [(3)H]saxitoxin ([(3)H]STX) binding by approximately 32% without altering the affinity of [(3)H]STX binding. This increase was prevented by cycloheximide and actinomycin D. SB216763 and SB415286 (GSK-3 inhibitors) also increased cell surface [(3)H]STX binding by approximately 31%. Simultaneous treatment with LiCl and SB216763 or SB415286 did not produce an increased effect on [(3)H]STX binding compared with either treatment alone. LiCl increased Na(+) channel alpha-subunit mRNA level by 32% at 24 h. LiCl accelerated alpha-subunit gene transcription by 35% without altering alpha-subunit mRNA stability. In LiCl-treated cells, LiCl inhibited veratridine-induced (22)Na(+) influx as in untreated cells. However, washout of LiCl after chronic treatment enhanced veratridine-induced (22)Na(+) influx, (45)Ca(2+) influx and catecholamine secretion by approximately 30%. Washout of LiCl after 24 h treatment shifted concentration-response curve of veratridine upon (22)Na(+) influx upward, without altering its EC(50) value. Ptychodiscus brevis toxin-3 allosterically enhanced veratridine-induced (22)Na(+) influx by two-fold in untreated and LiCl-treated cells. Whole-cell patch-clamp analysis indicated that I-V curve and steady-state inactivation/activation curves were comparable between untreated and LiCl-treated cells. Thus, GSK-3 inhibition by LiCl up-regulated cell surface Na(V)1.7 via acceleration of alpha-subunit gene transcription, enhancing veratridine-induced Na(+) influx, Ca(2+) influx and catecholamine secretion.

Type-I interferon receptor expression: its circadian rhythm and downregulation after interferon-alpha administration in peripheral blood cells from renal cancer patients.

PubMed

Shiba, Masahiro; Nonomura, Norio; Nakai, Yasutomo; Nakayama, Masashi; Takayama, Hitoshi; Inoue, Hitoshi; Tsujimura, Akira; Nishimura, Kazuo; Okuyama, Akihiko

2009-04-01

To investigate the regulation of interferon-alpha (IFN-alpha) receptor expression in metastatic renal cell carcinoma (RCC) after IFN-alpha administration. Blood sampling was carried out in eight patients with metastatic RCC and six healthy volunteers. Flow-cytometric analysis using a monoclonal antibody against the active subunit of the type-I IFN-alpha receptor (IFNAR2) was carried out to examine the circadian rhythm of IFNAR2 expression in peripheral blood mononuclear cells (PBMC) as well as its downregulation after IFN-alpha administration. According to its circadian rhythm IFNAR2 in PBMC had a peak expression at night. Once IFN-alpha is administered, IFNAR2 levels in PBMC showed downregulation within 48 h and recovered within another 48 h. Our findings might support the establishment of an optimal schedule for IFN-alpha administration.

The G protein alpha subunit (GP alpha1) is associated with the ER and the plasma membrane in meristematic cells of Arabidopsis and cauliflower.

PubMed

Weiss, C A; White, E; Huang, H; Ma, H

1997-05-05

Towards the elucidation of the cellular function(s) of GP alpha1, we have characterized its subcellular localization using immunofluorescence and cell fractionation. GP alpha1 is not present in nuclei or chloroplasts. It is a membrane-bound protein, and analysis of isolated endoplasmic and plasma membranes indicates a good correlation between GP alpha1 in both the plasma membrane and the ER compartment. Interestingly, these results may suggest more different functions for GP alpha1: it might be involved in transmission of extracellular signals across the plasma membrane and in the cytoplasm, and/or it may also be involved in regulating some aspects of the ER functions or membrane trafficking between both membranes.

Interallelic complementation of mutations in propionic acidemia by microinjection of mutant cDNAs into fibroblasts of affected patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loyer, M.; Leclerc, D.; Gravel, R.A.

1994-09-01

Propionic acidemia is a rare autosomal recessive disorder resulting from defects of the {alpha} or {beta} subunit of biotin-dependent propionyl-CoA carboxylase (PCC). Mutations are assigned to defects of the PCCA ({alpha} subunit) or PCCB ({beta} subunit) gene through complementation studies after somatic fusion of patient cell lines. About two-thirds of patients with {beta} subunit defects (complementation group pccBC) show interallelic complementation in cell fusion experiments (subgroups pccB and pccC), monitored by the PCC-dependent metabolisms of {sup 14}C-propionate. Most patient cell lines are heteroallelic for two different mutations, leaving ambiguous the identity of the mutation participating in interallelic complementation. To identifymore » the complementing mutations, we have expressed {beta}-subunit cDNAs containing individual mutations by microinjection of the cDNAs in recipient cells from patients with {beta} subunit defects. Correction of the PCC defect was monitored by autoradiography of {sup 14}C-propionate incorporation. In some experiments, cDNAs were co-injected with a plasmid expressing the E. coli lacZ gene as a positive control for successful injection. Two mutations from the pccB subgroup showed complementation when injected into pccC cells; dupKICK140-143 and Pro228Leu. Similarly, two mutations from the pccC subgroup complemented after injection into pccB cells; {Delta}Ile408 and Arg410Trp. No mutation complemented with mutation of the pccBC group which are classified as non-complementing in cell fusion experiments. The results show that the complementing pccB mutations are found in the N-terminal half of the {beta} subunit, while the complementing pccC mutations cluxter at a site in the C-terminal half. The latter site is a candidate for the propionyl-CoA binding site based on sequence identity with a region of transcarboxylase from Propionibacterium shermanii.« less

Characterization of the N-linked high-mannose oligosaccharides of the insulin pro-receptor and mature insulin receptor subunits.

PubMed

McElduff, A; Watkinson, A; Hedo, J A; Gorden, P

1986-11-01

The insulin receptor is synthesized as a 190,000-Mr single-chain precursor that contains exclusively asparagine-N-linked high-mannose-type carbohydrate chains. In this study we have characterized the structure of the pro-receptor oligosaccharides. IM-9 lymphocytes were pulse-chase-labelled with [3H]mannose, and the insulin pro-receptor was isolated by immunoprecipitation and SDS/polyacrylamide-gel electrophoresis. The pro-receptor oligosaccharides were removed from the protein backbone with endoglycosidase H and analysed by h.p.l.c. Immediately after a [3H]mannose pulse the largest oligosaccharide found in the pro-receptor was Glc1Man9GlcNAc2; this structure represented only a small fraction (3%) of the total. The predominant oligosaccharides present in the pro-receptor were Man9GlcNAc2 (25%) and Man8GlcNAc2 (48%). Smaller oligosaccharides were also detected: Man7GlcNAc2 (18%), Man6GlcNAc2 (3%) and Man5GlcNAc2 (3%). The relative distribution of the different oligosaccharides did not change at 1, 2 or 3 h after the pulse with the exception of the rapid disappearance of the Glc1Man9GlcNAc2 component. The mature alpha- and beta-subunits of the insulin receptor are known to contain both high-mannose-type and complex-type oligosaccharides. We have also examined here the structure of the high-mannose chains of these subunits. The predominant species in the alpha-subunit was Man8GlcNAc2 whereas in the beta-subunit it was Man7GlcNAc2. These results demonstrate that most (approx. 75%) oligosaccharides of the insulin pro-receptor are chains of the type Man8GlcNAc2 or Man9GlcNAc2. Thus, assuming that a Glc3Man9GlcNAc2 species is transferred co-translationally, carbohydrate processing of the pro-receptor appears to be very rapid and limited to the removal of the three glucose residues and one mannose residue. Further mannose removal does not occur until the pro-receptor has been proteolytically cleaved. In addition, the degree of mannose trimming appears to be different in the alpha- and beta-subunits.

Characterization of the N-linked high-mannose oligosaccharides of the insulin pro-receptor and mature insulin receptor subunits.

PubMed Central

McElduff, A; Watkinson, A; Hedo, J A; Gorden, P

1986-01-01

The insulin receptor is synthesized as a 190,000-Mr single-chain precursor that contains exclusively asparagine-N-linked high-mannose-type carbohydrate chains. In this study we have characterized the structure of the pro-receptor oligosaccharides. IM-9 lymphocytes were pulse-chase-labelled with [3H]mannose, and the insulin pro-receptor was isolated by immunoprecipitation and SDS/polyacrylamide-gel electrophoresis. The pro-receptor oligosaccharides were removed from the protein backbone with endoglycosidase H and analysed by h.p.l.c. Immediately after a [3H]mannose pulse the largest oligosaccharide found in the pro-receptor was Glc1Man9GlcNAc2; this structure represented only a small fraction (3%) of the total. The predominant oligosaccharides present in the pro-receptor were Man9GlcNAc2 (25%) and Man8GlcNAc2 (48%). Smaller oligosaccharides were also detected: Man7GlcNAc2 (18%), Man6GlcNAc2 (3%) and Man5GlcNAc2 (3%). The relative distribution of the different oligosaccharides did not change at 1, 2 or 3 h after the pulse with the exception of the rapid disappearance of the Glc1Man9GlcNAc2 component. The mature alpha- and beta-subunits of the insulin receptor are known to contain both high-mannose-type and complex-type oligosaccharides. We have also examined here the structure of the high-mannose chains of these subunits. The predominant species in the alpha-subunit was Man8GlcNAc2 whereas in the beta-subunit it was Man7GlcNAc2. These results demonstrate that most (approx. 75%) oligosaccharides of the insulin pro-receptor are chains of the type Man8GlcNAc2 or Man9GlcNAc2. Thus, assuming that a Glc3Man9GlcNAc2 species is transferred co-translationally, carbohydrate processing of the pro-receptor appears to be very rapid and limited to the removal of the three glucose residues and one mannose residue. Further mannose removal does not occur until the pro-receptor has been proteolytically cleaved. In addition, the degree of mannose trimming appears to be different in the alpha- and beta-subunits. Images Fig. 1. PMID:3827820

Schindler disease: the molecular lesion in the alpha-N-acetylgalactosaminidase gene that causes an infantile neuroaxonal dystrophy.

PubMed Central

Wang, A M; Schindler, D; Desnick, R

1990-01-01

Schindler disease is a recently recognized infantile neuroaxonal dystrophy resulting from the deficient activity of the lysosomal hydrolase, alpha-N-acetylgalctosaminidase (alpha-GalNAc). The recent isolation and expression of the full-length cDNA encoding alpha-GalNAc facilitated the identification of the molecular lesions in the affected brothers from family D, the first cases described with this autosomal recessive disease. Southern and Northern hybridization analyses of DNA and RNA from the affected homozygotes revealed a grossly normal alpha-GalNAc gene structure and normal transcript sizes and amounts. Therefore, the alpha-GalNAc transcript from an affected homozygote was reverse-transcribed, amplified by the polymerase chain reaction (PCR), and sequenced. A single G to A transition at nucleotide 973 was detected in multiple subclones containing the PCR products. This point mutation resulted in a glutamic acid to lysine substitution in residue 325 (E325K) of the alpha-GalNAc polypeptide. The base substitution was confirmed by dot blot hybridization analyses of PCR-amplified genomic DNA from family members with allele-specific oligonucleotides. Furthermore, transient expression of an alpha-GalNAc construct containing the E325K mutation resulted in the expression of an immunoreactive polypeptide which had no detectable alpha-GalNAc activity. Images PMID:2243144

Localization of mRNA for CHRNA7 in human fetal brain.

PubMed

Agulhon, C; Abitbol, M; Bertrand, D; Malafosse, A

1999-08-02

The aim of this study was to determine the regional distribution in situ of the mRNA for the alpha 7 subunit of the neuronal nicotinic acetylcholine receptor in human fetal brain. We found high levels of alpha 7 gene expression in nuclei that receive sensory information, such as those of the neocortex and hippocampus, the thalamic nuclei, the reticular thalamic nucleus, the pontine nuclei and the superior olive complex. These data support a possible regulatory function for alpha 7-containing receptors in sensory processing, which may be involved in the pathological physiology of schizophrenia and autism. Early alpha 7 gene expression is also consistent with a morphogenetic role for alpha 7 receptors in central nervous system development.

Effects of chronic ethanol consumption on rat GABA(A) and strychnine-sensitive glycine receptors expressed by lateral/basolateral amygdala neurons.

PubMed

McCool, Brian A; Frye, Gerald D; Pulido, Marisa D; Botting, Shaleen K

2003-02-14

It is well known that the anxiolytic potential of ethanol is maintained during chronic exposure. We have confirmed this using a light-dark box paradigm following chronic ethanol ingestion via a liquid diet. However, cessation from chronic ethanol exposure is known to cause severe withdrawal anxiety. These opposing effects on anxiety likely result from neuro-adaptations of neurotransmitter systems within the brain regions regulating anxiety. Recent work highlights the importance of amygdala ligand-gated chloride channels in the expression of anxiety. We have therefore examined the effects of chronic ethanol exposure on GABA(A) and strychnine-sensitive glycine receptors expressed by acutely isolated adult rat lateral/basolateral amygdala neurons. Chronic ethanol exposure increased the functional expression of GABA(A) receptors in acutely isolated basolateral amygdala neurons without altering strychnine-sensitive glycine receptors. Neither the acute ethanol nor benzodiazepine sensitivity of either receptor system was affected. We explored the likelihood that subunit composition might influence each receptor's response to chronic ethanol. Importantly, when expressed in a mammalian heterologous system, GABA(A) receptors composed of unique alpha subunits were differentially sensitive to acute ethanol. Likewise, the presence of the beta subunit appeared to influence the acute ethanol sensitivity of glycine receptors containing the alpha(2) subunit. Our results suggest that the facilitation of GABA(A) receptors during chronic ethanol exposure may help explain the maintenance of ethanol's anti-anxiety effects during chronic ethanol exposure. Furthermore, the subunit composition of GABA(A) and strychnine-sensitive glycine receptors may ultimately influence the response of each system to chronic ethanol exposure.

Behavior of a cloned murine interferon alpha/beta receptor expressed in homospecific or heterospecific background.

PubMed Central

Uzé, G; Lutfalla, G; Bandu, M T; Proudhon, D; Mogensen, K E

1992-01-01

A murine interferon (IFN) alpha/beta receptor was cloned from the IFN-sensitive L1210 cell line on the basis of its homology with the human receptor. A combination of methods that includes the screening of random-primed and oligo(dT)-primed cDNA libraries and polymerase chain reactions with a single-side specificity was used. At the amino acid level, the murine IFN-alpha/beta shows 46% identity with its human counterpart. Both human WISH cells presenting a low sensitivity to mouse IFN and a murine L1210 mutant subline that does not express the receptor have been stably transfected with the murine IFN-alpha/beta receptor. Whereas transfected human cells became sensitive to a limited number of mouse IFN-alpha/beta subtypes, the transfected murine L1210 mutant was found to be fully complemented and became sensitive to all mouse IFN-alpha/beta subtypes tested, including those that were not active on transfected human cells. These results strongly suggest that the receptor described here is implicated in the mediation of the activities of all murine IFN-alpha/beta subtypes. Images PMID:1533935

Purification and characterization of the {alpha}-glucuronidase from Thermoanaerobacterium sp. strain JW/SL-YS485, an important enzyme for the utilization of substituted xylans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shao, W.; Obi, S.K.C.; Wiegel, J.

1995-03-01

A cell-associated {alpha}-glucuronidase was purified to gel electrophoretic homogeneity from the thermophilic anaerobic bacterium Thermoanaerobacterium sp. strain JW/SL-YS485. This enzyme had a pI of 4.65, a molecular weight of 130,000, and two subunits; the molecular weight of each subunit was 74,000. The enzyme exhibited the highest level of activity at pH 5.4 and 60{degrees}C, as determined by a 5-min assay. The K{sub m} and k{sub cat} values of the enzyme for 4-methylglucuronosyl xylobiose were 0.76 mM and 1,083 IU/{mu}mol, respectively. The Arrhenius energy was 26.4 kJ/mol. The specific activities of the enzyme with 4-0-methylglucuronosyl xylobiose, 4-0-methylglucuronosyl xylotriose, and 4-0-methylglucuronosyl xylotetraosemore » were 8.4, 4.8, and 3.9 IU/mg, respectively. The purified {alpha}-glucuronidase and a {beta}-xylosidase purified from the same organism interacted synergistically to hydrolyze 4-methylglucuronosyl xylotetraose.« less

A single mutation at the catalytic site of TF1-alpha3beta3gamma complex switches the kinetics of ATP hydrolysis from negative to positive cooperativity.

PubMed

Muneyuki, E; Odaka, M; Yoshida, M

1997-08-11

Previously, we reported the substitution of Tyr341 of the F1-ATPase beta subunit from a thermophilic Bacillus strain PS3 with leucine, cysteine, or alanine (M. Odaka et al. J. Biochem., 115 (1994) 789-796). These mutations resulted in a great decrease in the affinity of the isolated beta subunit for ATP-Mg and an increase in the apparent Km of the alpha3beta3gamma complex in ATP hydrolysis when examined above 0.1 mM ATP. Here, we examined the ATPase activity of the mutant complexes in a wide range of ATP concentration and found that the mutants exhibited apparent positive cooperativity in ATP hydrolysis. This is the first clear demonstration that a single mutation in the catalytic sites converts the kinetics from apparent negative cooperativity in the wild-type alpha3beta3gamma complex to apparent positive cooperativity. The conversion of apparent cooperativity could be explained in terms of a simple kinetic scheme based on the binding change model proposed by Boyer.

Crystal Structure of the 25 kDa Subunit of Human Cleavage Factor I{m}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coseno,M.; Martin, G.; Berger, C.

Cleavage factor Im is an essential component of the pre-messenger RNA 3'-end processing machinery in higher eukaryotes, participating in both the polyadenylation and cleavage steps. Cleavage factor Im is an oligomer composed of a small 25 kDa subunit (CF Im25) and a variable larger subunit of either 59, 68 or 72 kDa. The small subunit also interacts with RNA, poly(A) polymerase, and the nuclear poly(A)-binding protein. These protein-protein interactions are thought to be facilitated by the Nudix domain of CF Im25, a hydrolase motif with a characteristic {alpha}/{beta}/{alpha} fold and a conserved catalytic sequence or Nudix box. We present heremore » the crystal structures of human CF Im25 in its free and diadenosine tetraphosphate (Ap4A) bound forms at 1.85 and 1.80 Angstroms, respectively. CF Im25 crystallizes as a dimer and presents the classical Nudix fold. Results from crystallographic and biochemical experiments suggest that CF Im25 makes use of its Nudix fold to bind but not hydrolyze ATP and Ap4A. The complex and apo protein structures provide insight into the active oligomeric state of CF Im and suggest a possible role of nucleotide binding in either the polyadenylation and/or cleavage steps of pre-messenger RNA 3'-end processing.« less

Identification of the gamma subunit-interacting residues on photoreceptor cGMP phosphodiesterase, PDE6alpha '.

PubMed

Granovsky, A E; Artemyev, N O

2000-12-29

Photoreceptor cGMP phosphodiesterase (PDE6) is the effector enzyme in the G protein-mediated visual transduction cascade. In the dark, the activity of PDE6 is shut off by the inhibitory gamma subunit (Pgamma). Chimeric proteins between cone PDE6alpha' and cGMP-binding and cGMP-specific PDE (PDE5) have been constructed and expressed in Sf9 cells to study the mechanism of inhibition of PDE6 catalytic activity by Pgamma. Substitution of the segment PDE5-(773-820) by the corresponding PDE6alpha'-(737-784) sequence in the wild-type PDE5 or in a PDE5/PDE6alpha' chimera containing the catalytic domain of PDE5 results in chimeric enzymes capable of inhibitory interaction with Pgamma. The catalytic properties of the chimeric PDEs remained similar to those of PDE5. Ala-scanning mutational analysis of the Pgamma-binding region, PDE6alpha'-(750-760), revealed PDE6alpha' residues essential for the interaction. The M758A mutation markedly impaired and the Q752A mutation moderately impaired the inhibition of chimeric PDE by Pgamma. The analysis of the catalytic properties of mutant PDEs and a model of the PDE6 catalytic domain suggest that residues Met(758) and Gln(752) directly bind Pgamma. A model of the PDE6 catalytic site shows that PDE6alpha'-(750-760) forms a loop at the entrance to the cGMP-binding pocket. Binding of Pgamma to Met(758) would effectively block access of cGMP to the catalytic cavity, providing a structural basis for the mechanism of PDE6 inhibition.

Expression of G(alpha)(s) proteins and TSH receptor signalling in hyperfunctioning thyroid nodules with TSH receptor mutations.

PubMed

Holzapfel, Hans-Peter; Bergner, Beate; Wonerow, Peter; Paschke, Ralf

2002-07-01

Constitutively activating mutations of the thyrotrophin receptor (TSHR) are the main molecular cause of hyperfunctioning thyroid nodules (HTNs). The G protein coupling is an important and critical step in the TSHR signalling which mainly includes G(alpha)(s), G(alpha)(i) and G(alpha)(q)/11 proteins. We investigated the in vitro consequences of overexpressing G(alpha) proteins on signalling of the wild-type (WT) or mutated TSHR. Moreover, we investigated whether changes in G(alpha) protein expression are pathophysiologically relevant in HTNs or cold thyroid nodules (CTNs). Wild-type TSH receptor and mutated TSH receptors were coexpressed with G(alpha)(s), G(alpha)(i) or G(alpha)(q)/11, and cAMP and inositol phosphate (IP) production was measured after stimulation with TSH. The expression of G(alpha)(s), G(alpha)(i) and G(alpha)(q)/11 proteins was examined by Western blotting in 28 HTNs and 14 CTNs. Coexpression of G(alpha)(s) with the WT TSH receptor in COS 7 cells significantly increased the basal and TSH-stimulated cAMP accumulation while coexpression of the G(alpha)(q) or G(alpha)11 protein significantly increased the production of cAMP and inositol triphosphate (IP(3)). The coexpression of the TSH receptor mutants (I486F, DEL613-621), known to couple constitutively to G(alpha)(s) and G(alpha)(q) with G(alpha)(s) and G(alpha)(q)/11, significantly increased the basal and stimulated cAMP and IP(3) accumulation. Coexpression of the TSH receptor mutant V556F with G(alpha)(s) only increased the basal and stimulated cAMP production while its coexpression with G(alpha)(q)/11 increased the basal and stimulated IP(3) signalling. The expression of G(alpha)(s) protein subunits determined by Western blotting was significantly decreased in 14 HTNs with a constitutively activating TSH receptor mutation in comparison with the corresponding surrounding tissue, while in 14 HTNs without TSH receptor or G(alpha)(s) protein mutation and in 14 CTNs the expression of G(alpha)(s) protein was not different compared with the surrounding tissue. The expression of G(alpha)(i) and G(alpha)(q)/11 proteins in HTNs or CTNs was not significantly different compared with the surrounding tissue. The reduced expression of G(alpha)(s) protein subunits in HTNs with TSHR mutations could act as a feedback mechanism to desensitise the chronically stimulated cAMP cascade. As G(alpha) protein expression was not significantly increased in the majority of CTNs and HTNs an influence of G(alpha) overexpression on TSH signalling could be excluded in these nodules.

Optical manipulation of the alpha subunits of heterotrimeric G proteins using photoswitchable dimerization systems

PubMed Central

Yu, Gaigai; Onodera, Hiroyuki; Aono, Yuki; Kawano, Fuun; Ueda, Yoshibumi; Furuya, Akihiro; Suzuki, Hideyuki; Sato, Moritoshi

2016-01-01

Alpha subunits of heterotrimeric G proteins (Gα) are involved in a variety of cellular functions. Here we report an optogenetic strategy to spatially and temporally manipulate Gα in living cells. More specifically, we applied the blue light-induced dimerization system, known as the Magnet system, and an alternative red light-induced dimerization system consisting of Arabidopsis thaliana phytochrome B (PhyB) and phytochrome-interacting factor 6 (PIF6) to optically control the activation of two different classes of Gα (Gαq and Gαs). By utilizing this strategy, we demonstrate successful regulation of Ca2+ and cAMP using light in mammalian cells. The present strategy is generally applicable to different kinds of Gα and could contribute to expanding possibilities of spatiotemporal regulation of Gα in mammalian cells. PMID:27767077

ADP-ribosylation of membrane components by pertussis and cholera toxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ribeiro-Neto, F.A.P.; Mattera, F.; Hildebrandt, J.D.

1985-01-01

Pertussis and cholera toxins are important tools to investigate functional and structural aspects of the stimulatory (N/sub s/) and inhibitory (N/sub i/) regulatory components of adenylyl cyclase. Cholera toxin acts on N/sub s/ by ADP-ribosylating its ..cap alpha../sub s/ subunit; pertussis toxin acts on N/sub i/ by ADP-ribosylating its ..cap alpha..; subunit. By using (/sup 32/P)NAD/sup +/ and determining the transfer of its (/sup 32/P)ADP-ribose moiety to membrane components, it is possible to obtain information on N/sub s/ and N/sub i/. A set of protocols is presented that can be used to study simultaneously and comparatively the susceptibility of N/submore » s/ and N/sub i/ to be ADP-ribosylated by cholera and pertussis toxin.« less

The Chlamydomonas Dhc1 gene encodes a dynein heavy chain subunit required for assembly of the I1 inner arm complex.

PubMed Central

Myster, S H; Knott, J A; O'Toole, E; Porter, M E

1997-01-01

Multiple members of the dynein heavy chain (Dhc) gene family have been recovered in several organisms, but the relationships between these sequences and the Dhc isoforms that they encode are largely unknown. To identify Dhc loci and determine the specific functions of the individual Dhc isoforms, we have screened a collection of motility mutants generated by insertional mutagenesis in Chlamydomonas. In this report, we characterize one strain, pf9-3, in which the insertion event was accompanied by a deletion of approximately 13 kb of genomic DNA within the transcription unit of the Dhc1 gene. Northern blot analysis confirms that pf9-3 is a null mutation. Biochemical and structural studies of isolated axonemes demonstrate that the pf9-3 mutant fails to assemble the I1 inner arm complex, a two-headed dynein isoform composed of two Dhcs (1 alpha and 1 beta) and three intermediate chains. To determine if the Dhc1 gene product corresponds to one of the Dhcs of the I1 complex, antibodies were generated against a Dhc1-specific peptide sequence. Immunoblot analysis reveals that the Dhc1 gene encodes the 1 alpha Dhc subunit. These studies thus, identify the first inner arm Dhc locus to be described in any organism and further demonstrate that the 1 alpha Dhc subunit plays an essential role in the assembly of the I1 inner arm complex. Images PMID:9247642

Recombinant human acetylcholine receptor alpha-subunit induces chronic experimental autoimmune myasthenia gravis.

PubMed

Lennon, V A; Lambert, E H; Leiby, K R; Okarma, T B; Talib, S

1991-04-01

A synthetic gene encoding the 210 N-terminal residues of the alpha-subunit of the nicotinic acetylcholine receptor (AChR) of human skeletal muscle was cloned into an inducible expression plasmid to produce a fusion protein in high yield in Escherichia coli. Like native human AChR, the recombinant human alpha 1-210 protein induced AChR-binding, AChR-modulating, and AChR-blocking autoantibodies in rats when injected once intradermally as an emulsion in CFA, with Bordetella pertussis vaccine as supplementary adjuvant. The minimum dose of recombinant protein required to induce biochemical signs of experimental autoimmune myasthenia gravis (EAMG) with 100% incidence was 2.2 micrograms. With 6.6 to 22 micrograms, serum levels of autoantibodies were persistent, and clinically apparent EAMG lasted more than a month. Clinical, electrophysiological, and biochemical indices of EAMG induced by doses of 66 micrograms or more were more uniformly severe and persistent, with 33% fatality. Rats receiving a control extract of E. coli containing plasmid without the alpha 1-210 codon insert, with adjuvants, did not develop autoantibodies or signs of EAMG. This highly reproducible new model of EAMG induced by a recombinant human autoantigen should be valuable for testing Ag-specific immunotherapeutic strategies that might be applicable to treating acquired myasthenia gravis in humans.

SPLASH (PLA2IID), a novel member of phospholipase A2 family, is associated with lymphotoxin deficiency.

PubMed

Shakhov, A N; Rubtsov, A V; Lyakhov, I G; Tumanov, A V; Nedospasov, S A

2000-02-01

Lymphotoxin (LT) deficient mice have profound defects in the splenic microarchitecture associated with defective expression on certain gene products, including chemokines. By using subtraction cloning of splenic cDNA from wild-type and LT alpha or TNF/LT alpha double deficient mice we isolated a novel murine gene encoding a secretory type phospholipase A2, called SPLASH. The two major alternative transcripts of SPLASH gene are predominantly expressed in lymphoid tissues, such as spleen and lymph nodes. SPLASH maps to the distal part of chromosome 4, to which several cancer-related loci have been also mapped.

The Heterodimeric Glycoprotein Hormone, GPA2/GPB5, Regulates Ion Transport across the Hindgut of the Adult Mosquito, Aedes aegypti

PubMed Central

Paluzzi, Jean-Paul; Vanderveken, Mark; O’Donnell, Michael J.

2014-01-01

A family of evolutionarily old hormones is the glycoprotein cysteine knot-forming heterodimers consisting of alpha- (GPA) and beta-subunits (GPB), which assemble by noncovalent bonds. In mammals, a common glycoprotein hormone alpha-subunit (GPA1) pairs with unique beta-subunits that establish receptor specificity, forming thyroid stimulating hormone (GPA1/TSHβ) and the gonadotropins luteinizing hormone (GPA1/LHβ), follicle stimulating hormone (GPA1/FSHβ), choriogonadotropin (GPA1/CGβ). A novel glycoprotein heterodimer was identified in vertebrates by genome analysis, called thyrostimulin, composed of two novel subunits, GPA2 and GPB5, and homologs occur in arthropods, nematodes and cnidarians, implying that this neurohormone system existed prior to the emergence of bilateral metazoans. In order to discern possible physiological roles of this hormonal signaling system in mosquitoes, we have isolated the glycoprotein hormone genes producing the alpha- and beta-subunits (AedaeGPA2 and AedaeGPB5) and assessed their temporal expression profiles in the yellow and dengue-fever vector, Aedes aegypti. We have also isolated a putative receptor for this novel mosquito hormone, AedaeLGR1, which contains features conserved with other glycoprotein leucine-rich repeating containing G protein-coupled receptors. AedaeLGR1 is expressed in tissues of the alimentary canal such as the midgut, Malpighian tubules and hindgut, suggesting that this novel mosquito glycoprotein hormone may regulate ionic and osmotic balance. Focusing on the hindgut in adult stage A. aegypti, where AedaeLGR1 was highly enriched, we utilized the Scanning Ion-selective Electrode Technique (SIET) to determine if AedaeGPA2/GPB5 modulated cation transport across this epithelial tissue. Our results suggest that AedaeGPA2/GPB5 does indeed participate in ionic and osmotic balance, since it appears to inhibit natriuresis and promote kaliuresis. Taken together, our findings imply this hormone may play an important role in ionic balance when levels of Na+ are limited and levels of K+ are in excess – such as during the digestion and assimilation of erythrocytes following vertebrate blood-feeding by females. PMID:24466069

Isolation and characterization of the stage-specific cytochrome b small subunit (CybS) of Ascaris suum complex II from the aerobic respiratory chain of larval mitochondria.

PubMed

Amino, Hisako; Osanai, Arihiro; Miyadera, Hiroko; Shinjyo, Noriko; Tomitsuka, Eriko; Taka, Hikari; Mineki, Reiko; Murayama, Kimie; Takamiya, Shinzaburo; Aoki, Takashi; Miyoshi, Hideto; Sakamoto, Kimitoshi; Kojima, Somei; Kita, Kiyoshi

2003-05-01

We recently reported that Ascaris suum mitochondria express stage-specific isoforms of complex II: the flavoprotein subunit and the small subunit of cytochrome b (CybS) of the larval complex II differ from those of adult enzyme, while two complex IIs share a common iron-sulfur cluster subunit (Ip). In the present study, A. suum larval complex II was highly purified to characterize the larval cytochrome b subunits in more detail. Peptide mass fingerprinting and N-terminal amino acid sequencing showed that the larval and adult cytochrome b (CybL) proteins are identical. In contrast, cDNA sequences revealed that the small subunit of larval cytochrome b (CybS(L)) is distinct from the adult CybS (CybS(A)). Furthermore, Northern analysis and immunoblotting showed stage-specific expression of CybS(L) and CybS(A) in larval and adult mitochondria, respectively. Enzymatic assays revealed that the ratio of rhodoquinol-fumarate reductase (RQFR) to succinate-ubiquinone reductase (SQR) activities and the K(m) values for quinones are almost identical for the adult and larval complex IIs, but that the fumarate reductase (FRD) activity is higher for the adult form than for the larval form. These results indicate that the adult and larval A. suum complex IIs have different properties than the complex II of the mammalian host and that the larval complex II is able to function as a RQFR. Such RQFR activity of the larval complex II would be essential for rapid adaptation to the dramatic change of oxygen availability during infection of the host.

Expression of the nuclear gene TaF(A)d is under mitochondrial retrograde regulation in anthers of male sterile wheat plants with timopheevii cytoplasm.

PubMed

Xu, Pei; Yang, Yuwen; Zhang, Zhengzhi; Chen, Weihua; Zhang, Caiqin; Zhang, Lixia; Zou, Sixiang; Ma, Zhengqiang

2008-01-01

Alterations of mitochondrial-encoded subunits of the F(o)F(1)-ATP synthase are frequently associated with cytoplasmic male sterility (CMS) in plants; however, little is known about the relationship of the nuclear encoded subunits of this enzyme with CMS. In the present study, the full cDNA of the gene TaF(A)d that encodes the putative F(A)d subunit of the F(o)F(1)-ATP synthase was isolated from the wheat (Triticum aestivum) fertility restorer '2114' for timopheevii cytoplasm-based CMS. The deduced 238 amino acid polypeptide is highly similar to its counterparts in dicots and other monocots but has low homology to its mammalian equivalents. TaF(A)d is a single copy gene in wheat and maps to the short arm of the group 6 chromosomes. Transient expression of the TaF(A)d-GFP fusion in onion epidermal cells demonstrated TaF(A)d's mitochondrial location. TaF(A)d was expressed abundantly in stem, leaf, anther, and ovary tissues of 2114. Nevertheless, its expression was repressed in anthers of CMS plants with timopheevii cytoplasm. Genic male sterility did not affect its expression in anthers. The expression of the nuclear gene encoding the 20 kDa subunit of F(o) was down-regulated in a manner similar to TaF(A)d in the T-CMS anthers while that of genes encoding the 6 kDa subunit of F(o) and the gamma subunit of F(1) was unaffected. These observations implied that TaF(A)d is under mitochondrial retrograde regulation in the anthers of CMS plants with timopheevii cytoplasm.

Molecular characterization and expression profiles of nicotinic acetylcholine receptors in the rice striped stem borer, Chilo suppressalis (Lepidoptera: Crambidae).

PubMed

Xu, Gang; Wu, Shun-Fan; Teng, Zi-Wen; Yao, Hong-Wei; Fang, Qi; Huang, Jia; Ye, Gong-Yin

2017-06-01

Nicotinic acetylcholine receptors (nAChRs) are members of the cys-loop ligand-gated ion channel (cysLGIC) superfamily, mediating fast synaptic cholinergic transmission in the central nervous system in insects. Insect nAChRs are the molecular targets of economically important insecticides, such as neonicotinoids and spinosad. Identification and characterization of the nAChR gene family in the rice striped stem borer, Chilo suppressalis, could provide beneficial information about this important receptor gene family and contribute to the investigation of the molecular modes of insecticide action and resistance for current and future chemical control strategies. We searched our C. suppressalis transcriptome database using Bombyx mori nAChR sequences in local BLAST searches and obtained the putative nAChR subunit complementary DNAs (cDNAs) via reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends methods. Similar to B. mori, C. suppressalis possesses 12 nAChR subunits, including nine α-type and three β-type subunits. Quantitative RT-PCR analysis revealed the expression profiles of the nAChR subunits in various tissues, including the brain, subesophageal ganglion, thoracic ganglion, abdominal ganglion, hemocytes, fat body, foregut, midgut, hindgut and Malpighian tubules. Developmental expression analyses showed clear differential expression of nAChR subunits throughout the C. suppressalis life cycle. The identification of nAChR subunits in this study will provide a foundation for investigating the diverse roles played by nAChRs in C. suppressalis and for exploring specific target sites for chemicals that control agricultural pests while sparing beneficial species. ©2016 The Authors Insect Science published by John Wiley & Sons Australia, Ltd on behalf of Institute of Zoology, Chinese Academy of Sciences.

Analysis of molecular assemblies by flow cytometry: determinants of Gi1 and by binding

NASA Astrophysics Data System (ADS)

Sarvazyan, Noune A.; Neubig, Richard R.

1998-05-01

We report here a novel application of flow cytometry for the quantitative analysis of the high affinity interaction between membrane proteins both in detergent solutions and when reconstituted into lipid vesicles. The approach is further advanced to permit the analysis of binding to expressed protein complexes in native cell membranes. The G protein heterotrimer signal transduction function links the extracellularly activated transmembrane receptors and intracellular effectors. Upon activation, (alpha) and (beta) (gamma) subunits of G protein undergo a dissociation/association cycle on the cell membrane interface. The binding parameters of solubilized G protein (alpha) and (beta) (gamma) subunits have been defined but little is known quantitatively about their interactions in the membrane. Using a novel flow cytometry approach, the binding of low nanomolar concentrations of fluorescein-labeled G(alpha) i1 (F- (alpha) ) to (beta) (gamma) both in detergent solution and in a lipid environment was quantitatively compared. Unlabeled (beta) $gama reconstituted in biotinylated phospholipid vesicles bound F-(alpha) tightly (Kd 6 - 12 nM) while the affinity for biotinylated-(beta) (gamma) in Lubrol was even higher (Kd of 2.9 nM). The application of this approach to proteins expressed in native cell membranes will advance our understanding of G protein function in context of receptor and effector interaction. More generally, this approach can be applied to study the interaction of any fluorescently labeled protein with a membrane protein which can be expressed in Sf9 plasma membranes.

Immunochemical analysis of Micrococcus lysodeikticus (luteus) F1-ATPase and its subunits.

PubMed

Urban, C; Salton, M R

1983-08-31

The F1-ATPase from Micrococcus lysodeikticus has been purified to 95% protein homogeneity in this laboratory and as all other bacterial F1S, possesses five distinct subunits with molecular weights ranging from 60 000 to 10 000 (Huberman, M. and Salton, M.R.J. (1979) Biochim. Biophys. Acta 547, 230-240). In this communication, we demonstrate the immunochemical reactivities of antibodies to native and SDS-dissociated subunits with the native and dissociated F1-ATPase and show that: (1) the antibodies generated to the native or SDS-dissociated subunits react with the native molecule; (2) all of the subunits comprising the F1 are antigenically unique as determined by crossed immunoelectrophoresis and the Ouchterlony double-diffusion techniques; (3) antibodies to the SDS-denatured individual delta- and epsilon-subunits can be used to destabilize the interaction of these specific subunits with the rest of the native F1; and (4) all subunit antibodies as well as anti-native F1 were found to inhibit ATPase activity to varying degrees, the strongest inhibition being seen with antibodies to the total F1 and anti-alpha- and anti-beta-subunit antibodies. The interaction of specific subunit antibodies may provide a new and novel way to study further and characterize the catalytic portions of F1-ATPases and in general may offer an additional method for the examination of multimeric proteins.

Purification and characterization of selenium-containing phycocyanin from selenium-enriched Spirulina platensis.

PubMed

Chen, Tianfeng; Wong, Yum-Shing; Zheng, Wenjie

2006-11-01

A fast protein liquid chromatographic method for purification of selenium-containing phycocyanin (Se-PC) from selenium-enriched Spirulina platensis was described in this study. The purification procedures involved fractionation by ammonium sulfate precipitation, DEAE-Sepharose ion-exchange chromatography and Sephacry S-300 size exclusion chromatography. The purity ratio (A620/A280) and the separation factor (A620/A655) of the purified Se-PC were 5.12 and 7.92, respectively. The Se concentration of purified Se-PC was 496.5 microg g(-1) protein, as determined by ICP-AES analysis. The purity of the Se-PC was further characterized by UV-VIS and fluorescence spectrometry, SDS-PAGE, RP-HPLC and gel filtration HPLC. The apparent molecular mass of the native Se-PC determined by gel filtration HPLC was 109 kDa, indicating that the protein existed as a trimer. SDS-PAGE of the purified Se-PC yielded two major bands corresponding to the alpha and beta subunits. A better separation of these two subunits was obtained by RP-HPLC. Identification of the alpha and beta subunits separated by SDS-PAGE and RP-HPLC was achieved by peptide mass fingerprinting (PMF) using MALDI-TOF-TOF mass spectrometry.

Molecular characterisation of tumour necrosis factor alpha and its potential connection with lipoprotein lipase and peroxisome proliferator-activated receptors in blunt snout bream (Megalobrama amblycephala).

PubMed

Zhou, Man; Mi, Hai-Feng; Liu, Wen-Bin; Wu, Ye-Yang; Wang, Kai-Zhou; Jiang, Guang-Zhen

2017-08-01

Tumour necrosis factor alpha (TNF-α) is one kind of cytokines which is related to inflammation and lipid metabolism. TNF-α cDNA was cloned from the liver of blunt snout bream (Megalobrama amblycephala) through real-time polymerase chain reaction (PCR) and rapid amplification of cDNA ends (RACE) methods. The full-length cDNA of TNF-α covered 1467 bp, with an open reading frame (ORF) of 723 bp, which encodes 240 amino acids. It possessed the TNF family signature IIIPDDGIYFVYSQ. After the lipopolysaccharide (LPS) challenge test, a graded tissue-specific expression pattern of TNF-α was observed and there was high expression abundance in the kidney, brain and liver. After 8 weeks feeding trial, liver samples, two groups fed with 6% and 11% lipid levels, were collected. The results showed that, for fish fed with high-fat diet, the triglyceride of serum and lipid content of liver were elevated. Furthermore, TNF-α and peroxisome proliferator-activated receptors (PPARα, β) mRNA expression of fish fed 11% lipid diet were significantly up-regulated (p < 0.05). Lipoprotein lipase (LPL) and PPARγ mRNA expression of fish fed 11% lipid lever diet were significantly decreased compared to those of fish fed 6% (p < 0.05). The differences between the various expression of related genes in the high and low fat groups demonstrated that TNF-α played a key role in lipid metabolism, which may have an influence on fat metabolism through reducing fat synthesis and strengthening the β-oxidation of fatty acid. These discrepancies warrant further research.

Comparative Mg(2+)-dependent sequential covalent binding stoichiometries of 3'-O-(4-benzoyl)benzoyl adenosine 5'-diphosphate of MF1, TF1, and the alpha 3 beta 3 core complex of TF1. The binding change motif is independent of the F1 gamma delta epsilon subunits.

PubMed

Aloise, P; Kagawa, Y; Coleman, P S

1991-06-05

Three F1 preparations, the beef heart (MF1) and thermophilic bacterium (TF1) holoenzymes, and the alpha 3 beta 3 "core" complex of TF1 reconstituted from individually expressed alpha and beta subunits, were compared as to their kinetic and binding stoichiometric responses to covalent photoaffinity labeling with BzATP and BzADP (+/- Mg2+). Each enzyme displayed an enhanced pseudo-first order rate of photoinhibition and one-third of the sites covalent binding to a catalytic site for full inhibition, plus, but not minus Mg2+. Titration of near stoichiometric [MgBzADP]/[F1] ratios during photolysis disclosed two sequential covalent binding patterns for each enzyme; a high affinity binding corresponding to unistoichiometric covalent association concomitant with enzyme inhibition, followed by a low affinity multisite-saturating covalent association. Thus, in the absence of the structural asymmetry inducing gamma delta epsilon subunits of the holoenzyme, the sequential binding of nucleotide at putative catalytic sites on the alpha 3 beta 3 complex of any F1 appears sufficient to effect binding affinity changes. With MF1, final covalent saturation of BzADP-accessible sites was achieved with 2 mol of BzADP/mol of enzyme, but with TF1 or its alpha 3 beta 3 complex, saturation required 3 mol of BzADP/mol of enzyme. Such differential final labeling stoichiometries could arise because of the endogenous presence of 1 nucleotide already bound to one of the 3 potential catalytic sites on normally prepared MF1, whereas TF1, possessing no endogenous nucleotide, has 3 vacant BzADP-accessible sites. Kinetics measurements revealed that regardless of the incremental extent of inhibition of the TF1 holoenzyme by BzADP during photolysis, the two higher apparent Km values (approximately 1.5 x 10(-4) and approximately 10(-3) M, respectively) of the progressively inactivated incubation are unchanged relative to fully unmodified enzyme. As reported for BzATP (or BzADP) and MF1 (Ackerman, S.H., Grubmeyer, C., and Coleman, P.S. (1987) J. Biol. Chem. 262, 13765-13772), this supports the fact that the photocovalent inhibition of F1 is a one-hit one-kill phenomenon. Isoelectric focusing gels revealed that [3H]BzADP covalently modifies both TF1 and MF1 exclusively on the beta subunit, whether or not Mg2+ is present. A single 19-residue [3H]BzADP-labeled peptide was resolved from a tryptic digest of MF1, and this peptide corresponded with the one believed to contain at least a portion of the beta subunit catalytic site domain (i.e. beta Ala-338----beta Arg-356).

Novel alpha-galactosidase A mutation in a female with recurrent strokes.

PubMed

Tuttolomondo, Antonino; Duro, Giovanni; Miceli, Salvatore; Di Raimondo, Domenico; Pecoraro, Rosaria; Serio, Antonia; Albeggiani, Giuseppe; Nuzzo, Domenico; Iemolo, Francesco; Pizzo, Federica; Sciarrino, Serafina; Licata, Giuseppe; Pinto, Antonio

2012-11-01

Anderson-Fabry disease (AFD) is an X-linked inborn error of glycosphingolipid catabolism resulting from the deficient activity of the lysosomal exoglycohydrolase, a-galactosidase A. The complete genomic and cDNA sequences of the human alpha-galactosidase A gene have been determined and to date, several disease-causing alpha-galactosidase A mutations have been identified, including missense mutations, small deletions/insertions, splice mutations, and large gene rearrangements We report a case of a 56-year-old woman with recurrent cryptogenic strokes. Ophthalmological examination revealed whorled opacities of the cornea (cornea verticillata) and dilated tortuous conjunctival vessels. She did not show other typical signs of Fabry disease such as acroparesthesias and angiokeratoma. The patient's alpha-galactosidase A activity was 4.13 nmol/mL/h in whole blood. Alpha-galactosidase A gene sequence analysis revealed a heterozygous single nucleotide point mutation at nucleotide c.550T>A in exon 4 in this woman, leading to the p.Tyr184Asn amino acid substitution. Copyright © 2012 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Anthranilate synthase subunit organization in Chromobacterium violaceum.

PubMed

Carminatti, C A; Oliveira, I L; Recouvreux, D O S; Antônio, R V; Porto, L M

2008-09-16

Tryptophan is an aromatic amino acid used for protein synthesis and cellular growth. Chromobacterium violaceum ATCC 12472 uses two tryptophan molecules to synthesize violacein, a secondary metabolite of pharmacological interest. The genome analysis of this bacterium revealed that the genes trpA-F and pabA-B encode the enzymes of the tryptophan pathway in which the first reaction is the conversion of chorismate to anthranilate by anthranilate synthase (AS), an enzyme complex. In the present study, the organization and structure of AS protein subunits from C. violaceum were analyzed using bioinformatics tools available on the Web. We showed by calculating molecular masses that AS in C. violaceum is composed of alpha (TrpE) and beta (PabA) subunits. This is in agreement with values determined experimentally. Catalytic and regulatory sites of the AS subunits were identified. The TrpE and PabA subunits contribute to the catalytic site while the TrpE subunit is involved in the allosteric site. Protein models for the TrpE and PabA subunits were built by restraint-based homology modeling using AS enzyme, chains A and B, from Salmonella typhimurium (PDB ID 1I1Q).

Structural and kinetic properties of a novel purple acid phosphatase from phosphate-starved tomato (Lycopersicon esculentum) cell cultures.

PubMed Central

Bozzo, Gale G; Raghothama, Kashchandra G; Plaxton, William C

2004-01-01

An intracellular acid phosphatase (IAP) from P(i)-starved (-P(i)) tomato ( Lycopersicon esculentum ) suspension cells has been purified to homogeneity. IAP is a purple acid phosphatase (PAP), as the purified protein was violet in colour (lambda(max)=546 nm) and was insensitive to L-tartrate. PAGE, periodic acid-Schiff staining and peptide mapping demonstrated that the enzyme exists as a 142 kDa heterodimer composed of an equivalent ratio of glycosylated and structurally dissimilar 63 (alpha-subunit) and 57 kDa (beta-subunit) polypeptides. However, the nine N-terminal amino acids of the alpha- and beta-subunits were identical, exhibiting similarity to the deduced N-terminal portions of several putative plant PAPs. Quantification of immunoblots probed with rabbit anti-(tomato acid phosphatase) immune serum revealed that the 4-fold increase in IAP activity due to P(i)-deprivation was correlated with similar increases in the amount of antigenic IAP alpha- and beta-subunits. IAP displayed optimal activity at pH 5.1, was activated 150% by 10 mM Mg(2+), but was potently inhibited by Zn(2+), Cu(2+), Fe(3+), molybdate, vanadate, fluoride and P(i). Although IAP demonstrated broad substrate selectivity, its specificity constant ( V (max)/ K (m)) with phosphoenolpyruvate was >250% greater than that obtained with any other substrate. IAP exhibited significant peroxidase activity, which was optimal at pH 9.0 and insensitive to Mg(2+) or molybdate. This IAP is proposed to scavenge P(i) from intracellular phosphate esters in -P(i) tomato. A possible secondary IAP role in the metabolism of reactive oxygen species is discussed. IAP properties are compared with those of two extracellular PAP isoenzymes that are secreted into the medium of -P(i) tomato cells [Bozzo, Raghothama and Plaxton (2002) Eur. J. Biochem. 269, 6278-6286]. PMID:14521509

Hyperthyroidism caused by a pituitary thyrotrophin-secreting tumour with excessive secretion of thyrotrophin-releasing hormone and subsequently followed by Graves' disease in a middle-aged woman.

PubMed

Kamoi, K; Mitsuma, T; Sato, H; Yokoyama, M; Washiyama, K; Tanaka, R; Arai, O; Takasu, N; Yamada, T

1985-11-01

A 46-year-old woman had signs of thyrotoxicosis and galactorrhoea. Serum immunoreactive TSH and its alpha-subunit increased in the presence of high serum triiodothyronine (T3), thyroxine (T4), and free T4 concentrations, whereas beta-subunit TSH was undetectable. Exogenous TRH failed to increase serum TSH. Serum TSH was markedly suppressed by glucocorticoid, but was increased by antithyroid drug. L-Dopa or bromocriptine partially suppressed, but nomifensine had no influence on serum TSH. Serum prolactin (Prl) was above normal and markedly increased by TRH, but depressed by bromocriptine and not suppressed by nomifensine. Plasma TRH was normal in the hyperthyroid state, but was increased by glucocorticoid and antithyroid drug. Excess thyroid hormone depressed plasma TRH concentrations. Basal serum GH levels were constantly low. Transsphenoidal removal of the tumour normalized serum hormones (T3, T4 free T4, TSH, alpha-subunit and Prl), and eradicated the clinical signs of hyperthyroidism and galactorrhoea. Histological study of the tumour tissue demonstrated both thyrotrophes and somatotrophes. A reciprocal relationship between serum TSH and T4 concentrations shifted to a higher level before but was normalized after removal of the tumour. Ten months later, the clinical signs of thyrotoxicosis and the increase in serum thyroid hormone recurred without a concomitant increase in serum TSH and its alpha-subunit. Thyroidal auto-antibodies were slightly positive, but thyrotrophin-binding inhibitor immunoglobulin (TBII) was negative. Administration of antithyroid drug produced a euthyroid state, but 3 years later, discontinuation of the treatment resulted in recurrent hyperthyroidism without suppressed plasma TRH and with no evidence of regrowth of the pituitary tumour. It is suggested that the patient initially had hyperthyroidism owing to excessive TSH secretion from the tumour caused by abnormal TRH secretion, and subsequently had hyperthyroidism owing to Graves' disease.

Molecular Cloning and Characterization of an Acetylcholinesterase cDNA in the Brown Planthopper, Nilaparvata lugens

PubMed Central

Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

2010-01-01

A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain. PMID:20874389

The C8-binding protein of human erythrocytes: interaction with the components of the complement-attack phase.

PubMed Central

Schönermark, S; Filsinger, S; Berger, B; Hänsch, G M

1988-01-01

C8-binding protein is an intrinsic membrane protein of the human erythrocyte. It inhibits the complement (C5b-9)-mediated lysis in a species-restricting manner. In the present study we incorporated C8bp, isolated from human erythrocytes, into sheep erythrocytes (SRBC). SRBC, normally sensitive to lysis by human C5b-9, became insensitive to lysis. Furthermore, we found that C8bp is incorporated into the membrane-attack complex C5b-9, most probably by interacting with C8, since C8bp has an affinity for C8, particularly for the C8 alpha-gamma-subunit. Antibodies to C8bp react with the C8 alpha-subunits and with C9, pointing to the possibility of a partial homology between these proteins. Images Figure 4 Figure 6 Figure 7 PMID:3366469

A network of hydrophobic residues impeding helix alphaC rotation maintains latency of kinase Gcn2, which phosphorylates the alpha subunit of translation initiation factor 2.

PubMed

Gárriz, Andrés; Qiu, Hongfang; Dey, Madhusudan; Seo, Eun-Joo; Dever, Thomas E; Hinnebusch, Alan G

2009-03-01

Kinase Gcn2 is activated by amino acid starvation and downregulates translation initiation by phosphorylating the alpha subunit of translation initiation factor 2 (eIF2alpha). The Gcn2 kinase domain (KD) is inert and must be activated by tRNA binding to the adjacent regulatory domain. Previous work indicated that Saccharomyces cerevisiae Gcn2 latency results from inflexibility of the hinge connecting the N and C lobes and a partially obstructed ATP-binding site in the KD. Here, we provide strong evidence that a network of hydrophobic interactions centered on Leu-856 also promotes latency by constraining helix alphaC rotation in the KD in a manner relieved during amino acid starvation by tRNA binding and autophosphorylation of Thr-882 in the activation loop. Thus, we show that mutationally disrupting the hydrophobic network in various ways constitutively activates eIF2alpha phosphorylation in vivo and bypasses the requirement for a key tRNA binding motif (m2) and Thr-882 in Gcn2. In particular, replacing Leu-856 with any nonhydrophobic residue activates Gcn2, while substitutions with various hydrophobic residues maintain kinase latency. We further provide strong evidence that parallel, back-to-back dimerization of the KD is a step on the Gcn2 activation pathway promoted by tRNA binding and autophosphorylation. Remarkably, mutations that disrupt the L856 hydrophobic network or enhance hinge flexibility eliminate the need for the conserved salt bridge at the parallel dimer interface, implying that KD dimerization facilitates the reorientation of alphaC and remodeling of the active site for enhanced ATP binding and catalysis. We propose that hinge remodeling, parallel dimerization, and reorientation of alphaC are mutually reinforcing conformational transitions stimulated by tRNA binding and secured by the ensuing autophosphorylation of T882 for stable kinase activation.

T-cell receptor V sub. alpha. and C sub. alpha. alleles associated with multiple sclerosis and myasthenia gravis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oksenberg, J.R.; Cavalli-Sforza, L.L.; Steinman, L.

1989-02-01

Polymorphic markers in genes encoding the {alpha} chain of the human T-cell receptor (TcR) have been detected by Southern blot analysis in Pss I digests. Polymorphic bands were observed at 6.3 and 2.0 kilobases (kb) with frequencies of 0.30 and 0.44, respectively, in the general population. Using the polymerase chain reaction (PCR) method, the authors amplified selected sequences derived from the full-length TcR {alpha} cDNA probe. These PcR products were used as specific probes to demonstrate that the 6.3-kb polymorphic fragment hybridizes to the variable (V)-region probe and the 2.0-kb fragment hybridizes to the constant (C)-region probe. Segregation of themore » polymorphic bands was analyzed in family studies. To look for associations between these markers and autoimmune diseases, the authors have studied the restriction fragment length polymorphism distribution of the Pss I markers in patients with multiple sclerosis, myasthenia gravis, and Graves disease. Significant differences in the frequency of the polymorphic V{sub {alpha}} and C{sub {alpha}} markers were identified between patients and healthy individuals.« less

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Alpha B- and βA3-crystallins containing d-aspartic acids exist in a monomeric state.

PubMed

Sakaue, Hiroaki; Takata, Takumi; Fujii, Norihiko; Sasaki, Hiroshi; Fujii, Noriko

2015-01-01

Crystallin stability and subunit-subunit interaction are essential for eye lens transparency. There are three types of crystallins in lens, designated as α-, β-, and γ-crystallins. Alpha-crystallin is a hetero-polymer of about 800kDa, consisting of 35-40 subunits of two different αA- and αB-subunits, each of 20kDa. The β/γ-crystallin superfamily comprises oligomeric β-crystallin (2-6 subunits) and monomeric γ-crystallin. Since lens proteins have very long half-lives, they undergo numerous post-translational modifications including racemization, isomerization, deamidation, oxidation, glycation, and truncation, which may decrease crystallin solubility and ultimately cause cataract formation. Racemization and isomerization of aspartyl (Asp) residues have been detected only in polymeric α- and oligomeric β-crystallin, while the situation in monomeric γ-crystallin has not been studied. Here, we investigated the racemization and isomerization of Asp in the γ-crystallin fraction of elderly donors. The results show that Asp residues of γS-, γD- and γC-crystallins were not racemized and isomerized. However, strikingly, we found that a portion of αB-crystallin and βA3-crystallin moved to the lower molecular weight fraction which is the same size of γ-crystallin. In those fractions, Asp-96 of αB-crystallin and Asp-37 of βA3-crystallin were highly inverted, which do not occur in the native lens higher molecular weight fraction. Our results indicate the possibility that the inversion of Asp residues may induce dissociation of αB- and βA3-crystallins from the polymeric and oligomeric states. This is the first report that stereoinversion of amino acids disturbs lens protein assembly in aged human lens. Copyright © 2014 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fouassier, Laura; Nichols, Matthew T.; Gidey, Elizabeth

Ezrin-Radixin-Moesin (ERM) binding phosphoprotein 50 (EBP50, a.k.a. NHERF-1) is a scaffold protein essential for the localization and coordinated activity of apical transporters, enzymes and receptors in epithelial cells. EBP50 acts via multiple protein binding interactions, including oligomerization through interactions of its PSD95-Dlg-ZO1 (PDZ) domains. EBP50 can be phosphorylated on multiple sites and phosphorylation of specific sites modulates the extent of oligomerization. The aim of the present study was to test the capacity of protein kinase C (PKC) to phosphorylate EBP50 and to regulate its oligomerization. In vitro experiments showed that the catalytic subunit of PKC directly phosphorylates EBP50. In HEK-293more » cells transfected with rat EBP50 cDNA, a treatment with 12 myristate 13-acetate (PMA) induced a translocation of PKC{alpha} and {beta} isoforms to the membrane and increased {sup 32}P incorporation into EBP50. In co-transfection/co-precipitation studies, PMA treatment stimulated EBP50 oligomerization. Mass spectrometry analysis of full-length EBP50 and phosphorylation analyses of specific domains, and of mutated or truncated forms of EBP50, indicated that PKC-induced phosphorylation of EBP50 occurred on the Ser{sup 337}/Ser{sup 338} residue within the carboxyl-tail domain of the protein. Truncation of Ser{sup 337}/Ser{sup 338} also diminished PKC-induced oligomerization of EBP50. These results suggest the PKC signaling pathway can impact EBP50-dependent cellular functions by regulating EBP50 oligomerization.« less

Calmodulin is a phospholipase C-beta interacting protein.

PubMed

McCullar, Jennifer S; Larsen, Shana A; Millimaki, Ryan A; Filtz, Theresa M

2003-09-05

Phospholipase C-beta 3 (PLC beta 3) is an important effector enzyme in G protein-coupled signaling pathways. Activation of PLC beta 3 by G alpha and G beta gamma subunits has been fairly well characterized, but little is known about other protein interactions that may also regulate PLC beta 3 function. A yeast two-hybrid screen of a mouse brain cDNA library with the amino terminus of PLC beta 3 has yielded potential PLC beta 3 interacting proteins including calmodulin (CaM). Physical interaction between CaM and PLC beta 3 is supported by a positive secondary screen in yeast and the identification of a CaM binding site in the amino terminus of PLC beta 3. Co-precipitation of in vitro translated and transcribed amino- and carboxyl-terminal PLC beta 3 revealed CaM binding at a putative amino-terminal binding site. Direct physical interaction of PLC beta 3 and PLC beta 1 isoforms with CaM is supported by pull-down of both isoenzymes with CaM-Sepharose beads from 1321N1 cell lysates. CaM inhibitors reduced M1-muscarinic receptor stimulation of inositol phospholipid hydrolysis in 1321N1 astrocytoma cells consistent with a physiologic role for CaM in modulation of PLC beta activity. There was no effect of CaM kinase II inhibitors, KN-93 and KN-62, on M1-muscarinic receptor stimulation of inositol phosphate hydrolysis, consistent with a direct interaction between PLC beta isoforms and CaM.

A patient with thyrotropinoma cosecreting growth hormone and follicle-stimulating hormone with low alpha-glycoprotein: a new subentity?

PubMed

Elhadd, Tarik A; Ghosh, Sujoy; Teoh, Wei Leng; Trevethick, Katy Ann; Hanzely, Zoltan; Dunn, Laurence T; Malik, Iqbal A; Collier, Andrew

2009-08-01

Thyrotropinomas are rare pituitary tumors. In 25 percent of cases there is autonomous secretion of a second pituitary hormone, adding to the clinical complexity. We report a patient with thyrotropin (TSH)-dependant hyperthyroidism along with growth hormone (GH) and follicle-stimulating hormone (FSH) hypersecretion but low alpha-glycoprotein (alpha-subunit) concentrations, a hitherto unique constellation of findings. A 67-year-old Scottish lady presented with longstanding ankle edema, paroxysmal atrial fibrillation, uncontrolled hypertension, fine tremors, warm peripheries, and agitation. Initial findings were a small goiter, elevated serum TSH of 7.37 mU/L (normal range, 0.30-6.0 mU/L), a free-thyroxine concentration of 34.9 pmol/L (normal range, 9.0-24.0 pmol/L), a flat TSH response to TSH-releasing hormone, and serum alpha-subunit of 3.1 IU/L (normal, <3.0 IU/L). There was no evidence of an abnormal thyroid hormone beta receptor by genotyping. Serum FSH was 56.8 U/L, but the luteinizing hormone (LH) was 23.6 U/L (postmenopausal FSH and LH reference ranges both >30 U/L) Basal insulin-like growth factor I was elevated to 487 microg/L with the concomitant serum GH being 14.1 mU/L, and subsequent serum GH values 30 minutes after 75 g oral glucose being 19.1 mU/L and 150 minutes later being 13.7 mU/L. An magnetic resonance imaging pituitary revealed a macroadenoma. Pituitary adenomectomy was performed with the histology confirming a pituitary adenoma, and the immunohistochemistry staining showed positive reactivity for FSH with scattered cells staining for GH and TSH. Staining for other anterior pituitary hormones was negative. After pituitary surgery she became clinically and biochemically euthyroid, the serum IFG-1 became normal, but the pattern of serum FSH and LH did not change. This case of plurihormonal thyrotropinoma is unique in having hypersecretion of TSH, GH, and FSH with low alpha-subunit. Such a combination may represent a new subentity of TSHomas.