Intricate interplay between astrocytes and motor neurons in ALS

PubMed Central

Phatnani, Hemali P.; Guarnieri, Paolo; Friedman, Brad A.; Carrasco, Monica A.; Muratet, Michael; O’Keeffe, Sean; Nwakeze, Chiamaka; Pauli-Behn, Florencia; Newberry, Kimberly M.; Meadows, Sarah K.; Tapia, Juan Carlos; Myers, Richard M.; Maniatis, Tom

2013-01-01

ALS results from the selective and progressive degeneration of motor neurons. Although the underlying disease mechanisms remain unknown, glial cells have been implicated in ALS disease progression. Here, we examine the effects of glial cell/motor neuron interactions on gene expression using the hSOD1G93A (the G93A allele of the human superoxide dismutase gene) mouse model of ALS. We detect striking cell autonomous and nonautonomous changes in gene expression in cocultured motor neurons and glia, revealing that the two cell types profoundly affect each other. In addition, we found a remarkable concordance between the cell culture data and expression profiles of whole spinal cords and acutely isolated spinal cord cells during disease progression in the G93A mouse model, providing validation of the cell culture approach. Bioinformatics analyses identified changes in the expression of specific genes and signaling pathways that may contribute to motor neuron degeneration in ALS, among which are TGF-β signaling pathways. PMID:23388633

Multiple Drug Treatments That Increase cAMP Signaling Restore Long-Term Memory and Aberrant Signaling in Fragile X Syndrome Models

PubMed Central

Choi, Catherine H.; Schoenfeld, Brian P.; Bell, Aaron J.; Hinchey, Joseph; Rosenfelt, Cory; Gertner, Michael J.; Campbell, Sean R.; Emerson, Danielle; Hinchey, Paul; Kollaros, Maria; Ferrick, Neal J.; Chambers, Daniel B.; Langer, Steven; Sust, Steven; Malik, Aatika; Terlizzi, Allison M.; Liebelt, David A.; Ferreiro, David; Sharma, Ali; Koenigsberg, Eric; Choi, Richard J.; Louneva, Natalia; Arnold, Steven E.; Featherstone, Robert E.; Siegel, Steven J.; Zukin, R. Suzanne; McDonald, Thomas V.; Bolduc, Francois V.; Jongens, Thomas A.; McBride, Sean M. J.

2016-01-01

Fragile X is the most common monogenic disorder associated with intellectual disability (ID) and autism spectrum disorders (ASD). Additionally, many patients are afflicted with executive dysfunction, ADHD, seizure disorder and sleep disturbances. Fragile X is caused by loss of FMRP expression, which is encoded by the FMR1 gene. Both the fly and mouse models of fragile X are also based on having no functional protein expression of their respective FMR1 homologs. The fly model displays well defined cognitive impairments and structural brain defects and the mouse model, although having subtle behavioral defects, has robust electrophysiological phenotypes and provides a tool to do extensive biochemical analysis of select brain regions. Decreased cAMP signaling has been observed in samples from the fly and mouse models of fragile X as well as in samples derived from human patients. Indeed, we have previously demonstrated that strategies that increase cAMP signaling can rescue short term memory in the fly model and restore DHPG induced mGluR mediated long term depression (LTD) in the hippocampus to proper levels in the mouse model (McBride et al., 2005; Choi et al., 2011, 2015). Here, we demonstrate that the same three strategies used previously with the potential to be used clinically, lithium treatment, PDE-4 inhibitor treatment or mGluR antagonist treatment can rescue long term memory in the fly model and alter the cAMP signaling pathway in the hippocampus of the mouse model. PMID:27445731

Targeting Extracellular Cyclophilin A Reduces Neuroinflammation and Extends Survival in a Mouse Model of Amyotrophic Lateral Sclerosis.

PubMed

Pasetto, Laura; Pozzi, Silvia; Castelnovo, Mariachiara; Basso, Manuela; Estevez, Alvaro G; Fumagalli, Stefano; De Simoni, Maria Grazia; Castellaneta, Valeria; Bigini, Paolo; Restelli, Elena; Chiesa, Roberto; Trojsi, Francesca; Monsurrò, Maria Rosaria; Callea, Leonardo; Malešević, Miroslav; Fischer, Gunter; Freschi, Mattia; Tortarolo, Massimo; Bendotti, Caterina; Bonetto, Valentina

2017-02-08

Neuroinflammation is a major hallmark of amyotrophic lateral sclerosis (ALS), which is currently untreatable. Several anti-inflammatory compounds have been evaluated in patients and in animal models of ALS, but have been proven disappointing in part because effective targets have not yet been identified. Cyclophilin A, also known as peptidylprolyl cis-/trans-isomerase A (PPIA), as a foldase is beneficial intracellularly, but extracellularly has detrimental functions. We found that extracellular PPIA is a mediator of neuroinflammation in ALS. It is a major inducer of matrix metalloproteinase 9 and is selectively toxic for motor neurons. High levels of PPIA were found in the CSF of SOD1 G93A mice and rats and sporadic ALS patients, suggesting that our findings may be relevant for familial and sporadic cases. A specific inhibitor of extracellular PPIA, MM218, given at symptom onset, rescued motor neurons and extended survival in the SOD1 G93A mouse model of familial ALS by 11 d. The treatment resulted in the polarization of glia toward a prohealing phenotype associated with reduced NF-κB activation, proinflammatory markers, endoplasmic reticulum stress, and insoluble phosphorylated TDP-43. Our results indicates that extracellular PPIA is a promising druggable target for ALS and support further studies to develop a therapy to arrest or slow the progression of the disease in patients. SIGNIFICANCE STATEMENT We provide evidence that extracellular cyclophilin A, also known as peptidylprolyl cis-/trans-isomerase A (PPIA), is a mediator of the neuroinflammatory reaction in amyotrophic lateral sclerosis (ALS) and is toxic for motor neurons. Supporting this, a specific extracellular PPIA inhibitor reduced neuroinflammation, rescued motor neurons, and extended survival in the SOD1 G93A mouse model of familial ALS. Our findings suggest selective pharmacological inhibition of extracellular PPIA as a novel therapeutic strategy, not only for SOD1-linked ALS, but possibly also for sporadic ALS. This approach aims to address the neuroinflammatory reaction that is a major hallmark of ALS. However, given the complexity of the disease, a combination of therapeutic approaches may be necessary. Copyright © 2017 the authors 0270-6474/17/371414-15$15.00/0.

A C9ORF72 BAC mouse model recapitulates key epigenetic perturbations of ALS/FTD.

PubMed

Esanov, Rustam; Cabrera, Gabriela Toro; Andrade, Nadja S; Gendron, Tania F; Brown, Robert H; Benatar, Michael; Wahlestedt, Claes; Mueller, Christian; Zeier, Zane

2017-06-12

Amyotrophic Lateral Sclerosis (ALS) is a fatal and progressive neurodegenerative disorder with identified genetic causes representing a significant minority of all cases. A GGGGCC hexanucleotide repeat expansion (HRE) mutation within the C9ORF72 gene has recently been identified as the most frequent known cause of ALS. The expansion leads to partial heterochromatinization of the locus, yet mutant RNAs and dipeptide repeat proteins (DPRs) are still produced in sufficient quantities to confer neurotoxicity. The levels of these toxic HRE products positively correlate with cellular toxicity and phenotypic severity across multiple disease models. Moreover, the degree of epigenetic repression inversely correlates with some facets of clinical presentation in C9-ALS patients. Recently, bacterial artificial chromosomes (BAC) have been used to generate transgenic mice that harbor the HRE mutation, complementing other relevant model systems such as patient-derived induced pluripotent stem cells (iPSCs). While epigenetic features of the HRE have been investigated in various model systems and post-mortem tissues, epigenetic dysregulation at the expanded locus in C9-BAC mice remains unexplored. Here, we sought to determine whether clinically relevant epigenetic perturbations caused by the HRE are mirrored in a C9-BAC mouse model. We used complementary DNA methylation assessment and immunoprecipitation methods to demonstrate that epigenetic aberrations caused by the HRE, such as DNA and histone methylation, are recapitulated in the C9-BAC mice. Strikingly, we found that cytosine hypermethylation within the promoter region of the human transgene occurred in a subset of C9-BAC mice similar to what is observed in patient populations. Moreover, we show that partial heterochromatinization of the C9 HRE occurs during the first weeks of the mouse lifespan, indicating age-dependent epigenetic repression. Using iPSC neurons, we found that preventing R-loop formation did not impede heterochromatinization of the HRE. Taken together, these observations provide further insight into mechanism and developmental time-course of epigenetic perturbations conferred by the C9ORF72 HRE. Finally, we suggest that epigenetic repression of the C9ORF72 HRE and nearby gene promoter could impede or delay motor neuron degeneration in C9-BAC mouse models of ALS/FTD.

Behavioral Analysis and Rescue of a Novel Cerebellar Mouse Model of Tuberous Sclerosis Complex

DTIC Science & Technology

2012-05-01

and Silva; Lee et al.; Marui et al., 2004). Therefore, dysregulation of mTORC1 appears to be an important pathway leading to the autistic-phenotype...for understanding the role of cerebellar pathology in autism. Eur J Neurosci. 31, 544-55. Marui , T., et al., 2004. Association between the

Gamma motor neurons survive and exacerbate alpha motor neuron degeneration in ALS.

PubMed

Lalancette-Hebert, Melanie; Sharma, Aarti; Lyashchenko, Alexander K; Shneider, Neil A

2016-12-20

The molecular and cellular basis of selective motor neuron (MN) vulnerability in amyotrophic lateral sclerosis (ALS) is not known. In genetically distinct mouse models of familial ALS expressing mutant superoxide dismutase-1 (SOD1), TAR DNA-binding protein 43 (TDP-43), and fused in sarcoma (FUS), we demonstrate selective degeneration of alpha MNs (α-MNs) and complete sparing of gamma MNs (γ-MNs), which selectively innervate muscle spindles. Resistant γ-MNs are distinct from vulnerable α-MNs in that they lack synaptic contacts from primary afferent (I A ) fibers. Elimination of these synapses protects α-MNs in the SOD1 mutant, implicating this excitatory input in MN degeneration. Moreover, reduced I A activation by targeted reduction of γ-MNs in SOD1 G93A mutants delays symptom onset and prolongs lifespan, demonstrating a pathogenic role of surviving γ-MNs in ALS. This study establishes the resistance of γ-MNs as a general feature of ALS mouse models and demonstrates that synaptic excitation of MNs within a complex circuit is an important determinant of relative vulnerability in ALS.

Gamma motor neurons survive and exacerbate alpha motor neuron degeneration in ALS

PubMed Central

Lalancette-Hebert, Melanie; Sharma, Aarti; Lyashchenko, Alexander K.; Shneider, Neil A.

2016-01-01

The molecular and cellular basis of selective motor neuron (MN) vulnerability in amyotrophic lateral sclerosis (ALS) is not known. In genetically distinct mouse models of familial ALS expressing mutant superoxide dismutase-1 (SOD1), TAR DNA-binding protein 43 (TDP-43), and fused in sarcoma (FUS), we demonstrate selective degeneration of alpha MNs (α-MNs) and complete sparing of gamma MNs (γ-MNs), which selectively innervate muscle spindles. Resistant γ-MNs are distinct from vulnerable α-MNs in that they lack synaptic contacts from primary afferent (IA) fibers. Elimination of these synapses protects α-MNs in the SOD1 mutant, implicating this excitatory input in MN degeneration. Moreover, reduced IA activation by targeted reduction of γ-MNs in SOD1G93A mutants delays symptom onset and prolongs lifespan, demonstrating a pathogenic role of surviving γ-MNs in ALS. This study establishes the resistance of γ-MNs as a general feature of ALS mouse models and demonstrates that synaptic excitation of MNs within a complex circuit is an important determinant of relative vulnerability in ALS. PMID:27930290

Differentiated NSC-34 cells as an in vitro Cell Model for VX

DTIC Science & Technology

2014-09-11

potential candidate drugs/antidotes. The development of an in vitro cellular model to aid in discovering new NA therapeutics would be highly beneficial...principally as potent cholinesterase inhibitors. The toxicity of these compounds and their mode of action are attributed to the inhibition of the enzyme ...of motor neuron- enriched, embryonic mouse spinal cord cells with mouse neuroblastoma as a potential neuronal model (Durham et al., 1993). This cell

Distinct roles for motor neuron autophagy early and late in the SOD1G93A mouse model of ALS

PubMed Central

Rudnick, Noam D.; Griffey, Christopher J.; Guarnieri, Paolo; Gerbino, Valeria; Wang, Xueyong; Piersaint, Jason A.; Tapia, Juan Carlos; Rich, Mark M.; Maniatis, Tom

2017-01-01

Mutations in autophagy genes can cause familial and sporadic amyotrophic lateral sclerosis (ALS). However, the role of autophagy in ALS pathogenesis is poorly understood, in part due to the lack of cell type-specific manipulations of this pathway in animal models. Using a mouse model of ALS expressing mutant superoxide dismutase 1 (SOD1G93A), we show that motor neurons form large autophagosomes containing ubiquitinated aggregates early in disease progression. To investigate whether this response is protective or detrimental, we generated mice in which the critical autophagy gene Atg7 was specifically disrupted in motor neurons (Atg7 cKO). Atg7 cKO mice were viable but exhibited structural and functional defects at a subset of vulnerable neuromuscular junctions. By crossing Atg7 cKO mice to the SOD1G93A mouse model, we found that autophagy inhibition accelerated early neuromuscular denervation of the tibialis anterior muscle and the onset of hindlimb tremor. Surprisingly, however, lifespan was extended in Atg7 cKO; SOD1G93A double-mutant mice. Autophagy inhibition did not prevent motor neuron cell death, but it reduced glial inflammation and blocked activation of the stress-related transcription factor c-Jun in spinal interneurons. We conclude that motor neuron autophagy is required to maintain neuromuscular innervation early in disease but eventually acts in a non–cell-autonomous manner to promote disease progression. PMID:28904095

In-vivo effects of knocking-down metabotropic glutamate receptor 5 in the SOD1G93A mouse model of amyotrophic lateral sclerosis.

PubMed

Bonifacino, Tiziana; Cattaneo, Luca; Gallia, Elena; Puliti, Aldamaria; Melone, Marcello; Provenzano, Francesca; Bossi, Simone; Musante, Ilaria; Usai, Cesare; Conti, Fiorenzo; Bonanno, Giambattista; Milanese, Marco

2017-09-01

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder due to loss of upper and lower motor neurons (MNs). The mechanisms of neuronal death are largely unknown, thus prejudicing the successful pharmacological treatment. One major cause for MN degeneration in ALS is represented by glutamate(Glu)-mediated excitotoxicity. We have previously reported that activation of Group I metabotropic Glu receptors (mGluR1 and mGluR5) at glutamatergic spinal cord nerve terminals produces abnormal Glu release in the widely studied SOD1 G93A mouse model of ALS. We also demonstrated that halving mGluR1 expression in the SOD1 G93A mouse had a positive impact on survival, disease onset, disease progression, and on a number of cellular and biochemical readouts of ALS. We generated here SOD1 G93A mice with reduced expression of mGluR5 (SOD1 G93A Grm5 -/+ ) by crossing the SOD1 G93A mutant mouse with the mGluR5 heterozigous Grm5 -/+ mouse. SOD1 G93A Grm5 -/+ mice showed prolonged survival probability and delayed pathology onset. These effects were associated to enhanced number of preserved MNs, decreased astrocyte and microglia activation, reduced cytosolic free Ca 2+ concentration, and regularization of abnormal Glu release in the spinal cord of SOD1 G93A Grm5 -/+ mice. Unexpectedly, only male SOD1 G93A Grm5 -/+ mice showed improved motor skills during disease progression vs. SOD1 G93A mice, while SOD1 G93A Grm5 -/+ females did not. These results demonstrate that a lower constitutive level of mGluR5 has a significant positive impact in mice with ALS and support the idea that blocking Group I mGluRs may represent a potentially effective pharmacological approach to the disease. Copyright © 2017 Elsevier Ltd. All rights reserved.

Developing Novel Automated Apparatus for Studying Battery of Social Behaviors in Mutant Mouse Models for Autism

DTIC Science & Technology

2013-06-01

Psychiatry, 2008. 13(1): p. 4-26. 2. McFarlane, H.G., et al., Autism -like behavioral phenotypes in BTBR T+tf/J mice. Genes Brain Behav, 2008. 7(2): p. 152...63. 3. Brodkin, E.S., BALB/c mice: low sociability and other phenotypes that may be relevant to autism . Behav Brain Res, 2007. 176(1): p. 53-65. 4...S.S., et al., Development of a mouse test for repetitive, restricted behaviors: relevance to autism . Behav Brain Res, 2008. 188(1): p. 178-94. 6

Characterization of Neurofibromas of the Skin and Spinal Roots in a Mouse Model

DTIC Science & Technology

2011-02-01

renewal program of stem/progenitor cells can cause tumorigenesis. By utilizing genetically engineered mouse models of neurofibromatosis type 1 (NF1...pathetic ganglia and adrenal medulla and died at birth (Gitler et al., 2003). To circumvent early lethality of the Nf1NC mice, we utilized a previously...Supplemental experimental procedures Tissue Processing For histological analysis, we utilized both paraffin sections and frozen sections. For both

Mouse models of ciliopathies: the state of the art

PubMed Central

Norris, Dominic P.; Grimes, Daniel T.

2012-01-01

The ciliopathies are an apparently disparate group of human diseases that all result from defects in the formation and/or function of cilia. They include disorders such as Meckel-Grüber syndrome (MKS), Joubert syndrome (JBTS), Bardet-Biedl syndrome (BBS) and Alström syndrome (ALS). Reflecting the manifold requirements for cilia in signalling, sensation and motility, different ciliopathies exhibit common elements. The mouse has been used widely as a model organism for the study of ciliopathies. Although many mutant alleles have proved lethal, continued investigations have led to the development of better models. Here, we review current mouse models of a core set of ciliopathies, their utility and future prospects. PMID:22566558

77 FR 24499 - Government-Owned Inventions; Availability for Licensing: Mouse Models

Federal Register 2010, 2011, 2012, 2013, 2014

2012-04-24

..., suggesting that Sirt3 may be a mitochondria-localized tumor suppressor by maintaining mitochondrial integrity.... Developer of Mouse: Chuxia Deng, Ph.D. (NIDDK). Relevant Publication: Kim HS, et al. SIRT3 is a mitochondria... which interacts with mitochondria to activate the caspase 9 pathway. Mice in which the Bcl-x gene is...

Hypoexcitability precedes denervation in the large fast-contracting motor units in two unrelated mouse models of ALS

PubMed Central

Martínez-Silva, María de Lourdes; Imhoff-Manuel, Rebecca D; Sharma, Aarti; Heckman, CJ; Shneider, Neil A; Roselli, Francesco; Zytnicki, Daniel

2018-01-01

Hyperexcitability has been suggested to contribute to motoneuron degeneration in amyotrophic lateral sclerosis (ALS). If this is so, and given that the physiological type of a motor unit determines the relative susceptibility of its motoneuron in ALS, then one would expect the most vulnerable motoneurons to display the strongest hyperexcitability prior to their degeneration, whereas the less vulnerable should display a moderate hyperexcitability, if any. We tested this hypothesis in vivo in two unrelated ALS mouse models by correlating the electrical properties of motoneurons with their physiological types, identified based on their motor unit contractile properties. We found that, far from being hyperexcitable, the most vulnerable motoneurons become unable to fire repetitively despite the fact that their neuromuscular junctions were still functional. Disease markers confirm that this loss of function is an early sign of degeneration. Our results indicate that intrinsic hyperexcitability is unlikely to be the cause of motoneuron degeneration. PMID:29580378

Resveratrol Ameliorates Motor Neuron Degeneration and Improves Survival in SOD1G93A Mouse Model of Amyotrophic Lateral Sclerosis

PubMed Central

Song, Lin; Zhang, Xiaojie; Li, Jia; Le, Weidong

2014-01-01

Resveratrol has recently been used as a supplemental treatment for several neurological and nonneurological diseases. It is not known whether resveratrol has neuroprotective effect on amyotrophic lateral sclerosis (ALS). To assess the effect of resveratrol on the disease, we tested this agent on an ALS model of SOD1G93A transgenic mouse. Rotarod measurement was performed to measure the motor function of the ALS mice. Nissl staining and SMI-32 immunofluorescent staining were used to determine motor neurons survival in the spinal cord of the ALS mice. Hematoxylin-eosin (H&E), succinic dehydrogenase (SDH), and cytochrome oxidase (COX) staining were applied to pathologically analyze the skeletal muscles of the ALS mice. We found that resveratrol treatment significantly delayed the disease onset and prolonged the lifespan of the ALS mice. Furthermore, resveratrol treatment attenuated motor neuron loss, relieved muscle atrophy, and improved mitochondrial function of muscle fibers in the ALS mice. In addition, we demonstrated that resveratrol exerted these neuroprotective effects mainly through increasing the expression of Sirt1, consequently suppressing oxidative stress and downregulating p53 and its related apoptotic pathway. Collectively, our findings suggest that resveratrol might provide a promising therapeutic intervention for ALS. PMID:25057490

The Autism Diagnosis in Translation: Shared Affect in Children and Mouse Models of ASD

PubMed Central

Bishop, Somer L.; Lahvis, Garet P.

2013-01-01

In recent years, there have been significant improvements in assessment and diagnostic procedures for autism spectrum disorders (ASD). Standardized diagnostic instruments have been developed, promoting consistent diagnostic practices among clinicians. For clinical researchers, these instruments have facilitated collaborations across different sites by providing standardized metrics with which to evaluate ASD symptoms. Nevertheless, because ASD remains a diagnosis that is defined on the basis of behavior, there are significant challenges associated with modeling ASD social behaviors in laboratory animals. In order to more effectively study the causes of ASD symptoms and behaviors, there is a need to develop new ways of measuring social behaviors that can be applied to non-human species. Critically, while verbal dialogue between the clinician and patient is integral to clinical diagnoses, it cannot be employed for studies of animal models. However, observations of autistic-like social interactions can be modeled in animals. In this regard, communication between professionals in the clinical and basic sciences is necessary to break down the complex diagnosis into units of social impairment that can be more feasibly measured in different species. This paper presents a discussion between an animal researcher and a clinical psychologist. Using shared affect as an example, we explore potential avenues for increasing the utility of animal models to move us toward a better understanding of the mechanisms underlying social impairments in ASD. In the absence of molecular biomarkers that can be used to diagnose ASD, current diagnostic tools depend upon clinical assessments of behavior. Research efforts with human subjects have successfully utilized standardized diagnostic instruments, which include clinician interviews with parents and direct observation of the children themselves (Risi et al., 2006). However, because clinical instruments are semi-structured and rely heavily on dynamic social processes and clinical skill, scores from these measures do not necessarily lend themselves directly to experimental investigations into the causes of ASD. Studies of the neurobiology of autism require experimental animal models. Mice are particularly useful, in this regard, for elucidating genetic and toxicologjcal contributions to impairments in social function (Halladay et al., 2009). Behavioral tests have been developed that are relevant to autism (Crawley, 2004, 2007), including measures of repetitive behaviors (Lewis, Tanimura, Lee, & Bodfish, 2007; Moy et al., 2008), social behavior (Brodkin, 2007; Lijam et al., 1997; Moretti, Bouwknecht, Teague, Paylor, & Zoghbi, 2005), and vocal communication (Panksepp et al., 2007). Advances also include development of high-throughput measures of mouse sociability that can be used to reliably compare inbred mouse strains (Moy, et al., 2008; Nadler et al., 2004), as well as measures of social reward (Panksepp & Lahvis, 2007) and empathy (Chen, Panksepp, & Lahvis, 2009; Langford et al., 2006). With continued generation of mouse gene-targeted mice that are directly relevant to genetic linkages in ASD, there remains an urgent need to utilize a full suite of mouse behavioral tests that allows for a comprehensive assessment of the spectrum of social difficulties relevant to ASD. Using impairments in shared affect as an example, this paper explores potential avenues for collaboration between clinical and basic scientists, within an amply considered translational framework. PMID:21882361

Memory Enhancing Effect of Black Pepper in the AlCl3 Induced Neurotoxicity Mouse Model is Mediated Through Its Active Component Chavicine.

PubMed

Iqbal, Ghazala; Iqbal, Anila; Mahboob, Aamra; Farhat, Syeda M; Ahmed, Touqeer

Black pepper (Piper nigrum Linn.) has vital pharmacological properties with profound effects on central nervous system. Neurotoxic agents like Aluminum Chloride (AlCl3) cause the oxidative stress and result in improper processing of amyloid proteins leading to accumulation of amyloid β plaques. The study aimed to explore the neuroprotective potential of black pepper (BP) extract (12.5mg/kg/day) on memory enhancement and its effect on expression of amyloid precursor protein (APP) isoforms (APP770 and APP695) in AlCl3 induced neurotoxicity (250mg/kg) mouse model. The study included the isolation and identification of pure compound from BP (chavicine) which was found pharmacologically active. Morris water maze test, elevated plus maze, fear conditioning, context and cue dependent test and social preference tests were performed to investigate the learning and memory. Gene expression (APP isoforms) and in-vitro and ex-vivo DPPH free radical scavenging activity were performed to evaluate the role of BP. BP significantly improved memory in AlCl3 induced neurotoxicity mouse model along with effectively decreasing the expression of APP770 (amyloidogenic) isoform and improved level of APP695 (non-amyloidogenic) in hippocampus, amygdala and cortex. Fear extinction learning was considerably improved in BP treated group (7.83±2.03) than AlCl3 induced neurotoxicity group (39.75±4.25). In the hippocampus, BP significantly reduced the expression of APP770 (0.37±0.05) as compared to AlCl3 induced neurotoxicity group (0.72±0.06), and effectively increased (34.80±1.39) the percentage inhibition of DPPH free radicals as compared to AlCl3 induced neurotoxicity group (14±2.68). The study revealed that BP improves memory and chavicine is a lead compound producing pharmacological effects of BP.

Neuroprotective efficacy of aminopropyl carbazoles in a mouse model of amyotrophic lateral sclerosis.

PubMed

Tesla, Rachel; Wolf, Hamilton Parker; Xu, Pin; Drawbridge, Jordan; Estill, Sandi Jo; Huntington, Paula; McDaniel, Latisha; Knobbe, Whitney; Burket, Aaron; Tran, Stephanie; Starwalt, Ruth; Morlock, Lorraine; Naidoo, Jacinth; Williams, Noelle S; Ready, Joseph M; McKnight, Steven L; Pieper, Andrew A

2012-10-16

We previously reported the discovery of P7C3, an aminopropyl carbazole having proneurogenic and neuroprotective properties in newborn neural precursor cells of the hippocampal dentate gyrus. We have further found that chemicals having efficacy in this in vivo screening assay also protect dopaminergic neurons of the substantia nigra following exposure to the neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine, a mouse model of Parkinson disease. Here, we provide evidence that an active analog of P7C3, known as P7C3A20, protects ventral horn spinal cord motor neurons from cell death in the G93A-SOD1 mutant mouse model of amyotrophic lateral sclerosis (ALS). P7C3A20 is efficacious in this model when administered at disease onset, and protection from cell death correlates with preservation of motor function in assays of walking gait and in the accelerating rotarod test. The prototypical member of this series, P7C3, delays disease progression in G93A-SOD1 mice when administration is initiated substantially earlier than the expected time of symptom onset. Dimebon, an antihistaminergic drug with significantly weaker proneurogenic and neuroprotective efficacy than P7C3, confers no protection in this ALS model. We propose that the chemical scaffold represented by P7C3 and P7C3A20 may provide a basis for the discovery and optimization of pharmacologic agents for the treatment of ALS.

Neuroprotective efficacy of aminopropyl carbazoles in a mouse model of amyotrophic lateral sclerosis

PubMed Central

Tesla, Rachel; Wolf, Hamilton Parker; Xu, Pin; Drawbridge, Jordan; Estill, Sandi Jo; Huntington, Paula; McDaniel, LaTisha; Knobbe, Whitney; Burket, Aaron; Tran, Stephanie; Starwalt, Ruth; Morlock, Lorraine; Naidoo, Jacinth; Williams, Noelle S.; Ready, Joseph M.; McKnight, Steven L.; Pieper, Andrew A.

2012-01-01

We previously reported the discovery of P7C3, an aminopropyl carbazole having proneurogenic and neuroprotective properties in newborn neural precursor cells of the hippocampal dentate gyrus. We have further found that chemicals having efficacy in this in vivo screening assay also protect dopaminergic neurons of the substantia nigra following exposure to the neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine, a mouse model of Parkinson disease. Here, we provide evidence that an active analog of P7C3, known as P7C3A20, protects ventral horn spinal cord motor neurons from cell death in the G93A-SOD1 mutant mouse model of amyotrophic lateral sclerosis (ALS). P7C3A20 is efficacious in this model when administered at disease onset, and protection from cell death correlates with preservation of motor function in assays of walking gait and in the accelerating rotarod test. The prototypical member of this series, P7C3, delays disease progression in G93A-SOD1 mice when administration is initiated substantially earlier than the expected time of symptom onset. Dimebon, an antihistaminergic drug with significantly weaker proneurogenic and neuroprotective efficacy than P7C3, confers no protection in this ALS model. We propose that the chemical scaffold represented by P7C3 and P7C3A20 may provide a basis for the discovery and optimization of pharmacologic agents for the treatment of ALS. PMID:23027932

Potential Role of the Gut Microbiome in ALS: A Systematic Review.

PubMed

Wright, Michelle L; Fournier, Christina; Houser, Madelyn C; Tansey, Malú; Glass, Jonathan; Hertzberg, Vicki Stover

2018-01-01

Amyotrophic lateral sclerosis (ALS) etiology and pathophysiology are not well understood. Recent data suggest that dysbiosis of gut microbiota may contribute to ALS etiology and progression. This review aims to explore evidence of associations between gut microbiota and ALS etiology and pathophysiology. Databases were searched for publications relevant to the gut microbiome in ALS. Three publications provided primary evidence of changes in microbiome profiles in ALS. An ALS mouse model revealed damaged tight junction structure and increased permeability in the intestine versus controls along with a shifted microbiome profile, including decreased levels of butyrate-producing bacteria. In a subsequent publication, again using an ALS mouse model, researchers showed that dietary supplementation with butyrate relieved symptoms and lengthened both time to onset of weight loss and survival time. In a small study of ALS patients and healthy controls, investigators also found decreased levels of butyrate-producing bacteria. Essential for maintaining gut barrier integrity, butyrate is the preferred energy source of intestinal epithelial cells. Ten other articles were reviews and commentaries providing indirect support for a role of gut microbiota in ALS pathophysiology. Thus, these studies provide a modicum of evidence implicating gut microbiota in ALS disease, although more research is needed to confirm the connection and determine pathophysiologic mechanisms. Nurses caring for these patients need to understand the gut microbiome and its potential role in ALS in order to effectively counsel patients and their families about emerging therapies (e.g., prebiotics, probiotics, and fecal microbial transplant) and their off-label uses.

Alantolactone and Isoalantolactone Prevent Amyloid β25-35 -induced Toxicity in Mouse Cortical Neurons and Scopolamine-induced Cognitive Impairment in Mice.

PubMed

Seo, Ji Yeon; Lim, Soon Sung; Kim, Jiyoung; Lee, Ki Won; Kim, Jong-Sang

2017-05-01

Given the evidence for detoxifying/antioxidant enzyme-inducing activities by alantolactone (AL) and isoalantolactone (IAL), the purpose of this study was to investigate the effects of AL and IAL on Aβ 25-35 -induced cell death in mouse cortical neuron cells and to determine their effects on scopolamine-induced amnesia in mice. Our data demonstrated that both compounds effectively attenuated the cytotoxicity of Aβ 25-35 (10 μM) in neuronal cells derived from the mouse cerebral cortex. It was also found that the production of intracellular reactive oxygen species, including superoxide anion induced by Aβ 25-35 , was inhibited. Moreover, the administration of the sesquiterpenes reversed scopolamine-induced cognitive impairments as assessed by Morris water, Y-maze, and the passive avoidance tests, and the compounds decreased acetylcholinesterase (AChE) activities in a dose-dependent manner. Interestingly, AL and IAL did not improve scopolamine-induced cognitive deficit in Nrf2 -/- mice, suggesting that memory improvement by sesquiterpenes was mediated not only by the activation of the Nrf2 signaling pathway but also by their inhibitory activity against AChE. In conclusion, our results showed that AL and IAL had neuroprotective effects and reversed cognitive impairments induced by scopolamine in a mouse model. Therefore, AL and IAL deserve further study as potential therapeutic agents for reactive oxygen species-related neurodegenerative diseases. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Brain and Plasma Molecular Characterization of the Pathogenic TBI-AD Interrelationship in Mouse Models

DTIC Science & Technology

2015-10-01

collegiate football players: the NCAA Concussion Study. JAMA 290, 2549-2555. Hinkebein, J.H., Martin, T.A., Callahan, C.D., and Johnstone, B. (2003). Concept...al., 2014). We have also developed a novel mouse model of mild TBI (mTBI)/ concussion in which we have demonstrated cognitive dysfunction at 6, 12...2010). Boxing-acute complications and late sequelae: from concussion to dementia. Dtsch Arztebl Int 107, 835-839. Gaetz, M., and Weinberg, H

Assessing the Mechanisms of MDS and Its Transformation to Leukemia in a Novel Humanized Mouse

DTIC Science & Technology

2016-05-01

achievements N/A References N/A References: 1. Rongvaux, A., et al., Development and function of human innate immune cells in a...in cancer survivors. MDS is inherently difficult to study. MDS stem cells cannot be grown in culture and in vivo models are thus the gold standard...However, MDS stem cells are diseased and fail to efficiently engraft in current immunodeficient mouse models. We have optimized engraftment of

Absence of Nrf2 or Its Selective Overexpression in Neurons and Muscle Does Not Affect Survival in ALS-Linked Mutant hSOD1 Mouse Models

PubMed Central

Vargas, Marcelo R.; Burton, Neal C.; Gan, Li; Johnson, Delinda A.; Schäfer, Matthias; Werner, Sabine; Johnson, Jeffrey A.

2013-01-01

The nuclear factor erythroid 2-related factor 2 (Nrf2) governs the expression of antioxidant and phase II detoxifying enzymes. Nrf2 activation can prevent or reduce cellular damage associated with several types of injury in many different tissues and organs. Dominant mutations in Cu/Zn-superoxide dismutase (SOD1) cause familial forms of amyotrophic lateral sclerosis (ALS), a fatal disorder characterized by the progressive loss of motor neurons and subsequent muscular atrophy. We have previously shown that Nrf2 activation in astrocytes delays neurodegeneration in ALS mouse models. To further investigate the role of Nrf2 in ALS we determined the effect of absence of Nrf2 or its restricted overexpression in neurons or type II skeletal muscle fibers on symptoms onset and survival in mutant hSOD1 expressing mice. We did not observe any detrimental effect associated with the lack of Nrf2 in two different mutant hSOD1 animal models of ALS. However, restricted Nrf2 overexpression in neurons or type II skeletal muscle fibers delayed disease onset but failed to extend survival in hSOD1G93A mice. These results highlight the concept that not only the pharmacological target but also the cell type targeted may be relevant when considering a Nrf2-mediated therapeutic approach for ALS. PMID:23418589

Absence of Nrf2 or its selective overexpression in neurons and muscle does not affect survival in ALS-linked mutant hSOD1 mouse models.

PubMed

Vargas, Marcelo R; Burton, Neal C; Kutzke, Jennifer; Gan, Li; Johnson, Delinda A; Schäfer, Matthias; Werner, Sabine; Johnson, Jeffrey A

2013-01-01

The nuclear factor erythroid 2-related factor 2 (Nrf2) governs the expression of antioxidant and phase II detoxifying enzymes. Nrf2 activation can prevent or reduce cellular damage associated with several types of injury in many different tissues and organs. Dominant mutations in Cu/Zn-superoxide dismutase (SOD1) cause familial forms of amyotrophic lateral sclerosis (ALS), a fatal disorder characterized by the progressive loss of motor neurons and subsequent muscular atrophy. We have previously shown that Nrf2 activation in astrocytes delays neurodegeneration in ALS mouse models. To further investigate the role of Nrf2 in ALS we determined the effect of absence of Nrf2 or its restricted overexpression in neurons or type II skeletal muscle fibers on symptoms onset and survival in mutant hSOD1 expressing mice. We did not observe any detrimental effect associated with the lack of Nrf2 in two different mutant hSOD1 animal models of ALS. However, restricted Nrf2 overexpression in neurons or type II skeletal muscle fibers delayed disease onset but failed to extend survival in hSOD1(G93A) mice. These results highlight the concept that not only the pharmacological target but also the cell type targeted may be relevant when considering a Nrf2-mediated therapeutic approach for ALS.

Modulating inflammatory monocytes with a unique microRNA gene signature ameliorates murine ALS.

PubMed

Butovsky, Oleg; Siddiqui, Shafiuddin; Gabriely, Galina; Lanser, Amanda J; Dake, Ben; Murugaiyan, Gopal; Doykan, Camille E; Wu, Pauline M; Gali, Reddy R; Iyer, Lakshmanan K; Lawson, Robert; Berry, James; Krichevsky, Anna M; Cudkowicz, Merit E; Weiner, Howard L

2012-09-01

Amyotrophic lateral sclerosis (ALS) is a progressive disease associated with neuronal cell death that is thought to involve aberrant immune responses. Here we investigated the role of innate immunity in a mouse model of ALS. We found that inflammatory monocytes were activated and that their progressive recruitment to the spinal cord, but not brain, correlated with neuronal loss. We also found a decrease in resident microglia in the spinal cord with disease progression. Prior to disease onset, splenic Ly6Chi monocytes expressed a polarized macrophage phenotype (M1 signature), which included increased levels of chemokine receptor CCR2. As disease onset neared, microglia expressed increased CCL2 and other chemotaxis-associated molecules, which led to the recruitment of monocytes to the CNS by spinal cord-derived microglia. Treatment with anti-Ly6C mAb modulated the Ly6Chi monocyte cytokine profile, reduced monocyte recruitment to the spinal cord, diminished neuronal loss, and extended survival. In humans with ALS, the analogous monocytes (CD14+CD16-) exhibited an ALS-specific microRNA inflammatory signature similar to that observed in the ALS mouse model, linking the animal model and the human disease. Thus, the profile of monocytes in ALS patients may serve as a biomarker for disease stage or progression. Our results suggest that recruitment of inflammatory monocytes plays an important role in disease progression and that modulation of these cells is a potential therapeutic approach.

Reduced Activity of AMP-Activated Protein Kinase Protects against Genetic Models of Motor Neuron Disease

PubMed Central

Lim, M. A.; Selak, M. A.; Xiang, Z.; Krainc, D.; Neve, R. L.; Kraemer, B. C.; Watts, J. L.

2012-01-01

A growing body of research indicates that amyotrophic lateral sclerosis (ALS) patients and mouse models of ALS exhibit metabolic dysfunction. A subpopulation of ALS patients possesses higher levels of resting energy expenditure and lower fat-free mass compared to healthy controls. Similarly, two mutant copper zinc superoxide dismutase 1 (mSOD1) mouse models of familial ALS possess a hypermetabolic phenotype. The pathophysiological relevance of the bioenergetic defects observed in ALS remains largely elusive. AMP-activated protein kinase (AMPK) is a key sensor of cellular energy status and thus might be activated in various models of ALS. Here, we report that AMPK activity is increased in spinal cord cultures expressing mSOD1, as well as in spinal cord lysates from mSOD1 mice. Reducing AMPK activity either pharmacologically or genetically prevents mSOD1-induced motor neuron death in vitro. To investigate the role of AMPK in vivo, we used Caenorhabditis elegans models of motor neuron disease. C. elegans engineered to express human mSOD1 (G85R) in neurons develops locomotor dysfunction and severe fecundity defects when compared to transgenic worms expressing human wild-type SOD1. Genetic reduction of aak-2, the ortholog of the AMPK α2 catalytic subunit in nematodes, improved locomotor behavior and fecundity in G85R animals. Similar observations were made with nematodes engineered to express mutant tat-activating regulatory (TAR) DNA-binding protein of 43 kDa molecular weight. Altogether, these data suggest that bioenergetic abnormalities are likely to be pathophysiologically relevant to motor neuron disease. PMID:22262909

A Cell Based Assay To Identify Neuroprotective Molecules for the Treatment of Amyotrophic Lateral Sclerosis

DTIC Science & Technology

This project on ALS stems from our findings that rodent astrocytes expressing mutated SOD1 kill specifically spinal primary and embryonic mouse stem...identifying the toxic factor, the topic of this project is to search for neuroprotective small molecules by using ourcell-based model of ALS for high

Protein Aggregation Inhibitors for ALS Therapy

DTIC Science & Technology

2013-07-01

mechanisms of neuronal degeneration remain unknown in ALS, it has been postulated that protein misfolding and aggregation may be an early event that...our best compounds from last year at different doses in the ALS mouse model, and investigating possible mechanisms of action of the compounds...attachment of groups for pull-down mechanism of action experiments. Table 1. SAR studies of substituted pyrazolones. Entry R1 R2 EC50 (M) a

Mouse model systems to study sex chromosome genes and behavior: relevance to humans

PubMed Central

Cox, Kimberly H.; Bonthuis, Paul J.; Rissman, Emilie F.

2014-01-01

Sex chromosome genes directly influence sex differences in behavior. The discovery of the Sry gene on the Y chromosome (Gubbay et al., 1990; Koopman et al., 1990) substantiated the sex chromosome mechanistic link to sex differences. Moreover, the pronounced connection between X chromosome gene mutations and mental illness produces a strong sex bias in these diseases. Yet, the dominant explanation for sex differences continues to be the gonadal hormones. Here we review progress made on behavioral differences in mouse models that uncouple sex chromosome complement from gonadal sex. We conclude that many social and cognitive behaviors are modified by sex chromosome complement, and discuss the implications for human research. Future directions need to include identification of the genes involved and interactions with these genes and gonadal hormones. PMID:24388960

How MMPs Impact Bone Responses to Metastatic Prostate Cancer

DTIC Science & Technology

2011-04-30

various tumor cell types including myeloma ( Barille et al., 1997; Vacca et al., 1998; Barille et al., 1999; Vacca et al., 1999). Previous studies have...useful in vivo mouse model of human multiple myeloma. Hematol. J. 1, 351-356. Barille , S., Akhoundi, C., Collette, M., Mellerin, M. P., Rapp, M. J...activation of proMMP-2, and induction of MMP-1 by myeloma cells. Blood 90, 1649-1655. Barille , S., Bataille, R., Rapp, M. J., Harousseau, J. L. and Amiot, M

The expanding syndrome of amyotrophic lateral sclerosis: a clinical and molecular odyssey

PubMed Central

Turner, Martin R; Swash, Michael

2015-01-01

Recent advances in understanding amyotrophic lateral sclerosis (ALS) have delivered new questions. Disappointingly, the initial enthusiasm for transgenic mouse models of the disease has not been followed by rapid advances in therapy or prevention. Monogenic models may have inadvertently masked the true complexity of the human disease. ALS has evolved into a multisystem disorder, involving a final common pathway accessible via multiple upstream aetiological tributaries. Nonetheless, there is a common clinical core to ALS, as clear today as it was to Charcot and others. We stress the continuing relevance of clinical observations amid the increasing molecular complexity of ALS. PMID:25644224

The Role of the Sonic Hedgehog Pathway for Prostate Cancer Progression

DTIC Science & Technology

2005-02-01

GY, Qi YP, Gysin S, Fernandez-Del Castillo C, Yalnik V, Antoniu and real-time PCR analyses. Sumnin Chi contributed to B, McMahon M, Warshaw AL, Hebrok... Romer JT, Kimura H, Magdaleno Set al:. 391(6662), 90-92 (1998). in a mouse model of prostate carcinogenesis. Suppression of the Shh pathway using a 10󈧘

SIRT1 deacetylase protects against neurodegeneration in models for Alzheimer's disease and amyotrophic lateral sclerosis.

PubMed

Kim, Dohoon; Nguyen, Minh Dang; Dobbin, Matthew M; Fischer, Andre; Sananbenesi, Farahnaz; Rodgers, Joseph T; Delalle, Ivana; Baur, Joseph A; Sui, Guangchao; Armour, Sean M; Puigserver, Pere; Sinclair, David A; Tsai, Li-Huei

2007-07-11

A progressive loss of neurons with age underlies a variety of debilitating neurological disorders, including Alzheimer's disease (AD) and amyotrophic lateral sclerosis (ALS), yet few effective treatments are currently available. The SIR2 gene promotes longevity in a variety of organisms and may underlie the health benefits of caloric restriction, a diet that delays aging and neurodegeneration in mammals. Here, we report that a human homologue of SIR2, SIRT1, is upregulated in mouse models for AD, ALS and in primary neurons challenged with neurotoxic insults. In cell-based models for AD/tauopathies and ALS, SIRT1 and resveratrol, a SIRT1-activating molecule, both promote neuronal survival. In the inducible p25 transgenic mouse, a model of AD and tauopathies, resveratrol reduced neurodegeneration in the hippocampus, prevented learning impairment, and decreased the acetylation of the known SIRT1 substrates PGC-1alpha and p53. Furthermore, injection of SIRT1 lentivirus in the hippocampus of p25 transgenic mice conferred significant protection against neurodegeneration. Thus, SIRT1 constitutes a unique molecular link between aging and human neurodegenerative disorders and provides a promising avenue for therapeutic intervention.

SIRT1 deacetylase protects against neurodegeneration in models for Alzheimer's disease and amyotrophic lateral sclerosis

PubMed Central

Kim, Dohoon; Nguyen, Minh Dang; Dobbin, Matthew M; Fischer, Andre; Sananbenesi, Farahnaz; Rodgers, Joseph T; Delalle, Ivana; Baur, Joseph A; Sui, Guangchao; Armour, Sean M; Puigserver, Pere; Sinclair, David A; Tsai, Li-Huei

2007-01-01

A progressive loss of neurons with age underlies a variety of debilitating neurological disorders, including Alzheimer's disease (AD) and amyotrophic lateral sclerosis (ALS), yet few effective treatments are currently available. The SIR2 gene promotes longevity in a variety of organisms and may underlie the health benefits of caloric restriction, a diet that delays aging and neurodegeneration in mammals. Here, we report that a human homologue of SIR2, SIRT1, is upregulated in mouse models for AD, ALS and in primary neurons challenged with neurotoxic insults. In cell-based models for AD/tauopathies and ALS, SIRT1 and resveratrol, a SIRT1-activating molecule, both promote neuronal survival. In the inducible p25 transgenic mouse, a model of AD and tauopathies, resveratrol reduced neurodegeneration in the hippocampus, prevented learning impairment, and decreased the acetylation of the known SIRT1 substrates PGC-1alpha and p53. Furthermore, injection of SIRT1 lentivirus in the hippocampus of p25 transgenic mice conferred significant protection against neurodegeneration. Thus, SIRT1 constitutes a unique molecular link between aging and human neurodegenerative disorders and provides a promising avenue for therapeutic intervention. PMID:17581637

A Mouse Ependymoma Model Provides Molecular Insights into Tumor Formation.

PubMed

Pajtler, Kristian W; Pfister, Stefan M

2018-06-26

Ozawa et al. present a murine tumor model resembling the most frequent molecular group of human supratentorial ependymoma, ST-EPN-RELA. Their model shows RELA-fusion-based de novo ependymoma tumorigenesis in the forebrain derived from neural stem cells. Copyright © 2018. Published by Elsevier Inc.

A Progressive Translational Mouse Model of Human VCP Disease: The VCP R155H/+ Mouse

PubMed Central

Nalbandian, Angèle; Llewellyn, Katrina J.; Badadani, Mallikarjun; Yin, Hong Z.; Nguyen, Christopher; Katheria, Veeral; Watts, Giles; Mukherjee, Jogeshwar; Vesa, Jouni; Caiozzo, Vincent; Mozaffar, Tahseen; Weiss, John H.; Kimonis, Virginia E.

2012-01-01

Introduction Mutations in the valosin containing protein (VCP) gene cause hereditary Inclusion Body Myopathy (hIBM) associated with Paget disease of bone (PDB), and frontotemporal dementia (FTD). More recently they have been linked to 2% of familial ALS cases. A knock-in mouse model offers the opportunity to study VCP-associated pathogenesis. Methods The VCPR155H/+ knock-in mouse model was assessed for muscle strength, immunohistochemical, Western, apoptosis, autophagy and MicroPET/CT imaging analyses. Results VCPR155H/+ mice developed significant progressive muscle weakness, and the quadriceps and brain developed progressive cytoplasmic accumulation of TDP-43, ubiquitin-positive inclusion bodies and increased LC3-II staining. MicroCT analyses revealed Paget-like lesions at the ends of long bones. Spinal cord demonstrated neurodegenerative changes, ubiquitin, and TDP-43 pathology of motor neurons. Discussion VCPR155H/+ knock-in mice represent an excellent pre-clinical model for understanding VCP-associated disease mechanisms and future treatments. PMID:23169451

Memory-enhancing effect of aspirin is mediated through opioid system modulation in an AlCl3-induced neurotoxicity mouse model

PubMed Central

RIZWAN, SAIMA; IDREES, AYESHA; ASHRAF, MUHAMMAD; AHMED, TOUQEER

2016-01-01

Neurodegenerative disorders such as Alzheimers disease (AD) are multifaceted and there are currently a limited number of therapeutic strategies available to treat them. Aspirin is known to act on multiple therapeutic targets and is a successful anti-inflammatory agent in various tissues. The present study aimed to ascertain the performance of aspirin when employed as a therapeutic agent to treat neurodegeneration on novel targets, including opioid system genes, in an AlCl3-induced neurotoxicity mouse model. The effects of two doses of aspirin (5 and 20 mg/kg aspirin for 12 days) were investigated in an AlCl3-induced neurotoxicity mouse model (150 mg/kg AlCl3 for 12 days). Neurological improvements were assessed through different behavioral tests and the effects of aspirin on opioid system gene expression levels were assessed by reverse transcription-polymerase chain reaction. Both doses resulted in improvements in cognitive behavior. A 5 mg/kg dose of aspirin was revealed to be effective for spatial memory improvement (7.14±0.84 sec), whilst a 20 mg/kg dose was superior for improving extinction learning (7.63±4.04%). Aspirin (5 mg/kg) also significantly improved contextual memory (48.05±10.6%) when compared with the AlCl3-treated group (1.49±0.62%; P<0.001). Aspirin was also observed to significantly decrease δ-opioid receptor expression in the cortex (1.09±0.08 and 1.27±0.08, respectively) at both doses (5 and 20 mg/kg) when compared with the AlCl3-treated group (3.69±1.43; P<0.05). Furthermore, aspirin at 5 mg/kg significantly reduced expression of prodynorphin in the cortex (0.57±0.20) when compared with the AlCl3-treated group (1.95±0.84; P<0.05). Notably, the effect of aspirin was significant in the cortex but not in the hippocampus. In summary, aspirin was effective in ameliorating the AD-like symptoms via the modulation of opioid systems. However, additional studies are required to determine the long term effects of aspirin on such conditions. PMID:27168835

Misbehaving macrophages in the pathogenesis of psoriasis.

PubMed

Clark, Rachael A; Kupper, Thomas S

2006-08-01

Psoriasis is a chronic inflammatory skin disease unique to humans. In this issue of the JCI, 2 studies of very different mouse models of psoriasis both report that macrophages play a key role in inducing psoriasis-like skin disease. Psoriasis is clearly a polygenic, inherited disease of uncontrolled cutaneous inflammation. The debate that currently rages in the field is whether psoriasis is a disease of autoreactive T cells or whether it reflects an intrinsic defect within the skin--or both. However, these questions have proven difficult to dissect using molecular genetic tools. In the current studies, the authors have used 2 different animal models to address the role of macrophages in disease pathogenesis: Wang et al. use a mouse model in which inflammation is T cell dependent, whereas the model used by Stratis et al. is T cell independent (see the related articles beginning on pages 2105 and 2094, respectively). Strikingly, both groups report an important contribution by macrophages, implying that macrophages can contribute to both epithelial-based and T cell-mediated pathways of inflammation.

Generation of a neuro-specific microarray reveals novel differentially expressed noncoding RNAs in mouse models for neurodegenerative diseases.

PubMed

Gstir, Ronald; Schafferer, Simon; Scheideler, Marcel; Misslinger, Matthias; Griehl, Matthias; Daschil, Nina; Humpel, Christian; Obermair, Gerald J; Schmuckermair, Claudia; Striessnig, Joerg; Flucher, Bernhard E; Hüttenhofer, Alexander

2014-12-01

We have generated a novel, neuro-specific ncRNA microarray, covering 1472 ncRNA species, to investigate their expression in different mouse models for central nervous system diseases. Thereby, we analyzed ncRNA expression in two mouse models with impaired calcium channel activity, implicated in Epilepsy or Parkinson's disease, respectively, as well as in a mouse model mimicking pathophysiological aspects of Alzheimer's disease. We identified well over a hundred differentially expressed ncRNAs, either from known classes of ncRNAs, such as miRNAs or snoRNAs or which represented entirely novel ncRNA species. Several differentially expressed ncRNAs in the calcium channel mouse models were assigned as miRNAs and target genes involved in calcium signaling, thus suggesting feedback regulation of miRNAs by calcium signaling. In the Alzheimer mouse model, we identified two snoRNAs, whose expression was deregulated prior to amyloid plaque formation. Interestingly, the presence of snoRNAs could be detected in cerebral spine fluid samples in humans, thus potentially serving as early diagnostic markers for Alzheimer's disease. In addition to known ncRNAs species, we also identified 63 differentially expressed, entirely novel ncRNA candidates, located in intronic or intergenic regions of the mouse genome, genomic locations, which previously have been shown to harbor the majority of functional ncRNAs. © 2014 Gstir et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

CUL4B ubiquitin ligase in mouse development: a model for human X-linked mental retardation syndrome?

PubMed

Zhao, Yongchao; Sun, Yi

2012-08-01

CUL4B, a member of the cullin-RING ubiquitin ligase family, is frequently mutated in X-linked mental retardation (XLMR) patients. The study by Liu et al. showed that Cul4b plays an essential developmental role in the extra-embryonic tissues, while it is dispensable in the embryo proper during mouse embryogenesis. Viable Cul4b-null mice provide the first animal model to study neuronal and behavioral deficiencies seen in human CUL4B XLMR patients.

Harnessing the Power of Light to See and Treat Breast Cancer

DTIC Science & Technology

2011-10-01

generate sarcomas include LSL- KrasG12D/+;Trp53Flox/Flox, BrafCa/+;Trp53 Flox/Flox and BrafCa/Ca;Trp53Flox/Flox.7,8 Soft tissue sarcomas were generated...temporally restricted mouse model of soft tissue sarcoma , Nat Med, 2007. 13(8): p. 992-7. 8. Dankort, D., et al., A new mouse model to explore the...resolution anatomical images of heterogeneous tissue. To do so we are employing the use of two ex vivo test beds: 1) murine sarcoma margins and 2

HFE p.H63D polymorphism does not influence ALS phenotype and survival.

PubMed

Chiò, Adriano; Mora, Gabriele; Sabatelli, Mario; Caponnetto, Claudia; Lunetta, Christian; Traynor, Bryan J; Johnson, Janel O; Nalls, Mike A; Calvo, Andrea; Moglia, Cristina; Borghero, Giuseppe; Monsurrò, Maria Rosaria; La Bella, Vincenzo; Volanti, Paolo; Simone, Isabella; Salvi, Fabrizio; Logullo, Francesco O; Nilo, Riva; Giannini, Fabio; Mandrioli, Jessica; Tanel, Raffaella; Murru, Maria Rita; Mandich, Paola; Zollino, Marcella; Conforti, Francesca L; Penco, Silvana; Brunetti, Maura; Barberis, Marco; Restagno, Gabriella

2015-10-01

It has been recently reported that the p.His63Asp polymorphism of the HFE gene accelerates disease progression both in the SOD1 transgenic mouse and in amyotrophic lateral sclerosis (ALS) patients. We have evaluated the effect of HFE p.His63Asp polymorphism on the phenotype in 1351 Italian ALS patients (232 of Sardinian ancestry). Patients were genotyped for the HFE p.His63Asp polymorphism (CC, GC, and GG). All patients were also assessed for C9ORF72, TARDBP, SOD1, and FUS mutations. Of the 1351 ALS patients, 363 (29.2%) were heterozygous (GC) for the p.His63Asp polymorphism and 30 (2.2%) were homozygous for the minor allele (GG). Patients with CC, GC, and GG polymorphisms did not significantly differ by age at onset, site of onset of symptoms, and survival; however, in SOD1 patients with CG or GG polymorphism had a significantly longer survival than those with a CC polymorphism. Differently from what observed in the mouse model of ALS, the HFE p.His63Asp polymorphism has no effect on ALS phenotype in this large series of Italian ALS patients. Copyright © 2015 Elsevier Inc. All rights reserved.

Phenotypic outcomes in Mouse and Human Foxc1 dependent Dandy-Walker cerebellar malformation suggest shared mechanisms.

PubMed

Haldipur, Parthiv; Dang, Derek; Aldinger, Kimberly A; Janson, Olivia K; Guimiot, Fabien; Adle-Biasette, Homa; Dobyns, William B; Siebert, Joseph R; Russo, Rosa; Millen, Kathleen J

2017-01-16

FOXC1 loss contributes to Dandy-Walker malformation (DWM), a common human cerebellar malformation. Previously, we found that complete Foxc1 loss leads to aberrations in proliferation, neuronal differentiation and migration in the embryonic mouse cerebellum (Haldipur et al., 2014). We now demonstrate that hypomorphic Foxc1 mutant mice have granule and Purkinje cell abnormalities causing subsequent disruptions in postnatal cerebellar foliation and lamination. Particularly striking is the presence of a partially formed posterior lobule which echoes the posterior vermis DW 'tail sign' observed in human imaging studies. Lineage tracing experiments in Foxc1 mutant mouse cerebella indicate that aberrant migration of granule cell progenitors destined to form the posterior-most lobule causes this unique phenotype. Analyses of rare human del chr 6p25 fetal cerebella demonstrate extensive phenotypic overlap with our Foxc1 mutant mouse models, validating our DWM models and demonstrating that many key mechanisms controlling cerebellar development are likely conserved between mouse and human.

Preclinical Studies of Signaling Pathways in a Mutant Mouse Model of Hormone-Refractory Prostate Cancer

DTIC Science & Technology

2011-02-01

uro - genital mesenchyme (Lamm et al. 2002; Freestone et al. 2003; Berman et al. 2004); and loss...recombination with rodent embryonic uro - genital mesenchyme and grafting into immunodeficient recipients (Hayward et al. 2001; Gao et al. 2004a; Jiang et al...M y c d ri v en b y A R R 2 P B p ro m o te r; H i- M y c an d lo w -M y c d if fe r in la te n cy . P h en o ty p e: P IN an d ad en o ca rc in o m

Glutamate release and uptake processes are altered in a new mouse model of amyotrophic lateral sclerosis.

PubMed

Grigoriev, V V; Efimova, A D; Ustyugov, A A; Shevchenko, V P; Bachurin, S O; Myasoedov, N F

2016-05-01

In this paper, we showed that in the cortex of mice expressing an abberant form of FUS protein that model amyotrophic lateral sclerosis (ALS), the processes of KCl-induced and basal [(3)H]glutamate release and uptake are altered at the presymptomatic stage as compared to the non-transgenic littermates. The change in these three parameters in transgenic animals causes excitotoxicity, which, in turn, may lead to massive loss of motor neurons and the onset of ALS symptoms.

The Overexpression of TDP-43 Protein in the Neuron and Oligodendrocyte Cells Causes the Progressive Motor Neuron Degeneration in the SOD1 G93A Transgenic Mouse Model of Amyotrophic Lateral Sclerosis.

PubMed

Lu, Yi; Tang, Chunyan; Zhu, Lei; Li, Jiao; Liang, Huiting; Zhang, Jie; Xu, Renshi

2016-01-01

The recent investigation suggested that the TDP-43 protein was closely related to the motor neuron degeneration in amyotrophic lateral sclerosis (ALS), but the pathogenesis contributed to motor neuron degeneration largely remained unknown. Therefore, we detected the alteration of TDP-43 expression and distribution in the adult spinal cord of the SOD1 G93A transgenic mouse model for searching the possible pathogenesis of ALS. We examined the TDP-43 expression and distribution in the different anatomic regions, segments and neural cells in the adult spinal cord at the different stages of the SOD1 wild-type and G93A transgenic model by the fluorescent immunohistochemical technology. We revealed that the amount of TDP-43 positive cell was cervical>lumbar>thoracic segment, that in the ventral horn was more than that in the dorsal horn, a few of TDP-43 protein sparsely expressed and distributed in the other regions, the TDP-43 protein weren't detected in the white matter and the central canal. The TDP-43 protein was mostly expressed and distributed in the nuclear of neuron cells and the cytoplasm of oligodendrocyte cells of the gray matter surrounding the central canal of spinal cord by the granular shape in the SOD1 wild-type and G93A transgenic mice. The amount of TDP-43 positive cell significantly increased at the onset and progression stages of ALS following with the increase of neuron death in spinal cord, particularly in the ventral horn of cervical segment at the progression stage. Our results suggested that the overexpression of TDP-43 protein in the neuron and oligodendrocyte cell causes the progressive motor neuron degeneration in the ALS-like mouse model.

Low-frequency magnetic fields do not aggravate disease in mouse models of Alzheimer's disease and amyotrophic lateral sclerosis

PubMed Central

Liebl, Martina P.; Windschmitt, Johannes; Besemer, Anna S.; Schäfer, Anne-Kathrin; Reber, Helmut; Behl, Christian; Clement, Albrecht M.

2015-01-01

Low-frequency magnetic fields (LF-MF) generated by power lines represent a potential environmental health risk and are classified as possibly carcinogenic by the World Health Organization. Epidemiological studies indicate that LF-MF might propagate neurodegenerative diseases like Alzheimer's disease (AD) or amyotrophic lateral sclerosis (ALS). We conducted a comprehensive analysis to determine whether long-term exposure to LF-MF (50 Hz, 1 mT) interferes with disease development in established mouse models for AD and ALS, namely APP23 mice and mice expressing mutant Cu/Zn-superoxide dismutase (SOD1), respectively. Exposure for 16 months did not aggravate learning deficit of APP23 mice. Likewise, disease onset and survival of SOD1G85R or SOD1G93A mice were not altered upon LF-MF exposure for ten or eight months, respectively. These results and an extended biochemical analysis of protein aggregation, glial activation and levels of toxic protein species suggests that LF-MF do not affect cellular processes involved in the pathogenesis of AD or ALS. PMID:25717019

Misbehaving macrophages in the pathogenesis of psoriasis

PubMed Central

Clark, Rachael A.; Kupper, Thomas S.

2006-01-01

Psoriasis is a chronic inflammatory skin disease unique to humans. In this issue of the JCI, 2 studies of very different mouse models of psoriasis both report that macrophages play a key role in inducing psoriasis-like skin disease. Psoriasis is clearly a polygenic, inherited disease of uncontrolled cutaneous inflammation. The debate that currently rages in the field is whether psoriasis is a disease of autoreactive T cells or whether it reflects an intrinsic defect within the skin — or both. However, these questions have proven difficult to dissect using molecular genetic tools. In the current studies, the authors have used 2 different animal models to address the role of macrophages in disease pathogenesis: Wang et al. use a mouse model in which inflammation is T cell dependent, whereas the model used by Stratis et al. is T cell independent (see the related articles beginning on pages 2105 and 2094, respectively). Strikingly, both groups report an important contribution by macrophages, implying that macrophages can contribute to both epithelial-based and T cell–mediated pathways of inflammation. PMID:16886055

Alpha-lipoic acid-mediated activation of muscarinic receptors improves hippocampus- and amygdala-dependent memory.

PubMed

Mahboob, Aamra; Farhat, Syeda Mehpara; Iqbal, Ghazala; Babar, Mustafeez Mujtaba; Zaidi, Najam-us-Sahar Sadaf; Nabavi, Seyed Mohammad; Ahmed, Touqeer

2016-04-01

Aluminum (Al) is a neurotoxic agent which readily crosses the blood-brain-barrier (BBB) and accumulates in the brain leading to neurodegenerative disorders, characterised by cognitive impairment. Alpha-lipoic acid (ALA) is an antioxidant and has a potential to improve cognitive functions. This study aimed to evaluate the neuroprotective effect of ALA in AlCl3-induced neurotoxicity mouse model. Effect of ALA (25mg/kg/day) was evaluated in the AlCl3-induced neurotoxicity (AlCl3 150 mg/kg/day) mouse model on learning and memory using behaviour tests and on the expression of muscarinic receptor genes (using RT-PCR), in hippocampus and amygdala. Following ALA treatment, the expression of muscarinic receptor genes M1, M2 and choline acetyltransferase (ChaT) were significantly improved (p<0.05) relative to AlCl3-treated group. ALA enhanced fear memory (p<0.01) and social novelty preference (p<0.001) comparative to the AlCl3-treated group. Fear extinction memory was remarkably restored (p<0.001) in ALA-treated group demonstrated by reduced freezing response as compared to the AlCl3-treated group which showed higher freezing. In-silico analysis showed that racemic mixture of ALA has higher binding affinity for M1 and M2 compared to acetylcholine. These novel findings highlight the potential role of ALA in cognitive functions and cholinergic system enhancement thus presenting it an enviable therapeutic candidate for the treatment of neurodegenerative disorders. Copyright © 2016 Elsevier Inc. All rights reserved.

Development of the Nonobese Diabetic Mouse and Contribution of Animal Models for Understanding Type 1 Diabetes.

PubMed

Mullen, Yoko

2017-04-01

In 1974, the discovery of a mouse and a rat that spontaneously developed hyperglycemia led to the development of 2 autoimmune diabetes models: nonobese diabetic (NOD) mouse and Bio-Breeding rat. These models have contributed to our understanding of autoimmune diabetes, provided tools to dissect autoimmune islet damage, and facilitated development of early detection, prevention, and treatment of type 1 diabetes. The genetic characterization, monoclonal antibodies, and congenic strains have made NOD mice especially useful.Although the establishment of the inbred NOD mouse strain was documented by Makino et al (Jikken Dobutsu. 1980;29:1-13), this review will focus on the not-as-well-known history leading to the discovery of a glycosuric female mouse by Yoshihiro Tochino. This discovery was spearheaded by years of effort by Japanese scientists from different disciplines and dedicated animal care personnel and by the support of the Shionogi Pharmaceutical Company, Osaka, Japan. The history is based on the early literature, mostly written in Japanese, and personal communications especially with Dr Tochino, who was involved in diabetes animal model development and who contributed to the release of NOD mice to the international scientific community. This article also reviews the scientific contributions made by the Bio-Breeding rat to autoimmune diabetes.

Knocking down metabotropic glutamate receptor 1 improves survival and disease progression in the SOD1(G93A) mouse model of amyotrophic lateral sclerosis.

PubMed

Milanese, Marco; Giribaldi, Francesco; Melone, Marcello; Bonifacino, Tiziana; Musante, Ilaria; Carminati, Enrico; Rossi, Pia I A; Vergani, Laura; Voci, Adriana; Conti, Fiorenzo; Puliti, Aldamaria; Bonanno, Giambattista

2014-04-01

Amyotrophic lateral sclerosis (ALS) is a late-onset fatal neurodegenerative disease reflecting degeneration of upper and lower motoneurons (MNs). The cause of ALS and the mechanisms of neuronal death are still largely obscure, thus impairing the establishment of efficacious therapies. Glutamate (Glu)-mediated excitotoxicity plays a major role in MN degeneration in ALS. We recently demonstrated that the activation of Group I metabotropic Glu autoreceptors, belonging to both type 1 and type 5 receptors (mGluR1 and mGluR5), at glutamatergic spinal cord nerve terminals, produces excessive Glu release in mice over-expressing human superoxide-dismutase carrying the G93A point mutation (SOD1(G93A)), a widely used animal model of human ALS. To establish whether these receptors are implicated in ALS, we generated mice expressing half dosage of mGluR1 in the SOD1(G93A) background (SOD1(G93A)Grm1(crv4/+)), by crossing the SOD1(G93A) mutant mouse with the Grm1(crv4/+) mouse, lacking mGluR1 because of a spontaneous recessive mutation. SOD1(G93A)Grm1(crv4/+) mice showed prolonged survival probability, delayed pathology onset, slower disease progression and improved motor performances compared to SOD1(G93A) mice. These effects were associated to reduction of mGluR5 expression, enhanced number of MNs, decreased astrocyte and microglia activation, normalization of metallothionein and catalase mRNA expression, reduced mitochondrial damage, and decrease of abnormal Glu release in spinal cord of SOD1(G93A)Grm1(crv4/+)compared to SOD1(G93A) mice. These results demonstrate that a lower constitutive level of mGluR1 has a significant positive impact on mice with experimental ALS, thus providing the rationale for future pharmacological approaches to ALS by selectively blocking Group I metabotropic Glu receptors. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Human Glial-Restricted Progenitor Transplantation into Cervical Spinal Cord of the SOD1G93A Mouse Model of ALS

PubMed Central

Lepore, Angelo C.; O'Donnell, John; Kim, Andrew S.; Williams, Timothy; Tuteja, Alicia; Rao, Mahendra S.; Kelley, Linda L.; Campanelli, James T.; Maragakis, Nicholas J.

2011-01-01

Cellular abnormalities are not limited to motor neurons in amyotrophic lateral sclerosis (ALS). There are numerous observations of astrocyte dysfunction in both humans with ALS and in SOD1G93A rodents, a widely studied ALS model. The present study therapeutically targeted astrocyte replacement in this model via transplantation of human Glial-Restricted Progenitors (hGRPs), lineage-restricted progenitors derived from human fetal neural tissue. Our previous findings demonstrated that transplantation of rodent-derived GRPs into cervical spinal cord ventral gray matter (in order to target therapy to diaphragmatic function) resulted in therapeutic efficacy in the SOD1G93A rat. Those findings demonstrated the feasibility and efficacy of transplantation-based astrocyte replacement for ALS, and also show that targeted multi-segmental cell delivery to cervical spinal cord is a promising therapeutic strategy, particularly because of its relevance to addressing respiratory compromise associated with ALS. The present study investigated the safety and in vivo survival, distribution, differentiation, and potential efficacy of hGRPs in the SOD1G93A mouse. hGRP transplants robustly survived and migrated in both gray and white matter and differentiated into astrocytes in SOD1G93A mice spinal cord, despite ongoing disease progression. However, cervical spinal cord transplants did not result in motor neuron protection or any therapeutic benefits on functional outcome measures. This study provides an in vivo characterization of this glial progenitor cell and provides a foundation for understanding their capacity for survival, integration within host tissues, differentiation into glial subtypes, migration, and lack of toxicity or tumor formation. PMID:21998733

Defective mitochondrial dynamics is an early event in skeletal muscle of an amyotrophic lateral sclerosis mouse model.

PubMed

Luo, Guo; Yi, Jianxun; Ma, Changling; Xiao, Yajuan; Yi, Frank; Yu, Tian; Zhou, Jingsong

2013-01-01

Mitochondria are dynamic organelles that constantly undergo fusion and fission to maintain their normal functionality. Impairment of mitochondrial dynamics is implicated in various neurodegenerative disorders. Amyotrophic lateral sclerosis (ALS) is an adult-onset neuromuscular degenerative disorder characterized by motor neuron death and muscle atrophy. ALS onset and progression clearly involve motor neuron degeneration but accumulating evidence suggests primary muscle pathology may also be involved. Here, we examined mitochondrial dynamics in live skeletal muscle of an ALS mouse model (G93A) harboring a superoxide dismutase mutation (SOD1(G93A)). Using confocal microscopy combined with overexpression of mitochondria-targeted photoactivatable fluorescent proteins, we discovered abnormal mitochondrial dynamics in skeletal muscle of young G93A mice before disease onset. We further demonstrated that similar abnormalities in mitochondrial dynamics were induced by overexpression of mutant SOD1(G93A) in skeletal muscle of normal mice, indicating the SOD1 mutation drives ALS-like muscle pathology in the absence of motor neuron degeneration. Mutant SOD1(G93A) forms aggregates inside muscle mitochondria and leads to fragmentation of the mitochondrial network as well as mitochondrial depolarization. Partial depolarization of mitochondrial membrane potential in normal muscle by carbonyl cyanide p-trifluoromethoxyphenylhydrazone (FCCP) caused abnormalities in mitochondrial dynamics similar to that in the SOD1(G93A) model muscle. A specific mitochondrial fission inhibitor (Mdivi-1) reversed the SOD1(G93A) action on mitochondrial dynamics, indicating SOD1(G93A) likely promotes mitochondrial fission process. Our results suggest that accumulation of mutant SOD1(G93A) inside mitochondria, depolarization of mitochondrial membrane potential and abnormal mitochondrial dynamics are causally linked and cause intrinsic muscle pathology, which occurs early in the course of ALS and may actively promote ALS progression.

Origin and Properties of Prostatic Stem Cells

DTIC Science & Technology

2007-02-01

Brinster RL. beta1- and alpha6-integrin are surface markers on mouse spermatogonial stem cells. Proc Natl Acad Sci U S A 1999;96(10):5504-9. 14. Tsujimura ...G. R., Donjacour, A. A., Cooke, P. S., Mee, S., Bigsby, R. M., Higgins, S. J. & Sugimura, Y. (1987) Endocr. Rev. 8, 338–362. 9. Tsujimura , A...90. 4 Tsujimura A, Koikawa Y, Salm S et al. Proximal location of mouse prostate epithelial stem cells: A model of prostatic homeostasis. J Cell Biol

Phenotypic outcomes in Mouse and Human Foxc1 dependent Dandy-Walker cerebellar malformation suggest shared mechanisms

PubMed Central

Haldipur, Parthiv; Dang, Derek; Aldinger, Kimberly A; Janson, Olivia K; Guimiot, Fabien; Adle-Biasette, Homa; Dobyns, William B; Siebert, Joseph R; Russo, Rosa; Millen, Kathleen J

2017-01-01

FOXC1 loss contributes to Dandy-Walker malformation (DWM), a common human cerebellar malformation. Previously, we found that complete Foxc1 loss leads to aberrations in proliferation, neuronal differentiation and migration in the embryonic mouse cerebellum (Haldipur et al., 2014). We now demonstrate that hypomorphic Foxc1 mutant mice have granule and Purkinje cell abnormalities causing subsequent disruptions in postnatal cerebellar foliation and lamination. Particularly striking is the presence of a partially formed posterior lobule which echoes the posterior vermis DW 'tail sign' observed in human imaging studies. Lineage tracing experiments in Foxc1 mutant mouse cerebella indicate that aberrant migration of granule cell progenitors destined to form the posterior-most lobule causes this unique phenotype. Analyses of rare human del chr 6p25 fetal cerebella demonstrate extensive phenotypic overlap with our Foxc1 mutant mouse models, validating our DWM models and demonstrating that many key mechanisms controlling cerebellar development are likely conserved between mouse and human. DOI: http://dx.doi.org/10.7554/eLife.20898.001 PMID:28092268

TNF-alpha Expression Patterns as Potential Molecular Biomarker for Human Skin Cells Exposed to Vesicant Chemical Warfare Agents: Sulfur Mustard (HD) and Lewisite (L)

DTIC Science & Technology

2004-01-01

First World War. It was Sabourin et al., 2000). Skin injuries caused by called Hun Stoffe by the Allies and given the HD are complex and involve... Sabourin et al., 2000, Kan et al., 2003) sup- port the involvement of TNF-cx in animal models such as mouse skin and hairless guinea References pigs... Sabourin CLK. Petrali JP. Casillas RP. Alteration in inflamma- Pharmacol Toxicol. 2003:92:20 4 -13. tory cytokine gene expression in sulfur mustard exposed

The neurite outgrowth inhibitor Nogo-A promotes denervation in an amyotrophic lateral sclerosis model

PubMed Central

Jokic, Natasa; Gonzalez de Aguilar, Jose-Luis; Dimou, Leda; Lin, Shuo; Fergani, Anissa; Ruegg, Markus A; Schwab, Martin E; Dupuis, Luc; Loeffler, Jean-Philippe

2006-01-01

Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease characterized by motor neuron loss and muscle wasting. In muscles of ALS patients, Nogo-A—a protein known to inhibit axon regeneration—is ectopically expressed at levels that correlate with the severity of the clinical symptoms. We now show that the genetic ablation of Nogo-A extends survival and reduces muscle denervation in a mouse model of ALS. In turn, overexpression of Nogo-A in wild-type muscle fibres leads to shrinkage of the postsynapse and retraction of the presynaptic motor ending. This suggests that the expression of Nogo-A occurring early in ALS skeletal muscle could cause repulsion and destabilization of the motor nerve terminals, and subsequent dying back of the axons and motor neurons. PMID:17039253

Biological effects of CCS in the absence of SOD1 enzyme activation: implications for disease in a mouse model for ALS.

PubMed

Proescher, Jody B; Son, Marjatta; Elliott, Jeffrey L; Culotta, Valeria C

2008-06-15

The CCS copper chaperone is critical for maturation of Cu, Zn-superoxide dismutase (SOD1) through insertion of the copper co-factor and oxidization of an intra-subunit disulfide. The disulfide helps stabilize the SOD1 polypeptide, which can be particularly important in cases of amyotrophic lateral sclerosis (ALS) linked to misfolding of mutant SOD1. Surprisingly, however, over-expressed CCS was recently shown to greatly accelerate disease in a G93A SOD1 mouse model for ALS. Herein we show that disease in these G93A/CCS mice correlates with incomplete oxidation of the SOD1 disulfide. In the brain and spinal cord, CCS over-expression failed to enhance oxidation of the G93A SOD1 disulfide and if anything, effected some accumulation of disulfide-reduced SOD1. This effect was mirrored in culture with a C244,246S mutant of CCS that has the capacity to interact with SOD1 but can neither insert copper nor oxidize the disulfide. In spite of disulfide effects, there was no evidence for increased SOD1 aggregation. If anything, CCS over-expression prevented SOD1 misfolding in culture as monitored by detergent insolubility. This protection against SOD1 misfolding does not require SOD1 enzyme activation as the same effect was obtained with the C244,246S allele of CCS. In the G93A SOD1 mouse, CCS over-expression was likewise associated with a lack of obvious SOD1 misfolding marked by detergent insolubility. CCS over-expression accelerates SOD1-linked disease without the hallmarks of misfolding and aggregation seen in other mutant SOD1 models. These studies are the first to indicate biological effects of CCS in the absence of SOD1 enzymatic activation.

Specific induction of Akt3 in spinal cord motor neurons is neuroprotective in a mouse model of familial amyotrophic lateral sclerosis.

PubMed

Peviani, Marco; Tortarolo, Massimo; Battaglia, Elisa; Piva, Roberto; Bendotti, Caterina

2014-02-01

Evidence is accumulating that an imbalance between pathways for degeneration or survival in motor neurons may play a central role in mechanisms that lead to neurodegeneration in amyotrophic lateral sclerosis (ALS). We and other groups have observed that downregulation, or lack of induction, of the PI3K/Akt prosurvival pathway may be responsible for defective response of motor neurons to injury and their consequent cellular demise. Some of the neuroprotective effects mediated by growth factors may involve activation of Akt, but a proof of concept of Akt as a target for therapy is lacking. We demonstrate that specific expression of constitutively activated Akt3 in motor neurons through the use of the promoter of homeobox gene Hb9 prevents neuronal loss induced by SOD1.G93A both in vitro (in mixed neuron/astrocyte cocultures) and in vivo (in a mouse model of ALS). Inhibition of ASK1 and GSK3beta was involved in the neuroprotective effects of activated Akt3, further supporting the hypothesis that induction of Akt3 may be a key step in activation of pathways for survival in the attempt to counteract motor neuronal degeneration in ALS.

Regulation of Intracellular Copper by Induction of Endogenous Metallothioneins Improves the Disease Course in a Mouse Model of Amyotrophic Lateral Sclerosis.

PubMed

Tokuda, Eiichi; Watanabe, Shunsuke; Okawa, Eriko; Ono, Shin-ichi

2015-04-01

Mutations in SOD1 cause amyotrophic lateral sclerosis (ALS), an incurable motor neuron disease. The pathogenesis of the disease is poorly understood, but intracellular copper dyshomeostasis has been implicated as a key process in the disease. We recently observed that metallothioneins (MTs) are an excellent target for the modification of copper dyshomeostasis in a mouse model of ALS (SOD1(G93A)). Here, we offer a therapeutic strategy designed to increase the level of endogenous MTs. The upregulation of endogenous MTs by dexamethasone, a synthetic glucocorticoid, significantly improved the disease course and rescued motor neurons in SOD1(G93A) mice, even if the induction was initiated when peak body weight had decreased by 10%. Neuroprotection was associated with the normalization of copper dyshomeostasis, as well as with decreased levels of SOD1(G93A) aggregates. Importantly, these benefits were clearly mediated in a MT-dependent manner, as dexamethasone did not provide any protection when endogenous MTs were abolished from SOD1(G93A) mice. In conclusion, the upregulation of endogenous MTs represents a promising strategy for the treatment of ALS linked to mutant SOD1.

A metabolic switch toward lipid use in glycolytic muscle is an early pathologic event in a mouse model of amyotrophic lateral sclerosis

PubMed Central

Palamiuc, Lavinia; Schlagowski, Anna; Ngo, Shyuan T; Vernay, Aurelia; Dirrig-Grosch, Sylvie; Henriques, Alexandre; Boutillier, Anne-Laurence; Zoll, Joffrey; Echaniz-Laguna, Andoni; Loeffler, Jean-Philippe; René, Frédérique

2015-01-01

Amyotrophic lateral sclerosis (ALS) is the most common fatal motor neuron disease in adults. Numerous studies indicate that ALS is a systemic disease that affects whole body physiology and metabolic homeostasis. Using a mouse model of the disease (SOD1G86R), we investigated muscle physiology and motor behavior with respect to muscle metabolic capacity. We found that at 65 days of age, an age described as asymptomatic, SOD1G86R mice presented with improved endurance capacity associated with an early inhibition in the capacity for glycolytic muscle to use glucose as a source of energy and a switch in fuel preference toward lipids. Indeed, in glycolytic muscles we showed progressive induction of pyruvate dehydrogenase kinase 4 expression. Phosphofructokinase 1 was inhibited, and the expression of lipid handling molecules was increased. This mechanism represents a chronic pathologic alteration in muscle metabolism that is exacerbated with disease progression. Further, inhibition of pyruvate dehydrogenase kinase 4 activity with dichloroacetate delayed symptom onset while improving mitochondrial dysfunction and ameliorating muscle denervation. In this study, we provide the first molecular basis for the particular sensitivity of glycolytic muscles to ALS pathology. PMID:25820275

Boosting ATM activity alleviates aging and extends lifespan in a mouse model of progeria.

PubMed

Qian, Minxian; Liu, Zuojun; Peng, Linyuan; Tang, Xiaolong; Meng, Fanbiao; Ao, Ying; Zhou, Mingyan; Wang, Ming; Cao, Xinyue; Qin, Baoming; Wang, Zimei; Zhou, Zhongjun; Wang, Guangming; Gao, Zhengliang; Xu, Jun; Liu, Baohua

2018-05-02

DNA damage accumulates with age (Lombard et al., 2005). However, whether and how robust DNA repair machinery promotes longevity is elusive. Here, we demonstrate that ATM-centered DNA damage response (DDR) progressively declines with senescence and age, while low dose of chloroquine (CQ) activates ATM, promotes DNA damage clearance, rescues age-related metabolic shift, and prolongs replicative lifespan. Molecularly, ATM phosphorylates SIRT6 deacetylase and thus prevents MDM2-mediated ubiquitination and proteasomal degradation. Extra copies of Sirt6 extend lifespan in Atm-/- mice, with restored metabolic homeostasis. Moreover, the treatment with CQ remarkably extends lifespan of Caenorhabditis elegans , but not the ATM-1 mutants. In a progeria mouse model with low DNA repair capacity, long-term administration of CQ ameliorates premature aging features and extends lifespan. Thus, our data highlights a pro-longevity role of ATM, for the first time establishing direct causal links between robust DNA repair machinery and longevity, and providing therapeutic strategy for progeria and age-related metabolic diseases. © 2018, Qian et al.

Comparison of Sirtuin 3 Levels in ALS and Huntington’s Disease—Differential Effects in Human Tissue Samples vs. Transgenic Mouse Models

PubMed Central

Buck, Eva; Bayer, Hanna; Lindenberg, Katrin S.; Hanselmann, Johannes; Pasquarelli, Noemi; Ludolph, Albert C.; Weydt, Patrick; Witting, Anke

2017-01-01

Neurodegenerative diseases are characterized by distinct patterns of neuronal loss. In amyotrophic lateral sclerosis (ALS) upper and lower motoneurons degenerate whereas in Huntington’s disease (HD) medium spiny neurons in the striatum are preferentially affected. Despite these differences the pathophysiological mechanisms and risk factors are remarkably similar. In addition, non-neuronal features, such as weight loss implicate a dysregulation in energy metabolism. Mammalian sirtuins, especially the mitochondrial NAD+ dependent sirtuin 3 (SIRT3), regulate mitochondrial function and aging processes. SIRT3 expression depends on the activity of the metabolic master regulator peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α), a modifier of ALS and HD in patients and model organisms. This prompted us to systematically probe Sirt3 mRNA and protein levels in mouse models of ALS and HD and to correlate these with patient tissue levels. We found a selective reduction of Sirt3 mRNA levels and function in the cervical spinal cord of end-stage ALS mice (superoxide dismutase 1, SOD1G93A). In sharp contrast, a tendency to increased Sirt3 mRNA levels was found in the striatum in HD mice (R6/2). Cultured primary neurons express the highest levels of Sirt3 mRNA. In primary cells from PGC-1α knock-out (KO) mice the Sirt3 mRNA levels were highest in astrocytes. In human post mortem tissue increased mRNA and protein levels of Sirt3 were found in the spinal cord in ALS, while Sirt3 levels were unchanged in the human HD striatum. Based on these findings we conclude that SIRT3 mediates the different effects of PGC-1α during the course of transgenic (tg) ALS and HD and in the human conditions only partial aspects Sirt3 dysregulation manifest. PMID:28603486

Over-expression of Oct4 and Sox2 transcription factors enhances differentiation of human umbilical cord blood cells in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guseva, Daria; Hannover Medical School, Hannover; Rizvanov, Albert A.

2014-09-05

Highlights: • Gene and cell-based therapies comprise innovative aspects of regenerative medicine. • Genetically modified hUCB-MCs enhanced differentiation of cells in a mouse model of ALS. • Stem cells successfully transformed into micro-glial and endothelial lines in spinal cords. • Over-expressing oct4 and sox2 also induced production of neural marker PGP9.5. • Formation of new nerve cells, secreting trophic factors and neo-vascularisation could improve symptoms in ALS. - Abstract: Gene and cell-based therapies comprise innovative aspects of regenerative medicine. Even though stem cells represent a highly potential therapeutic strategy, their wide-spread exploitation is marred by ethical concerns, potential for malignantmore » transformation and a plethora of other technical issues, largely restricting their use to experimental studies. Utilizing genetically modified human umbilical cord blood mono-nuclear cells (hUCB-MCs), this communication reports enhanced differentiation of transplants in a mouse model of amyotrophic lateral sclerosis (ALS). Over-expressing Oct4 and Sox2 induced production of neural marker PGP9.5, as well as transformation of hUCB-MCs into micro-glial and endothelial lines in ALS spinal cords. In addition to producing new nerve cells, providing degenerated areas with trophic factors and neo-vascularisation might prevent and even reverse progressive loss of moto-neurons and skeletal muscle paralysis.« less

Aluminium chloride promotes tumorigenesis and metastasis in normal murine mammary gland epithelial cells

PubMed Central

Tenan, Mirna; Ferrari, Paolo; Sappino, André‐Pascal

2016-01-01

Aluminium salts, present in many industrial products of frequent use like antiperspirants, anti‐acid drugs, food additives and vaccines, have been incriminated in contributing to the rise in breast cancer incidence in Western societies. However, current experimental evidence supporting this hypothesis is limited. For example, no experimental evidence that aluminium promotes tumorigenesis in cultured mammary epithelial cells exists. We report here that long‐term exposure to concentrations of aluminium—in the form of aluminium chloride (AlCl3)—in the range of those measured in the human breast, transform normal murine mammary gland (NMuMG) epithelial cells in vitro as revealed by the soft agar assay. Subcutaneous injections into three different mouse strains with decreasing immunodeficiency, namely, NOD SCID gamma (NSG), NOD SCID or nude mice, revealed that untreated NMuMG cells form tumors and metastasize, to a limited extent, in the highly immunodeficient and natural killer (NK) cell deficient NSG strain, but not in the less permissive and NK cell competent NOD SCID or nude strains. In contrast, NMuMG cells transformed in vitro by AlCl3 form large tumors and metastasize in all three mouse models. These effects correlate with a mutagenic activity of AlCl3. Our findings demonstrate for the first time that concentrations of aluminium in the range of those measured in the human breast fully transform cultured mammary epithelial cells, thus enabling them to form tumors and metastasize in well‐established mouse cancer models. Our observations provide experimental evidence that aluminium salts could be environmental breast carcinogens. PMID:27541736

Transcranial direct current stimulation in the male mouse to promote recovery after stroke.

PubMed

Pikhovych, Anton; Walter, Helene L; Mahabir, Esther; Fink, Gereon Rudolf; Graf, Rudolf; Schroeter, Michael; Rueger, Maria Adele

2016-06-01

Transcranial direct current stimulation (tDCS) constitutes a promising approach for promoting recovery of function after stroke, although the underlying neurobiological mechanisms are unclear. To conduct translational research in animal models, stimulation parameters should not lead to neuronal lesions. Liebetanz et al. recommend charge densities for cathodal stimulation in rats, but parameters for mice are not established. We established tDCS in the wild-type mouse, enabling studies with genetically-engineered mice (GEM). tDCS equipment was adapted to fit the mouse skull. Using different polarities and charge densities, tDCS was safe to apply in the mouse where the charge density was below 198 kC/m(2) for single or repeated stimulations. These findings are crucial for future investigations of the neurobiological mechanisms underlying tDCS using GEM. © The Author(s) 2015.

Identification of a novel herpes simplex virus type 1 transcript and protein (AL3) expressed during latency.

PubMed

Jaber, Tareq; Henderson, Gail; Li, Sumin; Perng, Guey-Chuen; Carpenter, Dale; Wechsler, Steven L; Jones, Clinton

2009-10-01

The herpes simplex virus type 1 (HSV-1) latency-associated transcript (LAT) is abundantly expressed in latently infected sensory neurons. In small animal models of infection, expression of the first 1.5 kb of LAT coding sequences is necessary and sufficient for wild-type reactivation from latency. The ability of LAT to inhibit apoptosis is important for reactivation from latency. Within the first 1.5 kb of LAT coding sequences and LAT promoter sequences, additional transcripts have been identified. For example, the anti-sense to LAT transcript (AL) is expressed in the opposite direction to LAT from the 5' end of LAT and LAT promoter sequences. In addition, the upstream of LAT (UOL) transcript is expressed in the LAT direction from sequences in the LAT promoter. Further examination of the first 1.5 kb of LAT coding sequences revealed two small ORFs that are anti-sense with respect to LAT (AL2 and AL3). A transcript spanning AL3 was detected in productively infected cells, mouse neuroblastoma cells stably expressing LAT and trigeminal ganglia (TG) of latently infected mice. Peptide-specific IgG directed against AL3 specifically recognized a protein migrating near 15 kDa in cells stably transfected with LAT, mouse neuroblastoma cells transfected with a plasmid containing the AL3 ORF and TG of latently infected mice. The inability to detect the AL3 protein during productive infection may have been because the 5' terminus of the AL3 transcript was downstream of the first in-frame methionine of the AL3 ORF during productive infection.

Comparative Genome Sequence Analysis of the Bpa/Str Region in Mouse and Man

PubMed Central

Mallon, A.-M.; Platzer, M.; Bate, R.; Gloeckner, G.; Botcherby, M.R.M.; Nordsiek, G.; Strivens, M.A.; Kioschis, P.; Dangel, A.; Cunningham, D.; Straw, R.N.A.; Weston, P.; Gilbert, M.; Fernando, S.; Goodall, K.; Hunter, G.; Greystrong, J.S.; Clarke, D.; Kimberley, C.; Goerdes, M.; Blechschmidt, K.; Rump, A.; Hinzmann, B.; Mundy, C.R.; Miller, W.; Poustka, A.; Herman, G.E.; Rhodes, M.; Denny, P.; Rosenthal, A.; Brown, S.D.M.

2000-01-01

The progress of human and mouse genome sequencing programs presages the possibility of systematic cross-species comparison of the two genomes as a powerful tool for gene and regulatory element identification. As the opportunities to perform comparative sequence analysis emerge, it is important to develop parameters for such analyses and to examine the outcomes of cross-species comparison. Our analysis used gene prediction and a database search of 430 kb of genomic sequence covering the Bpa/Str region of the mouse X chromosome, and 745 kb of genomic sequence from the homologous human X chromosome region. We identified 11 genes in mouse and 13 genes and two pseudogenes in human. In addition, we compared the mouse and human sequences using pairwise alignment and searches for evolutionary conserved regions (ECRs) exceeding a defined threshold of sequence identity. This approach aided the identification of at least four further putative conserved genes in the region. Comparative sequencing revealed that this region is a mosaic in evolutionary terms, with considerably more rearrangement between the two species than realized previously from comparative mapping studies. Surprisingly, this region showed an extremely high LINE and low SINE content, low G+C content, and yet a relatively high gene density, in contrast to the low gene density usually associated with such regions. [The sequence data described in this paper have been submitted to EMBL under the following accession nos.: Mouse Genomic Sequence: Mouse contig A (AL021127), Mouse contig B (AL049866), BAC41M10 (AL136328), PAC303O11(AL136329). Human Genomic Sequence: Human contig 1 (U82671, U82670), Human contig 2 (U82695).] PMID:10854409

Performance of a kinetic model for intracellular ice formation based on the extent of supercooling.

PubMed

Pitt, R E; Chandrasekaran, M; Parks, J E

1992-06-01

Cryomicroscopy was used to study the incidence of intracellular ice formation (IIF) in protoplasts isolated from rye (Secale cereale) leaves during subfreezing isothermal periods and in in vitro mature bovine oocytes during cooling at constant rates. IIF in protoplasts occurred at random times during isothermal periods, and the kinetics of IIF were faster as isothermal temperature decreased. Mean IIF times decreased from approximately 1700 s at -4.0 degrees C to less than 1 s at -18.5 degrees C. Total incidence of IIF after 200 s increased from 4% at -4.0 degrees C to near 100% at -15.5 degrees C. IIF behavior in protoplasts was qualitatively similar to that for Drosophila melanogaster embryos over the same temperature ranges (Myers et al., Cryobiology 26, 472-484, 1989), but the kinetics of IIF were about five times faster in protoplasts. IIF observations in linear cooling of bovine oocytes indicated a median IIF temperature of -11 degrees C at 16 degrees C/min and total incidences of 97%, 50%, and 19% at 16, 8, and 4 degrees C/min, respectively. A stochastic model of IIF was developed which preserved certain features of an earlier model (Pitt et al. Cryobiology 28, 72-86, 1991), namely Weibull behavior in IIF temperatures during rapid linear cooling, but with a departure from the concept of a supercooling tolerance. Instead, the new model uses the osmotic state of the cell, represented by the extent of supercooling, as the independent variable governing the kinetics of IIF. Two kinetic parameters are needed for the model: a scale factor tau 0 dictating the sensitivity to supercooling, and an exponent rho dictating the strength of time dependency. The model was fit to the data presented in this study as well as those from Myers et al. and Pitt et al. for D. melanogaster embryos with and without cryoprotectant, and from Toner et al. (Cryobiology 28, 55-71, 1991) for mouse oocytes. In protoplasts, D. melanogaster embryos, and mouse oocytes, the parameters were estimated from IIF times in the early stages of isothermal periods, while the osmotic state of the cell was relatively constant. In bovine oocytes, the parameters were estimated from linear cooling data. Without further calibration, the model was used to predict total IIF incidence under different cooling regimes. For protoplasts, D. melanogaster embryos, and bovine oocytes, the model's predictions were quite accurate compared to the actual data. In mouse oocytes, adjustment of the hydraulic permeability coefficient (Lp) at 0 degree C was required to yield realistic behavior.(ABSTRACT TRUNCATED AT 400 WORDS)

ETS-Associated Genomic Alterations including ETS2 Loss Markedly Affect Prostate Cancer Progression

DTIC Science & Technology

2015-10-01

upregulation of ERG, a transcription factor with oncogenic roles in other cancers such as leukemias and sarcomas (Tomlins, Rhodes et al. 2005; Turner ...represses Apc(Min)-mediated tumours in mouse models of Down’s syndrome ." Nature 451(7174): 73-75. Taylor, B. S., N. Schultz, et al. (2010...generation antiandrogen for treatment of advanced prostate cancer." Science 324(5928): 787-790. Turner , D. P. and D. K. Watson (2008). "ETS transcription

Testing the Oncogenic Relevance of Cell Adhesion and Cytosketal Genes Affected by DNA Deletions in Breast Cancer

DTIC Science & Technology

2010-07-01

j.ccr.2011.01.040SUMMARYWe screened 124 genes that are amplified in human hepatocellular carcinoma (HCC) using a mouse hepato- blast model and identified...particularly impor- tant in human hepatocellular carcinoma (HCC), which has limited treatment options and generally poor prognosis (Minguez et al., 2009). One...al. (2001). Disruption of the p16/cyclin D1/retinoblastoma protein pathway in the majority of human hepatocellular carcinomas . Oncology 60, 346–354

Development of a Novel Therapeutic Paradigm Utilizing a Mammary Gland-Targeted, Bin1-Knockout Mouse Model

DTIC Science & Technology

2008-07-01

Remodeling and Drives Cancer Progression Mee Young Chang, 1 Janette Boulden, 1 Erika Sutanto-Ward, 1 James B. Duhadaway, 1 Alejandro Peralta Soler, 1,2...proliferation by multiple mechanisms. Oncogene 1999;18:3564–73. 5. Pineda -Lucena A, Ho CS, Mao DY, et al. A structure- based model of the c-Myc/Bin1 protein

Accumulation of misfolded SOD1 in dorsal root ganglion degenerating proprioceptive sensory neurons of transgenic mice with amyotrophic lateral sclerosis.

PubMed

Sábado, Javier; Casanovas, Anna; Tarabal, Olga; Hereu, Marta; Piedrafita, Lídia; Calderó, Jordi; Esquerda, Josep E

2014-01-01

Amyotrophic lateral sclerosis (ALS) is an adult-onset progressive neurodegenerative disease affecting upper and lower motoneurons (MNs). Although the motor phenotype is a hallmark for ALS, there is increasing evidence that systems other than the efferent MN system can be involved. Mutations of superoxide dismutase 1 (SOD1) gene cause a proportion of familial forms of this disease. Misfolding and aggregation of mutant SOD1 exert neurotoxicity in a noncell autonomous manner, as evidenced in studies using transgenic mouse models. Here, we used the SOD1(G93A) mouse model for ALS to detect, by means of conformational-specific anti-SOD1 antibodies, whether misfolded SOD1-mediated neurotoxicity extended to neuronal types other than MNs. We report that large dorsal root ganglion (DRG) proprioceptive neurons accumulate misfolded SOD1 and suffer a degenerative process involving the inflammatory recruitment of macrophagic cells. Degenerating sensory axons were also detected in association with activated microglial cells in the spinal cord dorsal horn of diseased animals. As large proprioceptive DRG neurons project monosynaptically to ventral horn MNs, we hypothesise that a prion-like mechanism may be responsible for the transsynaptic propagation of SOD1 misfolding from ventral horn MNs to DRG sensory neurons.

ALS patients' regulatory T lymphocytes are dysfunctional, and correlate with disease progression rate and severity.

PubMed

Beers, David R; Zhao, Weihua; Wang, Jinghong; Zhang, Xiujun; Wen, Shixiang; Neal, Dan; Thonhoff, Jason R; Alsuliman, Abdullah S; Shpall, Elizabeth J; Rezvani, Katy; Appel, Stanley H

2017-03-09

Neuroinflammation is a pathological hallmark of ALS in both transgenic rodent models and patients, and is characterized by proinflammatory T lymphocytes and activated macrophages/microglia. In ALS mouse models, decreased regulatory T lymphocytes (Tregs) exacerbate the neuroinflammatory process, leading to accelerated motoneuron death and shortened survival; passive transfer of Tregs suppresses the neuroinflammation and prolongs survival. Treg numbers and FOXP3 expression are also decreased in rapidly progressing ALS patients. A key question is whether the marked neuroinflammation in ALS can be attributed to the impaired suppressive function of ALS Tregs in addition to their decreased numbers. To address this question, T lymphocyte proliferation assays were performed. Compared with control Tregs, ALS Tregs were less effective in suppressing responder T lymphocyte proliferation. Although both slowly and rapidly progressing ALS patients had dysfunctional Tregs, the greater the clinically assessed disease burden or the more rapidly progressing the patient, the greater the Treg dysfunction. Epigenetically, the percentage methylation of the Treg-specific demethylated region was greater in ALS Tregs. After in vitro expansion, ALS Tregs regained suppressive abilities to the levels of control Tregs, suggesting that autologous passive transfer of expanded Tregs might offer a novel cellular therapy to slow disease progression.

Association of Regulatory T-Cell Expansion With Progression of Amyotrophic Lateral Sclerosis: A Study of Humans and a Transgenic Mouse Model.

PubMed

Sheean, Rebecca K; McKay, Fiona C; Cretney, Erika; Bye, Christopher R; Perera, Nirma D; Tomas, Doris; Weston, Richard A; Scheller, Karlene J; Djouma, Elvan; Menon, Parvathi; Schibeci, Stephen D; Marmash, Najwa; Yerbury, Justin J; Nutt, Stephen L; Booth, David R; Stewart, Graeme J; Kiernan, Mathew C; Vucic, Steve; Turner, Bradley J

2018-06-01

Neuroinflammation appears to be a key modulator of disease progression in amyotrophic lateral sclerosis (ALS) and thereby a promising therapeutic target. The CD4+Foxp3+ regulatory T-cells (Tregs) infiltrating into the central nervous system suppress neuroinflammation and promote the activation of neuroprotective microglia in mouse models of ALS. To our knowledge, the therapeutic association of host Treg expansion with ALS progression has not been studied in vivo. To assess the role of Tregs in regulating the pathophysiology of ALS in humans and the therapeutic outcome of increasing Treg activity in a mouse model of the disease. This prospective multicenter human and animal study was performed in hospitals, outpatient clinics, and research institutes. Clinical and function assessment, as well as immunological studies, were undertaken in 33 patients with sporadic ALS, and results were compared with 38 healthy control participants who were consecutively recruited from the multidisciplinary ALS clinic at Westmead Hospital between February 1, 2013, and December 31, 2014. All data analysis on patients with ALS was undertaken between January 2015 and December 2016. Subsequently, we implemented a novel approach to amplify the endogenous Treg population using peripheral injections of interleukin 2/interleukin 2 monoclonal antibody complexes (IL-2c) in transgenic mice that expressed mutant superoxide dismutase 1 (SOD1), a gene associated with motor neuron degeneration. In patients with ALS, Treg levels were determined and then correlated with disease progression. Circulating T-cell populations, motor neuron size, glial cell activation, and T-cell and microglial gene expression in spinal cords were determined in SOD1G93A mice, as well as the association of Treg amplification with disease onset and survival time in mice. The cohort of patients with ALS included 24 male patients and 9 female patients (mean [SD] age at assessment, 58.9 [10.9] years). There was an inverse correlation between total Treg levels (including the effector CD45RO+ subset) and rate of disease progression (R = -0.40, P = .002). Expansion of the effector Treg population in the SOD1G93A mice was associated with a significant slowing of disease progression, which was accompanied by an increase in survival time (IL-2c-treated mice: mean [SD], 160.6 [10.8] days; control mice: mean [SD], 144.9 [10.6] days; P = .003). Importantly, Treg expansion was associated with preserved motor neuron soma size and marked suppression of astrocytic and microglial immunoreactivity in the spinal cords of SOD1G93A mice, as well as elevated neurotrophic factor gene expression in spinal cord and peripheral nerves. These findings establish a neuroprotective effect of Tregs, possibly mediated by suppression of toxic neuroinflammation in the central nervous system. Strategies aimed at enhancing the Treg population and neuroprotective activity from the periphery may prove therapeutically useful for patients with ALS.

Effect of Arctium lappa L. in the dextran sulfate sodium colitis mouse model.

PubMed

Huang, Tzou-Chi; Tsai, Shinn-Shyong; Liu, Li-Fang; Liu, Yu Lin; Liu, Hung-Jen; Chuang, Kuo Pin

2010-09-07

To analyze the possible protective role of Arctium lappa L. (AL) in a murine model of ulcerative colitis (UC). BALB/c mice were administered 100 mg/kg AL powder orally each day. After 7 d, colitis was induced by administration of dextran sulfate sodium (DSS) (5% W/V) in drinking water for a further 8 consecutive days. Diarrhea and bloody stools as well as colonic histology were observed. The level of interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-alpha) in colonic sections were detected by immunohistochemistry. There were significant differences in mean body weight values and disease activity indices between controls and AL-treated animals. Moreover, the histological findings showed that AL treatment can prevent mucosal edema, submucosal erosions, ulceration, inflammatory cell infiltration and colon damage. In addition, immunohistochemistry analysis showed that the levels of the inflammatory cytokines, IL-6 and TNF-alpha were also decreased in AL-treated groups. We suggest that AL can prevent intestinal damage and decrease inflammatory cytokines in mice with DSS-induced colitis. Thus, AL could prove to be a useful food for UC.

Angiogenin in Parkinson Disease Models: Role of Akt Phosphorylation and Evaluation of AAV-Mediated Angiogenin Expression in MPTP Treated Mice

PubMed Central

Steidinger, Trent U.; Slone, Sunny R.; Ding, Huiping; Standaert, David G.; Yacoubian, Talene A.

2013-01-01

The angiogenic factor, angiogenin, has been recently linked to both Amyotrophic Lateral Sclerosis (ALS) and Parkinson Disease (PD). We have recently shown that endogenous angiogenin levels are dramatically reduced in an alpha-synuclein mouse model of PD and that exogenous angiogenin protects against cell loss in neurotoxin-based cellular models of PD. Here, we extend our studies to examine whether activation of the prosurvival Akt pathway is required for angiogenin's neuroprotective effects against 1-methyl-4-phenylpyridinium (MPP+), as observed in ALS models, and to test the effect of virally-mediated overexpression of angiogenin in an in vivo PD model. Using a dominant negative Akt construct, we demonstrate that inhibition of the Akt pathway does not reduce the protective effect of angiogenin against MPP+ toxicity in the dopaminergic SH-SY5Y cell line. Furthermore, an ALS-associated mutant of angiogenin, K40I, which fails to induce Akt phosphorylation, was similar to wildtype angiogenin in protection against MPP+. These results confirm previous work showing neuroprotective effects of angiogenin against MPP+, and indicate that Akt is not required for this protective effect. We also investigated whether adeno-associated viral serotype 2 (AAV2)-mediated overexpression of angiogenin protects against dopaminergic neuron loss in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mouse model. We found that angiogenin overexpression using this approach does not reduce the MPTP-induced degeneration of dopaminergic cells in the substantia nigra, nor limit the depletion of dopamine and its metabolites in the striatum. Together, these findings extend the evidence for protective effects of angiogenin in vitro, but also suggest that further study of in vivo models is required to translate these effects into meaningful therapies. PMID:23409128

Therapeutic effects of dl-3-n-butylphthalide in a transgenic mouse model of amyotrophic lateral sclerosis.

PubMed

Feng, Xin-Hong; Yuan, Wei; Peng, Ying; Liu, Ming-Sheng; Cui, Li-Ying

2012-05-01

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder characterized by progressive death of the upper and lower motor neurons. Transgenic mice over-expressing a mutant form of the human SOD1 gene develop an ALS-like phenotype. Currently, there is no effective treatment or drug for the fatal disease. Previous studies reported potent efficacy of dl-3-n-butylphthalide (DL-NBP) for several neurodegenerative disorders and cerebral ischemia. SOD1-G93A mice are a mouse model of ALS. In this study, we investigated the efficacy of DL-NBP on this ALS mouse model. Sixty SOD1-G93A female mice were divided into four groups. The vehicle control group received 0 mg×kg(-1)×d(-1) DL-NBP. The experimental groups received DL-NBP with doses of 30, 60 or 120 mg×kg(-1)×d(-1), respectively. For measurement of motor activity, the hanging wire test and rotarod test were performed. Survival statistics were analyzed by Kaplan-Meier survival curves. The body weight of each mouse was recorded twice per week. The statistical motor unit number estimation (MUNE) technique was used to estimate the number of functioning motor units in gastrocnemius muscle. Muscle morphology was evaluated by hematoxylin and eosin staining. Motor neuron quantitation was performed by Nissl staining and microglia activation was observed by immunohistochemistry. Oral administration of 60 mg×kg(-1)×d(-1)1 DL-NBP significantly prolonged survival ((164.78 ± 16.67) days) of SOD1-G93A mice compared with vehicle control ((140.00 ± 16.89) days). Treating mice with DL-NBP (60 mg×kg(-1)×d(-1)) significantly decreased the progression rate of motor deficits and suppressed body weight reduction. Furthermore, we found that treating SOD1-G93A mice with DL-NBP (60 mg×kg(-1)×d(-1)) slowed the rate of MUNE reduction (P < 0.01). Motor neurons were remarkably preserved in the anterior horns in mice treated with DL-NBP (60 mg×kg(-1)×d(-1)) at the stage of 19 weeks (P < 0.01). Treating mice with DL-NBP (60 mg×kg(-1)×d(-1)) significantly reduced CD11b immunoreactivity compared with vehicle control mice (P < 0.05). No significant effect was observed in mice treated with DL-NBP of 30 or 120 mg×kg(-1)×d(-1). The post-disease-onset administration of DL-NBP significantly prolonged survival and improved motor performance in SOD1-G93A mice. DL-NBP may be a potential therapeutic agent for ALS.

Abnormalities in whisking behaviour are associated with lesions in brain stem nuclei in a mouse model of amyotrophic lateral sclerosis.

PubMed

Grant, Robyn A; Sharp, Paul S; Kennerley, Aneurin J; Berwick, Jason; Grierson, Andrew; Ramesh, Tennore; Prescott, Tony J

2014-02-01

The transgenic SOD1(G93A) mouse is a model of human amyotrophic lateral sclerosis (ALS) and recapitulates many of the pathological hallmarks observed in humans, including motor neuron degeneration in the brain and the spinal cord. In mice, neurodegeneration particularly impacts on the facial nuclei in the brainstem. Motor neurons innervating the whisker pad muscles originate in the facial nucleus of the brain stem, with contractions of these muscles giving rise to "whisking" one of the fastest movements performed by mammals. A longitudinal study was conducted on SOD1(G93A) mice and wild-type litter mate controls, comparing: (i) whisker movements using high-speed video recordings and automated whisker tracking, and (ii) facial nucleus degeneration using MRI. Results indicate that while whisking still occurs in SOD1(G93A) mice and is relatively resistant to neurodegeneration, there are significant disruptions to certain whisking behaviours, which correlate with facial nuclei lesions, and may be as a result of specific facial muscle degeneration. We propose that measures of mouse whisker movement could potentially be used in tandem with measures of limb dysfunction as biomarkers of disease onset and progression in ALS mice and offers a novel method for testing the efficacy of novel therapeutic compounds. Copyright © 2013 Elsevier B.V. All rights reserved.

Comparison of the Allergic Responses Induced by PeniciIlium chrysogenum and House Dust Mite Extracts in a Mouse Model

EPA Science Inventory

A report by the Institute of Medicine suggested that more research is needed to better understand mold effects on allergic disease, particularly asthma development. We compared the ability of the fungal Penicillium chrysogenum (PCE) and house dust mite (HDM) extracts to induce al...

Comment on "chronic traumatic encephalopathy in blast-exposed military veterans and a blast neurotrauma mouse model".

PubMed

Tsao, Jack W

2012-10-24

In their recent paper, Goldstein et al. show murine brain tau neuropathology after explosive blast with head rotation but do not present additional evidence that would delineate whether this neuropathology was principally caused by blast exposure alone or by blast exposure plus head rotational injury.

Characterization of the retina in the alpha7 nicotinic acetylcholine receptor knockout mouse

NASA Astrophysics Data System (ADS)

Smith, Marci L.

Acetylcholine receptors (AChRs) are involved in visual processing and are expressed by inner retinal neurons in all species studied to date (Keyser et al., 2000; Dmitrieva et al., 2007; Liu et al., 2009), but their distribution in the mouse retina remains unknown. Reductions in alpha7 nicotinic AChRs (nAChRs) are thought to contribute to memory and visual deficits observed in Alzheimer's and schizophrenia (Coyle et al., 1983; Nordberg et al., 1999; Leonard et al., 2006). However, the alpha7 nAChR knockout (KO) mouse has a mild phenotype (Paylor et al., 1998; Fernandes et al., 2006; Young et al., 2007; Origlia et al., 2012). The purpose of this study was to determine the expression of AChRs in wildtype (WT) mouse retina and to assess whether up-regulation of other AChRs in the alpha7 nAChR KO retina may explain the minimal deficits described in the KO mouse. Reverse-transcriptase PCR (RT-PCR) showed that mRNA transcripts for alpha2-7, alpha 9, alpha10, beta2-4 nAChR subunits and m1-m5 muscarinic AChR (mAChR) subtypes were present in WT murine retina. Western blot analysis confirmed the presence of alpha3-5, alpha9, and m1-m5 AChR proteins and immunohistochemical analysis demonstrated nAChR and mAChR proteins expressed by subsets of bipolar, amacrine and ganglion cells. This is the first reported expression of alpha9 and alpha10 nAChR transcripts and alpha9 nAChR proteins in the retina of any species. Quantitative RT-PCR (qPCR) showed changes in AChR transcript expression in the alpha7 nAChR KO mouse retina relative to WT. Within whole retina alpha2, alpha9, alpha10, beta4, m1 and m4 AChR transcripts were up-regulated, while alpha5 nAChR transcripts were down-regulated. However, cell populations showed subtle differences; m4 mAChR transcripts were up-regulated in the ganglion cell layer and outer portion of the inner nuclear layer (oINL),while beta4 nAChR transcript up-regulation was limited to the oINL. Surprisingly, alpha2, alpha9, beta4, m2 and m4 transcripts were down-regulated in the inner portion of the INL. These results indicate that compensation is mediated by differential regulation of more than one receptor type and changes in mRNA expression vary between cell populations.

Treacher Collins syndrome: New insights from animal models.

PubMed

Tse, William Ka Fai

2016-12-01

Treacher Collins syndrome (TCS, OMIM: 154500), an autosomal-dominant craniofacial developmental syndrome that occurs in 1 out of every 50,000 live births, is characterized by craniofacial malformation. Mutations in TCOF1, POLR1C, or POLR1D have been identified in affected individuals. In addition to established mouse models, zebrafish models have recently emerged as an valuable method to study facial disease. In this report, we summarized the two updated articles working on the pathogenesis of the newly identified polr1c and polr1d TCS mutations (Lau et al., 2016; Noack Watt et al., 2016) and discussed the possibility of using the anti-oxidants to prevent or rescue the TCS facial phenotype (Sakai et al., 2016). Taken together, this article provides an update on the disease from basic information to pathogenesis, and further summarizes the suggested therapies from recent laboratory research. Copyright © 2016 Elsevier Ltd. All rights reserved.

Anticancer activities against cholangiocarcinoma, toxicity and pharmacological activities of Thai medicinal plants in animal models

PubMed Central

2012-01-01

Background Chemotherapy of cholangiocarcinoma (CCA), a devastating cancer with increasing worldwide incidence and mortality rates, is largely ineffective. The discovery and development of effective chemotherapeutics is urgently needed. Methods/Design The study aimed at evaluating anticancer activities, toxicity, and pharmacological activities of the curcumin compound (CUR), the crude ethanolic extracts of rhizomes of Zingiber officinale Roscoe (Ginger: ZO) and Atractylodes lancea thung. DC (Khod-Kha-Mao: AL), fruits of Piper chaba Hunt. (De-Plee: PC), and Pra-Sa-Prao-Yhai formulation (a mixture of parts of 18 Thai medicinal plants: PPF) were investigated in animal models. Anti-cholangiocarcinoma (anti-CCA) was assessed using CCA-xenograft nude mouse model. The antihypertensive, analgesic, anti-inflammatory, antipyretic, and anti-ulcer activities and effects on motor coordination were investigated using Rota-rod test, CODA tail-cuff system, writhing and hot plate tests, carrageenan-induced paw edema test, brewer's yeast test, and alcohol-induced gastric ulcer test, respectively. Acute and subacute toxicity tests were performed according to the OECD guideline for testing of chemicals with modification. Results Promising anticancer activity against CCA in nude mouse xenograft model was shown for the ethanolic extract of AL at all oral dose levels (1000, 3000, and 5000 mg/kg body weight) as well as the extracts of ZO, PPF, and CUR compound at the highest dose level (5000, 4000, and 5000 mg/kg body weight, respectively). PC produced no significant anti-CCA activity. Results from acute and subacute toxicity tests both in mice and rats indicate safety profiles of all the test materials in a broad range of dose levels. No significant toxicity except stomach irritation and general CNS depressant signs were observed. Investigation of pharmacological activities of the test materials revealed promising anti-inflammatory (ZO, PPF, and AL), analgesic (CUR and PPF), antipyretic (CUR and AL), antihypertensive (ZO and AL), and anti-ulcer (CUR, ZO, and AL) activities. Conclusion Plants used in Thai traditional medicine for the treatment of various ailments may provide reservoirs of promising candidate chemotherapeutics for the treatment of CCA. PMID:22448640

Uncoupling of Protein Aggregation and Neurodegeneration in a Mouse Amyotrophic Lateral Sclerosis Model.

PubMed

Lee, Joo-Yong; Kawaguchi, Yoshiharu; Li, Ming; Kapur, Meghan; Choi, Su Jin; Kim, Hak-June; Park, Song-Yi; Zhu, Haining; Yao, Tso-Pang

2015-01-01

Aberrant accumulation of protein aggregates is a pathological hallmark of many neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS). Although a buildup of protein aggregates frequently leads to cell death, whether it is the key pathogenic factor in driving neurodegenerative disease remains controversial. HDAC6, a cytosolic ubiquitin-binding deacetylase, has emerged as an important regulator of ubiquitin-dependent quality control autophagy, a lysosome-dependent degradative system responsible for the disposal of misfolded protein aggregates and damaged organelles. Here, we show that in cell models HDAC6 plays a protective role against multiple disease-associated and aggregation-prone cytosolic proteins by facilitating their degradation. We further show that HDAC6 is required for efficient localization of lysosomes to protein aggregates, indicating that lysosome targeting to autophagic substrates is regulated. Supporting a critical role of HDAC6 in protein aggregate disposal in vivo, genetic ablation of HDAC6 in a transgenic SOD1G93A mouse, a model of ALS, leads to dramatic accumulation of ubiquitinated SOD1G93A protein aggregates. Surprisingly, despite a robust buildup of SOD1G93A aggregates, deletion of HDAC6 only moderately modified the motor phenotypes. These findings indicate that SOD1G93A aggregation is not the only determining factor to drive neurodegeneration in ALS, and that HDAC6 likely modulates neurodegeneration through additional mechanisms beyond protein aggregate clearance. © 2015 S. Karger AG, Basel.

S-acylation of SOD1, CCS, and a stable SOD1-CCS heterodimer in human spinal cords from ALS and non-ALS subjects.

PubMed

Antinone, Sarah E; Ghadge, Ghanashyam D; Ostrow, Lyle W; Roos, Raymond P; Green, William N

2017-01-25

Previously, we found that human Cu, Zn-superoxide dismutase (SOD1) is S-acylated (palmitoylated) in vitro and in amyotrophic lateral sclerosis (ALS) mouse models, and that S-acylation increased for ALS-causing SOD1 mutants relative to wild type. Here, we use the acyl resin-assisted capture (acyl-RAC) assay to demonstrate S-acylation of SOD1 in human post-mortem spinal cord homogenates from ALS and non-ALS subjects. Acyl-RAC further revealed that endogenous copper chaperone for SOD1 (CCS) is S-acylated in both human and mouse spinal cords, and in vitro in HEK293 cells. SOD1 and CCS formed a highly stable heterodimer in human spinal cord homogenates that was resistant to dissociation by boiling, denaturants, or reducing agents and was not observed in vitro unless both SOD1 and CCS were overexpressed. Cysteine mutations that attenuate SOD1 maturation prevented the SOD1-CCS heterodimer formation. The degree of S-acylation was highest for SOD1-CCS heterodimers, intermediate for CCS monomers, and lowest for SOD1 monomers. Given that S-acylation facilitates anchoring of soluble proteins to cell membranes, our findings suggest that S-acylation and membrane localization may play an important role in CCS-mediated SOD1 maturation. Furthermore, the highly stable S-acylated SOD1-CCS heterodimer may serve as a long-lived maturation intermediate in human spinal cord.

S-acylation of SOD1, CCS, and a stable SOD1-CCS heterodimer in human spinal cords from ALS and non-ALS subjects

PubMed Central

Antinone, Sarah E.; Ghadge, Ghanashyam D.; Ostrow, Lyle W.; Roos, Raymond P.; Green, William N.

2017-01-01

Previously, we found that human Cu, Zn-superoxide dismutase (SOD1) is S-acylated (palmitoylated) in vitro and in amyotrophic lateral sclerosis (ALS) mouse models, and that S-acylation increased for ALS-causing SOD1 mutants relative to wild type. Here, we use the acyl resin-assisted capture (acyl-RAC) assay to demonstrate S-acylation of SOD1 in human post-mortem spinal cord homogenates from ALS and non-ALS subjects. Acyl-RAC further revealed that endogenous copper chaperone for SOD1 (CCS) is S-acylated in both human and mouse spinal cords, and in vitro in HEK293 cells. SOD1 and CCS formed a highly stable heterodimer in human spinal cord homogenates that was resistant to dissociation by boiling, denaturants, or reducing agents and was not observed in vitro unless both SOD1 and CCS were overexpressed. Cysteine mutations that attenuate SOD1 maturation prevented the SOD1-CCS heterodimer formation. The degree of S-acylation was highest for SOD1-CCS heterodimers, intermediate for CCS monomers, and lowest for SOD1 monomers. Given that S-acylation facilitates anchoring of soluble proteins to cell membranes, our findings suggest that S-acylation and membrane localization may play an important role in CCS-mediated SOD1 maturation. Furthermore, the highly stable S-acylated SOD1-CCS heterodimer may serve as a long-lived maturation intermediate in human spinal cord. PMID:28120938

Potential of Lactobacillus plantarum CCFM639 in Protecting against Aluminum Toxicity Mediated by Intestinal Barrier Function and Oxidative Stress.

PubMed

Yu, Leilei; Zhai, Qixiao; Tian, Fengwei; Liu, Xiaoming; Wang, Gang; Zhao, Jianxin; Zhang, Hao; Narbad, Arjan; Chen, Wei

2016-12-02

Aluminum (Al) is a ubiquitous metal that can seriously harm the health of animals and humans. In our previous study, we demonstrated that Lactobacillus plantarum CCFM639 can decrease Al burden in the tissues of mice by inhibiting intestinal Al absorption. The main aim of the present research was to investigate whether the protection by the strain is also associated with enhancement of the intestinal barrier, alleviation of oxidative stress and modulation of the inflammatory response. In an in vitro cell model, two protection modes (intervention and therapy) were examined and the results indicated that L. plantarum CCFM639 alleviated Al-induced cytotoxicity. In a mouse model, L. plantarum CCFM639 treatment was found to significantly alleviate oxidative stress in the intestinal tract, regulate the function of the intestinal mucosal immune system, restore the integrity of tight junction proteins and maintain intestinal permeability. These results suggest that in addition to Al sequestration, L. plantarum CCFM639 can also inhibit Al absorption by protecting the intestinal barrier, alleviating Al-induced oxidative stress and inflammatory response. Therefore, L. plantarum CCFM639 has the potential to be a dietary supplement ingredient that provides protection against Al-induced gut injury.

SIRT1 overexpression ameliorates a mouse model of SOD1-linked amyotrophic lateral sclerosis via HSF1/HSP70i chaperone system.

PubMed

Watanabe, Seiji; Ageta-Ishihara, Natsumi; Nagatsu, Shinji; Takao, Keizo; Komine, Okiru; Endo, Fumito; Miyakawa, Tsuyoshi; Misawa, Hidemi; Takahashi, Ryosuke; Kinoshita, Makoto; Yamanaka, Koji

2014-08-29

Dominant mutations in superoxide dismutase 1 (SOD1) cause degeneration of motor neurons in a subset of inherited amyotrophic lateral sclerosis (ALS). The pathogenetic process mediated by misfolded and/or aggregated mutant SOD1 polypeptides is hypothesized to be suppressed by protein refolding. This genetic study is aimed to test whether mutant SOD1-mediated ALS pathology recapitulated in mice could be alleviated by overexpressing a longevity-related deacetylase SIRT1 whose substrates include a transcription factor heat shock factor 1 (HSF1), the master regulator of the chaperone system. We established a line of transgenic mice that chronically overexpress SIRT1 in the brain and spinal cord. While inducible HSP70 (HSP70i) was upregulated in the spinal cord of SIRT1 transgenic mice (PrP-Sirt1), no neurological and behavioral alterations were detected. To test hypothetical benefits of SIRT1 overexpression, we crossbred PrP-Sirt1 mice with two lines of ALS model mice: A high expression line that exhibits a severe phenotype (SOD1G93A-H) or a low expression line with a milder phenotype (SOD1G93A-L). The Sirt1 transgene conferred longer lifespan without altering the time of symptomatic onset in SOD1G93A-L. Biochemical analysis of the spinal cord revealed that SIRT1 induced HSP70i expression through deacetylation of HSF1 and that SOD1G93A-L/PrP-Sirt1 double transgenic mice contained less insoluble SOD1 than SOD1G93A-L mice. Parallel experiments showed that Sirt1 transgene could not rescue a more severe phenotype of SOD1G93A-H transgenic mice partly because their HSP70i level had peaked out. The genetic supplementation of SIRT1 can ameliorate a mutant SOD1-linked ALS mouse model partly through the activation of the HSF1/HSP70i chaperone system. Future studies shall include testing potential benefits of pharmacological enhancement of the deacetylation activity of SIRT1 after the onset of the symptom.

ALS patients’ regulatory T lymphocytes are dysfunctional, and correlate with disease progression rate and severity

PubMed Central

Beers, David R.; Zhao, Weihua; Wang, Jinghong; Zhang, Xiujun; Wen, Shixiang; Neal, Dan; Thonhoff, Jason R.; Alsuliman, Abdullah S.; Shpall, Elizabeth J.; Rezvani, Katy

2017-01-01

Neuroinflammation is a pathological hallmark of ALS in both transgenic rodent models and patients, and is characterized by proinflammatory T lymphocytes and activated macrophages/microglia. In ALS mouse models, decreased regulatory T lymphocytes (Tregs) exacerbate the neuroinflammatory process, leading to accelerated motoneuron death and shortened survival; passive transfer of Tregs suppresses the neuroinflammation and prolongs survival. Treg numbers and FOXP3 expression are also decreased in rapidly progressing ALS patients. A key question is whether the marked neuroinflammation in ALS can be attributed to the impaired suppressive function of ALS Tregs in addition to their decreased numbers. To address this question, T lymphocyte proliferation assays were performed. Compared with control Tregs, ALS Tregs were less effective in suppressing responder T lymphocyte proliferation. Although both slowly and rapidly progressing ALS patients had dysfunctional Tregs, the greater the clinically assessed disease burden or the more rapidly progressing the patient, the greater the Treg dysfunction. Epigenetically, the percentage methylation of the Treg-specific demethylated region was greater in ALS Tregs. After in vitro expansion, ALS Tregs regained suppressive abilities to the levels of control Tregs, suggesting that autologous passive transfer of expanded Tregs might offer a novel cellular therapy to slow disease progression. PMID:28289705

Development of a Novel Therapeutic Paradigm Utilizing a Mammary Gland-Targeted, Bin-1 Knockout Mouse Model

DTIC Science & Technology

2007-03-01

Cell. Biol. 23, 4295 (Jun, 2003). Bin1 Ablation in Mammary Gland Delays Tissue Remodeling and Drives Cancer Progression Mee Young Chang, 1...Basu A, et al. Bin1 functionally interacts with Myc in cells and inhibits cell proliferation by multiple mechanisms. Oncogene 1999;18:3564–73. 5. Pineda

Microbial networking in cancer: when two toxins collide.

PubMed

Tomkovich, Sarah; Jobin, Christian

2018-05-01

A recent study by Dejea et al. has demonstrated that two enterotoxigenic bacteria frequently associated with sporadic colorectal cancer, Bacteroides fragilis and pks+ Escherichia coli, are found together in biofilms on tissue from patients with familial adenomatous polyposis. In preclinical mouse models, these two bacteria and their corresponding toxins work synergistically to promote colon cancer.

Neuroscience. Stout guards of the central nervous system.

PubMed

Mechoulam, R; Lichtman, A H

2003-10-03

Endocannabinoids have paradoxical effects on the mammalian nervous system: Sometimes they block neuronal excitability and other times they augment it. In their Perspective, Mechoulam and Lichtman discuss new work (Marsicano et al.) showing that activation of the cannabinoid receptor CB1 by the endocannabinoid anandamide protects against excitotoxic damage in a mouse model of kainic acid-induced epilepsy.

Development of Mouse Lung Deposition Models

DTIC Science & Technology

2015-07-01

information on deposition of ultrafine particles in the URT of mice either by measurements or theoretical modeling. Comparison of the nasal structure of... ultrafine particles in rats to be extended to mice. Based on measurements in the nasal casts of rats, Cheng et al. [12] obtained the following...expression for losses of ultrafine particles in the nasal passages of rats by Brownian diffusion during inhalation and exhalation. γβα− − −=η QD

Effect of Arctium lappa L. in the dextran sulfate sodium colitis mouse model

PubMed Central

Huang, Tzou-Chi; Tsai, Shinn-Shyong; Liu, Li-Fang; Liu, Yu Lin; Liu, Hung-Jen; Chuang, Kuo Pin

2010-01-01

AIM: To analyze the possible protective role of Arctium lappa L. (AL) in a murine model of ulcerative colitis (UC). METHODS: BALB/c mice were administered 100 mg/kg AL powder orally each day. After 7 d, colitis was induced by administration of dextran sulfate sodium (DSS) (5% W/V) in drinking water for a further 8 consecutive days. Diarrhea and bloody stools as well as colonic histology were observed. The level of interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) in colonic sections were detected by immunohistochemistry. RESULTS: There were significant differences in mean body weight values and disease activity indices between controls and AL-treated animals. Moreover, the histological findings showed that AL treatment can prevent mucosal edema, submucosal erosions, ulceration, inflammatory cell infiltration and colon damage. In addition, immunohistochemistry analysis showed that the levels of the inflammatory cytokines, IL-6 and TNF-α were also decreased in AL-treated groups. CONCLUSION: We suggest that AL can prevent intestinal damage and decrease inflammatory cytokines in mice with DSS-induced colitis. Thus, AL could prove to be a useful food for UC. PMID:20806438

Induced pluripotent stem cells from goat fibroblasts.

PubMed

Song, Hui; Li, Hui; Huang, Mingrui; Xu, Dan; Gu, Chenghao; Wang, Ziyu; Dong, Fulu; Wang, Feng

2013-12-01

Embryonic stem cells (ESCs) are a powerful model for genetic engineering, studying developmental biology, and modeling disease. To date, ESCs have been established from the mouse (Evans and Kaufman, 1981, Nature 292:154-156), non-human primates (Thomson et al., , Proc Nat Acad Sci USA 92:7844-7848), humans (Thomson et al., 1998, Science 282:1145-1147), and rats (Buehr et al., , Cell 135:1287-1298); however, the derivation of ESCs from domesticated ungulates such as goats, sheep, cattle, and pigs have not been successful. Alternatively, induced pluripotent stem cells (iPSCs) can be generated by reprogramming somatic cells with several combinations of genes encoding transcription factors (OCT3/4, SOX2, KLF4, cMYC, LIN28, and NANOG). To date, iPSCs have been isolated from various species, but only limited information is available regarding goat iPSCs (Ren et al., 2011, Cell Res 21:849-853). The objectives of this study were to generate goat iPSCs from fetal goat primary ear fibroblasts using lentiviral transduction of four human transcription factors: OCT4, SOX2, KLF4, and cMYC. The goat iPSCs were successfully generated by co-culture with mitomycin C-treated mouse embryonic fibroblasts using medium supplemented with knockout serum replacement and human basic fibroblast growth factor. The goat iPSCs colonies are flat, compact, and closely resemble human iPSCs. They have a normal karyotype; stain positive for alkaline phosphatase, OCT4, and NANOG; express endogenous pluripotency genes (OCT4, SOX2, cMYC, and NANOG); and can spontaneously differentiate into three germ layers in vitro and in vivo. © 2013 Wiley Periodicals, Inc.

Hematopoietic Stem Cell Therapy to Countermeasure Cancer in Astronauts during Exploration of Deep Space

NASA Technical Reports Server (NTRS)

Ohi, S.; Kindred, R. P.; Roach, A-N.; Edossa, A.; Kim, B. C.; Gonda, S. R.; Emami, K.

2004-01-01

Exposure to cosmic radiation can cause chromosomal mutations, which may lead to cancer in astronauts engaged in space exploration. Therefore, our goals are to develop countermeasures to prevent space-induced cancer using hematopoietic stem cell therapy (HSCT) and gene therapy. This presentation focuses on HSCT for cancer. Our previous experiments on a simulated, space-induced immuno-deficiency model (mouse hind limb unloading ) indicated that transplanted hematopoietic stem cells (HSCs) could enhance the host's immunity by effectively eliminating bacterial infection (Ohi S, et. al. J Grav Physiol 10, P63-64, 2003; Ohi S, et. al. Proceedings of the Space Technology and Applications International Forum (STAIF) . American Institute of Physics, New York, pp. 938-950, 2004). Hence, we hypothesized that the HSCs might be effective in combating cancer as well. Studies of cocultured mouse HSCs with beta-galactosidase marked rat gliosarcoma spheroids (9L/lacZ), a cancer model, indicated antagonistic interactions , resulting in destruction of the spheroids by HSCs. Trypan Blue dye-exclusion assays were consistent with the conclusion. These results show potential usehlness of HSCT for cancer. Currently, the NASA Hydrodynamic Focusing Bioreactor (HFB), a space analog tissue/cell culture system, is being used to study invasion of the gliosarcoma (GS) spheroids into mouse brain with or without co-cultured HSCs. This may simulate the metastasis of gliosarcoma to brain. There is a tendency for the HSCs to inhibit invasion of GS spheroids into brain, as evidenced by the X-gal staining.

IRS-PCR-based genetic mapping of the huntingtin interacting protein gene (HIP1) on mouse chromosome 5.

PubMed

Himmelbauer, H; Wedemeyer, N; Haaf, T; Wanker, E E; Schalkwyk, L C; Lehrach, H

1998-01-01

Huntington's disease (HD) is a devastating central nervous system disorder. Even though the gene responsible has been positionally cloned recently, its etiology has remained largely unclear. To investigate potential disease mechanisms, we conducted a search for binding partners of the HD-protein huntingtin. With the yeast two-hybrid system, one such interacting factor, the huntingtin interacting protein-1 (HIP-1), was identified (Wanker et al. 1997; Kalchman et al. 1997) and the human gene mapped to 7q11.2. In this paper we demonstrate the localization of the HIP1 mouse homologue (Hip1) into a previously identified region of human-mouse synteny on distal mouse Chromosome (Chr) 5, both employing an IRS-PCR-based mapping strategy and traditional fluorescent in situ hybridization (FISH) mapping.

Cell of Origin and Cancer Stem Cells in Tumor Suppressor Mouse Models of Glioblastoma.

PubMed

Alcantara Llaguno, Sheila R; Xie, Xuanhua; Parada, Luis F

2016-01-01

The cellular origins and the mechanisms of progression, maintenance of tumorigenicity, and therapeutic resistance are central questions in the glioblastoma multiforme (GBM) field. Using tumor suppressor mouse models, our group recently reported two independent populations of adult GBM-initiating central nervous system progenitors. We found different functional and molecular subtypes depending on the tumor-initiating cell lineage, indicating that the cell of origin is a driver of GBM subtype diversity. Using an in vivo model, we also showed that GBM cancer stem cells (CSCs) or glioma stem cells (GSCs) contribute to resistance to chemotherapeutic agents and that genetic ablation of GSCs leads to a delay in tumor progression. These studies are consistent with the cell of origin and CSCs as critical regulators of the pathogenesis of GBM. © 2016 Alcantara Llaguno et al; Published by Cold Spring Harbor Laboratory Press.

The Role of the Sonic Hedgehog Pathway for Prostate Cancer Progression

DTIC Science & Technology

2005-02-01

analyses. Sumin Chi contributed to wers GY, Qi YP, Gysin S, Fernandez-Del Castillo C, Yajnik V. AntoniuB, McMahon M, Warshaw AL Hebrok M: Hedgehog is an...role for p27kiP, gene dosage • 15. Romer JT, Kimura H, Magdaleno S et at: 391(6662), 90-92 (1998). in a mouse model of prostate carcinogenesis

Trajectories Emerging from Discrete versus Continuous Processing Models in Phonological Competitor Tasks: A Commentary on Spivey, Grosjean, and Knoblich (2005)

ERIC Educational Resources Information Center

Van Der Wel, Robrecht P. R. D.; Eder, Jeffrey R.; Mitchel, Aaron D.; Walsh, Matthew M.; Rosenbaum, David A.

2009-01-01

M. J. Spivey, M. Grosjean, and G. Knoblich (2005) showed that in a phonological competitor task, participants' mouse cursor movements showed more curvature toward the competitor item when the competitor and target were phonologically similar than when the competitor and target were phonologically dissimilar. Spivey et al. interpreted this result…

Potential of Lactobacillus plantarum CCFM639 in Protecting against Aluminum Toxicity Mediated by Intestinal Barrier Function and Oxidative Stress

PubMed Central

Yu, Leilei; Zhai, Qixiao; Tian, Fengwei; Liu, Xiaoming; Wang, Gang; Zhao, Jianxin; Zhang, Hao; Narbad, Arjan; Chen, Wei

2016-01-01

Aluminum (Al) is a ubiquitous metal that can seriously harm the health of animals and humans. In our previous study, we demonstrated that Lactobacillus plantarum CCFM639 can decrease Al burden in the tissues of mice by inhibiting intestinal Al absorption. The main aim of the present research was to investigate whether the protection by the strain is also associated with enhancement of the intestinal barrier, alleviation of oxidative stress and modulation of the inflammatory response. In an in vitro cell model, two protection modes (intervention and therapy) were examined and the results indicated that L. plantarum CCFM639 alleviated Al-induced cytotoxicity. In a mouse model, L. plantarum CCFM639 treatment was found to significantly alleviate oxidative stress in the intestinal tract, regulate the function of the intestinal mucosal immune system, restore the integrity of tight junction proteins and maintain intestinal permeability. These results suggest that in addition to Al sequestration, L. plantarum CCFM639 can also inhibit Al absorption by protecting the intestinal barrier, alleviating Al-induced oxidative stress and inflammatory response. Therefore, L. plantarum CCFM639 has the potential to be a dietary supplement ingredient that provides protection against Al-induced gut injury. PMID:27918411

Inputs for subject-specific computational fluid dynamics simulation of blood flow in the mouse aorta.

PubMed

Van Doormaal, Mark; Zhou, Yu-Qing; Zhang, Xiaoli; Steinman, David A; Henkelman, R Mark

2014-10-01

Mouse models are an important way for exploring relationships between blood hemodynamics and eventual plaque formation. We have developed a mouse model of aortic regurgitation (AR) that produces large changes in plaque burden with charges in hemodynamics [Zhou et al., 2010, "Aortic Regurgitation Dramatically Alters the Distribution of Atherosclerotic Lesions and Enhances Atherogenesis in Mice," Arterioscler. Thromb. Vasc. Biol., 30(6), pp. 1181-1188]. In this paper, we explore the amount of detail needed for realistic computational fluid dynamics (CFD) calculations in this experimental model. The CFD calculations use inputs based on experimental measurements from ultrasound (US), micro computed tomography (CT), and both anatomical magnetic resonance imaging (MRI) and phase contrast MRI (PC-MRI). The adequacy of five different levels of model complexity (a) subject-specific CT data from a single mouse; (b) subject-specific CT centerlines with radii from US; (c) same as (b) but with MRI derived centerlines; (d) average CT centerlines and averaged vessel radius and branching vessels; and (e) same as (d) but with averaged MRI centerlines) is evaluated by demonstrating their impact on relative residence time (RRT) outputs. The paper concludes by demonstrating the necessity of subject-specific geometry and recommends for inputs the use of CT or anatomical MRI for establishing the aortic centerlines, M-mode US for scaling the aortic diameters, and a combination of PC-MRI and Doppler US for estimating the spatial and temporal characteristics of the input wave forms.

Sporadic and hereditary amyotrophic lateral sclerosis (ALS).

PubMed

Ajroud-Driss, Senda; Siddique, Teepu

2015-04-01

Genetic discoveries in ALS have a significant impact on deciphering molecular mechanisms of motor neuron degeneration. The identification of SOD1 as the first genetic cause of ALS led to the engineering of the SOD1 mouse, the backbone of ALS research, and set the stage for future genetic breakthroughs. In addition, careful analysis of ALS pathology added valuable pieces to the ALS puzzle. From this joint effort, major pathogenic pathways emerged. Whereas the study of TDP43, FUS and C9ORF72 pointed to the possible involvement of RNA biology in motor neuron survival, recent work on P62 and UBQLN2 refocused research on protein degradation pathways. Despite all these efforts, the etiology of most cases of sporadic ALS remains elusive. Newly acquired genomic tools now allow the identification of genetic and epigenetic factors that can either increase ALS risk or modulate disease phenotype. These developments will certainly allow for better disease modeling to identify novel therapeutic targets for ALS. This article is part of a Special Issue entitled: Neuromuscular Diseases: Pathology and Molecular Pathogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.

Deletion of galectin-3 exacerbates microglial activation and accelerates disease progression and demise in a SOD1G93A mouse model of amyotrophic lateral sclerosis

PubMed Central

Lerman, Bruce J; Hoffman, Eric P; Sutherland, Margaret L; Bouri, Khaled; Hsu, Daniel K; Liu, Fu-Tong; Rothstein, Jeffrey D; Knoblach, Susan M

2012-01-01

Galectins are pleiotropic carbohydrate-binding lectins involved in inflammation, growth/differentiation, and tissue remodeling. The functional role of galectins in amyotrophic lateral sclerosis (ALS) is unknown. Expression studies revealed increases in galectin-1 mRNA and protein in spinal cords from SOD1G93A mice, and in galectin-3 and -9 mRNAs and proteins in spinal cords of both SOD1G93A mice and sporadic ALS patients. As the increase in galectin-3 appeared in early presymptomatic stages and increased progressively through to end stage of disease in the mouse, it was selected for additional study, where it was found to be mainly expressed by microglia. Galectin-3 antagonists are not selective and do not readily cross the blood–brain barrier; therefore, we generated SOD1G93A/Gal-3−/− transgenic mice to evaluate galectin-3 deletion in a widely used mouse model of ALS. Disease progression, neurological symptoms, survival, and inflammation were assessed to determine the effect of galectin-3 deletion on the SOD1G93A disease phenotype. Galectin-3 deletion did not change disease onset, but resulted in more rapid progression through functionally defined disease stages, more severely impaired neurological symptoms at all stages of disease, and expiration, on average, 25 days earlier than SOD1G93A/Gal-3+/+ cohorts. In addition, microglial staining, as well as TNF-α, and oxidative injury were increased in SOD1G93A/Gal-3−/− mice compared with SOD1G93A/Gal-3+/+ cohorts. These data support an important functional role for microglial galectin-3 in neuroinflammation during chronic neurodegenerative disease. We suggest that elevations in galectin-3 by microglia as disease progresses may represent a protective, anti-inflammatory innate immune response to chronic motor neuron degeneration. PMID:23139902

Examination of the mGluR-mTOR Pathway for the Identification of Potential Therapeutic Targets to Treat Fragile X

DTIC Science & Technology

2014-10-01

of cAMP and ras signaling pathways improves distinct behavioral deficits in a zebrafish model of neurofibromatosis type 1. Cell Rep. 2014 Sep 11;8(5...that are already present in childhood as was first demonstrated in animal models of Fragile X and Neurofibromatosis type 1 in 2005 (Li et al., 2005...learning and attention deficits in a mouse model of neurofibromatosis type 1. Curr Biol 15:1961-1967. Liu ZH, Chuang DM, Smith CB (2011) Lithium

Two-color Dye-swap DNA Microarray approach toward confident gene expression profiling in PMCAO mouse model for ischemia-related and PACAP38-influenced genes

PubMed Central

Hori, Motohide; Shibato, Junko; Nakamachi, Tomoya; Rakwal, Randeep; Ogawa, Tetsuo; Shioda, Seiji; Numazawa, Satoshi

2015-01-01

Toward twin goals of identifying molecular factors in brain injured by ischemic stroke, and the effects of neuropeptide pituitary adenylate-cyclase activating polypeptide (PACAP) on the ischemic brain, we have established the permanent middle cerebral artery occlusion (PMCAO) mouse model and utilized the Agilent mouse whole genome 4 × 44 K DNA chip. PACAP38 (1 pmol) injection was given intracerebroventrically in comparison to a control saline (0.9% NaCl) injection, to screen genes responsive to PACAP38. Two sets of tissues were prepared, whole hemispheres (ischemic and non-ischemic) and infract core and penumbra regions at 6 and 24 h. In this study, we have detailed the experimental design and protocol used therein and explained the quality controls for the use of total RNA in the downstream DNA microarray experiment utilizing a two-color dye-swap approach for stringent and confident gene identification published in a series of papers by Hori and coworkers (Hori et al., 2012–2015). PMID:26484166

The contribution of mouse models to understanding the pathogenesis of spinal muscular atrophy

PubMed Central

Sleigh, James N.; Gillingwater, Thomas H.; Talbot, Kevin

2011-01-01

Spinal muscular atrophy (SMA), which is caused by inactivating mutations in the survival motor neuron 1 (SMN1) gene, is characterized by loss of lower motor neurons in the spinal cord. The gene encoding SMN is very highly conserved in evolution, allowing the disease to be modeled in a range of species. The similarities in anatomy and physiology to the human neuromuscular system, coupled with the ease of genetic manipulation, make the mouse the most suitable model for exploring the basic pathogenesis of motor neuron loss and for testing potential treatments. Therapies that increase SMN levels, either through direct viral delivery or by enhancing full-length SMN protein expression from the SMN1 paralog, SMN2, are approaching the translational stage of development. It is therefore timely to consider the role of mouse models in addressing aspects of disease pathogenesis that are most relevant to SMA therapy. Here, we review evidence suggesting that the apparent selective vulnerability of motor neurons to SMN deficiency is relative rather than absolute, signifying that therapies will need to be delivered systemically. We also consider evidence from mouse models suggesting that SMN has its predominant action on the neuromuscular system in early postnatal life, during a discrete phase of development. Data from these experiments suggest that the timing of therapy to increase SMN levels might be crucial. The extent to which SMN is required for the maintenance of motor neurons in later life and whether augmenting its levels could treat degenerative motor neuron diseases, such as amyotrophic lateral sclerosis (ALS), requires further exploration. PMID:21708901

A Model of Medical Countermeasures for Vesicant Exposure

DTIC Science & Technology

2015-10-01

measured protease activity that was collected from mouse ear exposures (Powers J. C., 1999) instead of via in vitro human keratinocyte exposure. The...to mice ears with and without treatment. This is a model study in the type of data that can best be used for the GVM, because it considers different...mice were exposed on their backs; however, for the Lomash et al. study the mice were exposed on their ears . This tends to be an issue when working

A Mouse Model of Familial ALS Has Increased CNS Levels of Endogenous Ubiquinol9/10 and Does Not Benefit from Exogenous Administration of Ubiquinol10

PubMed Central

Lucchetti, Jacopo; Marino, Marianna; Papa, Simonetta; Tortarolo, Massimo; Guiso, Giovanna; Pozzi, Silvia; Bonetto, Valentina; Caccia, Silvio; Beghi, Ettore; Bendotti, Caterina; Gobbi, Marco

2013-01-01

Oxidative stress and mitochondrial impairment are the main pathogenic mechanisms of Amyotrophic Lateral Sclerosis (ALS), a severe neurodegenerative disease still lacking of effective therapy. Recently, the coenzyme-Q (CoQ) complex, a key component of mitochondrial function and redox-state modulator, has raised interest for ALS treatment. However, while the oxidized form ubiquinone10 was ineffective in ALS patients and modestly effective in mouse models of ALS, no evidence was reported on the effect of the reduced form ubiquinol10, which has better bioavailability and antioxidant properties. In this study we compared the effects of ubiquinone10 and a new stabilized formulation of ubiquinol10 on the disease course of SOD1G93A transgenic mice, an experimental model of fALS. Chronic treatments (800 mg/kg/day orally) started from the onset of disease until death, to mimic the clinical trials that only include patients with definite ALS symptoms. Although the plasma levels of CoQ10 were significantly increased by both treatments (from <0.20 to 3.0–3.4 µg/mL), no effect was found on the disease progression and survival of SOD1G93A mice. The levels of CoQ10 in the brain and spinal cord of ubiquinone10- or ubiquinol10-treated mice were only slightly higher (≤10%) than the endogenous levels in vehicle-treated mice, indicating poor CNS availability after oral dosing and possibly explaining the lack of pharmacological effects. To further examine this issue, we measured the oxidized and reduced forms of CoQ9/10 in the plasma, brain and spinal cord of symptomatic SOD1G93A mice, in comparison with age-matched SOD1WT. Levels of ubiquinol9/10, but not ubiquinone9/10, were significantly higher in the CNS, but not in plasma, of SOD1G93A mice, suggesting that CoQ redox system might participate in the mechanisms trying to counteract the pathology progression. Therefore, the very low increases of CoQ10 induced by oral treatments in CNS might be not sufficient to provide significant neuroprotection in SOD1G93A mice. PMID:23936040

Identification and Characterization of Tumor Antigens Associated with Breast Cancer

DTIC Science & Technology

1999-08-01

antigens resulted in strong production of anti-envelope and anti- ATRX antibodies (Hampton et al., figure 5). Isotype analysis of the antibody response...antigens Key Words: tumor antigen, endogenous retrovirus, antibody , adenocarcinoma, ATRX ABSTRACT Evaluation of immunotherapy strategies in mouse models...individuals often develop a limited immune response to their tumor. The production of antibodies directed against tumor antigens has been described for

Additive Neuroprotective Effects of the Multifunctional Iron Chelator M30 with Enriched Diet in a Mouse Model of Amyotrophic Lateral Sclerosis.

PubMed

Golko-Perez, Sagit; Mandel, Silvia; Amit, Tamar; Kupershmidt, Lana; Youdim, Moussa B H; Weinreb, Orly

2016-02-01

Amyotrophic lateral sclerosis (ALS) is the most common degenerative disease of the motoneuron system, involving various abnormalities, such as mitochondrial dysfunction, oxidative stress, transitional metal accumulation, neuroinflammation, glutamate excitotoxicity, apoptosis, decreased supply of trophic factors, cytoskeletal abnormalities, and extracellular superoxide dismutase (SOD)-1 toxicity. These multiple disease etiologies implicated in ALS gave rise to the perception that future therapeutic approaches for the disease should be aimed at targeting multiple pathological pathways. In line with this view, we have evaluated in the current study the therapeutic effects of low doses of the novel multifunctional monoamine oxidase (MAO) inhibitor/iron-chelating compound, M30 in combination with high Calorie Energy supplemented Diet (CED) in the SOD1-G93A transgenic mouse model of ALS. Our results demonstrated that the combined administration of M30 with CED produced additive neuroprotective effects on motor performance and increased survival of SOD1-G93A mice. We also found that both M30 and M30/CED regimens caused a significant inhibition of MAO-A and -B activities and decreased the turnover of dopamine in the brain of SOD1-G93A mice. In addition, M30/CED combined treatment resulted in a significant increase in mRNA expression levels of various mitochondrial biogenesis and metabolism regulators, such as peroxisome proliferator-activated receptor-γ (PPARγ)-co activator 1 alpha (PGC-1α), PPARγ, uncoupling protein 1, and insulin receptor in the gastrocnemius muscle of SOD1-G93A mice. These results suggest that a combination of drug/agents with different, but complementary mechanisms may be beneficial in the treatment of ALS.

A Cystine-Rich Whey Supplement (Immunocal®) Delays Disease Onset and Prevents Spinal Cord Glutathione Depletion in the hSOD1G93A Mouse Model of Amyotrophic Lateral Sclerosis

PubMed Central

Ross, Erika K.; Winter, Aimee N.; Wilkins, Heather M.; Sumner, Whitney A.; Duval, Nathan; Patterson, David; Linseman, Daniel A.

2014-01-01

Depletion of the endogenous antioxidant, glutathione (GSH), underlies progression of the devastating neurodegenerative disease, amyotrophic lateral sclerosis (ALS). Thus, strategies aimed at elevating GSH may yield new therapeutics for ALS. Here, we investigated the effects of a unique non-denatured whey protein supplement, Immunocal®, in the transgenic Gly position 93 to Ala (G93A) mutant hSOD1 (hSOD1G93A) mouse model of ALS. Immunocal® is rich in the GSH precursor, cystine, and is therefore capable of bolstering GSH content. Transgenic hSOD1G93A mice receiving Immunocal® displayed a significant delay in disease onset compared to untreated hSOD1G93A controls. Additionally, Immunocal® treatment significantly decreased the rate of decline in grip strength and prevented disease-associated reductions in whole blood and spinal cord tissue GSH levels in end-stage hSOD1G93A mice. However, Immunocal® did not extend survival, likely due to its inability to preserve the mitochondrial GSH pool in spinal cord. Combination treatment with Immunocal® and the anti-glutamatergic compound, riluzole, delayed disease onset and extended survival in hSOD1G93A mice. These findings demonstrate that sustaining tissue GSH with Immunocal® only modestly delays disease onset and slows the loss of skeletal muscle strength in hSOD1G93A mice. Moreover, the inability of Immunocal® to rescue mitochondrial GSH in spinal cord provides a possible mechanism for its lack of effect on survival and is a limiting factor in the potential utility of this supplement as a therapeutic for ALS. PMID:26785244

Effect of fluoxetine on disease progression in a mouse model of ALS

PubMed Central

Koschnitzky, J. E.; Quinlan, K. A.; Lukas, T. J.; Kajtaz, E.; Kocevar, E. J.; Mayers, W. F.; Siddique, T.

2014-01-01

Selective serotonin reuptake inhibitors (SSRIs) and other antidepressants are often prescribed to amyotrophic lateral sclerosis (ALS) patients; however, the impact of these prescriptions on ALS disease progression has not been systematically tested. To determine whether SSRIs impact disease progression, fluoxetine (Prozac, 5 or 10 mg/kg) was administered to mutant superoxide dismutase 1 (SOD1) mice during one of three age ranges: neonatal [postnatal day (P)5–11], adult presymptomatic (P30 to end stage), and adult symptomatic (P70 to end stage). Long-term adult fluoxetine treatment (started at either P30 or P70 and continuing until end stage) had no significant effect on disease progression. In contrast, neonatal fluoxetine treatment (P5-11) had two effects. First, all animals (mutant SOD1G93A and control: nontransgenic and SOD1WT) receiving the highest dose (10 mg/kg) had a sustained decrease in weight from P30 onward. Second, the high-dose SOD1G93A mice reached end stage ∼8 days (∼6% decrease in life span) sooner than vehicle and low-dose animals because of an increased rate of motor impairment. Fluoxetine increases synaptic serotonin (5-HT) levels, which is known to increase spinal motoneuron excitability. We confirmed that 5-HT increases spinal motoneuron excitability during this neonatal time period and therefore hypothesized that antagonizing 5-HT receptors during the same time period would improve disease outcome. However, cyproheptadine (1 or 5 mg/kg), a 5-HT receptor antagonist, had no effect on disease progression. These results show that a brief period of antidepressant treatment during a critical time window (the transition from neonatal to juvenile states) can be detrimental in ALS mouse models. PMID:24598527

Delayed Disease Onset and Extended Survival in the SOD1G93A Rat Model of Amyotrophic Lateral Sclerosis after Suppression of Mutant SOD1 in the Motor Cortex

PubMed Central

Thomsen, Gretchen M.; Gowing, Genevieve; Latter, Jessica; Chen, Maximus; Vit, Jean-Philippe; Staggenborg, Kevin; Avalos, Pablo; Alkaslasi, Mor; Ferraiuolo, Laura; Likhite, Shibi; Kaspar, Brian K.

2014-01-01

Sporadic amyotrophic lateral sclerosis (ALS) is a fatal disease with unknown etiology, characterized by a progressive loss of motor neurons leading to paralysis and death typically within 3–5 years of onset. Recently, there has been remarkable progress in understanding inherited forms of ALS in which well defined mutations are known to cause the disease. Rodent models in which the superoxide dismutase-1 (SOD1) mutation is overexpressed recapitulate hallmark signs of ALS in patients. Early anatomical changes in mouse models of fALS are seen in the neuromuscular junctions (NMJs) and lower motor neurons, and selective reduction of toxic mutant SOD1 in the spinal cord and muscle of these models has beneficial effects. Therefore, much of ALS research has focused on spinal motor neuron and NMJ aspects of the disease. Here we show that, in the SOD1G93A rat model of ALS, spinal motor neuron loss occurs presymptomatically and before degeneration of ventral root axons and denervation of NMJs. Although overt cell death of corticospinal motor neurons does not occur until disease endpoint, we wanted to establish whether the upper motor neuron might still play a critical role in disease progression. Surprisingly, the knockdown of mutant SOD1 in only the motor cortex of presymptomatic SOD1G93A rats through targeted delivery of AAV9–SOD1–shRNA resulted in a significant delay of disease onset, expansion of lifespan, enhanced survival of spinal motor neurons, and maintenance of NMJs. This datum suggests an early dysfunction and thus an important role of the upper motor neuron in this animal model of ALS and perhaps patients with the disease. PMID:25411487

Mitochondrial Dysfunction and Decrease in Body Weight of a Transgenic Knock-in Mouse Model for TDP-43*

PubMed Central

Stribl, Carola; Samara, Aladin; Trümbach, Dietrich; Peis, Regina; Neumann, Manuela; Fuchs, Helmut; Gailus-Durner, Valerie; Hrabě de Angelis, Martin; Rathkolb, Birgit; Wolf, Eckhard; Beckers, Johannes; Horsch, Marion; Neff, Frauke; Kremmer, Elisabeth; Koob, Sebastian; Reichert, Andreas S.; Hans, Wolfgang; Rozman, Jan; Klingenspor, Martin; Aichler, Michaela; Walch, Axel Karl; Becker, Lore; Klopstock, Thomas; Glasl, Lisa; Hölter, Sabine M.; Wurst, Wolfgang; Floss, Thomas

2014-01-01

The majority of amyotrophic lateral sclerosis (ALS) cases as well as many patients suffering from frontotemporal lobar dementia (FTLD) with ubiquitinated inclusion bodies show TDP-43 pathology, the protein encoded by the TAR DNA-binding protein (Tardbp) gene. We used recombinase-mediated cassette exchange to introduce an ALS patient cDNA into the mouse Tdp-43 locus. Expression levels of human A315T TDP-43 protein were 300% elevated in heterozygotes, whereas the endogenous mouse Tdp-43 was decreased to 20% of wild type levels as a result of disturbed feedback regulation. Heterozygous TDP-43A315TKi mutants lost 10% of their body weight and developed insoluble TDP-43 protein starting as early as 3 months after birth, a pathology that was exacerbated with age. We analyzed the splicing patterns of known Tdp-43 target genes as well as genome-wide gene expression levels in different tissues that indicated mitochondrial dysfunction. In heterozygous mutant animals, we observed a relative decrease in expression of Parkin (Park2) and the fatty acid transporter CD36 along with an increase in fatty acids, HDL cholesterol, and glucose in the blood. As seen in transmission electron microscopy, neuronal cells in motor cortices of TDP-43A315TKi animals had abnormal neuronal mitochondrial cristae formation. Motor neurons were reduced to 90%, but only slight motoric impairment was detected. The observed phenotype was interpreted as a predisease model, which might be valuable for the identification of further environmental or genetic triggers of neurodegeneration. PMID:24515116

eGFP expression under the Uchl1 promoter labels corticospinal motor neurons and a subpopulation of degeneration resistant spinal motor neurons in ALS mouse models

NASA Astrophysics Data System (ADS)

Yasvoina, Marina V.

Current understanding of basic cellular and molecular mechanisms for motor neuron vulnerability during motor neuron disease initiation and progression is incomplete. The complex cytoarchitecture and cellular heterogeneity of the cortex and spinal cord greatly impedes our ability to visualize, isolate, and study specific neuron populations in both healthy and diseased states. We generated a novel reporter line, the Uchl1-eGFP mouse, in which cortical and spinal components of motor neuron circuitry are genetically labeled with eGFP under the Uchl1 promoter. A series of cellular and anatomical analyses combined with retrograde labeling, molecular marker expression, and electrophysiology were employed to determine identity of eGFP expressing cells in the motor cortex and the spinal cord of novel Uchl1-eGFP reporter mice. We conclude that eGFP is expressed in corticospinal motor neurons (CSMN) in the motor cortex and a subset of S-type alpha and gamma spinal motor neurons (SMN) in the spinal cord. hSOD1G93A and Alsin-/- mice, mouse models for amyotrophic lateral sclerosis (ALS), were bred to Uchl1-eGFP reporter mouse line to investigate the pathophysiology and underlying mechanisms of CSMN degeneration in vivo. Evidence suggests early and progressive degeneration of CSMN and SMN in the hSOD1G93A transgenic mice. We show an early increase of autophagosome formation in the apical dendrites of vulnerable CSMN in hSOD1G93A-UeGFP mice, which is localized to the apical dendrites. In addition, labeling S-type alpha and gamma SMN in the hSOD1G93A-UeGFP mice provide a unique opportunity to study basis of their resistance to degeneration. Mice lacking alsin show moderate clinical phenotype and mild CSMN axon degeneration in the spinal cord, which suggests vulnerability of CSMN. Therefore, we investigated the CSMN cellular and axon defects in aged Alsin-/- mice bred to Uchl1-eGFP reporter mouse line. We show that while CSMN are preserved and lack signs of degeneration, CSMN axons are vulnerable and show significant loss.

Prehistoric and Historic Cultural Resources of Selected Sites at Harlan County Lake, Harlan County, Nebraska: Test Excavations and Determination of Significance for 28 Sites

DTIC Science & Technology

1987-01-01

mouse (P. maniculatus) (Guilday et al. 1977). This gives the anterior end of the ml a more acute appearance in the deer mouse. Zapus Princeps - The...heather vole 1 PrmyscA deer mouse 1 Zapus princeps western jumping mouse 1 cf. Mates p.nant fisher 1 total 29 lithic artifact 1 313 cliff. The lithology is...Clethrionomys gapperi southern red-backed vole 2 Phenacomrs intermedius heather vole 1 Zapus cf. princeps western jumping mouse 1 Bison cf. occidentalis

Repeated sense of hunger leads to the development of visceral obesity and metabolic syndrome in a mouse model.

PubMed

Han, Jong-Min; Kim, Hyeong-Geug; Lee, Jin-Seok; Choi, Min-Kyung; Kim, Young-Ae; Son, Chang-Gue

2014-01-01

Obesity-related disorders, especially metabolic syndrome, contribute to 2.8 million deaths each year worldwide, with significantly increasing morbidity. Eating at regular times and proper food quantity are crucial for maintaining a healthy status. However, many people in developed countries do not follow a regular eating schedule due to a busy lifestyle. Herein, we show that a repeated sense of hunger leads to a high risk of developing visceral obesity and metabolic syndrome in a mouse model (both 3-week and 6-week-old age, 10 mice in each group). The ad libitum (AL) group (normal eating pattern) and the food restriction (FR) group (alternate-day partially food restriction by given only 1/3 of average amount) were compared after 8-week experimental period. The total food consumption in the FR group was lower than in the AL group, however, the FR group showed a metabolic syndrome-like condition with significant fat accumulation in adipose tissues. Consequently, the repeated sense of hunger induced the typical characteristics of metabolic syndrome in an animal model; a distinct visceral obesity, hyperlipidemia, hyperglycemia and hepatic steatosis. Furthermore, we found that specifically leptin, a major metabolic hormone, played a major role in the development of these pathological disorders. Our study indicated the importance of regular eating habits besides controlling calorie intake.

Increased expression of microRNA-29a in ALS mice: functional analysis of its inhibition.

PubMed

Nolan, Katie; Mitchem, Mollie R; Jimenez-Mateos, Eva M; Henshall, David C; Concannon, Caoimhín G; Prehn, Jochen H M

2014-06-01

Endoplasmic reticulum (ER) stress has been implicated in a number of neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS). MicroRNAs are small ribonucleic acids which can modulate protein expression by binding to the 3'UTR of target mRNAs. We recently identified increased miR-29a expression in response to ER stress in neurons, with members of the miR-29 family implicated in cancer and neurodegeneration. We found high expression of miR-29a in the mouse brain and spinal cord by quantitative PCR analysis and increased expression of miR-29a in the spinal cord of SOD1(G93A) transgenic mice, a mouse model of familial ALS. In situ hybridisation experiments revealed increased miR-29a expression in the lumbar spinal cord of SOD1(G93A) transgenic mice from postnatal day 70 onward when compared to wild-type mice. miR-29a knockdown was achieved in the CNS in vivo after a single intracerebroventricular injection of a miR-29a-specific antagomir. While analysis of disease progression and motor function could not identify a significant alteration in ALS disease manifestations, a trend towards increased lifespan was observed in male SOD1(G93A) mice. These findings demonstrate that miR-29a may act as a marker for disease progression in SOD1(G93A) mice, and provide first proof-of-concept for a therapeutic modulation of miR-29a function in ALS.

Curcumin Mimics the Neurocognitive and Anti-Inflammatory Effects of Caloric Restriction in a Mouse Model of Midlife Obesity.

PubMed

Sarker, Marjana Rahman; Franks, Susan; Sumien, Nathalie; Thangthaeng, Nopporn; Filipetto, Frank; Forster, Michael

2015-01-01

Dietary curcumin was studied for its potential to decrease adiposity and reverse obesity- associated cognitive impairment in a mouse model of midlife sedentary obesity. We hypothesized that curcumin intake, by decreasing adiposity, would improve cognitive function in a manner comparable to caloric restriction (CR), a weight loss regimen. 15-month-old male C57BL/6 mice were assigned in groups to receive the following dietary regimens for 12 weeks: (i) a base diet (Ain93M) fed ad libitum (AL), (ii) the base diet restricted to 70% of ad libitum (CR) or (iii) the base diet containing curcumin fed AL (1000 mg/kg diet, CURAL). Blood markers of inflammation, interleukin 6 (IL-6) and C-reactive protein (CRP), as well as an indicator of redox stress (GSH: GSSG ratio), were determined at different time points during the treatments, and visceral and subcutaneous adipose tissue were measured upon completion of the experiment. After 8 weeks of dietary treatment, the mice were tested for spatial cognition (Morris water maze) and cognitive flexibility (discriminated active avoidance). The CR group showed significant weight loss and reduced adiposity, whereas CURAL mice had stable weight throughout the experiment, consumed more food than the AL group, with no reduction of adiposity. However, both CR and CURAL groups took fewer trials than AL to reach criterion during the reversal sessions of the active avoidance task, suggesting an improvement in cognitive flexibility. The AL mice had higher levels of CRP compared to CURAL and CR, and GSH as well as the GSH: GSSG ratio were increased during curcumin intake, suggesting a reducing shift in the redox state. The results suggest that, independent of their effects on adiposity; dietary curcumin and caloric restriction have positive effects on frontal cortical functions that could be linked to anti-inflammatory or antioxidant actions.

Characterization of neurophysiological and behavioral changes, MRI brain volumetry and 1H MRS in zQ175 knock-in mouse model of Huntington's disease.

PubMed

Heikkinen, Taneli; Lehtimäki, Kimmo; Vartiainen, Nina; Puoliväli, Jukka; Hendricks, Susan J; Glaser, Jack R; Bradaia, Amyaouch; Wadel, Kristian; Touller, Chrystelle; Kontkanen, Outi; Yrjänheikki, Juha M; Buisson, Bruno; Howland, David; Beaumont, Vahri; Munoz-Sanjuan, Ignacio; Park, Larry C

2012-01-01

Huntington's disease (HD) is an autosomal neurodegenerative disorder, characterized by severe behavioral, cognitive, and motor deficits. Since the discovery of the huntingtin gene (HTT) mutation that causes the disease, several mouse lines have been developed using different gene constructs of Htt. Recently, a new model, the zQ175 knock-in (KI) mouse, was developed (see description by Menalled et al, [1]) in an attempt to have the Htt gene in a context and causing a phenotype that more closely mimics HD in humans. Here we confirm the behavioral phenotypes reported by Menalled et al [1], and extend the characterization to include brain volumetry, striatal metabolite concentration, and early neurophysiological changes. The overall reproducibility of the behavioral phenotype across the two independent laboratories demonstrates the utility of this new model. Further, important features reminiscent of human HD pathology are observed in zQ175 mice: compared to wild-type neurons, electrophysiological recordings from acute brain slices reveal that medium spiny neurons from zQ175 mice display a progressive hyperexcitability; glutamatergic transmission in the striatum is severely attenuated; decreased striatal and cortical volumes from 3 and 4 months of age in homo- and heterozygous mice, respectively, with whole brain volumes only decreased in homozygotes. MR spectroscopy reveals decreased concentrations of N-acetylaspartate and increased concentrations of glutamine, taurine and creatine + phosphocreatine in the striatum of 12-month old homozygotes, the latter also measured in 12-month-old heterozygotes. Motor, behavioral, and cognitive deficits in homozygotes occur concurrently with the structural and metabolic changes observed. In sum, the zQ175 KI model has robust behavioral, electrophysiological, and histopathological features that may be valuable in both furthering our understanding of HD-like pathophyisology and the evaluation of potential therapeutic strategies to slow the progression of disease.

Cdk2 Phosphorylation on Threonine39 by AKT and Its Implication on Cyclin Binding, Cellular Localization, and Cell Cycle Progression

DTIC Science & Technology

2008-10-01

cell cycle progression in most cell types. Mouse embryos develop normally until mid gestation without all interphase Cdks 28. Pertinent to the...Ciemerych and P. Sicinski, "Cell cycle in mouse development ," 24(17), 2877 (2005). Ref Type: Journal 5 K. Coulonval, et al., "Phosphorylations of...34 Development 135(20), 3389 (2008). Ref Type: Journal 30 J. P. Tassan, et al., "Cell cycle analysis of the activity, subcellular localization, and subunit

Enteric oxalate elimination is induced and oxalate is normalized in a mouse model of primary hyperoxaluria following intestinal colonization with Oxalobacter

PubMed Central

Gjymishka, Altin; Salido, Eduardo C.; Allison, Milton J.; Freel, Robert W.

2011-01-01

Oxalobacter colonization of rat intestine was previously shown to promote enteric oxalate secretion and elimination, leading to significant reductions in urinary oxalate excretion (Hatch et al. Kidney Int 69: 691–698, 2006). The main goal of the present study, using a mouse model of primary hyperoxaluria type 1 (PH1), was to test the hypothesis that colonization of the mouse gut by Oxalobacter formigenes could enhance enteric oxalate secretion and effectively reduce the hyperoxaluria associated with this genetic disease. Wild-type (WT) mice and mice deficient in liver alanine-glyoxylate aminotransferase (Agxt) exhibiting hyperoxalemia and hyperoxaluria were used in these studies. We compared the unidirectional and net fluxes of oxalate across isolated, short-circuited large intestine of artificially colonized and noncolonized mice. In addition, plasma and urinary oxalate was determined. Our results demonstrate that the cecum and distal colon contribute significantly to enteric oxalate excretion in Oxalobacter-colonized Agxt and WT mice. In colonized Agxt mice, urinary oxalate excretion was reduced 50% (to within the normal range observed for WT mice). Moreover, plasma oxalate concentrations in Agxt mice were also normalized (reduced 50%). Colonization of WT mice was also associated with marked (up to 95%) reductions in urinary oxalate excretion. We conclude that segment-specific effects of Oxalobacter on intestinal oxalate transport in the PH1 mouse model are associated with a normalization of plasma oxalate and urinary oxalate excretion in otherwise hyperoxalemic and hyperoxaluric animals. PMID:21163900

Nuclear Receptors in Neurodegenerative Diseases

PubMed Central

Skerrett, Rebecca; Malm, Tarja; Landreth, Gary

2014-01-01

Nuclear receptors have generated substantial interest in the past decade as potential therapeutic targets for the treatment of neurodegenerative disorders. Despite years of effort, effective treatments for progressive neurodegenerative diseases such as Alzheimer’s disease, Parkinson’s disease, Huntington’s disease and ALS remain elusive, making non-classical drug targets such as nuclear receptors an attractive alternative. A substantial literature in mouse models of disease and several clinical trials have investigated the role of nuclear receptors in various neurodegenerative disorders, most prominently AD. These studies have met with mixed results, yet the majority of studies in mouse models report positive outcomes. The mechanisms by which nuclear receptor agonists affect disease pathology remain unclear. Deciphering the complex signaling underlying nuclear receptor action in neurodegenerative diseases is essential for understanding this variability in preclinical studies, and for the successful translation of nuclear receptor agonists into clinical therapies. PMID:24874548

Photons for Therapy: Targeted Photodynamic Therapy for Infected and Contaminated Wounds

DTIC Science & Technology

2004-09-01

caused by Staphylococcus aureus that had been allowed to grow in abscesses below the skin. Conjugate injected into the infected area together with...16] these authors showed that several strains responsible for periodontal disease were efficiently inactivated by visible light irradiation in the...counting. Rocchetta et al studied the growth of bioluminescent E. coli in the neutropenic mouse-thigh abscess model of infection [25]. They found that

Injury, inflammation and the emergence of human specific genes

DTIC Science & Technology

2016-07-12

genes in circulating and resident human immune cells can be studied in mice after the transplantation and engraft- ment of human hemato- lymphoid immune...Martinek J, Strowig T, Gearty SV, Teichmann LL, et al. Development and function of human innate immune cells in a humanized mouse model. Nat Bio...normal wound repair and regeneration, we hypothesize that the preponderance of human-specific genes expressed in human inflammatory cells is commensurate

Shared Resistance to Aging and ALS in Neuromuscular Junctions of Specific Muscles

PubMed Central

Valdez, Gregorio; Tapia, Juan C.; Lichtman, Jeff W.; Fox, Michael A.; Sanes, Joshua R.

2012-01-01

Normal aging and neurodegenerative diseases both lead to structural and functional alterations in synapses. Comparison of synapses that are generally similar but respond differently to insults could provide the basis for discovering mechanisms that underlie susceptibility or resistance to damage. Here, we analyzed skeletal neuromuscular junctions (NMJs) in 16 mouse muscles to seek such differences. We find that muscles respond in one of three ways to aging. In some, including most limb and trunk muscles, age-related alterations to NMJs are progressive and extensive during the second postnatal year. NMJs in other muscles, such as extraocular muscles, are strikingly resistant to change. A third set of muscles, including several muscles of facial expression and the external anal sphinter, succumb to aging but not until the third postnatal year. We asked whether susceptible and resistant muscles differed in rostrocaudal or proximodistal position, source of innervation, motor unit size, or fiber type composition. Of these factors, muscle innervation by brainstem motor neurons correlated best with resistance to age-related decline. Finally, we compared synaptic alterations in normally aging muscles to those in a mouse model of amyotrophic lateral sclerosis (ALS). Patterns of resistance and susceptibility were strikingly correlated in the two conditions. Moreover, damage to NMJs in aged muscles correlated with altered expression and distribution of CRMP4a and TDP-43, which are both altered in motor neurons affected by ALS. Together, these results reveal novel structural, regional and molecular parallels between aging and ALS. PMID:22485182

Intron retention and nuclear loss of SFPQ are molecular hallmarks of ALS.

PubMed

Luisier, Raphaelle; Tyzack, Giulia E; Hall, Claire E; Mitchell, Jamie S; Devine, Helen; Taha, Doaa M; Malik, Bilal; Meyer, Ione; Greensmith, Linda; Newcombe, Jia; Ule, Jernej; Luscombe, Nicholas M; Patani, Rickie

2018-05-22

Mutations causing amyotrophic lateral sclerosis (ALS) strongly implicate ubiquitously expressed regulators of RNA processing. To understand the molecular impact of ALS-causing mutations on neuronal development and disease, we analysed transcriptomes during in vitro differentiation of motor neurons (MNs) from human control and patient-specific VCP mutant induced-pluripotent stem cells (iPSCs). We identify increased intron retention (IR) as a dominant feature of the splicing programme during early neural differentiation. Importantly, IR occurs prematurely in VCP mutant cultures compared with control counterparts. These aberrant IR events are also seen in independent RNAseq data sets from SOD1- and FUS-mutant MNs. The most significant IR is seen in the SFPQ transcript. The SFPQ protein binds extensively to its retained intron, exhibits lower nuclear abundance in VCP mutant cultures and is lost from nuclei of MNs in mouse models and human sporadic ALS. Collectively, we demonstrate SFPQ IR and nuclear loss as molecular hallmarks of familial and sporadic ALS.

Cerebellar Directed Optogenetic Intervention Inhibits Spontaneous Hippocampal Seizures in a Mouse Model of Temporal Lobe Epilepsy1 2

PubMed Central

Szabo, Gergely G.; Armstrong, Caren; Oijala, Mikko; Soltesz, Ivan

2014-01-01

Abstract Cover Figure Krook-Magnuson et al. report a bidirectional functional connectivity between the hippocampus and the cerebellum in a mouse model of temporal lobe epilepsy, and demonstrate that cerebellar directed on-demand optogenetic intervention can stop seizures recorded from the hippocampus. Temporal lobe epilepsy is often medically refractory and new targets for intervention are needed. We used a mouse model of temporal lobe epilepsy, on-line seizure detection, and responsive optogenetic intervention to investigate the potential for cerebellar control of spontaneous temporal lobe seizures. Cerebellar targeted intervention inhibited spontaneous temporal lobe seizures during the chronic phase of the disorder. We further report that the direction of modulation as well as the location of intervention within the cerebellum can affect the outcome of intervention. Specifically, on-demand optogenetic excitation or inhibition of parvalbumin-expressing neurons, including Purkinje cells, in the lateral or midline cerebellum results in a decrease in seizure duration. In contrast, a consistent reduction in spontaneous seizure frequency occurs uniquely with on-demand optogenetic excitation of the midline cerebellum, and was not seen with intervention directly targeting the hippocampal formation. These findings demonstrate that the cerebellum is a powerful modulator of temporal lobe epilepsy, and that intervention targeting the cerebellum as a potential therapy for epilepsy should be revisited. PMID:25599088

Autoimmune Myocarditis, Valvulitis, and Cardiomyopathy

PubMed Central

Myers, Jennifer M.; Cunningham, Madeleine W.; Fairweather, DeLisa; Huber, Sally A.

2013-01-01

Cardiac myosin-induced autoimmune myocarditis (EAM) is a model of inflammatory heart disease initiated by CD4+ T cells (Smith and Allen 1991; Li, Heuser et al. 2004). It is a paradigm of the immune-mediated cardiac damage believed to play a role in the pathogenesis of a subset of postinfectious human cardiomyopathies (Rose, Herskowitz et al. 1993). Myocarditis is induced in susceptible mice by immunization with purified cardiac myosin (Neu, Rose et al. 1987) or specific peptides derived from cardiac myosin (Donermeyer, Beisel et al. 1995; Pummerer, Luze et al. 1996) (see Basic Protocol 1), or by adoptive transfer of myosin-reactive T cells (Smith and Allen 1991) (see Alternate Protocol). Myocarditis has been induced in Lewis rats by immunization with purified rat or porcine cardiac myosin (Kodama, Matsumoto et al. 1990; Li, Heuser et al. 2004) (see Basic Protocol 2) or S2-16 peptide (Li, Heuser et al. 2004), or by adoptive transfer of T cells stimulated by specific peptides derived from cardiac myosin (Wegmann, Zhao et al. 1994). Myocarditis begins 12 to 14 days after the first immunization, and is maximal after 21 days. Other animal models commonly used to study myocarditis development include the pathogen-induced models in which disease is initiated by viral infection. The first murine model of acute viral myocarditis causes sudden death via viral damage to cardiomyocytes (Huber, Gauntt et al. 1998; Horwitz, La Cava et al. 2000; Fong 2003; Fuse, Chan et al. 2005; Fairweather and Rose 2007; Cihakova and Rose 2008) whereas the second model is based on inoculation with heart-passaged coxsackievirus B3 (CVB3) that includes damaged heart proteins (Fairweather, Frisancho-Kiss et al. 2004; Fairweather D 2004; Fairweather and Rose 2007; Cihakova and Rose 2008) In addition to the protocols used to induce EAM in mice and rats, support protocols are included for preparing purified cardiac myosin using mouse or rat heart tissue (see Support Protocol 1), preparing purified cardiac myosin for injection (see Support Protocol 2), and collecting and assessing hearts by histopathological means (see Support Protocol 3). PMID:23564686

A neuroprotective astrocyte state is induced by neuronal signal EphB1 but fails in ALS models.

PubMed

Tyzack, Giulia E; Hall, Claire E; Sibley, Christopher R; Cymes, Tomasz; Forostyak, Serhiy; Carlino, Giulia; Meyer, Ione F; Schiavo, Giampietro; Zhang, Su-Chun; Gibbons, George M; Newcombe, Jia; Patani, Rickie; Lakatos, András

2017-10-27

Astrocyte responses to neuronal injury may be beneficial or detrimental to neuronal recovery, but the mechanisms that determine these different responses are poorly understood. Here we show that ephrin type-B receptor 1 (EphB1) is upregulated in injured motor neurons, which in turn can activate astrocytes through ephrin-B1-mediated stimulation of signal transducer and activator of transcription-3 (STAT3). Transcriptional analysis shows that EphB1 induces a protective and anti-inflammatory signature in astrocytes, partially linked to the STAT3 network. This is distinct from the response evoked by interleukin (IL)-6 that is known to induce both pro inflammatory and anti-inflammatory processes. Finally, we demonstrate that the EphB1-ephrin-B1 pathway is disrupted in human stem cell derived astrocyte and mouse models of amyotrophic lateral sclerosis (ALS). Our work identifies an early neuronal help-me signal that activates a neuroprotective astrocytic response, which fails in ALS, and therefore represents an attractive therapeutic target.

Cloning and characterization of the mouse XPAC gene.

PubMed Central

van Oostrom, C T; de Vries, A; Verbeek, S J; van Kreijl, C F; van Steeg, H

1994-01-01

Xeroderma Pigmentosum is a human disease, which is, among others, characterized by a high incidence of (sunlight induced) skin cancer, due to a defect in nucleotide excision repair (NER). The human DNA repair gene XPAC corrects this defect in cells isolated from Xeroderma Pigmentosum complementation group A (XP-A) patients. To enable the development of a transgenic mouse model for XP-A by gene targeting in embryonic stem cells, we cloned and characterized the mouse homologue of the XPAC gene. The mouse XPAC gene was found to consist of 6 exons, spanning approximately 21 kb. The nucleotide sequence of the exons is identical to that of the also cloned the mouse XPAC cDNA. Furthermore, the deduced amino acid sequence of the XPAC protein is the same as the one published previously by Tanaka et al. From CAT assay analysis, the promoter of the XPAC gene appeared to be located within 313 bp upstream of the assumed transcriptional start site. Like the promoters of other eukaryotic DNA repair genes (i.e. ERCC-1 and XPBC/ERCC-3), the mouse XPAC promoter region lacks classical promoter elements like TATA-, GC- and CAAT boxes. However, it contains an unique polypyrimidine-rich box, which is so far only found in genes encoding DNA repair enzymes. The function of this box in the regulation of transcription is still unclear. PMID:8127648

Morphological Characteristics of Motor Neurons Do Not Determine Their Relative Susceptibility to Degeneration in a Mouse Model of Severe Spinal Muscular Atrophy

PubMed Central

Mutsaers, Chantal A.; Thomson, Derek; Hamilton, Gillian; Parson, Simon H.; Gillingwater, Thomas H.

2012-01-01

Spinal muscular atrophy (SMA) is a leading genetic cause of infant mortality, resulting primarily from the degeneration and loss of lower motor neurons. Studies using mouse models of SMA have revealed widespread heterogeneity in the susceptibility of individual motor neurons to neurodegeneration, but the underlying reasons remain unclear. Data from related motor neuron diseases, such as amyotrophic lateral sclerosis (ALS), suggest that morphological properties of motor neurons may regulate susceptibility: in ALS larger motor units innervating fast-twitch muscles degenerate first. We therefore set out to determine whether intrinsic morphological characteristics of motor neurons influenced their relative vulnerability to SMA. Motor neuron vulnerability was mapped across 10 muscle groups in SMA mice. Neither the position of the muscle in the body, nor the fibre type of the muscle innervated, influenced susceptibility. Morphological properties of vulnerable and disease-resistant motor neurons were then determined from single motor units reconstructed in Thy.1-YFP-H mice. None of the parameters we investigated in healthy young adult mice – including motor unit size, motor unit arbor length, branching patterns, motor endplate size, developmental pruning and numbers of terminal Schwann cells at neuromuscular junctions - correlated with vulnerability. We conclude that morphological characteristics of motor neurons are not a major determinant of disease-susceptibility in SMA, in stark contrast to related forms of motor neuron disease such as ALS. This suggests that subtle molecular differences between motor neurons, or extrinsic factors arising from other cell types, are more likely to determine relative susceptibility in SMA. PMID:23285108

Insights from Human/Mouse genome comparisons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pennacchio, Len A.

2003-03-30

Large-scale public genomic sequencing efforts have provided a wealth of vertebrate sequence data poised to provide insights into mammalian biology. These include deep genomic sequence coverage of human, mouse, rat, zebrafish, and two pufferfish (Fugu rubripes and Tetraodon nigroviridis) (Aparicio et al. 2002; Lander et al. 2001; Venter et al. 2001; Waterston et al. 2002). In addition, a high-priority has been placed on determining the genomic sequence of chimpanzee, dog, cow, frog, and chicken (Boguski 2002). While only recently available, whole genome sequence data have provided the unique opportunity to globally compare complete genome contents. Furthermore, the shared evolutionary ancestrymore » of vertebrate species has allowed the development of comparative genomic approaches to identify ancient conserved sequences with functionality. Accordingly, this review focuses on the initial comparison of available mammalian genomes and describes various insights derived from such analysis.« less

Cloning of apg-2 encoding a novel member of heat shock protein 110 family.

PubMed

Kaneko, Y; Kimura, T; Kishishita, M; Noda, Y; Fujita, J

1997-04-11

Chinese hamster heat shock protein 110-encoding gene (hsp110), mouse apg-1 and human hsp70RY are structurally related genes, with the first two encoding about 110-kDa HSPs [Yoon et al. (1995) J. Biol. Chem. 270, 15725-15733; Kaneko et al. (1997) J. Biol. Chem., in press; Fathallah et al. (1993) J. Immunol. 151, 810-813]. Using apg-1 cDNA as a probe, we isolated a novel cDNA, apg-2 from a mouse testis cDNA library, which was highly homologous to human hsp70RY. However, the predicted amino acid (aa) sequence of APG-2 was longer (841 aa) than that of HSP70RY (701 aa) and comparable to those of HSP110 and APG-1. Northern blot analysis revealed that the expression of apg-2 transcripts was ubiquitous in various mouse tissues, and most abundant in the testis and ovary. While induction of hsp70 transcripts was observed in mouse TAMA26 Sertoli cells and NIH/3T3 fibroblasts on temperature shift from 37 degrees C to 42 degrees C (traditional heat shock) or from 32 degrees C to 39 degrees C, apg-2 transcripts were not induced under either condition. These results suggest that apg-2 is an isoform of mouse homolog of hsp70RY, but that it belongs to the hsp110 family instead of hsp70 family, and that it plays a role under non-stress conditions.

RDH13L, an enzyme responsible for the aldehyde-alcohol redox coupling reaction (AL-OL coupling reaction) to supply 11-cis retinal in the carp cone retinoid cycle.

PubMed

Sato, Shinya; Miyazono, Sadaharu; Tachibanaki, Shuji; Kawamura, Satoru

2015-01-30

Cone photoreceptors require effective pigment regeneration mechanisms to maintain their sensitivity in the light. Our previous studies in carp cones suggested the presence of an unconventional and very effective mechanism to produce 11-cis retinal, the necessary component in pigment regeneration. In this reaction (aldehyde-alcohol redox coupling reaction, AL-OL coupling reaction), formation of 11-cis retinal, i.e. oxidation of 11-cis retinol is coupled to reduction of an aldehyde at a 1:1 molar ratio without exogenous NADP(H) which is usually required in this kind of reaction. Here, we identified carp retinol dehydrogenase 13-like (RDH13L) as an enzyme catalyzing the AL-OL coupling reaction. RDH13L was partially purified from purified carp cones, identified as a candidate protein, and its AL-OL coupling activity was confirmed using recombinant RDH13L. We further examined the substrate specificity, subcellular localization, and expression level of RDH13L. Based on these results, we concluded that RDH13L contributes to a significant part, but not all, of the AL-OL coupling activity in carp cones. RDH13L contained tightly bound NADP(+) which presumably functions as a cofactor in the reaction. Mouse RDH14, a mouse homolog of carp RDH13L, also showed the AL-OL coupling activity. Interestingly, although carp cone membranes, carp RDH13L and mouse RDH14 all showed the coupling activity at 15-37 °C, they also showed a conventional NADP(+)-dependent 11-cis retinol oxidation activity above 25 °C without addition of aldehydes. This dual mechanism of 11-cis retinal synthesis attained by carp RDH13L and mouse RDH14 probably contribute to effective pigment regeneration in cones that function in the light. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Tumor-Selective Targeting of Androgen Receptor Expression by Novel Small-Molecule Agents

DTIC Science & Technology

2013-05-01

Uro - genital...Mouse ID 310 315 316 322 331 302 307 309 318 333 PCNA β-Actin Mouse ID PCNA β-Actin OSU-CG5 CG5Ctl CG5 Ctl P = 0.002 Control D o rs al lo b e % R el...e xp re ss io n % C el ls im m u n o re ac ti ve fo r K i6 7 L at er al lo b e OSU-CG5 DP * * * * *P < 0.05 LP VP AP Figure 3.

Bacteria on External Fixators: Which Prep is Best?

DTIC Science & Technology

2012-01-01

aureus (lux). After 12 hours in the broth, a sufficient time to allow biofilm formation ,11 the constructs were individually removed and baseline imaging...difference when cleansing components consisting of stainless steel and alumi- num.15–17 We also found that a simulated external fixator adjustment exposed...Albert E, et al. Direct continuous method for monitoring biofilm infection in a mouse model. Infect Immun. 2003;71: 882–890. 11. Charles CA, Ricotti CA

Salvaging hope: Is increasing NAD(+) a key to treating mitochondrial myopathy?

PubMed

Lightowlers, Robert N; Chrzanowska-Lightowlers, Zofia M A

2014-06-01

Mitochondrial diseases can arise from mutations either in mitochondrial DNA or in nuclear DNA encoding mitochondrially destined proteins. Currently, there is no cure for these diseases although treatments to ameliorate a subset of the symptoms are being developed. In this issue of EMBO Molecular Medicine, Khan et al (2014) use a mouse model to test the efficacy of a simple dietary supplement of nicotinamide riboside to treat and prevent mitochondrial myopathies.

One universal common endpoint in mouse models of amyotrophic lateral sclerosis.

PubMed

Solomon, Jesse A; Tarnopolsky, Mark A; Hamadeh, Mazen J

2011-01-01

There is no consensus among research laboratories around the world on the criteria that define endpoint in studies involving rodent models of amyotrophic lateral sclerosis (ALS). Data from 4 nutrition intervention studies using 162 G93A mice, a model of ALS, were analyzed to determine if differences exist between the following endpoint criteria: CS 4 (functional paralysis of both hindlimbs), CS 4+ (CS 4 in addition to the earliest age of body weight loss, body condition deterioration or righting reflex), and CS 5 (CS 4 plus righting reflex >20 s). The age (d; mean ± SD) at which mice reached endpoint was recorded as the unit of measurement. Mice reached CS 4 at 123.9±10.3 d, CS 4+ at 126.6±9.8 d and CS 5 at 127.6±9.8 d, all significantly different from each other (P<0.001). There was a significant positive correlation between CS 4 and CS 5 (r = 0.95, P<0.001), CS 4 and CS 4+ (r = 0.96, P<0.001), and CS 4+ and CS 5 (r = 0.98, P<0.001), with the Bland-Altman plot showing an acceptable bias between all endpoints. Logrank tests showed that mice reached CS 4 24% and 34% faster than CS 4+ (P = 0.046) and CS 5 (P = 0.006), respectively. Adopting CS 4 as endpoint would spare a mouse an average of 4 days (P<0.001) from further neuromuscular disability and poor quality of life compared to CS 5. Alternatively, CS 5 provides information regarding proprioception and severe motor neuron death, both could be important parameters in establishing the efficacy of specific treatments. Converging ethics and discovery, would adopting CS 4 as endpoint compromise the acquisition of insight about the effects of interventions in animal models of ALS?

Generation of gene-targeted mice using embryonic stem cells derived from a transgenic mouse model of Alzheimer's disease.

PubMed

Yamamoto, Satoshi; Ooshima, Yuki; Nakata, Mitsugu; Yano, Takashi; Matsuoka, Kunio; Watanabe, Sayuri; Maeda, Ryouta; Takahashi, Hideki; Takeyama, Michiyasu; Matsumoto, Yoshio; Hashimoto, Tadatoshi

2013-06-01

Gene-targeting technology using mouse embryonic stem (ES) cells has become the "gold standard" for analyzing gene functions and producing disease models. Recently, genetically modified mice with multiple mutations have increasingly been produced to study the interaction between proteins and polygenic diseases. However, introduction of an additional mutation into mice already harboring several mutations by conventional natural crossbreeding is an extremely time- and labor-intensive process. Moreover, to do so in mice with a complex genetic background, several years may be required if the genetic background is to be retained. Establishing ES cells from multiple-mutant mice, or disease-model mice with a complex genetic background, would offer a possible solution. Here, we report the establishment and characterization of novel ES cell lines from a mouse model of Alzheimer's disease (3xTg-AD mouse, Oddo et al. in Neuron 39:409-421, 2003) harboring 3 mutated genes (APPswe, TauP301L, and PS1M146V) and a complex genetic background. Thirty blastocysts were cultured and 15 stable ES cell lines (male: 11; female: 4) obtained. By injecting these ES cells into diploid or tetraploid blastocysts, we generated germline-competent chimeras. Subsequently, we confirmed that F1 mice derived from these animals showed similar biochemical and behavioral characteristics to the original 3xTg-AD mice. Furthermore, we introduced a gene-targeting vector into the ES cells and successfully obtained gene-targeted ES cells, which were then used to generate knockout mice for the targeted gene. These results suggest that the present methodology is effective for introducing an additional mutation into mice already harboring multiple mutated genes and/or a complex genetic background.

Vitamin K supplementation increases vitamin K tissue levels but fails to counteract ectopic calcification in a mouse model for pseudoxanthoma elasticum.

PubMed

Gorgels, Theo G M F; Waarsing, Jan H; Herfs, Marjolein; Versteeg, Daniëlle; Schoensiegel, Frank; Sato, Toshiro; Schlingemann, Reinier O; Ivandic, Boris; Vermeer, Cees; Schurgers, Leon J; Bergen, Arthur A B

2011-11-01

Pseudoxanthoma elasticum (PXE) is an autosomal recessive disorder in which calcification of connective tissue leads to pathology in skin, eye and blood vessels. PXE is caused by mutations in ABCC6. High expression of this transporter in the basolateral hepatocyte membrane suggests that it secretes an as-yet elusive factor into the circulation which prevents ectopic calcification. Utilizing our Abcc6 (-/-) mouse model for PXE, we tested the hypothesis that this factor is vitamin K (precursor) (Borst et al. 2008, Cell Cycle). For 3 months, Abcc6 (-/-) and wild-type mice were put on diets containing either the minimum dose of vitamin K required for normal blood coagulation or a dose that was 100 times higher. Vitamin K was supplied as menaquinone-7 (MK-7). Ectopic calcification was monitored in vivo by monthly micro-CT scans of the snout, as the PXE mouse model develops a characteristic connective tissue mineralization at the base of the whiskers. In addition, calcification of kidney arteries was measured by histology. Results show that supplemental MK-7 had no effect on ectopic calcification in Abcc6 ( -/- ) mice. MK-7 supplementation increased vitamin K levels (in skin, heart and brain) in wild-type and in Abcc6 (-/-) mice. Vitamin K tissue levels did not depend on Abcc6 genotype. In conclusion, dietary MK-7 supplementation increased vitamin K tissue levels in the PXE mouse model but failed to counteract ectopic calcification. Hence, we obtained no support for the hypothesis that Abcc6 transports vitamin K and that PXE can be cured by increasing tissue levels of vitamin K.

Metabolic Reprogramming in Amyotrophic Lateral Sclerosis.

PubMed

Szelechowski, M; Amoedo, N; Obre, E; Léger, C; Allard, L; Bonneu, M; Claverol, S; Lacombe, D; Oliet, S; Chevallier, S; Le Masson, G; Rossignol, R

2018-03-02

Mitochondrial dysfunction in the spinal cord is a hallmark of amyotrophic lateral sclerosis (ALS), but the neurometabolic alterations during early stages of the disease remain unknown. Here, we investigated the bioenergetic and proteomic changes in ALS mouse motor neurons and patients' skin fibroblasts. We first observed that SODG93A mice presymptomatic motor neurons display alterations in the coupling efficiency of oxidative phosphorylation, along with fragmentation of the mitochondrial network. The proteome of presymptomatic ALS mice motor neurons also revealed a peculiar metabolic signature with upregulation of most energy-transducing enzymes, including the fatty acid oxidation (FAO) and the ketogenic components HADHA and ACAT2, respectively. Accordingly, FAO inhibition altered cell viability specifically in ALS mice motor neurons, while uncoupling protein 2 (UCP2) inhibition recovered cellular ATP levels and mitochondrial network morphology. These findings suggest a novel hypothesis of ALS bioenergetics linking FAO and UCP2. Lastly, we provide a unique set of data comparing the molecular alterations found in human ALS patients' skin fibroblasts and SODG93A mouse motor neurons, revealing conserved changes in protein translation, folding and assembly, tRNA aminoacylation and cell adhesion processes.

Changes in the Excitability of Neocortical Neurons in a Mouse Model of Amyotrophic Lateral Sclerosis Are Not Specific to Corticospinal Neurons and Are Modulated by Advancing Disease.

PubMed

Kim, Juhyun; Hughes, Ethan G; Shetty, Ashwin S; Arlotta, Paola; Goff, Loyal A; Bergles, Dwight E; Brown, Solange P

2017-09-13

Cell type-specific changes in neuronal excitability have been proposed to contribute to the selective degeneration of corticospinal neurons in amyotrophic lateral sclerosis (ALS) and to neocortical hyperexcitability, a prominent feature of both inherited and sporadic variants of the disease, but the mechanisms underlying selective loss of specific cell types in ALS are not known. We analyzed the physiological properties of distinct classes of cortical neurons in the motor cortex of hSOD1 G93A mice of both sexes and found that they all exhibit increases in intrinsic excitability that depend on disease stage. Targeted recordings and in vivo calcium imaging further revealed that neurons adapt their functional properties to normalize cortical excitability as the disease progresses. Although different neuron classes all exhibited increases in intrinsic excitability, transcriptional profiling indicated that the molecular mechanisms underlying these changes are cell type specific. The increases in excitability in both excitatory and inhibitory cortical neurons show that selective dysfunction of neuronal cell types cannot account for the specific vulnerability of corticospinal motor neurons in ALS. Furthermore, the stage-dependent alterations in neuronal function highlight the ability of cortical circuits to adapt as disease progresses. These findings show that both disease stage and cell type must be considered when developing therapeutic strategies for treating ALS. SIGNIFICANCE STATEMENT It is not known why certain classes of neurons preferentially die in different neurodegenerative diseases. It has been proposed that the enhanced excitability of affected neurons is a major contributor to their selective loss. We show using a mouse model of amyotrophic lateral sclerosis (ALS), a disease in which corticospinal neurons exhibit selective vulnerability, that changes in excitability are not restricted to this neuronal class and that excitability does not increase monotonically with disease progression. Moreover, although all neuronal cell types tested exhibited abnormal functional properties, analysis of their gene expression demonstrated cell type-specific responses to the ALS-causing mutation. These findings suggest that therapies for ALS may need to be tailored for different cell types and stages of disease. Copyright © 2017 the authors 0270-6474/17/379038-17$15.00/0.

Delayed disease onset and extended survival in the SOD1G93A rat model of amyotrophic lateral sclerosis after suppression of mutant SOD1 in the motor cortex.

PubMed

Thomsen, Gretchen M; Gowing, Genevieve; Latter, Jessica; Chen, Maximus; Vit, Jean-Philippe; Staggenborg, Kevin; Avalos, Pablo; Alkaslasi, Mor; Ferraiuolo, Laura; Likhite, Shibi; Kaspar, Brian K; Svendsen, Clive N

2014-11-19

Sporadic amyotrophic lateral sclerosis (ALS) is a fatal disease with unknown etiology, characterized by a progressive loss of motor neurons leading to paralysis and death typically within 3-5 years of onset. Recently, there has been remarkable progress in understanding inherited forms of ALS in which well defined mutations are known to cause the disease. Rodent models in which the superoxide dismutase-1 (SOD1) mutation is overexpressed recapitulate hallmark signs of ALS in patients. Early anatomical changes in mouse models of fALS are seen in the neuromuscular junctions (NMJs) and lower motor neurons, and selective reduction of toxic mutant SOD1 in the spinal cord and muscle of these models has beneficial effects. Therefore, much of ALS research has focused on spinal motor neuron and NMJ aspects of the disease. Here we show that, in the SOD1(G93A) rat model of ALS, spinal motor neuron loss occurs presymptomatically and before degeneration of ventral root axons and denervation of NMJs. Although overt cell death of corticospinal motor neurons does not occur until disease endpoint, we wanted to establish whether the upper motor neuron might still play a critical role in disease progression. Surprisingly, the knockdown of mutant SOD1 in only the motor cortex of presymptomatic SOD1(G93A) rats through targeted delivery of AAV9-SOD1-shRNA resulted in a significant delay of disease onset, expansion of lifespan, enhanced survival of spinal motor neurons, and maintenance of NMJs. This datum suggests an early dysfunction and thus an important role of the upper motor neuron in this animal model of ALS and perhaps patients with the disease. Copyright © 2014 the authors 0270-6474/14/3415587-14$15.00/0.

REDOX DISRUPTING POTENTIAL OF TOXCAST CHEMICALS RANKED BY ACTIVITY IN MOUSE EMBRYONIC STEM CELLS

EPA Science Inventory

To gain insight regarding the adverse outcome pathways leading to developmental toxicity following exposure to chemicals, we evaluated ToxCast™ Phase I chemicals in an adherent mouse embryonic stem cell (mESC) assay and identified a redox sensitive pathway that correlated with al...

Bioenergetic Defects and Oxidative Damage in Transgenic Mouse Models of Neurodegenerative Disorders

DTIC Science & Technology

2003-05-01

transport chain enzyme activities in G93A ALS mice at 60 and 120d. A^^; The laboratory moved from Massachussetts General Hospital, Boston, MA, to...glucose use changes by measurement at 42d, 56d and 84d of age. 7) Measurement of electron transport chain enzyme activities in R6/2 HD mice. 8) NMR...lactate imaging; in vitro spectrophotometric oxidative phosphorylation enzyme assays; HPLC detection of metabolites), and to investigate the

Immune Suppression and Inflammation in the Progression of Breast Cancer

DTIC Science & Technology

2008-03-01

CD14 association with complement receptor type 3, which is reversed by neutrophil adhesion. J Immunol 1996;156:430-3. 27. Karin M, Greten FR. NF...52. Greten FR, Eckmann L, Greten TF, et al. IKKbeta links inflammation and tumorigenesis in a mouse model of colitis-associated cancer. Cell...ceramide docking to CD14 provokes ligand-specific receptor clustering in rafts. Eur J Immunol 2001;31:3153-64. 26. Karin M, Greten FR. NF-kappaB

Epigenetic Control of Prolyl and Asparaginyl Hydroxylases in Prostate Cancer

DTIC Science & Technology

2009-07-01

2008). 4. Ikegami , T . et al. Model mice for tissue-specific deletion of the manganese superoxide dismutase (MnSOD) gene. Biochem Biophys Res Commun 296...Wiley-VCH) 2009. – See appendix for full text. Abstracts: Case, A.J., Johns, A., Takahashi, T ., Waldschmidt, T ., and Domann, FE. (2008) Aberrant...thymic development in a T -lymphocyte specific SOD2 knock-out mouse. Free Radical Biology and Medicine 45: S133-S134. Awards: Case, A.J., Young

Salvaging hope: Is increasing NAD+ a key to treating mitochondrial myopathy?

PubMed Central

Lightowlers, Robert N; Chrzanowska-Lightowlers, Zofia MA

2014-01-01

Mitochondrial diseases can arise from mutations either in mitochondrial DNA or in nuclear DNA encoding mitochondrially destined proteins. Currently, there is no cure for these diseases although treatments to ameliorate a subset of the symptoms are being developed. In this issue of EMBO Molecular Medicine, Khan et al (2014) use a mouse model to test the efficacy of a simple dietary supplement of nicotinamide riboside to treat and prevent mitochondrial myopathies. PMID:24838280

Monitoring and Counteracting Functional Deterioration in Parkinson’s Disease: A Multilevel Integrative Approach in a Primate Model System

DTIC Science & Technology

2006-09-01

PD like symptoms (Colisimo et al., 1992; Fukuda, 2001). The effects of Riluzole (anti-excitotoxic) treatment, epigallocatechin -3- gallate ( EGCG ...the dose response study (-)- Epigallocatechin 3-O- gallate ( EGCG ; Teavigo®) was kindly provided bij DSM, Switserland. The anti-excitotoxic compound...2003). " Epigallocatechin gallate modulates CYP450 isoforms in the female Swiss-Webster mouse." Toxicol Sci 76(2): 262-70. Heikkila RE, Cohen G

The anabolic/androgenic steroid nandrolone exacerbates gene expression modifications induced by mutant SOD1 in muscles of mice models of amyotrophic lateral sclerosis

PubMed Central

Galbiati, Mariarita; Onesto, Elisa; Zito, Arianna; Crippa, Valeria; Rusmini, Paola; Mariotti, Raffaella; Bentivoglio, Marina; Bendotti, Caterina; Poletti, Angelo

2012-01-01

Anabolic/androgenic steroids (AAS) are drugs that enhance muscle mass, and are often illegally utilized in athletes to improve their performances. Recent data suggest that the increased risk for amyotrophic lateral sclerosis (ALS) in male soccer and football players could be linked to AAS abuse. ALS is a motor neuron disease mainly occurring in sporadic (sALS) forms, but some familial forms (fALS) exist and have been linked to mutations in different genes. Some of these, in their wild type (wt) form, have been proposed as risk factors for sALS, i.e. superoxide dismutase 1 (SOD1) gene, whose mutations are causative of about 20% of fALS. Notably, SOD1 toxicity might occur both in motor neurons and in muscle cells. Using gastrocnemius muscles of mice overexpressing human mutant SOD1 (mutSOD1) at different disease stages, we found that the expression of a selected set of genes associated to muscle atrophy, MyoD, myogenin, atrogin-1, and transforming growth factor (TGF)β1, is up-regulated already at the presymptomatic stage. Atrogin-1 gene expression was increased also in mice overexpressing human wtSOD1. Similar alterations were found in axotomized mouse muscles and in cultured ALS myoblast models. In these ALS models, we then evaluated the pharmacological effects of the synthetic AAS nandrolone on the expression of the genes modified in ALS muscle. Nandrolone administration had no effects on MyoD, myogenin, and atrogin-1 expression, but it significantly increased TGFβ1 expression at disease onset. Altogether, these data suggest that, in fALS, muscle gene expression is altered at early stages, and AAS may exacerbate some of the alterations induced by SOD1 possibly acting as a contributing factor also in sALS. PMID:22178654

The anabolic/androgenic steroid nandrolone exacerbates gene expression modifications induced by mutant SOD1 in muscles of mice models of amyotrophic lateral sclerosis.

PubMed

Galbiati, Mariarita; Onesto, Elisa; Zito, Arianna; Crippa, Valeria; Rusmini, Paola; Mariotti, Raffaella; Bentivoglio, Marina; Bendotti, Caterina; Poletti, Angelo

2012-02-01

Anabolic/androgenic steroids (AAS) are drugs that enhance muscle mass, and are often illegally utilized in athletes to improve their performances. Recent data suggest that the increased risk for amyotrophic lateral sclerosis (ALS) in male soccer and football players could be linked to AAS abuse. ALS is a motor neuron disease mainly occurring in sporadic (sALS) forms, but some familial forms (fALS) exist and have been linked to mutations in different genes. Some of these, in their wild type (wt) form, have been proposed as risk factors for sALS, i.e. superoxide dismutase 1 (SOD1) gene, whose mutations are causative of about 20% of fALS. Notably, SOD1 toxicity might occur both in motor neurons and in muscle cells. Using gastrocnemius muscles of mice overexpressing human mutant SOD1 (mutSOD1) at different disease stages, we found that the expression of a selected set of genes associated to muscle atrophy, MyoD, myogenin, atrogin-1, and transforming growth factor (TGF)β1, is up-regulated already at the presymptomatic stage. Atrogin-1 gene expression was increased also in mice overexpressing human wtSOD1. Similar alterations were found in axotomized mouse muscles and in cultured ALS myoblast models. In these ALS models, we then evaluated the pharmacological effects of the synthetic AAS nandrolone on the expression of the genes modified in ALS muscle. Nandrolone administration had no effects on MyoD, myogenin, and atrogin-1 expression, but it significantly increased TGFβ1 expression at disease onset. Altogether, these data suggest that, in fALS, muscle gene expression is altered at early stages, and AAS may exacerbate some of the alterations induced by SOD1 possibly acting as a contributing factor also in sALS. Copyright © 2011 Elsevier Ltd. All rights reserved.

Overexpression of metallothionein-I, a copper-regulating protein, attenuates intracellular copper dyshomeostasis and extends lifespan in a mouse model of amyotrophic lateral sclerosis caused by mutant superoxide dismutase-1.

PubMed

Tokuda, Eiichi; Okawa, Eriko; Watanabe, Shunsuke; Ono, Shin-Ichi

2014-03-01

Over 170 mutations in superoxide dismutase-1 (SOD1) cause familial amyotrophic lateral sclerosis (ALS), a lethal motor neuron disease. Although the molecular properties of SOD1 mutants differ considerably, we have recently shown that intracellular copper dyshomeostasis is a common pathogenic feature of different SOD1 mutants. Thus, the potentiation of endogenous copper regulation could be a therapeutic strategy. In this study, we investigated the effects of the overexpression of metallothionein-I (MT-I), a major copper-regulating protein, on the disease course of a mouse model of ALS (SOD1(G93A)). Using double transgenic techniques, we found that the overexpression of MT-I in SOD1(G93A) mice significantly extended the lifespan and slowed disease progression, but the effects on disease onset were modest. Genetically induced MT-I normalized copper dyshomeostasis in the spinal cord without influencing SOD1 enzymatic activity. The overexpression of MT-I in SOD1(G93A) mice markedly attenuated the pathological features of the mice, including the death of motor neurons, the degeneration of ventral root axons, the atrophy of skeletal muscles, and the activation of glial cells. Double transgenic mice also showed a decreased level of SOD1 aggregates within the glial cells of the spinal cord. Furthermore, the overexpression of MT-I in SOD1(G93A) mice reduced the number of spheroid-shaped astrocytes cleaved by active caspase-3. We concluded that therapeutic strategies aimed at the potentiation of copper regulation by MT-I could be of benefit in cases of ALS caused by SOD1 mutations.

Radiation leukaemogenesis at low doses DE-FG02-05 ER 63947 Final Technical Report 15 May 2005; 14 May 2010

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bouffler, Simon

2010-07-28

This report provides a complete summary of the work undertaken and results obtained under US Department of Energy grant DF-FG02-05 ER 63947, Radiation leukaemogenesis at low doses. There is ample epidemiological evidence indicating that ionizing radiation is carcinogenic in the higher dose range. This evidence, however, weakens and carries increasing uncertainties at doses below 100-200 mSv. At these low dose levels the form of the dose-response curve for radiation-induced cancer cannot be determined reliably or directly from studies of human populations. Therefore animal, cellular and other experimental systems must be employed to provide supporting evidence on which to base judgementsmore » of risk at low doses. Currently in radiological protection a linear non-threshold (LNT) extrapolation of risk estimates derived from human epidemiological studies is used to estimate risks in the dose range of interest for protection purposes. Myeloid leukaemias feature prominently among the cancers associated with human exposures to ionising radiation (eg UNSCEAR 2006; IARC 2000). Good animal models of radiation-induced acute myeloid leukaemia (AML) are available including strains such as CBA, RFM and SJL (eg Major and Mole 1978; Ullrich et al 1976; Resnitzky et al 1985). Early mechanistic studies using cytogenetic methods in these mouse models established that the majority of radiation-induced AMLs carried substantial interstitial deletions in one copy of chromosome (chr) 2 (eg Hayata et al 1983; Trakhtenbrot et al 1988; Breckon et al 1991; Rithidech et al 1993; Bouffler et al 1996). Chr2 aberrations are known to occur in bone marrow cells as early as 24 hours after in vivo irradiation (Bouffler et al 1997). Subsequent molecular mapping studies defined a distinct region of chr2 that is commonly lost in AMLs (Clark et al 1996; Silver et al 1999). Further, more detailed, analysis identified point mutations at a specific region of the Sfpi1/PU.1 haemopoietic transcription factor gene which lies in the commonly deleted region of chr2 (Cook et al 2004; Suraweera et al 2005). These lines of evidence strongly implicate the Sfpi1/PU.1 gene as a tumour suppressor gene, dysregulation of which leads to myeloid leukaemia. The main focus of this project was to utilize the CBA mouse model of radiation leukaemogenesis to explore mechanisms of low dose and low dose-rate leukaemogenesis. A series of mechanistic investigations were undertaken, the central aim of which was to identify the events that convert normal cells into myeloid leukaemia cells and explore the dose-response relationships for these. Much of the work centred on the Sfpi1/PU.1 gene and its role in leukaemogenesis. Specific studies considered the dose-response and time-course relationships for loss of the gene, the functional consequences of Sfpi1/PU.1 loss and mutation on transcriptional programmes and developing an in vivo reporter gene system for radiation-induced alterations to PU.1 expression. Additional work sought further genetic changes associated with radiation-induced AMLs and a better characterization of the cell of origin or 'target cell' for radiation-induced AML. All the information gathered is of potential use in developing biologically realistic mathematical models for low dose cancer risk projection.« less

Studying the Role of Eukaryotic Translation Initiation Factor 4E (eIF4E) Phosphorylation by MNK1/2 Kinases in Prostate Cancer Development and Progression

DTIC Science & Technology

2012-06-01

preclinical mouse model. J Clin Invest 118: 3051–3064. 49. Le Bacquer O, et al. (2007) Elevated sensitivity to diet-induced obesity and insulin resistance in...Elevated sensitivity to diet-induced obesity and insulin resistance in mice lacking 4E-BP1 and 4E-BP2. J Clin Invest 117:387–396. 7. Frederickson RM...that knock-in mice expressing a nonphosphorylatable form of eIF4E are resistant to tumorigenesis in a prostate cancer model. By using a genome-wide

Structure and Function of the Splice Variants of TMPRSS2-ERG, a Prevalent Genomic Alteration in Prostate Cancer

DTIC Science & Technology

2011-09-01

the ETS family of transcription factors showing diverse expression patterns in human tissues (Turner and Watson, 2008). ERG, similar to other...and adult mouse tissues . Most striking of these observations was highly selective and abundant expression of erg protein in endothelial cells of...mouse tissues . We for the first time clarified that endogenous ERG was not expressed in normal mouse prostate epithelium (Mohamed et al., 2010

The Neuroprotective Properties of Hericium erinaceus in Glutamate-Damaged Differentiated PC12 Cells and an Alzheimer's Disease Mouse Model.

PubMed

Zhang, Junrong; An, Shengshu; Hu, Wenji; Teng, Meiyu; Wang, Xue; Qu, Yidi; Liu, Yang; Yuan, Ye; Wang, Di

2016-11-01

Hericium erinaceus , an edible and medicinal mushroom, displays various pharmacological activities in the prevention of dementia in conditions such as Parkinson's and Alzheimer's disease. The present study explored the neuroprotective effects of H. erinaceus mycelium polysaccharide-enriched aqueous extract (HE) on an l-glutamic acid (l-Glu)-induced differentiated PC12 (DPC12) cellular apoptosis model and an AlCl₃ combined with d-galactose-induced Alzheimer's disease mouse model. The data revealed that HE successfully induced PC12 cell differentiation. A 3 h HE incubation at doses of 50 and 100 µg/mL before 25 mM of l-Glu effectively reversed the reduction of cell viability and the enhancement of the nuclear apoptosis rate in DPC12 cells. Compared with l-Glu-damaged cells, in PC12 cells, HE suppressed intracellular reactive oxygen species accumulation, blocked Ca 2+ overload and prevented mitochondrial membrane potential (MMP) depolarization. In the Alzheimer's disease mouse model, HE administration enhanced the horizontal and vertical movements in the autonomic activity test, improved the endurance time in the rotarod test, and decreased the escape latency time in the water maze test. It also improved the central cholinergic system function in the Alzheimer's mice, demonstrated by the fact that it dose-dependently enhanced the acetylcholine (Ach) and choline acetyltransferase (ChAT) concentrations in both the serum and the hypothalamus. Our findings provide experimental evidence that HE may provide neuroprotective candidates for treating or preventing neurodegenerative diseases.

Boosting ATM activity alleviates aging and extends lifespan in a mouse model of progeria

PubMed Central

Peng, Linyuan; Tang, Xiaolong; Meng, Fanbiao; Ao, Ying; Zhou, Mingyan; Wang, Ming; Cao, Xinyue; Qin, Baoming; Wang, Zimei; Zhou, Zhongjun; Wang, Guangming; Gao, Zhengliang; Xu, Jun

2018-01-01

DNA damage accumulates with age (Lombard et al., 2005). However, whether and how robust DNA repair machinery promotes longevity is elusive. Here, we demonstrate that ATM-centered DNA damage response (DDR) progressively declines with senescence and age, while low dose of chloroquine (CQ) activates ATM, promotes DNA damage clearance, rescues age-related metabolic shift, and prolongs replicative lifespan. Molecularly, ATM phosphorylates SIRT6 deacetylase and thus prevents MDM2-mediated ubiquitination and proteasomal degradation. Extra copies of Sirt6 extend lifespan in Atm-/- mice, with restored metabolic homeostasis. Moreover, the treatment with CQ remarkably extends lifespan of Caenorhabditis elegans, but not the ATM-1 mutants. In a progeria mouse model with low DNA repair capacity, long-term administration of CQ ameliorates premature aging features and extends lifespan. Thus, our data highlights a pro-longevity role of ATM, for the first time establishing direct causal links between robust DNA repair machinery and longevity, and providing therapeutic strategy for progeria and age-related metabolic diseases. PMID:29717979

Type I interferons in tuberculosis: Foe and occasionally friend.

PubMed

Moreira-Teixeira, Lúcia; Mayer-Barber, Katrin; Sher, Alan; O'Garra, Anne

2018-05-07

Tuberculosis remains one of the leading causes of mortality worldwide, and, despite its clinical significance, there are still significant gaps in our understanding of pathogenic and protective mechanisms triggered by Mycobacterium tuberculosis infection. Type I interferons (IFN) regulate a broad family of genes that either stimulate or inhibit immune function, having both host-protective and detrimental effects, and exhibit well-characterized antiviral activity. Transcriptional studies have uncovered a potential deleterious role for type I IFN in active tuberculosis. Since then, additional studies in human tuberculosis and experimental mouse models of M. tuberculosis infection support the concept that type I IFN promotes both bacterial expansion and disease pathogenesis. More recently, studies in a different setting have suggested a putative protective role for type I IFN. In this study, we discuss the mechanistic and contextual factors that determine the detrimental versus beneficial outcomes of type I IFN induction during M. tuberculosis infection, from human disease to experimental mouse models of tuberculosis. © 2018 Moreira-Teixeira et al.

A differential autophagy-dependent response to DNA double-strand breaks in bone marrow mesenchymal stem cells from sporadic ALS patients.

PubMed

Wald-Altman, Shane; Pichinuk, Edward; Kakhlon, Or; Weil, Miguel

2017-05-01

Amyotrophic lateral sclerosis (ALS) is an incurable motor neurodegenerative disease caused by a diversity of genetic and environmental factors that leads to neuromuscular degeneration and has pathophysiological implications in non-neural systems. Our previous work showed abnormal levels of mRNA expression for biomarker genes in non-neuronal cell samples from ALS patients. The same genes proved to be differentially expressed in the brain, spinal cord and muscle of the SOD1 G93A ALS mouse model. These observations support the idea that there is a pathophysiological relevance for the ALS biomarkers discovered in human mesenchymal stem cells (hMSCs) isolated from bone marrow samples of ALS patients (ALS-hMSCs). Here, we demonstrate that ALS-hMSCs are also a useful patient-based model to study intrinsic cell molecular mechanisms of the disease. We investigated the ALS-hMSC response to oxidative DNA damage exerted by neocarzinostatin (NCS)-induced DNA double-strand breaks (DSBs). We found that the ALS-hMSCs responded to this stress differently from cells taken from healthy controls (HC-hMSCs). Interestingly, we found that ALS-hMSC death in response to induction of DSBs was dependent on autophagy, which was initialized by an increase of phosphorylated (p)AMPK, and blocked by the class III phosphoinositide 3-kinase (PI3K) and autophagy inhibitor 3-methyladenine (3MeA). ALS-hMSC death in response to DSBs was not apoptotic as it was caspase independent. This unique ALS-hMSC-specific response to DNA damage emphasizes the possibility that an intrinsic abnormal regulatory mechanism controlling autophagy initiation exists in ALS-patient-derived hMSCs. This mechanism may also be relevant to the most-affected tissues in ALS. Hence, our approach might open avenues for new personalized therapies for ALS. © 2017. Published by The Company of Biologists Ltd.

A differential autophagy-dependent response to DNA double-strand breaks in bone marrow mesenchymal stem cells from sporadic ALS patients

PubMed Central

Wald-Altman, Shane; Pichinuk, Edward; Kakhlon, Or

2017-01-01

ABSTRACT Amyotrophic lateral sclerosis (ALS) is an incurable motor neurodegenerative disease caused by a diversity of genetic and environmental factors that leads to neuromuscular degeneration and has pathophysiological implications in non-neural systems. Our previous work showed abnormal levels of mRNA expression for biomarker genes in non-neuronal cell samples from ALS patients. The same genes proved to be differentially expressed in the brain, spinal cord and muscle of the SOD1G93A ALS mouse model. These observations support the idea that there is a pathophysiological relevance for the ALS biomarkers discovered in human mesenchymal stem cells (hMSCs) isolated from bone marrow samples of ALS patients (ALS-hMSCs). Here, we demonstrate that ALS-hMSCs are also a useful patient-based model to study intrinsic cell molecular mechanisms of the disease. We investigated the ALS-hMSC response to oxidative DNA damage exerted by neocarzinostatin (NCS)-induced DNA double-strand breaks (DSBs). We found that the ALS-hMSCs responded to this stress differently from cells taken from healthy controls (HC-hMSCs). Interestingly, we found that ALS-hMSC death in response to induction of DSBs was dependent on autophagy, which was initialized by an increase of phosphorylated (p)AMPK, and blocked by the class III phosphoinositide 3-kinase (PI3K) and autophagy inhibitor 3-methyladenine (3MeA). ALS-hMSC death in response to DSBs was not apoptotic as it was caspase independent. This unique ALS-hMSC-specific response to DNA damage emphasizes the possibility that an intrinsic abnormal regulatory mechanism controlling autophagy initiation exists in ALS-patient-derived hMSCs. This mechanism may also be relevant to the most-affected tissues in ALS. Hence, our approach might open avenues for new personalized therapies for ALS. PMID:28213588

Do Curved Reaching Movements Emerge from Competing Perceptions? A Reply to van der Wel et al. (2009)

ERIC Educational Resources Information Center

Spivey, Michael J.; Dale, Rick; Knoblich, Guenther; Grosjean, Marc

2010-01-01

Spivey, Grosjean, and Knoblich (2005) reported smoothly curved reaching movements, via computer-mouse tracking, which suggested a continuously evolving flow of distributed lexical activation patterns into motor movement during a phonological competitor task. For example, when instructed to click the "candy," participants' mouse-cursor trajectories…

Rapamycin treatment for amyotrophic lateral sclerosis: Protocol for a phase II randomized, double-blind, placebo-controlled, multicenter, clinical trial (RAP-ALS trial).

PubMed

Mandrioli, Jessica; D'Amico, Roberto; Zucchi, Elisabetta; Gessani, Annalisa; Fini, Nicola; Fasano, Antonio; Caponnetto, Claudia; Chiò, Adriano; Dalla Bella, Eleonora; Lunetta, Christian; Mazzini, Letizia; Marinou, Kalliopi; Sorarù, Gianni; de Biasi, Sara; Lo Tartaro, Domenico; Pinti, Marcello; Cossarizza, Andrea

2018-06-01

Misfolded aggregated proteins and neuroinflammation significantly contribute to amyotrophic lateral sclerosis (ALS) pathogenesis, hence representing therapeutic targets to modify disease expression. Rapamycin inhibits mechanistic target of Rapamycin (mTOR) pathway and enhances autophagy with demonstrated beneficial effects in neurodegeneration in cell line and animal models, improving phenotype in SQSTM1 zebrafish, in Drosophila model of ALS-TDP, and in the TDP43 mouse model, in which it reduced neuronal loss and TDP43 inclusions. Rapamycin also expands regulatory T lymphocytes (Treg) and increased Treg levels are associated with slow progression in ALS patients.Therefore, we planned a randomized clinical trial testing Rapamycin treatment in ALS patients. RAP-ALS is a phase II randomized, double-blind, placebo-controlled, multicenter (8 ALS centers in Italy), clinical trial. The primary aim is to assess whether Rapamycin administration increases Tregs number in treated patients compared with control arm. Secondary aims include the assessment of safety and tolerability of Rapamycin in patients with ALS; the minimum dosage to have Rapamycin in cerebrospinal fluid; changes in immunological (activation and homing of T, B, NK cell subpopulations) and inflammatory markers, and on mTOR downstream pathway (S6RP phosphorylation); clinical activity (ALS Functional Rating Scale-Revised, survival, forced vital capacity); and quality of life (ALSAQ40 scale). Rapamycin potentially targets mechanisms at play in ALS (i.e., autophagy and neuroinflammation), with promising preclinical studies. It is an already approved drug, with known pharmacokinetics, already available and therefore with significant possibility of rapid translation to daily clinics. Findings will provide reliable data for further potential trials. The study protocol was approved by the Ethics Committee of Azienda Ospedaliero Universitaria of Modena and by the Ethics Committees of participating centers (Eudract n. 2016-002399-28) based on the Helsinki declaration.

Edaravone, a Free Radical Scavenger, Delayed Symptomatic and Pathological Progression of Motor Neuron Disease in the Wobbler Mouse.

PubMed

Ikeda, Ken; Iwasaki, Yasuo

2015-01-01

Edaravone, a free radical scavenger is used widely in Japanese patients with acute cerebral infarction. This antioxidant could have therapeutic potentials for other neurological diseases. Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease that affects the upper and the lower motor neuron, leading to death within 3-5 years after onset. A phase III clinical trial of edaravone suggested no significant effects in ALS patients. However, recent 2nd double-blind trial has demonstrated therapeutic benefits of edaravone in definite patients diagnosed by revised El Escorial diagnostic criteria of ALS. Two previous studies showed that edaravone attenuated motor symptoms or motor neuron degeneration in mutant superoxide dismutase 1-transgenic mice or rats, animal models of familial ALS. Herein we examined whether this radical scavenger can retard progression of motor dysfunction and neuropathological changes in wobbler mice, sporadic ALS-like model. After diagnosis of the disease onset at the postnatal age of 3-4 weeks, wobbler mice received edaravone (1 or 10 mg/kg, n = 10/group) or vehicle (n = 10), daily for 4 weeks by intraperitoneal administration. Motor symptoms and neuropathological changes were compared among three groups. Higher dose (10 mg/kg) of edaravone treatment significantly attenuated muscle weakness and contracture in the forelimbs, and suppressed denervation atrophy in the biceps muscle and degeneration in the cervical motor neurons compared to vehicle. Previous and the present studies indicated neuroprotective effects of edaravone in three rodent ALS-like models. This drug seems to be worth performing the clinical trial in ALS patients in the United States of American and Europe, in addition to Japan.

Edaravone, a Free Radical Scavenger, Delayed Symptomatic and Pathological Progression of Motor Neuron Disease in the Wobbler Mouse

PubMed Central

2015-01-01

Edaravone, a free radical scavenger is used widely in Japanese patients with acute cerebral infarction. This antioxidant could have therapeutic potentials for other neurological diseases. Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease that affects the upper and the lower motor neuron, leading to death within 3–5 years after onset. A phase III clinical trial of edaravone suggested no significant effects in ALS patients. However, recent 2nd double-blind trial has demonstrated therapeutic benefits of edaravone in definite patients diagnosed by revised El Escorial diagnostic criteria of ALS. Two previous studies showed that edaravone attenuated motor symptoms or motor neuron degeneration in mutant superoxide dismutase 1-transgenic mice or rats, animal models of familial ALS. Herein we examined whether this radical scavenger can retard progression of motor dysfunction and neuropathological changes in wobbler mice, sporadic ALS-like model. After diagnosis of the disease onset at the postnatal age of 3–4 weeks, wobbler mice received edaravone (1 or 10 mg/kg, n = 10/group) or vehicle (n = 10), daily for 4 weeks by intraperitoneal administration. Motor symptoms and neuropathological changes were compared among three groups. Higher dose (10 mg/kg) of edaravone treatment significantly attenuated muscle weakness and contracture in the forelimbs, and suppressed denervation atrophy in the biceps muscle and degeneration in the cervical motor neurons compared to vehicle. Previous and the present studies indicated neuroprotective effects of edaravone in three rodent ALS-like models. This drug seems to be worth performing the clinical trial in ALS patients in the United States of American and Europe, in addition to Japan. PMID:26469273

Comparison of Data on Mutation Frequencies of Mice Caused by Radiation with Low Dose Model

NASA Astrophysics Data System (ADS)

Manabe, Yuichiro; Bando, Masako

2013-09-01

We propose low dose (LD) model, the extension of LDM model which was proposed in the previous paper [Y. Manabe et al.: J. Phys. Soc. Jpn. 81 (2012) 104004] to estimate biological damage caused by irradiation. LD model takes account of cell death effect in addition to the proliferation, apoptosis, repair which were included in LDM model. As a typical example of estimation, we apply LD model to the experiment of mutation frequency on the responses induced by the exposure to low levels of ionizing radiation. The most famous and extensive experiments are those summarized by Russell and Kelly [Proc. Natl. Acad. Sci. U.S.A. 79 (1982) 539], which are known as ``mega-mouse project''. This provides us with important information of the frequencies of transmitted specific-locus mutations induced in mouse spermatogonia stem-cells. It is found that the numerical results of the mutation frequency of mice are in reasonable agreement with the experimental data: the LD model reproduces the total dose and dose rate dependence of data reasonably. In order to see such dose-rate dependence more explicitly, we introduce the dose-rate effectiveness factor (DREF). This represents a sort of dose rate dependent effect, which are to be competitive with proliferation effect of broken cells induced by irradiation.

Preclinical models for interrogating drug action in human cancers using Stable Isotope Resolved Metabolomics (SIRM).

PubMed

Lane, Andrew N; Higashi, Richard M; Fan, Teresa W-M

2016-07-01

In this review we compare the advantages and disadvantages of different model biological systems for determining the metabolic functions of cells in complex environments, how they may change in different disease states, and respond to therapeutic interventions. All preclinical drug-testing models have advantages and drawbacks. We compare and contrast established cell, organoid and animal models with ex vivo organ or tissue culture and in vivo human experiments in the context of metabolic readout of drug efficacy. As metabolism reports directly on the biochemical state of cells and tissues, it can be very sensitive to drugs and/or other environmental changes. This is especially so when metabolic activities are probed by stable isotope tracing methods, which can also provide detailed mechanistic information on drug action. We have developed and been applying Stable Isotope-Resolved Metabolomics (SIRM) to examine metabolic reprogramming of human lung cancer cells in monoculture, in mouse xenograft/explant models, and in lung cancer patients in situ (Lane et al. 2011; T. W. Fan et al. 2011; T. W-M. Fan et al. 2012; T. W. Fan et al. 2012; Xie et al. 2014b; Ren et al. 2014a; Sellers et al. 2015b). We are able to determine the influence of the tumor microenvironment using these models. We have now extended the range of models to fresh human tissue slices, similar to those originally described by O. Warburg (Warburg 1923), which retain the native tissue architecture and heterogeneity with a paired benign versus cancer design under defined cell culture conditions. This platform offers an unprecedented human tissue model for preclinical studies on metabolic reprogramming of human cancer cells in their tissue context, and response to drug treatment (Xie et al. 2014a). As the microenvironment of the target human tissue is retained and individual patient's response to drugs is obtained, this platform promises to transcend current limitations of drug selection for clinical trials or treatments. Development of ex vivo human tissue and animal models with humanized organs including bone marrow and liver show considerable promise for analyzing drug responses that are more relevant to humans. Similarly using stable isotope tracer methods with these improved models in advanced stages of the drug development pipeline, in conjunction with tissue biopsy is expected significantly to reduce the high failure rate of experimental drugs in Phase II and III clinical trials.

Investigating the contribution of VAPB/ALS8 loss of function in amyotrophic lateral sclerosis.

PubMed

Kabashi, Edor; El Oussini, Hajer; Bercier, Valérie; Gros-Louis, François; Valdmanis, Paul N; McDearmid, Jonathan; Mejier, Inge A; Dion, Patrick A; Dupre, Nicolas; Hollinger, David; Sinniger, Jérome; Dirrig-Grosch, Sylvie; Camu, William; Meininger, Vincent; Loeffler, Jean-Philippe; René, Frédérique; Drapeau, Pierre; Rouleau, Guy A; Dupuis, Luc

2013-06-15

The mutations P56S and T46I in the gene encoding vesicle-associated membrane protein-associated protein B/C (VAPB) cause ALS8, a familial form of amyotrophic lateral sclerosis (ALS). Overexpression of mutant forms of VAPB leads to cytosolic aggregates, suggesting a gain of function of the mutant protein. However, recent work suggested that the loss of VAPB function could be the major mechanism leading to ALS8. Here, we used multiple genetic and experimental approaches to study whether VAPB loss of function might be sufficient to trigger motor neuron degeneration. In order to identify additional ALS-associated VAPB mutations, we screened the entire VAPB gene in a cohort of ALS patients and detected two mutations (A145V and S160Δ). To directly address the contribution of VAPB loss of function in ALS, we generated zebrafish and mouse models with either a decreased or a complete loss of Vapb expression. Vapb knockdown in zebrafish led to swimming deficits. Mice knocked-out for Vapb showed mild motor deficits after 18 months of age yet had innervated neuromuscular junctions (NMJs). Importantly, overexpression of VAPB mutations were unable to rescue the motor deficit caused by Vapb knockdown in zebrafish and failed to cause a toxic gain-of-function defect on their own. Thus, Vapb loss of function weakens the motor system of vertebrate animal models but is on its own unable to lead to a complete ALS phenotype. Our findings are consistent with the notion that VAPB mutations constitute a risk factor for motor neuron disease through a loss of VAPB function.

The Src/c-Abl pathway is a potential therapeutic target in amyotrophic lateral sclerosis.

PubMed

Imamura, Keiko; Izumi, Yuishin; Watanabe, Akira; Tsukita, Kayoko; Woltjen, Knut; Yamamoto, Takuya; Hotta, Akitsu; Kondo, Takayuki; Kitaoka, Shiho; Ohta, Akira; Tanaka, Akito; Watanabe, Dai; Morita, Mitsuya; Takuma, Hiroshi; Tamaoka, Akira; Kunath, Tilo; Wray, Selina; Furuya, Hirokazu; Era, Takumi; Makioka, Kouki; Okamoto, Koichi; Fujisawa, Takao; Nishitoh, Hideki; Homma, Kengo; Ichijo, Hidenori; Julien, Jean-Pierre; Obata, Nanako; Hosokawa, Masato; Akiyama, Haruhiko; Kaneko, Satoshi; Ayaki, Takashi; Ito, Hidefumi; Kaji, Ryuji; Takahashi, Ryosuke; Yamanaka, Shinya; Inoue, Haruhisa

2017-05-24

Amyotrophic lateral sclerosis (ALS), a fatal disease causing progressive loss of motor neurons, still has no effective treatment. We developed a phenotypic screen to repurpose existing drugs using ALS motor neuron survival as readout. Motor neurons were generated from induced pluripotent stem cells (iPSCs) derived from an ALS patient with a mutation in superoxide dismutase 1 ( SOD1 ). Results of the screen showed that more than half of the hits targeted the Src/c-Abl signaling pathway. Src/c-Abl inhibitors increased survival of ALS iPSC-derived motor neurons in vitro. Knockdown of Src or c-Abl with small interfering RNAs (siRNAs) also rescued ALS motor neuron degeneration. One of the hits, bosutinib, boosted autophagy, reduced the amount of misfolded mutant SOD1 protein, and attenuated altered expression of mitochondrial genes. Bosutinib also increased survival in vitro of ALS iPSC-derived motor neurons from patients with sporadic ALS or other forms of familial ALS caused by mutations in TAR DNA binding protein ( TDP-43 ) or repeat expansions in C9orf72 Furthermore, bosutinib treatment modestly extended survival of a mouse model of ALS with an SOD1 mutation, suggesting that Src/c-Abl may be a potentially useful target for developing new drugs to treat ALS. Copyright © 2017, American Association for the Advancement of Science.

Evaluation of Beta-Absorbed Fractions in a Mouse Model for 90Y, 188Re, 166Ho, 149Pm, 64Cu, and 177Lu Radionuclides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, William H.; Hartmann-Siantar, Christine; Fisher, Darrell R.

2005-08-01

Several short-lived, high-energy beta emitters are being proposed as the radionuclide components for molecular-targeted potential cancer therapeutic agents. The laboratory mice used to determine the efficacy of these new agents have organs that are relatively small compared to the ranges of these high-energy particles. The dosimetry model developed by Hui et al. was extended to provide realistic beta-dose estimates for organs in mice that received therapeutic radiopharmaceuticals containing 90Y, 188Re, 166Ho, 149Pm, 64Cu, and 177 Lu. Major organs in this model included the liver, spleen, kidneys, lungs, heart, stomach, small and large bowel, thyroid, pancreas, bone, marrow, carcass, and amore » 0.025-g tumor. The study as reported in this paper verifies their results for 90Y and extends them by using their organ geometry factors combined with newly calculated organ self-absorbed fractions from PEREGRINE and MCNP. PEREGRINE and MCNP agree to within 8% for the worst-case organ with average differences (averaged over all organs) decreasing from 5% for 90Y to 1% for 177Lu. When used with typical biodistribution data, the three different models predict doses that are in agreement to within 5% for the worst-case organ. The beta-absorbed fractions and cross-organ-deposited energy provided in this paper can be used by researchers to predict mouse-organ doses and should contribute to an improved understanding of the relationship between dose and radiation toxicity in mouse models where use of these isotopes is favorable.« less

CRISPR/Cas9-Mediated Insertion of loxP Sites in the Mouse Dock7 Gene Provides an Effective Alternative to Use of Targeted Embryonic Stem Cells.

PubMed

Bishop, Kathleen A; Harrington, Anne; Kouranova, Evguenia; Weinstein, Edward J; Rosen, Clifford J; Cui, Xiaoxia; Liaw, Lucy

2016-07-07

Targeted gene mutation in the mouse is a primary strategy to understand gene function and relation to phenotype. The Knockout Mouse Project (KOMP) had an initial goal to develop a public resource of mouse embryonic stem (ES) cell clones that carry null mutations in all genes. Indeed, many useful novel mouse models have been generated from publically accessible targeted mouse ES cell lines. However, there are limitations, including incorrect targeting or cassette structure, and difficulties with germline transmission of the allele from chimeric mice. In our experience, using a small sample of targeted ES cell clones, we were successful ∼50% of the time in generating germline transmission of a correctly targeted allele. With the advent of CRISPR/Cas9 as a mouse genome modification tool, we assessed the efficiency of creating a conditional targeted allele in one gene, dedicator of cytokinesis 7 (Dock7), for which we were unsuccessful in generating a null allele using a KOMP targeted ES cell clone. The strategy was to insert loxP sites to flank either exons 3 and 4, or exons 3 through 7. By coinjecting Cas9 mRNA, validated sgRNAs, and oligonucleotide donors into fertilized eggs from C57BL/6J mice, we obtained a variety of alleles, including mice homozygous for the null alleles mediated by nonhomologous end joining, alleles with one of the two desired loxP sites, and correctly targeted alleles with both loxP sites. We also found frequent mutations in the inserted loxP sequence, which is partly attributable to the heterogeneity in the original oligonucleotide preparation. Copyright © 2016 Bishop et al.

A Feature-Based Approach to Modeling Protein–DNA Interactions

PubMed Central

Segal, Eran

2008-01-01

Transcription factor (TF) binding to its DNA target site is a fundamental regulatory interaction. The most common model used to represent TF binding specificities is a position specific scoring matrix (PSSM), which assumes independence between binding positions. However, in many cases, this simplifying assumption does not hold. Here, we present feature motif models (FMMs), a novel probabilistic method for modeling TF–DNA interactions, based on log-linear models. Our approach uses sequence features to represent TF binding specificities, where each feature may span multiple positions. We develop the mathematical formulation of our model and devise an algorithm for learning its structural features from binding site data. We also developed a discriminative motif finder, which discovers de novo FMMs that are enriched in target sets of sequences compared to background sets. We evaluate our approach on synthetic data and on the widely used TF chromatin immunoprecipitation (ChIP) dataset of Harbison et al. We then apply our algorithm to high-throughput TF ChIP data from mouse and human, reveal sequence features that are present in the binding specificities of mouse and human TFs, and show that FMMs explain TF binding significantly better than PSSMs. Our FMM learning and motif finder software are available at http://genie.weizmann.ac.il/. PMID:18725950

Adaptive optics retinal imaging in the living mouse eye

PubMed Central

Geng, Ying; Dubra, Alfredo; Yin, Lu; Merigan, William H.; Sharma, Robin; Libby, Richard T.; Williams, David R.

2012-01-01

Correction of the eye’s monochromatic aberrations using adaptive optics (AO) can improve the resolution of in vivo mouse retinal images [Biss et al., Opt. Lett. 32(6), 659 (2007) and Alt et al., Proc. SPIE 7550, 755019 (2010)], but previous attempts have been limited by poor spot quality in the Shack-Hartmann wavefront sensor (SHWS). Recent advances in mouse eye wavefront sensing using an adjustable focus beacon with an annular beam profile have improved the wavefront sensor spot quality [Geng et al., Biomed. Opt. Express 2(4), 717 (2011)], and we have incorporated them into a fluorescence adaptive optics scanning laser ophthalmoscope (AOSLO). The performance of the instrument was tested on the living mouse eye, and images of multiple retinal structures, including the photoreceptor mosaic, nerve fiber bundles, fine capillaries and fluorescently labeled ganglion cells were obtained. The in vivo transverse and axial resolutions of the fluorescence channel of the AOSLO were estimated from the full width half maximum (FWHM) of the line and point spread functions (LSF and PSF), and were found to be better than 0.79 μm ± 0.03 μm (STD)(45% wider than the diffraction limit) and 10.8 μm ± 0.7 μm (STD)(two times the diffraction limit), respectively. The axial positional accuracy was estimated to be 0.36 μm. This resolution and positional accuracy has allowed us to classify many ganglion cell types, such as bistratified ganglion cells, in vivo. PMID:22574260

Peptide p5 binds both heparinase-sensitive glycosaminoglycans and fibrils in patient-derived AL amyloid extracts.

PubMed

Martin, Emily B; Williams, Angela; Heidel, Eric; Macy, Sallie; Kennel, Stephen J; Wall, Jonathan S

2013-06-21

In previously published work, we have described heparin-binding synthetic peptides that preferentially recognize amyloid deposits in a mouse model of reactive systemic (AA) amyloidosis and can be imaged by using positron and single photon emission tomographic imaging. We wanted to extend these findings to the most common form of visceral amyloidosis, namely light chain (AL); however, there are no robust experimental animal models of AL amyloidosis. To further define the binding of the lead peptide, p5, to AL amyloid, we characterized the reactivity in vitro of p5 with in situ and patient-derived AL amyloid extracts which contain both hypersulfated heparan sulfate proteoglycans as well as amyloid fibrils. Histochemical staining demonstrated that the peptide specifically localized with tissue-associated AL amyloid deposits. Although we anticipated that p5 would undergo electrostatic interactions with the amyloid-associated glycosaminoglycans expressing heparin-like side chains, no significant correlation between peptide binding and glycosaminoglycan content within amyloid extracts was observed. In contrast, following heparinase I treatment, although overall binding was reduced, a positive correlation between peptide binding and amyloid fibril content became evident. This interaction was further confirmed using synthetic light chain fibrils that contain no carbohydrates. These data suggest that p5 can bind to both the sulfated glycosaminoglycans and protein fibril components of AL amyloid. Understanding these complex electrostatic interactions will aid in the optimization of synthetic peptides for use as amyloid imaging agents and potentially as therapeutics for the treatment of amyloid diseases. Copyright © 2013 Elsevier Inc. All rights reserved.

Quantitative Assessment of Peroxisome Proliferation in B6C3F1 Mouse Liver after Subchronic Exposure to Trichloroethylene by Gavage.

DTIC Science & Technology

1997-07-01

levels have been reported in association with a number of different peroxisome proliferators, such as clofibric acid (Bars, et al., 1993; Prough, et...exposure. Similar results have been reported for CYP4A1 mRNA after exposure to clofibric acid (Bars, et al., 1993). The present study also indicated...trichloroacetic acid (TCA), and dichloroacetic acid (DCA) (Herren-Freund, et al., 1987; Daniel, et al., 1992; DeAngelo, et al., 1991). Only CH has been found to

Bisphosphonates in the Prevention of Post-Traumatic Osteoarthritis

DTIC Science & Technology

David, et al . 2017 J Ortho Res. - Histological analysis of mouse joints following DMM demonstrated rapid (within 3-day of injury), and focal (spatially...Medial Meniscus in Mice (David, et al . 2018 In Preparation) - The present study has shown that repeated i. a. injection of ZA into the murine knee

The Neuroprotective Properties of Hericium erinaceus in Glutamate-Damaged Differentiated PC12 Cells and an Alzheimer’s Disease Mouse Model

PubMed Central

Zhang, Junrong; An, Shengshu; Hu, Wenji; Teng, Meiyu; Wang, Xue; Qu, Yidi; Liu, Yang; Yuan, Ye; Wang, Di

2016-01-01

Hericium erinaceus, an edible and medicinal mushroom, displays various pharmacological activities in the prevention of dementia in conditions such as Parkinson’s and Alzheimer’s disease. The present study explored the neuroprotective effects of H. erinaceus mycelium polysaccharide-enriched aqueous extract (HE) on an l-glutamic acid (l-Glu)-induced differentiated PC12 (DPC12) cellular apoptosis model and an AlCl3 combined with d-galactose-induced Alzheimer’s disease mouse model. The data revealed that HE successfully induced PC12 cell differentiation. A 3 h HE incubation at doses of 50 and 100 µg/mL before 25 mM of l-Glu effectively reversed the reduction of cell viability and the enhancement of the nuclear apoptosis rate in DPC12 cells. Compared with l-Glu-damaged cells, in PC12 cells, HE suppressed intracellular reactive oxygen species accumulation, blocked Ca2+ overload and prevented mitochondrial membrane potential (MMP) depolarization. In the Alzheimer’s disease mouse model, HE administration enhanced the horizontal and vertical movements in the autonomic activity test, improved the endurance time in the rotarod test, and decreased the escape latency time in the water maze test. It also improved the central cholinergic system function in the Alzheimer’s mice, demonstrated by the fact that it dose-dependently enhanced the acetylcholine (Ach) and choline acetyltransferase (ChAT) concentrations in both the serum and the hypothalamus. Our findings provide experimental evidence that HE may provide neuroprotective candidates for treating or preventing neurodegenerative diseases. PMID:27809277

Protective paraspeckle hyper-assembly downstream of TDP-43 loss of function in amyotrophic lateral sclerosis.

PubMed

Shelkovnikova, Tatyana A; Kukharsky, Michail S; An, Haiyan; Dimasi, Pasquale; Alexeeva, Svetlana; Shabir, Osman; Heath, Paul R; Buchman, Vladimir L

2018-06-01

Paraspeckles are subnuclear bodies assembled on a long non-coding RNA (lncRNA) NEAT1. Their enhanced formation in spinal neurons of sporadic amyotrophic lateral sclerosis (ALS) patients has been reported but underlying mechanisms are unknown. The majority of ALS cases are characterized by TDP-43 proteinopathy. In current study we aimed to establish whether and how TDP-43 pathology may augment paraspeckle assembly. Paraspeckle formation in human samples was analysed by RNA-FISH and laser capture microdissection followed by qRT-PCR. Mechanistic studies were performed in stable cell lines, mouse primary neurons and human embryonic stem cell-derived neurons. Loss and gain of function for TDP-43 and other microRNA pathway factors were modelled by siRNA-mediated knockdown and protein overexpression. We show that de novo paraspeckle assembly in spinal neurons and glial cells is a hallmark of both sporadic and familial ALS with TDP-43 pathology. Mechanistically, loss of TDP-43 but not its cytoplasmic accumulation or aggregation augments paraspeckle assembly in cultured cells. TDP-43 is a component of the microRNA machinery, and recently, paraspeckles have been shown to regulate pri-miRNA processing. Consistently, downregulation of core protein components of the miRNA pathway also promotes paraspeckle assembly. In addition, depletion of these proteins or TDP-43 results in accumulation of endogenous dsRNA and activation of type I interferon response which also stimulates paraspeckle formation. We demonstrate that human or mouse neurons in vitro lack paraspeckles, but a synthetic dsRNA is able to trigger their de novo formation. Finally, paraspeckles are protective in cells with compromised microRNA/dsRNA metabolism, and their assembly can be promoted by a small-molecule microRNA enhancer. Our study establishes possible mechanisms behind paraspeckle hyper-assembly in ALS and suggests their utility as therapeutic targets in ALS and other diseases with abnormal metabolism of microRNA and dsRNA.

In vivo detection of free radicals using molecular MRI and immuno-spin trapping in a mouse model for amyotrophic lateral sclerosis.

PubMed

Towner, Rheal A; Smith, Nataliya; Saunders, Debra; Lupu, Florea; Silasi-Mansat, Robert; West, Melinda; Ramirez, Dario C; Gomez-Mejiba, Sandra E; Bonini, Marcelo G; Mason, Ronald P; Ehrenshaft, Marilyn; Hensley, Kenneth

2013-10-01

Free radicals associated with oxidative stress play a major role in amyotrophic lateral sclerosis (ALS). By combining immuno-spin trapping and molecular magnetic resonance imaging, in vivo trapped radical adducts were detected in the spinal cords of SOD1(G93A)-transgenic (Tg) mice, a model for ALS. For this study, the nitrone spin trap DMPO (5,5-dimethyl-1-pyrroline N-oxide) was administered (ip) over 5 days before administration (iv) of an anti-DMPO probe (anti-DMPO antibody covalently bound to an albumin-gadolinium-diethylenetriamine pentaacetic acid-biotin MRI contrast agent) to trap free radicals. MRI was used to detect the presence of the anti-DMPO radical adducts by a significant sustained increase in MR signal intensities (p < 0.05) or anti-DMPO probe concentrations measured from T₁ relaxations (p < 0.01). The biotin moiety of the anti-DMPO probe was targeted with fluorescence-labeled streptavidin to locate the probe in excised tissues. Negative controls included either Tg ALS mice initially administered saline rather than DMPO followed by the anti-DMPO probe or non-Tg mice initially administered DMPO and then the anti-DMPO probe. The anti-DMPO probe was found to bind to neurons via colocalization fluorescence microscopy. DMPO adducts were also confirmed in diseased/nondiseased tissues from animals administered DMPO. Apparent diffusion coefficients from diffusion-weighted images of spinal cords from Tg mice were significantly elevated (p < 0.001) compared to wild-type controls. This is the first report regarding the detection of in vivo trapped radical adducts in an ALS model. This novel, noninvasive, in vivo diagnostic method can be applied to investigate the involvement of free radical mechanisms in ALS rodent models. Copyright © 2013 Elsevier Inc. All rights reserved.

Mutations in WNT7A cause a range of limb malformations, including Fuhrmann syndrome and Al-Awadi/Raas-Rothschild/Schinzel phocomelia syndrome.

PubMed

Woods, C G; Stricker, S; Seemann, P; Stern, R; Cox, J; Sherridan, E; Roberts, E; Springell, K; Scott, S; Karbani, G; Sharif, S M; Toomes, C; Bond, J; Kumar, D; Al-Gazali, L; Mundlos, S

2006-08-01

Fuhrmann syndrome and the Al-Awadi/Raas-Rothschild/Schinzel phocomelia syndrome are considered to be distinct limb-malformation disorders characterized by various degrees of limb aplasia/hypoplasia and joint dysplasia in humans. In families with these syndromes, we found homozygous missense mutations in the dorsoventral-patterning gene WNT7A and confirmed their functional significance in retroviral-mediated transfection of chicken mesenchyme cell cultures and developing limbs. The results suggest that a partial loss of WNT7A function causes Fuhrmann syndrome (and a phenotype similar to mouse Wnt7a knockout), whereas the more-severe limb truncation phenotypes observed in Al-Awadi/Raas-Rothschild/Schinzel phocomelia syndrome result from null mutations (and cause a phenotype similar to mouse Shh knockout). These findings illustrate the specific and conserved importance of WNT7A in multiple aspects of vertebrate limb development.

Mutations in WNT7A Cause a Range of Limb Malformations, Including Fuhrmann Syndrome and Al-Awadi/Raas-Rothschild/Schinzel Phocomelia Syndrome

PubMed Central

Woods, C. G.; Stricker, S.; Seemann, P.; Stern, R.; Cox, J.; Sherridan, E.; Roberts, E.; Springell, K.; Scott, S.; Karbani, G.; Sharif, S. M.; Toomes, C.; Bond, J.; Kumar, D.; Al-Gazali, L.; Mundlos, S.

2006-01-01

Fuhrmann syndrome and the Al-Awadi/Raas-Rothschild/Schinzel phocomelia syndrome are considered to be distinct limb-malformation disorders characterized by various degrees of limb aplasia/hypoplasia and joint dysplasia in humans. In families with these syndromes, we found homozygous missense mutations in the dorsoventral-patterning gene WNT7A and confirmed their functional significance in retroviral-mediated transfection of chicken mesenchyme cell cultures and developing limbs. The results suggest that a partial loss of WNT7A function causes Fuhrmann syndrome (and a phenotype similar to mouse Wnt7a knockout), whereas the more-severe limb truncation phenotypes observed in Al-Awadi/Raas-Rothschild/Schinzel phocomelia syndrome result from null mutations (and cause a phenotype similar to mouse Shh knockout). These findings illustrate the specific and conserved importance of WNT7A in multiple aspects of vertebrate limb development. PMID:16826533

The Role of the MHV Receptor and Related Glycoproteins in Murine Hepatitis Virus Infection of Murine Cell Lines

DTIC Science & Technology

1995-04-13

rhodamine-coupled goat anti -mouse antibody . A rare , fused Cl 1 D giant cell was selected to show (Al, while extensive fusion was common throughout the...mouse anti - MHV-AS9 antiserum. To quantify the lev el of susceptibility of cells to MHV infection , ten randomly selected fields for each sample...named CealO) was discovered and found to be co-expressed with MHVR in the CI 1 D and F40 lines of mouse fibroblasts. A monoclonal anti - MHVR

Derivation of Human Lethal Doses

DTIC Science & Technology

2006-01-19

1956; Blair, 1961; Mason et al., 1965; Clarke , 1969; Cretney, 1976; Gray et al., 1985). Gordon reported blood level of 5 mg/100ml in a victim. The...LD50 ( Clark et al., 1979). This is a primary source for the value. No LD50 for mouse Clinical Management of Poisoning and Drug Overdose 100 mL...Verschueren (2001) lists an oral LD50 range in various mammalian species as 30-112 mg/kg based on Clark et al., (1966 as cited in Verschueren, 2001

Elevated PGC-1α activity sustains mitochondrial biogenesis and muscle function without extending survival in a mouse model of inherited ALS.

PubMed

Da Cruz, Sandrine; Parone, Philippe A; Lopes, Vanda S; Lillo, Concepción; McAlonis-Downes, Melissa; Lee, Sandra K; Vetto, Anne P; Petrosyan, Susanna; Marsala, Martin; Murphy, Anne N; Williams, David S; Spiegelman, Bruce M; Cleveland, Don W

2012-05-02

The transcriptional coactivator PGC-1α induces multiple effects on muscle, including increased mitochondrial mass and activity. Amyotrophic lateral sclerosis (ALS) is a progressive, fatal, adult-onset neurodegenerative disorder characterized by selective loss of motor neurons and skeletal muscle degeneration. An early event is thought to be denervation-induced muscle atrophy accompanied by alterations in mitochondrial activity and morphology within muscle. We now report that elevation of PGC-1α levels in muscles of mice that develop fatal paralysis from an ALS-causing SOD1 mutant elevates PGC-1α-dependent pathways throughout disease course. Mitochondrial biogenesis and activity are maintained through end-stage disease, accompanied by retention of muscle function, delayed muscle atrophy, and significantly improved muscle endurance even at late disease stages. However, survival was not extended. Therefore, muscle is not a primary target of mutant SOD1-mediated toxicity, but drugs increasing PGC-1α activity in muscle represent an attractive therapy for maintaining muscle function during progression of ALS. Copyright © 2012 Elsevier Inc. All rights reserved.

Selective modulation of the prostaglandin F2α pathway markedly impacts on endometriosis progression in a xenograft mouse model.

PubMed

Ahmad, Syed Furquan; Akoum, Ali; Horne, Andrew W

2015-12-01

Selective activation or blockade of the prostaglandin (PG) F2α receptor (FP receptor) affects ectopic endometrial tissue growth and endometriosis development. FP receptor antagonists might represent a promising approach for the treatment of peritoneal endometriosis. Eutopic and ectopic endometrium from women with endometriosis exhibit higher expression of key enzymes involved in the PGF2α biosynthetic pathway. It has also been shown that the PGF2α-FP receptor interaction induces angiogenesis in human endometrial adenocarcinoma. For this study, a mouse model of endometriosis was developed by inoculating human endometrial biopsies into the peritoneal cavity of nude mouse (n = 15). Mice were treated with AL8810 (FP receptor antagonist), Fluprostenol (FP receptor agonist) or PBS. Endometriosis-like lesions were collected and analysed for set of markers for angiogenesis, tissue remodelling, apoptosis, cell proliferation and capillary formation using qPCR and immunohistochemistry. We found that selective inhibition of the FP receptor with a specific antagonist, AL8810, led to a significant decline in the number (P < 0.01) and size of endometriosis-like lesions (P < 0.001), down-regulated the expression of key mediators of tissue remodelling (MMP9, P < 0.05) and angiogenesis (VEGF, P < 0.01) and up-regulated the pro-apoptotic factor (Bax, P < 0.01) as compared with controls. Immunohistochemical analyses further showed a marked decrease in cell proliferation and capillary formation in endometrial implants from AL8810-treated mice, as determined by proliferating cell nuclear antigen (PCNA) and von Willebrand factor (vWF) immunostaining, respectively. Moreover, Fluprostenol, a selective FP receptor agonist, showed the opposite effects. We carried out this study in nude mice, which have low levels of endogenous estrogens which may affect the lesion growth. Caution is required when interpreting these results to women. This study extends the role of PG signalling in endometriosis pathogenesis and points towards the possible relevance of selective FP receptor antagonism as a targeted treatment for endometriosis. Not Applicable. This work was supported by grant MOP-123259 to the late Dr Ali Akoum from the Canadian Institutes for Health Research. The authors have no conflict of interest. © The Author 2015. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Mutations in the latent TGF-beta binding protein 3 (LTBP3) gene cause brachyolmia with amelogenesis imperfecta

PubMed Central

Huckert, Mathilde; Stoetzel, Corinne; Morkmued, Supawich; Laugel-Haushalter, Virginie; Geoffroy, Véronique; Muller, Jean; Clauss, François; Prasad, Megana K.; Obry, Frédéric; Raymond, Jean Louis; Switala, Marzena; Alembik, Yves; Soskin, Sylvie; Mathieu, Eric; Hemmerlé, Joseph; Weickert, Jean-Luc; Dabovic, Branka Brukner; Rifkin, Daniel B.; Dheedene, Annelies; Boudin, Eveline; Caluseriu, Oana; Cholette, Marie-Claude; Mcleod, Ross; Antequera, Reynaldo; Gellé, Marie-Paule; Coeuriot, Jean-Louis; Jacquelin, Louis-Frédéric; Bailleul-Forestier, Isabelle; Manière, Marie-Cécile; Van Hul, Wim; Bertola, Debora; Dollé, Pascal; Verloes, Alain; Mortier, Geert; Dollfus, Hélène; Bloch-Zupan, Agnès

2015-01-01

Inherited dental malformations constitute a clinically and genetically heterogeneous group of disorders. Here, we report on four families, three of them consanguineous, with an identical phenotype, characterized by significant short stature with brachyolmia and hypoplastic amelogenesis imperfecta (AI) with almost absent enamel. This phenotype was first described in 1996 by Verloes et al. as an autosomal recessive form of brachyolmia associated with AI. Whole-exome sequencing resulted in the identification of recessive hypomorphic mutations including deletion, nonsense and splice mutations, in the LTBP3 gene, which is involved in the TGF-beta signaling pathway. We further investigated gene expression during mouse development and tooth formation. Differentiated ameloblasts synthesizing enamel matrix proteins and odontoblasts expressed the gene. Study of an available knockout mouse model showed that the mutant mice displayed very thin to absent enamel in both incisors and molars, hereby recapitulating the AI phenotype in the human disorder. PMID:25669657

Disturbed mouse circadian rhythm before the Kobe EQ in 1995

NASA Astrophysics Data System (ADS)

Yokoi, Sayoko

2013-04-01

Legends of macro-anomalies before large earthquakes have been passed down for generations in Asia. Most of the statements on earthquake precursors are considered unreliable afterthoughts by traditional scientists. However, disturbed biological rhythms in mice were observed before the Kobe EQ in 1995 (Yokoi et al, 2003). The records of unusual mouse behavior before the earthquake were obtained to study biological clock at Institute for Protein Research, Osaka University. It is clarified that the disturbance was very rare phenomena statistically. Similar phenomenon was observed before the Wenchuan earthquake in 2008, too (Li et al, 2009). In the presentation, I will discuss the phenomena as one example of preseismic unusual animal behaviors.

More than a bystander: the contributions of intrinsic skeletal muscle defects in motor neuron diseases

PubMed Central

Boyer, Justin G.; Ferrier, Andrew; Kothary, Rashmi

2013-01-01

Spinal muscular atrophy (SMA), amyotrophic lateral sclerosis (ALS), and spinal-bulbar muscular atrophy (SBMA) are devastating diseases characterized by the degeneration of motor neurons. Although the molecular causes underlying these diseases differ, recent findings have highlighted the contribution of intrinsic skeletal muscle defects in motor neuron diseases. The use of cell culture and animal models has led to the important finding that muscle defects occur prior to and independently of motor neuron degeneration in motor neuron diseases. In SMA for instance, the muscle specific requirements of the SMA disease-causing gene have been demonstrated by a series of genetic rescue experiments in SMA models. Conditional ALS mouse models expressing a muscle specific mutant SOD1 gene develop atrophy and muscle degeneration in the absence of motor neuron pathology. Treating SBMA mice by over-expressing IGF-1 in a skeletal muscle-specific manner attenuates disease severity and improves motor neuron pathology. In the present review, we provide an in depth description of muscle intrinsic defects, and discuss how they impact muscle function in these diseases. Furthermore, we discuss muscle-specific therapeutic strategies used to treat animal models of SMA, ALS, and SBMA. The study of intrinsic skeletal muscle defects is crucial for the understanding of the pathophysiology of these diseases and will open new therapeutic options for the treatment of motor neuron diseases. PMID:24391590

Science to Practice: The Changing Face of Local Tumor Therapies-Do We Have to Think Systemically When Treating Cancer Locally?

PubMed

Chapiro, Julius; Geschwind, Jean-François

2015-08-01

In this issue, Rozenblum et al ( 1 ) were able to demonstrate that radiofrequency (RF) ablation-induced liver regeneration promotes "off-target" tumorigenesis in a MDR2 knock-out mouse model of hepatocellular carcinoma (HCC) in the setting of chronic liver inflammation. In addition, the authors demonstrated that blocking liver regeneration with a c-met inhibitor might attenuate or eliminate potential tumorigenic effects. These results provide the rationale for combined therapeutic approaches of RF ablation followed by a systemic application of immunomodulatory drugs.

Role of the 5HT3 Receptor in Alcohol Drinking and Aggression Using A Transgenic Mouse Model

DTIC Science & Technology

2005-09-01

HT3-OE mice, proliferation, survival and differentiation were quantified in the DG and depression-like behavior was examined using the forced swim ... FORCED SWIM TEST 15 animals from each genotype were tested. Mice were placed in a 30 cm diameter, 46 cm tall cylinder of water (22-25°C, depth...26 cm) and forced to swim for 6 minutes as described previously (43, 44). Six behaviors were scored as described by Scramm et al. (45). 1=floating, 2

WIP1 deficiency inhibits HTLV-1 Tax oncogenesis: novel therapeutic prospects for treatment of ATL?

PubMed Central

2012-01-01

Attenuation of p53 activity appears to be a major step in Human T-lymphotropic virus type 1 (HTLV-1) Tax transformation. However, p53 genomic mutations are late and rather infrequent events in HTLV-1 induced Adult T cell leukemia (ATL). The paper by Zane et al. shows that a mediator of p53 activity, Wild-type p53-induced phosphatase 1 (Wip1), contributes to Tax-induced oncogenesis in a mouse model. Wip1 may therefore be a novel target for therapeutic approaches. PMID:23256570

Intermittent fasting alleviates the neuropathic phenotype in a mouse model of Charcot-Marie-Tooth disease

PubMed Central

Madorsky, Irina; Opalach, Katherine; Waber, Amanda; Verrier, Jonathan D.; Solmo, Chelsea; Foster, Thomas; Dunn, William A; Notterpek, Lucia

2009-01-01

Charcot-Marie-Tooth type 1A (CMT1A) neuropathies linked to the misexpression of peripheral myelin protein 22 (PMP22) are progressive demyelinating disorders of the peripheral nervous system. In this study we asked whether dietary restriction by intermittent fasting (IF) could alleviate the neuropathic phenotype in the Trembler J (TrJ) mouse model of CMT1A. Our results show that neuropathic mice kept on a five month long IF regimen had improved locomotor performance compared to ad libitum (AL) fed littermates. The functional benefits of this dietary intervention are associated with an increased expression of myelin proteins combined with a thicker myelin sheath, less redundant basal lamina, and a reduction in aberrant Schwann cell proliferation. These morphological improvements are accompanied by a decrease in PMP22 protein aggregates, and enhanced expression of cytosolic chaperones and constituents of the autophagy-lysosomal pathway. These results indicate that dietary restriction is beneficial for peripheral nerve function in TrJ neuropathic mice, as it promotes the maintenance of locomotor performance. PMID:19320048

An activated form of ADAM10 is tumor selective and regulates cancer stem-like cells and tumor growth.

PubMed

Atapattu, Lakmali; Saha, Nayanendu; Chheang, Chanly; Eissman, Moritz F; Xu, Kai; Vail, Mary E; Hii, Linda; Llerena, Carmen; Liu, Zhanqi; Horvay, Katja; Abud, Helen E; Kusebauch, Ulrike; Moritz, Robert L; Ding, Bi-Sen; Cao, Zhongwei; Rafii, Shahin; Ernst, Matthias; Scott, Andrew M; Nikolov, Dimitar B; Lackmann, Martin; Janes, Peter W

2016-08-22

The transmembrane metalloprotease ADAM10 sheds a range of cell surface proteins, including ligands and receptors of the Notch, Eph, and erbB families, thereby activating signaling pathways critical for tumor initiation and maintenance. ADAM10 is thus a promising therapeutic target. Although widely expressed, its activity is normally tightly regulated. We now report prevalence of an active form of ADAM10 in tumors compared with normal tissues, in mouse models and humans, identified by our conformation-specific antibody mAb 8C7. Structure/function experiments indicate mAb 8C7 binds an active conformation dependent on disulfide isomerization and oxidative conditions, common in tumors. Moreover, this active ADAM10 form marks cancer stem-like cells with active Notch signaling, known to mediate chemoresistance. Importantly, specific targeting of active ADAM10 with 8C7 inhibits Notch activity and tumor growth in mouse models, particularly regrowth after chemotherapy. Our results indicate targeted inhibition of active ADAM10 as a potential therapy for ADAM10-dependent tumor development and drug resistance. © 2016 Atapattu et al.

Biomarkers for AAA: Encouraging steps but clinical relevance still to be delivered.

PubMed

Htun, Nay Min; Peter, Karlheinz

2014-10-01

Potential biomarkers have been investigated using proteomic studies in a variety of diseases. Some biomarkers have central roles in both diagnosis and monitoring of various disorders in clinical medicine, such as troponins, brain natriuretic peptide, and C-reactive protein. Although several biomarkers have been suggested in human abdominal aortic aneurysm (AAA), reliable markers have been lacking. In this issue, Moxon et al. [Proteomics Clin Appl. 2014, 8, 762-772] undertook a broad and systematic proteomic approach toward identification of biomarkers in a commonly used AAA mouse model (AAA created by angiotensin-II infusion). In this mouse model, apolipoprotein C1 and matrix metalloproteinase-9 were identified as novel biomarkers of stable AAA. This finding represents an important step forward, toward a clinically relevant role of biomarkers in AAA. This also encourages for further studies toward the identification of biomarkers (or their combinations) that can predict AAA progression and rupture, which would represent a major progress in AAA management and would establish an AAA biomarker as a much anticipated clinical tool. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Major Histocompatibility Complex I Expression by Motor Neurons and Its Implication in Amyotrophic Lateral Sclerosis

PubMed Central

Nardo, Giovanni; Trolese, Maria Chiara; Bendotti, Caterina

2016-01-01

Neuronal expression of major histocompatibility complex I (MHCI)-related molecules in adults and during CNS diseases is involved in the synaptic plasticity and axonal regeneration with mechanisms either dependent or independent of their immune functions. Motor neurons are highly responsive in triggering the expression of MHCI molecules during normal aging or following insults and diseases, and this has implications in the synaptic controls, axonal regeneration, and neuromuscular junction stability of these neurons. We recently reported that MHCI and immunoproteasome are strongly activated in spinal motor neurons and their peripheral motor axon in a mouse model of familial amyotrophic lateral sclerosis (ALS) during the course of the disease. This response was prominent in ALS mice with slower disease progression in which the axonal structure and function was better preserved than in fast-progressing mice. This review summarizes and discusses our observations in the light of knowledge about the possible role of MHCI in motor neurons providing additional insight into the pathophysiology of ALS. PMID:27379008

Inhibition on Breast Cancer Induced Bone Pain, Metastasis and Osteolysis in Nude Mice by LOVAZA and DHA Fattty Acids

DTIC Science & Technology

2011-10-01

GCGGTTGTCCC/CATGGTAACAGCATTGCAGGTGC (30 cycles); mouse ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 ...follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1 FIGURE 8A 8 324bp, and GAPDH 233bp as seen in Figure 8A. Reference: Malin S, et al. (2007

Caspase 6 has a protective role in SOD1(G93A) transgenic mice.

PubMed

Hogg, Marion C; Mitchem, Mollie R; König, Hans-Georg; Prehn, Jochen H M

2016-06-01

In amyotrophic lateral sclerosis (ALS), it has been suggested that the process of neurodegeneration starts at the neuromuscular junction and is propagated back along axons towards motor neurons. Caspase-dependent pathways are well established as a cause of motor neuron death, and recent work in other disease models indicated a role for caspase 6 in axonal degeneration. Therefore we hypothesised that caspase 6 may be involved in motor neuron death in ALS. To investigate the role of caspase 6 in ALS we profiled protein levels of caspase-6 throughout disease progression in the ALS mouse model SOD1(G93A); this did not reveal differences in caspase 6 levels during disease. To investigate the role of caspase 6 further we generated a colony with SOD1(G93A) transgenic mice lacking caspase 6. Analysis of the transgenic SOD1(G93A); Casp6(-/-) revealed an exacerbated phenotype with motor dysfunction occurring earlier and a significantly shortened lifespan when compared to transgenic SOD1(G93A); Casp6(+/+) mice. Immunofluorescence analysis of the neuromuscular junction revealed no obvious difference between caspase 6(+/+) and caspase 6(-/-) in non-transgenic mice, while the SOD1(G93A) transgenic mice showed severe degeneration compared to non-transgenic mice in both genotypes. Our data indicate that caspase-6 does not exacerbate ALS pathogenesis, but may have a protective role. Copyright © 2016 Elsevier B.V. All rights reserved.

Toward an organ based dose prescription method for the improved accuracy of murine dose in orthovoltage x-ray irradiators.

PubMed

Belley, Matthew D; Wang, Chu; Nguyen, Giao; Gunasingha, Rathnayaka; Chao, Nelson J; Chen, Benny J; Dewhirst, Mark W; Yoshizumi, Terry T

2014-03-01

Accurate dosimetry is essential when irradiating mice to ensure that functional and molecular endpoints are well understood for the radiation dose delivered. Conventional methods of prescribing dose in mice involve the use of a single dose rate measurement and assume a uniform average dose throughout all organs of the entire mouse. Here, the authors report the individual average organ dose values for the irradiation of a 12, 23, and 33 g mouse on a 320 kVp x-ray irradiator and calculate the resulting error from using conventional dose prescription methods. Organ doses were simulated in the Geant4 application for tomographic emission toolkit using the MOBY mouse whole-body phantom. Dosimetry was performed for three beams utilizing filters A (1.65 mm Al), B (2.0 mm Al), and C (0.1 mm Cu + 2.5 mm Al), respectively. In addition, simulated x-ray spectra were validated with physical half-value layer measurements. Average doses in soft-tissue organs were found to vary by as much as 23%-32% depending on the filter. Compared to filters A and B, filter C provided the hardest beam and had the lowest variation in soft-tissue average organ doses across all mouse sizes, with a difference of 23% for the median mouse size of 23 g. This work suggests a new dose prescription method in small animal dosimetry: it presents a departure from the conventional approach of assigninga single dose value for irradiation of mice to a more comprehensive approach of characterizing individual organ doses to minimize the error and uncertainty. In human radiation therapy, clinical treatment planning establishes the target dose as well as the dose distribution, however, this has generally not been done in small animal research. These results suggest that organ dose errors will be minimized by calibrating the dose rates for all filters, and using different dose rates for different organs.

Toward an organ based dose prescription method for the improved accuracy of murine dose in orthovoltage x-ray irradiators

PubMed Central

Belley, Matthew D.; Wang, Chu; Nguyen, Giao; Gunasingha, Rathnayaka; Chao, Nelson J.; Chen, Benny J.; Dewhirst, Mark W.; Yoshizumi, Terry T.

2014-01-01

Purpose: Accurate dosimetry is essential when irradiating mice to ensure that functional and molecular endpoints are well understood for the radiation dose delivered. Conventional methods of prescribing dose in mice involve the use of a single dose rate measurement and assume a uniform average dose throughout all organs of the entire mouse. Here, the authors report the individual average organ dose values for the irradiation of a 12, 23, and 33 g mouse on a 320 kVp x-ray irradiator and calculate the resulting error from using conventional dose prescription methods. Methods: Organ doses were simulated in the Geant4 application for tomographic emission toolkit using the MOBY mouse whole-body phantom. Dosimetry was performed for three beams utilizing filters A (1.65 mm Al), B (2.0 mm Al), and C (0.1 mm Cu + 2.5 mm Al), respectively. In addition, simulated x-ray spectra were validated with physical half-value layer measurements. Results: Average doses in soft-tissue organs were found to vary by as much as 23%–32% depending on the filter. Compared to filters A and B, filter C provided the hardest beam and had the lowest variation in soft-tissue average organ doses across all mouse sizes, with a difference of 23% for the median mouse size of 23 g. Conclusions: This work suggests a new dose prescription method in small animal dosimetry: it presents a departure from the conventional approach of assigning a single dose value for irradiation of mice to a more comprehensive approach of characterizing individual organ doses to minimize the error and uncertainty. In human radiation therapy, clinical treatment planning establishes the target dose as well as the dose distribution, however, this has generally not been done in small animal research. These results suggest that organ dose errors will be minimized by calibrating the dose rates for all filters, and using different dose rates for different organs. PMID:24593746

Toward an organ based dose prescription method for the improved accuracy of murine dose in orthovoltage x-ray irradiators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belley, Matthew D.; Wang, Chu; Nguyen, Giao

2014-03-15

Purpose: Accurate dosimetry is essential when irradiating mice to ensure that functional and molecular endpoints are well understood for the radiation dose delivered. Conventional methods of prescribing dose in mice involve the use of a single dose rate measurement and assume a uniform average dose throughout all organs of the entire mouse. Here, the authors report the individual average organ dose values for the irradiation of a 12, 23, and 33 g mouse on a 320 kVp x-ray irradiator and calculate the resulting error from using conventional dose prescription methods. Methods: Organ doses were simulated in the Geant4 application formore » tomographic emission toolkit using the MOBY mouse whole-body phantom. Dosimetry was performed for three beams utilizing filters A (1.65 mm Al), B (2.0 mm Al), and C (0.1 mm Cu + 2.5 mm Al), respectively. In addition, simulated x-ray spectra were validated with physical half-value layer measurements. Results: Average doses in soft-tissue organs were found to vary by as much as 23%–32% depending on the filter. Compared to filters A and B, filter C provided the hardest beam and had the lowest variation in soft-tissue average organ doses across all mouse sizes, with a difference of 23% for the median mouse size of 23 g. Conclusions: This work suggests a new dose prescription method in small animal dosimetry: it presents a departure from the conventional approach of assigninga single dose value for irradiation of mice to a more comprehensive approach of characterizing individual organ doses to minimize the error and uncertainty. In human radiation therapy, clinical treatment planning establishes the target dose as well as the dose distribution, however, this has generally not been done in small animal research. These results suggest that organ dose errors will be minimized by calibrating the dose rates for all filters, and using different dose rates for different organs.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, Emily B.; Williams, Angela; Heidel, Eric

Highlights: •Polybasic peptide p5 binds human light chain amyloid extracts. •The binding of p5 with amyloid involves both glycosaminoglycans and fibrils. •Heparinase treatment led to a correlation between p5 binding and fibril content. •p5 binding to AL amyloid requires electrostatic interactions. -- Abstract: In previously published work, we have described heparin-binding synthetic peptides that preferentially recognize amyloid deposits in a mouse model of reactive systemic (AA) amyloidosis and can be imaged by using positron and single photon emission tomographic imaging. We wanted to extend these findings to the most common form of visceral amyloidosis, namely light chain (AL); however, theremore » are no robust experimental animal models of AL amyloidosis. To further define the binding of the lead peptide, p5, to AL amyloid, we characterized the reactivity in vitro of p5 with in situ and patient-derived AL amyloid extracts which contain both hypersulfated heparan sulfate proteoglycans as well as amyloid fibrils. Histochemical staining demonstrated that the peptide specifically localized with tissue-associated AL amyloid deposits. Although we anticipated that p5 would undergo electrostatic interactions with the amyloid-associated glycosaminoglycans expressing heparin-like side chains, no significant correlation between peptide binding and glycosaminoglycan content within amyloid extracts was observed. In contrast, following heparinase I treatment, although overall binding was reduced, a positive correlation between peptide binding and amyloid fibril content became evident. This interaction was further confirmed using synthetic light chain fibrils that contain no carbohydrates. These data suggest that p5 can bind to both the sulfated glycosaminoglycans and protein fibril components of AL amyloid. Understanding these complex electrostatic interactions will aid in the optimization of synthetic peptides for use as amyloid imaging agents and potentially as therapeutics for the treatment of amyloid diseases.« less

Host range phenotype induced by mutations in the internal ribosomal entry site of poliovirus RNA.

PubMed Central

Shiroki, K; Ishii, T; Aoki, T; Ota, Y; Yang, W X; Komatsu, T; Ami, Y; Arita, M; Abe, S; Hashizume, S; Nomoto, A

1997-01-01

Most poliovirus strains infect only primates. The host range (HR) of poliovirus is thought to be primarily determined by a cell surface molecule that functions as poliovirus receptor (PVR), since it has been shown that transgenic mice are made poliovirus sensitive by introducing the human PVR gene into the genome. The relative levels of neurovirulence of polioviruses tested in these transgenic mice were shown to correlate well with the levels tested in monkeys (H. Horie et al., J. Virol. 68:681-688, 1994). Mutants of the virulent Mahoney strain of poliovirus have been generated by disruption of nucleotides 128 to 134, at stem-loop II within the 5' noncoding region, and four of these mutants multiplicated well in human HeLa cells but poorly in mouse TgSVA cells that had been established from the kidney of the poliovirus-sensitive transgenic mouse. Neurovirulence tests using the two animal models revealed that these mutants were strongly attenuated only in tests with the mouse model and were therefore HR mutants. The virus infection cycle in TgSVA cells was restricted by an internal ribosomal entry site (IRES)-dependent initiation process of translation. Viral protein synthesis and the associated block of cellular protein synthesis were not observed in TgSVA cells infected with three of four HR mutants and was evident at only a low level in the remaining mutant. The mutant RNAs were functional in a cell-free protein synthesis system from HeLa cells but not in those from TgSVA and mouse neuroblastoma NS20Y cells. These results suggest that host factor(s) affecting IRES-dependent translation of poliovirus differ between human and mouse cells and that the mutant IRES constructs detect species differences in such host factor(s). The IRES could potentially be a host range determinant for poliovirus infection. PMID:8985316

Quantitative mouse brain phenotyping based on single and multispectral MR protocols

PubMed Central

Badea, Alexandra; Gewalt, Sally; Avants, Brian B.; Cook, James J.; Johnson, G. Allan

2013-01-01

Sophisticated image analysis methods have been developed for the human brain, but such tools still need to be adapted and optimized for quantitative small animal imaging. We propose a framework for quantitative anatomical phenotyping in mouse models of neurological and psychiatric conditions. The framework encompasses an atlas space, image acquisition protocols, and software tools to register images into this space. We show that a suite of segmentation tools (Avants, Epstein et al., 2008) designed for human neuroimaging can be incorporated into a pipeline for segmenting mouse brain images acquired with multispectral magnetic resonance imaging (MR) protocols. We present a flexible approach for segmenting such hyperimages, optimizing registration, and identifying optimal combinations of image channels for particular structures. Brain imaging with T1, T2* and T2 contrasts yielded accuracy in the range of 83% for hippocampus and caudate putamen (Hc and CPu), but only 54% in white matter tracts, and 44% for the ventricles. The addition of diffusion tensor parameter images improved accuracy for large gray matter structures (by >5%), white matter (10%), and ventricles (15%). The use of Markov random field segmentation further improved overall accuracy in the C57BL/6 strain by 6%; so Dice coefficients for Hc and CPu reached 93%, for white matter 79%, for ventricles 68%, and for substantia nigra 80%. We demonstrate the segmentation pipeline for the widely used C57BL/6 strain, and two test strains (BXD29, APP/TTA). This approach appears promising for characterizing temporal changes in mouse models of human neurological and psychiatric conditions, and may provide anatomical constraints for other preclinical imaging, e.g. fMRI and molecular imaging. This is the first demonstration that multiple MR imaging modalities combined with multivariate segmentation methods lead to significant improvements in anatomical segmentation in the mouse brain. PMID:22836174

Mouse Genome Informatics (MGI): Resources for Mining Mouse Genetic, Genomic, and Biological Data in Support of Primary and Translational Research.

PubMed

Eppig, Janan T; Smith, Cynthia L; Blake, Judith A; Ringwald, Martin; Kadin, James A; Richardson, Joel E; Bult, Carol J

2017-01-01

The Mouse Genome Informatics (MGI), resource ( www.informatics.jax.org ) has existed for over 25 years, and over this time its data content, informatics infrastructure, and user interfaces and tools have undergone dramatic changes (Eppig et al., Mamm Genome 26:272-284, 2015). Change has been driven by scientific methodological advances, rapid improvements in computational software, growth in computer hardware capacity, and the ongoing collaborative nature of the mouse genomics community in building resources and sharing data. Here we present an overview of the current data content of MGI, describe its general organization, and provide examples using simple and complex searches, and tools for mining and retrieving sets of data.

Finding mouse models of human lymphomas and leukemia's using the Jackson laboratory mouse tumor biology database.

PubMed

Begley, Dale A; Sundberg, John P; Krupke, Debra M; Neuhauser, Steven B; Bult, Carol J; Eppig, Janan T; Morse, Herbert C; Ward, Jerrold M

2015-12-01

Many mouse models have been created to study hematopoietic cancer types. There are over thirty hematopoietic tumor types and subtypes, both human and mouse, with various origins, characteristics and clinical prognoses. Determining the specific type of hematopoietic lesion produced in a mouse model and identifying mouse models that correspond to the human subtypes of these lesions has been a continuing challenge for the scientific community. The Mouse Tumor Biology Database (MTB; http://tumor.informatics.jax.org) is designed to facilitate use of mouse models of human cancer by providing detailed histopathologic and molecular information on lymphoma subtypes, including expertly annotated, on line, whole slide scans, and providing a repository for storing information on and querying these data for specific lymphoma models. Copyright © 2015 Elsevier Inc. All rights reserved.

Soma size and Cav1.3 channel expression in vulnerable and resistant motoneuron populations of the SOD1G93A mouse model of ALS

PubMed Central

Shoenfeld, Liza; Westenbroek, Ruth E.; Fisher, Erika; Quinlan, Katharina A.; Tysseling, Vicki M.; Powers, Randall K.; Heckman, Charles J.; Binder, Marc D.

2014-01-01

Abstract Although the loss of motoneurons is an undisputed feature of amyotrophic lateral sclerosis (ALS) in man and in its animal models (SOD1 mutant mice), how the disease affects the size and excitability of motoneurons prior to their degeneration is not well understood. This study was designed to test the hypothesis that motoneurons in mutant SOD1G93A mice exhibit an enlargement of soma size (i.e., cross‐sectional area) and an increase in Cav1.3 channel expression at postnatal day 30, well before the manifestation of physiological symptoms that typically occur at p90 (Chiu et al. 1995). We made measurements of spinal and hypoglossal motoneurons vulnerable to degeneration, as well as motoneurons in the oculomotor nucleus that are resistant to degeneration. Overall, we found that the somata of motoneurons in male SOD1G93A mutants were larger than those in wild‐type transgenic males. When females were included in the two groups, significance was lost. Expression levels of the Cav1.3 channels were not differentiated by genotype, sex, or any interaction of the two. These results raise the intriguing possibility of an interaction between male sex steroid hormones and the SOD1 mutation in the etiopathogenesis of ALS. PMID:25107988

In vitro and in vivo drug disposition of cilengitide in animals and human.

PubMed

Dolgos, Hugues; Freisleben, Achim; Wimmer, Elmar; Scheible, Holger; Krätzer, Friedrich; Yamagata, Tetsuo; Gallemann, Dieter; Fluck, Markus

2016-04-01

Cilengitide is very low permeable (1.0 nm/sec) stable cyclic pentapeptide containing an Arg-Gly-Asp motif responsible for selective binding to αvβ3 and αvβ5 integrins administered intravenously (i.v.). In vivo studies in the mouse and Cynomolgus monkeys showed the major component in plasma was unchanged drug (>85%). These results, together with the absence of metabolism in vitro and in animals, indicate minimal metabolism in both species. The excretion of [(14)C]-cilengitide showed profound species differences, with a high renal excretion of the parent drug observed in Cynomolgus monkey (50% dose), but not in mouse (7 and 28%: m/f). Consistently fecal (biliary) secretion was high in mouse (87 and 66% dose: m/f) but low in Cynomolgus monkey (36.5%). Human volunteers administrated with [(14)C]-cilengitide showed that most of the dose was recovered in urine as unchanged drug (77.5%, referred to Becker et al. 2015), indicating that the Cynomolgus monkey was the closer species to human. In order to better understand the species difference between human and mouse, the hepatobiliary disposition of [(14)C]-cilengitide was determined in sandwich-cultured hepatocytes. Cilengitide exhibited modest biliary efflux (30-40%) in mouse, while in human hepatocytes this was negligible. Furthermore, it was confirmed that the uptake of cilengitide into human hepatocytes was minor and appeared to be passive. In summary, the extent of renal and biliary secretion of cilengitide appears to be highly species specific and is qualitatively well explained using sandwich hepatocyte culture models.

Rats, cats, and elephants, but still no unicorn: induced pluripotent stem cells from new species.

PubMed

Trounson, Alan

2009-01-09

Two independent studies in this issue of Cell Stem Cell (Liao et al., 2009; Li et al., 2009) derive rat induced pluripotent stem cells (iPSCs). In one report, the method used results in rat and human iPSCs that exhibit phenotypic traits similar to mouse embryonic stem cells.

Reduced nursing frequency during prolonged lactation in the mouse decreases milk production and increases mammary expression of tryptophan hydroxylase 1 (TPH1), but does not accelerate mammary gland remodeling

USDA-ARS?s Scientific Manuscript database

We have observed that lactating mouse dams nursed 4 times per day (4X) maintained lactation, but had lower milk yields by the weigh-suckle-weigh method, than dams nursed ad libitum (AL). Therefore, we hypothesized that decreased nursing frequency would also decrease lactation persistence, increase m...

Triheptanoin Protects Motor Neurons and Delays the Onset of Motor Symptoms in a Mouse Model of Amyotrophic Lateral Sclerosis

PubMed Central

Barkl-Luke, Mallory E.; Ngo, Shyuan T.; Thomas, Nicola K.; McDonald, Tanya S.; Borges, Karin

2016-01-01

There is increasing evidence that energy metabolism is disturbed in Amyotrophic Lateral Sclerosis (ALS) patients and animal models. Treatment with triheptanoin, the triglyceride of heptanoate, is a promising approach to provide alternative fuel to improve oxidative phosphorylation and aid ATP generation. Heptanoate can be metabolized to propionyl-CoA, which after carboxylation can produce succinyl-CoA and thereby re-fill the tricarboxylic acid (TCA) cycle (anaplerosis). Here we tested the hypothesis that treatment with triheptanoin prevents motor neuron loss and delays the onset of disease symptoms in female mice overexpressing the mutant human SOD1G93A (hSOD1G93A) gene. When oral triheptanoin (35% of caloric content) was initiated at P35, motor neuron loss at 70 days of age was attenuated by 33%. In untreated hSOD1G93A mice, the loss of hind limb grip strength began at 16.7 weeks. Triheptanoin maintained hind limb grip strength for 2.8 weeks longer (p<0.01). Loss of balance on the rotarod and reduction of body weight were delayed by 13 and 11 days respectively (both p<0.01). Improved motor function occurred in parallel with alterations in the expression of genes associated with muscle metabolism. In gastrocnemius muscles, the mRNA levels of pyruvate, 2-oxoglutarate and succinate dehydrogenases and methyl-malonyl mutase were reduced by 24–33% in 10 week old hSOD1G93A mice when compared to wild-type mice, suggesting that TCA cycling in skeletal muscle may be slowed in this ALS mouse model at a stage when muscle strength is still normal. At 25 weeks of age, mRNA levels of succinate dehydrogenases, glutamic pyruvic transaminase 2 and the propionyl carboxylase β subunit were reduced by 69–84% in control, but not in triheptanoin treated hSOD1G93A animals. Taken together, our results suggest that triheptanoin slows motor neuron loss and the onset of motor symptoms in ALS mice by improving TCA cycling. PMID:27564703

Alternative models in developmental toxicology.

PubMed

Lee, Hyung-yul; Inselman, Amy L; Kanungo, Jyotshnabala; Hansen, Deborah K

2012-02-01

In light of various pressures, toxicologists have been searching for alternative methods for safety testing of chemicals. According to a recent policy in the European Union (Regulation, Evaluation Authorisation and Restriction of Chemicals, REACH), it has been estimated that over the next twelve to fifteen years, approximately 30,000 chemicals may need to be tested for safety, and under current guidelines such testing would require the use of approximately 7.2 million laboratory animals [ Hofer et al. 2004 ]. It has also been estimated that over 80% of all animals used for safety testing under REACH legislation would be used for examining reproductive and developmental toxicity [Hofer et al., 2004]. In addition to REACH initiatives, it has been estimated that out of 5,000 to 10,000 new drug entities that a pharmaceutical company may start with, only one is finally approved by the Food and Drug Administration at a cost of over one billion dollars [ Garg et al. 2011 ]. A large portion of this cost is due to animal testing. Therefore, both the pharmaceutical and chemical industries are interested in using alternative models and in vitro tests for safety testing. This review will examine the current state of three alternative models - whole embryo culture (WEC), the mouse embryonic stem cell test (mEST), and zebrafish. Each of these alternatives will be reviewed, and advantages and disadvantages of each model will be discussed. These models were chosen because they are the models most commonly used and would appear to have the greatest potential for future applications in developmental toxicity screening and testing.

Concomitant differentiation of a population of mouse embryonic stem cells into neuron-like cells and Schwann cell-like cells in a slow-flow microfluidic device

PubMed Central

Ramamurthy, Poornapriya; White, Joshua B.; Park, Joong Yull; Hume, Richard I.; Ebisu, Fumi; Mendez, Flor; Takayama, Shuichi; Barald, Kate F

2016-01-01

Background To send meaningful information to the brain, an inner ear cochlear implant (CI) must become closely coupled to as large and healthy a population of remaining Spiral Ganglion Neurons (SGN) as possible. Inner ear gangliogenesis depends on macrophage migration inhibitory factor (MIF), a directionally attractant neurotrophic cytokine made by both Schwann and supporting cells (Bank et al., 2012). MIF-induced mouse embryonic stem cell (mESC)-derived “neurons” could potentially substitute for lost or damaged SGN. mESC-derived “Schwann cells” produce MIF as do all Schwann cells (Huang et al., 2002; Roth et al., 2007, 2008) and could attract SGN to “ cell coated” implant. Results Neuron- and Schwann cell-like cells were produced from a common population of mESC in an ultra-slow flow microfluidic device. As the populations interacted; “neurons” grew over the “Schwann cell” lawn and early events in myelination were documented. Blocking MIF on the Schwann cell side greatly reduced directional neurite outgrowth. MIF-expressing “Schwann cells” were used to “coat” a CI: mouse SGN and MIF-induced “neurons” grew directionally to the CI and to a wild type but not MIF-knock out Organ of Corti explant. Conclusions Two novel stem cell-based approaches for treating the problem of sensorineural hearing loss are described. PMID:27761977

Motoneurons secrete angiogenin to induce RNA cleavage in astroglia.

PubMed

Skorupa, Alexandra; King, Matthew A; Aparicio, Isabela M; Dussmann, Heiko; Coughlan, Karen; Breen, Bridget; Kieran, Dairin; Concannon, Caoimhin G; Marin, Philippe; Prehn, Jochen H M

2012-04-11

Amyotrophic lateral sclerosis (ALS) is an incurable neurodegenerative disorder affecting motoneurons. Mutations in angiogenin, encoding a member of the pancreatic RNase A superfamily, segregate with ALS. We previously demonstrated that angiogenin administration shows promise as a neuroprotective therapeutic in studies using transgenic ALS mice and primary motoneuron cultures. Its mechanism of action and target cells in the spinal cord, however, are largely unknown. Using mixed motoneuron cultures, motoneuron-like NSC34 cells, and primary astroglia cultures as model systems, we here demonstrate that angiogenin is a neuronally secreted factor that is endocytosed by astroglia and mediates neuroprotection in paracrine. We show that wild-type angiogenin acts unidirectionally to induce RNA cleavage in astroglia, while the ALS-associated K40I mutant is also secreted and endocytosed, but fails to induce RNA cleavage. Angiogenin uptake into astroglia requires heparan sulfate proteoglycans, and engages clathrin-mediated endocytosis. We show that this uptake mechanism exists for mouse and human angiogenin, and delivers a functional RNase output. Moreover, we identify syndecan 4 as the angiogenin receptor mediating the selective uptake of angiogenin into astroglia. Our data provide new insights into the paracrine activities of angiogenin in the nervous system, and further highlight the critical role of non-neuronal cells in the pathogenesis of ALS.

Influence of levamisole and Freund's adjuvant on mouse immunisation with antigens of adults of the liver fluke Fasciola hepatica Linnaeus, 1758.

PubMed

Gutierrez-Sanchez, Maria de Los Angeles; Luna-Herrera, Julieta; Trejo-Castro, Lauro; Montenegro-Cristino, Natividad; Almanza-Gonzalez, Alfredo; Escobar-Gutierrez, Alejandro; de la Rosa-Arana, Jorge Luis

2015-08-28

We have studied the influence of both levamisole (AL) and Freund's adjuvant (AF) on the immunisation of mice with the secretory antigens of adults of the liver fluke Fasciola hepatica Linnaeus, 1758. Total IgG antibodies were detected in all groups where the F. hepatica antigen was administered, been levels of IgG1 increased respect to IgG2a antibodies. During immunisation, IL-4 and IFN-γ were only detected in AL and AF groups, but after infection, IL-4 boosted in all groups. IFN-γ increased two fold in AF and AL groups compared to the saline solution (AS) group. Worm recovering was of 32-35% in groups administered without antigen whereas in AS, AL and AF groups recovering was of 25%, 12% and 8%, respectively. Macroscopical lesions in the liver were scarce in AL and AF groups. Our data suggest that immunisation of mice with antigens of F. hepatica enhances the immune response avoiding both liver damage and worm establishment after challenge infection. The murine model of fasciolosis has appeared to be useful to elucidate the mechanism by which the parasite modulates immune responses toward a Th2 type but also the development of Th1 type-inducing vaccines.

Clinical efficacy of edaravone for the treatment of amyotrophic lateral sclerosis.

PubMed

Sawada, Hideyuki

2017-05-01

Amyotrophic lateral sclerosis (ALS) is a progressive, fatal, neurodegenerative disease. Although the pathogenesis remains unresolved, oxidative stress is known to play a pivotal role. Edaravone works in the central nervous system as a potent scavenger of oxygen radicals. In ALS mouse models, edaravone suppresses motor functional decline and nitration of tyrosine residues in the cerebrospinal fluid. Areas covered: Three clinical trials, one phase II open-label trial, and two phase III placebo-control randomized trials were reviewed. In all trials, the primary outcome measure was the changes in scores on the revised ALS functional rating scale (ALSFRS-R) to evaluate motor function of patients. Expert opinion: The phase II open label trial suggested that edaravone is safe and effective in ALS, markedly reducing 3-nitrotyrosine levels in the cerebrospinal fluid. One of the two randomized controlled trials showed beneficial effects in ALSFRS-R, although the differences were not significant. The last trial demonstrated that edaravone provided significant efficacy in ALSFRS-R scores over 24 weeks where concomitant use of riluzole was permitted. Eligibility was restricted to patients with a relatively short disease duration and preserved vital capacity. Therefore, combination therapy with edaravone and riluzole should be considered earlier.

Expression of XBP1s in fibroblasts is critical for TiAl6 V4 particle-induced RANKL expression and osteolysis.

PubMed

Wang, Zhenheng; Liu, Naicheng; Zhou, Gang; Shi, Tongguo; Wang, Zhenzhen; Gan, Jingjing; Wang, Rui; Qian, Hongbo; Bao, Nirong; Guo, Ting; Zhao, Jianning

2017-04-01

Wear particle-induced osteolysis is a major cause of aseptic loosening, which is one of the most common reasons for total hip arthroplasty (THA) failure. Previous studies have shown that the expression of Receptor activation of nuclear factor (NF)-kB (RANKL) by fibroblasts in periprosthetic membrane played a crucial role in wear particle-induced osteolysis. However, the underlying mechanism of RANKL expression remains largely unknown. In the present study, we investigated the effect of TiAl 6 V 4 particle (TiPs)-induced XBP1s (spliced form of X-box binding protein 1) on RANKL expression and osteoclastogenesis both in vitro and in vivo. The levels of XBP1s in peri-implant membrane, animal models, and TiPs-stimulated fibroblasts were determined by western blots. To assess the effect of XBP1s on RANKL expression, fibroblasts were treated with both a small interfering RNA (siRNA) and an inhibitor of XBP1 prior to exposure to TiPs. The effect of XBP1s on osteoclasts formation was determined by tartrate-resistant acid phosphatase (TRAP) staining in vitro osteoclastogenesis assay and in animal models. The resorption of bone was assessed by micro-computed tomography (micro-CT) with three-dimensional reconstruction. Our results demonstrated that XBP1s was activated in periprosthetic membrane, mouse calvaria models, and TiPs-stimulated human synovial fibroblasts. Further, inhibition of XBP1s decreased the expression of RANKL and osteoclasts formation in vitro. In mouse calvaria models, both of the osteoclastogenesis and osteolysis were inhibited XBP1s inhibitor. Our results suggested that XBP1s mediated TiPs-induced of RANKL expression in fibroblasts, and down regulating XBP1s may represent a potential therapy for wear particle-induced osteolysis. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:752-759, 2017. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

System parameters for erythropoiesis control model: Comparison of normal values in human and mouse model

NASA Technical Reports Server (NTRS)

1979-01-01

The computer model for erythropoietic control was adapted to the mouse system by altering system parameters originally given for the human to those which more realistically represent the mouse. Parameter values were obtained from a variety of literature sources. Using the mouse model, the mouse was studied as a potential experimental model for spaceflight. Simulation studies of dehydration and hypoxia were performed. A comparison of system parameters for the mouse and human models is presented. Aside from the obvious differences expected in fluid volumes, blood flows and metabolic rates, larger differences were observed in the following: erythrocyte life span, erythropoietin half-life, and normal arterial pO2.

Autophagy as a melanocytic self-defense mechanism.

PubMed

Setaluri, Vijayasaradhi

2015-05-01

Defects in autophagy have implications for melanocyte survival and manifestations of skin pigmentary disorders. Zhang et al. (2015) show that mouse melanocytes lacking the autophagy protein Atg7 undergo premature senescence in vitro and accumulate products of oxidative damage, despite activation of the redox response. Interestingly, contrary to previous findings, the melanocyte-specific deficiency in autophagy did not cause major defects in melanosome biogenesis, nor did it produce visually striking changes in mouse coat color.

Recombinant MCF247 Virus, Leukemogenesis, and Immunosuppression in AKR Mice

DTIC Science & Technology

1990-06-01

knowledge of thymic leukemia and lymphoma in the AKR mouse system. Early leukemia and lymphoma development in the AKR mouse strain is caused by the ...inevitable in all individuals in a high incidence strain (e.g. AKR), as the retrovirus is integrated into the germline and is transmitted by vertical...Only those strains in which virus could induce suppressor cells * developed leukemia (Kumar et al., 1976). The association of immunosuppression and

Role of VAPB-MSP, a Novel EphA2 RTK Antagonist in Breast Cancer

DTIC Science & Technology

2012-12-01

13 REFERENCES 1. Arriola E, Marchio C, Tan DS, Drury SC, Lambros MB, et al. (2008) Genomic analysis of the HER2/TOP2A amplicon in breast cancer and...proliferation and branching in mouse mammary epithelium. Mol Biol Cell 12: 1445–1455. 27. Arriola E, Marchio C, Tan DS, Drury SC, Lambros MB, et al

Psychosocially influenced cancer: diverse early-life stress experiences and links to breast cancer.

PubMed

Schuler, Linda A; Auger, Anthony P

2010-11-01

This perspective on Boyd et al. (beginning on page 1398 in this issue of the journal) discusses recent published research examining the interplay between social stress and breast cancer. Cross-disciplinary studies using genetically defined mouse models and established neonatal and peripubertal paradigms of social stress are illuminating biological programming by diverse early-life experiences for the risk of breast cancer. Understanding the mechanisms underlying this programming can lead to the identification of risk factors and sensitive developmental windows, enabling improved prevention and treatment strategies for this devastating disease. ©2010 AACR.

Detection and Evaluation of Early Breast Cancer via Magnetic Resonance Imaging: Studies of Mouse Models and Clinical Implementation

DTIC Science & Technology

2007-03-01

Krausz 3 M.D., Marta Zamora1 B.Sc., Erica Markewicz1 B.Sc., Sean Foxley1 M.Sc., Xiaobing Fan1 Ph.D., Dianna Pang2 B.Sc., Brad Williams2 B.Sc., So...of prostate tumors in mice. NMR Biomed 2005; 18:285-292. 28. Szabo BK, Aspelin P, Wiberg MK, Bone B. Dynamic MR imaging of the breast. Analysis of...enhancement (E1, Epeak) and time to peak enhancement (Tpeak) were measured for each curve as performed by Szabo et al (24). The signal enhancement

Human mammary microenvironment better regulates the biology of human breast cancer in humanized mouse model.

PubMed

Zheng, Ming-Jie; Wang, Jue; Xu, Lu; Zha, Xiao-Ming; Zhao, Yi; Ling, Li-Jun; Wang, Shui

2015-02-01

During the past decades, many efforts have been made in mimicking the clinical progress of human cancer in mouse models. Previously, we developed a human breast tissue-derived (HB) mouse model. Theoretically, it may mimic the interactions between "species-specific" mammary microenvironment of human origin and human breast cancer cells. However, detailed evidences are absent. The present study (in vivo, cellular, and molecular experiments) was designed to explore the regulatory role of human mammary microenvironment in the progress of human breast cancer cells. Subcutaneous (SUB), mammary fat pad (MFP), and HB mouse models were developed for in vivo comparisons. Then, the orthotopic tumor masses from three different mouse models were collected for primary culture. Finally, the biology of primary cultured human breast cancer cells was compared by cellular and molecular experiments. Results of in vivo mouse models indicated that human breast cancer cells grew better in human mammary microenvironment. Cellular and molecular experiments confirmed that primary cultured human breast cancer cells from HB mouse model showed a better proliferative and anti-apoptotic biology than those from SUB to MFP mouse models. Meanwhile, primary cultured human breast cancer cells from HB mouse model also obtained the migratory and invasive biology for "species-specific" tissue metastasis to human tissues. Comprehensive analyses suggest that "species-specific" mammary microenvironment of human origin better regulates the biology of human breast cancer cells in our humanized mouse model of breast cancer, which is more consistent with the clinical progress of human breast cancer.

The Mouse Tumor Biology Database: A Comprehensive Resource for Mouse Models of Human Cancer.

PubMed

Krupke, Debra M; Begley, Dale A; Sundberg, John P; Richardson, Joel E; Neuhauser, Steven B; Bult, Carol J

2017-11-01

Research using laboratory mice has led to fundamental insights into the molecular genetic processes that govern cancer initiation, progression, and treatment response. Although thousands of scientific articles have been published about mouse models of human cancer, collating information and data for a specific model is hampered by the fact that many authors do not adhere to existing annotation standards when describing models. The interpretation of experimental results in mouse models can also be confounded when researchers do not factor in the effect of genetic background on tumor biology. The Mouse Tumor Biology (MTB) database is an expertly curated, comprehensive compendium of mouse models of human cancer. Through the enforcement of nomenclature and related annotation standards, MTB supports aggregation of data about a cancer model from diverse sources and assessment of how genetic background of a mouse strain influences the biological properties of a specific tumor type and model utility. Cancer Res; 77(21); e67-70. ©2017 AACR . ©2017 American Association for Cancer Research.

Mutations in the latent TGF-beta binding protein 3 (LTBP3) gene cause brachyolmia with amelogenesis imperfecta.

PubMed

Huckert, Mathilde; Stoetzel, Corinne; Morkmued, Supawich; Laugel-Haushalter, Virginie; Geoffroy, Véronique; Muller, Jean; Clauss, François; Prasad, Megana K; Obry, Frédéric; Raymond, Jean Louis; Switala, Marzena; Alembik, Yves; Soskin, Sylvie; Mathieu, Eric; Hemmerlé, Joseph; Weickert, Jean-Luc; Dabovic, Branka Brukner; Rifkin, Daniel B; Dheedene, Annelies; Boudin, Eveline; Caluseriu, Oana; Cholette, Marie-Claude; Mcleod, Ross; Antequera, Reynaldo; Gellé, Marie-Paule; Coeuriot, Jean-Louis; Jacquelin, Louis-Frédéric; Bailleul-Forestier, Isabelle; Manière, Marie-Cécile; Van Hul, Wim; Bertola, Debora; Dollé, Pascal; Verloes, Alain; Mortier, Geert; Dollfus, Hélène; Bloch-Zupan, Agnès

2015-06-01

Inherited dental malformations constitute a clinically and genetically heterogeneous group of disorders. Here, we report on four families, three of them consanguineous, with an identical phenotype, characterized by significant short stature with brachyolmia and hypoplastic amelogenesis imperfecta (AI) with almost absent enamel. This phenotype was first described in 1996 by Verloes et al. as an autosomal recessive form of brachyolmia associated with AI. Whole-exome sequencing resulted in the identification of recessive hypomorphic mutations including deletion, nonsense and splice mutations, in the LTBP3 gene, which is involved in the TGF-beta signaling pathway. We further investigated gene expression during mouse development and tooth formation. Differentiated ameloblasts synthesizing enamel matrix proteins and odontoblasts expressed the gene. Study of an available knockout mouse model showed that the mutant mice displayed very thin to absent enamel in both incisors and molars, hereby recapitulating the AI phenotype in the human disorder. © The Author 2015. Published by Oxford University Press.

Countermeasure for space flight effects on immune system: nutritional nucleotides

NASA Technical Reports Server (NTRS)

Kulkarni, A. D.; Yamauchi, K.; Sundaresan, A.; Ramesh, G. T.; Pellis, N. R.

2005-01-01

Microgravity and its environment have adverse effects on the immune system. Abnormal immune responses observed in microgravity may pose serious consequences, especially for the recent directions of NASA for long-term space missions to Moon, Mars and deep Space exploration. The study of space flight immunology is limited due to relative inaccessibility, difficulty of performing experiments in space, and inadequate provisions in this area in the United States and Russian space programs (Taylor 1993). Microgravity and stress experienced during space flights results in immune system aberration (Taylor 1993). In ground-based mouse models for some of the microgravity effects on the human body, hindlimb unloading (HU) has been reported to cause abnormal cell proliferation and cytokine production (Armstrong et al., 1993, Chapes et al. 1993). In this report, we document that a nutritional nucleotide supplementation as studied in ground-based microgravity analogs, has potential to serve as a countermeasure for the immune dysfunction observed in space travel.

Depletion of TDP-43 decreases fibril and plaque β-amyloid and exacerbates neurodegeneration in an Alzheimer's mouse model.

PubMed

LaClair, Katherine D; Donde, Aneesh; Ling, Jonathan P; Jeong, Yun Ha; Chhabra, Resham; Martin, Lee J; Wong, Philip C

2016-12-01

TDP-43 proteinopathy, initially associated with ALS and FTD, is also found in 30-60% of Alzheimer's disease (AD) cases and correlates with worsened cognition and neurodegeneration. A major component of this proteinopathy is depletion of this RNA-binding protein from the nucleus, which compromises repression of non-conserved cryptic exons in neurodegenerative diseases. To test whether nuclear depletion of TDP-43 may contribute to the pathogenesis of AD cases with TDP-43 proteinopathy, we examined the impact of depletion of TDP-43 in populations of neurons vulnerable in AD, and on neurodegeneration in an AD-linked context. Here, we show that some populations of pyramidal neurons that are selectively vulnerable in AD are also vulnerable to TDP-43 depletion in mice, while other forebrain neurons appear spared. Moreover, TDP-43 depletion in forebrain neurons of an AD mouse model exacerbates neurodegeneration, and correlates with increased prefibrillar oligomeric Aβ and decreased Aβ plaque burden. These findings support a role for nuclear depletion of TDP-43 in the pathogenesis of AD and provide strong rationale for developing novel therapeutics to alleviate the depletion of TDP-43 and functional antemortem biomarkers associated with its nuclear loss.

Towards a vaccine against Escherichia coli-associated urinary tract infections.

PubMed

Serino, Laura; Moriel, Danilo Gomes; Rappuoli, Rino; Pizza, Mariagrazia

2010-03-01

Evaluation of: Alteri CJ, Hagan EC, Sivick KE, Smith SN, Mobley HLT: Mucosal immunization with iron receptor antigens protects against urinary tract infections. PLoS Pathog. 5(9), E1000586 (2009). Urinary tract infection is one of the most common infections in humans. The eradication of uropathogenic Escherichia coli-mediated urinary tract infections has still not been achieved and no effective licensed vaccines are currently available. To overcome the limitations of previous approaches in developing an efficacious vaccine, Alteri et al., through a functional genomic approach, identified six novel vaccine candidates shown to be protective against urinary tract infection in a mouse model. The six proteins all belong to the class of outer membrane iron receptors, are upregulated in iron-restricted conditions and were demonstrated to induce, upon mucosal vaccination, antigen-specific antibodies and cytokine responses, which correlated with protection in a mouse model of urinary tract infection. Therefore, for the first time, antigens that were previously recognized as necessary for bacterial pathogenesis, being involved in iron acquisition in an iron-limited environment such as the urinary tract, are now proposed as potential candidates for the development of a vaccine against uropathogenic strain-associated urinary tract infections.

Clinical Implications of Basic Science Discoveries: Microchimerism Finds a Major Role in Reproductive Success; but Does It Also Contribute to Transplant Success?

PubMed

Burlingham, W J

2016-10-01

Conventional wisdom argues against inbreeding, to maintain hybrid vigor and increase MHC diversity in response to pathogens. A recent report from the laboratory of Sing-Sing Way uses a mouse model to test a hypothesis put forward by Ray D. Owen more than 60 years ago: that a certain amount of inbreeding is a good thing. Owen proposed that antigens not inherited from the mother (noninherited maternal antigens), when replicated on the mate of the daughter, could protect the latter's developing child from fetal wastage due to immune attack during her pregnancy. Kinder et al use elegant mouse breeding models and MHC class II peptide tetramers to show that Owen's hypothesis, based only on humoral (anti-Rh IgG) data and a small sample size, was indeed correct. The mediators of this cross-generational protection turn out to be a special kind of Foxp3 + T regulatory cell, the development of which requires the persistence of maternal microchimerism into adulthood. The implications of this discovery for the role of microchimerism in tolerance to transplants are discussed. © Copyright 2016 The American Society of Transplantation and the American Society of Transplant Surgeons.

Design and evaluation of a chronic EMG multichannel detection system for long-term recordings of hindlimb muscles in behaving mice

PubMed Central

Tysseling, Vicki M.; Janes, Lindsay; Imhoff, Rebecca; Quinlan, Katharina A.; Lookabaugh, Brad; Ramalingam, Shyma; Heckman, C.J.; Tresch, Matthew C.

2013-01-01

Mouse models are commonly used for identifying the behavioral consequences of genetic modifications, progression or recovery from disease or trauma models, and understanding spinal circuitry. Electromyographic recordings (EMGs) are recognized as providing information not possible from standard behavioral analyses involving gross behavioral or kinematic assessments. We describe here a method for recording from relatively large numbers of muscles in behaving mice. We demonstrate the use of this approach for recording from hindlimb muscles bilaterally in intact animals, following spinal cord injury, and during the progression of ALS. This design can be used in a variety of applications in order to characterize the coordination strategies of mice in health and disease. PMID:23369875

Vancomycin-Loaded Polymethylmethacrylate Spacers Fail to Eradicate Periprosthetic Joint Infection in a Clinically Representative Mouse Model.

PubMed

Carli, Alberto V; Bhimani, Samrath; Yang, Xu; de Mesy Bentley, Karen L; Ross, F Patrick; Bostrom, Mathias P G

2018-06-06

Periprosthetic joint infection (PJI) remains a devastating complication following total joint arthroplasty. Current animal models of PJI do not effectively recreate the clinical condition and thus provide limited help in understanding why treatments fail. We developed a mouse model of the first-stage surgery of a 2-stage revision for PJI involving a 3-dimensionally printed Ti-6Al-4V implant and a mouse-sized cement spacer that elutes vancomycin. Vancomycin was mixed with polymethylmethacrylate (PMMA) cement and inserted into custom-made mouse-sized spacer molds. Twenty C57BL/6 mice received a proximal tibial implant and an intra-articular injection of 3 × 10 colony-forming units of Staphylococcus aureus Xen36. At 2 weeks, 9 mice underwent irrigation and debridement of the leg with revision of the implant to an articulating vancomycin-loaded PMMA spacer. Postoperatively, mice underwent radiography and serum inflammatory-marker measurements. Following euthanasia of the mice at 6 weeks, bone and soft tissues were homogenized to quantify bacteria within periprosthetic tissues. Implants and articulating spacers were either sonicated to quantify adherent bacteria or examined under scanning electron microscopy (SEM) to characterize the biofilm. Vancomycin-loaded PMMA spacers eluted vancomycin for ≤144 hours and retained antimicrobial activity. Control mice had elevated levels of inflammatory markers, radiographic evidence of septic loosening of the implant, and osseous destruction. Mice treated with a vancomycin-loaded PMMA spacer had significantly lower levels of inflammatory markers (p < 0.01), preserved tibial bone, and no intra-articular purulence. Retrieved vancomycin-loaded spacers exhibited significantly lower bacterial counts compared with implants (p < 0.001). However, bacterial counts in periprosthetic tissue did not significantly differ between the groups. SEM identified S. aureus encased within biofilm on control implants, while vancomycin-loaded spacers contained no bacteria. This animal model is a clinically representative model of PJI treatment. The results suggest that the antimicrobial effects of PMMA spacers are tightly confined to the articular space and must be utilized in conjunction with thorough tissue debridement and systemic antibiotics. These data provide what we believe to be the first insight into the effect of antibiotic-loaded cement spacers in a clinically relevant animal model and justify the adjunctive use of intravenous antibiotics when performing a 2-stage revision for PJI.

Impaired Auditory and Contextual Fear Conditioning in Soman-Exposed Rats

DTIC Science & Technology

2011-01-01

include the piriform cortex, amygdala, thalamus and hippocampus (Carpentier et al., 1990; Petras , 1994; Shih et al., 2003). Often the resulting... Martin M, Shah R, Bertchume A, Colvin J, Dong H. Cholinesterase inhibitors ameliorate behavioral deficits induced by MK-801 in mice. Neuropsy...Csernansky CA, Martin MV, Bertchume A, Vallera D, Csernansky JG. Acetylcholinesterase inhibitors ameliorate behavioral deficits in the Tg2576 mouse

Moving Toward the Ground State.

PubMed

Kumar, Ishan; Ivanova, Natalia

2015-10-01

Transferring mouse ESCs to a media supplemented with Mek and Gsk3β inhibitors (2i) provokes marked transcriptional and epigenetic changes, embodying a shift toward ground-state pluripotency. In this issue of Cell Stem Cell, Kolodziejczyk et al. (2015) examine population structures of ESCs while Galonska et al. (2015) unravel the mechanisms underlying regulatory network rewiring during 2i-mediated reprogramming. Copyright © 2015 Elsevier Inc. All rights reserved.

A novel Phex mutation in a new mouse model of hypophosphatemic rickets.

PubMed

Owen, Celeste; Chen, Frieda; Flenniken, Ann M; Osborne, Lucy R; Ichikawa, Shoji; Adamson, S Lee; Rossant, Janet; Aubin, Jane E

2012-07-01

X-linked hypophosphatemic rickets (XLH) is a dominantly inherited disease characterized by renal phosphate wasting, aberrant vitamin D metabolism, and defective bone mineralization. It is known that XLH in humans and in certain mouse models is caused by inactivating mutations in PHEX/Phex (phosphate-regulating gene with homologies to endopeptidases on the X chromosome). By a genome-wide N-ethyl-N-nitrosourea (ENU)-induced mutagenesis screen in mice, we identified a dominant mouse mutation that exhibits the classic clinical manifestations of XLH, including growth retardation, skeletal abnormalities (rickets/osteomalacia), hypophosphatemia, and increased serum alkaline phosphatase (ALP) levels. Mapping and sequencing revealed that these mice carry a point mutation in exon 14 of the Phex gene that introduces a stop codon at amino acid 496 of the coding sequence (Phex(Jrt) also published as Phex(K496X) [Ichikawa et al., 2012]). Fgf23 mRNA expression as well as that of osteocalcin, bone sialoprotein, and matrix extracellular phosphoglycoprotein was upregulated in male mutant long bone, but that of sclerostin was unaffected. Although Phex mRNA is expressed in bone from mutant hemizygous male mice (Phex(Jrt)/Y mice), no Phex protein was detected in immunoblots of femoral bone protein. Stromal cultures from mutant bone marrow were indistinguishable from those of wild-type mice with respect to differentiation and mineralization. The ability of Phex(Jrt)/Y osteoblasts to mineralize and the altered expression levels of matrix proteins compared with the well-studied Hyp mice makes it a unique model with which to further explore the clinical manifestations of XLH and its link to FGF23 as well as to evaluate potential new therapeutic strategies. Copyright © 2012 Wiley Periodicals, Inc.

Amoxicillin-clavulanic acid and ciprofloxacin-treated SPF mice as gnotobiotic model.

PubMed

Popper, Miroslav; Gancarčíková, Soňa; Maďar, Marián; Mudroňová, Dagmar; Hrčková, Gabriela; Nemcová, Radomíra

2016-11-01

The experiment was carried out on 24 SPF BALB/c female mice and lasted for 15 days with a 5-day antibiotic (ATB) treatment and then 10 days without ATB treatment. The aim of our study was to acquire an animal model with reduced and controlled microflora and, at the same time, to ensure that the good health of these animals is maintained. Per oral administration of amoxicillin and clavulanate potassium in Amoksiklav (Sandoz, Slovenia) at a dose of 387.11 mg/kg body weight (0.2 ml of dilution per mouse) and subcutaneous administration of ciprofloxacin in Ciloxan (Alcon, Spain) at a dose of 18.87 mg/kg body weight (0.1 ml of dilution per mouse) were performed every 12 h during first 5 days of experiment. Five-day treatment with ATB led to a reduced survivability of microorganisms in faeces (28.33 ± 0.43 % on day 2) and caecum content (28.10 ± 1.56 %), where no cultivable microorganisms in faeces were present. Ten-day convalescence of decontaminated animals under gnotobiotic conditions prevented recovery of species diversity in mice gut microflora. This was reduced to two detectable cultivable species, namely Escherichia coli (GenBank KX086704) and Enterococcus sp. (GenBank KX086705) which were capable to restore its metabolic (CRL 2012) and morphological potential (Baratta et al. Histochem Cell Biol 131:713-726, 2009) within physiological range. Animals obtained under this procedure can be used in further studies. As a result, we created a mouse gnoto model with reduced and controlled microflora without alteration of the overall health status of the respective animals.

Cell-type specific differences in promoter activity of the ALS-linked C9orf72 mouse ortholog.

PubMed

Langseth, Abraham J; Kim, Juhyun; Ugolino, Janet E; Shah, Yajas; Hwang, Ho-Yon; Wang, Jiou; Bergles, Dwight E; Brown, Solange P

2017-07-18

A hexanucleotide repeat expansion in the C9orf72 gene is the most common cause of inherited forms of the neurodegenerative disease amyotrophic lateral sclerosis (ALS). Both loss-of-function and gain-of-function mechanisms have been proposed to underlie this disease, but the pathogenic pathways are not fully understood. To better understand the involvement of different cell types in the pathogenesis of ALS, we systematically analyzed the distribution of promoter activity of the mouse ortholog of C9orf72 in the central nervous system. We demonstrate that C9orf72 promoter activity is widespread in both excitatory and inhibitory neurons as well as in oligodendrocytes and oligodendrocyte precursor cells. In contrast, few microglia and astrocytes exhibit detectable C9orf72 promoter activity. Although at a gross level, the distribution of C9orf72 promoter activity largely follows overall cellular density, we found that it is selectively enriched in subsets of neurons and glial cells that degenerate in ALS. Specifically, we show that C9orf72 promoter activity is enriched in corticospinal and spinal motor neurons as well as in oligodendrocytes in brain regions that are affected in ALS. These results suggest that cell autonomous changes in both neurons and glia may contribute to C9orf72-mediated disease, as has been shown for mutations in superoxide dismutase-1 (SOD1).

The CB2 cannabinoid agonist AM-1241 prolongs survival in a transgenic mouse model of amyotrophic lateral sclerosis when initiated at symptom onset

PubMed Central

Shoemaker, Jennifer L.; Seely, Kathryn A.; Reed, Ronald L.; Crow, John P.; Prather, Paul L.

2010-01-01

Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease characterized by progressive motor neuron loss, paralysis and death within 2–5 years of diagnosis. Currently, no effective pharmacological agents exist for the treatment of this devastating disease. Neuroinflammation may accelerate the progression of ALS. Cannabinoids produce anti-inflammatory actions via cannabinoid receptor 1 (CB1) and cannabinoid receptor 2 (CB2), and delay the progression of neuroinflammatory diseases. Additionally, CB2 receptors, which normally exist primarily in the periphery, are dramatically up-regulated in inflamed neural tissues associated with CNS disorders. In G93A-SOD1 mutant mice, the most well-characterized animal model of ALS, endogenous cannabinoids are elevated in spinal cords of symptomatic mice. Furthermore, treatment with non-selective cannabinoid partial agonists prior to, or upon, symptom appearance minimally delays disease onset and prolongs survival through undefined mechanisms. We demonstrate that mRNA, receptor binding and function of CB2, but not CB1, receptors are dramatically and selectively up-regulated in spinal cords of G93A-SOD1 mice in a temporal pattern paralleling disease progression. More importantly, daily injections of the selective CB2 agonist AM-1241, initiated at symptom onset, increase the survival interval after disease onset by 56%. Therefore, CB2 agonists may slow motor neuron degeneration and preserve motor function, and represent a novel therapeutic modality for treatment of ALS. PMID:17241118

Rilmenidine promotes MTOR-independent autophagy in the mutant SOD1 mouse model of amyotrophic lateral sclerosis without slowing disease progression

PubMed Central

Perera, Nirma D.; Sheean, Rebecca K.; Lau, Chew L.; Shin, Yea Seul; Beart, Philip M.; Horne, Malcolm K.; Turner, Bradley J.

2018-01-01

ABSTRACT Macroautophagy/autophagy is the main intracellular catabolic pathway in neurons that eliminates misfolded proteins, aggregates and damaged organelles associated with ageing and neurodegeneration. Autophagy is regulated by both MTOR-dependent and -independent pathways. There is increasing evidence that autophagy is compromised in neurodegenerative disorders, which may contribute to cytoplasmic sequestration of aggregation-prone and toxic proteins in neurons. Genetic or pharmacological modulation of autophagy to promote clearance of misfolded proteins may be a promising therapeutic avenue for these disorders. Here, we demonstrate robust autophagy induction in motor neuronal cells expressing SOD1 or TARDBP/TDP-43 mutants linked to amyotrophic lateral sclerosis (ALS). Treatment of these cells with rilmenidine, an anti-hypertensive agent and imidazoline-1 receptor agonist that induces autophagy, promoted autophagic clearance of mutant SOD1 and efficient mitophagy. Rilmenidine administration to mutant SOD1G93A mice upregulated autophagy and mitophagy in spinal cord, leading to reduced soluble mutant SOD1 levels. Importantly, rilmenidine increased autophagosome abundance in motor neurons of SOD1G93A mice, suggesting a direct action on target cells. Despite robust induction of autophagy in vivo, rilmenidine worsened motor neuron degeneration and symptom progression in SOD1G93A mice. These effects were associated with increased accumulation and aggregation of insoluble and misfolded SOD1 species outside the autophagy pathway, and severe mitochondrial depletion in motor neurons of rilmenidine-treated mice. These findings suggest that rilmenidine treatment may drive disease progression and neurodegeneration in this mouse model due to excessive mitophagy, implying that alternative strategies to beneficially stimulate autophagy are warranted in ALS. PMID:28980850

Drug discovery in prostate cancer mouse models.

PubMed

Valkenburg, Kenneth C; Pienta, Kenneth J

2015-01-01

The mouse is an important, though imperfect, organism with which to model human disease and to discover and test novel drugs in a preclinical setting. Many experimental strategies have been used to discover new biological and molecular targets in the mouse, with the hopes of translating these discoveries into novel drugs to treat prostate cancer in humans. Modeling prostate cancer in the mouse, however, has been challenging, and often drugs that work in mice have failed in human trials. The authors discuss the similarities and differences between mice and men; the types of mouse models that exist to model prostate cancer; practical questions one must ask when using a mouse as a model; and potential reasons that drugs do not often translate to humans. They also discuss the current value in using mouse models for drug discovery to treat prostate cancer and what needs are still unmet in field. With proper planning and following practical guidelines by the researcher, the mouse is a powerful experimental tool. The field lacks genetically engineered metastatic models, and xenograft models do not allow for the study of the immune system during the metastatic process. There remain several important limitations to discovering and testing novel drugs in mice for eventual human use, but these can often be overcome. Overall, mouse modeling is an essential part of prostate cancer research and drug discovery. Emerging technologies and better and ever-increasing forms of communication are moving the field in a hopeful direction.

Orthology for comparative genomics in the mouse genome database.

PubMed

Dolan, Mary E; Baldarelli, Richard M; Bello, Susan M; Ni, Li; McAndrews, Monica S; Bult, Carol J; Kadin, James A; Richardson, Joel E; Ringwald, Martin; Eppig, Janan T; Blake, Judith A

2015-08-01

The mouse genome database (MGD) is the model organism database component of the mouse genome informatics system at The Jackson Laboratory. MGD is the international data resource for the laboratory mouse and facilitates the use of mice in the study of human health and disease. Since its beginnings, MGD has included comparative genomics data with a particular focus on human-mouse orthology, an essential component of the use of mouse as a model organism. Over the past 25 years, novel algorithms and addition of orthologs from other model organisms have enriched comparative genomics in MGD data, extending the use of orthology data to support the laboratory mouse as a model of human biology. Here, we describe current comparative data in MGD and review the history and refinement of orthology representation in this resource.

Relationship between intracellular ice formation in oocytes of the mouse and Xenopus and the physical state of the external medium--a revisit.

PubMed

Mazur, Peter; Kleinhans, F W

2008-02-01

We have previously reported that intracellular ice formation (IIF) in mouse oocytes suspended in glycerol/PBS solutions or ethylene glycol (EG)/PBS solutions and rapidly cooled to -50 degrees C or below occurs at temperatures where a critical fraction of the external water remains unfrozen [P. Mazur, S. Seki, I.L. Pinn, F.W. Kleinhans, K. Edashige, Extra- and intracellular ice formation in mouse oocytes, Cryobiology 51 (2005) 29-53; P. Mazur, I.L. Pinn, F.W. Kleinhans, The temperature of intracellular ice formation in mouse oocytes vs. the unfrozen fraction at that temperature, Cryobiology 54 (2007) 223-233]. For mouse oocytes in PBS or glycerol/PBS that fraction is 0.06; for oocytes in EG that fraction was calculated to be 0.13, more than double. The fractions unfrozen are computed from ternary phase diagrams. In the previous publication, we used the EG data of Woods et al. [E.J. Woods, M.A.J. Zieger, D.Y. Gao, J.K. Critser, Equations for obtaining melting points for the ternary system ethylene glycol/sodium chloride/Water and their application to cryopreservation., Cryobiology 38 (1999) 403-407]. Since then, we have determined that ternary phase diagrams for EG/NaCl/water synthesized by summing binary phase data for EG/water NaCl/water gives substantially different curves, which seem more realistic [F.W. Kleinhans, P. Mazur, Comparison of actual vs. synthesized ternary phase diagrams for solutes of cryobiological interest, Cryobiology 54 (2007) 212-222]. Unfrozen fractions at the temperatures of IIF computed from these synthesized phase diagrams are about half of those calculated from the Woods et al. data, and are in close agreement with the computations for glycerol; i.e., IIF occurs when about 92-94% of the external water is frozen. A parallel paper was published by Guenther et al. [J.F. Guenther, S. Seki, F.W. Kleinhans, K. Edashige, D.M. Roberts, P. Mazur, Extra-and intra-cellular ice formation in Stage I and II Xenopus laevis oocytes, Cryobiology 52 (2006) 401-416] on IIF in oocytes of the frog Xenopus. It too examined whether the temperatures of IIF were related to the unfrozen fractions at those temperatures. It also used the Woods et al. ternary phase data to calculate the unfrozen fractions for EG solutions. As reported here, once again the values of these unfrozen fractions are substantially different from those calculated using synthesized phase diagrams. With the latter, the unfrozen fractions at IIF become very similar for EG and glycerol.

Genetically Engineered Mouse Models for Studying Inflammatory Bowel Disease

PubMed Central

Mizoguchi, Atsushi; Takeuchi, Takahito; Himuro, Hidetomo; Okada, Toshiyuki; Mizoguchi, Emiko

2015-01-01

Inflammatory bowel disease (IBD) is a chronic intestinal inflammatory condition that is mediated by very complex mechanisms controlled by genetic, immune, and environmental factors. More than 74 kinds of genetically engineered mouse strains have been established since 1993 for studying IBD. Although mouse models cannot fully reflect human IBD, they have provided significant contributions for not only understanding the mechanism, but also developing new therapeutic means for IBD. Indeed, 20 kinds of genetically engineered mouse models carry the susceptibility genes identified in human IBD, and the functions of some other IBD susceptibility genes have also been dissected out using mouse models. Cutting-edge technologies such as cell-specific and inducible knockout systems, which were recently employed to mouse IBD models, have further enhanced the ability of investigators to provide important and unexpected rationales for developing new therapeutic strategies for IBD. In this review article, we briefly introduce 74 kinds of genetically engineered mouse models that spontaneously develop intestinal inflammation. PMID:26387641

Targeting GPR30 in Abiraterone and MDV3100 Resistant Prostate Cancer

DTIC Science & Technology

2017-12-01

ID Labs, London, ON, Canada) following the manufacturer’s protocols. Quantitative real- time PCR Total RNA was treated with RNase-free DNase (Qiagen...99-gene panel for confirmation based on a literature search showing their relatedness to cell-mediated immune responses. Quantitative real- time PCR...mouse neutrophils (Geiser et al. 1993, Schaider et al. 2003), we analyzed murine neutrophil-related cytokine genes using quantitative real- time PCR

Excess Circulating Alternatively Activated Myeloid (M2) Cells Accelerate ALS Progression While Inhibiting Experimental Autoimmune Encephalomyelitis

PubMed Central

Miller, Omer; Butovsky, Oleg; Bukshpan, Shay; Beers, David R.; Henkel, Jenny S.; Yoles, Eti; Appel, Stanley H.; Schwartz, Michal

2011-01-01

Background Circulating immune cells including autoreactive T cells and monocytes have been documented as key players in maintaining, protecting and repairing the central nervous system (CNS) in health and disease. Here, we hypothesized that neurodegenerative diseases might be associated, similarly to tumors, with increased levels of circulating peripheral myeloid derived suppressor cells (MDSCs), representing a subset of suppressor cells that often expand under pathological conditions and inhibit possible recruitment of helper T cells needed for fighting off the disease. Methods and Findings We tested this working hypothesis in amyotrophic lateral sclerosis (ALS) and its mouse model, which are characterized by a rapid progression once clinical symptoms are evident. Adaptive transfer of alternatively activated myeloid (M2) cells, which homed to the spleen and exhibited immune suppressive activity in G93A mutant superoxide dismutase-1 (mSOD1) mice at a stage before emergence of disease symptoms, resulted in earlier appearance of disease symptoms and shorter life expectancy. The same protocol mitigated the inflammation-induced disease model of multiple sclerosis, experimental autoimmune encephalomyelitis (EAE), which requires circulating T cells for disease induction. Analysis of whole peripheral blood samples obtained from 28 patients suffering from sporadic ALS (sALS), revealed a two-fold increase in the percentage of circulating MDSCs (LIN−/LowHLA-DR−CD33+) compared to controls. Conclusions Taken together, these results emphasize the distinct requirements for fighting the inflammatory neurodegenerative disease, multiple sclerosis, and the neurodegenerative disease, ALS, though both share a local inflammatory component. Moreover, the increased levels of circulating MDSCs in ALS patients indicates the operation of systemic mechanisms that might lead to an impairment of T cell reactivity needed to overcome the disease conditions within the CNS. This high level of suppressive immune cells might represent a risk factor and a novel target for therapeutic intervention in ALS at least at the early stage. PMID:22073221

Modeling Protein Aggregation and the Heat Shock Response in ALS iPSC-Derived Motor Neurons.

PubMed

Seminary, Emily R; Sison, Samantha L; Ebert, Allison D

2018-01-01

Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disorder caused by the selective loss of the upper and lower motor neurons. Only 10% of all cases are caused by a mutation in one of the two dozen different identified genes, while the remaining 90% are likely caused by a combination of as yet unidentified genetic and environmental factors. Mutations in C9orf72, SOD1 , or TDP-43 are the most common causes of familial ALS, together responsible for at least 60% of these cases. Remarkably, despite the large degree of heterogeneity, all cases of ALS have protein aggregates in the brain and spinal cord that are immunopositive for SOD1, TDP-43, OPTN, and/or p62. These inclusions are normally prevented and cleared by heat shock proteins (Hsps), suggesting that ALS motor neurons have an impaired ability to induce the heat shock response (HSR). Accordingly, there is evidence of decreased induction of Hsps in ALS mouse models and in human post-mortem samples compared to unaffected controls. However, the role of Hsps in protein accumulation in human motor neurons has not been fully elucidated. Here, we generated motor neuron cultures from human induced pluripotent stem cell (iPSC) lines carrying mutations in SOD1, TDP-43 , or C9orf72 . In this study, we provide evidence that despite a lack of overt motor neuron loss, there is an accumulation of insoluble, aggregation-prone proteins in iPSC-derived motor neuron cultures but that content and levels vary with genetic background. Additionally, although iPSC-derived motor neurons are generally capable of inducing the HSR when exposed to a heat stress, protein aggregation itself is not sufficient to induce the HSR or stress granule formation. We therefore conclude that ALS iPSC-derived motor neurons recapitulate key early pathological features of the disease and fail to endogenously upregulate the HSR in response to increased protein burden.

Modeling Protein Aggregation and the Heat Shock Response in ALS iPSC-Derived Motor Neurons

PubMed Central

Seminary, Emily R.; Sison, Samantha L.; Ebert, Allison D.

2018-01-01

Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disorder caused by the selective loss of the upper and lower motor neurons. Only 10% of all cases are caused by a mutation in one of the two dozen different identified genes, while the remaining 90% are likely caused by a combination of as yet unidentified genetic and environmental factors. Mutations in C9orf72, SOD1, or TDP-43 are the most common causes of familial ALS, together responsible for at least 60% of these cases. Remarkably, despite the large degree of heterogeneity, all cases of ALS have protein aggregates in the brain and spinal cord that are immunopositive for SOD1, TDP-43, OPTN, and/or p62. These inclusions are normally prevented and cleared by heat shock proteins (Hsps), suggesting that ALS motor neurons have an impaired ability to induce the heat shock response (HSR). Accordingly, there is evidence of decreased induction of Hsps in ALS mouse models and in human post-mortem samples compared to unaffected controls. However, the role of Hsps in protein accumulation in human motor neurons has not been fully elucidated. Here, we generated motor neuron cultures from human induced pluripotent stem cell (iPSC) lines carrying mutations in SOD1, TDP-43, or C9orf72. In this study, we provide evidence that despite a lack of overt motor neuron loss, there is an accumulation of insoluble, aggregation-prone proteins in iPSC-derived motor neuron cultures but that content and levels vary with genetic background. Additionally, although iPSC-derived motor neurons are generally capable of inducing the HSR when exposed to a heat stress, protein aggregation itself is not sufficient to induce the HSR or stress granule formation. We therefore conclude that ALS iPSC-derived motor neurons recapitulate key early pathological features of the disease and fail to endogenously upregulate the HSR in response to increased protein burden. PMID:29515358

Molecular chaperone mediated late-stage neuroprotection in the SOD1(G93A) mouse model of amyotrophic lateral sclerosis.

PubMed

Novoselov, Sergey S; Mustill, Wendy J; Gray, Anna L; Dick, James R; Kanuga, Naheed; Kalmar, Bernadett; Greensmith, Linda; Cheetham, Michael E

2013-01-01

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder characterized by the selective loss of motor neurons in the spinal cord, brain stem, and motor cortex. Mutations in superoxide dismutase (SOD1) are associated with familial ALS and lead to SOD1 protein misfolding and aggregation. Here we show that the molecular chaperone, HSJ1 (DNAJB2), mutations in which cause distal hereditary motor neuropathy, can reduce mutant SOD1 aggregation and improve motor neuron survival in mutant SOD1 models of ALS. Overexpression of human HSJ1a (hHSJ1a) in vivo in motor neurons of SOD1(G93A) transgenic mice ameliorated disease. In particular, there was a significant improvement in muscle force, increased motor unit number and enhanced motor neuron survival. hHSJ1a was present in a complex with SOD1(G93A) and led to reduced SOD1 aggregation at late stages of disease progression. We also observed altered ubiquitin immunoreactivity in the double transgenic animals, suggesting that ubiquitin modification might be important for the observed improvements. In a cell model of SOD1(G93A) aggregation, HSJ1a preferentially bound to mutant SOD1, enhanced SOD1 ubiquitylation and reduced SOD1 aggregation in a J-domain and ubiquitin interaction motif (UIM) dependent manner. Collectively, the data suggest that HSJ1a acts on mutant SOD1 through a combination of chaperone, co-chaperone and pro-ubiquitylation activity. These results show that targeting SOD1 protein misfolding and aggregation in vivo can be neuroprotective and suggest that manipulation of DnaJ molecular chaperones might be useful in the treatment of ALS.

Genome-wide expression profiling of five mouse models identifies similarities and differences with human psoriasis.

PubMed

Swindell, William R; Johnston, Andrew; Carbajal, Steve; Han, Gangwen; Wohn, Christian; Lu, Jun; Xing, Xianying; Nair, Rajan P; Voorhees, John J; Elder, James T; Wang, Xiao-Jing; Sano, Shigetoshi; Prens, Errol P; DiGiovanni, John; Pittelkow, Mark R; Ward, Nicole L; Gudjonsson, Johann E

2011-04-04

Development of a suitable mouse model would facilitate the investigation of pathomechanisms underlying human psoriasis and would also assist in development of therapeutic treatments. However, while many psoriasis mouse models have been proposed, no single model recapitulates all features of the human disease, and standardized validation criteria for psoriasis mouse models have not been widely applied. In this study, whole-genome transcriptional profiling is used to compare gene expression patterns manifested by human psoriatic skin lesions with those that occur in five psoriasis mouse models (K5-Tie2, imiquimod, K14-AREG, K5-Stat3C and K5-TGFbeta1). While the cutaneous gene expression profiles associated with each mouse phenotype exhibited statistically significant similarity to the expression profile of psoriasis in humans, each model displayed distinctive sets of similarities and differences in comparison to human psoriasis. For all five models, correspondence to the human disease was strong with respect to genes involved in epidermal development and keratinization. Immune and inflammation-associated gene expression, in contrast, was more variable between models as compared to the human disease. These findings support the value of all five models as research tools, each with identifiable areas of convergence to and divergence from the human disease. Additionally, the approach used in this paper provides an objective and quantitative method for evaluation of proposed mouse models of psoriasis, which can be strategically applied in future studies to score strengths of mouse phenotypes relative to specific aspects of human psoriasis.

Departure gate of acidic Ca2+ confirmed

PubMed Central

Jentsch, Thomas J; Hoegg-Beiler, Maja B; Vogt, Janis

2015-01-01

More potent, but less known than IP3 that liberates Ca2+ from the ER, NAADP releases Ca2+ from acidic stores. The notion that TPC channels mediate this Ca2+ release was questioned recently by studies suggesting that TPCs are rather PI(3,5)P2-activated Na+ channels. Ruas et al (2015) now partially reconcile these views by showing that TPCs significantly conduct both cations and confirm their activation by both NAADP and PI(3,5)P2. They attribute the failure of others to observe TPC-dependent NAADP-induced Ca2+ release in vivo to inadequate mouse models that retain partial TPC function. PMID:26022292

Molecular mechanisms of transformation of C3H/10T1/2 C1 8 mouse embryo cells and diploid human fibroblasts by carcinogenic metal compounds.

PubMed Central

Landolph, J R

1994-01-01

Carcinogenic arsenic, nickel, and chromium compounds induced morphological and neoplastic transformation but no mutation to ouabain resistance in 10T1/2 mouse embryo cells; lead chromate also did not induce mutation to ouabain or 6-thioguanine resistance in Chinese hamster ovary cells. The mechanism of metal-induced morphological transformation was likely not due to the specific base substitution mutations measured in ouabain resistance mutation assays, and for lead chromate, likely not due to this type of base substitution mutation or to frameshift mutations. Preliminary data indicate increases in steady-state levels of c-myc RNA in arsenic-, nickel-, and chromium-transformed cell lines. We also showed that carcinogenic nickel, chromium, and arsenic compounds and N-methyl-N-nitro-N-nitrosoguanidine (MNNG) induced stable anchorage independence (Al) in diploid human fibroblasts (DHF) but no focus formation or immortality. Nickel subsulfide and lead chromate induced Al but not mutation to 6-thioguanine resistance. The mechanism of induction of Al by metal salts in DHF was likely not by the type of base substitution or frameshift mutations measured in these assays. MNNG induced Al, mutation to 6-thioguanine resistance, and mutation to ouabain resistance, and might induce Al by base substitution or frameshift mutations. Dexamethasone, aspirin, and salicylic acid inhibited nickel subsulfide, MNNG, and 12-O-tetrade-canoylphorbol-13-acetate (TPA)-induced Al in DHF, suggesting that arachidonic acid metabolism and oxygen radical generation play a role in induction of Al. We propose that nickel compounds stimulate arachidonic acid metabolism, consequent oxygen radical generation, and oxygen radical attack upon DNA.(ABSTRACT TRUNCATED AT 250 WORDS) Images Figure 1. PMID:7843085

A novel ALS-associated variant in UBQLN4 regulates motor axon morphogenesis.

PubMed

Edens, Brittany M; Yan, Jianhua; Miller, Nimrod; Deng, Han-Xiang; Siddique, Teepu; Ma, Yongchao C

2017-05-02

The etiological underpinnings of amyotrophic lateral sclerosis (ALS) are complex and incompletely understood, although contributions to pathogenesis by regulators of proteolytic pathways have become increasingly apparent. Here, we present a novel variant in UBQLN4 that is associated with ALS and show that its expression compromises motor axon morphogenesis in mouse motor neurons and in zebrafish. We further demonstrate that the ALS-associated UBQLN4 variant impairs proteasomal function, and identify the Wnt signaling pathway effector beta-catenin as a UBQLN4 substrate. Inhibition of beta-catenin function rescues the UBQLN4 variant-induced motor axon phenotypes. These findings provide a strong link between the regulation of axonal morphogenesis and a new ALS-associated gene variant mediated by protein degradation pathways.

The Omega-3 Fatty Acid Eicosapentaenoic Acid Accelerates Disease Progression in a Model of Amyotrophic Lateral Sclerosis

PubMed Central

Gladman, Stacy; Biggio, Maria Luigia; Marino, Marianna; Jayasinghe, Maduka; Ullah, Farhan; Dyall, Simon C.; Malaspina, Andrea; Bendotti, Caterina; Michael-Titus, Adina

2013-01-01

Amyotrophic lateral sclerosis (ALS) is a progressive fatal neurodegenerative disease characterised by loss of motor neurons that currently has no cure. Omega-3 polyunsaturated fatty acids, such as eicosapentaenoic acid (EPA), have many health benefits including neuroprotective and myoprotective potential. We tested the hypothesis that a high level of dietary EPA could exert beneficial effects in ALS. The dietary exposure to EPA (300 mg/kg/day) in a well-established mouse model of ALS expressing the G93A superoxide dismutase 1 (SOD1) mutation was initiated at a pre-symptomatic or symptomatic stage, and the disease progression was monitored until the end stage. Daily dietary EPA exposure initiated at the disease onset did not significantly alter disease presentation and progression. In contrast, EPA treatment initiated at the pre-symptomatic stage induced a significantly shorter lifespan. In a separate group of animals sacrificed before the end stage, the tissue analysis showed that the vacuolisation detected in G93A-SOD1 mice was significantly increased by exposure to EPA. Although EPA did not alter motor neurone loss, EPA reversed the significant increase in activated microglia and the astrocytic activation seen in G93A-SOD1 mice. The microglia in the spinal cord of G93A-SOD1 mice treated with EPA showed a significant increase in 4-hydroxy-2-hexenal, a highly toxic aldehydic oxidation product of omega-3 fatty acids. These data show that dietary EPA supplementation in ALS has the potential to worsen the condition and accelerate the disease progression. This suggests that great caution should be exerted when considering dietary omega-3 fatty acid supplements in ALS patients. PMID:23620776

Preparation and characterization of a novel Al(18)F-NOTA-BZA conjugate for melanin-targeted imaging of malignant melanoma.

PubMed

Chang, Chih-Chao; Chang, Chih-Hsien; Lo, Yi-Hsuan; Lin, Ming-Hsien; Shen, Chih-Chieh; Liu, Ren-Shyan; Wang, Hsin-Ell; Chen, Chuan-Lin

2016-08-15

Melanin is an attractive target for the diagnosis and treatment of malignant melanoma. Previous studies have demonstrated the specific binding ability of benzamide moiety to melanin. In this study, we developed a novel (18)F-labeled NOTA-benzamide conjugate, Al(18)F-NOTA-BZA, which can be synthesized in 30min with a radiochemical yield of 20-35% and a radiochemical purity of >95%. Al(18)F-NOTA-BZA is highly hydrophilic (logP=-1.96) and shows good in vitro stability. Intravenous administration of Al(18)F-NOTA-BZA in two melanoma-bearing mouse models revealed highly specific uptake in B16F0 melanotic melanoma (6.67±0.91 and 1.50±0.26%ID/g at 15 and 120min p.i., respectively), but not in A375 amelanotic melanoma (0.87±0.21 and 0.24±0.09%ID/g at 15 and 120min p.i., respectively). The clearance from most normal tissues was fast. A microPET scan of Al(18)F-NOTA-BZA-injected mice also displayed high-contrast tumor images as compared with normal organs. Owing to the favorable in vivo distribution of Al(18)F-NOTA-BZA after intravenous administration, the estimated absorption dose was low in all normal organs and tissues. The melanin-specific binding ability, sustained tumor retention, fast normal tissues clearance and thelow projected human dosimetry supported that Al(18)F-NOTA-BZA is a very promising melanin-specific PET probe for melanin-positive melanoma. Copyright © 2016 Elsevier Ltd. All rights reserved.

Loss of spatacsin function alters lysosomal lipid clearance leading to upper and lower motor neuron degeneration.

PubMed

Branchu, Julien; Boutry, Maxime; Sourd, Laura; Depp, Marine; Leone, Céline; Corriger, Alexandrine; Vallucci, Maeva; Esteves, Typhaine; Matusiak, Raphaël; Dumont, Magali; Muriel, Marie-Paule; Santorelli, Filippo M; Brice, Alexis; El Hachimi, Khalid Hamid; Stevanin, Giovanni; Darios, Frédéric

2017-06-01

Mutations in SPG11 account for the most common form of autosomal recessive hereditary spastic paraplegia (HSP), characterized by a gait disorder associated with various brain alterations. Mutations in the same gene are also responsible for rare forms of Charcot-Marie-Tooth (CMT) disease and progressive juvenile-onset amyotrophic lateral sclerosis (ALS). To elucidate the physiopathological mechanisms underlying these human pathologies, we disrupted the Spg11 gene in mice by inserting stop codons in exon 32, mimicking the most frequent mutations found in patients. The Spg11 knockout mouse developed early-onset motor impairment and cognitive deficits. These behavioral deficits were associated with progressive brain atrophy with the loss of neurons in the primary motor cortex, cerebellum and hippocampus, as well as with accumulation of dystrophic axons in the corticospinal tract. Spinal motor neurons also degenerated and this was accompanied by fragmentation of neuromuscular junctions and muscle atrophy. This new Spg11 knockout mouse therefore recapitulates the full range of symptoms associated with SPG11 mutations observed in HSP, ALS and CMT patients. Examination of the cellular alterations observed in this model suggests that the loss of spatacsin leads to the accumulation of lipids in lysosomes by perturbing their clearance from these organelles. Altogether, our results link lysosomal dysfunction and lipid metabolism to neurodegeneration and pinpoint a critical role of spatacsin in lipid turnover. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Optimizing mouse models of neurodegenerative disorders: are therapeutics in sight?

PubMed

Lutz, Cathleen M; Osborne, Melissa A

2013-01-01

The genomic and biologic conservation between mice and humans, along with our increasing ability to manipulate the mouse genome, places the mouse as a premier model for deciphering disease mechanisms and testing potential new therapies. Despite these advantages, mouse models of neurodegenerative disease are sometimes difficult to generate and can present challenges that must be carefully addressed when used for preclinical studies. For those models that do exist, the standardization and optimization of the models is a critical step in ensuring success in both basic research and preclinical use. This review looks back on the history of model development for neurodegenerative diseases and highlights the key strategies that have been learned in order to improve the design, development and use of mouse models in the study of neurodegenerative disease.

Applications and Limitations of Mouse Models for Understanding Human Atherosclerosis

PubMed Central

von Scheidt, Moritz; Zhao, Yuqi; Kurt, Zeyneb; Pan, Calvin; Zeng, Lingyao; Yang, Xia; Schunkert, Heribert; Lusis, Aldons J.

2017-01-01

Most of the biological understanding of mechanisms underlying coronary artery disease (CAD) derives from studies of mouse models. The identification of multiple CAD loci and strong candidate genes in large human genome-wide association studies (GWAS) presented an opportunity to examine the relevance of mouse models for the human disease. We comprehensively reviewed the mouse literature, including 827 literature-derived genes, and compared it to human data. First, we observed striking concordance of risk factors for atherosclerosis in mice and humans. Second, there was highly significant overlap of mouse genes with human genes identified by GWAS. In particular, of the 46 genes with strong association signals in CAD-GWAS that were studied in mouse models all but one exhibited consistent effects on atherosclerosis-related phenotypes. Third, we compared 178 CAD-associated pathways derived from human GWAS with 263 from mouse studies and observed that over 50% were consistent between both species. PMID:27916529

Genetically engineered mouse models for studying inflammatory bowel disease.

PubMed

Mizoguchi, Atsushi; Takeuchi, Takahito; Himuro, Hidetomo; Okada, Toshiyuki; Mizoguchi, Emiko

2016-01-01

Inflammatory bowel disease (IBD) is a chronic intestinal inflammatory condition that is mediated by very complex mechanisms controlled by genetic, immune, and environmental factors. More than 74 kinds of genetically engineered mouse strains have been established since 1993 for studying IBD. Although mouse models cannot fully reflect human IBD, they have provided significant contributions for not only understanding the mechanism, but also developing new therapeutic means for IBD. Indeed, 20 kinds of genetically engineered mouse models carry the susceptibility genes identified in human IBD, and the functions of some other IBD susceptibility genes have also been dissected out using mouse models. Cutting-edge technologies such as cell-specific and inducible knockout systems, which were recently employed to mouse IBD models, have further enhanced the ability of investigators to provide important and unexpected rationales for developing new therapeutic strategies for IBD. In this review article, we briefly introduce 74 kinds of genetically engineered mouse models that spontaneously develop intestinal inflammation. Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Mouse Tumor Biology (MTB): a database of mouse models for human cancer.

PubMed

Bult, Carol J; Krupke, Debra M; Begley, Dale A; Richardson, Joel E; Neuhauser, Steven B; Sundberg, John P; Eppig, Janan T

2015-01-01

The Mouse Tumor Biology (MTB; http://tumor.informatics.jax.org) database is a unique online compendium of mouse models for human cancer. MTB provides online access to expertly curated information on diverse mouse models for human cancer and interfaces for searching and visualizing data associated with these models. The information in MTB is designed to facilitate the selection of strains for cancer research and is a platform for mining data on tumor development and patterns of metastases. MTB curators acquire data through manual curation of peer-reviewed scientific literature and from direct submissions by researchers. Data in MTB are also obtained from other bioinformatics resources including PathBase, the Gene Expression Omnibus and ArrayExpress. Recent enhancements to MTB improve the association between mouse models and human genes commonly mutated in a variety of cancers as identified in large-scale cancer genomics studies, provide new interfaces for exploring regions of the mouse genome associated with cancer phenotypes and incorporate data and information related to Patient-Derived Xenograft models of human cancers. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

The latest animal models of ovarian cancer for novel drug discovery.

PubMed

Magnotti, Elizabeth; Marasco, Wayne A

2018-03-01

Epithelial ovarian cancer is a heterogeneous disease classified into five subtypes, each with a different molecular profile. Most cases of ovarian cancer are diagnosed after metastasis of the primary tumor and are resistant to traditional platinum-based chemotherapeutics. Mouse models of ovarian cancer have been utilized to discern ovarian cancer tumorigenesis and the tumor's response to therapeutics. Areas covered: The authors provide a review of mouse models currently employed to understand ovarian cancer. This article focuses on advances in the development of orthotopic and patient-derived tumor xenograft (PDX) mouse models of ovarian cancer and discusses current humanized mouse models of ovarian cancer. Expert opinion: The authors suggest that humanized mouse models of ovarian cancer will provide new insight into the role of the human immune system in combating and augmenting ovarian cancer and aid in the development of novel therapeutics. Development of humanized mouse models will take advantage of the NSG and NSG-SGM3 strains of mice as well as new strains that are actively being derived.

How Genetically Engineered Mouse Tumor Models Provide Insights Into Human Cancers

PubMed Central

Politi, Katerina; Pao, William

2011-01-01

Genetically engineered mouse models (GEMMs) of human cancer were first created nearly 30 years ago. These early transgenic models demonstrated that mouse cells could be transformed in vivo by expression of an oncogene. A new field emerged, dedicated to generating and using mouse models of human cancer to address a wide variety of questions in cancer biology. The aim of this review is to highlight the contributions of mouse models to the diagnosis and treatment of human cancers. Because of the breadth of the topic, we have selected representative examples of how GEMMs are clinically relevant rather than provided an exhaustive list of experiments. Today, as detailed here, sophisticated mouse models are being created to study many aspects of cancer biology, including but not limited to mechanisms of sensitivity and resistance to drug treatment, oncogene cooperation, early detection, and metastasis. Alternatives to GEMMs, such as chemically induced or spontaneous tumor models, are not discussed in this review. PMID:21263096

Integrating model behavior, optimization, and sensitivity/uncertainty analysis: overview and application of the MOUSE software toolbox

USDA-ARS?s Scientific Manuscript database

This paper provides an overview of the Model Optimization, Uncertainty, and SEnsitivity Analysis (MOUSE) software application, an open-source, Java-based toolbox of visual and numerical analysis components for the evaluation of environmental models. MOUSE is based on the OPTAS model calibration syst...

Als2 mRNA splicing variants detected in KO mice rescue severe motor dysfunction phenotype in Als2 knock-down zebrafish.

PubMed

Gros-Louis, Francois; Kriz, Jasna; Kabashi, Edor; McDearmid, Jonathan; Millecamps, Stéphanie; Urushitani, Makoto; Lin, Li; Dion, Patrick; Zhu, Qinzhang; Drapeau, Pierre; Julien, Jean-Pierre; Rouleau, Guy A

2008-09-01

Recessive ALS2 mutations are linked to three related but slightly different neurodegenerative disorders: amyotrophic lateral sclerosis, hereditary spastic paraplegia and primary lateral sclerosis. To investigate the function of the ALS2 encoded protein, we generated Als2 knock-out (KO) mice and zAls2 knock-down zebrafish. The Als2(-/-) mice lacking exon 2 and part of exon 3 developed mild signs of neurodegeneration compatible with axonal transport deficiency. In contrast, zAls2 knock-down zebrafish had severe developmental abnormalities, swimming deficits and motor neuron perturbation. We identified, by RT-PCR, northern and western blotting novel Als2 transcripts in mouse central nervous system. These Als2 transcripts were present in Als2 null mice as well as in wild-type littermates and some rescued the zebrafish phenotype. Thus, we speculate that the newly identified Als2 mRNA species prevent the Als2 KO mice from developing severe neurodegenerative disease and might also regulate the severity of the motor neurons phenotype observed in ALS2 patients.

Active suppression rather than ignorance: tolerance to abacavir-induced HLA-B*57:01 peptide repertoire alteration.

PubMed

Phillips, Elizabeth J; Mallal, Simon A

2018-05-21

The discovery of HLA-B*57:01-associated abacavir hypersensitivity is a translational success story that eliminated adverse reactions to abacavir through pretreatment screening and defined a mechanistic model of an altered peptide repertoire. In this issue of the JCI, Cardone et al. have developed an HLA-B*57:01-transgenic mouse model and demonstrated that CD4+ T cells play a key role in mediating tolerance to the dramatically altered endogenous peptide repertoire induced by abacavir and postulate a known mechanism by which CD4+ T cells suppress DC maturation. This report potentially explains why 45% of HLA-B*57:01 carriers tolerate abacavir and provides a framework for future studies of HLA-restricted, T cell-mediated drug tolerance and hypersensitivity.

Cutaneous challenge with chemical warfare agents in the SKH-1 hairless mouse. (I) Development of a model for screening studies in skin decontamination and protection.

PubMed

Dorandeu, F; Taysse, L; Boudry, I; Foquin, A; Hérodin, F; Mathieu, J; Daulon, S; Cruz, C; Lallement, G

2011-06-01

Exposure to lethal chemical warfare agents (CWAs) is no longer only a military issue due to the terrorist threat. Among the CWAs of concern are the organophosphorus nerve agent O-ethyl-S-(2[di-isopropylamino]ethyl)methyl-phosphonothioate (VX) and the vesicant sulfur mustard (SM). Although efficient means of decontamination are available, most of them lose their efficacy when decontamination is delayed after exposure of the bare skin. Alternatively, CWA skin penetration can be prevented by topical skin protectants. Active research in skin protection and decontamination is thus paramount. In vivo screening of decontaminants or skin protectants is usually time consuming and may be expensive depending on the animal species used. We were thus looking for a suitable, scientifically sound and cost-effective model, which is easy to handle. The euthymic hairless mouse Crl: SKH-1 (hr/hr) BR is widely used in some skin studies and has previously been described to be suitable for some experiments involving SM or SM analogs. To evaluate the response of this species, we studied the consequences of exposing male anaesthetized SKH-1 mice to either liquid VX or to SM, the latter being used in liquid form or as saturated vapours. Long-term effects of SM burn were also evaluated. The model was then used in the companion paper (Taysse et al.(1)).

Protective effects of cultured and fermented ginseng extracts against scopolamine-induced memory loss in a mouse model.

PubMed

Han, Song-Hee; Kim, Sung-June; Yun, Young Won; Nam, Sang Yoon; Lee, Hu-Jang; Lee, Beom-Jun

2018-03-01

This study was performed to investigate the effect of a concentrate of fermented wild ginseng root culture (HLJG0701) on memory improvement in the scopolamine (SPL)-induced memory-deficient mouse model. Eight-week-old male ICR mice were used to evaluate the protective effect of HLJG0701 against the SPL-induced memory loss animal model. The Morris water maze test, which measures hippocampus-dependent learning ability, and the Y-maze test, a short-term memory assessment test, were performed and related markers were analyzed. HLJG0701-treated groups displayed significantly reduced acetylcholinesterase activity and increased acetylcholine level compared with the SPL-administered group (SPL-G) ( P <0.05). In the Y-maze test, the spontaneous alternation in al HLJG0711-treated groups was significantly increased compared with that in SPL-G ( P <0.05). In the Morris water maze test, the escape latency and time spent in the target quadrant in all HLJG0701-treated groups were significantly decreased and increased, respectively, compared with those in SPL-G ( P <0.05). In addition, the brain-derived neurotrophic factor level in groups treated with HLJG0701 300 and 600 mg/kg body weight was significantly increased compared with that in SPL-G ( P <0.05). These results suggest that the HLJG0701 may protect against memory loss by inhibiting acetylcholinesterase activity and preventing acetylcholine deficiency.

Disrupting the male germ line to find infertility and contraception targets.

PubMed

Archambeault, Denise R; Matzuk, Martin M

2014-05-01

Genetically-manipulated mouse models have become indispensible for broadening our understanding of genes and pathways related to male germ cell development. Until suitable in vitro systems for studying spermatogenesis are perfected, in vivo models will remain the gold standard for inquiry into testicular function. Here, we discuss exciting advances that are allowing researchers faster, easier, and more customizable access to their mouse models of interest. Specifically, the trans-NIH Knockout Mouse Project (KOMP) is working to generate knockout mouse models of every gene in the mouse genome. The related Knockout Mouse Phenotyping Program (KOMP2) is performing systematic phenotypic analysis of this genome-wide collection of knockout mice, including fertility screening. Together, these programs will not only uncover new genes involved in male germ cell development but also provide the research community with the mouse models necessary for further investigations. In addition to KOMP/KOMP2, another promising development in the field of mouse models is the advent of CRISPR (clustered regularly interspaced short palindromic repeat)-Cas technology. Utilizing 20 nucleotide guide sequences, CRISPR/Cas has the potential to introduce sequence-specific insertions, deletions, and point mutations to produce null, conditional, activated, or reporter-tagged alleles. CRISPR/Cas can also successfully target multiple genes in a single experimental step, forgoing the multiple generations of breeding traditionally required to produce mouse models with deletions, insertions, or mutations in multiple genes. In addition, CRISPR/Cas can be used to create mouse models carrying variants identical to those identified in infertile human patients, providing the opportunity to explore the effects of such mutations in an in vivo system. Both the KOMP/KOMP2 projects and the CRISPR/Cas system provide powerful, accessible genetic approaches to the study of male germ cell development in the mouse. A more complete understanding of male germ cell biology is critical for the identification of novel targets for potential non-hormonal contraceptive intervention. Copyright © 2014. Published by Elsevier Masson SAS.

Genome-Wide Expression Profiling of Five Mouse Models Identifies Similarities and Differences with Human Psoriasis

PubMed Central

Swindell, William R.; Johnston, Andrew; Carbajal, Steve; Han, Gangwen; Wohn, Christian; Lu, Jun; Xing, Xianying; Nair, Rajan P.; Voorhees, John J.; Elder, James T.; Wang, Xiao-Jing; Sano, Shigetoshi; Prens, Errol P.; DiGiovanni, John; Pittelkow, Mark R.; Ward, Nicole L.; Gudjonsson, Johann E.

2011-01-01

Development of a suitable mouse model would facilitate the investigation of pathomechanisms underlying human psoriasis and would also assist in development of therapeutic treatments. However, while many psoriasis mouse models have been proposed, no single model recapitulates all features of the human disease, and standardized validation criteria for psoriasis mouse models have not been widely applied. In this study, whole-genome transcriptional profiling is used to compare gene expression patterns manifested by human psoriatic skin lesions with those that occur in five psoriasis mouse models (K5-Tie2, imiquimod, K14-AREG, K5-Stat3C and K5-TGFbeta1). While the cutaneous gene expression profiles associated with each mouse phenotype exhibited statistically significant similarity to the expression profile of psoriasis in humans, each model displayed distinctive sets of similarities and differences in comparison to human psoriasis. For all five models, correspondence to the human disease was strong with respect to genes involved in epidermal development and keratinization. Immune and inflammation-associated gene expression, in contrast, was more variable between models as compared to the human disease. These findings support the value of all five models as research tools, each with identifiable areas of convergence to and divergence from the human disease. Additionally, the approach used in this paper provides an objective and quantitative method for evaluation of proposed mouse models of psoriasis, which can be strategically applied in future studies to score strengths of mouse phenotypes relative to specific aspects of human psoriasis. PMID:21483750

Inflammation and Fibrosis in Polycystic Kidney Disease.

PubMed

Song, Cheng Jack; Zimmerman, Kurt A; Henke, Scott J; Yoder, Bradley K

Polycystic kidney disease (PKD) is a commonly inherited disorder characterized by cyst formation and fibrosis (Wilson, N Engl J Med 350:151-164, 2004) and is caused by mutations in cilia or cilia-related proteins, such as polycystin 1 or 2 (Oh and Katsanis, Development 139:443-448, 2012; Kotsis et al., Nephrol Dial Transplant 28:518-526, 2013). A major pathological feature of PKD is the development of interstitial inflammation and fibrosis with an associated accumulation of inflammatory cells (Grantham, N Engl J Med 359:1477-1485, 2008; Zeier et al., Kidney Int 42:1259-1265, 1992; Ibrahim, Sci World J 7:1757-1767, 2007). It is unclear whether inflammation is a driving force for cyst formation or a consequence of the pathology (Ta et al., Nephrology 18:317-330, 2013) as in some murine models cysts are present prior to the increase in inflammatory cells (Phillips et al., Kidney Blood Press Res 30:129-144, 2007; Takahashi et al., J Am Soc Nephrol JASN 1:980-989, 1991), while in other models the increase in inflammatory cells is present prior to or coincident with cyst initiation (Cowley et al., Kidney Int 43:522-534, 1993, Kidney Int 60:2087-2096, 2001). Additional support for inflammation as an important contributor to cystic kidney disease is the increased expression of many pro-inflammatory cytokines in murine models and human patients with cystic kidney disease (Karihaloo et al., J Am Soc Nephrol JASN 22:1809-1814, 2011; Swenson-Fields et al., Kidney Int, 2013; Li et al., Nat Med 14:863-868, 2008a). Based on these data, an emerging model in the field is that disruption of primary cilia on tubule epithelial cells leads to abnormal cytokine cross talk between the epithelium and the inflammatory cells contributing to cyst growth and fibrosis (Ta et al., Nephrology 18:317-330, 2013). These cytokines are produced by interstitial fibroblasts, inflammatory cells, and tubule epithelial cells and activate multiple pathways including the JAK-STAT and NF-κB signaling (Qin et al., J Am Soc Nephrol JASN 23:1309-1318, 2012; Park et al., Am J Nephrol 32:169-178, 2010; Bhunia et al., Cell 109:157-168, 2002). Indeed, inflammatory cells are responsible for producing several of the pro-fibrotic growth factors observed in PKD patients with fibrosis (Nakamura et al., Am J Nephrol 20:32-36, 2000; Wilson et al., J Cell Physiol 150:360-369, 1992; Song et al., Hum Mol Genet 18:2328-2343, 2009; Schieren et al., Nephrol Dial Transplant 21:1816-1824, 2006). These growth factors trigger epithelial cell proliferation and myofibroblast activation that stimulate the production of extracellular matrix (ECM) genes including collagen types 1 and 3 and fibronectin, leading to reduced glomerular function with approximately 50% of ADPKD patients progressing to end-stage renal disease (ESRD). Therefore, treatments designed to reduce inflammation and slow the rate of fibrosis are becoming important targets that hold promise to improve patient life span and quality of life. In fact, recent studies in several PKD mouse models indicate that depletion of macrophages reduces cyst severity. In this chapter, we review the potential mechanisms of interstitial inflammation in PKD with a focus on ADPKD and discuss the role of interstitial inflammation in progression to fibrosis and ESRD.

[Effect of topical application of a recombinant adenovirus carrying promyelocytic leukemia gene in a psoriasis-like mouse model].

PubMed

Wang, Qiongyu; Zhang, Aijun; Ma, Huiqun; Wang, Shijie; Ma, Yunyun; Zou, Xingwei; Li, Ruilian

2013-03-01

To investigate the effects of topical treatment with adenovirus-mediated promyelocytic leukemia gene (PML) gene in a psoriasis-like mouse model. The effect of adenovirus-mediated PML gene on the granular layer of mouse tail scale epidermis and epithelial mitosis were observed on longitudinal histological sections prepared from the tail skin and vaginal epithelium of the mice. Adenovirus-mediated PML gene significantly inhibited mitosis of mouse vaginal epithelial cells and promoted the formation of granular layer in mouse tail scale epidermis. The therapeutic effect of PML gene in the psoriasis-like mouse model may be associated with increased granular cells and suppressed epidemic cell proliferation.

Generation of transgenic mouse model using PTTG as an oncogene.

PubMed

Kakar, Sham S; Kakar, Cohin

2015-01-01

The close physiological similarity between the mouse and human has provided tools to understanding the biological function of particular genes in vivo by introduction or deletion of a gene of interest. Using a mouse as a model has provided a wealth of resources, knowledge, and technology, helping scientists to understand the biological functions, translocation, trafficking, and interaction of a candidate gene with other intracellular molecules, transcriptional regulation, posttranslational modification, and discovery of novel signaling pathways for a particular gene. Most importantly, the generation of the mouse model for a specific human disease has provided a powerful tool to understand the etiology of a disease and discovery of novel therapeutics. This chapter describes in detail the step-by-step generation of the transgenic mouse model, which can be helpful in guiding new investigators in developing successful models. For practical purposes, we will describe the generation of a mouse model using pituitary tumor transforming gene (PTTG) as the candidate gene of interest.

Pharmacological Basis for Use of Armillaria mellea Polysaccharides in Alzheimer's Disease: Antiapoptosis and Antioxidation

PubMed Central

An, Shengshu; Lu, Wenqian; Zhang, Yongfeng; Yuan, Qingxia

2017-01-01

Armillaria mellea, an edible fungus, exhibits various pharmacological activities, including antioxidant and antiapoptotic properties. However, the effects of A. mellea on Alzheimer's disease (AD) have not been systemically reported. The present study aimed to explore the protective effects of mycelium polysaccharides (AMPS) obtained from A. mellea, especially AMPSc via 70% ethanol precipitation in a L-glutamic acid- (L-Glu-) induced HT22 cell apoptosis model and an AlCl3 plus D-galactose- (D-gal-) induced AD mouse model. AMPSc significantly enhanced cell viability, suppressed nuclear apoptosis, inhibited intracellular reactive oxygen species accumulation, prevented caspase-3 activation, and restored mitochondrial membrane potential (MMP). In AD mice, AMPSc enhanced horizontal movements in an autonomic activity test, improved endurance times in a rotarod test, and decreased escape latency time in a water maze test. Furthermore, AMPSc reduced the apoptosis rate, amyloid beta (Aβ) deposition, oxidative damage, and p-Tau aggregations in the AD mouse hippocampus. The central cholinergic system functions in AD mice improved after a 4-week course of AMPSc administration, as indicated by enhanced acetylcholine (Ach) and choline acetyltransferase (ChAT) concentrations, and reduced acetylcholine esterase (AchE) levels in serum and hypothalamus. Our findings provide experimental evidence suggesting A. mellea as a neuroprotective candidate for treating or preventing neurodegenerative diseases. PMID:29081887

An allometric pharmacokinetic/pharmacodynamics model for BI 893923, a novel IGF-1 receptor inhibitor.

PubMed

Titze, Melanie I; Schaaf, Otmar; Hofmann, Marco H; Sanderson, Michael P; Zahn, Stephan K; Quant, Jens; Lehr, Thorsten

2017-03-01

BI 893923 is a novel IGF1R/INSR inhibitor with promising anti-tumor efficacy. Dose-limiting hyperglycemia has been observed for other IGF1R/INSR inhibitors in clinical trials. To counterbalance anti-tumor efficacy with the risk of hyperglycemia and to determine the therapeutic window, we aimed to develop a translational pharmacokinetic/pharmacodynamics model for BI 893923. This aimed to translate pharmacokinetics and pharmacodynamics from animals to humans by an allometrically scaled semi-mechanistic model. Model development was based on a previously published PK/PD model for BI 893923 in mice (Titze et al., Cancer Chemother Pharmacol 77:1303-1314, 13). PK and blood glucose parameters were scaled by allometric principles using body weight as a scaling factor along with an estimation of the parameter exponents. Biomarker and tumor growth parameters were extrapolated from mouse to human using the body weight ratio as scaling factor. The allometric PK/PD model successfully described BI 893923 pharmacokinetics and blood glucose across mouse, rat, dog, minipig, and monkey. BI 893923 human exposure as well as blood glucose and tumor growth were predicted and compared for different dosing scenarios. A comprehensive risk-benefit analysis was conducted by determining the net clinical benefit for each schedule. An oral dose of 2750 mg BI 893923 divided in three evenly distributed doses was identified as the optimal human dosing regimen, predicting a tumor growth inhibition of 90.4% without associated hyperglycemia. Our model supported human therapeutic dose estimation by rationalizing the optimal efficacious dosing regimen with minimal undesired effects. This modeling approach may be useful for PK/PD scaling of other IGF1R/INSR inhibitors.

Creation of a Mouse with Stress-Induced Dystonia: Control of an ATPase Chaperone

DTIC Science & Technology

2012-10-01

Mice with mutations in genes known to cause dystonia in humans are so far virtually asymptomatic. Only mild motor deficiencies have been seen, such...identified the gene for one of the subunits of Na,K- ATPase, ATP1A3, as the site of mutations in RDP (de Carvalho Aguiar et al. 2004). Our prior work in...first paper, and to be able to give the mouse line an official name based on the mutated gene . Funding has been applied for from the following

Comparisons of Native and Chimeric Shiga Toxins Indicate that the Binding Subunit Dictates Degree of Toxicity

DTIC Science & Technology

2014-03-17

to the original BXD panel as BXD strains 43-103 (218). The genomes of both founder strains, B6 (308) and D2 (47; 307), have been sequenced and 1.8... sequencing of the DBA/2J mouse genome . BMC.Bioinformatics. 11 :07 308. Waterston RH, Lindblad-Toh K, Birney E, Rogers J, Abril JF, et al. 2002. Initial... sequencing and comparative analysis of the mouse genome . Nature 420:520-62 309. Weeratna RD, Doyle MP. 1991. Detection and production of verotoxin 1

What Is the Predictive Value of Animal Models for Vaccine Efficacy in Humans? Reevaluating the Potential of Mouse Models for the Human Immune System.

PubMed

Jameson, Stephen C; Masopust, David

2018-04-02

Much of what we understand about immunology, including the response to vaccines, come from studies in mice because they provide many practical advantages compared with research in higher mammals and humans. Nevertheless, modalities for preventing or treating disease do not always translate from mouse to humans, which has led to increasing scrutiny of the continued merits of mouse research. Here, we summarize the pros and cons of current laboratory mouse models for immunology research and discuss whether overreliance on nonphysiological, ultra-hygienic animal husbandry approaches has limited the ultimate translation potential of mouse-derived data to humans. Alternative approaches are discussed that may extend the use of the mouse model for preclinical studies. Copyright © 2018 Cold Spring Harbor Laboratory Press; all rights reserved.

Generation and Identification of GM-CSF Derived Alveolar-like Macrophages and Dendritic Cells From Mouse Bone Marrow

PubMed Central

Dong, Yifei; Arif, Arif A.; Poon, Grace F. T.; Hardman, Blair; Dosanjh, Manisha; Johnson, Pauline

2016-01-01

Macrophages and dendritic cells (DCs) are innate immune cells found in tissues and lymphoid organs that play a key role in the defense against pathogens. However, they are difficult to isolate in sufficient numbers to study them in detail, therefore, in vitro models have been developed. In vitro cultures of bone marrow-derived macrophages and dendritic cells are well-established and valuable methods for immunological studies. Here, a method for culturing and identifying both DCs and macrophages from a single culture of primary mouse bone marrow cells using the cytokine granulocyte macrophage colony-stimulating factor (GM-CSF) is described. This protocol is based on the established procedure first developed by Lutz et al. in 1999 for bone marrow-derived DCs. The culture is heterogeneous, and MHCII and fluoresceinated hyaluronan (FL-HA) are used to distinguish macrophages from immature and mature DCs. These GM-CSF derived macrophages provide a convenient source of in vitro derived macrophages that closely resemble alveolar macrophages in both phenotype and function. PMID:27404290

Early structural and functional plasticity alterations in a susceptibility period of DYT1 dystonia mouse striatum.

PubMed

Maltese, Marta; Stanic, Jennifer; Tassone, Annalisa; Sciamanna, Giuseppe; Ponterio, Giulia; Vanni, Valentina; Martella, Giuseppina; Imbriani, Paola; Bonsi, Paola; Mercuri, Nicola Biagio; Gardoni, Fabrizio; Pisani, Antonio

2018-03-05

The onset of abnormal movements in DYT1 dystonia is between childhood and adolescence, although it is unclear why clinical manifestations appear during this developmental period. Plasticity at corticostriatal synapses is critically involved in motor memory. In the Tor1a +/Δgag DYT1 dystonia mouse model, long-term potentiation (LTP) appeared prematurely in a critical developmental window in striatal spiny neurons (SPNs), while long-term depression (LTD) was never recorded. Analysis of dendritic spines showed an increase of both spine width and mature mushroom spines in Tor1a +/Δgag neurons, paralleled by an enhanced AMPA receptor (AMPAR) accumulation. BDNF regulates AMPAR expression during development. Accordingly, both proBDNF and BDNF levels were significantly higher in Tor1a +/Δgag mice. Consistently, antagonism of BDNF rescued synaptic plasticity deficits and AMPA currents. Our findings demonstrate that early loss of functional and structural synaptic homeostasis represents a unique endophenotypic trait during striatal maturation, promoting the appearance of clinical manifestations in mutation carriers. © 2018, Maltese et al.

Adducin at the Neuromuscular Junction in Amyotrophic Lateral Sclerosis: Hanging on for Dear Life

PubMed Central

Krieger, Charles; Wang, Simon Ji Hau; Yoo, Soo Hyun; Harden, Nicholas

2016-01-01

The neurological dysfunction in amyotrophic lateral sclerosis (ALS)/motor neurone disease (MND) is associated with defective nerve-muscle contacts early in the disease suggesting that perturbations of cell adhesion molecules (CAMs) linking the pre- and post-synaptic components of the neuromuscular junction (NMJ) are involved. To search for candidate proteins implicated in this degenerative process, researchers have studied the Drosophila larval NMJ and find that the cytoskeleton-associated protein, adducin, is ideally placed to regulate synaptic contacts. By controlling the levels of synaptic proteins, adducin can de-stabilize synaptic contacts. Interestingly, elevated levels of phosphorylated adducin have been reported in ALS patients and in a mouse model of the disease. Adducin is regulated by phosphorylation through protein kinase C (PKC), some isoforms of which exhibit Ca2+-dependence, raising the possibility that changes in intracellular Ca2+ might alter PKC activation and secondarily influence adducin phosphorylation. Furthermore, adducin has interactions with the alpha subunit of the Na+/K+-ATPase. Thus, the phosphorylation of adducin may secondarily influence synaptic stability at the NMJ and so influence pre- and post-synaptic integrity at the NMJ in ALS. PMID:26858605

Phase 2 study of sodium phenylbutyrate in ALS.

PubMed

Cudkowicz, Merit E; Andres, Patricia L; Macdonald, Sally A; Bedlack, Richard S; Choudry, Rabia; Brown, Robert H; Zhang, Hui; Schoenfeld, David A; Shefner, Jeremy; Matson, Samantha; Matson, Wayne R; Ferrante, Robert J

2009-04-01

The objective of the study was to establish the safety and pharmacodynamics of escalating dosages of sodium phenylbutyrate (NaPB) in participants with ALS. Transcription dysregulation may play a role in the pathogenesis of ALS. Sodium phenylbutyrate, a histone deacetylase inhibitor, improves transcription and post-transcriptional pathways, promoting cell survival in a mouse model of motor neuron disease. Forty research participants at eight sites enrolled in an open-label study. Study medication was increased from 9 to 21 g/day. The primary outcome measure was tolerability. Secondary outcome measures included adverse events, blood histone acetylation levels, and NaPB blood levels at each dosage. Twenty-six participants completed the 20-week treatment phase. NaPB was safe and tolerable. No study deaths or clinically relevant laboratory changes occurred with NaPB treatment. Histone acetylation was decreased by approximately 50% in blood buffy-coat specimens at screening and was significantly increased after NaPB administration. Blood levels of NaPB and the primary metabolite, phenylacetate, increased with dosage. While the majority of subjects tolerated higher dosages of NaPB, the lowest dose (9 g/day), was therapeutically efficient in improving histone acetylation levels.

Systemic deregulation of autophagy upon loss of ALS- and FTD-linked C9orf72.

PubMed

Ji, Yon Ju; Ugolino, Janet; Brady, Nathan Ryan; Hamacher-Brady, Anne; Wang, Jiou

2017-07-03

A genetic mutation in the C9orf72 gene causes the most common forms of neurodegenerative diseases amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). The C9orf72 protein, predicted to be a DENN-family protein, is reduced in ALS and FTD, but its functions remain poorly understood. Using a 3110043O21Rik/C9orf72 knockout mouse model, as well as cellular analysis, we have found that loss of C9orf72 causes alterations in the signaling states of central autophagy regulators. In particular, C9orf72 depletion leads to reduced activity of MTOR, a negative regulator of macroautophagy/autophagy, and concomitantly increased TFEB levels and nuclear translocation. Consistent with these alterations, cells exhibit enlarged lysosomal compartments and enhanced autophagic flux. Loss of the C9orf72 interaction partner SMCR8 results in similar phenotypes. Our findings suggest that C9orf72 functions as a potent negative regulator of autophagy, with a central role in coupling the cellular metabolic state with autophagy regulation. We thus propose C9orf72 as a fundamental component of autophagy signaling with implications in basic cell physiology and pathophysiology, including neurodegeneration.

Mouse Models in Bone Marrow Transplantation and Adoptive Cellular Therapy

PubMed Central

Arber, Caroline; Brenner, Malcolm K.; Reddy, Pavan

2014-01-01

Mouse models of transplantation have been indispensable to the development of bone marrow transplantation (BMT). Their role in the generation of basic science knowledge is invaluable and is subject to discussion below. However, this article focuses on the direct role and relevance of mouse models towards the clinical development and advances in BMT and adoptive T-cell therapy for human diseases. The authors aim to present a thoughtful perspective on the pros and cons of mouse models while noting that despite imperfections these models are obligatory for the development of science-based medicine. PMID:24216170

Centralized mouse repositories.

PubMed

Donahue, Leah Rae; Hrabe de Angelis, Martin; Hagn, Michael; Franklin, Craig; Lloyd, K C Kent; Magnuson, Terry; McKerlie, Colin; Nakagata, Naomi; Obata, Yuichi; Read, Stuart; Wurst, Wolfgang; Hörlein, Andreas; Davisson, Muriel T

2012-10-01

Because the mouse is used so widely for biomedical research and the number of mouse models being generated is increasing rapidly, centralized repositories are essential if the valuable mouse strains and models that have been developed are to be securely preserved and fully exploited. Ensuring the ongoing availability of these mouse strains preserves the investment made in creating and characterizing them and creates a global resource of enormous value. The establishment of centralized mouse repositories around the world for distributing and archiving these resources has provided critical access to and preservation of these strains. This article describes the common and specialized activities provided by major mouse repositories around the world.

Centralized Mouse Repositories

PubMed Central

Donahue, Leah Rae; de Angelis, Martin Hrabe; Hagn, Michael; Franklin, Craig; Lloyd, K. C. Kent; Magnuson, Terry; McKerlie, Colin; Nakagata, Naomi; Obata, Yuichi; Read, Stuart; Wurst, Wolfgang; Hörlein, Andreas; Davisson, Muriel T.

2013-01-01

Because the mouse is used so widely for biomedical research and the number of mouse models being generated is increasing rapidly, centralized repositories are essential if the valuable mouse strains and models that have been developed are to be securely preserved and fully exploited. Ensuring the ongoing availability of these mouse strains preserves the investment made in creating and characterizing them and creates a global resource of enormous value. The establishment of centralized mouse repositories around the world for distributing and archiving these resources has provided critical access to and preservation of these strains. This article describes the common and specialized activities provided by major mouse repositories around the world. PMID:22945696

The Paradoxical Signals of Two TrkC Receptor Isoforms Supports a Rationale for Novel Therapeutic Strategies in ALS

PubMed Central

Barcelona, Pablo F.; Galan, Alba; Aboulkassim, Tahar; Teske, Katrina; Rogers, Mary-Louise; Bertram, Lisa; Wang, Jing; Yousefi, Masoud; Rush, Robert; Fabian, Marc; Cashman, Neil

2016-01-01

Full length TrkC (TrkC-FL) is a receptor tyrosine kinase whose mRNA can be spliced to a truncated TrkC.T1 isoform lacking the kinase domain. Neurotrophin-3 (NT-3) activates TrkC-FL to maintain motor neuron health and function and TrkC.T1 to produce neurotoxic TNF-α; hence resulting in opposing pathways. In mouse and human ALS spinal cord, the reduction of miR-128 that destabilizes TrkC.T1 mRNA results in up-regulated TrkC.T1 and TNF-α in astrocytes. We exploited conformational differences to develop an agonistic mAb 2B7 that selectively activates TrkC-FL, to circumvent TrkC.T1 activation. In mouse ALS, 2B7 activates spinal cord TrkC-FL signals, improves spinal cord motor neuron phenotype and function, and significantly prolongs life-span. Our results elucidate biological paradoxes of receptor isoforms and their role in disease progression, validate the concept of selectively targeting conformational epitopes in naturally occurring isoforms, and may guide the development of pro-neuroprotective (TrkC-FL) and anti-neurotoxic (TrkC.T1) therapeutic strategies. PMID:27695040

Target dependence of orientation and direction selectivity of corticocortical projection neurons in the mouse V1

PubMed Central

Matsui, Teppei; Ohki, Kenichi

2013-01-01

Higher order visual areas that receive input from the primary visual cortex (V1) are specialized for the processing of distinct features of visual information. However, it is still incompletely understood how this functional specialization is acquired. Here we used in vivo two photon calcium imaging in the mouse visual cortex to investigate whether this functional distinction exists at as early as the level of projections from V1 to two higher order visual areas, AL and LM. Specifically, we examined whether sharpness of orientation and direction selectivity and optimal spatial and temporal frequency of projection neurons from V1 to higher order visual areas match with that of target areas. We found that the V1 input to higher order visual areas were indeed functionally distinct: AL preferentially received inputs from V1 that were more orientation and direction selective and tuned for lower spatial frequency compared to projection of V1 to LM, consistent with functional differences between AL and LM. The present findings suggest that selective projections from V1 to higher order visual areas initiates parallel processing of sensory information in the visual cortical network. PMID:24068987

MicroRNA-206: A Potential Circulating Biomarker Candidate for Amyotrophic Lateral Sclerosis

PubMed Central

Toivonen, Janne M.; Manzano, Raquel; Oliván, Sara; Zaragoza, Pilar; García-Redondo, Alberto; Osta, Rosario

2014-01-01

Amyotrophic lateral sclerosis (ALS) is a lethal motor neuron disease that progressively debilitates neuronal cells that control voluntary muscle activity. Biomarkers are urgently needed to facilitate ALS diagnosis and prognosis, and as indicators of therapeutic response in clinical trials. microRNAs (miRNAs), small posttranscriptional modifiers of gene expression, are frequently altered in disease conditions. Besides their important regulatory role in variety of biological processes, miRNAs can also be released into the circulation by pathologically affected tissues and display remarkable stability in body fluids. In a mouse model of ALS that expresses mutated human superoxide dismutase 1 (SOD1-G93A) skeletal muscle is one of the tissues affected early by mutant SOD1 toxicity. To find biomarkers for ALS, we studied miRNA alterations from skeletal muscle and plasma of SOD1-G93A mice, and subsequently tested the levels of the affected miRNAs in the serum from human ALS patients. Fast-twitch and slow-twitch muscles from symptomatic SOD1-G93A mice (age 90 days) and their control littermates were first studied using miRNA microarrays and then evaluated with quantitative PCR from five age groups from neonatal to the terminal disease stage (10–120 days). Among those miRNA changed in various age/gender/muscle groups (miR-206, -1, -133a, -133b, -145, -21, -24), miR-206 was the only one consistently altered during the course of the disease pathology. In both sexes, mature miR-206 was increased in fast-twitch muscles preferably affected in the SOD1-G93A model, with highest expression towards the most severely affected animals. Importantly, miR-206 was also increased in the circulation of symptomatic animals and in a group of 12 definite ALS patients tested. We conclude that miR-206 is elevated in the circulation of symptomatic SOD1-G93A mice and possibly in human ALS patients. Although larger scale studies on ALS patients are warranted, miR-206 is a promising candidate biomarker for this motor neuron disease. PMID:24586506

Neuroprotective effects of the mitochondria-targeted antioxidant MitoQ in a model of inherited amyotrophic lateral sclerosis.

PubMed

Miquel, Ernesto; Cassina, Adriana; Martínez-Palma, Laura; Souza, José M; Bolatto, Carmen; Rodríguez-Bottero, Sebastián; Logan, Angela; Smith, Robin A J; Murphy, Michael P; Barbeito, Luis; Radi, Rafael; Cassina, Patricia

2014-05-01

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder characterized by motor neuron degeneration that ultimately results in progressive paralysis and death. Growing evidence indicates that mitochondrial dysfunction and oxidative stress contribute to motor neuron degeneration in ALS. To further explore the hypothesis that mitochondrial dysfunction and nitroxidative stress contribute to disease pathogenesis at the in vivo level, we assessed whether the mitochondria-targeted antioxidant [10-(4,5-dimethoxy-2-methyl-3,6-dioxo-1,4-cyclohexadien-1-yl)decyl]triphenylphosphonium methane sulfonate (MitoQ) can modify disease progression in the SOD1(G93A) mouse model of ALS. To do this, we administered MitoQ (500 µM) in the drinking water of SOD1(G93A) mice from a time when early symptoms of neurodegeneration become evident at 90 days of age until death. This regime is a clinically plausible scenario and could be more easily translated to patients as this corresponds to initiating treatment of patients after they are first diagnosed with ALS. MitoQ was detected in all tested tissues by liquid chromatography/mass spectrometry after 20 days of administration. MitoQ treatment slowed the decline of mitochondrial function, in both the spinal cord and the quadriceps muscle, as measured by high-resolution respirometry. Importantly, nitroxidative markers and pathological signs in the spinal cord of MitoQ-treated animals were markedly reduced and neuromuscular junctions were recovered associated with a significant increase in hindlimb strength. Finally, MitoQ treatment significantly prolonged the life span of SOD1(G93A) mice. Our results support a role for mitochondrial nitroxidative damage and dysfunction in the pathogenesis of ALS and suggest that mitochondria-targeted antioxidants may be of pharmacological use for ALS treatment. Copyright © 2014 Elsevier Inc. All rights reserved.

AFRRI (Armed Forces Radiobiology Research Institute) Reports, October, November and December 1987.

DTIC Science & Technology

1988-03-01

cells (Blakely et al., 1979), mouse BalbC 3T3 cells (Ngo et al., 1981), cells grown in multicellular spheroids (Durand and Olive , 1976), in situ mela...0 radiation. It appeared that an experimental elemental diet was associated with both an enhanced cellular proliferation in the blood-forming tissues...elemental diet for I week before irradiation, and the mean survival time was 59 days. Beginning the diet after irradiation offered no protection. Vitamin E

A Literature Review on the Mechanism of Action of Sulphur and Nitrogen Mustard

DTIC Science & Technology

1989-07-01

for years is also poeqible (Aasted et al, 1987; Colardyn et al, 1986). Severely poisoned individuals exhibit bone marrow depression and may die from...MMS does not produce the enhanced depression of DNA synthesis in sensitive cells, compared to resistant cells, produced by sulphur mustard and...Compound MATD 1 Protection (mg/mouse) index 2 WR-3689 15 159 WR-2721 15 44 Aminoethylcysteine 80 27 N- acetylcysteine 8 26 Glutathione 60 22 Cysteine 8

Detection and Quantitation of T-2 Mycotoxin Using a Simplified Protein Synthesis Inhibition Assay.

DTIC Science & Technology

1983-07-18

immunosuppressive nature of the mycotoxins. The mouse bioassay (Ueno et al, 1971) and the skin sensitivity test (Ueno et al, 1970; Chung, 1974) are effective... natural occurrence. In Mycotoxins in Human and Animal Health WJ. V. Rodricks, C. W. Hasseltine, and M. A. Mehlman, eds.), pp. 229-253. Pathotox: Publishers...363, 14I37-1441. Terac, K., and Ito, E. (1981). The effects of naturally occurring bisdihydrofuran ring-containing mycotoxins on cultured chick

Molecular Indicators of Stress-Induced Neuroinflammation in a Mouse Model Simulating Features of Post-Traumatic Stress Disorder (Open Access)

DTIC Science & Technology

2017-05-23

OPEN ORIGINAL ARTICLE Molecular indicators of stress-induced neuroinflammation in a mouse model simulating features of post -traumatic stress disorder... post -traumatic stress disorder (PTSD). The model involved exposure of an intruder (male C57BL/6) mouse to a resident aggressor (male SJL) mouse for 5...revealed that neurogenesis and synaptic plasticity pathways were activated during the early responses but were inhibited after the later post -trauma

Ionizing radiation-induced mutagenesis: radiation studies in Neurospora predictive for results in mammalian cells

NASA Technical Reports Server (NTRS)

Evans, H. H.; DeMarini, D. M.

1999-01-01

Ionizing radiation was the first mutagen discovered and was used to develop the first mutagenicity assay. In the ensuing 70+ years, ionizing radiation became a fundamental tool in understanding mutagenesis and is still a subject of intensive research. Frederick de Serres et al. developed and used the Neurospora crassa ad-3 system initially to explore the mutagenic effects of ionizing radiation. Using this system, de Serres et al. demonstrated the dependence of the frequency and spectra of mutations induced by ionizing radiation on the dose, dose rate, radiation quality, repair capabilities of the cells, and the target gene employed. This work in Neurospora predicted the subsequent observations of the mutagenic effects of ionizing radiation in mammalian cells. Modeled originally on the mouse specific-locus system developed by William L. Russell, the N. crassa ad-3 system developed by de Serres has itself served as a model for interpreting the results in subsequent systems in mammalian cells. This review describes the primary findings on the nature of ionizing radiation-induced mutagenesis in the N. crassa ad-3 system and the parallel observations made years later in mammalian cells.

Nonparametric modeling of longitudinal covariance structure in functional mapping of quantitative trait loci.

PubMed

Yap, John Stephen; Fan, Jianqing; Wu, Rongling

2009-12-01

Estimation of the covariance structure of longitudinal processes is a fundamental prerequisite for the practical deployment of functional mapping designed to study the genetic regulation and network of quantitative variation in dynamic complex traits. We present a nonparametric approach for estimating the covariance structure of a quantitative trait measured repeatedly at a series of time points. Specifically, we adopt Huang et al.'s (2006, Biometrika 93, 85-98) approach of invoking the modified Cholesky decomposition and converting the problem into modeling a sequence of regressions of responses. A regularized covariance estimator is obtained using a normal penalized likelihood with an L(2) penalty. This approach, embedded within a mixture likelihood framework, leads to enhanced accuracy, precision, and flexibility of functional mapping while preserving its biological relevance. Simulation studies are performed to reveal the statistical properties and advantages of the proposed method. A real example from a mouse genome project is analyzed to illustrate the utilization of the methodology. The new method will provide a useful tool for genome-wide scanning for the existence and distribution of quantitative trait loci underlying a dynamic trait important to agriculture, biology, and health sciences.

Genetic characterization and improved genotyping of the dysferlin-deficient mouse strain Dysf (tm1Kcam).

PubMed

Wiktorowicz, Tatiana; Kinter, Jochen; Kobuke, Kazuhiro; Campbell, Kevin P; Sinnreich, Michael

2015-01-01

Mouse models of dysferlinopathies are valuable tools with which to investigate the pathomechanisms underlying these diseases and to test novel therapeutic strategies. One such mouse model is the Dysf (tm1Kcam) strain, which was generated using a targeting vector to replace a 12-kb region of the dysferlin gene and which features a progressive muscular dystrophy. A prerequisite for successful animal studies using genetic mouse models is an accurate genotyping protocol. Unfortunately, the lack of robustness of currently available genotyping protocols for the Dysf (tm1Kcam) mouse has prevented efficient colony management. Initial attempts to improve the genotyping protocol based on the published genomic structure failed. These difficulties led us to analyze the targeted locus of the dysferlin gene of the Dysf (tm1Kcam) mouse in greater detail. In this study we resequenced and analyzed the targeted locus of the Dysf (tm1Kcam) mouse and developed a novel PCR protocol for genotyping. We found that instead of a deletion, the dysferlin locus in the Dysf (tm1Kcam) mouse carries a targeted insertion. This genetic characterization enabled us to establish a reliable method for genotyping of the Dysf (tm1Kcam) mouse, and thus has made efficient colony management possible. Our work will make the Dysf (tm1Kcam) mouse model more attractive for animal studies of dysferlinopathies.

Mouse models of neurodegenerative diseases: criteria and general methodology.

PubMed

Janus, Christopher; Welzl, Hans

2010-01-01

The major symptom of Alzheimer's disease is rapidly progressing dementia, coinciding with the formation of amyloid and tau deposits in the central nervous system, and neuronal death. At present familial cases of dementias provide the most promising foundation for modelling neurodegeneration. We describe the mnemonic and other major behavioral symptoms of tauopathies, briefly outline the genetics underlying familiar cases and discuss the arising implications for modelling the disease in mostly transgenic mouse lines. We then depict to what degree the most recent mouse models replicate pathological and cognitive characteristics observed in patients.There is no universally valid behavioral test battery to evaluate mouse models. The selection of individual tests depends on the behavioral and/or memory system in focus, the type of a model and how well it replicates the pathology of a disease and the amount of control over the genetic background of the mouse model. However it is possible to provide guidelines and criteria for modelling the neurodegeneration, setting up the experiments and choosing relevant tests. One should not adopt a "one (trans)gene, one disease" interpretation, but should try to understand how the mouse genome copes with the protein expression of the transgene in question. Further, it is not possible to recommend some mouse models over others since each model is valuable within its own constraints, and the way experiments are performed often reflects the idiosyncratic reality of specific laboratories. Our purpose is to improve bridging molecular and behavioural approaches in translational research.

Direct comparison of the pharmacodynamics of four antifungal drugs in a mouse model of disseminated candidiasis using microbiological assays of serum drug concentrations.

PubMed

Maki, Katsuyuki; Holmes, Ann R; Watabe, Etsuko; Iguchi, Yumi; Matsumoto, Satoru; Ikeda, Fumiaki; Tawara, Shuichi; Mutoh, Seitaro

2007-01-01

The aim of this study was to compare the pharmacodynamics of the azole antifungal drugs fluconazole, itraconazole and ketoconazole, and the polyene antifungal amphotericin B, in a mouse model of disseminated Candida albicans infection. In order to directly compare effective serum concentrations of these antifungals, drug concentrations were assayed microbiologically by measuring inhibition of C. albicans mycelial growth (mMIC) in a mouse serum-based assay (serum antifungal titer). Efficacy in the mouse infection model was determined using an organ-based (kidney burden) endpoint. For all four drugs, the serum antifungal titers, 8 hr after administration of single doses of drugs at a range of drug concentrations, correlated closely with C. albicans kidney fungal burden in the mouse model. The results showed that determining serum antifungal titer may be used to accurately represent kidney fungal burden in a mouse model of disseminated candidiasis and allowed direct comparison of the pharmacodynamics of differing classes of antifungal drugs.

Mouse Models as Tools to Identify Genetic Pathways for Retinal Degeneration, as Exemplified by Leber's Congenital Amaurosis.

PubMed

Chang, Bo

2016-01-01

Leber's congenital amaurosis (LCA) is an inherited retinal degenerative disease characterized by severe loss of vision in the first year of life. In addition to early vision loss, a variety of other eye-related abnormalities including roving eye movements, deep-set eyes, and sensitivity to bright light also occur with this disease. Many animal models of LCA are available and the study them has led to a better understanding of the pathology of the disease, and has led to the development of therapeutic strategies aimed at curing or slowing down LCA. Mouse models, with their well-developed genetics and similarity to human physiology and anatomy, serve as powerful tools with which to investigate the etiology of human LCA. Such mice provide reproducible, experimental systems for elucidating pathways of normal development, function, designing strategies and testing compounds for translational research and gene-based therapies aimed at delaying the diseases progression. In this chapter, I describe tools used in the discovery and evaluation of mouse models of LCA including a Phoenix Image-Guided Optical Coherence Tomography (OCT) and a Diagnosys Espion Visual Electrophysiology System. Three mouse models are described, the rd3 mouse model for LCA12 and LCA1, the rd12 mouse model for LCA2, and the rd16 mouse model for LCA10.

Differences in Pathogenesis for Salmonella enterica serovar Typhimurium in the Mouse Versus the Swine Model Identify Bacterial Gene Products Required for Systemic but not Gastrointestinal Disease

USDA-ARS?s Scientific Manuscript database

Over the last several decades, the mouse model of Typhoid fever has been an extremely productive model to investigate Salmonella enterica serovar Typhimurium pathogenesis. The mouse is the paradigm for investigating systemic disease due to infection by Salmonella; however, the swine model of gastro...

Neuroanatomical characterization of the cellular and axonal architecture of subcortical band heterotopia in the BXD29-Tlr4lps-2J/J mouse cortex.

PubMed

Ramos, Raddy L; Toia, Alyssa R; Pasternack, Daniel M; Dotzler, Timothy P; Cuoco, Joshua A; Esposito, Anthony W; Le, Megan M; Parker, Alexander K; Goodman, Jeffrey H; Sarkisian, Matthew R

2016-11-19

Subcortical band heterotopia (SBH) are malformations of the human cerebral cortex typically associated with epilepsy and cognitive delay/disability. Rodent models of SBH have demonstrated strong face validity as they are accompanied by both cognitive deficits and spontaneous seizures or reduced seizure threshold. BXD29-Tlr4 lps-2J /J recombinant inbred mice display striking bilateral SBH, partial callosal agenesis, morphological changes in subcortical structures of the auditory pathway, and display sensory deficits in behavioral tests (Rosen et al., 2013; Truong et al., 2013, 2015). Surprisingly, these mice show no cognitive deficits and have a higher seizure threshold to chemi-convulsive treatment (Gabel et al., 2013) making them different than other rodent SBH models described previously. In the present report, we perform a detailed characterization of the cellular and axonal constituents of SBH in BXD29-Tlr4 lps-2J /J mice and demonstrate that various types of interneurons and glia as well as cortical and subcortical projections are found in SBH. In addition, the length of neuronal cilia was reduced in SBH compared to neurons in the overlying and adjacent normotopic cortex. Finally, we describe additional and novel malformations of the hippocampus and neocortex present in BXD29-Tlr4 lps-2J /J mice. Together, our findings in BXD29-Tlr4 lps-2J /J mice are discussed in the context of the known neuroanatomy and phenotype of other SBH rodent models. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.

Aberrant regulation of DNA methylation in amyotrophic lateral sclerosis: a new target of disease mechanisms.

PubMed

Martin, Lee J; Wong, Margaret

2013-10-01

Amyotrophic lateral sclerosis (ALS) is the third most common adult-onset neurodegenerative disease. A diagnosis is fatal owing to degeneration of motor neurons in brain and spinal cord that control swallowing, breathing, and movement. ALS can be inherited, but most cases are not associated with a family history of the disease. The mechanisms causing motor neuron death in ALS are still unknown. Given the suspected complex interplay between multiple genes, the environment, metabolism, and lifestyle in the pathogenesis of ALS, we have hypothesized that the mechanisms of disease in ALS involve epigenetic contributions that can drive motor neuron degeneration. DNA methylation is an epigenetic mechanism for gene regulation engaged by DNA methyltransferase (Dnmt)-catalyzed methyl group transfer to carbon-5 in cytosine residues in gene regulatory promoter and nonpromoter regions. Recent genome-wide analyses have found differential gene methylation in human ALS. Neuropathologic assessments have revealed that motor neurons in human ALS show significant abnormalities in Dnmt1, Dnmt3a, and 5-methylcytosine. Similar changes are seen in mice with motor neuron degeneration, and Dnmt3a was found abundantly at synapses and in mitochondria. During apoptosis of cultured motor neuron-like cells, Dnmt1 and Dnmt3a protein levels increase, and 5-methylcytosine accumulates. Enforced expression of Dnmt3a, but not Dnmt1, induces degeneration of cultured neurons. Truncation mutation of the Dnmt3a catalytic domain and Dnmt3a RNAi blocks apoptosis of cultured neurons. Inhibition of Dnmt catalytic activity with small molecules RG108 and procainamide protects motor neurons from excessive DNA methylation and apoptosis in cell culture and in a mouse model of ALS. Thus, motor neurons can engage epigenetic mechanisms to cause their degeneration, involving Dnmts and increased DNA methylation. Aberrant DNA methylation in vulnerable cells is a new direction for discovering mechanisms of ALS pathogenesis that could be relevant to new disease target identification and therapies for ALS.

A unified model of the excitability of mouse sensory and motor axons.

PubMed

Makker, Preet G S; Matamala, José Manuel; Park, Susanna B; Lees, Justin G; Kiernan, Matthew C; Burke, David; Moalem-Taylor, Gila; Howells, James

2018-06-19

Non-invasive nerve excitability techniques have provided valuable insight into the understanding of neurological disorders. The widespread use of mice in translational research on peripheral nerve disorders and by pharmaceutical companies during drug development requires valid and reliable models that can be compared to humans. This study established a novel experimental protocol that enables comparative assessment of the excitability properties of motor and sensory axons at the same site in mouse caudal nerve, compared the mouse data to data for motor and sensory axons in human median nerve at the wrist, and constructed a mathematical model of the excitability of mouse axons. In a separate study, ischaemia was employed as an experimental manoeuvre to test the translational utility of this preparation. The patterns of mouse sensory and motor excitability were qualitatively similar to human studies under normal and ischaemic conditions. The most conspicuous differences between mouse and human studies were observed in the recovery cycle and the response to hyperpolarization. Modelling showed that an increase in temperature in mouse axons could account for most of the differences in the recovery cycle. The modelling also suggested a larger hyperpolarization-activated conductance in mouse axons. The kinetics of this conductance appeared to be much slower raising the possibility that an additional or different hyperpolarization-activated cyclic-nucleotide gated (HCN) channel isoform underlies the accommodation to hyperpolarization in mouse axons. Given a possible difference in HCN isoforms, caution should be exercised in extrapolating from studies of mouse motor and sensory axons to human nerve disorders. This article is protected by copyright. All rights reserved.

Rapamycin improves sociability in the BTBR T(+)Itpr3(tf)/J mouse model of autism spectrum disorders.

PubMed

Burket, Jessica A; Benson, Andrew D; Tang, Amy H; Deutsch, Stephen I

2014-01-01

Overactivation of the mammalian target of rapamycin (mTOR) has been implicated in the pathogenesis of syndromic forms of autism spectrum disorders (ASDs), such as tuberous sclerosis complex, neurofibromatosis 1, and fragile X syndrome. Administration of mTORC1 (mTOR complex 1) inhibitors (e.g. rapamycin) in syndromic mouse models of ASDs improved behavior, cognition, and neuropathology. However, since only a minority of ASDs are due to the effects of single genes (∼10%), there is a need to explore inhibition of mTOR activity in mouse models that may be more relevant to the majority of nonsyndromic presentations, such as the genetically inbred BTBR T(+)Itpr3(tf)/J (BTBR) mouse model of ASDs. BTBR mice have social impairment and exhibit increased stereotypic behavior. In prior work, d-cycloserine, a partial glycineB site agonist that targets the N-methyl-d-aspartate (NMDA) receptor, was shown to improve sociability in both Balb/c and BTBR mouse models of ASDs. Importantly, NMDA receptor activation regulates mTOR signaling activity. The current study investigated the ability of rapamycin (10mg/kg, i.p.×four days), an mTORC1 inhibitor, to improve sociability and stereotypic behavior in BTBR mice. Using a standard paradigm to assess mouse social behavior, rapamycin improved several measures of sociability in the BTBR mouse, suggesting that mTOR overactivation represents a therapeutic target that mediates or contributes to impaired sociability in the BTBR mouse model of ASDs. Interestingly, there was no effect of rapamycin on stereotypic behaviors in this mouse model. Copyright © 2013 Elsevier Inc. All rights reserved.

Experimental Design and Data Analysis Issues Contribute to Inconsistent Results of C-Bouton Changes in Amyotrophic Lateral Sclerosis.

PubMed

Dukkipati, S Shekar; Chihi, Aouatef; Wang, Yiwen; Elbasiouny, Sherif M

2017-01-01

The possible presence of pathological changes in cholinergic synaptic inputs [cholinergic boutons (C-boutons)] is a contentious topic within the ALS field. Conflicting data reported on this issue makes it difficult to assess the roles of these synaptic inputs in ALS. Our objective was to determine whether the reported changes are truly statistically and biologically significant and why replication is problematic. This is an urgent question, as C-boutons are an important regulator of spinal motoneuron excitability, and pathological changes in motoneuron excitability are present throughout disease progression. Using male mice of the SOD1-G93A high-expresser transgenic ( G93A ) mouse model of ALS, we examined C-boutons on spinal motoneurons. We performed histological analysis at high statistical power, which showed no difference in C-bouton size in G93A versus wild-type motoneurons throughout disease progression. In an attempt to examine the underlying reasons for our failure to replicate reported changes, we performed further histological analyses using several variations on experimental design and data analysis that were reported in the ALS literature. This analysis showed that factors related to experimental design, such as grouping unit, sampling strategy, and blinding status, potentially contribute to the discrepancy in published data on C-bouton size changes. Next, we systematically analyzed the impact of study design variability and potential bias on reported results from experimental and preclinical studies of ALS. Strikingly, we found that practices such as blinding and power analysis are not systematically reported in the ALS field. Protocols to standardize experimental design and minimize bias are thus critical to advancing the ALS field.

Viral Diversity of House Mice in New York City.

PubMed

Williams, Simon H; Che, Xiaoyu; Garcia, Joel A; Klena, John D; Lee, Bohyun; Muller, Dorothy; Ulrich, Werner; Corrigan, Robert M; Nichol, Stuart; Jain, Komal; Lipkin, W Ian

2018-04-17

The microbiome of wild Mus musculus (house mouse), a globally distributed invasive pest that resides in close contact with humans in urban centers, is largely unexplored. Here, we report analysis of the fecal virome of house mice in residential buildings in New York City, NY. Mice were collected at seven sites in Manhattan, Queens, Brooklyn, and the Bronx over a period of 1 year. Unbiased high-throughput sequencing of feces revealed 36 viruses from 18 families and 21 genera, including at least 6 novel viruses and 3 novel genera. A representative screen of 15 viruses by PCR confirmed the presence of 13 of these viruses in liver. We identified an uneven distribution of diversity, with several viruses being associated with specific locations. Higher mouse weight was associated with an increase in the number of viruses detected per mouse, after adjusting for site, sex, and length. We found neither genetic footprints to known human viral pathogens nor antibodies to lymphocytic choriomeningitis virus. IMPORTANCE Mice carry a wide range of infectious agents with zoonotic potential. Their proximity to humans in the built environment is therefore a concern for public health. Laboratory mice are also the most common experimental model for investigating the pathobiology of infectious diseases. In this survey of mice trapped in multiple locations within New York City over a period of 1 year, we found a diverse collection of viruses that includes some previously not associated with house mice and others that appear to be novel. Although we found no known human pathogens, our findings provide insights into viral ecology and may yield models that have utility for clinical microbiology. Copyright © 2018 Williams et al.

In Vivo Hyperthermic Stress Model: An Easy Tool to Study the Effects of Oxidative Stress on Neuronal Tau Functionality in Mouse Brain.

PubMed

Chauderlier, Alban; Delattre, Lucie; Buée, Luc; Galas, Marie-Christine

2017-01-01

Oxidative damage is an early event in neurodegenerative disorders such as Alzheimer disease. To increase oxidative stress in AD-related mouse models is essential to study early mechanisms involved in the physiopathology of these diseases. In this chapter, we describe an experimental mouse model of transient and acute hyperthermic stress to induce in vivo an increase of oxidative stress in the brain of any kind of wild-type or transgenic mouse.

Implementation of a manual for working with wobbler mice and criteria for discontinuation of the experiment.

PubMed

Ott, Bastian; Dahlke, Carolin; Meller, Karl; Napirei, Markus; Schmitt-John, Thomas; Brand-Saberi, Beate; Theiss, Carsten; Saberi, Darius

2015-07-01

Mouse breeding is of importance to a whole range of medical and biological research. There are many known mouse models for motor neuron diseases. However, it must be kept in mind that especially mouse models for amyotrophic lateral sclerosis develop severe symptoms causing intense stress. This article is designed to summarize conscientious work with the wobbler mouse, a model for the sporadic form of amyotrophic lateral sclerosis. This mouse model is characterized by a degeneration of α-motor-neurons leading to head tremor, loss of body weight and rapidly progressive paralysis. Although this mouse model has been known since 1956, there are no guidelines for breeding wobbler mice. Due to the lack of such guidelines the present study tries to close this gap and implements a manual for further studies. It includes the whole workflow in regard to wobbler mice from breeding and animal care taking, genotyping and phenotype analysis, but also gives some examples for the use of various neuronal tissues for histological investigation. Beside the progress in research a second aim should always be the enhancement of mouse welfare and reduction of stress for the laboratory animals. Copyright © 2015 Elsevier GmbH. All rights reserved.

Anonymous sources: where do adult β cells come from?

PubMed Central

German, Michael S.

2013-01-01

Evidence that the pool of insulin-producing β cells in the pancreas is reduced in both major forms of diabetes mellitus has led to efforts to understand β cell turnover in the adult pancreas. Unfortunately, previous studies have reached opposing conclusions regarding the source of new β cells during regeneration in the adult pancreas. In this issue of the JCI, Xiao et al. use a novel mouse model for detecting new β cells derived from non–β cells to demonstrate the absence of β cell neogenesis from non–β cells during normal postnatal growth and in models of β cell regeneration. This work adds to mounting evidence that in most physiological and pathological conditions, β cell neogenesis may not make large contributions to the postnatal β cell pool — at least not in rodents. PMID:23619356

Rational Design of Mouse Models for Cancer Research.

PubMed

Landgraf, Marietta; McGovern, Jacqui A; Friedl, Peter; Hutmacher, Dietmar W

2018-03-01

The laboratory mouse is widely considered as a valid and affordable model organism to study human disease. Attempts to improve the relevance of murine models for the investigation of human pathologies led to the development of various genetically engineered, xenograft and humanized mouse models. Nevertheless, most preclinical studies in mice suffer from insufficient predictive value when compared with cancer biology and therapy response of human patients. We propose an innovative strategy to improve the predictive power of preclinical cancer models. Combining (i) genomic, tissue engineering and regenerative medicine approaches for rational design of mouse models with (ii) rapid prototyping and computational benchmarking against human clinical data will enable fast and nonbiased validation of newly generated models. Copyright © 2017 Elsevier Ltd. All rights reserved.

Back to the drawing board: Understanding the complexity of hepatic innate lymphoid cells.

PubMed

Marotel, Marie; Hasan, Uzma; Viel, Sébastien; Marçais, Antoine; Walzer, Thierry

2016-09-01

Recent studies of immune populations in nonlymphoid organs have highlighted the great diversity of the innate lymphoid system. It has also become apparent that mouse and human innate lymphoid cells (ILCs) have distinct phenotypes and properties. In this issue of the European Journal of Immunology, Harmon et al. [Eur. J. Immunol. 2016. 46: 2111-2120] characterized human hepatic NK-cell subsets. The authors report that hepatic CD56(bright) NK cells resemble mouse liver ILC1s in that they express CXCR6 and have an immature phenotype. However, unlike mouse ILC1s, they express high levels of Eomes and low levels of T-bet, and upon stimulation with tumor cells, secrete low amounts of cytokines. These unexpected findings further support the differences between human and mouse immune populations and prompt the study of the role of hepatic ILC subsets in immune responses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Visual Processing: Hungry Like the Mouse.

PubMed

Piscopo, Denise M; Niell, Cristopher M

2016-09-07

In this issue of Neuron, Burgess et al. (2016) explore how motivational state interacts with visual processing, by examining hunger modulation of food-associated visual responses in postrhinal cortical neurons and their inputs from amygdala. Copyright © 2016 Elsevier Inc. All rights reserved.

Review of DoD Malaria Research Programs,

DTIC Science & Technology

1992-05-01

the irraliated sporozoite vaccine. Work in the mouse model system and then extrapolate to human malarias. Study naturally acquired immune ...recombinant vaccines. Work simultaneously in the mouse model system and with human malarias. 3. Identify targets and mechanisms of protective immunity not...multivalent vaccines that attack these same targets. 3. Working again in the mouse model, non- human primate model, andI human systems we

Anaerobic respiration of Escherichia coli in the mouse intestine.

PubMed

Jones, Shari A; Gibson, Terri; Maltby, Rosalie C; Chowdhury, Fatema Z; Stewart, Valley; Cohen, Paul S; Conway, Tyrrell

2011-10-01

The intestine is inhabited by a large microbial community consisting primarily of anaerobes and, to a lesser extent, facultative anaerobes, such as Escherichia coli, which we have shown requires aerobic respiration to compete successfully in the mouse intestine (S. A. Jones et al., Infect. Immun. 75:4891-4899, 2007). If facultative anaerobes efficiently lower oxygen availability in the intestine, then their sustained growth must also depend on anaerobic metabolism. In support of this idea, mutants lacking nitrate reductase or fumarate reductase have extreme colonization defects. Here, we further explore the role of anaerobic respiration in colonization using the streptomycin-treated mouse model. We found that respiratory electron flow is primarily via the naphthoquinones, which pass electrons to cytochrome bd oxidase and the anaerobic terminal reductases. We found that E. coli uses nitrate and fumarate in the intestine, but not nitrite, dimethyl sulfoxide, or trimethylamine N-oxide. Competitive colonizations revealed that cytochrome bd oxidase is more advantageous than nitrate reductase or fumarate reductase. Strains lacking nitrate reductase outcompeted fumarate reductase mutants once the nitrate concentration in cecal mucus reached submillimolar levels, indicating that fumarate is the more important anaerobic electron acceptor in the intestine because nitrate is limiting. Since nitrate is highest in the absence of E. coli, we conclude that E. coli is the only bacterium in the streptomycin-treated mouse large intestine that respires nitrate. Lastly, we demonstrated that a mutant lacking the NarXL regulator (activator of the NarG system), but not a mutant lacking the NarP-NarQ regulator, has a colonization defect, consistent with the advantage provided by NarG. The emerging picture is one in which gene regulation is tuned to balance expression of the terminal reductases that E. coli uses to maximize its competitiveness and achieve the highest possible population in the intestine.

ATF3 expression improves motor function in the ALS mouse model by promoting motor neuron survival and retaining muscle innervation.

PubMed

Seijffers, Rhona; Zhang, Jiangwen; Matthews, Jonathan C; Chen, Adam; Tamrazian, Eric; Babaniyi, Olusegun; Selig, Martin; Hynynen, Meri; Woolf, Clifford J; Brown, Robert H

2014-01-28

ALS is a fatal neurodegenerative disease characterized by a progressive loss of motor neurons and atrophy of distal axon terminals in muscle, resulting in loss of motor function. Motor end plates denervated by axonal retraction of dying motor neurons are partially reinnervated by remaining viable motor neurons; however, this axonal sprouting is insufficient to compensate for motor neuron loss. Activating transcription factor 3 (ATF3) promotes neuronal survival and axonal growth. Here, we reveal that forced expression of ATF3 in motor neurons of transgenic SOD1(G93A) ALS mice delays neuromuscular junction denervation by inducing axonal sprouting and enhancing motor neuron viability. Maintenance of neuromuscular junction innervation during the course of the disease in ATF3/SOD1(G93A) mice is associated with a substantial delay in muscle atrophy and improved motor performance. Although disease onset and mortality are delayed, disease duration is not affected. This study shows that adaptive axonal growth-promoting mechanisms can substantially improve motor function in ALS and importantly, that augmenting viability of the motor neuron soma and maintaining functional neuromuscular junction connections are both essential elements in therapy for motor neuron disease in the SOD1(G93A) mice. Accordingly, effective protection of optimal motor neuron function requires restitution of multiple dysregulated cellular pathways.

Animal models for prenatal gene therapy: rodent models for prenatal gene therapy.

PubMed

Roybal, Jessica L; Endo, Masayuki; Buckley, Suzanne M K; Herbert, Bronwen R; Waddington, Simon N; Flake, Alan W

2012-01-01

Fetal gene transfer has been studied in various animal models, including rabbits, guinea pigs, cats, dogs, and nonhuman primate; however, the most common model is the rodent, particularly the mouse. There are numerous advantages to mouse models, including a short gestation time of around 20 days, large litter size usually of more than six pups, ease of colony maintenance due to the small physical size, and the relatively low expense of doing so. Moreover, the mouse genome is well defined, there are many transgenic models particularly of human monogenetic disorders, and mouse-specific biological reagents are readily available. One criticism has been that it is difficult to perform procedures on the fetal mouse with suitable accuracy. Over the past decade, accumulation of technical expertise and development of technology such as high-frequency ultrasound have permitted accurate vector delivery to organs and tissues. Here, we describe our experiences of gene transfer to the fetal mouse with and without ultrasound guidance from mid to late gestation. Depending upon the vector type, the route of delivery and the age of the fetus, specific or widespread gene transfer can be achieved, making fetal mice excellent models for exploratory biodistribution studies.

Adherence of Enterohemorrhagic Escherichia coli to Human Epithelial Cells: The Role of Intimin

DTIC Science & Technology

1995-04-28

1994). Contamination of salad vegetables (Abdul-Raouf et al., 1993), raw milk (MacDonald et al., 1988), and unpasteurized apple cider (Besser et...membranes were blocked with 5% nonfat dried milk (Carnation Company, los Angeles, Cali!.) in Tris-buffered saline, pH 7.2 with 0.1% Tween-20 (v/v) (1B5-T...then ove~aid with a 1 :5000 dilution of either horseradish peroxidase-conjugated goat anti-mouse Ig (BMB), donkey anti-rabbit Ig (Amersham), or sheep

P53 Gene Mutagenesis in Breast Cancer

DTIC Science & Technology

2005-03-01

the wild type T peak. 12 Table 1. Sonic ntations dected by SINtA Individual Cell Sequence Amino Acid Species Conservation 3 ID’ ID Change2 Change... differences in the content of toxic substances in the diet (Biggs et al., 1993; Blaszyk et al., 1996). The development of this p53 mutation load...Changes in the P53 Gene in Single Cells Individual Sequence Amino acid Species conservation ’ ID’ Cell ID change’ change Monkey Mouse Rat Chicken

A novel ALS-associated variant in UBQLN4 regulates motor axon morphogenesis

PubMed Central

Edens, Brittany M; Yan, Jianhua; Miller, Nimrod; Deng, Han-Xiang; Siddique, Teepu; Ma, Yongchao C

2017-01-01

The etiological underpinnings of amyotrophic lateral sclerosis (ALS) are complex and incompletely understood, although contributions to pathogenesis by regulators of proteolytic pathways have become increasingly apparent. Here, we present a novel variant in UBQLN4 that is associated with ALS and show that its expression compromises motor axon morphogenesis in mouse motor neurons and in zebrafish. We further demonstrate that the ALS-associated UBQLN4 variant impairs proteasomal function, and identify the Wnt signaling pathway effector beta-catenin as a UBQLN4 substrate. Inhibition of beta-catenin function rescues the UBQLN4 variant-induced motor axon phenotypes. These findings provide a strong link between the regulation of axonal morphogenesis and a new ALS-associated gene variant mediated by protein degradation pathways. DOI: http://dx.doi.org/10.7554/eLife.25453.001 PMID:28463112

Treatment of d-galactose induced mouse aging with Lycium barbarum polysaccharides and its mechanism study.

PubMed

Tang, Tao; He, Bixiu

2013-01-01

We evaluated the effects of Lycium barbarum polysaccharides LBP) on D-galactose aging model mouse, and explored its possible mechanism. Kunming mice were randomly divided into the control group, the model group, the high-dose LBP group, and the low-dose LBP group. Except the control group, D-galactose was used for modelling. The drug was administrated when modelling. Mouse behavioural, learning and memory changes were observed, and the contents of lipid peroxidation (LPO), lipofuscin (LF) and monoamine oxidase B (MAO-B) in mouse brain tissue and the weight of immune organs were measured after 6 weeks. Compared with the control group, mouse weight gain in the model group reduced significantly. Compared with model group, after mice drank LBP, the times of electric shock was less than aging mice (in which, the high-dose LBP group, P<0.05), and electric shock incubation period was longer (P<0.01). On Day 45 after modelling and drug administration, the contents of LPO, LF and MAO-B in mouse brain tissue in the model group increased significantly, while those in the drug administration groups decreased significantly. The thymus index in the aging model group decreased significantly; the thymus index and the spleen index in the high-dose LBP group and the low-dose LBP group rebounded significantly (P<0.01). We concluded that LBP has an anti-aging effect on D-galactose induced aging model mouse, and its mechanism may be related with the alleviation of glucose metabolism disorder and the resistance of the generation of lipid peroxide and other substances, which damage cell membrane lipid.

Anti-Oxidative Stress Activity Is Essential for Amanita caesarea Mediated Neuroprotection on Glutamate-Induced Apoptotic HT22 Cells and an Alzheimer’s Disease Mouse Model

PubMed Central

Li, Zhiping; Chen, Xia; Lu, Wenqian; Zhang, Shun; Guan, Xin; Li, Zeyu; Wang, Di

2017-01-01

Amanita caesarea, an edible mushroom found mainly in Asia and southern Europe, has been reported to show good antioxidative activities. In the present study, the neuroprotective effects of A. caesarea aqueous extract (AC) were determined in an l-glutamic acid (l-Glu) induced HT22 cell apoptosis model, and in a d-galactose (d-gal) and AlCl3-developed experimental Alzheimer’s disease (AD) mouse model. In 25 mM of l-Glu-damaged HT22 cells, a 3-h pretreatment with AC strongly improved cell viability, reduced the proportion of apoptotic cells, restored mitochondrial function, inhibited the over-production of intracellular reactive oxygen species (ROS) and Ca2+, and suppressed the high expression levels of cleaved-caspase-3, calpain 1, apoptosis-inducing factor (AIF) and Bax. Compared with HT22 exposed only to l-Glu cells, AC enhanced the phosphorylation activities of protein kinase B (Akt) and the mammalian target of rapamycin (mTOR), and suppressed the phosphorylation activities of phosphatase and tensin homolog deleted on chromosome ten (PTEN). In the experimental AD mouse, 28-day AC administration at doses of 250, 500, and 1000 mg/kg/day strongly enhanced vertical movements and locomotor activities, increased the endurance time in the rotarod test, and decreased the escape latency time in the Morris water maze test. AC also alleviated the deposition of amyloid beta (Aβ) in the brain and improved the central cholinergic system function, as indicated by an increase acetylcholine (Ach) and choline acetyltransferase (ChAT) concentrations and a reduction in acetylcholine esterase (AchE) levels. Moreover, AC reduced ROS levels and enhanced superoxide dismutase (SOD) levels in the brain of experimental AD mice. Taken together, our data provide experimental evidence that A. caesarea may serve as potential food for treating or preventing neurodegenerative diseases. PMID:28749416

Synergistic Drug Combinations with a CDK4/6 Inhibitor in T-cell Acute Lymphoblastic Leukemia.

PubMed

Pikman, Yana; Alexe, Gabriela; Roti, Giovanni; Conway, Amy Saur; Furman, Andrew; Lee, Emily S; Place, Andrew E; Kim, Sunkyu; Saran, Chitra; Modiste, Rebecca; Weinstock, David M; Harris, Marian; Kung, Andrew L; Silverman, Lewis B; Stegmaier, Kimberly

2017-02-15

Purpose: Although significant progress has been made in the treatment of T-cell acute lymphoblastic leukemia (T-ALL), many patients will require additional therapy for relapsed/refractory disease. Cyclin D3 (CCND3) and CDK6 are highly expressed in T-ALL and have been effectively targeted in mutant NOTCH1-driven mouse models of this disease with a CDK4/6 small-molecule inhibitor. Combination therapy, however, will be needed for the successful treatment of human disease. Experimental Design: We performed preclinical drug testing using a panel of T-ALL cell lines first with LEE011, a CDK4/6 inhibitor, and next with the combination of LEE011 with a panel of drugs relevant to T-ALL treatment. We then tested the combination of LEE011 with dexamethasone or everolimus in three orthotopic mouse models and measured on-target drug activity. Results: We first determined that both NOTCH1 -mutant and wild-type T-ALL are highly sensitive to pharmacologic inhibition of CDK4/6 when wild-type RB is expressed. Next, we determined that CDK4/6 inhibitors are antagonistic when used either concurrently or in sequence with many of the drugs used to treat relapsed T-ALL (methotrexate, mercaptopurine, asparaginase, and doxorubicin) but are synergistic with glucocorticoids, an mTOR inhibitor, and gamma secretase inhibitor. The combinations of LEE011 with the glucocorticoid dexamethasone or the mTOR inhibitor everolimus were tested in vivo and prolonged survival in three orthotopic mouse models of T-ALL. On-target activity was measured in peripheral blood and tissue of treated mice. Conclusions: We conclude that LEE011 is active in T-ALL and that combination therapy with corticosteroids and/or mTOR inhibitors warrants further investigation. Clin Cancer Res; 23(4); 1012-24. ©2016 AACR See related commentary by Carroll et al., p. 873 . ©2016 American Association for Cancer Research.

Mutagenicity testing with transgenic mice. Part II: Comparison with the mouse spot test

PubMed Central

Wahnschaffe, Ulrich; Bitsch, Annette; Kielhorn, Janet; Mangelsdorf, Inge

2005-01-01

The mouse spot test, an in vivo mutation assay, has been used to assess a number of chemicals. It is at present the only in vivo mammalian test system capable of detecting somatic gene mutations according to OECD guidelines (OECD guideline 484). It is however rather insensitive, animal consuming and expensive type of test. More recently several assays using transgenic animals have been developed. From data in the literature, the present study compares the results of in vivo testing of over twenty chemicals using the mouse spot test and compares them with results from the two transgenic mouse models with the best data base available, the lacI model (commercially available as the Big Blue® mouse), and the lacZ model (commercially available as the Muta™ Mouse). There was agreement in the results from the majority of substances. No differences were found in the predictability of the transgenic animal assays and the mouse spot test for carcinogenicity. However, from the limited data available, it seems that the transgenic mouse assay has several advantages over the mouse spot test and may be a suitable test system replacing the mouse spot test for detection of gene but not chromosome mutations in vivo. PMID:15676065

Ex Vivo Profiling of PD-1 Blockade Using Organotypic Tumor Spheroids.

PubMed

Jenkins, Russell W; Aref, Amir R; Lizotte, Patrick H; Ivanova, Elena; Stinson, Susanna; Zhou, Chensheng W; Bowden, Michaela; Deng, Jiehui; Liu, Hongye; Miao, Diana; He, Meng Xiao; Walker, William; Zhang, Gao; Tian, Tian; Cheng, Chaoran; Wei, Zhi; Palakurthi, Sangeetha; Bittinger, Mark; Vitzthum, Hans; Kim, Jong Wook; Merlino, Ashley; Quinn, Max; Venkataramani, Chandrasekar; Kaplan, Joshua A; Portell, Andrew; Gokhale, Prafulla C; Phillips, Bart; Smart, Alicia; Rotem, Asaf; Jones, Robert E; Keogh, Lauren; Anguiano, Maria; Stapleton, Lance; Jia, Zhiheng; Barzily-Rokni, Michal; Cañadas, Israel; Thai, Tran C; Hammond, Marc R; Vlahos, Raven; Wang, Eric S; Zhang, Hua; Li, Shuai; Hanna, Glenn J; Huang, Wei; Hoang, Mai P; Piris, Adriano; Eliane, Jean-Pierre; Stemmer-Rachamimov, Anat O; Cameron, Lisa; Su, Mei-Ju; Shah, Parin; Izar, Benjamin; Thakuria, Manisha; LeBoeuf, Nicole R; Rabinowits, Guilherme; Gunda, Viswanath; Parangi, Sareh; Cleary, James M; Miller, Brian C; Kitajima, Shunsuke; Thummalapalli, Rohit; Miao, Benchun; Barbie, Thanh U; Sivathanu, Vivek; Wong, Joshua; Richards, William G; Bueno, Raphael; Yoon, Charles H; Miret, Juan; Herlyn, Meenhard; Garraway, Levi A; Van Allen, Eliezer M; Freeman, Gordon J; Kirschmeier, Paul T; Lorch, Jochen H; Ott, Patrick A; Hodi, F Stephen; Flaherty, Keith T; Kamm, Roger D; Boland, Genevieve M; Wong, Kwok-Kin; Dornan, David; Paweletz, Cloud Peter; Barbie, David A

2018-02-01

Ex vivo systems that incorporate features of the tumor microenvironment and model the dynamic response to immune checkpoint blockade (ICB) may facilitate efforts in precision immuno-oncology and the development of effective combination therapies. Here, we demonstrate the ability to interrogate ex vivo response to ICB using murine- and patient-derived organotypic tumor spheroids (MDOTS/PDOTS). MDOTS/PDOTS isolated from mouse and human tumors retain autologous lymphoid and myeloid cell populations and respond to ICB in short-term three-dimensional microfluidic culture. Response and resistance to ICB was recapitulated using MDOTS derived from established immunocompetent mouse tumor models. MDOTS profiling demonstrated that TBK1/IKKε inhibition enhanced response to PD-1 blockade, which effectively predicted tumor response in vivo Systematic profiling of secreted cytokines in PDOTS captured key features associated with response and resistance to PD-1 blockade. Thus, MDOTS/PDOTS profiling represents a novel platform to evaluate ICB using established murine models as well as clinically relevant patient specimens. Significance: Resistance to PD-1 blockade remains a challenge for many patients, and biomarkers to guide treatment are lacking. Here, we demonstrate feasibility of ex vivo profiling of PD-1 blockade to interrogate the tumor immune microenvironment, develop therapeutic combinations, and facilitate precision immuno-oncology efforts. Cancer Discov; 8(2); 196-215. ©2017 AACR. See related commentary by Balko and Sosman, p. 143 See related article by Deng et al., p. 216 This article is highlighted in the In This Issue feature, p. 127 . ©2017 American Association for Cancer Research.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Levova, Katerina; Moserova, Michaela; Nebert, Daniel W.

Aristolochic acid causes a specific nephropathy (AAN), Balkan endemic nephropathy, and urothelial malignancies. Using Western blotting suitable to determine protein expression, we investigated in several transgenic mouse lines expression of NAD(P)H:quinone oxidoreductase (NQO1)—the most efficient cytosolic enzyme that reductively activates aristolochic acid I (AAI). The mouse tissues used were from previous studies [Arlt et al., Chem. Res. Toxicol. 24 (2011) 1710; Stiborova et al., Toxicol. Sci. 125 (2012) 345], in which the role of microsomal cytochrome P450 (CYP) enzymes in AAI metabolism in vivo had been determined. We found that NQO1 levels in liver, kidney and lung of Cyp1a1(−/−), Cyp1a2(−/−)more » and Cyp1a1/1a2(−/−) knockout mouse lines, as well as in two CYP1A-humanized mouse lines harboring functional human CYP1A1 and CYP1A2 and lacking the mouse Cyp1a1/1a2 orthologs, differed from NQO1 levels in wild-type mice. NQO1 protein and enzymic activity were induced in hepatic and renal cytosolic fractions isolated from AAI-pretreated mice, compared with those in untreated mice. Furthermore, this increase in hepatic NQO1 enzyme activity was associated with bioactivation of AAI and elevated AAI-DNA adduct levels in ex vivo incubations of cytosolic fractions with DNA and AAI. In conclusion, AAI appears to increase its own metabolic activation by inducing NQO1, thereby enhancing its own genotoxic potential. Highlights: ► NAD(P)H:quinone oxidoreductase expression in Cyp1a knockout and humanized CYP1A mice ► Reductive activation of the nephrotoxic and carcinogenic aristolochic acid I (AAI) ► NAD(P)H:quinone oxidoreductase is induced in mice treated with AAI. ► Induced hepatic enzyme activity resulted in elevated AAI-DNA adduct levels.« less

The Mouse Genome Database (MGD): facilitating mouse as a model for human biology and disease.

PubMed

Eppig, Janan T; Blake, Judith A; Bult, Carol J; Kadin, James A; Richardson, Joel E

2015-01-01

The Mouse Genome Database (MGD, http://www.informatics.jax.org) serves the international biomedical research community as the central resource for integrated genomic, genetic and biological data on the laboratory mouse. To facilitate use of mouse as a model in translational studies, MGD maintains a core of high-quality curated data and integrates experimentally and computationally generated data sets. MGD maintains a unified catalog of genes and genome features, including functional RNAs, QTL and phenotypic loci. MGD curates and provides functional and phenotype annotations for mouse genes using the Gene Ontology and Mammalian Phenotype Ontology. MGD integrates phenotype data and associates mouse genotypes to human diseases, providing critical mouse-human relationships and access to repositories holding mouse models. MGD is the authoritative source of nomenclature for genes, genome features, alleles and strains following guidelines of the International Committee on Standardized Genetic Nomenclature for Mice. A new addition to MGD, the Human-Mouse: Disease Connection, allows users to explore gene-phenotype-disease relationships between human and mouse. MGD has also updated search paradigms for phenotypic allele attributes, incorporated incidental mutation data, added a module for display and exploration of genes and microRNA interactions and adopted the JBrowse genome browser. MGD resources are freely available to the scientific community. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genetically engineered mouse models of craniopharyngioma: an opportunity for therapy development and understanding of tumor biology

PubMed Central

Martinez‐Barbera, Juan Pedro

2017-01-01

Abstract Adamantinomatous craniopharyngioma (ACP) is the commonest tumor of the sellar region in childhood. Two genetically engineered mouse models have been developed and are giving valuable insights into ACP biology. These models have identified novel pathways activated in tumors, revealed an important function of paracrine signalling and extended conventional theories about the role of organ‐specific stem cells in tumorigenesis. In this review, we summarize these mouse models, what has been learnt, their limitations and open questions for future research. We then discussed how these mouse models may be used to test novel therapeutics against potentially targetable pathways recently identified in human ACP. PMID:28414891

Mouse neuroblastoma cell based model and the effect of epileptic events on calcium oscillations and neural spikes

NASA Astrophysics Data System (ADS)

Kim, Suhwan; Baek, Juyeong; Jung, Unsang; Lee, Sangwon; Jung, Woonggyu; Kim, Jeehyun; Kang, Shinwon

2013-05-01

Recently, Mouse neuroblastoma cells are considered as an attractive model for the study of human neurological and prion diseases, and intensively used as a model system in different areas. Among those areas, differentiation of neuro2a (N2A) cells, receptor mediated ion current, and glutamate induced physiological response are actively investigated. The reason for the interest to mouse neuroblastoma N2A cells is that they have a fast growing rate than other cells in neural origin with a few another advantages. This study evaluated the calcium oscillations and neural spikes recording of mouse neuroblastoma N2A cells in an epileptic condition. Based on our observation of neural spikes in mouse N2A cell with our proposed imaging modality, we report that mouse neuroblastoma N2A cells can be an important model related to epileptic activity studies. It is concluded that the mouse neuroblastoma N2A cells produce the epileptic spikes in vitro in the same way as produced by the neurons or the astrocytes. This evidence advocates the increased and strong level of neurotransmitters release by enhancement in free calcium using the 4-aminopyridine which causes the mouse neuroblastoma N2A cells to produce the epileptic spikes and calcium oscillation.

Comparison of independent screens on differentially vulnerable motor neurons reveals alpha-synuclein as a common modifier in motor neuron diseases

PubMed Central

Kaifer, Kevin A.; Osman, Erkan Y.; Carella, Francesco; Tiberi, Ariana; Ross, Jolill; Pennetta, Giuseppa; Lorson, Christian L.

2017-01-01

The term “motor neuron disease” encompasses a spectrum of disorders in which motor neurons are the primary pathological target. However, in both patients and animal models of these diseases, not all motor neurons are equally vulnerable, in that while some motor neurons are lost very early in disease, others remain comparatively intact, even at late stages. This creates a valuable system to investigate the factors that regulate motor neuron vulnerability. In this study, we aim to use this experimental paradigm to identify potential transcriptional modifiers. We have compared the transcriptome of motor neurons from healthy wild-type mice, which are differentially vulnerable in the childhood motor neuron disease Spinal Muscular Atrophy (SMA), and have identified 910 transcriptional changes. We have compared this data set with published microarray data sets on other differentially vulnerable motor neurons. These neurons were differentially vulnerable in the adult onset motor neuron disease Amyotrophic Lateral Sclerosis (ALS), but the screen was performed on the equivalent population of neurons from neurologically normal human, rat and mouse. This cross species comparison has generated a refined list of differentially expressed genes, including CELF5, Col5a2, PGEMN1, SNCA, Stmn1 and HOXa5, alongside a further enrichment for synaptic and axonal transcripts. As an in vivo validation, we demonstrate that the manipulation of a significant number of these transcripts can modify the neurodegenerative phenotype observed in a Drosophila line carrying an ALS causing mutation. Finally, we demonstrate that vector-mediated expression of alpha-synuclein (SNCA), a transcript decreased in selectively vulnerable motor neurons in all four screens, can extend life span, increase weight and decrease neuromuscular junction pathology in a mouse model of SMA. In summary, we have combined multiple data sets to identify transcripts, which are strong candidates for being phenotypic modifiers, and demonstrated SNCA is a modifier of pathology in motor neuron disease. PMID:28362802

Comparison of independent screens on differentially vulnerable motor neurons reveals alpha-synuclein as a common modifier in motor neuron diseases.

PubMed

Kline, Rachel A; Kaifer, Kevin A; Osman, Erkan Y; Carella, Francesco; Tiberi, Ariana; Ross, Jolill; Pennetta, Giuseppa; Lorson, Christian L; Murray, Lyndsay M

2017-03-01

The term "motor neuron disease" encompasses a spectrum of disorders in which motor neurons are the primary pathological target. However, in both patients and animal models of these diseases, not all motor neurons are equally vulnerable, in that while some motor neurons are lost very early in disease, others remain comparatively intact, even at late stages. This creates a valuable system to investigate the factors that regulate motor neuron vulnerability. In this study, we aim to use this experimental paradigm to identify potential transcriptional modifiers. We have compared the transcriptome of motor neurons from healthy wild-type mice, which are differentially vulnerable in the childhood motor neuron disease Spinal Muscular Atrophy (SMA), and have identified 910 transcriptional changes. We have compared this data set with published microarray data sets on other differentially vulnerable motor neurons. These neurons were differentially vulnerable in the adult onset motor neuron disease Amyotrophic Lateral Sclerosis (ALS), but the screen was performed on the equivalent population of neurons from neurologically normal human, rat and mouse. This cross species comparison has generated a refined list of differentially expressed genes, including CELF5, Col5a2, PGEMN1, SNCA, Stmn1 and HOXa5, alongside a further enrichment for synaptic and axonal transcripts. As an in vivo validation, we demonstrate that the manipulation of a significant number of these transcripts can modify the neurodegenerative phenotype observed in a Drosophila line carrying an ALS causing mutation. Finally, we demonstrate that vector-mediated expression of alpha-synuclein (SNCA), a transcript decreased in selectively vulnerable motor neurons in all four screens, can extend life span, increase weight and decrease neuromuscular junction pathology in a mouse model of SMA. In summary, we have combined multiple data sets to identify transcripts, which are strong candidates for being phenotypic modifiers, and demonstrated SNCA is a modifier of pathology in motor neuron disease.

Dynamics of circulating gamma delta T cell activity in an immunocompetent mouse model of high-grade glioma

USDA-ARS?s Scientific Manuscript database

Human gamma delta T cells are potent effectors against glioma cell lines in vitro and in human/mouse xenograft models of glioblastoma, however, this effect has not been investigated in an immunocompetent mouse model. In this report, we established GL261 intracranial gliomas in syngeneic WT C57BL/6 m...

Lack of species-specific difference in pulmonary function when using mouse versus human plasma in a mouse model of hemorrhagic shock.

PubMed

Peng, Zhanglong; Pati, Shibani; Fontaine, Magali J; Hall, Kelly; Herrera, Anthony V; Kozar, Rosemary A

2016-11-01

Clinical studies have demonstrated that the early and empiric use of plasma improves survival after hemorrhagic shock. We have demonstrated in rodent models of hemorrhagic shock that resuscitation with plasma is protective to the lungs compared with lactated Ringer's solution. As our long-term objective is to determine the molecular mechanisms that modulate plasma's protective effects in injured bleeding patients, we have used human plasma in a mouse model of hemorrhagic shock. The goal of the current experiments is to determine if there are significant adverse effects on lung injury when using human versus mouse plasma in an established murine model of hemorrhagic shock and laparotomy. Mice underwent laparotomy and 90 minutes of hemorrhagic shock to a mean arterial pressure (MAP) of 35 ± 5 mm Hg followed by resuscitation at 1× shed blood using either mouse fresh frozen plasma (FFP), human FFP, or human lyophilized plasma. Mean arterial pressure was recorded during shock and for the first 30 minutes of resuscitation. After 3 hours, animals were killed, and lungs collected for analysis. There was a significant increase in early MAP when mouse FFP was used to resuscitate animals compared with human FFP or human lyophilized plasma. However, despite these differences, analysis of the mouse lungs revealed no significant differences in pulmonary histopathology, lung permeability, or lung edema between all three plasma groups. Analysis of neutrophil infiltration in the lungs revealed that mouse FFP decreased neutrophil influx as measured by neutrophil staining; however, myeloperoxidase immunostaining revealed no significant differences in between groups. The study of human plasma in a mouse model of hemorrhagic shock is feasible but does reveal some differences compared with mouse plasma-based resuscitation in physiologic measures such as MAP postresuscitation. Measures of end organ function such as lung injury appear to be comparable in this acute model of hemorrhagic shock and resuscitation.

In vivo quantitative bioluminescence tomography using heterogeneous and homogeneous mouse models.

PubMed

Liu, Junting; Wang, Yabin; Qu, Xiaochao; Li, Xiangsi; Ma, Xiaopeng; Han, Runqiang; Hu, Zhenhua; Chen, Xueli; Sun, Dongdong; Zhang, Rongqing; Chen, Duofang; Chen, Dan; Chen, Xiaoyuan; Liang, Jimin; Cao, Feng; Tian, Jie

2010-06-07

Bioluminescence tomography (BLT) is a new optical molecular imaging modality, which can monitor both physiological and pathological processes by using bioluminescent light-emitting probes in small living animal. Especially, this technology possesses great potential in drug development, early detection, and therapy monitoring in preclinical settings. In the present study, we developed a dual modality BLT prototype system with Micro-computed tomography (MicroCT) registration approach, and improved the quantitative reconstruction algorithm based on adaptive hp finite element method (hp-FEM). Detailed comparisons of source reconstruction between the heterogeneous and homogeneous mouse models were performed. The models include mice with implanted luminescence source and tumor-bearing mice with firefly luciferase report gene. Our data suggest that the reconstruction based on heterogeneous mouse model is more accurate in localization and quantification than the homogeneous mouse model with appropriate optical parameters and that BLT allows super-early tumor detection in vivo based on tomographic reconstruction of heterogeneous mouse model signal.

Of Mice and Men: Comparative Analysis of Neuro-Inflammatory Mechanisms in Human and Mouse Using Cause-and-Effect Models.

PubMed

Kodamullil, Alpha Tom; Iyappan, Anandhi; Karki, Reagon; Madan, Sumit; Younesi, Erfan; Hofmann-Apitius, Martin

2017-01-01

Perturbance in inflammatory pathways have been identified as one of the major factors which leads to neurodegenerative diseases (NDD). Owing to the limited access of human brain tissues and the immense complexity of the brain, animal models, specifically mouse models, play a key role in advancing the NDD field. However, many of these mouse models fail to reproduce the clinical manifestations and end points of the disease. NDD drugs, which passed the efficacy test in mice, were repeatedly not successful in clinical trials. There are numerous studies which are supporting and opposing the applicability of mouse models in neuroinflammation and NDD. In this paper, we assessed to what extend a mouse can mimic the cellular and molecular interactions in humans at a mechanism level. Based on our mechanistic modeling approach, we investigate the failure of a neuroinflammation targeted drug in the late phases of clinical trials based on the comparative analyses between the two species.

NCI Mouse Repository | FNLCR Staging

Cancer.gov

The NCI Mouse Repository is an NCI-funded resource for mouse cancer models and associated strains. The repository makes strains available to all members of the scientific community (academic, non-profit, and commercial). NCI Mouse Repository strains

An extended Kalman filter for mouse tracking.

PubMed

Choi, Hongjun; Kim, Mingi; Lee, Onseok

2018-05-19

Animal tracking is an important tool for observing behavior, which is useful in various research areas. Animal specimens can be tracked using dynamic models and observation models that require several types of data. Tracking mouse has several barriers due to the physical characteristics of the mouse, their unpredictable movement, and cluttered environments. Therefore, we propose a reliable method that uses a detection stage and a tracking stage to successfully track mouse. The detection stage detects the surface area of the mouse skin, and the tracking stage implements an extended Kalman filter to estimate the state variables of a nonlinear model. The changes in the overall shape of the mouse are tracked using an oval-shaped tracking model to estimate the parameters for the ellipse. An experiment is conducted to demonstrate the performance of the proposed tracking algorithm using six video images showing various types of movement, and the ground truth values for synthetic images are compared to the values generated by the tracking algorithm. A conventional manual tracking method is also applied to compare across eight experimenters. Furthermore, the effectiveness of the proposed tracking method is also demonstrated by applying the tracking algorithm with actual images of mouse. Graphical abstract.

Mouse Models for Down Syndrome-Associated Developmental Cognitive Disabilities

PubMed Central

Liu, Chunhong; Belichenko, Pavel V.; Zhang, Li; Fu, Dawei; Kleschevnikov, Alexander M.; Baldini, Antonio; Antonarakis, Stylianos E.; Mobley, William C.; Yu, Y. Eugene

2011-01-01

Down syndrome (DS) is mainly caused by the presence of an extra copy of human chromosome 21 (Hsa21) and is a leading genetic cause for developmental cognitive disabilities in humans. The mouse is a premier model organism for DS because the regions on Hsa21 are syntenically conserved with three regions in the mouse genome, which are located on mouse chromosome 10 (Mmu10), Mmu16 and Mmu17. With the advance of chromosomal manipulation technologies, new mouse mutants have been generated to mimic DS at both the genotypic and phenotypic levels. Further mouse-based molecular genetic studies in the future may lead to the unraveling of the mechanisms underlying DS-associated developmental cognitive disabilities, which would lay the groundwork for developing effective treatments for this phenotypic manifestation. In this review, we will discuss recent progress and future challenges in modeling DS-associated developmental cognitive disability in mice with an emphasis on hippocampus-related phenotypes. PMID:21865664

High-Resolution Maps of Mouse Reference Populations.

PubMed

Simecek, Petr; Forejt, Jiri; Williams, Robert W; Shiroishi, Toshihiko; Takada, Toyoyuki; Lu, Lu; Johnson, Thomas E; Bennett, Beth; Deschepper, Christian F; Scott-Boyer, Marie-Pier; Pardo-Manuel de Villena, Fernando; Churchill, Gary A

2017-10-05

Genetic reference panels are widely used to map complex, quantitative traits in model organisms. We have generated new high-resolution genetic maps of 259 mouse inbred strains from recombinant inbred strain panels (C57BL/6J × DBA/2J, ILS/IbgTejJ × ISS/IbgTejJ, and C57BL/6J × A/J) and chromosome substitution strain panels (C57BL/6J-Chr#, C57BL/6J-Chr#, and C57BL/6J-Chr#). We genotyped all samples using the Affymetrix Mouse Diversity Array with an average intermarker spacing of 4.3 kb. The new genetic maps provide increased precision in the localization of recombination breakpoints compared to the previous maps. Although the strains were presumed to be fully inbred, we found residual heterozygosity in 40% of individual mice from five of the six panels. We also identified de novo deletions and duplications, in homozygous or heterozygous state, ranging in size from 21 kb to 8.4 Mb. Almost two-thirds (46 out of 76) of these deletions overlap exons of protein coding genes and may have phenotypic consequences. Twenty-nine putative gene conversions were identified in the chromosome substitution strains. We find that gene conversions are more likely to occur in regions where the homologous chromosomes are more similar. The raw genotyping data and genetic maps of these strain panels are available at http://churchill-lab.jax.org/website/MDA. Copyright © 2017 Simecek et al.

Methods in Molecular Biology Mouse Genetics: Methods and Protocols | Center for Cancer Research

Cancer.gov

Mouse Genetics: Methods and Protocols provides selected mouse genetic techniques and their application in modeling varieties of human diseases. The chapters are mainly focused on the generation of different transgenic mice to accomplish the manipulation of genes of interest, tracing cell lineages, and modeling human diseases.

Use of mouse models to study the mechanisms and consequences of RBC clearance

PubMed Central

Hod, E. A.; Arinsburg, S. A.; Francis, R. O.; Hendrickson, J. E.; Zimring, J. C.; Spitalnik, S. L.

2013-01-01

Mice provide tractable animal models for studying the pathophysiology of various human disorders. This review discusses the use of mouse models for understanding red-blood-cell (RBC) clearance. These models provide important insights into the pathophysiology of various clinically relevant entities, such as autoimmune haemolytic anaemia, haemolytic transfusion reactions, other complications of RBC transfusions and immunomodulation by Rh immune globulin therapy. Mouse models of both antibody- and non-antibody-mediated RBC clearance are reviewed. Approaches for exploring unanswered questions in transfusion medicine using these models are also discussed. PMID:20345515

Generation Of A Mouse Model For Schwannomatosis

DTIC Science & Technology

2010-09-01

TITLE: Generation of a Mouse Model for Schwannomatosis PRINCIPAL INVESTIGATOR: Long-Sheng Chang, Ph.D. CONTRACTING ORGANIZATION: The...Annual 3. DATES COVERED (From - To) 1 Sep 2009 - 31 Aug 2010 4. TITLE AND SUBTITLE Generation of a Mouse Model for Schwannomatosis 5a. CONTRACT...hypothesis involving inactivation of both the INI1/SNF5 and NF2 tumor suppressor genes in the formation of schwannomatosis -associated tumors. To

ALS-associated mutant FUS induces selective motor neuron degeneration through toxic gain of function

PubMed Central

Sharma, Aarti; Lyashchenko, Alexander K.; Lu, Lei; Nasrabady, Sara Ebrahimi; Elmaleh, Margot; Mendelsohn, Monica; Nemes, Adriana; Tapia, Juan Carlos; Mentis, George Z.; Shneider, Neil A.

2016-01-01

Mutations in FUS cause amyotrophic lateral sclerosis (ALS), including some of the most aggressive, juvenile-onset forms of the disease. FUS loss-of-function and toxic gain-of-function mechanisms have been proposed to explain how mutant FUS leads to motor neuron degeneration, but neither has been firmly established in the pathogenesis of ALS. Here we characterize a series of transgenic FUS mouse lines that manifest progressive, mutant-dependent motor neuron degeneration preceded by early, structural and functional abnormalities at the neuromuscular junction. A novel, conditional FUS knockout mutant reveals that postnatal elimination of FUS has no effect on motor neuron survival or function. Moreover, endogenous FUS does not contribute to the onset of the ALS phenotype induced by mutant FUS. These findings demonstrate that FUS-dependent motor degeneration is not due to loss of FUS function, but to the gain of toxic properties conferred by ALS mutations. PMID:26842965

ALS-associated mutant FUS induces selective motor neuron degeneration through toxic gain of function.

PubMed

Sharma, Aarti; Lyashchenko, Alexander K; Lu, Lei; Nasrabady, Sara Ebrahimi; Elmaleh, Margot; Mendelsohn, Monica; Nemes, Adriana; Tapia, Juan Carlos; Mentis, George Z; Shneider, Neil A

2016-02-04

Mutations in FUS cause amyotrophic lateral sclerosis (ALS), including some of the most aggressive, juvenile-onset forms of the disease. FUS loss-of-function and toxic gain-of-function mechanisms have been proposed to explain how mutant FUS leads to motor neuron degeneration, but neither has been firmly established in the pathogenesis of ALS. Here we characterize a series of transgenic FUS mouse lines that manifest progressive, mutant-dependent motor neuron degeneration preceded by early, structural and functional abnormalities at the neuromuscular junction. A novel, conditional FUS knockout mutant reveals that postnatal elimination of FUS has no effect on motor neuron survival or function. Moreover, endogenous FUS does not contribute to the onset of the ALS phenotype induced by mutant FUS. These findings demonstrate that FUS-dependent motor degeneration is not due to loss of FUS function, but to the gain of toxic properties conferred by ALS mutations.

VAChT overexpression increases acetylcholine at the synaptic cleft and accelerates aging of neuromuscular junctions.

PubMed

Sugita, Satoshi; Fleming, Leland L; Wood, Caleb; Vaughan, Sydney K; Gomes, Matheus P S M; Camargo, Wallace; Naves, Ligia A; Prado, Vania F; Prado, Marco A M; Guatimosim, Cristina; Valdez, Gregorio

2016-01-01

Cholinergic dysfunction occurs during aging and in a variety of diseases, including amyotrophic lateral sclerosis (ALS). However, it remains unknown whether changes in cholinergic transmission contributes to age- and disease-related degeneration of the motor system. Here we investigated the effect of moderately increasing levels of synaptic acetylcholine (ACh) on the neuromuscular junction (NMJ), muscle fibers, and motor neurons during development and aging and in a mouse model for amyotrophic lateral sclerosis (ALS). Chat-ChR2-EYFP (VAChT Hyp ) mice containing multiple copies of the vesicular acetylcholine transporter (VAChT), mutant superoxide dismutase 1 (SOD1 G93A ), and Chat-IRES-Cre and tdTomato transgenic mice were used in this study. NMJs, muscle fibers, and α-motor neurons' somata and their axons were examined using a light microscope. Transcripts for select genes in muscles and spinal cords were assessed using real-time quantitative PCR. Motor function tests were carried out using an inverted wire mesh and a rotarod. Electrophysiological recordings were collected to examine miniature endplate potentials (MEPP) in muscles. We show that VAChT is elevated in the spinal cord and at NMJs of VAChT Hyp mice. We also show that the amplitude of MEPPs is significantly higher in VAChT Hyp muscles, indicating that more ACh is loaded into synaptic vesicles and released into the synaptic cleft at NMJs of VAChT Hyp mice compared to control mice. While the development of NMJs was not affected in VAChT Hyp mice, NMJs prematurely acquired age-related structural alterations in adult VAChT Hyp mice. These structural changes at NMJs were accompanied by motor deficits in VAChT Hyp mice. However, cellular features of muscle fibers and levels of molecules with critical functions at the NMJ and in muscle fibers were largely unchanged in VAChT Hyp mice. In the SOD1 G93A mouse model for ALS, increasing synaptic ACh accelerated degeneration of NMJs caused motor deficits and resulted in premature death specifically in male mice. The data presented in this manuscript demonstrate that increasing levels of ACh at the synaptic cleft promote degeneration of adult NMJs, contributing to age- and disease-related motor deficits. We thus propose that maintaining normal cholinergic signaling in muscles will slow degeneration of NMJs and attenuate loss of motor function caused by aging and neuromuscular diseases.

Mouse Genome Database: From sequence to phenotypes and disease models

PubMed Central

Richardson, Joel E.; Kadin, James A.; Smith, Cynthia L.; Blake, Judith A.; Bult, Carol J.

2015-01-01

Summary The Mouse Genome Database (MGD, www.informatics.jax.org) is the international scientific database for genetic, genomic, and biological data on the laboratory mouse to support the research requirements of the biomedical community. To accomplish this goal, MGD provides broad data coverage, serves as the authoritative standard for mouse nomenclature for genes, mutants, and strains, and curates and integrates many types of data from literature and electronic sources. Among the key data sets MGD supports are: the complete catalog of mouse genes and genome features, comparative homology data for mouse and vertebrate genes, the authoritative set of Gene Ontology (GO) annotations for mouse gene functions, a comprehensive catalog of mouse mutations and their phenotypes, and a curated compendium of mouse models of human diseases. Here, we describe the data acquisition process, specifics about MGD's key data areas, methods to access and query MGD data, and outreach and user help facilities. genesis 53:458–473, 2015. © 2015 The Authors. Genesis Published by Wiley Periodicals, Inc. PMID:26150326

Magnetic Resonance Spectroscopy of Regional Brain Metabolite Markers in FALS Mice and the Effects of Dietary Creatine Supplementation

PubMed Central

Choi, JiKyung; Kustermann, Ekkehard; Dedeoglu, Alpaslan; Jenkins, Bruce G.

2010-01-01

We investigated the effects of disease progression on brain regional neurochemistry in a mutant mouse model of familial amyotrophic lateral sclerosis (FALS; the G93A model) using in vivo and in vitro magnetic resonance spectroscopy (MRS). There were numerous changes in the brain spectra that were brain region dependent. At early time points starting around 80 days of age there were increases in brain glutamate. At later time points there were more extensive changes including decreased NAA, decreased glutamate and increased glutamine, taurine and myo-inositol. The effects of the disease were most severe in spinal cord followed by medulla and then sensorimotor cortex. There were no changes noted in cerebellum as a control region. The effects of creatine supplementation in the diet (2%) were measured in wild-type and FALS animals in medulla, cerebellum and cortex. The increase in brain creatine was largest in cerebellum (25%) followed by medulla (11%) and then cortex (4%) reflecting the ordering of creatine kinase activity. There was a protective effect of creatine on NAA loss in the medulla at late stages. Creatine supplementation had a positive effect on weight retention leading to a 13% increase in weight between 120-130 days. MRS shows promise in monitoring multiple facets of neuroprotective strategies in ALS and ALS models. PMID:19930399

Establishing a laboratory animal model from a transgenic animal: RasH2 mice as a model for carcinogenicity studies in regulatory science.

PubMed

Urano, K; Tamaoki, N; Nomura, T

2012-01-01

Transgenic animal models have been used in small numbers in gene function studies in vivo for a period of time, but more recently, the use of a single transgenic animal model has been approved as a second species, 6-month alternative (to the routine 2-year, 2-animal model) used in short-term carcinogenicity studies for generating regulatory application data of new drugs. This article addresses many of the issues associated with the creation and use of one of these transgenic models, the rasH2 mouse, for regulatory science. The discussion includes strategies for mass producing mice with the same stable phenotype, including constructing the transgene, choosing a founder mouse, and controlling both the transgene and background genes; strategies for developing the model for regulatory science, including measurements of carcinogen susceptibility, stability of a large-scale production system, and monitoring for uniform carcinogenicity responses; and finally, efficient use of the transgenic animal model on study. Approximately 20% of mouse carcinogenicity studies for new drug applications in the United States currently use transgenic models, typically the rasH2 mouse. The rasH2 mouse could contribute to animal welfare by reducing the numbers of animals used as well as reducing the cost of carcinogenicity studies. A better understanding of the advantages and disadvantages of the transgenic rasH2 mouse will result in greater and more efficient use of this animal model in the future.

NCI Mouse Repository | Frederick National Laboratory for Cancer Research

Cancer.gov

The NCI Mouse Repository is an NCI-funded resource for mouse cancer models and associated strains. The repository makes strains available to all members of the scientific community (academic, non-profit, and commercial). NCI Mouse Repository strains

Identification of a misfolded region in superoxide dismutase 1 that is exposed in amyotrophic lateral sclerosis.

PubMed

Rotunno, Melissa S; Auclair, Jared R; Maniatis, Stephanie; Shaffer, Scott A; Agar, Jeffrey; Bosco, Daryl A

2014-10-10

Mutations and aberrant post-translational modifications within Cu,Zn-superoxide dismutase (SOD1) cause this otherwise protective enzyme to misfold, leading to amyotrophic lateral sclerosis (ALS). The C4F6 antibody selectively binds misfolded SOD1 in spinal cord tissues from postmortem human ALS cases, as well as from an ALS-SOD1 mouse model, suggesting that the C4F6 epitope reports on a pathogenic conformation that is common to misfolded SOD1 variants. To date, the residues and structural elements that comprise this epitope have not been elucidated. Using a chemical cross-linking and mass spectrometry approach, we identified the C4F6 epitope within several ALS-linked SOD1 variants, as well as an oxidized form of WT SOD1, supporting the notion that a similar misfolded conformation is shared among pathological SOD1 proteins. Exposure of the C4F6 epitope was modulated by the SOD1 electrostatic (loop VII) and zinc binding (loop IV) loops and correlated with SOD1-induced toxicity in a primary microglia activation assay. Site-directed mutagenesis revealed Asp(92) and Asp(96) as key residues within the C4F6 epitope required for the SOD1-C4F6 binding interaction. We propose that stabilizing the functional loops within SOD1 and/or obscuring the C4F6 epitope are viable therapeutic strategies for treating SOD1-mediated ALS. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

"Preconditioning" with latrepirdine, an adenosine 5'-monophosphate-activated protein kinase activator, delays amyotrophic lateral sclerosis progression in SOD1(G93A) mice.

PubMed

Coughlan, Karen S; Mitchem, Mollie R; Hogg, Marion C; Prehn, Jochen H M

2015-02-01

Adenosine 5'-monophosphate-activated protein kinase (AMPK) is a master regulator of energy balance. As energy imbalance is documented as a key pathologic feature of amyotrophic lateral sclerosis (ALS), we investigated AMPK as a pharmacologic target in SOD1(G93A) mice. We noted a strong activation of AMPK in lumbar spinal cords of SOD1(G93A) mice. Pharmacologic activation of AMPK has shown protective effects in neuronal "preconditioning" models. We tested the hypothesis that "preconditioning" with a small molecule activator of AMPK, latrepirdine, exerts beneficial effects on disease progression. SOD1(G93A) mice (n = 24 animals per group; sex and litter matched) were treated with latrepirdine (1 μg/kg, intraperitoneal) or vehicle from postnatal day 70 to 120. Treatment with latrepirdine increased AMPK activity in primary mouse motor neuron cultures and in SOD1(G93A) lumbar spinal cords. Mice "preconditioned" with latrepirdine showed a delayed symptom onset and a significant increase in life span (p < 0.01). Our study suggests that "preconditioning" with latrepirdine may represent a possible therapeutic strategy for individuals harboring ALS-associated gene mutations who are at risk for developing ALS. Copyright © 2015 Elsevier Inc. All rights reserved.

Oligodendroglia metabolically support axons and contribute to neurodegeneration

PubMed Central

Lee, Youngjin; Morrison, Brett M.; Li, Yun; Lengacher, Sylvain; Farah, Mohamed H.; Hoffman, Paul N.; Liu, Yiting; Tsingalia, Akivaga; Jin, Lin; Zhang, Ping-Wu; Pellerin, Luc; Magistretti, Pierre J.; Rothstein, Jeffrey D.

2012-01-01

Summary Oligodendroglia support axon survival and function through mechanisms independent of myelination and their dysfunction leads to axon degeneration in several diseases. The cause of this degeneration has not been determined, but lack of energy metabolites such as glucose or lactate has been hypothesized. Lactate is transported exclusively by monocarboxylate transporters, and changes to these transporters alter lactate production and utilization. We show the most abundant lactate transporter in the CNS, monocarboxylate transporter 1 (MCT1), is highly enriched within oligodendroglia and that disruption of this transporter produces axon damage and neuron loss in animal and cell culture models. In addition, this same transporter is reduced in patients with, and mouse models of, amyotrophic lateral sclerosis (ALS), suggesting a role for oligodendroglial MCT1 in pathogenesis. The role of oligodendroglia in axon function and neuron survival has been elusive; this study defines a new fundamental mechanism by which oligodendroglia support neurons and axons. PMID:22801498

Acquired immunologic tolerance: with particular reference to transplantation

PubMed Central

Starzl, Thomas E.

2009-01-01

The first unequivocally successful bone marrow cell transplantation in humans was recorded in 1968 by the University of Minnesota team of Robert A. Good (Gatti et al. Lancet 2: 1366–1369, 1968). This achievement was a direct extension of mouse models of acquired immunologic tolerance that were established 15 years earlier. In contrast, organ (i.e. kidney) transplantation was accomplished precociously in humans (in 1959) before demonstrating its feasibility in any experimental model and in the absence of a defensible immunologic rationale. Due to the striking differences between the outcomes with the two kinds of procedure, the mechanisms of organ engraftment were long thought to differ from the leukocyte chimerism-associated ones of bone marrow transplantation. This and other concepts of alloengraftment and acquired tolerance have changed over time. Current concepts and their clinical implications can be understood and discussed best from the perspective provided by the life and times of Bob Good. PMID:17917005

Therapeutic effects of autologous lymphocytes activated with trastuzumab for xenograft mouse models of human breast cancer.

PubMed

Nakagawa, Shinichiro; Matsuoka, Yusuke; Ichihara, Hideaki; Yoshida, Hitoji; Yoshida, Kenshi; Ueoka, Ryuichi

2013-01-01

Trastuzumab (TTZ) is molecular targeted drug used for metastatic breast cancer patients overexpressing human epidermal growth factor receptor 2 (HER2). Therapeutic effects of lymphocytes activated with TTZ (TTZ-LAK) using xenograft mouse models of human breast cancer (MDA-MB-453) cells were examined in vivo. Remarkable reduction of tumor volume in a xenograft mouse models intravenously treated with TTZ-LAK cells after the subcutaneously inoculated of MDA-MB-453 cells was verified in vivo. The migration of TTZ-LAK cells in tumor of mouse models subcutaneously inoculated MDA-MB-453 cells was observed on the basis of histological analysis using immunostaining with CD-3. Induction of apoptosis in tumor of xenograft mice treated with TTZ-LAK cells was observed in micrographs using terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling (TUNEL) method. It was noteworthy that the therapeutic effects of TTZ-LAK cells along with apoptosis were obtained for xenograft mouse models of human breast tumor in vivo.

Poly(GP) proteins are a useful pharmacodynamic marker for C9ORF72-associated amyotrophic lateral sclerosis.

PubMed

Gendron, Tania F; Chew, Jeannie; Stankowski, Jeannette N; Hayes, Lindsey R; Zhang, Yong-Jie; Prudencio, Mercedes; Carlomagno, Yari; Daughrity, Lillian M; Jansen-West, Karen; Perkerson, Emilie A; O'Raw, Aliesha; Cook, Casey; Pregent, Luc; Belzil, Veronique; van Blitterswijk, Marka; Tabassian, Lilia J; Lee, Chris W; Yue, Mei; Tong, Jimei; Song, Yuping; Castanedes-Casey, Monica; Rousseau, Linda; Phillips, Virginia; Dickson, Dennis W; Rademakers, Rosa; Fryer, John D; Rush, Beth K; Pedraza, Otto; Caputo, Ana M; Desaro, Pamela; Palmucci, Carla; Robertson, Amelia; Heckman, Michael G; Diehl, Nancy N; Wiggs, Edythe; Tierney, Michael; Braun, Laura; Farren, Jennifer; Lacomis, David; Ladha, Shafeeq; Fournier, Christina N; McCluskey, Leo F; Elman, Lauren B; Toledo, Jon B; McBride, Jennifer D; Tiloca, Cinzia; Morelli, Claudia; Poletti, Barbara; Solca, Federica; Prelle, Alessandro; Wuu, Joanne; Jockel-Balsarotti, Jennifer; Rigo, Frank; Ambrose, Christine; Datta, Abhishek; Yang, Weixing; Raitcheva, Denitza; Antognetti, Giovanna; McCampbell, Alexander; Van Swieten, John C; Miller, Bruce L; Boxer, Adam L; Brown, Robert H; Bowser, Robert; Miller, Timothy M; Trojanowski, John Q; Grossman, Murray; Berry, James D; Hu, William T; Ratti, Antonia; Traynor, Bryan J; Disney, Matthew D; Benatar, Michael; Silani, Vincenzo; Glass, Jonathan D; Floeter, Mary Kay; Rothstein, Jeffrey D; Boylan, Kevin B; Petrucelli, Leonard

2017-03-29

There is no effective treatment for amyotrophic lateral sclerosis (ALS), a devastating motor neuron disease. However, discovery of a G 4 C 2 repeat expansion in the C9ORF72 gene as the most common genetic cause of ALS has opened up new avenues for therapeutic intervention for this form of ALS. G 4 C 2 repeat expansion RNAs and proteins of repeating dipeptides synthesized from these transcripts are believed to play a key role in C9ORF72 -associated ALS (c9ALS). Therapeutics that target G 4 C 2 RNA, such as antisense oligonucleotides (ASOs) and small molecules, are thus being actively investigated. A limitation in moving such treatments from bench to bedside is a lack of pharmacodynamic markers for use in clinical trials. We explored whether poly(GP) proteins translated from G 4 C 2 RNA could serve such a purpose. Poly(GP) proteins were detected in cerebrospinal fluid (CSF) and in peripheral blood mononuclear cells from c9ALS patients and, notably, from asymptomatic C9ORF72 mutation carriers. Moreover, CSF poly(GP) proteins remained relatively constant over time, boding well for their use in gauging biochemical responses to potential treatments. Treating c9ALS patient cells or a mouse model of c9ALS with ASOs that target G 4 C 2 RNA resulted in decreased intracellular and extracellular poly(GP) proteins. This decrease paralleled reductions in G 4 C 2 RNA and downstream G 4 C 2 RNA-mediated events. These findings indicate that tracking poly(GP) proteins in CSF could provide a means to assess target engagement of G 4 C 2 RNA-based therapies in symptomatic C9ORF72 repeat expansion carriers and presymptomatic individuals who are expected to benefit from early therapeutic intervention. Copyright © 2017, American Association for the Advancement of Science.

Poly(GP) proteins are a useful pharmacodynamic marker for C9ORF72-associated amyotrophic lateral sclerosis

PubMed Central

Gendron, Tania F.; Chew, Jeannie; Stankowski, Jeannette N.; Hayes, Lindsey R.; Zhang, Yong-Jie; Prudencio, Mercedes; Carlomagno, Yari; Daughrity, Lillian M.; Jansen-West, Karen; Perkerson, Emilie A.; O’Raw, Aliesha; Cook, Casey; Pregent, Luc; Belzil, Veronique; van Blitterswijk, Marka; Tabassian, Lilia J.; Lee, Chris W.; Yue, Mei; Tong, Jimei; Song, Yuping; Castanedes-Casey, Monica; Rousseau, Linda; Phillips, Virginia; Dickson, Dennis W.; Rademakers, Rosa; Fryer, John D.; Rush, Beth K.; Pedraza, Otto; Caputo, Ana M.; Desaro, Pamela; Palmucci, Carla; Robertson, Amelia; Heckman, Michael G.; Diehl, Nancy N.; Wiggs, Edythe; Tierney, Michael; Braun, Laura; Farren, Jennifer; Lacomis, David; Ladha, Shafeeq; Fournier, Christina N.; McCluskey, Leo F.; Elman, Lauren B.; Toledo, Jon B.; McBride, Jennifer D.; Tiloca, Cinzia; Morelli, Claudia; Poletti, Barbara; Solca, Federica; Prelle, Alessandro; Wuu, Joanne; Jockel-Balsarotti1, Jennifer; Rigo, Frank; Ambrose, Christine; Datta, Abhishek; Yang, Weixing; Raitcheva, Denitza; Antognetti, Giovanna; McCampbell, Alexander; Van Swieten, John C.; Miller, Bruce L.; Boxer, Adam L.; Brown, Robert H.; Bowser, Robert; Miller, Timothy M.; Trojanowski, John Q.; Grossman, Murray; Berry, James D.; Hu, William T.; Ratti, Antonia; Traynor, Bryan J.; Disney, Matthew D.; Benatar, Michael; Silani, Vincenzo; Glass, Jonathan D.; Floeter, Mary Kay; Rothstein, Jeffrey D.; Boylan, Kevin B.; Petrucelli, Leonard

2017-01-01

There is no effective treatment for amyotrophic lateral sclerosis (ALS), a devastating motor neuron disease. However, discovery of a G4C2 repeat expansion in the C9ORF72 gene as the most common genetic cause of ALS has opened up new avenues for therapeutic intervention for this form of ALS. G4C2 repeat expansion RNAs and proteins of repeating dipeptides synthesized from these transcripts are believed to play a key role in C9ORF72-associated ALS (c9ALS). Therapeutics that target G4C2 RNA, such as antisense oligonucleotides (ASOs) and small molecules, are thus being actively investigated. A limitation in moving such treatments from bench to bedside is a lack of pharmacodynamic markers for use in clinical trials. We explored whether poly(GP) proteins translated from G4C2 RNA could serve such a purpose. Poly(GP) proteins were detected in cerebrospinal fluid (CSF) and in peripheral blood mononuclear cells from c9ALS patients and, notably, from asymptomatic C9ORF72 mutation carriers. Moreover, CSF poly(GP) proteins remained relatively constant over time, boding well for their use in gauging biochemical responses to potential treatments. Treating c9ALS patient cells or a mouse model of c9ALS with ASOs that target G4C2 RNA resulted in decreased intracellular and extracellular poly(GP) proteins. This decrease paralleled reductions in G4C2 RNA and downstream G4C2 RNA–mediated events. These findings indicate that tracking poly(GP) proteins in CSF could provide a means to assess target engagement of G4C2 RNA–based therapies in symptomatic C9ORF72 repeat expansion carriers and presymptomatic individuals who are expected to benefit from early therapeutic intervention. PMID:28356511

Transposable elements in TDP-43-mediated neurodegenerative disorders.

PubMed

Li, Wanhe; Jin, Ying; Prazak, Lisa; Hammell, Molly; Dubnau, Josh

2012-01-01

Elevated expression of specific transposable elements (TEs) has been observed in several neurodegenerative disorders. TEs also can be active during normal neurogenesis. By mining a series of deep sequencing datasets of protein-RNA interactions and of gene expression profiles, we uncovered extensive binding of TE transcripts to TDP-43, an RNA-binding protein central to amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). Second, we find that association between TDP-43 and many of its TE targets is reduced in FTLD patients. Third, we discovered that a large fraction of the TEs to which TDP-43 binds become de-repressed in mouse TDP-43 disease models. We propose the hypothesis that TE mis-regulation contributes to TDP-43 related neurodegenerative diseases.

PDX-1 Is a Therapeutic Target for Pancreatic Cancer, Insulinoma and Islet Neoplasia Using a Novel RNA Interference Platform

PubMed Central

Liu, Shi-He; Rao, Donald D.; Nemunaitis, John; Senzer, Neil; Zhou, Guisheng; Dawson, David; Gingras, Marie-Claude; Wang, Zhaohui; Gibbs, Richard; Norman, Michael; Templeton, Nancy S.; DeMayo, Francesco J.; O'Malley, Bert; Sanchez, Robbi; Fisher, William E.; Brunicardi, F. Charles

2012-01-01

Pancreatic and duodenal homeobox-1 (PDX-1) is a transcription factor that regulates insulin expression and islet maintenance in the adult pancreas. Our recent studies demonstrate that PDX-1 is an oncogene for pancreatic cancer and is overexpressed in pancreatic cancer. The purpose of this study was to demonstrate that PDX-1 is a therapeutic target for both hormonal symptoms and tumor volume in mouse models of pancreatic cancer, insulinoma and islet neoplasia. Immunohistochemistry of human pancreatic and islet neoplasia specimens revealed marked PDX-1 overexpression, suggesting PDX-1 as a “drugable” target within these diseases. To do so, a novel RNA interference effector platform, bifunctional shRNAPDX-1, was developed and studied in mouse and human cell lines as well as in mouse models of pancreatic cancer, insulinoma and islet neoplasia. Systemic delivery of bi-shRNAhumanPDX-1 lipoplexes resulted in marked reduction of tumor volume and improved survival in a human pancreatic cancer xenograft mouse model. bi-shRNAmousePDX-1 lipoplexes prevented death from hyperinsulinemia and hypoglycemia in an insulinoma mouse model. shRNAmousePDX-1 lipoplexes reversed hyperinsulinemia and hypoglycemia in an immune-competent mouse model of islet neoplasia. PDX-1 was overexpressed in pancreatic neuroendocrine tumors and nesidioblastosis. These data demonstrate that PDX-1 RNAi therapy controls hormonal symptoms and tumor volume in mouse models of pancreatic cancer, insulinoma and islet neoplasia, therefore, PDX-1 is a potential therapeutic target for these pancreatic diseases. PMID:22905092

Development and Characterization of a Mouse Model for Marburg Hemorrhagic Fever

DTIC Science & Technology

2009-07-01

Microbiology. All Rights Reserved. Development and Characterization of a Mouse Model for Marburg Hemorrhagic Fever Kelly L. Warfield,* Steven B...mouse model has hampered an understanding of the pathogenesis and immunity of Marburg hemorrhagic fever (MHF), the disease caused by marburgvirus (MARV...cause severe hemorrhagic fevers in humans and non- human primates (27). The incubation time is estimated to be 3 to 21 days, with human case fatality

Producing a Mouse Model to Explore the Linkages Between Tocopherol Biology and Prostate Cancer

DTIC Science & Technology

2005-07-01

Edwards, Prostate cancer and supplementation with alpha-tocopherol and beta -carotene: incidence and mortality in a controlled trial. J Natl Cancer ...1-0153 TITLE: Producing a Mouse Model to Explore the Linkages Between Tocopherol Biology and Prostate Cancer ...TITLE AND SUBTITLE Producing a Mouse Model to Explore the Linkages Between Tocopherol 5a. CONTRACT NUMBER Biology and Prostate Cancer 5b. GRANT

Synergistic Action of FOXP3 and TSC1 Pathways During Tumor Progression

DTIC Science & Technology

2015-10-01

invasive carcinoma and, ultimately, metastatic disease [1-3]. Mouse models of PIN (mPIN) generated by a single- mutant gene in prostate do not progress...downstream target) is sufficient to significantly reduce the initiation of prostate cancer in the Pten conditional knockout mouse model [19-21...the possibility that these two genetic hits cooperate to promote tumor progression, and mouse models show that this cooperation accelerates

Astringency: A More Stringent Definition

PubMed Central

Gong, Naihua N.; Matsunami, Hiroaki

2014-01-01

Despite being an everyday sensory experience, the nature of astringency perception is not clear. In this issue of Chemical Senses, Schöbel et al. demonstrate that astringency is a trigeminal sensation in human, and astringents trigger a G protein-coupled pathway in trigeminal ganglion cells in the mouse. PMID:24860069

STUNTED MOUSE MAMMARY GLAND DEVELOPMENT, IN THE ABSENCE OF BODY WEIGHT EFFECTS, FOLLOWING PRENATAL EXPOSURE TO PFOA

EPA Science Inventory

Perfluorooctanoic acid (PFOA), a synthetic compound resistant to severe weather and heat, is ubiquitous in the environment and is detected in serum of the human population and several wildlife species. Previous studies (Lau et al., 2004) have demonstrated that prenatal exposure ...

A dural lymphatic vascular system that drains brain interstitial fluid and macromolecules.

PubMed

Aspelund, Aleksanteri; Antila, Salli; Proulx, Steven T; Karlsen, Tine Veronica; Karaman, Sinem; Detmar, Michael; Wiig, Helge; Alitalo, Kari

2015-06-29

The central nervous system (CNS) is considered an organ devoid of lymphatic vasculature. Yet, part of the cerebrospinal fluid (CSF) drains into the cervical lymph nodes (LNs). The mechanism of CSF entry into the LNs has been unclear. Here we report the surprising finding of a lymphatic vessel network in the dura mater of the mouse brain. We show that dural lymphatic vessels absorb CSF from the adjacent subarachnoid space and brain interstitial fluid (ISF) via the glymphatic system. Dural lymphatic vessels transport fluid into deep cervical LNs (dcLNs) via foramina at the base of the skull. In a transgenic mouse model expressing a VEGF-C/D trap and displaying complete aplasia of the dural lymphatic vessels, macromolecule clearance from the brain was attenuated and transport from the subarachnoid space into dcLNs was abrogated. Surprisingly, brain ISF pressure and water content were unaffected. Overall, these findings indicate that the mechanism of CSF flow into the dcLNs is directly via an adjacent dural lymphatic network, which may be important for the clearance of macromolecules from the brain. Importantly, these results call for a reexamination of the role of the lymphatic system in CNS physiology and disease. © 2015 Aspelund et al.

Designing Mouse Behavioral Tasks Relevant to Autistic-Like Behaviors

ERIC Educational Resources Information Center

Crawley, Jacqueline N.

2004-01-01

The importance of genetic factors in autism has prompted the development of mutant mouse models to advance our understanding of biological mechanisms underlying autistic behaviors. Mouse models of human neuropsychiatric diseases are designed to optimize (1) face validity, i.e., resemblance to the human symptoms; (2) construct validity, i.e.,…

Behavioral phenotypes of genetic mouse models of autism

PubMed Central

Kazdoba, T. M.; Leach, P. T.; Crawley, J. N.

2016-01-01

More than a hundred de novo single gene mutations and copy-number variants have been implicated in autism, each occurring in a small subset of cases. Mutant mouse models with syntenic mutations offer research tools to gain an understanding of the role of each gene in modulating biological and behavioral phenotypes relevant to autism. Knockout, knockin and transgenic mice incorporating risk gene mutations detected in autism spectrum disorder and comorbid neurodevelopmental disorders are now widely available. At present, autism spectrum disorder is diagnosed solely by behavioral criteria. We developed a constellation of mouse behavioral assays designed to maximize face validity to the types of social deficits and repetitive behaviors that are central to an autism diagnosis. Mouse behavioral assays for associated symptoms of autism, which include cognitive inflexibility, anxiety, hyperactivity, and unusual reactivity to sensory stimuli, are frequently included in the phenotypic analyses. Over the past 10 years, we and many other laboratories around the world have employed these and additional behavioral tests to phenotype a large number of mutant mouse models of autism. In this review, we highlight mouse models with mutations in genes that have been identified as risk genes for autism, which work through synaptic mechanisms and through the mTOR signaling pathway. Robust, replicated autism-relevant behavioral outcomes in a genetic mouse model lend credence to a causal role for specific gene contributions and downstream biological mechanisms in the etiology of autism. PMID:26403076

Defining the role of polyamines in colon carcinogenesis using mouse models

PubMed Central

Ignatenko, Natalia A.; Gerner, Eugene W.; Besselsen, David G.

2011-01-01

Genetics and diet are both considered important risk determinants for colorectal cancer, a leading cause of death in the US and worldwide. Genetically engineered mouse (GEM) models have made a significant contribution to the characterization of colorectal cancer risk factors. Reliable, reproducible, and clinically relevant animal models help in the identification of the molecular events associated with disease progression and in the development of effictive treatment strategies. This review is focused on the use of mouse models for studying the role of polyamines in colon carcinogenesis. We describe how the available mouse models of colon cancer such as the multiple intestinal neoplasia (Min) mice and knockout genetic models facilitate understanding of the role of polyamines in colon carcinogenesis and help in the development of a rational strategy for colon cancer chemoprevention. PMID:21712957

Targeting Cancer Protein Profiles with Split-Enzyme Reporter Fragments to Achieve Chemical Resolution for Molecular Imaging

DTIC Science & Technology

2013-08-01

We next tested the utility of the construct to accumulate in tumors expressing EGFR using an orthotopic mouse model for brain tumors. Glioma cells...filament tumor marker, identified implanted cells within the orthotopic mouse model which were of human origin, i.e. Gli36Δ5 cells, and demonstrated that...forward into in vivo animal tumor model studies. • In vivo imaging of EGFR targeted-complex in orthotopic mouse model of brain tumor. • Ex vivo validation

Genetically engineered mouse models of melanoma.

PubMed

Pérez-Guijarro, Eva; Day, Chi-Ping; Merlino, Glenn; Zaidi, M Raza

2017-06-01

Melanoma is a complex disease that exhibits highly heterogeneous etiological, histopathological, and genetic features, as well as therapeutic responses. Genetically engineered mouse (GEM) models provide powerful tools to unravel the molecular mechanisms critical for melanoma development and drug resistance. Here, we expound briefly the basis of the mouse modeling design, the available technology for genetic engineering, and the aspects influencing the use of GEMs to model melanoma. Furthermore, we describe in detail the currently available GEM models of melanoma. Cancer 2017;123:2089-103. © 2017 American Cancer Society. © 2017 American Cancer Society.

CRISPR-Mediated Knockout of Cybb in NSG Mice Establishes a Model of Chronic Granulomatous Disease for Human Stem-Cell Gene Therapy Transplants.

PubMed

Sweeney, Colin L; Choi, Uimook; Liu, Chengyu; Koontz, Sherry; Ha, Seung-Kwon; Malech, Harry L

2017-07-01

Chronic granulomatous disease (CGD) is characterized by defects in the production of microbicidal reactive oxygen species (ROS) by phagocytes. Testing of gene and cell therapies for the treatment of CGD in human hematopoietic cells requires preclinical transplant models. The use of the lymphocyte-deficient NOD.Cg-Prkdc scid Il2rg tm1Wjl/ SzJ (NSG) mouse strain for human hematopoietic cell xenografts to test CGD therapies is complicated by the presence of functional mouse granulocytes capable of producing ROS for subsequent bacterial and fungal killing. To establish a phagocyte-defective mouse model of X-linked CGD (X-CGD) in NSG mice, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 was utilized for targeted knockout of mouse Cybb on the X-chromosome by microinjection of NSG mouse zygotes with Cas9 mRNA and CRISPR single-guide RNA targeting Cybb exon 1 or exon 3. This resulted in a high incidence of indel formation at the CRISPR target site, with all mice exhibiting deletions in at least one Cybb allele based on sequence analysis of tail snip DNA. A female mouse heterozygous for a 235-bp deletion in Cybb exon 1 was bred to an NSG male to establish the X-CGD NSG mouse strain, NSG.Cybb[KO]. Resulting male offspring with the 235 bp deletion were found to be defective for production of ROS by neutrophils and other phagocytes, and demonstrated increased susceptibility to spontaneous bacterial and fungal infections with granulomatous inflammation. The establishment of the phagocyte-defective NSG.Cybb[KO] mouse model enables the in vivo assessment of gene and cell therapy strategies for treating CGD in human hematopoietic cell transplants without obfuscation by functional mouse phagocytes, and may also be useful for modeling other phagocyte disorders in humanized NSG mouse xenografts.

Genetically engineered mouse models of craniopharyngioma: an opportunity for therapy development and understanding of tumor biology.

PubMed

Apps, John Richard; Martinez-Barbera, Juan Pedro

2017-05-01

Adamantinomatous craniopharyngioma (ACP) is the commonest tumor of the sellar region in childhood. Two genetically engineered mouse models have been developed and are giving valuable insights into ACP biology. These models have identified novel pathways activated in tumors, revealed an important function of paracrine signalling and extended conventional theories about the role of organ-specific stem cells in tumorigenesis. In this review, we summarize these mouse models, what has been learnt, their limitations and open questions for future research. We then discussed how these mouse models may be used to test novel therapeutics against potentially targetable pathways recently identified in human ACP. © 2017 The Authors. Brain Pathology published by John Wiley & Sons Ltd on behalf of International Society of Neuropathology.

Compensatory Limb Use and Behavioral Assessment of Motor Skill Learning Following Sensorimotor Cortex Injury in a Mouse Model of Ischemic Stroke

PubMed Central

Kerr, Abigail L.; Tennant, Kelly A.

2014-01-01

Mouse models have become increasingly popular in the field of behavioral neuroscience, and specifically in studies of experimental stroke. As models advance, it is important to develop sensitive behavioral measures specific to the mouse. The present protocol describes a skilled motor task for use in mouse models of stroke. The Pasta Matrix Reaching Task functions as a versatile and sensitive behavioral assay that permits experimenters to collect accurate outcome data and manipulate limb use to mimic human clinical phenomena including compensatory strategies (i.e., learned non-use) and focused rehabilitative training. When combined with neuroanatomical tools, this task also permits researchers to explore the mechanisms that support behavioral recovery of function (or lack thereof) following stroke. The task is both simple and affordable to set up and conduct, offering a variety of training and testing options for numerous research questions concerning functional outcome following injury. Though the task has been applied to mouse models of stroke, it may also be beneficial in studies of functional outcome in other upper extremity injury models. PMID:25045916

Object Creation and Human Factors Evaluation for Virtual Environments

NASA Technical Reports Server (NTRS)

Lindsey, Patricia F.

1998-01-01

The main objective of this project is to provide test objects for simulated environments utilized by the recently established Army/NASA Virtual Innovations Lab (ANVIL) at Marshall Space Flight Center, Huntsville, Al. The objective of the ANVIL lab is to provide virtual reality (VR) models and environments and to provide visualization and manipulation methods for the purpose of training and testing. Visualization equipment used in the ANVIL lab includes head-mounted and boom-mounted immersive virtual reality display devices. Objects in the environment are manipulated using data glove, hand controller, or mouse. These simulated objects are solid or surfaced three dimensional models. They may be viewed or manipulated from any location within the environment and may be viewed on-screen or via immersive VR. The objects are created using various CAD modeling packages and are converted into the virtual environment using dVise. This enables the object or environment to be viewed from any angle or distance for training or testing purposes.

Edaravone suppresses retinal ganglion cell death in a mouse model of normal tension glaucoma

PubMed Central

Akaiwa, Kei; Namekata, Kazuhiko; Azuchi, Yuriko; Guo, Xiaoli; Kimura, Atsuko; Harada, Chikako; Mitamura, Yoshinori; Harada, Takayuki

2017-01-01

Glaucoma, one of the leading causes of irreversible blindness, is characterized by progressive degeneration of optic nerves and retinal ganglion cells (RGCs). In the mammalian retina, excitatory amino-acid carrier 1 (EAAC1) is expressed in neural cells, including RGCs. Loss of EAAC1 leads to RGC degeneration without elevated intraocular pressure (IOP) and exhibits glaucomatous pathology including glutamate neurotoxicity and oxidative stress. In the present study, we found that edaravone, a free radical scavenger that is used for treatment of acute brain infarction and amyotrophic lateral sclerosis (ALS), reduces oxidative stress and prevents RGC death and thinning of the inner retinal layer in EAAC1-deficient (KO) mice. In addition, in vivo electrophysiological analyses demonstrated that visual impairment in EAAC1 KO mice was ameliorated with edaravone treatment, clearly establishing that edaravone beneficially affects both histological and functional aspects of the glaucomatous retina. Our findings raise intriguing possibilities for the management of glaucoma by utilizing a widely prescribed drug for the treatment of acute brain infarction and ALS, edaravone, in combination with conventional treatments to lower IOP. PMID:28703795

The individuality of mice.

PubMed

Lathe, R

2004-12-01

Mutant mice simulating human CNS disorders are used as models for therapeutic drug development. Drug evaluation requires a coherent correlation between behavioral phenotype and drug status. Variations in behavioral responses could mask such correlations, a problem highlighted by the three-site studies of Crabbe et al. (1999) and Wahlsten et al. (2003a). Factors contributing to variation are considered, focusing on differences between individual animals. Genetic differences due to minisatellite variation suggest that each mouse is genetically distinct. Effects during gestation, including maternal stress, influence later life behavior; while endocrine exchanges between fetus and parent, and between male and female fetuses dependent on intrauterine position, also contribute. Pre and perinatal nutrition and maternal attention also play a role. In adults, endocrine cyclicity in females is a recognized source of behavioral diversity. Notably, there is increasing recognition that groups of wild and laboratory mice have complex social structures, illustrated through consideration of Crowcroft (1966). Dominance status can markedly modify behavior in test paradigms addressing anxiety, locomotion and aggressiveness, to an extent comparable to mutation or drug status. Understanding how such effects amplify the behavioral spectrum displayed by otherwise identical animals will improve testing.

A comparison of some organizational characteristics of the mouse central retina and the human macula.

PubMed

Volland, Stefanie; Esteve-Rudd, Julian; Hoo, Juyea; Yee, Claudine; Williams, David S

2015-01-01

Mouse models have greatly assisted our understanding of retinal degenerations. However, the mouse retina does not have a macula, leading to the question of whether the mouse is a relevant model for macular degeneration. In the present study, a quantitative comparison between the organization of the central mouse retina and the human macula was made, focusing on some structural characteristics that have been suggested to be important in predisposing the macula to stresses leading to degeneration: photoreceptor density, phagocytic load on the RPE, and the relative thinness of Bruch's membrane. Light and electron microscopy measurements from retinas of two strains of mice, together with published data on human retinas, were used for calculations and subsequent comparisons. As in the human retina, the central region of the mouse retina possesses a higher photoreceptor cell density and a thinner Bruch's membrane than in the periphery; however, the magnitudes of these periphery to center gradients are larger in the human. Of potentially greater relevance is the actual photoreceptor cell density, which is much greater in the mouse central retina than in the human macula, underlying a higher phagocytic load for the mouse RPE. Moreover, at eccentricities that correspond to the peripheral half of the human macula, the rod to cone ratio is similar between mouse and human. Hence, with respect to photoreceptor density and phagocytic load of the RPE, the central mouse retina models at least the more peripheral part of the macula, where macular degeneration is often first evident.

Comparison of three dimeric 18F-AlF-NOTA-RGD tracers.

PubMed

Guo, Jinxia; Lang, Lixin; Hu, Shuo; Guo, Ning; Zhu, Lei; Sun, Zhongchan; Ma, Ying; Kiesewetter, Dale O; Niu, Gang; Xie, Qingguo; Chen, Xiaoyuan

2014-04-01

RGD peptide-based radiotracers are well established as integrin αvβ3 imaging probes to evaluate tumor angiogenesis or tissue remodeling after ischemia or infarction. In order to optimize the labeling process and pharmacokinetics of the imaging probes, we synthesized three dimeric RGD peptides with or without PEGylation and performed in vivo screening. Radiolabeling was achieved through the reaction of F-18 aluminum-fluoride complex with the cyclic chelator, 1,4,7-triazacyclononane-1,4,7-triacetic acid (NOTA). Three imaging probes were synthesized as (18)F-AlF-NOTA-E[c(RGDfK)]2, (18)F-AlF-NOTA-PEG4-E[c(RGDfK)]2, and (18)F-AlF-NOTA-E[PEG4-c(RGDfk)]2. The receptor binding affinity was determined by competitive cell binding assay, and the stability was evaluated by mouse serum incubation. Tumor uptake and whole body distribution of the three tracers were compared through direct tissue sampling and PET quantification of U87MG tumor-bearing mice. All three compounds remained intact after 120 min incubation with mouse serum. They all had a rapid and relatively high tracer uptake in U87MG tumors with good target-to-background ratios. Compared with the other two tracers, (18)F-AlF-NOTA-E[PEG4-c(RGDfk)]2 had the highest tumor uptake and the lowest accumulation in the liver. The integrin receptor specificity was confirmed by co-injection of unlabeled dimeric RGD peptide. The rapid one-step radiolabeling strategy by the complexation of (18)F-aluminum fluoride with NOTA-peptide conjugates was successfully applied to synthesize three dimeric RGD peptides. Among the three probes developed, (18)F-AlF-NOTA-E[PEG4-c(RGDfk)]2 with relatively low liver uptake and high tumor accumulation appears to be a promising candidate for further translational research.

Copper and Zinc Metallation Status of Copper Zinc Superoxide Dismutase form Amyotrophic Lateral Sclerosis Transgenic Mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lelie, H.L.; Miller, L.; Liba, A.

2010-09-24

Mutations in the metalloenzyme copper-zinc superoxide dismutase (SOD1) cause one form of familial amyotrophic lateral sclerosis (ALS), and metals are suspected to play a pivotal role in ALS pathology. To learn more about metals in ALS, we determined the metallation states of human wild-type or mutant (G37R, G93A, and H46R/H48Q) SOD1 proteins from SOD1-ALS transgenic mice spinal cords. SOD1 was gently extracted from spinal cord and separated into insoluble (aggregated) and soluble (supernatant) fractions, and then metallation states were determined by HPLC inductively coupled plasma MS. Insoluble SOD1-rich fractions were not enriched in copper and zinc. However, the soluble mutantmore » and WT SOD1s were highly metallated except for the metal-binding-region mutant H46R/H48Q, which did not bind any copper. Due to the stability conferred by high metallation of G37R and G93A, it is unlikely that these soluble SOD1s are prone to aggregation in vivo, supporting the hypothesis that immature nascent SOD1 is the substrate for aggregation. We also investigated the effect of SOD1 overexpression and disease on metal homeostasis in spinal cord cross-sections of SOD1-ALS mice using synchrotron-based x-ray fluorescence microscopy. In each mouse genotype, except for the H46R/H48Q mouse, we found a redistribution of copper between gray and white matters correlated to areas of high SOD1. Interestingly, a disease-specific increase of zinc was observed in the white matter for all mutant SOD1 mice. Together these data provide a picture of copper and zinc in the cell as well as highlight the importance of these metals in understanding SOD1-ALS pathology.« less

A Genetically Engineered Mouse Model of Neuroblastoma Driven by Mutated ALK and MYCN

DTIC Science & Technology

2014-09-01

AWARD NUMBER: W81XWH-13-1-0220 TITLE: A Genetically Engineered Mouse Model of Neuroblastoma ...CONTRACT NUMBER A Genetically Engineered Mouse Model of Neuroblastoma Driven by Mutated ALK and MYCN 5b. GRANT NUMBER W81XWH-13-1-0220 5c...common ALK mutations in neuroblastoma , F1174L and R1275Q. We have determined that in tumors cells expressing mutated ALK, different downstream

Developing Novel Therapeutic Approaches in Small Cell Lung Carcinoma Using Genetically Engineered Mouse Models and Human Circulating Tumor Cells

DTIC Science & Technology

2014-10-01

AD_________________ Award Number: W81XWH-13-1-0325 TITLE: Developing Novel Therapeutic Approaches in Small Cell Lung Carcinoma Using ...Genetically Engineered Mouse Models and Human Circulating Tumor Cells PRINCIPAL INVESTIGATOR: Jeffrey Engelman MD PhD CONTRACTING ORGANIZATION ...Novel Therapeutic Approaches in Small Cell Lung 5a. CONTRACT NUMBER W81XWH-13-1-0325 Carcinoma Using Genetically Engineered Mouse Models and 5b

Focal dysfunction of the proteasome: a pathogenic factor in a mouse model of amyotrophic lateral sclerosis.

PubMed

Kabashi, Edor; Agar, Jeffrey N; Taylor, David M; Minotti, Sandra; Durham, Heather D

2004-06-01

Mutations in the Cu/Zn-superoxide dismutase (SOD-1) gene are responsible for a familial form of amyotrophic lateral sclerosis (fALS). The present study demonstrated impaired proteasomal function in the lumbar spinal cord of transgenic mice expressing human SOD-1 with the ALS-causing mutation G93A (SOD-1(G93A)) compared to non-transgenic littermates (LM) and SOD-1(WT) transgenic mice. Chymotrypsin-like activity was decreased as early as 45 days of age. By 75 days, chymotrypsin-, trypsin-, and caspase-like activities of the proteasome were impaired, at about 50% of control activity in lumbar spinal cord, but unchanged in thoracic spinal cord and liver. Both total and specific activities of the proteasome were reduced to a similar extent, indicating that a change in proteasome function, rather than a decrease in proteasome levels, had occurred. Similar decreases of total and specific activities of the proteasome were observed in NIH 3T3 cell lines expressing fALS mutants SOD-1(G93A) and SOD-1(G41S), but not in SOD-1(WT) controls. Although overall levels of proteasome were maintained in spinal cord of SOD-1(G93A) transgenic mice, the level of 20S proteasome was substantially reduced in lumbar spinal motor neurons relative to the surrounding neuropil. It is concluded that impairment of the proteasome is an early event and contributes to ALS pathogenesis.

Behavioural phenotyping assays for mouse models of autism

PubMed Central

Silverman, Jill L.; Yang, Mu; Lord, Catherine; Crawley, Jacqueline N.

2011-01-01

Autism is a heterogeneous neurodevelopmental disorder of unknown aetiology that affects 1 in 100–150 individuals. Diagnosis is based on three categories of behavioural criteria: abnormal social interactions, communication deficits and repetitive behaviours. Strong evidence for a genetic basis has prompted the development of mouse models with targeted mutations in candidate genes for autism. As the diagnostic criteria for autism are behavioural, phenotyping these mouse models requires behavioural assays with high relevance to each category of the diagnostic symptoms. Behavioural neuroscientists are generating a comprehensive set of assays for social interaction, communication and repetitive behaviours to test hypotheses about the causes of austism. Robust phenotypes in mouse models hold great promise as translational tools for discovering effective treatments for components of autism spectrum disorders. PMID:20559336

Intermittent fasting in mice does not improve hindlimb motor performance after spinal cord injury.

PubMed

Streijger, Femke; Plunet, Ward T; Plemel, Jason Ryan; Lam, Clarrie K; Liu, Jie; Tetzlaff, Wolfram

2011-06-01

Previously, we reported that every-other-day-fasting (EODF) in Sprague-Dawley rats initiated after cervical spinal cord injury (SCI) effectively promoted functional recovery, reduced lesion size, and enhanced sprouting of the corticospinal tract. More recently, we also showed improved behavioral recovery with EODF after a moderate thoracic contusion injury in rats. In order to make use of transgenic mouse models to study molecular mechanisms of EODF, we tested here whether this intermittent fasting regimen was also beneficial in mice after SCI. Starting after SCI, C57BL/6 mice were fed a standard rodent chow diet either with unrestricted access or feeding every other day. Over a 14-week post-injury period, we assessed hindlimb locomotor function with the Basso Mouse Scale (BMS) open-field test and horizontal ladder, and the spinal cords were evaluated histologically to measure white and grey matter sparing. EODF resulted in an overall caloric restriction of 20% compared to animals fed ad libitum (AL). The EODF-treated animals exhibited a ∼ 14% reduction in body weight compared to AL mice, and never recovered to their pre-operative body weight. In contrast to rats on an intermittent fasting regimen, mice exhibited no increase in blood ketone bodies by the end of the second, third, and fourth day of fasting. EODF had no beneficial effect on tissue sparing and failed to improve behavioral recovery of hindlimb function. Hence this observation stands in stark contrast to our earlier observations in Sprague-Dawley rats. This is likely due to the difference in the metabolic response to intermittent fasting as evidenced by different ketone levels during the first week of the EODF regimen.

A developmentally plastic adult mouse kidney cell line spontaneously generates multiple adult kidney structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Webb, Carol F., E-mail: carol-webb@omrf.org; Immunobiology and Cancer Research, Oklahoma Medical Research Foundation, Oklahoma City, OK; Department of Microbiology and Immunology, University of Oklahoma Health Sciences Center, Oklahoma City, OK

Despite exciting new possibilities for regenerative therapy posed by the ability to induce pluripotent stem cells, recapitulation of three-dimensional kidneys for repair or replacement has not been possible. ARID3a-deficient mouse tissues generated multipotent, developmentally plastic cells. Therefore, we assessed the adult mouse ARID3a−/− kidney cell line, KKPS5, which expresses renal progenitor surface markers as an alternative cell source for modeling kidney development. Remarkably, these cells spontaneously developed into multicellular nephron-like structures in vitro, and engrafted into immunocompromised medaka mesonephros, where they formed mouse nephron structures. These data implicate KKPS5 cells as a new model system for studying kidney development. - Highlights:more » • An ARID3a-deficient mouse kidney cell line expresses multiple progenitor markers. • This cell line spontaneously forms multiple nephron-like structures in vitro. • This cell line formed mouse kidney structures in immunocompromised medaka fish kidneys. • Our data identify a novel model system for studying kidney development.« less

Mouse phenotyping.

PubMed

Fuchs, Helmut; Gailus-Durner, Valérie; Adler, Thure; Aguilar-Pimentel, Juan Antonio; Becker, Lore; Calzada-Wack, Julia; Da Silva-Buttkus, Patricia; Neff, Frauke; Götz, Alexander; Hans, Wolfgang; Hölter, Sabine M; Horsch, Marion; Kastenmüller, Gabi; Kemter, Elisabeth; Lengger, Christoph; Maier, Holger; Matloka, Mikolaj; Möller, Gabriele; Naton, Beatrix; Prehn, Cornelia; Puk, Oliver; Rácz, Ildikó; Rathkolb, Birgit; Römisch-Margl, Werner; Rozman, Jan; Wang-Sattler, Rui; Schrewe, Anja; Stöger, Claudia; Tost, Monica; Adamski, Jerzy; Aigner, Bernhard; Beckers, Johannes; Behrendt, Heidrun; Busch, Dirk H; Esposito, Irene; Graw, Jochen; Illig, Thomas; Ivandic, Boris; Klingenspor, Martin; Klopstock, Thomas; Kremmer, Elisabeth; Mempel, Martin; Neschen, Susanne; Ollert, Markus; Schulz, Holger; Suhre, Karsten; Wolf, Eckhard; Wurst, Wolfgang; Zimmer, Andreas; Hrabě de Angelis, Martin

2011-02-01

Model organisms like the mouse are important tools to learn more about gene function in man. Within the last 20 years many mutant mouse lines have been generated by different methods such as ENU mutagenesis, constitutive and conditional knock-out approaches, knock-down, introduction of human genes, and knock-in techniques, thus creating models which mimic human conditions. Due to pleiotropic effects, one gene may have different functions in different organ systems or time points during development. Therefore mutant mouse lines have to be phenotyped comprehensively in a highly standardized manner to enable the detection of phenotypes which might otherwise remain hidden. The German Mouse Clinic (GMC) has been established at the Helmholtz Zentrum München as a phenotyping platform with open access to the scientific community (www.mousclinic.de; [1]). The GMC is a member of the EUMODIC consortium which created the European standard workflow EMPReSSslim for the systemic phenotyping of mouse models (http://www.eumodic.org/[2]). Copyright © 2010 Elsevier Inc. All rights reserved.

Human androgen deficiency: insights gained from androgen receptor knockout mouse models

PubMed Central

Rana, Kesha; Davey, Rachel A; Zajac, Jeffrey D

2014-01-01

The mechanism of androgen action is complex. Recently, significant advances have been made into our understanding of how androgens act via the androgen receptor (AR) through the use of genetically modified mouse models. A number of global and tissue-specific AR knockout (ARKO) models have been generated using the Cre-loxP system which allows tissue- and/or cell-specific deletion. These ARKO models have examined a number of sites of androgen action including the cardiovascular system, the immune and hemopoetic system, bone, muscle, adipose tissue, the prostate and the brain. This review focuses on the insights that have been gained into human androgen deficiency through the use of ARKO mouse models at each of these sites of action, and highlights the strengths and limitations of these Cre-loxP mouse models that should be considered to ensure accurate interpretation of the phenotype. PMID:24480924

Modelling clinical systemic lupus erythematosus: similarities, differences and success stories

PubMed Central

Celhar, Teja

2017-01-01

Abstract Mouse models of SLE have been indispensable tools to study disease pathogenesis, to identify genetic susceptibility loci and targets for drug development, and for preclinical testing of novel therapeutics. Recent insights into immunological mechanisms of disease progression have boosted a revival in SLE drug development. Despite promising results in mouse studies, many novel drugs have failed to meet clinical end points. This is probably because of the complexity of the disease, which is driven by polygenic predisposition and diverse environmental factors, resulting in a heterogeneous clinical presentation. Each mouse model recapitulates limited aspects of lupus, especially in terms of the mechanism underlying disease progression. The main mouse models have been fairly successful for the evaluation of broad-acting immunosuppressants. However, the advent of targeted therapeutics calls for a selection of the most appropriate model(s) for testing and, ultimately, identification of patients who will be most likely to respond. PMID:28013204

Mouse Models of Gastric Cancer

PubMed Central

Hayakawa, Yoku; Fox, James G.; Gonda, Tamas; Worthley, Daniel L.; Muthupalani, Sureshkumar; Wang, Timothy C.

2013-01-01

Animal models have greatly enriched our understanding of the molecular mechanisms of numerous types of cancers. Gastric cancer is one of the most common cancers worldwide, with a poor prognosis and high incidence of drug-resistance. However, most inbred strains of mice have proven resistant to gastric carcinogenesis. To establish useful models which mimic human gastric cancer phenotypes, investigators have utilized animals infected with Helicobacter species and treated with carcinogens. In addition, by exploiting genetic engineering, a variety of transgenic and knockout mouse models of gastric cancer have emerged, such as INS-GAS mice and TFF1 knockout mice. Investigators have used the combination of carcinogens and gene alteration to accelerate gastric cancer development, but rarely do mouse models show an aggressive and metastatic gastric cancer phenotype that could be relevant to preclinical studies, which may require more specific targeting of gastric progenitor cells. Here, we review current gastric carcinogenesis mouse models and provide our future perspectives on this field. PMID:24216700

Phenotyping male infertility in the mouse: how to get the most out of a 'non-performer'.

PubMed

Borg, Claire L; Wolski, Katja M; Gibbs, Gerard M; O'Bryan, Moira K

2010-01-01

Functional male gametes are produced through complex processes that take place within the testis, epididymis and female reproductive tract. A breakdown at any of these phases can result in male infertility. The production of mutant mouse models often yields an unexpected male infertility phenotype. It is with this in mind that the current review has been written. The review aims to act as a guide to the 'non-reproductive biologist' to facilitate a systematic analysis of sterile or subfertile mice and to assist in extracting the maximum amount of information from each model. This is a review of the original literature on defects in the processes that take a mouse spermatogonial stem cell through to a fully functional spermatozoon, which result in male infertility. Based on literature searches and personal experience, we have outlined a step-by-step strategy for the analysis of an infertile male mouse line. A wide range of methods can be used to define the phenotype of an infertile male mouse. These methods range from histological methods such as electron microscopy and immunohistochemistry, to hormone analyses and methods to assess sperm maturation status and functional competence. With the increased rate of genetically modified mouse production, the generation of mouse models with unexpected male infertility is increasing. This manuscript will help to ensure that the maximum amount of information is obtained from each mouse model and, by extension, will facilitate the knowledge of both normal fertility processes and the causes of human infertility.

Cloning and characterization of a mouse gene with homology to the human von Hippel-Lindau disease tumor suppressor gene: implications for the potential organization of the human von Hippel-Lindau disease gene.

PubMed

Gao, J; Naglich, J G; Laidlaw, J; Whaley, J M; Seizinger, B R; Kley, N

1995-02-15

The human von Hippel-Lindau disease (VHL) gene has recently been identified and, based on the nucleotide sequence of a partial cDNA clone, has been predicted to encode a novel protein with as yet unknown functions [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. The length of the encoded protein and the characteristics of the cellular expressed protein are as yet unclear. Here we report the cloning and characterization of a mouse gene (mVHLh1) that is widely expressed in different mouse tissues and shares high homology with the human VHL gene. It predicts a protein 181 residues long (and/or 162 amino acids, considering a potential alternative start codon), which across a core region of approximately 140 residues displays a high degree of sequence identity (98%) to the predicted human VHL protein. High stringency DNA and RNA hybridization experiments and protein expression analyses indicate that this gene is the most highly VHL-related mouse gene, suggesting that it represents the mouse VHL gene homologue rather than a related gene sharing a conserved functional domain. These findings provide new insights into the potential organization of the VHL gene and nature of its encoded protein.

A surgical approach appropriate for targeted cochlear gene therapy in the mouse.

PubMed

Jero, J; Tseng, C J; Mhatre, A N; Lalwani, A K

2001-01-01

Therapeutic manipulations of the mammalian cochlea, including cochlear gene transfer, have been predominantly studied using the guinea pig as the experimental model. With the significant developments in mouse genomics and the availability of mutant strains of mice with well-characterized hearing loss, the mouse justifiably will be the preferred animal model for therapeutic manipulations. However, the potential advantages of the mouse model have not been fully realized due to the surgical difficulty of accessing its small cochlea. This study describes a ventral approach, instead of the routinely used postauricular approach in other rodents, for accessing the mouse middle and inner ear, and its application in cochlear gene transfer. This ventral approach enabled rapid and direct delivery of liposome-transgene complex to the mouse inner ear while avoiding blood loss, facial nerve morbidity, and mortality. Transgene expression at 3 days was detected in Reissner's membrane, spiral limbus, spiral ligament, and spiral ganglion cells, in a pattern similar to that previously described in the guinea pig. The successful access and delivery of material to the mouse cochlea and the replication of gene expression seen in the guinea pig demonstrated in this study should promote the use of the mouse in future studies investigating targeted cochlear therapy.

Bone sialoprotein mediates the tumor cell-targeted prometastatic activity of TGF-β in a mouse model of breast cancer.

PubMed Central

Nam, Jeong-Seok; Suchar, Adam M.; Kang, Mi-Jin; Stuelten, Christina H.; Tang, Binwu; Michalowska, Aleksandra M.; Fisher, Larry W.; Fedarko, Neal S.; Jain, Alka; Pinkas, Jan; Lonning, Scott; Wakefield, Lalage M.

2006-01-01

Transforming growth factor-βs (TGF-βs) play a dual role in carcinogenesis, functioning as tumor suppressors early in the process, and then switching to act as pro-metastatic factors in late-stage disease. We have previously shown that high molecular weight TGF-β antagonists can suppress metastasis without the predicted toxicities (Yang et al., J. Clin. Invest. (2002) 109:1607-1615). To address the underlying mechanisms, we have used the 4T1 syngeneic mouse model of metastatic breast cancer. Treatment of mice with a monoclonal anti-TGF-β antibody (1D11) significantly suppressed metastasis of 4T1 cells to the lungs. When metastatic 4T1 cells were recovered from lungs of 1D11-treated and control mice, the most differentially expressed gene was found to be bone sialoprotein (Bsp). Immunostaining confirmed the loss of Bsp protein in 1D11-treated lung metastases, and TGF-β was shown to regulate and correlate with Bsp expression in vitro. Functionally, knockdown of Bsp in 4T1 cells reduced the ability of TGF-β to induce local collagen degradation and invasion in vitro, and treatment with recombinant BSP protected 4T1 cells from complement-mediated lysis. Finally, suppression of Bsp in 4T1 cells reduced metastasis in vivo. We conclude that Bsp is a plausible mediator of at least some of the tumor cell-targeted prometastatic activity of TGF-β in this model, and that Bsp expression in metastases can be successfully suppressed by systemic treatment with anti-TGF-β antibodies. PMID:16778210

Behavioral phenotypes of genetic mouse models of autism.

PubMed

Kazdoba, T M; Leach, P T; Crawley, J N

2016-01-01

More than a hundred de novo single gene mutations and copy-number variants have been implicated in autism, each occurring in a small subset of cases. Mutant mouse models with syntenic mutations offer research tools to gain an understanding of the role of each gene in modulating biological and behavioral phenotypes relevant to autism. Knockout, knockin and transgenic mice incorporating risk gene mutations detected in autism spectrum disorder and comorbid neurodevelopmental disorders are now widely available. At present, autism spectrum disorder is diagnosed solely by behavioral criteria. We developed a constellation of mouse behavioral assays designed to maximize face validity to the types of social deficits and repetitive behaviors that are central to an autism diagnosis. Mouse behavioral assays for associated symptoms of autism, which include cognitive inflexibility, anxiety, hyperactivity, and unusual reactivity to sensory stimuli, are frequently included in the phenotypic analyses. Over the past 10 years, we and many other laboratories around the world have employed these and additional behavioral tests to phenotype a large number of mutant mouse models of autism. In this review, we highlight mouse models with mutations in genes that have been identified as risk genes for autism, which work through synaptic mechanisms and through the mTOR signaling pathway. Robust, replicated autism-relevant behavioral outcomes in a genetic mouse model lend credence to a causal role for specific gene contributions and downstream biological mechanisms in the etiology of autism. © 2015 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

Differing Efficacies of Lead Group A Streptococcal Vaccine Candidates and Full-Length M Protein in Cutaneous and Invasive Disease Models.

PubMed

Rivera-Hernandez, Tania; Pandey, Manisha; Henningham, Anna; Cole, Jason; Choudhury, Biswa; Cork, Amanda J; Gillen, Christine M; Ghaffar, Khairunnisa Abdul; West, Nicholas P; Silvestri, Guido; Good, Michael F; Moyle, Peter M; Toth, Istvan; Nizet, Victor; Batzloff, Michael R; Walker, Mark J

2016-06-14

Group A Streptococcus (GAS) is an important human pathogen responsible for both superficial infections and invasive diseases. Autoimmune sequelae may occur upon repeated infection. For this reason, development of a vaccine against GAS represents a major challenge, since certain GAS components may trigger autoimmunity. We formulated three combination vaccines containing the following: (i) streptolysin O (SLO), interleukin 8 (IL-8) protease (Streptococcus pyogenes cell envelope proteinase [SpyCEP]), group A streptococcal C5a peptidase (SCPA), arginine deiminase (ADI), and trigger factor (TF); (ii) the conserved M-protein-derived J8 peptide conjugated to ADI; and (iii) group A carbohydrate lacking the N-acetylglucosamine side chain conjugated to ADI. We compared these combination vaccines to a "gold standard" for immunogenicity, full-length M1 protein. Vaccines were adjuvanted with alum, and mice were immunized on days 0, 21, and 28. On day 42, mice were challenged via cutaneous or subcutaneous routes. High-titer antigen-specific antibody responses with bactericidal activity were detected in mouse serum samples for all vaccine candidates. In comparison with sham-immunized mice, all vaccines afforded protection against cutaneous challenge. However, only full-length M1 protein provided protection in the subcutaneous invasive disease model. This set of experiments demonstrates the inherent variability of mouse models for the characterization of GAS vaccine candidate protective efficacy. Such variability poses an important challenge for GAS vaccine development, as advancement of candidates to human clinical trials requires strong evidence of efficacy. This study highlights the need for an open discussion within the field regarding standardization of animal models for GAS vaccine development. Copyright © 2016 Rivera-Hernandez et al.

Using Genetic Mouse Models to Gain Insight into Glaucoma: Past Results and Future Possibilities

PubMed Central

Fernandes, Kimberly A.; Harder, Jeffrey M.; Williams, Pete A.; Rausch, Rebecca L.; Kiernan, Amy E.; Nair, K. Saidas; Anderson, Michael G.; John, Simon W.; Howell, Gareth R.; Libby, Richard T.

2015-01-01

While all forms of glaucoma are characterized by a specific pattern of retinal ganglion cell death, they are clinically divided into several distinct subclasses, including normal tension glaucoma, primary open angle glaucoma, congenital glaucoma, and secondary glaucoma. For each type of glaucoma there are likely numerous molecular pathways that control susceptibility to the disease. Given this complexity, a single animal model will never precisely model all aspects of all the different types of human glaucoma. Therefore, multiple animal models have been utilized to study glaucoma but more are needed. Because of the powerful genetic tools available to use in the laboratory mouse, it has proven to be a highly useful mammalian system for studying the pathophysiology of human disease. The similarity between human and mouse eyes coupled with the ability to use a combination of advanced cell biological and genetic tools in mice have led to a large increase in the number of studies using mice to model specific glaucoma phenotypes. Over the last decade, numerous new mouse models and genetic tools have emerged, providing important insight into the cell biology and genetics of glaucoma. In this review, we describe available mouse genetic models that can be used to study glaucoma-relevant disease/pathobiology. Furthermore, we discuss how these models have been used to gain insights into ocular hypertension (a major risk factor for glaucoma) and glaucomatous retinal ganglion cell death. Finally, the potential for developing new mouse models and using advanced genetic tools and resources for studying glaucoma are discussed. PMID:26116903

Early presymptomatic cholinergic dysfunction in a murine model of amyotrophic lateral sclerosis

PubMed Central

Casas, Caty; Herrando-Grabulosa, Mireia; Manzano, Raquel; Mancuso, Renzo; Osta, Rosario; Navarro, Xavier

2013-01-01

Sporadic and familiar amyotrophic lateral sclerosis (ALS) cases presented lower cholinergic activity than in healthy individuals in their still preserved spinal motoneurons (MNs) suggesting that cholinergic reduction might occur before MN death. To unravel how and when cholinergic function is compromised, we have analyzed the spatiotemporal expression of choline acetyltransferase (ChAT) from early presymptomatic stages of the SOD1G93A ALS mouse model by confocal immunohistochemistry. The analysis showed an early reduction in ChAT content in soma and presynaptic boutons apposed onto MNs (to 76%) as well as in cholinergic interneurons in the lumbar spinal cord of the 30-day-old SOD1G93A mice. Cholinergic synaptic stripping occurred simultaneously to the presence of abundant surrounding major histocompatibility complex II (MHC-II)-positive microglia and the accumulation of nuclear Tdp-43 and the appearance of mild oxidative stress within MNs. Besides, there was a loss of neuronal MHC-I expression, which is necessary for balanced synaptic stripping after axotomy. These events occurred before the selective raise of markers of denervation such as ATF3. By the same time, alterations in postsynaptic cholinergic-related structures were also revealed with a loss of the presence of sigma-1 receptor, a Ca2+ buffering chaperone in the postsynaptic cisternae. By 2 months of age, ChAT seemed to accumulate in the soma of MNs, and thus efferences toward Renshaw interneurons were drastically diminished. In conclusion, cholinergic dysfunction in the local circuitry of the spinal cord may be one of the earliest events in ALS etiopathogenesis. PMID:23531559

Neurocognitive endophenotypes in CGG KI and Fmr1 KO mouse models of Fragile X-Associated disorders: an analysis of the state of the field

PubMed Central

Hunsaker, Michael R.

2013-01-01

It has become increasingly important that the field of behavioral genetics identifies not only the gross behavioral phenotypes associated with a given mutation, but also the behavioral endophenotypes that scale with the dosage of the particular mutation being studied. Over the past few years, studies evaluating the effects of the polymorphic CGG trinucleotide repeat on the FMR1 gene underlying Fragile X-Associated Disorders have reported preliminary evidence for a behavioral endophenotype in human Fragile X Premutation carrier populations as well as the CGG knock-in (KI) mouse model. More recently, the behavioral experiments used to test the CGG KI mouse model have been extended to the Fmr1 knock-out (KO) mouse model. When combined, these data provide compelling evidence for a clear neurocognitive endophenotype in the mouse models of Fragile X-Associated Disorders such that behavioral deficits scale predictably with genetic dosage. Similarly, it appears that the CGG KI mouse effectively models the histopathology in Fragile X-Associated Disorders across CGG repeats well into the full mutation range, resulting in a reliable histopathological endophenotype. These endophenotypes may influence future research directions into treatment strategies for not only Fragile X Syndrome, but also the Fragile X Premutation and Fragile X-Associated Tremor/Ataxia Syndrome (FXTAS). PMID:24627796

Long non-coding RNA expression patterns in lung tissues of chronic cigarette smoke induced COPD mouse model.

PubMed

Zhang, Haiyun; Sun, Dejun; Li, Defu; Zheng, Zeguang; Xu, Jingyi; Liang, Xue; Zhang, Chenting; Wang, Sheng; Wang, Jian; Lu, Wenju

2018-05-15

Long non-coding RNAs (lncRNAs) have critical regulatory roles in protein-coding gene expression. Aberrant expression profiles of lncRNAs have been observed in various human diseases. In this study, we investigated transcriptome profiles in lung tissues of chronic cigarette smoke (CS)-induced COPD mouse model. We found that 109 lncRNAs and 260 mRNAs were significantly differential expressed in lungs of chronic CS-induced COPD mouse model compared with control animals. GO and KEGG analyses indicated that differentially expressed lncRNAs associated protein-coding genes were mainly involved in protein processing of endoplasmic reticulum pathway, and taurine and hypotaurine metabolism pathway. The combination of high throughput data analysis and the results of qRT-PCR validation in lungs of chronic CS-induced COPD mouse model, 16HBE cells with CSE treatment and PBMC from patients with COPD revealed that NR_102714 and its associated protein-coding gene UCHL1 might be involved in the development of COPD both in mouse and human. In conclusion, our study demonstrated that aberrant expression profiles of lncRNAs and mRNAs existed in lungs of chronic CS-induced COPD mouse model. From animal models perspective, these results might provide further clues to investigate biological functions of lncRNAs and their potential target protein-coding genes in the pathogenesis of COPD.

Modeling bladder cancer in mice: opportunities and challenges

PubMed Central

Kobayashi, Takashi; Owczarek, Tomasz B.; McKiernan, James M.; Abate-Shen, Cory

2015-01-01

The prognosis and treatment of bladder cancer have hardly improved in the last 20 years. Bladder cancer remains a debilitating and often fatal disease, and among the most costly cancers to treat. The generation of informative mouse models has the potential to improve our understanding of bladder cancer progression, as well as impact its diagnosis and treatment. However, relatively few mouse models of bladder cancer have been described and particularly few that develop invasive cancer phenotypes. This review focuses on opportunities for improving the landscape of mouse models of bladder cancer. PMID:25533675

Development and function of human innate immune cells in a humanized mouse model.

PubMed

Rongvaux, Anthony; Willinger, Tim; Martinek, Jan; Strowig, Till; Gearty, Sofia V; Teichmann, Lino L; Saito, Yasuyuki; Marches, Florentina; Halene, Stephanie; Palucka, A Karolina; Manz, Markus G; Flavell, Richard A

2014-04-01

Mice repopulated with human hematopoietic cells are a powerful tool for the study of human hematopoiesis and immune function in vivo. However, existing humanized mouse models cannot support development of human innate immune cells, including myeloid cells and natural killer (NK) cells. Here we describe two mouse strains called MITRG and MISTRG, in which human versions of four genes encoding cytokines important for innate immune cell development are knocked into their respective mouse loci. The human cytokines support the development and function of monocytes, macrophages and NK cells derived from human fetal liver or adult CD34(+) progenitor cells injected into the mice. Human macrophages infiltrated a human tumor xenograft in MITRG and MISTRG mice in a manner resembling that observed in tumors obtained from human patients. This humanized mouse model may be used to model the human immune system in scenarios of health and pathology, and may enable evaluation of therapeutic candidates in an in vivo setting relevant to human physiology.

Development and function of human innate immune cells in a humanized mouse model

PubMed Central

Rongvaux, Anthony; Willinger, Tim; Martinek, Jan; Strowig, Till; Gearty, Sofia V.; Teichmann, Lino L.; Saito, Yasuyuki; Marches, Florentina; Halene, Stephanie; Palucka, A. Karolina; Manz, Markus G.; Flavell, Richard A.

2014-01-01

Mice repopulated with human hematopoietic cells are a powerful tool for the study of human hematopoiesis and immune function in vivo. However, existing humanized mouse models are unable to support development of human innate immune cells, including myeloid cells and NK cells. Here we describe a mouse strain, called MI(S)TRG, in which human versions of four genes encoding cytokines important for innate immune cell development are knocked in to their respective mouse loci. The human cytokines support the development and function of monocytes/macrophages and natural killer cells derived from human fetal liver or adult CD34+ progenitor cells injected into the mice. Human macrophages infiltrated a human tumor xenograft in MI(S)TRG mice in a manner resembling that observed in tumors obtained from human patients. This humanized mouse model may be used to model the human immune system in scenarios of health and pathology, and may enable evaluation of therapeutic candidates in an in vivo setting relevant to human physiology. PMID:24633240

Effect of electroacupuncture on brain-derived neurotrophic factor mRNA expression in mouse hippocampus following cerebral ischemia-reperfusion injury.

PubMed

Zhao, Jianxin; Xu, Huazhou; Tian, Yuanxiang; Hu, Manxiang; Xiao, Hongling

2013-04-01

This work aims to observe the effects of electroacupuncture on brain-derived neurotrophic factor (BDNF) mRNA expression in mouse hippocampus following cerebral ischemia-reperfusion injury. The models of mouse cerebral ischemia-reperfusion injury were established. A total of 96 healthy mice were randomly assigned into 4 groups, namely, the sham surgery, model, model + electroacupuncture, and mode + hydergine groups. Mice in the model + electroacupuncture group were treated through electroacupuncture at the Shenshu (BL 23), Geshu (BL 17), and Baihui (GV 20) acupoints. Mice in the model+hydergine group were intragastrically administered with hydergine (0.77 mg/kg(-1) x day(-1)). The levels of BDNF mRNA expressions in the hippocampus were ana lyzed through a semi-quantitative reverse transcription-polymerase chain reaction assay on days 1 and 7 after the surgeries. BDNF mRNA expressions in the mouse hippocampus of the model group on days 1 and 7 after the surgery were higher than those of the sham surgery group (both P < 0.01). On days 1 and 7 of the electroacupuncture treatment, BDNF mRNA expression in the mouse hippocampus of the model + electroacupuncture group was significantly elevated compared with the model group (both P < 0.01) or the model + hydergine group (both P < 0.01). On days 1 and 7 of the hydergine treatment, BDNF mRNA expression in the mouse hippocampus of the model + hydergine group tended to increase compared with the model group; however, statistical significance was not achieved (both P > 0.05). Electroacupuncture treatment enhances endogenous BDNF expression, which may improve the survival environment for intracerebral neurons and inhibit the apoptosis of hippocampal cells.

Intramyocardial Injection of siRNAs Can Efficiently Establish Myocardial Tissue-Specific Renalase Knockdown Mouse Model.

PubMed

Huang, Kun; Liu, Ju; Zhang, Hui; Wang, Jiliang; Li, Huili

2016-01-01

Ischaemia/reperfusion (I/R) injury will cause additional death of cardiomyocytes in ischaemic heart disease. Recent studies revealed that renalase was involved in the I/R injury. So, the myocardial tissue-specific knockdown mouse models were needed for the investigations of renalase. To establish the mouse models, intramyocardial injection of siRNAs targeting renalase was performed in mice. The wild distribution and high transfection efficiency of the siRNAs were approved. And the renalase expression was efficiently suppressed in myocardial tissue. Compared with the high cost, time consumption, and genetic compensation risk of the Cre/loxP technology, RNA interference (RNAi) technology is much cheaper and less time-consuming. Among the RNAi technologies, injection of siRNAs is safer than virus. And considering the properties of the I/R injury mouse models, the efficiency and durability of injection with siRNAs are acceptable for the studies. Altogether, intramyocardial injection of siRNAs targeting renalase is an economical, safe, and efficient method to establish myocardial tissue-specific renalase knockdown mouse models.

Improvements and Limitations of Humanized Mouse Models for HIV Research: NIH/NIAID "Meet the Experts" 2015 Workshop Summary.

PubMed

Akkina, Ramesh; Allam, Atef; Balazs, Alejandro B; Blankson, Joel N; Burnett, John C; Casares, Sofia; Garcia, J Victor; Hasenkrug, Kim J; Kashanchi, Fatah; Kitchen, Scott G; Klein, Florian; Kumar, Priti; Luster, Andrew D; Poluektova, Larisa Y; Rao, Mangala; Sanders-Beer, Brigitte E; Shultz, Leonard D; Zack, Jerome A

2016-02-01

The number of humanized mouse models for the human immunodeficiency virus (HIV)/acquired immunodeficiency syndrome (AIDS) and other infectious diseases has expanded rapidly over the past 8 years. Highly immunodeficient mouse strains, such as NOD/SCID/gamma chain(null) (NSG, NOG), support better human hematopoietic cell engraftment. Another improvement is the derivation of highly immunodeficient mice, transgenic with human leukocyte antigens (HLAs) and cytokines that supported development of HLA-restricted human T cells and heightened human myeloid cell engraftment. Humanized mice are also used to study the HIV reservoir using new imaging techniques. Despite these advances, there are still limitations in HIV immune responses and deficits in lymphoid structures in these models in addition to xenogeneic graft-versus-host responses. To understand and disseminate the improvements and limitations of humanized mouse models to the scientific community, the NIH sponsored and convened a meeting on April 15, 2015 to discuss the state of knowledge concerning these questions and best practices for selecting a humanized mouse model for a particular scientific investigation. This report summarizes the findings of the NIH meeting.

Oral recombinant human or mouse lactoferrin reduces Mycobacterium tuberculosis TDM induced granulomatous lung pathology.

PubMed

Hwang, Shen-An; Kruzel, Marian L; Actor, Jeffrey K

2017-02-01

Trehalose 6'6-dimycolate (TDM) is the most abundant glycolipid on the cell wall of Mycobacterium tuberculosis (MTB). TDM is capable of inducing granulomatous pathology in mouse models that resembles those induced by MTB infection. Using the acute TDM model, this work investigates the effect of recombinant human and mouse lactoferrin to reduce granulomatous pathology. C57BL/6 mice were injected intravenously with TDM at a dose of 25 μg·mouse -1 . At day 4 and 6, recombinant human or mouse lactoferrin (1 mg·(100 μL) -1 ·mouse -1 ) were delivered by gavage. At day 7 after TDM injection, mice were evaluated for lung pathology, cytokine production, and leukocyte populations. Mice given human or mouse lactoferrin had reduced production of IL-12p40 in their lungs. Mouse lactoferrin increased IL-6 and KC (CXCL1) in lung tissue. Increased numbers of macrophages were observed in TDM-injected mice given human or mouse lactoferrin. Granulomatous pathology, composed of mainly migrated leukocytes, was visually reduced in mice that received human or mouse lactoferrin. Quantitation of granulomatous pathology demonstrated a significant decrease in mice given human or mouse lactoferrin compared with TDM control mice. This report is the first to directly compare the immune modulatory effects of both heterologous recombinant human and homologous mouse lactoferrin on the development of TDM-induced granulomas.

Mouse neuroblastoma cell-based model and the effect of epileptic events on calcium oscillations and neural spikes

NASA Astrophysics Data System (ADS)

Kim, Suhwan; Jung, Unsang; Baek, Juyoung; Lee, Sangwon; Jung, Woonggyu; Kim, Jeehyun; Kang, Shinwon

2013-01-01

Recently, mouse neuroblastoma cells have been considered as an attractive model for the study of human neurological and prion diseases, and they have been intensively used as a model system in different areas. For example, the differentiation of neuro2a (N2A) cells, receptor-mediated ion current, and glutamate-induced physiological responses have been actively investigated with these cells. These mouse neuroblastoma N2A cells are of interest because they grow faster than other cells of neural origin and have a number of other advantages. The calcium oscillations and neural spikes of mouse neuroblastoma N2A cells in epileptic conditions are evaluated. Based on our observations of neural spikes in these cells with our proposed imaging modality, we reported that they can be an important model in epileptic activity studies. We concluded that mouse neuroblastoma N2A cells produce epileptic spikes in vitro in the same way as those produced by neurons or astrocytes. This evidence suggests that increased levels of neurotransmitter release due to the enhancement of free calcium from 4-aminopyridine causes the mouse neuroblastoma N2A cells to produce epileptic spikes and calcium oscillations.

Understanding the Etiology of Tuberous Sclerosis Complex

DTIC Science & Technology

2012-07-01

catalog #4856), mouse anti-NeuN (1:500; Millipore), GFAP (1:100, DAKO) and DCX (1:500, Santa Cruz Biotechnology). Each staining was replicated in slices...Tramontin, A.D., Quinones-Hinojosa, A., Barbaro, N.M., Gupta, N., Kunwar, S., Lawton, M.T., McDermott, M.W., Parsa, A.T., Manuel -Garcia, V.J. et al

Oncogenicity and Selective Inhibition of ERG Splicing Variants in Prostate Cancer

DTIC Science & Technology

2010-09-01

cancer specific TMPRSS2-ERG gene fusion products RNA Society’s 2010 Annual Meeting, Seattle, (2010). A manuscript is in preparation and planned for...21 and comparison with the region of conserved synteny on mouse chromosome 16. Gene, 2004. 324: p. 65-77. 20. Carrere , S., et al., Erg proteins

Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries

PubMed Central

Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans

2000-01-01

We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641

High-fertility phenotypes: two outbred mouse models exhibit substantially different molecular and physiological strategies warranting improved fertility.

PubMed

Langhammer, Martina; Michaelis, Marten; Hoeflich, Andreas; Sobczak, Alexander; Schoen, Jennifer; Weitzel, Joachim M

2014-01-01

Animal models are valuable tools in fertility research. Worldwide, there are more than 400 transgenic or knockout mouse models available showing a reproductive phenotype; almost all of them exhibit an infertile or at least subfertile phenotype. By contrast, animal models revealing an improved fertility phenotype are barely described. This article summarizes data on two outbred mouse models exhibiting a 'high-fertility' phenotype. These mouse lines were generated via selection over a time period of more than 40 years and 161 generations. During this selection period, the number of offspring per litter and the total birth weight of the entire litter nearly doubled. Concomitantly with the increased fertility phenotype, several endocrine parameters (e.g. serum testosterone concentrations in male animals), physiological parameters (e.g. body weight, accelerated puberty, and life expectancy), and behavioral parameters (e.g. behavior in an open field and endurance fitness on a treadmill) were altered. We demonstrate that the two independently bred high-fertility mouse lines warranted their improved fertility phenotype using different molecular and physiological strategies. The fertility lines display female- as well as male-specific characteristics. These genetically heterogeneous mouse models provide new insights into molecular and cellular mechanisms that enhance fertility. In view of decreasing fertility in men, these models will therefore be a precious information source for human reproductive medicine. Translated abstract A German translation of abstract is freely available at http://www.reproduction-online.org/content/147/4/427/suppl/DC1.

Ultrasonic vocalizations: a tool for behavioural phenotyping of mouse models of neurodevelopmental disorders

PubMed Central

Scattoni, Maria Luisa; Crawley, Jacqueline; Ricceri, Laura

2009-01-01

In neonatal mice ultrasonic vocalizations have been studied both as an early communicative behavior of the pup-mother dyad and as a sign of an aversive affective state. Adult mice of both sexes produce complex ultrasonic vocalization patterns in different experimental/social contexts. All these vocalizations are becoming an increasingly valuable assay for behavioral phenotyping throughout the mouse life-span and alterations of the ultrasound patterns have been reported in several mouse models of neurodevelopmental disorders. Here we also show that the modulation of vocalizations by maternal cues (maternal potentiation paradigm) – originally identified and investigated in rats - can be measured in C57Bl/6 mouse pups with appropriate modifications of the rat protocol and can likely be applied to mouse behavioral phenotyping. In addition we suggest that a detailed qualitative evaluation of neonatal calls together with analysis of adult mouse vocalization patterns in both sexes in social settings, may lead to a greater understanding of the communication value of vocalizations in mice. Importantly, both neonatal and adult USV altered patterns can be determined during the behavioural phenotyping of mouse models of human neurodevelopmental and neuropsychiatric disorders, starting from those in which deficits in communication are a primary symptom. PMID:18771687

A Comparison of Some Organizational Characteristics of the Mouse Central Retina and the Human Macula

PubMed Central

Hoo, Juyea; Yee, Claudine; Williams, David S.

2015-01-01

Mouse models have greatly assisted our understanding of retinal degenerations. However, the mouse retina does not have a macula, leading to the question of whether the mouse is a relevant model for macular degeneration. In the present study, a quantitative comparison between the organization of the central mouse retina and the human macula was made, focusing on some structural characteristics that have been suggested to be important in predisposing the macula to stresses leading to degeneration: photoreceptor density, phagocytic load on the RPE, and the relative thinness of Bruch’s membrane. Light and electron microscopy measurements from retinas of two strains of mice, together with published data on human retinas, were used for calculations and subsequent comparisons. As in the human retina, the central region of the mouse retina possesses a higher photoreceptor cell density and a thinner Bruch’s membrane than in the periphery; however, the magnitudes of these periphery to center gradients are larger in the human. Of potentially greater relevance is the actual photoreceptor cell density, which is much greater in the mouse central retina than in the human macula, underlying a higher phagocytic load for the mouse RPE. Moreover, at eccentricities that correspond to the peripheral half of the human macula, the rod to cone ratio is similar between mouse and human. Hence, with respect to photoreceptor density and phagocytic load of the RPE, the central mouse retina models at least the more peripheral part of the macula, where macular degeneration is often first evident. PMID:25923208

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ding, Ying; Adachi, Hiroaki, E-mail: hadachi-ns@umin.org; Department of Neurology, University of Occupational and Environmental Health School of Medicine, 1-1 Iseigaoka, Yahata-nishi-ku, Kitakyushu 807-8555

Spinal and bulbar muscular atrophy (SBMA) is an inherited motor neuron disease caused by the expansion of a polyglutamine (polyQ)-encoding tract within the androgen receptor (AR) gene. The pathologic features of SBMA are motor neuron loss in the spinal cord and brainstem and diffuse nuclear accumulation and nuclear inclusions of mutant AR in residual motor neurons and certain visceral organs. Hepatocyte growth factor (HGF) is a polypeptide growth factor which has neuroprotective properties. To investigate whether HGF overexpression can affect disease progression in a mouse model of SBMA, we crossed SBMA transgenic model mice expressing an AR gene with anmore » expanded CAG repeat with mice overexpressing HGF. Here, we report that high expression of HGF induces Akt phosphorylation and modestly ameliorated motor symptoms in an SBMA transgenic mouse model treated with or without castration. These findings suggest that HGF overexpression can provide a potential therapeutic avenue as a combination therapy with disease-modifying therapies in SBMA. - Highlights: • HGF overexpression ameliorates the motor phenotypes of the SBMA mouse model. • HGF overexpression induces Akt phosphorylation in the SBMA mouse model. • This is the first report of combination therapy in a mouse model of polyQ diseases.« less

Defining the optimal animal model for translational research using gene set enrichment analysis.

PubMed

Weidner, Christopher; Steinfath, Matthias; Opitz, Elisa; Oelgeschläger, Michael; Schönfelder, Gilbert

2016-08-01

The mouse is the main model organism used to study the functions of human genes because most biological processes in the mouse are highly conserved in humans. Recent reports that compared identical transcriptomic datasets of human inflammatory diseases with datasets from mouse models using traditional gene-to-gene comparison techniques resulted in contradictory conclusions regarding the relevance of animal models for translational research. To reduce susceptibility to biased interpretation, all genes of interest for the biological question under investigation should be considered. Thus, standardized approaches for systematic data analysis are needed. We analyzed the same datasets using gene set enrichment analysis focusing on pathways assigned to inflammatory processes in either humans or mice. The analyses revealed a moderate overlap between all human and mouse datasets, with average positive and negative predictive values of 48 and 57% significant correlations. Subgroups of the septic mouse models (i.e., Staphylococcus aureus injection) correlated very well with most human studies. These findings support the applicability of targeted strategies to identify the optimal animal model and protocol to improve the success of translational research. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

Use of systems pharmacology modeling to elucidate the operating characteristics of SGLT1 and SGLT2 in renal glucose reabsorption in humans

PubMed Central

Lu, Yasong; Griffen, Steven C.; Boulton, David W.; Leil, Tarek A.

2014-01-01

In the kidney, glucose in glomerular filtrate is reabsorbed primarily by sodium-glucose cotransporters 1 (SGLT1) and 2 (SGLT2) along the proximal tubules. SGLT2 has been characterized as a high capacity, low affinity pathway responsible for reabsorption of the majority of filtered glucose in the early part of proximal tubules, and SGLT1 reabsorbs the residual glucose in the distal part. Inhibition of SGLT2 is a viable mechanism for removing glucose from the body and improving glycemic control in patients with diabetes. Despite demonstrating high levels (in excess of 80%) of inhibition of glucose transport by SGLT2 in vitro, potent SGLT2 inhibitors, e.g., dapagliflozin and canagliflozin, inhibit renal glucose reabsorption by only 30–50% in clinical studies. Hypotheses for this apparent paradox are mostly focused on the compensatory effect of SGLT1. The paradox has been explained and the role of SGLT1 demonstrated in the mouse, but direct data in humans are lacking. To further explore the roles of SGLT1/2 in renal glucose reabsorption in humans, we developed a systems pharmacology model with emphasis on SGLT1/2 mediated glucose reabsorption and the effects of SGLT2 inhibition. The model was calibrated using robust clinical data in the absence or presence of dapagliflozin (DeFronzo et al., 2013), and evaluated against clinical data from the literature (Mogensen, 1971; Wolf et al., 2009; Polidori et al., 2013). The model adequately described all four data sets. Simulations using the model clarified the operating characteristics of SGLT1/2 in humans in the healthy and diabetic state with or without SGLT2 inhibition. The modeling and simulations support our proposition that the apparent moderate, 30–50% inhibition of renal glucose reabsorption observed with potent SGLT2 inhibitors is a combined result of two physiological determinants: SGLT1 compensation and residual SGLT2 activity. This model will enable in silico inferences and predictions related to SGLT1/2 modulation. PMID:25540623

Use of systems pharmacology modeling to elucidate the operating characteristics of SGLT1 and SGLT2 in renal glucose reabsorption in humans.

PubMed

Lu, Yasong; Griffen, Steven C; Boulton, David W; Leil, Tarek A

2014-01-01

In the kidney, glucose in glomerular filtrate is reabsorbed primarily by sodium-glucose cotransporters 1 (SGLT1) and 2 (SGLT2) along the proximal tubules. SGLT2 has been characterized as a high capacity, low affinity pathway responsible for reabsorption of the majority of filtered glucose in the early part of proximal tubules, and SGLT1 reabsorbs the residual glucose in the distal part. Inhibition of SGLT2 is a viable mechanism for removing glucose from the body and improving glycemic control in patients with diabetes. Despite demonstrating high levels (in excess of 80%) of inhibition of glucose transport by SGLT2 in vitro, potent SGLT2 inhibitors, e.g., dapagliflozin and canagliflozin, inhibit renal glucose reabsorption by only 30-50% in clinical studies. Hypotheses for this apparent paradox are mostly focused on the compensatory effect of SGLT1. The paradox has been explained and the role of SGLT1 demonstrated in the mouse, but direct data in humans are lacking. To further explore the roles of SGLT1/2 in renal glucose reabsorption in humans, we developed a systems pharmacology model with emphasis on SGLT1/2 mediated glucose reabsorption and the effects of SGLT2 inhibition. The model was calibrated using robust clinical data in the absence or presence of dapagliflozin (DeFronzo et al., 2013), and evaluated against clinical data from the literature (Mogensen, 1971; Wolf et al., 2009; Polidori et al., 2013). The model adequately described all four data sets. Simulations using the model clarified the operating characteristics of SGLT1/2 in humans in the healthy and diabetic state with or without SGLT2 inhibition. The modeling and simulations support our proposition that the apparent moderate, 30-50% inhibition of renal glucose reabsorption observed with potent SGLT2 inhibitors is a combined result of two physiological determinants: SGLT1 compensation and residual SGLT2 activity. This model will enable in silico inferences and predictions related to SGLT1/2 modulation.

Transgenic and gene knockout mice in gastric cancer research

PubMed Central

Jiang, Yannan; Yu, Yingyan

2017-01-01

Mouse models are useful tool for carcinogenic study. They will greatly enrich the understanding of pathogenesis and molecular mechanisms for gastric cancer. However, only few of mice could develop gastric cancer spontaneously. With the development and improvement of gene transfer technology, investigators created a variety of transgenic and knockout/knockin mouse models of gastric cancer, such as INS-GAS mice and gastrin knockout mice. Combined with helicobacter infection and carcinogens treatment, these transgenic/knockout/knockin mice developed precancerous or cancerous lesions, which are proper for gene function study or experimental therapy. Here we review the progression of genetically engineered mouse models on gastric cancer research, and emphasize the effects of chemical carcinogens or infectious factors on carcinogenesis of genetically modified mouse. We also emphasize the histological examination on mouse stomach. We expect to provide researchers with some inspirations on this field. PMID:27713138

The Oncogenic Role of RhoGAPs in Basal-Like Breast Cancer

DTIC Science & Technology

2015-02-01

cell lines, and mouse models . c) In vivo tumorigenesis and metastasis assays. Milestones: Identify whether ArhGAP11A and RacGAP1 can promote tumor growth...also upregulated in basal (C3(I)-Tag) but not luminal (MMTV-Neu) genetically- engineered mouse models (Fig. 1B). At the protein level, RacGAP1 was...hypothesis that these RhoGAPs are indeed playing an oncogenic role in these cells. Human Tumors Mouse Model Tumors Normal Luminal A Basal-like Normal

A Physiologically Based Kinetic Model of Rat and Mouse Gestation: Disposition of a Weak Acid

EPA Science Inventory

A physiologically based toxicokinetic model of gestation in the rat mouse has been developed. The model is superimposed on the normal growth curve for nonpregnant females. It describes the entire gestation period including organogenesis. The model consists of uterus, mammary tiss...

Priceless GEMMs: genetically engineered mouse models for colorectal cancer drug development.

PubMed

Roper, Jatin; Hung, Kenneth E

2012-08-01

To establish effective drug development for colorectal cancer (CRC), preclinical models that are robust surrogates for human disease are crucial. Mouse models are an attractive platform because of their relatively low cost, short life span, and ease of use. There are two main categories of mouse CRC models: xenografts derived from implantation of CRC cells or tumors in immunodeficient mice; and genetically engineered mouse models (GEMMs) derived from modification of human cancer predisposition genes, resulting in spontaneous tumor formation. Here, we review xenografts and GEMMs and focus on their potential application in translational research. Furthermore, we describe newer GEMMs for sporadic CRC that are particularly suitable for drug testing. Finally, we discuss recent advances in small-animal imaging, such as optical colonoscopy, which allow in vivo assessment of tumors. With the increasing sophistication of GEMMs, our preclinical armamentarium provides new hope for the ongoing war against CRC. Copyright © 2012. Published by Elsevier Ltd.

A Genetically Engineered Mouse Model of Sporadic Colorectal Cancer.

PubMed

Betzler, Alexander M; Kochall, Susan; Blickensdörfer, Linda; Garcia, Sebastian A; Thepkaysone, May-Linn; Nanduri, Lahiri K; Muders, Michael H; Weitz, Jürgen; Reissfelder, Christoph; Schölch, Sebastian

2017-07-06

Despite the advantages of easy applicability and cost-effectiveness, colorectal cancer mouse models based on tumor cell injection have severe limitations and do not accurately simulate tumor biology and tumor cell dissemination. Genetically engineered mouse models have been introduced to overcome these limitations; however, such models are technically demanding, especially in large organs such as the colon in which only a single tumor is desired. As a result, an immunocompetent, genetically engineered mouse model of colorectal cancer was developed which develops highly uniform tumors and can be used for tumor biology studies as well as therapeutic trials. Tumor development is initiated by surgical, segmental infection of the distal colon with adeno-cre virus in compound conditionally mutant mice. The tumors can be easily detected and monitored via colonoscopy. We here describe the surgical technique of segmental adeno-cre infection of the colon, the surveillance of the tumor via high-resolution colonoscopy and present the resulting colorectal tumors.

Absence of Prenatal Forebrain Defects in the Dp(16)1Yey/+ Mouse Model of Down Syndrome

PubMed Central

Goodliffe, Joseph W.; Olmos-Serrano, Jose Luis; Aziz, Nadine M.; Pennings, Jeroen L.A.; Guedj, Faycal; Bianchi, Diana W.

2016-01-01

Studies in humans with Down syndrome (DS) show that alterations in fetal brain development are followed by postnatal deficits in neuronal numbers, synaptic plasticity, and cognitive and motor function. This same progression is replicated in several mouse models of DS. Dp(16)1Yey/+ (hereafter called Dp16) is a recently developed mouse model of DS in which the entire region of mouse chromosome 16 that is homologous to human chromosome 21 has been triplicated. As such, Dp16 mice may more closely reproduce neurodevelopmental changes occurring in humans with DS. Here, we present the first comprehensive cellular and behavioral study of the Dp16 forebrain from embryonic to adult stages. Unexpectedly, our results demonstrate that Dp16 mice do not have prenatal brain defects previously reported in human fetal neocortex and in the developing forebrains of other mouse models, including microcephaly, reduced neurogenesis, and abnormal cell proliferation. Nevertheless, we found impairments in postnatal developmental milestones, fewer inhibitory forebrain neurons, and deficits in motor and cognitive performance in Dp16 mice. Therefore, although this new model does not express prenatal morphological phenotypes associated with DS, abnormalities in the postnatal period appear sufficient to produce significant cognitive deficits in Dp16. SIGNIFICANCE STATEMENT Down syndrome (DS) leads to intellectual disability. Several mouse models have increased our understanding of the neuropathology of DS and are currently being used to test therapeutic strategies. A new mouse model that contains an expanded number of DS-related genes, known as Dp(16)1Yey/+ (Dp16), has been generated recently. We sought to determine whether the extended triplication creates a better phenocopy of DS-related brain pathologies. We measured embryonic development, forebrain maturation, and perinatal/adult behavior and revealed an absence of prenatal phenotypes in Dp16 fetal brain, but specific cellular and behavioral deficits after the first 2 postnatal weeks. These results uncover important differences in prenatal phenotype between Dp16 animals and humans with DS and other DS mouse models. PMID:26961948

Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease

PubMed Central

2010-01-01

Background The BALB/c mouse is commonly used to study RSV infection and disease. However, despite the many advantages of this well-characterised model, the inoculum is large, viral replication is restricted and only a very small amount of virus can be recovered from infected animals. A key question in this model is the fate of the administered virus. Is replication really being measured or is the model measuring the survival of the virus over time? To answer these questions we developed a highly sensitive strand-specific quantitative PCR (QPCR) able to accurately quantify the amount of RSV replication in the BALB/c mouse lung, allowing characterisation of RSV negative and positive strand RNA dynamics. Results In the mouse lung, no increase in RSV genome was seen above the background of the original inoculum whilst only a limited transient increase (< 1 log) in positive strand, replicative intermediate (RI) RNA occurred. This RNA did however persist at detectable levels for 59 days post infection. As expected, ribavirin therapy reduced levels of infectious virus and RI RNA in the mouse lung. However, whilst Palivizumab therapy was also able to reduce levels of infectious virus, it failed to prevent production of intracellular RI RNA. A comparison of RSV RNA kinetics in human (A549) and mouse (KLN205) cell lines demonstrated that RSV replication was also severely delayed and impaired in vitro in the mouse cells. Conclusions This is the first time that such a sensitive strand-specific QPCR technique has been to the RSV mouse system. We have accurately quantified the restricted and abortive nature of RSV replication in the mouse. Further in vitro studies in human and mouse cells suggest this restricted replication is due at least in part to species-specific host cell-viral interactions. PMID:20860795

Establishment of mouse neuron and microglial cell co-cultured models and its action mechanism.

PubMed

Zhang, Bo; Yang, Yunfeng; Tang, Jun; Tao, Yihao; Jiang, Bing; Chen, Zhi; Feng, Hua; Yang, Liming; Zhu, Gang

2017-06-27

The objective of this study is to establish a co-culture model of mouse neurons and microglial cells, and to analyze the mechanism of action of oxygen glucose deprivation (OGD) and transient oxygen glucose deprivation (tOGD) preconditioning cell models. Mouse primary neurons and BV2 microglial cells were successfully cultured, and the OGD and tOGD models were also established. In the co-culture of mouse primary neurons and microglial cells, the cell number of tOGD mouse neurons and microglial cells was larger than the OGD cell number, observed by a microscope. CCK-8 assay result showed that at 1h after treatment, the OD value in the control group is lower compared to all the other three groups (P < 0.05). The treatment group exhibited the highest OD value among the four groups. The results observed at 5h were consistent with the results at 1 h. Flow cytometry results showed that at 1h after treatment the apoptosis percentages is higher in the control group compared to other three groups (P < 0.05). Mouse brain tissues were collected and primary neurons cells were cultured. In the meantime mouse BV2 microglia cells were cultured. Two types of cells were co-cultured, and OGD and tOGD cell models were established. There were four groups in the experiment: control group (OGD), treatment group (tOGD+OGD), placebo group (tOGD+OGD+saline) and minocycline intervention group (tOGD+OGD+minocycline). CCK-8 kit was used to detect cell viability and flow cytometry was used to detect apoptosis. In this study, mouse primary neurons and microglial cells were co-cultured. The OGD and tOGD models were established successfully. tOGD was able to effectively protect neurons and microglial cells from damage, and inhibit the apoptosis caused by oxygen glucose deprivation.

Galactooligosaccharide improves the animal survival and alleviates motor neuron death in SOD1G93A mouse model of amyotrophic lateral sclerosis.

PubMed

Song, L; Gao, Y; Zhang, X; Le, W

2013-08-29

Amyotrophic lateral sclerosis (ALS) is a progressive and devastating neurodegenerative disease caused by selective degeneration and death of motor neurons. So far very limited therapeutic options have emerged to treat this fatal disease. Homocysteine (Hcy) lowering drugs have been suggested to be a palliative therapy of this disease. Folate, Vitamin B12 (VitB12) and Vitamin B6 (VitB6) are important elements involved in the Hcy metabolism and we proposed that medications which could promote the absorption of folate, VitB12 and VitB6 might have benefit for ALS. Galactooligosaccharides (GOS) is a prebiotic which could significantly improve the absorption and syntheses of B Vitamins. To investigate whether GOS could provide neuroprotective effect in ALS, we applied GOS and GOS-rich prebiotic yogurt in SOD1(G93A) mice and assessed their effects on the disease progression of ALS. Our results showed that GOS and prebiotics yogurt administration significantly delayed the disease onset and prolonged the lifespan in SOD1(G93A) mice. Also, these products increased the concentration of folate, VitB12 and reduced the level of Hcy. Moreover, we found that both GOS and prebiotics yogurt attenuated motor neurons loss, improved the atrophy and mitochondrial activity in myocyte. Furthermore, we demonstrated that GOS and GOS-rich prebiotic treatment suppressed the activation of astrocytes and microglia and regulated several inflammatory- and apoptosis-related factors. Our findings suggested that GOS might have therapeutic potential for ALS, and GOS-rich prebiotic yogurt might be considered as a nutritional therapy for this disease. Copyright © 2013 IBRO. All rights reserved.

Actinic keratosis modelling in mice: A translational study

PubMed Central

Vandenberghe, Isabelle; Cartron, Valérie; Cèbe, Patrick; Blanchet, Jean-Christophe; Sibaud, Vincent; Guilbaud, Nicolas; Audoly, Laurent; Lamant, Laurence; Kruczynski, Anna

2017-01-01

Background Actinic keratoses (AK) are pre-malignant cutaneous lesions caused by prolonged exposure to ultraviolet radiation. As AKs lesions are generally accepted to be the initial lesions in a disease continuum that progresses to squamous cell carcinoma (SCC), AK lesions have to be treated. They are also the second most common reason for visits to the dermatologist. Several treatments are available but their efficacy still needs to be improved. The UV-B-induced KA lesion mouse model is used in preclinical studies to assess the efficacy of novel molecules, even though it is often more representative of advanced AK or SCC. Objectives Here we report on a translational study, comparing the various stages of AK development in humans and in the UV-B irradiated mouse model, as well as the optimization of photograph acquisition of AK lesions on mouse skin. Methods Human and mouse skin lesions were analysed by histology and immunohistochemistry. Mouse lesions were also assessed using a digital dermatoscope. Results An histological and phenotypic analysis, including p53, Ki67 and CD3 expression detection, performed on human and mouse AK lesions, shows that overall AK modelling in mice is relevant in the clinical situation. Some differences are observed, such as disorganization of keratinocytes of the basal layer and a number of atypical nuclei which are more numerous in human AK, whereas much more pronounced acanthosis is observed in skin lesion in mice. Thanks to this translational study, we are able to select appropriate experimental conditions for establishing either early or advanced stage AK or an SCC model. Furthermore, we optimized photograph acquisition of AK lesions on mouse skin by using a digital dermatoscope which is also used in clinics and allows reproducible photograph acquisition for further reliable assessment of mouse lesions. Use of this camera is illustrated through a pharmacological study assessing the activity of CARAC®. Conclusion These data demonstrate that this mouse model of UV-B-induced skin lesions is predictive for the identification of novel therapeutic treatments for both early and advanced stages of the disease. PMID:28662116

Taltirelin alleviates fatigue-like behavior in mouse models of cancer-related fatigue.

PubMed

Dougherty, John P; Wolff, Brian S; Cullen, Mary J; Saligan, Leorey N; Gershengorn, Marvin C

2017-10-01

Fatigue affects most cancer patients and has numerous potential causes, including cancer itself and cancer treatment. Cancer-related fatigue (CRF) is not relieved by rest, can decrease quality of life, and has no FDA-approved therapy. Thyrotropin-releasing hormone (TRH) has been proposed as a potential novel treatment for CRF, but its efficacy against CRF remains largely untested. Thus, we tested the TRH analog, taltirelin (TAL), in mouse models of CRF. To model fatigue, we used a mouse model of chemotherapy, a mouse model of radiation therapy, and mice bearing colon 26 carcinoma tumors. We used the treadmill fatigue test to assess fatigue-like behavior after treatment with TAL. Additionally, we used wild-type and TRH receptor knockout mice to determine which TRH receptor was necessary for the actions of TAL. Tumor-bearing mice displayed muscle wasting and all models caused fatigue-like behavior, with mice running a shorter distance in the treadmill fatigue test than controls. TAL reversed fatigue-like behavior in all three models and the mouse TRH 1 receptor was necessary for the effects of TAL. These data suggest that TAL may be useful in alleviating fatigue in all cancer patients and provide further support for evaluating TAL as a potential therapy for CRF in humans. Published by Elsevier Ltd.

A Small Molecule Screen in Stem Cell-derived Motor Neurons Identifies a Kinase Inhibitor as a Candidate Therapeutic for ALS

PubMed Central

Yang, Yin M.; Gupta, Shailesh K.; Kim, Kevin J.; Powers, Berit E.; Cerqueira, Antonio; Wainger, Brian J.; Ngo, Hien D.; Rosowski, Kathryn A.; Schein, Pamela A.; Ackeifi, Courtney A.; Arvanites, Anthony C.; Davidow, Lance S.; Woolf, Clifford J.; Rubin, Lee L.

2013-01-01

Amyotrophic lateral sclerosis (ALS) is a rapidly progressing neurodegenerative disease, characterized by motor neuron (MN) death, for which there are no truly effective treatments. Here, we describe a new small molecule survival screen carried out using MNs from both wildtype and mutant SOD1 mouse embryonic stem cells. Among the hits we found, kenpaullone had a particularly impressive ability to prolong the healthy survival of both types of MNs that can be attributed to its dual inhibition of GSK3 and HGK kinases. Furthermore, kenpaullone also strongly improved the survival of human MNs derived from ALS patient induced pluripotent stem cells and was more active than either of two compounds, olesoxime and dexpramipexole, that recently failed in ALS clinical trials. Our studies demonstrate the value of a stem cell approach to drug discovery and point to a new paradigm for identification and preclinical testing of future ALS therapeutics. PMID:23602540

Overhead View of Area Surrounding Pathfinder

NASA Technical Reports Server (NTRS)

1997-01-01

Overhead view of the area surrounding the Pathfinder lander illustrating the Sojourner traverse. Red rectangles are rover positions at the end of sols 1-30. Locations of soil mechanics experiments, wheel abrasion experiments, and APXS measurements are shown. The A numbers refer to APXS measurements as discussed in the paper by Rieder et al. (p. 1770, Science Magazine, see image note). Coordinates are given in the LL frame.

The photorealistic, interactive, three-dimensional virtual reality (VR) terrain models were created from IMP images using a software package developed for Pathfinder by C. Stoker et al. as a participating science project. By matching features in the left and right camera, an automated machine vision algorithm produced dense range maps of the nearfield, which were projected into a three-dimensional model as a connected polygonal mesh. Distance and angle measurements can be made on features viewed in the model using a mouse-driven three-dimensional cursor and a point-and-click interface. The VR model also incorporates graphical representations of the lander and rover and the sequence and spatial locations at which rover data were taken. As the rover moved, graphical models of the rover were added for each position that could be uniquely determined using stereo images of the rover taken by the IMP. Images taken by the rover were projected into the model as two-dimensional 'billboards' to show the proper perspective of these images.

NOTE: original caption as published in Science Magazine

Mars Pathfinder is the second in NASA's Discovery program of low-cost spacecraft with highly focused science goals. The Jet Propulsion Laboratory, Pasadena, CA, developed and manages the Mars Pathfinder mission for NASA's Office of Space Science, Washington, D.C. JPL is a division of the California Institute of Technology (Caltech).

HISTOPATHOLOGICAL EFFECTS IN MICE OF HETEROLOGOUS ANTILYMPHOCYTE SERUM

PubMed Central

Taub, Robert N.; Lance, Eugene M.

1968-01-01

The effects of heterologous rabbit anti-mouse lymphocyte antiserum on the morphology of lymphoid and other tissues was investigated in CBA mice. The lymphoid tissues exhibited characteristic changes specific for ALS treatment, which were an invariable accompaniment to its immunosuppressive effects. These consisted of peripheral lymphopenia occurring at some time during a course of ALS treatment and persistent depletion of small lymphocytes in lymph node paracortical areas and splenic follicular periarteriolar zones. The thymic histology was generally well preserved. It is suggested that the relevant lesions reflect a rapid depletion of the pool of recirculating lymphocytes, possibly by a primary cytotoxic effect exerted on cells peripheral to lymphoid tissue. Other histologic features attendant to the administration of ALS were accounted for as consequences of immunization of ALS recipients to rabbit serum constituents or by the deleterious effects of antibodies directed against tissues other than lymphoid cells. PMID:5688077

MR images of mouse brain using clinical 3T MR scanner and 4CH-Mouse coil

NASA Astrophysics Data System (ADS)

Lim, Soo Mee; Park, Eun Mi; Lyoo, In Kyoon; Lee, Junghyun; Han, Bo Mi; Lee, Jeong Kyong; Lee, Su Bin

2015-07-01

Objectives: Although small-bore high-field magnets are useful for research in small rodent models,this technology, however, has not been easily accessible to most researchers. This current study, thus,tried to evaluate the usability of 4CH-Mouse coil (Philips Healthcare, Best, the Netherlands) forpreclinical investigations in clinical 3T MR scan environment. We evaluated the effects of ischemicpreconditioning (IP) in the mouse stroke model with clinical 3T MR scanner and 4CH-Mouse coil. Materials and Methods: Experiments were performed on male C57BL/6 mice that either received the IP or sham operation (control). Three different MR sequences including diffusion weighted images (DWI), T2-weighted images (T2WI), and fluid attenuated inversion recovery (FLAIR) were performed on the mouse brains following 24, 72 hours of middle cerebral artery occlusion (MCAO) and analyzed for infarct lesions. Results: The images showed that the IP-treated mouse brains had significantly smaller infarct volumes compared to the control group. Of the MR sequences employed, the T2WI showed the highest level of correlations with postmortem infarct volume measurements. Conclusions: The clinical 3T MR scanner turned out to have a solid potential as a practical tool for imaging small animal brains. MR sequences including DWI, T2WI, FLAIR were obtained with acceptable resolution and in a reasonable time constraint in evaluating a mouse stroke model brain.

Lipopolysaccharide-induced brain activation of the indoleamine 2,3-dioxygenase and depressive-like behavior are impaired in a mouse model of metabolic syndrome.

PubMed

Dinel, Anne-Laure; André, Caroline; Aubert, Agnès; Ferreira, Guillaume; Layé, Sophie; Castanon, Nathalie

2014-02-01

Although peripheral low-grade inflammation has been associated with a high incidence of mood symptoms in patients with metabolic syndrome (MetS), much less is known about the potential involvement of brain activation of cytokines in that context. Recently we showed in a mouse model of MetS, namely the db/db mice, an enhanced hippocampal inflammation associated with increased anxiety-like behavior (Dinel et al., 2011). However, depressive-like behavior was not affected in db/db mice. Based on the strong association between depressive-like behavior and cytokine-induced brain activation of indoleamine 2,3-dioxygenase (IDO), the enzyme that metabolizes tryptophan along the kynurenine pathway, these results may suggest an impairment of brain IDO activation in db/db mice. To test this hypothesis, we measured the ability of db/db mice and their healthy db/+ littermates to enhance brain IDO activity and depressive-like behavior after a systemic immune challenge with lipopolysaccharide (LPS). Here we show that LPS (5 μg/mouse) significantly increased depressive-like behavior (increased immobility time in a forced-swim test, FST) 24h after treatment in db/+ mice, but not in db/db mice. Interestingly, db/db mice also displayed after LPS treatment blunted increase of brain kynurenine/tryptophan ratio compared to their db/+ counterparts, despite enhanced induction of hippocampal cytokine expression (interleukin-1β, tumor necrosis factor-α). Moreover, this was associated with an impaired effect of LPS on hippocampal expression of the brain-derived neurotrophic factor (BDNF) that contributes to mood regulation, including under inflammatory conditions. Collectively, these data indicate that the rise in brain tryptophan catabolism and depressive-like behavior induced by innate immune system activation is impaired in db/db mice. These findings could have relevance in improving the management and treatment of inflammation-related complications in MetS. Copyright © 2013 Elsevier Ltd. All rights reserved.

Nutritional basis for colonization resistance by human commensal Escherichia coli strains HS and Nissle 1917 against E. coli O157:H7 in the mouse intestine.

PubMed

Maltby, Rosalie; Leatham-Jensen, Mary P; Gibson, Terri; Cohen, Paul S; Conway, Tyrrell

2013-01-01

Escherichia coli is a single species consisting of many biotypes, some of which are commensal colonizers of mammals and others that cause disease. Humans are colonized on average with five commensal biotypes, and it is widely thought that the commensals serve as a barrier to infection by pathogens. Previous studies showed that a combination of three pre-colonized commensal E. coli strains prevents colonization of E. coli O157:H7 in a mouse model (Leatham, et al., 2010, Infect Immun 77: 2876-7886). The commensal biotypes included E. coli HS, which is known to successfully colonize humans at high doses with no adverse effects, and E. coli Nissle 1917, a human commensal strain that is used in Europe as a preventative of traveler's diarrhea. We hypothesized that commensal biotypes could exert colonization resistance by consuming nutrients needed by E. coli O157:H7 to colonize, thus preventing this first step in infection. Here we report that to colonize streptomycin-treated mice E. coli HS consumes six of the twelve sugars tested and E. coli Nissle 1917 uses a complementary yet divergent set of seven sugars to colonize, thus establishing a nutritional basis for the ability of E. coli HS and Nissle 1917 to occupy distinct niches in the mouse intestine. Together these two commensals use the five sugars previously determined to be most important for colonization of E. coli EDL933, an O157:H7 strain. As predicted, the two commensals prevented E. coli EDL933 colonization. The results support a model in which invading pathogenic E. coli must compete with the gut microbiota to obtain the nutrients needed to colonize and establish infection; accordingly, the outcome of the challenge is determined by the aggregate capacity of the native microbiota to consume the nutrients required by the pathogen.

Strong conservation of inbred mouse strain microRNA loci but broad variation in brain microRNAs due to RNA editing and isomiR expression.

PubMed

Trontti, Kalevi; Väänänen, Juho; Sipilä, Tessa; Greco, Dario; Hovatta, Iiris

2018-05-01

Diversity in the structure and expression of microRNAs, important regulators of gene expression, arises from SNPs, duplications followed by divergence, production of isomiRs, and RNA editing. Inbred mouse strains and crosses using them are important reference populations for genetic mapping, and as models of human disease. We determined the nature and extent of interstrain miRNA variation by (i) identifying miRNA SNPs in whole-genome sequence data from 36 strains, and (ii) examining miRNA editing and expression in hippocampus (Hpc) and frontal cortex (FCx) of six strains, to facilitate the study of miRNAs in neurobehavioral phenotypes. miRNA loci were strongly conserved among the 36 strains, but even the highly conserved seed region contained 16 SNPs. In contrast, we identified RNA editing in 58.9% of miRNAs, including 11 consistent editing events in the seed region. We confirmed the functional significance of three conserved edits in the miR-379/410 cluster, demonstrating that edited miRNAs gained novel target mRNAs not recognized by the unedited miRNAs. We found significant interstrain differences in miRNA and isomiR expression: Of 779 miRNAs expressed in Hpc and 719 in FCx, 262 were differentially expressed (190 in Hpc, 126 in FCx, 54 in both). We also identified 32 novel miRNA candidates using miRNA prediction tools. Our studies provide the first comprehensive analysis of SNP, isomiR, and RNA editing variation in miRNA loci across inbred mouse strains, and a detailed catalog of expressed miRNAs in Hpc and FCx in six commonly used strains. These findings will facilitate the molecular analysis of neurological and behavioral phenotypes in this model organism. © 2018 Trontti et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Witnessing stressful events induces glutamatergic synapse pathway alterations and gene set enrichment of positive EPSP regulation within the VTA of adult mice: An ontology based approach

NASA Astrophysics Data System (ADS)

Brewer, Jacob S.

It is well known that exposure to severe stress increases the risk for developing mood disorders. Currently, the neurobiological and genetic mechanisms underlying the functional effects of psychological stress are poorly understood. Presenting a major obstacle to the study of psychological stress is the inability of current animal models of stress to distinguish between physical and psychological stressors. A novel paradigm recently developed by Warren et al., is able to tease apart the effects of physical and psychological stress in adult mice by allowing these mice to "witness," the social defeat of another mouse thus removing confounding variables associated with physical stressors. Using this 'witness' model of stress and RNA-Seq technology, the current study aims to study the genetic effects of psychological stress. After, witnessing the social defeat of another mouse, VTA tissue was extracted, sequenced, and analyzed for differential expression. Since genes often work together in complex networks, a pathway and gene ontology (GO) analysis was performed using data from the differential expression analysis. The pathway and GO analyzes revealed a perturbation of the glutamatergic synapse pathway and an enrichment of positive excitatory post-synaptic potential regulation. This is consistent with the excitatory synapse theory of depression. Together these findings demonstrate a dysregulation of the mesolimbic reward pathway at the gene level as a result of psychological stress potentially contributing to depressive like behaviors.

Mutagenicity testing with transgenic mice. Part I: Comparison with the mouse bone marrow micronucleus test

PubMed Central

Wahnschaffe, U; Bitsch, A; Kielhorn, J; Mangelsdorf, I

2005-01-01

As part of a larger literature study on transgenic animals in mutagenicity testing, test results from the transgenic mutagenicity assays (lacI model; commercially available as the Big Blue® mouse, and the lacZ model; commercially available as the Muta™Mouse), were compared with the results on the same substances in the more traditional mouse bone marrow micronucleus test. 39 substances were found which had been tested in the micronucleus assay and in the above transgenic mouse systems. Although, the transgenic animal mutation assay is not directly comparable with the micronucleus test, because different genetic endpoints are examined: chromosome aberration versus gene mutation, the results for the majority of substances were in agreement. Both test systems, the transgenic mouse assay and the mouse bone marrow micronucleus test, have advantages and they complement each other. However, the transgenic animal assay has some distinct advantages over the micronucleus test: it is not restricted to one target organ and detects systemic as well as local mutagenic effects. PMID:15655069

In vivo characterization of a bigenic fluorescent mouse model of Alzheimer's disease with neurodegeneration.

PubMed

Crowe, Sarah E; Ellis-Davies, Graham C R

2013-07-01

The loss of cognitive function in Alzheimer's disease (AD) patients is strongly correlated with the loss of neurons in various regions of the brain. We have created a new fluorescent bigenic mouse model of AD by crossing "H-line" yellow fluorescent protein (YFP) mice with the 5xFAD mouse model, which we call the 5XY mouse model. The 5xFAD mouse has been shown to have significant loss of L5 pyramidal neurons by 12 months of age. These neurons are transgenically labeled with YFP in the 5XY mouse, which enable longitudinal imaging of structural changes. In the 5XY mice, we observed an appearance of axonal dystrophies, with two distinct morphologies in the early stages of the disease progression. Simple swelling dystrophies are transient in nature and are not directly associated with amyloid plaques. Rosette dystrophies are more complex structures that remained stable throughout all imaging sessions, and always surrounded an amyloid plaque. Plaque growth was followed over 4 weeks, and significant growth was seen between weekly imaging sessions. In addition to axonal dystrophy appearance and plaque growth, we were able to follow spine stability in 4-month old 5XY mice, which revealed no significant loss of spines. 5XY mice also showed a striking shrinkage of the neocortex at older ages (12-14 months). The 5XY mouse model may be a valuable tool for studying specific events in the degeneration of the neocortex, and may suggest new avenues for therapeutic intervention. Copyright © 2013 Wiley Periodicals, Inc.

Altered Sleep and Affect in the Neurotensin Receptor 1 Knockout Mouse

PubMed Central

Fitzpatrick, Karrie; Winrow, Christopher J.; Gotter, Anthony L.; Millstein, Joshua; Arbuzova, Janna; Brunner, Joseph; Kasarskis, Andrew; Vitaterna, Martha H.; Renger, John J.; Turek, Fred W.

2012-01-01

Study Objective: Sleep and mood disorders have long been understood to have strong genetic components, and there is considerable comorbidity of sleep abnormalities and mood disorders, suggesting the involvement of common genetic pathways. Here, we examine a candidate gene implicated in the regulation of both sleep and affective behavior using a knockout mouse model. Design: Previously, we identified a quantitative trait locus (QTL) for REM sleep amount, REM sleep bout number, and wake amount in a genetically segregating population of mice. Here, we show that traits mapping to this QTL correlated with an expression QTL for neurotensin receptor 1 (Ntsr1), a receptor for neurotensin, a ligand known to be involved in several psychiatric disorders. We examined sleep as well as behaviors indicative of anxiety and depression in the NTSR1 knockout mouse. Measurements and Results: NTSR1 knockouts had a lower percentage of sleep time spent in REM sleep in the dark phase and a larger diurnal variation in REM sleep duration than wild types under baseline conditions. Following sleep deprivation, NTSR1 knockouts exhibited more wake and less NREM rebound sleep. NTSR1 knockouts also showed increased anxious and despair behaviors. Conclusions: Here we illustrate a link between expression of the Ntsr1 gene and sleep traits previously associated with a particular QTL. We also demonstrate a relationship between Ntsr1 and anxiety and despair behaviors. Given the considerable evidence that anxiety and depression are closely linked with abnormalities in sleep, the data presented here provide further evidence that neurotensin and Ntsr1 may be a component of a pathway involved in both sleep and mood disorders. Citation: Fitzpatrick K; Winrow CJ; Gotter AL; Millstein J; Arbuzova J; Brunner J; Kasarskis A; Vitaterna MH; Renger JJ; Turek FW. Altered sleep and affect in the neurotensin receptor 1 knockout mouse. SLEEP 2012;35(7):949-956. PMID:22754041

Technique Selectively Represses Immune System

MedlinePlus

... from attacking myelin in a mouse model of multiple sclerosis. Dr David Furness, Wellcome Images. All rights reserved ... devised a way to successfully treat symptoms resembling multiple sclerosis in a mouse model. With further development, the ...

Lipopolysaccharide-induced endotoxemia in corn oil-preloaded mice causes an extended course of lung injury and repair and pulmonary fibrosis: A translational mouse model of acute respiratory distress syndrome.

PubMed

Wu, Chaomin; Evans, Colin E; Dai, Zhiyu; Huang, Xiaojia; Zhang, Xianming; Jin, Hua; Hu, Guochang; Song, Yuanlin; Zhao, You-Yang

2017-01-01

Acute respiratory distress syndrome (ARDS) is characterized by acute hypoxemia respiratory failure, bilateral pulmonary infiltrates, and pulmonary edema of non-cardiac origin. Effective treatments for ARDS patients may arise from experimental studies with translational mouse models of this disease that aim to delineate the mechanisms underlying the disease pathogenesis. Mouse models of ARDS, however, can be limited by their rapid progression from injured to recovery state, which is in contrast to the course of ARDS in humans. Furthermore, current mouse models of ARDS do not recapitulate certain prominent aspects of the pathogenesis of ARDS in humans. In this study, we developed an improved endotoxemic mouse model of ARDS resembling many features of clinical ARDS including extended courses of injury and recovery as well as development of fibrosis following i.p. injection of lipopolysaccharide (LPS) to corn oil-preloaded mice. Compared with mice receiving LPS alone, those receiving corn oil and LPS exhibited extended course of lung injury and repair that occurred over a period of >2 weeks instead of 3-5days. Importantly, LPS challenge of corn oil-preloaded mice resulted in pulmonary fibrosis during the repair phase as often seen in ARDS patients. In summary, this simple novel mouse model of ARDS could represent a valuable experimental tool to elucidate mechanisms that regulate lung injury and repair in ARDS patients.

Endometrial apoptosis and neutrophil infiltration during menstruation exhibits spatial and temporal dynamics that are recapitulated in a mouse model.

PubMed

Armstrong, Gregory M; Maybin, Jacqueline A; Murray, Alison A; Nicol, Moira; Walker, Catherine; Saunders, Philippa T K; Rossi, Adriano G; Critchley, Hilary O D

2017-12-12

Menstruation is characterised by synchronous shedding and restoration of tissue integrity. An in vivo model of menstruation is required to investigate mechanisms responsible for regulation of menstrual physiology and to investigate common pathologies such as heavy menstrual bleeding (HMB). We hypothesised that our mouse model of simulated menstruation would recapitulate the spatial and temporal changes in the inflammatory microenvironment of human menses. Three regulatory events were investigated: cell death (apoptosis), neutrophil influx and cytokine/chemokine expression. Well-characterised endometrial tissues from women were compared with uteri from a mouse model (tissue recovered 0, 4, 8, 24 and 48 h after removal of a progesterone-secreting pellet). Immunohistochemistry for cleaved caspase-3 (CC3) revealed significantly increased staining in human endometrium from late secretory and menstrual phases. In mice, CC3 was significantly increased at 8 and 24 h post-progesterone-withdrawal. Elastase + human neutrophils were maximal during menstruation; Ly6G + mouse neutrophils were maximal at 24 h. Human endometrial and mouse uterine cytokine/chemokine mRNA concentrations were significantly increased during menstrual phase and 24 h post-progesterone-withdrawal respectively. Data from dated human samples revealed time-dependent changes in endometrial apoptosis preceding neutrophil influx and cytokine/chemokine induction during active menstruation. These dynamic changes were recapitulated in the mouse model of menstruation, validating its use in menstrual research.

The STR/ort mouse model of spontaneous osteoarthritis - an update.

PubMed

Staines, K A; Poulet, B; Wentworth, D N; Pitsillides, A A

2017-06-01

Osteoarthritis is a degenerative joint disease and a world-wide healthcare burden. Characterized by cartilage degradation, subchondral bone thickening and osteophyte formation, osteoarthritis inflicts much pain and suffering, for which there are currently no disease-modifying treatments available. Mouse models of osteoarthritis are proving critical in advancing our understanding of the underpinning molecular mechanisms. The STR/ort mouse is a well-recognized model which develops a natural form of osteoarthritis very similar to the human disease. In this Review we discuss the use of the STR/ort mouse in understanding this multifactorial disease with an emphasis on recent advances in its genetics and its bone, endochondral and immune phenotypes. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Mouse brain magnetic resonance microscopy: Applications in Alzheimer disease.

PubMed

Lin, Lan; Fu, Zhenrong; Xu, Xiaoting; Wu, Shuicai

2015-05-01

Over the past two decades, various Alzheimer's disease (AD) trangenetic mice models harboring genes with mutation known to cause familial AD have been created. Today, high-resolution magnetic resonance microscopy (MRM) technology is being widely used in the study of AD mouse models. It has greatly facilitated and advanced our knowledge of AD. In this review, most of the attention is paid to fundamental of MRM, the construction of standard mouse MRM brain template and atlas, the detection of amyloid plaques, following up on brain atrophy and the future applications of MRM in transgenic AD mice. It is believed that future testing of potential drugs in mouse models with MRM will greatly improve the predictability of drug effect in preclinical trials. © 2015 Wiley Periodicals, Inc.

Better Utilization of Mouse Models of Neurodegenerative Diseases in Preclinical Studies: From the Bench to the Clinic.

PubMed

Janus, Christopher; Hernandez, Carolina; deLelys, Victoria; Roder, Hanno; Welzl, Hans

2016-01-01

The major symptom of Alzheimer's disease is dementia progressing with age. Its clinical diagnosis is preceded by a long prodromal period of brain pathology that encompasses both formation of extracellular amyloid and intraneuronal tau deposits in the brain and widespread neuronal death. At present, familial cases of dementia provide the most promising foundation for modeling neurodegenerative tauopathies, a group of heterogeneous disorders characterized by prominent intracellular accumulation of hyperphosphorylated tau protein. In this chapter, we describe major behavioral hallmarks of tauopathies, briefly outline the genetics underlying familial cases, and discuss the arising implications for modeling the disease in transgenic mouse systems. The selection of tests performed to evaluate the phenotype of a model should be guided by the key behavioral hallmarks that characterize human disorder and their homology to mouse cognitive systems. We attempt to provide general guidelines and establish criteria for modeling dementia in a mouse; however, interpretations of obtained results should avoid a reductionist "one gene, one disease" explanation of model characteristics. Rather, the focus should be directed to the question of how the mouse genome can cope with the over-expression of the protein coded by transgene(s). While each model is valuable within its own constraints and the experiments performed are guided by specific hypotheses, we seek to expand upon their methodology by offering guidance spanning from issues of mouse husbandry to choices of behavioral tests and routes of drug administration that might increase the external validity of studies and consequently optimize the translational aspect of preclinical research.

Rodent models of congenital and hereditary cataract in man.

PubMed

Tripathi, B J; Tripathi, R C; Borisuth, N S; Dhaliwal, R; Dhaliwal, D

1991-01-01

Because the organogenesis and physiology of the lens are essentially similar in various mammals, an understanding of the etiology and pathogenesis of the formation of cataract in an animal model will enhance our knowledge of cataractogenesis in man. In this review, we summarize the background, etiology, and pathogenesis of cataracts that occur in rodents. The main advantages of using rodent mutants include the well-researched genetics of the animals and the comparative ease of breeding of large litters. Numerous rodent models of congenital and hereditary cataracts have been studied extensively. In mice, the models include the Cts strain, Fraser mouse, lens opacity gene (Lop) strain, Lop-2 and Lop-3 strains, Philly mouse, Nakano mouse, Nop strain, Deer mouse, Emory mouse, Swiss Webster strain, Balb/c-nct/nct mouse, and SAM-R/3 strain. The rat models include BUdR, ICR, Sprague-Dawley, and Wistar rats, the spontaneously hypertensive rat (SHR), the John Rapp inbred strain of Dahl salt-sensitive rat, as well as WBN/Kob, Royal College of Surgeons (RCS), and Brown-Norway rats. Other proposed models for the study of hereditary cataract include the degu and the guinea pig. Because of the ease of making clinical observations in vivo and the subsequent availability of the intact lens for laboratory analyses at different stages of cataract formation, these animals provide excellent models for clinicopathologic correlations, for monitoring of the natural history of the aging process and of metabolic defects, as well as for investigations on the effect of cataract-modulating agents and drugs, including the prospect of gene therapy.

Mouse Genome Informatics (MGI) Is the International Resource for Information on the Laboratory Mouse.

PubMed

Law, MeiYee; Shaw, David R

2018-01-01

Mouse Genome Informatics (MGI, http://www.informatics.jax.org/ ) web resources provide free access to meticulously curated information about the laboratory mouse. MGI's primary goal is to help researchers investigate the genetic foundations of human diseases by translating information from mouse phenotypes and disease models studies to human systems. MGI provides comprehensive phenotypes for over 50,000 mutant alleles in mice and provides experimental model descriptions for over 1500 human diseases. Curated data from scientific publications are integrated with those from high-throughput phenotyping and gene expression centers. Data are standardized using defined, hierarchical vocabularies such as the Mammalian Phenotype (MP) Ontology, Mouse Developmental Anatomy and the Gene Ontologies (GO). This chapter introduces you to Gene and Allele Detail pages and provides step-by-step instructions for simple searches and those that take advantage of the breadth of MGI data integration.

Differential biological effects of dehydroepiandrosterone (DHEA) between mouse (B16F10) and human melanoma (BLM) cell lines.

PubMed

Joshi, Kumud; Hassan, Sherif S; Ramaraj, Pandurangan

2017-01-01

Dehydroepiandrosterone (DHEA) is a weak androgen and had been shown to have anti-cancer, anti-adipogenic and anti-inflammatory effects on mouse and other rodent models, but not on humans, suggesting a systemic level difference between mouse and human. Our previous study on DHEA biological functions involving a variety of cell lines, suggested that the functional differences between mouse and human existed even at the cellular level. Hence, using mouse and human melanoma cell models, in-vitro effects of DHEA on cell growth, mechanism of cell death and mechanism of DHEA action were studied. Results indicated a differential biological effects of DHEA between mouse and human melanoma cell lines. These in-vitro studies also suggested that the differential biological effects observed between these two cell lines could be due to the difference in the way DHEA was processed or metabolized inside the cell.

Current State of Animal (Mouse) Modeling in Melanoma Research.

PubMed

Kuzu, Omer F; Nguyen, Felix D; Noory, Mohammad A; Sharma, Arati

2015-01-01

Despite the considerable progress in understanding the biology of human cancer and technological advancement in drug discovery, treatment failure remains an inevitable outcome for most cancer patients with advanced diseases, including melanoma. Despite FDA-approved BRAF-targeted therapies for advanced stage melanoma showed a great deal of promise, development of rapid resistance limits the success. Hence, the overall success rate of melanoma therapy still remains to be one of the worst compared to other malignancies. Advancement of next-generation sequencing technology allowed better identification of alterations that trigger melanoma development. As development of successful therapies strongly depends on clinically relevant preclinical models, together with the new findings, more advanced melanoma models have been generated. In this article, besides traditional mouse models of melanoma, we will discuss recent ones, such as patient-derived tumor xenografts, topically inducible BRAF mouse model and RCAS/TVA-based model, and their advantages as well as limitations. Although mouse models of melanoma are often criticized as poor predictors of whether an experimental drug would be an effective treatment, development of new and more relevant models could circumvent this problem in the near future.

Identification of novel mRNAs and lncRNAs associated with mouse experimental colitis and human inflammatory bowel disease.

PubMed

Rankin, Carl Robert; Theodorou, Evangelos; Law, Ivy Ka Man; Rowe, Lorraine; Kokkotou, Efi; Pekow, Joel; Wang, Jiafang; Martin, Martin G; Pothoulakis, Charalabos; Padua, David Miguel

2018-06-28

Inflammatory bowel disease (IBD) is a complex disorder that is associated with significant morbidity. While many recent advances have been made with new diagnostic and therapeutic tools, a deeper understanding of its basic pathophysiology is needed to continue this trend towards improving treatments. By utilizing an unbiased, high-throughput transcriptomic analysis of two well-established mouse models of colitis, we set out to uncover novel coding and non-coding RNAs that are differentially expressed in the setting of colonic inflammation. RNA-seq analysis was performed using colonic tissue from two mouse models of colitis, a dextran sodium sulfate induced model and a genetic-induced model in mice lacking IL-10. We identified 81 coding RNAs that were commonly altered in both experimental models. Of these coding RNAs, 12 of the human orthologs were differentially expressed in a transcriptomic analysis of IBD patients. Interestingly, 5 of the 12 of human differentially expressed genes have not been previously identified as IBD-associated genes, including ubiquitin D. Our analysis also identified 15 non-coding RNAs that were differentially expressed in either mouse model. Surprisingly, only three non-coding RNAs were commonly dysregulated in both of these models. The discovery of these new coding and non-coding RNAs expands our transcriptional knowledge of mouse models of IBD and offers additional targets to deepen our understanding of the pathophysiology of IBD.

Circulating levels of IGF-1 directly regulate bone growth and density

PubMed Central

Yakar, Shoshana; Rosen, Clifford J.; Beamer, Wesley G.; Ackert-Bicknell, Cheryl L.; Wu, Yiping; Liu, Jun-Li; Ooi, Guck T.; Setser, Jennifer; Frystyk, Jan; Boisclair, Yves R.; LeRoith, Derek

2002-01-01

IGF-1 is a growth-promoting polypeptide that is essential for normal growth and development. In serum, the majority of the IGFs exist in a 150-kDa complex including the IGF molecule, IGF binding protein 3 (IGFBP-3), and the acid labile subunit (ALS). This complex prolongs the half-life of serum IGFs and facilitates their endocrine actions. Liver IGF-1–deficient (LID) mice and ALS knockout (ALSKO) mice exhibited relatively normal growth and development, despite having 75% and 65% reductions in serum IGF-1 levels, respectively. Double gene disrupted mice were generated by crossing LID+ALSKO mice. These mice exhibited further reductions in serum IGF-1 levels and a significant reduction in linear growth. The proximal growth plates of the tibiae of LID+ALSKO mice were smaller in total height as well as in the height of the proliferative and hypertrophic zones of chondrocytes. There was also a 10% decrease in bone mineral density and a greater than 35% decrease in periosteal circumference and cortical thickness in these mice. IGF-1 treatment for 4 weeks restored the total height of the proximal growth plate of the tibia. Thus, the double gene disruption LID+ALSKO mouse model demonstrates that a threshold concentration of circulating IGF-1 is necessary for normal bone growth and suggests that IGF-1, IGFBP-3, and ALS play a prominent role in the pathophysiology of osteoporosis. PMID:12235108

A Dynamic Simulation of Musculoskeletal Function in the Mouse Hindlimb During Trotting Locomotion

PubMed Central

Charles, James P.; Cappellari, Ornella; Hutchinson, John R.

2018-01-01

Mice are often used as animal models of various human neuromuscular diseases, and analysis of these models often requires detailed gait analysis. However, little is known of the dynamics of the mouse musculoskeletal system during locomotion. In this study, we used computer optimization procedures to create a simulation of trotting in a mouse, using a previously developed mouse hindlimb musculoskeletal model in conjunction with new experimental data, allowing muscle forces, activation patterns, and levels of mechanical work to be estimated. Analyzing musculotendon unit (MTU) mechanical work throughout the stride allowed a deeper understanding of their respective functions, with the rectus femoris MTU dominating the generation of positive and negative mechanical work during the swing and stance phases. This analysis also tested previous functional inferences of the mouse hindlimb made from anatomical data alone, such as the existence of a proximo-distal gradient of muscle function, thought to reflect adaptations for energy-efficient locomotion. The results do not strongly support the presence of this gradient within the mouse musculoskeletal system, particularly given relatively high negative net work output from the ankle plantarflexor MTUs, although more detailed simulations could test this further. This modeling analysis lays a foundation for future studies of the control of vertebrate movement through the development of neuromechanical simulations. PMID:29868576

Additive interactions between 1-methyl-1,2,3,4-tetrahydroisoquinoline and clobazam in the mouse maximal electroshock-induced tonic seizure model--an isobolographic analysis for parallel dose-response relationship curves.

PubMed

Andres-Mach, Marta; Haratym-Maj, Agnieszka; Zagaja, Mirosław; Luszczki, Jarogniew J

2014-01-01

The aim of this study was to characterize the anticonvulsant effect of 1-methyl-1,2,3,4-tetrahydroisoquinoline (1-MeTHIQ) in combination with clobazam (CLB) in the mouse maximal electroshock-induced seizure (MES) model. The anticonvulsant interaction profile between 1-MeTHIQ and CLB in the mouse MES model was determined using an isobolographic analysis for parallel dose-response relationship curves. Electroconvulsions were produced in albino Swiss mice by a current (sine wave, 25 mA, 500 V, 50 Hz, 0.2-second stimulus duration) delivered via auricular electrodes by a Hugo Sachs generator. There was an additive effect of the combination of 1-MeTHIQ with CLB (at the fixed ratios of 1:3, 1:1 and 3:1) in the mouse MES-induced tonic seizure model. The additive interaction of the combination of 1-MeTHIQ with CLB (at fixed-ratios of 1:3, 1:1 and 3:1) in the mouse MES model seems to be pharmacodynamic in nature and worth of considering in further clinical practice. © 2014 S. Karger AG, Basel.

Improvements and Limitations of Humanized Mouse Models for HIV Research: NIH/NIAID “Meet the Experts” 2015 Workshop Summary

PubMed Central

Akkina, Ramesh; Allam, Atef; Balazs, Alejandro B.; Blankson, Joel N.; Burnett, John C.; Casares, Sofia; Garcia, J. Victor; Hasenkrug, Kim J.; Kitchen, Scott G.; Klein, Florian; Kumar, Priti; Luster, Andrew D.; Poluektova, Larisa Y.; Rao, Mangala; Shultz, Leonard D.; Zack, Jerome A.

2016-01-01

Abstract The number of humanized mouse models for the human immunodeficiency virus (HIV)/acquired immunodeficiency syndrome (AIDS) and other infectious diseases has expanded rapidly over the past 8 years. Highly immunodeficient mouse strains, such as NOD/SCID/gamma chainnull (NSG, NOG), support better human hematopoietic cell engraftment. Another improvement is the derivation of highly immunodeficient mice, transgenic with human leukocyte antigens (HLAs) and cytokines that supported development of HLA-restricted human T cells and heightened human myeloid cell engraftment. Humanized mice are also used to study the HIV reservoir using new imaging techniques. Despite these advances, there are still limitations in HIV immune responses and deficits in lymphoid structures in these models in addition to xenogeneic graft-versus-host responses. To understand and disseminate the improvements and limitations of humanized mouse models to the scientific community, the NIH sponsored and convened a meeting on April 15, 2015 to discuss the state of knowledge concerning these questions and best practices for selecting a humanized mouse model for a particular scientific investigation. This report summarizes the findings of the NIH meeting. PMID:26670361

Behavioral assays with mouse models of Alzheimer’s disease: practical considerations and guidelines

PubMed Central

Puzzo, Daniela; Lee, Linda; Palmeri, Agostino; Calabrese, Giorgio; Arancio, Ottavio

2014-01-01

In Alzheimer’s disease (AD) basic research and drug discovery, mouse models are essential resources for uncovering biological mechanisms, validating molecular targets and screening potential compounds. Both transgenic and non-genetically modified mouse models enable access to different types of AD-like pathology in vivo. Although there is a wealth of genetic and biochemical studies on proposed AD pathogenic pathways, as a disease that centrally features cognitive failure, the ultimate readout for any interventions should be measures of learning and memory. This is particularly important given the lack of knowledge on disease etiology – assessment by cognitive assays offers the advantage of targeting relevant memory systems without requiring assumptions about pathogenesis. A multitude of behavioral assays are available for assessing cognitive functioning in mouse models, including ones specific for hippocampal-dependent learning and memory. Here we review the basics of available transgenic and non-transgenic AD mouse models and detail three well-established behavioral tasks commonly used for testing hippocampal-dependent cognition in mice – contextual fear conditioning, radial arm water maze and Morris water maze. In particular, we discuss the practical considerations, requirements and caveats of these behavioral testing paradigms. PMID:24462904

Icotinib inhibits EGFR signaling and alleviates psoriasis-like symptoms in animal models.

PubMed

Tan, Fenlai; Yang, Guiqun; Wang, Yanping; Chen, Haibo; Yu, Bo; Li, He; Guo, Jing; Huang, Xiaoling; Deng, Yifang; Yu, Pengxia; Ding, Lieming

2018-02-01

To investigate the effects of icotinib hydrochloride and a derivative cream on epidermal growth factor receptor (EGFR) signaling and within animal psoriasis models, respectively. The effect of icotinib on EGFR signaling was examined in HaCaT cells, while its effect on angiogenesis was tested in chick embryo chorioallantoic membranes (CAM). The effectiveness of icotinib in treating psoriasis was tested in three psoriasis models, including diethylstilbestrol-treated mouse vaginal epithelial cells, mouse tail granular cell layer formation, and propranolol-induced psoriasis-like features in guinea pig ear skin. Icotinib treatment blocked EGFR signaling and reduced HaCaT cell viability as well as suppressed CAM angiogenesis. Topical application of icotinib ameliorated psoriasis-like histological characteristics in mouse and guinea pig psoriasis models. Icotinib also significantly inhibited mouse vaginal epithelium mitosis, promoted mouse tail squamous epidermal granular layer formation, and reduced the thickness of the horny layer in propranolol treated auricular dorsal surface of guinea pig. We conclude that icotinib can effectively inhibit psoriasis in animal models. Future clinical studies should be conducted to explore the therapeutic effects of icotinb in humans. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Pathogenicity of swine influenza viruses possessing an avian or swine-origin PB2 polymerase gene evaluated in mouse and pig models.

PubMed

Ma, Wenjun; Lager, Kelly M; Li, Xi; Janke, Bruce H; Mosier, Derek A; Painter, Laura E; Ulery, Eva S; Ma, Jingqun; Lekcharoensuk, Porntippa; Webby, Richard J; Richt, Jürgen A

2011-02-05

PB2 627K is a determinant of influenza host range and contributes to the pathogenicity of human-, avian-, and mouse-adapted influenza viruses in the mouse model. Here we used mouse and pig models to analyze the contribution of a swine-origin and avian-origin PB2 carrying either 627K or 627E in the background of the classical swine H1N1 (A/Swine/Iowa/15/30; 1930) virus. The results showed PB2 627K is crucial for virulence in the mouse model, independent of whether PB2 is derived from an avian or swine influenza virus (SIV). In the pig model, PB2 627E decreases pathogenicity of the classical 1930 SIV when it contains the swine-origin PB2, but not when it possesses the avian-origin PB2. Our study suggests the pathogenicity of SIVs with different PB2 genes and mutation of codon 627 in mice does not correlate with the pathogenicity of the same SIVs in the natural host, the pig. Copyright © 2010 Elsevier Inc. All rights reserved.

Genetic correlational analysis reveals no association between MPP+ and the severity of striatal dopaminergic damage following MPTP treatment in BXD mouse strains.

PubMed

Jones, Byron C; O'Callaghan, James P; Lu, Lu; Williams, Robert W; Alam, Gelareh; Miller, Diane B

2014-01-01

1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) is a pro-neurotoxicant that must be metabolized to 1-methyl-4-phenylpyridinium (MPP(+)) and taken up into striatal dopaminergic neurons to produce neurodegeneration. Recently, we showed wide genetic variability in MPTP-associated neuronal damage in a panel of recombinant inbred mouse strains. Here we examined the amount of MPP(+) produced in the striatum in the same strains of inbred BXD mice. This allowed us to determine if the differences in the dopaminergic neurotoxicity and associated astrogliosis among the BXD mouse strains were due to differential metabolism of MPTP to MPP(+). Using the same BXD mouse strains examined previously (Jones et al., 2013) we found that the extent of the striatal damage produced following MPTP treatment is not correlated quantitatively with the production of MPP(+) in the striatum. Our findings also extend those of others regarding strain differences in MPTP-induced dopaminergic neurotoxicity. Importantly, our finding suggests that additional factors influence the neurodegenerative response other than the presence and amount of the toxicant at the target site. Published by Elsevier Inc.

The Peptide Near the C Terminus Regulates Receptor CAR Nuclear Translocation Induced by Xenochemicals in Mouse Liver

PubMed Central

Zelko, Igor; Sueyoshi, Tatsuya; Kawamoto, Takeshi; Moore, Rick; Negishi, Masahiko

2001-01-01

In response to phenobarbital (PB) and other PB-type inducers, the nuclear receptor CAR translocates to the mouse liver nucleus (T. Kawamoto et al., Mol. Cell. Biol. 19:6318–6322, 1999). To define the translocation mechanism, fluorescent protein-tagged human CAR (hCAR) was expressed in the mouse livers using the in situ DNA injection and gene delivery systems. As in the wild-type hCAR, the truncated receptor lacking the C-terminal 10 residues (i.e., AF2 domain) translocated to the nucleus, indicating that the PB-inducible translocation is AF2 independent. Deletion of the 30 C-terminal residues abolished the receptor translocation, and subsequent site-directed mutagenesis delineated the PB-inducible translocation activity of the receptor to the peptide L313GLL316AEL319. Ala mutations of Leu313, Leu316, or Leu319 abrogated the translocation of CAR in the livers, while those of Leu312 or Leu315 did not affect the nuclear translocation. The leucine-rich peptide dictates the nuclear translocation of hCAR in response to various PB-type inducers and appears to be conserved in the mouse and rat receptors. PMID:11283262

Effects of the EVCAM chemical validation library on differentiation using marker gene expression in lmouse embryonic stem cells

EPA Science Inventory

The adherent cell differentiation and cytotoxicity (ACDC) assay was used to profile the effects of the ECVAM EST validation chemical library (19 compounds) on J1 mouse embryonic stem cells (mESC). PCR-based TaqMan Low Density Arrays (TLDA) provided a high-content assessment of al...

Aurora B/C in Meiosis: Correct Me If I'm Right.

PubMed

Dumont, Julien

2015-06-08

In this issue of Developmental Cell, Yoshida et al. (2015) report that during meiosis I in mouse oocytes, the kinase Aurora B/C continuously destabilizes chromosome attachments to spindle microtubules, which potentially provides an explanation for the notably high error rate of chromosome segregation in mammalian oocytes. Copyright © 2015 Elsevier Inc. All rights reserved.

A mouse following in the footsteps of human prehistory.

PubMed

Vohr, Samuel H; Green, Richard E

2013-02-14

One of the strongest signals of positive selection in humans surrounds the V370A variant of Ectodysplasin A receptor (EDAR). However, its phenotypic consequences and impetus for selection are not well understood. Kamberov et al. nail down when it originated and, using transgenic mice, delineate its phenotypic impacts. Copyright © 2013 Elsevier Inc. All rights reserved.

An Immunocompetent Mouse Model of Zika Virus Infection.

PubMed

Gorman, Matthew J; Caine, Elizabeth A; Zaitsev, Konstantin; Begley, Matthew C; Weger-Lucarelli, James; Uccellini, Melissa B; Tripathi, Shashank; Morrison, Juliet; Yount, Boyd L; Dinnon, Kenneth H; Rückert, Claudia; Young, Michael C; Zhu, Zhe; Robertson, Shelly J; McNally, Kristin L; Ye, Jing; Cao, Bin; Mysorekar, Indira U; Ebel, Gregory D; Baric, Ralph S; Best, Sonja M; Artyomov, Maxim N; Garcia-Sastre, Adolfo; Diamond, Michael S

2018-05-09

Progress toward understanding Zika virus (ZIKV) pathogenesis is hindered by lack of immunocompetent small animal models, in part because ZIKV fails to effectively antagonize Stat2-dependent interferon (IFN) responses in mice. To address this limitation, we first passaged an African ZIKV strain (ZIKV-Dak-41525) through Rag1 -/- mice to obtain a mouse-adapted virus (ZIKV-Dak-MA) that was more virulent than ZIKV-Dak-41525 in mice treated with an anti-Ifnar1 antibody. A G18R substitution in NS4B was the genetic basis for the increased replication, and resulted in decreased IFN-β production, diminished IFN-stimulated gene expression, and the greater brain infection observed with ZIKV-Dak-MA. To generate a fully immunocompetent mouse model of ZIKV infection, human STAT2 was introduced into the mouse Stat2 locus (hSTAT2 KI). Subcutaneous inoculation of pregnant hSTAT2 KI mice with ZIKV-Dak-MA resulted in spread to the placenta and fetal brain. An immunocompetent mouse model of ZIKV infection may prove valuable for evaluating countermeasures to limit disease. Copyright © 2018 Elsevier Inc. All rights reserved.

Histologic scoring of gastritis and gastric cancer in mouse models.

PubMed

Rogers, Arlin B

2012-01-01

Histopathology is a defining endpoint in mouse models of experimental gastritis and gastric adenocarcinoma. Presented here is an overview of the histology of gastritis and gastric cancer in mice experimentally infected with Helicobacter pylori or H. felis. A modular histopathologic scoring scheme is provided that incorporates relevant disease-associated changes. Whereas the guide uses Helicobacter infection as the prototype challenge, features may be applied to chemical and genetically engineered mouse models of stomach cancer as well. Specific criteria included in the combined gastric histologic activity index (HAI) include inflammation, epithelial defects, oxyntic atrophy, hyperplasia, pseudopyloric metaplasia, and dysplasia or neoplasia. Representative photomicrographs accompany descriptions for each lesion grade. Differentiation of genuine tumor invasion from pseudoinvasion is highlighted. A brief comparison of normal rodent versus human stomach anatomy and physiology is accompanied by an introduction to mouse-specific lesions including mucous metaplasia and eosinophilic droplets (hyalinosis). In conjunction with qualified pathology support, this guide is intended to assist research scientists, postdoctoral fellows, graduate students, and medical professionals from affiliated disciplines in the interpretation and histologic grading of chronic gastritis and gastric carcinoma in mouse models.

Astonishing advances in mouse genetic tools for biomedical research.

PubMed

Kaczmarczyk, Lech; Jackson, Walker S

2015-01-01

The humble house mouse has long been a workhorse model system in biomedical research. The technology for introducing site-specific genome modifications led to Nobel Prizes for its pioneers and opened a new era of mouse genetics. However, this technology was very time-consuming and technically demanding. As a result, many investigators continued to employ easier genome manipulation methods, though resulting models can suffer from overlooked or underestimated consequences. Another breakthrough, invaluable for the molecular dissection of disease mechanisms, was the invention of high-throughput methods to measure the expression of a plethora of genes in parallel. However, the use of samples containing material from multiple cell types could obfuscate data, and thus interpretations. In this review we highlight some important issues in experimental approaches using mouse models for biomedical research. We then discuss recent technological advances in mouse genetics that are revolutionising human disease research. Mouse genomes are now easily manipulated at precise locations thanks to guided endonucleases, such as transcription activator-like effector nucleases (TALENs) or the CRISPR/Cas9 system, both also having the potential to turn the dream of human gene therapy into reality. Newly developed methods of cell type-specific isolation of transcriptomes from crude tissue homogenates, followed by detection with next generation sequencing (NGS), are vastly improving gene regulation studies. Taken together, these amazing tools simplify the creation of much more accurate mouse models of human disease, and enable the extraction of hitherto unobtainable data.

Mutational landscape of a chemically-induced mouse model of liver cancer.

PubMed

Connor, Frances; Rayner, Tim F; Aitken, Sarah J; Feig, Christine; Lukk, Margus; Santoyo-Lopez, Javier; Odom, Duncan T

2018-06-26

Carcinogen-induced mouse models of liver cancer are used extensively to study pathogenesis of the disease and have a critical role in validating candidate therapeutics. These models can recapitulate molecular and histological features of human disease. However, it is not known if the genomic alterations driving these mouse tumour genomes are comparable to those found in human tumours. Here, we provide a detailed genomic characterisation of tumours from a commonly used mouse model of hepatocellular carcinoma (HCC). We analysed whole exome sequences of liver tumours arising in mice exposed to diethylnitrosamine (DEN). DEN-initiated tumours had a high, uniform number of somatic single nucleotide variants (SNVs), with few insertions, deletions or copy number alterations, consistent with the known genotoxic action of DEN. Exposure of hepatocytes to DEN left a reproducible mutational imprint in resulting tumour exomes which we could computationally reconstruct using six known COSMIC mutational signatures. The tumours carried a high diversity of low-incidence, non-synonymous point mutations in many oncogenes and tumour suppressors, reflecting the stochastic introduction of SNVs into the hepatocyte genome by the carcinogen. We identified four recurrently mutated genes that were putative oncogenic drivers of HCC in this model. Every neoplasm carried activating hotspot mutations either in codon 61 of Hras, in codon 584 of Braf or in codon 254 of Egfr. Truncating mutations of Apc occurred in 21% of neoplasms, which were exclusively carcinomas supporting a role for deregulation of Wnt/β-catenin signalling in cancer progression. Our study provides detailed insight into the mutational landscape of tumours arising in a commonly-used carcinogen model of HCC, facilitating the future use of this model to understand the human disease. Mouse models are widely used to study the biology of cancer and to test potential therapies. Here, we have described the mutational landscape of tumours arising in a carcinogen-induced mouse model of liver cancer. Since cancer is a disease caused by genomic alterations, information about the patterns and types of mutations in the tumours in this mouse model should facilitate its use to study human liver cancer. Copyright © 2018 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Using a Novel Transgenic Mouse Model to Study c-Myc Oncogenic Pathway in Castration Resistance and Chemoresistance of Prostate Cancer

DTIC Science & Technology

2017-12-01

AWARD NUMBER: W81XWH-13-1-0162 TITLE: Using a Novel Transgenic Mouse Model to Study c-Myc Oncogenic Pathway in Castration Resistance and...DATES COVERED 15Sept2013 - 14Sept2017 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Using a Novel Transgenic Mouse Model to Study c-Myc Oncogenic...for concisely studying castration response and CRPC. However, most mice never developed significant tumors. Here, we showed that ablation of p53 in this

Mouse Models for Drug Discovery. Can New Tools and Technology Improve Translational Power?

PubMed Central

Zuberi, Aamir; Lutz, Cathleen

2016-01-01

Abstract The use of mouse models in biomedical research and preclinical drug evaluation is on the rise. The advent of new molecular genome-altering technologies such as CRISPR/Cas9 allows for genetic mutations to be introduced into the germ line of a mouse faster and less expensively than previous methods. In addition, the rapid progress in the development and use of somatic transgenesis using viral vectors, as well as manipulations of gene expression with siRNAs and antisense oligonucleotides, allow for even greater exploration into genomics and systems biology. These technological advances come at a time when cost reductions in genome sequencing have led to the identification of pathogenic mutations in patient populations, providing unprecedented opportunities in the use of mice to model human disease. The ease of genetic engineering in mice also offers a potential paradigm shift in resource sharing and the speed by which models are made available in the public domain. Predictively, the knowledge alone that a model can be quickly remade will provide relief to resources encumbered by licensing and Material Transfer Agreements. For decades, mouse strains have provided an exquisite experimental tool to study the pathophysiology of the disease and assess therapeutic options in a genetically defined system. However, a major limitation of the mouse has been the limited genetic diversity associated with common laboratory mice. This has been overcome with the recent development of the Collaborative Cross and Diversity Outbred mice. These strains provide new tools capable of replicating genetic diversity to that approaching the diversity found in human populations. The Collaborative Cross and Diversity Outbred strains thus provide a means to observe and characterize toxicity or efficacy of new therapeutic drugs for a given population. The combination of traditional and contemporary mouse genome editing tools, along with the addition of genetic diversity in new modeling systems, are synergistic and serve to make the mouse a better model for biomedical research, enhancing the potential for preclinical drug discovery and personalized medicine. PMID:28053071

Genetic Biomarkers for ALS Disease in Transgenic SOD1G93A Mice

PubMed Central

Calvo, Ana C.; Manzano, Raquel; Atencia-Cibreiro, Gabriela; Oliván, Sara; Muñoz, María J.; Zaragoza, Pilar; Cordero-Vázquez, Pilar; Esteban-Pérez, Jesús; García-Redondo, Alberto; Osta, Rosario

2012-01-01

The pathophysiological mechanisms of both familial and sporadic Amyotrophic Lateral Sclerosis (ALS) are unknown, although growing evidence suggests that skeletal muscle tissue is a primary target of ALS toxicity. Skeletal muscle biopsies were performed on transgenic SOD1G93A mice, a mouse model of ALS, to determine genetic biomarkers of disease longevity. Mice were anesthetized with isoflurane, and three biopsy samples were obtained per animal at the three main stages of the disease. Transcriptional expression levels of seventeen genes, Ankrd1, Calm1, Col19a1, Fbxo32, Gsr, Impa1, Mef2c, Mt2, Myf5, Myod1, Myog, Nnt, Nogo A, Pax7, Rrad, Sln and Snx10, were tested in each muscle biopsy sample. Total RNA was extracted using TRIzol Reagent according to the manufacturer's protocol, and variations in gene expression were assayed by real-time PCR for all of the samples. The Pearson correlation coefficient was used to determine the linear correlation between transcriptional expression levels throughout disease progression and longevity. Consistent with the results obtained from total skeletal muscle of transgenic SOD1G93A mice and 74-day-old denervated mice, five genes (Mef2c, Gsr, Col19a1, Calm1 and Snx10) could be considered potential genetic biomarkers of longevity in transgenic SOD1G93A mice. These results are important because they may lead to the exploration of previously unexamined tissues in the search for new disease biomarkers and even to the application of these findings in human studies. PMID:22412900

A ketogenic diet as a potential novel therapeutic intervention in amyotrophic lateral sclerosis.

PubMed

Zhao, Zhong; Lange, Dale J; Voustianiouk, Andrei; MacGrogan, Donal; Ho, Lap; Suh, Jason; Humala, Nelson; Thiyagarajan, Meenakshisundaram; Wang, Jun; Pasinetti, Giulio M

2006-04-03

The cause of neuronal death in amyotrophic lateral sclerosis (ALS) is uncertain but mitochondrial dysfunction may play an important role. Ketones promote mitochondrial energy production and membrane stabilization. SOD1-G93A transgenic ALS mice were fed a ketogenic diet (KD) based on known formulations for humans. Motor performance, longevity, and motor neuron counts were measured in treated and disease controls. Because mitochondrial dysfunction plays a central role in neuronal cell death in ALS, we also studied the effect that the principal ketone body, D-beta-3 hydroxybutyrate (DBH), has on mitochondrial ATP generation and neuroprotection. Blood ketones were > 3.5 times higher in KD fed animals compared to controls. KD fed mice lost 50% of baseline motor performance 25 days later than disease controls. KD animals weighed 4.6 g more than disease control animals at study endpoint; the interaction between diet and change in weight was significant (p = 0.047). In spinal cord sections obtained at the study endpoint, there were more motor neurons in KD fed animals (p = 0.030). DBH prevented rotenone mediated inhibition of mitochondrial complex I but not malonate inhibition of complex II. Rotenone neurotoxicity in SMI-32 immunopositive motor neurons was also inhibited by DBH. This is the first study showing that diet, specifically a KD, alters the progression of the clinical and biological manifestations of the G93A SOD1 transgenic mouse model of ALS. These effects may be due to the ability of ketone bodies to promote ATP synthesis and bypass inhibition of complex I in the mitochondrial respiratory chain.

Dispersion fraction enhances cellular growth of carbon nanotube and aluminum oxide reinforced ultrahigh molecular weight polyethylene biocomposites.

PubMed

Patel, Anup Kumar; Balani, Kantesh

2015-01-01

Ultrahigh molecular weight polyethylene (UHMWPE) is widely used as bone-replacement material for articulating surfaces due to its excellent wear resistance and low coefficient of friction. But, the wear debris, generated during abrasion between mating surfaces, leads to aseptic loosening of implants. Thus, various reinforcing agents are generally utilized, which may alter the surface and biological properties of UHMWPE. In the current work, the cellular response of compression molded UHMWPE upon reinforcement of bioactive multiwalled carbon nanotubes (MWCNTs) and bioinert aluminum oxide (Al2O3) is investigated. The phase retention and stability were observed using X-ray diffraction, Raman spectroscopy and Fourier transform infrared (FTIR) spectroscopy. The reinforcement of MWCNTs and Al2O3 has shown to alter the wettability (from contact angle of ~88°±2° to ~118°±4°) and surface energy (from ~23.20 to ~17.75 mN/m) of composites with respect to UHMWPE, without eliciting any adverse effect on cytocompatibility for the L929 mouse fibroblast cell line. Interestingly, the cellular growth of the L929 mouse fibroblast cell line is observed to be dominated by the dispersion fraction of surface free energy (SFE). After 48 h of incubation period, a decrease in metabolic activity of MWCNT-Al2O3 reinforced composites is attributed to apatite formation that reduces the dispersion fraction of surface energy. The mineralized apatite during incubation was confirmed and quantified by energy dispersive spectroscopy and X-ray diffraction respectively. Thus, the dispersion fraction of surface free energy can be engineered to play an important role in achieving enhanced metabolic activity of the MWCNT-Al2O3 reinforced UHMWPE biopolymer composites. Copyright © 2014 Elsevier B.V. All rights reserved.

In vivo evasion of MxA by avian influenza viruses requires human signature in the viral nucleoprotein.

PubMed

Deeg, Christoph M; Hassan, Ebrahim; Mutz, Pascal; Rheinemann, Lara; Götz, Veronika; Magar, Linda; Schilling, Mirjam; Kallfass, Carsten; Nürnberger, Cindy; Soubies, Sébastien; Kochs, Georg; Haller, Otto; Schwemmle, Martin; Staeheli, Peter

2017-05-01

Zoonotic transmission of influenza A viruses can give rise to devastating pandemics, but currently it is impossible to predict the pandemic potential of circulating avian influenza viruses. Here, we describe a new mouse model suitable for such risk assessment, based on the observation that the innate restriction factor MxA represents an effective species barrier that must be overcome by zoonotic viruses. Our mouse lacks functional endogenous Mx genes but instead carries the human MX1 locus as a transgene. Such transgenic mice were largely resistant to highly pathogenic avian H5 and H7 influenza A viruses, but were almost as susceptible to infection with influenza viruses of human origin as nontransgenic littermates. Influenza A viruses that successfully established stable lineages in humans have acquired adaptive mutations which allow partial MxA escape. Accordingly, an engineered avian H7N7 influenza virus carrying a nucleoprotein with signature mutations typically found in human virus isolates was more virulent in transgenic mice than parental virus, demonstrating that a few amino acid changes in the viral target protein can mediate escape from MxA restriction in vivo. Similar mutations probably need to be acquired by emerging influenza A viruses before they can spread in the human population. © 2017 Deeg et al.

Mouse Model for the Preclinical Study of Metastatic Disease | NCI Technology Transfer Center | TTC

Cancer.gov

The Laboratory of Cancer Biology and Genetics, National Cancer Institute seeks partners for collaborative research to co-develop a mouse model that shows preclinical therapeutic response of residual metastatic disease.

Oral treatment with Cu(II)(atsm) increases mutant SOD1 in vivo but protects motor neurons and improves the phenotype of a transgenic mouse model of amyotrophic lateral sclerosis.

PubMed

Roberts, Blaine R; Lim, Nastasia K H; McAllum, Erin J; Donnelly, Paul S; Hare, Dominic J; Doble, Philip A; Turner, Bradley J; Price, Katherine A; Lim, Sin Chun; Paterson, Brett M; Hickey, James L; Rhoads, Timothy W; Williams, Jared R; Kanninen, Katja M; Hung, Lin W; Liddell, Jeffrey R; Grubman, Alexandra; Monty, Jean-Francois; Llanos, Roxana M; Kramer, David R; Mercer, Julian F B; Bush, Ashley I; Masters, Colin L; Duce, James A; Li, Qiao-Xin; Beckman, Joseph S; Barnham, Kevin J; White, Anthony R; Crouch, Peter J

2014-06-04

Mutations in the metallo-protein Cu/Zn-superoxide dismutase (SOD1) cause amyotrophic lateral sclerosis (ALS) in humans and an expression level-dependent phenotype in transgenic rodents. We show that oral treatment with the therapeutic agent diacetyl-bis(4-methylthiosemicarbazonato)copper(II) [Cu(II)(atsm)] increased the concentration of mutant SOD1 (SOD1G37R) in ALS model mice, but paradoxically improved locomotor function and survival of the mice. To determine why the mice with increased levels of mutant SOD1 had an improved phenotype, we analyzed tissues by mass spectrometry. These analyses revealed most SOD1 in the spinal cord tissue of the SOD1G37R mice was Cu deficient. Treating with Cu(II)(atsm) decreased the pool of Cu-deficient SOD1 and increased the pool of fully metallated (holo) SOD1. Tracking isotopically enriched (65)Cu(II)(atsm) confirmed the increase in holo-SOD1 involved transfer of Cu from Cu(II)(atsm) to SOD1, suggesting the improved locomotor function and survival of the Cu(II)(atsm)-treated SOD1G37R mice involved, at least in part, the ability of the compound to improve the Cu content of the mutant SOD1. This was supported by improved survival of SOD1G37R mice that expressed the human gene for the Cu uptake protein CTR1. Improving the metal content of mutant SOD1 in vivo with Cu(II)(atsm) did not decrease levels of misfolded SOD1. These outcomes indicate the metal content of SOD1 may be a greater determinant of the toxicity of the protein in mutant SOD1-associated forms of ALS than the mutations themselves. Improving the metal content of SOD1 therefore represents a valid therapeutic strategy for treating ALS caused by SOD1. Copyright © 2014 the authors 0270-6474/14/348021-11$15.00/0.

Role of Growth Hormone in Prostate Cancer

DTIC Science & Technology

2007-02-01

syndrome produced by targeted disruption of the mouse growth hormone receptor/binding protein gene (the Laron mouse). Proc Natl Acad Sci USA 94:13215... Laron mouse, in which the gene coding for both GHR and GH binding protein has been disrupted or knocked out, with the C3(1)/Tag mouse, which develops...the Laron mouse). Nevertheless, the new model presented here demonstrates that the loss of GHR produced a significant reduction in the level of PIN in

Bat-mouse bone marrow chimera: a novel animal model for dissecting the uniqueness of the bat immune system.

PubMed

Yong, Kylie Su Mei; Ng, Justin Han Jia; Her, Zhisheng; Hey, Ying Ying; Tan, Sue Yee; Tan, Wilson Wei Sheng; Irac, Sergio Erdal; Liu, Min; Chan, Xue Ying; Gunawan, Merry; Foo, Randy Jee Hiang; Low, Dolyce Hong Wen; Mendenhall, Ian Hewitt; Chionh, Yok Teng; Dutertre, Charles-Antoine; Chen, Qingfeng; Wang, Lin-Fa

2018-03-16

Bats are an important animal model with long lifespans, low incidences of tumorigenesis and an ability to asymptomatically harbour pathogens. Currently, in vivo studies of bats are hampered due to their low reproduction rates. To overcome this, we transplanted bat cells from bone marrow (BM) and spleen into an immunodeficient mouse strain NOD-scid IL-2R -/- (NSG), and have successfully established stable, long-term reconstitution of bat immune cells in mice (bat-mice). Immune functionality of our bat-mouse model was demonstrated through generation of antigen-specific antibody response by bat cells following immunization. Post-engraftment of total bat BM cells and splenocytes, bat immune cells survived, expanded and repopulated the mouse without any observable clinical abnormalities. Utilizing bat's remarkable immunological functions, this novel model has a potential to be transformed into a powerful platform for basic and translational research.

Galantamine improves olfactory learning in the Ts65Dn mouse model of Down syndrome

PubMed Central

Simoes de Souza, Fabio M.; Busquet, Nicolas; Blatner, Megan; Maclean, Kenneth N.; Restrepo, Diego

2011-01-01

Down syndrome (DS) is the most common form of congenital intellectual disability. Although DS involves multiple disturbances in various tissues, there is little doubt that in terms of quality of life cognitive impairment is the most serious facet and there is no effective treatment for this aspect of the syndrome. The Ts65Dn mouse model of DS recapitulates multiple aspects of DS including cognitive impairment. Here the Ts65Dn mouse model of DS was evaluated in an associative learning paradigm based on olfactory cues. In contrast to disomic controls, trisomic mice exhibited significant deficits in olfactory learning. Treatment of trisomic mice with the acetylcholinesterase inhibitor galantamine resulted in a significant improvement in olfactory learning. Collectively, our study indicates that olfactory learning can be a sensitive tool for evaluating deficits in associative learning in mouse models of DS and that galantamine has therapeutic potential for improving cognitive abilities. PMID:22355654

Galantamine improves olfactory learning in the Ts65Dn mouse model of Down syndrome.

PubMed

de Souza, Fabio M Simoes; Busquet, Nicolas; Blatner, Megan; Maclean, Kenneth N; Restrepo, Diego

2011-01-01

Down syndrome (DS) is the most common form of congenital intellectual disability. Although DS involves multiple disturbances in various tissues, there is little doubt that in terms of quality of life cognitive impairment is the most serious facet and there is no effective treatment for this aspect of the syndrome. The Ts65Dn mouse model of DS recapitulates multiple aspects of DS including cognitive impairment. Here the Ts65Dn mouse model of DS was evaluated in an associative learning paradigm based on olfactory cues. In contrast to disomic controls, trisomic mice exhibited significant deficits in olfactory learning. Treatment of trisomic mice with the acetylcholinesterase inhibitor galantamine resulted in a significant improvement in olfactory learning. Collectively, our study indicates that olfactory learning can be a sensitive tool for evaluating deficits in associative learning in mouse models of DS and that galantamine has therapeutic potential for improving cognitive abilities.

A candidate model for Angelman syndrome in the mouse.

PubMed

Cattanach, B M; Barr, J A; Beechey, C V; Martin, J; Noebels, J; Jones, J

1997-07-01

Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are well-recognized examples of imprinting in humans. They occur most commonly with paternal and maternal 15q11-13 deletions, but also with maternal and paternal disomy. Both syndromes have also occurred more rarely in association with smaller deletions seemingly causing abnormal imprinting. A putative mouse model of PWS, occurring with maternal duplication (partial maternal disomy) for the homologous region, has been described in a previous paper but, although a second imprinting effect that could have provided a mouse model of AS was found, it appeared to be associated with a slightly different region of the chromosome. Here, we provide evidence that the same region is in fact involved and further demonstrate that animals with paternal duplication for the region exhibit characteristics of AS patients. A mouse model of AS is, therefore, strongly indicated.

Development and testing of a mouse simulated space flight model

NASA Technical Reports Server (NTRS)

Sonnenfeld, Gerald

1987-01-01

The development and testing of a mouse model for simulating some aspects of weightlessness that occurs during space flight, and the carrying out of immunological experiments on animals undergoing space flight is examined. The mouse model developed was an antiorthostatic, hypokinetic, hypodynamic suspension model similar to one used with rats. The study was divided into two parts. The first involved determination of which immunological parameters should be observed on animals flown during space flight or studied in the suspension model. The second involved suspending mice and determining which of those immunological parameters were altered by the suspension. Rats that were actually flown in Space Shuttle SL-3 were used to test the hypotheses.