Sample records for amp pcr technique

  1. Antimicrobial peptide gene expression in periodontitis patients: A pilot study.

    PubMed

    Jourdain, Marie-Laure; Pierrard, Loïc; Kanagaratnam, Lukshe; Velard, Frédéric; Sergheraert, Johan; Lefèvre, Benoît; Gangloff, Sophie C; Braux, Julien

    2018-05-01

    Antimicrobial peptides (AMPs) are one of the most active components of innate immunity and have characteristics that could place them at the heart of the pathogenesis of periodontal disease. This study investigated differences in the expression of AMP coding genes obtained using a simple harvesting technique, gingival smear, between two groups of patients: chronic periodontitis subjects versus healthy ones. Twenty-three patients were enrolled in two groups: 12 were diagnosed with moderate or severe generalized chronic periodontitis, and 11 were diagnosed as clinically healthy. Gingival smears were retrieved and studied using reverse transcription-quantitative PCR (RT-qPCR) after mRNA purification. Fifteen gene expressions were obtained using real-time RT-qPCR. Three AMP genes, histatin 3 (HTN3), α-defensin 4 (DEFA4) and lysozyme C (LYZ), presented different expression levels in periodontitis patients compared with healthy subjects. The relative expression level of DEFA4 appeared to be a protective factor against periodontitis. Gingival smears studied by RT-qPCR may be used to assess the expression of AMPs coding genes. A lack of expression of DEFA4 could be a potential indicator of periodontitis status. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. [Occurrence of AmpC-positive Klebsiella pneumoniae strains in patients with haematological malignancies].

    PubMed

    Chromá, Magdaléna; Kolár, Milan; Sauer, Pavel; Faber, Edgar; Stosová, Tatána; Koukalová, Dagmar; Indrák, Karel

    2008-10-01

    Currently, important bacterial beta-lactamases of increasing clinical significance include AmpC enzymes. The aim was to assess their occurrence in Klebsiella pneumoniae strains isolated from patients with haematological malignancies in a prospective study. Over a 2-month period, strains of the species were isolated from clinical material obtained from patients hospitalized at the Department of Haemato-Oncology of the University Hospital Olomouc. The strains were identified using standard microbiological techniques and the Vitek 2 automated system. Production of AmpC beta-lactamases was roughly determined by phenotypic tests and subsequently confirmed by PCR detection of genes encoding these enzymes. During the above-mentioned period, a total of 35 K. pneumoniae isolates were collected. In 7 of them, production of AmpC beta-lactamases was preliminarily detected by phenotypic test. The multiplex PCR method confirmed phenotyping and determined DHA types in all the isolates. All AmpC-positive isolates were false-susceptible to at least one of the tested third-generation cephalosporins. In one patient, clinically apparent infection caused by this strain was documented. The reported results suggest the possibility of occurrence of AmpC-beta-lactamases in K. pneumoniae strains with clinical significance.

  3. Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls.

    PubMed

    Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol

    2010-03-05

    The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90%) were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8%) and the lowest in fibroblastic DNA (92.3%, P < or = 0.05). Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P < or = 0.05). The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic cells.

  4. Structural and Functional Characterization of Pseudomonas aeruginosa Global Regulator AmpR

    PubMed Central

    Caille, Olivier; Zincke, Diansy; Merighi, Massimo; Balasubramanian, Deepak; Kumari, Hansi; Kong, Kok-Fai; Silva-Herzog, Eugenia; Narasimhan, Giri; Schneper, Lisa; Lory, Stephen

    2014-01-01

    Pseudomonas aeruginosa is a dreaded pathogen in many clinical settings. Its inherent and acquired antibiotic resistance thwarts therapy. In particular, derepression of the AmpC β-lactamase is a common mechanism of β-lactam resistance among clinical isolates. The inducible expression of ampC is controlled by the global LysR-type transcriptional regulator (LTTR) AmpR. In the present study, we investigated the genetic and structural elements that are important for ampC induction. Specifically, the ampC (PampC) and ampR (PampR) promoters and the AmpR protein were characterized. The transcription start sites (TSSs) of the divergent transcripts were mapped using 5′ rapid amplification of cDNA ends-PCR (RACE-PCR), and strong σ54 and σ70 consensus sequences were identified at PampR and PampC, respectively. Sigma factor RpoN was found to negatively regulate ampR expression, possibly through promoter blocking. Deletion mapping revealed that the minimal PampC extends 98 bp upstream of the TSS. Gel shifts using membrane fractions showed that AmpR binds to PampC in vitro whereas in vivo binding was demonstrated using chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR). Additionally, site-directed mutagenesis of the AmpR helix-turn-helix (HTH) motif identified residues critical for binding and function (Ser38 and Lys42) and critical for function but not binding (His39). Amino acids Gly102 and Asp135, previously implicated in the repression state of AmpR in the enterobacteria, were also shown to play a structural role in P. aeruginosa AmpR. Alkaline phosphatase fusion and shaving experiments suggest that AmpR is likely to be membrane associated. Lastly, an in vivo cross-linking study shows that AmpR dimerizes. In conclusion, a potential membrane-associated AmpR dimer regulates ampC expression by direct binding. PMID:25182487

  5. Expression profiles of seven channel catfish antimicrobial peptides in response to Edwardsiella ictaluri infection

    USDA-ARS?s Scientific Manuscript database

    Using quantitative PCR technique, the relative transcriptional levels of seven channel catfish antimicrobial peptide (AMP) genes [NK-lysin type 1, NK-lysin type 2, NK-lysin type 3, bactericidal permeability-increasing protein (BPI), cathepsin D, hepcidin, and liver-expressed antimicrobial peptide 2 ...

  6. Highly Sensitive Detection of Low-Abundance White Spot Syndrome Virus by a Pre-Amplification PCR Method.

    PubMed

    Pan, Xiaoming; Zhang, Yanfang; Sha, Xuejiao; Wang, Jing; Li, Jing; Dong, Ping; Liang, Xingguo

    2017-03-28

    White spot syndrome virus (WSSV) is a major threat to the shrimp farming industry and so far there is no effective therapy for it, and thus early diagnostic of WSSV is of great importance. However, at the early stage of infection, the extremely low-abundance of WSSV DNA challenges the detection sensitivity and accuracy of PCR. To effectively detect low-abundance WSSV, here we developed a pre-amplification PCR (pre-amp PCR) method to amplify trace amounts of WSSV DNA from massive background genomic DNA. Combining with normal specific PCR, 10 copies of target WSSV genes were detected from ~10 10 magnitude of backgrounds. In particular, multiple target genes were able to be balanced amplified with similar efficiency due to the usage of the universal primer. The efficiency of the pre-amp PCR was validated by nested-PCR and quantitative PCR, and pre-amp PCR showed higher efficiency than nested-PCR when multiple targets were detected. The developed method is particularly suitable for the super early diagnosis of WSSV, and has potential to be applied in other low-abundance sample detection cases.

  7. Prevalence of Ambler class A β-lactamases and ampC expression in cephalosporin-resistant isolates of Acinetobacter baumannii.

    PubMed

    Rezaee, Mohammad Ahangarzadeh; Pajand, Omid; Nahaei, Mohammad Reza; Mahdian, Reza; Aghazadeh, Mohammad; Ghojazadeh, Morteza; Hojabri, Zoya

    2013-07-01

    We examined the prevalence of various cephalosporins' resistance mechanisms in Acinetobacter baumannii clinical isolates. Phenotypic and molecular detection of Ambler classes A, B and D β-lactamases was performed on 75 isolates. Clonal relatedness was defined using Repetitive Extragenic Palindromic PCR. PCR mapping was used to examine the linkage of insertion sequences and the ampC gene, and ampC expression was analyzed by TaqMan reverse transcriptase-PCR. Twenty-six (37%) isolates carried at least one of the blaPER-1 or blaTEM-1. Sixty-nine (98.5%) out of 70 cephalosporin-resistant isolates had insertions upstream of the ampC gene, of which 48 (69%) and 6 (8%) were identified as ISAba1and ISAba125, respectively. Higher level of expression was obtained in resistant isolates lacking ISAba1/ampC combination in comparison with that in positive ones. The ability to up-regulate the expression of ampC gene in association with different insertion elements has become an important factor in A. baumannii resistance to cephalosporins. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Epidemiology and risk factors for infections due to AmpC β-lactamase-producing Escherichia coli.

    PubMed

    Pascual, Vanesa; Ortiz, Gabriel; Simó, Maria; Alonso, Noemí; Garcia, Maria Consol; Xercavins, Mariona; Rivera, Alba; Morera, Maria Antonia; Miró, Elisenda; Espejo, Elena; Navarro, Ferran; Gurguí, Mercè; Pérez, Josefa; Rodríguez-Carballeira, Mónica; Garau, Javier; Calbo, Esther

    2015-03-01

    To describe the prevalence and risk factors for infection due to AmpC β-lactamase-producing Escherichia coli (AmpC-EC). For the prevalence study, all clinical isolates of E. coli with reduced susceptibility to third-generation cephalosporins were prospectively included from June 2010 to November 2011. For risk factor analysis, a case-control study was conducted. Cases were patients with an infection due to AmpC-EC. Controls were patients infected with cephalosporin-susceptible E. coli, matched 1 : 2. Detection of blaAmpC genes was done with a multiplex AmpC-PCR, and hyperproduction of E. coli chromosomal blaAmpC by quantitative RT-PCR. Alteration of the blaAmpC promoter was studied by PCR and sequencing. We identified 243 (1.1%) AmpC-EC strains out of 21 563 clinical isolates. Three cases with strains carrying ESBLs, 18 strains that were considered due to colonization and 8 cases lost to clinical follow-up were excluded. Finally, 214 cases were included in the analysis. Ninety-one cases (42.5%) and 269 (62.8%) controls were strictly community acquired (P < 0.001). Thirty-five (16.3%) cases and 186 controls (43.5%) did not have any identifiable risk factor (P < 0.001). Among cases, 158 (73.8%) were found to harbour an acquired AmpC (73.4% CMY-2). Previous use of fluoroquinolones [OR 2.6 (95% CI 1.12-3.36); P = 0.008] was independently associated with AmpC-EC in the multivariate analysis. Prevalence of AmpC in E. coli remains low in our area. Plasmid acquisition (CMY type) represents the main mechanism of AmpC production. A high proportion of community-acquired isolates and patients with no identifiable risk factors were found. Previous use of fluoroquinolones was identified as a risk factor. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  9. Emergence of multidrug-resistant Proteus mirabilis in a long-term care facility in Croatia.

    PubMed

    Bedenić, Branka; Firis, Nataša; Elveđi-Gašparović, Vesna; Krilanović, Marija; Matanović, Krešimir; Štimac, Iva; Luxner, Josefa; Vraneš, Jasmina; Meštrović, Tomislav; Zarfel, Gernot; Grisold, Andrea

    2016-06-01

    An increased frequency of Proteus mirabilis isolates resistant to expanded-spectrum cephalosporins was observed recently in a long-term care facility in Zagreb (Godan). The aim of this study was the molecular characterization of resistance mechanisms to new cephalosporins in P. mirabilis isolates from this nursing home. Thirty-eight isolates collected from 2013-2015 showing reduced susceptibility to ceftazidime were investigated. Antibiotic susceptibilities were determined by broth microdilution method. Inhibitor-based tests were performed to detect extended-spectrum (ESBLs) and AmpC β-lactamases. AmpC β-lactamases were characterized by polymerase chain reaction (PCR) followed by sequencing of bla ampC genes. Quinolone resistance determinants (qnr genes) were characterized by PCR. Genotyping of the isolates was performed by repetitive element sequence (rep)-PCR and pulsed-field gel electrophoresis (PFGE). Presence of an AmpC β-lactamase was confirmed in all isolates by combined-disk test with phenylboronic acid. All isolates were resistant to amoxicillin alone and combined with clavulanate, cefotaxime, ceftriaxone, cefoxitin, and ciprofloxacin; but susceptible to cefepime, imipenem, and meropenem. PCR followed by sequencing using primers targeting bla ampc genes revealed CMY-16 β-lactamase in all but one strain. Bla cmy-16 was carried by a non-conjugative plasmid which did not belong to any known plasmid-based replicon typing (PBRT) group. Rep-PCR identified one large clone consisting of 15 isolates, three pairs or related isolates, one triplet, and four singletons. PFGE confirmed the clonality of the isolates. This is the first report of multidrug resistant P. mirabilis in a nursing home in Croatia. Cephalosporin resistance was due to plasmid-mediated AmpC β-lactamase CMY-16.

  10. Role of 2',3'-cyclic nucleotide 3'-phosphodiesterase in the renal 2',3'-cAMP-adenosine pathway.

    PubMed

    Jackson, Edwin K; Gillespie, Delbert G; Mi, Zaichuan; Cheng, Dongmei; Bansal, Rashmi; Janesko-Feldman, Keri; Kochanek, Patrick M

    2014-07-01

    Energy depletion increases the renal production of 2',3'-cAMP (a positional isomer of 3',5'-cAMP that opens mitochondrial permeability transition pores) and 2',3'-cAMP is converted to 2'-AMP and 3'-AMP, which in turn are metabolized to adenosine. Because the enzymes involved in this "2',3'-cAMP-adenosine pathway" are unknown, we examined whether 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNPase) participates in the renal metabolism of 2',3'-cAMP. Western blotting and real-time PCR demonstrated expression of CNPase in rat glomerular mesangial, preglomerular vascular smooth muscle and endothelial, proximal tubular, thick ascending limb and collecting duct cells. Real-time PCR established the expression of CNPase in human glomerular mesangial, proximal tubular and vascular smooth muscle cells; and the level of expression of CNPase was greater than that for phosphodiesterase 4 (major enzyme for the metabolism of 3',5'-cAMP). Overexpression of CNPase in rat preglomerular vascular smooth muscle cells increased the metabolism of exogenous 2',3'-cAMP to 2'-AMP. Infusions of 2',3'-cAMP into isolated CNPase wild-type (+/+) kidneys increased renal venous 2'-AMP, and this response was diminished by 63% in CNPase knockout (-/-) kidneys, whereas the conversion of 3',5'-cAMP to 5'-AMP was similar in CNPase +/+ vs. -/- kidneys. In CNPase +/+ kidneys, energy depletion (metabolic poisons) increased kidney tissue levels of adenosine and its metabolites (inosine, hypoxanthine, xanthine, and uric acid) without accumulation of 2',3'-cAMP. In contrast, in CNPase -/- kidneys, energy depletion increased kidney tissue levels of 2',3'-cAMP and abolished the increase in adenosine and its metabolites. In conclusion, kidneys express CNPase, and renal CNPase mediates in part the renal 2',3'-cAMP-adenosine pathway. Copyright © 2014 the American Physiological Society.

  11. Faecal colonization of E. coli and Klebsiella spp. producing extended-spectrum beta-lactamases and plasmid-mediated AmpC in Mozambican university students.

    PubMed

    Chirindze, L M; Zimba, T F; Sekyere, J O; Govinden, U; Chenia, H Y; Sundsfjord, A; Essack, S Y; Simonsen, G S

    2018-05-30

    In recent years, the world has seen a surge in Enterobacteriaceae resistant to broad-spectrum beta-lactam antibiotics due to the production of extended-spectrum beta-lactamases (ESBLs) or plasmid-mediated AmpC (pAmpC) enzymes. Data on the epidemiology of cephalosporin-resistant Enterobacteriaceae in Sub-Saharan Africa are still limited. Two hundred seventy-five non-repetitive stool samples were collected from Mozambican university students of both sexes. Samples were cultured on MacConkey agar with and without ceftriaxone (1 mg/L) for selection of third-generation cephalosporin-resistant isolates, which were subjected to antimicrobial susceptibility testing by disc diffusion, characterization of resistance genes by PCR and ERIC-PCR analysis for strain clonality. Among the 275 students, 55 (20%) carried a total of 56 E. coli (n = 35) and Klebsiella spp. (n = 21) isolates resistant to ceftriaxone and phenotypically positive for ESBL- and/or pAmpC-production. Forty-three percent of the isolates (24/56) contained only ESBL genes, 11% (6/56) only pAmpC genes, and 36% (20/56) both ESBL and pAmpC genes. The remaining six isolates were negative for the CTX-M/pAmpC genes included in the test panel. E. coli and Klebsiella spp. combined demonstrated 70% resistance to tetracycline and co-trimoxazole, 63% to ceftazidime and 34% to ciprofloxacin. In total, 89% of ESBL/pAmpC-positive isolates were defined as multi-resistant by being resistant to three or more antibiotic classes. ERIC-PCR fingerprinting demonstrated low similarity among isolates. None of the participants reported recent hospitalization and just 12.5% had taken antibiotics 3 months prior to the study. This study demonstrated 20% colonization with multi-resistant E. coli and Klebsiella spp. among Mozambican students with a diversity of ESBL and pAmpC genes. Colonization was not related to prior hospitalization or antimicrobial consumption.

  12. Rapid identification of oral isolates of Aggregatibacter actinomycetemcomitans obtained from humans and primates by an ultrafast super convection based polymerase chain reaction

    PubMed Central

    Karched, M.; Furgang, D.; Sawalha, N.; Fine, D.H.

    2017-01-01

    Aggregatibacter actinomycetemcomitans is a Gram negative oral bacterium associated with localized aggressive periodontitis (LAP). Detection of A. actinomycetemcomitans in clinical samples is routinely done by PCR. Our aim was to develop a rapid and reliable PCR method that can be used as a chair-side tool to detect A. actinomycetemcomitans in clinical samples. Sensitivity and specificity assessment was performed on buccal and plaque samples obtained from 40 adolescents enrolled in an ongoing LAP study by comparing 20 A. actinomycetemcomitans-positive subjects and 20 who were negative. In a second study, A. actinomycetemcomitans presence was tested in oral samples from eighty-six primates that included rhesus monkeys, chimpanzees, marmosets, tamarins and baboons. All samples were processed for detection of A. actinomycetemcomitans by means of culture, conventional PCR (cPCR) and rapid PCR (rPCR) using a Super Convection based AmpXpress thermal cycler (AlphaHelix, Sweden). For human samples, culture, cPCR and rPCR showed perfect agreement. Using this method A. actinomycetemcomitans was detected in 27 of 32 rhesus monkeys, 4 of 8 chimpanzees and 1 of 34 marmosets. Rapidity of AmpXpress thermal cycler, combined with Ready-To-Go PCR beads (GE Life sciences), a quick DNA extraction kit (Epicentre Biotechnologies, Madison, Wisconsin, USA) and a bufferless fast agarose gel system, made it possible to obtain results on A. actinomycetemcomitans detection within 35 min. We conclude that AmpXpress fast PCR can be conveniently used as a chair-side tool for rapid detection of A. actinomycetemcomitans in clinical samples. PMID:22326236

  13. Role of 2′,3′-cyclic nucleotide 3′-phosphodiesterase in the renal 2′,3′-cAMP-adenosine pathway

    PubMed Central

    Gillespie, Delbert G.; Mi, Zaichuan; Cheng, Dongmei; Bansal, Rashmi; Janesko-Feldman, Keri; Kochanek, Patrick M.

    2014-01-01

    Energy depletion increases the renal production of 2′,3′-cAMP (a positional isomer of 3′,5′-cAMP that opens mitochondrial permeability transition pores) and 2′,3′-cAMP is converted to 2′-AMP and 3′-AMP, which in turn are metabolized to adenosine. Because the enzymes involved in this “2′,3′-cAMP-adenosine pathway” are unknown, we examined whether 2′,3′-cyclic nucleotide 3′-phosphodiesterase (CNPase) participates in the renal metabolism of 2′,3′-cAMP. Western blotting and real-time PCR demonstrated expression of CNPase in rat glomerular mesangial, preglomerular vascular smooth muscle and endothelial, proximal tubular, thick ascending limb and collecting duct cells. Real-time PCR established the expression of CNPase in human glomerular mesangial, proximal tubular and vascular smooth muscle cells; and the level of expression of CNPase was greater than that for phosphodiesterase 4 (major enzyme for the metabolism of 3′,5′-cAMP). Overexpression of CNPase in rat preglomerular vascular smooth muscle cells increased the metabolism of exogenous 2′,3′-cAMP to 2′-AMP. Infusions of 2′,3′-cAMP into isolated CNPase wild-type (+/+) kidneys increased renal venous 2′-AMP, and this response was diminished by 63% in CNPase knockout (−/−) kidneys, whereas the conversion of 3′,5′-cAMP to 5′-AMP was similar in CNPase +/+ vs. −/− kidneys. In CNPase +/+ kidneys, energy depletion (metabolic poisons) increased kidney tissue levels of adenosine and its metabolites (inosine, hypoxanthine, xanthine, and uric acid) without accumulation of 2′,3′-cAMP. In contrast, in CNPase −/− kidneys, energy depletion increased kidney tissue levels of 2′,3′-cAMP and abolished the increase in adenosine and its metabolites. In conclusion, kidneys express CNPase, and renal CNPase mediates in part the renal 2′,3′-cAMP-adenosine pathway. PMID:24808540

  14. Inhibition of Gαs/cAMP Signaling Decreases TCR-Stimulated IL-2 transcription in CD4(+) T Helper Cells.

    PubMed

    Hynes, Thomas R; Yost, Evan A; Yost, Stacy M; Hartle, Cassandra M; Ott, Braden J; Berlot, Catherine H

    2015-07-06

    The role of cAMP in regulating T cell activation and function has been controversial. cAMP is generally known as an immunosuppressant, but it is also required for generating optimal immune responses. As the effect of cAMP is likely to depend on its cellular context, the current study investigated whether the mechanism of activation of Gαs and adenylyl cyclase influences their effect on T cell receptor (TCR)-stimulated interleukin-2 (IL-2) mRNA levels. The effect of blocking Gs-coupled receptor (GsPCR)-mediated Gs activation on TCR-stimulated IL-2 mRNA levels in CD4(+) T cells was compared with that of knocking down Gαs expression or inhibiting adenylyl cyclase activity. The effect of knocking down Gαs expression on TCR-stimulated cAMP accumulation was compared with that of blocking GsPCR signaling. ZM-241385, an antagonist to the Gs-coupled A2A adenosine receptor (A2AR), enhanced TCR-stimulated IL-2 mRNA levels in primary human CD4(+) T helper cells and in Jurkat T cells. A dominant negative Gαs construct, GαsDN3, also enhanced TCR-stimulated IL-2 mRNA levels. Similar to GsPCR antagonists, GαsDN3 blocked GsPCR-dependent activation of both Gαs and Gβγ. In contrast, Gαs siRNA and 2',5'-dideoxyadenosine (ddA), an adenylyl cyclase inhibitor, decreased TCR-stimulated IL-2 mRNA levels. Gαs siRNA, but not GαsDN3, decreased TCR-stimulated cAMP synthesis. Potentiation of IL-2 mRNA levels by ZM-241385 required at least two days of TCR stimulation, and addition of ddA after three days of TCR stimulation enhanced IL-2 mRNA levels. GsPCRs play an inhibitory role in the regulation of TCR-stimulated IL-2 mRNA levels whereas Gαs and cAMP can play a stimulatory one. Additionally, TCR-dependent activation of Gαs does not appear to involve GsPCRs. These results suggest that the context of Gαs/cAMP activation and the stage of T cell activation and differentiation determine the effect on TCR-stimulated IL-2 mRNA levels.

  15. Aquaporin 3 expression in human fetal membranes and its up-regulation by cyclic adenosine monophosphate in amnion epithelial cell culture.

    PubMed

    Wang, Shengbiao; Amidi, Fataneh; Beall, Marie; Gui, Lizhen; Ross, Michael G

    2006-04-01

    The cell membrane water channel protein aquaporins (AQPs) may be important in regulating the intramembranous (IM) pathway of amniotic fluid (AF) resorption. The objective of the present study was to determine whether aquaporin 3 (AQP3) is expressed in human fetal membranes and to further determine if AQP3 expression in primary human amnion cell culture is regulated by second-messenger cyclic adenosine monophosphate (cAMP). AQP3 expression in human fetal membranes of normal term pregnancy was studied by reverse transcription polymerase chain reaction (RT-PCR) and immunohistochemistry (IHC). To determine the effect of cAMP on AQP3 expression, primary human amnion cell cultures were treated in either heat-inactivated medium alone (control), or heat-inactivated medium containing: (1) SP-cAMP, a membrane-permeable and phosphodiesterase resistant cAMP agonist, or (2) forskolin, an adenylate cyclase stimulator. Total RNA was isolated and multiplex real-time RT-PCR employed for relative quantitation of AQP3 expression. We detected AQP3 expression in placenta, chorion, and amnion using RT-PCR. Using IHC, we identified AQP3 protein expression in placenta syncytiotrophoblasts and cytotrophoblasts, chorion cytotrophoblasts, and amnion epithelia. In primary amnion epithelial cell culture, AQP3 mRNA significantly increased at 2 hours following forskolin or SP-cAMP, remained elevated at 10 hours following forskolin, and returned to baseline levels by 20 hours following treatment. This study provides evidence of AQP3 expression in human fetal membranes and demonstrates that AQP3 expression in primary human amnion cell culture is up-regulated by second-messenger cAMP. As AQP3 is permeable to water, urea, and glycerol, modulation of its expression in fetal membranes may contribute to AF homeostasis.

  16. AmpC β-lactamases in nosocomial isolates of Klebsiella pneumoniae from India

    PubMed Central

    Gupta, Varsha; Kumarasamy, Karthikeyan; Gulati, Neelam; Garg, Ritu; Krishnan, Padma; Chander, Jagdish

    2012-01-01

    Background & objectives: AmpC β-lactamases are clinically significant since these confer resistance to cephalosporins in the oxyimino group, 7-α methoxycephalosporins and are not affected by available β-lactamase inhibitors. In this study we looked for both extended spectrum β-lactamases (ESBL) and AmpC β-lactamases in Klebsiella pneumoniae clinical isolates. Methods: One hundred consecutive, non-duplicate clinical isolates of K. pneumoniae collected over a period of one year (June 2008 - June 2009) were included in the study. An antibiotic susceptibility method was used with 10 antibiotics for Gram-negative infections which helped in screening for ESBL and AmpC β-lactamases and also in confirmation of ESBL production. The detection of AmpC β-lactamases was done based on screening and confirmatory tests. For screening, disc diffusion zones of cefoxitin <18 mm was taken as cefoxitin resistant. All cefoxitin resistant isolates were tested further by AmpC disk test and modified three dimensional test. Multiplex-PCR was performed for screening the presence of plasmid-mediated AmpC genes. Results: Of the 100 isolates of K. pneumoniae studied, 48 were resistant to cefoxitin on screening. AmpC disk test was positive in 32 (32%) isolates. This was also confirmed with modified three dimensional test. Indentation indicating strong AmpC producer was observed in 25 isolates whereas little distortion (weak AmpC) was observed in 7 isolates. ESBL detection was confirmed by a modification of double disk synergy test in 56 isolates. Cefepime was the best cephalosporin in synergy with tazobactam for detecting ESBL production in isolates co-producing AmpC β-lactamases. The subsets of isolates phenotypically AmpC β-lactamase positive were subjected to amplification of six different families of AmpC gene using multiplex PCR. The sequence analysis revealed 12 CMY-2 and eight DHA-1 types. Interpretation & conclusions: Tazobactam was the best β-lactamase inhibitor for detecting ESBL in presence of AmpC β-lactamase as this is a very poor inducer of AmpC gene. Amongst cephalosporins, cefepime was the best cephalosporin in detecting ESBL in presence of AmpC β-lactamase as it is least hydrolyzed by AmpC enzymes. Cefepime-tazobactam combination disk test would be a simple and best method in detection of ESBLs in Enterobacteriaceae co-producing AmpC β-lactamase in the routine diagnostic microbiology laboratories. PMID:22960890

  17. Renal proximal tubule function is preserved in Cftrtm2camΔF508 cystic fibrosis mice

    PubMed Central

    Kibble, J D; Balloch, K J D; Neal, A M; Hill, C; White, S; Robson, L; Green, R; Taylor, C J

    2001-01-01

    Changes in proximal tubule function have been reported in cystic fibrosis patients. The aim of this study was to investigate proximal tubule function in the Cftrtm2camΔF508 cystic fibrosis (CF) mouse model. A range of techniques were used including renal clearance studies, in situ microperfusion, RT-PCR and whole-cell patch clamping. Renal Na+ clearance was similar in wild-type (1.4 ± 0.3 μl min−1, number of animals, N= 12) and CF mice (1.6 ± 0.4 μl min−1, N= 7) under control conditions. Acute extracellular volume expansion resulted in significant natriuresis in wild-type (7.0 ± 0.8 μl min−1, N= 8) and CF mice (9.3 ± 1.4 μl min−1, N= 9); no difference between genotypes was observed. In situ microperfusion revealed that fluid absorptive rate (Jv) was similar under control conditions between wild-type (2.2 ± 0.4 nl mm−1 min−1, n= 10) and CF mice (1.9 ± 0.3 nl mm−1 min−1, n= 11). Addition of a forskolin-dibutyryl cAMP (db-cAMP) cocktail to the perfusate caused no significant change in Jv in either wild-type (2.6 ± 0.7 nl mm−1 min−1, n= 10) or Cftrtm2camΔF508 mice (2.0 ± 0.5 nl mm−1 min−1, n= 10). CFTR expression was confirmed in samples of outer cortex using RT-PCR. However, no evidence for functional CFTR was obtained when outer cortical cells were stimulated with protein kinase A or forskolin-db-cAMP using whole-cell patch clamping. In conclusion, no functional deficit in proximal tubule function was found in Cftrtm2camΔF508 mice. This may be a consequence of a lack of whole-cell cAMP-dependent Cl− conductance in mouse proximal tubule cells. PMID:11306663

  18. Molecular characterization and epidemiology of cefoxitin resistance among Enterobacteriaceae lacking inducible chromosomal ampC genes from hospitalized and non-hospitalized patients in Algeria: description of new sequence type in Klebsiella pneumoniae isolates.

    PubMed

    Gharout-Sait, Alima; Touati, Abdelaziz; Guillard, Thomas; Brasme, Lucien; de Champs, Christophe

    2015-01-01

    In this study, 922 consecutive non-duplicate clinical isolates of Enterobacteriaceae obtained from hospitalized and non-hospitalized patients at Bejaia, Algeria were analyzed for AmpC-type β-lactamases production. The ampC genes and their genetic environment were characterized using polymerase chain reaction (PCR) and sequencing. Plasmid incompatibility groups were determined by using PCR-based replicon typing. Phylogenetic grouping and multilocus sequence typing were determined for molecular typing of the plasmid-mediated AmpC (pAmpC) isolates. Of the isolates, 15 (1.6%) were identified as AmpC producers including 14 CMY-4-producing isolates and one DHA-1-producing Klebsiella pneumoniae. All AmpC-producing isolates co-expressed the broad-spectrum TEM-1 β-lactamase and three of them co-produced CTX-M and/or SHV-12 ESBL. Phylogenetic grouping and virulence genotyping of the E. coli isolates revealed that most of them belonged to groups D and B1. Multilocus sequence typing analysis of K. pneumoniae isolates identified four different sequence types (STs) with two new sequences: ST1617 and ST1618. Plasmid replicon typing indicates that blaCMY-4 gene was located on broad host range A/C plasmid, while LVPK replicon was associated with blaDHA-1. All isolates carrying blaCMY-4 displayed the transposon-like structures ISEcp1/ΔISEcp1-blaCMY-blc-sugE. Our study showed that CMY-4 was the main pAmpC in the Enterobacteriaceae isolates in Algeria. Copyright © 2015 Elsevier Editora Ltda. All rights reserved.

  19. Extended-spectrum cephalosporin-resistant Escherichia coli in community, specialized outpatient clinic and hospital settings in Switzerland.

    PubMed

    Seiffert, Salome N; Hilty, Markus; Kronenberg, Andreas; Droz, Sara; Perreten, Vincent; Endimiani, Andrea

    2013-10-01

    Resistance to extended-spectrum cephalosporins (ESCs) in Escherichia coli can be due to the production of ESBLs, plasmid-mediated AmpCs (pAmpCs) or chromosomal AmpCs (cAmpCs). Information regarding type and prevalence of β-lactamases, clonal relations and plasmids associated with the bla genes for ESC-R E. coli (ESC-R-Ec) detected in Switzerland is lacking. Moreover, data focusing on patients referred to the specialized outpatient clinics (SOCs) are needed. We analysed 611 unique E. coli isolated during September-December 2011. ESC-R-Ec were studied with microarrays, PCR/DNA sequencing for blaESBLs, blapAmpCs, promoter region of blacAmpC, IS elements, plasmid incompatibility group, and also implementing transformation, aIEF, rep-PCR and MLST. The highest resistance rates were observed in the SOCs, whereas those in the hospital and community were lower (e.g. quinolone resistance of 22.6%, 17.2% and 9.0%, respectively; P = 0.003 for SOCs versus community). The prevalence of ESC-R-Ec in the three settings was 5.3% (n = 11), 7.8% (n = 22) and 5.7% (n = 7), respectively. Thirty isolates produced CTX-M ESBLs (14 were CTX-M-15), 5 produced CMY-2 pAmpC and 5 hyper-expressed cAmpCs due to promoter mutations. Fourteen isolates were of sequence type 131 (ST131; 10 with CTX-M-15). blaCTX-M and blaCMY-2 were associated with an intact or truncated ISEcp1 and were mainly carried by IncF, IncFII and IncI1plasmids. ST131 producing CTX-M-15 is the predominant clone. The prevalence of ESC-R-Ec (overall 6.5%) is low, but an unusual relatively high frequency of AmpC producers (25%) was noted. The presence of ESC-R-Ec in the SOCs and their potential ability to be exchanged between hospital and community should be taken into serious consideration.

  20. Piperacillin-Tazobactam versus Other Antibacterial Agents for Treatment of Bloodstream Infections Due to AmpC β-Lactamase-Producing Enterobacteriaceae.

    PubMed

    Cheng, Lucy; Nelson, Brian C; Mehta, Monica; Seval, Nikhil; Park, Sarah; Giddins, Marla J; Shi, Qiuhu; Whittier, Susan; Gomez-Simmonds, Angela; Uhlemann, Anne-Catrin

    2017-06-01

    In vivo induction of AmpC beta-lactamases produces high-level resistance to many beta-lactam antibiotics in Enterobacteriaceae , often resulting in the need to use carbapenems or cefepime (FEP). The clinical effectiveness of piperacillin-tazobactam (TZP), a weak inducer of AmpC beta-lactamases, is poorly understood. Here, we conducted a case-control study of adult inpatients with bloodstream infections (BSIs) due to Enterobacter , Serratia , or Citrobacter species from 2009 to 2015 to assess outcomes following treatment with TZP compared to FEP or meropenem (MEM). We collected clinical data and screened all isolates for the presence of ampC alleles by PCR. Primary study outcomes were 30-day mortality and persistent bacteremia at ≥72 h from the time of treatment initiation. Of 493 patients with bacteremia, 165 patients met the inclusion criteria, of which 88 were treated with TZP and 77 with FEP or MEM. To minimize differences between covariates, we carried out propensity score matching, which yielded 41 matched pairs. Groups only differed by age, with patients in the TZP group significantly older ( P = 0.012). There were no significant differences in 30-day mortality, persistent bacteremia, 7-day mortality, or treatment escalation between the two treatment groups, including in the propensity score-matched cohort. PCR amplification and sequencing of amp C genes revealed the presence of amp C in isolates with cefoxitin MICs below 16 μg/ml, in particular in Serratia spp., and demonstrated that these alleles were highly genetically diverse. Taken together, TZP may be a valuable treatment option for BSIs due to AmpC beta-lactamase-producing Enterobacteriaceae , diminishing the need for broader-spectrum agents. Future studies are needed to validate these findings. Copyright © 2017 American Society for Microbiology.

  1. Detection of carbapenemases and other mechanisms of enzymatic resistance to β-lactams in Enterobacteriaceae with diminished susceptibility to carbapenems in a tertiary care hospital.

    PubMed

    Gómara, Marta; López-Calleja, Ana Isabel; Iglesia, Berta María Pilar Vela; Cerón, Isabel Ferrer; López, Antonio Rezusta; Pinilla, María José Revillo

    2018-05-01

    Our objective was to characterize the enzymatic β-lactam resistance in clinical Enterobacteriaceae isolates with diminished susceptibility to carbapenems from 2013 to 2014 at Hospital Universitario Miguel Servet. A total of 63 clinical isolates were analyzed for the presence of carbapenemases (KPC, OXA-48 and MBL), ESBLs and AmpC enzymes by combined disk methods and PCR detection of carbapenemase-encoding and beta-lactamase-encoding genes. Fifteen isolates had a phenotypic test compatible with carbapenemase production; two of these were confirmed by PCR as OXA-48 producers. ESBL detection was positive in 27 isolates (43%); plasmid-mediated AmpC was detected in nine isolates (14.2%) and derepressed AmpC β-lactamase was present in 18 isolates (28%). During the study period, the decreased susceptibility to carbapenems in Enterobacteriaceae in our area was not due to true carbapenemases but rather to β-lactamase activity (82.5% were ESBL or AmpC producers), probably in combination with decreased permeability of the outer membrane. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  2. Expression profiles of antimicrobial peptides (AMPs) and their regulation by Relish

    NASA Astrophysics Data System (ADS)

    Wang, Dongdong; Li, Fuhua; Li, Shihao; Wen, Rong; Xiang, Jianhai

    2012-07-01

    Antimicrobial peptides (AMPs), as key immune effectors, play important roles in the innate immune system of invertebrates. Different types of AMPs, including Penaeidin, Crustin, ALF (antilipopolysaccharide factor) have been identified in different penaeid shrimp; however, systematic analyses on the function of different AMPs in shrimp responsive to different types of bacteria are very limited. In this study, we analyzed the expression profiles of AMPs in the Chinese shrimps, Fenneropenaeus chinensis, simultaneously by real-time RT-PCR (reverse transcription-polymerase chain reaction) when shrimp were challenged with Micrococcus lysodeikticus (Gram-positive, G+) or Vibrio anguillarium (Gram-negative, G-). Different AMPs showed different expression profiles when shrimp were injected with one type of bacterium, and one AMP also showed different expression profiles when shrimp were challenged with different bacteria. Furthermore, the expression of these AMPs showed temporal expression profiles, suggesting that different AMPs function coordinately in bacteria-infected shrimp. An RNA interference approach was used to study the function of the Relish transcription factor in regulating the transcription of different AMPs. The current study showed that Relish could regulate the transcription of different AMPs in shrimp. Differential expression profiles of AMPs in shrimp injected with different types of bacteria indicated that a complicated antimicrobial response network existed in shrimp. These data contribute to our understanding of immunity in shrimp and may provide a strategy for the control of disease in shrimp.

  3. Variant Profiling of Candidate Genes in Pancreatic Ductal Adenocarcinoma.

    PubMed

    Huang, Jiaqi; Löhr, Johannes-Matthias; Nilsson, Magnus; Segersvärd, Ralf; Matsson, Hans; Verbeke, Caroline; Heuchel, Rainer; Kere, Juha; Iafrate, A John; Zheng, Zongli; Ye, Weimin

    2015-11-01

    Pancreatic ductal adenocarcinoma (PDAC) has a poor prognosis. Variant profiling is crucial for developing personalized treatment and elucidating the etiology of this disease. Patients with PDAC undergoing surgery from 2007 to 2012 (n = 73) were followed from diagnosis until death or the end of the study. We applied an anchored multiplex PCR (AMP)-based next-generation sequencing (NGS) method to a panel of 65 selected genes and assessed analytical performance by sequencing a quantitative multiplex DNA reference standard. In clinical PDAC samples, detection of low-level KRAS (Kirsten rat sarcoma viral oncogene homolog) mutations was validated by allele-specific PCR and digital PCR. We compared overall survival of patients according to KRAS mutation status by log-rank test and applied logistic regression to evaluate the association between smoking and tumor variant types. The AMP-based NGS method could detect variants with allele frequencies as low as 1% given sufficient sequencing depth (>1500×). Low-frequency KRAS G12 mutations (allele frequency 1%-5%) were all confirmed by allele-specific PCR and digital PCR. The most prevalent genetic alterations were in KRAS (78% of patients), TP53 (tumor protein p53) (25%), and SMAD4 (SMAD family member 4) (8%). Overall survival in T3-stage PDAC patients differed among KRAS mutation subtypes (P = 0.019). Transversion variants were more common in ever-smokers than in never-smokers (odds ratio 5.7; 95% CI 1.2-27.8). The AMP-based NGS method is applicable for profiling tumor variants. Using this approach, we demonstrated that in PDAC patients, KRAS mutant subtype G12V is associated with poorer survival, and that transversion variants are more common among smokers. © 2015 American Association for Clinical Chemistry.

  4. Enterobacter cloacae with a novel variant of ACT AmpC beta-lactamase originating from glaucous gull (Larus hyperboreus) in Svalbard.

    PubMed

    Literak, Ivan; Manga, Ivan; Wojczulanis-Jakubas, Katarzyna; Chroma, Magdalena; Jamborova, Ivana; Dobiasova, Hana; Sedlakova, Miroslava Htoutou; Cizek, Alois

    2014-07-16

    We aimed at Escherichia coli and Enterobacter cloacae isolates resistant to cephalosporins and fluoroquinolones and Salmonella isolates in wild birds in Arctic Svalbard, Norway. Cloacal swabs of little auks (Alle alle, n=215) and samples of faeces of glaucous gulls (Larus hyperboreus, n=15) were examined. Inducible production of AmpC enzyme was detected in E. cloacae KW218 isolate. Sequence analysis of the 1146 bp PCR product of the ampC gene from this isolate revealed 99% sequence homology with the blaACT-14 and blaACT-5 AmpC beta-lactamase genes. Four, respectively six of the identified single nucleotide polymorphisms generated amino acid substitutions in the amino acid chain. As the ampC sequence polymorphism in the investigated E. cloacae strain was identified as unique, we revealed a novel variant of the ampC beta-lactamase gene blaACT-23. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Forager bees (Apis mellifera) highly express immune and detoxification genes in tissues associated with nectar processing.

    PubMed

    Vannette, Rachel L; Mohamed, Abbas; Johnson, Brian R

    2015-11-09

    Pollinators, including honey bees, routinely encounter potentially harmful microorganisms and phytochemicals during foraging. However, the mechanisms by which honey bees manage these potential threats are poorly understood. In this study, we examine the expression of antimicrobial, immune and detoxification genes in Apis mellifera and compare between forager and nurse bees using tissue-specific RNA-seq and qPCR. Our analysis revealed extensive tissue-specific expression of antimicrobial, immune signaling, and detoxification genes. Variation in gene expression between worker stages was pronounced in the mandibular and hypopharyngeal gland (HPG), where foragers were enriched in transcripts that encode antimicrobial peptides (AMPs) and immune response. Additionally, forager HPGs and mandibular glands were enriched in transcripts encoding detoxification enzymes, including some associated with xenobiotic metabolism. Using qPCR on an independent dataset, we verified differential expression of three AMP and three P450 genes between foragers and nurses. High expression of AMP genes in nectar-processing tissues suggests that these peptides may contribute to antimicrobial properties of honey or to honey bee defense against environmentally-acquired microorganisms. Together, these results suggest that worker role and tissue-specific expression of AMPs, and immune and detoxification enzymes may contribute to defense against microorganisms and xenobiotic compounds acquired while foraging.

  6. Forager bees (Apis mellifera) highly express immune and detoxification genes in tissues associated with nectar processing

    PubMed Central

    Vannette, Rachel L.; Mohamed, Abbas; Johnson, Brian R.

    2015-01-01

    Pollinators, including honey bees, routinely encounter potentially harmful microorganisms and phytochemicals during foraging. However, the mechanisms by which honey bees manage these potential threats are poorly understood. In this study, we examine the expression of antimicrobial, immune and detoxification genes in Apis mellifera and compare between forager and nurse bees using tissue-specific RNA-seq and qPCR. Our analysis revealed extensive tissue-specific expression of antimicrobial, immune signaling, and detoxification genes. Variation in gene expression between worker stages was pronounced in the mandibular and hypopharyngeal gland (HPG), where foragers were enriched in transcripts that encode antimicrobial peptides (AMPs) and immune response. Additionally, forager HPGs and mandibular glands were enriched in transcripts encoding detoxification enzymes, including some associated with xenobiotic metabolism. Using qPCR on an independent dataset, we verified differential expression of three AMP and three P450 genes between foragers and nurses. High expression of AMP genes in nectar-processing tissues suggests that these peptides may contribute to antimicrobial properties of honey or to honey bee defense against environmentally-acquired microorganisms. Together, these results suggest that worker role and tissue-specific expression of AMPs, and immune and detoxification enzymes may contribute to defense against microorganisms and xenobiotic compounds acquired while foraging. PMID:26549293

  7. In vitro activities and detection performances of cefmetazole and flomoxef for extended-spectrum β-lactamase and plasmid-mediated AmpC β-lactamase-producing Enterobacteriaceae.

    PubMed

    Matsumura, Yasufumi; Yamamoto, Masaki; Nagao, Miki; Tanaka, Michio; Takakura, Shunji; Ichiyama, Satoshi

    2016-04-01

    To investigate the in vitro activities of cephamycins (cefmetazole and flomoxef) for extended-spectrum β-lactamase (ESBL)- and plasmid-mediated AmpC β-lactamase (pAmpC)-producing Enterobacteriaceae, a total of 574 third-generation cephalosporin-resistant clinical isolates were collected at a Japanese multicenter study. PCR and sequencing identified 394 isolates with only ESBL genes, 63 isolates with only pAmpC genes, and 6 isolates with both ESBL and pAmpC genes. blaCTX-M types predominated 95.5% of the ESBL genes, and blaCMY-2 predominated 91.3% of the pAmpC genes. The MIC50/90 values of cefmetazole and flomoxef were ≤ 1/4 and ≤ 1/≤ 1 μg/mL for isolates with only ESBL genes, respectively, and 16/>16 and 8/16 μg/mL for isolates with only pAmpC genes, respectively. Flomoxef ≥ 4 μg/mL had the best screening performance for the detection of isolates with pAmpC genes. Flomoxef had better in vitro activities against ESBL-producing Enterobacteriaceae and provided a clearer distinction between ESBL and pAmpC-producing Enterobacteriaceae compared to cefmetazole. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Near instrument-free, simple molecular device for rapid detection of herpes simplex viruses.

    PubMed

    Lemieux, Bertrand; Li, Ying; Kong, Huimin; Tang, Yi-Wei

    2012-06-01

    The first near instrument-free, inexpensive and simple molecular diagnostic device (IsoAmp HSV, BioHelix Corp., MA, USA) recently received US FDA clearance for use in the detection of herpes simplex viruses (HSV) in genital and oral lesion specimens. The IsoAmp HSV assay uses isothermal helicase-dependent amplification in combination with a disposable, hermetically-sealed, vertical-flow strip identification. The IsoAmp HSV assay has a total test-to-result time of less than 1.5 h by omitting the time-consuming nucleic acid extraction. The diagnostic sensitivity and specificity are comparable to PCR and are superior to culture-based methods. The near instrument-free, rapid and simple characteristics of the IsoAmp HSV assay make it potentially suitable for point-of-care testing.

  9. Real-time fluorescence loop mediated isothermal amplification for the diagnosis of malaria.

    PubMed

    Lucchi, Naomi W; Demas, Allison; Narayanan, Jothikumar; Sumari, Deborah; Kabanywanyi, Abdunoor; Kachur, S Patrick; Barnwell, John W; Udhayakumar, Venkatachalam

    2010-10-29

    Molecular diagnostic methods can complement existing tools to improve the diagnosis of malaria. However, they require good laboratory infrastructure thereby restricting their use to reference laboratories and research studies. Therefore, adopting molecular tools for routine use in malaria endemic countries will require simpler molecular platforms. The recently developed loop-mediated isothermal amplification (LAMP) method is relatively simple and can be improved for better use in endemic countries. In this study, we attempted to improve this method for malaria diagnosis by using a simple and portable device capable of performing both the amplification and detection (by fluorescence) of LAMP in one platform. We refer to this as the RealAmp method. Published genus-specific primers were used to test the utility of this method. DNA derived from different species of malaria parasites was used for the initial characterization. Clinical samples of P. falciparum were used to determine the sensitivity and specificity of this system compared to microscopy and a nested PCR method. Additionally, directly boiled parasite preparations were compared with a conventional DNA isolation method. The RealAmp method was found to be simple and allowed real-time detection of DNA amplification. The time to amplification varied but was generally less than 60 minutes. All human-infecting Plasmodium species were detected. The sensitivity and specificity of RealAmp in detecting P. falciparum was 96.7% and 91.7% respectively, compared to microscopy and 98.9% and 100% respectively, compared to a standard nested PCR method. In addition, this method consistently detected P. falciparum from directly boiled blood samples. This RealAmp method has great potential as a field usable molecular tool for diagnosis of malaria. This tool can provide an alternative to conventional PCR based diagnostic methods for field use in clinical and operational programs.

  10. SURVEY OF GROUND, SURFACE, AND POTABLE WATERS FOR THE PRESENCE OF LEGIONELLA SPECIES BY ENVIROAMP PCR LEGIONELLA KIT, CULTURE, AND IMMUNOFLUORESCENT STAINING

    EPA Science Inventory

    A total of 116 samples from numerous aquatic sources including water from faucets, showerheads, dental units, fire sprinklers, and surface waters were examined for the presence of Legionella by the EnviroAmp Legionella PCR kit, culture on BCYEx, or direct fluorescent antibody (DF...

  11. Role of Pseudomonas aeruginosa low-molecular-mass penicillin-binding proteins in AmpC expression, β-lactam resistance, and peptidoglycan structure.

    PubMed

    Ropy, Alaa; Cabot, Gabriel; Sánchez-Diener, Irina; Aguilera, Cristian; Moya, Bartolome; Ayala, Juan A; Oliver, Antonio

    2015-07-01

    This study aimed to characterize the role of Pseudomonas aeruginosa low-molecular-mass penicillin-binding proteins (LMM PBPs), namely, PBP4 (DacB), PBP5 (DacC), and PBP7 (PbpG), in peptidoglycan composition, β-lactam resistance, and ampC regulation. For this purpose, we constructed all single and multiple mutants of dacB, dacC, pbpG, and ampC from the wild-type P. aeruginosa PAO1 strain. Peptidoglycan composition was determined by high-performance liquid chromatography (HPLC), ampC expression by reverse transcription-PCR (RT-PCR), PBP patterns by a Bocillin FL-binding test, and antimicrobial susceptibility by MIC testing for a panel of β-lactams. Microscopy and growth rate analyses revealed no apparent major morphological changes for any of the mutants compared to the wild-type PAO1 strain. Of the single mutants, only dacC mutation led to significantly increased pentapeptide levels, showing that PBP5 is the major dd-carboxypeptidase in P. aeruginosa. Moreover, our results indicate that PBP4 and PBP7 play a significant role as dd-carboxypeptidase only if PBP5 is absent, and their dd-endopeptidase activity is also inferred. As expected, the inactivation of PBP4 led to a significant increase in ampC expression (around 50-fold), but, remarkably, the sequential inactivation of the three LMM PBPs produced a much greater increase (1,000-fold), which correlated with peptidoglycan pentapeptide levels. Finally, the β-lactam susceptibility profiles of the LMM PBP mutants correlated well with the ampC expression data. However, the inactivation of ampC in these mutants also evidenced a role of LMM PBPs, especially PBP5, in intrinsic β-lactam resistance. In summary, in addition to assessing the effect of P. aeruginosa LMM PBPs on peptidoglycan structure for the first time, we obtained results that represent a step forward in understanding the impact of these PBPs on β-lactam resistance, apparently driven by the interplay between their roles in AmpC induction, β-lactam trapping, and dd-carboxypeptidase/β-lactamase activity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  12. Development of a fast PCR protocol enabling rapid generation of AmpFℓSTR® Identifiler® profiles for genotyping of human DNA

    PubMed Central

    2012-01-01

    Background Traditional PCR methods for forensic STR genotyping require approximately 2.5 to 4 hours to complete, contributing a significant portion of the time required to process forensic DNA samples. The purpose of this study was to develop and validate a fast PCR protocol that enabled amplification of the 16 loci targeted by the AmpFℓSTR® Identifiler® primer set, allowing decreased cycling times. Methods Fast PCR conditions were achieved by substituting the traditional Taq polymerase for SpeedSTAR™ HS DNA polymerase which is designed for fast PCR, by upgrading to a thermal cycler with faster temperature ramping rates and by modifying cycling parameters (less time at each temperature) and adopting a two-step PCR approach. Results The total time required for the optimized protocol is 26 min. A total of 147 forensically relevant DNA samples were amplified using the fast PCR protocol for Identifiler. Heterozygote peak height ratios were not affected by fast PCR conditions, and full profiles were generated for single-source DNA amounts between 0.125 ng and 2.0 ng. Individual loci in profiles produced with the fast PCR protocol exhibited average n-4 stutter percentages ranging from 2.5 ± 0.9% (THO1) to 9.9 ± 2.7% (D2S1338). No increase in non-adenylation or other amplification artefacts was observed. Minor contributor alleles in two-person DNA mixtures were reliably discerned. Low level cross-reactivity (monomorphic peaks) was observed with some domestic animal DNA. Conclusions The fast PCR protocol presented offers a feasible alternative to current amplification methods and could aid in reducing the overall time in STR profile production or could be incorporated into a fast STR genotyping procedure for time-sensitive situations. PMID:22394458

  13. Development of a fast PCR protocol enabling rapid generation of AmpFℓSTR® Identifiler® profiles for genotyping of human DNA.

    PubMed

    Foster, Amanda; Laurin, Nancy

    2012-03-06

    Traditional PCR methods for forensic STR genotyping require approximately 2.5 to 4 hours to complete, contributing a significant portion of the time required to process forensic DNA samples. The purpose of this study was to develop and validate a fast PCR protocol that enabled amplification of the 16 loci targeted by the AmpFℓSTR® Identifiler® primer set, allowing decreased cycling times. Fast PCR conditions were achieved by substituting the traditional Taq polymerase for SpeedSTAR™ HS DNA polymerase which is designed for fast PCR, by upgrading to a thermal cycler with faster temperature ramping rates and by modifying cycling parameters (less time at each temperature) and adopting a two-step PCR approach. The total time required for the optimized protocol is 26 min. A total of 147 forensically relevant DNA samples were amplified using the fast PCR protocol for Identifiler. Heterozygote peak height ratios were not affected by fast PCR conditions, and full profiles were generated for single-source DNA amounts between 0.125 ng and 2.0 ng. Individual loci in profiles produced with the fast PCR protocol exhibited average n-4 stutter percentages ranging from 2.5 ± 0.9% (THO1) to 9.9 ± 2.7% (D2S1338). No increase in non-adenylation or other amplification artefacts was observed. Minor contributor alleles in two-person DNA mixtures were reliably discerned. Low level cross-reactivity (monomorphic peaks) was observed with some domestic animal DNA. The fast PCR protocol presented offers a feasible alternative to current amplification methods and could aid in reducing the overall time in STR profile production or could be incorporated into a fast STR genotyping procedure for time-sensitive situations.

  14. Sequence characterization of cDNA sequence of encoding of an antimicrobial Peptide with no disulfide bridge from the Iranian mesobuthus eupeus venomous glands.

    PubMed

    Farajzadeh-Sheikh, Ahmad; Jolodar, Abbas; Ghaemmaghami, Shamsedin

    2013-01-01

    Scorpion venom glands produce some antimicrobial peptides (AMP) that can rapidly kill a broad range of microbes and have additional activities that impact on the quality and effectiveness of innate responses and inflammation. In this study, we reported the identification of a cDNA sequence encoding cysteine-free antimicrobial peptides isolated from venomous glands of this species. Total RNA was extracted from the Iranian mesobuthus eupeus venom glands, and cDNA was synthesized by using the modified oligo (dT). The cDNA was used as the template for applying Semi-nested RT- PCR technique. PCR Products were used for direct nucleotide sequencing and the results were compared with Gen Bank database. A 213 BP cDNA fragment encoding the entire coding region of an antimicrobial toxin from the Iranian scorpion M. Eupeus venom glands were isolated. The full-length sequence of the coding region was 210 BP contained an open reading frame of 70 amino with a predicted molecular mass of 7970.48 Da and theoretical Pi of 9.10. The open reading frame consists of 210 BP encoding a precursor of 70 amino acid residues, including a signal peptide of 23 residues a propertied of 7 residues, and a mature peptide of 34 residues with no disulfide bridge. The peptide has detectable sequence identity to the Lesser Asian mesobuthus eupeus MeVAMP-2 (98%), MeVAMP-9 (60%) and several previously described AMPs from other scorpion venoms including mesobuthus martensii (94%) and buthus occitanus Israelis (82%). The secondary structure of the peptide mainly consisted of α-helical structure which was generally conserved by previously reported scorpion counterparts. The phylogenetic analysis showed that the Iranian MeAMP-like toxin was similar but not identical with that of venom antimicrobial peptides from lesser Asian scorpion mesobuthus eupeus.

  15. Alteration of Cyclic-AMP Response Element Binding Protein in the Postmortem Brain of Subjects with Bipolar Disorder and Schizophrenia

    PubMed Central

    Ren, Xinguo; Rizavi, Hooriyah S.; Khan, Mansoor A.; Bhaumik, Runa; Dwivedi, Yogesh; Pandey, Ghanshyam N.

    2013-01-01

    Background Abnormalities of cyclic-AMP (cAMP) response element binding protein (CREB) function has been suggested in bipolar (BP) illness and schizophrenia (SZ), based on both indirect and direct evidence. To further elucidate the role of CREB in these disorders, we studied CREB expression and function in two brain areas implicated in these disorders, i.e., dorsolateral prefrontal cortex (DLPFC) and cingulate gyrus (CG). Methods We determined CREB protein expression using Western blot technique, CRE-DNA binding using gel shift assay, and mRNA expression using real-time RT-polymerase chain reaction (qPCR) in DLPFC and CG of the postmortem brain of BP (n = 19), SZ (n = 20), and normal control (NC, n = 20) subjects. Results We observed that CREB protein and mRNA expression and CRE-DNA binding activity were significantly decreased in the nuclear fraction of DLPFC and CG obtained from BP subjects compared with NC subjects. However, the protein and mRNA expression and CRE-DNA binding in SZ subjects was significantly decreased in CG, but not in DLPFC, compared with NC. Conclusion These studies thus indicate region-specific abnormalities of CREB expression and function in both BP and SZ. They suggest that abnormalities of CREB in CG may be associated with both BP and SZ, but its abnormality in DLPFC is specific to BP illness. PMID:24148789

  16. Experiment definition studies for AMPS Spacelab

    NASA Technical Reports Server (NTRS)

    Liemohn, H.

    1975-01-01

    The electrical charging of the space shuttle orbiter is discussed in relation to the AMPS Spacelab payload along with an operations research technique for the selection of AMPS Spacelab experiments. Experiments proposed for AMPS include: hydromagnetic wave experiments; bistatic sounder of AMPS wake; and an artificial meteor gun. Experiment objectives and instrument functions are given for all experiments.

  17. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  18. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  19. Sonorensin: an Antimicrobial Peptide, Belonging to the Heterocycloanthracin Subfamily of Bacteriocins, from a New Marine Isolate, Bacillus sonorensis MT93

    PubMed Central

    Chopra, Lipsy; Singh, Gurdeep; Choudhary, Vikas

    2014-01-01

    Marine environments are the greatest fronts of biodiversity, representing a resource of unexploited or unknown microorganisms and new substances having potential applications. Among microbial products, antimicrobial peptides (AMPs) have received great attention recently due to their applications as food preservatives and therapeutic agents. A new marine soil isolate producing an AMP was identified as Bacillus sonorensis based on 16S rRNA gene sequence analysis. It produced an AMP that showed a broad spectrum of activity against both Gram-positive and Gram-negative bacteria. The peptide, named sonorensin, was purified to homogeneity using a combination of chromatographic techniques. The intact molecular mass of the purified peptide, 6,274 Da, as revealed by matrix-assisted laser desorption ionization–time of flight (MALDI-TOF), was in agreement with Tricine-SDS-PAGE analysis. A PCR array of primers was used to identify AMP structural genes, which allowed the successful amplification of the related genes from strain MT93. The putative open reading frame of sonorensin was amplified, cloned into the pET-32a(+) vector, expressed as a thioredoxin (Trx) fusion protein in Escherichia coli, and then purified. Sequence alignment analysis revealed that the bacteriocin being reported could belong to new subfamily of bacteriocins, heterocycloanthracin. The peptide indicated its potential as a biocontrol agent or food antimicrobial agent, due to its antimicrobial activity against bacteria such as Listeria monocytogenes and Staphylococcus aureus. This is the first report of the production, purification, and characterization of wild-type and recombinant bacteriocin by B. sonorensis and the first bacteriocin of the heterocycloanthracin subfamily to be characterized. PMID:24610839

  20. Sonorensin: an antimicrobial peptide, belonging to the heterocycloanthracin subfamily of bacteriocins, from a new marine isolate, Bacillus sonorensis MT93.

    PubMed

    Chopra, Lipsy; Singh, Gurdeep; Choudhary, Vikas; Sahoo, Debendra K

    2014-05-01

    Marine environments are the greatest fronts of biodiversity, representing a resource of unexploited or unknown microorganisms and new substances having potential applications. Among microbial products, antimicrobial peptides (AMPs) have received great attention recently due to their applications as food preservatives and therapeutic agents. A new marine soil isolate producing an AMP was identified as Bacillus sonorensis based on 16S rRNA gene sequence analysis. It produced an AMP that showed a broad spectrum of activity against both Gram-positive and Gram-negative bacteria. The peptide, named sonorensin, was purified to homogeneity using a combination of chromatographic techniques. The intact molecular mass of the purified peptide, 6,274 Da, as revealed by matrix-assisted laser desorption ionization-time of flight (MALDI-TOF), was in agreement with Tricine-SDS-PAGE analysis. A PCR array of primers was used to identify AMP structural genes, which allowed the successful amplification of the related genes from strain MT93. The putative open reading frame of sonorensin was amplified, cloned into the pET-32a(+) vector, expressed as a thioredoxin (Trx) fusion protein in Escherichia coli, and then purified. Sequence alignment analysis revealed that the bacteriocin being reported could belong to new subfamily of bacteriocins, heterocycloanthracin. The peptide indicated its potential as a biocontrol agent or food antimicrobial agent, due to its antimicrobial activity against bacteria such as Listeria monocytogenes and Staphylococcus aureus. This is the first report of the production, purification, and characterization of wild-type and recombinant bacteriocin by B. sonorensis and the first bacteriocin of the heterocycloanthracin subfamily to be characterized.

  1. [The estimation of possibilities for the application of the laser capture microdissection technology for the molecular-genetic expert analysis (genotyping) of human chromosomal DNA].

    PubMed

    Ivanov, P L; Leonov, S N; Zemskova, E Iu

    2012-01-01

    The present study was designed to estimate the possibilities of application of the laser capture microdissection (LCM) technology for the molecular-genetic expert analysis (genotyping) of human chromosomal DNA. The experimental method employed for the purpose was the multiplex multilocus analysis of autosomal DNA polymorphism in the preparations of buccal epitheliocytes obtained by LCM. The key principles of the study were the application of physical methods for contrast enhancement of the micropreparations (such as phase-contrast microscopy and dark-field microscopy) and PCR-compatible cell lysis. Genotyping was carried out with the use of AmpFISTR Minifiler TM PCR Amplification Kits ("Applied Biosynthesis", USA). It was shown that the technique employed in the present study ensures reliable genotyping of human chromosomal DNA in the pooled preparations containing 10-20 dissected diploid cells each. This result fairly well agrees with the calculated sensitivity of the method. A few practical recommendations are offered.

  2. Characterization of AmpC, CTX-M and MBLs types of β-lactamases in clinical isolates of Klebsiella pneumoniae and Escherichia coli producing Extended Spectrum β-lactamases in Kerman, Iran

    PubMed Central

    Mansouri, Shahla; Kalantar Neyestanaki, Davood; Shokoohi, Mostafa; Halimi, Shahnaz; Beigverdi, Reza; Rezagholezadeh, Fereshteh; Hashemi, Ali

    2014-01-01

    Background: Extended spectrum β-lactamases (ESBLs) and AmpC β-lactamases enzyme are major sources of resistance to β-lactam antibiotics especially in Enterobacteriaceae such as Escherichia coli and Klebsiella pneumoniae. Increasing frequency of the co-existence of ESBLs with AmpC-β-lactamases in bacteria is a serious threat for treating bacterial infections. Objectives: The aim of this study was to determine the presence of AmpC and CTX-M types of β-lactamases in clinical isolates of E. coli and K. pneumoniae producing ESBLs. Materials and Methods: Resistance to different antibiotics was determined using the standard disk diffusion method. ESBLs, MBLs and AmpC-β-lactamases were detected by the combination double disk test (CDDT) method and polymerase chain reaction (PCR) was used to determine blaCTX-M genes in the ESBLs and AmpC positive isolates. Results: The prevalence of ESBLs and AmpC-β-lactamase producer isolates was 181 (43.8%) and 133 (37.2%), respectively. The prevalence of blaCTX-M among isolates was 61 (14.7%). Conclusions: Outbreak of isolates co-expressing AmpC-β-lactamases and ESBLs can cause serious problems in the future, regarding the treatment of infections caused by these common enteric pathogens. PMID:25147671

  3. [Expression of plant antimicrobial peptide pro-SmAMP2 gene increases resistance of transgenic potato plants to Alternaria and Fusarium pathogens].

    PubMed

    Vetchinkina, E M; Komakhina, V V; Vysotskii, D A; Zaitsev, D V; Smirnov, A N; Babakov, A V; Komakhin, R A

    2016-09-01

    The chickweed (Stellaria media L.) pro-SmAMP2 gene encodes the hevein-like peptides that have in vitro antimicrobial activity against certain harmful microorganisms. These peptides play an important role in protecting the chickweed plants from infection, and the pro-SmAMP2 gene was previously used to protect transgenic tobacco and Arabidopsis plants from phytopathogens. In this study, the pro-SmAMP2 gene under control of viral CaMV35S promoter or under control of its own pro-SmAMP2 promoter was transformed into cultivated potato plants of two cultivars, differing in the resistance to Alternaria: Yubiley Zhukova (resistant) and Skoroplodny (susceptible). With the help of quantitative real-time PCR, it was demonstrated that transgenic potato plants expressed the pro-SmAMP2 gene under control of both promoters at the level comparable to or exceeding the level of the potato actin gene. Assessment of the immune status of the transformants demonstrated that expression of antimicrobial peptide pro-SmAMP2 gene was able to increase the resistance to a complex of Alternaria sp. and Fusarium sp. phytopathogens only in potato plants of the Yubiley Zhukova cultivar. The possible role of the pro-SmAMP2 products in protecting potatoes from Alternaria sp. and Fusarium sp. is discussed.

  4. The pro-apoptotic protein Bim is a convergence point for cAMP/protein kinase A- and glucocorticoid-promoted apoptosis of lymphoid cells.

    PubMed

    Zhang, Lingzhi; Insel, Paul A

    2004-05-14

    The mechanisms by which cAMP mediates apoptosis are not well understood. In the current studies, we used wild-type (WT) S49 T-lymphoma cells and the kin(-) variant (which lacks protein kinase A (PKA)) to examine cAMP/PKA-mediated apoptosis. The cAMP analog, 8-CPT-cAMP, increased phosphorylation of the cAMP response element-binding protein (CREB), activated caspase-3, and induced apoptosis in WT but not in kin(-) S49 cells. Using an array of 96 apoptosis-related genes, we found that treatment of WT cells with 8-CPT-cAMP for 24 h induced expression of mRNA for the pro-apoptotic gene, Bim. Real-time PCR analysis indicated that 8-CPT-cAMP increased Bim RNA in WT cells in <2 h and maintained this increase for >24 h. Bim protein expression increased in WT but not kin(-) cells treated with 8-CPT-cAMP or with the beta-adrenergic receptor agonist isoproterenol. Both apoptosis and Bim expression were reversible with removal of 8-CPT-cAMP after <6 h. The glucocorticoid dexamethasone also promoted apoptosis and Bim expression in S49 cells. In contrast, both UV light and anti-mouse Fas monoclonal antibody promoted apoptosis in S49 cells but did not induce Bim expression. 8-CPT-cAMP also induced Bim expression and enhanced dexamethasone-promoted apoptosis in human T-cell leukemia CEM-C7-14 (glucocorticoid-sensitive) and CEM-C1-15 (glucocorticoid-resistant) cells; increased Bim expression in 8-CPT-cAMP-treated CEM-C1-15 cells correlated with conversion of the cells from resistance to sensitivity to glucocorticoid-promoted apoptosis. Induction of Bim appears to be a key event in cAMP-promoted apoptosis in both murine and human T-cell lymphoma and leukemia cells and thus appears to be a convergence point for the killing of such cells by glucocorticoids and agents that elevate cAMP.

  5. Screen for leukotoxin mutants in Aggregatibacter actinomycetemcomitans: genes of the phosphotransferase system are required for leukotoxin biosynthesis.

    PubMed

    Isaza, Maria P; Duncan, Matthew S; Kaplan, Jeffrey B; Kachlany, Scott C

    2008-08-01

    Aggregatibacter (formerly Actinobacillus) actinomycetemcomitans is a pathogen that causes localized aggressive periodontitis and extraoral infections including infective endocarditis. Recently, we reported that A. actinomycetemcomitans is beta-hemolytic on certain growth media due to the production of leukotoxin (LtxA). Based on this observation and our ability to generate random transposon insertions in A. actinomycetemcomitans, we developed and carried out a rapid screen for LtxA mutants. Using PCR, we mapped several of the mutations to genes that are known or predicted to be required for LtxA production, including ltxA, ltxB, ltxD, and tdeA. In addition, we identified an insertion in a gene previously not recognized to be involved in LtxA biosynthesis, ptsH. ptsH encodes the protein HPr, a phosphocarrier protein that is part of the sugar phosphotransferase system. HPr results in the phosphorylation of other proteins and ultimately in the activation of adenylate cyclase and cyclic AMP (cAMP) production. The ptsH mutant showed only partial hemolysis on blood agar and did not produce LtxA. The phenotype was complemented by supplying wild-type ptsH in trans, and real-time PCR analysis showed that the ptsH mutant produced approximately 10-fold less ltxA mRNA than the wild-type strain. The levels of cAMP in the ptsH mutant were significantly lower than in the wild-type strain, and LtxA production could be restored by adding exogenous cAMP to the culture.

  6. Simultaneous genotyping of single-nucleotide polymorphisms in alcoholism-related genes using duplex and triplex allele-specific PCR with two-step thermal cycles.

    PubMed

    Shirasu, Naoto; Kuroki, Masahide

    2014-01-01

    We developed a time- and cost-effective multiplex allele-specific polymerase chain reaction (AS-PCR) method based on the two-step PCR thermal cycles for genotyping single-nucleotide polymorphisms in three alcoholism-related genes: alcohol dehydrogenase 1B, aldehyde dehydrogenase 2 and μ-opioid receptor. Applying MightyAmp(®) DNA polymerase with optimized AS-primers and PCR conditions enabled us to achieve effective and selective amplification of the target alleles from alkaline lysates of a human hair root, and simultaneously to determine the genotypes within less than 1.5 h using minimal lab equipment.

  7. Interplay among Membrane-Bound Lytic Transglycosylase D1, the CreBC Two-Component Regulatory System, the AmpNG-AmpDI-NagZ-AmpR Regulatory Circuit, and L1/L2 β-Lactamase Expression in Stenotrophomonas maltophilia

    PubMed Central

    Huang, Yi-Wei; Wu, Chao-Jung; Hu, Rouh-Mei; Lin, Yi-Tsung

    2015-01-01

    Lytic transglycosylases (LTs) are an important class of enzymes involved in peptidoglycan (PG) cleavage, with the concomitant formation of an intramolecular 1,6-anhydromuramoyl reaction product. There are six annotated LT genes in the Stenotrophomonas maltophilia genome, including genes for five membrane-bound LTs (mltA, mltB1, mltB2, mltD1, and mltD2) and a gene for soluble LT (slt). Six LTs of S. maltophilia KJ were systematically mutated, yielding the ΔmltA, ΔmltB1, ΔmltB2, ΔmltD1, ΔmltD2, and Δslt mutants. Inactivation of mltD1 conferred a phenotype of elevated uninduced β-lactamase activity. The underlying mechanism responsible for this phenotype was elucidated by the construction of several mutants and determination of β-lactamase activity. The expression of the genes assayed was assessed by quantitative reverse transcriptase PCR and a promoter transcription fusion assay. The results demonstrate that ΔmltD1 mutant-mediated L1/L2 β-lactamase expression involved the creBC two-component regulatory system (TCS) and the ampNG-ampDI-nagZ-ampR regulatory circuit. The inactivation of mltD1 resulted in mltB1 and mltD2 upexpression in a creBC- and ampNG-dependent manner. The overexpressed MltB1 and MltD2 activity contributed to the expression of the L1/L2 β-lactamase genes via the ampNG-ampDI-nagZ-ampR regulatory circuit. These findings reveal, for the first time, a linkage between LTs, the CreBC TCS, the ampNG-ampDI-nagZ-ampR regulatory circuit, and L1/L2 β-lactamase expression in S. maltophilia. PMID:26282431

  8. AmpC-BETA Lactamases among Enterobacteriaceae Isolated at a Tertiary Hospital, South Western Uganda

    PubMed Central

    Nakaye, Martha; Bwanga, Freddie; Itabangi, Herbert; Stanley, Iramiot J.; Bashir, Mwambi; Bazira, Joel

    2015-01-01

    Aim To characterize AmpC-beta lactamases among Enterobacteriaceae isolates from clinical samples at Mbarara Regional Referral Hospital. Study Design Laboratory-based descriptive cross-sectional study Place and Duration of Study Microbiology Department, Mbarara Regional Referral Hospital and MBN clinical Laboratories, between May to September 2013. Methodology This study included 293 Enterobacteriaceae isolates recovered from clinical specimens that included blood, urine, stool and aspirates. AmpC Beta lactamase production was determined using disc placement method for cefoxitin at a break point of <18mm. Common AmpC plasmid mediated genes were EBC, ACC, FOX, DHA, CIT and MOX were; was determined by Multiplex PCR as described by Hanson and Perez-Perez. Results Plasmid mediated AmpC phenotype was confirmed in 107 of the 293 (36.5%) cefoxitin resistant isolates with 30 isolates having more than one gene coding for resistance. The commonest source that harbored AmpC beta lactamases was urine and E. coli was the most common AmpC producer (59.5%). The genotypes detected in this study, included EBC (n=36), FOX (n=18), ACC (n=11), CIT (n=10), DHA (n=07) and MOX (n=1). Conclusion Our findings showed that prevalence of AmpC beta-lactamase at MRRH was high (39.6), with EBC as the commonest genotype among Enterobacteriaceae Urine and E. coli were the commonest source and organism respectively that harbored AmpC beta-lactamases. There‘s rational antimicrobial therapy and antibiotic susceptibility tests should be requested by health workers especially patients presenting with urinary tract infections and bacteraemias. PMID:26078920

  9. Prevalence of AmpC and other beta-lactamases in enterobacteria at a large urban university hospital in Brazil

    PubMed Central

    Dias, Rubens Clayton da Silva; Borges-Neto, Armando Alves; Ferraiuoli, Giovanna Ianini D’Almeida; de-Oliveira, Márcia P.; Riley, Lee W.; Moreira, Beatriz Meurer

    2010-01-01

    Production of extended-spectrum β-lactamases (ESBL) has been reported in virtually all species of Enterobacteriaceae, which greatly complicates the therapy of infections caused by these organisms. However, the frequency of isolates producing AmpC β-lactamases, especially plasmid mediated AmpC (pAmpC), is largely unknown. These β-lactamases confer resistance to extended spectrum cephalosporins and aztreonam, a multidrug-resistant (MDR) profile. The aim of the present study was to determine the occurrence of ESBL and pAmpC β-lactamases in a hospital where MDR enterobacterial isolates recently emerged. A total of 123 consecutive enterobacterial isolates obtained from 112 patients at a university hospital in Rio de Janeiro, Brazil during March-June 2001 were included in the study. ESBL was detected by the addition of clavulanate to cephalosporin containing disks and by double diffusion. AmpC production was evaluated by a modified tridimensional test and a modified Hodge test. The presence of plasmid-mediated ampC β-lactamase genes was evaluated by multiplex-PCR. Sixty-five (53%) of 123 enterobacterial isolates were MDR, obtained from 56 patients. ESBL production was detected in 35 isolates; 5 clonal E. coli isolates exhibited high levels of chromosomal AmpC and ESBL production. However, no isolates contained pAmpC genes. Infection or colonization by MDR enterobacteria was not associated with any predominant resistant clones. A large proportion of hospital infections caused by ESBL-producing enterobacteria identified during the study period were due to sporadic infections rather than undetected outbreaks. This observation emphasizes the need to improve our detection methods for ESBL- and AmpC-producing organisms in hospitals where extended-spectrum cephalosporins are in wide use. PMID:17900845

  10. Hydrostatic pressure-dependent changes in cyclic AMP signaling in optic nerve head astrocytes from Caucasian and African American donors

    PubMed Central

    Chen, Lin; Hernandez, M. Rosario

    2009-01-01

    Purpose Investigate the effect of hydrostatic pressure (HP) on 3′, 5′-cyclic adenosine monophosphate (cAMP) levels and downstream signaling in cultures of normal optic nerve head (ONH) astrocytes from Caucasian American (CA) and African American (AA) donors. Methods Intracellular cAMP levels were assayed after exposing ONH astrocytes to HP for varying times. Quantitative RT–PCR was used to determine the expression levels of selected cAMP pathway genes in human ONH astrocytes after HP treatment. Western blots were used to measure changes in the phosphorylation state of cAMP response element binding protein (CREB) in astrocytes subjected to HP, ATP, and phosphodiesterase or kinase inhibitors. Results The basal intracellular cAMP level is similar among AA and CA astrocytes. After exposure to HP for 15 min and 30 min in the presence of a phosphodiesterase inhibitor a further increase of intracellular cAMP was observed in AA astrocytes, but not in CA astrocytes. Consistent with activation of the cAMP-dependent protein kinase pathway, CREB phosphorylation (Ser-133) was increased to a greater extent in AA than in CA astrocytes after 3 h of HP. Exposure to elevated HP for 3–6 h differentially altered the expression levels of selected cAMP pathway genes (ADCY3, ADCY9, PTHLH, PDE7B) in AA compared to CA astrocytes. Treatment with ATP increased more CREB phosphorylation in CA than in AA astrocytes, suggesting differential Ca2+ signaling in these populations. Conclusions Activation of the cAMP-dependent signaling pathway by pressure may be an important contributor to increased susceptibility to elevated intraocular pressure and glaucoma in AA, a population at higher risk for the disease. PMID:19710943

  11. Prevention of ESKAPE pathogen biofilm formation by antimicrobial peptides WLBU2 and LL37.

    PubMed

    Lin, Qiao; Deslouches, Berthony; Montelaro, Ronald C; Di, Y Peter

    2018-05-09

    Bacterial biofilm-dependent infections (e.g., cystic fibrosis, surgical sites, and medical implants) are associated with enhanced drug-resistance and thus difficult to eradicate. The goal of this study was to systematically compare three distinct classes of antimicrobial peptides (AMPs) that include the clinically used antibiotic colistin, the natural AMP LL37, the engineered cationic-AMP WLBU2, and four commonly used antibiotics with different bactericidal mechanisms (tobramycin, ciprofloxacin, ceftazidime and vancomycin) for biofilm prevention properties. Using biofilm-prevention assays, we detected bacterial biomass post-attachment in subinhibitory concentrations (1/3 of the MIC) for each AMP, by the crystal violet method, to distinguish the commonly known bactericidal from potentially distinct mechanisms of biofilm prevention. Biofilm regulatory gene expression was assessed using RT-qPCR for correlation with biofilm growth inhibition. Commonly used antibiotics at 1x MIC showed modest ESKAPE biofilm prevention while 1/3 MIC of AMPs demonstrated up to 90% of biofilm prevention. WLBU2 was generally more effective in preventing bacterial attachment than colistin and LL37. Changes in expression of bacterial genes known to affect biofilm regulation were consistent with biofilm prevention. The data warrant further exploration of AMPs with optimized structures to fill a knowledge gap on the potential application of AMPs to difficult-to-cure bacterial biofilm-related infections. Copyright © 2018. Published by Elsevier B.V.

  12. Development of internal amplification controls for DNA profiling with the AmpFℓSTR(®) SGM Plus(®) kit.

    PubMed

    Zahra, Nathalie; Hadi, Sibte; Smith, Judith A; Iyengar, Arati; Goodwin, William

    2011-06-01

    DNA extracted from forensic samples can be degraded and also contain co-extracted contaminants that inhibit PCR. The effects of DNA degradation and PCR inhibition are often indistinguishable when examining a DNA profile. Two internal amplification controls (IACs) were developed to improve quality control of PCR using the AmpFℓSTR® SGM Plus® kit. The co-amplification of these controls with DNA samples was used to monitor amplification efficiency and detect PCR inhibitors. IAC fragments of 90 and 410 bp (IAC₉₀ and IAC₄₁₀) were generated from the plasmid pBR322 using tailed primers and then amplified with ROX-labelled primers. Co-amplification of IAC₉₀ and IAC₄₁₀ was performed with varying amounts of template DNA, degraded DNA and DNA contaminated with humic acid, heme and indigo dye. Both IAC₉₀ and IAC₄₁₀ were successfully amplified with human DNA without significantly affecting the quality of the DNA profile, even with DNA amounts lower than 0.5 ng. In the presence of inhibitors, the IAC₉₀ signal was still present after all human DNA loci fail to amplify; in contrast, the IAC₄₁₀ signal was reduced or absent at low levels of inhibition. Amplification of the two IACs provided an internal PCR control and allowed partial profiles caused by inhibition to be distinguished from degraded DNA profiles. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Screen for Leukotoxin Mutants in Aggregatibacter actinomycetemcomitans: Genes of the Phosphotransferase System Are Required for Leukotoxin Biosynthesis▿

    PubMed Central

    Isaza, Maria P.; Duncan, Matthew S.; Kaplan, Jeffrey B.; Kachlany, Scott C.

    2008-01-01

    Aggregatibacter (formerly Actinobacillus) actinomycetemcomitans is a pathogen that causes localized aggressive periodontitis and extraoral infections including infective endocarditis. Recently, we reported that A. actinomycetemcomitans is beta-hemolytic on certain growth media due to the production of leukotoxin (LtxA). Based on this observation and our ability to generate random transposon insertions in A. actinomycetemcomitans, we developed and carried out a rapid screen for LtxA mutants. Using PCR, we mapped several of the mutations to genes that are known or predicted to be required for LtxA production, including ltxA, ltxB, ltxD, and tdeA. In addition, we identified an insertion in a gene previously not recognized to be involved in LtxA biosynthesis, ptsH. ptsH encodes the protein HPr, a phosphocarrier protein that is part of the sugar phosphotransferase system. HPr results in the phosphorylation of other proteins and ultimately in the activation of adenylate cyclase and cyclic AMP (cAMP) production. The ptsH mutant showed only partial hemolysis on blood agar and did not produce LtxA. The phenotype was complemented by supplying wild-type ptsH in trans, and real-time PCR analysis showed that the ptsH mutant produced approximately 10-fold less ltxA mRNA than the wild-type strain. The levels of cAMP in the ptsH mutant were significantly lower than in the wild-type strain, and LtxA production could be restored by adding exogenous cAMP to the culture. PMID:18541661

  14. Effect of triptolide on progesterone production from cultured rat granulosa cells.

    PubMed

    Zhang, J; Jiang, Z; Mu, X; Wen, J; Su, Y; Zhang, L

    2012-06-01

    Triptolide(CAS 38748-32-2), a major active component of Tripterygium wilfordii Hook F (TWHF), is known to have multiple pharmacological activities. However, studies have also shown that triptolide is highly disrupt to the reproductive system by disrupting normal steroid hormone signaling. In the present study, we investigated the effect of triptolide (5, 10, or 20 nM for 24 h) on progesterone production by rat granulosa cells. Triptolide inhibited both basal and human chorionic gonadotropin (HCG)- and 8-bromo-cAMP-stimulated progesterone production as revealed by RIA assay. Furthermore, the HCG-evoked increase in cellular cAMP content was also inhibited by triptolide, indicating that disruption of the cAMP/PKA signaling pathway may mediate the deleterious effects of triptolide on progesterone regulation. In addition, triptolide inhibited 25-OH-cholesterol-stimulated progesterone production, suggesting that activity of the P450 side chain cleavage (P450scc) enzyme was also be inhibited by triptolide. Western blot and quantitative real-time PCR (qRT-PCR) assays further revealed that triptolide decreased mRNA and protein expression of P450scc and the steroidogenic regulatory (StAR) protein in granulosa cells. In contrast, cell viability tests using 3-(4,5-dimethyl-thiazol-2-yl)-2,5- diphenyl-tetrazolium bromide (MTT) indicated that triptolide did not cause measurable cell death at doses that suppressed steroidogenesis. The reproductive toxicity of triptolide may be caused by disruption of cAMP/PKA-mediated expression of a number of progesterone synthesis enzymes or regulatory proteins, leading to reduced progesterone synthesis and reproductive dysfunction. © Georg Thieme Verlag KG Stuttgart · New York.

  15. The occurrence of ESBL-producing Escherichia coli carrying aminoglycoside resistance genes in urinary tract infections in Saudi Arabia.

    PubMed

    Alyamani, Essam J; Khiyami, Anamil M; Booq, Rayan Y; Majrashi, Majed A; Bahwerth, Fayez S; Rechkina, Elena

    2017-01-06

    The infection and prevalence of extended-spectrum β-lactamases (ESBLs) is a worldwide problem, and the presence of ESBLs varies between countries. In this study, we investigated the occurrence of plasmid-mediated ESBL/AmpC/carbapenemase/aminoglycoside resistance gene expression in Escherichia coli using phenotypic and genotypic techniques. A total of 58 E. coli isolates were collected from hospitals in the city of Makkah and screened for the production of ESBL/AmpC/carbapenemase/aminoglycoside resistance genes. All samples were subjected to phenotypic and genotypic analyses. The antibiotic susceptibility of the E. coli isolates was determined using the Vitek-2 system and the minimum inhibitory concentration (MIC) assay. Antimicrobial agents tested using the Vitek 2 system and MIC assay included the expanded-spectrum (or third-generation) cephalosporins (e.g., cefoxitin, cefepime, aztreonam, cefotaxime, ceftriaxone, and ceftazidime) and carbapenems (meropenem and imipenem). Reported positive isolates were investigated using genotyping technology (oligonucleotide microarray-based assay and PCR). The genotyping investigation was focused on ESBL variants and the AmpC, carbapenemase and aminoglycoside resistance genes. E. coli was phylogenetically grouped, and the clonality of the isolates was studied using multilocus sequence typing (MLST). Our E. coli isolates exhibited different levels of resistance to ESBL drugs, including ampicillin (96.61%), cefoxitin (15.25%), ciprofloxacin (79.66%), cefepime (75.58%), aztreonam (89.83%), cefotaxime (76.27%), ceftazidime (81.36%), meropenem (0%) and imipenem (0%). Furthermore, the distribution of ESBL-producing E. coli was consistent with the data obtained using an oligonucleotide microarray-based assay and PCR genotyping against genes associated with β-lactam resistance. ST131 was the dominant sequence type lineage of the isolates and was the most uropathogenic E. coli lineage. The E. coli isolates also carried aminoglycoside resistance genes. The evolution and prevalence of ESBL-producing E. coli may be rapidly accelerating in Saudi Arabia due to the high visitation seasons (especially to the city of Makkah). The health authority in Saudi Arabia should monitor the level of drug resistance in all general hospitals to reduce the increasing trend of microbial drug resistance and the impact on patient therapy.

  16. Hardness Assurance Techniques for New Generation COTS Devices

    NASA Technical Reports Server (NTRS)

    Lee, C. I.; Rax, B. G.; Johnston, A. H.

    1996-01-01

    Hardness Assurance (HA) techniques and total dose radiation characterization data for new generation linear and COTS devices from various manufacturers are presented. A bipolar op amp showed significant degradation at HDR, not at low dose rate environment. New generation low-power op amps showed more degradation at low voltage applications. HA test techniques for COTS devices are presented in this paper.

  17. Effect of dibutyryl cyclic adenosine monophosphate on the gene expression of plasminogen activator inhibitor-1 and tissue factor in adipocytes.

    PubMed

    Taniguchi, Makoto; Ono, Naoko; Hayashi, Akira; Yakura, Yuwna; Takeya, Hiroyuki

    2011-10-01

    Hypertrophic adipocytes in obese states express the elevated levels of plasminogen activator inhibitor-1 (PAI-1) and tissue factor (TF). An increase in the intracellular concentration of cyclic adenosine monophosphate (cAMP) promotes triglyceride hydrolysis and may improve dysregulation of adipocyte metabolism. Here, we investigate the effect of dibutyryl-cAMP (a phosphodiesterase-resistant analog of cAMP) on the gene expression of PAI-1 and TF in adipocytes. Differentiated 3T3-L1 adipocytes were treated with dibutyryl-cAMP and agents that would be expected to elevate intracellular cAMP, including cilostazol (a phosphodiesterase inhibitor with anti-platelet and vasodilatory properties), isoproterenol (a beta adrenergic agonist) and forskolin (an adenylyl cyclase activator). The levels of PAI-1 and TF mRNAs were measured using real-time quantitative reverse transcription-PCR. The treatment of adipocytes with dibutyryl-cAMP resulted in the inhibition of both lipid accumulation and TF gene expression. However, PAI-1 gene expression was slightly but significantly increased by dibutyryl-cAMP. On the other hand, cilostazol inhibited the expression of PAI-1 without affecting lipid accumulation. When the adipocytes were treated with cilostazol in combination with isoproterenol or forskolin, the inhibitory effect of cilostazol on PAI-1 gene expression was counteracted, thus suggesting that inhibition by cilostazol may not be the result of intracellular cAMP accumulation by phosphodiesterase inhibition. These results suggest the implication of cAMP in regulation of the gene expression of TF and PAI-1 in adipocytes. Our findings will serve as a useful basis for further research in therapy for obesity-associated thrombosis. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Development of PCR internal controls for DNA profiling with the AmpFℓSTR® SGM Plus® amplification kit.

    PubMed

    Nathalie, Zahra; Hadi, Sibte; Goodwin, William

    2012-09-01

    Forensic DNA profiling uses a series of commercial kits that co-amplify several loci in one reaction; the products of the PCR are fluorescently labelled and analysed using CE. Before CE, an aliquot of the PCR is mixed with formamide and an internal lane size standard. Using the SGM Plus amplification kit, we have developed two internal non-amplified controls of 80 bp and 380 bp that are labelled with ROX fluorescent dye and added to the PCR. Combined with two internal amplification controls of 90 bp and 410 bp, they provide additional controls for the PCR, electrokinetic injection, and CE and also function as an internal size standard. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Occurrence and molecular characteristics of ESBL/AmpC-producing Escherichia coli in faecal samples from horses in an equine clinic.

    PubMed

    Apostolakos, Ilias; Franz, Eelco; van Hoek, Angela H A M; Florijn, Alice; Veenman, Christiaan; Sloet-van Oldruitenborgh-Oosterbaan, Marianne M; Dierikx, Cindy; van Duijkeren, Engeline

    2017-07-01

    To investigate the occurrence and characteristics of ESBL/AmpC-producing Escherichia coli in faecal samples from horses at one equine clinic in the Netherlands. A total of 91 horses, including residents and patients, were sampled. ESBL/AmpC-producing E. coli were identified by a combination disc diffusion test. Phylogenetic groups and MLST were determined. ESBL/AmpC genes were analysed using PCR and sequencing. Plasmids were characterized by transformation and PCR-based replicon typing. Subtyping of plasmids was done by plasmid MLST. At least one E. coli isolate with a confirmed ESBL/AmpC gene was found in samples from 76 horses (84%). Although phylogenetic group B1 E. coli bla CTX-M-1 predominated, a diverse E. coli population was found, indicating that clonal nosocomial spread was not the only reason for the high occurrence found. MLST analysis revealed the presence of 47 E. coli STs, organized in four clusters of genetically related strains. ST10, ST641, ST1079 and ST1250 were most commonly found. With regard to the genes, bla CTX-M-1 was most prevalent ( n  =   91), followed by bla CTX-M-2 ( n  =   26). The most frequently found plasmid type was IncHI1, but plasmids belonging to the IncF, IncI1 and IncN groups were also identified. A high occurrence of ESBL-producing E. coli in faecal samples was found among horses in an equine clinic and the variety of STs, ESBL genes and plasmid types suggests nosocomial transmission. ESBL E. coli can cause difficult-to-treat infections in horses and prudent use of antimicrobials is warranted. A further assessment of the risks of transmission to persons in close contact with horses, such as caretakers or veterinarians, is crucial. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Anteromedial portal versus transtibial drilling techniques in ACL reconstruction: a blinded cross-sectional study at two- to five-year follow-up

    PubMed Central

    Alentorn-Geli, Eduard; Samitier, Gonzalo; Álvarez, Pedro; Steinbacher, Gilbert

    2010-01-01

    Drilling of the femoral tunnel with the transtibial (TT) technique is widely used in bone-patellar tendon-bone (BPTB) anterior cruciate ligament (ACL) reconstruction. Recent studies suggest higher knee stability with the use of the anteromedial portal (AMP). The purpose of this study was to compare functional and clinical outcomes of BPTB ACL reconstruction using the TT or the AMP technique for drilling the femoral tunnel. All ACL reconstructions between January 2003 and April 2006 were approached for eligibility. Forty-seven patients met inclusion criteria (21 TT group and 26 AMP group). Blinded assessments of IKDC score, knee stability and range of motion, one-leg hop test, mid-quadriceps circumference, VAS for satisfaction with surgery, Lysholm and Tegner scores, and SF-12 questionnaire were obtained for both groups. Data on preoperative and postoperative surgical timing were retrospectively reviewed through the charts. The AMP group demonstrated a significantly lower recovery time from surgery to walking without crutches (p < 0.01), to return to normal life (p < 0.03), to return jogging (p < 0.03), to return training (p < 0.03), and to return to play (p < 0.03). Knee stability values measured with KT-1000, Lachman test, pivot-shift sign, and objective IKDC score assessments were significantly better for the AMP compared to TT group (p < 0.002, p < 0.03, p < 0.02, p < 0.015, respectively). No differences were found for VAS for satisfaction with surgery, Lysholm, Tegner, and SF-12 between both groups. The use of the AMP technique significantly improved the anterior-posterior and rotational knee stability, IKDC scores, and recovery time from surgery compared to the TT technique. PMID:20401753

  1. Further studies on the effect of adenosine cyclic monophosphate derivatives on cell proliferation in the jejunal crypts of rat.

    PubMed

    Tutton, P J; Barkla, D H

    1982-01-01

    1. Cell proliferation in the jejunal crypt epithelium of rat was measured using a stathmokinetic technique. 2. Sodium butyrate was found to promote jejunal crypt cell proliferation. 3. N6, O2'-Dibutyryl cyclic adenosine monophosphate (cAMP), N6-monobutyryl-cAMP and N6-monobutyryl-8-bromo-cAMP were found to inhibit cell proliferation when compared to sodium butyrate treated tissues. 4. 8-Chlorophenylthio-cAMP was found to inhibit cell division when compared to untreated animals. 5. O2'-Monobutyryl cAMP and 8-bromo-cAMP were not found to inhibit cell proliferation.

  2. Selection of hyperproduction of AmpC and SME-1 in a carbapenem-resistant Serratia marcescens isolate during antibiotic therapy.

    PubMed

    Hemarajata, Peera; Amick, Thomas; Yang, Shangxin; Gregson, Aric; Holzmeyer, Cameron; Bush, Karen; Humphries, Romney M

    2018-02-19

    Antibiotic selective pressure may result in changes to antimicrobial susceptibility throughout the course of infection, especially for organisms that harbour chromosomally encoded AmpC β-lactamases, notably Enterobacter spp., in which hyperexpression of ampC may be induced following treatment with cephalosporins. In this study, we document a case of bacteraemia caused by a blaSME-1-harbouring Serratia marcescens that subsequently developed resistance to expanded-spectrum cephalosporins, piperacillin/tazobactam and fluoroquinolones, over the course of several months of treatment with piperacillin/tazobactam and ciprofloxacin. Susceptibility testing and WGS were performed on three S. marcescens isolates from the patient. β-Lactamase activity in the presence or absence of induction by imipenem was measured by nitrocefin hydrolysis assays. Expression of ampC and blaSME-1 under the same conditions was determined by real-time PCR. WGS demonstrated accumulation of missense and nonsense mutations in ampD associated with stable derepression of AmpC. Gene expression and β-lactamase activity of both AmpC and SME-1 were inducible in the initial susceptible isolate, but were constitutively high in the resistant isolate, in which total β-lactamase activity was increased by 128-fold. Although development of such in vitro resistance due to selective pressure imposed by antibiotics is reportedly low in S. marcescens, our findings highlight the need to evaluate isolates on a regular basis during long-term antibiotic therapy.

  3. Molecular and clinical characterization of plasmid-mediated AmpC β-lactamase-producing Escherichia coli bacteraemia: a comparison with extended-spectrum β-lactamase-producing and non-resistant E. coli bacteraemia.

    PubMed

    Matsumura, Y; Nagao, M; Iguchi, M; Yagi, T; Komori, T; Fujita, N; Yamamoto, M; Matsushima, A; Takakura, S; Ichiyama, S

    2013-02-01

    Plasmid-mediated AmpC β-lactamase-producing Escherichia coli (AmpC-E) bacteraemia was characterized by comparison with bacteraemia caused by extended-spectrum β-lactamase (ESBL)-producing E. coli (ESBL-E) and non-resistant E. coli (NR-E) in the era of the worldwide spread of the CTX-M-15-producing O25b-ST131-B2 clone. Of 706 bloodstream E. coli isolates collected between 2005 and 2010 in three Japanese university hospitals, 111 ESBL screening-positive isolates were analysed for AmpC and ESBL genes by PCR. A case-control study was performed in which the cases consisted of all of the patients with AmpC-E bacteraemia. Phylogenetic groups, sequence types and O25b serotype were determined. Twenty-seven AmpC-E isolates (26 of which were of the CMY-2 type) were identified, and 54 ESBL-E and 54 NR-E isolates were selected for the controls. Nineteen AmpC-E isolates were also positive for ESBL. CTX-M-14 was the most prevalent ESBL type among both the AmpC-E and ESBL-E isolates. The O25b-ST131-B2 clone was the most prevalent among the ESBL-E isolates (26%) and the second most prevalent among the NR-E isolates (13%), but only one O25b-ST131-B2 clone was found among the AmpC-E isolates. Twenty-three different sequence types were identified among the AmpC-E isolates. When compared with bacteraemia with ESBL-E, previous isolation of multidrug-resistant bacteria and intravascular catheterization were independently associated with a lower risk for AmpC-E. When compared with NR-E bacteraemia, prior use of antibiotics was the only significant risk factor for AmpC-E. Unlike the spread of the O25b-ST131-B2 clone between ESBL-E and NR-E, the AmpC-E isolates were not dominated by any specific clone. © 2012 The Authors. Clinical Microbiology and Infection © 2012 European Society of Clinical Microbiology and Infectious Diseases.

  4. Development of a real-time fluorescence loop-mediated isothermal amplification assay for rapid and quantitative detection of Fusarium oxysporum f. sp. cubense tropical race 4 in soil.

    PubMed

    Zhang, Xin; Zhang, He; Pu, Jinji; Qi, Yanxiang; Yu, Qunfang; Xie, Yixian; Peng, Jun

    2013-01-01

    Fusarium oxysporum f. sp. cubense (Foc), the causal agent of Fusarium wilt (Panama disease), is one of the most devastating diseases of banana (Musa spp.). The Foc tropical race 4 (TR4) is currently known as a major concern in global banana production. No effective resistance is known in Musa to Foc, and no effective measures for controlling Foc once banana plants have been infected in place. Early and accurate detection of Foc TR4 is essential to protect banana industry and guide banana planting. A real-time fluorescence loop-mediated isothermal amplification assay (RealAmp) was developed for the rapid and quantitative detection of Foc TR4 in soil. The detection limit of the RealAmp assay was approximately 0.4 pg/µl plasmid DNA when mixed with extracted soil DNA or 10(3) spores/g of artificial infested soil, and no cross-reaction with other relative pathogens were observed. The RealAmp assay for quantifying genomic DNA of TR4 was confirmed by testing both artificially and naturally infested samples. Quantification of the soil-borne pathogen DNA of Foc TR4 in naturally infested samples was no significant difference compared to classic real-time PCR (P>0.05). Additionally, RealAmp assay was visual with an improved closed-tube visual detection system by adding SYBR Green I fluorescent dye to the inside of the lid prior to amplification, which avoided the inhibitory effects of the stain on DNA amplification and makes the assay more convenient in the field and could thus become a simple, rapid and effective technique that has potential as an alternative tool for the detection and monitoring of Foc TR4 in field, which would be a routine DNA-based testing service for the soil-borne pathogen in South China.

  5. Efficacy of amoxycillin-clavulanate in an experimental model of murine pneumonia caused by AmpC-non-hyperproducing clinical isolates of Escherichia coli resistant to cefoxitin.

    PubMed

    Docobo-Pérez, F; Fernández-Cuenca, F; Pachón-Ibáñez, M E; Pascual, A; Pichardo, C; Martínez-Martínez, L; Pachón, J

    2008-06-01

    The algorithms included in most automated systems used for antimicrobial susceptibility testing (e.g., Vitek 2) consider that Escherichia coli isolates resistant to cefoxitin are AmpC-hyperproducers and, consequently, resistant also to amoxycillin-clavulanate. However, a recent study revealed that 30% of E. coli clinical isolates resistant to cefoxitin remained susceptible in vitro to amoxycillin-clavulanate. The aim of the present study was to evaluate the in-vivo efficacy of amoxycillin-clavulanate in the treatment of an experimental model of pneumonia, using two clonally related isolates (with identical repetitive extragenic palindromic sequence (REP)-PCR patterns) of AmpC-non-hyperproducing and OmpF-lacking E. coli (Ec985 and Ec571) that were resistant to cefoxitin and susceptible to cefotaxime and amoxycillin-clavulanate. MICs were determined using a microdilution technique, and in-vitro bactericidal activity was tested using time-kill assays. The in-vivo efficacy of amoxycillin, amoxycillin-clavulanate and cefotaxime against both isolates was tested in a murine pneumonia model using immunocompetent C57BL/6 mice. Ec571 (a TEM-1/2 producer) was resistant to amoxycillin, whereas Ec985 (a TEM-1/2 non-producer) was susceptible. Amoxycillin, amoxycillin-clavulanate and cefotaxime were bactericidal for Ec985, and amoxycillin-clavulanate and cefotaxime were bactericidal for Ec571 at different concentrations and time-points, as determined using time-kill assays. Treatment with amoxycillin, amoxycillin-clavulanate and cefotaxime reduced the bacterial lung concentration of Ec985 compared with non-treated controls (p <0.05), whereas amoxycillin-clavulanate and cefotaxime showed efficacy against Ec571 when compared with the control and amoxycillin groups (p <0.05). Regardless of the exact underlying mechanism(s) of resistance, amoxycillin-clavulanate was effective in the experimental murine model in the treatment of pneumonia caused by AmpC-non-hyperproducing strains of E. coli resistant to cefoxitin.

  6. Halocin C8: an antimicrobial peptide distributed among four halophilic archaeal genera: Natrinema, Haloterrigena, Haloferax, and Halobacterium.

    PubMed

    Besse, Alison; Vandervennet, Manon; Goulard, Christophe; Peduzzi, Jean; Isaac, Stéphanie; Rebuffat, Sylvie; Carré-Mlouka, Alyssa

    2017-05-01

    Halophilic archaea thrive in hypersaline ecosystems and produce antimicrobial peptides (AMPs) named halocins. AMPs are essential effectors of microbial interactions in natural ecosystems. Halocin C8 is a 7.4 kDa peptide produced by Natrinema sp. AS7092. Surrounded by genes involved in regulation and transport, the halC8 gene encodes a precursor, processed into the mature halocin and an immunity protein, protecting the producing strain against its halocin. This feature constitutes a unique property of halocin C8, as known AMPs and their immunity proteins are generally encoded on distinct ORFs in an operon. By complementary in silico and PCR-based approaches, the presence of halC8 in halophilic archaea collected from various parts of the world was evidenced. The full-length halC8 gene is restricted and consistently found in the genomes of strains belonging to the phylogenetically related genera Natrinema and Haloterrigena, along with transport and regulation genes. Functional expression of halC8 was demonstrated by RT-PCR and antimicrobial assays. Active halocin C8 was shown to contain five disulphide bridges, presumably conferring a compact structure resistant to harsh environmental conditions. In other archaeal genera, Haloferax and Halobacterium, genes encoding halocin C8 with diverging immunity protein moiety were evidenced. A phylogenetic analysis of halocin C8 sequences was conducted.

  7. Longitudinal monitoring of extended-spectrum-beta-lactamase/AmpC-producing Escherichia coli at German broiler chicken fattening farms.

    PubMed

    Laube, H; Friese, A; von Salviati, C; Guerra, B; Käsbohrer, A; Kreienbrock, L; Roesler, U

    2013-08-01

    Antimicrobial resistance of Escherichia coli to modern beta-lactam antibiotics due to the production of extended-spectrum beta-lactamases (ESBL) and/or plasmid-mediated AmpC beta-lactamases (AmpC) represents an emerging and increasing resistance problem that dramatically limits therapeutic options in both human and veterinary medicine. The presence of ESBL/AmpC genes in commensal E. coli from food-producing animals like broilers may pose a human health hazard. However, there are no data available concerning the prevalence of ESBL/AmpC-producing E. coli in German broiler flocks using selective methods. In this longitudinal study, samples were taken from seven conventional broiler fattening farms at three different times within one fattening period. Various samples originating from the animals as well as from their direct environment in the barn were investigated for the occurrence of ESBL/AmpC-producing E. coli. Average detection levels of 51, 75, and 76% in animal samples collected during the three samplings in the course of the fattening period demonstrate a colonization of even 1-day-old chicks, as well as a continuous significant (P < 0.001) increase in prevalence thereafter. The detection frequencies in housing environmental samples were relatively high, with an increase over time, and ranged between 54.2 and 100%. A total of 359 E. coli isolates were characterized by PCR and partly via the disc diffusion method. This study shows that prevalence of ESBL/AmpC-producing E. coli increases during the fattening period of the broiler flocks examined. Both colonized day-old chicks and contaminated farm environments could represent significant sources of ESBL/AmpC-producing E. coli in German broiler fattening farms.

  8. The differential importance of mutations within AmpD in cephalosporin resistance of Enterobacter aerogenes and Enterobacter cloacae.

    PubMed

    Babouee Flury, Baharak; Ellington, Matthew J; Hopkins, Katie L; Turton, Jane F; Doumith, Michel; Woodford, Neil

    2016-11-01

    Mechanisms leading to carbapenem and cephalosporin resistance were sought in Enterobacter aerogenes isolates that were highly resistant to carbapenems but had no known carbapenemase. Results were compared with recent work examining carbapenem-resistant Enterobacter cloacae. Eighteen carbapenem-resistant E. aerogenes were screened for known β-lactamase and carbapenemase genes, and novel carbapenemases were sought in whole-genome sequencing (WGS) data of the three most resistant isolates. For all isolates, ampC, ampR, ampD and the porin genes omp35 and omp36 were investigated by Sanger sequencing or from available WGS data. Expression of ampC and porin genes was measured in comparison with cephalosporin- and carbapenem-susceptible control strains by reverse transcriptase PCR, with porin translation also detected by SDS-PAGE. Loss of Omp35, primarily due to decreased transcription (up to 250×), was observed in ertapenem-resistant isolates (MICs ≥ 2 mg/L), whereas meropenem resistance (MICs ≥ 4 mg/L) was observed in those isolates also showing decreased or no production of Omp36. Loss of Omp36 was due to combinations of premature translation termination or reduced transcription. In contrast to E. cloacae, cephalosporin resistance in E. aerogenes was not associated with lesions in AmpD. High-level cefepime resistance (MIC = 32 mg/L) was caused by a novel modification in the H-10 helix of AmpC in one isolate. The differential importance of AmpD lesions in cephalosporin resistance in E. cloacae and E. aerogenes underlines the differences between these contrasting members of the Enterobacter genus. Porin loss resulted in high-level carbapenem resistance with gradual loss of Omp36, which led to high-level meropenem resistance. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  9. Phosphodiesterase 4 regulates the migration of B16-F10 melanoma cells.

    PubMed

    Watanabe, Yoshihiro; Murata, Taku; Shimizu, Kasumi; Morita, Hiroshi; Inui, Madoka; Tagawa, Toshiro

    2012-08-01

    Phosphodiesterases (PDEs) are important regulators of signal transduction processes. Eleven PDE gene families (PDE1-11) have been identified and several PDE isoforms are selectively expressed in various cell types. PDE4 family members specifically hydrolyze cyclic AMP (cAMP). Four genes (PDE4A-D) are known to encode PDE4 enzymes, with additional diversity generated by the use of alternative mRNA splicing and the use of different promoters. While PDE4 selective inhibitors show therapeutic potential for treating major diseases such as asthma and chronic obstructive pulmonary disease, little is known concerning the role of PDE4 in malignant melanoma. In this study, we examined the role of PDE4 in mouse B16-F10 melanoma cells. In these cells, PDE4 activity was found to be ∼60% of total PDE activity. RT-PCR detected only PDE4B and PDE4D mRNA. Cell growth was inhibited by the cAMP analog, 8-bromo-cAMP, but not by the specific PDE4 inhibitors, rolipram and denbufylline, which increased intracellular cAMP concentrations. Finally, migration of the B16-F10 cells was inhibited by the PDE4 inhibitors and 8-bromo-cAMP, while migration was increased by a protein kinase A (PKA) inhibitor, PKI(14-22), and was not affected by 8-pCPT-2'-O-Me-cAMP, which is an analog of exchange protein activated by cAMP (Epac). The inhibitory effect of rolipram on migration was reversed by PKI(14-22). Based on these results, PDE4 appears to play an important role in the migration of B16-F10 cells, and therefore may be a novel target for the treatment of malignant melanoma.

  10. Gα-cAMP/PKA pathway positively regulates pigmentation, chaetoglobosin A biosynthesis and sexual development in Chaetomium globosum

    PubMed Central

    Hu, Yang; Chen, Longfei; Akhberdi, Oren; Yu, Xi; Liu, Yanjie; Zhu, Xudong

    2018-01-01

    Sensing the environmental signals, the canonical Gα-cAMP/PKA pathway modulates mycelial growth and development, and negatively regulates some secondary metabolism in filamentous fungi, e.g. aflatoxin in Aspergillus nidulans. Here we report the characterization of this signaling pathway in Chaetomium globosum, a widely spread fungus known for synthesizing abundant secondary metabolites, e.g. chaetoglobosin A (ChA). RNAi-mediated knockdown of a putative Gα-encoding gene gna-1, led to plural changes in phenotype, e.g. albino mycelium, significant restriction on perithecium development and decreased production of ChA. RNA-seq profiling and qRT-PCR verified significantly fall in expression of corresponding genes, e.g. pks-1 and CgcheA. These defects could be restored by simultaneous knock-down of the pkaR gene encoding a regulatory subunit of cAMP-dependent protein kinase A (PKA), suggesting that pkaR had a negative effect on the above mentioned traits. Confirmatively, the intracellular level of cAMP in wild-type strain was about 3.4-fold to that in gna-1 silenced mutant pG14, and addition of a cAMP analog, 8-Br-cAMP, restored the same defects, e.g., the expression of CgcheA. Furthermore, the intracellular cAMP in gna-1 and pkaR double silenced mutant was approaching the normal level. The following activity inhibition experiment proved that the expression of CgcheA was indeed regulated by PKA. Down-regulation of LaeA/VeA/SptJ expression in gna-1 mutant was also observed, implying that Gα signaling may crosstalk to other regulatory pathways. Taken together, this study proposes that the heterotrimeric Gα protein-cAMP/PKA signaling pathway positively mediates the sexual development, melanin biosynthesis, and secondary metabolism in C. globosum. PMID:29652900

  11. Role of Pseudomonas aeruginosa AmpR on β-lactam and non-β-lactam transient cross-resistance upon pre-exposure to subinhibitory concentrations of antibiotics

    PubMed Central

    Kumari, Hansi; Balasubramanian, Deepak; Zincke, Diansy

    2014-01-01

    Pseudomonas aeruginosa is one of the most dreaded opportunistic pathogens accounting for 10 % of hospital-acquired infections, with a 50 % mortality rate in chronically ill patients. The increased prevalence of drug-resistant isolates is a major cause of concern. Resistance in P. aeruginosa is mediated by various mechanisms, some of which are shared among different classes of antibiotics and which raise the possibility of cross-resistance. The goal of this study was to explore the effect of subinhibitory concentrations (SICs) of clinically relevant antibiotics and the role of a global antibiotic resistance and virulence regulator, AmpR, in developing cross-resistance. We investigated the induction of transient cross-resistance in P. aeruginosa PAO1 upon exposure to SICs of antibiotics. Pre-exposure to carbapenems, specifically imipenem, even at 3 ng ml−1, adversely affected the efficacy of clinically used penicillins and cephalosporins. The high β-lactam resistance was due to elevated expression of both ampC and ampR, encoding a chromosomal β-lactamase and its regulator, respectively. Differences in the susceptibility of ampR and ampC mutants suggested non-AmpC-mediated regulation of β-lactam resistance by AmpR. The increased susceptibility of P. aeruginosa in the absence of ampR to various antibiotics upon SIC exposure suggests that AmpR plays a major role in the cross-resistance. AmpR was shown previously to be involved in resistance to quinolones by regulating MexEF–OprN efflux pump. The data here further indicate the role of AmpR in cross-resistance between quinolones and aminoglycosides. This was confirmed using quantitative PCR, where expression of the mexEF efflux pump was further induced by ciprofloxacin and tobramycin, its substrate and a non-substrate, respectively, in the absence of ampR. The data presented here highlight the intricate cross-regulation of antibiotic resistance pathways at SICs of antibiotics and the need for careful assessment of the order of antibiotic regimens as this may have dire consequences. Targeting a global regulator such as AmpR that connects diverse pathways is a feasible therapeutic approach to combat P. aeruginosa pathogenesis. PMID:24464693

  12. Role of Pseudomonas aeruginosa AmpR on β-lactam and non-β-lactam transient cross-resistance upon pre-exposure to subinhibitory concentrations of antibiotics.

    PubMed

    Kumari, Hansi; Balasubramanian, Deepak; Zincke, Diansy; Mathee, Kalai

    2014-04-01

    Pseudomonas aeruginosa is one of the most dreaded opportunistic pathogens accounting for 10 % of hospital-acquired infections, with a 50 % mortality rate in chronically ill patients. The increased prevalence of drug-resistant isolates is a major cause of concern. Resistance in P. aeruginosa is mediated by various mechanisms, some of which are shared among different classes of antibiotics and which raise the possibility of cross-resistance. The goal of this study was to explore the effect of subinhibitory concentrations (SICs) of clinically relevant antibiotics and the role of a global antibiotic resistance and virulence regulator, AmpR, in developing cross-resistance. We investigated the induction of transient cross-resistance in P. aeruginosa PAO1 upon exposure to SICs of antibiotics. Pre-exposure to carbapenems, specifically imipenem, even at 3 ng ml(-1), adversely affected the efficacy of clinically used penicillins and cephalosporins. The high β-lactam resistance was due to elevated expression of both ampC and ampR, encoding a chromosomal β-lactamase and its regulator, respectively. Differences in the susceptibility of ampR and ampC mutants suggested non-AmpC-mediated regulation of β-lactam resistance by AmpR. The increased susceptibility of P. aeruginosa in the absence of ampR to various antibiotics upon SIC exposure suggests that AmpR plays a major role in the cross-resistance. AmpR was shown previously to be involved in resistance to quinolones by regulating MexEF-OprN efflux pump. The data here further indicate the role of AmpR in cross-resistance between quinolones and aminoglycosides. This was confirmed using quantitative PCR, where expression of the mexEF efflux pump was further induced by ciprofloxacin and tobramycin, its substrate and a non-substrate, respectively, in the absence of ampR. The data presented here highlight the intricate cross-regulation of antibiotic resistance pathways at SICs of antibiotics and the need for careful assessment of the order of antibiotic regimens as this may have dire consequences. Targeting a global regulator such as AmpR that connects diverse pathways is a feasible therapeutic approach to combat P. aeruginosa pathogenesis.

  13. Co-Occurrence of Plasmid-Mediated AmpC β-Lactamase Activity Among Klebsiella pneumoniae and Escherichia Coli

    PubMed Central

    Zorgani, Abdulaziz; Daw, Hiyam; Sufya, Najib; Bashein, Abdullah; Elahmer, Omar; Chouchani, Chedly

    2017-01-01

    Introduction: Extended-spectrum β-lactamases (ESBLs), including the AmpC type, are important mechanisms of resistance among Klebsiella pneumoniae and Escherichia coli isolates. Objective: The aim of the study was to investigate the occurrence of AmpC-type β-lactamase producers isolated from two hospitals in Tripoli, Libya. Methods: All clinical isolates (76 K. pneumoniae and 75 E. coli) collected over two years (2013-2014) were evaluated for susceptibility to a panel of antimicrobials and were analyzed phenotypically for the ESBL and AmpC phenotype using E-test and ESBL and AmpC screen disc test. Both ESBL and AmpC-positive isolates were then screened for the presence of genes encoding plasmid-mediated AmpC β-lactamases by polymerase chain reaction (PCR). Results: Of the K. pneumoniae and E. coli tested, 75% and 16% were resistant to gentamicin, 74% and 1.3% to imipenem, 71% and 12% to cefoxitin, 80% and 12% to cefepime, 69% and 22.6% to ciprofloxacin, respectively. None of the E. coli isolates were multidrug resistant compared with K. pneumoniae (65.8%). K. pneumoniae ESBL producers were significantly higher (85.5%) compared with (17.3%) E. coli isolates (P <0.0001, OR=4.93). Plasmid-mediated AmpC genes were detected in 7.9% of K. pneumoniae, and 4% E. coli isolates. There was low agreement between phenotypic and genotypic methods, phenotypic testing underestimated detection of AmpC enzyme and did not correlate well with molecular results. The gene encoding CMY enzyme was the most prevalent (66.6%) of AmpC positive isolates followed by MOX, DHA and EBC. Only one AmpC gene was detected in 5/9 isolates, i.e, blaCMY (n=3), bla MOX (n=1), blaDHA (n=1). However, co-occurrence of AmpC genes were evident in 3/9 isolates with the following distribution: bla CMY and blaEBC (n=1), and blaCMY and blaMOX (n=2). Neither blaFOX nor blaACC was detected in all tested isolates. All AmpC positive strains were resistant to cefoxitin and isolated from patients admitted to intensive care units. Conclusion: Further studies are needed for detection of other AmpC variant enzyme production among such isolates. Continued surveillance and judicious antibiotic usage together with the implementation of efficient infection control measures are absolutely required. PMID:29151996

  14. Co-Occurrence of Plasmid-Mediated AmpC β-Lactamase Activity Among Klebsiella pneumoniae and Escherichia Coli.

    PubMed

    Zorgani, Abdulaziz; Daw, Hiyam; Sufya, Najib; Bashein, Abdullah; Elahmer, Omar; Chouchani, Chedly

    2017-01-01

    Extended-spectrum β-lactamases (ESBLs), including the AmpC type, are important mechanisms of resistance among Klebsiella pneumoniae and Escherichia coli isolates. The aim of the study was to investigate the occurrence of AmpC-type β-lactamase producers isolated from two hospitals in Tripoli, Libya. All clinical isolates (76 K. pneumoniae and 75 E. coli ) collected over two years (2013-2014) were evaluated for susceptibility to a panel of antimicrobials and were analyzed phenotypically for the ESBL and AmpC phenotype using E-test and ESBL and AmpC screen disc test. Both ESBL and AmpC-positive isolates were then screened for the presence of genes encoding plasmid-mediated AmpC β-lactamases by polymerase chain reaction (PCR). Of the K. pneumoniae and E. coli tested, 75% and 16% were resistant to gentamicin, 74% and 1.3% to imipenem, 71% and 12% to cefoxitin, 80% and 12% to cefepime, 69% and 22.6% to ciprofloxacin, respectively. None of the E. coli isolates were multidrug resistant compared with K. pneumoniae (65.8%). K. pneumoniae ESBL producers were significantly higher (85.5%) compared with (17.3%) E. coli isolates (P <0.0001, OR=4.93). Plasmid-mediated AmpC genes were detected in 7.9% of K. pneumoniae , and 4% E. coli isolates. There was low agreement between phenotypic and genotypic methods, phenotypic testing underestimated detection of AmpC enzyme and did not correlate well with molecular results. The gene encoding CMY enzyme was the most prevalent (66.6%) of AmpC positive isolates followed by MOX, DHA and EBC. Only one AmpC gene was detected in 5/9 isolates, i.e, bla CMY (n=3), bla MOX (n=1), bla DHA (n=1). However, co-occurrence of AmpC genes were evident in 3/9 isolates with the following distribution: bla CMY and bla EBC (n=1), and bla CMY and bla MOX (n=2). Neither bla FOX nor bla ACC was detected in all tested isolates. All AmpC positive strains were resistant to cefoxitin and isolated from patients admitted to intensive care units. Further studies are needed for detection of other AmpC variant enzyme production among such isolates. Continued surveillance and judicious antibiotic usage together with the implementation of efficient infection control measures are absolutely required.

  15. Genotypic and Phenotypic Detection of AmpC β-lactamases in Enterobacter spp. Isolated from a Teaching Hospital in Malaysia.

    PubMed

    Mohd Khari, Fatin Izzati; Karunakaran, Rina; Rosli, Roshalina; Tee Tay, Sun

    2016-01-01

    The objective of this study was to determine the occurrence of chromosomal and plasmid-mediated β-lactamases (AmpC) genes in a collection of Malaysian isolates of Enterobacter species. Several phenotypic tests for detection of AmpC production of Enterobacter spp. were evaluated and the agreements between tests were determined. Antimicrobial susceptibility profiles for 117 Enterobacter clinical isolates obtained from the Medical Microbiology Diagnostic Laboratory, University Malaya Medical Centre, Malaysia, from November 2012-February 2014 were determined in accordance to CLSI guidelines. AmpC genes were detected using a multiplex PCR assay targeting the MIR/ACT gene (closely related to chromosomal EBC family gene) and other plasmid-mediated genes, including DHA, MOX, CMY, ACC, and FOX. The AmpC β-lactamase production of the isolates was assessed using cefoxitin disk screening test, D69C AmpC detection set, cefoxitin-cloxacillin double disk synergy test (CC-DDS) and AmpC induction test. Among the Enterobacter isolates in this study, 39.3% were resistant to cefotaxime and ceftriaxone and 23.9% were resistant to ceftazidime. Ten (8.5%) of the isolates were resistant to cefepime, and one isolate was resistant to meropenem. Chromosomal EBC family gene was amplified from 36 (47.4%) E. cloacae and three (25%) E. asburiae. A novel blaDHA type plasmid-mediated AmpC gene was identified for the first time from an E. cloacae isolate. AmpC β-lactamase production was detected in 99 (89.2%) of 111 potential AmpC β-lactamase producers (positive in cefoxitin disk screening) using D69C AmpC detection set. The detection rates were lower with CC-DDS (80.2%) and AmpC induction tests (50.5%). There was low agreement between the D69C AmpC detection set and the other two phenotypic tests. Of the 40 isolates with AmpC genes detected in this study, 87.5%, 77.5% and 50.0% of these isolates were positive by the D69C AmpC detection set, CC-DDS and AmpC induction tests, respectively. Besides MIR/ACT gene, a novel plasmid-mediated AmpC gene belonging to the DHA-type was identified in this study. Low agreement was noted between the D69C AmpC detection set and two other phenotypic tests for detection of AmpC production in Enterobacter spp. As plasmid-mediated genes may serve as the reservoir for the emergence of antibiotic resistance in a clinical setting, surveillance and infection control measures are necessary to limit the spread of these genes in the hospital.

  16. Genotypic and Phenotypic Detection of AmpC β-lactamases in Enterobacter spp. Isolated from a Teaching Hospital in Malaysia

    PubMed Central

    Mohd Khari, Fatin Izzati; Karunakaran, Rina; Rosli, Roshalina; Tee Tay, Sun

    2016-01-01

    Objectives The objective of this study was to determine the occurrence of chromosomal and plasmid-mediated β-lactamases (AmpC) genes in a collection of Malaysian isolates of Enterobacter species. Several phenotypic tests for detection of AmpC production of Enterobacter spp. were evaluated and the agreements between tests were determined. Methods Antimicrobial susceptibility profiles for 117 Enterobacter clinical isolates obtained from the Medical Microbiology Diagnostic Laboratory, University Malaya Medical Centre, Malaysia, from November 2012—February 2014 were determined in accordance to CLSI guidelines. AmpC genes were detected using a multiplex PCR assay targeting the MIR/ACT gene (closely related to chromosomal EBC family gene) and other plasmid-mediated genes, including DHA, MOX, CMY, ACC, and FOX. The AmpC β-lactamase production of the isolates was assessed using cefoxitin disk screening test, D69C AmpC detection set, cefoxitin-cloxacillin double disk synergy test (CC-DDS) and AmpC induction test. Results Among the Enterobacter isolates in this study, 39.3% were resistant to cefotaxime and ceftriaxone and 23.9% were resistant to ceftazidime. Ten (8.5%) of the isolates were resistant to cefepime, and one isolate was resistant to meropenem. Chromosomal EBC family gene was amplified from 36 (47.4%) E. cloacae and three (25%) E. asburiae. A novel blaDHA type plasmid-mediated AmpC gene was identified for the first time from an E. cloacae isolate. AmpC β-lactamase production was detected in 99 (89.2%) of 111 potential AmpC β-lactamase producers (positive in cefoxitin disk screening) using D69C AmpC detection set. The detection rates were lower with CC-DDS (80.2%) and AmpC induction tests (50.5%). There was low agreement between the D69C AmpC detection set and the other two phenotypic tests. Of the 40 isolates with AmpC genes detected in this study, 87.5%, 77.5% and 50.0% of these isolates were positive by the D69C AmpC detection set, CC-DDS and AmpC induction tests, respectively. Conclusions Besides MIR/ACT gene, a novel plasmid-mediated AmpC gene belonging to the DHA-type was identified in this study. Low agreement was noted between the D69C AmpC detection set and two other phenotypic tests for detection of AmpC production in Enterobacter spp. As plasmid-mediated genes may serve as the reservoir for the emergence of antibiotic resistance in a clinical setting, surveillance and infection control measures are necessary to limit the spread of these genes in the hospital. PMID:26963619

  17. P2Y6 receptor mediates colonic NaCl secretion via differential activation of cAMP-mediated transport

    PubMed Central

    Köttgen, Michael; Löffler, Thomas; Jacobi, Christoph; Nitschke, Roland; Pavenstädt, Hermann; Schreiber, Rainer; Frische, Sebastian; Nielsen, Søren; Leipziger, Jens

    2003-01-01

    Extracellular nucleotides are important regulators of epithelial ion transport. Here we investigated nucleotide-mediated effects on colonic NaCl secretion and the signal transduction mechanisms involved. Basolateral UDP induced a sustained activation of Cl– secretion, which was completely inhibited by 293B, a specific inhibitor of cAMP-stimulated basolateral KCNQ1/KCNE3 K+ channels. We therefore speculated that a basolateral P2Y6 receptor could increase cAMP. Indeed UDP elevated cAMP in isolated crypts. We identified an epithelial P2Y6 receptor using crypt [Ca2+]i measurements, RT-PCR, and immunohistochemistry. To investigate whether the rat P2Y6elevates cAMP, we coexpressed the P2Y1 or P2Y6 receptor together with the cAMP-regulated cystic fibrosis transmembrane conductance regulator (CFTR) Cl– channel in Xenopus oocytes. A two-electrode voltage clamp was used to monitor nucleotide-induced Cl– currents. In oocytes expressing the P2Y1 receptor, ATP transiently activated the endogenous Ca2+-activated Cl– current, but not CFTR. In contrast, in oocytes expressing the P2Y6receptor, UDP transiently activated the Ca2+-activated Cl– current and subsequently CFTR. CFTR Cl– currents were identified by their halide conductance sequence. In summary we find a basolateral P2Y6 receptor in colonic epithelial cells stimulating sustained NaCl secretion by way of a synergistic increase of [Ca2+]i and cAMP. In support of these data P2Y6 receptor stimulation differentially activates CFTR in Xenopus oocytes. PMID:12569163

  18. Suppression of Antimicrobial Peptide Expression by Ureaplasma Species

    PubMed Central

    Crabb, Donna M.; Dai, Yuling; Chen, Yuying; Waites, Ken B.; Atkinson, T. Prescott

    2014-01-01

    Ureaplasma species commonly colonize the adult urogenital tract and are implicated in invasive diseases of adults and neonates. Factors that permit the organisms to cause chronic colonization or infection are poorly understood. We sought to investigate whether host innate immune responses, specifically, antimicrobial peptides (AMPs), are involved in determining the outcome of Ureaplasma infections. THP-1 cells, a human monocytoid tumor line, were cocultured with Ureaplasma parvum and U. urealyticum. Gene expression levels of a variety of host defense genes were quantified by real-time PCR. In vitro antimicrobial activities of synthetic AMPs against Ureaplasma spp. were determined using a flow cytometry-based assay. Chromosomal histone modifications in host defense gene promoters were tested by chromatin immunoprecipitation (ChIP). DNA methylation status in the AMP promoter regions was also investigated. After stimulation with U. parvum and U. urealyticum, the expression of cell defense genes, including the AMP genes (DEFB1, DEFA5, DEFA6, and CAMP), was significantly downregulated compared to that of TNFA and IL-8, which were upregulated. In vitro flow cytometry-based antimicrobial assay revealed that synthetic peptides LL-37, hBD-3, and hBD-1 had activity against Ureaplasma spp. Downregulation of the AMP genes was associated with chromatin modification alterations, including the significantly decreased histone H3K9 acetylation with U. parvum infection. No DNA methylation status changes were detected upon Ureaplasma infection. In conclusion, AMPs have in vitro activity against Ureaplasma spp., and suppression of AMP expression might be important for the organisms to avoid this aspect of the host innate immune response and to establish chronic infection and colonization. PMID:24491573

  19. Suppression of antimicrobial peptide expression by ureaplasma species.

    PubMed

    Xiao, Li; Crabb, Donna M; Dai, Yuling; Chen, Yuying; Waites, Ken B; Atkinson, T Prescott

    2014-04-01

    Ureaplasma species commonly colonize the adult urogenital tract and are implicated in invasive diseases of adults and neonates. Factors that permit the organisms to cause chronic colonization or infection are poorly understood. We sought to investigate whether host innate immune responses, specifically, antimicrobial peptides (AMPs), are involved in determining the outcome of Ureaplasma infections. THP-1 cells, a human monocytoid tumor line, were cocultured with Ureaplasma parvum and U. urealyticum. Gene expression levels of a variety of host defense genes were quantified by real-time PCR. In vitro antimicrobial activities of synthetic AMPs against Ureaplasma spp. were determined using a flow cytometry-based assay. Chromosomal histone modifications in host defense gene promoters were tested by chromatin immunoprecipitation (ChIP). DNA methylation status in the AMP promoter regions was also investigated. After stimulation with U. parvum and U. urealyticum, the expression of cell defense genes, including the AMP genes (DEFB1, DEFA5, DEFA6, and CAMP), was significantly downregulated compared to that of TNFA and IL-8, which were upregulated. In vitro flow cytometry-based antimicrobial assay revealed that synthetic peptides LL-37, hBD-3, and hBD-1 had activity against Ureaplasma spp. Downregulation of the AMP genes was associated with chromatin modification alterations, including the significantly decreased histone H3K9 acetylation with U. parvum infection. No DNA methylation status changes were detected upon Ureaplasma infection. In conclusion, AMPs have in vitro activity against Ureaplasma spp., and suppression of AMP expression might be important for the organisms to avoid this aspect of the host innate immune response and to establish chronic infection and colonization.

  20. Improving Behavioral Support for Smoking Cessation in Pregnancy: What Are the Barriers to Stopping and Which Behavior Change Techniques Can Influence These? Application of Theoretical Domains Framework.

    PubMed

    Campbell, Katarzyna A; Fergie, Libby; Coleman-Haynes, Tom; Cooper, Sue; Lorencatto, Fabiana; Ussher, Michael; Dyas, Jane; Coleman, Tim

    2018-02-17

    Behavioral support interventions are used to help pregnant smokers stop; however, of those tested, few are proven effective. Systematic research developing effective pregnancy-specific behavior change techniques (BCTs) is ongoing. This paper reports contributory work identifying potentially-effective BCTs relative to known important barriers and facilitators (B&Fs) to smoking cessation in pregnancy; to detect priority areas for BCTs development. A Nominal Group Technique with cessation experts ( n = 12) elicited an expert consensus on B&Fs most influencing women's smoking cessation and those most modifiable through behavioral support. Effective cessation interventions in randomized trials from a recent Cochrane review were coded into component BCTs using existing taxonomies. B&Fs were categorized using Theoretical Domains Framework (TDF) domains. Matrices, mapping BCT taxonomies against TDF domains, were consulted to investigate the extent to which BCTs in existing interventions target key B&Fs. Experts ranked "smoking a social norm" and "quitting not a priority" as most important barriers and "desire to protect baby" an important facilitator to quitting. From 14 trials, 23 potentially-effective BCTs were identified (e.g., information about consequences). Most B&Fs fell into "Social Influences", "Knowledge", "Emotions" and "Intentions" TDF domains; few potentially-effective BCTs mapped onto every TDF domain. B&Fs identified by experts as important to cessation, are not sufficiently targeted by BCT's currently within interventions for smoking cessation in pregnancy.

  1. Biatriosporin D displays anti-virulence activity through decreasing the intracellular cAMP levels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Ming; Chang, Wenqiang; Shi, Hongzhuo

    Candidiasis has long been a serious human health problem, and novel antifungal approaches are greatly needed. During both superficial and systemic infection, C. albicans relies on a battery of virulence factors, such as adherence, filamentation, and biofilm formation. In this study, we found that a small phenolic compound, Biatriosporin D (BD), isolated from an endolichenic fungus, Biatriospora sp., displayed anti-virulence activity by inhibiting adhesion, hyphal morphogenesis and biofilm formation of C. albicans. Of note is the high efficacy of BD in preventing filamentation with a much lower dose than its MIC value. Furthermore, BD prolonged the survival of worms infectedmore » by C. albicans in vivo. Quantitative real-time PCR analysis, exogenous cAMP rescue experiments and intracellular cAMP measurements revealed that BD regulates the Ras1-cAMP-Efg1 pathway by reducing cAMP levels to inhibit the hyphal formation. Further investigation showed that BD could upregulate Dpp3 to synthesize much more farnesol, which could inhibit the activity of Cdc35 and reduce the generation of cAMP. Taken together, these findings indicate that BD stimulates the expression of Dpp3 to synthesize more farnesol that directly inhibits the Cdc35 activity, reducing intracellular cAMP and thereby disrupting the morphologic transition and attenuating the virulence of C. albicans. Our study uncovers the underlying mechanism of BD as a prodrug in fighting against pathogenic C. albicans and provides a potential application of BD in fighting clinically relevant fungal infections by targeting fungal virulence. - Highlights: • BD inhibits the filamentation of C. albicans in multiple hypha-inducing conditions. • BD can prolong the survival of nematodes infected by C. albicans. • BD stimulates the expression of Dpp3 to synthesize more farnesol. • BD reduces intracellular cAMP and regulates Ras1-cAMP-PKA pathway.« less

  2. Radiotherapy Suppresses Bone Cancer Pain through Inhibiting Activation of cAMP Signaling in Rat Dorsal Root Ganglion and Spinal Cord.

    PubMed

    Zhu, Guiqin; Dong, Yanbin; He, Xueming; Zhao, Ping; Yang, Aixing; Zhou, Rubing; Ma, Jianhua; Xie, Zhong; Song, Xue-Jun

    2016-01-01

    Radiotherapy is one of the major clinical approaches for treatment of bone cancer pain. Activation of cAMP-PKA signaling pathway plays important roles in bone cancer pain. Here, we examined the effects of radiotherapy on bone cancer pain and accompanying abnormal activation of cAMP-PKA signaling. Female Sprague-Dawley rats were used and received tumor cell implantation (TCI) in rat tibia (TCI cancer pain model). Some of the rats that previously received TCI treatment were treated with X-ray radiation (radiotherapy). Thermal hyperalgesia and mechanical allodynia were measured and used for evaluating level of pain caused by TCI treatment. PKA mRNA expression in dorsal root ganglion (DRG) was detected by RT-PCR. Concentrations of cAMP, IL-1β, and TNF-α as well as PKA activity in DRG and the spinal cord were measured by ELISA. The results showed that radiotherapy significantly suppressed TCI-induced thermal hyperalgesia and mechanical allodynia. The level of PKA mRNA in DRG, cAMP concentration and PKA activity in DRG and in the spinal cord, and concentrations of IL-1β and TNF-α in the spinal cord were significantly reduced by radiotherapy. In addition, radiotherapy also reduced TCI-induced bone loss. These findings suggest that radiotherapy may suppress bone cancer pain through inhibition of activation of cAMP-PKA signaling pathway in DRG and the spinal cord.

  3. A transient expression assay for the in planta efficacy screening of an antimicrobial peptide against grapevine bacterial pathogens.

    PubMed

    Visser, M; Stephan, D; Jaynes, J M; Burger, J T

    2012-06-01

    Natural and synthetic antimicrobial peptides (AMPs) are of increasing interest as potential resistance conferring elements in plants against pathogen infection. The efficacy of AMPs against pathogens is prescreened by in vitro assays, and promising AMP candidates are introduced as transgenes into plants. As in vitro and in planta environments differ, a prescreening procedure of the AMP efficacy in the plant environment is desired. Here, we report the efficacy of the purified synthetic peptide D4E1 against the grapevine-infecting bacterial pathogens Agrobacterium vitis and Xylophilus ampelinus in vitro and describe for the first time an in planta prescreening procedure based on transiently expressed D4E1. The antimicrobial effect of D4E1 against Ag. vitis and X. ampelinus was shown by a reduction in colony-forming units in vitro in a traditional plate-based assay and by a reduction in bacterial titres in planta as measured by quantitative real-time PCR (qPCR) in grapevine leaves transiently expressing D4E1. A statistically significant reduction in titre was shown for X. ampelinus, but for Ag. vitis, a significant reduction in titre was only observed in a subset of plants. The titres of both grapevine-infecting bacterial pathogens were reduced in an in vitro assay and for X. ampelinus in an in planta assay by D4E1 application. This widens the applicability of D4E1 as a potential resistance-enhancing element to additional pathogens and in a novel plant species. D4E1 is a promising candidate to confer enhanced resistance against the two tested grapevine bacterial pathogens, and the applied transient expression system proved to be a valuable tool for prescreening of D4E1 efficacy in an in planta environment. The described prescreening procedure can be used for other AMPs and might be adapted to other plant species and pathogens before the expensive and tedious development of stably transgenic lines is started. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

  4. SFG studies on interactions between antimicrobial peptides and supported lipid bilayers.

    PubMed

    Chen, Xiaoyun; Chen, Zhan

    2006-09-01

    The mode of action of antimicrobial peptides (AMPs) in disrupting cell membrane bilayers is of fundamental importance in understanding the efficiency of different AMPs, which is crucial to design antibiotics with improved properties. Recent developments in the field of sum frequency generation (SFG) vibrational spectroscopy have made it a powerful and unique biophysical technique in investigating the interactions between AMPs and a single substrate supported planar lipid bilayer. We will review some of the recent progress in applying SFG to study membrane lipid bilayers and discuss how SFG can provide novel information such as real-time bilayer structure change and AMP orientation during AMP-lipid bilayer interactions in a very biologically relevant manner. Several examples of applying SFG to monitor such interactions between AMPs and a dipalmitoyl phosphatidylglycerol (DPPG) bilayer are presented. Different modes of actions are observed for melittin, tachyplesin I, d-magainin 2, MSI-843, and a synthetic antibacterial oligomer, demonstrating that SFG is very effective in the study of AMPs and AMP-lipid bilayer interactions.

  5. Preparation and evaluation of effect on Escherichia coli and Staphylococcus aureus of radiolabeled ampicillin-loaded graphene oxide nanoflakes.

    PubMed

    Yurt, Fatma; Ersöz, Onur Alp; Harputlu, Ersan; Ocakoglu, Kasim

    2018-06-01

    Ampicillin is a one of effective antibiotics against Gram-positive and Gram-negative bacteria. This study aimed to label ampicillin-loaded graphene oxide nanoflake (AMP-GO) with 99m Tc and evaluate of its in vitro binding to Staphylococcus aureus and Escherichia coli. Firstly, ampicillin was loaded into graphene oxide nanoflake prepared. AMP-GO was characterized by Fourier transform infrared spectroscopy (FTIR) and scanning electron microscope (SEM) techniques, and the amount of loaded ampicillin onto GO was determined by UV-Vis absorption spectroscopy. AMP and AMP-GO were labeled with 99m Tc using stannous chloride reducing agent. Labeling efficiency of 99m Tc-AMP-GO was found to be 97.66 ± 2.06%. 99m Tc-AMP-GO has higher binding efficiencies to both S. aureus and E. coli than 99m Tc-AMP. 99m Tc-AMP-GO could be promising candidate as agent infection nuclear imaging. Furthermore, in vivo studies of 99m Tc-AMP-GO with infected rats are planned to be performed. © 2018 John Wiley & Sons A/S.

  6. Involvement of DDAH/ADMA/NOS/cGMP and COX-2/PTGIS/cAMP Pathways in Human Tissue Kallikrein 1 Protecting Erectile Function in Aged Rats

    PubMed Central

    Tang, Zhe; Rao, Ke; Wang, Tao; Chen, Zhong; Wang, Shaogang; Liu, Jihong; Wang, Daowen

    2017-01-01

    Our previous studies had reported that Human Tissue Kallikrein 1 (hKLK1) preserved erectile function in aged transgenic rats, while the detailed mechanism of hKLK1 protecting erectile function in aged rats through activation of cGMP and cAMP was not mentioned. To explore the latent mechanism, male wild-type Sprague-Dawley rats (WTR) and transgenic rats harboring the hKLK1 gene (TGR) were fed to 4 and 18 months old and divided into four groups: young WTR (yWTR) as the control, aged WTR (aWTR), aged TGR (aTGR) and aged TGRs with HOE140 (aTGRH). Erectile function of all rats was evaluated by cavernous nerve electrostimulation method and measured by the ratio of intracavernous pressure/ mean arterial pressure (ICP/MAP) in rats. Expression levels of cAMP and cGMP were assessed, and related signaling pathways were detected by western blot, immunohistochemistry and RT-PCR. Our experiment results showed erectile function of the aWTR group and aTGRH group was lower compared with those of other two groups. Also, expression levels of cAMP and cGMP were significantly lower than those of other two groups. Moreover, expressions of related signaling pathways including DDAH/ADMA/NOS/cGMP and COX-2/PTGIS/cAMP were also downregulated in the corpus cavernosum of rats in aWTR group. Our finding revealed hKLK1 played a protective role in age-related ED. The DDAH/ADMA/NOS/cGMP and COX-2/PTGIS/cAMP pathways that were linked to the mechanism hKLK1 could increase the levels of cGMP and cAMP, which might provide novel therapy targets for age-related ED. PMID:28103290

  7. Expanded spectrum β-lactamase producing Escherichia coli isolated from chickens with colibacillosis in Egypt.

    PubMed

    El-Shazly, D A; Nasef, S A; Mahmoud, F F; Jonas, Daniel

    2017-07-01

    Throughout the world, expanded spectrum β-lactamases (ESBL) are increasing among clinical isolates of Enterobacteriaceae, both in humans and animals. Unfortunately, there is a paucity of data on ESBL or Ampicillin class C β-lactamase (AmpC) in Egypt, although antimicrobial consumption is high in this developing country. This study aims to characterize the resistance mechanisms to expanded spectrum cephalosporins among resistant veterinary Escherichia coli isolates in Egypt. We investigated 50 clinical multi-resistant E. coli strains isolated from 20 chicken farms for production of ESBL or AmpC. Antibiotic susceptibility was tested by Clinical and Laboratory Standards Institute (CLSI) disk diffusion and ESBL confirmatory tests. PCR and sequencing were performed to screen for plasmid mediated ESBL genes and genes encoding AmpC β-lactamases. All the isolates were phylogentically classified, investigated for harboring class 1 integrons, and genotyped by amplified fragment length polymorphism (AFLP). Three strains showed ESBL and 6 strains AmpC phenotypic patterns, respectively, with confirmed ESBL genes of blaTEM-57, blaSHV-12, blaCTX-M-14, and blaCMY-2 for AmpC producing strains. All ESBL strains belonged to phylogroup D with different clones isolated from different flocks, while most of the AmpC strains belonged to phylogroup B1 (4/6) and were assigned to the same genotype distributed in 2 different farms. Class 1 integrons were disseminated in 60% of all tested strains and in 100% of ESBL and AmpC strains. These results highlight the antimicrobial resistance problem in Egypt, caused in all probability by unwise use of antimicrobials in animal husbandry. The results call for a nationwide surveillance program to monitor antimicrobial resistance. © 2017 Poultry Science Association Inc.

  8. Activation of the cAMP-PKA signaling pathway in rat dorsal root ganglion and spinal cord contributes toward induction and maintenance of bone cancer pain.

    PubMed

    Zhu, Gui-Qin; Liu, Su; He, Duan-Duan; Liu, Yue-Peng; Song, Xue-Jun

    2014-08-01

    The objective of this study was to explore the role of cyclic adenosine monophosphate-protein kinase A (cAMP-PKA) signaling in the development of bone cancer pain in rats. Female Sprague-Dawley rats (N=48) were divided randomly into four groups: sham (n=8), tumor cell implantation (TCI) (n=16), TCI+saline (n=8), and TCI+PKA inhibitor (n=16). Bone cancer-induced pain behaviors - thermal hyperalgesia and mechanical allodynia - were tested at postoperative days -3, -1, 1, 3, 5, 7, 10, and 14. A PKA inhibitor, Rp-cAMPS (1 mmol/l/20 μl), was injected intrathecally on postoperative days 3, 4, and 5 (early phase) or 7, 8, and 9 postoperative days (late phase). The expression of PKA mRNA in dorsal root ganglia (DRG) was detected by reverse transcription-PCR. The concentration of cAMP and activity of PKA in DRG and spinal cord were measured by enzyme-linked immunosorbent assay. TCI treatment induced significant pain behaviors, manifested as thermal hyperalgesia and mechanical allodynia. Spinal administration of the PKA inhibitor Rp-cAMPS during the early phase and late phase significantly delayed or reversed, respectively, TCI-induced thermal hyperalgesia and mechanical allodynia. TCI treatment also led to obvious tumor growth and bone destruction. The level of PKA mRNA in the DRG, as well as the concentration of cAMP and the activity of PKA, in both the DRG and spinal cord were significantly increased after TCI treatment (P<0.01). We conclude that the inhibition of the cAMP-PKA signaling pathway may reduce bone cancer pain.

  9. Characterisation of extended-spectrum β-lactamase and AmpC β-lactamase-producing Enterobacteriaceae isolated from companion animals in New Zealand.

    PubMed

    Karkaba, A; Grinberg, A; Benschop, J; Pleydell, E

    2017-03-01

    To assess the occurrence of, and characterise, extended-spectrum β-lactamase (ESBL) and AmpC β-lactamase (AmpC)-producing Enterobacteriaceae isolated by veterinary diagnostic laboratories from infection sites in companion animals in New Zealand. Selected Enterobacteriaceae isolates were submitted by seven New Zealand veterinary diagnostic laboratories. They were isolated from infection sites in companion animals between June 2012 and June 2013, and were resistant to amoxicillin-clavulanic acid, fluoroquinolones, or any combination of two or more antimicrobials. Based on disk diffusion test results, the isolates were phenotypically categorised according to production of ESBL and AmpC. Genes for ESBL and AmpC production were amplified by PCR and sequenced. Escherichia coli isolates were also typed by multilocus sequence typing. A total of 115 isolates matching the inclusion criteria were obtained from the participating laboratories, of which 74 (64%) originated from dogs and 29 (25%) from cats. Seven bacterial species were identified, of which E. coli was the most common (87/115, 76%). Of the 115 isolates, 10 (9%) expressed the ESBL phenotype, 43 (37%) the AmpC phenotype, and seven (6%) both ESBL and AmpC phenotypes. Of the 60 ESBL and AmpC-producing isolates, 36 (60%) were E. coli. Amongst these isolates, 27/60 (45%) were classified as multidrug resistant, compared with 15/55 (27%) non-ESBL or AmpC-producing isolates (p<0.01). Ninety five isolates were resistant to amoxicillin-clavulanic acid and 58 (61%) of these were ESBL or AmpC-producing. The predominant ESBL genes were bla CTX-M-14 and bla CTX-M-15 , and the dominant plasmid-encoded AmpC gene was bla CMY-2 . Thirty-eight E. coli multilocus sequence types (ST) were identified, and the most prevalent were ST12 (12/89, 13%), ST131 (6/89, 7%) and ST648 (6/89, 7%). ESBL and AmpC-producing isolates accounted for 35/1,082 (3.2%) of the Enterobacteriaceae isolated by one laboratory network over the study period. ESBL and AmpC-producing Enterobacteriaceae were associated with clinical infections in companion animals in New Zealand, and were often multidrug resistant. In this study, these organisms accounted for <5% of all Enterobacteriaceae isolated from infection sites by one laboratory network, but their prevalence among isolates resistant to amoxicillin-clavulanic acid was 61%. Therefore routine secondary testing for ESBL and AmpC production by Enterobacteriaceae that are resistant to amoxicillin-clavulanic acid in primary testing could improve the accuracy of definitive antimicrobial therapy in companion animals in New Zealand.

  10. Cloning of the cDNA encoding adenosine 5'-monophosphate deaminase 1 and its mRNA expression in Japanese flounder Paralichthys olivaceus

    NASA Astrophysics Data System (ADS)

    Jiang, Keyong; Sun, Shujuan; Liu, Mei; Wang, Baojie; Meng, Xiaolin; Wang, Lei

    2013-01-01

    AMP deaminase catalyzes the conversion of AMP into IMP and ammonia. In the present study, a full-length cDNA of AMPD1 from skeletal muscle of Japanese flounder Paralichthys olivaceus was cloned and characterized. The 2 526 bp cDNA contains a 5'-UTR of 78 bp, a 3'-UTR of 237 bp and an open reading frame (ORF) of 2 211 bp, which encodes a protein of 736 amino acids. The predicted protein contains a highly conserved AMP deaminase motif (SLSTDDP) and an ATP-binding site sequence (EPLMEEYAIAAQVFK). Phylogenetic analysis showed that the AMPD1 and AMPD3 genes originate from the same branch, but are evolutionarily distant from the AMPD2 gene. RT-PCR showed that the flounder AMPD1 gene was expressed only in skeletal muscle. QRT-PCR analysis revealed a statistically significant 2.54 fold higher level of AMPD1 mRNA in adult muscle (750±40 g) compared with juvenile muscle (7.5±2 g) ( P<0.05). HPLC analysis showed that the IMP content in adult muscle (3.35±0.21 mg/g) was also statistically significantly higher than in juvenile muscle (1.08±0.04 mg/g) ( P<0.05). There is a direct relationship between the AMPD1 gene expression level and IMP content in the skeletal muscle of juvenile and adult flounders. These results may provide useful information for quality improvement and molecular breeding of aquatic animals.

  11. Allele frequency distribution for 21 autosomal STR loci in Bhutan.

    PubMed

    Kraaijenbrink, Thirsa; van Driem, George L; Tshering of Gaselô, Karma; de Knijff, Peter

    2007-07-20

    We studied the allele frequency distribution of 21 autosomal STR loci contained in the AmpFlSTR Identifiler (Applied Biosystems), the Powerplex 16 (Promega) and the FFFL (Promega) multiplex PCR kits among 936 individuals from the Royal Kingdom of Bhutan. As such these are the first published autosomal DNA results from this country.

  12. Extended PCR conditions to reduce drop-out frequencies in low template STR typing including unequal mixtures.

    PubMed

    Weiler, Natalie E C; Matai, Anuska S; Sijen, Titia

    2012-01-01

    Forensic laboratories employ various approaches to obtain short tandem repeat (STR) profiles from minimal traces (<100 pg DNA input). Most approaches aim to sensitize DNA profiling by increasing the amplification level by a higher cycle number or enlarging the amount of PCR products analyzed during capillary electrophoresis. These methods have limitations when unequal mixtures are genotyped, since the major component will be over-amplified or over-loaded. This study explores an alternative strategy for improved detection of the minor components in low template (LT) DNA typing that may be better suited for the detection of the minor component in mixtures. The strategy increases the PCR amplification efficiency by extending the primer annealing time several folds. When the AmpFℓSTR(®) Identifiler(®) amplification parameters are changed to an annealing time of 20 min during all 28 cycles, the drop-out frequency is reduced for both pristine DNA and single or multiple donor mock case work samples. In addition, increased peak heights and slightly more drop-ins are observed while the heterozygous peak balance remains similar as with the conventional Identifiler protocol. By this extended protocol, full DNA profiles were obtained from only 12 sperm heads (which corresponds to 36 pg of DNA) that were collected by laser micro dissection. Notwithstanding the improved detection, allele drop-outs do persist, albeit in lower frequencies. Thus a LT interpretation strategy such as deducing consensus profiles from multiple independent amplifications is appropriate. The use of extended PCR conditions represents a general approach to improve detection of unequal mixtures as shown using four commercially available kits (AmpFℓSTR(®) Identifiler, SEfiler Plus, NGM and Yfiler). The extended PCR protocol seems to amplify more of the molecules in LT samples during PCR, which results in a lower drop-out frequency. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  13. Development and validation of the AmpFℓSTR® Identifiler® Direct PCR Amplification Kit: a multiplex assay for the direct amplification of single-source samples.

    PubMed

    Wang, Dennis Y; Chang, Chien-Wei; Lagacé, Robert E; Oldroyd, Nicola J; Hennessy, Lori K

    2011-07-01

    The AmpFℓSTR(®) Identifiler(®) Direct PCR Amplification Kit is a new short tandem repeat multiplex assay optimized to allow the direct amplification of single-source blood and buccal samples on FTA(®) card without the need for sample purification and quantification. This multiplex assay has been validated according to the FBI/National Standards and SWGDAM guidelines. Validation results revealed that slight variations in primer concentration, master mix component concentration, and thermal cycling parameters did not affect the performance of the chemistry. The assay's sensitivity was demonstrated by amplifying known amounts of white blood cells spotted onto FTA(®) cards, and the assay's specificity was verified by establishing minimal cross-reactivity with nonhuman DNA. No effect on the age of the sample stored on the FTA(®) substrate was observed and full concordance was established in the population study. These findings of the validation study support the use of the Identifiler(®) Direct Kit for forensic standards and database samples genotyping. © 2011 American Academy of Forensic Sciences.

  14. Computational tools for exploring sequence databases as a resource for antimicrobial peptides.

    PubMed

    Porto, W F; Pires, A S; Franco, O L

    Data mining has been recognized by many researchers as a hot topic in different areas. In the post-genomic era, the growing number of sequences deposited in databases has been the reason why these databases have become a resource for novel biological information. In recent years, the identification of antimicrobial peptides (AMPs) in databases has gained attention. The identification of unannotated AMPs has shed some light on the distribution and evolution of AMPs and, in some cases, indicated suitable candidates for developing novel antimicrobial agents. The data mining process has been performed mainly by local alignments and/or regular expressions. Nevertheless, for the identification of distant homologous sequences, other techniques such as antimicrobial activity prediction and molecular modelling are required. In this context, this review addresses the tools and techniques, and also their limitations, for mining AMPs from databases. These methods could be helpful not only for the development of novel AMPs, but also for other kinds of proteins, at a higher level of structural genomics. Moreover, solving the problem of unannotated proteins could bring immeasurable benefits to society, especially in the case of AMPs, which could be helpful for developing novel antimicrobial agents and combating resistant bacteria. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Characterization and Use of Catabolite-Repressed Promoters from Gluconate Genes in Corynebacterium glutamicum†

    PubMed Central

    Letek, Michal; Valbuena, Noelia; Ramos, Angelina; Ordóñez, Efrén; Gil, José A.; Mateos, Luís M.

    2006-01-01

    The genes involved in gluconate catabolism (gntP and gntK) in Corynebacterium glutamicum are scattered in the chromosome, and no regulatory genes are apparently associated with them, in contrast with the organization of the gnt operon in Escherichia coli and Bacillus subtilis. In C. glutamicum, gntP and gntK are essential genes when gluconate is the only carbon and energy source. Both genes contain upstream regulatory regions consisting of a typical promoter and a hypothetical cyclic AMP (cAMP) receptor protein (CRP) binding region but lack the expected consensus operator region for binding of the GntR repressor protein. Expression analysis by Northern blotting showed monocistronic transcripts for both genes. The expression of gntP and gntK is not induced by gluconate, and the gnt genes are subject to catabolite repression by sugars, such as glucose, fructose, and sucrose, as was detected by quantitative reverse transcription-PCR (qRT-PCR). Specific analysis of the DNA promoter sequences (PgntK and PgntP) was performed using bifunctional promoter probe vectors containing mel (involved in melanin production) or egfp2 (encoding a green fluorescent protein derivative) as the reporter gene. Using this approach, we obtained results parallel to those from qRT-PCR. An applied example of in vivo gene expression modulation of the divIVA gene in C. glutamicum is shown, corroborating the possible use of the gnt promoters to control gene expression. glxR (which encodes GlxR, the hypothetical CRP protein) was subcloned from the C. glutamicum chromosomal DNA and overexpressed in corynebacteria; we found that the level of gnt expression was slightly decreased compared to that of the control strains. The purified GlxR protein was used in gel shift mobility assays, and a specific interaction of GlxR with sequences present on PgntP and PgntK fragments was detected only in the presence of cAMP. PMID:16385030

  16. Characterization and use of catabolite-repressed promoters from gluconate genes in Corynebacterium glutamicum.

    PubMed

    Letek, Michal; Valbuena, Noelia; Ramos, Angelina; Ordóñez, Efrén; Gil, José A; Mateos, Luís M

    2006-01-01

    The genes involved in gluconate catabolism (gntP and gntK) in Corynebacterium glutamicum are scattered in the chromosome, and no regulatory genes are apparently associated with them, in contrast with the organization of the gnt operon in Escherichia coli and Bacillus subtilis. In C. glutamicum, gntP and gntK are essential genes when gluconate is the only carbon and energy source. Both genes contain upstream regulatory regions consisting of a typical promoter and a hypothetical cyclic AMP (cAMP) receptor protein (CRP) binding region but lack the expected consensus operator region for binding of the GntR repressor protein. Expression analysis by Northern blotting showed monocistronic transcripts for both genes. The expression of gntP and gntK is not induced by gluconate, and the gnt genes are subject to catabolite repression by sugars, such as glucose, fructose, and sucrose, as was detected by quantitative reverse transcription-PCR (qRT-PCR). Specific analysis of the DNA promoter sequences (PgntK and PgntP) was performed using bifunctional promoter probe vectors containing mel (involved in melanin production) or egfp2 (encoding a green fluorescent protein derivative) as the reporter gene. Using this approach, we obtained results parallel to those from qRT-PCR. An applied example of in vivo gene expression modulation of the divIVA gene in C. glutamicum is shown, corroborating the possible use of the gnt promoters to control gene expression. glxR (which encodes GlxR, the hypothetical CRP protein) was subcloned from the C. glutamicum chromosomal DNA and overexpressed in corynebacteria; we found that the level of gnt expression was slightly decreased compared to that of the control strains. The purified GlxR protein was used in gel shift mobility assays, and a specific interaction of GlxR with sequences present on PgntP and PgntK fragments was detected only in the presence of cAMP.

  17. The Role of OmpK35, OmpK36 Porins, and Production of β-Lactamases on Imipenem Susceptibility in Klebsiella pneumoniae Clinical Isolates, Cairo, Egypt.

    PubMed

    Wassef, Mona; Abdelhaleim, Mona; AbdulRahman, Eiman; Ghaith, Doaa

    2015-12-01

    OmpK35 and OmpK36 are the major outer membrane porins of Klebsiella pneumoniae. We aimed to study the effect of combined porin loss and production of extended-spectrum β-lactamases (ESBLs) on imipenem susceptibility among K. pneumoniae clinical isolates. This study included 91 suspected ESBL-producing K. pneumoniae clinical isolates, isolated from different patient specimens at the Cairo University hospital from January to June 2010. All isolates were subjected to genotypic analysis of the outer membrane protein gene expression using reverse transcription-PCR (RT-PCR) and analysis of OmpK35/36 of 38 isolates by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). By RT-PCR, loss of Omp35 was detected in 78 (85.7%) isolates, loss of Omp36 was detected in 64 (70.32%), and loss of both porins was detected in 62 (68.1%). Out of 91 isolates, 45 (49.5%) were resistant to cefoxitin, and 17 (18.7%) were confirmed as derepressed AmpC producers. Omp35 was lost in all FOX-resistant isolates, whereas Omp36 was lost in 42 (93.3%) (p-value 0.002). The mean of ceftazidime inhibition zone diameter was significantly decreased among ESBL-producing isolates with loss of Omp35/36 (p-value 0.041 and 0.006), respectively. The mean of imipenem minimal inhibitory concentration (MIC) was markedly increased to 8.55 μg/ml among AmpC-producing isolates with Omp35/36 loss, while the mean of imipenem MIC among the 66 confirmed ESBL producers was 0.32 μg/ml. Imipenem MIC was markedly increased among K. pneumoniae isolates showing AmpC production with loss of both porins OmpK35/36. Meanwhile, the association of porin OmpK35/36 loss with ESBL production was not a direct cause of resistance to imipenem.

  18. Allele Frequencies for 15 Short Tandem Repeat Loci in Representative Sample of Croatian Population

    PubMed Central

    Projić, Petar; Škaro, Vedrana; Šamija, Ivana; Pojskić, Naris; Durmić-Pašić, Adaleta; Kovačević, Lejla; Bakal, Narcisa; Primorac, Dragan; Marjanović, Damir

    2007-01-01

    Aim To study the distribution of allele frequencies of 15 short tandem repeat (STR) loci in a representative sample of the Croatian population. Methods A total of 195 unrelated Caucasian individuals born in Croatia, from 14 counties and the City of Zagreb, were sampled for the analysis. All the tested individuals were voluntary donors. Buccal swab was used as the DNA source. AmpFlSTR® Identifiler® was applied to simultaneously amplify 15 STR loci. Total reaction volume was 12.5 μL. The polymerase chain reaction (PCR) amplification was carried out in PE Gene Amp PCR System Thermal Cycler. Electrophoresis of the amplification products was preformed on an ABI PRISM 3130 Genetic Analyzer. After PCR amplification and separation by electrophoresis, raw data were compiled, analyzed, and numerical allele designations of the profiles were obtained. Deviation from Hardy-Weinberg equilibrium, observed and expected heterozygosity, power of discrimination, and power of exclusion were calculated. Bonferroni’s correction was used before each comparative analysis. Results We compared Croatian data with those obtained from geographically neighboring European populations. The significant difference (at P<0.01) in allele frequencies was recorded only between the Croatian and Slovenian populations for vWA locus. There was no significant deviation from Hardy-Weinberg equilibrium for all the observed loci. Conclusion Obtained population data concurred with the expected “STR data frame” for this part of Europe. PMID:17696301

  19. [Role of cyclic adenosine monophosphate(cAMP) in the regulation of intestinal epithelial barrier function under hypoxia].

    PubMed

    Yang, Yang; Wang, Wen-Sheng; Qiu, Yuan; Sun, Li-Hua; Yang, Hua

    2013-05-01

    To investigate the role of cyclic adenosine monophosphate(cAMP) in the regulation of intestinal epithelial barrier function under hypoxia. Intestinal epithelial barrier was established by Caco-2 monolayers. Cells were divided into four groups: normoxia (Nx), normoxia plus Forskolin(Nx+FSK), hypoxia(Hx), hypoxia plus SQ22536(Hx+SQ22536). cAMP concentrations of different groups were assessed by cAMP enzyme immunoassay kit. RT-PCR and Western blotting were used to detect the mRNA and protein expressions of claudin-1 and occludin under normoxic and hypoxic condition. Caco-2 monolayers were grown on Millicell filters, and transepithelial electrical resistance(TER) was measured using a Millipore electric resistance system. The concentration of cAMP under hypoxic conditions(Hx group) was higher compared with Nx group [(6.30±0.50) pmol/L vs. (2.38±0.18) pmol/L, P<0.01]. At the same time, both mRNA and protein expressions of claudin-1 and occluding were lower in Hx group than those in Nx group(all P<0.05). TER decreased by 76.30±0.64(P<0.01). When the monolayers were exposed to hypoxia plus SQ22536 (Hx+SQ22536 group), the concentration of cAMP was(2.12±0.23) pmol/L, which was lower than that under hypoxic conditions(Hx group, P<0.01). Both mRNA and protein expressions of claudin-1 and occludin were higher compared to Hx group (all P<0.01). TER increased by 32.96±2.16 (P<0.05). When Caco-2 cells are exposed to hypoxia, barrier function, claudin-1 and occludin expression are diminished in parallel with a high level of intracellular cAMP compared with the normoxic condition. Inhibition of the intracellular cAMP level under hypoxia can maintain the intestinal epithelial function through regulating the claudin-1 and occludin expression and attenuate the permeability of intestinal mucosa.

  20. Application of six multiplex PCR's among 200 clinical isolates of Pseudomonas aeruginosa for the detection of 20 drug resistance encoding genes.

    PubMed

    Murugan, Nandagopal; Malathi, Jambulingam; Therese, K Lily; Madhavan, Hajib NarahariRao

    2018-02-01

    Pseudomonas aeruginosa (P. aeruginosa) is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA) has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR) to detect the presence of betalactamase genes encoding bla Tem , bla OXA , bla CTX-M-15 , bla Vim , bla Ges , bla Veb , bla DIM , AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5%) nfxB regulator gene, 102 (51%) MexA, 96 (48%) MexC, 93 (46.5%) MexB, 86 (43%) MexD, 81 (40.5%) OprM, 74 (37%) OprJ, 72 (36%) OprD and MexR, 53 (26.5%) Mex X and OprN, 49 (24.5%) MexY gene. Betalactamase genes 145 (72.5%) bla Tem , 67 (33.5%) bla OXA, 35 (17.5%) blaVim, 25(12.50%), 23 (11.50%) blaVeb, 21 (11.5%) blaGes, 14 (7%) Ctx-m and 10 (5%) AmpC and 5 (2.5%) blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19%) and 29 (14.5%) out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection. Copyright © 2017. Published by Elsevier Taiwan.

  1. Adenosine monophosphate affects competence development and plasmid DNA transformation in Escherichia coli.

    PubMed

    Zhang, Yan; Li, Wenhua; Wang, Liming; Shen, Ping; Xie, Zhixiong

    2013-11-01

    Artificial plasmid DNA transformation of Escherichia coli induced by calcium chloride is a routine technique in molecular biology and genetic engineering processes, but its mechanism has remained elusive. Because adenosine monophosphate (AMP) has been found to regulate natural transformation in Haemophilus influenza, we aimed to investigate the effects of AMP and its derivatives on E. coli transformation by treating competence with different concentrations of them. Analysis of the transformation efficiencies revealed that AMP inhibited the artificial plasmid DNA transformation of E. coli in a concentration- and time-dependent manner. Furthermore, we found that AMP had no effect on the expression of the transformed gene but that the intracellular AMP level of the competent cells rose after a 6 h treatment. These results suggested that the intracellular AMP level had an important role in E. coli transformation. And these have useful implications for the further investigation of the mechanism of E. coli transformation.

  2. Increase in Ca2+ current by sustained cAMP levels enhances proliferation rate in GH3 cells.

    PubMed

    Rodrigues, Andréia Laura; Brescia, Marcella; Koschinski, Andreas; Moreira, Thaís Helena; Cameron, Ryan T; Baillie, George; Beirão, Paulo S L; Zaccolo, Manuela; Cruz, Jader S

    2018-01-01

    Ca 2+ and cAMP are important intracellular modulators. In order to generate intracellular signals with various amplitudes, as well as different temporal and spatial properties, a tightly and precise control of these modulators in intracellular compartments is necessary. The aim of this study was to evaluate the effects of elevated and sustained cAMP levels on voltage-dependent Ca 2+ currents and proliferation in pituitary tumor GH3 cells. Effect of long-term exposure to forskolin and dibutyryl-cyclic AMP (dbcAMP) on Ca 2+ current density and cell proliferation rate were determined by using the whole-cell patch-clamp technique and real time cell monitoring system. The cAMP levels were assayed, after exposing transfected GH3 cells with the EPAC-1 cAMP sensor to forskolin and dbcAMP, by FRET analysis. Sustained forskolin treatment (24 and 48h) induced a significant increase in total Ca 2+ current density in GH3 cells. Accordingly, dibutyryl-cAMP incubation (dbcAMP) also elicited increase in Ca 2+ current density. However, the maximum effect of dbcAMP occurred only after 72h incubation, whereas forskolin showed maximal effect at 48h. FRET-experiments confirmed that the time-course to elevate intracellular cAMP was distinct between forskolin and dbcAMP. Mibefradil inhibited the fast inactivating current component selectively, indicating the recruitment of T-type Ca 2+ channels. A significant increase on cell proliferation rate, which could be related to the elevated and sustained intracellular levels of cAMP was observed. We conclude that maintaining high levels of intracellular cAMP will cause an increase in Ca 2+ current density and this phenomenon impacts proliferation rate in GH3 cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Antibiotic resistances of intestinal lactobacilli isolated from wild boars.

    PubMed

    Klose, Viviana; Bayer, Katharina; Kern, Corinna; Goelß, Florian; Fibi, Silvia; Wegl, Gertrude

    2014-01-10

    Acquired antibiotic resistances have been reported in lactobacilli of various animal and food sources, but there are no data from wild boar. The objective was a preliminary examination of the antibiotic resistance prevalence of intrinsically vancomycin-resistant lactobacilli isolated from wild boar intestines and analysis of the genetic determinants implicated. Out of three wild boars, 121 lactobacilli were recovered and grouped according to their whole cell protein patterns. Initial phenotypic screening revealed that all were susceptible to erythromycin (2 μg/ml), but 30 were resistant to tetracycline (32 μg/ml). Based on Randomly Amplified Polymorphic DNA-PCR clustering, 64 strains were selected as representative genotypes for identification and minimum inhibitory concentration (MIC) determination. Partial 16S rRNA gene sequencing identified four species: (i) L. mucosae (n=57), (ii) L. reuteri (n=47), (iii) L. fermentum (n=12), and (iv) L. murinus (n=5). Most heterofermentative strains displayed low MICs for ampicillin (AMP), chloramphenicol (CHL), streptomycin (STR), kanamycin (KAN), gentamicin (GEN), erythromycin (ERY), quinupristin/dalfopristin (Q/D), and clindamycin (CLI). Atypical MICs were found mainly in L. mucosae and L. reuteri for TET, KAN, STR, AMP and CHL, but except the TET MICs of L. mucosae mostly at low level. L. murinus strains revealed atypical MICs for aminoglycosides, and/or CHL, AMP, CLI. PCR screening detected tet(W) in 12 and tet(M) in one of heterofermentative strains, as well as the aph(3')-III kanamycin gene in L. murinus. This is the first report showing acquired antibiotic resistance determinants in intestinal lactobacilli of wild boar origin. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. MRI signal intensity of anterior cruciate ligament graft after transtibial versus anteromedial portal technique (TRANSIG): design of a randomized controlled clinical trial.

    PubMed

    Ruiter, Simeon J S; Brouwer, Reinoud W; Meys, Tim W G M; Slump, Cornelis H; van Raay, Jos J A M

    2016-08-10

    There are two primary surgical techniques to reconstruct the anterior cruciate ligament (ACL), transtibial (TT) technique and anteromedial portal (AMP) technique. Currently, there is no consensus which surgical technique elicits the best clinical and functional outcomes. MRI-derived measures of the signal intensity (SI) of the ACL graft have been described as an independent predictor of graft properties. The purpose of this study is to compare the MRI derived SI measurements of the ACL graft one year after ACL reconstruction, in order to compare the outcomes of both the AMP and TT ACL reconstruction technique. Thirty-six patients will be included in a randomized controlled trial. Patients who are admitted for primary unilateral ACL reconstruction will be included in the study. Exclusion criteria are a history of previous surgery on the ipsilateral knee, re-rupture of the ipsilateral ACL graft, associated ligamentous injuries or meniscal tear of the ipsilateral knee, unhealthy contralateral knee, contra-indications for MRI and a preference for one of the two surgical techniques and/or orthopaedic surgeon. Primary outcome is MRI Signal intensity ratio (SIR) of the ACL graft. Secondary outcome measures are the International Knee Documentation Committee (IKDC) Knee Examination Form,the Knee injury and Osteoarthritis Outcome Scores (KOOS) and the Anterior Cruciate Ligament OsteoArthritis Score (ACLOAS). Differences between MRI SIR assessment with the current MRI protocol (proton density weighted imaging protocol) and the additional T2*-weighted gradient-echo protocol will be assessed. There is no consensus regarding the TT or AMP ACL reconstruction technique. SI measurements with MRI have been used in other clinical studies for evaluation of the ACL graft and maturation after ACL reconstruction compared to clinical and functional outcomes. This randomized controlled trial has been designed to compare the TT technique with the AMP technique with the use of MRI SI of the graft after ACL reconstruction. Netherlands Trial Registry NTR5410 (registered on August 24, 2015).

  5. A calmodulin inhibitor, W-7 influences the effect of cyclic adenosine 3', 5'-monophosphate signaling on ligninolytic enzyme gene expression in Phanerochaete chrysosporium

    PubMed Central

    2012-01-01

    The capacity of white-rot fungi to degrade wood lignin may be highly applicable to the development of novel bioreactor systems, but the mechanisms underlying this function are not yet fully understood. Lignin peroxidase (LiP) and manganese peroxidase (MnP), which are thought to be very important for the ligninolytic property, demonstrated increased activity in Phanerochaete chrysosporium RP-78 (FGSC #9002, ATCC MYA-4764™) cultures following exposure to 5 mM cyclic adenosine 3', 5'-monophosphate (cAMP) and 500 μM 3'-isobutyl-1-methylxanthine (IBMX), a phosphodiesterase inhibitor. Real-time reverse transcription polymerase chain reaction (RT-PCR) analysis revealed that transcription of most LiP and MnP isozyme genes was statistically significantly upregulated in the presence of the cAMP and IBMX compared to the untreated condition. However, 100 μM calmodulin (CaM) inhibitor N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide (W-7), which had insignificant effects on fungal growth and intracellular cAMP concentration, not only offset the increased activity and transcription induced by the drugs, but also decreased them to below basal levels. Like the isozyme genes, transcription of the CaM gene (cam) was also upregulated by cAMP and IBMX. These results suggest that cAMP signaling functions to increase the transcription of LiP and MnP through the induction of cam transcription. PMID:22273182

  6. The high-affinity phosphodiesterase PdeH regulates development and aflatoxin biosynthesis in Aspergillus flavus.

    PubMed

    Yang, Kunlong; Liu, Yinghang; Liang, Linlin; Li, Zhenguo; Qin, Qiuping; Nie, Xinyi; Wang, Shihua

    2017-04-01

    Cyclic AMP signaling controls a range of physiological processes in response to extracellular stimuli in organisms. Among the signaling cascades, cAMP, as a second messenger, is orchestrated by adenylate cyclase (biosynthesis) and cAMP phosphodiesterases (PDEs) (hydrolysis). In this study, we investigated the function of the high-affinity (PdeH) and low-affinity (PdeL) cAMP phosphodiesterase from the carcinogenic aflatoxin producing fungus Aspergillus flavus, and found that instead of PdeL, inactivation of PdeH exhibited a reduction in conidiation and sclerotia formation. However, the ΔpdeL/ΔpdeH mutant exhibited an enhanced phenotype defects, a similar phenotype defects to wild-type strain treated with exogenous cAMP. The activation of PKA activity was inhibited in the ΔpdeH or ΔpdeL/ΔpdeH mutant, both of whom exhibited increasing AF production. Further analysis by qRT-PCR revealed that pdeH had a high transcriptional level compared to pdeL in wild-type strain, and affected pdeL transcription. Green fluorescent protein tagging at the C-terminus of PDEs showed that PdeH-GFP is broadly compartmentalized in the cytosol, while PdeL-GFP localized mainly to the nucleus. Overall, our results indicated that PdeH plays a major role, but has overlapping function with PdeL, in vegetative growth, development and AF biosynthesis in A. flavus. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  7. Integrative function of adrenaline receptors for glucagon-like peptide-1 exocytosis in enteroendocrine L cell line GLUTag.

    PubMed

    Harada, Kazuki; Kitaguchi, Tetsuya; Tsuboi, Takashi

    2015-05-15

    Adrenaline reacts with three types of adrenergic receptors, α1, α2 and β-adrenergic receptors (ARs), inducing many physiological events including exocytosis. Although adrenaline has been shown to induce glucagon-like peptide-1 (GLP-1) secretion from intestinal L cells, the precise molecular mechanism by which adrenaline regulates GLP-1 secretion remains unknown. Here we show by live cell imaging that all types of adrenergic receptors are stimulated by adrenaline in enteroendocrine L cell line GLUTag cells and are involved in GLP-1 exocytosis. We performed RT-PCR analysis and found that α1B-, α2A-, α2B-, and β1-ARs were expressed in GLUTag cells. Application of adrenaline induced a significant increase of intracellular Ca(2+) and cAMP concentration ([Ca(2+)]i and [cAMP]i, respectively), and GLP-1 exocytosis in GLUTag cells. Blockade of α1-AR inhibited adrenaline-induced [Ca(2+)]i increase and exocytosis but not [cAMP]i increase, while blockade of β1-AR inhibited adrenaline-induced [cAMP]i increase and exocytosis but not [Ca(2+)]i increase. Furthermore, overexpression of α2A-AR suppressed the adrenaline-induced [cAMP]i increase and exocytosis. These results suggest that the fine-turning of GLP-1 secretion from enteroendocrine L cells is established by the balance between α1-, α2-, and β-ARs activation. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Cross-Sectional Study on Prevalence and Molecular Characteristics of Plasmid Mediated ESBL/AmpC-Producing Escherichia coli Isolated from Veal Calves at Slaughter

    PubMed Central

    Hordijk, Joost; Wagenaar, Jaap A.; Kant, Arie; van Essen-Zandbergen, Alieda; Dierikx, Cindy; Veldman, Kees; Wit, Ben; Mevius, Dik

    2013-01-01

    Objectives The presence of ESBL/AmpC-producing E. coli in cattle has been reported previously, however information on veal calves is limited. This study describes the prevalence and molecular characteristics of E. coli with non-wild type susceptibility to cefotaxime in veal calves at slaughter. Methods Faecal samples from 100 herds, 10 individual animals per herd, were screened for E. coli with non-wild type susceptibility for cefotaxime. Molecular characterization of ESBL/AmpC genes and plasmids was performed on one isolate per herd by microarray, PCR and sequence analysis. Results 66% of the herds were positive for E. coli with non-wild type susceptibility for cefotaxime. Within-herd prevalence varied from zero to 90%. 83% of E. coli producing ESBL/AmpC carried bla CTX-M genes, of which bla CTX-M-1, bla CTX-M-14 and bla CTX-M-15 were most prevalent. The dominant plasmids were IncI1 and IncF-type plasmids. Conclusions A relatively high prevalence of various bla CTX-M producing E. coli was found in veal calves at slaughter. The genes were mainly located on IncI1 and IncF plasmids. PMID:23724148

  9. Right ventricular outflow tract tachycardia due to a somatic cell mutation in G protein subunitalphai2.

    PubMed Central

    Lerman, B B; Dong, B; Stein, K M; Markowitz, S M; Linden, J; Catanzaro, D F

    1998-01-01

    Idiopathic ventricular tachycardia is a generic term that describes the various forms of ventricular arrhythmias that occur in patients without structural heart disease and in the absence of the long QT syndrome. Many of these tachycardias are focal in origin, localize to the right ventricular outflow tract (RVOT), terminate in response to beta blockers, verapamil, vagal maneuvers, and adenosine, and are thought to result from cAMP-mediated triggered activity. DNA was prepared from biopsy samples obtained from myocardial tissue from a patient with adenosine-insensitive idiopathic ventricular tachycardia arising from the RVOT. Genomic sequences of the inhibitory G protein Galphai2 were determined after amplification by PCR and subcloning. A point mutation (F200L) in the GTP binding domain of the inhibitory G protein Galphai2 was identified in a biopsy sample from the arrhythmogenic focus. This mutation was shown to increase intracellular cAMP concentration and inhibit suppression of cAMP by adenosine. No mutations were detected in Galphai2 sequences from myocardial tissue sampled from regions remote from the origin of tachycardia, or from peripheral lymphocytes. These findings suggest that somatic cell mutations in the cAMP-dependent signal transduction pathway occurring during myocardial development may be responsible for some forms of idiopathic ventricular tachycardia. PMID:9637720

  10. PDE4 and PDE5 regulate cyclic nucleotide contents and relaxing effects on carbachol-induced contraction in the bovine abomasum.

    PubMed

    Kaneda, Takeharu; Kido, Yuuki; Tajima, Tsuyoshi; Urakawa, Norimoto; Shimizu, Kazumasa

    2015-01-01

    The effects of various selective phosphodiesterase (PDE) inhibitors on carbachol (CCh)-induced contraction in the bovine abomasum were investigated. Various selective PDE inhibitors, vinpocetine (type 1), erythro-9-(2-hydroxy-3-nonyl) adenine (EHNA, type 2), milrinone (type 3), Ro20-1724 (type 4), vardenafil (type 5), BRL-50481 (type 7) and BAY73-6691 (type 9), inhibited CCh-induced contractions in a concentration-dependent manner. Among the PDE inhibitors, Ro20-1724 and vardenafil induced more relaxation than the other inhibitors based on the data for the IC50 or maximum relaxation. In smooth muscle of the bovine abomasum, we showed the expression of PDE4B, 4C, 4D and 5 by RT-PCR analysis. In the presence of CCh, Ro20-1724 increased the cAMP content, but not the cGMP content. By contrast, vardenafil increased the cGMP content, but not the cAMP content. These results suggest that Ro20-1724-induced relaxation was correlated with cAMP and that vardenafil-induced relaxation was correlated with cGMP in the bovine abomasum. In conclusion, PDE4 and PDE5 are the enzymes involved in regulation of the relaxation associated with cAMP and cGMP, respectively, in the bovine abomasum.

  11. Endogenous Production of Extracellular Adenosine by Trabecular Meshwork Cells: Potential Role in Outflow Regulation

    PubMed Central

    Wu, Jing; Li, Guorong; Luna, Coralia; Spasojevic, Ivan; Epstein, David L.; Gonzalez, Pedro

    2012-01-01

    Purpose. To investigate the mechanisms for endogenous production of extracellular adenosine in trabecular meshwork (TM) cells and evaluate its physiological relevance to the regulation of aqueous humor outflow facility. Methods. Extra-cellular levels of adenosine monophosphate (AMP) and adenosine in porcine trabecular meshwork (PTM) cells treated with adenosine triphosphate (ATP), AMP, cAMP or forskolin with or without specific inhibitors of phosphodiesterases (IBMX) and CD73 (AMPCP) were determined by high-pressure liquid chromatography fluorometry. Extracellular adenosine was also evaluated in cell cultures subjected to cyclic mechanical stress (CMS) (20% stretching; 1 Hz) and after disruption of lipid rafts with methyl-β-cyclodextrin. Expression of CD39 and CD73 in porcine TM cells and tissue were examined by Q-PCR and Western blot. The effect of inhibition of CD73 on outflow facility was evaluated in perfused living mouse eyes. Results. PTM cells generated extracellular adenosine from extracellular ATP and AMP but not from extracellular cAMP. Increased intracellular cAMP mediated by forskolin led to a significant increase in extracellular adenosine production that was not prevented by IBMX. Inhibition of CD73 resulted, in all cases, in a significant decrease in extracellular adenosine. CMS induced a significant activation of extracellular adenosine production. Inhibition of CD73 activity with AMPCP in living mouse eyes resulted in a significant decrease in outflow facility. Conclusions. These results support the concept that the extracellular adenosine pathway might play an important role in the homeostatic regulation of outflow resistance in the TM, and suggest a novel mechanism by which pathologic alteration of the TM, such as increased tissue rigidity, could lead to abnormal elevation of IOP in glaucoma. PMID:22997289

  12. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System

    PubMed Central

    Zahid, M. Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M.; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens. PMID:26361388

  13. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System.

    PubMed

    Zahid, M Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens.

  14. Low-level laser therapy (LLLT) acts as cAMP-elevating agent in acute respiratory distress syndrome.

    PubMed

    de Lima, Flávia Mafra; Moreira, Leonardo M; Villaverde, A B; Albertini, Regiane; Castro-Faria-Neto, Hugo C; Aimbire, Flávio

    2011-05-01

    The aim of this work was to investigate if the low-level laser therapy (LLLT) on acute lung inflammation (ALI) induced by lipopolysaccharide (LPS) is linked to tumor necrosis factor (TNF) in alveolar macrophages (AM) from bronchoalveolar lavage fluid (BALF) of mice. LLLT has been reported to actuate positively for relieving the late and early symptoms of airway and lung inflammation. It is not known if the increased TNF mRNA expression and dysfunction of cAMP generation observed in ALI can be influenced by LLLT. For in vivo studies, Balb/c mice (n = 5 for group) received LPS inhalation or TNF intra nasal instillation and 3 h after LPS or TNF-α, leukocytes in BALF were analyzed. LLLT administered perpendicularly to a point in the middle of the dissected bronchi with a wavelength of 660 nm and a dose of 4.5 J/cm(2). The mice were irradiated 15 min after ALI induction. In vitro AM from mice were cultured for analyses of TNF mRNA expression and protein and adenosine3':5'-cyclic monophosphate (cAMP) levels. One hour after LPS, the TNF and cAMP levels in AM were measured by ELISA. RT-PCR was used to measure TNF mRNA in AM. The LLLT was inefficient in potentiating the rolipram effect in presence of a TNF synthesis inhibitor. LLLT attenuated the neutrophil influx and TNF in BALF. In AM, the laser increased the cAMP and reduced the TNF-α mRNA. LLLT increases indirectly the cAMP in AM by a TNF-dependent mechanism.

  15. Antimicrobial Activity of Cationic Antimicrobial Peptides against Gram-Positives: Current Progress Made in Understanding the Mode of Action and the Response of Bacteria.

    PubMed

    Omardien, Soraya; Brul, Stanley; Zaat, Sebastian A J

    2016-01-01

    Antimicrobial peptides (AMPs) have been proposed as a novel class of antimicrobials that could aid the fight against antibiotic resistant bacteria. The mode of action of AMPs as acting on the bacterial cytoplasmic membrane has often been presented as an enigma and there are doubts whether the membrane is the sole target of AMPs. Progress has been made in clarifying the possible targets of these peptides, which is reported in this review with as focus gram-positive vegetative cells and spores. Numerical estimates are discussed to evaluate the possibility that targets, other than the membrane, could play a role in susceptibility to AMPs. Concerns about possible resistance that bacteria might develop to AMPs are addressed. Proteomics, transcriptomics, and other molecular techniques are reviewed in the context of explaining the response of bacteria to the presence of AMPs and to predict what resistance strategies might be. Emergent mechanisms are cell envelope stress responses as well as enzymes able to degrade and/or specifically bind (and thus inactivate) AMPs. Further studies are needed to address the broadness of the AMP resistance and stress responses observed.

  16. Antimicrobial Activity of Cationic Antimicrobial Peptides against Gram-Positives: Current Progress Made in Understanding the Mode of Action and the Response of Bacteria

    PubMed Central

    Omardien, Soraya; Brul, Stanley; Zaat, Sebastian A. J.

    2016-01-01

    Antimicrobial peptides (AMPs) have been proposed as a novel class of antimicrobials that could aid the fight against antibiotic resistant bacteria. The mode of action of AMPs as acting on the bacterial cytoplasmic membrane has often been presented as an enigma and there are doubts whether the membrane is the sole target of AMPs. Progress has been made in clarifying the possible targets of these peptides, which is reported in this review with as focus gram-positive vegetative cells and spores. Numerical estimates are discussed to evaluate the possibility that targets, other than the membrane, could play a role in susceptibility to AMPs. Concerns about possible resistance that bacteria might develop to AMPs are addressed. Proteomics, transcriptomics, and other molecular techniques are reviewed in the context of explaining the response of bacteria to the presence of AMPs and to predict what resistance strategies might be. Emergent mechanisms are cell envelope stress responses as well as enzymes able to degrade and/or specifically bind (and thus inactivate) AMPs. Further studies are needed to address the broadness of the AMP resistance and stress responses observed. PMID:27790614

  17. Development of high temperature, high radiation resistant silicon semiconductors

    NASA Technical Reports Server (NTRS)

    Whorl, C. A.; Evans, A. W.

    1972-01-01

    The development of a hardened silicon power transistor for operation in severe nuclear radiation environments at high temperature was studied. Device hardness and diffusion techniques are discussed along with the geometries of hardened power transistor chips. Engineering drawings of 100 amp and 5 amp silicon devices are included.

  18. Recent Advances in the Development of Antimicrobial Peptides (AMPs): Attempts for Sustainable Medicine?

    PubMed

    Kokel, Anne; Torok, Marianna

    2018-01-17

    Since the first isolation of antimicrobial peptides (AMPs) they have attracted extensive interest in medicinal chemistry. However, only a few AMP-based drugs are currently available on the market. Despite their effectiveness, biodegradability, and versatile mode of action that is less likely to induce resistance compared to conventional antibiotics, AMPs suffer from major issues that need to be addressed to broaden their use. Notably, AMPs can lack selectivity leading to side effects and cytotoxicity, and also exhibit in vivo instability. Several strategies are being actively considered to overcome the limitations that restrain the success of AMPs. In the current work, recent strategies reported for improving AMPs in the context of drug design and delivery were surveyed, and also their possible impact on patients and the environment was assessed. As a major advantage AMPs possess an easily tunable skeleton offering opportunities to improve their properties. Strategic structural modifications and the beneficial properties of cyclic or branched AMPs in term of stability have been reported. The conjugation of AMPs with nanoparticles has also been explored to increase their in vivo stability. Other techniques such as the coupling of AMPs with specific antibodies aim to increase the selectivity of the potential drug towards the target. These strategies were evaluated for their effect on the environment highlighting green technologies. Although further research is needed taking into account both environmental and human health consequences of novel AMPs several of these compounds are promising drug candidates for use in sustainable medicine. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  19. Identical plasmid AmpC beta-lactamase genes and plasmid types in E. coli isolates from patients and poultry meat in the Netherlands.

    PubMed

    Voets, Guido M; Fluit, Ad C; Scharringa, Jelle; Schapendonk, Claudia; van den Munckhof, Thijs; Leverstein-van Hall, Maurine A; Stuart, James Cohen

    2013-11-01

    The increasing prevalence of third-generation cephalosporin-resistant Enterobacteriaceae is a worldwide problem. Recent studies showed that poultry meat and humans share identical Extended-Spectrum Beta-Lactamase genes, plasmid types, and Escherichia coli strain types, suggesting that transmission from poultry meat to humans may occur. The aim of this study was to compare plasmid-encoded Ambler class C beta-lactamase (pAmpC) genes, their plasmids, and bacterial strain types between E. coli isolates from retail chicken meat and clinical isolates in the Netherlands. In total, 98 Dutch retail chicken meat samples and 479 third-generation cephalosporin non-susceptible human clinical E. coli isolates from the same period were screened for pAmpC production. Plasmid typing was performed using PCR-based replicon typing (PBRT). E coli strains were compared using Multi-Locus-Sequence-Typing (MLST). In 12 of 98 chicken meat samples (12%), pAmpC producing E. coli were detected (all blaCMY-2). Of the 479 human E. coli, 25 (5.2%) harboured pAmpC genes (blaCMY-2 n = 22, blaACT n = 2, blaMIR n = 1). PBRT showed that 91% of poultry meat isolates harboured blaCMY-2 on an IncK plasmid, and 9% on an IncI1 plasmid. Of the human blaCMY-2 producing isolates, 42% also harboured blaCMY-2 on an IncK plasmid, and 47% on an IncI1 plasmid. Thus, 68% of human pAmpC producing E. coli have the same AmpC gene (blaCMY-2) and plasmid type (IncI1 or IncK) as found in poultry meat. MLST showed one cluster containing one human isolate and three meat isolates, with an IncK plasmid. These findings imply that a foodborne transmission route of blaCMY-2 harbouring plasmids cannot be excluded and that further evaluation is required. © 2013.

  20. Biofilm Formation and β-Lactamase Production in Burn Isolates of Pseudomonas aeruginosa.

    PubMed

    Heydari, Samira; Eftekhar, Fereshteh

    2015-03-01

    Pseudomonas aeruginosa is an important nosocomial pathogen characterized by its innate resistance to multiple antimicrobial agents. Plasmid-mediated drug resistance also occurs by the production of extended-spectrum β-lactamases (ESBL), metallo β-lactamases (MBL), and AmpC β-lactamases. Another important factor for establishment of chronic infections by P. aeruginosa is biofilm formation mediated by the psl gene cluster. The aim of this study was to evaluate biofilm formation and presence of the pslA gene in burn isolates of P. aeruginosa as well as the association of antibiotic resistance, MBL, ESBL and AmpC β-lactamase production with biofilm formation among the isolates. Sixty-two burn isolates of P. aeruginosa were obtained from Shahid Motahari Hospital in Tehran from August to October 2011. Antibiotic susceptibility was determined by the disc diffusion assay. MBL, AmpC and ESBL production were screened using the double disc synergy test, AmpC disc test and combined disc diffusion assay, respectively. The potential to form biofilm was measured using the microtiter plate assay and pslA gene was detected using specific primers and PCR. Biofilm formation was observed in 43.5% of the isolates, of which 66.7% produced strong and 33.3% formed weak biofilms. All biofilm-positive and 14.2% of biofilm-negative isolates harbored the pslA gene. MBL, AmpC and ESBL production were significantly higher in the biofilm-positive isolates (70.3%, 62.9% and 33.3%, respectively) compared to the biofilm-negative strains (31.4%, 34.2% and 20%, respectively). Overall, 19 isolates (30.6%) co-produced MBL and AmpC, among which the majority were biofilm-positive (63.1%). Finally, four isolates (6.4%) had all three enzymes, of which 3 (75%) produced biofilm. Biofilm formation (both strong and weak) strongly correlated with pslA gene carriage. Biofilm formation also correlated with MBL and AmpC β-lactamase production. More importantly, multiple-β-lactamase phenotype was associated with formation of strong biofilms.

  1. The effects of IGF1 on the melanogenesis in alpaca melanocytes in vitro.

    PubMed

    Hu, Shuaipeng; Liu, Yu; Yang, Shanshan; Ji, Kaiyuan; Liu, Xuexian; Zhang, Junzhen; Fan, Ruiwen; Dong, Changsheng

    2016-09-01

    In order to investigate the effects of the insulin-like growth factor 1(IGF-1) on alpaca melanocyte in vitro, different dosees of IGF1 (0, 10, 20, 40 ng/ml) were added in the medium of alpaca melanocyte. The RTCA machine was used to monitor the proliferation, quantitative real-time PCR, and western blot to test the relative gene expression, ELISA to test cAMP production, and spectrum method to test the melanin production. The results showed that compared to the normal melanocyte, the proliferation of melanocytes was increased within 60 h following adding IGF1. It also showed that cAMP content produced by melanocytes was increased, microphthalmia-associtated transcription factor (MITF), tyrosinase (TYR) and tyrosinase-related protein 2 (TYRP2) expression was increased, and melanin production with most obvious change in 10 ng/ml supplementary group, when compared with the control group. The results suggested that IGF1 with the dose of 10 ng/ml had the important effects on the melanogenesis in alpaca melanocyte by the cAMP pathway.

  2. Nobiletin enhances differentiation and lipolysis of 3T3-L1 adipocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Saito, Takeshi; Abe, Daigo; Sekiya, Keizo

    2007-06-01

    Nobiletin is a polymethoxylated flavone found in certain citrus fruits. Here we demonstrate that nobiletin enhance differentiation of 3T3-L1 preadipocytes. Nobiletin dose-dependently increased accumulation of lipid droplets in adipocytes. Quantitative RT-PCR analyses indicated that nobiletin increased the expression of genes critical for acquisition of the adipocyte phenotype. Some of them were known peroxisome proliferator activated receptor {gamma} (PPAR{gamma}) targets and PPAR{gamma} itself, however, nobiletin did not exhibit PPAR{gamma} ligand activity. We observed the expression of CCAAT/enhancer binding protein {beta} (C/EBP{beta}), a transcription factor for PPAR{gamma}, was increased by nobiletin. The activation of cAMP-responsive element binding protein (CREB) and extracellular signal-regulatedmore » kinase (ERK), which play important roles in C/EBP{beta} expression were also potentiated by nobiletin. Furthermore, nobiletin stimulated lipolysis in differentiated adipocytes, which is known to be stimulated by cAMP pathway. These results suggested that nobiletin enhanced both differentiation and lipolysis of adipocyte through activation of signaling cascades mediated by cAMP/CREB.« less

  3. Allele frequency distribution for 21 autosomal STR loci in Nepal.

    PubMed

    Kraaijenbrink, T; van Driem, G L; Opgenort, J R M L; Tuladhar, N M; de Knijff, P

    2007-05-24

    The allele frequency distributions of 21 autosomal loci contained in the AmpFlSTR Identifiler, the Powerplex 16 and the FFFL multiplex PCR kits, was studied in 953 unrelated individuals from Nepal. Several new alleles (i.e. not yet reported in the NIST Short Tandem Repeat DNA Internet DataBase [http://www.cstl.nist.gov/biotech/strbase/]) have been detected in the process.

  4. Antimicrobial peptides interact with peptidoglycan

    NASA Astrophysics Data System (ADS)

    Neelay, Om P.; Peterson, Christian A.; Snavely, Mary E.; Brown, Taylor C.; TecleMariam, Ariam F.; Campbell, Jennifer A.; Blake, Allison M.; Schneider, Sydney C.; Cremeens, Matthew E.

    2017-10-01

    Traditional therapeutics are losing effectiveness as bacterial resistance increases, and antimicrobial peptides (AMPs) can serve as an alternative source for antimicrobial agents. Their mode of action is commonly hypothesized to involve pore formation in the lipid membrane, thereby leading to cell death. However, bacterial cell walls are much more complex than just the lipid membrane. A large portion of the wall is comprised of peptidoglycan, yet we did not find any report of AMP-peptidoglycan interactions. Consequently, this work evaluated AMP-peptidoglycan and AMP-phospholipid (multilamellar vesicles) interactions through tryptophan fluorescence. Given that peptidoglycan is insoluble and vesicles are large particles, we took advantage of the unique properties of Trp-fluorescence to use one technique for two very different systems. Interestingly, melittin and cecropin A interacted with peptidoglycan to a degree similar to vancomycin, a positive control. Whether these AMP-peptidoglycan interactions relate to a killing mode of action requires further study.

  5. Imaging Live Drosophila Brain with Two-Photon Fluorescence Microscopy

    NASA Astrophysics Data System (ADS)

    Ahmed, Syeed Ehsan

    Two-photon fluorescence microscopy is an imaging technique which delivers distinct benefits for in vivo cellular and molecular imaging. Cyclic adenosine monophosphate (cAMP), a second messenger molecule, is responsible for triggering many physiological changes in neural system. However, the mechanism by which this molecule regulates responses in neuron cells is not yet clearly understood. When cAMP binds to a target protein, it changes the structure of that protein. Therefore, studying this molecular structure change with fluorescence resonance energy transfer (FRET) imaging can shed light on the cAMP functioning mechanism. FRET is a non-radiative dipole-dipole coupling which is sensitive to small distance change in nanometer scale. In this study we have investigated the effect of dopamine in cAMP dynamics in vivo. In our study two-photon fluorescence microscope was used for imaging mushroom bodies inside live Drosophila melanogaster brain and we developed a method for studying the change in cyclic AMP level.

  6. High fructose consumption induces DNA methylation at PPARα and CPT1A promoter regions in the rat liver

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ohashi, Koji; Munetsuna, Eiji; Yamada, Hiroya, E-mail: hyamada@fujita-hu.ac.jp

    DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR.more » Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.« less

  7. Real-time loop-mediated isothermal amplification (RealAmp) for the species-specific identification of Plasmodium vivax.

    PubMed

    Patel, Jaymin C; Oberstaller, Jenna; Xayavong, Maniphet; Narayanan, Jothikumar; DeBarry, Jeremy D; Srinivasamoorthy, Ganesh; Villegas, Leopoldo; Escalante, Ananias A; DaSilva, Alexandre; Peterson, David S; Barnwell, John W; Kissinger, Jessica C; Udhayakumar, Venkatachalam; Lucchi, Naomi W

    2013-01-01

    Plasmodium vivax infections remain a major source of malaria-related morbidity and mortality. Early and accurate diagnosis is an integral component of effective malaria control programs. Conventional molecular diagnostic methods provide accurate results but are often resource-intensive, expensive, have a long turnaround time and are beyond the capacity of most malaria-endemic countries. Our laboratory has recently developed a new platform called RealAmp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of malaria parasites. Here we describe new primers for the detection of P. vivax using the RealAmp method. Three pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the P. vivax genome. The amplification was carried out at 64°C using SYBR Green or SYTO-9 intercalating dyes for 90 minutes with the tube scanner set to collect fluorescence signals at 1-minute intervals. Clinical samples of P. vivax and other human-infecting malaria parasite species were used to determine the sensitivity and specificity of the primers by comparing with an 18S ribosomal RNA-based nested PCR as the gold standard. The new set of primers consistently detected laboratory-maintained isolates of P. vivax from different parts of the world. The primers detected P. vivax in the clinical samples with 94.59% sensitivity (95% CI: 87.48-98.26%) and 100% specificity (95% CI: 90.40-100%) compared to the gold standard nested-PCR method. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting P. vivax.

  8. Expression of aquaporin 1 and 5 and their regulation by ovarian hormones, arachidonic acid, forskolin and cAMP during implantation in pigs.

    PubMed

    Skowronska, A; Mlotkowska, P; Majewski, M; Nielsen, S; Skowronski, M T

    2016-11-08

    Aquaporin proteins (AQPs) are a family of channels expressed in numerous mammalian tissues, where they play a fundamental role in regulating water transport across cell membranes. Based on reports that AQPs are present in the reproductive system and participate in reproductive processes, our aim was to investigate the effect of progesterone (P(4)), estradiol (E(2)), oxytocin (OT), arachidonic acid (AA), forskolin (FSK) and cyclic adenosine monophosphate (cAMP) on AQP1 and AQP5 expression at mRNA and protein levels in porcine uterine explants from Days 14-16 of gestation in order to determine if they play a role in implantation period in pigs. Quantitative real time PCR and Western-blot analysis revealed that the uterine explants treated with FSK and cAMP produce delayed, but long-term effects on AQP1 abundance (24 h) while AQP5 had a rapid and sustained response to FSK and cAMP in protein content (3 and 24 h). AA increases gene and protein content of AQP1 after longer exposition whereas AQP5 increases after 3 h only at the protein level. Both AQPs potentially remains under control of steroid hormones. OT has been shown to increase AQP1, and decrease AQP5 mRNA, without visible changes in protein content. P(4), E(2), AA, FSK and cAMP caused the appearance of AQP5 expression in the basolateral plasma membrane of the epithelial cells. The staining represents most likely AQP5 functioning mechanism for both absorption and reabsorption across the glandular epithelium.

  9. Innovative use of self-organising maps (SOMs) in model validation.

    NASA Astrophysics Data System (ADS)

    Jolly, Ben; McDonald, Adrian; Coggins, Jack

    2016-04-01

    We present an innovative combination of techniques for validation of numerical weather prediction (NWP) output against both observations and reanalyses using two classification schemes, demonstrated by a validation of the operational NWP 'AMPS' (the Antarctic Mesoscale Prediction System). Historically, model validation techniques have centred on case studies or statistics at various time scales (yearly/seasonal/monthly). Within the past decade the latter technique has been expanded by the addition of classification schemes in place of time scales, allowing more precise analysis. Classifications are typically generated for either the model or the observations, then used to create composites for both which are compared. Our method creates and trains a single self-organising map (SOM) on both the model output and observations, which is then used to classify both datasets using the same class definitions. In addition to the standard statistics on class composites, we compare the classifications themselves between the model and the observations. To add further context to the area studied, we use the same techniques to compare the SOM classifications with regimes developed for another study to great effect. The AMPS validation study compares model output against surface observations from SNOWWEB and existing University of Wisconsin-Madison Antarctic Automatic Weather Stations (AWS) during two months over the austral summer of 2014-15. Twelve SOM classes were defined in a '4 x 3' pattern, trained on both model output and observations of 2 m wind components, then used to classify both training datasets. Simple statistics (correlation, bias and normalised root-mean-square-difference) computed for SOM class composites showed that AMPS performed well during extreme weather events, but less well during lighter winds and poorly during the more changeable conditions between either extreme. Comparison of the classification time-series showed that, while correlations were lower during lighter wind periods, AMPS actually forecast the existence of those periods well suggesting that the correlations may be unfairly low. Further investigation showed poor temporal alignment during more changeable conditions, highlighting problems AMPS has around the exact timing of events. There was also a tendency for AMPS to over-predict certain wind flow patterns at the expense of others. In order to gain a larger scale perspective, we compared our mesoscale SOM classification time-series with synoptic scale regimes developed by another study using ERA-Interim reanalysis output and k-means clustering. There was good alignment between the regimes and the observations classifications (observations/regimes), highlighting the effect of synoptic scale forcing on the area. However, comparing the alignment between observations/regimes and AMPS/regimes showed that AMPS may have problems accurately resolving the strength and location of cyclones in the Ross Sea to the north of the target area.

  10. Transcutaneous electrical nerve stimulation (TENS) improves the diabetic cytopathy (DCP) via up-regulation of CGRP and cAMP.

    PubMed

    Ding, Liucheng; Song, Tao; Yi, Chaoran; Huang, Yi; Yu, Wen; Ling, Lin; Dai, Yutian; Wei, Zhongqing

    2013-01-01

    The objective of this study was to investigate the effects and mechanism of Transcutaneous Electrical Nerve Stimulation (TENS) on the diabetic cytopathy (DCP) in the diabetic bladder. A total of 45 rats were randomly divided into diabetes mellitus (DM)/TENS group (n=15), DM group (n=15) and control group (n=15). The rats in the DM/TENS and TENS groups were electronically stimulated (stimulating parameters: intensity-31 V, frequency-31 Hz, and duration of stimulation of 15 min) for three weeks. Bladder histology, urodynamics and contractile responses to field stimulation and carbachol were determined. The expression of calcitonin gene-related peptide (CGRP) was analyzed by RT-PCR and Western blotting. The results showed that contractile responses of the DM rats were ameliorated after 3 weeks of TENS. Furthermore, TENS significantly increased bladder wet weight, volume threshold for micturition and reduced PVR, V% and cAMP content of the bladder. The mRNA and protein levels of CGRP in dorsal root ganglion (DRG) in the DM/TENS group were higher than those in the DM group. TENS also significantly up-regulated the cAMP content in the bladder body and base compared with diabetic rats. We conclude that TENS can significantly improve the urine contractility and ameliorate the feeling of bladder fullness in DM rats possibly via up-regulation of cAMP and CGRP in DRG.

  11. Real-time fluorescence loop-mediated isothermal amplification assay for direct detection of egg drop syndrome virus.

    PubMed

    Zheney, Makay; Kaziyev, Zhambul; Kassenova, Gulmira; Zhao, Lingna; Liu, Wei; Liang, Lin; Li, Gang

    2018-02-13

    Egg drop syndrome (EDS), caused by the adenovirus "egg drop syndrome virus" (EDSV) causes severe economic losses through reduced egg production in breeder and layer flocks. The diagnosis of EDSV has been done by molecular tools since its complete genome sequence was identified. In order to enhance the capabilities of the real-time fluorescence loop-mediated isothermal amplification (RealAmp) assay, we aimed to apply the method for direct detection of the EDSV without viral DNA extraction. In order to detect the presence of the EDSV DNA, three pairs of primers were designed, from the conserved region of fiber gene of the EDSV. For our assay, test and control samples were directly used in the reaction mixture in 10-fold serial dilution. The target DNA was amplified at 65 °C, which yield positive results in a relatively short period of 40-45 min. The method reported in this study is highly sensitive as compared to polymerase chain reaction (PCR) and showed no sign of cross-reactivity or false positive results. The RealAmp accomplished specific identification of EDSV among a variety of poultry disease viruses. The direct RealAmp can be used to detect the presence of EDSV. As our result showed, the RealAmp method could be suitable for the direct detection of other DNA viruses.

  12. Pathogenic and commensal Escherichia coli from irrigation water show potential in transmission of extended spectrum and AmpC β-lactamases determinants to isolates from lettuce

    PubMed Central

    Njage, Patrick M K; Buys, Elna M

    2015-01-01

    There are few studies on the presence of extended-spectrum β-lactamases and AmpC β-lactamases (ESBL/AmpC) in bacteria that contaminate vegetables. The role of the production environment in ESBL/AmpC gene transmission is poorly understood. The occurrence of ESBL/AmpC in Escherichia coli (n = 46) from lettuce and irrigation water and the role of irrigation water in the transmission of resistant E. coli were studied. The presence of ESBL/AmpC, genetic similarity and phylogeny were typed using genotypic and phenotypic techniques. The frequency of β-lactamase gene transfer was studied in vitro. ESBLs/AmpC were detected in 35 isolates (76%). Fourteen isolates (30%) produced both ESBLs/AmpC. Prevalence was highest in E. coli from lettuce (90%). Twenty-two isolates (48%) were multi-resistant with between two and five ESBL/AmpC genes. The major ESBL determinant was the CTX-M type (34 isolates). DHA (33% of isolates) were the dominant AmpC β lactamases. There was a high conjugation efficiency among the isolates, ranging from 3.5 × 10−2 to 1 × 10−2 ± 1.4 × 10−1 transconjugants per recipient. Water isolates showed a significantly higher conjugation frequency than those from lettuce. A high degree of genetic relatedness between E. coli from irrigation water and lettuce indicated possible common ancestry and pathway of transmission. PMID:25488608

  13. Machine learning in the rational design of antimicrobial peptides.

    PubMed

    Rondón-Villarreal, Paola; Sierra, Daniel A; Torres, Rodrigo

    2014-01-01

    One of the most important public health issues is the microbial and bacterial resistance to conventional antibiotics by pathogen microorganisms. In recent years, many researches have been focused on the development of new antibiotics. Among these, antimicrobial peptides (AMPs) have raised as a promising alternative to combat antibioticresistant microorganisms. For this reason, many theoretical efforts have been done in the development of new computational tools for the rational design of both better and effective AMPs. In this review, we present an overview of the rational design of AMPs using machine learning techniques and new research fields.

  14. Trends in primary and revision anterior cruciate ligament reconstruction among National Basketball Association team physicians.

    PubMed

    Mall, Nathan A; Abrams, Geoffrey D; Azar, Frederick M; Traina, Steve M; Allen, Answorth A; Parker, Richard; Cole, Brian J

    2014-06-01

    Anterior cruciate ligament (ACL) tears are common in athletes. Techniques and methods of treatment for these injuries continue to vary among surgeons. Thirty National Basketball Association (NBA) team physicians were surveyed during the NBA Pre-Draft Combine. Survey questions involved current and previous practice methods of primary and revision ACL reconstruction, including technique, graft choice, rehabilitation, and treatment of combined ACL and medial collateral ligament injuries. Descriptive parametric statistics, Fisher exact test, and logistic regression were used, and significance was set at α = 0.05. All 30 team physicians completed the survey. Eighty-seven percent indicated they use autograft (81% bone-patellar tendon-bone) for primary ACL reconstruction in NBA athletes, and 43% indicated they use autograft for revision cases. Fourteen surgeons (47%) indicated they use an anteromedial portal (AMP) for femoral tunnel drilling, whereas 5 years earlier only 4 (13%) used this technique. There was a significant (P = .009) positive correlation between fewer years in practice and AMP use. NBA team physicians' use of an AMP for femoral tunnel drilling has increased over the past 5 years.

  15. CREB expression in the brains of two closely related parasitic wasp species that differ in long-term memory formation.

    PubMed

    van den Berg, M; Verbaarschot, P; Hontelez, S; Vet, L E M; Dicke, M; Smid, H M

    2010-06-01

    The cAMP/PKA signalling pathway and transcription factor cAMP response element-binding protein (CREB) play key roles in long-term memory (LTM) formation. We used two closely related parasitic wasp species, Cotesia glomerata and Cotesia rubecula, which were previously shown to be different in LTM formation, and sequenced at least nine different CREB transcripts in both wasp species. The splicing patterns, functional domains and amino acid sequences were similar to those found in the CREB genes of other organisms. The predicted amino acid sequences of the CREB isoforms were identical in both wasp species. Using real-time quantitative PCR we found that two low abundant CREB transcripts are differentially expressed in the two wasps, whereas the expression levels of high abundant transcripts are similar.

  16. Development of a recombinase polymerase amplification assay for the detection of pathogenic Leptospira.

    PubMed

    Ahmed, Ahmed; van der Linden, Hans; Hartskeerl, Rudy A

    2014-05-08

    Detection of leptospires based on DNA amplification techniques is essential for the early diagnosis of leptospirosis when anti-Leptospira antibodies are below the detection limit of most serological tests. In middle and low income countries where leptospirosis is endemic, routine implementation of real-time PCR is financially and technically challenging due to the requirement of expensive thermocycler equipment. In this study we report the development and evaluation of a novel isothermal recombinase polymerase amplification assay (RPA) for detection of pathogenic Leptospira based on TwistAmp chemistry. RPA enabled the detection of less than two genome copies per reaction. Retrospective evaluation revealed a high diagnostic accuracy (sensitivity and specificity of 94.7% and 97.7%, respectively) compared to culturing as the reference standard. RPA presents a powerful tool for the early diagnosis of leptospirosis in humans and in animals. Furthermore, it enables the detection of the causative agent in reservoirs and environment, and as such is a valuable adjunct to current tools for surveillance and early outbreak warning.

  17. Development of a Recombinase Polymerase Amplification Assay for the Detection of Pathogenic Leptospira

    PubMed Central

    Ahmed, Ahmed; van der Linden, Hans; Hartskeerl, Rudy A.

    2014-01-01

    Detection of leptospires based on DNA amplification techniques is essential for the early diagnosis of leptospirosis when anti-Leptospira antibodies are below the detection limit of most serological tests. In middle and low income countries where leptospirosis is endemic, routine implementation of real-time PCR is financially and technically challenging due to the requirement of expensive thermocycler equipment. In this study we report the development and evaluation of a novel isothermal recombinase polymerase amplification assay (RPA) for detection of pathogenic Leptospira based on TwistAmp chemistry. RPA enabled the detection of less than two genome copies per reaction. Retrospective evaluation revealed a high diagnostic accuracy (sensitivity and specificity of 94.7% and 97.7%, respectively) compared to culturing as the reference standard. RPA presents a powerful tool for the early diagnosis of leptospirosis in humans and in animals. Furthermore, it enables the detection of the causative agent in reservoirs and environment, and as such is a valuable adjunct to current tools for surveillance and early outbreak warning. PMID:24814943

  18. Temporal Analysis of the Magnaporthe Oryzae Proteome During Conidial Germination and Cyclic AMP (cAMP)-mediated Appressorium Formation*

    PubMed Central

    Franck, William L.; Gokce, Emine; Oh, Yeonyee; Muddiman, David C.; Dean, Ralph A.

    2013-01-01

    Rice blast disease caused by Magnaporthe oryzae is one of the most serious threats to global rice production. During the earliest stages of rice infection, M. oryzae conidia germinate on the leaf surface and form a specialized infection structure termed the appressorium. The development of the appressorium represents the first critical stage of infectious development. A total of 3200 unique proteins were identified by nanoLC-MS/MS in a temporal study of conidial germination and cAMP-induced appressorium formation in M. oryzae. Using spectral counting based label free quantification, observed changes in relative protein abundance during the developmental process revealed changes in the cell wall biosynthetic machinery, transport functions, and production of extracellular proteins in developing appressoria. One hundred and sixty-six up-regulated and 208 down-regulated proteins were identified in response to cAMP treatment. Proteomic analysis of a cAMP-dependent protein kinase A mutant that is compromised in the ability to form appressoria identified proteins whose developmental regulation is dependent on cAMP signaling. Selected reaction monitoring was used for absolute quantification of four regulated proteins to validate the global proteomics data and confirmed the germination or appressorium specific regulation of these proteins. Finally, a comparison of the proteome and transcriptome was performed and revealed little correlation between transcript and protein regulation. A subset of regulated proteins were identified whose transcripts show similar regulation patterns and include many of the most strongly regulated proteins indicating a central role in appressorium formation. A temporal quantitative RT-PCR analysis confirmed a strong correlation between transcript and protein abundance for some but not all genes. Collectively, the data presented here provide the first comprehensive view of the M. oryzae proteome during early infection-related development and highlight biological processes important for pathogenicity. PMID:23665591

  19. Antimicrobial peptides secreted by equine mesenchymal stromal cells inhibit the growth of bacteria commonly found in skin wounds.

    PubMed

    Harman, Rebecca M; Yang, Steven; He, Megan K; Van de Walle, Gerlinde R

    2017-07-04

    The prevalence of chronic skin wounds in humans is high, and treatment is often complicated by the presence of pathogenic bacteria. Therefore, safe and innovative treatments to reduce the bacterial load in cutaneous wounds are needed. Mesenchymal stromal cells (MSC) are known to provide paracrine signals that act on resident skin cells to promote wound healing, but their potential antibacterial activities are not well described. The present study was designed to examine the antibacterial properties of MSC from horses, as this animal model offers a readily translatable model for MSC therapies in humans. Specifically, we aimed to (i) evaluate the in vitro effects of equine MSC on the growth of representative gram-negative and gram-positive bacterial species commonly found in skin wounds and (ii) define the mechanisms by which MSC inhibit bacterial growth. MSC were isolated from the peripheral blood of healthy horses. Gram-negative E. coli and gram-positive S. aureus were cultured in the presence of MSC and MSC conditioned medium (CM), containing all factors secreted by MSC. Bacterial growth was measured by plating bacteria and counting viable colonies or by reading the absorbance of bacterial cultures. Bacterial membrane damage was detected by incorporation of N-phenyl-1-naphthylamine (NPN). Antimicrobial peptide (AMP) gene and protein expression by equine MSC were determined by RT-PCR and Western blot analysis, respectively. Blocking of AMP activity of MSC CM was achieved using AMP-specific antibodies. We found that equine MSC and MSC CM inhibit the growth of E. coli and S. aureus, and that MSC CM depolarizes the cell membranes of these bacteria. In addition, we found that equine MSC CM contains AMPs, and blocking these AMPs with antibodies reduces the effects of MSC CM on bacteria. Our results demonstrate that equine MSC inhibit bacterial growth and secrete factors that compromise the membrane integrity of bacteria commonly found in skin wounds. We also identified four specific AMPs produced by equine MSC. The secretion of AMPs may contribute to the value of MSC as a therapy for cutaneous wounds in both horses and humans.

  20. Biofilm Formation and β-Lactamase Production in Burn Isolates of Pseudomonas aeruginosa

    PubMed Central

    Heydari, Samira; Eftekhar, Fereshteh

    2015-01-01

    Background: Pseudomonas aeruginosa is an important nosocomial pathogen characterized by its innate resistance to multiple antimicrobial agents. Plasmid-mediated drug resistance also occurs by the production of extended-spectrum β-lactamases (ESBL), metallo β-lactamases (MBL), and AmpC β-lactamases. Another important factor for establishment of chronic infections by P. aeruginosa is biofilm formation mediated by the psl gene cluster. Objectives: The aim of this study was to evaluate biofilm formation and presence of the pslA gene in burn isolates of P. aeruginosa as well as the association of antibiotic resistance, MBL, ESBL and AmpC β-lactamase production with biofilm formation among the isolates. Materials and Methods: Sixty-two burn isolates of P. aeruginosa were obtained from Shahid Motahari Hospital in Tehran from August to October 2011. Antibiotic susceptibility was determined by the disc diffusion assay. MBL, AmpC and ESBL production were screened using the double disc synergy test, AmpC disc test and combined disc diffusion assay, respectively. The potential to form biofilm was measured using the microtiter plate assay and pslA gene was detected using specific primers and PCR. Results: Biofilm formation was observed in 43.5% of the isolates, of which 66.7% produced strong and 33.3% formed weak biofilms. All biofilm-positive and 14.2% of biofilm-negative isolates harbored the pslA gene. MBL, AmpC and ESBL production were significantly higher in the biofilm-positive isolates (70.3%, 62.9% and 33.3%, respectively) compared to the biofilm-negative strains (31.4%, 34.2% and 20%, respectively). Overall, 19 isolates (30.6%) co-produced MBL and AmpC, among which the majority were biofilm-positive (63.1%). Finally, four isolates (6.4%) had all three enzymes, of which 3 (75%) produced biofilm. Conclusions: Biofilm formation (both strong and weak) strongly correlated with pslA gene carriage. Biofilm formation also correlated with MBL and AmpC β-lactamase production. More importantly, multiple-β-lactamase phenotype was associated with formation of strong biofilms. PMID:25964848

  1. cAMP-dependent chloride secretion mediates tubule enlargement and cyst formation by cultured mammalian collecting duct cells.

    PubMed

    Montesano, Roberto; Ghzili, Hafida; Carrozzino, Fabio; Rossier, Bernard C; Féraille, Eric

    2009-02-01

    Polycystic kidney diseases result from disruption of the genetically defined program that controls the size and geometry of renal tubules. Cysts which frequently arise from the collecting duct (CD) result from cell proliferation and fluid secretion. From mCCD(cl1) cells, a differentiated mouse CD cell line, we isolated a clonal subpopulation (mCCD-N21) that retains morphogenetic capacity. When grown in three-dimensional gels, mCCD-N21 cells formed highly organized tubular structures consisting of a palisade of polarized epithelial cells surrounding a cylindrical lumen. Subsequent addition of cAMP-elevating agents (forskolin or cholera toxin) or of membrane-permeable cAMP analogs (CPT-cAMP) resulted in rapid and progressive dilatation of existing tubules, leading to the formation of cystlike structures. When grown on filters, mCCD-N21 cells exhibited a high transepithelial resistance as well as aldosterone- and/or vasopressin-induced amiloride-sensitive and -insensitive current. The latter was in part inhibited by Na(+)-K(+)-2Cl(-) cotransporter (bumetanide) and chloride channel (NPPB) inhibitors. Real-time PCR analysis confirmed the expression of NKCC1, the ubiquitous Na(+)-K(+)-2Cl(-) cotransporter and cystic fibrosis transmembrane regulator (CFTR) in mCCD-N21 cells. Tubule enlargement and cyst formation were prevented by inhibitors of Na(+)-K(+)-2Cl(-) cotransporters (bumetanide or ethacrynic acid) or CFTR (NPPB or CFTR inhibitor-172). These results further support the notion that cAMP signaling plays a key role in renal cyst formation, at least in part by promoting chloride-driven fluid secretion. This new in vitro model of tubule-to-cyst conversion affords a unique opportunity for investigating the molecular mechanisms that govern the architecture of epithelial tubes, as well as for dissecting the pathophysiological processes underlying cystic kidney diseases.

  2. Adenylyl cyclase 3/adenylyl cyclase-associated protein 1 (CAP1) complex mediates the anti-migratory effect of forskolin in pancreatic cancer cells.

    PubMed

    Quinn, Sierra N; Graves, Sarai H; Dains-McGahee, Clayton; Friedman, Emilee M; Hassan, Humma; Witkowski, Piotr; Sabbatini, Maria E

    2017-04-01

    Pancreatic cancer is one of the most lethal human malignancies. A better understanding of the intracellular mechanism of migration and invasion is urgently needed to develop treatment that will suppress metastases and improve overall survival. Cyclic adenosine monophosphate (cyclic AMP) is a second messenger that has shown to regulate migration and invasion of pancreatic cancer cells. The rise of cyclic AMP suppressed migration and invasion of pancreatic ductal adenocarcinoma cells. Cyclic AMP is formed from cytosolic ATP by the enzyme adenylyl cyclase (AC). There are ten isoforms of ACs; nine are anchored in the plasma membrane and one is soluble. What remains unknown is the extent to which the expression of transmembrane AC isoforms is both modified in pancreatic cancer and mediates the inhibitory effect of forskolin on cell motility. Using real-time PCR analysis, ADCY3 was found to be highly expressed in pancreatic tumor tissues, resulting in a constitutive increase in cyclic AMP levels. On the other hand, ADCY2 was down-regulated. Migration, invasion, and filopodia formation in two different pancreatic adenocarcinoma cell lines, HPAC and PANC-1 deficient in AC1 or AC3, were studied. We found that AC3, upon stimulation with forskolin, enhanced cyclic AMP levels and inhibited cell migration and invasion. Unlikely to be due to a cytotoxic effect, the inhibitory effects of forskolin involved the quick formation of AC3/adenylyl cyclase-associated protein 1 (CAP1)/G-actin complex, which inhibited filopodia formation and cell motility. Using Western blotting analysis, forskolin, through AC3 activation, caused phosphorylation of CREB, but not ERK. The effect of CREB phosphorylation is likely to be associated with long-term signaling changes. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  3. Lubiprostone activates Cl- secretion via cAMP signaling and increases membrane CFTR in the human colon carcinoma cell line, T84.

    PubMed

    Ao, Mei; Venkatasubramanian, Jayashree; Boonkaewwan, Chaiwat; Ganesan, Nivetha; Syed, Asma; Benya, Richard V; Rao, Mrinalini C

    2011-02-01

    Lubiprostone, used clinically (b.i.d.) to treat constipation, has been reported to increase transepithelial Cl(-) transport in T84 cells by activating ClC-2 channels. To identify the underlying signaling pathway, we explored the effects of short-term and overnight lubiprostone treatment on second messenger signaling and Cl(-) transport. Cl(-) transport was assessed either as I(sc) across T84 monolayers grown on Transwells and mounted in Ussing chambers or by the iodide efflux assay. [cAMP](i) was measured by enzyme immunoassay, and [Ca(2+)](i) by Fluo-3 fluorescence. Quantitation of apical cell surface CFTR protein levels was assessed by Western blotting and biotinylation with the EZ-Link Sulfo-NHS-LC-LC-Biotin. ClC-2 mRNA level was studied by RT-PCR. Lubiprostone and the cAMP stimulator, forskolin, caused comparable and maximal increases of I(sc) in T84 cells. The I(sc) effects of lubiprostone and forskolin were each suppressed if the tissue had previously been treated with the other agent. These responses were unaltered even if the monolayers were treated with lubiprostone overnight. Lubiprostone-induced increases in iodide efflux were ~80% of those obtained with forskolin. Lubiprostone increased [cAMP](i). H89, bumetanide, or CFTR(inh)-172 greatly attenuated lubiprostone-stimulated Cl(-) secretion, whereas the ClC-2 inhibitor CdCl(2) did not. Compared to controls, FSK-treatment increased membrane-associated CFTR by 1.9 fold, and lubiprostone caused a 2.6-fold increase in apical membrane CFTR as seen by immunoblotting following cell surface biotinylation. Lubiprostone activates Cl(-) secretion in T84 cells via cAMP, protein kinase A, and by increasing apical membrane CFTR protein.

  4. In Vitro and In Vivo Activities of Pterostilbene against Candida albicans Biofilms

    PubMed Central

    Li, De-Dong; Zhao, Lan-Xue; Mylonakis, Eleftherios; Hu, Gan-Hai; Zou, Yong; Huang, Tong-Kun; Yan, Lan

    2014-01-01

    Pterostilbene (PTE) is a stilbene-derived phytoalexin that originates from several natural plant sources. In this study, we evaluated the activity of PTE against Candida albicans biofilms and explored the underlying mechanisms. In 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) reduction assays, biofilm biomass measurement, confocal laser scanning microscopy, and scanning electron microscopy, we found that ≤16 μg/ml PTE had a significant effect against C. albicans biofilms in vitro, while it had no fungicidal effect on planktonic C. albicans cells, which suggested a unique antibiofilm effect of PTE. Then we found that PTE could inhibit biofilm formation and destroy the maintenance of mature biofilms. At 4 μg/ml, PTE decreased cellular surface hydrophobicity (CSH) and suppressed hyphal formation. Gene expression microarrays and real-time reverse transcription-PCR showed that exposure of C. albicans to 16 μg/ml PTE altered the expression of genes that function in morphological transition, ergosterol biosynthesis, oxidoreductase activity, and cell surface and protein unfolding processes (heat shock proteins). Filamentation-related genes, especially those regulated by the Ras/cyclic AMP (cAMP) pathway, including ECE1, ALS3, HWP1, HGC1, and RAS1 itself, were downregulated upon PTE treatment, indicating that the antibiofilm effect of PTE was related to the Ras/cAMP pathway. Then, we found that the addition of exogenous cAMP reverted the PTE-induced filamentous growth defect. Finally, with a rat central venous catheter infection model, we confirmed the in vivo activity of PTE against C. albicans biofilms. Collectively, PTE had strong activities against C. albicans biofilms both in vitro and in vivo, and these activities were associated with the Ras/cAMP pathway. PMID:24514088

  5. Sweet Taste Receptor Expressed in Pancreatic β-Cells Activates the Calcium and Cyclic AMP Signaling Systems and Stimulates Insulin Secretion

    PubMed Central

    Nakagawa, Yuko; Nagasawa, Masahiro; Yamada, Satoko; Hara, Akemi; Mogami, Hideo; Nikolaev, Viacheslav O.; Lohse, Martin J.; Shigemura, Noriatsu; Ninomiya, Yuzo; Kojima, Itaru

    2009-01-01

    Background Sweet taste receptor is expressed in the taste buds and enteroendocrine cells acting as a sugar sensor. We investigated the expression and function of the sweet taste receptor in MIN6 cells and mouse islets. Methodology/Principal Findings The expression of the sweet taste receptor was determined by RT–PCR and immunohistochemistry. Changes in cytoplasmic Ca2+ ([Ca2+]c) and cAMP ([cAMP]c) were monitored in MIN6 cells using fura-2 and Epac1-camps. Activation of protein kinase C was monitored by measuring translocation of MARCKS-GFP. Insulin was measured by radioimmunoassay. mRNA for T1R2, T1R3, and gustducin was expressed in MIN6 cells. In these cells, artificial sweeteners such as sucralose, succharin, and acesulfame-K increased insulin secretion and augmented secretion induced by glucose. Sucralose increased biphasic increase in [Ca2+]c. The second sustained phase was blocked by removal of extracellular calcium and addition of nifedipine. An inhibitor of inositol(1, 4, 5)-trisphophate receptor, 2-aminoethoxydiphenyl borate, blocked both phases of [Ca2+]c response. The effect of sucralose on [Ca2+]c was inhibited by gurmarin, an inhibitor of the sweet taste receptor, but not affected by a Gq inhibitor. Sucralose also induced sustained elevation of [cAMP]c, which was only partially inhibited by removal of extracellular calcium and nifedipine. Finally, mouse islets expressed T1R2 and T1R3, and artificial sweeteners stimulated insulin secretion. Conclusions Sweet taste receptor is expressed in β-cells, and activation of this receptor induces insulin secretion by Ca2+ and cAMP-dependent mechanisms. PMID:19352508

  6. Improving Ethanol Tolerance of Escherichia coli by Rewiring Its Global Regulator cAMP Receptor Protein (CRP)

    PubMed Central

    Yeow, Jianwei; Wang, Ivy; Zhang, Hongfang; Song, Hao; Jiang, Rongrong

    2013-01-01

    A major challenge in bioethanol fermentation is the low tolerance of the microbial host towards the end product bioethanol. Here we report to improve the ethanol tolerance of E. coli from the transcriptional level by engineering its global transcription factor cAMP receptor protein (CRP), which is known to regulate over 400 genes in E. coli. Three ethanol tolerant CRP mutants (E1– E3) were identified from error-prone PCR libraries. The best ethanol-tolerant strain E2 (M59T) had the growth rate of 0.08 h−1 in 62 g/L ethanol, higher than that of the control at 0.06 h−1. The M59T mutation was then integrated into the genome to create variant iE2. When exposed to 150 g/l ethanol, the survival of iE2 after 15 min was about 12%, while that of BW25113 was <0.01%. Quantitative real-time reverse transcription PCR analysis (RT-PCR) on 444 CRP-regulated genes using OpenArray® technology revealed that 203 genes were differentially expressed in iE2 in the absence of ethanol, whereas 92 displayed differential expression when facing ethanol stress. These genes belong to various functional groups, including central intermediary metabolism (aceE, acnA, sdhD, sucA), iron ion transport (entH, entD, fecA, fecB), and general stress response (osmY, rpoS). Six up-regulated and twelve down-regulated common genes were found in both iE2 and E2 under ethanol stress, whereas over one hundred common genes showed differential expression in the absence of ethanol. Based on the RT-PCR results, entA, marA or bhsA was knocked out in iE2 and the resulting strains became more sensitive towards ethanol. PMID:23469036

  7. Reciprocal immune benefit based on complementary production of antibiotics by the leech Hirudo verbana and its gut symbiont Aeromonas veronii.

    PubMed

    Tasiemski, Aurélie; Massol, François; Cuvillier-Hot, Virginie; Boidin-Wichlacz, Céline; Roger, Emmanuel; Rodet, Franck; Fournier, Isabelle; Thomas, Frédéric; Salzet, Michel

    2015-12-04

    The medicinal leech has established a long-term mutualistic association with Aeromonas veronii, a versatile bacterium which can also display free-living waterborne and fish- or human-pathogenic lifestyles. Here, we investigated the role of antibiotics in the dynamics of interaction between the leech and its gut symbiont Aeromonas. By combining biochemical and molecular approaches, we isolated and identified for the first time the antimicrobial peptides (AMPs) produced by the leech digestive tract and by its symbiont Aeromonas. Immunohistochemistry data and PCR analyses evidenced that leech AMP genes are induced in the gut epithelial cells when Aeromonas load is low (starved animals), while repressed when Aeromonas abundance is the highest (post blood feeding). The asynchronous production of AMPs by both partners suggests that these antibiotic substances (i) provide them with reciprocal protection against invasive bacteria and (ii) contribute to the unusual simplicity of the gut microflora of the leech. This immune benefit substantially reinforces the evidence of an evolutionarily stable association between H. verbana and A. veronii. Altogether these data may provide insights into the processes making the association with an Aeromonas species in the digestive tract either deleterious or beneficial.

  8. Salmonella Heidelberg: Genetic profile of its antimicrobial resistance related to extended spectrum β-lactamases (ESBLs).

    PubMed

    Giuriatti, Jéssica; Stefani, Lenita Moura; Brisola, Maiara Cristina; Crecencio, Regiane Boaretto; Bitner, Dinael Simão; Faria, Gláucia Amorim

    2017-08-01

    The objective of this study was to evaluate the phenotypic and genotypic profile of antimicrobial susceptibility and the possible involvement of extended spectrum beta-lactamases (ESBLs) in the resistance profile of Salmonella Heidelberg (SH) isolated from chicken meat. We used 18 SH isolates from chicken meat produced in 2013 in the state of Paraná, Southern Brazil. The isolates were submitted to disk-diffusion tests and from these results it was possible to determine the number of isolates considered multiresistant and the index of multiple antimicrobial resistance (IRMA) against ten antimicrobials routinely used in human and veterinary medicine. It was considered multidrug resistant the isolate that showed resistance to three or more classes of antibiotics. Another test performed was the disc-approximation in order to investigate interposed zones of inhibition, indicative of ESBLs production. In the isolates that presented multidrug resistance (18/18), a search of resistance genes involved in the production of ESBLs was performed using PCR: blaCMY-2, blaSHV-1, blaTEM-1, blaCTX-M2, blaOXA-1, blaPSE-1 and AmpC. The overall antimicrobial resistance was 80.55%. The highest levels of resistance were observed for nalidixic acid and ceftiofur (100%). The most commonly resistance pattern found (42.1%) was A (penicillin-cephalosporin-quinolone-tetracycline). The results were negative for ghost zone formation, indicative of ESBLs. However, PCR technique was able to detect resistance genes via ESBLs where the blaTEM-1 gene showed the highest amplification (83.33%), and the second most prevalent genes were blaCMY-2 (38.88%) and AmpC gene (38.88%). The blaOXA-1 and blaPSE-1 genes were not detected. These results are certainly of concern since SH is becoming more prevalent in the South of Brazil and able to cause severe disease in immune compromised individuals, showing high antimicrobial resistance to those drugs routinely used in the treatment and control of human and animal salmonellosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Occurrence of qnr-positive clinical isolates in Klebsiella pneumoniae producing ESBL or AmpC-type beta-lactamase from five pediatric hospitals in China.

    PubMed

    Wang, Aihua; Yang, Yonghong; Lu, Quan; Wang, Yi; Chen, Yuan; Deng, Li; Ding, Hui; Deng, Qiulian; Wang, Li; Shen, Xuzhuang

    2008-06-01

    The plasmid-mediated quinolone resistance qnr genes in clinical isolates in adults have been described in different countries; however, the frequency of their occurrence has not been detected in pediatric patients. A total of 410 clinical isolates of Klebsiella pneumoniae, identified as producers of an extended-spectrum beta-lactamase (ESBL), or AmpC beta-lactamase, were collected from five children's hospitals in China during 2005-2006. The isolates were screened for the presence of the qnrA, qnrB, and qnrS genes, and then the harboring qnr gene isolates were detected for a bla gene coding for the TEM, SHV, CTX-M, and plasmid-mediated ampC gene by a PCR experiment. Ninety-two isolates (22.7%) were positive for the qnr gene, including 10 of qnrA (2.4%), 25 of qnrB (6.1%), and 62 of qnrS (15.1%). Eighty-one of the 92 (88.0%) qnr-positive isolates carried at least one bla gene for TEM, SHV, CTX-M, or DHA-1. The ciprofloxacin resistance increased 16-256-fold and oflaxacin resistance increased 2-32-fold in transconjugants, respectively. These results indicated that the plasmid-mediated qnr quinolone resistance gene was qnrS, followed by qnrB and qnrA. Most of the isolates also carried a bla gene coding ESBL or ampC gene coding DHA-1 among Klebsiella pneumoniae isolated from Chinese pediatric patients.

  10. Cyclic Adenosine Monophosphate Regulation of Ion Transport in Porcine Vocal Fold Mucosae

    PubMed Central

    Sivasankar, Mahalakshmi; Nofziger, Charity; Blazer-Yost, Bonnie

    2012-01-01

    Objectives/Hypothesis Cyclic adenosine monophosphate (cAMP) is an important biological molecule that regulates ion transport and inflammatory responses in epithelial tissue. The present study examined whether the adenylyl cyclase activator, forskolin, would increase cAMP concentration in porcine vocal fold mucosa and whether the effects of increased cAMP would be manifested as a functional increase in transepithelial ion transport. Additionally, changes in cAMP concentrations following exposure to an inflammatory mediator, tumor necrosis factor-α (TNFα) were investigated. Study Design In vitro experimental design with matched treatment and control groups. Methods Porcine vocal fold mucosae (N = 30) and tracheal mucosae (N = 20) were exposed to forskolin, TNFα, or vehicle (dimethyl sulfoxide) treatment. cAMP concentrations were determined with enzyme-linked immunosorbent assay. Ion transport was measured using electrophysiological techniques. Results Thirty minute exposure to forskolin significantly increased cAMP concentration and ion transport in porcine vocal fold and tracheal mucosae. However, 30-minute and 2-hour exposure to TNFα did not significantly alter cAMP concentration. Conclusions We demonstrate that forskolin-sensitive adenylyl cyclase is present in vocal fold mucosa, and further, that the product, cAMP increases vocal fold ion transport. The results presented here contribute to our understanding of the intracellular mechanisms underlying vocal fold ion transport. As ion transport is important for maintaining superficial vocal fold hydration, data demonstrating forskolin-stimulated ion transport in vocal fold mucosa suggest opportunities for developing pharmacological treatments that increase surface hydration. PMID:18596479

  11. Plasmid-mediated AmpC beta-lactamase-producing Escherichia coli causing urinary tract infection in the Auckland community likely to be resistant to commonly prescribed antimicrobials.

    PubMed

    Drinkovic, Dragana; Morris, Arthur J; Dyet, Kristin; Bakker, Sarah; Heffernan, Helen

    2015-03-13

    To estimate the prevalence and characterise plasmid-mediated AmpC beta-lactamase (PMACBL)- producing Escherichia coli in the Auckland community. All cefoxitin non-susceptible (NS) E. coli identified at the two Auckland community laboratories between 1 January and 31 August 2011 were referred to ESR for boronic acid double-disc synergy testing, to detect the production of AmpC beta-lactamase, and polymerase chain reaction (PCR) to identify the presence of PMACBL genes. PMACBL-producing isolates were typed using pulsed-field gel electrophoresis (PFGE), and PCR was used to determine their phylogenetic group and to identify multilocus sequence type (ST)131. Antimicrobial susceptibility testing and detection of extended-spectrum beta-lactamases (ESBLs) were performed according to the Clinical and Laboratory Standards Institute recommendations. 101 (51%) and 74 (37%) of 200 non-duplicate cefoxitin-NS E. coli were PMACBL producers or assumed hyper-producers of chromosomal AmpC beta-lactamase, respectively. The prevalence of PMACBL-producing E. coli was 0.4%. PMACBL-producing E. coli were significantly less susceptible to norfloxacin, trimethoprim and nitrofurantoin than E. coli that produced neither a PMACBL nor an ESBL. Very few (4%) PMACBL-producing E. coli co-produced an ESBL. Most (88%) of the PMACBL-producing isolates had a CMY-2-like PMACBL. The PMACBL-producing E. coli isolates were diverse based on their PFGE profiles, 44% belonged to phylogenetic group D, and only four were ST131. 100 of the 101 PMACBL-producing E. coli were cultured from urine, and were causing urinary tract infection (UTI) in the majority of patients. The median patient age was 56 years and most (94%) of the patients were women. A greater proportion of patients with community-acquired UTI caused by PMACBL-producing E. coli received a beta-lactam antimicrobial than patients with community-acquired UTI caused by other non-AmpC, non-ESBL-producing E. coli. Thirty-six (43%) patients with community-acquired UTI due to PMACBL-producing E. coli were neither hospitalised nor had any antimicrobial treatment in the previous 6 months. The prevalence of PMACBL-producing E. coli was relatively low in the Auckland community, but has increased in recent years. Typing revealed that the majority of the PMACBL-producing E. coli in the Auckland region were genetically unrelated meaning that a point source or direct person to person transmission are not drivers of local community spread currently. The isolates were more resistant to non-beta-lactam antimicrobials than other non-AmpC, non-ESBL-producing E. coli, leaving few treatment options. The majority of the PMACBL-producing E. coli isolates seemed to be acquired in the community and were most frequently isolated from women with UTI. A large proportion of patients with community-acquired UTI had not been hospitalised nor had any antimicrobial treatment in the previous 6 months.

  12. iTRAQ-based proteomic analysis of LI-F type peptides produced by Paenibacillus polymyxa JSa-9 mode of action against Bacillus cereus.

    PubMed

    Han, Jinzhi; Gao, Peng; Zhao, Shengming; Bie, Xiaomei; Lu, Zhaoxin; Zhang, Chong; Lv, Fengxia

    2017-01-06

    LI-F type peptides (AMP-jsa9) produced by Paenibacillus polymyxa JSa-9 are a group of cyclic lipodepsipeptide antibiotics that exhibit a broad antimicrobial spectrum against Gram-positive bacteria and filamentous fungi, especially Bacillus cereus and Fusarium moniliforme. In this study, to better understand the antibacterial mechanism of AMP-jsa9 against B. cereus, the ultrastructure of AMP-jsa9-treated B. cereus cells was observed by both atomic force microscopy and transmission electron microscopy, and quantitative proteomic analysis was performed on proteins extracted from treated and untreated bacterial cells by using isobaric tag for relative and absolute quantitation (iTRAQ) labeling and LC-MS/MS analysis to access differentially expressed proteins. Furthermore, multiple experiments were conducted to validate the results of the proteomic analysis, including determinations of ATP, NAD (+) H, NADP (+) H, reactive oxygen species (ROS), the activities of catalase (CAT) and superoxide dismutase (SOD), and the relative expression of target genes by quantitative real-time PCR. Bacterial cells exposed to AMP-jsa9 showed irregular surfaces with bleb projections and concaves; we hypothesize that AMP-jsa9 penetrated the cell wall and was anchored on the cytoplasmic membrane and that ROS accumulated in the cell membrane after treatment with AMP-jsa9, modulating the bacterial membrane properties and increasing membrane permeability. Consequently, the blebs were formed on the cell wall by the impulsive force of the leakage of intercellular contents. iTRAQ-based proteomic analysis detected a total of 1317 proteins, including 176 differentially expressed proteins (75 upregulated (fold >2) and 101 downregulated (fold <0.5)). Based on proteome analysis, the putative pathways of AMP-jsa9 action against B. cereus can be summarized as: (i) inhibition of bacterial sporulation, thiamine biosynthesis, energy metabolism, DNA transcription and translation, and cell wall biosynthesis, through direct regulation of protein levels; and (ii) indirect effects on the same pathways through the accumulation of ROS and the consequent impairment of cellular functions, resulting from downregulation of antioxidant proteins, especially CAT and SOD. The mode of action of LI-F type antimicrobial peptides (AMP-jsa9) against B. cereus was elucidated at the proteomic level. Two pathways of AMP-jsa9 action upon B. cereus cells were identified and the mechanism of bleb formation on the surfaces of bacterial cells was predicted based on the results of ultrastructural observation and proteomic analysis. These results are helpful in understanding the mechanism of LI-F type peptides and in providing the theoretical base for applying AMP-jsa9 or its analogs to combat Gram-positive pathogenic bacteria in the food and feed industries. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. AMP kinase-related kinase NUAK2 affects tumor growth, migration, and clinical outcome of human melanoma.

    PubMed

    Namiki, Takeshi; Tanemura, Atsushi; Valencia, Julio C; Coelho, Sergio G; Passeron, Thierry; Kawaguchi, Masakazu; Vieira, Wilfred D; Ishikawa, Masashi; Nishijima, Wataru; Izumo, Toshiyuki; Kaneko, Yasuhiko; Katayama, Ichiro; Yamaguchi, Yuji; Yin, Lanlan; Polley, Eric C; Liu, Hongfang; Kawakami, Yutaka; Eishi, Yoshinobu; Takahashi, Eishi; Yokozeki, Hiroo; Hearing, Vincent J

    2011-04-19

    The identification of genes that participate in melanomagenesis should suggest strategies for developing therapeutic modalities. We used a public array comparative genomic hybridization (CGH) database and real-time quantitative PCR (qPCR) analyses to identify the AMP kinase (AMPK)-related kinase NUAK2 as a candidate gene for melanomagenesis, and we analyzed its functions in melanoma cells. Our analyses had identified a locus at 1q32 where genomic gain is strongly associated with tumor thickness, and we used real-time qPCR analyses and regression analyses to identify NUAK2 as a candidate gene at that locus. Associations of relapse-free survival and overall survival of 92 primary melanoma patients with NUAK2 expression measured using immunohistochemistry were investigated using Kaplan-Meier curves, log rank tests, and Cox regression models. Knockdown of NUAK2 induces senescence and reduces S-phase, decreases migration, and down-regulates expression of mammalian target of rapamycin (mTOR). In vivo analysis demonstrated that knockdown of NUAK2 suppresses melanoma tumor growth in mice. Survival analysis showed that the risk of relapse is greater in acral melanoma patients with high levels of NUAK2 expression than in acral melanoma patients with low levels of NUAK2 expression (hazard ratio = 3.88; 95% confidence interval = 1.44-10.50; P = 0.0075). These data demonstrate that NUAK2 expression is significantly associated with the oncogenic features of melanoma cells and with the survival of acral melanoma patients. NUAK2 may provide a drug target to suppress melanoma progression. This study further supports the importance of NUAK2 in cancer development and tumor progression, while AMPK has antioncogenic properties.

  14. Studies related to primitive chemistry. A proton and nitrogen-14 nuclear magnetic resonance amino acid and nucleic acid constituents and a and their possible relation to prebiotic

    NASA Technical Reports Server (NTRS)

    Manatt, S. L.; Cohen, E. A.; Shiller, A. M.; Chan, S. I.

    1973-01-01

    Preliminary proton nuclear magnetic resonance (NMR) studies were made to determine the applicability of this technique for the study of interactions between monomeric and polymeric amino acids with monomeric nucleic acid bases and nucleotides. Proton NMR results for aqueous solutions (D2O) demonstrated interactions between the bases cytosine and adenine and acidic and aromatic amino acids. Solutions of 5'-AMP admixed with amino acids exhibited more complex behavior but stacking between aromatic rings and destacking at high amino acids concentration was evident. The multisite nature of 5'-AMP was pointed out. Chemical shift changes for adenine and 5'-AMP with three water soluble polypeptides demonstrated that significant interactions exist. It was found that the linewidth-pH profile of each amino acid is unique. It is concluded that NMR techniques can give significant and quantitative data on the association of amino acid and nucleic acid constituents.

  15. Evaluation of a Commercial Multiplex PCR for Rapid Detection of Multi Drug Resistant Gram Negative Infections

    PubMed Central

    Chavada, Ruchir; Maley, Michael

    2015-01-01

    Introduction: Community and healthcare associated infections caused by multi-drug resistant gram negative organisms (MDR GN) represent a worldwide threat. Nucleic Acid Detection tests are becoming more common for their detection; however they can be expensive requiring specialised equipment and local expertise. This study was done to evaluate the utility of a commercial multiplex tandem (MT) PCR for detection of MDR GN. Methods: The study was done on stored laboratory MDR GN isolates from sterile and non-sterile specimens (n=126, out of stored 567 organisms). Laboratory validation of the MT PCR was done to evaluate sensitivity, specificity and agreement with the current phenotypic methods used in the laboratory. Amplicon sequencing was also done on selected isolates for assessing performance characteristics. Workflow and cost implications of the MT PCR were evaluated. Results: The sensitivity and specificity of the MT PCR were calculated to be 95% and 96.7% respectively. Agreement with the phenotypic methods was 80%. Major lack of agreement was seen in detection of AmpC beta lactamase in enterobacteriaceae and carbapenemase in non-fermenters. Agreement of the MT PCR with another multiplex PCR was found to be 87%. Amplicon sequencing confirmed the genotype detected by MT PCR in 94.2 % of cases tested. Time to result was faster for the MT PCR but cost per test was higher. Conclusion: This study shows that with carefully chosen targets for detection of resistance genes in MDR GN, rapid and efficient identification is possible. MT PCR was sensitive and specific and likely more accurate than phenotypic methods. PMID:26464612

  16. Function of beta 2-adrenergic receptors in chronic localized myalgia.

    PubMed

    Maekawa, Kenji; Kuboki, Takuo; Inoue, Eitoku; Inoue-Minakuchi, Mami; Suzuki, Koji; Yatani, Hirofumi; Clark, Glenn T

    2003-01-01

    To investigate alteration of beta 2-adrenergic receptor (beta 2 AR) function in chronic localized myalgia subjects by evaluating levels of the beta 2 AR second messenger, cyclic adenosine monophosphate (cAMP), in mononuclear cells after beta AR-agonist stimulation. Eleven chronic localized myalgia subjects and 21 matched healthy controls participated in this study. Peripheral blood (30 cc) was drawn from the subjects' anterocubital vein. Mononuclear cells were isolated from the total blood by using the Ficoll-Hypaque gradient technique. Basal and stimulated intracellular cAMP levels were determined by enzyme immunoassay using a commercially available kit. Aliquots of 5 x 10(6) cells were incubated with or without stimulation of the beta AR-agonist isoproterenol for 5 minutes. Five different concentrations of isoproterenol (10(-3) M to 10(-7) M) were utilized. cAMP levels in both groups were tested statistically by a 2-way repeated-measures ANOVA with 2 predictors, group difference and isoproterenol concentration difference. As with isoproterenol stimulation, the cAMP responses to forskolin, which activates adenylyl cyclase directly and produces cAMP, bypassing the cell surface receptors were also measured. The basal cAMP levels in both groups (myalgia: 0.33 +/- 0.02 pmol/5 x 10(6) cells; control: 0.43 +/- 0.10 pmol/5 x 10(6) cells) were almost identical, and isoproterenol-produced cAMP levels increased dose-dependently in both groups. No significant differences in the mean cAMP levels were observed between the groups (P = .909). Significant increases were observed according to the isoproterenol concentration increase (P < .0001). The cAMP responses to forskolin stimulation also showed no significant group difference (P = .971). These results suggest that beta 2 AR function is not different between localized myalgia subjects and healthy individuals.

  17. Electrospun polymeric dressings functionalized with antimicrobial peptides and collagen type I for enhanced wound healing

    NASA Astrophysics Data System (ADS)

    Felgueiras, H. P.; Amorim, M. T. P.

    2017-10-01

    Modern wound dressings combine medical textiles with active compounds that stimulate wound healing while protecting against infection. Electrospun wound dressings have been extensively studied and the electrospinning technique recognized as an efficient approach for the production of nanoscale fibrous mats. The unique diverse function and architecture of antimicrobial peptides (AMPs) has attracted considerable attention as a tool for the design of new anti-infective drugs. Functionalizing electrospun wound dressings with these AMPs is nowadays being researched. In the present work, we explore these new systems by highlighting the most important characteristics of electropsun wound dressings, revealing the importance of AMPs to wound healing, and the methods available to functionalize the electrospun mats with these molecules. The combined therapeutic potential of collagen type I and these AMP functionalized dressings will be highlighted as well; the significance of these new strategies for the future of wound healing will be clarified.

  18. Null alleles and sequence variations at primer binding sites of STR loci within multiplex typing systems.

    PubMed

    Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui

    2018-01-01

    Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Separate Cl^- Conductances Activated by cAMP and Ca2+ in Cl^--Secreting Epithelial Cells

    NASA Astrophysics Data System (ADS)

    Cliff, William H.; Frizzell, Raymond A.

    1990-07-01

    We studied the cAMP- and Ca2+-activated secretory Cl^- conductances in the Cl^--secreting colonic epithelial cell line T84 using the whole-cell patch-clamp technique. Cl^- and K^+ currents were measured under voltage clamp. Forskolin or cAMP increased Cl^- current 2-15 times with no change in K^+ current. The current-voltage relation for cAMP-activated Cl^- current was linear from -100 to +100 mV and showed no time-dependent changes in current during voltage pulses. Ca2+ ionophores or increased pipette Ca2+ increased both Cl^- and K^+ currents 2-30 times. The Ca2+-activated Cl^- current was outwardly rectified, activated during depolarizing voltage pulses, and inactivated during hyperpolarizing voltage pulses. Addition of ionophore after forskolin further increased Cl^- conductance 1.5-5 times, and the current took on the time-dependent characteristics of that stimulated by Ca2+. Thus, cAMP and Ca2+ activate Cl^- conductances with different properties, implying that these second messengers activate different Cl^- channels or that they induce different conductive and kinetic states in the same Cl^- channel.

  20. Pit-1/growth hormone factor 1 splice variant expression in the rhesus monkey pituitary gland and the rhesus and human placenta.

    PubMed

    Schanke, J T; Conwell, C M; Durning, M; Fisher, J M; Golos, T G

    1997-03-01

    We have examined the expression of Pit-1 messenger RNA (mRNA) splice variants in the nonhuman primate pituitary and in rhesus and human placenta. Full-length complementary DNAs (cDNAs) representing Pit-1 and the Pit-1 beta splice variants were cloned from a rhesus monkey pituitary cDNA library and were readily detectable by RT-PCR with rhesus pituitary gland RNA. The Pit-1T variant previously reported in mouse pituitary tumor cell lines was not detectable in normal rhesus pituitary tissue, although two novel splice variants were detected. A cDNA approximating the rat Pit-1 delta 4 variant was cloned but coded for a truncated and presumably nonfunctional protein. Only by using a nested RT-PCR approach were Pit-1 and Pit-1 beta variants consistently detectable in both human and rhesus placental tissue. The Pit-1 beta variant mRNA was not detectable in JEG-3 choriocarcinoma cells unless the cells were stimulated with 8-Br-cAMP. Immunoblot studies with nuclear extracts from primary rhesus syncytiotrophoblast cultures or JEG-3 choriocarcinoma cells indicated that although mRNA levels were very low, Pit-1 protein was detectable in differentiated cytotrophoblasts, and levels increased after treatment with 8-Br-cAMP. Two major species of Pit-1 protein were detected that corresponded to the two major bands in rat pituitary GH3 cell nuclear extracts. Low levels of slightly larger bands also were seen, which may represent Pit-1 beta protein or phosphorylated species. We conclude that Pit-1 splice variants expressed in the primate pituitary gland differ from those in the rodent gland and that the Pit-1 and Pit-1 beta mRNAs expressed in the placenta give rise to a pattern of protein expression similar to that seen in pituitary cells, which is inducible by treatment with 8-Br-cAMP.

  1. cAMP controls rod photoreceptor sensitivity via multiple targets in the phototransduction cascade

    PubMed Central

    Astakhova, Luba A.; Samoiliuk, Evgeniia V.; Govardovskii, Victor I.

    2012-01-01

    In early studies, both cyclic AMP (cAMP) and cGMP were considered as potential secondary messengers regulating the conductivity of the vertebrate photoreceptor plasma membrane. Later discovery of the cGMP specificity of cyclic nucleotide–gated channels has shifted attention to cGMP as the only secondary messenger in the phototransduction cascade, and cAMP is not considered in modern schemes of phototransduction. Here, we report evidence that cAMP may also be involved in regulation of the phototransduction cascade. Using a suction pipette technique, we recorded light responses of isolated solitary rods from the frog retina in normal solution and in the medium containing 2 µM of adenylate cyclase activator forskolin. Under forskolin action, flash sensitivity rose more than twofold because of a retarded photoresponse turn-off. The same concentration of forskolin lead to a 2.5-fold increase in the rod outer segment cAMP, which is close to earlier reported natural day/night cAMP variations. Detailed analysis of cAMP action on the phototransduction cascade suggests that several targets are affected by cAMP increase: (a) basal dark phosphodiesterase (PDE) activity decreases; (b) at the same intensity of light background, steady background-induced PDE activity increases; (c) at light backgrounds, guanylate cyclase activity at a given fraction of open channels is reduced; and (d) the magnitude of the Ca2+ exchanger current rises 1.6-fold, which would correspond to a 1.6-fold elevation of [Ca2+]in. Analysis by a complete model of rod phototransduction suggests that an increase of [Ca2+]in might also explain effects (b) and (c). The mechanism(s) by which cAMP could regulate [Ca2+]in and PDE basal activity is unclear. We suggest that these regulations may have adaptive significance and improve the performance of the visual system when it switches between day and night light conditions. PMID:23008435

  2. Parathyroid Hormone Activates Phospholipase C (PLC)-Independent Protein Kinase C Signaling Pathway via Protein Kinase A (PKA)-Dependent Mechanism: A New Defined Signaling Route Would Induce Alternative Consideration to Previous Conceptions

    PubMed Central

    Tong, Guojun; Meng, Yue; Hao, Song; Hu, Shaoyu; He, Youhua; Yan, Wenjuan; Yang, Dehong

    2017-01-01

    Background Parathyroid hormone (PTH) is an effective anti-osteoporosis agent, after binding to its receptor PTHR1, several signaling pathways, including cAMP/protein kinase A (PKA) and phospholipase C (PLC)/protein kinase C (PKC), are initiated through G proteins; with the cAMP/PKA pathway as the major pathway. Earlier studies have reported that PTHR1 might also activate PKC via a PLC-independent mechanism, but this pathway remains unclear. Material/Methods In HEK293 cells, cAMP accumulation was measured with ELISA and PKC was measured with fluorescence resonance energy transfer (FRET) analysis using CKAR plasmid. In MC3T3-E1 cells, real-time PCR was performed to examine gene expressions. Then assays for cell apoptosis, cell differentiation, alkaline phosphatase activity, and mineralization were performed. Results The FRET analysis found that PTH(1–34), [G1,R19]PTH(1–34) (GR(1–34), and [G1,R19]PTH(1–28) (GR(1–28) were all activated by PKC. The PKC activation ability of GR(1–28) was blocked by cAMP inhibitor (Rp-cAMP) and rescued with the addition of active PKA-α and PKA-β. The PKC activation ability of GR(1–34) was partially inhibited by Rp-cAMP. In MC3T3-E1 cells, gene expressions of ALP, CITED1, NR4a2, and OSX that was regulated by GR(1–28) were significantly changed by the pan-PKC inhibitor Go6983. After pretreatment with Rp-cAMP, the gene expressions of ALP, CITED1, and OPG were differentially regulated by GR(1–28) or GR(1–34), and the difference was blunted by Go6983. PTH(1–34), GR(1–28), and GR(1–34) significantly decreased early apoptosis and augmented osteoblastic differentiation in accordance with the activities of PKA and PKC. Conclusions PLC-independent PKC activation induced by PTH could be divided into two potential mechanisms: one was PKA-dependent and associated with PTH(1–28); the other was PKA-independent and associated with PTH(29–34). We also found that PTH could activate PLC-independent PKC via PKA-dependent mechanisms. PMID:28424452

  3. Antimicrobial susceptibilities of Proteus mirabilis: a longitudinal nationwide study from the Taiwan surveillance of antimicrobial resistance (TSAR) program.

    PubMed

    Wang, Jann-Tay; Chen, Pei-Chen; Chang, Shan-Chwen; Shiau, Yih-Ru; Wang, Hui-Ying; Lai, Jui-Fen; Huang, I-Wen; Tan, Mei-Chen; Lauderdale, Tsai-Ling Yang

    2014-09-05

    Longitudinal nationwide data on antimicrobial susceptibility in Proteus mirabilis from different sources are rare. The effects of the revised Clinical and Laboratory Standards Institute (CLSI) β-lactam breakpoints on susceptibility rates and on detecting extended-spectrum β-lactamase (ESBL) and AmpC β-lactamase-producers in this species are also seldom evaluated. The present study analyzed data from the Taiwan Surveillance of Antimicrobial Resistance program to address these issues. Isolates were collected biennially between 2002 and 2012 from 25 to 28 hospitals in Taiwan. Minimum inhibitory concentrations (MIC) were determined by reference broth microdilution method. All isolates with aztreonam, ceftazidime, or cefotaxime MIC ≥ 2 mg/L were checked for the presence of ESBL by CLSI confirmatory test and subjected to ESBL and AmpC β-lactamases gene detection by PCR. Univariate and multivariate analyses were performed. Between 2002 and 2012, a total of 1157 P. mirabilis were studied. Susceptibility to cefotaxime, ceftazidime, and ciprofloxacin decreased significantly during the past decade, from 92.6% to 81.7%, 100% to 95.2%, and 80.1% to 53.8%, respectively (P < 0.01). The revised CLSI breakpoints had significant impact on susceptibility to cefazolin (2009 vs. current breakpoints, 71.9% vs. 0.9%) and imipenem (99.8% vs. 55.1%) (P < 0.001 for both). However, using the 2014 cefazolin breakpoints for urinary tract infections, 81.2% of the urine isolates were susceptible. Susceptibilities of isolates from different specimen types were mostly similar but outpatient isolates were more susceptible than inpatient isolates. The overall prevalence of ESBL- and AmpC- producers was 8.2% and 4.7%, respectively, but AmpC carriage increased significantly over the years (from 0 to 7.0%, P < 0.001). ESBL and AmpC β-lactamase-producers were more likely to be found in elderly and ICU patients. The predominant ESBL and AmpC β-lactamase genes were CTX-M- and CMY- types, respectively. A significant decrease in susceptibility to 3rd-generation cephalosporins and ciprofloxacin occurred in P. mirabilis from Taiwan in the past decade. The prevalence of ESBL remained stable but AmpC β-lactamase-producing P. mirabilis increased significantly. Cefotaxime was a better surrogate than ceftazidime for predicting the presence of these β-lactamases. Continuous surveillance on antimicrobial resistance and associated resistance mechanisms in P. mirabilis is warranted.

  4. Paternity testing in case of brother-sister incest.

    PubMed

    Macan, Marijana; Uvodić, Petra; Botica, Vladimir

    2003-06-01

    We performed a paternity test in a case of incest between brother and sister. DNA from blood samples of the alleged parents and their two children was obtained with Chelex DNA extraction method and quantified with Applied Biosystems QuantiBlot quantitation kit. Polymerase chain reaction (PCR) amplification of DNA samples was performed with AmpFlSTR SGM Plus PCR amplification kit and GenePrint PowerPlex PCR amplification kit. The amplified products were separated and detected by using the Perkin Elmer's ABI PRISM trade mark 310 Genetic Analyser. DNA and data analysis of 17 loci and Amelogenin confirmed the suspicion of brother-sister incest. Since both children had inherited all of the obligate alleles from the alleged father, we could confirm with certainty of 99.999999% that the oldest brother in the family was the biological father of both children. Calculated data showed that even in a case of brother-sister incest, paternity could be proved by the analysis of Amelogenin and 17 DNA loci.

  5. Expression and Significance of the HIP/PAP and RegIIIγ Antimicrobial Peptides during Mammalian Urinary Tract Infection.

    PubMed

    Spencer, John David; Jackson, Ashley R; Li, Birong; Ching, Christina B; Vonau, Martin; Easterling, Robert S; Schwaderer, Andrew L; McHugh, Kirk M; Becknell, Brian

    2015-01-01

    Recent evidence indicates that antimicrobial peptides (AMPs) serve key roles in defending the urinary tract against invading uropathogens. To date, the individual contribution of AMPs to urinary tract host defense is not well defined. In this study, we identified Regenerating islet-derived 3 gamma (RegIIIγ) as the most transcriptionally up-regulated AMP in murine bladder transcriptomes following uropathogenic Escherichia coli (UPEC) infection. We confirmed induction of RegIIIγ mRNA during cystitis and pyelonephritis by quantitative RT-PCR. Immunoblotting demonstrates increased bladder and urinary RegIIIγ protein levels following UPEC infection. Immunostaining localizes RegIIIγ protein to urothelial cells of infected bladders and kidneys. Human patients with UTI have increased urine concentrations of the orthologous Hepatocarcinoma-Intestine-Pancreas / Pancreatitis Associated Protein (HIP/PAP) compared to healthy controls. Recombinant RegIIIγ protein does not demonstrate bactericidal activity toward UPEC in vitro, but does kill Staphylococcus saprophyticus in a dose-dependent manner. Kidney and bladder tissue from RegIIIγ knockout mice and wild-type mice contain comparable bacterial burden following UPEC and Gram-positive UTI. Our results demonstrate that RegIIIγ and HIP/PAP expression is induced during human and murine UTI. However, their specific function in the urinary tract remains uncertain.

  6. Expression and Significance of the HIP/PAP and RegIIIγ Antimicrobial Peptides during Mammalian Urinary Tract Infection

    PubMed Central

    Spencer, John David; Jackson, Ashley R.; Li, Birong; Ching, Christina B.; Vonau, Martin; Easterling, Robert S.; Schwaderer, Andrew L.; McHugh, Kirk M.; Becknell, Brian

    2015-01-01

    Recent evidence indicates that antimicrobial peptides (AMPs) serve key roles in defending the urinary tract against invading uropathogens. To date, the individual contribution of AMPs to urinary tract host defense is not well defined. In this study, we identified Regenerating islet-derived 3 gamma (RegIIIγ) as the most transcriptionally up-regulated AMP in murine bladder transcriptomes following uropathogenic Escherichia coli (UPEC) infection. We confirmed induction of RegIIIγ mRNA during cystitis and pyelonephritis by quantitative RT-PCR. Immunoblotting demonstrates increased bladder and urinary RegIIIγ protein levels following UPEC infection. Immunostaining localizes RegIIIγ protein to urothelial cells of infected bladders and kidneys. Human patients with UTI have increased urine concentrations of the orthologous Hepatocarcinoma-Intestine-Pancreas / Pancreatitis Associated Protein (HIP/PAP) compared to healthy controls. Recombinant RegIIIγ protein does not demonstrate bactericidal activity toward UPEC in vitro, but does kill Staphylococcus saprophyticus in a dose-dependent manner. Kidney and bladder tissue from RegIIIγ knockout mice and wild-type mice contain comparable bacterial burden following UPEC and Gram-positive UTI. Our results demonstrate that RegIIIγ and HIP/PAP expression is induced during human and murine UTI. However, their specific function in the urinary tract remains uncertain. PMID:26658437

  7. A family of octopamine [corrected] receptors that specifically induce cyclic AMP production or Ca2+ release in Drosophila melanogaster.

    PubMed

    Balfanz, Sabine; Strünker, Timo; Frings, Stephan; Baumann, Arnd

    2005-04-01

    In invertebrates, the biogenic-amine octopamine is an important physiological regulator. It controls and modulates neuronal development, circadian rhythm, locomotion, 'fight or flight' responses, as well as learning and memory. Octopamine mediates its effects by activation of different GTP-binding protein (G protein)-coupled receptor types, which induce either cAMP production or Ca(2+) release. Here we describe the functional characterization of two genes from Drosophila melanogaster that encode three octopamine receptors. The first gene (Dmoa1) codes for two polypeptides that are generated by alternative splicing. When heterologously expressed, both receptors cause oscillatory increases of the intracellular Ca(2+) concentration in response to applying nanomolar concentrations of octopamine. The second gene (Dmoa2) codes for a receptor that specifically activates adenylate cyclase and causes a rise of intracellular cAMP with an EC(50) of approximately 3 x 10(-8) m octopamine. Tyramine, the precursor of octopamine biosynthesis, activates all three receptors at > or = 100-fold higher concentrations, whereas dopamine and serotonin are non-effective. Developmental expression of Dmoa genes was assessed by RT-PCR. Overlapping but not identical expression patterns were observed for the individual transcripts. The genes characterized in this report encode unique receptors that display signature properties of native octopamine receptors.

  8. Early Intervention of Didang Decoction on MLCK Signaling Pathways in Vascular Endothelial Cells of Type 2 Diabetic Rats

    PubMed Central

    Song, Zhenqiang; Li, Jing; Li, Chunshen

    2016-01-01

    In the study, type 2 diabetic rat model was established using streptozotocin (STZ) combined with a high-fat diet, and the rats were divided into control and diabetic groups. Diabetic groups were further divided into nonintervening, simvastatin, Didang Decoction (DDD) early-phase intervening, DDD mid-phase intervening, and DDD late-phase intervening groups. The expression level of MLCK was detected using Western Blot analysis, and the levels of cyclic adenosine monophosphate (cAMP), protein kinase C (PKC), and protein kinase A (PKA) were examined using Real Time PCR. Under the electron microscope, the cells in the early-DDD-intervention group and the simvastatin group were significantly more continuous and compact than those in the diabetic group. Compared with the control group, the expression of cAMP-1 and PKA was decreased in all diabetic groups, whereas the expression of MLCK and PKC was increased in early- and mid-phase DDD-intervening groups (P < 0.05); compared with the late-phase DDD-intervening group, the expression of cAMP-1 and PKA was higher, but the level of MLCK and PKC was lower in early-phase DDD-intervening group (P < 0.05). In conclusion, the early use of DDD improves the permeability of vascular endothelial cells by regulating the MLCK signaling pathway. PMID:27703477

  9. Expression profiles of antimicrobial peptides in the genital tract of women using progesterone intrauterine devices versus combined oral contraceptives.

    PubMed

    Introini, Andrea; Kaldensjö, Tove; Hirbod, Taha; Röhl, Maria; Tjernlund, Annelie; Andersson, Sonia; Broliden, Kristina

    2014-11-01

    Sex hormones can influence the immune defenses of the female genital tract (FGT) and its susceptibility to infections. Here we investigated the effect of different hormonal contraceptives on the production of antimicrobial peptides (AMPs) in different compartments of the female genital mucosa (FGM), secretions and tissue. Cervicovaginal secretions (CVS) and ectocervical tissue samples obtained from women using progesterone intrauterine devices (pIUD) (n = 23) and combined oral contraceptives (COC) (n = 23) were analyzed for the expression and in situ localization of HNP1-3, BD-2, LL-37, SLPI and trappin-2 by ELISA, real-time PCR and immunohistochemistry. Women using COC had significantly lower mRNA levels of BD-2 and trappin-2 in ectocervical tissue than pIUD users. The two groups showed no differences in CVS concentration, as well as similar in situ expression patterns in ectocervical tissue, of all five AMPs. The use of hormonal contraceptives influences AMP expression differently in genital secretions compared to ectocervical tissue. This suggests that the impact of sex hormones on local immune defenses varies in different compartments of the FGM, and likely in different locations across the FGT. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Optimization and validation of a fast amplification protocol for AmpFlSTR® Profiler Plus® for rapid forensic human identification.

    PubMed

    Laurin, Nancy; Frégeau, Chantal

    2012-01-01

    The goal of this work was to optimize and validate a fast amplification protocol for the multiplex amplification of the STR loci included in AmpFlSTR(®) Profiler Plus(®) to expedite human DNA identification. By modifying the cycling conditions and by combining the use of a DNA polymerase optimized for high speed PCR (SpeedSTAR™ HS) and a more efficient thermal cycler instrument (Bio-RAD C1000™), we were able to reduce the amplification process from 4h to 26 min. No modification to the commercial AmpFlSTR(®) Profiler Plus(®) primer mix was required. When compared to the current Royal Canadian Mounted Police (RCMP) amplification protocol, no differences with regards to specificity, sensitivity, heterozygote peak height ratios and overall profile balance were noted. Moreover, complete concordance was obtained with profiles previously generated with the standard amplification protocol and minor alleles in mixture samples were reliably typed. An increase in n-4 stutter ratios (2.2% on average for all loci) was observed for profiles amplified with the fast protocol compared to the current procedure. Our results document the robustness of this rapid amplification protocol for STR profiling using the AmpFlSTR(®) Profiler Plus(®) primer set and demonstrate that comparable data can be obtained in substantially less time. This new approach could provide an alternative option to current multiplex STR typing amplification protocols in order to increase throughput or expedite time-sensitive cases. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  11. Investigation of cAMP microdomains as a path to novel cancer diagnostics.

    PubMed

    Desman, Garrett; Waintraub, Caren; Zippin, Jonathan H

    2014-12-01

    Understanding of cAMP signaling has greatly improved over the past decade. The advent of live cell imaging techniques and more specific pharmacologic modulators has led to an improved understanding of the intricacies by which cAMP is able to modulate such a wide variety of cellular pathways. It is now appreciated that cAMP is able to activate multiple effector proteins at distinct areas in the cell leading to the activation of very different downstream targets. The investigation of signaling proteins in cancer is a common route to the development of diagnostic tools, prognostic tools, and/or therapeutic targets, and in this review we highlight how investigation of cAMP signaling microdomains driven by the soluble adenylyl cyclase in different cancers has led to the development of a novel cancer biomarker. Antibodies directed against the soluble adenylyl cyclase (sAC) are highly specific markers for melanoma especially for lentigo maligna melanoma and are being described as "second generation" cancer diagnostics, which are diagnostics that determine the 'state' of a cell and not just identify the cell type. Due to the wide presence of cAMP signaling pathways in cancer, we predict that further investigation of both sAC and other cAMP microdomains will lead to additional cancer biomarkers. This article is part of a Special Issue entitled: The role of soluble adenylyl cyclase in health and disease. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Effect of signal compounds and incubation conditions on the culturability of freshwater bacterioplankton.

    PubMed

    Bruns, Alke; Nübel, Ulrich; Cypionka, Heribert; Overmann, Jörg

    2003-04-01

    The effect of signal compounds and of different incubation conditions on the culturability (i.e., the fraction of all cells capable of growth) of natural bacterioplankton from the eutrophic lake Zwischenahner Meer was investigated over a period of 20 months. Numbers of growing cells were determined by the most-probable-number technique in liquid media containing low concentrations (10 micro M) of the signal compounds N-(oxohexanoyl)-DL-homoserine lactone, N-(butyryl)-DL-homoserine lactone, cyclic AMP (cAMP), or ATP. cAMP was the most effective signal compound, leading to significantly increased cultivation efficiencies of up to 10% of the total bacterial counts. Microautoradiography with [2,8-(3)H]cAMP, combined with fluorescence in situ hybridization, demonstrated that cAMP was taken up by 18% of all cells. The bacterial cAMP uptake systems had a very low K(m) value of

  13. The V-ATPase is expressed in the choroid plexus and mediates cAMP-induced intracellular pH alterations.

    PubMed

    Christensen, Henriette L; Păunescu, Teodor G; Matchkov, Vladimir; Barbuskaite, Dagne; Brown, Dennis; Damkier, Helle H; Praetorius, Jeppe

    2017-01-01

    The cerebrospinal fluid (CSF) pH influences brain interstitial pH and, therefore, brain function. We hypothesized that the choroid plexus epithelium (CPE) expresses the vacuolar H + -ATPase (V-ATPase) as an acid extrusion mechanism in the luminal membrane to counteract detrimental elevations in CSF pH. The expression of mRNA corresponding to several V-ATPase subunits was demonstrated by RT-PCR analysis of CPE cells (CPECs) isolated by fluorescence-activated cell sorting. Immunofluorescence and electron microscopy localized the V-ATPase primarily in intracellular vesicles with only a minor fraction in the luminal microvillus area. The vesicles did not translocate to the luminal membrane in two in vivo models of hypocapnia-induced alkalosis. The Na + -independent intracellular pH (pH i ) recovery from acidification was studied in freshly isolated clusters of CPECs. At extracellular pH (pH o ) 7.4, the cells failed to display significant concanamycin A-sensitive pH i recovery (i.e., V-ATPase activity). The recovery rate in the absence of Na + amounted to <10% of the pH i recovery rate observed in the presence of Na + Recovery of pH i was faster at pH o 7.8 and was abolished at pH o 7.0. The concanamycin A-sensitive pH i recovery was stimulated by cAMP at pH 7.4 in vitro, but intraventricular infusion of the membrane-permeant cAMP analog 8-CPT-cAMP did not result in trafficking of the V-ATPase. In conclusion, we find evidence for the expression of a minor fraction of V-ATPase in the luminal membrane of CPECs. This fraction does not contribute to enhanced acid extrusion at high extracellular pH, but seems to be activated by cAMP in a trafficking-independent manner. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  14. The Kynurenine 3-Monooxygenase Encoding Gene, BcKMO, Is Involved in the Growth, Development, and Pathogenicity of Botrytis cinerea

    PubMed Central

    Zhang, Kang; Yuan, Xuemei; Zang, Jinping; Wang, Min; Zhao, Fuxin; Li, Peifen; Cao, Hongzhe; Han, Jianmin; Xing, Jihong; Dong, Jingao

    2018-01-01

    A pathogenic mutant, BCG183, was obtained by screening the T-DNA insertion library of Botrytis cinerea. A novel pathogenicity-related gene BcKMO, which encodes kynurenine 3-monooxygenase (KMO), was isolated and identified via thermal asymmetric interlaced PCR, bioinformatics analyses, and KMO activity measurement. The mutant BCG183 grew slowly, did not produce conidia and sclerotia, had slender hyphae, and presented enhanced pathogenicity. The phenotype and pathogenicity of the BcKMO-complementing mutant (BCG183/BcKMO) were similar to those of the wild-type (WT) strain. The activities of polymethylgalacturonase, polygalacturonase, and toxins were significantly higher, whereas acid production was significantly decreased in the mutant BCG183, when compared with those in the WT and BCG183/BcKMO. Moreover, the sensitivity of mutant BCG183 to NaCl and KCl was remarkably increased, whereas that to fluconazole, Congo Red, menadione, H2O2, and SQ22536 and U0126 [cAMP-dependent protein kinase (cAMP) and mitogen-activated protein kinase (MAPK) signaling pathways inhibitors, respectively] were significantly decreased compared with the other strains. Furthermore, the key genes involved in the cAMP and MAPK signaling pathways, Pka1, Pka2, PkaR, Bcg2, Bcg3, bmp1, and bmp3, were significantly upregulated or downregulated in the mutant BCG183. BcKMO expression levels were also upregulated or downregulated in the RNAi mutants of the key genes involved in the cAMP and MAPK signaling pathways. These findings indicated that BcKMO positively regulates growth and development, but negatively regulates pathogenicity of B. cinerea. Furthermore, BcKMO was found to be involved in controlling cell wall degrading enzymes activity, toxins activity, acid production, and cell wall integrity, and participate in cAMP and MAPK signaling pathways of B. cinerea. PMID:29867912

  15. Triiodothyronine stimulates VEGF expression and secretion via steroids and HIF-1α in murine Leydig cells.

    PubMed

    Dhole, Bodhana; Gupta, Surabhi; Venugopal, Senthil Kumar; Kumar, Anand

    2018-06-01

    Leydig cells are the principal steroidogenic cells of the testis. Leydig cells also secrete a number of growth factors including vascular endothelial growth factor (VEGF) which has been shown to regulate both testicular steroidogenesis and spermatogenesis. The thyroid hormone, T 3, is known to stimulate steroidogenesis in Leydig cells. T 3 has also been shown to stimulate VEGF production in a variety of cell lines. However, studies regarding the effect of T 3 on VEGF synthesis and secretion by the Leydig cells were lacking. Therefore, we investigated the effect of T 3 on VEGF synthesis and secretion in a mouse Leydig tumour cell line, MLTC-1. The effect of T 3 was compared with that of LH/cAMP and hypoxia, two known stimulators of Leydig cell functions. The cells were treated with T 3 , 8-Br-cAMP (a cAMP analogue), or CoCl 2 (a hypoxia mimetic) and VEGF secreted in the cell supernatant was measured using ELISA. The mRNA levels of VEGF were measured by quantitative RT-PCR. In the MLTC-1 cells, T 3 , 8-Br-cAMP, and CoCl 2 stimulated VEGF mRNA levels and the protein secretion. T 3 also increased steroid secretion as well as HIF-1α protein levels, two well-established upstream regulators of VEGF. Inhibitors of steroidogenesis as well as HIF-1α resulted in inhibition of T 3 -stimulated VEGF secretion by the MLTC-1 cells. This suggested a mediatory role of steroids and HIF-1α protein in T 3 -stimulated VEGF secretion by MLTC-1 cells. The mediation by steroids and HIF-1α were independent of each other. 8-Br-cAMP: 8-bromo - 3', 5' cyclic adenosine monophosphate; CoCl 2 : cobalt chloride; HIF-1α: hypoxia inducible factor -1α; LH: luteinizing hormone; T 3 : 3, 5, 3'-L-triiodothyronine; VEGF: vascular endothelial growth factor.

  16. Thyroid hormone activates rat liver adenosine 5,-monophosphate-activated protein kinase: relation to CaMKKb, TAK1 and LKB1 expression and energy status.

    PubMed

    Vargas, R; Ortega, Y; Bozo, V; Andrade, M; Minuzzi, G; Cornejo, P; Fernandez, V; Videla, L A

    2013-01-01

    AMP-activated protein kinase (AMPK) is a sensor of energy status supporting cellular energy homeostasis that may represent the metabolic basis for 3,3,,5-triiodo-L-thyronine (T3) liver preconditioning. Functionally transient hyperthyroid state induced by T3 (single dose of 0.1 mg/kg) in fed rats led to upregulation of mRNA expression (RT-PCR) and protein phosphorylation (Western blot) of hepatic AMPK at 8 to 36 h after treatment. AMPK Thr 172 phosphorylation induced by T3 is associated with enhanced mRNA expression of the upstream kinases Ca2+ -calmodulin-dependent protein kinase kinase-beta (CaMKKbeta) and transforming growth-factor-beta-activated kinase-1 (TAK1), with increased protein levels of CaMKKbeta and higher TAK1 phosphorylation, without changes in those of the liver kinase B1 (LKB1) signaling pathway. Liver contents of AMP and ADP were augmented by 291 percent and 44 percent by T3 compared to control values (p less than 0.05), respectively, whereas those of ATP decreased by 64% (p less than 0.05), with no significant changes in the total content of adenine nucleotides (AMP + ADP + ATP) at 24 h after T3 administration. Consequently, hepatic ATP/ADP content ratios exhibited 64 percent diminution (p less than 0.05) and those of AMP/ATP increased by 425 percent (p less than 0.05) in T3-treated rats over controls. It is concluded that in vivoT3 administration triggers liver AMPK upregulation in association with significant enhancements in AMPK mRNA expression, AMPK phosphorylation coupled to CaMKKbeta and TAK1 activation, and in AMP/ATP ratios, which may promote enhanced AMPK activity to support T3-induced energy consuming processes such as those of liver preconditioning.

  17. Inhibition of Candida albicans Biofilm Formation by the Synthetic Lactoferricin Derived Peptide hLF1-11

    PubMed Central

    Morici, Paola; Fais, Roberta; Rizzato, Cosmeri

    2016-01-01

    The aim of this study was to evaluate the in vitro activity of the synthetic peptide hLF1-11 against biofilm produced by clinical isolates of Candida albicans with different fluconazole susceptibility. The antibiofilm activity of the peptide hLF1-11 was assessed in terms of reduction of biofilm cellular density, metabolic activity and sessile cell viability. The extent of morphogenesis in hLF1-11 treated and untreated biofilms was also investigated microscopically. Transcription levels of genes related to cell adhesion, hyphal development and extracellular matrix production were analysed by qRT-PCR in hLF1-11 treated and untreated biofilms. Exogenous dibutyryl-cAMP (db-cAMP) was used to rescue morphogenesis in cells exposed to the peptide. The results revealed that hLF1-11 exhibited an inhibitory effect on biofilm formation by all C. albicans isolates tested in a dose-dependent manner, regardless of their fluconazole susceptibility. Visual inspection of treated or untreated biofilm cells with an inverted microscope revealed a significant reduction in hyphal formation by hLF1-11 treated cells, as early as 3 hours of incubation. Moreover, hLF1-11 showed a reduced activity on preadherent cells. hLF1-11 induced the down-regulation of biofilm and hyphal-associated genes, which were predominantly regulated via the Ras1-cAMP-Efg1 pathway. Indeed, exogenous db-cAMP restored morphogenesis in hLF1-11 treated cells. The hLF1-11 peptide significantly inhibited biofilm formation by C. albicans mainly at early stages, interfering with biofilm cellular density and metabolic activity, and affected morphogenesis through the Ras1-cAMP-Efg1 pathway. Our findings provide the first evidence that hLF1-11 could represent a potential candidate for the prevention of biofilm formation by C. albicans. PMID:27902776

  18. The Kynurenine 3-Monooxygenase Encoding Gene, BcKMO, Is Involved in the Growth, Development, and Pathogenicity of Botrytis cinerea.

    PubMed

    Zhang, Kang; Yuan, Xuemei; Zang, Jinping; Wang, Min; Zhao, Fuxin; Li, Peifen; Cao, Hongzhe; Han, Jianmin; Xing, Jihong; Dong, Jingao

    2018-01-01

    A pathogenic mutant, BCG183, was obtained by screening the T-DNA insertion library of Botrytis cinerea . A novel pathogenicity-related gene BcKMO , which encodes kynurenine 3-monooxygenase (KMO), was isolated and identified via thermal asymmetric interlaced PCR, bioinformatics analyses, and KMO activity measurement. The mutant BCG183 grew slowly, did not produce conidia and sclerotia, had slender hyphae, and presented enhanced pathogenicity. The phenotype and pathogenicity of the BcKMO -complementing mutant (BCG183/ BcKMO ) were similar to those of the wild-type (WT) strain. The activities of polymethylgalacturonase, polygalacturonase, and toxins were significantly higher, whereas acid production was significantly decreased in the mutant BCG183, when compared with those in the WT and BCG183/ BcKMO . Moreover, the sensitivity of mutant BCG183 to NaCl and KCl was remarkably increased, whereas that to fluconazole, Congo Red, menadione, H 2 O 2 , and SQ22536 and U0126 [cAMP-dependent protein kinase (cAMP) and mitogen-activated protein kinase (MAPK) signaling pathways inhibitors, respectively] were significantly decreased compared with the other strains. Furthermore, the key genes involved in the cAMP and MAPK signaling pathways, Pka1 , Pka2 , PkaR , Bcg2 , Bcg3 , bmp1 , and bmp3, were significantly upregulated or downregulated in the mutant BCG183. BcKMO expression levels were also upregulated or downregulated in the RNAi mutants of the key genes involved in the cAMP and MAPK signaling pathways. These findings indicated that BcKMO positively regulates growth and development, but negatively regulates pathogenicity of B. cinerea . Furthermore, BcKMO was found to be involved in controlling cell wall degrading enzymes activity, toxins activity, acid production, and cell wall integrity, and participate in cAMP and MAPK signaling pathways of B. cinerea .

  19. Activation of G protein-coupled bile acid receptor, TGR5, induces smooth muscle relaxation via both Epac- and PKA-mediated inhibition of RhoA/Rho kinase pathway.

    PubMed

    Rajagopal, Senthilkumar; Kumar, Divya P; Mahavadi, Sunila; Bhattacharya, Sayak; Zhou, Ruizhe; Corvera, Carlos U; Bunnett, Nigel W; Grider, John R; Murthy, Karnam S

    2013-03-01

    The present study characterized the TGR5 expression and the signaling pathways coupled to this receptor that mediates the relaxation of gastric smooth muscle. TGR5 was detected in gastric muscle cells by RT-PCR and Western blotting. Treatment of cells with the TGR5-selective ligand oleanolic acid (OA) activated Gαs, but not Gαq, Gαi1, Gαi2, or Gαi3, and increased cAMP levels. OA did not elicit contraction, but caused relaxation of carbachol-induced contraction of gastric muscle cells from wild-type mice, but not tgr5(-/-) mice. OA, but not a selective exchange protein activated by cAMP (Epac) ligand (8-pCPT-2'-O-Me-cAMP), caused phosphorylation of RhoA and the phosphorylation was blocked by the PKA inhibitor, myristoylated PKI, and by the expression of phosphorylation-deficient mutant RhoA (S188A). Both OA and Epac ligand stimulated Ras-related protein 1 (Rap1) and inhibited carbachol (CCh)-induced Rho kinase activity. Expression of RhoA (S188A) or PKI partly reversed the inhibition of Rho kinase activity by OA but had no effect on inhibition by Epac ligand. However, suppression of Rap1 with siRNA blocked the inhibition of Rho kinase by Epac ligand, and partly reversed the inhibition by OA; the residual inhibition was blocked by PKI. Muscle relaxation in response to OA, but not Epac ligand, was partly reversed by PKI. We conclude that activation of TGR5 causes relaxation of gastric smooth muscle and the relaxation is mediated through inhibition of RhoA/Rho kinase pathway via both cAMP/Epac-dependent stimulation of Rap1 and cAMP/PKA-dependent phosphorylation of RhoA at Ser(188). TGR5 receptor activation on smooth muscle reveals a novel mechanism for the regulation of gut motility by bile acids.

  20. Molecular characterization of extended-spectrum β-lactamase, plasmid-mediated AmpC cephalosporinase and carbapenemase genes among Enterobacteriaceae isolates in five medical centres of East and West Azerbaijan, Iran.

    PubMed

    Sadeghi, Mohammad Reza; Ghotaslou, Reza; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Hasani, Alka

    2016-11-01

    Very little is known about the occurrence and various types of extended-spectrum β-lactamase (ESBL), AmpC and carbapenemase in Iran. The aims of this study were to determine the prevalence of ESBLs, AmpCs and carbapenemase genes among Enterobacteriaceae in Azerbaijan and to characterize the genetic composition of the detected genes. A total of 307 Enterobacteriaceae isolates, recovered from five medical centres, were screened for ESBL, AmpC and carbapenemase activities by the disc diffusion method and phenotypic confirmatory tests. The 162 selected strains (third-generation cephalosporins, cefoxitin- or carbapenem-resistant strains with positive or negative phenotypic confirmatory tests) were selected for multiplex PCR screening for β-lactamase genes, and detected genes were confirmed by sequencing. Of 162 isolates, 156 harboured 1 to 6 β-lactamase genes of 41 types. The most prevalent genes were blaTEM-1 (29.9 %), followed by blaCTX-M-15 (25.7 %). Plasmid-mediated AmpC was detected in 66 strains (21.5 %) alone or in combination with other genes. Carbapenemase-encoding genes were detected in 18 strains (5.8 %) of 27 carbapenem-non-susceptible isolates including 11, 7, 3 and 1 cases of blaOXA-48, blaNDM-1, blaKPC-2 and blaKPC-3 genes, respectively. Interestingly, 148 (94.8 %) of 156 strains with any β-lactamase gene were found to have a multidrug-resistant pattern. The rate of resistance to β-lactams and multidrug-resistant Enterobacteriaceae is high in Azerbaijan. All positive strains for carbapenemase genes were resistant to all β-lactams. The present study reveals the high occurrence of CTX-M-type ESBLs followed by TEM and SHV variants among Enterobacteriaceae isolates. East Azerbaijan seems to be an alarming focus for OXA-48, NDM-1 and KPC dissemination.

  1. Activation of G protein-coupled bile acid receptor, TGR5, induces smooth muscle relaxation via both Epac- and PKA-mediated inhibition of RhoA/Rho kinase pathway

    PubMed Central

    Rajagopal, Senthilkumar; Kumar, Divya P.; Mahavadi, Sunila; Bhattacharya, Sayak; Zhou, Ruizhe; Corvera, Carlos U.; Bunnett, Nigel W.; Grider, John R.

    2013-01-01

    The present study characterized the TGR5 expression and the signaling pathways coupled to this receptor that mediates the relaxation of gastric smooth muscle. TGR5 was detected in gastric muscle cells by RT-PCR and Western blotting. Treatment of cells with the TGR5-selective ligand oleanolic acid (OA) activated Gαs, but not Gαq, Gαi1, Gαi2, or Gαi3, and increased cAMP levels. OA did not elicit contraction, but caused relaxation of carbachol-induced contraction of gastric muscle cells from wild-type mice, but not tgr5−/− mice. OA, but not a selective exchange protein activated by cAMP (Epac) ligand (8-pCPT-2′-O-Me-cAMP), caused phosphorylation of RhoA and the phosphorylation was blocked by the PKA inhibitor, myristoylated PKI, and by the expression of phosphorylation-deficient mutant RhoA (S188A). Both OA and Epac ligand stimulated Ras-related protein 1 (Rap1) and inhibited carbachol (CCh)-induced Rho kinase activity. Expression of RhoA (S188A) or PKI partly reversed the inhibition of Rho kinase activity by OA but had no effect on inhibition by Epac ligand. However, suppression of Rap1 with siRNA blocked the inhibition of Rho kinase by Epac ligand, and partly reversed the inhibition by OA; the residual inhibition was blocked by PKI. Muscle relaxation in response to OA, but not Epac ligand, was partly reversed by PKI. We conclude that activation of TGR5 causes relaxation of gastric smooth muscle and the relaxation is mediated through inhibition of RhoA/Rho kinase pathway via both cAMP/Epac-dependent stimulation of Rap1 and cAMP/PKA-dependent phosphorylation of RhoA at Ser188. TGR5 receptor activation on smooth muscle reveals a novel mechanism for the regulation of gut motility by bile acids. PMID:23275618

  2. Inhibition of Candida albicans Biofilm Formation by the Synthetic Lactoferricin Derived Peptide hLF1-11.

    PubMed

    Morici, Paola; Fais, Roberta; Rizzato, Cosmeri; Tavanti, Arianna; Lupetti, Antonella

    2016-01-01

    The aim of this study was to evaluate the in vitro activity of the synthetic peptide hLF1-11 against biofilm produced by clinical isolates of Candida albicans with different fluconazole susceptibility. The antibiofilm activity of the peptide hLF1-11 was assessed in terms of reduction of biofilm cellular density, metabolic activity and sessile cell viability. The extent of morphogenesis in hLF1-11 treated and untreated biofilms was also investigated microscopically. Transcription levels of genes related to cell adhesion, hyphal development and extracellular matrix production were analysed by qRT-PCR in hLF1-11 treated and untreated biofilms. Exogenous dibutyryl-cAMP (db-cAMP) was used to rescue morphogenesis in cells exposed to the peptide. The results revealed that hLF1-11 exhibited an inhibitory effect on biofilm formation by all C. albicans isolates tested in a dose-dependent manner, regardless of their fluconazole susceptibility. Visual inspection of treated or untreated biofilm cells with an inverted microscope revealed a significant reduction in hyphal formation by hLF1-11 treated cells, as early as 3 hours of incubation. Moreover, hLF1-11 showed a reduced activity on preadherent cells. hLF1-11 induced the down-regulation of biofilm and hyphal-associated genes, which were predominantly regulated via the Ras1-cAMP-Efg1 pathway. Indeed, exogenous db-cAMP restored morphogenesis in hLF1-11 treated cells. The hLF1-11 peptide significantly inhibited biofilm formation by C. albicans mainly at early stages, interfering with biofilm cellular density and metabolic activity, and affected morphogenesis through the Ras1-cAMP-Efg1 pathway. Our findings provide the first evidence that hLF1-11 could represent a potential candidate for the prevention of biofilm formation by C. albicans.

  3. Effects of an Encapsulated Fruit and Vegetable Juice Concentrate on Obesity-Induced Systemic Inflammation: A Randomised Controlled Trial.

    PubMed

    Williams, Evan J; Baines, Katherine J; Berthon, Bronwyn S; Wood, Lisa G

    2017-02-08

    Phytochemicals from fruit and vegetables reduce systemic inflammation. This study examined the effects of an encapsulated fruit and vegetable (F&V) juice concentrate on systemic inflammation and other risk factors for chronic disease in overweight and obese adults. A double-blinded, parallel, randomized placebo-controlled trial was conducted in 56 adults aged ≥40 years with a body mass index (BMI) ≥28 kg/m². Before and after eight weeks daily treatment with six capsules of F&V juice concentrate or placebo, peripheral blood gene expression (microarray, quantitative polymerase chain reaction (qPCR)), plasma tumour necrosis factor (TNF)α (enzyme-linked immunosorbent assay (ELISA)), body composition (Dual-energy X-ray absorptiometry (DEXA)) and lipid profiles were assessed. Following consumption of juice concentrate, total cholesterol, low-density lipoprotein (LDL) cholesterol and plasma TNFα decreased and total lean mass increased, while there was no change in the placebo group. In subjects with high systemic inflammation at baseline (serum C-reactive protein (CRP) ≥3.0 mg/mL) who were supplemented with the F&V juice concentrate ( n = 16), these effects were greater, with decreased total cholesterol, LDL cholesterol and plasma TNFα and increased total lean mass; plasma CRP was unchanged by the F&V juice concentrate following both analyses. The expression of several genes involved in lipogenesis, the nuclear factor-κB (NF-κB) and 5' adenosine monophosphate-activated protein kinase (AMPK) signalling pathways was altered, including phosphomevalonate kinase (PMVK), zinc finger AN1-type containing 5 (ZFAND5) and calcium binding protein 39 (CAB39), respectively. Therefore, F&V juice concentrate improves the metabolic profile, by reducing systemic inflammation and blood lipid profiles and, thus, may be useful in reducing the risk of obesity-induced chronic disease.

  4. Affinity improvement of a therapeutic antibody to methamphetamine and amphetamine through structure-based antibody engineering

    PubMed Central

    Thakkar, Shraddha; Nanaware-Kharade, Nisha; Celikel, Reha; Peterson, Eric C.; Varughese, Kottayil I.

    2014-01-01

    Methamphetamine (METH) abuse is a worldwide threat, without any FDA approved medications. Anti-METH IgGs and single chain fragments (scFvs) have shown efficacy in preclinical studies. Here we report affinity enhancement of an anti-METH scFv for METH and its active metabolite amphetamine (AMP), through the introduction of point mutations, rationally designed to optimize the shape and hydrophobicity of the antibody binding pocket. The binding affinity was measured using saturation binding technique. The mutant scFv-S93T showed 3.1 fold enhancement in affinity for METH and 26 fold for AMP. The scFv-I37M and scFv-Y34M mutants showed enhancement of 94, and 8 fold for AMP, respectively. Structural analysis of scFv-S93T:METH revealed that the substitution of Ser residue by Thr caused the expulsion of a water molecule from the cavity, creating a more hydrophobic environment for the binding that dramatically increases the affinities for METH and AMP. PMID:24419156

  5. Controlling fertilization and cAMP signaling in sperm by optogenetics.

    PubMed

    Jansen, Vera; Alvarez, Luis; Balbach, Melanie; Strünker, Timo; Hegemann, Peter; Kaupp, U Benjamin; Wachten, Dagmar

    2015-01-20

    Optogenetics is a powerful technique to control cellular activity by light. The light-gated Channelrhodopsin has been widely used to study and manipulate neuronal activity in vivo, whereas optogenetic control of second messengers in vivo has not been examined in depth. In this study, we present a transgenic mouse model expressing a photoactivated adenylyl cyclase (bPAC) in sperm. In transgenic sperm, bPAC mimics the action of the endogenous soluble adenylyl cyclase (SACY) that is required for motility and fertilization: light-stimulation rapidly elevates cAMP, accelerates the flagellar beat, and, thereby, changes swimming behavior of sperm. Furthermore, bPAC replaces endogenous adenylyl cyclase activity. In mutant sperm lacking the bicarbonate-stimulated SACY activity, bPAC restored motility after light-stimulation and, thereby, enabled sperm to fertilize oocytes in vitro. We show that optogenetic control of cAMP in vivo allows to non-invasively study cAMP signaling, to control behaviors of single cells, and to restore a fundamental biological process such as fertilization.

  6. A System for Planning Ahead

    NASA Technical Reports Server (NTRS)

    2002-01-01

    A software system that uses artificial intelligence techniques to help with complex Space Shuttle scheduling at Kennedy Space Center is commercially available. Stottler Henke Associates, Inc.(SHAI), is marketing its automatic scheduling system, the Automated Manifest Planner (AMP), to industries that must plan and project changes many different times before the tasks are executed. The system creates optimal schedules while reducing manpower costs. Using information entered into the system by expert planners, the system automatically makes scheduling decisions based upon resource limitations and other constraints. It provides a constraint authoring system for adding other constraints to the scheduling process as needed. AMP is adaptable to assist with a variety of complex scheduling problems in manufacturing, transportation, business, architecture, and construction. AMP can benefit vehicle assembly plants, batch processing plants, semiconductor manufacturing, printing and textiles, surface and underground mining operations, and maintenance shops. For most of SHAI's commercial sales, the company obtains a service contract to customize AMP to a specific domain and then issues the customer a user license.

  7. Grape seed procyanidin B2 ameliorates mitochondrial dysfunction and inhibits apoptosis via the AMP-activated protein kinase-silent mating type information regulation 2 homologue 1-PPARγ co-activator-1α axis in rat mesangial cells under high-dose glucosamine.

    PubMed

    Bao, Lei; Cai, Xiaxia; Zhang, Zhaofeng; Li, Yong

    2015-01-14

    Grape seed procyanidin B2 (GSPB2), an antioxidative and anti-inflammatory polyphenol in grape seed, has been found to have protective effects on diabetic nephropathy. Based on its favourable biological activities, in the present study, we aimed to investigate whether GSPB2 could inhibit apoptosis in rat mesangial cells treated with glucosamine (GlcN) under high-dose conditions. The results showed that the administration of GSPB2 (10 μg/ml) significantly increased the viability of mesangial cells treated with GlcN at a dose of 15 mM. We found that GSPB2 inhibited apoptosis in mesangial cells using terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphates (dUTP) nick-end labelling staining and flow cytometry technique (P< 0·05 for both). GSPB2 treatment also suppressed oxidative stress by elevating the activity of glutathione peroxidase (P< 0·05) and superoxide dismutase (P< 0·01), as well as prevented cellular damage. GSPB2 enhanced the mRNA expression of nuclear respiratory factor 1, mitochondrial transcription factor A and mitochondrial DNA copy number in mesangial cells as determined by real-time PCR (P< 0·05 for each). Finally, GSPB2 treatment activated the protein expression of PPARγ co-activator-1α (PGC-1α), silent mating type information regulation 2 homologue 1 (SIRT1) and AMP-activated protein kinase (AMPK) in mesangial cells. These findings suggest that GSPB2 markedly ameliorates mitochondrial dysfunction and inhibits apoptosis in rat mesangial cells treated with high-dose GlcN. This protective effect could be, at least in part, due to the activation of the AMPK-SIRT1-PGC-1α axis.

  8. Protein Kinase A Regulatory Subunits in Human Adipose Tissue

    PubMed Central

    Mantovani, Giovanna; Bondioni, Sara; Alberti, Luisella; Gilardini, Luisa; Invitti, Cecilia; Corbetta, Sabrina; Zappa, Marco A.; Ferrero, Stefano; Lania, Andrea G.; Bosari, Silvano; Beck-Peccoz, Paolo; Spada, Anna

    2009-01-01

    OBJECTIVE—In human adipocytes, the cAMP-dependent pathway mediates signals originating from β-adrenergic activation, thus playing a key role in the regulation of important metabolic processes, i.e., lipolysis and thermogenesis. Cyclic AMP effects are mainly mediated by protein kinase A (PKA), whose R2B regulatory isoform is the most expressed in mouse adipose tissue, where it protects against diet-induced obesity and fatty liver development. The aim of the study was to investigate possible differences in R2B expression, PKA activity, and lipolysis in adipose tissues from obese and nonobese subjects. RESEARCH DESIGN AND METHODS—The expression of the different PKA regulatory subunits was evaluated by immunohistochemistry, Western blot, and real-time PCR in subcutaneous and visceral adipose tissue samples from 20 nonobese and 67 obese patients. PKA activity and glycerol release were evaluated in total protein extract and adipocytes isolated from fresh tissue samples, respectively. RESULTS—Expression techniques showed that R2B was the most abundant regulatory protein, both at mRNA and protein level. Interestingly, R2B mRNA levels were significantly lower in both subcutaneous and visceral adipose tissues from obese than nonobese patients and negatively correlated with BMI, waist circumference, insulin levels, and homeostasis model assessment of insulin resistance. Moreover, both basal and stimulated PKA activity and glycerol release were significantly lower in visceral adipose tissue from obese patients then nonobese subjects. CONCLUSIONS—Our results first indicate that, in human adipose tissue, there are important BMI-related differences in R2B expression and PKA activation, which might be included among the multiple determinants involved in the different lipolytic response to β-adrenergic activation in obesity. PMID:19095761

  9. Genetic Background of β-Lactamases in Enterobacteriaceae Isolates from Environmental Samples.

    PubMed

    de Oliveira, Daniele V; Nunes, Luciana S; Barth, Afonso Luís; Van Der Sand, Sueli T

    2017-10-01

    The prevalence of β-lactamase-producing Enterobacteriaceae has increased worldwide. Although antibiotic-resistant bacteria are usually associated with hospitals, there are a growing number of reports of resistant bacteria in other environments. Concern about resistant microorganisms outside the hospital setting highlights the need to investigate mechanisms of antibiotic resistance in isolates collected from the environment. The present study evaluated the resistance mechanism to β-lactam antibiotics in 40 isolates from hospital sewage and surface water from the Dilúvio Stream, Porto Alegre City, Southern Brazil. The multiplex PCR technique was used to detect several resistance genes of β-lactamases: extended-spectrum β-lactamases (ESBLs), carbapenemases, and β-lactamase AmpC. After genes, detection amplicons were sequenced to confirm their identification. The clonal relationship was established by DNA macrorestriction using the XbaI enzyme, followed by pulsed-field gel electrophoresis (PFGE). The results indicated that resistance genes were present in 85% of the isolates. The most prevalent genes encoded narrow-spectrum β-lactamase, such as TEM-1 and SHV-1 with 70% of the strains, followed by carbapenemase KPC and GES (45%), ESBL types SHV-5 and CTX-M-8 (27.5%), and AmpC (ACT-1/MIR-1) (2.5%). Twelve isolates contained only one resistance gene, 14 contained two, and eight isolates had three resistance genes. PFGE indicated a clonal relationship among K. pneumoniae isolates. It was not possible to establish a clonal relationship between Enterobacter sp. isolates. The results highlight the potential of these resistance genes to spread in the polluted environment and to present a health risk to communities. This report is the first description of these resistance genes present in environmental samples other than a hospital in the city of Porto Alegre/RS.

  10. Hypoxia decreases creatine uptake in cardiomyocytes, while creatine supplementation enhances HIF activation.

    PubMed

    Santacruz, Lucia; Arciniegas, Antonio Jose Luis; Darrabie, Marcus; Mantilla, Jose G; Baron, Rebecca M; Bowles, Dawn E; Mishra, Rajashree; Jacobs, Danny O

    2017-08-01

    Creatine (Cr), phosphocreatine (PCr), and creatine kinases (CK) comprise an energy shuttle linking ATP production in mitochondria with cellular consumption sites. Myocytes cannot synthesize Cr: these cells depend on uptake across the cell membrane by a specialized creatine transporter (CrT) to maintain intracellular Cr levels. Hypoxia interferes with energy metabolism, including the activity of the creatine energy shuttle, and therefore affects intracellular ATP and PCr levels. Here, we report that exposing cultured cardiomyocytes to low oxygen levels rapidly diminishes Cr transport by decreasing V max and K m Pharmacological activation of AMP-activated kinase (AMPK) abrogated the reduction in Cr transport caused by hypoxia. Cr supplementation increases ATP and PCr content in cardiomyocytes subjected to hypoxia, while also significantly augmenting the cellular adaptive response to hypoxia mediated by HIF-1 activation. Our results indicate that: (1) hypoxia reduces Cr transport in cardiomyocytes in culture, (2) the cytoprotective effects of Cr supplementation are related to enhanced adaptive physiological responses to hypoxia mediated by HIF-1, and (3) Cr supplementation increases the cellular ATP and PCr content in RNCMs exposed to hypoxia. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  11. Human autosomal DNA and X chromosome STR profiles obtained from Chrysomya albiceps (Diptera: Calliphoridae) larvae used as a biological trace.

    PubMed

    Oliveira, T C; Santos, A B R; Rabelo, K C N; Souza, C A; Santos, S M; Crovella, S

    2016-11-03

    The use of insects to answer questions in criminal investigations, as well as a combination of forensic genetic techniques to obtain human DNA from the organisms, especially necrophagous dipterians, have gained ground in recent decades among researchers and professionals in this area. The objective of our study was to evaluate and compare two methods of human DNA extraction, commonly used for forensic samples, to obtain human autosomal DNA and X chromosome short tandem repeat profiles from the digestive tract of Chrysomya albiceps (Diptera: Calliphoridae) larvae. Immature specimens were collected from corpses at the Institute of Forensic Medicine of Pernambuco and raised in bovine ground meat to allow stabilization of the colony. Groups of larvae in the third instar were provided with bovine ground meat plus human blood for 48 h, dissected, and then subjected to DNA extraction. DNA was extracted using two methods: a DNA IQ™ kit and a phenol-chloroform method. Genomic DNA was amplified using AmpFℓSTR ® Identifiler ® Plus PCR and Argus-X-12 ® kits, and samples were sequenced to determine if the two extraction techniques generated reliable profiles that were compatible with a reference sample. The existence of comparable profiles from both techniques demonstrates the usefulness of dipteran larvae for obtaining human DNA from corpses, which can be further used to correlate genetic profiles in a crime scene when other traces are not available. However, several variables still require revision; thus, the technique should be further investigated for its validity, security, and, in particular, its reproducibility.

  12. Comparison of conventional PCR, quantitative PCR, bacteriological culture and the Warthin Starry technique to detect Leptospira spp. in kidney and liver samples from naturally infected sheep from Brazil.

    PubMed

    Fornazari, Felipe; da Silva, Rodrigo Costa; Richini-Pereira, Virginia Bodelão; Beserra, Hugo Enrique Orsini; Luvizotto, Maria Cecília Rui; Langoni, Helio

    2012-09-01

    Leptospirosis is an infectious disease of worldwide importance. The development of diagnostic techniques allows sick animals to be identified, reservoirs to be eliminated and the disease prevented and controlled. The present study aimed to compare different techniques for diagnosing leptospirosis in sheep. Samples of kidney, liver and blood were collected from 465 animals that originated from a slaughterhouse. The sera were analyzed by the Microscopic Agglutination Test (MAT), and kidney and liver samples of seropositive animals were analyzed using four techniques: bacteriological culture, the Warthin Starry (WS) technique, conventional PCR (cPCR), and quantitative PCR (qPCR). With the MAT, 21 animals were positive (4.5%) to serovars Hardjo (n=12), Hebdomadis (n=5), Sentot (n=2), Wolfii (n=1) and Shermani (n=1). Titers were 100 (n=10), 200 (n=2), 400 (n=6) and 1600 (n=3). No animal was positive by bacteriological culture; four animals were positive by the WS technique in kidney samples; six animals were positive by cPCR in kidney samples; and 11 animals were positive by qPCR, eight of which in kidney samples and three in liver. The bacterial quantification revealed a median of 4.3 bacteria/μL in liver samples and 36.6 bacteria/μL in kidney samples. qPCR presented the highest sensitivity among the techniques, followed by cPCR, the WS technique and bacteriological culture. These results indicate that sheep can carry leptospires of the Sejroe serogroup, and demonstrate the efficiency of quantitative PCR to detect Leptospira spp. in tissue samples. Published by Elsevier B.V.

  13. Introduction to digital PCR.

    PubMed

    Bizouarn, Francisco

    2014-01-01

    Digital PCR (dPCR) is a molecular biology technique going through a renaissance. With the arrival of new instrumentation dPCR can now be performed as a routine molecular biology assay. This exciting new technique provides quantitative and detection capabilities that by far surpass other methods currently used. This chapter is an overview of some of the applications currently being performed using dPCR as well as the fundamental concepts and techniques this technology is based on.

  14. Reverse transcription and polymerase chain reaction: principles and applications in dentistry.

    PubMed

    Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth

    2004-03-01

    Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

  15. Automated forensic DNA purification optimized for FTA card punches and identifiler STR-based PCR analysis.

    PubMed

    Tack, Lois C; Thomas, Michelle; Reich, Karl

    2007-03-01

    Forensic labs globally face the same problem-a growing need to process a greater number and wider variety of samples for DNA analysis. The same forensic lab can be tasked all at once with processing mixed casework samples from crime scenes, convicted offender samples for database entry, and tissue from tsunami victims for identification. Besides flexibility in the robotic system chosen for forensic automation, there is a need, for each sample type, to develop new methodology that is not only faster but also more reliable than past procedures. FTA is a chemical treatment of paper, unique to Whatman Bioscience, and is used for the stabilization and storage of biological samples. Here, the authors describe optimization of the Whatman FTA Purification Kit protocol for use with the AmpFlSTR Identifiler PCR Amplification Kit.

  16. Regulation of ecto-apyrase CD39 (ENTPD1) expression by phosphodiesterase III (PDE3)

    PubMed Central

    Baek, Amy E.; Kanthi, Yogendra; Sutton, Nadia R.; Liao, Hui; Pinsky, David J.

    2013-01-01

    The ectoenzyme CD39 suppresses thrombosis and inflammation by suppressing ATP and ADP to AMP. However, mechanisms of CD39 transcriptional and post-translational regulation are not well known. Here we show that CD39 levels are modulated by inhibition of phosphodiesterase 3 (PDE3). RAW macrophages and human umbilical vein endothelial cells (HUVECs) were treated with the PDE3 inhibitors cilostazol and milrinone, then analyzed using qRT-PCR, immunoprecipitation/Western blot, immunofluorescent staining, radio-thin-layer chromatography, a malachite green assay, and ELISA. HUVECs expressed elevated CD39 protein (2-fold [P<0.05] for cilostazol and 2.5-fold [P<0.01] for milrinone), while macrophage CD39 mRNA and protein were both elevated after PDE3 inhibition. HUVEC ATPase activity increased by 25% with cilostazol and milrinone treatment (P<0.05 and P<0.01, respectively), as did ADPase activity (47% and 61%, P<0.001). There was also a dose-dependent elevation of soluble CD39 after treatment with 8-Br-cAMP, with maximal elevation of 60% more CD39 present compared to controls (1 mM, P<0.001). Protein harvested after 8-Br-cAMP treatment showed that ubiquitination of CD39 was decreased by 43% compared to controls. A DMSO or PBS vehicle control was included for each experiment based on solubility of cilostazol, milrinone, and 8-Br-cAMP. These results indicate that PDE3 inhibition regulates endothelial CD39 at a post-translational level.—Baek, A. E., Kanthi, Y., Sutton, N. R., Liao, H., Pinsky, D. J. Regulation of ecto-apyrase CD39 (ENTPD1) expression by phosphodiesterase III (PDE3). PMID:23901069

  17. Presence of antimicrobial resistance in coliform bacteria from hatching broiler eggs with emphasis on ESBL/AmpC-producing bacteria.

    PubMed

    Mezhoud, H; Chantziaras, I; Iguer-Ouada, M; Moula, N; Garmyn, A; Martel, A; Touati, A; Smet, A; Haesebrouck, F; Boyen, F

    2016-08-01

    Antimicrobial resistance is recognized as one of the most important global health challenges. Broilers are an important reservoir of antimicrobial resistant bacteria in general and, more particularly, extended-spectrum β-lactamases (ESBL)/AmpC-producing Enterobacteriaceae. Since contamination of 1-day-old chicks is a potential risk factor for the introduction of antimicrobial resistant Enterobacteriaceae in the broiler production chain, the presence of antimicrobial resistant coliform bacteria in broiler hatching eggs was explored in the present study. Samples from 186 hatching eggs, collected from 11 broiler breeder farms, were inoculated on MacConkey agar with or without ceftiofur and investigated for the presence of antimicrobial resistant lactose-positive Enterobacteriaceae, particularly, ESBL/AmpC-producers. Escherichia coli and Enterobacter cloacae were obtained from the eggshells in 10 out of 11 (10/11) sampled farms. The majority of the isolates were recovered from crushed eggshells after external decontamination suggesting that these bacteria are concealed from the disinfectants in the egg shell pores. Antimicrobial resistance testing revealed that approximately 30% of the isolates showed resistance to ampicillin, tetracycline, trimethoprim and sulphonamides, while the majority of isolates were susceptible to amoxicillin-clavulanic acid, nitrofurantoin, aminoglycosides, florfenicol, neomycin and apramycin. Resistance to extended-spectrum cephalosporins was detected in eight Enterobacteriaceae isolates from five different broiler breeder farms. The ESBL phenotype was confirmed by the double disk synergy test and blaSHV-12, blaTEM-52 and blaACT-39 resistance genes were detected by PCR. This report is the first to present broiler hatching eggs as carriers and a potential source of ESBL/AmpC-producing Enterobacteriaceae for broiler chicks.

  18. Dopamine inhibits somatolactin gene expression in tilapia pituitary cells through the dopamine D2 receptors.

    PubMed

    Jiang, Quan; Lian, Anji; He, Qi

    2016-07-01

    Dopamine (DA) is an important neurotransmitter in the central nervous system of vertebrates and possesses key hypophysiotropic functions. Early studies have shown that DA has a potent inhibitory effect on somatolactin (SL) release in fish. However, the mechanisms responsible for DA inhibition of SL gene expression are largely unknown. To this end, tilapia DA type-1 (D1) and type-2 (D2) receptor transcripts were examined in the neurointermediate lobe (NIL) of the tilapia pituitary by real-time PCR. In tilapia, DA not only was effective in inhibiting SL mRNA levels in vivo and in vitro, but also could abolish pituitary adenylate cyclase-activating polypeptide (PACAP)- and salmon gonadotropin-releasing hormone (sGnRH)-stimulated SL gene expression at the pituitary level. In parallel studies, the specific D2 receptor agonists quinpirole and bromocriptine could mimic the DA-inhibited SL gene expression. Furthermore, the D2 receptor antagonists domperidone and (-)-sulpiride could abolish the SL response to DA or the D2 agonist quinpirole, whereas D1 receptor antagonists SCH23390 and SKF83566 were not effective in this respect. In primary cultures of tilapia NIL cells, D2 agonist quinpirole-inhibited cAMP production could be blocked by co-treatment with the D2 antagonist domperidone and the ability of forskolin to increase cAMP production was also inhibited by quinpirole. Using a pharmacological approach, the AC/cAMP pathway was shown to be involved in quinpirole-inhibited SL mRNA expression. These results provide evidence that DA can directly inhibit SL gene expression at the tilapia pituitary level via D2 receptor through the AC/cAMP-dependent mechanism. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. The Prevalence and Molecular Epidemiology of Multidrug-Resistant Enterobacteriaceae Colonization in a Pediatric Intensive Care Unit.

    PubMed

    Suwantarat, Nuntra; Logan, Latania K; Carroll, Karen C; Bonomo, Robert A; Simner, Patricia J; Rudin, Susan D; Milstone, Aaron M; Tekle, Tsigereda; Ross, Tracy; Tamma, Pranita D

    2016-05-01

    To determine the prevalence and acquisition of extended-spectrum β-lactamases (ESBLs), plasmid-mediated AmpCs (pAmpCs), and carbapenemases ("MDR Enterobacteriaceae") colonizing children admitted to a pediatric intensive care unit (PICU). Prospective study. 40-bed PICU. Admission and weekly thereafter rectal surveillance swabs were collected on all pediatric patients during a 6-month study period. Routine phenotypic identification and antibiotic susceptibility testing were performed. Enterobacteriaceae displaying characteristic resistance profiles underwent further molecular characterization to identify genetic determinants of resistance likely to be transmitted on mobile genetic elements and to evaluate relatedness of strains including DNA microarray, multilocus sequence typing, repetitive sequence-based PCR, and hsp60 sequencing typing. Evaluating 854 swabs from unique children, the overall prevalence of colonization with an MDR Enterobacteriaceae upon admission to the PICU based on β-lactamase gene identification was 4.3% (n=37), including 2.8% ESBLs (n=24), 1.3% pAmpCs (n=11), and 0.2% carbapenemases (n=2). Among 157 pediatric patients contributing 603 subsequent weekly swabs, 6 children (3.8%) acquired an incident MDR Enterobacteriaceae during their PICU stay. One child acquired a pAmpC (E. coli containing bla DHA) related to an isolate from another patient. Approximately 4% of children admitted to a PICU were colonized with MDR Enterobacteriaceae (based on β-lactamase gene identification) and an additional 4% of children who remained in the PICU for at least 1 week acquired 1 of these organisms during their PICU stay. The acquired MDR Enterobacteriaceae were relatively heterogeneous, suggesting that a single source was not responsible for the introduction of these resistance mechanisms into the PICU setting.

  20. The Prevalence and Molecular Epidemiology of Multidrug-Resistant Enterobacteriaceae Colonization in a Pediatric Intensive Care Unit

    PubMed Central

    Suwantarat, Nuntra; Logan, Latania K.; Carroll, Karen C.; Bonomo, Robert A.; Simner, Patricia J.; Rudin, Susan D.; Milstone, Aaron M.; Tekle, Tsigereda; Ross, Tracy; Tamma, Pranita D.

    2016-01-01

    OBJECTIVE To determine the prevalence and acquisition of extended-spectrum β-lactamases (ESBLs), plasmid-mediated AmpCs (pAmpCs), and carbapenemases (“MDR Enterobacteriaceae”) colonizing children admitted to a pediatric intensive care unit (PICU). DESIGN Prospective study. SETTING 40-bed PICU. METHODS Admission and weekly thereafter rectal surveillance swabs were collected on all pediatric patients during a 6-month study period. Routine phenotypic identification and antibiotic susceptibility testing were performed. Enterobacteriaceae displaying characteristic resistance profiles underwent further molecular characterization to identify genetic determinants of resistance likely to be transmitted on mobile genetic elements and to evaluate relatedness of strains including DNA microarray, multilocus sequence typing, repetitive sequence-based PCR, and hsp60 sequencing typing. Results Evaluating 854 swabs from unique children, the overall prevalence of colonization with an MDR Enterobacteriaceae upon admission to the PICU based on β-lactamase gene identification was 4.3% (n = 37), including 2.8% ESBLs (n =24), 1.3% pAmpCs (n =11), and 0.2% carbapenemases (n =2). Among 157 pediatric patients contributing 603 subsequent weekly swabs, 6 children (3.8%) acquired an incident MDR Enterobacteriaceae during their PICU stay. One child acquired a pAmpC (E. coli containing blaDHA) related to an isolate from another patient. Conclusions Approximately 4% of children admitted to a PICU were colonized with MDR Enterobacteriaceae (based on β-lactamase gene identification) and an additional 4% of children who remained in the PICU for at least 1 week acquired 1 of these organisms during their PICU stay. The acquired MDR Enterobacteriaceae were relatively heterogeneous, suggesting that a single source was not responsible for the introduction of these resistance mechanisms into the PICU setting. PMID:26856439

  1. Dissemination of plasmid-encoded AmpC β-lactamases in antimicrobial resistant Salmonella serotypes originating from humans, pigs and the swine environment.

    PubMed

    Keelara, Shivaramu; Thakur, Siddhartha

    2014-09-17

    The aim of this study was to characterize and determine the inter-serovar exchange of AmpC β-lactamase conferring plasmids isolated from humans, pigs and the swine environment. Plasmids isolated from a total of 21 antimicrobial resistant (AMR) Salmonella isolates representing human clinical cases (n=6), pigs (n=6) and the swine farm environment (n=9) were characterized by replicon typing and restriction digestion, inter-serovar transferability by conjugation, and presence of AmpC β-lactamase enzyme encoding gene blaCMY-2 by southern hybridization. Based on replicon typing, the majority (17/21, 81%) of the plasmids belonged to the I1-Iγ Inc group and were between 70 and 103kb. The potential for inter-serovar plasmid transfer was further confirmed by the PCR detection of AMR genes on the plasmids isolated from trans-conjugants. Plasmids from Salmonella serovars Anatum, Ouakam, Johannesburg and Typhimurium isolated from the same cohort of pigs and their environment and S. Heidelberg from a single human clinical isolate had identical plasmids based on digestion with multiple restriction enzymes (EcoRI, HindIII and PstI) and southern blotting. We demonstrated likely horizontal inter-serovar exchange of plasmid-encoding AmpC β-lactamases resistance among MDR Salmonella serotypes isolated from pigs, swine farm environment and clinical human cases. This study provides valuable information on the role of the swine farm environment and by extension other livestock farm environments, as a potential reservoir of resistant bacterial strains that potentially transmit resistance determinants to livestock, in this case, swine, humans and possibly other hosts by horizontal exchange of plasmids. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Role of the major antigenic membrane protein in phytoplasma transmission by two insect vector species.

    PubMed

    Rashidi, Mahnaz; Galetto, Luciana; Bosco, Domenico; Bulgarelli, Andrea; Vallino, Marta; Veratti, Flavio; Marzachì, Cristina

    2015-09-30

    Phytoplasmas are bacterial plant pathogens (class Mollicutes), transmitted by phloem feeding leafhoppers, planthoppers and psyllids in a persistent/propagative manner. Transmission of phytoplasmas is under the control of behavioral, environmental and geographical factors, but molecular interactions between membrane proteins of phytoplasma and vectors may also be involved. The aim of the work was to provide experimental evidence that in vivo interaction between phytoplasma antigenic membrane protein (Amp) and vector proteins has a role in the transmission process. In doing so, we also investigated the topology of the interaction at the gut epithelium and at the salivary glands, the two barriers encountered by the phytoplasma during vector colonization. Experiments were performed on the 'Candidatus Phytoplasma asteris' chrysanthemum yellows strain (CYP), and the two leafhopper vectors Macrosteles quadripunctulatus Kirschbaum and Euscelidius variegatus Kirschbaum. To specifically address the interaction of CYP Amp at the gut epithelium barrier, insects were artificially fed with media containing either the recombinant phytoplasma protein Amp, or the antibody (A416) or both, and transmission, acquisition and inoculation efficiencies were measured. An abdominal microinjection protocol was employed to specifically address the interaction of CYP Amp at the salivary gland barrier. Phytoplasma suspension was added with Amp or A416 or both, injected into healthy E. variegatus adults and then infection and inoculation efficiencies were measured. An internalization assay was developed, consisting of dissected salivary glands from healthy E. variegatus exposed to phytoplasma suspension alone or together with A416 antibody. The organs were then either observed in confocal microscopy or subjected to DNA extraction and phytoplasma quantification by qPCR, to visualize and quantify possible differences among treatments in localization/presence/number of CYP cells. Artificial feeding and abdominal microinjection protocols were developed to address the two barriers separately. The in vivo interactions between Amp of 'Candidatus Phytoplasma asteris' Chrysanthemum yellows strain (CYP) and vector proteins were studied by evaluating their effects on phytoplasma transmission by Euscelidius variegatus and Macrosteles quadripunctulatus leafhoppers. An internalization assay was developed, consisting of dissected salivary glands from healthy E. variegatus exposed to phytoplasma suspension alone or together with anti-Amp antibody. To visualize possible differences among treatments in localization/presence of CYP cells, the organs were observed in confocal microscopy. Pre-feeding of E. variegatus and M. quadripunctulatus on anti-Amp antibody resulted in a significant decrease of acquisition efficiencies in both species. Inoculation efficiency of microinjected E. variegatus with CYP suspension and anti-Amp antibody was significantly reduced compared to that of the control with phytoplasma suspension only. The possibility that this was due to reduced infection efficiency or antibody-mediated inhibition of phytoplasma multiplication was ruled out. These results provided the first indirect proof of the role of Amp in the transmission process. Protocols were developed to assess the in vivo role of the phytoplasma native major antigenic membrane protein in two phases of the vector transmission process: movement through the midgut epithelium and colonization of the salivary glands. These methods will be useful also to characterize other phytoplasma-vector combinations. Results indicated for the first time that native CYP Amp is involved in vivo in specific crossing of the gut epithelium and salivary gland colonization during early phases of vector infection.

  3. Non-coding Double-stranded RNA and Antimicrobial Peptide LL-37 Induce Growth Factor Expression from Keratinocytes and Endothelial Cells*

    PubMed Central

    Adase, Christopher A.; Borkowski, Andrew W.; Zhang, Ling-juan; Williams, Michael R.; Sato, Emi; Sanford, James A.

    2016-01-01

    A critical function for skin is that when damaged it must simultaneously identify the nature of the injury, repair barrier function, and limit the intrusion of pathogenic organisms. These needs are carried out through the detection of damage-associated molecular patterns (DAMPs) and a response that includes secretion of cytokines, chemokines, growth factors, and antimicrobial peptides (AMPs). In this study, we analyzed how non-coding double-stranded RNA (dsRNAs) act as a DAMP in the skin and how the human cathelicidin AMP LL-37 might influence growth factor production in response to this DAMP. dsRNA alone significantly increased the expression of multiple growth factors in keratinocytes, endothelial cells, and fibroblasts. Furthermore, RNA sequencing transcriptome analysis found that multiple growth factors increase when cells are exposed to both LL-37 and dsRNA, a condition that mimics normal wounding. Quantitative PCR and/or ELISA validated that growth factors expressed by keratinocytes in these conditions included, but were not limited to, basic fibroblast growth factor (FGF2), heparin-binding EGF-like growth factor (HBEGF), vascular endothelial growth factor C (VEGFC), betacellulin (BTC), EGF, epiregulin (EREG), and other members of the transforming growth factor β superfamily. These results identify a novel role for DAMPs and AMPs in the stimulation of repair and highlight the complex interactions involved in the wound environment. PMID:27048655

  4. Glomerular Podocytes Express Type 1 Adenylate Cyclase: Inactivation Results in Susceptibility to Proteinuria

    PubMed Central

    Xiao, Zhijie; He, Liqun; Takemoto, Minoru; Jalanko, Hannu; Chan, Guy C.; Storm, Daniel R.; Betsholtz, Christer; Tryggvason, Karl; Patrakka, Jaakko

    2011-01-01

    Background/Aims The organization of actin cytoskeleton in podocyte foot processes plays a critical role in the maintenance of the glomerular filtration barrier. The cAMP pathway is an important regulator of the actin network assembly in cells. However, the role of the cAMP pathway in podocytes is not well understood. Type 1 adenylate cyclase (Adcy1), previously thought to be specific for neuronal tissue, is a member of the family of enzymes that catalyses the formation of cAMP. In this study, we characterized the expression and role of Adcy1 in the kidney. Methods Expression of Adcy1 was studied by RT-PCR, Northern blotting and in situ hybridization. The role of Adcy1 in podocytes was investigated by analyzing Adcy1 knockout mice (Adcy1–/–). Results and Conclusion: Adcy1 is expressed in the kidney specifically by podocytes. In the kidney, Adcy1 does not have a critical role in normal physiological functioning as kidney histology and function are normal in Adcy1–/– mice. However, albumin overload resulted in severe albuminuria in Adcy1–/– mice, whereas wild-type control mice showed only mild albumin leakage to urine. In conclusion, we have identified Adcy1 as a novel podocyte signaling protein that seems to have a role in compensatory physiological processes in the glomerulus. PMID:21196775

  5. Divergent mechanisms of insulin-like growth factor I and II on rat hepatocyte proliferation.

    PubMed

    Raper, S; Kothary, P; Ishoo, E; Dikin, M; Kokudo, N; Hashimoto, M; DeMatteo, R P

    1995-07-21

    Insulin-like growth factors I and II are peptides with a structural homology for proinsulin, and are involved in hepatocyte proliferation. IGF-I and IGF-II, however, have different metabolic roles, and their mechanisms of action are incompletely known. We hypothesized that IGF-I and IGF-II act by different signal transduction pathways. To test this hypothesis, hepatocytes from 200 g male Sprague-Dawley rats were isolated by a two-step collagenase perfusion technique and plated at a density of 10(5) cells/16 mm Primaria plate. Proliferation was measured by [3H]thymidine ([3H]thy) incorporation into DNA, and an autoradiographic nuclear labeling index (LI). To analyze signal transduction, cyclic AMP (cAMP) levels were measured 5 min after addition of reagents by a radioimmunoassay. Reagents (doses) used were: IGF-I (2 nM), IGF-II (2 nM), the inhibitory peptide somatostatin-14 (SS14) (10 nM), and the adenylyl cyclase antagonist dideoxyadenosine (DDA) (10 microM). A summary of the findings is as follows: (1) IGF-I stimulates [3H]thy, LI and cAMP accumulation. (2) IGF-II stimulates [3H]thy and LI but not cAMP; (3) IGF-I but not IGF-II effects are inhibited by SS14 and DDA. We conclude that the hepatotrophic effects of IGF-I and IGF-II occur by different mechanisms: IGF-I is cAMP-dependent, IGF-II is cAMP-independent.

  6. Studying of cellular interaction of hairpin-like peptide EcAMP1 from barnyard grass (Echinochloa crusgalli L.) seeds with plant pathogenic fungus Fusarium solani using microscopy techniques.

    PubMed

    Vasilchenko, Alexey S; Yuryev, Mikhail; Ryazantsev, Dmitry Yu; Zavriev, Sergey K; Feofanov, Alexey V; Grishin, Eugene V; Rogozhin, Eugene A

    2016-11-01

    An interaction of recombinant hairpin-like cationic peptide EcAMP1 with conidia of plant pathogenic fungus Fusarium solani at the cellular level was studied by a combination of microscopic methods. EcAMP1 is from barnyard grass (Echinochloa crusgalli L.), and obtained by heterologous expression in Escherichia coli system. As a result, a direct relationship between hyphal growth inhibition and increasing active peptide concentration, time of incubation and fungal physiological condition has been determined. Dynamics of accumulation and redistribution of the peptide studied on fungal cellular cover and inside the conidia cells has been shown. The dynamics are dependent on time of coupling, as well as, a dissimilarity of EcAMP1 binding with cover of fungal conidia and its stepwise accumulation and diffuse localization in the cytoplasm. Correlation between structural disruption of fungal conidia and the presence of morphological changes has also been found. The correlation was found under the influence of peptide high concentrations at concentrations above 32 μM. The results indicate the presence of a binding of EcAMP1 with the surface of fungal conidia, thus, demonstrating a main specificity for its antifungal action at the cellular level. These results, however, cannot exclude the existence of attendant EcAMP1 action based on its intracellular localization on some specific targets. SCANNING 38:591-598, 2016. © 2016 Wiley Periodicals, Inc. © Wiley Periodicals, Inc.

  7. A novel universal real-time PCR system using the attached universal duplex probes for quantitative analysis of nucleic acids.

    PubMed

    Yang, Litao; Liang, Wanqi; Jiang, Lingxi; Li, Wenquan; Cao, Wei; Wilson, Zoe A; Zhang, Dabing

    2008-06-04

    Real-time PCR techniques are being widely used for nucleic acids analysis, but one limitation of current frequently employed real-time PCR is the high cost of the labeled probe for each target molecule. We describe a real-time PCR technique employing attached universal duplex probes (AUDP), which has the advantage of generating fluorescence by probe hydrolysis and strand displacement over current real-time PCR methods. AUDP involves one set of universal duplex probes in which the 5' end of the fluorescent probe (FP) and a complementary quenching probe (QP) lie in close proximity so that fluorescence can be quenched. The PCR primer pair with attached universal template (UT) and the FP are identical to the UT sequence. We have shown that the AUDP technique can be used for detecting multiple target DNA sequences in both simplex and duplex real-time PCR assays for gene expression analysis, genotype identification, and genetically modified organism (GMO) quantification with comparable sensitivity, reproducibility, and repeatability with other real-time PCR methods. The results from GMO quantification, gene expression analysis, genotype identification, and GMO quantification using AUDP real-time PCR assays indicate that the AUDP real-time PCR technique has been successfully applied in nucleic acids analysis, and the developed AUDP real-time PCR technique will offer an alternative way for nucleic acid analysis with high efficiency, reliability, and flexibility at low cost.

  8. In vitro covalent binding of new brain tracer, para-125I-amphetamine, to rat liver and lung microsomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Joulin, Y.; Delaforge, M.; Hoellinger, H.

    1990-01-01

    p-125I-amphetamine (I-Amp) is retained significantly in liver and lung during brain tomoscintigraphy. To attempt to explain this clinical observation, we have investigated the interaction of I-Amp with rat liver and lung microsomal proteins. Studies using spectral shift technique indicate that low concentration of I-Amp gives a type I complex and high concentration appears very stable type II complex with cytochrome P-450 Fe III. In the presence of NADPH, I-Amp gives rise to a 455 nm absorbing complex with similar properties to the Fe-RNO complexes. This complex formation was greatly enhanced with phenobarbital treated liver microsomes. The in vitro binding studymore » shows that I-Amp and/or its metabolites was covalently bound to macromolecules in the presence of the molecular oxygen and NADPH-generating system. Incubation in the presence of glutathione, cystein and radical scavengers decreases binding. Mixed function oxydase (MFO) inhibitors diminish the amount of covalent binding and alter the extent of metabolite formation. The total covalent binding level increased with liver microsomes from PB pretreated rats as it was observed with the 455nm complex formation. The radioactivity distribution on microsomal proteins was examinated with SDS polyacrylamide gel electrophoresis and autoradiography. This experiment proves that the radiolabelled compounds are bound on the cytochrome P-450. The radioactivity bound increased when the PB induced rat liver microsomes were used. All these results indicate that I-Amp was activated by an oxydative process dependent on the MFO system which suggests a N-oxydation of I-Amp and the formation of reactive entities which covalently bind to proteins.« less

  9. Object-oriented numerics with FOSS: comparing PyPy &amp; NumPy, GCC/Clang &amp; Bitz++ and Gfortran

    NASA Astrophysics Data System (ADS)

    Jarecka, Dorota; Arabas, Sylwester; Fijalkowski, Maciej; Jaruga, Anna; Del Vento, Davide

    2013-04-01

    Employment of object-oriented programming (OOP) techniques may help to improve code readability, and hence its auditability and maintainability - both being arguably crucial for scientific software. OOP offers, in particular, the possibility to reproduce in the program code the mathematical "blackboard abstractions" used in the literature. There exist a number of free and open-source tools allowing to obtain this goal without sacrificing performance. An OOP implementation of the MPDATA advection algorithm used as a core of weather, ocean and climate modelling systems will serve as an example for briefly highlighting some relevant recent FOSS developments including: - NumPy support in the PyPy just-in-time compiler of Python. - the Blitz++ library coupled with the C++11 support in GCC and Clang; - support for OOP constructs from Fortran 2003/2008 in GFortran; A brief overview of other performance-related packages for Python like Numba and Cython will be also given. This poster will describe and extends key findings presented in http://arxiv.org/abs/1301.1334

  10. In Vivo, In Vitro, and In Silico Characterization of Peptoids as Antimicrobial Agents.

    PubMed

    Czyzewski, Ann M; Jenssen, Håvard; Fjell, Christopher D; Waldbrook, Matt; Chongsiriwatana, Nathaniel P; Yuen, Eddie; Hancock, Robert E W; Barron, Annelise E

    2016-01-01

    Bacterial resistance to conventional antibiotics is a global threat that has spurred the development of antimicrobial peptides (AMPs) and their mimetics as novel anti-infective agents. While the bioavailability of AMPs is often reduced due to protease activity, the non-natural structure of AMP mimetics renders them robust to proteolytic degradation, thus offering a distinct advantage for their clinical application. We explore the therapeutic potential of N-substituted glycines, or peptoids, as AMP mimics using a multi-faceted approach that includes in silico, in vitro, and in vivo techniques. We report a new QSAR model that we developed based on 27 diverse peptoid sequences, which accurately correlates antimicrobial peptoid structure with antimicrobial activity. We have identified a number of peptoids that have potent, broad-spectrum in vitro activity against multi-drug resistant bacterial strains. Lastly, using a murine model of invasive S. aureus infection, we demonstrate that one of the best candidate peptoids at 4 mg/kg significantly reduces with a two-log order the bacterial counts compared with saline-treated controls. Taken together, our results demonstrate the promising therapeutic potential of peptoids as antimicrobial agents.

  11. Molecular methods (digital PCR and real-time PCR) for the quantification of low copy DNA of Phytophthora nicotianae in environmental samples.

    PubMed

    Blaya, Josefa; Lloret, Eva; Santísima-Trinidad, Ana B; Ros, Margarita; Pascual, Jose A

    2016-04-01

    Currently, real-time polymerase chain reaction (qPCR) is the technique most often used to quantify pathogen presence. Digital PCR (dPCR) is a new technique with the potential to have a substantial impact on plant pathology research owing to its reproducibility, sensitivity and low susceptibility to inhibitors. In this study, we evaluated the feasibility of using dPCR and qPCR to quantify Phytophthora nicotianae in several background matrices, including host tissues (stems and roots) and soil samples. In spite of the low dynamic range of dPCR (3 logs compared with 7 logs for qPCR), this technique proved to have very high precision applicable at very low copy numbers. The dPCR was able to detect accurately the pathogen in all type of samples in a broad concentration range. Moreover, dPCR seems to be less susceptible to inhibitors than qPCR in plant samples. Linear regression analysis showed a high correlation between the results obtained with the two techniques in soil, stem and root samples, with R(2) = 0.873, 0.999 and 0.995 respectively. These results suggest that dPCR is a promising alternative for quantifying soil-borne pathogens in environmental samples, even in early stages of the disease. © 2015 Society of Chemical Industry.

  12. A novel universal real-time PCR system using the attached universal duplex probes for quantitative analysis of nucleic acids

    PubMed Central

    Yang, Litao; Liang, Wanqi; Jiang, Lingxi; Li, Wenquan; Cao, Wei; Wilson, Zoe A; Zhang, Dabing

    2008-01-01

    Background Real-time PCR techniques are being widely used for nucleic acids analysis, but one limitation of current frequently employed real-time PCR is the high cost of the labeled probe for each target molecule. Results We describe a real-time PCR technique employing attached universal duplex probes (AUDP), which has the advantage of generating fluorescence by probe hydrolysis and strand displacement over current real-time PCR methods. AUDP involves one set of universal duplex probes in which the 5' end of the fluorescent probe (FP) and a complementary quenching probe (QP) lie in close proximity so that fluorescence can be quenched. The PCR primer pair with attached universal template (UT) and the FP are identical to the UT sequence. We have shown that the AUDP technique can be used for detecting multiple target DNA sequences in both simplex and duplex real-time PCR assays for gene expression analysis, genotype identification, and genetically modified organism (GMO) quantification with comparable sensitivity, reproducibility, and repeatability with other real-time PCR methods. Conclusion The results from GMO quantification, gene expression analysis, genotype identification, and GMO quantification using AUDP real-time PCR assays indicate that the AUDP real-time PCR technique has been successfully applied in nucleic acids analysis, and the developed AUDP real-time PCR technique will offer an alternative way for nucleic acid analysis with high efficiency, reliability, and flexibility at low cost. PMID:18522756

  13. Antibiotic Resistance, RAPD- PCR Typing of Multiple Drug Resistant Strains of Escherichia Coli From Urinary Tract Infection (UTI).

    PubMed

    Marialouis, Xavier Alexander; Santhanam, Amutha

    2016-03-01

    Global spreading of multidrug resistant strains of Escherichia coli is responsible for Urinary Tract Infection (UTI) which is a major health problem in of concern. Among the gram negative bacteria, the major contributors for UTI belongs to the family Enterobacteriaceae, which includes E. coli, Klebsiella, Citrobacter and Proteus. However, E. coli accounts for the major cause of Urinary tract infections (UTIs) and accounts for 75% to 90% of UTI isolates. The main aim of this study is to analyse the phylogenetic grouping of clinical isolates of UTI E. coli. In this study nearly 58 E. coli strains were isolated and confirmed through microbiological, biochemical characterization. The urine samples were collected from outpatients having symptoms of UTI, irrespective of age and sex in Tamil Nadu, India. The isolates were subjected to analyse for ESBL and AmpC β-lactamase production. To understand its genetic correlation, molecular typing was carried out using RAPD-PCR method. Here we noted phenotypically twenty seven isolates were positive for ESBL and seven for AmpC β-lactamase production. However, among the ESBL isolates higher sensitivity was noted for Nitrofurantoin and Cefoxitin. It is worth to note that the prevalence of UTIs was more common among female and elderly male. Phylogenetic grouping revealed the presence of 24 isolates belonged to B2 group followed by 19 isolates to group A, eight isolates to group B1 and Seven isolates to group D. Phenotypically most of the strains were positive for ESBL and showed high sensitivity for Nitrofurantoin and cefoxitin.

  14. Inhibition of verocytotoxigenic Escherichia coli by antimicrobial peptides caseicin A and B and the factors affecting their antimicrobial activities.

    PubMed

    McDonnell, Mary J; Rivas, Lucia; Burgess, Catherine M; Fanning, Séamus; Duffy, Geraldine

    2012-02-15

    The antimic robial activities of caseicin A and B antimicrobial peptides (AMPs) were assessed against a selection of verocytotoxigenic Escherichia coli (VTEC) strains (n=11), other bacterial pathogenic and spoilage bacteria (n=7), using a model broth system. The ability of the AMPs to retain their antimicrobial activities against a strain of E. coli O157:H7 380-94 under various test conditions (pH, temperature, water activity, sodium chloride concentrations, inoculum size and the presence of competitive microflora) was assessed and the minimum inhibitory concentrations (MIC) and number of surviving E. coli O157:H7 calculated. The mean number of VTEC surviving after exposure to 2 mg/ml caseicin A and B was reduced by 4.96 and 4.19 log(10) cfu/ml compared to the respective controls. The susceptibility of E. coli O157:H7 to the caseicin AMPs decreased as temperature, pH, water activity and inoculum size were reduced. The presence of sodium chloride (0.5-2.5%) did not affect the activity of caseicin A (p>0.05), however it did inhibit the activity of caseicin B. The presence of a competitive microflora cocktail did not significantly (p>0.05) affect the activities of the AMPs for the majority of the concentrations tested. Using a quantitative PCR assay, the levels of verotoxins (vt1 and vt2) expressed by E. coli O157:H7 following exposure to a sub-inhibitory concentration (0.5 mg/ml) of caseicin A showed that the verotoxin levels did not differ from the levels produced by the control cultures. The antimicrobial activity of caseicin A against E. coli O157:H7 was also tested in a model rumen system, however concentrations of ≥2 mg/ml did not significantly (p>0.05) reduce E. coli O157:H7 numbers in the model system over a 24 h period. The application of caseicin AMPs in food and/or animal production may be valuable in combination with other antimicrobials although further research is required. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Population Distribution of Beta-Lactamase Conferring Resistance to Third-Generation Cephalosporins in Human Clinical Enterobacteriaceae in The Netherlands

    PubMed Central

    Voets, Guido M.; Platteel, Tamara N.; Fluit, Ad C.; Scharringa, Jelle; Schapendonk, Claudia M.; Stuart, James Cohen; Bonten, Marc J. M.; Hall, Maurine A. L.

    2012-01-01

    There is a global increase in infections caused by Enterobacteriaceae with plasmid-borne β-lactamases that confer resistance to third-generation cephalosporins. The epidemiology of these bacteria is not well understood, and was, therefore, investigated in a selection of 636 clinical Enterobacteriaceae with a minimal inhibitory concentration >1 mg/L for ceftazidime/ceftriaxone from a national survey (75% E. coli, 11% E. cloacae, 11% K. pneumoniae, 2% K. oxytoca, 2% P. mirabilis). Isolates were investigated for extended-spectrum β-lactamases (ESBLs) and ampC genes using microarray, PCR, gene sequencing and molecular straintyping (Diversilab and multi-locus sequence typing (MLST)). ESBL genes were demonstrated in 512 isolates (81%); of which 446 (87%) belonged to the CTX-M family. Among 314 randomly selected and sequenced isolates, bla CTX-M-15 was most prevalent (n = 124, 39%), followed by bla CTX-M-1 (n = 47, 15%), bla CTX-M-14 (n = 15, 5%), bla SHV-12 (n = 24, 8%) and bla TEM-52 (n = 13, 4%). Among 181 isolates with MIC ≥16 mg/L for cefoxitin plasmid encoded AmpCs were detected in 32 and 27 were of the CMY-2 group. Among 102 E. coli isolates with MIC ≥16 mg/L for cefoxitin ampC promoter mutations were identified in 29 (28%). Based on Diversilab genotyping of 608 isolates (similarity cut-off >98%) discriminatory indices of bacteria with ESBL and/or ampC genes were 0.994, 0.985 and 0.994 for E. coli, K. pneumoniae and E. cloacae, respectively. Based on similarity cut-off >95% two large clusters of E. coli were apparent (of 43 and 30 isolates) and 21 of 21 that were typed by belonged to ST131 of which 13 contained bla CTX-M-15. Our findings demonstrate that bla CTX-M-15 is the most prevalent ESBL and we report a larger than previously reported prevalence of ampC genes among Enterobacteriaceae responsible for resistance to third-generation cephalosporins. PMID:23284886

  16. Progesterone, estradiol, arachidonic acid, oxytocin, forskolin and cAMP influence on aquaporin 1 and 5 expression in porcine uterine explants during the mid-luteal phase of the estrous cycle and luteolysis: an in vitro study.

    PubMed

    Skowronska, Agnieszka; Młotkowska, Patrycja; Wojciechowicz, Bartosz; Okrasa, Stanisław; Nielsen, Soren; Skowronski, Mariusz T

    2015-02-18

    The cell membrane water channel protein, aquaporins (AQPs), regulate cellular water transport and cell volume and play a key role in water homeostasis. Recently, AQPs are considered as important players in the field of reproduction. In previous studies, we have established the presence of AQP1 and 5 in porcine uterus. Their expression at protein level altered in distinct tissues of the female reproductive system depending on the phase of the estrous cycle. However, the regulation of aquaporin genes and proteins expression has not been examined in porcine uterine tissue. Therefore, we have designed an in vitro experiment to explain whether steroid hormones, progesterone (P4) and estradiol (E2), and other factors: oxytocine (OT), arachidonic acid (AA; substrate for prostaglandins synthesis) as well as forskolin (FSK; adenylate cyclase activator) and cAMP (second messenger, cyclic adenosine monophosphate) may impact AQPs expression. Uterine tissues were collected on Days 10-12 and 14-16 of the estrous cycle representing the mid-luteal phase and luteolysis. Real-time PCR and Western blot analysis were performed to examine the expression of porcine AQP1 and AQP5. Their expression in the uterine explants was also evaluated by immunohistochemistry. The results indicated that uterine expression of AQP1 and AQP5 potentially remains under control of steroid hormones and AA-derived compounds (e.g. prostaglandins). P4, E2, AA, FSK and cAMP cause translocation of AQP5 from apical to the basolateral plasma membrane of the epithelial cells, which might affect the transcellular water movement (through epithelial cells) between uterine lumen and blood vessels. The AC/cAMP pathway is involved in the intracellular signals transduction connected with the regulation of AQPs expression in the pig uterus. This study documented specific patterns of AQP1 and AQP5 expression in response to P4, E2, AA, FSK and cAMP, thereby providing new indirect evidence of their role in maintaining the local fluid balance within the uterus during the mid-luteal phase of the estrous cycle and luteolysis in pigs.

  17. Increase in resistance to extended-spectrum cephalosporins in Salmonella isolated from retail chicken products in Japan.

    PubMed

    Noda, Tamie; Murakami, Koichi; Etoh, Yoshiki; Okamoto, Fuyuki; Yatsuyanagi, Jun; Sera, Nobuyuki; Furuta, Munenori; Onozuka, Daisuke; Oda, Takahiro; Asai, Tetsuo; Fujimoto, Shuji

    2015-01-01

    Extended-spectrum β-lactamase (ESBL)-producing Salmonella are one of the most important public health problems in developed countries. ESBL-producing Salmonella strains have been isolated from humans in Asian countries neighboring Japan, along with strains harboring the plasmid-mediated extended-spectrum cephalosporin (ESC)-resistance gene, ampC (pAmpC). However, only a few studies have investigated the prevalence of ESC-resistant Salmonella in chicken products in Japan, which are the main vehicle of Salmonella transmission. The aim of this study was to investigate the prevalence of ESBL-producing, pAmpC-harboring, or carbapenem-resistant Salmonella in chicken products in Japan. In total, 355 out of 779 (45.6%) chicken product samples collected from 1996-2010 contained Salmonella, resulting in 378 distinct isolates. Of these isolates, 373 were tested for resistance to ESCs, cephamycins, or carbapenems. Isolates that showed resistance to one or more of these antimicrobials were then examined by PCR and DNA sequence analysis for the presence of the bla(CMY), bla(CTX-M), bla(TEM), and bla(SHV) resistance genes. Thirty-five resistant isolates were detected, including 26 isolates that contained pAmpC (bla(CMY-2)), and nine ESBL-producing isolates harboring bla(CTX-M) (n = 4, consisting of two bla(CTX-M-2) and two bla(CTX-M-15 genes)), bla(TEM) (n = 4, consisting of one bla(TEM-20) and three bla(TEM-52) genes), and bla(SHV) (n = 1, bla(SHV-12)). All pAmpC-harboring and ESBL-producing Salmonella isolates were obtained from samples collected after 2005, and the percentage of resistant isolates increased significantly from 0% in 2004 to 27.9% in 2010 (P for trend = 0.006). This increase was caused in part by an increase in the number of Salmonella enterica subsp. enterica serovar Infantis strains harboring an approximately 280-kb plasmid containing bla(CMY-2) in proximity to ISEcp1. The dissemination of ESC-resistant Salmonella containing plasmid-mediated bla(CMY-2) in chicken products indicates the need for the development of continuous monitoring strategies in the interests of public health.

  18. Induction of miR-132 and miR-212 Expression by Glucagon-Like Peptide 1 (GLP-1) in Rodent and Human Pancreatic β-Cells

    PubMed Central

    Li, Jing; Keller, Mark P.; Hohmeier, Hans E.; Wang, Yong; Feng, Yue; Zhou, Heather H.; Shen, Xiaolan; Rabaglia, Mary; Soni, Mufaddal; Attie, Alan D.; Newgard, Christopher B.; Thornberry, Nancy A.; Howard, Andrew D.; Zhou, Yun-Ping

    2015-01-01

    Better understanding how glucagon-like peptide 1 (GLP-1) promotes pancreatic β-cell function and/or mass may uncover new treatment for type 2 diabetes. In this study, we investigated the potential involvement of microRNAs (miRNAs) in the effect of GLP-1 on glucose-stimulated insulin secretion. miRNA levels in INS-1 cells and isolated rodent and human islets treated with GLP-1 in vitro and in vivo (with osmotic pumps) were measured by real-time quantitative PCR. The role of miRNAs on insulin secretion was studied by transfecting INS-1 cells with either precursors or antisense inhibitors of miRNAs. Among the 250 miRNAs surveyed, miR-132 and miR-212 were significantly up-regulated by GLP-1 by greater than 2-fold in INS-1 832/3 cells, which were subsequently reproduced in freshly isolated rat, mouse, and human islets, as well as the islets from GLP-1 infusion in vivo in mice. The inductions of miR-132 and miR-212 by GLP-1 were correlated with cAMP production and were blocked by the protein kinase A inhibitor H-89 but not affected by the exchange protein activated by cAMP activator 8-pCPT-2′-O-Me-cAMP-AM. GLP-1 failed to increase miR-132 or miR-212 expression levels in the 832/13 line of INS-1 cells, which lacks robust cAMP and insulin responses to GLP-1 treatment. Overexpression of miR-132 or miR-212 significantly enhanced glucose-stimulated insulin secretion in both 832/3 and 832/13 cells, and restored insulin responses to GLP-1 in INS-1 832/13 cells. GLP-1 increases the expression of miRNAs 132 and 212 via a cAMP/protein kinase A-dependent pathway in pancreatic β-cells. Overexpression of miR-132 or miR-212 enhances glucose and GLP-1-stimulated insulin secretion. PMID:26218441

  19. Induction of miR-132 and miR-212 Expression by Glucagon-Like Peptide 1 (GLP-1) in Rodent and Human Pancreatic β-Cells.

    PubMed

    Shang, Jin; Li, Jing; Keller, Mark P; Hohmeier, Hans E; Wang, Yong; Feng, Yue; Zhou, Heather H; Shen, Xiaolan; Rabaglia, Mary; Soni, Mufaddal; Attie, Alan D; Newgard, Christopher B; Thornberry, Nancy A; Howard, Andrew D; Zhou, Yun-Ping

    2015-09-01

    Better understanding how glucagon-like peptide 1 (GLP-1) promotes pancreatic β-cell function and/or mass may uncover new treatment for type 2 diabetes. In this study, we investigated the potential involvement of microRNAs (miRNAs) in the effect of GLP-1 on glucose-stimulated insulin secretion. miRNA levels in INS-1 cells and isolated rodent and human islets treated with GLP-1 in vitro and in vivo (with osmotic pumps) were measured by real-time quantitative PCR. The role of miRNAs on insulin secretion was studied by transfecting INS-1 cells with either precursors or antisense inhibitors of miRNAs. Among the 250 miRNAs surveyed, miR-132 and miR-212 were significantly up-regulated by GLP-1 by greater than 2-fold in INS-1 832/3 cells, which were subsequently reproduced in freshly isolated rat, mouse, and human islets, as well as the islets from GLP-1 infusion in vivo in mice. The inductions of miR-132 and miR-212 by GLP-1 were correlated with cAMP production and were blocked by the protein kinase A inhibitor H-89 but not affected by the exchange protein activated by cAMP activator 8-pCPT-2'-O-Me-cAMP-AM. GLP-1 failed to increase miR-132 or miR-212 expression levels in the 832/13 line of INS-1 cells, which lacks robust cAMP and insulin responses to GLP-1 treatment. Overexpression of miR-132 or miR-212 significantly enhanced glucose-stimulated insulin secretion in both 832/3 and 832/13 cells, and restored insulin responses to GLP-1 in INS-1 832/13 cells. GLP-1 increases the expression of miRNAs 132 and 212 via a cAMP/protein kinase A-dependent pathway in pancreatic β-cells. Overexpression of miR-132 or miR-212 enhances glucose and GLP-1-stimulated insulin secretion.

  20. High Heterogeneity of Escherichia coli Sequence Types Harbouring ESBL/AmpC Genes on IncI1 Plasmids in the Colombian Poultry Chain

    PubMed Central

    Donado-Godoy, Pilar; León, Maribel; Clavijo, Viviana; Arevalo, Alejandra; Bernal, Johan F.; Timmerman, Arjen J.; Mevius, Dik J.; Wagenaar, Jaap A.; Hordijk, Joost

    2017-01-01

    Background Escherichia coli producing ESBL/AmpC enzymes are unwanted in animal production chains as they may pose a risk to human and animal health. Molecular characterization of plasmids and strains carrying genes that encode these enzymes is essential to understand their local and global spread. Objectives To investigate the diversity of genes, plasmids and strains in ESBL/AmpC-producing E. coli from the Colombian poultry chain isolated within the Colombian Integrated Program for Antimicrobial Resistance Surveillance (Coipars). Methods A total of 541 non-clinical E. coli strains from epidemiologically independent samples and randomly isolated between 2008 and 2013 within the Coipars program were tested for antimicrobial susceptibility. Poultry isolates resistant to cefotaxime (MIC ≥ 4 mg/L) were screened for ESBL/AmpC genes including blaCTX-M, blaSHV, blaTEM, blaCMY and blaOXA. Plasmid and strain characterization was performed for a selection of the ESBL/AmpC-producing isolates. Plasmids were purified and transformed into E. coli DH10B cells or transferred by conjugation to E. coli W3110. When applicable, PCR Based Replicon Typing (PBRT), plasmid Multi Locus Sequence Typing (pMLST), plasmid Double Locus Sequence Typing (pDLST) and/or plasmid Replicon Sequence Typing (pRST) was performed on resulting transformants and conjugants. Multi Locus Sequence Typing (MLST) was used for strain characterization. Results In total, 132 of 541 isolates were resistant to cefotaxime and 122 were found to carry ESBL/AmpC genes. Ninety-two harboured blaCMY-2 (75%), fourteen blaSHV-12 (11%), three blaSHV-5 (2%), five blaCTX-M-2 (4%), one blaCTX-M-15 (1%), one blaCTX-M-8 (1%), four a combination of blaCMY-2 and blaSHV-12 (4%) and two a combination of blaCMY-2 and blaSHV-5 (2%). A selection of 39 ESBL/AmpC-producing isolates was characterized at the plasmid and strain level. ESBL/AmpC genes from 36 isolates were transferable by transformation or conjugation of which 22 were located on IncI1 plasmids. These IncI1 plasmids harboured predominantly blaCMY-2 (16/22), and to a lesser extend blaSHV-12 (5/22) and blaCTX-M-8 (1/22). Other plasmid families associated with ESBL/AmpC-genes were IncK (4/33), IncHI2 (3/33), IncA/C (2/33), IncΒ/O (1/33) and a non-typeable replicon (1/33). Subtyping of IncI1 and IncHI2 demonstrated IncI1/ST12 was predominantly associated with blaCMY-2 (12/16) and IncHI2/ST7 with blaCTX-M-2 (2/3). Finally, 31 different STs were detected among the 39 selected isolates. Conclusions Resistance to extended spectrum cephalosporins in E. coli from Colombian poultry is mainly caused by blaCMY-2 and blaSHV-12. The high diversity of strain Sequence Types and the dissemination of homogeneous IncI1/ST12 plasmids suggest that spread of the resistance is mainly mediated by horizontal gene transfer. PMID:28125687

  1. High Heterogeneity of Escherichia coli Sequence Types Harbouring ESBL/AmpC Genes on IncI1 Plasmids in the Colombian Poultry Chain.

    PubMed

    Castellanos, Luis Ricardo; Donado-Godoy, Pilar; León, Maribel; Clavijo, Viviana; Arevalo, Alejandra; Bernal, Johan F; Timmerman, Arjen J; Mevius, Dik J; Wagenaar, Jaap A; Hordijk, Joost

    2017-01-01

    Escherichia coli producing ESBL/AmpC enzymes are unwanted in animal production chains as they may pose a risk to human and animal health. Molecular characterization of plasmids and strains carrying genes that encode these enzymes is essential to understand their local and global spread. To investigate the diversity of genes, plasmids and strains in ESBL/AmpC-producing E. coli from the Colombian poultry chain isolated within the Colombian Integrated Program for Antimicrobial Resistance Surveillance (Coipars). A total of 541 non-clinical E. coli strains from epidemiologically independent samples and randomly isolated between 2008 and 2013 within the Coipars program were tested for antimicrobial susceptibility. Poultry isolates resistant to cefotaxime (MIC ≥ 4 mg/L) were screened for ESBL/AmpC genes including blaCTX-M, blaSHV, blaTEM, blaCMY and blaOXA. Plasmid and strain characterization was performed for a selection of the ESBL/AmpC-producing isolates. Plasmids were purified and transformed into E. coli DH10B cells or transferred by conjugation to E. coli W3110. When applicable, PCR Based Replicon Typing (PBRT), plasmid Multi Locus Sequence Typing (pMLST), plasmid Double Locus Sequence Typing (pDLST) and/or plasmid Replicon Sequence Typing (pRST) was performed on resulting transformants and conjugants. Multi Locus Sequence Typing (MLST) was used for strain characterization. In total, 132 of 541 isolates were resistant to cefotaxime and 122 were found to carry ESBL/AmpC genes. Ninety-two harboured blaCMY-2 (75%), fourteen blaSHV-12 (11%), three blaSHV-5 (2%), five blaCTX-M-2 (4%), one blaCTX-M-15 (1%), one blaCTX-M-8 (1%), four a combination of blaCMY-2 and blaSHV-12 (4%) and two a combination of blaCMY-2 and blaSHV-5 (2%). A selection of 39 ESBL/AmpC-producing isolates was characterized at the plasmid and strain level. ESBL/AmpC genes from 36 isolates were transferable by transformation or conjugation of which 22 were located on IncI1 plasmids. These IncI1 plasmids harboured predominantly blaCMY-2 (16/22), and to a lesser extend blaSHV-12 (5/22) and blaCTX-M-8 (1/22). Other plasmid families associated with ESBL/AmpC-genes were IncK (4/33), IncHI2 (3/33), IncA/C (2/33), IncΒ/O (1/33) and a non-typeable replicon (1/33). Subtyping of IncI1 and IncHI2 demonstrated IncI1/ST12 was predominantly associated with blaCMY-2 (12/16) and IncHI2/ST7 with blaCTX-M-2 (2/3). Finally, 31 different STs were detected among the 39 selected isolates. Resistance to extended spectrum cephalosporins in E. coli from Colombian poultry is mainly caused by blaCMY-2 and blaSHV-12. The high diversity of strain Sequence Types and the dissemination of homogeneous IncI1/ST12 plasmids suggest that spread of the resistance is mainly mediated by horizontal gene transfer.

  2. Love Acoustic Wave-Based Devices and Molecularly-Imprinted Polymers as Versatile Sensors for Electronic Nose or Tongue for Cancer Monitoring

    PubMed Central

    Dejous, Corinne; Hallil, Hamida; Raimbault, Vincent; Lachaud, Jean-Luc; Plano, Bernard; Delépée, Raphaël; Favetta, Patrick; Agrofoglio, Luigi; Rebière, Dominique

    2016-01-01

    Cancer is a leading cause of death worldwide and actual analytical techniques are restrictive in detecting it. Thus, there is still a challenge, as well as a need, for the development of quantitative non-invasive tools for the diagnosis of cancers and the follow-up care of patients. We introduce first the overall interest of electronic nose or tongue for such application of microsensors arrays with data processing in complex media, either gas (e.g., Volatile Organic Compounds or VOCs as biomarkers in breath) or liquid (e.g., modified nucleosides as urinary biomarkers). Then this is illustrated with a versatile acoustic wave transducer, functionalized with molecularly-imprinted polymers (MIP) synthesized for adenosine-5′-monophosphate (AMP) as a model for nucleosides. The device including the thin film coating is described, then static measurements with scanning electron microscopy (SEM) and electrical characterization after each step of the sensitive MIP process (deposit, removal of AMP template, capture of AMP target) demonstrate the thin film functionality. Dynamic measurements with a microfluidic setup and four targets are presented afterwards. They show a sensitivity of 5 Hz·ppm−1 of the non-optimized microsensor for AMP detection, with a specificity of three times compared to PMPA, and almost nil sensitivity to 3′AMP and CMP, in accordance with previously published results on bulk MIP. PMID:27331814

  3. Love Acoustic Wave-Based Devices and Molecularly-Imprinted Polymers as Versatile Sensors for Electronic Nose or Tongue for Cancer Monitoring.

    PubMed

    Dejous, Corinne; Hallil, Hamida; Raimbault, Vincent; Lachaud, Jean-Luc; Plano, Bernard; Delépée, Raphaël; Favetta, Patrick; Agrofoglio, Luigi; Rebière, Dominique

    2016-06-20

    Cancer is a leading cause of death worldwide and actual analytical techniques are restrictive in detecting it. Thus, there is still a challenge, as well as a need, for the development of quantitative non-invasive tools for the diagnosis of cancers and the follow-up care of patients. We introduce first the overall interest of electronic nose or tongue for such application of microsensors arrays with data processing in complex media, either gas (e.g., Volatile Organic Compounds or VOCs as biomarkers in breath) or liquid (e.g., modified nucleosides as urinary biomarkers). Then this is illustrated with a versatile acoustic wave transducer, functionalized with molecularly-imprinted polymers (MIP) synthesized for adenosine-5'-monophosphate (AMP) as a model for nucleosides. The device including the thin film coating is described, then static measurements with scanning electron microscopy (SEM) and electrical characterization after each step of the sensitive MIP process (deposit, removal of AMP template, capture of AMP target) demonstrate the thin film functionality. Dynamic measurements with a microfluidic setup and four targets are presented afterwards. They show a sensitivity of 5 Hz·ppm(-1) of the non-optimized microsensor for AMP detection, with a specificity of three times compared to PMPA, and almost nil sensitivity to 3'AMP and CMP, in accordance with previously published results on bulk MIP.

  4. The influence of dibutyryl adenosine cyclic monophosphate on cell proliferation in the epithelium of the jejunal crypts, the colonic crypts and in colonic carcinomata of rat.

    PubMed

    Tutton, P J; Barkla, D H

    1980-01-01

    1. Cell proliferation in the jejunal crypts, the colonic crypts and in dimethylhydrazine (DMH)-induced adenocarcinomata of rat colon was measured using a stathmokinetic technique. 2. Dibutryl cyclic adneosine monophosphate (dibutyryl cAMP) was found to inhibit cell proliferation in colonic crypts and in colonic adenocarcinomata. 3. Dibutryl cAMP at very high doses was found to inhibit jejunal crypt cell proliferation but at lower doses was found to accelerate jejunal crypt cell proliferation. 4. Neither bilateral adrenalectomy nor chemical sympathectomy was found to abolish the ability of dibutryl cAMP to stimulate jejunal crypt cell proliferation. 5. The present results are difficult to interpret in terms of known hormonal influences on cell proliferation in the tissues examined and of established actions, of these hormones on cyclic nucleotide metabolism in other tissues.

  5. Solubility of Gliclazide and Ion-Molecular Interactions with Aminopropanol in Aqueous Solutions

    NASA Astrophysics Data System (ADS)

    Hamdan, Imad I.; El-Sabawi, Dina; Abu-Dahab, Rana

    2018-01-01

    A new salt of gliclazide (GZD) was prepared and was shown to have a significantly higher aqueous solubility at physiological pH together with superior dissolution profiles in comparison to GZD employing an organic amino-alcohol base. Characterization by NMR, IR, DSC, conductometry and HPLC techniques concluded that an ion pair salt is formed between acidic GZD and basic aminopropanol (AMP). In addition to the presence of about 5% tightly bound water, hydrogen bonds appeared to form extensively between GZD, AMP and water molecules. Unlike many of solubility enhancing approaches, the salt did not hamper the permeability of GZD as shown by transport through Caco-2 cells model. In vivo studies on rats confirmed that the blood glucose lowering effect of GZD-AMP was significantly higher and more rapid compared to parent GZD indicating an enhanced overall performance of the prepared salt.

  6. Comparative effectiveness of light-microscopic techniques and PCR in detecting Thelohania solenopsae (Microsporidia) infections in red imported fire ants (Solenopsis invicta).

    PubMed

    Milks, Maynard L; Sokolova, Yuliya Y; Isakova, Irina A; Fuxa, James R; Mitchell, Forrest; Snowden, Karen F; Vinson, S Bradleigh

    2004-01-01

    The main goal of this study was to compare the effectiveness of three staining techniques (calcofluor white M2R, Giemsa and modified trichrome), and the polymerase chain reaction (PCR) in detecting the microsporidium Thelohania solenopsae in red imported fire ants (Solenopsis invicta). The effect of the number of ants in a sample on the sensitivity of the staining techniques and the PCR, and the effect of three DNA extraction protocols on the sensitivity of PCR were also examined. In the first protocol, the ants were macerated and the crude homogenate was used immediately in the PCR. In the second protocol, the homogenate was placed on a special membrane (FTA card) that traps DNA, which is subsequently used in the PCR. In the third protocol, the DNA was purified from the homogenate by traditional phenol-chloroform extraction. Except for PCR using FTA cards, the sensitivity (number of samples positive for T. solenopsae) of all detection techniques increased with the number of ants in the sample. Overall, Giemsa was the least sensitive of all detection techniques. Calcofluor was more sensitive than modified trichrome with ants from one site and was equally as sensitive as PCR with crude DNA or a FTA card with ants from both sites. Trichrome staining was equally as sensitive as PCR with a FTA card at both sites, but it was less sensitive than PCR with crude DNA at one site. PCR on FTA cards was less sensitive than PCR with crude DNA for ants from one site but not the other. There was no difference whether crude or phenol-chloroform purified DNA was used as template. In summary, the results of this study show that PCR based on a crude DNA solution is equal to or more sensitive in detecting T. solenopsae than the other detection techniques investigated, and that it can be used as a reliable diagnostic tool for screening field samples of S. invicta for T. solenopsae. Nevertheless, ant smear stained with calcofluor or modified trichrome should be used to buttress findings from PCR.

  7. Resistance Emergence Mechanism and Mechanism of Resistance Suppression by Tobramycin for Cefepime for Pseudomonas aeruginosa

    PubMed Central

    Bonomo, Robert A.; Bahniuk, Nadzeya; Bulitta, Juergen B.; VanScoy, Brian; DeFiglio, Holland; Fikes, Steven; Brown, David; Drawz, Sarah M.; Kulawy, Robert; Louie, Arnold

    2012-01-01

    The panoply of resistance mechanisms in Pseudomonas aeruginosa makes resistance suppression difficult. Defining optimal regimens is critical. Cefepime is a cephalosporin whose 3′ side chain provides some stability against AmpC β-lactamases. We examined the activity of cefepime against P. aeruginosa wild-type strain PAO1 and its isogenic AmpC stably derepressed mutant in our hollow-fiber infection model. Dose-ranging studies demonstrated complete failure with resistance emergence (both isolates). Inoculum range studies demonstrated ultimate failure for all inocula. Lower inocula failed last (10 days to 2 weeks). Addition of a β-lactamase inhibitor suppressed resistance even with the stably derepressed isolate. Tobramycin combination studies demonstrated resistance suppression in both the wild-type and the stably derepressed isolates. Quantitating the RNA message by quantitative PCR demonstrated that tobramycin decreased the message relative to that in cefepime-alone experiments. Western blotting with AmpC-specific antibody for P. aeruginosa demonstrated decreased expression. We concluded that suppression of β-lactamase expression by tobramycin (a protein synthesis inhibitor) was at least part of the mechanism behind resistance suppression. Monte Carlo simulation demonstrated that a regimen of 2 g of cefepime every 8 h plus 7 mg/kg of body weight of tobramycin daily would provide robust resistance suppression for Pseudomonas isolates with cefepime MIC values up to 8 mg/liter and tobramycin MIC values up to 1 mg/liter. For P. aeruginosa resistance suppression, combination therapy is critical. PMID:22005996

  8. Evaluation of Enterococcus faecalis clinical isolates with 'penicillin-resistant, ampicillin-susceptible' phenotype as reported by Vitek-2 Compact system.

    PubMed

    Tan, Yen Ee; Ng, Lily S Y; Tan, Thean Yen

    2014-10-01

    It has been recently reported that ampicillin susceptibility cannot accurately predict piperacillin and imipenem susceptibilities in penicillin-resistant, ampicillin-susceptible (Pen-R, Amp-S) Enterococcus faecalis isolates, contrary to the current Clinical and Laboratory Standards Institute (CLSI) recommendations. This has important therapeutic implications. Such isolates were noted after the use of Vitek-2 Compact system AST-GP67 susceptibility cards in a Singapore general hospital and they were increasing in numbers. The primary aim of this study was to evaluate these clinical isolates against microbroth dilution (MBD) technique and other commonly used antimicrobial susceptibility test (AST) methods for penicillin and ampicillin. The secondary aim was to evaluate whether ampicillin susceptibility could indeed be a reliable surrogate marker for piperacillin and imipenem susceptibilities in E. faecalis isolates that were confirmed Pen-R, Amp-S.From 2009 to 2013, a total of 49 isolates (5%) of 983 non-duplicate E. faecalis tested by Vitek-2 displayed the 'Pen-R, Amp-S' phenotype in a general hospital in Singapore. These were tested against MBD which was the reference method, Etest and disc diffusion for penicillin and ampicillin. Susceptibilities to piperacillin and imipenem were also tested using MBD. In addition, β-lactamase production test was performed. Forty E. faecalis isolates with penicillin-susceptible, ampicillin-susceptible (Pen-S, Amp-S) phenotype were included for comparative purposes.The categorical agreement rate was 100% for all AST methods in ampicillin reporting for the 'Pen-R, Amp-S' group of E. faecalis isolates. However, a large number of isolates (46 isolates, 93.9%) fell into the major error category for penicillin testing by the Vitek-2 system. Penicillin minimum inhibitory concentrations (MICs) generated by the Vitek-2 system for the majority of these isolates were two doubling dilutions higher compared to those obtained by the reference test. The Etest method correlated well with the MBD method. Thirty-two isolates (65.3%) were in categorical agreement with the MBD method when tested by the disc diffusion method for penicillin. Only three E. faecalis isolates (6.1%) were confirmed to have the uncommon penicillin resistance phenotype, with two of them showing resistance to piperacillin and intermediate to imipenem. β-lactamase production test was negative for all isolates. Among the Pen-S, Amp-S E. faecalis isolates, the categorical agreement was 100% for penicillin and ampicillin in all the tested methods.Enterococcus faecalis with 'Pen-R, Amp-S' phenotype reported by the Vitek-2 system using AST-GP67 susceptibility cards must be confirmed with a reference test, the Etest method being a good alternative. The Vitek-2 system generated higher penicillin MIC readings compared to MBD in this study. The actual prevalence of this uncommon penicillin resistance phenotype in E. faecalis was found to be low in this institution. More studies are required to confirm the reliability of ampicillin as a surrogate marker for piperacillin and imipenem susceptibilities in these isolates.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Salud, J.; Lopez, D.O.; Barrio, M.

    The experimental two-component phase diagram between the orientationally disordered crystals 2-amino-2-methyl-1,3-propanediol (AMP) and 1,1,1-tris(hydroxymethyl)propane (PG) has been established from room temperature to the liquid state using thermal analysis and X-ray powder diffraction techniques. The intermolecular interactions in the orientationally disordered mixed crystals of the mentioned system and other related two-component systems are discussed by analyzing the evolution of the packing coefficient as a function of the composition. A thermodynamic analysis of the presented phase diagram and the redetermined AMP/NPG (2,2-dimethyl-1,3-propanediol) is reported on the basis of the enthalpy-entropy compensation theory.

  10. Automated extraction of DNA from blood and PCR setup using a Tecan Freedom EVO liquid handler for forensic genetic STR typing of reference samples.

    PubMed

    Stangegaard, Michael; Frøslev, Tobias G; Frank-Hansen, Rune; Hansen, Anders J; Morling, Niels

    2011-04-01

    We have implemented and validated automated protocols for DNA extraction and PCR setup using a Tecan Freedom EVO liquid handler mounted with the Te-MagS magnetic separation device (Tecan, Männedorf, Switzerland). The protocols were validated for accredited forensic genetic work according to ISO 17025 using the Qiagen MagAttract DNA Mini M48 kit (Qiagen GmbH, Hilden, Germany) from fresh whole blood and blood from deceased individuals. The workflow was simplified by returning the DNA extracts to the original tubes minimizing the risk of misplacing samples. The tubes that originally contained the samples were washed with MilliQ water before the return of the DNA extracts. The PCR was setup in 96-well microtiter plates. The methods were validated for the kits: AmpFℓSTR Identifiler, SGM Plus and Yfiler (Applied Biosystems, Foster City, CA), GenePrint FFFL and PowerPlex Y (Promega, Madison, WI). The automated protocols allowed for extraction and addition of PCR master mix of 96 samples within 3.5h. In conclusion, we demonstrated that (1) DNA extraction with magnetic beads and (2) PCR setup for accredited, forensic genetic short tandem repeat typing can be implemented on a simple automated liquid handler leading to the reduction of manual work, and increased quality and throughput. Copyright © 2011 Society for Laboratory Automation and Screening. Published by Elsevier Inc. All rights reserved.

  11. Allele frequency data of 15 autosomal STR loci in four major population groups of South Africa.

    PubMed

    Lucassen, Anton; Ehlers, Karen; Grobler, Paul J; Shezi, Adeline L

    2014-03-01

    Allele frequency distributions for 15 tetrameric short tandem repeat (STR) loci were determined using the AmpFlSTR® Identifiler Plus™ PCR amplification kit. There was little evidence of departures from Hardy-Weinberg equilibrium or association of alleles of different loci in the population samples. The probability of identity values for the different populations range from 1/3.3 × 10(17) (White) to 1/1.88 × 10(18) (Coloured). The combined probability of paternal exclusion for the different population groups ranges from 0.9995858 (Coloured) to 0.9997874 (Indian).

  12. Optimization of a cAMP response element signal pathway reporter system.

    PubMed

    Shan, Qiang; Storm, Daniel R

    2010-08-15

    A sensitive cAMP response element (CRE) reporter system is essential for studying the cAMP/protein kinase A/cAMP response element binding protein signal pathway. Here we have tested a few CRE promoters and found one with high sensitivity to external stimuli. Using this optimal CRE promoter and the enhanced green fluorescent protein as the reporter, we have established a CRE reporter cell line. This cell line can be used to study the signal pathway by fluorescent microscope, fluorescence-activated cell analysis and luciferase assay. This cell line's sensitivity to forskolin, using the technique of fluorescence-activated cell sorting, was increased to approximately seven times that of its parental HEK 293 cell line, which is currently the most commonly used cell line in the field for the signal pathway study. Therefore, this newly created cell line is potentially useful for studying the signal pathway's modulators, which generally have weaker effect than its mediators. Our research has also established a general procedure for optimizing transcription-based reporter cell lines, which might be useful in performing the same task when studying many other transcription-based signal pathways. (c) 2010 Elsevier B.V. All rights reserved.

  13. In Vivo, In Vitro, and In Silico Characterization of Peptoids as Antimicrobial Agents

    PubMed Central

    Fjell, Christopher D.; Waldbrook, Matt; Chongsiriwatana, Nathaniel P.; Yuen, Eddie; Hancock, Robert E. W.; Barron, Annelise E.

    2016-01-01

    Bacterial resistance to conventional antibiotics is a global threat that has spurred the development of antimicrobial peptides (AMPs) and their mimetics as novel anti-infective agents. While the bioavailability of AMPs is often reduced due to protease activity, the non-natural structure of AMP mimetics renders them robust to proteolytic degradation, thus offering a distinct advantage for their clinical application. We explore the therapeutic potential of N-substituted glycines, or peptoids, as AMP mimics using a multi-faceted approach that includes in silico, in vitro, and in vivo techniques. We report a new QSAR model that we developed based on 27 diverse peptoid sequences, which accurately correlates antimicrobial peptoid structure with antimicrobial activity. We have identified a number of peptoids that have potent, broad-spectrum in vitro activity against multi-drug resistant bacterial strains. Lastly, using a murine model of invasive S. aureus infection, we demonstrate that one of the best candidate peptoids at 4 mg/kg significantly reduces with a two-log order the bacterial counts compared with saline-treated controls. Taken together, our results demonstrate the promising therapeutic potential of peptoids as antimicrobial agents. PMID:26849681

  14. Development of real-time PCR technique for the estimation of population density of Pythium intermedium in forest soils.

    PubMed

    Li, Mingzhu; Senda, Masako; Komatsu, Tsutomu; Suga, Haruhisa; Kageyama, Koji

    2010-10-20

    Pythium intermedium is known to play an important role in the carbon cycling of cool-temperate forest soils. In this study, a fast, precise and effective real-time PCR technique for estimating the population densities of P. intermedium from soils was developed using species-specific primers. Specificity was confirmed both with conventional PCR and real-time PCR. The detection limit (sensitivity) was determined and amplification standard curves were generated using SYBR Green II fluorescent dye. A rapid and accurate assay for quantification of P. intermedium in Takayama forest soils of Japan was developed using a combination of a new DNA extraction method and PCR primers were developed for real-time PCR. And the distribution of P. intermedium in forest soil was investigated with both soil plating method and the developed real-time PCR technique. This new technique will be a useful tool and can be applied to practical use for studying the role of Pythium species in forest and agricultural ecosystems. Copyright © 2009 Elsevier GmbH. All rights reserved.

  15. Antimicrobial Peptides in Biomedical Device Manufacturing.

    PubMed

    Riool, Martijn; de Breij, Anna; Drijfhout, Jan W; Nibbering, Peter H; Zaat, Sebastian A J

    2017-01-01

    Over the past decades the use of medical devices, such as catheters, artificial heart valves, prosthetic joints, and other implants, has grown significantly. Despite continuous improvements in device design, surgical procedures, and wound care, biomaterial-associated infections (BAI) are still a major problem in modern medicine. Conventional antibiotic treatment often fails due to the low levels of antibiotic at the site of infection. The presence of biofilms on the biomaterial and/or the multidrug-resistant phenotype of the bacteria further impair the efficacy of antibiotic treatment. Removal of the biomaterial is then the last option to control the infection. Clearly, there is a pressing need for alternative strategies to prevent and treat BAI. Synthetic antimicrobial peptides (AMPs) are considered promising candidates as they are active against a broad spectrum of (antibiotic-resistant) planktonic bacteria and biofilms. Moreover, bacteria are less likely to develop resistance to these rapidly-acting peptides. In this review we highlight the four main strategies, three of which applying AMPs, in biomedical device manufacturing to prevent BAI. The first involves modification of the physicochemical characteristics of the surface of implants. Immobilization of AMPs on surfaces of medical devices with a variety of chemical techniques is essential in the second strategy. The main disadvantage of these two strategies relates to the limited antibacterial effect in the tissue surrounding the implant. This limitation is addressed by the third strategy that releases AMPs from a coating in a controlled fashion. Lastly, AMPs can be integrated in the design and manufacturing of additively manufactured/3D-printed implants, owing to the physicochemical characteristics of the implant material and the versatile manufacturing technologies compatible with antimicrobials incorporation. These novel technologies utilizing AMPs will contribute to development of novel and safe antimicrobial medical devices, reducing complications and associated costs of device infection.

  16. Antimicrobial Peptides in Biomedical Device Manufacturing

    NASA Astrophysics Data System (ADS)

    Riool, Martijn; de Breij, Anna; Drijfhout, Jan W.; Nibbering, Peter H.; Zaat, Sebastian A. J.

    2017-08-01

    Over the past decades the use of medical devices, such as catheters, artificial heart valves, prosthetic joints and other implants, has grown significantly. Despite continuous improvements in device design, surgical procedures and wound care, biomaterial-associated infections (BAI) are still a major problem in modern medicine. Conventional antibiotic treatment often fails due to the low levels of antibiotic at the site of infection. The presence of biofilms on the biomaterial and/or the multidrug-resistant phenotype of the bacteria further impair the efficacy of antibiotic treatment. Removal of the biomaterial is then the last option to control the infection. Clearly, there is a pressing need for alternative strategies to prevent and treat BAI. Synthetic antimicrobial peptides (AMPs) are considered promising candidates as they are active against a broad spectrum of (antibiotic-resistant) planktonic bacteria and biofilms. Moreover, bacteria are less likely to develop resistance to these rapidly-acting peptides. In this review we highlight the four main strategies, three of which applying AMPs, in biomedical device manufacturing to prevent BAI. The first involves modification of the physicochemical characteristics of the surface of implants. Immobilization of AMPs on surfaces of medical devices with a variety of chemical techniques is essential in the second strategy. The main disadvantage of these two strategies relates to the limited antibacterial effect in the tissue surrounding the implant. This limitation is addressed by the third strategy that releases AMPs from a coating in a controlled fashion. Lastly, AMPs can be integrated in the design and manufacturing of additively manufactured / 3D-printed implants, owing to the physicochemical characteristics of the implant material and the versatile manufacturing technologies compatible with antimicrobials incorporation. These novel technologies utilizing AMPs will contribute to development of novel and safe antimicrobial medical devices, reducing complications and associated costs of device infection.

  17. Forensic and population genetic analyses of Danes, Greenlanders and Somalis typed with the Yfiler® Plus PCR amplification kit.

    PubMed

    Olofsson, Jill Katharina; Mogensen, Helle Smidt; Buchard, Anders; Børsting, Claus; Morling, Niels

    2015-05-01

    Recently, the Yfiler® Plus PCR Amplification Kit (Yfiler® Plus, Thermo Fisher Scientific, Waltham, MA, USA) was introduced. Yfiler® Plus amplifies 27 Y-chromosomal short tandem repeat loci (Y-STRs) and adds ten new Y-STRs to those analysed with the commonly used AmpFlSTR® Yfiler® PCR Amplification Kit (Yfiler®, Thermo Fisher Scientific, Waltham, MA, USA). Seven of the new Y-STRs are rapidly mutating Y-STRs (RM Y-STRs). In this study, 551 male individuals from Denmark, Greenland and Somalia were typed with Yfiler® Plus. The results were compared to those obtained with Yfiler® in the same individuals. Forensic and population genetic parameters were estimated for Yfiler® Plus. Yfiler® Plus had a higher power of discrimination than Yfiler® in all three populations. Compared to Yfiler®, Yfiler® Plus offers increased power of discrimination, which is obviously an advantage in crime case investigations. However, the inclusion of seven RM Y-STRs in Yfiler® Plus makes it less attractive for relationship testing because of the relatively high combined mutation rate, approximately 15%. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  18. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID:25611823

  19. The Identification of Novel Protein-Protein Interactions in Liver that Affect Glucagon Receptor Activity

    PubMed Central

    Froese, Sean; Dai, Feihan F.; Robitaille, Mélanie; Bhattacharjee, Alpana; Huang, Xinyi; Jia, Weiping; Angers, Stéphane; Wheeler, Michael B.; Wei, Li

    2015-01-01

    Glucagon regulates glucose homeostasis by controlling glycogenolysis and gluconeogenesis in the liver. Exaggerated and dysregulated glucagon secretion can exacerbate hyperglycemia contributing to type 2 diabetes (T2D). Thus, it is important to understand how glucagon receptor (GCGR) activity and signaling is controlled in hepatocytes. To better understand this, we sought to identify proteins that interact with the GCGR to affect ligand-dependent receptor activation. A Flag-tagged human GCGR was recombinantly expressed in Chinese hamster ovary (CHO) cells, and GCGR complexes were isolated by affinity purification (AP). Complexes were then analyzed by mass spectrometry (MS), and protein-GCGR interactions were validated by co-immunoprecipitation (Co-IP) and Western blot. This was followed by studies in primary hepatocytes to assess the effects of each interactor on glucagon-dependent glucose production and intracellular cAMP accumulation, and then in immortalized CHO and liver cell lines to further examine cell signaling. Thirty-three unique interactors were identified from the AP-MS screening of GCGR expressing CHO cells in both glucagon liganded and unliganded states. These studies revealed a particularly robust interaction between GCGR and 5 proteins, further validated by Co-IP, Western blot and qPCR. Overexpression of selected interactors in mouse hepatocytes indicated that two interactors, LDLR and TMED2, significantly enhanced glucagon-stimulated glucose production, while YWHAB inhibited glucose production. This was mirrored with glucagon-stimulated cAMP production, with LDLR and TMED2 enhancing and YWHAB inhibiting cAMP accumulation. To further link these interactors to glucose production, key gluconeogenic genes were assessed. Both LDLR and TMED2 stimulated while YWHAB inhibited PEPCK and G6Pase gene expression. In the present study, we have probed the GCGR interactome and found three novel GCGR interactors that control glucagon-stimulated glucose production by modulating cAMP accumulation and genes that control gluconeogenesis. These interactors may be useful targets to control glucose homeostasis in T2D. PMID:26075596

  20. Extended-Spectrum β-lactam Resistance in the Enteric Flora of Patients at a Tertiary Care Medical Centre.

    PubMed

    Landers, T F; Mollenkopf, D F; Faubel, R L; Dent, A; Pancholi, P; Daniels, J B; Wittum, T E

    2017-03-01

    The dissemination of Enterobacteriaceae expressing resistance to extended-spectrum cephalosporins, which are therapeutically used in both human and veterinary medicine, is of critical concern. The normal commensal flora of food animals may serve as an important reservoir for the zoonotic food-borne transmission of Enterobacteriaceae harbouring β-lactam resistance. We hypothesized that the predominant AmpC and ESBL genes reported in US livestock and fresh retail meat products, bla CMY -2 and bla CTX -M , would also be predominant in human enteric flora. We recovered enteric flora from a convenience sample of patients included in a large tertiary medical centre's Clostridium difficile surveillance programme to screen for and estimate the frequency of carriage of AmpC and ESBL resistance genes. In- and outpatient diarrhoeic submissions (n = 692) received for C. difficile testing at the medical centre's clinical diagnostic laboratory from July to December, 2013, were included. Aliquoted to a transport swab, each submission was inoculated to MacConkey broth with cefotaxime, incubated at 37°C and then inoculated to MacConkey agars supplemented with cefoxitin and cefepime to select for the AmpC and ESBL phenotypes, with bla CMY and bla CTX -M genotypes confirmed by PCR and sequencing. From the 692 diarrhoeic submissions, our selective culture yielded 184 isolates (26.6%) with reduced susceptibility to cefotaxime. Of these, 46 (6.7%) samples harboured commensal isolates carrying the AmpC bla CMY . Another 21 (3.0%) samples produced isolates harbouring the ESBL bla CTX -M : 19 carrying CTX-M-15 and 2 with CTX-M-27. Our results indicate that β-lactam resistance genes likely acquired through zoonotic food-borne transmission are present in the enteric flora of this hospital-associated population at lower levels than reported in livestock and fresh food products. © 2016 Blackwell Verlag GmbH.

  1. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  2. Viability PCR, a Culture-Independent Method for Rapid and Selective Quantification of Viable Legionella pneumophila Cells in Environmental Water Samples▿

    PubMed Central

    Delgado-Viscogliosi, Pilar; Solignac, Lydie; Delattre, Jean-Marie

    2009-01-01

    PCR-based methods have been developed to rapidly screen for Legionella pneumophila in water as an alternative to time-consuming culture techniques. However, these methods fail to discriminate between live and dead bacteria. Here, we report a viability assay (viability PCR [v-PCR]) for L. pneumophila that combines ethidium monoazide bromide with quantitative real-time PCR (qPCR). The ability of v-PCR to differentiate viable from nonviable L. pneumophila cells was confirmed with permeabilizing agents, toluene, or isopropanol. v-PCR suppressed more than 99.9% of the L. pneumophila PCR signal in nonviable cultures and was able to discriminate viable cells in mixed samples. A wide range of physiological states, from culturable to dead cells, was observed with 64 domestic hot-water samples after simultaneous quantification of L. pneumophila cells by v-PCR, conventional qPCR, and culture methods. v-PCR counts were equal to or higher than those obtained by culture and lower than or equal to conventional qPCR counts. v-PCR was used to successfully monitor in vitro the disinfection efficacy of heating to 70°C and glutaraldehyde and chlorine curative treatments. The v-PCR method appears to be a promising and rapid technique for enumerating L. pneumophila bacteria in water and, in comparison with conventional qPCR techniques used to monitor Legionella, has the advantage of selectively amplifying only viable cells. PMID:19363080

  3. Detection of DNA double-strand breaks and chromosome translocations using ligation-mediated PCR and inverse PCR.

    PubMed

    Villalobos, Michael J; Betti, Christopher J; Vaughan, Andrew T M

    2006-01-01

    Current techniques for examining the global creation and repair of DNA double-strand breaks are restricted in their sensitivity, and such techniques mask any site-dependent variations in breakage and repair rate or fidelity. We present here a system for analyzing the fate of documented DNA breaks, using the MLL gene as an example, through application of ligation-mediated PCR. Here, a simple asymmetric double-stranded DNA adapter molecule is ligated to experimentally induced DNA breaks and subjected to seminested PCR using adapter and gene-specific primers. The rate of appearance and loss of specific PCR products allows detection of both the break and its repair. Using the additional technique of inverse PCR, the presence of misrepaired products (translocations) can be detected at the same site, providing information on the fidelity of the ligation reaction in intact cells. Such techniques may be adapted for the analysis of DNA breaks introduced into any identifiable genomic location.

  4. Short tandem repeat analysis in Japanese population.

    PubMed

    Hashiyada, M

    2000-01-01

    Short tandem repeats (STRs), known as microsatellites, are one of the most informative genetic markers for characterizing biological materials. Because of the relatively small size of STR alleles (generally 100-350 nucleotides), amplification by polymerase chain reaction (PCR) is relatively easy, affording a high sensitivity of detection. In addition, STR loci can be amplified simultaneously in a multiplex PCR. Thus, substantial information can be obtained in a single analysis with the benefits of using less template DNA, reducing labor, and reducing the contamination. We investigated 14 STR loci in a Japanese population living in Sendai by three multiplex PCR kits, GenePrint PowerPlex 1.1 and 2.2. Fluorescent STR System (Promega, Madison, WI, USA) and AmpF/STR Profiler (Perkin-Elmer, Norwalk, CT, USA). Genomic DNA was extracted using sodium dodecyl sulfate (SDS) proteinase K or Chelex 100 treatment followed by the phenol/chloroform extraction. PCR was performed according to the manufacturer's protocols. Electrophoresis was carried out on an ABI 377 sequencer and the alleles were determined by GeneScan 2.0.2 software (Perkin-Elmer). In 14 STRs loci, statistical parameters indicated a relatively high rate, and no significant deviation from Hardy-Weinberg equilibrium was detected. We apply this STR system to paternity testing and forensic casework, e.g., personal identification in rape cases. This system is an effective tool in the forensic sciences to obtain information on individual identification.

  5. Comparison of PCR-Electrospray Ionization Mass Spectrometry with 16S rRNA PCR and Amplicon Sequencing for Detection of Bacteria in Excised Heart Valves

    PubMed Central

    Peeters, Bart; Herijgers, Paul; Beuselinck, Kurt; Peetermans, Willy E.; Herregods, Marie-Christin

    2016-01-01

    Identification of the causative pathogen of infective endocarditis (IE) is crucial for adequate management and therapy. A broad-range PCR-electrospray ionization mass spectrometry (PCR-ESI-MS) technique was compared with broad-spectrum 16S rRNA PCR and amplicon sequencing (16S rRNA PCR) for the detection of bacterial pathogens in 40 heart valves obtained from 34 definite infective endocarditis patients according to the modified Duke criteria and six nonendocarditis patients. Concordance between the two molecular techniques was 98% for being positive or negative, 97% for concordant identification up to the genus level, and 77% for concordant identification up to the species level. Sensitivity for detecting the causative pathogen (up to the genus level) in excised heart valves was 88% for 16S rRNA PCR and 85% for PCR-ESI-MS; the specificity was 83% for both methods. The two molecular techniques were significantly more sensitive than valve culture (18%) and accurately identified bacteria in excised heart valves. In eight patients with culture-negative IE, the following results were obtained: concordant detection of Coxiella burnetii (n = 2), Streptococcus gallolyticus (n = 1), Propionibacterium acnes (n = 1), and viridans group streptococci (n = 1) by both molecular tests, detection of P. acnes by PCR-ESI-MS whereas the 16S rRNA PCR was negative (n = 1), and a false-negative result by both molecular techniques (n = 2). In one case of IE caused by viridans streptococci, PCR-ESI-MS was positive for Enterococcus spp. The advantages of PCR-ESI-MS compared to 16S rRNA PCR are its automated workflow and shorter turnaround times. PMID:27629895

  6. Shaker-related voltage-gated K+ channel expression and vasomotor function in human coronary resistance arteries.

    PubMed

    Nishijima, Yoshinori; Korishettar, Ankush; Chabowski, Dawid S; Cao, Sheng; Zheng, Xiaodong; Gutterman, David D; Zhang, David X

    2018-01-01

    K V channels are important regulators of vascular tone, but the identity of specific K V channels involved and their regulation in disease remain less well understood. We determined the expression of K V 1 channel subunits and their role in cAMP-mediated dilation in coronary resistance arteries from subjects with and without CAD. HCAs from patients with and without CAD were assessed for mRNA and protein expression of K V 1 channel subunits with molecular techniques and for vasodilator response with isolated arterial myography. Assays of mRNA transcripts, membrane protein expression, and vascular cell-specific localization revealed abundant expression of K V 1.5 in vascular smooth muscle cells of non-CAD HCAs. Isoproterenol and forskolin, two distinct cAMP-mediated vasodilators, induced potent dilation of non-CAD arterioles, which was inhibited by both the general K V blocker 4-AP and the selective K V 1.5 blocker DPO-1. The cAMP-mediated dilation was reduced in CAD and was accompanied by a loss of or reduced contribution of 4-AP-sensitive K V channels. K V 1.5, as a major 4-AP-sensitive K V 1 channel expressed in coronary VSMCs, mediates cAMP-mediated dilation in non-CAD arterioles. The cAMP-mediated dilation is reduced in CAD coronary arterioles, which is associated with impaired 4-AP-sensitive K V channel function. © 2017 John Wiley & Sons Ltd.

  7. Antimicrobial activity of a 48-kDa protease (AMP48) from Artocarpus heterophyllus latex.

    PubMed

    Siritapetawee, J; Thammasirirak, S; Samosornsuk, W

    2012-01-01

    Artocarpus heterophyllus (jackfruit) is a latex producing plant. Plant latex is produced from secretory cells and contains many intergradients. It also has been used in folk medicine. This study aimed to purify and characterize the biological activities of a protease from jackfruit latex. A protease was isolated and purified from crude latex of a jackfruit tree by acid precipitation and ion exchange chromatography. The proteolytic activities of protein were tested using gelatin- and casein-zymography. The molecular weight and isoelectric point (pl) of protein were analysed by SDS/12.5% PAGE and 2D-PAGE, respectively. Antimicrobial activity of protein was analysed by broth microdilution method. In addition, the antibacterial activity of protein against Pseudomonas aeruginosa ATCC 27853 was observed and measured using atomic force microscopy (AFM) technique. The purified protein contained protease activity by digesting gelatin- and casein-substrates. The protease was designated as antimicrobial protease-48 kDa or AMP48 due to its molecular mass on SDS-PAGE was approximately 48 kDa. The isoelectric point (pl) of AMP48 was approximately 4.2. In addition, AMP48 contained antimicrobial activities by it could inhibit the growths of Pseudomonas aeruginosa ATCC 27853 and clinical isolated Candida albicans at minimum inhibitory concentration (MIC) 2.2 mg/ml and Minimum microbicidal concentration (MMC) 8.8 mg/ml. AFM image also supported the antimicrobial activities of AMP48 by the treated bacterial morphology and size were altered from normal.

  8. Electrophysiological differences in the processing of affect misattribution.

    PubMed

    Hashimoto, Yohei; Minami, Tetsuto; Nakauchi, Shigeki

    2012-01-01

    The affect misattribution procedure (AMP) was proposed as a technique to measure an implicit attitude to a prime image [1]. In the AMP, neutral symbols (e.g., a Chinese pictograph, called the target) are presented, following an emotional stimulus (known as the prime). Participants often misattribute the positive or negative affect of the priming images to the targets in spite of receiving an instruction to ignore the primes. The AMP effect has been investigated using behavioral measures; however, it is difficult to identify when the AMP effect occurs in emotional processing-whether the effect may occur in the earlier attention allocation stage or in the later evaluation stage. In this study, we examined the neural correlates of affect misattribution, using event-related potential (ERP) dividing the participants into two groups based on their tendency toward affect misattribution. The ERP results showed that the amplitude of P2 was larger for the prime at the parietal location in participants showing a low tendency to misattribution than for those showing a high tendency, while the effect of judging neutral targets amiss according to the primes was reflected in the late processing of targets (LPP). In addition, the topographic pattern analysis revealed that EPN-like component to targets was correlated with the difference of AMP tendency as well as P2 to primes and LPP to targets. Taken together, the mechanism of the affective misattribution was closely related to the attention allocation processing. Our findings provide neural evidence that evaluations of neutral targets are misattributed to emotional primes.

  9. The growth hormone-releasing hormone (GHRH) antagonist JV-1-36 inhibits proliferation and survival of human ectopic endometriotic stromal cells (ESCs) and the T HESC cell line.

    PubMed

    Annunziata, Marta; Grande, Cristina; Scarlatti, Francesca; Deltetto, Francesco; Delpiano, Elena; Camanni, Marco; Ghigo, Ezio; Granata, Riccarda

    2010-08-01

    To determine the effect of the GHRH antagonist JV-1-36 on proliferation and survival of primary ectopic human endometriotic stromal cells (ESCs) and the T HESC cell line. Prospective laboratory study. University hospital. 22 women with endometriosis (aged 34.8+/-5.7 years) undergoing therapeutic laparoscopy. Eutopic (n=10) and ectopic (n=22) endometrial tissues were collected from women who underwent therapeutic laparoscopic surgery for endometriosis (stage III/IV). Expression of GHRH, GHRH receptor (GHRH-R) and GHRH-R splice variant (SV) 1 mRNA was determined by reverse-transcription polymerase chain reaction (RT-PCR). The ESC proliferation was assessed by 5-bromo-2-deoxyuridine incorporation, cell survival by 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (MTT) and Trypan blue assay. The T HESC survival was evaluated by MTT, cyclic adenosine monophosphate (cAMP) levels by ELISA, extracellular signal-regulated kinases 1 and 2 (ERK1/2) phosphorylation by Western blot, and insulin-like growth factor (IGF)-2 mRNA by real-time PCR. The ESCs and T HESCs, but not normal endometrial tissues, expressed GHRH-R mRNA; SV1 mRNA was determined in normal endometrial tissues, ESCs, and T HESCs; GHRH mRNAwas found in T HESCs; JV-1-36 inhibited ESC proliferation and ESC and T HESC survival. In T HESCs, JV-1-36 reduced cAMP production and ERK1/2 phosphorylation but had no effect on IGF-2 mRNA expression. The GHRH antagonist JV-1-36 inhibits endometriotic cell proliferation and survival, suggesting that GHRH antagonist may represent promising tools for treatment of endometriosis. Copyright (c) 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  10. Antimicrobial peptides and pro-inflammatory cytokines are differentially regulated across epidermal layers following bacterial stimuli.

    PubMed

    Percoco, Giuseppe; Merle, Chloé; Jaouen, Thomas; Ramdani, Yasmina; Bénard, Magalie; Hillion, Mélanie; Mijouin, Lily; Lati, Elian; Feuilloley, Marc; Lefeuvre, Luc; Driouich, Azeddine; Follet-Gueye, Marie-Laure

    2013-12-01

    The skin is a natural barrier between the body and the environment and is colonised by a large number of microorganisms. Here, we report a complete analysis of the response of human skin explants to microbial stimuli. Using this ex vivo model, we analysed at both the gene and protein level the response of epidermal cells to Staphylococcus epidermidis (S. epidermidis) and Pseudomonas fluorescens (P. fluorescens), which are present in the cutaneous microbiota. We showed that both bacterial species affect the structure of skin explants without penetrating the living epidermis. We showed by real-time quantitative polymerase chain reaction (qPCR) that S. epidermidis and P. fluorescens increased the levels of transcripts that encode antimicrobial peptides (AMPs), including human β defensin (hBD)2 and hBD3, and the pro-inflammatory cytokines interleukin (IL)-1α and (IL)-1-β, as well as IL-6. In addition, we analysed the effects of bacterial stimuli on the expression profiles of genes related to innate immunity and the inflammatory response across the epidermal layers, using laser capture microdissection (LCM) coupled to qPCR. We showed that AMP transcripts were principally upregulated in suprabasal keratinocytes. Conversely, the expression of pro-inflammatory cytokines was upregulated in the lower epidermis. These findings were confirmed by protein localisation using specific antibodies coupled to optical or electron microscopy. This work underscores the potential value of further studies that use LCM on human skin explants model to study the roles and effects of the epidermal microbiota on human skin physiology. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Effects of oral eicosapentaenoic acid versus docosahexaenoic acid on human peripheral blood mononuclear cell gene expression.

    PubMed

    Tsunoda, Fumiyoshi; Lamon-Fava, Stefania; Asztalos, Bela F; Iyer, Lakshmanan K; Richardson, Kris; Schaefer, Ernst J

    2015-08-01

    Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have beneficial effects on inflammation and cardiovascular disease (CVD). Our aim was to assess the effect of a six-week supplementation with either olive oil, EPA, or DHA on gene expression in peripheral blood mononuclear cells (PBMC). Subjects were sampled at baseline and six weeks after receiving either: olive oil 6.0 g/day (n = 16), EPA 1.8 g/day (n = 16), or DHA 1.8 g/day (n = 18). PBMC were subjected to gene expression analysis by microarray with key findings confirmed by quantitative real-time polymerase chain reaction (Q-PCR). Plasma phospholipid EPA increased 3 fold in the EPA group, and DHA increased 63% in the DHA group (both p < 0.01), while no effects were observed in the olive oil group. Microarray analysis indicated that EPA but not DHA or olive oil significantly affected the gene expression in the following pathways: 1) interferon signaling, 2) receptor recognition of bacteria and viruses, 3) G protein signaling, glycolysis and glycolytic shunting, 4) S-adenosyl-l-methionine biosynthesis, and 5) cAMP-mediated signaling including cAMP responsive element protein 1 (CREB1), as well as many other individual genes including hypoxia inducible factor 1, α subunit (HIF1A). The findings for CREB1 and HIF1A were confirmed by Q-PCR analysis. Our data indicate that EPA supplementation was associated with significant effects on gene expression involving the interferon pathway as well as down-regulation of CREB1 and HIF1A, which may relate to its beneficial effect on CVD risk reduction. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  12. Molecular and pharmacological evidence for MT1 melatonin receptor subtype in the tail artery of juvenile Wistar rats

    PubMed Central

    Ting, K N; Blaylock, N A; Sugden, D; Delagrange, P; Scalbert, E; Wilson, V G

    1999-01-01

    In this study reverse transcriptase-polymerase chain reaction (RT–PCR) has been used to identify mt1 and MT2 receptor mRNA expression in the rat tail artery. The contributions of both receptors to the functional response to melatonin were examined with the putative selective MT2 receptor antagonists, 4-phenyl-2-propionamidotetraline (4-P-PDOT) and 2-benzyl-N-pentanoyltryptamine. In addition, the action of melatonin on the second messenger cyclic AMP was investigated.Using RT–PCR, mt1 receptor mRNA was detected in the tail artery from seven rats. In contrast MT2 receptor mRNA was not detected even after nested PCR.At low concentrations of the MT2 selective ligands, neither 10 nM 4-P-PDOT (pEC50=8.70±0.31 (control) vs 8.73±0.16, n=6) nor 60 nM 2-benzyl-N-pentanoyltryptamine (pEC50=8.53±0.20 (control) vs 8.83±0.38, n=6) significantly altered the potency of melatonin in the rat tail artery.At concentrations non-selective for mt1 and MT2 receptors, 4-P-PDOT (3 μM) and 2-benzyl-N-pentanoyltryptamine (5 μM) caused a significant rightward displacement of the vasoconstrictor effect of melatonin. In the case of 4-P-PDOT, the estimated pKB (6.17±0.16, n=8) is similar to the binding affinity for mt1 receptor.Pre-incubation with 1 μM melatonin did not affect the conversion of [3H]-adenine to [3H]-cyclic AMP under basal condition (0.95±0.19% conversion (control) vs 0.92±0.19%, n=4) or following exposure to 30 μM forskolin (5.20±1.30% conversion (control) vs 5.35±0.90%, n=4).Based on the above findings, we conclude that melatonin receptor on the tail artery belongs to the MT1 receptor subtype, and that this receptor is probably independent of the adenylyl cyclase pathway. PMID:10433507

  13. Discrimination of SHV β-Lactamase Genes by Restriction Site Insertion-PCR

    PubMed Central

    Chanawong, Aroonwadee; M'Zali, Fatima Hannachi; Heritage, John; Lulitanond, Aroonlug; Hawkey, Peter Michael

    2001-01-01

    Restriction site insertion-PCR (RSI-PCR) is a simple, rapid technique for detection of point mutations. This technique exploits primers with one to three base mismatches near the 3′ end to modulate a restriction site. We have developed this technique to identify described mutations of the blaSHV genes for differentiation of SHV variants that cannot be distinguished easily by other techniques. To validate this method, eight standard strains were used, each producing a different SHV β-lactamase: SHV-1, SHV-2, SHV-3, SHV-4, SHV-5, SHV-6, SHV-8, and SHV-18. Mismatch primers were designed to detect mutations affecting amino acids at positions 8 (SspI), 179 (HinfI), 205 (PstI), 238 (Gly→Ala) (BsrI), and 240 (NruI) of blaSHV genes. All amplimers of the blaSHV genes used in this study yielded the predicted restriction endonuclease digestion products. In addition, this study also makes theoretical identification of blaSHV-6, blaSHV-8, and 12 novel blaSHV variants using the PCR-restriction fragment length polymorphism (RFLP) technique possible. By using a combination of PCR-RFLP and RSI-PCR techniques, up to 27 SHV variants can now be distinguished rapidly and reliably. These simple techniques are readily applied to epidemiological studies of the SHV β-lactamases and may be extended to the characterisation of other resistance determinants. PMID:11408231

  14. Primary adenosine monophosphate (AMP) deaminase deficiency in a hypotonic infant.

    PubMed

    Castro-Gago, Manuel; Gómez-Lado, Carmen; Pérez-Gay, Laura; Eirís-Puñal, Jesús; Martínez, Elena Pintos; García-Consuegra, Inés; Martín, Miguel Angel

    2011-06-01

    The spectrum of the adenosine monophosphate (AMP) deaminase deficiency ranges from asymptomatic carriers to patients who manifest exercise-induced muscle pain, occasionally rhabdomyolysis, and idiopathic hyperCKemia. However, previous to the introduction of molecular techniques, rare cases with congenital weakness and hypotonia have also been reported. We report a 6-month-old girl with the association of congenital muscle weakness and hypotonia, muscle deficiency of adenosine monophosphate deaminase, and the homozygous C to T mutation at nucleotide 34 of the adenosine monophosphate deaminase-1 gene. This observation indicates the possible existence of a primary adenosine monophosphate deaminase deficiency manifested by congenital muscle weakness and hypotonia.

  15. Autonomously managed electrical power systems

    NASA Technical Reports Server (NTRS)

    Callis, Charles P.

    1986-01-01

    The electric power systems for future spacecraft such as the Space Station will necessarily be more sophisticated and will exhibit more nearly autonomous operation than earlier spacecraft. These new power systems will be more reliable and flexible than their predecessors offering greater utility to the users. Automation approaches implemented on various power system breadboards are investigated. These breadboards include the Hubble Space Telescope power system test bed, the Common Module Power Management and Distribution system breadboard, the Autonomusly Managed Power System (AMPS) breadboard, and the 20 kilohertz power system breadboard. Particular attention is given to the AMPS breadboard. Future plans for these breadboards including the employment of artificial intelligence techniques are addressed.

  16. In Vivo Cardiovascular Pharmacology of 2′,3′-cAMP, 2′-AMP, and 3′-AMP in the Rat

    PubMed Central

    Mi, Zaichuan

    2013-01-01

    The naturally occurring purine 2′,3′-cAMP is metabolized in vitro to 2′-AMP and 3′-AMP, which are subsequently metabolized to adenosine. Whether in vivo 2′,3′-cAMP, 2′-AMP, or 3′-AMP are rapidly converted to adenosine and exert rapid effects via adenosine receptors is unknown. To address this question, we compared the cardiovascular and renal effects of 2′,3′-cAMP, 2′-AMP, 3′-AMP, 3′,5′-cAMP, 5′-AMP, and adenosine in vivo in the rat. Purines were infused intravenously while monitoring mean arterial blood pressure (MABP), heart rate (HR), cardiac output, and renal and mesenteric blood flows. Total peripheral (TPR), renal vascular (RVR), and mesenteric vascular (MVR) resistances were calculated. Urine was collected for determination of urine excretion rate [urine volume (UV)]. When sufficient urine was available, the sodium excretion rate (Na+ER) and glomerular filtration rate (GFR) were determined. 2′,3′-cAMP, 2′-AMP, and 3′-AMP dose-dependently and profoundly reduced MABP, HR, TPR, and MVR with efficacy and potency similar to adenosine and 5′-AMP. These effects of 2′,3′-cAMP, 2′-AMP, and 3′-AMP were attenuated by blockade of adenosine receptors with 1,3-dipropyl-8-(p-sulfophenyl)xanthine. 2′,3′-cAMP, 2′-AMP, 3′-AMP, adenosine, and 5′-AMP variably affected RVR, but profoundly (nearly 100%) decreased UV at higher doses. GFR and Na+ER could be measured at the lower doses and were suppressed by 2′,3′-cAMP, 2′-AMP, and 3′-AMP, but not by adenosine or 5′-AMP. 2′,3′-cAMP increased urinary excretion rates of 2′-AMP, 3′-AMP, and adenosine. 3′,5′-cAMP exerted no adverse hemodynamic effects yet increased urinary adenosine as efficiently as 2′,3′-cAMP. Conclusions: In vivo 2′,3′-cAMP is rapidly converted to adenosine. Because both cAMPs increase adenosine in the urinary compartment, these agents may provide unique therapeutic opportunities. PMID:23759508

  17. 2′,3′-cAMP, 3′-AMP, and 2′-AMP inhibit human aortic and coronary vascular smooth muscle cell proliferation via A2B receptors

    PubMed Central

    Ren, Jin; Gillespie, Delbert G.

    2011-01-01

    Rat vascular smooth muscle cells (VSMCs) from renal microvessels metabolize 2′,3′-cAMP to 2′-AMP and 3′-AMP, and these AMPs are converted to adenosine that inhibits microvascular VSMC proliferation via A2B receptors. The goal of this study was to test whether this mechanism also exists in VSMCs from conduit arteries and whether it is similarly expressed in human vs. rat VSMCs. Incubation of rat and human aortic VSMCs with 2′,3′-cAMP concentration-dependently increased levels of 2′-AMP and 3′-AMP in the medium, with a similar absolute increase in 2′-AMP vs. 3′-AMP. In contrast, in human coronary VSMCs, 2′,3′-cAMP increased 2′-AMP levels yet had little effect on 3′-AMP levels. In all cell types, 2′,3′-cAMP increased levels of adenosine, but not 5′-AMP, and 2′,3′-AMP inhibited cell proliferation. Antagonism of A2B receptors (MRS-1754), but not A1 (1,3-dipropyl-8-cyclopentylxanthine), A2A (SCH-58261), or A3 (VUF-5574) receptors, attenuated the antiproliferative effects of 2′,3′-cAMP. In all cell types, 2′-AMP, 3′-AMP, and 5′-AMP increased adenosine levels, and inhibition of ecto-5′-nucleotidase blocked this effect of 5′-AMP but not that of 2′-AMP nor 3′-AMP. Also, 2′-AMP, 3′-AMP, and 5′-AMP, like 2′,3′-cAMP, exerted antiproliferative effects that were abolished by antagonism of A2B receptors with MRS-1754. In conclusion, VSMCs from conduit arteries metabolize 2′,3′-cAMP to AMPs, which are metabolized to adenosine. In rat and human aortic VSMCs, both 2′-AMP and 3′-AMP are involved in this process, whereas, in human coronary VSMCs, 2′,3′-cAMP is mainly converted to 2′-AMP. Because adenosine inhibits VSMC proliferation via A2B receptors, local vascular production of 2′,3′-cAMP may protect conduit arteries from atherosclerosis. PMID:21622827

  18. Inactivation efficiency of plasmid-encoded antibiotic resistance genes during water treatment with chlorine, UV, and UV/H2O2.

    PubMed

    Yoon, Younggun; Chung, Hay Jung; Wen Di, Doris Yoong; Dodd, Michael C; Hur, Hor-Gil; Lee, Yunho

    2017-10-15

    This study assessed the inactivation efficiency of plasmid-encoded antibiotic resistance genes (ARGs) both in extracellular form (e-ARG) and present within Escherichia coli (intracellular form, i-ARG) during water treatment with chlorine, UV (254 nm), and UV/H 2 O 2 . A quantitative real-time PCR (qPCR) method was used to quantify the ARG damage to amp R (850 bp) and kan R (806 bp) amplicons, both of which are located in the pUC4K plasmid. The plate count and flow cytometry methods were also used to determine the bacterial inactivation parameters, such as culturability and membrane damage, respectively. In the first part of the study, the kinetics of E. coli inactivation and ARG damage were determined in phosphate buffered solutions. The ARG damage occurred much more slowly than E. coli inactivation in all cases. To achieve 4-log reduction of ARG concentration at pH 7, the required chlorine exposure and UV fluence were 33-72 (mg × min)/L for chlorine and 50-130 mJ/cm 2 for UV and UV/H 2 O 2 . After increasing pH from 7 to 8, the rates of ARG damage decreased for chlorine, while they did not vary for UV and UV/H 2 O 2 . The i-ARGs mostly showed lower rates of damage compared to the e-ARGs due to the protective roles of cellular components against oxidants and UV. The contribution of OH radicals to i-ARG damage was negligible in UV/H 2 O 2 due to significant OH radical scavenging by cellular components. In all cases, the ARG damage rates were similar for amp R versus kan R , except for the chlorination of e-ARGs, in which the damage to amp R occurred faster than that to kan R . Chlorine and UV dose-dependent ARG inactivation levels determined in a wastewater effluent matrix could be reasonably explained by the kinetic data obtained from the phosphate buffered solutions and the expected oxidant (chlorine and OH radicals) demands by water matrix components. These results can be useful in optimizing chlorine and UV-based disinfection systems to achieve ARG inactivation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Developmental validation of the PowerPlex(®) ESI 16 and PowerPlex(®) ESI 17 Systems: STR multiplexes for the new European standard.

    PubMed

    Tucker, Valerie C; Hopwood, Andrew J; Sprecher, Cynthia J; McLaren, Robert S; Rabbach, Dawn R; Ensenberger, Martin G; Thompson, Jonelle M; Storts, Douglas R

    2011-11-01

    In response to the ENFSI and EDNAP groups' call for new STR multiplexes for Europe, Promega(®) developed a suite of four new DNA profiling kits. This paper describes the developmental validation study performed on the PowerPlex(®) ESI 16 (European Standard Investigator 16) and the PowerPlex(®) ESI 17 Systems. The PowerPlex(®) ESI 16 System combines the 11 loci compatible with the UK National DNA Database(®), contained within the AmpFlSTR(®) SGM Plus(®) PCR Amplification Kit, with five additional loci: D2S441, D10S1248, D22S1045, D1S1656 and D12S391. The multiplex was designed to reduce the amplicon size of the loci found in the AmpFlSTR(®) SGM Plus(®) kit. This design facilitates increased robustness and amplification success for the loci used in the national DNA databases created in many countries, when analyzing degraded DNA samples. The PowerPlex(®) ESI 17 System amplifies the same loci as the PowerPlex(®) ESI 16 System, but with the addition of a primer pair for the SE33 locus. Tests were designed to address the developmental validation guidelines issued by the Scientific Working Group on DNA Analysis Methods (SWGDAM), and those of the DNA Advisory Board (DAB). Samples processed include DNA mixtures, PCR reactions spiked with inhibitors, a sensitivity series, and 306 United Kingdom donor samples to determine concordance with data generated with the AmpFlSTR(®) SGM Plus(®) kit. Allele frequencies from 242 white Caucasian samples collected in the United Kingdom are also presented. The PowerPlex(®) ESI 16 and ESI 17 Systems are robust and sensitive tools, suitable for the analysis of forensic DNA samples. Full profiles were routinely observed with 62.5pg of a fully heterozygous single source DNA template. This high level of sensitivity was found to impact on mixture analyses, where 54-86% of unique minor contributor alleles were routinely observed in a 1:19 mixture ratio. Improved sensitivity combined with the robustness afforded by smaller amplicons has substantially improved the quantity of data obtained from degraded samples, and the improved chemistry confers exceptional tolerance to high levels of laboratory prepared inhibitors. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  20. Gating, modulation and subunit composition of voltage-gated K+ channels in dendritic inhibitory interneurones of rat hippocampus

    PubMed Central

    Lien, Cheng-Chang; Martina, Marco; Schultz, Jobst H; Ehmke, Heimo; Jonas, Peter

    2002-01-01

    GABAergic interneurones are diverse in their morphological and functional properties. Perisomatic inhibitory cells show fast spiking during sustained current injection, whereas dendritic inhibitory cells fire action potentials with lower frequency. We examined functional and molecular properties of K+ channels in interneurones with horizontal dendrites in stratum oriens-alveus (OA) of the hippocampal CA1 region, which mainly comprise somatostatin-positive dendritic inhibitory cells. Voltage-gated K+ currents in nucleated patches isolated from OA interneurones consisted of three major components: a fast delayed rectifier K+ current component that was highly sensitive to external 4-aminopyridine (4-AP) and tetraethylammonium (TEA) (half-maximal inhibitory concentrations < 0.1 mm for both blockers), a slow delayed rectifier K+ current component that was sensitive to high concentrations of TEA, but insensitive to 4-AP, and a rapidly inactivating A-type K+ current component that was blocked by high concentrations of 4-AP, but resistant to TEA. The relative contributions of these components to the macroscopic K+ current were estimated as 57 ± 5, 25 ± 6, and 19 ± 2 %, respectively. Dendrotoxin, a selective blocker of Kv1 channels had only minimal effects on K+ currents in nucleated patches. Coapplication of the membrane-permeant cAMP analogue 8-(4-chlorophenylthio)-adenosine 3′:5′-cyclic monophosphate (cpt-cAMP) and the phosphodiesterase blocker isobutyl-methylxanthine (IBMX) resulted in a selective inhibition of the fast delayed rectifier K+ current component. This inhibition was absent in the presence of the protein kinase A (PKA) inhibitor H-89, implying the involvement of PKA-mediated phosphorylation. Single-cell reverse transcription-polymerase chain reaction (RT-PCR) analysis revealed a high abundance of Kv3.2 mRNA in OA interneurones, whereas the expression level of Kv3.1 mRNA was markedly lower. Similarly, RT-PCR analysis showed a high abundance of Kv4.3 mRNA, whereas Kv4.2 mRNA was undetectable. This suggests that the fast delayed rectifier K+ current and the A-type K+ current component are mediated predominantly by homomeric Kv3.2 and Kv4.3 channels. Selective modulation of Kv3.2 channels in OA interneurones by cAMP is likely to be an important factor regulating the activity of dendritic inhibitory cells in principal neurone-interneurone microcircuits. PMID:11790809

  1. Detection of DNA double-strand breaks and chromosome translocations using ligation-mediated PCR and inverse PCR.

    PubMed

    Singh, Sheetal; Shih, Shyh-Jen; Vaughan, Andrew T M

    2014-01-01

    Current techniques for examining the global creation and repair of DNA double-strand breaks are restricted in their sensitivity, and such techniques mask any site-dependent variations in breakage and repair rate or fidelity. We present here a system for analyzing the fate of documented DNA breaks, using the MLL gene as an example, through application of ligation-mediated PCR. Here, a simple asymmetric double-stranded DNA adapter molecule is ligated to experimentally induced DNA breaks and subjected to seminested PCR using adapter- and gene-specific primers. The rate of appearance and loss of specific PCR products allows detection of both the break and its repair. Using the additional technique of inverse PCR, the presence of misrepaired products (translocations) can be detected at the same site, providing information on the fidelity of the ligation reaction in intact cells. Such techniques may be adapted for the analysis of DNA breaks and rearrangements introduced into any identifiable genomic location. We have also applied parallel sequencing for the high-throughput analysis of inverse PCR products to facilitate the unbiased recording of all rearrangements located at a specific genomic location.

  2. The Gα1-cAMP signaling pathway controls conidiation, development and secondary metabolism in the taxol-producing fungus Pestalotiopsis microspora.

    PubMed

    Yu, Xi; Liu, Heng; Niu, Xueliang; Akhberdi, Oren; Wei, Dongsheng; Wang, Dan; Zhu, Xudong

    2017-10-01

    G-protein-mediated signaling pathways regulate fungal morphogenesis, development and secondary metabolism. In this study, we report a gene, pgα1, that putatively encodes the α-subunit of a group I G protein in Pestalotiopsis microspora NK17, which is known to produce various secondary metabolites, including the antitumor drug taxol and pestalotiollide B (PB). Mutants of pgα1 showed retarded vegetative growth, aging of the mycelium, premature conidiation, deformed conidia, significantly increased melanin production, and a sharp decrease in PB production. The introduction of extra copies of pgα1 led to a different phenotype that was characterized by enhanced production of PB. qRT-PCR revealed that the expression of pks1, which encodes melanin polyketide synthase, an enzyme that is involved in 1, 8-dihydroxynaphthalene (DHN) melanin biosynthesis, was up regulated by 55-fold in the absence of pgα1. Changes in conidiation and PB production in pgα1 mutants were able to be restored by the addition of exogenous cAMP. The deficiencies of PB production and conidiation in Δpgα1 were not able to be rescued by deletion or overexpression of a previously reported histone deacetylase gene (hid1), suggesting that pgα1 is able to override the effect of hid1 on PB production and conidiation. Our results suggested that the G protein-cAMP pathway plays a critical role in vegetative growth as well as in asexual development of P. microspora. Copyright © 2017 Elsevier GmbH. All rights reserved.

  3. Inhibition by salmeterol and cilomilast of fluticasone-enhanced IP-10 release in airway epithelial cells.

    PubMed

    Reddy, P J; Aksoy, Mark O; Yang, Yi; Li, Xiu Xia; Ji, Rong; Kelsen, Steven G

    2008-02-01

    The CXC chemokines, IP-10/CXCL10 and IL-8/CXCL8, play a role in obstructive lung disease by attracting Th1/Tc1 lymphocytes and neutrophils, respectively. Inhaled corticosteroids (ICS) and long acting beta 2-agonists (LABA) are widely used. However, their effect(s) on the release of IP-10 and IL-8 by airway epithelial cells are poorly understood. This study examined the effects of fluticasone, salmeterol, and agents which raise intracellular cAMP (cilomilast and db-cAMP) on the expression of IP-10 and IL-8 protein and mRNA. Studies were performed in cultured human airway epithelial cells during cytokine-stimulated IP-10 and IL-8 release. Cytokine treatment (TNF-alpha, IL-1beta and IFN-gamma) increased IP-10 and IL-8 protein and mRNA levels. Fluticasone (0.1 nM to 1 microM) increased IP-10 but reduced IL-8 protein release without changing IP-10 mRNA levels assessed by real time RT-PCR. The combination of salmeterol (1 micro M) and cilomilast (1-10 mu M) reduced IP-10 but had no effect on IL-8 protein. Salmeterol alone (1 micro M) and db-cAMP alone (1 mM) antagonised the effects of fluticasone on IP-10 but not IL-8 protein. In human airway epithelial cells, inhibition by salmeterol of fluticasone-enhanced IP-10 release may be an important therapeutic effect of the LABA/ICS combination not present when the two drugs are used separately.

  4. Established and potential physiological roles of bicarbonate-sensing soluble adenylyl cyclase (sAC) in aquatic animals

    PubMed Central

    Tresguerres, Martin; Barott, Katie L.; Barron, Megan E.; Roa, Jinae N.

    2014-01-01

    Soluble adenylyl cyclase (sAC) is a recently recognized source of the signaling molecule cyclic AMP (cAMP) that is genetically and biochemically distinct from the classic G-protein-regulated transmembrane adenylyl cyclases (tmACs). Mammalian sAC is distributed throughout the cytoplasm and it may be present in the nucleus and inside mitochondria. sAC activity is directly stimulated by HCO3−, and sAC has been confirmed to be a HCO3− sensor in a variety of mammalian cell types. In addition, sAC can functionally associate with carbonic anhydrases to act as a de facto sensor of pH and CO2. The two catalytic domains of sAC are related to HCO3−-regulated adenylyl cyclases from cyanobacteria, suggesting the cAMP pathway is an evolutionarily conserved mechanism for sensing CO2 levels and/or acid/base conditions. Reports of sAC in aquatic animals are still limited but are rapidly accumulating. In shark gills, sAC senses blood alkalosis and triggers compensatory H+ absorption. In the intestine of bony fishes, sAC modulates NaCl and water absorption. And in sea urchin sperm, sAC may participate in the initiation of flagellar movement and in the acrosome reaction. Bioinformatics and RT-PCR results reveal that sAC orthologs are present in most animal phyla. This review summarizes the current knowledge on the physiological roles of sAC in aquatic animals and suggests additional functions in which sAC may be involved. PMID:24574382

  5. Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).

    PubMed

    Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli

    2018-02-26

    Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.

  6. Input-output Transfer Function Analysis of a Photometer Circuit Based on an Operational Amplifier.

    PubMed

    Hernandez, Wilmar

    2008-01-09

    In this paper an input-output transfer function analysis based on the frequencyresponse of a photometer circuit based on operational amplifier (op amp) is carried out. Opamps are universally used in monitoring photodetectors and there are a variety of amplifierconnections for this purpose. However, the electronic circuits that are usually used to carryout the signal treatment in photometer circuits introduce some limitations in theperformance of the photometers that influence the selection of the op amps and otherelectronic devices. For example, the bandwidth, slew-rate, noise, input impedance and gain,among other characteristics of the op amp, are often the performance limiting factors ofphotometer circuits. For this reason, in this paper a comparative analysis between twophotodiode amplifier circuits is carried out. One circuit is based on a conventional currentto-voltage converter connection and the other circuit is based on a robust current-to-voltageconverter connection. The results are satisfactory and show that the photodiode amplifierperformance can be improved by using robust control techniques.

  7. Fingerprinting and quantification of GMOs in the agro-food sector.

    PubMed

    Taverniers, I; Van Bockstaele, E; De Loose, M

    2003-01-01

    Most strategies for analyzing GMOs in plants and derived food and feed products, are based on the polymerase chain reaction (PCR) technique. In conventional PCR methods, a 'known' sequence between two specific primers is amplified. To the contrary, with the 'anchor PCR' technique, unknown sequences adjacent to a known sequence, can be amplified. Because T-DNA/plant border sequences are being amplified, anchor PCR is the perfect tool for unique identification of transgenes, including non-authorized GMOs. In this work, anchor PCR was applied to characterize the 'transgene locus' and to clarify the complete molecular structure of at least six different commercial transgenic plants. Based on sequences of T-DNA/plant border junctions, obtained by anchor PCR, event specific primers were developed. The junction fragments, together with endogeneous reference gene targets, were cloned in plasmids. The latter were then used as event specific calibrators in real-time PCR, a new technique for the accurate relative quantification of GMOs. We demonstrate here the importance of anchor PCR for identification and the usefulness of plasmid DNA calibrators in quantification strategies for GMOs, throughout the agro-food sector.

  8. Extracellular 2′,3′-cAMP-adenosine pathway in proximal tubular, thick ascending limb, and collecting duct epithelial cells

    PubMed Central

    Gillespie, Delbert G.

    2013-01-01

    In a previous study, we demonstrated that human proximal tubular epithelial cells obtained from a commercial source metabolized extracellular 2′,3′-cAMP to 2′-AMP and 3′-AMP and extracellular 2′-AMP and 3′-AMP to adenosine (the extracellular 2′,3′-cAMP-adenosine pathway; extracellular 2′,3′-cAMP → 2′-AMP + 3′-AMP → adenosine). The purpose of this study was to investigate the metabolism of extracellular 2′,3′-cAMP in proximal tubular vs. thick ascending limb vs. collecting duct epithelial cells freshly isolated from their corresponding nephron segments obtained from rat kidneys. In epithelial cells from all three nephron segments, 1) extracellular 2′,3′-cAMP was metabolized to 2′-AMP and 3′-AMP, with 2′-AMP > 3′-AMP, 2) the metabolism of extracellular 2′,3′-cAMP to 2′-AMP and 3′-AMP was not inhibited by either 3-isobutyl-1-methylxanthine (phosphodiesterase inhibitor) or 1,3-dipropyl-8-p-sulfophenylxanthine (ecto-phosphodiesterase inhibitor), 3) extracellular 2′,3′-cAMP increased extracellular adenosine levels, 4) 3′-AMP and 2′-AMP were metabolized to adenosine with an efficiency similar to that of 5′-AMP, and 5) the metabolism of 5′-AMP, 3′-AMP, and 2′-AMP was not inhibited by α,β-methylene-adenosine-5′-diphosphate (CD73 inhibitor). These results support the conclusion that renal epithelial cells all along the nephron can metabolize extracellular 2′,3′-cAMP to 2′-AMP and 3′-AMP and can efficiently metabolize extracellular 2′-AMP and 3′-AMP to adenosine and that the metabolic enzymes involved are not the classical phosphodiesterases nor ecto-5′-nucleotidase (CD73). Because 2′,3′-cAMP is released by injury and because previous studies demonstrate that the extracellular 2′,3′-cAMP-adenosine pathway stimulates epithelial cell proliferation via adenosine A2B receptors, the present results suggest that the extracellular 2′,3′-cAMP-adenosine pathway may help restore epithelial cells along the nephron following kidney injury. PMID:23077101

  9. The Brain In Vivo Expresses the 2′,3′-cAMP-Adenosine Pathway

    PubMed Central

    Verrier, Jonathan D.; Jackson, Travis C.; Bansal, Rashmi; Kochanek, Patrick M.; Puccio, Ava M.; Okonkwo, David O.; Jackson, Edwin K.

    2012-01-01

    Although multiple biochemical pathways produce adenosine, studies suggest that the 2′,3′-cAMP-adenosine pathway (2′,3′-cAMP → 2′-AMP/3′-AMP → adenosine) contributes to adenosine production in some cells/tissues/organs. To determine whether the 2′,3′-cAMP-adenosine pathway exists in vivo in the brain, we delivered to the brain (gray matter and white matter separately) via the inflow perfusate of a microdialysis probe either 2′,3′-cAMP, 3′,5′-cAMP, 2′-AMP, 3′-AMP, or 5′-AMP and measured the recovered metabolites in the microdialysis outflow perfusate with mass spectrometry. In both gray and white matter, 2′,3′-cAMP increased 2′-AMP, 3′-AMP and adenosine, and 3′,5′-cAMP increased 5′-AMP and adenosine. In both brain regions, 2′-AMP, 3-AMP and 5′-AMP were converted to adenosine. Microdialysis experiments in 2′,3′-cyclic nucleotide-3′-phosphodiesterase (CNPase) wild-type mice demonstrated that traumatic brain injury (TBI; controlled cortical impact model) activated the brain 2,3′-cAMP-adenosine pathway; similar experiments in CNPase knockout mice indicated that CNPase was involved in the metabolism of endogenous 2′,3′-cAMP to 2′-AMP and to adenosine. In CSF from TBI patients, 2′,3′-cAMP was significantly increased in the initial 12 hours after injury and strongly correlated with CSF levels of 2′-AMP, 3′-AMP, adenosine and inosine. We conclude that in vivo, 2′,3′-cAMP is converted to 2′-AMP/3′-AMP, and these AMPs are metabolized to adenosine. This pathway exists endogenously in both mice and humans. PMID:22360621

  10. Kinetic solvers with adaptive mesh in phase space

    NASA Astrophysics Data System (ADS)

    Arslanbekov, Robert R.; Kolobov, Vladimir I.; Frolova, Anna A.

    2013-12-01

    An adaptive mesh in phase space (AMPS) methodology has been developed for solving multidimensional kinetic equations by the discrete velocity method. A Cartesian mesh for both configuration (r) and velocity (v) spaces is produced using a “tree of trees” (ToT) data structure. The r mesh is automatically generated around embedded boundaries, and is dynamically adapted to local solution properties. The v mesh is created on-the-fly in each r cell. Mappings between neighboring v-space trees is implemented for the advection operator in r space. We have developed algorithms for solving the full Boltzmann and linear Boltzmann equations with AMPS. Several recent innovations were used to calculate the discrete Boltzmann collision integral with dynamically adaptive v mesh: the importance sampling, multipoint projection, and variance reduction methods. We have developed an efficient algorithm for calculating the linear Boltzmann collision integral for elastic and inelastic collisions of hot light particles in a Lorentz gas. Our AMPS technique has been demonstrated for simulations of hypersonic rarefied gas flows, ion and electron kinetics in weakly ionized plasma, radiation and light-particle transport through thin films, and electron streaming in semiconductors. We have shown that AMPS allows minimizing the number of cells in phase space to reduce the computational cost and memory usage for solving challenging kinetic problems.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bockris, J.O.; Devanathan, M.A.V.

    The galvanostatic double charging method was applied to determine the coverage of Ni cathodes with adsorbed atomic H in 2 N NaOH solutions. Anodic current densities were varied from 0.05 to 1.8 amp/sq cm. The plateau indicating absence of readsorption was between 0.6 and 1.8 amp/sq cm, for a constant cathodic c.d. of 1/10,000 amp/sq cm. The variation of the adsorbed H over cathodic c.d.'s ranging from 10 to the -6th power to 1/10 at a constant anodic c.d. of 1 amp/sq cm were calculated and the coverage calculated. The mechanism of the H evolution reaction was elucidated. The ratemore » determining step is discharge from a water molecules followed by rapid Tafel recombination. The rate constants for these processes and the rate constant for the ionisation, calculated with the extrapolated value of coverage for the reversible H electrode, were determined. A modification of the Tafel equation which takes into account both coverage and ionisation is in harmony with the results. A new method for the determination of coverage suitable for corrodible metals is described which involves the measurement of the rate of permeation of H by electrochemical techniques which enhances the sensitivity of the method. (Author)« less

  12. Kinetic solvers with adaptive mesh in phase space.

    PubMed

    Arslanbekov, Robert R; Kolobov, Vladimir I; Frolova, Anna A

    2013-12-01

    An adaptive mesh in phase space (AMPS) methodology has been developed for solving multidimensional kinetic equations by the discrete velocity method. A Cartesian mesh for both configuration (r) and velocity (v) spaces is produced using a "tree of trees" (ToT) data structure. The r mesh is automatically generated around embedded boundaries, and is dynamically adapted to local solution properties. The v mesh is created on-the-fly in each r cell. Mappings between neighboring v-space trees is implemented for the advection operator in r space. We have developed algorithms for solving the full Boltzmann and linear Boltzmann equations with AMPS. Several recent innovations were used to calculate the discrete Boltzmann collision integral with dynamically adaptive v mesh: the importance sampling, multipoint projection, and variance reduction methods. We have developed an efficient algorithm for calculating the linear Boltzmann collision integral for elastic and inelastic collisions of hot light particles in a Lorentz gas. Our AMPS technique has been demonstrated for simulations of hypersonic rarefied gas flows, ion and electron kinetics in weakly ionized plasma, radiation and light-particle transport through thin films, and electron streaming in semiconductors. We have shown that AMPS allows minimizing the number of cells in phase space to reduce the computational cost and memory usage for solving challenging kinetic problems.

  13. Advances in PCR technology.

    PubMed

    Lauerman, Lloyd H

    2004-12-01

    Since the discovery of the polymerase chain reaction (PCR) 20 years ago, an avalanche of scientific publications have reported major developments and changes in specialized equipment, reagents, sample preparation, computer programs and techniques, generated through business, government and university research. The requirement for genetic sequences for primer selection and validation has been greatly facilitated by the development of new sequencing techniques, machines and computer programs. Genetic libraries, such as GenBank, EMBL and DDBJ continue to accumulate a wealth of genetic sequence information for the development and validation of molecular-based diagnostic procedures concerning human and veterinary disease agents. The mechanization of various aspects of the PCR assay, such as robotics, microfluidics and nanotechnology, has made it possible for the rapid advancement of new procedures. Real-time PCR, DNA microarray and DNA chips utilize these newer techniques in conjunction with computer and computer programs. Instruments for hand-held PCR assays are being developed. The PCR and reverse transcription-PCR (RT-PCR) assays have greatly accelerated the speed and accuracy of diagnoses of human and animal disease, especially of the infectious agents that are difficult to isolate or demonstrate. The PCR has made it possible to genetically characterize a microbial isolate inexpensively and rapidly for identification, typing and epidemiological comparison.

  14. Typing of mutans streptococci by arbitrarily primed polymerase chain reaction.

    PubMed

    Saarela, M; Hannula, J; Mättö, J; Asikainen, S; Alaluusua, S

    1996-01-01

    The discriminative power of the arbitrarily primed polymerase chain reaction (AP-PCR) in differentiating between Streptococcus mutans and Strep. sobrinus species, serotypes and clones was investigated. Mutans streptococcal isolates (12(7)) obtained from 65 individuals (1-10 isolates per individual) were AP-PCR typed separately with two random primers, OPA-05 and OPA-13. Bacterial cell lysates were used as a template in PCR reactions, which made AP-PCR easy and fast to perform. Eighty-one isolates from 19 individuals were also ribotyped to compare the discriminative ability of ribotyping and AP-PCR techniques. AP-PCR performed with the two primers differentiated between Strep. mutans and Strep. sobrinus isolates, but neither primer detected serotype-specific amplification products. OPA-05 distinguished two main AP-PCR patterns among Strep. mutans isolates and one main pattern among Strep. sobrinus isolates, whereas OPA-13 found one main AP-PCR pattern among Strep. mutans isolates and two main patterns among Strep. sobrinus isolates. Ribotyping and AP-PCR revealed 40 and 33 different types among 81 selected isolates, respectively. Both techniques detected intra-individual heterogeneity in 16 out of 19 participants. The results indicate that AP-PCR has good discriminative ability in differentiating between mutans streptococcal clones and that the technique is suitable for epidemiological studies on mutans streptococci.

  15. Calibration-free assays on standard real-time PCR devices

    PubMed Central

    Debski, Pawel R.; Gewartowski, Kamil; Bajer, Seweryn; Garstecki, Piotr

    2017-01-01

    Quantitative Polymerase Chain Reaction (qPCR) is one of central techniques in molecular biology and important tool in medical diagnostics. While being a golden standard qPCR techniques depend on reference measurements and are susceptible to large errors caused by even small changes of reaction efficiency or conditions that are typically not marked by decreased precision. Digital PCR (dPCR) technologies should alleviate the need for calibration by providing absolute quantitation using binary (yes/no) signals from partitions provided that the basic assumption of amplification a single target molecule into a positive signal is met. Still, the access to digital techniques is limited because they require new instruments. We show an analog-digital method that can be executed on standard (real-time) qPCR devices. It benefits from real-time readout, providing calibration-free assessment. The method combines advantages of qPCR and dPCR and bypasses their drawbacks. The protocols provide for small simplified partitioning that can be fitted within standard well plate format. We demonstrate that with the use of synergistic assay design standard qPCR devices are capable of absolute quantitation when normal qPCR protocols fail to provide accurate estimates. We list practical recipes how to design assays for required parameters, and how to analyze signals to estimate concentration. PMID:28327545

  16. Calibration-free assays on standard real-time PCR devices

    NASA Astrophysics Data System (ADS)

    Debski, Pawel R.; Gewartowski, Kamil; Bajer, Seweryn; Garstecki, Piotr

    2017-03-01

    Quantitative Polymerase Chain Reaction (qPCR) is one of central techniques in molecular biology and important tool in medical diagnostics. While being a golden standard qPCR techniques depend on reference measurements and are susceptible to large errors caused by even small changes of reaction efficiency or conditions that are typically not marked by decreased precision. Digital PCR (dPCR) technologies should alleviate the need for calibration by providing absolute quantitation using binary (yes/no) signals from partitions provided that the basic assumption of amplification a single target molecule into a positive signal is met. Still, the access to digital techniques is limited because they require new instruments. We show an analog-digital method that can be executed on standard (real-time) qPCR devices. It benefits from real-time readout, providing calibration-free assessment. The method combines advantages of qPCR and dPCR and bypasses their drawbacks. The protocols provide for small simplified partitioning that can be fitted within standard well plate format. We demonstrate that with the use of synergistic assay design standard qPCR devices are capable of absolute quantitation when normal qPCR protocols fail to provide accurate estimates. We list practical recipes how to design assays for required parameters, and how to analyze signals to estimate concentration.

  17. Undergraduate virology exercises demonstrate conventional and real-time PCR using commercially available HIV primers and noninfectious target.

    PubMed

    Sulzinski, Michael A; Wasilewski, Melissa A; Farrell, James C; Glick, David L

    2009-07-01

    It is an extraordinary challenge to offer an undergraduate laboratory course in virology that teaches hands-on, relevant molecular biology techniques using nonpathogenic models of human virus detection. To our knowledge, there exists no inexpensive kits or reagent sets that are appropriate for demonstrating real-time PCR (RT-PCR) in an undergraduate laboratory course in virology. Here we describe simple procedures for student exercises that demonstrate the PCR detection of an HIV target nucleic acid. Our procedures combine a commercially available kit for conventional PCR with a modification for RT-PCR using the same reagents in the kit, making it possible for an instructor with access to a LightCycler® instrument to implement a relevant student exercise on RT-PCR detection of HIV nucleic acid targets. This combination of techniques is useful for demonstrating and comparing conventional PCR amplification and detection with agarose gel electrophoresis, with real-time PCR over a series of three laboratory periods. The series of laboratory periods also is used to provide the foundation for teaching the concept of PCR primer design, optimization of PCR detection systems, and introduction to nucleic acid queries using NCBI-BLAST to find and identify primers, amplicons, and other potential amplification targets within the HIV viral genome. The techniques were successfully implemented at the Biology 364 undergraduate virology course at the University of Scranton during the Fall 2008 semester. The techniques are particularly targeted to students who intend to pursue either postgraduate technical employment or graduate studies in the molecular life sciences. Copyright © 2009 International Union of Biochemistry and Molecular Biology, Inc.

  18. Stimulation of StAR expression by cAMP is controlled by inhibition of highly inducible SIK1 via CRTC2, a co-activator of CREB.

    PubMed

    Lee, Jinwoo; Tong, Tiegang; Takemori, Hiroshi; Jefcoate, Colin

    2015-06-15

    In mouse steroidogenic cells the activation of cholesterol metabolism is mediated by steroidogenic acute regulatory protein (StAR). Here, we visualized a coordinated regulation of StAR transcription, splicing and post-transcriptional processing, which are synchronized by salt inducible kinase (SIK1) and CREB-regulated transcription coactivator (CRTC2). To detect primary RNA (pRNA), spliced primary RNA (Sp-RNA) and mRNA in single cells, we generated probe sets by using fluorescence in situ hybridization (FISH). These methods allowed us to address the nature of StAR gene expression and to visualize protein-nucleic acid interactions through direct detection. We show that SIK1 represses StAR expression in Y1 adrenal and MA10 testis cells through inhibition of processing mediated by CRTC2. Digital image analysis matches qPCR analyses of the total cell culture. Evidence is presented for spatially separate accumulation of StAR pRNA and Sp-RNA at the gene loci in the nucleus. These findings establish that cAMP, SIK and CRTC mediate StAR expression through activation of individual StAR gene loci. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  19. Vascular endothelial cells express isoforms of protein kinase A inhibitor.

    PubMed

    Lum, Hazel; Hao, Zengping; Gayle, Dave; Kumar, Priyadarsini; Patterson, Carolyn E; Uhler, Michael D

    2002-01-01

    The expression and function of the endogenous inhibitor of cAMP-dependent protein kinase (PKI) in endothelial cells are unknown. In this study, overexpression of rabbit muscle PKI gene into endothelial cells inhibited the cAMP-mediated increase and exacerbated thrombin-induced decrease in endothelial barrier function. We investigated PKI expression in human pulmonary artery (HPAECs), foreskin microvessel (HMECs), and brain microvessel endothelial cells (HBMECs). RT-PCR using specific primers for human PKI alpha, human PKI gamma, and mouse PKI beta sequences detected PKI alpha and PKI gamma mRNA in all three cell types. Sequencing and BLAST analysis indicated that forward and reverse DNA strands for PKI alpha and PKI gamma were of >96% identity with database sequences. RNase protection assays showed protection of the 542 nucleotides in HBMEC and HPAEC PKI alpha mRNA and 240 nucleotides in HBMEC, HPAEC, and HMEC PKI gamma mRNA. Western blot analysis indicated that PKI gamma protein was detected in all three cell types, whereas PKI alpha was found in HBMECs. In summary, endothelial cells from three different vascular beds express PKI alpha and PKI gamma, which may be physiologically important in endothelial barrier function.

  20. Molecular epidemiological survey of bacteremia by multidrug resistant Pseudomonas aeruginosa: the relevance of intrinsic resistance mechanisms

    PubMed Central

    Dantas, Raquel Cristina Cavalcanti; Silva, Rebecca Tavares e; Ferreira, Melina Lorraine; Gonçalves, Iara Rossi; Araújo, Bruna Fuga; de Campos, Paola Amaral; Royer, Sabrina; Batistão, Deivid William da Fonseca; Gontijo-Filho, Paulo Pinto; Ribas, Rosineide Marques

    2017-01-01

    The bacterial factors associated with bacteremia by multidrug-resistant and extensively drug-resistant P. aeruginosa, including overexpression of efflux pumps, AmpC overproduction, and loss/alteration of the OprD porin in isolates that are non-Metallo-β-Lactamase producing were analyzed in a retrospective study. Molecular analyses included strain typing by Pulsed Field Gel Electrophoresis and identification of key genes via qualitative and quantitative PCR-based assays. Previous use of carbapenems and tracheostomy was independently associated with the development of bacteremia by extensively drug-resistant and multidrug-resistant strains of P. aeruginosa. A high consumption of antimicrobials was observed, and 75.0% of the isolates contained amplicons with the blaSPM-1 and blaVIM genes. Of the 47 non-Metallo-β-Lactamase isolates, none had another type of carbapenemase. However, the isolates exhibited high rates of hyperproduction of AmpC, loss of the OprD porin (71.4%) and the presence of MexABOprM (57.1%) and MexXY (64.3%). This study suggests that in non-Metallo-β-Lactamase isolates, the association of intrinsic resistance mechanisms could contributes to the expression of multidrug-resistant/extensively drug-resistant phenotypes. PMID:28481953

  1. [Effects of cytosolic bacteria on cyclic GMP-AMP synthase expression in human gingival tissues and periodontal ligament cells].

    PubMed

    Xiaojun, Yang; Yongmei, Tan; Zhihui, Tian; Ting, Zhou; Wanghong, Zhao; Jin, Hou

    2017-04-01

    This work aims to determine the effect of cytosolic bacteria on the expression of cyclic GMP-AMP synthase (cGAS) in human periodontal ligament cells (hPDLCs) and gingival tissues. The ability of Porphyromonas gingivalis (P. gingivalis) to invade hPDLCs was detected using laser scanning confocal microscope assay at a multiplicity of infection of 10. P. gingivalis-infected cells were sorted by fluorescence-activated cell sorting (FACS). Then, quantitative real time reverse transcription polymerase chain reaction (qRT-PCR) and Western blot were used to detect cGAS expression in infected cells. Finally, the location and expression of cGAS in inflammatory and normal gingival tissues were investigated by immunohistochemistry. P. gingivalis actively invaded hPDLCs. Moreover, cGAS expression significantly increased in P. gingivalis-infected cells. Although cGAS was expressed in the epithelial and subepithelial cells of both inflamed and normal gingival tissues, cGAS expression significantly increased in inflamed gingival tissues. Cytosolic bacteria can upregulate cGAS expression in infected cells. These data suggest that cGAS may act as pattern-recognition receptors and participate in recognizing cytosolic nucleic acid pathogen-associated molecular patterns.
.

  2. STITCHER: A web resource for high-throughput design of primers for overlapping PCR applications.

    PubMed

    O'Halloran, Damien M

    2015-06-01

    Overlapping PCR is routinely used in a wide number of molecular applications. These include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping by traditional PCR techniques and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online (http://ohalloranlab.net/STITCHER.html). STITCHER can handle both single sequence and multi-sequence input, and specific features facilitate numerous other PCR applications, including assembly PCR, adapter PCR, and primer walking. Field PCR, and in particular, LAMP, offers promise as an on site tool for pathogen detection in underdeveloped areas, and STITCHER includes off-target detection features for pathogens commonly targeted using LAMP technology.

  3. Histochemistry in biology and medicine: a message from the citing journals.

    PubMed

    Pellicciari, Carlo

    2015-12-23

    Especially in recent years, biomedical research has taken advantage of the progress in several disciplines, among which microscopy and histochemistry. To assess the influence of histochemistry in the biomedical field, the articles published during the period 2011-2015 have been selected from different databases and grouped by subject categories: as expected, biological and biomedical studies where histochemistry has been used as a major experimental approach include a wide of basic and applied researches on both humans and other animal or plant organisms. To better understand the impact of histochemical publications onto the different biological and medical disciplines, it was useful to look at the journals where the articles published in a multidisciplinary journal of histochemistry have been cited: it was observed that, in the five-years period considered, 20% only of the citations were in histochemical periodicals, the remaining ones being in journals of Cell & Tissue biology,  general and experimental Medicine, Oncology, Biochemistry & Molecular biology, Neurobiology, Anatomy & Morphology, Pharmacology & Toxicology, Reproductive biology, Veterinary sciences, Physiology, Endocrinology, Tissue engineering & Biomaterials,  as well as in multidisciplinary journals.It is easy to foresee that also in the future the histochemical journals will be an attended forum for basic and applied scientists in the biomedical field. It will be crucial that these journals be open to an audience as varied as possible, publishing articles on the application of refined techniques to very different experimental models: this will stimulate non-histochemist scientists to approach histochemistry whose application horizon could expand to novel and possibly exclusive subjects.

  4. Electrophysiological Differences in the Processing of Affect Misattribution

    PubMed Central

    Hashimoto, Yohei; Minami, Tetsuto; Nakauchi, Shigeki

    2012-01-01

    The affect misattribution procedure (AMP) was proposed as a technique to measure an implicit attitude to a prime image [1]. In the AMP, neutral symbols (e.g., a Chinese pictograph, called the target) are presented, following an emotional stimulus (known as the prime). Participants often misattribute the positive or negative affect of the priming images to the targets in spite of receiving an instruction to ignore the primes. The AMP effect has been investigated using behavioral measures; however, it is difficult to identify when the AMP effect occurs in emotional processing—whether the effect may occur in the earlier attention allocation stage or in the later evaluation stage. In this study, we examined the neural correlates of affect misattribution, using event-related potential (ERP) dividing the participants into two groups based on their tendency toward affect misattribution. The ERP results showed that the amplitude of P2 was larger for the prime at the parietal location in participants showing a low tendency to misattribution than for those showing a high tendency, while the effect of judging neutral targets amiss according to the primes was reflected in the late processing of targets (LPP). In addition, the topographic pattern analysis revealed that EPN-like component to targets was correlated with the difference of AMP tendency as well as P2 to primes and LPP to targets. Taken together, the mechanism of the affective misattribution was closely related to the attention allocation processing. Our findings provide neural evidence that evaluations of neutral targets are misattributed to emotional primes. PMID:23145097

  5. Quantitative PCR high-resolution melting (qPCR-HRM) curve analysis, a new approach to simultaneously screen point mutations and large rearrangements: application to MLH1 germline mutations in Lynch syndrome.

    PubMed

    Rouleau, Etienne; Lefol, Cédrick; Bourdon, Violaine; Coulet, Florence; Noguchi, Tetsuro; Soubrier, Florent; Bièche, Ivan; Olschwang, Sylviane; Sobol, Hagay; Lidereau, Rosette

    2009-06-01

    Several techniques have been developed to screen mismatch repair (MMR) genes for deleterious mutations. Until now, two different techniques were required to screen for both point mutations and large rearrangements. For the first time, we propose a new approach, called "quantitative PCR (qPCR) high-resolution melting (HRM) curve analysis (qPCR-HRM)," which combines qPCR and HRM to obtain a rapid and cost-effective method suitable for testing a large series of samples. We designed PCR amplicons to scan the MLH1 gene using qPCR HRM. Seventy-six patients were fully scanned in replicate, including 14 wild-type patients and 62 patients with known mutations (57 point mutations and five rearrangements). To validate the detected mutations, we used sequencing and/or hybridization on a dedicated MLH1 array-comparative genomic hybridization (array-CGH). All point mutations and rearrangements detected by denaturing high-performance liquid chromatography (dHPLC)+multiplex ligation-dependent probe amplification (MLPA) were successfully detected by qPCR HRM. Three large rearrangements were characterized with the dedicated MLH1 array-CGH. One variant was detected with qPCR HRM in a wild-type patient and was located within the reverse primer. One variant was not detected with qPCR HRM or with dHPLC due to its proximity to a T-stretch. With qPCR HRM, prescreening for point mutations and large rearrangements are performed in one tube and in one step with a single machine, without the need for any automated sequencer in the prescreening process. In replicate, its reagent cost, sensitivity, and specificity are comparable to those of dHPLC+MLPA techniques. However, qPCR HRM outperformed the other techniques in terms of its rapidity and amount of data provided.

  6. Comparison of Quantitative PCR and Droplet Digital PCR Multiplex Assays for Two Genera of Bloom-Forming Cyanobacteria, Cylindrospermopsis and Microcystis.

    PubMed

    Te, Shu Harn; Chen, Enid Yingru; Gin, Karina Yew-Hoong

    2015-08-01

    The increasing occurrence of harmful cyanobacterial blooms, often linked to deteriorated water quality and adverse public health effects, has become a worldwide concern in recent decades. The use of molecular techniques such as real-time quantitative PCR (qPCR) has become increasingly popular in the detection and monitoring of harmful cyanobacterial species. Multiplex qPCR assays that quantify several toxigenic cyanobacterial species have been established previously; however, there is no molecular assay that detects several bloom-forming species simultaneously. Microcystis and Cylindrospermopsis are the two most commonly found genera and are known to be able to produce microcystin and cylindrospermopsin hepatotoxins. In this study, we designed primers and probes which enable quantification of these genera based on the RNA polymerase C1 gene for Cylindrospermopsis species and the c-phycocyanin beta subunit-like gene for Microcystis species. Duplex assays were developed for two molecular techniques-qPCR and droplet digital PCR (ddPCR). After optimization, both qPCR and ddPCR assays have high linearity and quantitative correlations for standards. Comparisons of the two techniques showed that qPCR has higher sensitivity, a wider linear dynamic range, and shorter analysis time and that it was more cost-effective, making it a suitable method for initial screening. However, the ddPCR approach has lower variability and was able to handle the PCR inhibition and competitive effects found in duplex assays, thus providing more precise and accurate analysis for bloom samples. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  7. Applications of the rep-PCR DNA fingerprinting technique to study microbial diversity, ecology and evolution.

    PubMed

    Ishii, Satoshi; Sadowsky, Michael J

    2009-04-01

    A large number of repetitive DNA sequences are found in multiple sites in the genomes of numerous bacteria, archaea and eukarya. While the functions of many of these repetitive sequence elements are unknown, they have proven to be useful as the basis of several powerful tools for use in molecular diagnostics, medical microbiology, epidemiological analyses and environmental microbiology. The repetitive sequence-based PCR or rep-PCR DNA fingerprint technique uses primers targeting several of these repetitive elements and PCR to generate unique DNA profiles or 'fingerprints' of individual microbial strains. Although this technique has been extensively used to examine diversity among variety of prokaryotic microorganisms, rep-PCR DNA fingerprinting can also be applied to microbial ecology and microbial evolution studies since it has the power to distinguish microbes at the strain or isolate level. Recent advancement in rep-PCR methodology has resulted in increased accuracy, reproducibility and throughput. In this minireview, we summarize recent improvements in rep-PCR DNA fingerprinting methodology, and discuss its applications to address fundamentally important questions in microbial ecology and evolution.

  8. Evaluating the Role of Host AMPK in Leishmania Burden.

    PubMed

    Moreira, Diana; Estaquier, Jérôme; Cordeiro-da-Silva, Anabela; Silvestre, Ricardo

    2018-01-01

    The study of host AMP-activated protein kinase (AMPK) activation during Leishmania infection imposes distinct types of techniques to measure protein expression and activation, as well as to quantify, at transcription and translational levels, its downstream targets. The investigation of host AMPK protein modulation during Leishmania infection should primarily be assessed during in vitro infections using as a host murine bone marrow-derived macrophages (BMMos). The infection outcome is assessed measuring the percentage of infected cells in the context of BMMos. To evaluate AMPK activity during infection, the expression of AMPK phosphorylated at Thr172 as well as the transcription and translational levels of its downstream targets are evaluated by quantitative PCR and immunoblotting. The modulation of AMPK activity in vivo is determined specifically in sorted splenic macrophages harboring Leishmania parasites recovered from infected mice using fluorescent-labeled parasites in the infectious inocolum. The modulation of AMPK activity was assessed by AMPK activators and inhibitors and also using AMPK, SIRT1, or LKB1 KO mice models. The infection outcome in BMMos and in vivo was further determined using these two different approaches. To finally understand the metabolic impact of AMPK during infection, in vitro metabolic assays in infected BMMos were measured in the bioenergetic profile using an extracellular flux analyzer.

  9. Use of Sequenom Sample ID Plus® SNP Genotyping in Identification of FFPE Tumor Samples

    PubMed Central

    Miller, Jessica K.; Buchner, Nicholas; Timms, Lee; Tam, Shirley; Luo, Xuemei; Brown, Andrew M. K.; Pasternack, Danielle; Bristow, Robert G.; Fraser, Michael; Boutros, Paul C.; McPherson, John D.

    2014-01-01

    Short tandem repeat (STR) analysis, such as the AmpFlSTR® Identifiler® Plus kit, is a standard, PCR-based human genotyping method used in the field of forensics. Misidentification of cell line and tissue DNA can be costly if not detected early; therefore it is necessary to have quality control measures such as STR profiling in place. A major issue in large-scale research studies involving archival formalin-fixed paraffin embedded (FFPE) tissues is that varying levels of DNA degradation can result in failure to correctly identify samples using STR genotyping. PCR amplification of STRs of several hundred base pairs is not always possible when DNA is degraded. The Sample ID Plus® panel from Sequenom allows for human DNA identification and authentication using SNP genotyping. In comparison to lengthy STR amplicons, this multiplexing PCR assay requires amplification of only 76–139 base pairs, and utilizes 47 SNPs to discriminate between individual samples. In this study, we evaluated both STR and SNP genotyping methods of sample identification, with a focus on paired FFPE tumor/normal DNA samples intended for next-generation sequencing (NGS). The ability to successfully validate the identity of FFPE samples can enable cost savings by reducing rework. PMID:24551080

  10. Use of Sequenom sample ID Plus® SNP genotyping in identification of FFPE tumor samples.

    PubMed

    Miller, Jessica K; Buchner, Nicholas; Timms, Lee; Tam, Shirley; Luo, Xuemei; Brown, Andrew M K; Pasternack, Danielle; Bristow, Robert G; Fraser, Michael; Boutros, Paul C; McPherson, John D

    2014-01-01

    Short tandem repeat (STR) analysis, such as the AmpFlSTR® Identifiler® Plus kit, is a standard, PCR-based human genotyping method used in the field of forensics. Misidentification of cell line and tissue DNA can be costly if not detected early; therefore it is necessary to have quality control measures such as STR profiling in place. A major issue in large-scale research studies involving archival formalin-fixed paraffin embedded (FFPE) tissues is that varying levels of DNA degradation can result in failure to correctly identify samples using STR genotyping. PCR amplification of STRs of several hundred base pairs is not always possible when DNA is degraded. The Sample ID Plus® panel from Sequenom allows for human DNA identification and authentication using SNP genotyping. In comparison to lengthy STR amplicons, this multiplexing PCR assay requires amplification of only 76-139 base pairs, and utilizes 47 SNPs to discriminate between individual samples. In this study, we evaluated both STR and SNP genotyping methods of sample identification, with a focus on paired FFPE tumor/normal DNA samples intended for next-generation sequencing (NGS). The ability to successfully validate the identity of FFPE samples can enable cost savings by reducing rework.

  11. Fast and simple DNA extraction from saliva and sperm cells obtained from the skin or isolated from swabs.

    PubMed

    von Wurmb-Schwark, Nicole; Mályusz, Victoria; Fremdt, Heike; Koch, Christine; Simeoni, Eva; Schwark, Thorsten

    2006-05-01

    The forensic scientist often has to cope with problematic samples from the crime scene due to their minute size and thus the low amount of extractable DNA. The retrieval of DNA from swabs taken from the surface of the skin, for example, in cases of strangulation, can be especially difficult. We systematically investigated swabs taken from the skin (to obtain a genetic profile from the victim and also from a possible offender) and from sperm cell containing swabs using two extraction kits: the Invisorb forensic and the Invisorb spin swab kit (both Invitek, Germany). DNA quality and quantity were tested on ethidium bromide containing agarose gels and in a highly sensitive duplex-PCR, which amplifies fragments specific for mitochondrial and nuclear DNA. Absolute quantification was done using real time PCR. Samples, which were positive in the duplex-PCR, were also employed to genetic fingerprinting using the Powerplex ES and the AmpFlSTRIdentifiler(TM) kits. Our study shows that the easy-to-use Invisorb spin swab kit is very suitable for DNA isolation from swabs taken from the skin and also from sperm cells. Retrieval of cells from the skin with swabs moistened in extraction buffer, not in distilled water, led to a significant higher DNA yield.

  12. Target-Triggered Switching on and off the Luminescence of Lanthanide Coordination Polymer Nanoparticles for Selective and Sensitive Sensing of Copper Ions in Rat Brain.

    PubMed

    Huang, Pengcheng; Wu, Fangying; Mao, Lanqun

    2015-07-07

    Copper ions (Cu(2+)) in the central nervous system play a crucial role in the physiological and pathological events, so simple, selective, and sensitive detection of cerebral Cu(2+) is of great importance. In this work, we report a facile yet effective fluorescent method for sensing of Cu(2+) in rat brain using one kind of lanthanide coordination polymer nanoparticle, adenosine monophosphate (AMP) and terbium ion (Tb(3+)), i.e., AMP-Tb, as the sensing platform. Initially, a cofactor ligand, 5-sulfosalicylic acid (SSA), as the sensitizer, was introduced into the nonluminescent AMP-Tb suspension, resulting in switching on the luminescence of AMP-Tb by the removal of coordinating water molecules and concomitant energy transfer from SSA to Tb(3+). The subsequent addition of Cu(2+) into the resulting SSA/AMP-Tb can strongly quench the fluorescence because the specific coordination interaction between SSA and Cu(2+) rendered energy transfer from SSA to Tb(3+) inefficient. The decrease ratio of the fluorescence intensities of SSA/AMP-Tb at 550 nm show a linear relationship for Cu(2+) within the concentration range from 1.5 to 24 μM with a detection limit of 300 nM. The method demonstrated here is highly selective and is free from the interference of metal ions, amino acids, and the biological species commonly existing in the brain such as dopamine, lactate, and glucose. Eventually, by combining the microdialysis technique, the present method has been successfully applied in the detection of cerebral Cu(2+) in rat brain with the basal dialysate level of 1.91 ± 0.40 μM (n = 3). This method is very promising to be used for investigating the physiological and pathological events that cerebral Cu(2+) participates in.

  13. A novel rapid genotyping technique for Collie eye anomaly: SYBR Green-based real-time polymerase chain reaction method applicable to blood and saliva specimens on Flinders Technology Associates filter paper.

    PubMed

    Chang, Hye-Sook; Mizukami, Keijiro; Yabuki, Akira; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Arai, Toshiro; Yamato, Osamu

    2010-09-01

    Collie eye anomaly (CEA) is a canine inherited ocular disease that shows a wide variety of manifestations and severity of clinical lesions. Recently, a CEA-associated mutation was reported, and a DNA test that uses conventional polymerase chain reaction (PCR) has now become available. The objective of the current study was to develop a novel rapid genotyping technique by using SYBR Green-based real-time PCR for future large-scale surveys as a key part in the strategy to eradicate CEA by selective breeding. First, a SYBR Green-based real-time PCR assay for genotyping of CEA was developed and evaluated by using purified DNA samples from normal, carrier, and affected Border Collies in which genotypes had previously been determined by conventional PCR. This real-time PCR assay demonstrated appropriate amplifications in all genotypes, and the results were consistent with those of conventional PCR. Second, the availability of Flinders Technology Associates filter paper (FTA card) as DNA templates for the real-time PCR assay was evaluated by using blood and saliva specimens to determine suitability for CEA screening. DNA-containing solution prepared from a disc of blood- or saliva-spotted FTA cards was available directly as templates for the real-time PCR assay when the volume of solution was 2.5% of the PCR mixture. In conclusion, SYBR Green-based real-time PCR combined with FTA cards is a rapid genotyping technique for CEA that can markedly shorten the overall time required for genotyping as well as simplify the sample preparation. Therefore, this newly developed technique suits large-scale screening in breeding populations of Collie-related breeds.

  14. Optimization of PCR Condition: The First Study of High Resolution Melting Technique for Screening of APOA1 Variance.

    PubMed

    Wahyuningsih, Hesty; K Cayami, Ferdy; Bahrudin, Udin; A Sobirin, Mochamad; Ep Mundhofir, Farmaditya; Mh Faradz, Sultana; Hisatome, Ichiro

    2017-03-01

    High resolution melting (HRM) is a post-PCR technique for variant screening and genotyping based on the different melting points of DNA fragments. The advantages of this technique are that it is fast, simple, and efficient and has a high output, particularly for screening of a large number of samples. APOA1 encodes apolipoprotein A1 (apoA1) which is a major component of high density lipoprotein cholesterol (HDL-C). This study aimed to obtain an optimal quantitative polymerase chain reaction (qPCR)-HRM condition for screening of APOA1 variance. Genomic DNA was isolated from a peripheral blood sample using the salting out method. APOA1 was amplified using the RotorGeneQ 5Plex HRM. The PCR product was visualized with the HRM amplification curve and confirmed using gel electrophoresis. The melting profile was confirmed by looking at the melting curve. Five sets of primers covering the translated region of APOA1 exons were designed with expected PCR product size of 100-400 bps. The amplified segments of DNA were amplicons 2, 3, 4A, 4B, and 4C. Amplicons 2, 3 and 4B were optimized at an annealing temperature of 60 °C at 40 PCR cycles. Amplicon 4A was optimized at an annealing temperature of 62 °C at 45 PCR cycles. Amplicon 4C was optimized at an annealing temperature of 63 °C at 50 PCR cycles. In addition to the suitable procedures of DNA isolation and quantification, primer design and an estimated PCR product size, the data of this study showed that appropriate annealing temperature and PCR cycles were important factors in optimization of HRM technique for variant screening in APOA1 .

  15. Optimization of PCR Condition: The First Study of High Resolution Melting Technique for Screening of APOA1 Variance

    PubMed Central

    Wahyuningsih, Hesty; K Cayami, Ferdy; Bahrudin, Udin; A Sobirin, Mochamad; EP Mundhofir, Farmaditya; MH Faradz, Sultana; Hisatome, Ichiro

    2017-01-01

    Background High resolution melting (HRM) is a post-PCR technique for variant screening and genotyping based on the different melting points of DNA fragments. The advantages of this technique are that it is fast, simple, and efficient and has a high output, particularly for screening of a large number of samples. APOA1 encodes apolipoprotein A1 (apoA1) which is a major component of high density lipoprotein cholesterol (HDL-C). This study aimed to obtain an optimal quantitative polymerase chain reaction (qPCR)-HRM condition for screening of APOA1 variance. Methods Genomic DNA was isolated from a peripheral blood sample using the salting out method. APOA1 was amplified using the RotorGeneQ 5Plex HRM. The PCR product was visualized with the HRM amplification curve and confirmed using gel electrophoresis. The melting profile was confirmed by looking at the melting curve. Results Five sets of primers covering the translated region of APOA1 exons were designed with expected PCR product size of 100–400 bps. The amplified segments of DNA were amplicons 2, 3, 4A, 4B, and 4C. Amplicons 2, 3 and 4B were optimized at an annealing temperature of 60 °C at 40 PCR cycles. Amplicon 4A was optimized at an annealing temperature of 62 °C at 45 PCR cycles. Amplicon 4C was optimized at an annealing temperature of 63 °C at 50 PCR cycles. Conclusion In addition to the suitable procedures of DNA isolation and quantification, primer design and an estimated PCR product size, the data of this study showed that appropriate annealing temperature and PCR cycles were important factors in optimization of HRM technique for variant screening in APOA1. PMID:28331418

  16. Purification, characterization, and sequencing of antimicrobial peptides, Cy-AMP1, Cy-AMP2, and Cy-AMP3, from the Cycad (Cycas revoluta) seeds.

    PubMed

    Yokoyama, Seiya; Kato, Kouji; Koba, Atsuko; Minami, Yuji; Watanabe, Keiichi; Yagi, Fumio

    2008-12-01

    Novel antimicrobial peptides (AMP), designated Cy-AMP1, Cy-AMP2, and Cy-AMP3, were purified from seeds of the cycad (Cycas revoluta) by a CM cellulofine column, ion-exchange HPLC on SP COSMOGEL, and reverse-phase HPLC. They had molecular masses of 4583.2 Da, 4568.9 Da and 9275.8 Da, respectively, by MALDI-TOF MS analysis. Half of the amino acid residues of Cy-AMP1 and Cy-AMP2 were cysteine, glycine and proline, and their sequences were similar. The sequence of Cy-AMP3 showed high homology to various lipid transfer proteins. For Cy-AMP1 and Cy-AMP2, the concentrations of peptides required for 50% inhibition (IC(50)) of the growth of plant pathogenic fungi, Gram-positive and Gram-negative bacteria were 7.0-8.9 microg/ml. The Cy-AMP3 had weak antimicrobial activity. The structural and antimicrobial characteristics of Cy-AMP1 and Cy-AMP2 indicated that they are a novel type of antimicrobial peptide belonging to a plant defensin family.

  17. Existence of multiple receptors in single neurons: responses of single bullfrog olfactory neurons to many cAMP-dependent and independent odorants.

    PubMed

    Kashiwayanagi, M; Shimano, K; Kurihara, K

    1996-11-04

    The responses of single bullfrog olfactory neurons to various odorants were measured with the whole-cell patch clamp which offers direct information on cellular events and with the ciliary recording technique to obtain stable quantitative data from many neurons. A large portion of single olfactory neurons (about 64% and 79% in the whole-cell recording and in the ciliary recording, respectively) responded to many odorants with quite diverse molecular structures, including both odorants previously indicated to be cAMP-dependent (increasing) and independent odorants. One odorant elicited a response in many cells; e.g. hedione and citralva elicited the response in 100% and 92% of total neurons examined with the ciliary recording technique. To confirm that a single neuron carries different receptors or transduction pathways, the cross-adaptation technique was applied to single neurons. Application of hedione to a single neuron after desensitization of the current in response to lyral or citralva induced an inward current with a similar magnitude to that applied alone. It was suggested that most single olfactory neurons carry multiple receptors and at least dual transduction pathways.

  18. Electronic transport characterization of silicon wafers by spatially resolved steady-state photocarrier radiometric imaging

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Qian; University of the Chinese Academy of Sciences, Beijing 100039; Li, Bincheng, E-mail: bcli@ioe.ac.cn

    2015-09-28

    Spatially resolved steady-state photocarrier radiometric (PCR) imaging technique is developed to characterize the electronic transport properties of silicon wafers. Based on a nonlinear PCR theory, simulations are performed to investigate the effects of electronic transport parameters (the carrier lifetime, the carrier diffusion coefficient, and the front surface recombination velocity) on the steady-state PCR intensity profiles. The electronic transport parameters of an n-type silicon wafer are simultaneously determined by fitting the measured steady-state PCR intensity profiles to the three-dimensional nonlinear PCR model. The determined transport parameters are in good agreement with the results obtained by the conventional modulated PCR technique withmore » multiple pump beam radii.« less

  19. Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis).

    PubMed

    Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret

    2003-12-01

    A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.

  20. 2',3'-cAMP, 3'-AMP, 2'-AMP and adenosine inhibit TNF-α and CXCL10 production from activated primary murine microglia via A2A receptors.

    PubMed

    Newell, Elizabeth A; Exo, Jennifer L; Verrier, Jonathan D; Jackson, Travis C; Gillespie, Delbert G; Janesko-Feldman, Keri; Kochanek, Patrick M; Jackson, Edwin K

    2015-01-12

    Some cells, tissues and organs release 2',3'-cAMP (a positional isomer of 3',5'-cAMP) and convert extracellular 2',3'-cAMP to 2'-AMP plus 3'-AMP and convert these AMPs to adenosine (called the extracellular 2',3'-cAMP-adenosine pathway). Recent studies show that microglia have an extracellular 2',3'-cAMP-adenosine pathway. The goal of the present study was to investigate whether the extracellular 2',3'-cAMP-adenosine pathway could have functional consequences on the production of cytokines/chemokines by activated microglia. Experiments were conducted in cultures of primary murine microglia. In the first experiment, the effect of 2',3'-cAMP, 3'-AMP, 2'-AMP and adenosine on LPS-induced TNF-α and CXCL10 production was determined. In the next experiment, the first protocol was replicated but with the addition of 1,3-dipropyl-8-p-sulfophenylxanthine (DPSPX) (0.1 μM; antagonist of adenosine receptors). The last experiment compared the ability of 2-chloro-N(6)-cyclopentyladenosine (CCPA) (10 μM; selective A1 agonist), 5'-N-ethylcarboxamide adenosine (NECA) (10 μM; agonist for all adenosine receptor subtypes) and CGS21680 (10 μM; selective A2A agonist) to inhibit LPS-induced TNF-α and CXCL10 production. (1) 2',3'-cAMP, 3'-AMP, 2'-AMP and adenosine similarly inhibited LPS-induced TNF-α and CXCL10 production; (2) DPSPX nearly eliminated the inhibitory effects of 2',3'-cAMP, 3'-AMP, 2'-AMP and adenosine on LPS-induced TNF-α and CXCL10 production; (3) CCPA did not affect LPS-induced TNF-α and CXCL10; (4) NECA and CGS21680 similarly inhibited LPS-induced TNF-α and CXCL10 production. 2',3'-cAMP and its metabolites (3'-AMP, 2'-AMP and adenosine) inhibit LPS-induced TNF-α and CXCL10 production via A2A-receptor activation. Adenosine and its precursors, via A2A receptors, likely suppress TNF-α and CXCL10 production by activated microglia in brain diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Mechanisms of calcium sequestration by isolated Malpighian tubules of the house cricket Acheta domesticus.

    PubMed

    Browne, Austin; O'Donnell, Michael J

    2018-01-01

    Hemolymph calcium homeostasis in insects is achieved by the Malpighian tubules, primarily by sequestering excess Ca 2+ within internal calcium stores (Ca-rich granules) most often located within type I (principal) tubule cells. Using both the scanning ion-selective electrode technique and the Ramsay secretion assay this study provides the first measurements of basolateral and transepithelial Ca 2+ fluxes across the Malpighian tubules of an Orthopteran insect, the house cricket Acheta domesticus. Ca 2+ transport was specific to midtubule segments, where 97% of the Ca 2+ entering the tubule is sequestered within intracellular calcium stores and the remaining 3% is secreted into the lumen. Antagonists of voltage-gated (L-type) calcium channels decreased Ca 2+ influx ≥fivefold in adenosine 3',5'-cyclic monophosphate (cAMP)-stimulated tubules, suggesting basolateral Ca 2+ influx is facilitated by voltage-gated Ca 2+ channels. Increasing fluid secretion through manipulation of intracellular levels of cAMP or Ca 2+ had opposite effects on tubule Ca 2+ transport. The adenylyl cyclase-cAMP-PKA pathway promotes Ca 2+ sequestration whereas both 5-hydroxytryptamine and thapsigargin inhibited sequestration. Our results suggest that the midtubules of Acheta domesticus are dynamic calcium stores, which maintain hemolymph calcium concentration by manipulating rates of Ca 2+ sequestration through stimulatory (cAMP) and inhibitory (Ca 2+ ) regulatory pathways. © 2017 Wiley Periodicals, Inc.

  2. Identification and functional characterization of an uncharacterized antimicrobial peptide from a ciliate Paramecium caudatum.

    PubMed

    Cui, Pengfei; Dong, Yuan; Li, Zhijian; Zhang, Yubo; Zhang, Shicui

    2016-07-01

    The global ever-growing concerns about multi-drug resistant (MDR) microbes leads to urgent demands for exploration of new antibiotics including antimicrobial peptides (AMPs). Here we demonstrated that a cDNA from Ciliata Paramecium caudatum, designated Pcamp1, coded for a protein with features characteristic of AMPs, which is not homologous to any AMPs currently known. Both the C-terminal 91 amino acid residues of PcAMP1, cPcAMP1, expressed in Escherichia coli and the C-terminal 26 amino acid residues (predicted mature AMP), cPcAMP1/26, synthesized, underwent a coil-to-helix transition in the presence of TFE, SDS or DPC. Functional assays revealed that cPcAMP1 and cPcAMP1/26 were both able to kill Aeromonas hydrophila and Staphylococcus aureus. ELISA showed that cPcAMP1 and cPcAMP1/26 were able to bind to microbe-associated molecular pattern molecules LPS and LTA, which was further corroborated by the observations that cPcAMP1 could deposit onto the bacterial membranes. Importantly, both cPcAMP1 and cPcAMP1/26 were able to induce bacterial membrane permeabilization and depolarization, and to increase intracellular ROS levels. Additionally, cPcAMP1 and cPcAMP1/26 were not cytotoxic to mammalian cells. Taken together, our results show that PcAMP1 is a potential AMP with a membrane selectivity towards bacterial cells, which renders it a promising template for the design of novel peptide antibiotics against MDR microbes. It also shows that use of signal conserved sequence of AMPs can be an effective tool to identify potential AMPs across different animal classes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Intracellular tortuosity underlies slow cAMP diffusion in adult ventricular myocytes.

    PubMed

    Richards, Mark; Lomas, Oliver; Jalink, Kees; Ford, Kerrie L; Vaughan-Jones, Richard D; Lefkimmiatis, Konstantinos; Swietach, Pawel

    2016-06-01

    3',5'-Cyclic adenosine monophosphate (cAMP) signals in the heart are often confined to concentration microdomains shaped by cAMP diffusion and enzymatic degradation. While the importance of phosphodiesterases (degradative enzymes) in sculpting cAMP microdomains is well established in cardiomyocytes, less is known about cAMP diffusivity (DcAMP) and factors affecting it. Many earlier studies have reported fast diffusivity, which argues against sharply defined microdomains. [cAMP] dynamics in the cytoplasm of adult rat ventricular myocytes were imaged using a fourth generation genetically encoded FRET-based sensor. The [cAMP]-response to the addition and removal of isoproterenol (β-adrenoceptor agonist) quantified the rates of cAMP synthesis and degradation. To obtain a read out of DcAMP, a stable [cAMP] gradient was generated using a microfluidic device which delivered agonist to one half of the myocyte only. After accounting for phosphodiesterase activity, DcAMP was calculated to be 32 µm(2)/s; an order of magnitude lower than in water. Diffusivity was independent of the amount of cAMP produced. Saturating cAMP-binding sites with the analogue 6-Bnz-cAMP did not accelerate DcAMP, arguing against a role of buffering in restricting cAMP mobility. cAMP diffused at a comparable rate to chemically unrelated but similar sized molecules, arguing for a common physical cause of restricted diffusivity. Lower mitochondrial density and order in neonatal cardiac myocytes allowed for faster diffusion, demonstrating the importance of mitochondria as physical barriers to cAMP mobility. In adult cardiac myocytes, tortuosity due to physical barriers, notably mitochondria, restricts cAMP diffusion to levels that are more compatible with microdomain signalling. © The Author 2016. Published by Oxford University Press on behalf of the European Society of Cardiology.

  4. Metformin and phenformin activate AMP-activated protein kinase in the heart by increasing cytosolic AMP concentration.

    PubMed

    Zhang, Li; He, Huamei; Balschi, James A

    2007-07-01

    AMP-activated protein kinase (AMPK) acts as a cellular energy sensor: it responds to an increase in AMP concentration ([AMP]) or the AMP-to-ATP ratio (AMP/ATP). Metformin and phenformin, which are biguanides, have been reported to increase AMPK activity without increasing AMP/ATP. This study tests the hypothesis that these biguanides increase AMPK activity in the heart by increasing cytosolic [AMP]. Groups of isolated rat hearts (n = 5-7 each) were perfused with Krebs-Henseleit buffer with or without 0.2 mM phenformin or 10 mM metformin, and (31)P-NMR-measured phosphocreatine, ATP, and intracellular pH were used to calculate cytosolic [AMP]. At various times, hearts were freeze-clamped and assayed for AMPK activity, phosphorylation of Thr(172) on AMPK-alpha, and phosphorylation of Ser(79) on acetyl-CoA carboxylase, an AMPK target. In hearts treated with phenformin for 18 min and then perfused for 20 min with Krebs-Henseleit buffer, [AMP] began to increase at 26 min and AMPK activity was elevated at 36 min. In hearts treated with metformin, [AMP] was increased at 50 min and AMPK activity, phosphorylated AMPK, and phosphorylated acetyl-CoA carboxylase were elevated at 61 min. In metformin-treated hearts, HPLC-measured total AMP content and total AMP/ATP did not increase. In summary, phenformin and metformin increase AMPK activity and phosphorylation in the isolated heart. The increase in AMPK activity was always preceded by and correlated with increased cytosolic [AMP]. Total AMP content and total AMP/ATP did not change. Cytosolic [AMP] reported metabolically active AMP, which triggered increased AMPK activity, but measures of total AMP did not.

  5. Novel C617Y mutation in the 7th transmembrane segment of luteinizing hormone/choriogonadotropin receptor in a Japanese boy with peripheral precocious puberty.

    PubMed

    Nagasaki, Keisuke; Katsumata, Noriyuki; Ogawa, Yohei; Kikuchi, Toru; Uchiyama, Makoto

    2010-01-01

    Testotoxicosis, also known as familial male-limited precocious puberty, is an autosomal dominant form of gonadotropin-independent precocious puberty caused by heterozygous constitutively activating mutations of the LHCGR gene encoding the luteinizing hormone/choriogonadotropin receptor (LH/CGR). The patient is an 8-year-old boy who started to develop pubic hair and penile enlargement at 6 years of age. The patient had elevated serum testosterone levels, but initially exhibited a prepubertal response of gonadotropins to GnRH, which was followed by central activation of the hypothalamo-pituitary-gonadal axis. The father reported having experienced precocious puberty, and is 158 cm tall. There is no history of short stature and precocious puberty in the family except for the father. The LHCGR gene was analyzed by direct DNA sequencing of amplified PCR products from the patient and his parents. The wild-type and mutant LH/CGRs were transiently expressed in COS-1 cells and cAMP levels in the cells were determined with or without hCG stimulation. Genetic analysis revealed a novel C617Y mutation of the LHCGR gene in the patient and his mother, while his father had no mutations. Functional expression study demonstrated around 15% increase in the basal intracellular cAMP level in cells expressing the mutant LH/CGR compared with that in cells expressing the wild-type receptor. We have reported the first missense C617Y mutation located in the 7th transmembrane segment of LH/CGR causing testotoxicosis. The modest phenotype of our patient may be explained, at least in part, by the modest increase in the intracellular cAMP level caused by the C617Y mutation.

  6. Superbugs in the supermarket? Assessing the rate of contamination with third-generation cephalosporin-resistant gram-negative bacteria in fresh Australian pork and chicken.

    PubMed

    McLellan, Jade E; Pitcher, Joshua I; Ballard, Susan A; Grabsch, Elizabeth A; Bell, Jan M; Barton, Mary; Grayson, M Lindsay

    2018-01-01

    Antibiotic misuse in food-producing animals is potentially associated with human acquisition of multidrug-resistant (MDR; resistance to ≥ 3 drug classes) bacteria via the food chain. We aimed to determine if MDR Gram-negative (GNB) organisms are present in fresh Australian chicken and pork products. We sampled raw, chicken drumsticks (CD) and pork ribs (PR) from 30 local supermarkets/butchers across Melbourne on two occasions. Specimens were sub-cultured onto selective media for third-generation cephalosporin-resistant (3GCR) GNBs, with species identification and antibiotic susceptibility determined for all unique colonies. Isolates were assessed by PCR for SHV, TEM, CTX-M, AmpC and carbapenemase genes (encoding IMP, VIM, KPC, OXA-48, NDM). From 120 specimens (60 CD, 60 PR), 112 (93%) grew a 3GCR-GNB ( n  = 164 isolates; 86 CD, 78 PR); common species were Acinetobacter baumannii (37%), Pseudomonas aeruginosa (13%) and Serratia fonticola (12%), but only one E. coli isolate. Fifty-nine (36%) had evidence of 3GCR alone, 93/163 (57%) displayed 3GCR plus resistance to one additional antibiotic class, and 9/163 (6%) were 3GCR plus resistance to two additional classes. Of 158 DNA specimens, all were negative for ESBL/carbapenemase genes, except 23 (15%) which were positive for AmpC, with 22/23 considered to be inherently chromosomal, but the sole E. coli isolate contained a plasmid-mediated CMY-2 AmpC. We found low rates of MDR-GNBs in Australian chicken and pork meat, but potential 3GCR-GNBs are common (93% specimens). Testing programs that only assess for E. coli are likely to severely underestimate the diversity of 3GCR organisms in fresh meat.

  7. Molecular characteristics of extended-spectrum beta-lactamases and qnr determinants in Enterobacter species from Japan.

    PubMed

    Kanamori, Hajime; Yano, Hisakazu; Hirakata, Yoichi; Hirotani, Ayako; Arai, Kazuaki; Endo, Shiro; Ichimura, Sadahiro; Ogawa, Miho; Shimojima, Masahiro; Aoyagi, Tetsuji; Hatta, Masumitsu; Yamada, Mitsuhiro; Gu, Yoshiaki; Tokuda, Koichi; Kunishima, Hiroyuki; Kitagawa, Miho; Kaku, Mitsuo

    2012-01-01

    The incidence of extended-spectrum β-lactamases (ESBLs) has been increasing worldwide, but screening criteria for detection of ESBLs are not standardized for AmpC-producing Enterobacteriaceae such as Enterobacter species. In this study, we investigated the prevalence of ESBLs and/or AmpC β-lactamases in Japanese clinical isolates of Enterobacter spp. and the association of plasmid-mediated quinolone resistance (PMQR) determinants with ESBL producers. A total of 364 clinical isolates of Enterobacter spp. collected throughout Japan between November 2009 and January 2010 were studied. ESBL-producing strains were assessed by the CLSI confirmatory test and the boronic acid disk test. PCR and sequencing were performed to detect CTX-M, TEM, and SHV type ESBLs and PMQR determinants. For ESBL-producing Enterobacter spp., pulsed-field gel electrophoresis (PFGE) was performed using XbaI restriction enzyme. Of the 364 isolates, 22 (6.0%) were ESBL producers. Seven isolates of Enterobacter cloacae produced CTX-M-3, followed by two isolates producing SHV-12. Two isolates of Enterobacter aerogenes produced CTX-M-2. Of the 22 ESBL producers, 21 had the AmpC enzyme, and six met the criteria for ESBL production in the boronic acid test. We found a significant association of qnrS with CTX-M-3-producing E. cloacae. The 11 ESBL-producing Enterobacter spp. possessing bla(CTX-M), bla(SHV), or bla(TEM) were divided into six unique PFGE types. This is the first report about the prevalence of qnr determinants among ESBL-producing Enterobacter spp. from Japan. Our results suggest that ESBL-producing Enterobacter spp. with qnr determinants are spreading in Japan.

  8. Hepatic TRAF2 Regulates Glucose Metabolism Through Enhancing Glucagon Responses

    PubMed Central

    Chen, Zheng; Sheng, Liang; Shen, Hong; Zhao, Yujun; Wang, Shaomeng; Brink, Robert; Rui, Liangyou

    2012-01-01

    Obesity is associated with intrahepatic inflammation that promotes insulin resistance and type 2 diabetes. Tumor necrosis factor receptor–associated factor (TRAF)2 is a key adaptor molecule that is known to mediate proinflammatory cytokine signaling in immune cells; however, its metabolic function remains unclear. We examined the role of hepatic TRAF2 in the regulation of insulin sensitivity and glucose metabolism. TRAF2 was deleted specifically in hepatocytes using the Cre/loxP system. The mutant mice were fed a high-fat diet (HFD) to induce insulin resistance and hyperglycemia. Hepatic glucose production (HGP) was examined using pyruvate tolerance tests, 2H nuclear magnetic resonance spectroscopy, and in vitro HGP assays. The expression of gluconeogenic genes was measured by quantitative real-time PCR. Insulin sensitivity was analyzed using insulin tolerance tests and insulin-stimulated phosphorylation of insulin receptors and Akt. Glucagon action was examined using glucagon tolerance tests and glucagon-stimulated HGP, cAMP-responsive element–binding (CREB) phosphorylation, and expression of gluconeogenic genes in the liver and primary hepatocytes. Hepatocyte-specific TRAF2 knockout (HKO) mice exhibited normal body weight, blood glucose levels, and insulin sensitivity. Under HFD conditions, blood glucose levels were significantly lower (by >30%) in HKO than in control mice. Both insulin signaling and the hypoglycemic response to insulin were similar between HKO and control mice. In contrast, glucagon signaling and the hyperglycemic response to glucagon were severely impaired in HKO mice. In addition, TRAF2 overexpression significantly increased the ability of glucagon or a cAMP analog to stimulate CREB phosphorylation, gluconeogenic gene expression, and HGP in primary hepatocytes. These results suggest that the hepatic TRAF2 cell autonomously promotes hepatic gluconeogenesis by enhancing the hyperglycemic response to glucagon and other factors that increase cAMP levels, thus contributing to hyperglycemia in obesity. PMID:22315325

  9. Prostaglandin E2-induced up-regulation of c-fos messenger ribonucleic acid is primarily mediated by 3',5'-cyclic adenosine monophosphate in MC3T3-E1 osteoblasts

    NASA Technical Reports Server (NTRS)

    Fitzgerald, J.; Dietz, T. J.; Hughes-Fulford, M.

    2000-01-01

    The mechanism by which the proto-oncogene, c-fos, is up-regulated in response to PGE2 in the mouse osteoblastic (MC3T3-E1) cell line was investigated using RT-PCR. c-fos messenger RNA up-regulation by dmPGE2 is rapid, starting 10 min post stimulation, and transient. The specific protein kinase A (PKA) inhibitor, H89, inhibited c-fos induction. Moreover, down-regulation of protein kinase C (PKC) activity by chronic TPA treatment had no effect on the induction of c-fos by dmPGE2. We conclude that up-regulation of c-fos by dmPGE2 is primarily dependent on PKA in MC3T3-E1 osteoblasts. In S49 lymphoma wild-type but not S49 cyc- cells, which are deficient in cAMP signaling, dmPGE2 up-regulates c-fos and increases cell growth compared with unstimulated cells. Thus in S49 lymphoma cells, c-fos induction by PGE2 is also dependent on cAMP signaling. The minimal c-fos promoter region required for dmPGE2-induced expression was identified by transfecting c-fos promoter deletion constructs coupled to the chloramphenicol acetyltransferase (CAT) reporter gene into Vero cells. Transfection of a plasmid containing 99 bp c-fos proximal promoter was sufficient to direct c-fos/CAT expression following stimulation with dmPGE2. Because induction of c-fos is mediated by cAMP, these data are consistent with activation of c-fos via the CRE/ATF cis element.

  10. Molecular Characteristics of Extended-Spectrum Beta-Lactamases and qnr Determinants in Enterobacter Species from Japan

    PubMed Central

    Hirakata, Yoichi; Hirotani, Ayako; Arai, Kazuaki; Endo, Shiro; Ichimura, Sadahiro; Ogawa, Miho; Shimojima, Masahiro; Aoyagi, Tetsuji; Hatta, Masumitsu; Yamada, Mitsuhiro; Gu, Yoshiaki; Tokuda, Koichi; Kunishima, Hiroyuki; Kitagawa, Miho; Kaku, Mitsuo

    2012-01-01

    The incidence of extended-spectrum β-lactamases (ESBLs) has been increasing worldwide, but screening criteria for detection of ESBLs are not standardized for AmpC-producing Enterobacteriaceae such as Enterobacter species. In this study, we investigated the prevalence of ESBLs and/or AmpC β-lactamases in Japanese clinical isolates of Enterobacter spp. and the association of plasmid-mediated quinolone resistance (PMQR) determinants with ESBL producers. A total of 364 clinical isolates of Enterobacter spp. collected throughout Japan between November 2009 and January 2010 were studied. ESBL-producing strains were assessed by the CLSI confirmatory test and the boronic acid disk test. PCR and sequencing were performed to detect CTX-M, TEM, and SHV type ESBLs and PMQR determinants. For ESBL-producing Enterobacter spp., pulsed-field gel electrophoresis (PFGE) was performed using XbaI restriction enzyme. Of the 364 isolates, 22 (6.0%) were ESBL producers. Seven isolates of Enterobacter cloacae produced CTX-M-3, followed by two isolates producing SHV-12. Two isolates of Enterobacter aerogenes produced CTX-M-2. Of the 22 ESBL producers, 21 had the AmpC enzyme, and six met the criteria for ESBL production in the boronic acid test. We found a significant association of qnrS with CTX-M-3-producing E. cloacae. The 11 ESBL-producing Enterobacter spp. possessing bla CTX-M, bla SHV, or bla TEM were divided into six unique PFGE types. This is the first report about the prevalence of qnr determinants among ESBL-producing Enterobacter spp. from Japan. Our results suggest that ESBL-producing Enterobacter spp. with qnr determinants are spreading in Japan. PMID:22719857

  11. The adipokine adiponectin has potent anti-fibrotic effects mediated via adenosine monophosphate-activated protein kinase: novel target for fibrosis therapy

    PubMed Central

    2012-01-01

    Introduction Fibrosis in scleroderma is associated with collagen deposition and myofibroblast accumulation. Peroxisome proliferator activated receptor gamma (PPAR-γ), a master regulator of adipogenesis, inhibits profibrotic responses induced by transforming growth factor-ß (TGF-β), and its expression is impaired in scleroderma. The roles of adiponectin, a PPAR-γ regulated pleiotropic adipokine, in regulating the response of fibroblasts and in mediating the effects of PPAR-γ are unknown. Methods Regulation of fibrotic gene expression and TGF-ß signaling by adiponectin and adenosine monophosphate protein-activated (AMP) kinase agonists were examined in normal fibroblasts in monolayer cultures and in three-dimensional skin equivalents. AdipoR1/2 expression on skin fibroblasts was determined by real-time quantitative PCR. Results Adiponectin, an adipokine directly regulated by PPAR-γ, acts as a potent anti-fibrotic signal in normal and scleroderma fibroblasts that abrogates the stimulatory effects of diverse fibrotic stimuli and reduces elevated collagen gene expression in scleroderma fibroblasts. Adiponectin responses are mediated via AMP kinase, a fuel-sensing cellular enzyme that is necessary and sufficient for down-regulation of fibrotic genes by blocking canonical Smad signaling. Moreover, we demonstrate that endogenous adiponectin accounts, at least in part, for the anti-fibrotic effects exerted by ligands of PPAR-γ. Conclusions These findings reveal a novel link between cellular energy metabolism and extracellular matrix homeostasis converging on AMP kinase. Since the levels of adiponectin as well as its receptor are impaired in scleroderma patients with progressive fibrosis, the present results suggest a potential role for defective adiponectin expression or function in progressive fibrogenesis in scleroderma and other chronic fibrosing conditions. Restoring the adiponectin signaling axis in fibroblasts might, therefore, represent a novel pharmacological approach to controlling fibrosis. PMID:23092446

  12. The glutamate carboxypeptidase AMP1 mediates abscisic acid and abiotic stress responses in Arabidopsis.

    PubMed

    Shi, Yiting; Wang, Zheng; Meng, Pei; Tian, Siqi; Zhang, Xiaoyan; Yang, Shuhua

    2013-07-01

    ALTERED MERISTEM PROGRAM1 (AMP1) encodes a glutamate carboxypeptidase that plays an important role in shoot apical meristem development and phytohormone homeostasis. We isolated a new mutant allele of AMP1, amp1-20, from a screen for abscisic acid (ABA) hypersensitive mutants and characterized the function of AMP1 in plant stress responses. amp1 mutants displayed ABA hypersensitivity, while overexpression of AMP1 caused ABA insensitivity. Moreover, endogenous ABA concentration was increased in amp1-20- and decreased in AMP1-overexpressing plants under stress conditions. Application of ABA reduced the AMP1 protein level in plants. Interestingly, amp1 mutants accumulated excess superoxide and displayed hypersensitivity to oxidative stress. The hypersensitivity of amp1 to ABA and oxidative stress was partially rescued by reactive oxygen species (ROS) scavenging agent. Furthermore, amp1 was tolerant to freezing and drought stress. The ABA hypersensitivity and freezing tolerance of amp1 was dependent on ABA signaling. Moreover, amp1 had elevated soluble sugar content and showed hypersensitivity to high concentrations of sugar. By contrast, the contents of amino acids were changed in amp1 mutant compared to the wild-type. This study suggests that AMP1 modulates ABA, oxidative and abotic stress responses, and is involved in carbon and amino acid metabolism in Arabidopsis. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  13. Schwann Cells Metabolize Extracellular 2′,3′-cAMP to 2′-AMP

    PubMed Central

    Verrier, Jonathan D.; Kochanek, Patrick M.

    2015-01-01

    The 3′,5′-cAMP–adenosine pathway (3′,5′-cAMP→5′-AMP→adenosine) and the 2′,3′-cAMP–adenosine pathway (2′,3′-cAMP→2′-AMP/3′-AMP→adenosine) are active in the brain. Oligodendrocytes participate in the brain 2′,3′-cAMP–adenosine pathway via their robust expression of 2′,3′-cyclic nucleotide 3′-phosphodiesterase (CNPase; converts 2′,3′-cAMP to 2′-AMP). Because Schwann cells also express CNPase, it is conceivable that the 2′,3′-cAMP–adenosine pathway exists in the peripheral nervous system. To test this and to compare the 2′,3′-cAMP–adenosine pathway to the 3′,5′-cAMP–adenosine pathway in Schwann cells, we examined the metabolism of 2′,3′-cAMP, 2′-AMP, 3′-AMP, 3′,5′-cAMP, and 5′-AMP in primary rat Schwann cells in culture. Addition of 2′,3′-cAMP (3, 10, and 30 µM) to Schwann cells increased levels of 2′-AMP in the medium from 0.006 ± 0.002 to 21 ± 2, 70 ± 3, and 187 ± 10 nM/µg protein, respectively; in contrast, Schwann cells had little ability to convert 2′,3′-cAMP to 3′-AMP or 3′,5′-cAMP to either 3′-AMP or 5′-AMP. Although Schwann cells slightly converted 2′,3′-cAMP and 2′-AMP to adenosine, they did so at very modest rates (e.g., 5- and 3-fold, respectively, more slowly compared with our previously reported studies in oligodendrocytes). Using transected myelinated rat sciatic nerves in culture medium, we observed a time-related increase in endogenous intracellular 2′,3′-cAMP and extracellular 2′-AMP. These findings indicate that Schwann cells do not have a robust 3′,5′-cAMP–adenosine pathway but do have a 2′,3′-cAMP–adenosine pathway; however, because the pathway mostly involves 2′-AMP formation rather than 3′-AMP, and because the conversion of 2′-AMP to adenosine is slow, metabolism of 2′,3′-cAMP mostly results in the accumulation of 2′-AMP. Accumulation of 2′-AMP in peripheral nerves postinjury could have pathophysiological consequences. PMID:25998049

  14. Atmosphere, Magnetosphere and Plasmas in Space (AMPS). Spacelab payload definition study. Volume 7, book 3: Supporting Research and Technology (SR and T) report

    NASA Technical Reports Server (NTRS)

    1976-01-01

    The items identified as required to support the AMPS mission and requiring SR and T support and further work are: (1) a general purpose Experiment Pointing Mount; (2) a technique for measuring the attitude of the pallet-mounted or deployed experiments; (3) the development of a common optics cryogenically cooled interferometer spectrometer; (4) the development of a differential absorption lidar system for the measurement of ozone densitites in the earth's atmosphere; (5) the development of dc to dc power processors which are capable of converting energy stored in a capacitor system at 500 V to energy supplied to equipment operating at 40 kV and at 20 kW (eventually up to 100 kW); and (6) the development of a magnetic or possibly electrostatic deflection system capable of bending the beam of an electron accelerator. A data sheet is included for each item, briefly describing the background and need for each item, and the general objectives of the required development, and identifying the schedule requirements in support of the AMPS program.

  15. Evaluating experimental molecular physics studies of radiation damage in DNA*

    NASA Astrophysics Data System (ADS)

    Śmiałek, Małgorzata A.

    2016-11-01

    The field of Atomic and Molecular Physics (AMP) is a mature field exploring the spectroscopy, excitation, ionisation of atoms and molecules in all three phases. Understanding of the spectroscopy and collisional dynamics of AMP has been fundamental to the development and application of quantum mechanics and is applied across a broad range of disparate disciplines including atmospheric sciences, astrochemistry, combustion and environmental science, and in central to core technologies such as semiconductor fabrications, nanotechnology and plasma processing. In recent years the molecular physics also started significantly contributing to the area of the radiation damage at molecular level and thus cancer therapy improvement through both experimental and theoretical advances, developing new damage measurement and analysis techniques. It is therefore worth to summarise and highlight the most prominent findings from the AMP community that contribute towards better understanding of the fundamental processes in biologically-relevant systems as well as to comment on the experimental challenges that were met for more complex investigation targets. Contribution to the Topical Issue "Low-Energy Interactions related to Atmospheric and Extreme Conditions", edited by S. Ptasinska, M. Smialek-Telega, A. Milosavljevic, B. Sivaraman.

  16. Structural basis of RNA folding and recognition in an AMP-RNA aptamer complex.

    PubMed

    Jiang, F; Kumar, R A; Jones, R A; Patel, D J

    1996-07-11

    The catalytic properties of RNA and its well known role in gene expression and regulation are the consequence of its unique solution structures. Identification of the structural determinants of ligand recognition by RNA molecules is of fundamental importance for understanding the biological functions of RNA, as well as for the rational design of RNA Sequences with specific catalytic activities. Towards this latter end, Szostak et al. used in vitro selection techniques to isolate RNA sequences ('aptamers') containing a high-affinity binding site for ATP, the universal currency of cellular energy, and then used this motif to engineer ribozymes with polynucleotide kinase activity. Here we present the solution structure, as determined by multidimensional NMR spectroscopy and molecular dynamics calculations, of both uniformly and specifically 13C-, 15N-labelled 40-mer RNA containing the ATP-binding motif complexed with AMP. The aptamer adopts an L-shaped structure with two nearly orthogonal stems, each capped proximally by a G x G mismatch pair, binding the AMP ligand at their junction in a GNRA-like motif.

  17. Difference in expression between AQP1 and AQP5 in porcine endometrium and myometrium in response to steroid hormones, oxytocin, arachidonic acid, forskolin and cAMP during the mid-luteal phase of the estrous cycle and luteolysis.

    PubMed

    Skowronska, Agnieszka; Mlotkowska, Patrycja; Nielsen, Soren; Skowronski, Mariusz T

    2015-12-01

    Recently, we demonstrated in vitro that AQP1 and AQP5 in the porcine uterus are regulated by steroid hormones (P4, E2), arachidonic acid (AA), forskolin (FSK) and cAMP during the estrous cycle. However, the potential of the porcine separated uterine tissues, the endometrium and myometrium, to express these AQPs remains unknown. Thus, in this study, the responses of AQP1 and AQP5 to P4, E2 oxytocin (OT), AA, FSK and cAMP in the porcine endometrium and myometrium were examined during the mid-luteal phase of the estrous cycle and luteolysis. Real-time PCR and western blot analysis. Progesterone up-regulated the expression of AQP1/AQP5 mRNAs and proteins in the endometrium and myometrium, especially during luteolysis. Similarly, E2 also stimulated the expression of both AQPs, but only in the endometrium. AA led to the upregulation of AQP1/AQP5 in the endometrium during luteolysis. In turn, OT increased the expression of AQP1/AQP5 mRNAs and proteins in the myometrium during mid-luteal phase. Moreover, a stimulatory effect of forskolin and cAMP on the expression of AQP1/AQP5 mRNAs and proteins in the endometrium and myometrium dominated during luteolysis, but during the mid-luteal phase their influence on the expression of these AQPs was differentiated depending on the type of tissue and the incubation duration. These results seem to indicate that uterine tissues; endometrium and myometrium, exhibit their own AQP expression profiles in response to examined factors. Moreover, the responses of AQP1/AQP5 at mRNA and protein levels to the studied factors in the endometrium and myometrium are more pronounced during luteolysis. This suggests that the above effects of the studied factors are connected with morphological and physiological changes taking place in the pig uterus during the estrous cycle.

  18. Distribution of ESBLs, AmpC β-lactamases and carbapenemases among Enterobacteriaceae isolates causing intra-abdominal and urinary tract infections in the Asia-Pacific region during 2008-14: results from the Study for Monitoring Antimicrobial Resistance Trends (SMART).

    PubMed

    Jean, Shio-Shin; Hsueh, Po-Ren

    2017-01-01

    To investigate the antimicrobial resistance and assess the molecular characteristics of β-lactamases (ESBLs, AmpC β-lactamases and carbapenemases) among Enterobacteriaceae isolates that caused intra-abdominal infections (IAIs) in patients hospitalized in the Asia-Pacific region during 2008-14. Multiplex PCR was used to detect the specific types of β-lactamase in 2893 isolates with MICs of ertapenem >0.5 mg/L. In-hospital acquisition times for most isolates were also delineated. Among 2728 (94.3%) isolates proven with β-lactamase production, the rates of non-susceptibility to imipenem were low (average = 7.9%) among IAI Enterobacteriaceae isolates from all Asia-Pacific countries except Vietnam (17.7%) and the Philippines (10.2%). A stepwise and significant increase in annual rates of carbapenemase production among these isolates was noted. CTX-M-15 and CTX-M-14 were the dominant ESBL variants in most IAI Enterobacteriaceae species. The most abundant AmpC β-lactamase variants were bla CMY-2 among isolates of Escherichia coli and bla DHA-1 among isolates of Klebsiella pneumoniae. In addition, the IAI Enterobacteriaceae isolates harbouring a bla CMY-2 or bla DHA-1 allele were associated with high community-acquired rates (38.0% and 42.6%, respectively). AmpC ACT and MIR variants were mostly detected in Enterobacter species. The bla NDM-1,4,5,7 -harbouring isolates of E. coli, K. pneumoniae and Enterobacter cloacae were most commonly identified among IAI isolates from Vietnam and the Philippines. Also of note, bla OXA-48 -harbouring IAI Enterobacteriaceae isolates were detected exclusively in Vietnam. The high resistance burden in Vietnam and the Philippines warrants aggressive control policies to combat the worsening trend in antimicrobial resistance among Enterobacteriaceae species causing IAIs. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  19. Development of a PCR technique specific for Demodex injai in biological specimens.

    PubMed

    Sastre, N; Ravera, I; Ferreira, D; Altet, L; Sánchez, A; Bardagí, M; Francino, O; Ferrer, L

    2013-09-01

    The identification of Demodex injai as a second Demodex species of dog opened new questions and challenges in the understanding on the Demodex-host relationships. In this paper, we describe the development of a conventional PCR technique based on published genome sequences of D. injai from GenBank that specifically detects DNA from D. injai. This technique amplifies a 238-bp fragment corresponding to a region of the mitochondrial 16S rDNA of D. injai. The PCR was positive in DNA samples obtained from mites identified morphologically as D. injai, which served as positive controls, as well as in samples from three cases of demodicosis associated with proliferation of mites identified as D. injai. Furthermore, the PCR was positive in 2 out of 19 healthy dogs. Samples of Demodex canis and Demodex folliculorum were consistently negative. Skin samples from seven dogs with generalized demodicosis caused by D. canis were all negative in the D. injai-specific PCR, demonstrating that in generalized canine demodicosis, mite proliferation is species-specific. This technique can be a useful tool in the diagnosis and in epidemiologic and pathogenic studies.

  20. A multiple antibiotic-resistant enterobacter cloacae strain isolated from a bioethanol fermentation facility.

    PubMed

    Murphree, Colin A; Li, Qing; Heist, E Patrick; Moe, Luke A

    2014-09-17

    An Enterobacter cloacae strain (E. cloacae F3S3) that was collected as part of a project to assess antibiotic resistance among bacteria isolated from bioethanol fermentation facilities demonstrated high levels of resistance to antibiotics added prophylactically to bioethanol fermentors. PCR assays revealed the presence of canonical genes encoding resistance to penicillin (ampC) and erythromycin (ermG). Assays measuring biofilm formation under antibiotic stress indicated that erythromycin induced biofilm formation in E. cloacae F3S3. Planktonic growth and biofilm formation were observed at a high ethanol content, indicating E. cloacae F3S3 can persist in a bioethanol fermentor under the highly variable environmental conditions found in fermentors.

  1. Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods.

    PubMed

    Edagawa, Akiko; Kimura, Akio; Kawabuchi-Kurata, Takako; Adachi, Shinichi; Furuhata, Katsunori; Miyamoto, Hiroshi

    2015-10-19

    We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR), and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%). Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%). In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8%) compared with real-time qPCR alone (46/68, 67.6%). Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1%) compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%). Legionella was not detected in the remaining six samples (6/68, 8.8%), irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.

  2. Real time PCR to detect the environmental faecal contamination by Echinococcus multilocularis from red fox stools.

    PubMed

    Knapp, Jenny; Millon, Laurence; Mouzon, Lorane; Umhang, Gérald; Raoul, Francis; Ali, Zeinaba Said; Combes, Benoît; Comte, Sébastien; Gbaguidi-Haore, Houssein; Grenouillet, Frédéric; Giraudoux, Patrick

    2014-03-17

    The oncosphere stage of Echinococcus multilocularis in red fox stools can lead, after ingestion, to the development of alveolar echinococcosis in the intermediate hosts, commonly small mammals and occasionally humans. Monitoring animal infection and environmental contamination is a key issue in public health surveillance. We developed a quantitative real-time PCR technique (qPCR) to detect and quantify E. multilocularis DNA released in fox faeces. A qPCR technique using a hydrolysis probe targeting part of the mitochondrial gene rrnL was assessed on (i) a reference collection of stools from 57 necropsied foxes simultaneously investigated using the segmental sedimentation and counting technique (SSCT) (29 positive for E. multilocularis worms and 28 negative animals for the parasite); (ii) a collection of 114 fox stools sampled in the field: two sets of 50 samples from contrasted endemic regions in France and 14 from an E. multilocularis-free area (Greenland). Of the negative SSCT controls, 26/28 were qPCR-negative and two were weakly positive. Of the positive SSCT foxes, 25/29 samples were found to be positive by qPCR. Of the field samples, qPCR was positive in 21/50 (42%) and 5/48 (10.4%) stools (2 samples inhibited), originating respectively from high and low endemic areas. In faeces, averages of 0.1 pg/μl of DNA in the Jura area and 0.7 pg/μl in the Saône-et-Loire area were detected. All qPCR-positive samples were confirmed by sequencing. The qPCR technique developed here allowed us to quantify environmental E. multilocularis contamination by fox faeces by studying the infectious agent directly. No previous study had performed this test in a one-step reaction. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods

    PubMed Central

    Edagawa, Akiko; Kimura, Akio; Kawabuchi-Kurata, Takako; Adachi, Shinichi; Furuhata, Katsunori; Miyamoto, Hiroshi

    2015-01-01

    We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR), and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%). Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%). In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8%) compared with real-time qPCR alone (46/68, 67.6%). Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1%) compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%). Legionella was not detected in the remaining six samples (6/68, 8.8%), irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples. PMID:26492259

  4. Optimization and Verification of Droplet Digital PCR Even-Specific Methods for the Quantification of GM Maize DAS1507 and NK603.

    PubMed

    Grelewska-Nowotko, Katarzyna; Żurawska-Zajfert, Magdalena; Żmijewska, Ewelina; Sowa, Sławomir

    2018-05-01

    In recent years, digital polymerase chain reaction (dPCR), a new molecular biology technique, has been gaining in popularity. Among many other applications, this technique can also be used for the detection and quantification of genetically modified organisms (GMOs) in food and feed. It might replace the currently widely used real-time PCR method (qPCR), by overcoming problems related to the PCR inhibition and the requirement of certified reference materials to be used as a calibrant. In theory, validated qPCR methods can be easily transferred to the dPCR platform. However, optimization of the PCR conditions might be necessary. In this study, we report the transfer of two validated qPCR methods for quantification of maize DAS1507 and NK603 events to the droplet dPCR (ddPCR) platform. After some optimization, both methods have been verified according to the guidance of the European Network of GMO Laboratories (ENGL) on analytical method verification (ENGL working group on "Method Verification." (2011) Verification of Analytical Methods for GMO Testing When Implementing Interlaboratory Validated Methods). Digital PCR methods performed equally or better than the qPCR methods. Optimized ddPCR methods confirm their suitability for GMO determination in food and feed.

  5. Role of CNPase in the Oligodendrocytic Extracellular 2′,3′-cAMP-Adenosine Pathway

    PubMed Central

    Verrier, Jonathan D.; Jackson, Travis C.; Gillespie, Delbert G.; Janesko-Feldman, Keri; Bansal, Rashmi; Goebbels, Sandra; Nave, Klaus-Armin; Kochanek, Patrick M.; Jackson, Edwin K.

    2014-01-01

    Extracellular adenosine 3′,5′-cyclic monophosphate (3′,5′-cAMP) is an endogenous source of localized adenosine production in many organs. Recent studies suggest that extracellular 2′,3′-cAMP (positional isomer of 3′,5′-cAMP) is also a source of adenosine, particularly in the brain in vivo post-injury. Moreover, in vitro studies show that both microglia and astrocytes can convert extracellular 2′,3′-cAMP to adenosine. Here we examined the ability of primary mouse oligodendrocytes and neurons to metabolize extracellular 2′,3′-cAMP and their respective adenosine monophosphates (2′-AMP and 3′-AMP). Cells were also isolated from mice deficient in 2′,3′-cyclic nucleotide-3′-phosphodiesterase (CNPase). Oligodendrocytes metabolized 2′,3′-cAMP to 2′-AMP with 10-fold greater efficiency than did neurons (and also more than previously examined microglia and astrocytes); whereas, the production of 3′-AMP was minimal in both oligodendrocytes and neurons. The production of 2′-AMP from 2′,3′-cAMP was reduced by 65% in CNPase -/- versus CNPase +/+ oligodendrocytes. Oligodendrocytes also converted 2′-AMP to adenosine, and this was also attenuated in CNPase -/- oligodendrocytes. Inhibition of classic 3′,5′-cAMP-3′-phosphodiesterases with 3-isobutyl-1-methylxanthine did not block metabolism of 2′,3′-cAMP to 2′-AMP and inhibition of classic ecto-5′-nucleotidase (CD73) with α,β-methylene-adenosine-5′-diphosphate did not attenuate the conversion of 2′-AMP to adenosine. These studies demonstrate that oligodendrocytes express the extracellular 2′,3′-cAMP-adenosine pathway (2′,3′-cAMP → 2′-AMP → adenosine). This pathway is more robustly expressed in oligodendrocytes than in all other CNS cell types because CNPase is the predominant enzyme that metabolizes 2′,3′-cAMP to 2-AMP in CNS cells. By reducing levels of 2′,3′-cAMP (a mitochondrial toxin) and increasing levels of adenosine (a neuroprotectant), oligodendrocytes may protect axons from injury. PMID:23922219

  6. 2’,3’-cAMP, 3’-AMP, 2’-AMP and Adenosine Inhibit TNF-α and CXCL10 Production From Activated Primary Murine Microglia via A2A Receptors

    PubMed Central

    Newell, Elizabeth A.; Exo, Jennifer L.; Verrier, Jonathan D.; Jackson, Travis C.; Gillespie, Delbert G.; Janesko-Feldman, Keri; Kochanek, Patrick M.

    2014-01-01

    Background Some cells, tissues and organs release 2’,3’-cAMP (a positional isomer of 3’,5’-cAMP) and convert extracellular 2’,3’-cAMP to 2’-AMP plus 3’-AMP and convert these AMPs to adenosine (called the extracellular 2’,3’-cAMP-adenosine pathway). Recent studies show that microglia have an extracellular 2’,3’-cAMP-adenosine pathway. The goal of the present study was to investigate whether the extracellular 2’,3’-cAMP-adenosine pathway could have functional consequences on the production of cytokines/chemokines by activated microglia. Methods Experiments were conducted in cultures of primary murine microglia. In the first experiment, the effect of 2’,3’-cAMP, 3’-AMP, 2’-AMP and adenosine on LPS-induced TNF-α and CXCL10 production was determined. In the next experiment, the first protocol was replicated but with the addition of 1,3-dipropyl-8-p-sulfophenylxanthine (DPSPX) (0.1 µM; antagonist of adenosine receptors). The last experiment compared the ability of 2-chloro-N6-cyclopentyladenosine (CCPA) (10 µM; selective A1 agonist), 5’-N-ethylcarboxamide adenosine (NECA) (10 µM; agonist for all adenosine receptor subtypes) and CGS21680 (10 µM; selective A2A agonist) to inhibit LPS-induced TNF-α and CXCL10 production. Results 1) 2’,3’-cAMP, 3’-AMP, 2’-AMP and adenosine similarly inhibited LPS-induced TNF-α and CXCL10 production; 2) DPSPX nearly eliminated the inhibitory effects of 2’,3’-cAMP, 3’-AMP, 2’-AMP and adenosine on LPS-induced TNF-α and CXCL10 production; 3) CCPA did not affect LPS-induced TNF-α and CXCL10; 4) NECA and CGS21680 similarly inhibited LPS-induced TNF-α and CXCL10 production. Conclusions 2’,3’-cAMP and its metabolites (3’-AMP, 2’-AMP and adenosine) inhibit LPS-induced TNF-α and CXCL10 production via A2A-receptor activation. Adenosine and its precursors, via A2A receptors, likely suppress TNF-α and CXCL10 production by activated microglia in brain diseases. PMID:25451117

  7. High-throughput avian molecular sexing by SYBR green-based real-time PCR combined with melting curve analysis.

    PubMed

    Chang, Hsueh-Wei; Cheng, Chun-An; Gu, De-Leung; Chang, Chia-Che; Su, San-Hua; Wen, Cheng-Hao; Chou, Yii-Cheng; Chou, Ta-Ching; Yao, Cheng-Te; Tsai, Chi-Li; Cheng, Chien-Chung

    2008-02-12

    Combination of CHD (chromo-helicase-DNA binding protein)-specific polymerase chain reaction (PCR) with electrophoresis (PCR/electrophoresis) is the most common avian molecular sexing technique but it is lab-intensive and gel-required. Gender determination often fails when the difference in length between the PCR products of CHD-Z and CHD-W genes is too short to be resolved. Here, we are the first to introduce a PCR-melting curve analysis (PCR/MCA) to identify the gender of birds by genomic DNA, which is gel-free, quick, and inexpensive. Spilornis cheela hoya (S. c. hoya) and Pycnonotus sinensis (P. sinensis) were used to illustrate this novel molecular sexing technique. The difference in the length of CHD genes in S. c. hoya and P. sinensis is 13-, and 52-bp, respectively. Using Griffiths' P2/P8 primers, molecular sexing failed both in PCR/electrophoresis of S. c. hoya and in PCR/MCA of S. c. hoya and P. sinensis. In contrast, we redesigned sex-specific primers to yield 185- and 112-bp PCR products for the CHD-Z and CHD-W genes of S. c. hoya, respectively, using PCR/MCA. Using this specific primer set, at least 13 samples of S. c. hoya were examined simultaneously and the Tm peaks of CHD-Z and CHD-W PCR products were distinguished. In this study, we introduced a high-throughput avian molecular sexing technique and successfully applied it to two species. This new method holds a great potential for use in high throughput sexing of other avian species, as well.

  8. [A new method of processing quantitative PCR data].

    PubMed

    Ke, Bing-Shen; Li, Guang-Yun; Chen, Shi-Min; Huang, Xiang-Yan; Chen, Ying-Jian; Xu, Jun

    2003-05-01

    Today standard PCR can't satisfy the need of biotechnique development and clinical research any more. After numerous dynamic research, PE company found there is a linear relation between initial template number and cycling time when the accumulating fluorescent product is detectable.Therefore,they developed a quantitative PCR technique to be used in PE7700 and PE5700. But the error of this technique is too great to satisfy the need of biotechnique development and clinical research. A better quantitative PCR technique is needed. The mathematical model submitted here is combined with the achievement of relative science,and based on the PCR principle and careful analysis of molecular relationship of main members in PCR reaction system. This model describes the function relation between product quantity or fluorescence intensity and initial template number and other reaction conditions, and can reflect the accumulating rule of PCR product molecule accurately. Accurate quantitative PCR analysis can be made use this function relation. Accumulated PCR product quantity can be obtained from initial template number. Using this model to do quantitative PCR analysis,result error is only related to the accuracy of fluorescence intensity or the instrument used. For an example, when the fluorescence intensity is accurate to 6 digits and the template size is between 100 to 1,000,000, the quantitative result accuracy will be more than 99%. The difference of result error is distinct using same condition,same instrument but different analysis method. Moreover,if the PCR quantitative analysis system is used to process data, it will get result 80 times of accuracy than using CT method.

  9. The 2′,3′-cAMP-adenosine pathway

    PubMed Central

    2011-01-01

    Our recent studies employing HPLC-tandem mass spectrometry to analyze venous perfusate from isolated, perfused kidneys demonstrate that intact kidneys produce and release into the extracellular compartment 2′,3′-cAMP, a positional isomer of the second messenger 3′,5′-cAMP. To our knowledge, this represents the first detection of 2′,3′-cAMP in any cell/tissue/organ/organism. Nuclear magnetic resonance experiments with isolated RNases and experiments in isolated, perfused kidneys suggest that 2′,3′-cAMP likely arises from RNase-mediated transphosphorylation of mRNA. Both in vitro and in vivo kidney experiments demonstrate that extracellular 2′,3′-cAMP is efficiently metabolized to 2′-AMP and 3′-AMP, both of which can be further metabolized to adenosine. This sequence of reactions is called the 2′,3′-cAMP-adenosine pathway (2′,3′-cAMP → 2′-AMP/3′-AMP → adenosine). Experiments in rat and mouse kidneys show that metabolic poisons increase extracellular levels of 2′,3′-cAMP, 2′-AMP, 3′-AMP, and adenosine; however, little is known regarding the pharmacology of 2′,3′-cAMP, 2′-AMP, and 3′-AMP. What is known is that 2′,3′-cAMP facilitates activation of mitochondrial permeability transition pores, a process that can lead to apoptosis and necrosis, and inhibits proliferation of vascular smooth muscle cells and glomerular mesangial cells. In summary, there is mounting evidence that at least some types of cellular injury, by triggering mRNA degradation, engage the 2′,3′-cAMP-adenosine pathway, and therefore this pathway should be added to the list of biochemical pathways that produce adenosine. Although speculative, it is possible that the 2′,3′-cAMP-adenosine pathway may protect against some forms of acute organ injury, for example acute kidney injury, by both removing an intracellular toxin (2′,3′-cAMP) and increasing an extracellular renoprotectant (adenosine). PMID:21937608

  10. Gene Profiling Technique to Accelerate Stem Cell Therapies for Eye Diseases

    MedlinePlus

    ... like RPE. They also use a technique called quantitative RT-PCR to measure the expression of genes ... higher in iPS cells than mature RPE. But quantitative RT-PCR only permits the simultaneous measurement of ...

  11. Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

    PubMed Central

    Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

    2009-01-01

    Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310

  12. Dietary effects of adenosine monophosphate to enhance growth, digestibility, innate immune responses and stress resistance of juvenile red sea bream, Pagrus major.

    PubMed

    Hossain, Md Sakhawat; Koshio, Shunsuke; Ishikawa, Manabu; Yokoyama, Saichiro; Sony, Nadia Mahjabin

    2016-09-01

    Our study explored the dietary effects of adenosine monophosphate (AMP) to enhance growth, digestibility, innate immune responses and stress resistance of juvenile red sea bream. A semi-purified basal diet supplemented with 0% (Control), 0.1% (AMP-0.1), 0.2% (AMP-0.2), 0.4% (AMP-0.4) and 0.8% (AMP-0.8) purified AMP to formulate five experimental diets. Each diet was randomly allocated to triplicate groups of fish (mean initial weight 3.4 g) for 56 days. The results indicated that dietary AMP supplements tended to improve growth performances. One of the best ones was found in diet group AMP-0.2, followed by diet groups AMP-0.1, AMP-0.4 and AMP-0.8. The Apparent digestibility coefficients (dry matter, protein and lipid) also improved by AMP supplementation and the significantly highest dry matter digestibility was observed in diet group AMP-0.2. Fish fed diet groups AMP-0.2 and AMP-0.4 had significantly higher peroxidase and bactericidal activities than fish fed the control diet. Nitro-blue-tetrazolium (NBT) activity was found to be significantly (P < 0.05) greater in fish fed diet groups AMP-0.4 and AMP-0.8. Total serum protein, lysozyme activity and agglutination antibody titer were also increased (P > 0.05) by dietary supplementation. In contrast, catalase activity decreased with AMP supplementation. Moreover, the fish fed AMP supplemented diets had better improvement (P < 0.05) in body lipid contents, condition factor, hematocrit content and glutamyl oxaloacetic transaminase (GOT) level than the control group. Supplementation also improved both freshwater and oxidative stress resistances. Interestingly, the fish fed diet groups AMP-0.2 and AMP-0.4 showed the least oxidative stress condition. Finally it is concluded that, dietary AMP supplementation enhanced the growth, digestibility, immune response and stress resistance of red sea bream. The regression analysis revealed that a dietary AMP supplementation between 0.2 and 0.4% supported weight gain and lysozyme activity as a marker of immune functions for red sea bream, which is also inline with the most of the growth and health performance parameters of fish under present experimental conditions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Real-time polymerase chain reaction assay for rapid and sensitive detection of anthrax spores in spiked soil and talcum powder.

    PubMed

    Jain, Neha; Merwyn, S; Rai, G P; Agarwal, G S

    2012-05-01

    Real-time polymerase chain reaction (real-time PCR) is a laboratory technique based on PCR. This technique is able to detect sequence-specific PCR products as they accumulate in "real time" during the PCR amplification, and also to quantify the number of substrates present in the initial PCR mixture before amplification begins. In the present study, real-time PCR assay was employed for rapid and real-time detection of Bacillus anthracis spores spiked in 0.1 g of soil and talcum powder ranging from 5 to 10(7) spores. DNA was isolated from spiked soil and talcum powder, using PBS containing 1 % Triton-X-100, followed by heat treatment. The isolated DNA was used as template for real-time PCR and PCR. Real-time PCR amplification was obtained in 60 min under the annealing condition at 60°C by employing primers targeting the pag gene of B. anthracis. In the present study, the detection limit of real-time PCR assay in soil was 10(3) spores and 10(2) spores in talcum powder, respectively, whereas PCR could detect 10(4) spores in soil and 10(3) spores in talcum powder, respectively.

  14. Reliability of clinical diagnosis and laboratory testing techniques currently used for identification of canine parvovirus enteritis in clinical settings

    PubMed Central

    FAZ, Mirna; MARTÍNEZ, José Simón; QUIJANO-HERNÁNDEZ, Israel; FAJARDO, Raúl

    2016-01-01

    Canine parvovirus type 2 (CPV-2) is the main etiological agent of viral enteritis in dogs. Actually in literature, CPV-2 has been reported with clinical signs that vary from the classical disease, and immunochromatography test and PCR technique have been introduced to veterinary hospitals to confirm CPV-2 diagnosis and other infections. However, the reliability of these techniques has been poorly analyzed. In this study, we evaluated the sensitivity and specificity of veterinary clinical diagnosis, immunochromatography test and PCR technique. Our data indicate that variations in the clinical signs of CPV-2 complicate the gathering of an appropriate diagnosis; and immunochromatography test and PCR technique do not have adequate sensitivity to diagnose positive cases. PMID:27818461

  15. Naturally occurring glucagon-like peptide-2 (GLP-2) receptors in human intestinal cell lines.

    PubMed

    Sams, Anette; Hastrup, Sven; Andersen, Marie; Thim, Lars

    2006-02-17

    Although clinical trials with GLP-2 receptor agonists are currently ongoing, the mechanisms behind GLP-2-induced intestinal epithelial growth remain to be understood. To approach the GLP-2 mechanism of action this study aimed to identify intestinal cell lines endogenously expressing the GLP-2 receptor. Here we report the first identification of a cell line endogenously expressing functional GLP-2 receptors. The human intestinal epithelial cell line, FHC, expressed GLP-2 receptor encoding mRNA (RT-PCR) and GLP-2 receptor protein (Western blot). In cultured FHC cells, GLP-2 induced concentration dependent cAMP accumulation (pEC(50)=9.7+/-0.04 (mean+/-S.E.M., n=4)). In addition, a naturally occurring human intestinal fibroblast cell line, 18Co, endogenously expressing GLP-2 receptor encoding mRNA (RT-PCR) and protein (Western blot) was identified. No receptor functionality (binding or G-protein signalling) could be demonstrated in 18Co cells. The identified gut-relevant cell lines provide tools for future clarification of the mechanisms underlying GLP-2-induced epithelial growth.

  16. Reduced cAMP, Akt Activation and p65-c-Rel Dimerization: Mechanisms Involved in the Protective Effects of mGluR3 Agonists in Cultured Astrocytes

    PubMed Central

    Durand, Daniela; Carniglia, Lila; Caruso, Carla; Lasaga, Mercedes

    2011-01-01

    In recent decades, astrocytes have emerged as key pieces in the maintenance of normal functioning of the central nervous system. Any impairment in astroglial function can ultimately lead to generalized disturbance in the brain, thus pharmacological targets associated with prevention of astrocyte death are actually promising. Subtype 3 of metabotropic glutamate receptors (mGluR3) is present in astrocytes, its activation exerting neuroprotective roles. In fact, we have previously demonstrated that mGluR3 selective agonists prevent nitric oxide (NO)-induced astrocyte death. However, mechanisms responsible for that cytoprotective property are still subject to study. Although inhibition of adenylyl cyclase by mGluR3 activation was extensively reported, the involvement of reduced cAMP levels in the effects of mGluR3 agonists and the association between cAMP decrease and the downstream pathways activated by mGluR3 remain neglected. Thus, we studied intracellular signaling mediating anti-apoptotic actions of mGluR3 in cultured rat astrocytes exposed to NO. In the present work, we showed that the cytoprotective effect of mGluR3 agonists (LY379268 and LY404039) requires both the reduction of intracellular cAMP levels and activation of Akt, as assessed by MTT and TUNEL techniques. Moreover, dibutyryl-cAMP impairs Akt phosphorylation induced by LY404039, indicating a relationship between mGluR3-reduced cAMP levels and PI3K/Akt pathway activation. We also demonstrated, by co-immunoprecipitation followed by western-blot, that the mGluR3 agonists not only induce per se survival-linked interaction between members of the NF-κB family p65 and c-Rel, but also impede reduction of levels of p65-c-Rel dimers caused by NO, suggesting a possible anti-apoptotic role for p65-c-Rel. All together, these data suggest that mGluR3 agonists may regulate cAMP/Akt/p65-c-Rel pathway, which would contribute to the protective effect of mGluR3 against NO challenge in astrocytes. Our results widen the knowledge about mechanisms of action of mGluR3, potential targets for the treatment of neurodegenerative disorders where a pathophysiological role for NO has been established. PMID:21779400

  17. Multiplex PCR technique could be an alternative approach for early detection of leprosy among close contacts--a pilot study from India.

    PubMed

    Banerjee, Surajita; Sarkar, Kamalesh; Gupta, Soma; Mahapatra, Prasanta Sinha; Gupta, Siddhartha; Guha, Samudra; Bandhopadhayay, Debasis; Ghosal, Chaitry; Paine, Suman Kalyan; Dutta, Rathindra Nath; Biswas, Nibir; Bhattacharya, Basudev

    2010-08-24

    Implementation of Multi drug Therapy (MDT) regimen has resulted in the decline of the total number of leprosy cases in the world. Though the prevalence rate has been declining, the incidence rate remains more or less constant and high in South East Asian countries particularly in India, Nepal, Bangladesh, Pakistan and Srilanka. Leprosy, particularly that of multibacillary type spreads silently before it is clinically detected. An early detection and treatment would help to prevent transmission in the community. Multiplex PCR (M-PCR) technique appears to be promising towards early detection among contacts of leprosy cases. A total of 234 paucibacillary (PB) and 205 multibacillary (MB) leprosy cases were studied in a community of an endemic area of Bankura district of West Bengal (Eastern India). They were assessed by smear examination for acid-fast bacilli (AFB) and M-PCR technique. These patients were treated with Multidrug Therapy (MDT) as prescribed by WHO following detection. A total of 110 MB and 72 PB contacts were studied by performing M-PCR in their nasal swab samples. 83.4% of MB patients were observed to be positive by smear examination for AFB and 89.2% by M-PCR. While 22.2% of PB patients were found to be positive by smear examination for AFB, 80.3% of these patients were positive by M-PCR. Among leprosy contacts (using M-PCR), 10.9% were found to be positive among MB contacts and 1.3% among PB contacts. Interestingly, two contacts of M-PCR positive MB cases developed leprosy during the period of two years follow up. The M-PCR technique appears to be an efficient tool for early detection of leprosy cases in community based contact tracing amongst close associates of PB and MB cases. Early contact tracing using a molecular biology tool can be of great help in curbing the incidence of leprosy further.

  18. AMP-Activated Protein Kinase Interacts with the Peroxisome Proliferator-Activated Receptor Delta to Induce Genes Affecting Fatty Acid Oxidation in Human Macrophages.

    PubMed

    Kemmerer, Marina; Finkernagel, Florian; Cavalcante, Marcela Frota; Abdalla, Dulcineia Saes Parra; Müller, Rolf; Brüne, Bernhard; Namgaladze, Dmitry

    2015-01-01

    AMP-activated protein kinase (AMPK) maintains energy homeostasis by suppressing cellular ATP-consuming processes and activating catabolic, ATP-producing pathways such as fatty acid oxidation (FAO). The transcription factor peroxisome proliferator-activated receptor δ (PPARδ) also affects fatty acid metabolism, stimulating the expression of genes involved in FAO. To question the interplay of AMPK and PPARδ in human macrophages we transduced primary human macrophages with lentiviral particles encoding for the constitutively active AMPKα1 catalytic subunit, followed by microarray expression analysis after treatment with the PPARδ agonist GW501516. Microarray analysis showed that co-activation of AMPK and PPARδ increased expression of FAO genes, which were validated by quantitative PCR. Induction of these FAO-associated genes was also observed upon infecting macrophages with an adenovirus coding for AMPKγ1 regulatory subunit carrying an activating R70Q mutation. The pharmacological AMPK activator A-769662 increased expression of several FAO genes in a PPARδ- and AMPK-dependent manner. Although GW501516 significantly increased FAO and reduced the triglyceride amount in very low density lipoproteins (VLDL)-loaded foam cells, AMPK activation failed to potentiate this effect, suggesting that increased expression of fatty acid catabolic genes alone may be not sufficient to prevent macrophage lipid overload.

  19. AMP-Activated Protein Kinase Interacts with the Peroxisome Proliferator-Activated Receptor Delta to Induce Genes Affecting Fatty Acid Oxidation in Human Macrophages

    PubMed Central

    Kemmerer, Marina; Finkernagel, Florian; Cavalcante, Marcela Frota; Abdalla, Dulcineia Saes Parra; Müller, Rolf; Brüne, Bernhard; Namgaladze, Dmitry

    2015-01-01

    AMP-activated protein kinase (AMPK) maintains energy homeostasis by suppressing cellular ATP-consuming processes and activating catabolic, ATP-producing pathways such as fatty acid oxidation (FAO). The transcription factor peroxisome proliferator-activated receptor δ (PPARδ) also affects fatty acid metabolism, stimulating the expression of genes involved in FAO. To question the interplay of AMPK and PPARδ in human macrophages we transduced primary human macrophages with lentiviral particles encoding for the constitutively active AMPKα1 catalytic subunit, followed by microarray expression analysis after treatment with the PPARδ agonist GW501516. Microarray analysis showed that co-activation of AMPK and PPARδ increased expression of FAO genes, which were validated by quantitative PCR. Induction of these FAO-associated genes was also observed upon infecting macrophages with an adenovirus coding for AMPKγ1 regulatory subunit carrying an activating R70Q mutation. The pharmacological AMPK activator A-769662 increased expression of several FAO genes in a PPARδ- and AMPK-dependent manner. Although GW501516 significantly increased FAO and reduced the triglyceride amount in very low density lipoproteins (VLDL)-loaded foam cells, AMPK activation failed to potentiate this effect, suggesting that increased expression of fatty acid catabolic genes alone may be not sufficient to prevent macrophage lipid overload. PMID:26098914

  20. Expression of adenylyl cyclase types III and VI in human hyperfunctioning thyroid nodules.

    PubMed

    Celano, M; Arturi, F; Presta, I; Bruno, R; Scarpelli, D; Calvagno, M G; Cristofaro, C; Bulotta, S; Giannasio, P; Sacco, R; Filetti, S; Russo, D

    2003-05-30

    Hyperfunctioning thyroid nodules are characterized by the presence of spontaneous somatic mutations responsible for constitutive activation of the cAMP pathway. However, alterations affecting other elements of the cAMP signaling system may counteract the effects of the mutations. In this study, the expression of the adenylyl cyclase (AC) types III and VI was investigated by Western blot in 18 hyperfunctioning thyroid nodules; in 12 samples, we also assessed the presence of TSH receptor (TSHR) or gsp mutations and levels of AC VI and III mRNA. We found that the expression of nodular AC VI (but not AC III) was significantly lower (85.1% of normal, P=0.014) than the expression of both adenylyl cycles types of perinodular tissue from the same patients. Slightly, but not significant differences were detected in nodules with or without mutations and AC protein levels generally showed correlation with the levels of the transcripts detected by RT-PCR. In addition, AC III and AC VI expression levels within a given nodule were characterized by a significant positive correlation. These findings indicate that a diminished expression of AC type VI may be part of the mechanisms occurring in the hyperfunctioning nodules, independently of the presence of TSHR or gsp mutations, which influence the resulting phenotype.

  1. The principle and application of new PCR Technologies

    NASA Astrophysics Data System (ADS)

    Yu, Miao; Cao, Yue; Ji, Yubin

    2017-12-01

    Polymerase chain reaction (PCR) is essentially a selective DNA amplification technique commonlyapplied for genetic testing and molecular diagnosis because of its high specificity and sensitivity.PCR technologies as the key of molecular biology, has realized that the qualitative detection of absolute quantitative has been changed. It has produced a variety of new PCR technologies, such as extreme PCR, photonic PCR, o-amplification at lower denaturation temperature PCR, nanoparticle PCR and so on. In this paper, the principle and application of PCR technologies are reviewed, and its development is prospected too.

  2. The state of RT-quantitative PCR: firsthand observations of implementation of minimum information for the publication of quantitative real-time PCR experiments (MIQE).

    PubMed

    Taylor, Sean C; Mrkusich, Eli M

    2014-01-01

    In the past decade, the techniques of quantitative PCR (qPCR) and reverse transcription (RT)-qPCR have become accessible to virtually all research labs, producing valuable data for peer-reviewed publications and supporting exciting research conclusions. However, the experimental design and validation processes applied to the associated projects are the result of historical biases adopted by individual labs that have evolved and changed since the inception of the techniques and associated technologies. This has resulted in wide variability in the quality, reproducibility and interpretability of published data as a direct result of how each lab has designed their RT-qPCR experiments. The 'minimum information for the publication of quantitative real-time PCR experiments' (MIQE) was published to provide the scientific community with a consistent workflow and key considerations to perform qPCR experiments. We use specific examples to highlight the serious negative ramifications for data quality when the MIQE guidelines are not applied and include a summary of good and poor practices for RT-qPCR. © 2013 S. Karger AG, Basel.

  3. Perturbed Mucosal Immunity and Dysbiosis Accompany Clinical Disease in a Rat Model of Spondyloarthritis

    PubMed Central

    Asquith, Mark; Stauffer, Patrick; Davin, Sean; Mitchell, Claire; Lin, Phoebe; Rosenbaum, James T.

    2017-01-01

    Objective The HLA-B27/β2 microglobulin (β2m) transgenic rat is a leading model of B27-associated spondyloarthopathy and disease is dependent on the presence of intestinal bacteria. We have shown previously that adult HLA-B27/β2m rats have an altered intestinal microbiota. In this study we sought to better define age-dependent changes to both mucosal immune function and dysbiosis in this model. Methods Intestinal contents were collected from wild type and HLA-B27/β2m+ rats post-weaning (3 and 6 weeks), at disease onset (10 wks) and after the establishment of disease (16 wks). Microbial community structure was determined by 16s sequencing and qRT-PCR. Mucosal and systemic Th1, Th17 and Treg responses were analyzed by flow cytometry, as was the frequency of IgA-coated intestinal bacteria. Intestinal expression of inflammatory cytokines and antimicrobial peptides (AMPs) was determined by qRT-PCR. Results An inflammatory cytokine signature and elevated AMP expression during the post-weaning period preceded the development of clinical bowel inflammation and dysbiosis in HLA-B27/β2m+ rats. An early and sustained expansion of the Th17 pool was specifically observed in cecal and colonic mucosa of HLA-B27/β2m rats. Strongly elevated Akkermansia mucinphilia colonization and IgA coating of intestinal bacteria was significantly associated with HLA-B27 expression and arthritis development. Conclusions and Perspectives HLA-B27/β2m expression in this rat model renders the host hyper-responsive to microbial antigens from infancy. Early activation of innate immunity and expansion of a mucosal Th17 signature are soon followed by dysbiosis in HLA-B27/β2m+ve animals. Perturbed mucosal immunity and dysbiosis strongly merit further study in both pre-diseased and diseased SpA patient populations. PMID:26992013

  4. The prostaglandin E2 receptor PTGER2 and prostaglandin F2α receptor PTGFR mediate oviductal glycoprotein 1 expression in bovine oviductal epithelial cells.

    PubMed

    Zhang, Nan; Mao, Wei; Zhang, Ying; Huang, Na; Liu, Bo; Gao, Long; Zhang, Shuangyi; Cao, Jinshan

    2018-04-13

    Oviductal glycoprotein 1 (OVGP1), an oviductin, is involved in the maintenance of sperm viability and motility and contributes to sperm capacitation in the oviduct. In this study, the regulatory effects exerted by prostaglandin E 2 (PGE 2 ) and F 2α (PGF 2α ) on OVGP1 expression via their corresponding receptors in bovine oviductal epithelial cells (BOECs) were investigated. BOECs were cultured in vitro, and their expression of receptors of PGE 2 (PTGER1, PTGER2, PTGER3, and PTGER4) and PGF 2α (PTGFR) was measured using RT-qPCR. Ca 2+ concentration was determined with a fluorescence-based method and cAMP was quantified by enzyme-linked immunosorbent assays to verify activation of PTGER2 and PTGFR by their corresponding agonists in these cells. OVGP1 mRNA and protein expression was measured using RT-qPCR and western blotting, respectively, following PTGER2 and PTGFR agonist-induced activation. PTGER1, PTGER2, PTGER4, and PTGFR were found to be present in BOECs; however, PTGER3 expression was not detected. OVGP1 expression was significantly promoted by 10 -6 M butaprost (a PTGER2 agonist) and decreased by 10 -6 M fluprostenol (a PTGFR agonist). In addition, 3 μM H-89 (a PKA inhibitor) and 3 μM U0126 (an ERK inhibitor) effectively inhibited PGE 2 -induced upregulation of OVGP1, and 5 μM chelerythrine chloride (a PKC inhibitor) and 3 μM U0126 negated OVGP1 downregulation by PGF 2α . In conclusion, this study demonstrates that OVGP1 expression in BOECs is enhanced by PGE 2 via PTGER2-cAMP-PKA signaling, and reduced by PGF 2α through the PTGFR-Ca 2+ -PKC pathway.

  5. Biotechnical use of polymerase chain reaction for microbiological analysis of biological samples.

    PubMed

    Lantz, P G; Abu al-Soud, W; Knutsson, R; Hahn-Hägerdal, B; Rådström, P

    2000-01-01

    Since its introduction in the mid-80s, polymerase chain reaction (PCR) technology has been recognised as a rapid, sensitive and specific molecular diagnostic tool for the analysis of micro-organisms in clinical, environmental and food samples. Although this technique can be extremely effective with pure solutions of nucleic acids, it's sensitivity may be reduced dramatically when applied directly to biological samples. This review describes PCR technology as a microbial detection method, PCR inhibitors in biological samples and various sample preparation techniques that can be used to facilitate PCR detection, by either separating the micro-organisms from PCR inhibitors and/or by concentrating the micro-organisms to detectable concentrations. Parts of this review are updated and based on a doctoral thesis by Lantz [1] and on a review discussing methods to overcome PCR inhibition in foods [2].

  6. A comparison between polymerase chain reaction (PCR) and traditional techniques for the diagnosis of leptospirosis in bovines.

    PubMed

    Hernández-Rodríguez, Patricia; Díaz, César A; Dalmau, Ernesto A; Quintero, Gladys M

    2011-01-01

    Leptospirosis is caused by Leptospira, gram negative spirochaetes whose microbiologic identification is difficult due to their low rate of growth and metabolic activity. In Colombia leptospirosis diagnosis is achieved by serological techniques without unified criteria for what positive titers are. In this study we compared polymerase chain reaction (PCR) with microbiological culture and dark field microscopy for the diagnosis of leptospirosis. Microbiological and molecular techniques were performed on 83 samples of urine taken from bovines in the savannahs surrounding Bogotá in Colombia, with presumptive diagnosis of leptospirosis. 117 samples of urine taken from healthy bovines were used as negative controls. 83 samples were MAT positive with titers ≥ 1:50; 81 with titers ≥ 1:100; and 66 with titers ≥ 1:200. 36% of the total samples (73/200) were Leptospira positives by microbiological culture, 32% (63/200) by dark field microscopy and 37% (74/200) by PCR. Amplicons obtained by PCR were 482 base pair long which are Leptospira specific. An amplicon of 262 base pairs typical of pathogenic Leptospira was observed in 71 out of the 74 PCR positive samples. The remaining 3 samples showed a 240 base pair amplicon which is typical of saprophytic Leptospira. PCR as a Leptospira diagnosis technique was 100% sensitive and 99% specific in comparison to microbiological culture. Kappa value of 0.99 indicated an excellent concordance between these techniques. Sensitivity and specificity reported for MAT when compared to microbiological culture was 0.95 and 0.89 with a ≥ 1:50 cut off. PCR was a reliable method for the rapid and precise diagnosis of leptospirosis when compared to traditional techniques in our study. The research presented here will be helpful to improve diagnosis and control of leptospirosis in Colombia and other endemic countries. Copyright © 2010 Elsevier B.V. All rights reserved.

  7. Stochastic sampling effects in STR typing: Implications for analysis and interpretation.

    PubMed

    Timken, Mark D; Klein, Sonja B; Buoncristiani, Martin R

    2014-07-01

    The analysis and interpretation of forensic STR typing results can become more complicated when reduced template amounts are used for PCR amplification due to increased stochastic effects. These effects are typically observed as reduced heterozygous peak-height balance and increased frequency of undetected alleles (allelic "dropout"). To investigate the origins of these effects, a study was performed using the AmpFlSTR(®) Identifiler Plus(®) and MiniFiler(®) kits to amplify replicates from a dilution series of NIST Human DNA Quantitation Standard (SRM(®) 2372A). The resulting amplicons were resolved and detected on two different genetic analyzer platforms, the Applied Biosystems 3130xL and 3500 analyzers. Results from our study show that the four different STR/genetic analyzer combinations exhibited very similar peak-height ratio statistics when normalized for the amount of template DNA in the PCR. Peak-height ratio statistics were successfully modeled using the Poisson distribution to simulate pre-PCR stochastic sampling of the alleles, confirming earlier explanations that sampling is the primary source for peak-height imbalance in reduced template dilutions. In addition, template-based pre-PCR sampling simulations also successfully predicted allelic dropout frequencies, as modeled by logistic regression methods, for the low-template DNA dilutions. We discuss the possibility that an accurately quantified DNA template might be used to characterize the linear signal response for data collected using different STR kits or genetic analyzer platforms, so as to provide a standardized approach for comparing results obtained from different STR/CE combinations and to aid in validation studies. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  8. Quantifying environmental DNA signals for aquatic invasive species across multiple detection platforms.

    PubMed

    Nathan, Lucas M; Simmons, Megan; Wegleitner, Benjamin J; Jerde, Christopher L; Mahon, Andrew R

    2014-11-04

    The use of molecular surveillance techniques has become popular among aquatic researchers and managers due to the improved sensitivity and efficiency compared to traditional sampling methods. Rapid expansion in the use of environmental DNA (eDNA), paired with the advancement of molecular technologies, has resulted in new detection platforms and techniques. In this study we present a comparison of three eDNA surveillance platforms: traditional polymerase chain reaction (PCR), quantitative PCR (qPCR), and digital droplet PCR (ddPCR) in which water samples were collected over a 24 h time period from mesocosm experiments containing a population gradient of invasive species densities. All platforms reliably detected the presence of DNA, even at low target organism densities within the first hour. The two quantitative platforms (qPCR and ddPCR) produced similar estimates of DNA concentrations. The analyses completed with ddPCR was faster from sample collection through analyses and cost approximately half the expenditure of qPCR. Although a new platform for eDNA surveillance of aquatic species, ddPCR was consistent with more commonly used qPCR and a cost-effective means of estimating DNA concentrations. Use of ddPCR by researchers and managers should be considered in future eDNA surveillance applications.

  9. Molecular diagnosis of rhino-orbito-cerebral mucormycosis from fresh tissue samples.

    PubMed

    Zaman, Kamran; Rudramurthy, Shivaprakash Mandya; Das, Ashim; Panda, Naresh; Honnavar, Prasanna; Kaur, Harsimran; Chakrabarti, Arunaloke

    2017-08-01

    We aimed to evaluate a PCR-based technique for the diagnosis of mucormycosis and the identification of fungi from fresh tissue specimens in patients with rhino-orbito-cerebral-mucormycosis (ROCM). Fifty cases of ROCM were included in the study. Conventional identification was performed using microscopy and culture. Molecular diagnosis was performed by amplifying the ribosomal DNA using pan-fungal ITS primers and semi-nested Mucorales-specific primers of the 18S region. The amplified products were sequenced to identify the agents. The utility of PCR-RFLP of the 18S region of rDNA was evaluated to identify the Mucorales. The ROCM cases were diagnosed by the demonstration of aseptate ribbon-like hyphae in biopsy specimens collected from the patients. Isolation was possible in 24 (48 %) samples. The ITS2 PCR confirmed mucormycosis in 27 cases (54 %; CI 59.4-68.2). By comparison, Mucorales-specific PCR was able to amplify DNA and the sequence enabled the identification of Mucorales speciesin all the patients. PCR-RFLP of the 18S region of rDNA could only identify the agent to genus level. The molecular technique was able to identify Mucorales species in 26 (42 %) cases that were negative by culture. Mucorales-specific semi-nested PCR targeting the 18S region is a better technique than ITS2 PCR for diagnosis. PCR-RFLP of the 18S region helps in identification to genus level.

  10. Evaluation of a nested-PCR for mycobacterium tuberculosis detection in blood and urine samples.

    PubMed

    da Cruz, Heidi Lacerda Alves; de Albuquerque Montenegro, Rosana; de Araújo Lima, Juliana Falcão; da Rocha Poroca, Diogo; da Costa Lima, Juliana Figueirêdo; Maria Lapa Montenegro, Lílian; Crovella, Sergio; Charifker Schindler, Haiana

    2011-01-01

    The polymerase chain reaction (PCR) and its variations, such as the nested-PCR, have been described as promising techniques for rapid diagnosis of tuberculosis (TB). With the aim of evaluating the usefulness of a nested-PCR method on samples of blood and urine of patients suspected of tuberculosis we analyzed 192 clinical samples, using as a molecular target the insertion element IS6110 specific of M. tuberculosis genome. Nested-PCR method showed higher sensitivity in patients with extrapulmonary tuberculosis (47.8% and 52% in blood and urine) when compared to patients with the pulmonary form of the disease (sensitivity of 29% and 26.9% in blood and urine), regardless of the type of biological sample used. The nested-PCR is a rapid technique that, even if not showing a good sensitivity, should be considered as a helpful tool especially in the extrapulmonary cases or in cases where confirmatory diagnosis is quite difficult to be achieved by routine methods. The performance of PCR-based techniques should be considered and tested in future works on other types of biological specimens besides sputum, like blood and urine, readily obtainable in most cases. The improving of M. tuberculosis nested-PCR detection in TB affected patients will give the possibility of an earlier detection of bacilli thus interrupting the transmission chain of the disease.

  11. Evaluation of PCR Approaches for Detection of Bartonella bacilliformis in Blood Samples.

    PubMed

    Gomes, Cláudia; Martinez-Puchol, Sandra; Pons, Maria J; Bazán, Jorge; Tinco, Carmen; del Valle, Juana; Ruiz, Joaquim

    2016-03-01

    The lack of an effective diagnostic tool for Carrion's disease leads to misdiagnosis, wrong treatments and perpetuation of asymptomatic carriers living in endemic areas. Conventional PCR approaches have been reported as a diagnostic technique. However, the detection limit of these techniques is not clear as well as if its usefulness in low bacteriemia cases. The aim of this study was to evaluate the detection limit of 3 PCR approaches. We determined the detection limit of 3 different PCR approaches: Bartonella-specific 16S rRNA, fla and its genes. We also evaluated the viability of dry blood spots to be used as a sample transport system. Our results show that 16S rRNA PCR is the approach with a lowest detection limit, 5 CFU/μL, and thus, the best diagnostic PCR tool studied. Dry blood spots diminish the sensitivity of the assay. From the tested PCRs, the 16S rRNA PCR-approach is the best to be used in the direct blood detection of acute cases of Carrion's disease. However its use in samples from dry blood spots results in easier management of transport samples in rural areas, a slight decrease in the sensitivity was observed. The usefulness to detect by PCR the presence of low-bacteriemic or asymptomatic carriers is doubtful, showing the need to search for new more sensible techniques.

  12. Evaluation of ALK gene rearrangement in central nervous system metastases of non-small-cell lung cancer using two-step RT-PCR technique.

    PubMed

    Nicoś, M; Krawczyk, P; Wojas-Krawczyk, K; Bożyk, A; Jarosz, B; Sawicki, M; Trojanowski, T; Milanowski, J

    2017-12-01

    RT-PCR technique has showed a promising value as pre-screening method for detection of mRNA containing abnormal ALK sequences, but its sensitivity and specificity is still discussable. Previously, we determined the incidence of ALK rearrangement in CNS metastases of NSCLC using IHC and FISH methods. We evaluated ALK gene rearrangement using two-step RT-PCR method with EML4-ALK Fusion Gene Detection Kit (Entrogen, USA). The studied group included 145 patients (45 females, 100 males) with CNS metastases of NSCLC and was heterogeneous in terms of histology and smoking status. 21% of CNS metastases of NSCLC (30/145) showed presence of mRNA containing abnormal ALK sequences. FISH and IHC tests confirmed the presence of ALK gene rearrangement and expression of ALK abnormal protein in seven patients with positive result of RT-PCR analysis (4.8% of all patients, 20% of RT-PCR positive patients). RT-PCR method compared to FISH analysis achieved 100% of sensitivity and only 82.7% of specificity. IHC method compared to FISH method indicated 100% of sensitivity and 97.8% of specificity. In comparison to IHC, RT-PCR showed identical sensitivity with high number of false positive results. Utility of RT-PCR technique in screening of ALK abnormalities and in qualification patients for molecularly targeted therapies needs further validation.

  13. Optimization of routine KRAS mutation PCR-based testing procedure for rational individualized first-line-targeted therapy selection in metastatic colorectal cancer.

    PubMed

    Chretien, Anne-Sophie; Harlé, Alexandre; Meyer-Lefebvre, Magali; Rouyer, Marie; Husson, Marie; Ramacci, Carole; Harter, Valentin; Genin, Pascal; Leroux, Agnès; Merlin, Jean-Louis

    2013-02-01

    KRAS mutation detection represents a crucial issue in metastatic colorectal cancer (mCRC). The optimization of KRAS mutation detection delay enabling rational prescription of first-line treatment in mCRC including anti-EGFR-targeted therapy requires robust and rapid molecular biology techniques. Routine analysis of mutations in codons 12 and 13 on 674 paraffin-embedded tissue specimens of mCRC has been performed for KRAS mutations detection using three molecular biology techniques, that is, high-resolution melting (HRM), polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP), and allelic discrimination PCR (TaqMan PCR). Discordant cases were assessed with COBAS 4800 KRAS CE-IVD assay. Among the 674 tumor specimens, 1.5% (10/674) had excessive DNA degradation and could not be analyzed. KRAS mutations were detected in 38.0% (256/674) of the analysable specimens (82.4% in codon 12 and 17.6% in codon 13). Among 613 specimens in whom all three techniques were used, 12 (2.0%) cases of discordance between the three techniques were observed. 83.3% (10/12) of the discordances were due to PCR-RFLP as confirmed by COBAS 4800 retrospective analysis. The three techniques were statistically comparable (κ > 0.9; P < 0.001). From these results, optimization of the routine procedure consisted of proceeding to systematic KRAS detection using HRM and TaqMan and PCR-RFLP in case of discordance and allowed significant decrease in delays. The results showed an excellent correlation between the three techniques. Using HRM and TaqMan warrants high-quality and rapid-routine KRAS mutation detection in paraffin-embedded tumor specimens. The new procedure allowed a significant decrease in delays for reporting results, enabling rational prescription of first-line-targeted therapy in mCRC.

  14. Purification, characterization, and sequencing of novel antimicrobial peptides, Tu-AMP 1 and Tu-AMP 2, from bulbs of tulip (Tulipa gesneriana L.).

    PubMed

    Fujimura, Masatoshi; Ideguchi, Mineo; Minami, Yuji; Watanabe, Keiichi; Tadera, Kenjiro

    2004-03-01

    Novel antimicrobial peptides (AMP), designated Tu-AMP 1 and Tu-AMP 2, were purified from the bulbs of tulip (Tulipa gesneriana L.) by chitin affinity chromatography and reverse-phase high-performance liquid chromatography (HPLC). They bind to chitin in a reversible way. They were basic peptides having isoelectric points of over 12. Tu-AMP 1 and Tu-AMP 2 had molecular masses of 4,988 Da and 5,006 Da on MALDI-TOF MS analysis, and their extinction coefficients of 1% aqueous solutions at 280 nm were 3.3 and 3.4, respectively. Half of all amino acid residues of Tu-AMP 1 and Tu-AMP 2 were occupied by cysteine, arginine, lysine, and proline. The concentrations of peptides required for 50% inhibition (IC(50)) of the growth of plant pathogenic bacteria and fungi were 2 to 20 microg/ml. The structural characteristics of Tu-AMP 1 and Tu-AMP 2 indicated that they were novel thionin-like antimicrobial peptides, though Tu-AMP 2 was a heterodimer composes of two short peptides joined with disulfide bonds.

  15. Critical points of DNA quantification by real-time PCR – effects of DNA extraction method and sample matrix on quantification of genetically modified organisms

    PubMed Central

    Cankar, Katarina; Štebih, Dejan; Dreo, Tanja; Žel, Jana; Gruden, Kristina

    2006-01-01

    Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary criterion by which to evaluate the quality and performance on different matrixes and extraction techniques. The effect of PCR efficiency on the resulting GMO content is demonstrated. Conclusion The crucial influence of extraction technique and sample matrix properties on the results of GMO quantification is demonstrated. Appropriate extraction techniques for each matrix need to be determined to achieve accurate DNA quantification. Nevertheless, as it is shown that in the area of food and feed testing matrix with certain specificities is impossible to define strict quality controls need to be introduced to monitor PCR. The results of our study are also applicable to other fields of quantitative testing by real-time PCR. PMID:16907967

  16. Real-Time PCR in faecal samples of Triatoma infestans obtained by xenodiagnosis: proposal for an exogenous internal control.

    PubMed

    Bravo, Nicolás; Muñoz, Catalina; Nazal, Nicolás; Saavedra, Miguel; Martínez, Gabriela; Araya, Eduardo; Apt, Werner; Zulantay, Inés

    2012-03-26

    The polymerase chain reaction (PCR) has proved to be a sensitive technique to detect Trypanosoma cruzi in the chronic phase of Chagas disease, which is characterized by low and fluctuating parasitemia. Another technique proposed for parasitological diagnosis in this phase of infection combines a microscopic search for motile trypomastigote forms in faecal samples (FS) obtained by xenodiagnosis (XD) with conventional PCR (XD-PCR). In this study we evaluate the use of human blood DNA as an exogenous internal control (EIC) for real time PCR (qPCR) combined with XD (XD-qPCR) using chromosome 12 (X12) detection. None of the FS-XD evaluated by qPCR amplified for X12. Nevertheless, all the EIC-FS-XD mixtures amplified for X12. We determined that X12 is useful as an EIC for XD-qPCR because we showed that the FS-XD does not contain human DNA after 30 or more days of XD incubation. This information is relevant for research on T. cruzi by XD-qPCR since it allows ruling out inhibition and false negative results due to DNA loss during the process of extraction and purification.

  17. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems.

    PubMed

    Ximenes, Camila; Brandão, Eduardo; Oliveira, Paula; Rocha, Abraham; Rego, Tamisa; Medeiros, Rafael; Aguiar-Santos, Ana; Ferraz, João; Reis, Christian; Araujo, Paulo; Carvalho, Luiz; Melo, Fabio L

    2014-12-01

    The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  18. Lipopolysaccharide-induced endothelial barrier breakdown is cyclic adenosine monophosphate dependent in vivo and in vitro.

    PubMed

    Schlegel, Nicolas; Baumer, Yvonne; Drenckhahn, Detlev; Waschke, Jens

    2009-05-01

    To determine whether cyclic adenosine monophosphate (cAMP) is critically involved in lipopolysaccharide (LPS)-induced breakdown of endothelial barrier functions in vivo and in vitro. Experimental laboratory research. Research laboratory. Wistar rats and cultured human microvascular endothelial cells. Permeability measurements in single postcapillary venules in vivo and permeability measurements and cell biology techniques in vitro. We demonstrate that within 120 minutes LPS increased endothelial permeability in rat mesenteric postcapillary venules in vivo and caused a barrier breakdown in human dermal microvascular endothelial cells in vitro. This was associated with the formation of large intercellular gaps and fragmentation of vascular endothelial cadherin immunostaining. Furthermore, claudin 5 immunostaining at cell borders was drastically reduced after LPS treatment. Interestingly, activity of the small GTPase Rho A, which has previously been suggested to mediate the LPS-induced endothelial barrier breakdown, was not increased after 2 hours. However, activity of Rac 1, which is known to be important for maintenance of endothelial barrier functions, was significantly reduced to 64 +/- 8% after 2 hours. All LPS-induced changes of endothelial cells were blocked by a forskolin-mediated or rolipram-mediated increase of cAMP. Consistently, enzyme-linked immunosorbent assay-based measurements demonstrated that LPS significantly decreased intracellular cAMP. In summary, our data demonstrate that LPS disrupts endothelial barrier properties by decreasing intracellular cAMP. This mechanism may involve inactivation of Rac 1 rather than activation of Rho A.

  19. Toxins and antimicrobial peptides: interactions with membranes

    NASA Astrophysics Data System (ADS)

    Schlamadinger, Diana E.; Gable, Jonathan E.; Kim, Judy E.

    2009-08-01

    The innate immunity to pathogenic invasion of organisms in the plant and animal kingdoms relies upon cationic antimicrobial peptides (AMPs) as the first line of defense. In addition to these natural peptide antibiotics, similar cationic peptides, such as the bee venom toxin melittin, act as nonspecific toxins. Molecular details of AMP and peptide toxin action are not known, but the universal function of these peptides to disrupt cell membranes of pathogenic bacteria (AMPs) or a diverse set of eukaryotes and prokaryotes (melittin) is widely accepted. Here, we have utilized spectroscopic techniques to elucidate peptide-membrane interactions of alpha-helical human and mouse AMPs of the cathelicidin family as well as the peptide toxin melittin. The activity of these natural peptides and their engineered analogs was studied on eukaryotic and prokaryotic membrane mimics consisting of <200-nm bilayer vesicles composed of anionic and neutral lipids as well as cholesterol. Vesicle disruption, or peptide potency, was monitored with a sensitive fluorescence leakage assay. Detailed molecular information on peptidemembrane interactions and peptide structure was further gained through vibrational spectroscopy combined with circular dichroism. Finally, steady-state fluorescence experiments yielded insight into the local environment of native or engineered tryptophan residues in melittin and human cathelicidin embedded in bilayer vesicles. Collectively, our results provide clues to the functional structures of the engineered and toxic peptides and may impact the design of synthetic antibiotic peptides that can be used against the growing number of antibiotic-resistant pathogens.

  20. In vitro pharmacokinetics of antimicrobial cationic peptides alone and in combination with antibiotics against methicillin resistant Staphylococcus aureus biofilms.

    PubMed

    Dosler, Sibel; Mataraci, Emel

    2013-11-01

    Antibiotic therapy for methicillin-resistant Staphylococcus aureus (MRSA) infections is becoming more difficult in hospitals and communities because of strong biofilm-forming properties and multidrug resistance. Biofilm-associated MRSA is not affected by therapeutically achievable concentrations of antibiotics. Therefore, we investigated the in vitro pharmacokinetic activities of antimicrobial cationic peptides (AMPs; indolicidin, cecropin [1-7]-melittin A [2-9] amide [CAMA], and nisin), either alone or in combination with antibiotics (daptomycin, linezolid, teicoplanin, ciprofloxacin, and azithromycin), against standard and 2 clinically obtained MRSA biofilms. The minimum inhibitory concentrations (MIC) and minimum biofilm-eradication concentrations (MBEC) were determined by microbroth dilution technique. The time-kill curve (TKC) method was used to determine the bactericidal activities of the AMPs alone and in combination with the antibiotics against standard and clinically obtained MRSA biofilms. The MIC values of the AMPs and antibiotics ranged between 2 to 16 and 0.25 to 512 mg/L, and their MBEC values were 640 and 512 to 5120 mg/L, respectively. The TKC studies demonstrated that synergistic interactions occurred most frequently when using nisin+daptomycin/ciprofloxacin, indolicidin+teicoplanin, and CAMA+ciprofloxacin combinations. No antagonism was observed with any combination. AMPs appear to be good candidates for the treatment of MRSA biofilms, as they act as both enhancers of anti-biofilm activities and help to prevent or delay the emergence of resistance when used either alone or in combination with antibiotics. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Phloretin differentially inhibits volume-sensitive and cyclic AMP-activated, but not Ca-activated, Cl− channels

    PubMed Central

    Fan, Hai-Tian; Morishima, Shigeru; Kida, Hajime; Okada, Yasunobu

    2001-01-01

    Some phenol derivatives are known to block volume-sensitive Cl− channels. However, effects on the channel of the bisphenol phloretin, which is a known blocker of glucose uniport and anion antiport, have not been examined. In the present study, we investigated the effects of phloretin on volume-sensitive Cl− channels in comparison with cyclic AMP-activated CFTR Cl− channels and Ca2+-activated Cl− channels using the whole-cell patch-clamp technique.Extracellular application of phloretin (over 10 μM) voltage-independently, and in a concentration-dependent manner (IC50 ∼30 μM), inhibited the Cl− current activated by a hypotonic challenge in human epithelial T84, Intestine 407 cells and mouse mammary C127/CFTR cells.In contrast, at 30 μM phloretin failed to inhibit cyclic AMP-activated Cl− currents in T84 and C127/CFTR cells. Higher concentrations (over 100 μM) of phloretin, however, partially inhibited the CFTR Cl− currents in a voltage-dependent manner.At 30 and 300 μM, phloretin showed no inhibitory effect on Ca2+-dependent Cl− currents induced by ionomycin in T84 cells.It is concluded that phloretin preferentially blocks volume-sensitive Cl− channels at low concentrations (below 100 μM) and also inhibits cyclic AMP-activated Cl− channels at higher concentrations, whereas phloretin does not inhibit Ca2+-activated Cl− channels in epithelial cells. PMID:11487521

  2. Typeability of DNA in Touch Traces Deposited on Paper and Optical Data Discs.

    PubMed

    Sołtyszewski, Ireneusz; Szeremeta, Michał; Skawrońska, Małgorzata; Niemcunowicz-Janica, Anna; Pepiński, Witold

    2015-01-01

    Nucleated epithelial cells that are transferred by casual touching and handling of objects are the primary source of biological evidence that is found in high-volume crimes. Cellular material associated with touch traces usually contains low levels of DNA template making it challenging to acquire an informative profile. The main purpose of this study was to examine the efficacy of DNA typing in fingerprints deposited on optical data discs and the office paper. Latent fingerprints were made by 60 subjects of both sexes (30 males and 30 females). A highly effective DNA extraction method with QIAamp DNA Mini Kit (Qiagen) and an increased sensitivity PCR by AmpFlSTR® NGM™ Amplification Kit (Applied Biosystems) carried out at standard 30 cycles and at increased 34 cycles were used. The mean value of total DNA recovery was 0.4 ng from CDs/DVDs and 0.3 ng from the office paper. Amplification of Low Template DNA (LT-DNA) resulted in improved analytical success by increasing the number of PCR cycles from standard 30 to 34. On the other hand, the increased PCR cycles resulted in allele drop-ins showing additional peaks, the majority of which were outside the stutter positions. Rigorous procedures and interpretation guidelines are required during LT-DNA for producing reliable and reproducible DNA profiles for forensic purposes.

  3. A Laboratory Practical Illustrating the Use of the ChIP-qPCR Method in a Robust Model: Estrogen Receptor Alpha Immunoprecipitation Using MCF-7 Culture Cells

    ERIC Educational Resources Information Center

    Lacazette, Eric

    2017-01-01

    Chromatin immunoprecipitation followed by qPCR analysis (ChIP-qPCR) is a widely used technique to study gene expression. A large number of students in molecular biology and more generally in life sciences will be confronted with the use of this technique, which is quite difficult to set up and can lead to misinterpretation if not carefully…

  4. Use of the Genomic Subtractive Hybridization Technique To Develop a Real-Time PCR Assay for Quantitative Detection of Prevotella spp. in Oral Biofilm Samples

    PubMed Central

    Nagashima, Shiori; Yoshida, Akihiro; Suzuki, Nao; Ansai, Toshihiro; Takehara, Tadamichi

    2005-01-01

    Genomic subtractive hybridization was used to design Prevotella nigrescens-specific primers and TaqMan probes. Based on this technique, a TaqMan real-time PCR assay was developed for quantifying four oral black-pigmented Prevotella species. The combination of real-time PCR and genomic subtractive hybridization is useful for preparing species-specific primer-probe sets for closely related species. PMID:15956428

  5. A SIMPLE AND EFFECTIVE MULTIPLEX PCR TECHNIQUE FOR DETECTING HUMAN PATHOGENIC TAENIA EGGS IN HOUSEFLIES.

    PubMed

    Pornruseetriratn, Siritavee; Maipanich, Wanna; Sa-nguankiat, Surapol; Pubampen, Somchit; Poodeepiyasawat, Akkarin; Thaenkham, Urusa

    2017-01-01

    Taenia solium, T. saginata, and T. asiatica are cestode pathogens causing taeniasis in humans. Houseflies can transfer Taenia eggs to food. However, houseflies are thought to carry only small numbers of Taenia eggs, sometimes fewer than 10. Although several PCR-based methods have been developed to detect Taenia DNA, these require more than 10 eggs for adequate detection. We developed a multiplex PCR method with high specificity for the discrimination among the eggs of the three Taenia species, T. solium, T. saginata, and T. asiatica, using 18S ribosomal DNA (rDNA) as a genetic marker. This technique was found to be highly sensitive, capable of identifying the Taenia species from only one egg. This multiplex PCR technique using 18S rDNA specific primers should be suitable to diagnose Taenia eggs.

  6. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  7. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Sensitivity of GBM cells to cAMP agonist-mediated apoptosis correlates with CD44 expression and agonist resistance with MAPK signaling.

    PubMed

    Daniel, Paul M; Filiz, Gulay; Mantamadiotis, Theo

    2016-12-01

    In some cell types, activation of the second messenger cAMP leads to increased expression of proapoptotic Bim and subsequent cell death. We demonstrate that suppression of the cAMP pathway is a common event across many cancers and that pharmacological activation of cAMP in glioblastoma (GBM) cells leads to enhanced BIM expression and apoptosis in specific GBM cell types. We identified the MAPK signaling axis as the determinant of cAMP agonist sensitivity in GBM cells, with high MAPK activity corresponding to cAMP resistance and low activity corresponding to sensitization to cAMP-induced apoptosis. Sensitive cells were efficiently killed by cAMP agonists alone, while targeting both the cAMP and MAPK pathways in resistant GBM cells resulted in efficient apoptosis. We also show that CD44 is differentially expressed in cAMP agonist-sensitive and -resistant cells. We thus propose that CD44 may be a useful biomarker for distinguishing tumors that may be sensitive to cAMP agonists alone or cAMP agonists in combination with other pathway inhibitors. This suggests that using existing chemotherapeutic compounds in combination with existing FDA-approved cAMP agonists may fast track trials toward improved therapies for difficult-to-treat cancers, such as GBM.

  9. Calcitriol affects hCG gene transcription in cultured human syncytiotrophoblasts

    PubMed Central

    Barrera, David; Avila, Euclides; Hernández, Guillermo; Méndez, Isabel; González, Leticia; Halhali, Ali; Larrea, Fernando; Morales, Angélica; Díaz, Lorenza

    2008-01-01

    Background In pregnancy, maternal serum concentrations of calcitriol significantly rise as a result of increased renal and placental contribution in order to assure calcium supply for the developing fetus. Considering that placenta is a site for vitamin D activation, and the versatility and potency of calcitriol, it is feasible that this hormone participates in fetal/placental development and physiology. In the present work we studied calcitriol actions upon human chorionic gonadotropin (hCG) secretion and expression in cultured trophoblasts, as well as vitamin D receptor (VDR) and CYP27B1 immunolocalization in placental villi. Methods Quantification of hCG in culture media was performed by immunoassay. Expression studies were carried out by real time PCR. Analysis of CYP27B1 and VDR localization in placental slides were performed by immunohistochemistry. Statistical significance was established by one way ANOVA using Tukey test for comparisons. Results Calcitriol regulated hCG in a time-dependent manner: at 6 h the secosteroid stimulated hCG, whereas longer incubations (24 h) showed opposite effects. Interestingly, calcitriol stimulatory effects on hCG were accompanied by an increase in intracellular cAMP content and were abolished by pre-incubation of the cells with a selective protein kinase A inhibitor. Immunohistochemical techniques showed differential VDR localization in the syncytiotrophoblast layer or in the vascular smooth muscle cells depending on the epitope to which the antibodies were raised (specific for the carboxy- or amino-terminal regions, respectively). CYP27B1 was immunolocalized in the syncytiotrophoblast layer of placental villi. Conclusion The presence and location of the vitamin D activating enzyme CYP27B1 as well as the specific receptor for vitamin D were shown in placental sections. The latter, together with findings demonstrating specific effects of calcitriol acting through the VDR and the cAMP/PKA signaling pathway upon hCG expression and secretion, indicate that there is a functional vitamin D endocrine system in the placenta, and recognize calcitriol as an autocrine regulator of hCG. PMID:18211694

  10. [Contribution of Leishmania identification using polymerase chain reaction--restriction fragment length polymerase for epidemiological studies of cutaneous leishmaniasis in Tunisia].

    PubMed

    Bousslimi, N; Ben Abda, I; Ben Mously, R; Siala, E; Harrat, Z; Zallagua, N; Bouratbine, A; Aoun, K

    2014-02-01

    Three forms of cutaneous leishmaniasis (CL) are endemic in Tunisia. The identification of the causative species is useful to complete epidemiological data and to manage the cases. The aim of this study is to assess PCR-RFLP technique in the identification of Leishmania species responsible of CL in Tunisia and to compare the results of this technique to those of isoenzyme analysis. Sixty-one CL lesions were sampled. Dermal samples were tested by culture on NNN medium and analyzed by PCR-RFLP assay targeting the ITS1 region of ribosomal DNA. Species identification was performed by both iso-enzymatic typing for positive cultures and analysis of restriction profiles after enzymatic digestion by HaeIII of the obtained amplicons. Thirty-eight (62%) samples were positive by culture. The iso-enzymatic typing of 32 isolates identified 3 L. infantum, 23 L. major MON-25 and 6 L. tropica MON-8. Sixty samples were positive by PCR. The PCR-RFLP digestion profiles of the 56 PCR products identified 12 L. infantum, 38 L. major and 6 L. tropica. The results of both techniques were concordant in the 32 strains identified by both techniques. Species identification correlated with the geographical distribution of CL forms endemic in Tunisia. Results of PCR-RFLP revealed highly concordant with those of isoenzyme electrophoresis. Thanks to its simplicity, rapidity and ability to be performed directly on biological samples, this technique appears as an interesting alternative for the identification of Leishmania strains responsible of CL in Tunisia. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  11. Skeletal muscle expresses the extracellular cyclic AMP–adenosine pathway

    PubMed Central

    Chiavegatti, T; Costa, V L; Araújo, M S; Godinho, R O

    2007-01-01

    Background and purpose: cAMP is a key intracellular signalling molecule that regulates multiple processes of the vertebrate skeletal muscle. We have shown that cAMP can be actively pumped out from the skeletal muscle cell. Since in other tissues, cAMP efflux had been associated with extracellular generation of adenosine, in the present study we have assessed the fate of interstitial cAMP and the existence of an extracellular cAMP-adenosine signalling pathway in skeletal muscle. Experimental approach: cAMP efflux and/or its extracellular degradation were analysed by incubating rat cultured skeletal muscle with exogenous cAMP, forskolin or isoprenaline. cAMP and its metabolites were quantified by radioassay or HPLC, respectively. Key results: Incubation of cells with exogenous cAMP was followed by interstitial accumulation of 5′-AMP and adenosine, a phenomenon inhibited by selective inhibitors of ecto-phosphodiesterase (DPSPX) and ecto-nucleotidase (AMPCP). Activation of adenylyl cyclase (AC) in cultured cells with forskolin or isoprenaline increased cAMP efflux and extracellular generation of 5′-AMP and adenosine. Extracellular cAMP-adenosine pathway was also observed after direct and receptor-dependent stimulation of AC in rat extensor muscle ex vivo. These events were attenuated by probenecid, an inhibitor of ATP binding cassette family transporters. Conclusions and implications: Our results show the existence of an extracellular biochemical cascade that converts cAMP into adenosine. The functional relevance of this extracellular signalling system may involve a feedback modulation of cellular response initiated by several G protein-coupled receptor ligands, amplifying cAMP influence to a paracrine mode, through its metabolite, adenosine. PMID:18157164

  12. Rp-cAMPS Prodrugs Reveal the cAMP Dependence of First-Phase Glucose-Stimulated Insulin Secretion

    PubMed Central

    Schwede, Frank; Chepurny, Oleg G.; Kaufholz, Melanie; Bertinetti, Daniela; Leech, Colin A.; Cabrera, Over; Zhu, Yingmin; Mei, Fang; Cheng, Xiaodong; Manning Fox, Jocelyn E.; MacDonald, Patrick E.; Genieser, Hans-G.; Herberg, Friedrich W.

    2015-01-01

    cAMP-elevating agents such as the incretin hormone glucagon-like peptide-1 potentiate glucose-stimulated insulin secretion (GSIS) from pancreatic β-cells. However, a debate has existed since the 1970s concerning whether or not cAMP signaling is essential for glucose alone to stimulate insulin secretion. Here, we report that the first-phase kinetic component of GSIS is cAMP-dependent, as revealed through the use of a novel highly membrane permeable para-acetoxybenzyl (pAB) ester prodrug that is a bioactivatable derivative of the cAMP antagonist adenosine-3′,5′-cyclic monophosphorothioate, Rp-isomer (Rp-cAMPS). In dynamic perifusion assays of human or rat islets, a step-wise increase of glucose concentration leads to biphasic insulin secretion, and under these conditions, 8-bromoadenosine-3′,5′-cyclic monophosphorothioate, Rp-isomer, 4-acetoxybenzyl ester (Rp-8-Br-cAMPS-pAB) inhibits first-phase GSIS by up to 80%. Surprisingly, second-phase GSIS is inhibited to a much smaller extent (≤20%). Using luciferase, fluorescence resonance energy transfer, and bioluminescence resonance energy transfer assays performed in living cells, we validate that Rp-8-Br-cAMPS-pAB does in fact block cAMP-dependent protein kinase activation. Novel effects of Rp-8-Br-cAMPS-pAB to block the activation of cAMP-regulated guanine nucleotide exchange factors (Epac1, Epac2) are also validated using genetically encoded Epac biosensors, and are independently confirmed in an in vitro Rap1 activation assay using Rp-cAMPS and Rp-8-Br-cAMPS. Thus, in addition to revealing the cAMP dependence of first-phase GSIS from human and rat islets, these findings establish a pAB-based chemistry for the synthesis of highly membrane permeable prodrug derivatives of Rp-cAMPS that act with micromolar or even nanomolar potency to inhibit cAMP signaling in living cells. PMID:26061564

  13. Multiplex Amplification Refractory Mutation System PCR (ARMS-PCR) provides sequencing independent typing of canine parvovirus.

    PubMed

    Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K

    2016-12-01

    Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. A PCR technique based on the Hip1 interspersed repetitive sequence distinguishes cyanobacterial species and strains.

    PubMed

    Smith, J K; Parry, J D; Day, J G; Smith, R J

    1998-10-01

    The use of primers based on the Hip1 sequence as a typing technique for cyanobacteria has been investigated. The discovery of short repetitive sequence structures in bacterial DNA during the last decade has led to the development of PCR-based methods for typing, i.e., distinguishing and identifying, bacterial species and strains. An octameric palindromic sequence known as Hip1 has been shown to be present in the chromosomal DNA of many species of cyanobacteria as a highly repetitious interspersed sequence. PCR primers were constructed that extended the Hip1 sequence at the 3' end by two bases. Five of the 16 possible extended primers were tested. Each of the five primers produced a different set of products when used to prime PCR from cyanobacterial genomic DNA. Each primer produced a distinct set of products for each of the 15 cyanobacterial species tested. The ability of Hip1-based PCR to resolve taxonomic differences was assessed by analysis of independent isolates of Anabaena flos-aquae and Nostoc ellipsosporum obtained from the CCAP (Culture Collection of Algae and Protozoa, IFE, Cumbria, UK). A PCR-based RFLP analysis of products amplified from the 23S-16S rDNA intergenic region was used to characterize the isolates and to compare with the Hip1 typing data. The RFLP and Hip1 typing yielded similar results and both techniques were able to distinguish different strains. On the basis of these results it is suggested that the Hip1 PCR technique may assist in distinguishing cyanobacterial species and strains.

  15. Detection of Hepatitis A Virus by the Nucleic Acid Sequence-Based Amplification Technique and Comparison with Reverse Transcription-PCR

    PubMed Central

    Jean, Julie; Blais, Burton; Darveau, André; Fliss, Ismaïl

    2001-01-01

    A nucleic acid sequence-based amplification (NASBA) technique for the detection of hepatitis A virus (HAV) in foods was developed and compared to the traditional reverse transcription (RT)-PCR technique. Oligonucleotide primers targeting the VP1 and VP2 genes encoding the major HAV capsid proteins were used for the amplification of viral RNA in an isothermal process resulting in the accumulation of RNA amplicons. Amplicons were detected by hybridization with a digoxigenin-labeled oligonucleotide probe in a dot blot assay format. Using the NASBA, as little as 0.4 ng of target RNA/ml was detected per comparison to 4 ng/ml for RT-PCR. When crude HAV viral lysate was used, a detection limit of 2 PFU (4 × 102 PFU/ml) was obtained with NASBA, compared to 50 PFU (1 × 104 PFU/ml) obtained with RT-PCR. No interference was encountered in the amplification of HAV RNA in the presence of excess nontarget RNA or DNA. The NASBA system successfully detected HAV recovered from experimentally inoculated samples of waste water, lettuce, and blueberries. Compared to RT-PCR and other amplification techniques, the NASBA system offers several advantages in terms of sensitivity, rapidity, and simplicity. This technique should be readily adaptable for detection of other RNA viruses in both foods and clinical samples. PMID:11722911

  16. Detection of hepatitis A virus by the nucleic acid sequence-based amplification technique and comparison with reverse transcription-PCR.

    PubMed

    Jean, J; Blais, B; Darveau, A; Fliss, I

    2001-12-01

    A nucleic acid sequence-based amplification (NASBA) technique for the detection of hepatitis A virus (HAV) in foods was developed and compared to the traditional reverse transcription (RT)-PCR technique. Oligonucleotide primers targeting the VP1 and VP2 genes encoding the major HAV capsid proteins were used for the amplification of viral RNA in an isothermal process resulting in the accumulation of RNA amplicons. Amplicons were detected by hybridization with a digoxigenin-labeled oligonucleotide probe in a dot blot assay format. Using the NASBA, as little as 0.4 ng of target RNA/ml was detected per comparison to 4 ng/ml for RT-PCR. When crude HAV viral lysate was used, a detection limit of 2 PFU (4 x 10(2) PFU/ml) was obtained with NASBA, compared to 50 PFU (1 x 10(4) PFU/ml) obtained with RT-PCR. No interference was encountered in the amplification of HAV RNA in the presence of excess nontarget RNA or DNA. The NASBA system successfully detected HAV recovered from experimentally inoculated samples of waste water, lettuce, and blueberries. Compared to RT-PCR and other amplification techniques, the NASBA system offers several advantages in terms of sensitivity, rapidity, and simplicity. This technique should be readily adaptable for detection of other RNA viruses in both foods and clinical samples.

  17. Broad-range PCR: past, present, or future of bacteriology?

    PubMed

    Renvoisé, A; Brossier, F; Sougakoff, W; Jarlier, V; Aubry, A

    2013-08-01

    PCR targeting the gene encoding 16S ribosomal RNA (commonly named broad-range PCR or 16S PCR) has been used for 20 years as a polyvalent tool to study prokaryotes. Broad-range PCR was first used as a taxonomic tool, then in clinical microbiology. We will describe the use of broad-range PCR in clinical microbiology. The first application was identification of bacterial strains obtained by culture but whose phenotypic or proteomic identification remained difficult or impossible. This changed bacterial taxonomy and allowed discovering many new species. The second application of broad-range PCR in clinical microbiology is the detection of bacterial DNA from clinical samples; we will review the clinical settings in which the technique proved useful (such as endocarditis) and those in which it did not (such as characterization of bacteria in ascites, in cirrhotic patients). This technique allowed identifying the etiological agents for several diseases, such as Whipple disease. This review is a synthesis of data concerning the applications, assets, and drawbacks of broad-range PCR in clinical microbiology. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  18. Mechanism of cAMP Partial Agonism in Protein Kinase G (PKG)*♦

    PubMed Central

    VanSchouwen, Bryan; Selvaratnam, Rajeevan; Giri, Rajanish; Lorenz, Robin; Herberg, Friedrich W.; Kim, Choel; Melacini, Giuseppe

    2015-01-01

    Protein kinase G (PKG) is a major receptor of cGMP and controls signaling pathways often distinct from those regulated by cAMP. Hence, the selective activation of PKG by cGMP versus cAMP is critical. However, the mechanism of cGMP-versus-cAMP selectivity is only limitedly understood. Although the C-terminal cyclic nucleotide-binding domain B of PKG binds cGMP with higher affinity than cAMP, the intracellular concentrations of cAMP are typically higher than those of cGMP, suggesting that the cGMP-versus-cAMP selectivity of PKG is not controlled uniquely through affinities. Here, we show that cAMP is a partial agonist for PKG, and we elucidate the mechanism for cAMP partial agonism through the comparative NMR analysis of the apo, cGMP-, and cAMP-bound forms of the PKG cyclic nucleotide-binding domain B. We show that although cGMP activation is adequately explained by a two-state conformational selection model, the partial agonism of cAMP arises from the sampling of a third, partially autoinhibited state. PMID:26370085

  19. Atmospheric, Magnetospheric and Plasmas in space (AMPS) spacelab payload definition study. Volume 4. Part 1, AMPS program specification

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    The AMPS Program Specification delineates the AMPS Program requirements consistent with the resources defined in the AMPS Project Plan. All subsidiary specifications and requirements shall conform to the requirements presented. The requirements hierarchy for the AMPS program is illustrated. A brief description of each of the requirements documents and their intended use is provided.

  20. Cyclic AMP- and (Rp)-cAMPS-induced Conformational Changes in a Complex of the Catalytic and Regulatory (RIα) Subunits of Cyclic AMP-dependent Protein Kinase*

    PubMed Central

    Anand, Ganesh S.; Krishnamurthy, Srinath; Bishnoi, Tanushree; Kornev, Alexandr; Taylor, Susan S.; Johnson, David A.

    2010-01-01

    We took a discovery approach to explore the actions of cAMP and two of its analogs, one a cAMP mimic ((Sp)-adenosine cyclic 3′:5′-monophosphorothioate ((Sp)-cAMPS)) and the other a diastereoisomeric antagonist ((Rp)-cAMPS), on a model system of the type Iα cyclic AMP-dependent protein kinase holoenzyme, RIα(91–244)·C-subunit, by using fluorescence spectroscopy and amide H/2H exchange mass spectrometry. Specifically, for the fluorescence experiments, fluorescein maleimide was conjugated to three cysteine single residue substitution mutants, R92C, T104C, and R239C, of RIα(91–244), and the effects of cAMP, (Sp)-cAMPS, and (Rp)-cAMPS on the kinetics of R-C binding and the time-resolved anisotropy of the reporter group at each conjugation site were measured. For the amide exchange experiments, ESI-TOF mass spectrometry with pepsin proteolytic fragmentation was used to assess the effects of (Rp)-cAMPS on amide exchange of the RIα(91–244)·C-subunit complex. We found that cAMP and its mimic perturbed at least parts of the C-subunit interaction Sites 2 and 3 but probably not Site 1 via reduced interactions of the linker region and αC of RIα(91–244). Surprisingly, (Rp)-cAMPS not only increased the affinity of RIα(91–244) toward the C-subunit by 5-fold but also produced long range effects that propagated through both the C- and R-subunits to produce limited unfolding and/or enhanced conformational flexibility. This combination of effects is consistent with (Rp)-cAMPS acting by enhancing the internal entropy of the R·C complex. Finally, the (Rp)-cAMPS-induced increase in affinity of RIα(91–244) toward the C-subunit indicates that (Rp)-cAMPS is better described as an inverse agonist because it decreases the fractional dissociation of the cyclic AMP-dependent protein kinase holoenzyme and in turn its basal activity. PMID:20167947

  1. Cyclic AMP Enhances TGFβ Responses of Breast Cancer Cells by Upregulating TGFβ Receptor I Expression

    PubMed Central

    Oerlecke, Ilka; Bauer, Elke; Dittmer, Angela; Leyh, Benjamin; Dittmer, Jürgen

    2013-01-01

    Cellular functions are regulated by complex networks of many different signaling pathways. The TGFβ and cAMP pathways are of particular importance in tumor progression. We analyzed the cross-talk between these pathways in breast cancer cells in 2D and 3D cultures. We found that cAMP potentiated TGFβ-dependent gene expression by enhancing Smad3 phosphorylation. Higher levels of total Smad3, as observed in 3D-cultured cells, blocked this effect. Two Smad3 regulating proteins, YAP (Yes-associated protein) and TβRI (TGFβ receptor 1), were responsive to cAMP. While YAP had little effect on TGFβ-dependent expression and Smad3 phosphorylation, a constitutively active form of TβRI mimicked the cAMP effect on TGFβ signaling. In 3D-cultured cells, which show much higher levels of TβRI and cAMP, TβRI was unresponsive to cAMP. Upregulation of TβRI expression by cAMP was dependent on transcription. A proximal TβRI promoter fragment was moderately, but significantly activated by cAMP suggesting that cAMP increases TβRI expression at least partially by activating TβRI transcription. Neither the cAMP-responsive element binding protein (CREB) nor the TβRI-regulating transcription factor Six1 was required for the cAMP effect. An inhibitor of histone deacetylases alone or together with cAMP increased TβRI expression by a similar extent as cAMP alone suggesting that cAMP may exert its effect by interfering with histone acetylation. Along with an additive stimulatory effect of cAMP and TGFβ on p21 expression an additive inhibitory effect of these agents on proliferation was observed. Finally, we show that mesenchymal stem cells that interact with breast cancer cells can simultaneously activate the cAMP and TGFβ pathways. In summary, these data suggest that combined effects of cAMP and TGFβ, as e.g. induced by mesenchymal stem cells, involve the upregulation of TβRI expression on the transcriptional level, likely due to changes in histone acetylation. As a consequence, cancer cell functions such as proliferation are affected. PMID:23349840

  2. [Do Multiplex PCR techniques displace classical cultures in microbiology?].

    PubMed

    Auckenthaler, Raymond; Risch, Martin

    2015-02-01

    Multiplex PCR technologies progressively find their way in clinical microbiology. This technique allows the simultaneous amplification of multiple DNA targets in a single test run for the identification of pathogens up to the species level. Various pathogens of infectious diseases can be detected by a symptom-oriented approach clearly and quickly with high reliability. Essentially multiplex PCR panels are available for clarification of gastrointestinal, respiratory, sexually transmitted infections and meningitis. Today's offer from industry, university hospitals and large private laboratories of Switzerland is tabulated and commented.

  3. Molecular diagnosis of canine visceral leishmaniasis: a comparative study of three methods using skin and spleen from dogs with natural Leishmania infantum infection.

    PubMed

    Reis, Levi Eduardo Soares; Coura-Vital, Wendel; Roatt, Bruno Mendes; Bouillet, Leoneide Érica Maduro; Ker, Henrique Gama; Fortes de Brito, Rory Cristiane; Resende, Daniela de Melo; Carneiro, Mariângela; Giunchetti, Rodolfo Cordeiro; Marques, Marcos José; Carneiro, Cláudia Martins; Reis, Alexandre Barbosa

    2013-11-08

    Polymerase chain reaction (PCR) and its variations represent highly sensitive and specific methods for Leishmania DNA detection and subsequent canine visceral leishmaniasis (CVL) diagnosis. The aim of this work was to compare three different molecular diagnosis techniques (conventional PCR [cPCR], seminested PCR [snPCR], and quantitative PCR [qPCR]) in samples of skin and spleen from 60 seropositive dogs by immunofluorescence antibody test and enzyme-linked immunosorbent assay. Parasitological analysis was conducted by culture of bone marrow aspirate and optical microscopic assessment of ear skin and spleen samples stained with Giemsa, the standard tests for CVL diagnosis. The primers L150/L152 and LINR4/LIN17/LIN19 were used to amplify the conserved region of the Leishmania kDNA minicircle in the cPCR, and snPCR and qPCR were performed using the DNA polymerase gene (DNA pol α) primers from Leishmania infantum. The parasitological analysis revealed parasites in 61.7% of the samples. Sensitivities were 89.2%, 86.5%, and 97.3% in the skin and 81.1%, 94.6%, and 100.0% in spleen samples used for cPCR, snPCR, and qPCR, respectively. We demonstrated that the qPCR method was the best technique to detect L. infantum in both skin and spleen samples. However, we recommend the use of skin due to the high sensitivity and sampling being less invasive. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. The N-terminus of glycogen phosphorylase b is not required for activation by adenosine 5'-monophosphate.

    PubMed

    Bigley, Andrew N; Reinhart, Gregory D

    2010-06-15

    The, so far unsuccessful, search for selective effective inhibitors of glycogen phosphorylase for the treatment of type II diabetes has made phosphorylase an active target of research for the past 20 years. Many crystallographic structures of phosphorylase are currently available to aid in this research. However, those structures have been interpreted, at least in part, on the basis of work conducted with a proteolytically derived form of phosphorylase that lacked the N-terminus (phosphorylase b'). It has been reported that phosphorylase b' shows no allostery, neither homotropic nor heterotropic. The original report on phosphorylase b' examined the allosteric characteristics over very narrow ranges of effector and substrate concentrations and reported the presence of proteolytic cleavages in addition to the removal of the N-terminus. We have applied molecular biological techniques to generate a truncate lacking the N-terminus with known primary structure, and we have established conditions for fully quantifying the allosteric effect of AMP on glycogen phosphorylase b. We report here for the first time the full thermodynamic effect of AMP on phosphorylase b. Our findings with a truncate lacking the N-terminus show that the effect of AMP binding does not depend on the N-terminus.

  5. β-Cyclodextrin and permeability to water in the bladder of Bufo arenarum.

    PubMed

    Orce, G; Castillo, G; Chanampa, Y

    2011-05-01

    We measured the effect of β-cyclodextrin (BCD, a cholesterol scavenger) on water flow across the isolated toad bladder exposed to an osmotic gradient (J(w)) by a gravimetric technique. BCD, when present in the solution bathing the apical side of the bladder, inhibited the increase in J(w) caused by nystatin, a polyene antibiotic that acts by directly binding apical membrane cholesterol. When present in the basolateral bath, BCD inhibited the increase in J(w) caused by basolateral exposure to oxytocin (which binds membrane receptors and stimulates the synthesis of cAMP), but did not alter the response to theophylline (which inhibits hydrolysis of cAMP by cyclic nucleotide phosphodiesterase). The present data are consistent with the notion that agents that increase J(w) by interacting with membrane receptors, which appear to be clustered in cholesterol-rich domains of the basolateral membrane, are altered by cholesterol depletion, whereas agents that do not interact with receptors or other basolateral membrane components are not affected by this treatment. In either case, cholesterol depletion of the apical membrane does not affect the increase in J(w) brought about by an increase in intracellular cAMP concentration.

  6. Signaling molecules involved in the transition of growth to development of Dictyostelium discoideum.

    PubMed

    Mir, Hina A; Rajawat, Jyotika; Pradhan, Shalmali; Begum, Rasheedunnisa

    2007-03-01

    The social amoeba Dictyostelium discoideum, a powerful paradigm provides clear insights into the regulation of growth and development. In addition to possessing complex individual cellular functions like a unicellular eukaryote, D. discoideum cells face the challenge of multicellular development. D. discoideum undergoes a relatively simple differentiation process mainly by cAMP mediated pathway. Despite this relative simplicity, the regulatory signaling pathways are as complex as those seen in metazoan development. However, the introduction of restriction-enzyme-mediated integration (REMI) technique to produce developmental gene knockouts has provided novel insights into the discovery of signaling molecules and their role in D. discoideum development. Cell cycle phase is an important aspect for differentiation of D. discoideum, as cells must reach a specific stage to enter into developmental phase and specific cell cycle regulators are involved in arresting growth phase genes and inducing the developmental genes. In this review, we present an overview of the signaling molecules involved in the regulation of growth to differentiation transition (GDT), molecular mechanism of early developmental events leading to generation of cAMP signal and components of cAMP relay system that operate in this paradigm.

  7. Modification of gDNA extraction from soil for PCR designed for the routine examination of soil samples contaminated with Toxocara spp. eggs.

    PubMed

    Borecka, A; Gawor, J

    2008-06-01

    A modification of gDNA extraction was developed for the polymerase chain reaction (PCR) technique, intended for the detection and differentiation of Toxocara spp. eggs in soil or sediments. Sand samples from sandpits confirmed as being contaminated with Toxocara spp. eggs by the flotation technique were analysed by PCR. The use of proteinase K made it possible to obtain genomic DNA from the sample without needing to isolate eggs using flotation or to inactivate PCR inhibitors present in the sand. Specific primers in the PCR reaction allowed discrimination between T. canis and T. cati eggs. The modification simplified the procedure, thanks to eliminating the step of gDNA isolation from eggs, which is both laborious and difficult.

  8. In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.

    PubMed

    Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl

    2017-01-01

    The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .

  9. Comparison of nested competitive RT-PCR and real-time RT-PCR for the detection and quantification of AML1/MTG8 fusion transcripts in t(8;21) positive acute myelogenous leukemia.

    PubMed

    Wattjes, M P; Krauter, J; Nagel, S; Heidenreich, O; Ganser, A; Heil, G

    2000-02-01

    The chromosomal translocation t(8;21)(q22;q22) is one of the most frequent karyotypic aberrations in acute myeloid leukemia (AML) and results in a chimeric fusion transcript AML1/MTG8. Since AML1/MTG8 fusion transcripts remain detectable by RT-PCR in t(8;21) AML patients in long-term hematological remission, quantitative assessment of AML1/MTG8 transcripts is necessary for the monitoring of minimal residual disease (MRD) in these patients. Competitive RT-PCR and recently real-time RT-PCR are increasingly used for detection and quantification of leukemia specific fusion transcripts. For the direct comparison of both methods we cloned a 42 bp DNA fragment into the original AML1/MTG8 sequence. The resulting molecule was used as an internal competitor for our novel competitive nested RT-PCR for AML1/MTG8 and as an external standard for the generation of AML1/MTG8 standard curves in a real-time PCR assay. Using this standard molecule for both PCR techniques, we compared their sensitivity, linearity and reproducibility. Both methods were comparable with regard to all parameters tested irrespective of analyzing serial dilutions of plasmids, cell lines or samples from t(8;21) positive AML patients at different stages of the disease. Therefore, both techniques can be recommended for the monitoring of MRD in these particular AML patients. However, the automatization of the real-time PCR technique offers some technical advantages.

  10. 5D imaging approaches reveal the formation of distinct intracellular cAMP spatial gradients

    NASA Astrophysics Data System (ADS)

    Rich, Thomas C.; Annamdevula, Naga; Trinh, Kenny; Britain, Andrea L.; Mayes, Samuel A.; Griswold, John R.; Deal, Joshua; Hoffman, Chase; West, Savannah; Leavesley, Silas J.

    2017-02-01

    Cyclic AMP (cAMP) is a ubiquitous second messenger known to differentially regulate many cellular functions. Several lines of evidence suggest that the distribution of cAMP within cells is not uniform. However, to date, no studies have measured the kinetics of 3D cAMP distributions within cells. This is largely due to the low signal-tonoise ratio of FRET-based probes. We previously reported that hyperspectral imaging improves the signal-to-noise ratio of FRET measurements. Here we utilized hyperspectral imaging approaches to measure FRET signals in five dimensions (5D) - three spatial (x, y, z), wavelength (λ), and time (t) - allowing us to visualize cAMP gradients in pulmonary endothelial cells. cAMP levels were measured using a FRET-based sensor (H188) comprised of a cAMP binding domain sandwiched between FRET donor and acceptor - Turquoise and Venus fluorescent proteins. We observed cAMP gradients in response to 0.1 or 1 μM isoproterenol, 0.1 or 1 μM PGE1, or 50 μM forskolin. Forskolin- and isoproterenol-induced cAMP gradients formed from the apical (high cAMP) to basolateral (low cAMP) face of cells. In contrast, PGE1-induced cAMP gradients originated from both the basolateral and apical faces of cells. Data suggest that 2D (x,y) studies of cAMP compartmentalization may lead to erroneous conclusions about the existence of cAMP gradients, and that 3D (x,y,z) studies are required to assess mechanisms of signaling specificity. Results demonstrate that 5D imaging technologies are powerful tools for measuring biochemical processes in discrete subcellular domains.

  11. Inhibition of basolateral cAMP permeability in the toad urinary bladder.

    PubMed

    Boom, A; Golstein, P E; Frerotte, M; Sande, J V; Beauwens, R

    2000-10-01

    1. The effect of sulphonylurea drugs on hydrosmotic flow across toad urinary bladder epithelium was re-evaluated in the present study. Glibenclamide, added to the basolateral medium, significantly enhanced the osmotic flow induced by low doses of antidiuretic hormone (ADH) or forskolin (FK), while it inhibited the effect of exogenous cyclic adenosine monophosphate (cAMP) or its non-hydrolysable bromo derivative, 8-Br-cAMP, added to the basolateral medium. These opposite effects of glibenclamide on the transepithelial osmotic flow can be explained by a reduction of cAMP permeability across the basolateral membrane of the epithelium. The decrease in cAMP permeability leads, according to the direction of the cAMP gradient, to firstly an enhanced osmotic flow when cAMP is generated intracellularly by addition of ADH and FK, glibenclamide reducing cAMP exit from the cell, and secondly a decreased osmotic flow in response to cAMP (and 8-Br-cAMP) added to the basolateral medium, glibenclamide inhibiting, in this case, their entry into the cell. 2. The demonstration that glibenclamide actually inhibits the basolateral cAMP permeability rests on the fact that firstly it decreases the release of cAMP into the basolateral medium by about 40 %, at each concentration of ADH or forskolin tested, secondly it increases the cAMP content of paired hemibladders incubated in the presence of ADH or FK, when intracellular degradation was prevented by phosphodiesterase inhibition, and thirdly it decreases also the uptake of basolateral 8-Br-[3H]cAMP into paired toad hemibladders. 3. Taken together, the present data demonstrate that glibenclamide inhibits the toad urinary bladder basolateral membrane permeability to cAMP, most probably by a direct interaction with a membrane protein not yet indentified but distinct from the sulphonylurea receptor.

  12. AmpA protein functions by different mechanisms to influence early cell type specification and to modulate cell adhesion and actin polymerization in Dictyostelium discoideum

    PubMed Central

    Cost, Hoa N.; Noratel, Elizabeth F.; Blumberg, Daphne D.

    2013-01-01

    The Dictyostelium discoideum ampA gene encodes a multifunctional regulator protein that modulates cell–cell and cell–substrate adhesions and actin polymerization during growth and is necessary for correct cell type specification and patterning during development. Insertional inactivation of the ampA gene results in defects that define two distinct roles for the ampA gene during development. AmpA is necessary in a non-cell autonomous manner to prevent premature expression of a prespore gene marker. It is also necessary in a cell autonomous manner for the anterior like cells, which express the ampA gene, to migrate to the upper cup during culmination. It is also necessary to prevent excessive cell–cell agglutination when cells are developed in a submerged suspension culture. Here, we demonstrate that a supernatant source of AmpA protein, added extracellularly, can prevent the premature mis-expression of the prespore marker. Synthetic oligopeptides are used to identify the domain of the AmpA protein that is important for preventing cells from mis-expressing the prespore gene. We further demonstrate that a factor capable of inducing additional cells to express the prespore gene marker accumulates extracellularly in the absence of AmpA protein. While the secreted AmpA acts extracellularly to suppress prespore gene expression, the effects of AmpA on cell agglutination and on actin polymerization in growing cells are not due to an extracellular role of secreted AmpA protein. Rather, these effects appear to reflect a distinct cell autonomous role of the ampA gene. Finally, we show that secretion of AmpA protein is brought about by elevating the levels of expression of ampA so that the protein accumulates to an excessive level. PMID:23911723

  13. Parallel Allostery by cAMP and PDE Coordinates Activation and Termination Phases in cAMP Signaling.

    PubMed

    Krishnamurthy, Srinath; Tulsian, Nikhil Kumar; Chandramohan, Arun; Anand, Ganesh S

    2015-09-15

    The second messenger molecule cAMP regulates the activation phase of the cAMP signaling pathway through high-affinity interactions with the cytosolic cAMP receptor, the protein kinase A regulatory subunit (PKAR). Phosphodiesterases (PDEs) are enzymes responsible for catalyzing hydrolysis of cAMP to 5' AMP. It was recently shown that PDEs interact with PKAR to initiate the termination phase of the cAMP signaling pathway. While the steps in the activation phase are well understood, steps in the termination pathway are unknown. Specifically, the binding and allosteric networks that regulate the dynamic interplay between PKAR, PDE, and cAMP are unclear. In this study, PKAR and PDE from Dictyostelium discoideum (RD and RegA, respectively) were used as a model system to monitor complex formation in the presence and absence of cAMP. Amide hydrogen/deuterium exchange mass spectrometry was used to monitor slow conformational transitions in RD, using disordered regions as conformational probes. Our results reveal that RD regulates its interactions with cAMP and RegA at distinct loci by undergoing slow conformational transitions between two metastable states. In the presence of cAMP, RD and RegA form a stable ternary complex, while in the absence of cAMP they maintain transient interactions. RegA and cAMP each bind at orthogonal sites on RD with resultant contrasting effects on its dynamics through parallel allosteric relays at multiple important loci. RD thus serves as an integrative node in cAMP termination by coordinating multiple allosteric relays and governing the output signal response. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  14. Fibroblast growth factor and cyclic AMP (cAMP) synergistically activate gene expression at a cAMP response element.

    PubMed Central

    Tan, Y; Low, K G; Boccia, C; Grossman, J; Comb, M J

    1994-01-01

    Growth factors and cyclic AMP (cAMP) are known to activate distinct intracellular signaling pathways. Fibroblast growth factor (FGF) activates ras-dependent kinase cascades, resulting in the activation of MAP kinases, whereas cAMP activates protein kinase A. In this study, we report that growth factors and cAMP act synergistically to stimulate proenkephalin gene expression. Positive synergy between growth factor- and cAMP-activated signaling pathways on gene expression has not been previously reported, and we suggest that these synergistic interactions represent a useful model for analyzing interactions between these pathways. Transfection and mutational studies indicate that both FGF-dependent gene activation and cAMP-dependent gene activation require cAMP response element 2 (CRE-2), a previously characterized cAMP-dependent regulatory element. Furthermore, multiple copies of this element are sufficient to confer FGF regulation upon a minimal promoter, indicating that FGF and cAMP signaling converge upon transcription factors acting at CRE-2. Among many different ATF/AP-1 factors tested, two factors, ATF-3 and c-Jun, stimulate proenkephalin transcription in an FGF- or Ras-dependent fashion. Finally, we show that ATF-3 and c-Jun form heterodimeric complexes in SK-N-MC cells and that the levels of both proteins are increased in response to FGF but not cAMP. Together, these results indicate that growth factor- and cAMP-dependent signaling pathways converge at CRE-2 to synergistically stimulate gene expression and that ATF-3 and c-Jun regulate proenkephalin transcription in response to both growth factor- and cAMP-dependent intracellular signaling pathways. Images PMID:7935470

  15. The cAMP analogs have potent anti-proliferative effects on medullary thyroid cancer cell lines.

    PubMed

    Dicitore, Alessandra; Grassi, Elisa Stellaria; Caraglia, Michele; Borghi, Maria Orietta; Gaudenzi, Germano; Hofland, Leo J; Persani, Luca; Vitale, Giovanni

    2016-01-01

    The oncogenic activation of the rearranged during transfection (RET) proto-oncogene has a main role in the pathogenesis of medullary thyroid cancer (MTC). Several lines of evidence suggest that RET function could be influenced by cyclic AMP (cAMP)-dependent protein kinase A (PKA) activity. We evaluated the in vitro anti-tumor activity of 8-chloroadenosine-3',5'-cyclic monophosphate (8-Cl-cAMP) and PKA type I-selective cAMP analogs [equimolar combination of the 8-piperidinoadenosine-3',5'-cyclic monophosphate (8-PIP-cAMP) and 8-hexylaminoadenosine-3',5'-cyclic monophosphate (8-HA-cAMP) in MTC cell lines (TT and MZ-CRC-1)]. 8-Cl-cAMP and the PKA I-selective cAMP analogs showed a potent anti-proliferative effect in both cell lines. In detail, 8-Cl-cAMP blocked significantly the transition of TT cell population from G2/M to G0/G1 phase and from G0/G1 to S phase and of MZ-CRC-1 cells from G0/G1 to S phase. Moreover, 8-Cl-cAMP induced apoptosis in both cell lines, as demonstrated by FACS analysis for annexin V-FITC/propidium iodide, the activation of caspase-3 and PARP cleavage. On the other hand, the only effect induced by PKA I-selective cAMP analogs was a delay in G0/G1-S and S-G2/M progression in TT and MZ-CRC-1 cells, respectively. In conclusion, these data demonstrate that cAMP analogs, particularly 8-Cl-cAMP, significantly suppress in vitro MTC proliferation and provide rationale for a potential clinical use of cAMP analogs in the treatment of advanced MTC.

  16. Biocontrol Potentials of Antimicrobial Peptide Producing Bacillus Species: Multifaceted Antagonists for the Management of Stem Rot of Carnation Caused by Sclerotinia sclerotiorum

    PubMed Central

    Vinodkumar, S.; Nakkeeran, S.; Renukadevi, P.; Malathi, V. G.

    2017-01-01

    Bacillus species are widely exploited as biocontrol agents because of their efficiency in impeding various plant pathogens with multifaceted approach. In this study, Bacillus species were isolated from rhizosphere of various plants viz., carnations, cotton, turmeric, and bananas in Tamil Nadu state of India. Their potential to control the mycelial growth of Sclerotinia sclerotiorum was assessed in vitro by dual plate and partition plate techniques. B. amyloliquefaciens strain VB7 was much effective in inhibiting mycelial growth (45% inhibition of over control) and sclerotial production (100%). PCR detection of AMP genes revealed that B. amyloliquefaciens (VB7) had a maximum of 10 diverse antibiotic biosynthesis genes, namely, ituD, ipa14, bacA, bacD, bamC, sfP, spaC, spaS, alba, and albF, that resulted in production of the antibiotics iturin, bacilysin, bacillomycin, surfactin, subtilin, and subtilosin. Further, metabolites from B. amyloliquefaciens strains VB2 and VB7, associated with inhibition of S. sclerotiorum, were identified as phenols and fatty acids by gas chromatography mass spectrometry (GC-MS). Delivery of bacterial suspension of the effective strains of Bacillus spp. as root dip was found promising for the management of stem rot of cultivated carnations. Minimal percent disease incidence (4.6%) and maximum plant growth promotion was observed in the plants treated with B. amyloliquefaciens (VB7). PMID:28392780

  17. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) spacelab payload definition study. Volume 3: Interface control documents. Part 2: AMPS payload to spacelab ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    The AMPS to Spacelab Interface Control Document which is to be used as a guide for format and information content in generating specific AMPS Mission ICDs is presented. This document is meant to supplement the Spacelab Payload Accommodations Handbook in that it only defines interfaces which are not discussed in the handbook to the level required for design purposes. The AMPS Top Level Requirements Tree, illustrates this ICD by a shaded area and its relationship to the other AMPS technical documents. Other interface documents shown are the Level II, AMPS to Space Shuttle Vehicle ICD and the Level III, AMPS to Instruments ICD.

  18. Steps to achieve quantitative measurements of microRNA using two step droplet digital PCR.

    PubMed

    Stein, Erica V; Duewer, David L; Farkas, Natalia; Romsos, Erica L; Wang, Lili; Cole, Kenneth D

    2017-01-01

    Droplet digital PCR (ddPCR) is being advocated as a reference method to measure rare genomic targets. It has consistently been proven to be more sensitive and direct at discerning copy numbers of DNA than other quantitative methods. However, one of the largest obstacles to measuring microRNA (miRNA) using ddPCR is that reverse transcription efficiency depends upon the target, meaning small RNA nucleotide composition directly effects primer specificity in a manner that prevents traditional quantitation optimization strategies. Additionally, the use of reagents that are optimized for miRNA measurements using quantitative real-time PCR (qRT-PCR) appear to either cause false positive or false negative detection of certain targets when used with traditional ddPCR quantification methods. False readings are often related to using inadequate enzymes, primers and probes. Given that two-step miRNA quantification using ddPCR relies solely on reverse transcription and uses proprietary reagents previously optimized only for qRT-PCR, these barriers are substantial. Therefore, here we outline essential controls, optimization techniques, and an efficacy model to improve the quality of ddPCR miRNA measurements. We have applied two-step principles used for miRNA qRT-PCR measurements and leveraged the use of synthetic miRNA targets to evaluate ddPCR following cDNA synthesis with four different commercial kits. We have identified inefficiencies and limitations as well as proposed ways to circumvent identified obstacles. Lastly, we show that we can apply these criteria to a model system to confidently quantify miRNA copy number. Our measurement technique is a novel way to quantify specific miRNA copy number in a single sample, without using standard curves for individual experiments. Our methodology can be used for validation and control measurements, as well as a diagnostic technique that allows scientists, technicians, clinicians, and regulators to base miRNA measures on a single unit of measurement rather than a ratio of values.

  19. Steps to achieve quantitative measurements of microRNA using two step droplet digital PCR

    PubMed Central

    Duewer, David L.; Farkas, Natalia; Romsos, Erica L.; Wang, Lili; Cole, Kenneth D.

    2017-01-01

    Droplet digital PCR (ddPCR) is being advocated as a reference method to measure rare genomic targets. It has consistently been proven to be more sensitive and direct at discerning copy numbers of DNA than other quantitative methods. However, one of the largest obstacles to measuring microRNA (miRNA) using ddPCR is that reverse transcription efficiency depends upon the target, meaning small RNA nucleotide composition directly effects primer specificity in a manner that prevents traditional quantitation optimization strategies. Additionally, the use of reagents that are optimized for miRNA measurements using quantitative real-time PCR (qRT-PCR) appear to either cause false positive or false negative detection of certain targets when used with traditional ddPCR quantification methods. False readings are often related to using inadequate enzymes, primers and probes. Given that two-step miRNA quantification using ddPCR relies solely on reverse transcription and uses proprietary reagents previously optimized only for qRT-PCR, these barriers are substantial. Therefore, here we outline essential controls, optimization techniques, and an efficacy model to improve the quality of ddPCR miRNA measurements. We have applied two-step principles used for miRNA qRT-PCR measurements and leveraged the use of synthetic miRNA targets to evaluate ddPCR following cDNA synthesis with four different commercial kits. We have identified inefficiencies and limitations as well as proposed ways to circumvent identified obstacles. Lastly, we show that we can apply these criteria to a model system to confidently quantify miRNA copy number. Our measurement technique is a novel way to quantify specific miRNA copy number in a single sample, without using standard curves for individual experiments. Our methodology can be used for validation and control measurements, as well as a diagnostic technique that allows scientists, technicians, clinicians, and regulators to base miRNA measures on a single unit of measurement rather than a ratio of values. PMID:29145448

  20. Real-time PCR assay is superior to other methods for the detection of mycoplasma contamination in the cell lines of the National Cell Bank of Iran.

    PubMed

    Molla Kazemiha, Vahid; Bonakdar, Shahin; Amanzadeh, Amir; Azari, Shahram; Memarnejadian, Arash; Shahbazi, Shirin; Shokrgozar, Mohammad Ali; Mahdian, Reza

    2016-08-01

    Mycoplasmas are the most important contaminants of cell cultures throughout the world. They are considered as a major problem in biological studies and biopharmaceutical economic issues. In this study, our aim was to find the best standard technique as a rapid method with high sensitivity, specificity and accuracy for the detection of mycoplasma contamination in the cell lines of the National Cell Bank of Iran. Thirty cell lines suspected to mycoplasma contamination were evaluated by five different techniques including microbial culture, indirect DNA DAPI staining, enzymatic mycoalert(®) assay, conventional PCR and real-time PCR. Five mycoplasma-contaminated cell lines were assigned as positive controls and five mycoplasma-free cell lines as negative controls. The enzymatic method was performed using the mycoalert(®) mycoplasma detection kit. Real-time PCR technique was conducted by PromoKine diagnostic kits. In the conventional PCR method, mycoplasma genus-specific primers were designed to analyze the sequences based on a fixed and common region on 16S ribosomal RNA with PCR product size of 425 bp. Mycoplasma contamination was observed in 60, 56.66, 53.33, 46.66 and 33.33 % of 30 different cell cultures by real-time PCR, PCR, enzymatic mycoalert(®), indirect DNA DAPI staining and microbial culture methods, respectively. The analysis of the results of the different methods showed that the real-time PCR assay was superior the other methods with the sensitivity, specificity, accuracy, predictive value of positive and negative results of 100 %. These values were 94.44, 100, 96.77, 100 and 92.85 % for the conventional PCR method, respectively. Therefore, this study showed that real-time PCR and PCR assays based on the common sequences in the 16S ribosomal RNA are reliable methods with high sensitivity, specificity and accuracy for detection of mycoplasma contamination in cell cultures and other biological products.

  1. Regulation of Maltodextrin Phosphorylase Synthesis in Escherichia coli by Cyclic Adenosine 3′, 5′-Monophosphate and Glucose1

    PubMed Central

    Chao, Julie; Weathersbee, Carolyn J.

    1974-01-01

    Cyclic adenosine 3′, 5′-monophosphate (AMP) stimulates maltodextrin phosphorylase synthesis in Escherichia coli cells induced with maltose. A maximal effect occurs at 2 to 3 mM cyclic AMP. The action of cyclic AMP is specific, inasmuch as adenosine triphosphate, 3′-AMP, 5′-AMP, adenosine, and dibutyryl cyclic AMP are inactive. Glucose, α-methyl glucoside, 2-deoxyglucose, and pyridoxal 5′-phosphate repress maltodextrin phosphorylase synthesis. This repression is reversed by cyclic AMP. The action of cyclic AMP appears to be at the transcriptional level, since cyclic AMP fails to stimulate phosphorylase production in induced cells in which messenger ribonucleic acid synthesis has been arrested by rifampin or by inducer removal. The two other enzymes involved in the metabolism of maltose, amylomaltase and maltose permease, are also induced in this strain of E. coli and affected by glucose and cyclic AMP in a manner similar to phosphorylase. PMID:4358043

  2. Effect of 3,3',5-triiodothyronine and 3,5-diiodothyronine on progesterone production, cAMP synthesis, and mRNA expression of STAR, CYP11A1, and HSD3B genes in granulosa layer of chicken preovulatory follicles.

    PubMed

    Sechman, A; Pawlowska, K; Hrabia, A

    2011-10-01

    In vitro studies were performed to assess whether stimulatory effects of triiodothyronine (T3) on progesterone (P4) production in a granulosa layer (GL) of chicken preovulatory follicles are associated with 3',5'-cyclic adenosine monophosphate (cAMP) synthesis and mRNA expression of STAR protein, CYP11A1, and HSD3B. Effects of 3,5-diiodothyronine (3,5-T2) on steroidogenic function in these follicles were also investigated. The GL of F3 to F1 follicles was incubated in medium supplemented with T3 or 3,5-T2, LH, or forskolin (F), and a combination of each iodothyronine with LH or F. Levels of P4 and cAMP in culture media were determined by RIA. Expression of genes involved in P4 synthesis (ie, STAR protein, CYP11A1, and HSD3B) in the GL of F3 to F1 follicles incubated in medium with T3 or 3,5-T2 and their combination with LH was performed by real-time PCR. Triiodothyronine increased basal and LH- and F-stimulated P4 secretion by preovulatory follicles. The 3,5-T2 elevated P4 synthesis by F3, had no effect on F2 follicles, and diminished P4 production by the GL of F1 follicles. It had no effect on LH-stimulated P4 production; however, it augmented F-stimulated P4 production by F2 and F1 follicles. Although T3 did not affect basal and F-stimulated cAMP synthesis by the GL of preovulatory follicles, it increased LH-stimulated synthesis of this nucleotide. However, 3,5-T2 elevated F-stimulated cAMP synthesis in F3 and F2 follicles; it did not change basal and LH-stimulated cAMP production. Triiodothyronine decreased basal STAR and CYP11A1 mRNAs in F3 follicles, increased them in F1 follicles, and elevated HSD3B mRNA levels in F1 follicles. Triiodothyronine augmented LH-stimulated STAR, CYP11A1, and HSD3B mRNA levels in F2 and CYP11A1 in F1 follicles. However, T3 decreased LH-stimulated STAR and HSD3B mRNA levels in F1 follicles. The 3,5-T2 did not affect basal STAR and CYP11A1 mRNA expression in all investigated follicles; however, it decreased LH-stimulated STAR expression in F2 and F1 ones. The effects of 3,5-T2 caused elevated basal but diminished LH-stimulated HSD3B mRNA levels. In conclusion, data indicate that both iodothyronines are involved in P4 production in the GL of chicken preovulatory follicles acting alone and additively with LH. Effects of iodothyronines depend on follicle maturation and are associated with modulation of cAMP synthesis and STAR, CYP11A1, and HSD3B mRNA expression. We suggest that iodothyronines participate in maturation and ovulation of chicken follicles. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Adsorption characteristics of green 5-arylaminomethylene pyrimidine-2,4,6-triones on mild steel surface in acidic medium: Experimental and computational approach

    NASA Astrophysics Data System (ADS)

    Verma, Chandrabhan; Olasunkanmi, Lukman O.; Ebenso, Eno E.; Quraishi, M. A.

    2018-03-01

    The effect of electron withdrawing nitro (-NO2) and electron releasing hydroxyl (-OH) groups on corrosion inhibition potentials of 5-arylaminomethylenepyrimidine-2,4,6-trione (AMP) had been studied. Four AMPs tagged AMP-1, AMP-2, AMP-3 and AMP-4 were studied for their ability to inhibit mild steel corrosion in 1 M HCl using experimental and theoretical methods. Gravimetric results showed that inhibition efficiency of the studied inhibitors increases with increasing concentration. The results further revealed that that electron withdrawing nitro (-NO2) group decreases the inhibition efficiency of AMP, while electron donating hydroxyl (-OH) group increases the inhibition efficiency of AMP. SEM and AFM studies showed that the studied compounds inhibit mild steel corrosion by adsorbing at the metal/electrolyte interface and their adsorption obeyed the Temkin adsorption isotherm. Potentiodynamic polarization study revealed that studied inhibitors act as mixed type inhibitors with predominant effect on cathodic reaction. The inhibitive strength of the compounds might have direct relationship electron donating ability of the molecules as revealed by quantum chemical parameters. The order of interaction energies derived from Monte Carlo simulations is AMP-4 > AMP-3 > AMP-2 > AMP-1, which is in agreement with the order of inhibition efficiencies obtained from experimental measurements.

  4. Gene Expression Patterns Define Key Transcriptional Events InCell-Cycle Regulation By cAMP And Protein Kinase A

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zambon, Alexander C.; Zhang, Lingzhi; Minovitsky, Simon

    Although a substantial number of hormones and drugs increase cellular cAMP levels, the global impact of cAMP and its major effector mechanism, protein kinase A (PKA), on gene expression is not known. Here we show that treatment of murine wild-type S49 lymphoma cells for 24 h with 8-(4-chlorophenylthio)-cAMP (8-CPTcAMP), a PKA-selective cAMP analog, alters the expression of approx equal to 4,500 of approx. equal to 13,600 unique genes. By contrast, gene expression was unaltered in Kin- S49 cells (that lack PKA) incubated with 8-CPTcAMP. Changes in mRNA and protein expression of several cell cycle regulators accompanied cAMP-induced G1-phase cell-cycle arrestmore » of wild-type S49 cells. Within 2h, 8-CPT-cAMP altered expression of 152 genes that contain evolutionarily conserved cAMP-response elements within 5 kb of transcriptional start sites, including the circadian clock gene Per1. Thus, cAMP through its activation of PKA produces extensive transcriptional regulation in eukaryotic cells. These transcriptional networks include a primary group of cAMP-response element-containing genes and secondary networks that include the circadian clock.« less

  5. Cyclic AMP efflux inhibitors as potential therapeutic agents for leukemia.

    PubMed

    Perez, Dominique R; Smagley, Yelena; Garcia, Matthew; Carter, Mark B; Evangelisti, Annette; Matlawska-Wasowska, Ksenia; Winter, Stuart S; Sklar, Larry A; Chigaev, Alexandre

    2016-06-07

    Apoptotic evasion is a hallmark of cancer. We propose that some cancers may evade cell death by regulating 3'-5'-cyclic adenosine monophosphate (cAMP), which is associated with pro-apoptotic signaling. We hypothesize that leukemic cells possess mechanisms that efflux cAMP from the cytoplasm, thus protecting them from apoptosis. Accordingly, cAMP efflux inhibition should result in: cAMP accumulation, activation of cAMP-dependent downstream signaling, viability loss, and apoptosis. We developed a novel assay to assess cAMP efflux and performed screens to identify inhibitors. In an acute myeloid leukemia (AML) model, several identified compounds reduced cAMP efflux, appropriately modulated pathways that are responsive to cAMP elevation (cAMP-responsive element-binding protein phosphorylation, and deactivation of Very Late Antigen-4 integrin), and induced mitochondrial depolarization and caspase activation. Blocking adenylyl cyclase activity was sufficient to reduce effects of the most potent compounds. These compounds also decreased cAMP efflux and viability of B-lineage acute lymphoblastic leukemia (B-ALL) cell lines and primary patient samples, but not of normal primary peripheral blood mononuclear cells. Our data suggest that cAMP efflux is a functional feature that could be therapeutically targeted in leukemia. Furthermore, because some of the identified drugs are currently used for treating other illnesses, this work creates an opportunity for repurposing.

  6. Dual contradictory roles of cAMP signaling pathways in hydroxyl radical production in the rat striatum.

    PubMed

    Hara, Shuichi; Kobayashi, Masamune; Kuriiwa, Fumi; Mukai, Toshiji; Mizukami, Hajime

    2012-03-15

    Studies have suggested that cAMP signaling pathways may be associated with the production of reactive oxygen species. In this study, we examined how modifications in cAMP signaling affected the production of hydroxyl radicals in rat striatum using microdialysis to measure extracellular 2,3-dihydroxybenzoic acid (2,3-DHBA), which is a hydroxyl radical adduct of salicylate. Up to 50 nmol of the cell-permeative cAMP mimetic 8-bromo-cAMP (8-Br-cAMP) increased 2,3-DHBA in a dose-dependent manner (there was no additional increase in 2,3-DHBA at 100 nmol). Another cAMP mimetic, dibutyryl cAMP (db-cAMP), caused a nonsignificant increase in 2,3-DHBA at 50 nmol and a significant decrease at 100 nmol. Up to 20 nmol of forskolin, which is a direct activator of adenylyl cyclase, increased 2,3-DHBA, similar to the effect of 8-Br-cAMP; however, forskolin resulted in a much greater increase in 2,3-DHBA. A potent inhibitor of protein kinase A (PKA), H89 (500 μM), potentiated the 8-Br-cAMP- and forskolin-induced increases in 2,3-DHBA and antagonized the inhibitory effect of 100 nmol of db-cAMP. Interestingly, the administration of 100 nmol of 8-bromo-cGMP alone or in combination with H89 had no significant effect on 2,3-DHBA levels. Doses of 100 nmol of a preferential PKA activator (6-phenyl-cAMP) or a preferential PKA inhibitor (8-bromoadenosine-3',5'-cyclic monophosphorothionate, Rp-isomer; Rp-8-Br-cAMPS), which also inhibits the cAMP-mediated activation of Epac (the exchange protein directly activated by cAMP), suppressed or enhanced, respectively, the formation of 2,3-DHBA. Up to 100 nmol of 8-(4-chlorophenylthio)-2'-O-methyladenosine-cAMP, which is a selective activator of Epac, dose-dependently stimulated the formation of 2,3-DHBA. These findings suggest that cAMP signaling plays contradictory roles (stimulation and inhibition) in the production of hydroxyl radicals in rat striatum by differential actions of Epac and PKA. These roles might contribute to the production of hydroxyl radicals concomitant with cAMP in carbon monoxide poisoning, because the formation of 2,3-DHBA was potentiated by the PKA inhibitor H89 and suppressed by Rp-8-Br-cAMPS, which inhibits PKA and Epac. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Molecular characterization of Streptococcus agalactiae strains isolated from fishes in Malaysia.

    PubMed

    Amal, M N A; Zamri-Saad, M; Siti-Zahrah, A; Zulkafli, A R; Nur-Nazifah, M

    2013-07-01

    The aim of this study was to characterize Streptococcus agalactiae strains that were isolated from fishes in Malaysia using random amplified polymorphic DNA (RAPD) and repetitive extragenic palindromic PCR (REP-PCR) techniques. A total of 181 strains of Strep. agalactiae isolated from red hybrid tilapia (Oreochromis sp.) and golden pompano (Trachinotus blochii) were characterized using RAPD and REP-PCR techniques. Both the fingerprinting techniques generated reproducible band patterns, differing in the number and molecular mass amplicons. The RAPD technique displayed greater discriminatory power by its production of more complex binding pattern and divided all the strains into 13 groups, compared to 9 by REP-PCR technique. Both techniques showed the availability to differentiate the genetic profiles of the strains according to their geographical location of origin. Three strains of Strep. agalactiae that were recovered from golden pompano showed a genetic dissimilarity from the strains isolated from red hybrid tilapia, while the strain of ATCC 27956 that recovered from bovine displayed a unique profile for both methods. Both techniques possess excellent discriminative capabilities and can be used as a rapid means of comparing Strep. agalactiae strains for future epidemiological investigation. Framework as the guideline in traceability of this disease and in the search for potential local vaccine candidates for streptococcosis in this country. Journal of Applied Microbiology © 2013 The Society for Applied Microbiology.

  8. Development of fluorogenic probe-based PCR assays for the detection and quantification of bovine piroplasmids.

    PubMed

    Criado-Fornelio, A; Buling, A; Asenzo, G; Benitez, D; Florin-Christensen, M; Gonzalez-Oliva, A; Henriques, G; Silva, M; Alongi, A; Agnone, A; Torina, A; Madruga, C R

    2009-06-10

    This paper reports two new quantitative PCR (qPCR) assays, developed in an attempt to improve the detection of bovine piroplasmids. The first of these techniques is a duplex TaqMan assay for the simultaneous diagnosis of Babesia bovis and B. bigemina. This technique is ideal for use in South America where bovids harbour no theilerids. The second technique, which is suitable for the diagnosis of both babesiosis and theileriosis worldwide, involves fluorescence resonance energy transfer (FRET) probes. In FRET assays, Babesia bovis, B. divergens, Babesia sp. (B. major or B. bigemina), Theileria annae and Theileria sp. were all identifiable based on the melting temperatures of their amplified fragments. Both techniques provided linear calibration curves over the 0.1fg/microl to 0.01ng/microl DNA range. The assays showed good sensitivity and specificity. To assess their performance, both procedures were compared in two separate studies: the first was intended to monitor the experimental infection of calves with B. bovis and the second was a survey where 200 bovid/equine DNA samples from different countries were screened for piroplasmids. Comparative studies showed that duplex TaqMan qPCR was more sensitive than FRET qPCR in the detection of babesids.

  9. Comparison of Quantitative PCR and Droplet Digital PCR Multiplex Assays for Two Genera of Bloom-Forming Cyanobacteria, Cylindrospermopsis and Microcystis

    PubMed Central

    Te, Shu Harn; Chen, Enid Yingru

    2015-01-01

    The increasing occurrence of harmful cyanobacterial blooms, often linked to deteriorated water quality and adverse public health effects, has become a worldwide concern in recent decades. The use of molecular techniques such as real-time quantitative PCR (qPCR) has become increasingly popular in the detection and monitoring of harmful cyanobacterial species. Multiplex qPCR assays that quantify several toxigenic cyanobacterial species have been established previously; however, there is no molecular assay that detects several bloom-forming species simultaneously. Microcystis and Cylindrospermopsis are the two most commonly found genera and are known to be able to produce microcystin and cylindrospermopsin hepatotoxins. In this study, we designed primers and probes which enable quantification of these genera based on the RNA polymerase C1 gene for Cylindrospermopsis species and the c-phycocyanin beta subunit-like gene for Microcystis species. Duplex assays were developed for two molecular techniques—qPCR and droplet digital PCR (ddPCR). After optimization, both qPCR and ddPCR assays have high linearity and quantitative correlations for standards. Comparisons of the two techniques showed that qPCR has higher sensitivity, a wider linear dynamic range, and shorter analysis time and that it was more cost-effective, making it a suitable method for initial screening. However, the ddPCR approach has lower variability and was able to handle the PCR inhibition and competitive effects found in duplex assays, thus providing more precise and accurate analysis for bloom samples. PMID:26025892

  10. Discovery of novel antimicrobial peptides with unusual cysteine motifs in dandelion Taraxacum officinale Wigg. flowers.

    PubMed

    Astafieva, A A; Rogozhin, E A; Odintsova, T I; Khadeeva, N V; Grishin, E V; Egorov, Ts A

    2012-08-01

    Three novel antimicrobial peptides designated ToAMP1, ToAMP2 and ToAMP3 were purified from Taraxacum officinale flowers. Their amino acid sequences were determined. The peptides are cationic and cysteine-rich and consist of 38, 44 and 42 amino acid residues for ToAMP1, ToAMP2 and ToAMP3, respectively. Importantly, according to cysteine motifs, the peptides are representatives of two novel previously unknown families of plant antimicrobial peptides. ToAMP1 and ToAMP2 share high sequence identity and belong to 6-Cys-containing antimicrobial peptides, while ToAMP3 is a member of a distinct 8-Cys family. The peptides were shown to display high antimicrobial activity both against fungal and bacterial pathogens, and therefore represent new promising molecules for biotechnological and medicinal applications. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.

  11. On-chip isothermal, chemical cycling polymerase chain reaction (ccPCR)

    NASA Astrophysics Data System (ADS)

    Persat, Alexandre; Santiago, Juan

    2008-11-01

    We demonstrate a novel ccPCR technique for microfluidic DNA amplification where temperature is held constant in space and time. The polymerase chain reaction is a platform of choice for biological assays and typically based on a three-step thermal cycling: DNA denaturation, primers annealing and extension by an enzyme. We here demonstrate a novel technique where high concentration chemical denaturants (solvents) denature DNA. We leverage the high electrophoretic mobility of DNA and the electrical neutrality of denaturants to achieve chemical cycling. We focus DNA with isotachophoresis (ITP); a robust electrophoretic preconcentration technique which generates strong electric field gradients and protects the sample from dispersion. We apply a pressure-driven flow to balance electromigration velocity and keep the DNA sample stationary in a microchannel. We drive the DNA through a series of high denaturant concentration zones. DNA denatures at high denaturant concentration. At low denaturant concentration, the enzyme creates complementary strands. DNA reaction kinetics are slower than buffer reactions involved in ITP. We demonstrate successful ccPCR amplification for detection of E. Coli. The ccPCR has the potential for simpler chemistry than traditional PCR.

  12. A continuous spectrophotometric assay for monitoring adenosine 5'-monophosphate production.

    PubMed

    First, Eric A

    2015-08-15

    A number of biologically important enzymes release adenosine 5'-monophosphate (AMP) as a product, including aminoacyl-tRNA synthetases, cyclic AMP (cAMP) phosphodiesterases, ubiquitin and ubiquitin-like ligases, DNA ligases, coenzyme A (CoA) ligases, polyA deadenylases, and ribonucleases. In contrast to the abundance of assays available for monitoring the conversion of adenosine 5'-triphosphate (ATP) to ADP, there are relatively few assays for monitoring the conversion of ATP (or cAMP) to AMP. In this article, we describe a homogeneous assay that continuously monitors the production of AMP. Specifically, we have coupled the conversion of AMP to inosine 5'-monophosphate (IMP) (by AMP deaminase) to the oxidation of IMP (by IMP dehydrogenase). This results in the reduction of oxidized nicotine adenine dinucleotide (NAD(+)) to reduced nicotine adenine dinucleotide (NADH), allowing AMP formation to be monitored by the change in the absorbance at 340 nm. Changes in AMP concentrations of 5 μM or more can be reliably detected. The ease of use and relatively low expense make the AMP assay suitable for both high-throughput screening and kinetic analyses. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. A novel cysteine-rich antifungal peptide ToAMP4 from Taraxacum officinale Wigg. flowers.

    PubMed

    Astafieva, A A; Rogozhin, Eugene A; Andreev, Yaroslav A; Odintsova, T I; Kozlov, S A; Grishin, Eugene V; Egorov, Tsezi A

    2013-09-01

    A novel peptide named ToAMP4 was isolated from Taraxacum officinale Wigg. flowers by a combination of acetic acid extraction and different types of chromatography: affinity, size-exclusion, and RP-HPLC. The amino acid sequence of ToAMP4 was determined by automated Edman degradation. The peptide is basic, consists of 41 amino acids, and incorporates three disulphide bonds. Due to the unusual cysteine spacing pattern, ToAMP4 does not belong to any known plant AMP family, but classifies together with two other antimicrobial peptides ToAMP1 and ToAMP2 previously isolated from the dandelion flowers. To study the biological activity of ToAMP4, it was successfully produced in a prokaryotic expression system as a fusion protein with thioredoxin. The recombinant peptide was shown to be identical to the native ToAMP4 by chromatographic behavior, molecular mass, and N-terminal amino acid sequence. The peptide displays broad-spectrum antifungal activity against important phytopathogens. Two ToAMP4-mediated inhibition strategies depending on the fungus were demonstrated. The results obtained add to our knowledge on the structural and functional diversity of AMPs in plants. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  14. AMP Is an Adenosine A1 Receptor Agonist*

    PubMed Central

    Rittiner, Joseph E.; Korboukh, Ilia; Hull-Ryde, Emily A.; Jin, Jian; Janzen, William P.; Frye, Stephen V.; Zylka, Mark J.

    2012-01-01

    Numerous receptors for ATP, ADP, and adenosine exist; however, it is currently unknown whether a receptor for the related nucleotide adenosine 5′-monophosphate (AMP) exists. Using a novel cell-based assay to visualize adenosine receptor activation in real time, we found that AMP and a non-hydrolyzable AMP analog (deoxyadenosine 5′-monophosphonate, ACP) directly activated the adenosine A1 receptor (A1R). In contrast, AMP only activated the adenosine A2B receptor (A2BR) after hydrolysis to adenosine by ecto-5′-nucleotidase (NT5E, CD73) or prostatic acid phosphatase (PAP, ACPP). Adenosine and AMP were equipotent human A1R agonists in our real-time assay and in a cAMP accumulation assay. ACP also depressed cAMP levels in mouse cortical neurons through activation of endogenous A1R. Non-selective purinergic receptor antagonists (pyridoxalphosphate-6-azophenyl-2′,4′-disulfonic acid and suramin) did not block adenosine- or AMP-evoked activation. Moreover, mutation of His-251 in the human A1R ligand binding pocket reduced AMP potency without affecting adenosine potency. In contrast, mutation of a different binding pocket residue (His-278) eliminated responses to AMP and to adenosine. Taken together, our study indicates that the physiologically relevant nucleotide AMP is a full agonist of A1R. In addition, our study suggests that some of the physiological effects of AMP may be direct, and not indirect through ectonucleotidases that hydrolyze this nucleotide to adenosine. PMID:22215671

  15. AMP is an adenosine A1 receptor agonist.

    PubMed

    Rittiner, Joseph E; Korboukh, Ilia; Hull-Ryde, Emily A; Jin, Jian; Janzen, William P; Frye, Stephen V; Zylka, Mark J

    2012-02-17

    Numerous receptors for ATP, ADP, and adenosine exist; however, it is currently unknown whether a receptor for the related nucleotide adenosine 5'-monophosphate (AMP) exists. Using a novel cell-based assay to visualize adenosine receptor activation in real time, we found that AMP and a non-hydrolyzable AMP analog (deoxyadenosine 5'-monophosphonate, ACP) directly activated the adenosine A(1) receptor (A(1)R). In contrast, AMP only activated the adenosine A(2B) receptor (A(2B)R) after hydrolysis to adenosine by ecto-5'-nucleotidase (NT5E, CD73) or prostatic acid phosphatase (PAP, ACPP). Adenosine and AMP were equipotent human A(1)R agonists in our real-time assay and in a cAMP accumulation assay. ACP also depressed cAMP levels in mouse cortical neurons through activation of endogenous A(1)R. Non-selective purinergic receptor antagonists (pyridoxalphosphate-6-azophenyl-2',4'-disulfonic acid and suramin) did not block adenosine- or AMP-evoked activation. Moreover, mutation of His-251 in the human A(1)R ligand binding pocket reduced AMP potency without affecting adenosine potency. In contrast, mutation of a different binding pocket residue (His-278) eliminated responses to AMP and to adenosine. Taken together, our study indicates that the physiologically relevant nucleotide AMP is a full agonist of A(1)R. In addition, our study suggests that some of the physiological effects of AMP may be direct, and not indirect through ectonucleotidases that hydrolyze this nucleotide to adenosine.

  16. Selection of reference genes for RT-qPCR analysis in the monarch butterfly, Danaus plexippus (L.), a migrating bio-indicator

    USDA-ARS?s Scientific Manuscript database

    Quantitative real-time PCR (qRT-PCR) is a reliable and reproducible technique for measuring and evaluating changes in gene expression. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. In this study, expres...

  17. DNA-PCR analysis of bloodstains sampled by the polyvinyl-alcohol method.

    PubMed

    Schyma, C; Huckenbeck, W; Bonte, W

    1999-01-01

    Among the usual techniques of sampling gunshot residues (GSR), the polyvinyl-alcohol method (PVAL) includes the advantage of embedding all particles, foreign bodies and stains on the surface of the shooter's hand in exact and reproducible topographic localization. The aim of the present study on ten persons killed by firearms was to check the possibility of DNA-PCR typing of blood traces embedded in the PVAL gloves in a second step following GSR analysis. The results of these examinations verify that the PVAL technique does not include factors that inhibit successful PCR typing. Thus the PVAL method can be recommended as a combination technique to secure and preserve inorganic and biological traces at the same time.

  18. A Guide to Using STITCHER for Overlapping Assembly PCR Applications.

    PubMed

    O'Halloran, Damien M

    2017-01-01

    Overlapping PCR is commonly used in many molecular applications that include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping assembly PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online.

  19. Digital PCR: A brief history.

    PubMed

    Morley, Alexander A

    2014-09-01

    Digital PCR for quantification of a target of interest has been independently developed several times, being described in 1990 and 1991 using the term "limiting dilution PCR" and in 1999 using the term "digital PCR". It came into use in the decade following its first development but its use was cut short by the description of real-time PCR in 1996. However digital PCR has now had a renaissance due to the recent development of new instruments and chemistry which have made it a much simpler and more practical technique.

  20. Adsorption of nucleotides on biomimetic apatite: The case of adenosine 5‧ monophosphate (AMP)

    NASA Astrophysics Data System (ADS)

    Hammami, K.; Feki, H. El; Marsan, O.; Drouet, C.

    2015-10-01

    This work investigates the interaction between the nucleotide adenosine 5‧ monophosphate molecule (AMP) and a biomimetic nanocrystalline carbonated apatite as a model for bone mineral. The analogy of the apatite phase used in this work with biological apatite was first pointed out by complementary techniques. AMP adsorption isotherms were then investigated. Obtained data were fitted to a Sips isotherm with an exponent greater than one suggesting positive cooperativity among adsorbed molecules. The data were compared to a previous study relative to the adsorption of another nucleotide, cytidine monophosphate (CMP) onto a similar substrate, evidencing some effect of the chemical nature of the nucleic base. An enhanced adsorption was observed under acidic (pH 6) conditions as opposed to pH 7.4, which parallels the case of DNA adsorption on biomimetic apatite. An estimated standard Gibbs free energy associated to the adsorption process (ΔG°ads ≅ -22 kJ/mol) intermediate between "physisorption" and "chemisorption" was found. The analysis of the solids after adsorption pointed to the preservation of the main characteristics of the apatite substrate but shifts or enhancements of Raman bands attributed to AMP showed the existence of chemical interactions involving both the phosphate and adenine parts of AMP. This contribution adds to the works conducted in view of better understanding the interaction of DNA/RNA and their constitutive nucleotides and the surface of biomimetic apatites. It could prove helpful in disciplines such as bone diagenesis (DNA/apatite interface in aged bones) or nanomedicine (setup of DNA- or RNA-loaded apatite systems). Also, the adsorption of nucleic acids on minerals like apatites could have played a role in the preservation of such biomolecules in the varying conditions known to exist at the origin of life on Earth, underlining the importance of dedicated adsorption studies.

  1. Modafinil inhibits K(Ca)3.1 currents and muscle contraction via a cAMP-dependent mechanism.

    PubMed

    Choi, Shinkyu; Kim, Moon Young; Joo, Ka Young; Park, Seonghee; Kim, Ji Aee; Jung, Jae-Chul; Oh, Seikwan; Suh, Suk Hyo

    2012-07-01

    Modafinil has been used as a psychostimulant for the treatment of narcolepsy. However, its primary mechanism of action remains elusive. Therefore, we examined the effects of modafinil on K(Ca)3.1 channels and vascular smooth muscle contraction. K(Ca)3.1 currents and channel activity were measured using a voltage-clamp technique and inside-out patches in mouse embryonic fibroblast cell line, NIH-3T3 fibroblasts. Intracellular adenosine 3',5'-cyclic monophosphate (cAMP) concentration was measured, and the phosphorylation of K(Ca)3.1 channel protein was examined using western blotting in NIH-3T3 fibroblasts and/or primary cultured mouse aortic smooth muscle cells (SMCs). Muscle contractions were recorded from mouse aorta and rat pulmonary artery by using a myograph developed in-house. Modafinil was found to inhibit K(Ca)3.1 currents in a concentration-dependent manner, and the half-maximal inhibition (IC(50)) of modafinil for the current inhibition was 6.8 ± 0.7 nM. The protein kinase A (PKA) activator forskolin also inhibited K(Ca)3.1 currents. The inhibitory effects of modafinil and forskolin on K(Ca)3.1 currents were blocked by the PKA inhibitors PKI(14-22) or H-89. In addition, modafinil relaxed blood vessels (mouse aorta and rat pulmonary artery) in a concentration-dependent manner. Modafinil increased cAMP concentrations in NIH-3T3 fibroblasts or primary cultured mouse aortic SMCs and phosphorylated K(Ca)3.1 channel protein in NIH-3T3 fibroblasts. However, open probability and single-channel current amplitudes of K(Ca)3.1 channels were not changed by modafinil. From these results, we conclude that modafinil inhibits K(Ca)3.1 channels and vascular smooth muscle contraction by cAMP-dependent phosphorylation, suggesting that modafinil can be used as a cAMP-dependent K(Ca)3.1 channel blocker and vasodilator. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Reproducibility of telomere length assessment: an international collaborative study.

    PubMed

    Martin-Ruiz, Carmen M; Baird, Duncan; Roger, Laureline; Boukamp, Petra; Krunic, Damir; Cawthon, Richard; Dokter, Martin M; van der Harst, Pim; Bekaert, Sofie; de Meyer, Tim; Roos, Goran; Svenson, Ulrika; Codd, Veryan; Samani, Nilesh J; McGlynn, Liane; Shiels, Paul G; Pooley, Karen A; Dunning, Alison M; Cooper, Rachel; Wong, Andrew; Kingston, Andrew; von Zglinicki, Thomas

    2015-10-01

    Telomere length is a putative biomarker of ageing, morbidity and mortality. Its application is hampered by lack of widely applicable reference ranges and uncertainty regarding the present limits of measurement reproducibility within and between laboratories. We instigated an international collaborative study of telomere length assessment: 10 different laboratories, employing 3 different techniques [Southern blotting, single telomere length analysis (STELA) and real-time quantitative PCR (qPCR)] performed two rounds of fully blinded measurements on 10 human DNA samples per round to enable unbiased assessment of intra- and inter-batch variation between laboratories and techniques. Absolute results from different laboratories differed widely and could thus not be compared directly, but rankings of relative telomere lengths were highly correlated (correlation coefficients of 0.63-0.99). Intra-technique correlations were similar for Southern blotting and qPCR and were stronger than inter-technique ones. However, inter-laboratory coefficients of variation (CVs) averaged about 10% for Southern blotting and STELA and more than 20% for qPCR. This difference was compensated for by a higher dynamic range for the qPCR method as shown by equal variance after z-scoring. Technical variation per laboratory, measured as median of intra- and inter-batch CVs, ranged from 1.4% to 9.5%, with differences between laboratories only marginally significant (P = 0.06). Gel-based and PCR-based techniques were not different in accuracy. Intra- and inter-laboratory technical variation severely limits the usefulness of data pooling and excludes sharing of reference ranges between laboratories. We propose to establish a common set of physical telomere length standards to improve comparability of telomere length estimates between laboratories. © The Author 2014. Published by Oxford University Press on behalf of the International Epidemiological Association.

  3. Single-tube analysis of DNA methylation with silica superparamagnetic beads.

    PubMed

    Bailey, Vasudev J; Zhang, Yi; Keeley, Brian P; Yin, Chao; Pelosky, Kristen L; Brock, Malcolm; Baylin, Stephen B; Herman, James G; Wang, Tza-Huei

    2010-06-01

    DNA promoter methylation is a signature for the silencing of tumor suppressor genes. Most widely used methods to detect DNA methylation involve 3 separate, independent processes: DNA extraction, bisulfite conversion, and methylation detection via a PCR method, such as methylation-specific PCR (MSP). This method includes many disconnected steps with associated losses of material, potentially reducing the analytical sensitivity required for analysis of challenging clinical samples. Methylation on beads (MOB) is a new technique that integrates DNA extraction, bisulfite conversion, and PCR in a single tube via the use of silica superparamagnetic beads (SSBs) as a common DNA carrier for facilitating cell debris removal and buffer exchange throughout the entire process. In addition, PCR buffer is used to directly elute bisulfite-treated DNA from SSBs for subsequent target amplifications. The diagnostic sensitivity of MOB was evaluated by methylation analysis of the CDKN2A [cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4); also known as p16(INK4a)] promoter in serum DNA of lung cancer patients and compared with that of conventional methods. Methylation analysis consisting of DNA extraction followed by bisulfite conversion and MSP was successfully carried out within 9 h in a single tube. The median pre-PCR DNA yield was 6.61-fold higher with the MOB technique than with conventional techniques. Furthermore, MOB increased the diagnostic sensitivity in our analysis of the CDKN2A promoter in patient serum by successfully detecting methylation in 74% of cancer patients, vs the 45% detection rate obtained with conventional techniques. The MOB technique successfully combined 3 processes into a single tube, thereby allowing ease in handling and an increased detection throughput. The increased pre-PCR yield in MOB allowed efficient, diagnostically sensitive methylation detection.

  4. Detection of Mycoplasma hyopneumoniae by polymerase chain reaction in swine presenting respiratory problems

    PubMed Central

    Yamaguti, M.; Muller, E.E.; Piffer, A.I.; Kich, J.D.; Klein, C.S.; Kuchiishi, S.S.

    2008-01-01

    Since Mycoplasma hyopneumoniae isolation in appropriate media is a difficult task and impractical for daily routine diagnostics, Nested-PCR (N-PCR) techniques are currently used to improve the direct diagnostic sensitivity of Swine Enzootic Pneumonia. In a first experiment, this paper describes a N-PCR technique optimization based on three variables: different sampling sites, sample transport media, and DNA extraction methods, using eight pigs. Based on the optimization results, a second experiment was conducted for testing validity using 40 animals. In conclusion, the obtained results of the N-PCR optimization and validation allow us to recommend this test as a routine monitoring diagnostic method for Mycoplasma hyopneumoniae infection in swine herds. PMID:24031248

  5. Single Fluorescence Channel-based Multiplex Detection of Avian Influenza Virus by Quantitative PCR with Intercalating Dye

    PubMed Central

    Ahberg, Christian D.; Manz, Andreas; Neuzil, Pavel

    2015-01-01

    Since its invention in 1985 the polymerase chain reaction (PCR) has become a well-established method for amplification and detection of segments of double-stranded DNA. Incorporation of fluorogenic probe or DNA intercalating dyes (such as SYBR Green) into the PCR mixture allowed real-time reaction monitoring and extraction of quantitative information (qPCR). Probes with different excitation spectra enable multiplex qPCR of several DNA segments using multi-channel optical detection systems. Here we show multiplex qPCR using an economical EvaGreen-based system with single optical channel detection. Previously reported non quantitative multiplex real-time PCR techniques based on intercalating dyes were conducted once the PCR is completed by performing melting curve analysis (MCA). The technique presented in this paper is both qualitative and quantitative as it provides information about the presence of multiple DNA strands as well as the number of starting copies in the tested sample. Besides important internal control, multiplex qPCR also allows detecting concentrations of more than one DNA strand within the same sample. Detection of the avian influenza virus H7N9 by PCR is a well established method. Multiplex qPCR greatly enhances its specificity as it is capable of distinguishing both haemagglutinin (HA) and neuraminidase (NA) genes as well as their ratio. PMID:26088868

  6. Molecular Technique to Understand Deep Microbial Diversity

    NASA Technical Reports Server (NTRS)

    Vaishampayan, Parag A.; Venkateswaran, Kasthuri J.

    2012-01-01

    Current sequencing-based and DNA microarray techniques to study microbial diversity are based on an initial PCR (polymerase chain reaction) amplification step. However, a number of factors are known to bias PCR amplification and jeopardize the true representation of bacterial diversity. PCR amplification of the minor template appears to be suppressed by the exponential amplification of the more abundant template. It is widely acknowledged among environmental molecular microbiologists that genetic biosignatures identified from an environment only represent the most dominant populations. The technological bottleneck has overlooked the presence of the less abundant minority population, and underestimated their role in the ecosystem maintenance. To generate PCR amplicons for subsequent diversity analysis, bacterial l6S rRNA genes are amplified by PCR using universal primers. Two distinct PCR regimes are employed in parallel: one using normal and the other using biotinlabeled universal primers. PCR products obtained with biotin-labeled primers are mixed with streptavidin-labeled magnetic beads and selectively captured in the presence of a magnetic field. Less-abundant DNA templates that fail to amplify in this first round of PCR amplification are subjected to a second round of PCR using normal universal primers. These PCR products are then subjected to downstream diversity analyses such as conventional cloning and sequencing. A second round of PCR amplified the minority population and completed the deep diversity picture of the environmental sample.

  7. AmpH, a bifunctional DD-endopeptidase and DD-carboxypeptidase of Escherichia coli.

    PubMed

    González-Leiza, Silvia M; de Pedro, Miguel A; Ayala, Juan A

    2011-12-01

    In Escherichia coli, low-molecular-mass penicillin-binding proteins (LMM PBPs) are important for correct cell morphogenesis. These enzymes display DD-carboxypeptidase and/or dd-endopeptidase activities associated with maturation and remodeling of peptidoglycan (PG). AmpH has been classified as an AmpH-type class C LMM PBP, a group closely related to AmpC β-lactamases. AmpH has been associated with PG recycling, although its enzymatic activity remained uncharacterized until now. Construction and purification of His-tagged AmpH from E. coli permitted a detailed study of its enzymatic properties. The N-terminal export signal of AmpH is processed, but the protein remains membrane associated. The PBP nature of AmpH was demonstrated by its ability to bind the β-lactams Bocillin FL (a fluorescent penicillin) and cefmetazole. In vitro assays with AmpH and specific muropeptides demonstrated that AmpH is a bifunctional DD-endopeptidase and DD-carboxypeptidase. Indeed, the enzyme cleaved the cross-linked dimers tetrapentapeptide (D45) and tetratetrapeptide (D44) with efficiencies (k(cat)/K(m)) of 1,200 M(-1) s(-1) and 670 M(-1) s(-1), respectively, and removed the terminal D-alanine from muropeptides with a C-terminal D-Ala-D-Ala dipeptide. Both DD-peptidase activities were inhibited by 40 μM cefmetazole. AmpH also displayed a weak β-lactamase activity for nitrocefin of 1.4 × 10(-3) nmol/μg protein/min, 1/1,000 the rate obtained for AmpC under the same conditions. AmpH was also active on purified sacculi, exhibiting the bifunctional character that was seen with pure muropeptides. The wide substrate spectrum of the DD-peptidase activities associated with AmpH supports a role for this protein in PG remodeling or recycling.

  8. AmpH, a Bifunctional dd-Endopeptidase and dd-Carboxypeptidase of Escherichia coli▿

    PubMed Central

    González-Leiza, Silvia M.; de Pedro, Miguel A.; Ayala, Juan A.

    2011-01-01

    In Escherichia coli, low-molecular-mass penicillin-binding proteins (LMM PBPs) are important for correct cell morphogenesis. These enzymes display dd-carboxypeptidase and/or dd-endopeptidase activities associated with maturation and remodeling of peptidoglycan (PG). AmpH has been classified as an AmpH-type class C LMM PBP, a group closely related to AmpC β-lactamases. AmpH has been associated with PG recycling, although its enzymatic activity remained uncharacterized until now. Construction and purification of His-tagged AmpH from E. coli permitted a detailed study of its enzymatic properties. The N-terminal export signal of AmpH is processed, but the protein remains membrane associated. The PBP nature of AmpH was demonstrated by its ability to bind the β-lactams Bocillin FL (a fluorescent penicillin) and cefmetazole. In vitro assays with AmpH and specific muropeptides demonstrated that AmpH is a bifunctional dd–endopeptidase and dd-carboxypeptidase. Indeed, the enzyme cleaved the cross-linked dimers tetrapentapeptide (D45) and tetratetrapeptide (D44) with efficiencies (kcat/Km) of 1,200 M−1 s−1 and 670 M−1 s−1, respectively, and removed the terminal d-alanine from muropeptides with a C-terminal d-Ala-d-Ala dipeptide. Both dd-peptidase activities were inhibited by 40 μM cefmetazole. AmpH also displayed a weak β-lactamase activity for nitrocefin of 1.4 × 10−3 nmol/μg protein/min, 1/1,000 the rate obtained for AmpC under the same conditions. AmpH was also active on purified sacculi, exhibiting the bifunctional character that was seen with pure muropeptides. The wide substrate spectrum of the dd-peptidase activities associated with AmpH supports a role for this protein in PG remodeling or recycling. PMID:22001512

  9. Determining Annealing Temperatures for Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  10. Aligning Goals, Assessments, and Activities: An Approach to Teaching PCR and Gel Electrophoresis

    ERIC Educational Resources Information Center

    Phillips, Allison R.; Robertson, Amber L.; Batzli, Janet; Harris, Michelle; Miller, Sarah

    2008-01-01

    Polymerase chain reaction (PCR) and gel electrophoresis have become common techniques used in undergraduate molecular and cell biology labs. Although students enjoy learning these techniques, they often cannot fully comprehend and analyze the outcomes of their experiments because of a disconnect between concepts taught in lecture and experiments…

  11. Immunohistochemical detection of the BRAF V600E mutation in papillary thyroid carcinoma. Evaluation against real-time polymerase chain reaction.

    PubMed

    Paja Fano, Miguel; Ugalde Olano, Aitziber; Fuertes Thomas, Elena; Oleaga Alday, Amelia

    2017-02-01

    The BRAF V600E mutation is the most common genetic change in papillary thyroid carcinoma and is associated with a poorer clinical course. Usual methods for its study (DNA sequencing or molecular test based on PCR) are expensive and time-consuming. Recently, immunohistochemistry (IHC) for BRAF mutation has been introduced. To compare the results of IHC and real time PCR (RT-PCR) in the detection of BRAF V600E mutation in papillary thyroid carcinoma. Analysis of clinical and pathological differences depending on RT-PCR results is included. A prospective study was performed in 82 consecutive samples, 54 of them taken through a core needle biopsy. IHC was performed on tissue fixed for 24hours with 10% neutral formalin using the anti-BRAF V600E (VE-1) mouse monoclonal primary antibody and was rated as positive or negative. DNA was extracted from formalin-fixed, paraffin-embedded tissues by manual microdissection, and BRAF mutation was detected by RT-PCR using the Cobas® 4800 BRAF V600 mutation test (Roche). Both techniques were concordant in 81 cases, and BRAF was positive in 49. Discordance appeared in a follicular variant showing positive IHC and negative RT-PCR, attributed to histological heterogeneity. Cost of materials for IHC was less than half of the cost for RT-PCR. IHC appears to be a reliable, economical and easily available alternative to molecular biology techniques for routine detection of the BRAF V600E mutation in papillary thyroid carcinoma patients, provided optimal fixation conditions are used. It may be a useful technique in hospitals with no access to molecular biology techniques. Copyright © 2017 SEEN. Publicado por Elsevier España, S.L.U. All rights reserved.

  12. A blinded international study on the reliability of genetic testing for GGGGCC-repeat expansions in C9orf72 reveals marked differences in results among 14 laboratories

    PubMed Central

    Akimoto, Chizuru; Volk, Alexander E; van Blitterswijk, Marka; Van den Broeck, Marleen; Leblond, Claire S; Lumbroso, Serge; Camu, William; Neitzel, Birgit; Onodera, Osamu; van Rheenen, Wouter; Pinto, Susana; Weber, Markus; Smith, Bradley; Proven, Melanie; Talbot, Kevin; Keagle, Pamela; Chesi, Alessandra; Ratti, Antonia; van der Zee, Julie; Alstermark, Helena; Birve, Anna; Calini, Daniela; Nordin, Angelica; Tradowsky, Daniela C; Just, Walter; Daoud, Hussein; Angerbauer, Sabrina; DeJesus-Hernandez, Mariely; Konno, Takuya; Lloyd-Jani, Anjali; de Carvalho, Mamede; Mouzat, Kevin; Landers, John E; Veldink, Jan H; Silani, Vincenzo; Gitler, Aaron D; Shaw, Christopher E; Rouleau, Guy A; van den Berg, Leonard H; Van Broeckhoven, Christine; Rademakers, Rosa; Andersen, Peter M; Kubisch, Christian

    2014-01-01

    Background The GGGGCC-repeat expansion in C9orf72 is the most frequent mutation found in patients with amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Most of the studies on C9orf72 have relied on repeat-primed PCR (RP-PCR) methods for detection of the expansions. To investigate the inherent limitations of this technique, we compared methods and results of 14 laboratories. Methods The 14 laboratories genotyped DNA from 78 individuals (diagnosed with ALS or FTD) in a blinded fashion. Eleven laboratories used a combination of amplicon-length analysis and RP-PCR, whereas three laboratories used RP-PCR alone; Southern blotting techniques were used as a reference. Results Using PCR-based techniques, 5 of the 14 laboratories got results in full accordance with the Southern blotting results. Only 50 of the 78 DNA samples got the same genotype result in all 14 laboratories. There was a high degree of false positive and false negative results, and at least one sample could not be genotyped at all in 9 of the 14 laboratories. The mean sensitivity of a combination of amplicon-length analysis and RP-PCR was 95.0% (73.9–100%), and the mean specificity was 98.0% (87.5–100%). Overall, a sensitivity and specificity of more than 95% was observed in only seven laboratories. Conclusions Because of the wide range seen in genotyping results, we recommend using a combination of amplicon-length analysis and RP-PCR as a minimum in a research setting. We propose that Southern blotting techniques should be the gold standard, and be made obligatory in a clinical diagnostic setting. PMID:24706941

  13. Discovery of a cAMP Deaminase That Quenches Cyclic AMP-Dependent Regulation

    PubMed Central

    Goble, Alissa M.; Feng, Youjun; Raushel, Frank M.; Cronan, John E.

    2013-01-01

    An enzyme of unknown function within the amidohydrolase superfamily was discovered to catalyze the hydrolysis of the universal second messenger, cyclic-3’, 5’-adenosine monophosphate (cAMP). The enzyme, which we have named CadD, is encoded by the human pathogenic bacterium Leptospira interrogans. Although CadD is annotated as an adenosine deaminase, the protein specifically deaminates cAMP to cyclic-3’, 5’-inosine monophosphate (cIMP) with a kcat/Km of 2.7 ± 0.4 × 105 M−1 s−1 and has no activity on adenosine, adenine, or 5’-adenosine monophosphate (AMP). This is the first identification of a deaminase specific for cAMP. Expression of CadD in Escherichia coli mimics the loss of adenylate cyclase in that it blocks growth on carbon sources that require the cAMP-CRP transcriptional activator complex for expression of the cognate genes. The cIMP reaction product cannot replace cAMP as the ligand for CRP binding to DNA in vitro and cIMP is a very poor competitor of cAMP activation of CRP for DNA binding. Transcriptional analyses indicate that CadD expression represses expression of several cAMP-CRP dependent genes. CadD adds a new activity to the cAMP metabolic network and may be a useful tool in intracellular study of cAMP-dependent processes. PMID:24074367

  14. Application of Droplet Digital PCR to Validate Rift Valley Fever Vaccines.

    PubMed

    Ly, Hoai J; Lokugamage, Nandadeva; Ikegami, Tetsuro

    2016-01-01

    Droplet Digital™ polymerase chain reaction (ddPCR™) is a promising technique that quantitates the absolute concentration of nucleic acids in a given sample. This technique utilizes water-in-oil emulsion technology, a system developed by Bio-Rad Laboratories that partitions a single sample into thousands of nanoliter-sized droplets and counts nucleic acid molecules encapsulated in each individual particle as one PCR reaction. This chapter discusses the applications and methodologies of ddPCR for development of Rift Valley fever (RVF) vaccine, using an example that measures RNA copy numbers of a live-attenuated MP-12 vaccine from virus stocks, infected cells, or animal blood. We also discuss how ddPCR detects a reversion mutant of MP-12 from virus stocks accurately. The use of ddPCR improves the quality control of live-attenuated vaccines in the seed lot systems.

  15. Cyclic AMP Inhibits the Activity and Promotes the Acetylation of Acetyl-CoA Synthetase through Competitive Binding to the ATP/AMP Pocket.

    PubMed

    Han, Xiaobiao; Shen, Liqiang; Wang, Qijun; Cen, Xufeng; Wang, Jin; Wu, Meng; Li, Peng; Zhao, Wei; Zhang, Yu; Zhao, Guoping

    2017-01-27

    The high-affinity biosynthetic pathway for converting acetate to acetyl-coenzyme A (acetyl-CoA) is catalyzed by the central metabolic enzyme acetyl-coenzyme A synthetase (Acs), which is finely regulated both at the transcriptional level via cyclic AMP (cAMP)-driven trans-activation and at the post-translational level via acetylation inhibition. In this study, we discovered that cAMP directly binds to Salmonella enterica Acs (SeAcs) and inhibits its activity in a substrate-competitive manner. In addition, cAMP binding increases SeAcs acetylation by simultaneously promoting Pat-dependent acetylation and inhibiting CobB-dependent deacetylation, resulting in enhanced SeAcs inhibition. A crystal structure study and site-directed mutagenesis analyses confirmed that cAMP binds to the ATP/AMP pocket of SeAcs, and restrains SeAcs in an open conformation. The cAMP contact residues are well conserved from prokaryotes to eukaryotes, suggesting a general regulatory mechanism of cAMP on Acs. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. cAMP enhances BMP2-signaling through PKA and MKP1-dependent mechanisms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghayor, Chafik; Ehrbar, Martin; Miguel, Blanca San

    2009-04-03

    Recent studies suggest that the elevation of intracellular cyclic adenosine monophosphate (cAMP) and the activation of the protein kinase A regulate BMP-induced osteogenesis. However, the precise mechanisms underlying the enhancing effect of cAMP on BMP2 signaling were not completely revealed. In this study we investigated the effect of elevated cAMP level and PKA activation on the BMP2-induced osteoblastic differentiation in pluripotent C2C12 cells. Alkaline phosphatase activity and its mRNA were consistently induced by BMP2 treatment. The pretreatment of C2C12 cells with Forskolin, a cAMP generating agent, dbcAMP, an analogue of cAMP, or IBMX (3-isobutyl 1-methyl xanthine), and a nonspecific inhibitormore » of phosphodiesterases elicited further activation of alkaline phosphatase. Furthermore, elevated intracellular cAMP level increased BMP2-induced MKP1. On the other hand, BMP2-induced Erk phosphorylation (p44/p42) and cell proliferation were suppressed in the presence of cAMP. Thus, cAMP might enhance BMP2-induced osteoblastic differentiation by a MKP1-Erk-dependent mechanism.« less

  17. cAMP dependent and independent regulation of thyroglobulin synthesis by two clones of the OVNIS 6H thyroid cell line.

    PubMed

    Aouani, A; Hovsépian, S; Fayet, G

    1987-07-01

    The hormonal regulation of thyroglobulin synthesis has been studied using two independent clones of the OVNIS 6H cell line. Insulin, hydrocortisone and TSH were able to stimulate thyroglobulin synthesis, whereas transferrin, somatostatin and glycyl-histidyl-lysine were without effect. Insulin stimulated thyroglobulin synthesis without affecting cAMP production. Hydrocortisone, when combined with insulin was a stimulator too; this stimulation was not accompanied by an increase in cAMP. TSH alone was unable to stimulate either cAMP or thyroglobulin synthesis. The stimulatory effect of TSH on thyroglobulin synthesis took place only when combined with insulin or insulin plus hydrocortisone, and was mediated by cAMP. Consequently, insulin and hydrocortisone stimulated thyroglobulin synthesis by cAMP-independent mechanisms, whereas TSH acted via the cAMP system. Forskolin mimicked TSH effects on cAMP and thyroglobulin synthesis. Calf serum inhibited cAMP and thyroglobulin production. Optimal cAMP and thyroglobulin synthesis as well as TSH responsiveness were obtained in serum-free medium supplemented with 5 micrograms/ml insulin, 100 nM hydrocortisone and 1 mU/ml TSH.

  18. Mechanisms Restricting Diffusion of Intracellular cAMP.

    PubMed

    Agarwal, Shailesh R; Clancy, Colleen E; Harvey, Robert D

    2016-01-22

    Although numerous receptors stimulate cAMP production in a wide array of cells, many elicit distinct, highly localized responses, implying that the subcellular distribution of cAMP is not uniform. One often used explanation is that phosphodiesterases, which breakdown cAMP, act as functional barriers limiting diffusion. However, several studies refute the notion that this is sufficient, suggesting that phosphodiesterase-independent movement of cAMP must occur at rates slower than free diffusion. But, until now this has never been demonstrated. Using Raster Image Correlation Spectroscopy (RICS), we measured the diffusion coefficient of a fluorescently-labeled cAMP derivative (φ450-cAMP) as well as other fluorescent molecules in order to investigate the role that molecular size, cell morphology, and buffering by protein kinase A (PKA) play in restricting cAMP mobility in different cell types. Our results demonstrate that cytosolic movement of cAMP is indeed much slower than the rate of free diffusion and that interactions with PKA, especially type II PKA associated with mitochondria, play a significant role. These findings have important implications with respect to cAMP signaling in all cells.

  19. Mechanisms Restricting Diffusion of Intracellular cAMP

    PubMed Central

    Agarwal, Shailesh R.; Clancy, Colleen E.; Harvey, Robert D.

    2016-01-01

    Although numerous receptors stimulate cAMP production in a wide array of cells, many elicit distinct, highly localized responses, implying that the subcellular distribution of cAMP is not uniform. One often used explanation is that phosphodiesterases, which breakdown cAMP, act as functional barriers limiting diffusion. However, several studies refute the notion that this is sufficient, suggesting that phosphodiesterase-independent movement of cAMP must occur at rates slower than free diffusion. But, until now this has never been demonstrated. Using Raster Image Correlation Spectroscopy (RICS), we measured the diffusion coefficient of a fluorescently-labeled cAMP derivative (φ450-cAMP) as well as other fluorescent molecules in order to investigate the role that molecular size, cell morphology, and buffering by protein kinase A (PKA) play in restricting cAMP mobility in different cell types. Our results demonstrate that cytosolic movement of cAMP is indeed much slower than the rate of free diffusion and that interactions with PKA, especially type II PKA associated with mitochondria, play a significant role. These findings have important implications with respect to cAMP signaling in all cells. PMID:26795432

  20. Interlaboratory Comparison of Quantitative PCR Test Results for Dehalococcoides

    EPA Science Inventory

    Quantitative PCR (qPCR) techniques have been widely used to measure Dehalococcoides (Dhc) DNA in the groundwater at field sites for several years. Interpretation of these data may be complicated when different laboratories using alternate methods conduct the analysis. An...

  1. Comparison of DNA-based techniques for differentiation of production strains of ale and lager brewing yeast.

    PubMed

    Kopecká, J; Němec, M; Matoulková, D

    2016-06-01

    Brewing yeasts are classified into two species-Saccharomyces pastorianus and Saccharomyces cerevisiae. Most of the brewing yeast strains are natural interspecies hybrids typically polyploids and their identification is thus often difficult giving heterogenous results according to the method used. We performed genetic characterization of a set of the brewing yeast strains coming from several yeast culture collections by combination of various DNA-based techniques. The aim of this study was to select a method for species-specific identification of yeast and discrimination of yeast strains according to their technological classification. A group of 40 yeast strains were characterized using PCR-RFLP analysis of ITS-5·8S, NTS, HIS4 and COX2 genes, multiplex PCR, RAPD-PCR of genomic DNA, mtDNA-RFLP and electrophoretic karyotyping. Reliable differentiation of yeast to the species level was achieved by PCR-RFLP of HIS4 gene. Numerical analysis of the obtained RAPD-fingerprints and karyotype revealed species-specific clustering corresponding with the technological classification of the strains. Taxonomic position and partial hybrid nature of strains were verified by multiplex PCR. Differentiation among species using the PCR-RFLP of ITS-5·8S and NTS region was shown to be unreliable. Karyotyping and RFLP of mitochondrial DNA evinced small inaccuracies in strain categorization. PCR-RFLP of HIS4 gene and RAPD-PCR of genomic DNA are reliable and suitable methods for fast identification of yeast strains. RAPD-PCR with primer 21 is a fast and reliable method applicable for differentiation of brewing yeasts with only 35% similarity of fingerprint profile between the two main technological groups (ale and lager) of brewing strains. It was proved that PCR-RFLP method of HIS4 gene enables precise discrimination among three technologically important Saccharomyces species. Differentiation of brewing yeast to the strain level can be achieved using the RAPD-PCR technique. © 2016 The Society for Applied Microbiology.

  2. Technique for quantitative RT-PCR analysis directly from single muscle fibers.

    PubMed

    Wacker, Michael J; Tehel, Michelle M; Gallagher, Philip M

    2008-07-01

    The use of single-cell quantitative RT-PCR has greatly aided the study of gene expression in fields such as muscle physiology. For this study, we hypothesized that single muscle fibers from a biopsy can be placed directly into the reverse transcription buffer and that gene expression data can be obtained without having to first extract the RNA. To test this hypothesis, biopsies were taken from the vastus lateralis of five male subjects. Single muscle fibers were isolated and underwent RNA isolation (technique 1) or placed directly into reverse transcription buffer (technique 2). After cDNA conversion, individual fiber cDNA was pooled and quantitative PCR was performed using primer-probes for beta(2)-microglobulin, glyceraldehyde-3-phosphate dehydrogenase, insulin-like growth factor I receptor, and glucose transporter subtype 4. The no RNA extraction method provided similar quantitative PCR data as that of the RNA extraction method. A third technique was also tested in which we used one-quarter of an individual fiber's cDNA for PCR (not pooled) and the average coefficient of variation between fibers was <8% (cycle threshold value) for all genes studied. The no RNA extraction technique was tested on isolated muscle fibers using a gene known to increase after exercise (pyruvate dehydrogenase kinase 4). We observed a 13.9-fold change in expression after resistance exercise, which is consistent with what has been previously observed. These results demonstrate a successful method for gene expression analysis directly from single muscle fibers.

  3. AMP Affects Intracellular Ca2+ Signaling, Migration, Cytokine Secretion and T Cell Priming Capacity of Dendritic Cells

    PubMed Central

    Panther, Elisabeth; Dürk, Thorsten; Ferrari, Davide; Di Virgilio, Francesco; Grimm, Melanie; Sorichter, Stephan; Cicko, Sanja; Herouy, Yared; Norgauer, Johannes; Idzko, Marco; Müller, Tobias

    2012-01-01

    The nucleotide adenosine-5′-monophosphate (AMP) can be released by various cell types and has been shown to elicit different cellular responses. In the extracellular space AMP is dephosphorylated to the nucleoside adenosine which can then bind to adenosine receptors. However, it has been shown that AMP can also activate A1 and A2a receptors directly. Here we show that AMP is a potent modulator of mouse and human dendritic cell (DC) function. AMP increased intracellular Ca2+ concentration in a time and dose dependent manner. Furthermore, AMP stimulated actin-polymerization in human DCs and induced migration of immature human and bone marrow derived mouse DCs, both via direct activation of A1 receptors. AMP strongly inhibited secretion of TNF-α and IL-12p70, while it enhanced production of IL-10 both via activation of A2a receptors. Consequently, DCs matured in the presence of AMP and co-cultivated with naive CD4+CD45RA+ T cells inhibited IFN-γ production whereas secretion of IL-5 and IL-13 was up-regulated. An enhancement of Th2-driven immune response could also be observed when OVA-pulsed murine DCs were pretreated with AMP prior to co-culture with OVA-transgenic naïve OTII T cells. An effect due to the enzymatic degradation of AMP to adenosine could be ruled out, as AMP still elicited migration and changes in cytokine secretion in bone-marrow derived DCs generated from CD73-deficient animals and in human DCs pretreated with the ecto-nucleotidase inhibitor 5′-(alpha,beta-methylene) diphosphate (APCP). Finally, the influence of contaminating adenosine could be excluded, as AMP admixed with adenosine desaminase (ADA) was still able to influence DC function. In summary our data show that AMP when present during maturation is a potent regulator of dendritic cell function and point out the role for AMP in the pathogenesis of inflammatory disorders. PMID:22624049

  4. c-di-AMP: An Essential Molecule in the Signaling Pathways that Regulate the Viability and Virulence of Gram-Positive Bacteria

    PubMed Central

    Fahmi, Tazin; Port, Gary C.

    2017-01-01

    Signal transduction pathways enable organisms to monitor their external environment and adjust gene regulation to appropriately modify their cellular processes. Second messenger nucleotides including cyclic adenosine monophosphate (c-AMP), cyclic guanosine monophosphate (c-GMP), cyclic di-guanosine monophosphate (c-di-GMP), and cyclic di-adenosine monophosphate (c-di-AMP) play key roles in many signal transduction pathways used by prokaryotes and/or eukaryotes. Among the various second messenger nucleotides molecules, c-di-AMP was discovered recently and has since been shown to be involved in cell growth, survival, and regulation of virulence, primarily within Gram-positive bacteria. The cellular level of c-di-AMP is maintained by a family of c-di-AMP synthesizing enzymes, diadenylate cyclases (DACs), and degradation enzymes, phosphodiesterases (PDEs). Genetic manipulation of DACs and PDEs have demonstrated that alteration of c-di-AMP levels impacts both growth and virulence of microorganisms. Unlike other second messenger molecules, c-di-AMP is essential for growth in several bacterial species as many basic cellular functions are regulated by c-di-AMP including cell wall maintenance, potassium ion homeostasis, DNA damage repair, etc. c-di-AMP follows a typical second messenger signaling pathway, beginning with binding to receptor molecules to subsequent regulation of downstream cellular processes. While c-di-AMP binds to specific proteins that regulate pathways in bacterial cells, c-di-AMP also binds to regulatory RNA molecules that control potassium ion channel expression in Bacillus subtilis. c-di-AMP signaling also occurs in eukaryotes, as bacterially produced c-di-AMP stimulates host immune responses during infection through binding of innate immune surveillance proteins. Due to its existence in diverse microorganisms, its involvement in crucial cellular activities, and its stimulating activity in host immune responses, c-di-AMP signaling pathway has become an attractive antimicrobial drug target and therefore has been the focus of intensive study in several important pathogens. PMID:28783096

  5. cAMP-secretion coupling is impaired in diabetic GK/Par rat β-cells: a defect counteracted by GLP-1.

    PubMed

    Dolz, Manuel; Movassat, Jamileh; Bailbé, Danielle; Le Stunff, Hervé; Giroix, Marie-Hélène; Fradet, Magali; Kergoat, Micheline; Portha, Bernard

    2011-11-01

    cAMP-raising agents with glucagon-like peptide-1 (GLP-1) as the first in class, exhibit multiple actions that are beneficial for the treatment of type 2 diabetic (T2D) patients, including improvement of glucose-induced insulin secretion (GIIS). To gain additional insight into the role of cAMP in the disturbed stimulus-secretion coupling within the diabetic β-cell, we examined more thoroughly the relationship between changes in islet cAMP concentration and insulin release in the GK/Par rat model of T2D. Basal cAMP content in GK/Par islets was significantly higher, whereas their basal insulin release was not significantly different from that of Wistar (W) islets. Even in the presence of IBMX or GLP-1, their insulin release did not significantly change despite further enhanced cAMP accumulation in both cases. The high basal cAMP level most likely reflects an increased cAMP generation in GK/Par compared with W islets since 1) forskolin dose-dependently induced an exaggerated cAMP accumulation; 2) adenylyl cyclase (AC)2, AC3, and G(s)α proteins were overexpressed; 3) IBMX-activated cAMP accumulation was less efficient and PDE-3B and PDE-1C mRNA were decreased. Moreover, the GK/Par insulin release apparatus appears less sensitive to cAMP, since GK/Par islets released less insulin at submaximal cAMP levels and required five times more cAMP to reach a maximal secretion rate no longer different from W. GLP-1 was able to reactivate GK/Par insulin secretion so that GIIS became indistinguishable from that of W. The exaggerated cAMP production is instrumental, since GLP-1-induced GIIS reactivation was lost in the presence the AC blocker 2',5'-dideoxyadenosine. This GLP-1 effect takes place in the absence of any improvement of the [Ca(2+)](i) response and correlates with activation of the cAMP-dependent PKA-dependent pathway.

  6. 8-Bromo-cAMP decreases the Ca2+ sensitivity of airway smooth muscle contraction through a mechanism distinct from inhibition of Rho-kinase.

    PubMed

    Endou, Katsuaki; Iizuka, Kunihiko; Yoshii, Akihiro; Tsukagoshi, Hideo; Ishizuka, Tamotsu; Dobashi, Kunio; Nakazawa, Tsugio; Mori, Masatomo

    2004-10-01

    To clarify whether cyclic AMP (cAMP)/cAMP-dependent protein kinase (PKA) activation and Rho-kinase inhibition share a common mechanism to decrease the Ca2+ sensitivity of airway smooth muscle contraction, we examined the effects of 8-bromoadenosine 3',5'-cyclic monophosphate (8-BrcAMP), a stable cAMP analog, and (+)-(R)-trans-4-(1-aminoethyl)-N-(4-pyridyl) cyclohexane carboxamide dihydrochloride, monohydrate (Y-27632), a Rho-kinase inhibitor, on carbachol (CCh)-, guanosine 5'-O-(3-thiotriphosphate) (GTPgammaS)-, 4beta-phorbol 12,13-dibutyrate (PDBu)-, and leukotriene D4 (LTD4)-induced Ca2+ sensitization in alpha-toxin-permeabilized rabbit tracheal and human bronchial smooth muscle. In rabbit trachea, CCh-induced smooth muscle contraction was inhibited by 8-BrcAMP and Y-27632 to a similar extent. However, GTPgammaS-induced smooth muscle contraction was resistant to 8-BrcAMP. In the presence of a saturating concentration of Y-27632, PDBu-induced smooth muscle contraction was completely reversed by 8-BrcAMP. Conversely, PDBu-induced smooth muscle contraction was resistant to Y-27632. In the presence of a saturating concentration of 8-BrcAMP, GTPgammaS-induced Ca2+ sensitization was also reversed by Y-27632. The 8-BrcAMP had no effect on the ATP-triggered contraction of tracheal smooth muscle that had been treated with calyculin A in rigor solutions. The 8-BrcAMP and Y-27632 additively accelerated the relaxation rate of PDBu- and GTPgammaS-treated smooth muscle under myosin light chain kinase-inhibited conditions. In human bronchus, LTD4-induced smooth muscle contraction was inhibited by both 8-BrcAMP and Y-27632. We conclude that cAMP/PKA-induced Ca2+ desensitization contains at least two mechanisms: 1) inhibition of the muscarinic receptor signaling upstream from Rho activation and 2) cAMP/PKA's preferential reversal of PKC-mediated Ca2+ sensitization in airway smooth muscle.

  7. A Computational approach in optimizing process parameters of GTAW for SA 106 Grade B steel pipes using Response surface methodology

    NASA Astrophysics Data System (ADS)

    Sumesh, A.; Sai Ramnadh, L. V.; Manish, P.; Harnath, V.; Lakshman, V.

    2016-09-01

    Welding is one of the most common metal joining techniques used in industry for decades. As in the global manufacturing scenario the products should be more cost effective. Therefore the selection of right process with optimal parameters will help the industry in minimizing their cost of production. SA 106 Grade B steel has a wide application in Automobile chassis structure, Boiler tubes and pressure vessels industries. Employing central composite design the process parameters for Gas Tungsten Arc Welding was optimized. The input parameters chosen were weld current, peak current and frequency. The joint tensile strength was the response considered in this study. Analysis of variance was performed to determine the statistical significance of the parameters and a Regression analysis was performed to determine the effect of input parameters over the response. From the experiment the maximum tensile strength obtained was 95 KN reported for a weld current of 95 Amp, frequency of 50 Hz and peak current of 100 Amp. With an aim of maximizing the joint strength using Response optimizer a target value of 100 KN is selected and regression models were optimized. The output results are achievable with a Weld current of 62.6148 Amp, Frequency of 23.1821 Hz, and Peak current of 65.9104 Amp. Using Die penetration test the weld joints were also classified in to 2 categories as good weld and weld with defect. This will also help in getting a defect free joint when welding is performed using GTAW process.

  8. Chronic exercise improves repeated restraint stress-induced anxiety and depression through 5HT1A receptor and cAMP signaling in hippocampus.

    PubMed

    Kim, Mun Hee; Leem, Yea Hyun

    2014-03-01

    Mood disorders such as anxiety and depression are prevalent psychiatric illness, but the role of 5HT1A in the anti-depressive effects of exercise has been rarely known yet. We investigated whether long-term exercise affected a depressive-like behavior and a hippocampal 5HT1A receptor-mediated cAMP/PKA/CREB signaling in depression mice model. To induce depressive behaviors, mice were subjected to 14 consecutive days of restraint stress (2 hours/day). Depression-like behaviors were measured by forced swimming test (TST), and anxiety-like behavior was assessed by elevated plus maze (EPM). Treadmill exercise was performed with 19 m/min for 60 min/day, 5 days/week from weeks 0 to 8. Restraint stress was started at week 6 week and ended at week 8. To elucidate the role of 5HT1A in depression, the immunoreactivities of 5HT1A were detected in hippocampus using immunohistochemical technique. Chronic/repeated restraint stress induced behavioral anxiety and depression, such as reduced time and entries in open arms in EPM and enhanced immobility time in FST. These anxiety and depressive behaviors were ameliorated by chronic exercise. Also, these behavioral changes were concurrent with the deficit of 5HT1A and cAMP/PKA/CREB cascade in hippocampus, which was coped with chronic exercise. These results suggest that chronic exercise may improve the disturbance of hippocampal 5HT1A-regulated cAMP/PKA/CREB signaling in a depressed brain, thereby exerting an antidepressive action.

  9. Regulation of murine cystic fibrosis transmembrane conductance regulator Cl− channels expressed in Chinese hamster ovary cells

    PubMed Central

    Lansdell, K A; Kidd, J F; Delaney, S J; Wainwright, B J; Sheppard, D N

    1998-01-01

    We investigated the effect of protein kinases and phosphatases on murine cystic fibrosis transmembrane conductance regulator (CFTR) Cl− channels, expressed in Chinese hamster ovary (CHO) cells, using iodide efflux and the excised inside-out configuration of the patch-clamp technique.The protein kinase C (PKC) activator, phorbol dibutyrate, enhanced cAMP-stimulated iodide efflux. However, PKC did not augment the single-channel activity of either human or murine CFTR Cl− channels that had previously been activated by protein kinase A.Fluoride, a non-specific inhibitor of protein phosphatases, stimulated both human and murine CFTR Cl− channels. However, calyculin A, a potent inhibitor of protein phosphatases 1 and 2A, did not enhance cAMP-stimulated iodide efflux.The alkaline phosphatase inhibitor, (−)-bromotetramisole augmented cAMP-stimulated iodide efflux and, by itself, stimulated a larger efflux than that evoked by cAMP agonists. However, (+)-bromotetramisole, the inactive enantiomer, had the same effect. For murine CFTR, neither enantiomer enhanced single-channel activity. In contrast, both enantiomers increased the open probability (Po) of human CFTR, suggesting that bromotetramisole may promote the opening of human CFTR.As murine CFTR had a low Po and was refractory to stimulation by activators of human CFTR, we investigated whether murine CFTR may open to a subconductance state. When single-channel records were filtered at 50 Hz, a very small subconductance state of murine CFTR was observed that had a Po greater than that of human CFTR. The occupancy of this subconductance state may explain the differences in channel regulation observed between human and murine CFTR. PMID:9769419

  10. Further studies on rat mast cell degranulation by IgE—anti-IgE and the inhibitory effect of drugs related to cAMP

    PubMed Central

    Kimura, Y.; Inoue, Yoshie; Honda, H.

    1974-01-01

    With a modified rat mast cell degranulation (RMCD) technique developed by Korotzer, Haddad and Lopapa (1971), the mechanism of mast cell degranulation by IgE—anti-IgE reaction and the inhibitory effect of cAMP-related compounds upon IgE-mediated mast cell degranulation were studied. Degranulations of 90 per cent or more were decreased to 13–16 per cent when the mast cells were pretreated with human IgE or normal human serum. However, if rat mast cells were pretreated with anti-human IgE rabbit serum or normal rabbit serum, the degranulation per cent in these cells by IgE—anti-IgE reaction was the same as in the nontreated cells. These results suggest the presence of receptors in rat mast cells for human IgE or normal human serum, and the lack of receptors in these cells for anti-human IgE rabbit serum or normal rabbit serum. Treatment of isolated rat mast cells with adenyl cyclase stimulating agents (isoprenaline, adrenaline, prostaglandin E1 and E2) and theophylline or aminophylline, which inhibit the enzymatic degradation of cAMP, also inhibited the morphological degranulation of the mast cells. Cromoglycate or chlorophenes in derivatives, which might have a stabilizing effect of the cell membrane, also inhibited the degranulation of the rat mast cells mediated by IgE—anti-IgE reaction. These results support the attractive hypothesis that cAMP occupies a central modulatory role in the in vitro mast cell degranulation by IgE—anti-IgE reaction. PMID:4368738

  11. Development of real-time RT-PCR for the detection of low concentrations of Rift Valley fever virus.

    PubMed

    Maquart, Marianne; Temmam, Sarah; Héraud, Jean-Michel; Leparc-Goffart, Isabelle; Cêtre-Sossah, Catherine; Dellagi, Koussay; Cardinale, Eric; Pascalis, Hervé

    2014-01-01

    In recent years, Madagascar and the Comoros archipelago have been affected by epidemics of Rift Valley fever (RVF), however detection of Rift Valley fever virus (RVFV) in zebu, sheep and goats during the post epidemic periods was frequently unsuccessful. Thus, a highly sensitive real-time RT-PCR assay was developed for the detection of RVFV at low viral loads. A new RVF SYBR Green RT-PCR targeting the M segment was tested on serum from different RVF seronegative ruminant species collected from May 2010 to August 2011 in Madagascar and the Comoros archipelago and compared with a RVF specific quantitative real time RT-PCR technique, which is considered as the reference technique. The specificity was tested on a wide range of arboviruses or other viruses giving RVF similar clinical signs. A total of 38 out of 2756 serum samples tested positive with the new RT-PCR, whereas the reference technique only detected 5 out of the 2756. The described RT-PCR is an efficient diagnostic tool for the investigation of enzootic circulation of the RVF virus. It allows the detection of low viral RNA loads adapted for the investigations of reservoirs or specific epidemiological situations such as inter-epizootic periods. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Application of PCR and real-time PCR for monitoring cyanobacteria, Microcystis spp. and Cylindrospermopsis raciborskii in Macau freshwater reservoir

    NASA Astrophysics Data System (ADS)

    Zhang, Weiying; Lou, Inchio; Ung, Wai Kin; Kong, Yijun; Mok, Kai Meng

    2014-06-01

    Freshwater algal blooms have become a growing concern world-wide. They are caused by a high level of cyanobacteria, predominantly Microcystis spp. and Cylindrospermopsis raciborskii, which can produce microcystin and cylindrospermopsin, respectively. Longtime exposure to these cyanotoxins may affect public health, thus reliable detection, quantification, and enumeration of these harmful algae species has become a priority in water quality management. Traditional manual enumeration of algal bloom cells primarily involves microscopic identification which limited by inaccuracy and time-consumption.With the development of molecular techniques and an increasing number of microbial sequences available in the Genbank database, the use of molecular methods can be used for more rapid, reliable, and accurate detection and quantification. In this study, multiplex polymerase chain reaction (PCR) and real-time quantitative PCR (qPCR) techniques were developed and applied for monitoring cyanobacteria Microcystis spp. and C. raciborskii in the Macau Storage Reservoir (MSR). The results showed that the techniques were successful for identifying and quantifying the species in pure cultures and mixed cultures, and proved to be a potential application for water sampling in MSR. When the target species were above 1 million cells/L, similar cell numbers estimated by microscopic enumeration and qPCR were obtained. Further quantification in water samples indicated that the ratio of the estimated number of cell by microscopy and qPCR was 0.4-12.9 for cyanobacteria and 0.2-3.9 for C. raciborskii. However, Microcystis spp. was not observed by manual enumeration, while it was detected at low levels by qPCR, suggesting that qPCR is more sensitive and accurate. Thus the molecular approaches provide an additional reliable monitoring option to traditional microscopic enumeration for the ecosystems monitoring program.

  13. Enzymatic Characterization of AMP Phosphorylase and Ribose-1,5-Bisphosphate Isomerase Functioning in an Archaeal AMP Metabolic Pathway

    PubMed Central

    Aono, Riku; Sato, Takaaki; Yano, Ayumu; Yoshida, Shosuke; Nishitani, Yuichi; Miki, Kunio; Imanaka, Tadayuki

    2012-01-01

    AMP phosphorylase (AMPpase), ribose-1,5-bisphosphate (R15P) isomerase, and type III ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) have been proposed to constitute a novel pathway involved in AMP metabolism in the Archaea. Here we performed a biochemical examination of AMPpase and R15P isomerase from Thermococcus kodakarensis. R15P isomerase was specific for the α-anomer of R15P and did not recognize other sugar compounds. We observed that activity was extremely low with the substrate R15P alone but was dramatically activated in the presence of AMP. Using AMP-activated R15P isomerase, we reevaluated the substrate specificity of AMPpase. AMPpase exhibited phosphorylase activity toward CMP and UMP in addition to AMP. The [S]-v plot (plot of velocity versus substrate concentration) of the enzyme toward AMP was sigmoidal, with an increase in activity observed at concentrations higher than approximately 3 mM. The behavior of the two enzymes toward AMP indicates that the pathway is intrinsically designed to prevent excess degradation of intracellular AMP. We further examined the formation of 3-phosphoglycerate from AMP, CMP, and UMP in T. kodakarensis cell extracts. 3-Phosphoglycerate generation was observed from AMP alone, and from CMP or UMP in the presence of dAMP, which also activates R15P isomerase. 3-Phosphoglycerate was not formed when 2-carboxyarabinitol 1,5-bisphosphate, a Rubisco inhibitor, was added. The results strongly suggest that these enzymes are actually involved in the conversion of nucleoside monophosphates to 3-phosphoglycerate in T. kodakarensis. PMID:23065974

  14. Response Time Measurements of the NIF DANTE XRD-31 X-Ray Diodes (Pre-print)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Don Pellinen and Michael Griffin

    2009-01-23

    The XRD-31 is a fast, windowless X-ray vacuum photodiode developed by EG&G. It is currently the primary fast X-ray detector used to diagnose the X-rays on NIF and OMEGA on the multichannel DANTE spectrometer. The XRD-31 has a dynamic range of less than 1e-12 amps to more than 10 amps. A technique is described to measure the impulse response of the diodes to a 150 fs pulse of 200 nm laser light and a method to calculate the “risetime” for a square pulse and compare it with the computed electron transit time from the photocathode to the anode. Measured responsemore » time for 5 XRD-31s assembled in early 2004 was 149.7 ps +-2.75 ps.« less

  15. Anticonvulsant effect of AMP by direct activation of adenosine A1 receptor.

    PubMed

    Muzzi, Mirko; Coppi, Elisabetta; Pugliese, Anna Maria; Chiarugi, Alberto

    2013-12-01

    Purinergic neurotransmission mediated by adenosine (Ado) type 1 receptors (A1Rs) plays pivotal roles in negative modulation of epileptic seizures, and Ado is thought to be a key endogenous anticonvulsant. Recent evidence, however, indicates that AMP, the metabolic precursor of Ado, also activate A1Rs. Here, we evaluated the antiepileptic effects of AMP adopting in vitro and in vivo models of epilepsy. We report that AMP reversed the increase in population spike (PS) amplitude and the decrease in PS latency induced by a Mg(2+)-free extracellular solution in CA1 neurons of mouse hippocampal slices. The AMP effects were inhibited by the A1R antagonist DPCPX, but not prevented by inhibiting conversion of AMP into Ado, indicating that AMP inhibited per se sustained hippocampal excitatory neurotransmission by directly activating A1Rs. AMP also reduced seizure severity and mortality in a model of audiogenic convulsion. Of note, the anticonvulsant effects of AMP were potentiated by preventing its conversion into Ado and inhibited by DPCPX. When tested in a model of kainate-induced seizure, AMP prolonged latency of convulsions but had no effects on seizure severity and mortality. Data provide the first evidence that AMP is an endogenous anticonvulsant acting at A1Rs. © 2013.

  16. The relationship between pulsatile GnRH secretion and cAMP production in immortalized GnRH neurons.

    PubMed

    Frattarelli, John L; Krsmanovic, Lazar Z; Catt, Kevin J

    2011-06-01

    In perifused immortalized GnRH neurons (GT1-7), simultaneous measurements of GnRH and cAMP revealed that the secretory profiles for both GnRH and cAMP are pulsatile. An analysis of GnRH and cAMP pulses in 16 independent experiments revealed that 25% of pulses coincide. Inversion of the peak and nadir levels was found in 33% and random relationship between GnRH and cAMP found in 42% of analyzed pulses. The random relation between GnRH and cAMP pulse resets to synchronous after an inverse relation between pulses occurred during the major GnRH release, indicating that GnRH acts as a switching mechanism to synchronize cAMP and GnRH release in perifused GT1-7 neurons. Activation of GnRH receptors with increasing agonist concentrations caused a biphasic change in cAMP levels. Low nanomolar concentrations increased cAMP production, but at high concentrations the initial increase was followed by a rapid decline to below the basal level. Blockade of the GnRH receptors by peptide and nonpeptide antagonists generated monotonic nonpulsatile increases in both GnRH and cAMP production. These findings indicate that cAMP positively regulates GnRH secretion but does not participate in the mechanism of pulsatile GnRH release.

  17. Exchange protein activated by cAMP (Epac) mediates cAMP-dependent but protein kinase A-insensitive modulation of vascular ATP-sensitive potassium channels

    PubMed Central

    Purves, Gregor I; Kamishima, Tomoko; Davies, Lowri M; Quayle, John M; Dart, Caroline

    2009-01-01

    Exchange proteins directly activated by cyclic AMP (Epacs or cAMP-GEF) represent a family of novel cAMP-binding effector proteins. The identification of Epacs and the recent development of pharmacological tools that discriminate between cAMP-mediated pathways have revealed previously unrecognized roles for cAMP that are independent of its traditional target cAMP-dependent protein kinase (PKA). Here we show that Epac exists in a complex with vascular ATP-sensitive potassium (KATP) channel subunits and that cAMP-mediated activation of Epac modulates KATP channel activity via a Ca2+-dependent mechanism involving the activation of Ca2+-sensitive protein phosphatase 2B (PP-2B, calcineurin). Application of the Epac-specific cAMP analogue 8-pCPT-2′-O-Me-cAMP, at concentrations that activate Epac but not PKA, caused a 41.6 ± 4.7% inhibition (mean ±s.e.m.; n= 7) of pinacidil-evoked whole-cell KATP currents recorded in isolated rat aortic smooth muscle cells. Importantly, similar results were obtained when cAMP was elevated by addition of the adenylyl cyclase activator forskolin in the presence of the structurally distinct PKA inhibitors, Rp-cAMPS or KT5720. Activation of Epac by 8-pCPT-2′-O-Me-cAMP caused a transient 171.0 ± 18.0 nm (n= 5) increase in intracellular Ca2+ in Fura-2-loaded aortic myocytes, which persisted in the absence of extracellular Ca2+. Inclusion of the Ca2+-specific chelator BAPTA in the pipette-filling solution or preincubation with the calcineurin inhibitors, cyclosporin A or ascomycin, significantly reduced the ability of 8-pCPT-2′-O-Me-cAMP to inhibit whole-cell KATP currents. These results highlight a previously undescribed cAMP-dependent regulatory mechanism that may be essential for understanding the physiological and pathophysiological roles ascribed to arterial KATP channels in the control of vascular tone and blood flow. PMID:19491242

  18. Effect of entacapone on colon motility and ion transport in a rat model of Parkinson's disease.

    PubMed

    Li, Li-Sheng; Liu, Chen-Zhe; Xu, Jing-Dong; Zheng, Li-Fei; Feng, Xiao-Yan; Zhang, Yue; Zhu, Jin-Xia

    2015-03-28

    To study the effects of entacapone, a catechol-O-methyltransferase inhibitor, on colon motility and electrolyte transport in Parkinson's disease (PD) rats. Distribution and expression of catechol-O-methyltransferase (COMT) were measured by immunohistochemistry and Western blotting methods. The colonic smooth muscle motility was examined in vitro by means of a muscle motility recording device. The mucosal electrolyte transport of PD rats was examined by using a short-circuit current (ISC ) technique and scanning ion-selective electrode technique (SIET). Intracellular detection of cAMP and cGMP was accomplished by radioimmunoassay testing. COMT was expressed in the colons of both normal and PD rats, mainly on the apical membranes of villi and crypts in the colon. Compared to normal controls, PD rats expressed less COMT. The COMT inhibitor entacapone inhibited contraction of the PD rat longitudinal muscle in a dose-dependent manner. The β2 adrenoceptor antagonist ICI-118,551 blocked this inhibitory effect by approximately 67% (P < 0.01). Entacapone increased mucosal ISC in the colon of rats with PD. This induction was significantly inhibited by apical application of Cl(-) channel blocker diphenylamine-2, 2'-dicarboxylic acid, basolateral application of Na(+)-K(+)-2Cl(-)co-transporter antagonist bumetanide, elimination of Cl(-) from the extracellular fluid, as well as pretreatment using adenylate cyclase inhibitor MDL12330A. As an inhibitor of prostaglandin synthetase, indomethacin can inhibit entacapone-induced ISC by 45% (P < 0.01). When SIET was applied to measure Cl(-) flux changes, this provided similar results. Entacapone significantly increased intracellular cAMP content in the colonic mucosa, which was greatly inhibited by indomethacin. COMT expression exists in rat colons. The β2 adrenoceptor is involved in the entacapone-induced inhibition of colon motility. Entacapone induces cAMP-dependent Cl(-) secretion in the PD rat.

  19. Attenuated response of L-type calcium current to nitric oxide in atrial fibrillation.

    PubMed

    Rozmaritsa, Nadiia; Christ, Torsten; Van Wagoner, David R; Haase, Hannelore; Stasch, Johannes-Peter; Matschke, Klaus; Ravens, Ursula

    2014-03-01

    Nitric oxide (NO) synthesized by cardiomyocytes plays an important role in the regulation of cardiac function. Here, we studied the impact of NO signalling on calcium influx in human right atrial myocytes and its relation to atrial fibrillation (AF). Right atrial appendages (RAAs) were obtained from patients in sinus rhythm (SR) and AF. The biotin-switch technique was used to evaluate endogenous S-nitrosylation of the α1C subunit of L-type calcium channels. Comparing SR to AF, S-nitrosylation of Ca(2+) channels was similar. Direct effects of the NO donor S-nitroso-N-acetyl-penicillamine (SNAP) on L-type calcium current (ICa,L) were studied in cardiomyocytes with standard voltage-clamp techniques. In SR, ICa,L increased with SNAP (100 µM) by 48%, n/N = 117/56, P < 0.001. The SNAP effect on ICa,L involved activation of soluble guanylate cyclase and protein kinase A. Specific inhibition of phosphodiesterase (PDE)3 with cilostamide (1 µM) enhanced ICa,L to a similar extent as SNAP. However, when cAMP was elevated by PDE3 inhibition or β-adrenoceptor stimulation, SNAP reduced ICa,L, pointing to cGMP-cAMP cross-regulation. In AF, the stimulatory effect of SNAP on ICa,L was attenuated, while its inhibitory effect on isoprenaline- or cilostamide-stimulated current was preserved. cGMP elevation with SNAP was comparable between the SR and AF group. Moreover, the expression of PDE3 and soluble guanylate cyclase was not reduced in AF. NO exerts dual effects on ICa,L in SR with an increase of basal and inhibition of cAMP-stimulated current, and in AF NO inhibits only stimulated ICa,L. We conclude that in AF, cGMP regulation of PDE2 is preserved, but regulation of PDE3 is lost.

  20. Adenosine receptors regulate gap junction coupling of the human cerebral microvascular endothelial cells hCMEC/D3 by Ca2+ influx through cyclic nucleotide-gated channels.

    PubMed

    Bader, Almke; Bintig, Willem; Begandt, Daniela; Klett, Anne; Siller, Ina G; Gregor, Carola; Schaarschmidt, Frank; Weksler, Babette; Romero, Ignacio; Couraud, Pierre-Olivier; Hell, Stefan W; Ngezahayo, Anaclet

    2017-04-15

    Gap junction channels are essential for the formation and regulation of physiological units in tissues by allowing the lateral cell-to-cell diffusion of ions, metabolites and second messengers. Stimulation of the adenosine receptor subtype A 2B increases the gap junction coupling in the human blood-brain barrier endothelial cell line hCMEC/D3. Although the increased gap junction coupling is cAMP-dependent, neither the protein kinase A nor the exchange protein directly activated by cAMP were involved in this increase. We found that cAMP activates cyclic nucleotide-gated (CNG) channels and thereby induces a Ca 2+ influx, which leads to the increase in gap junction coupling. The report identifies CNG channels as a possible physiological link between adenosine receptors and the regulation of gap junction channels in endothelial cells of the blood-brain barrier. The human cerebral microvascular endothelial cell line hCMEC/D3 was used to characterize the physiological link between adenosine receptors and the gap junction coupling in endothelial cells of the blood-brain barrier. Expressed adenosine receptor subtypes and connexin (Cx) isoforms were identified by RT-PCR. Scrape loading/dye transfer was used to evaluate the impact of the A 2A and A 2B adenosine receptor subtype agonist 2-phenylaminoadenosine (2-PAA) on the gap junction coupling. We found that 2-PAA stimulated cAMP synthesis and enhanced gap junction coupling in a concentration-dependent manner. This enhancement was accompanied by an increase in gap junction plaques formed by Cx43. Inhibition of protein kinase A did not affect the 2-PAA-related enhancement of gap junction coupling. In contrast, the cyclic nucleotide-gated (CNG) channel inhibitor l-cis-diltiazem, as well as the chelation of intracellular Ca 2+ with BAPTA, or the absence of external Ca 2+ , suppressed the 2-PAA-related enhancement of gap junction coupling. Moreover, we observed a 2-PAA-dependent activation of CNG channels by a combination of electrophysiology and pharmacology. In conclusion, the stimulation of adenosine receptors in hCMEC/D3 cells induces a Ca 2+ influx by opening CNG channels in a cAMP-dependent manner. Ca 2+ in turn induces the formation of new gap junction plaques and a consecutive sustained enhancement of gap junction coupling. The report identifies CNG channels as a physiological link that integrates gap junction coupling into the adenosine receptor-dependent signalling of endothelial cells of the blood-brain barrier. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.

  1. Persons with allergy symptoms use alternative medicine more often.

    PubMed

    Kłak, Anna; Raciborski, Filip; Krzych-Fałta, Edyta; Opoczyńska-Świeżewska, Dagmara; Szymański, Jakub; Lipiec, Agnieszka; Piekarska, Barbara; Sybilski, Adam; Tomaszewska, Aneta; Samoliński, Bolesław

    2016-01-01

    The aim of the study is to indicate the relation between the use of alternative medicine and the occurrence of allergic diseases in the Polish population of adults in the age of 20-44 years. Moreover the additional aim of the study is to define the relation between the sex, age and place of living and the use of alternative medicine. The data from the project Epidemiology of Allergic Diseases in Poland (ECAP) has been used for analysis. This project was a continuation of the European Community Respiratory Health Survey II. The questions on alternative medicine were asked to the group of 4671 respondents in the age of 20-44 years. Additionally outpatient tests were performed in order to confirm the diagnosis of allergic diseases. The total of 22.2% of respondents that participated in the study have ever used alternative medicine (n = 4621). A statistically significant relation between the use of alternative medicine and declaration of allergic diseases and asthma symptoms has been demonstrated (p &amp;amp;amp;amp;amp;lt; 0.001). No statistically significant relation between the use of alternative medicine by persons diagnosed by a doctor with any form of asthma or seasonal allergic rhinitis (p &amp;amp;amp;amp;amp;gt; 0.05) has been demonstrated. The occurrence of allergic diseases and asthma influences the frequency of alternative medicine use. However the frequency of alternative medicine use does not depend on allergic disease or asthma being confirmed by a doctor.

  2. Distinct profiling of antimicrobial peptide families

    PubMed Central

    Khamis, Abdullah M.; Essack, Magbubah; Gao, Xin; Bajic, Vladimir B.

    2015-01-01

    Motivation: The increased prevalence of multi-drug resistant (MDR) pathogens heightens the need to design new antimicrobial agents. Antimicrobial peptides (AMPs) exhibit broad-spectrum potent activity against MDR pathogens and kills rapidly, thus giving rise to AMPs being recognized as a potential substitute for conventional antibiotics. Designing new AMPs using current in-silico approaches is, however, challenging due to the absence of suitable models, large number of design parameters, testing cycles, production time and cost. To date, AMPs have merely been categorized into families according to their primary sequences, structures and functions. The ability to computationally determine the properties that discriminate AMP families from each other could help in exploring the key characteristics of these families and facilitate the in-silico design of synthetic AMPs. Results: Here we studied 14 AMP families and sub-families. We selected a specific description of AMP amino acid sequence and identified compositional and physicochemical properties of amino acids that accurately distinguish each AMP family from all other AMPs with an average sensitivity, specificity and precision of 92.88%, 99.86% and 95.96%, respectively. Many of our identified discriminative properties have been shown to be compositional or functional characteristics of the corresponding AMP family in literature. We suggest that these properties could serve as guides for in-silico methods in design of novel synthetic AMPs. The methodology we developed is generic and has a potential to be applied for characterization of any protein family. Contact: vladimir.bajic@kaust.edu.sa Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25388148

  3. cAMP Stimulates Transepithelial Short-Circuit Current and Fluid Transport Across Porcine Ciliary Epithelium.

    PubMed

    Cheng, Angela King-Wah; Civan, Mortimer M; To, Chi-Ho; Do, Chi-Wai

    2016-12-01

    To investigate the effects of cAMP on transepithelial electrical parameters and fluid transport across porcine ciliary epithelium. Transepithelial electrical parameters were determined by mounting freshly isolated porcine ciliary epithelium in a modified Ussing chamber. Similarly, fluid movement across intact ciliary body was measured with a custom-made fluid flow chamber. Addition of 1, 10, and 100 μM 8-Br-cAMP (cAMP) to the aqueous side (nonpigmented ciliary epithelium, NPE) induced a sustained increase in short-circuit current (Isc). Addition of niflumic acid (NFA) to the aqueous surface effectively blocked the cAMP-induced Isc stimulation. The administration of cAMP to the stromal side (pigmented ciliary epithelium, PE) triggered a significant stimulation of Isc only at 100 μM. No additive effect was observed with bilateral application of cAMP. Likewise, forskolin caused a significant stimulation of Isc when applied to the aqueous side. Concomitantly, cAMP and forskolin increased fluid transport across porcine ciliary epithelium, and this stimulation was effectively inhibited by aqueous NFA. Depleting Cl- in the bathing solution abolished the baseline Isc and inhibited the subsequent stimulation by cAMP. Pretreatment with protein kinase A (PKA) blockers (H89/KT5720) significantly inhibited the cAMP- and forskolin-induced Isc responses. Our results suggest that cAMP triggers a sustained stimulation of Cl- and fluid transport across porcine ciliary epithelium; Cl- channels in the NPE cells are potentially a cellular site for this PKA-sensitive cAMP-mediated response.

  4. Temporospatial fate of bacteria and immune effector expression in house flies (Musca domestica L.) fed GFP-E. coli O157:H7

    PubMed Central

    Fleming, A.; Kumar, H.V.; Joyner, C.; Reynolds, A.; Nayduch, D.

    2014-01-01

    House flies (Diptera: Muscidae; Musca domestica L.) harbor and transmit a variety of human enteropathogens including E. coli O157:H7. Interactions between ingested bacteria and the fly gut directly impact bacterial persistence, survival and ultimately fly vector competence. We assessed the temporospatial fate of GFP-E. coli O157:H7 (GFP-ECO157) in house flies along with fly antimicrobial responses for 12 h post-ingestion. In flies fed GFP-ECO157, culture and microscopy revealed a steady decrease in bacterial load over 12 h, which was likely attributable to the combined effects of immobilization within the peritrophic matrix, lysis and peristaltic excretion. However, flies can putatively transmit this pathogen in excreta because intact bacteria were observed in the crop and rectum. qRT-PCR analysis of antimicrobial peptides (AMP) and lysozyme gene expression showed minimal upregulation in both the gut and carcass of house flies fed GFP-ECO157. However, these genes were upregulated in fly heads and salivary glands, and effector proteins were detected in the gut of some flies. Collectively, these data indicate that house flies can serve as reservoirs of E. coli O157:H7 for up to 12 h, and factors in addition to AMPs and lysozyme may contribute to bacteria destruction in the gut. PMID:24712451

  5. Drosophila melanogaster mounts a unique immune response to the Rhabdovirus sigma virus.

    PubMed

    Tsai, C W; McGraw, E A; Ammar, E-D; Dietzgen, R G; Hogenhout, S A

    2008-05-01

    Rhabdoviruses are important pathogens of humans, livestock, and plants that are often vectored by insects. Rhabdovirus particles have a characteristic bullet shape with a lipid envelope and surface-exposed transmembrane glycoproteins. Sigma virus (SIGMAV) is a member of the Rhabdoviridae and is a naturally occurring disease agent of Drosophila melanogaster. The infection is maintained in Drosophila populations through vertical transmission via germ cells. We report here the nature of the Drosophila innate immune response to SIGMAV infection as revealed by quantitative reverse transcription-PCR analysis of differentially expressed genes identified by microarray analysis. We have also compared and contrasted the immune response of the host with respect to two nonenveloped viruses, Drosophila C virus (DCV) and Drosophila X virus (DXV). We determined that SIGMAV infection upregulates expression of the peptidoglycan receptor protein genes PGRP-SB1 and PGRP-SD and the antimicrobial peptide (AMP) genes Diptericin-A, Attacin-A, Attacin-B, Cecropin-A1, and Drosocin. SIGMAV infection did not induce PGRP-SA and the AMP genes Drosomycin-B, Metchnikowin, and Defensin that are upregulated in DCV and/or DXV infections. Expression levels of the Toll and Imd signaling cascade genes are not significantly altered by SIGMAV infection. These results highlight shared and unique aspects of the Drosophila immune response to the three viruses and may shed light on the nature of the interaction with the host and the evolution of these associations.

  6. Drosophila melanogaster Mounts a Unique Immune Response to the Rhabdovirus Sigma virus▿

    PubMed Central

    Tsai, C. W.; McGraw, E. A.; Ammar, E.-D.; Dietzgen, R. G.; Hogenhout, S. A.

    2008-01-01

    Rhabdoviruses are important pathogens of humans, livestock, and plants that are often vectored by insects. Rhabdovirus particles have a characteristic bullet shape with a lipid envelope and surface-exposed transmembrane glycoproteins. Sigma virus (SIGMAV) is a member of the Rhabdoviridae and is a naturally occurring disease agent of Drosophila melanogaster. The infection is maintained in Drosophila populations through vertical transmission via germ cells. We report here the nature of the Drosophila innate immune response to SIGMAV infection as revealed by quantitative reverse transcription-PCR analysis of differentially expressed genes identified by microarray analysis. We have also compared and contrasted the immune response of the host with respect to two nonenveloped viruses, Drosophila C virus (DCV) and Drosophila X virus (DXV). We determined that SIGMAV infection upregulates expression of the peptidoglycan receptor protein genes PGRP-SB1 and PGRP-SD and the antimicrobial peptide (AMP) genes Diptericin-A, Attacin-A, Attacin-B, Cecropin-A1, and Drosocin. SIGMAV infection did not induce PGRP-SA and the AMP genes Drosomycin-B, Metchnikowin, and Defensin that are upregulated in DCV and/or DXV infections. Expression levels of the Toll and Imd signaling cascade genes are not significantly altered by SIGMAV infection. These results highlight shared and unique aspects of the Drosophila immune response to the three viruses and may shed light on the nature of the interaction with the host and the evolution of these associations. PMID:18378641

  7. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

    PubMed

    Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

    2017-06-25

    Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

  8. Analysis of specific RNA in cultured cells through quantitative integration of q-PCR and N-SIM single cell FISH images: Application to hormonal stimulation of StAR transcription.

    PubMed

    Lee, Jinwoo; Foong, Yee Hoon; Musaitif, Ibrahim; Tong, Tiegang; Jefcoate, Colin

    2016-07-05

    The steroidogenic acute regulatory protein (StAR) has been proposed to serve as the switch that can turn on/off steroidogenesis. We investigated the events that facilitate dynamic StAR transcription in response to cAMP stimulation in MA-10 Leydig cells, focusing on splicing anomalies at StAR gene loci. We used 3' reverse primers in a single reaction to respectively quantify StAR primary (p-RNA), spliced (sp-RNA/mRNA), and extended 3' untranslated region (UTR) transcripts, which were quantitatively imaged by high-resolution fluorescence in situ hybridization (FISH). This approach delivers spatio-temporal resolution of initiation and splicing at single StAR loci, and transfers individual mRNA molecules to cytoplasmic sites. Gene expression was biphasic, initially showing slow splicing, transitioning to concerted splicing. The alternative 3.5-kb mRNAs were distinguished through the use of extended 3'UTR probes, which exhibited distinctive mitochondrial distribution. Combining quantitative PCR and FISH enables imaging of localization of RNA expression and analysis of RNA processing rates. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  9. Detection of Actinobacillus pleuropneumoniae in drinking water from pig farms.

    PubMed

    Loera-Muro, Victor M; Jacques, Mario; Tremblay, Yannick D N; Avelar-González, Francisco J; Loera Muro, Abraham; Ramírez-López, Elsa M; Medina-Figueroa, Alejandra; González-Reynaga, Higinio M; Guerrero-Barrera, Alma L

    2013-03-01

    Actinobacillus pleuropneumoniae is the aetiological agent of porcine pleuropneumonia and is normally transmitted by aerosols and direct contact between animals. A. pleuropneumoniae has traditionally been considered an obligate pathogen of pigs and its presence in the environment has yet to be investigated. Here, the presence of A. pleuropneumoniae was detected in drinking water of pig farms in Mexico using a PCR specific for the RTX toxin gene, apxIV. The presence of A. pleuropneumoniae in farm drinking water was confirmed by indirect immunofluorescence using an A. pleuropneumoniae-specific polyclonal antibody and by fluorescent in situ hybridization. Viable bacteria from the farm drinking water were detected using the Live/Dead BacLight stain. Additionally, viable A. pleuropneumoniae was selected and isolated using the cAMP test and the identity of the isolated bacteria were confirmed by Gram staining, a specific polyclonal antibody and an A. pleuropneumoniae-specific PCR. Furthermore, biofilms were observed by scanning electron microscopy in A. pleuropneumoniae-positive samples. In conclusion, our data suggest that viable A. pleuropneumoniae is present in the drinking water of swine farms and may use biofilm as a strategy to survive in the environment.

  10. Genome wide analysis in a discordant monozygotic twin with caudal appendage and multiple congenital anomalies.

    PubMed

    Cogulu, O; Pariltay, E; Koroglu, O A; Aykut, A; Ozyurek, R; Levent, E; Kultursay, N; Ozkinay, F

    2013-01-01

    Caudal appendage is a rare dysmorphic feature of which etiologic mechanisms are not well understood. Here we report monozygotic (MZ) twin brothers who are discordant for the caudal appendage and multiple congenital anomalies. Twins were the product of a 33 weeks of gestation, monochorionic-diamniotic pregnancy. On admission the proband had micrognathia, beaked nose, hypospadias, caudal appendage and juxtaductal aorta coarctation. At birth, he was small for gestational age and he had transient hypothyroidism which was detected in the newborn period. Karyotype analysis showed 46,XY. Monozygosity was shown by 15 microsatellite markers plus amelogenin (AmpFlSTR Identifiler PCR Amplification Kit, Applied Biosystems). Genome-wide copy number analysis of the twins by DNA-DNA hybridization of whole genomic DNA (NimbleGen Human CGH 385K WG-T v2.0 array) showed a significant difference at two neighboring probes with Log2 ratio: 0.72088 which are located on chromosome 3p12.3. Further analysis by high resolution of chromosome 3 array (Roche NimbleGen Human HG18 CHR3 FT Median Probe Spacing 475 bp) and quantitative PCR analysis did not confirm the deletion.

  11. Molecular typing of Vibrio parahaemolyticus strains isolated from the Philippines by PCR-based methods.

    PubMed

    Maluping, R P; Ravelo, C; Lavilla-Pitogo, C R; Krovacek, K; Romalde, J L

    2005-01-01

    The main aim of the present study was to use three PCR-based techniques for the analysis of genetic variability among Vibrio parahaemolyticus strains isolated from the Philippines. Seventeen strains of V. parahaemolyticus isolated from shrimps (Penaeus monodon) and from the environments where these shrimps are being cultivated were analysed by random amplified polymorphic DNA PCR (RAPD-PCR), enterobacterial repetitive intergenic consensus sequence PCR (ERIC-PCR) and repetitive extragenic palindromic PCR (REP-PCR). The results of this work have demonstrated genetic variability within the V. parahaemolyticus strains that were isolated from the Philippines. In addition, RAPD, ERIC and REP-PCR are suitable rapid typing methods for V. parahaemolyticus. All three methods have good discriminative ability and can be used as a rapid means of comparing V. parahaemolyticus strains for epidemiological investigation. Based on the results of this study, we could say that REP-PCR is inferior to RAPD and ERIC-PCR owing to the fact that it is less reproducible. Moreover, the REP-PCR analysis yielded a relatively small number of products. This may suggests that the REP sequences may not be widely distributed in the V. parahaemolyticus genome. Genetic variability within V. parahaemolyticus strains isolated in the Philippines has been demonstrated. The presence of ERIC and REP sequences in the genome of this bacterial species was confirmed. The RAPD, ERIC and REP-PCR techniques are useful methods for molecular typing of V. parahaemolyticus strains. To our knowledge this is the first study of this kind carried out on V. parahaemolyticus strains isolated from the Philippines.

  12. Optimisation of techniques for quantification of Botrytis cinerea in grape berries and receptacles by quantitative polymerase chain reaction

    USDA-ARS?s Scientific Manuscript database

    Quantitative PCR (qPCR) can be used to detect and monitor pathogen colonization, but early attempts to apply the technology to Botrytis cinerea infection of grape berries have identified limitations to current techniques. In this study, four DNA extraction methods, two grinding methods, two grape or...

  13. Isolation of "Caenorhabditis elegans" Genomic DNA and Detection of Deletions in the "unc-93" Gene Using PCR

    ERIC Educational Resources Information Center

    Lissemore, James L.; Lackner, Laura L.; Fedoriw, George D.; De Stasio, Elizabeth A.

    2005-01-01

    PCR, genomic DNA isolation, and agarose gel electrophoresis are common molecular biology techniques with a wide range of applications. Therefore, we have developed a series of exercises employing these techniques for an intermediate level undergraduate molecular biology laboratory course. In these exercises, students isolate genomic DNA from the…

  14. Alternative Fuels Data Center: ampCNG Puts Conventional Fuels Out to

    Science.gov Websites

    ; Steve Josephs, co-founder and director of engineering at ampCNG, Chicago, Illinois When ampCNG isn't the process. ampCNG's Cow-Powered Trucks ampCNG, a CNG station developer based in Chicago, Illinois interest in using more sustainable forms of fuel began in 2010, when the company partnered with Fair Oaks

  15. Antimicrobial Peptides as Mediators of Innate Immunity in Teleosts

    PubMed Central

    Katzenback, Barbara A.

    2015-01-01

    Antimicrobial peptides (AMPs) have been identified throughout the metazoa suggesting their evolutionarily conserved nature and their presence in teleosts is no exception. AMPs are short (18–46 amino acids), usually cationic, amphipathic peptides. While AMPs are diverse in amino acid sequence, with no two AMPs being identical, they collectively appear to have conserved functions in the innate immunity of animals towards the pathogens they encounter in their environment. Fish AMPs are upregulated in response to pathogens and appear to have direct broad-spectrum antimicrobial activity towards both human and fish pathogens. However, an emerging role for AMPs as immunomodulatory molecules has become apparent—the ability of AMPs to activate the innate immune system sheds light onto the multifaceted capacity of these small peptides to combat pathogens through direct and indirect means. Herein, this review focuses on the role of teleost AMPs as modulators of the innate immune system and their regulation in response to pathogens or other exogenous molecules. The capacity to regulate AMP expression by exogenous factors may prove useful in modulating AMP expression in fish to prevent disease, particularly in aquaculture settings where crowded conditions and environmental stress pre-dispose these fish to infection. PMID:26426065

  16. PKA and Epac synergistically inhibit smooth muscle cell proliferation

    PubMed Central

    Hewer, Richard C.; Sala-Newby, Graciela B.; Wu, Yih-Jer; Newby, Andrew C.; Bond, Mark

    2011-01-01

    Cyclic AMP signalling promotes VSMC quiescence in healthy vessels and during vascular healing following injury. Cyclic AMP inhibits VSMC proliferation via mechanisms that are not fully understood. We investigated the role of PKA and Epac signalling on cAMP-induced inhibition of VSMC proliferation. cAMP-mediated growth arrest was PKA-dependent. However, selective PKA activation with 6-Benzoyl-cAMP did not inhibit VSMC proliferation, indicating a requirement for additional pathways. Epac activation using the selective cAMP analogue 8-CPT-2′-O-Me-cAMP, did not affect levels of hyperphosphorylated Retinoblastoma (Rb) protein, a marker of G1-S phase transition, or BrdU incorporation, despite activation of the Epac-effector Rap1. However, 6-Benzoyl-cAMP and 8-CPT-2′-O-Me-cAMP acted synergistically to inhibit Rb-hyperphosphorylation and BrdU incorporation, indicating that both pathways are required for growth inhibition. Consistent with this, constitutively active Epac increased Rap1 activity and synergised with 6-Benzoyl-cAMP to inhibit VSMC proliferation. PKA and Epac synergised to inhibit phosphorylation of ERK and JNK. Induction of stellate morphology, previously associated with cAMP-mediated growth arrest, was also dependent on activation of both PKA and Epac. Rap1 inhibition with Rap1GAP or siRNA silencing did not negate forskolin-induced inhibition of Rb-hyperphosphorylation, BrdU incorporation or stellate morphology. This data demonstrates for the first time that Epac synergises with PKA via a Rap1-independent mechanism to mediate cAMP-induced growth arrest in VSMC. This work highlights the role of Epac as a major player in cAMP-dependent growth arrest in VSMC. PMID:20971121

  17. Nephrogenous Cyclic Adenosine Monophosphate as a Parathyroid Function Test

    PubMed Central

    Broadus, Arthur E.; Mahaffey, Jane E.; Bartter, Frederic C.; Neer, Robert M.

    1977-01-01

    Nephrogenous cyclic AMP (NcAMP), total cyclic AMP excretion (UcAMP), and plasma immunoreactive parathyroid hormone (iPTH), determined with a multivalent antiserum, were prospectively measured in 55 control subjects, 57 patients with primary hyperparathyroidism (1°HPT), and 10 patients with chronic hypoparathyroidism. In the group with 1° HPT, NcAMP was elevated in 52 patients (91%), and similar elevations were noted in subgroups of 26 patients with mild (serum calcium ≤10.7 mg/dl) or intermittent hypercalcemia, 19 patients with mild renal insufficiency (mean glomerular filtration rate, 64 ml/min), and 10 patients with moderate renal insufficiency (mean glomerular filtration rate, 43 ml/min). Plasma iPTH was increased in 41 patients (73%). The development of a parametric expression for UcAMP was found to be critically important in the clinical interpretation of results for total cAMP excretion. Because of renal impairment in a large number of patients, the absolute excretion rate of cAMP correlated poorly with the hyperparathyroid state. Expressed as a function of creatinine excretion, UcAMP was elevated in 81% of patients with 1° HPT, but the nonparametric nature of the expression led to a number of interpretive difficulties. The expression of cAMP excretion as a function of glomerular filtration rate was developed on the basis of the unique features of cAMP clearance in man, and this expression, which provided elevated values in 51 (89%) of the patients with 1° HPT, avoided entirely the inadequacies of alternative expressions. Results for NcAMP and UcAMP in nonazotemic and azotemic patients with hypoparathyroidism confirmed the validity of the measurements and the expressions employed. PMID:197123

  18. Cardiac Hypertrophy Is Inhibited by a Local Pool of cAMP Regulated by Phosphodiesterase 2.

    PubMed

    Zoccarato, Anna; Surdo, Nicoletta C; Aronsen, Jan M; Fields, Laura A; Mancuso, Luisa; Dodoni, Giuliano; Stangherlin, Alessandra; Livie, Craig; Jiang, He; Sin, Yuan Yan; Gesellchen, Frank; Terrin, Anna; Baillie, George S; Nicklin, Stuart A; Graham, Delyth; Szabo-Fresnais, Nicolas; Krall, Judith; Vandeput, Fabrice; Movsesian, Matthew; Furlan, Leonardo; Corsetti, Veronica; Hamilton, Graham; Lefkimmiatis, Konstantinos; Sjaastad, Ivar; Zaccolo, Manuela

    2015-09-25

    Chronic elevation of 3'-5'-cyclic adenosine monophosphate (cAMP) levels has been associated with cardiac remodeling and cardiac hypertrophy. However, enhancement of particular aspects of cAMP/protein kinase A signaling seems to be beneficial for the failing heart. cAMP is a pleiotropic second messenger with the ability to generate multiple functional outcomes in response to different extracellular stimuli with strict fidelity, a feature that relies on the spatial segregation of the cAMP pathway components in signaling microdomains. How individual cAMP microdomains affect cardiac pathophysiology remains largely to be established. The cAMP-degrading enzymes phosphodiesterases (PDEs) play a key role in shaping local changes in cAMP. Here we investigated the effect of specific inhibition of selected PDEs on cardiac myocyte hypertrophic growth. Using pharmacological and genetic manipulation of PDE activity, we found that the rise in cAMP resulting from inhibition of PDE3 and PDE4 induces hypertrophy, whereas increasing cAMP levels via PDE2 inhibition is antihypertrophic. By real-time imaging of cAMP levels in intact myocytes and selective displacement of protein kinase A isoforms, we demonstrate that the antihypertrophic effect of PDE2 inhibition involves the generation of a local pool of cAMP and activation of a protein kinase A type II subset, leading to phosphorylation of the nuclear factor of activated T cells. Different cAMP pools have opposing effects on cardiac myocyte cell size. PDE2 emerges as a novel key regulator of cardiac hypertrophy in vitro and in vivo, and its inhibition may have therapeutic applications. © 2015 American Heart Association, Inc.

  19. Osthole, a coumadin analog from Cnidium monnieri (L.) Cusson, stimulates corticosterone secretion by increasing steroidogenic enzyme expression in mouse Y1 adrenocortical tumor cells.

    PubMed

    Pan, Zhiqiang; Fang, Zhaoqin; Lu, Wenli; Liu, Xiaomei; Zhang, Yuanyuan

    2015-12-04

    Osthole is an O-methylated coumadin, which was isolated and purified from the seeds of Cnidium monnieri (L.) Cusson. Osthole is a commonly used traditional Chinese medicine to treat patients with Kidney-Yang deficiency patients, who exhibit clinical signs similar to those of glucocorticoid withdrawal. However, the mechanism of action of osthole is not fully understood. This study was designed to reveal the effects of osthole on corticosterone production in mouse Y1 cell. Mouse Y1 adrenocortical cells were used to evaluate corticosterone production, which was quantified by enzyme-linked immunosorbent assay (ELISA) kits. Cell viability was tested using the MTT assay, and the mRNA and protein expression of genes encoding steroidogenic enzymes and transcription factors was monitored by quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) and western blotting, respectively. Osthole stimulated corticosterone secretion from mouse Y1 cells in a dose- and time-dependent manner, and osthole enhanced the effect of dibutyryl-cAMP (Bu2cAMP) on corticosterone production. Further, osthole also increased StAR and CYP11B1 mRNA expression in a dose-dependent manner and enhanced the expression of transcription factors such as HSD3B1, FDX1, POR and RXRα as well as immediate early genes such as NR4A1. Moreover, osthole significantly increased SCARB1(SRB1) mRNA and StAR protein expression in the presence or absence of Bu2cAMP; these proteins are an important for the transport of the corticosteroid precursor cholesterol transport into mitochondria. Our results show that the promotion of corticosterone biosynthesis and secretion is a novel effect of osthole, suggesting that this agent can be utilized for the prevention and treatment of Kidney-Yang deficiency syndrome. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  20. Molecular cloning and characterization of V2-type receptor in two ray-finned fish, gray bichir, Polypterus senegalus and medaka, Oryzias latipes.

    PubMed

    Konno, Norifumi; Kurosawa, Mayumi; Kaiya, Hiroyuki; Miyazato, Mikiya; Matsuda, Kouhei; Uchiyama, Minoru

    2010-07-01

    In tetrapods, vasopressin (VP) and vasotocin (VT) are involved in various aspects of physiology and behavior including osmoregulation, cardiovascular function, reproduction, stress response and social behavior. Pharmacological and molecular studies have identified three types of VP/VT receptors, V1a-type (V1aR), V1b-type (V1bR) and V2-type (V2R). On the other hand, only V1aR has so far been identified in teleosts. In the present study, we successfully cloned V2Rs from two ray-finned fish, gray bichir and medaka. Phylogenetic analysis showed that the cloned receptors belong to the V2R group of lobe-finned fish and tetrapods. The amino acid sequences of bichir V2R and medaka V2R were high identity (60-65.5% and 53.2-80.9%, respectively) with other known V2R members, respectively. Reverse transcriptase PCR revealed that ray-finned fish V2R transcripts have been detected in various tissues including brain, gill, heart, liver, kidney and reproductive organs, suggesting that ray-finned fish V2R might mediate multiple functions of VT. In functional analysis, the cells transfected with the cloned receptors responded with the accumulation of intracellular cAMP in a concentration-dependent manner following VT stimulation, but not respond with [Ca(2+)]i. Furthermore, pretreatment with mammalian V2R antagonist (OPC-31260) to the cells transfected with medaka V2R significantly inhibited an increase of the VT-induced intracellular cAMP. These results suggest that ray-finned fish possess a functional V2R linked to adenylate cyclase and the cAMP signaling pathway as well as V2Rs of lobe-finned fish and tetrapods. Thus, the present study suggests that functional V2R evolved prior to the divergence of the ray- and lobe-finned fish lineages. Copyright 2010 Elsevier Inc. All rights reserved.

  1. Analysis of β-Lactamase Resistance Determinants in Enterobacteriaceae from Chicago Children: a Multicenter Survey

    PubMed Central

    Hujer, Andrea M.; Marshall, Steven H.; Domitrovic, T. Nicholas; Rudin, Susan D.; Zheng, Xiaotian; Qureshi, Nadia K.; Hayden, Mary K.; Scaggs, Felicia A.; Karadkhele, Anand; Bonomo, Robert A.

    2016-01-01

    Multidrug-resistant (MDR) Enterobacteriaceae infections are increasing in U.S. children; however, there is a paucity of multicentered analyses of antibiotic resistance genes responsible for MDR phenotypes among pediatric Enterobacteriaceae isolates. In this study, 225 isolates phenotypically identified as extended-spectrum β-lactamase (ESBL) or carbapenemase producers, recovered from children ages 0 to 18 years hospitalized between January 2011 and April 2015 at three Chicago area hospitals, were analyzed. We used DNA microarray platforms to detect ESBL, plasmid-mediated AmpC (pAmpC), and carbapenemase type β-lactamase (bla) genes. Repetitive-sequence-based PCR and multilocus sequence typing (MLST) were performed to assess isolate similarity. Plasmid replicon typing was conducted to classify plasmids. The median patient age was 4.2 years, 56% were female, and 44% presented in the outpatient setting. The majority (60.9%) of isolates were Escherichia coli and from urinary sources (69.8%). Of 225 isolates exhibiting ESBL- or carbapenemase-producing phenotypes, 90.7% contained a bla gene. The most common genotype was the blaCTX-M-1 group (49.8%); 1.8% were carbapenem-resistant Enterobacteriaceae (three blaKPC and one blaIMP). Overall, pAmpC (blaACT/MIR and blaCMY) were present in 14.2%. The predominant E. coli phylogenetic group was the virulent B2 group (67.6%) associated with ST43/ST131 (Pasteur/Achtman MLST scheme) containing the blaCTX-M-1 group (84%), and plasmid replicon types FIA, FII, and FIB. K. pneumoniae harboring blaKPC were non-ST258 with replicon types I1 and A/C. Enterobacter spp. carrying blaACT/MIR contained plasmid replicon FIIA. We found that β-lactam resistance in children is diverse and that certain resistance mechanisms differ from known circulating genotypes in adults in an endemic area. The potential impact of complex molecular types and the silent dissemination of MDR Enterobacteriaceae in a vulnerable population needs to be studied further. PMID:27021322

  2. "Host tissue damage" signal ATP promotes non-directional migration and negatively regulates toll-like receptor signaling in human monocytes.

    PubMed

    Kaufmann, Andreas; Musset, Boris; Limberg, Sven H; Renigunta, Vijay; Sus, Rainer; Dalpke, Alexander H; Heeg, Klaus M; Robaye, Bernard; Hanley, Peter J

    2005-09-16

    The activation of Toll-like receptors (TLRs) by lipopolysaccharide or other ligands evokes a proinflammatory immune response, which is not only capable of clearing invading pathogens but can also inflict damage to host tissues. It is therefore important to prevent an overshoot of the TLR-induced response where necessary, and here we show that extracellular ATP is capable of doing this in human monocytes. Using reverse transcription-PCR, we showed that monocytes express P2Y(1), P2Y(2), P2Y(4), P2Y(11), and P2Y(13) receptors, as well as several P2X receptors. To elucidate the function of these receptors, we first studied Ca(2+) signaling in single cells. ATP or UTP induced a biphasic increase in cytosolic Ca(2+), which corresponded to internal Ca(2+) release followed by activation of store-operated Ca(2+) entry. The evoked Ca(2+) signals stimulated Ca(2+)-activated K(+) channels, producing transient membrane hyperpolarization. In addition, ATP promoted cytoskeleton reorganization and cell migration; however, unlike chemoattractants, the migration was non-directional and further analysis showed that ATP did not activate Akt, essential for sensing gradients. When TLR2, TLR4, or TLR2/6 were stimulated with their respective ligands, ATPgammaS profoundly inhibited secretion of proinflammatory cytokines (tumor necrosis factor-alpha and monocyte chemoattractant protein-1) but increased the production of interleukin-10, an anti-inflammatory cytokine. In radioimmune assays, we found that ATP (or ATPgammaS) strongly increased cAMP levels, and, moreover, the TLR-response was inhibited by forskolin, whereas UTP neither increased cAMP nor inhibited the TLR-response. Thus, our data suggest that ATP promotes non-directional migration and, importantly, acts as a "host tissue damage" signal via the G(s) protein-coupled P2Y(11) receptor and increased cAMP to negatively regulate TLR signaling.

  3. Post-injection hybridization of complementary DNA strands on capillary electrophoresis platforms: a novel solution for dsDNA artifacts.

    PubMed

    McLaren, Robert S; Ensenberger, Martin G; Budowle, Bruce; Rabbach, Dawn; Fulmer, Patricia M; Sprecher, Cindy J; Bessetti, Joseph; Sundquist, Terri M; Storts, Douglas R

    2008-09-01

    Several laboratories have reported the occurrence of a split or n-1 peak at the vWA locus in PowerPlex 16 and PowerPlex ES amplification products separated on 4- and 16-capillary electrophoresis instruments. The root cause of this artifact is post-PCR reannealing of the unlabeled, unincorporated vWA primer to the 3'-end of the tetramethylrhodamine (TMR)-labeled strand of the vWA amplicon. This reannealing occurs in the capillary post-electrokinetic injection. The split peak is eliminated by incorporation into the loading cocktail of a sacrificial hybridization sequence (SHS) oligonucleotide that is complementary to the vWA primer. The SHS preferentially anneals to the primer instead of the TMR-labeled strand of the vWA amplicon. In addition, the n-10/n-18 artifact that may be seen at the vWA locus was determined to be due to double-stranded amplicon formed post-electrokinetic injection into the capillary. This was also eliminated by adding in two Complementary Oligo Targets (COT1 and COT2) in addition to the SHS oligonucleotide into the loading cocktail. These three oligonucleotides are complementary to the 33 bases at the 5'-end of the unlabeled vWA amplicon strand and the 60 bases at its 3'-end and therefore compete for hybridization to the TMR-labeled amplicon strand. Incorporation of these three oligonucleotides in the Internal Lane Standard 600 (ILS600) eliminate both the split peak and n-10/n-18 artifact in PowerPlex 16 and PowerPlex ES amplification products without affecting sizing of alleles at the vWA locus or any locus in the PowerPlex 16, PowerPlex Y, PowerPlex ES, AmpFlSTR Profiler Plus ID, AmpFlSTR Cofiler, and AmpFlSTR SGM Plus kits.

  4. Molecular and pharmacological characterization of serotonin 5-HT2α and 5-HT7 receptors in the salivary glands of the blowfly Calliphora vicina.

    PubMed

    Röser, Claudia; Jordan, Nadine; Balfanz, Sabine; Baumann, Arnd; Walz, Bernd; Baumann, Otto; Blenau, Wolfgang

    2012-01-01

    Secretion in blowfly (Calliphora vicina) salivary glands is stimulated by the biogenic amine serotonin (5-hydroxytryptamine, 5-HT), which activates both inositol 1,4,5-trisphosphate (InsP(3))/Ca(2+) and cyclic adenosine 3',5'-monophosphate (cAMP) signalling pathways in the secretory cells. In order to characterize the signal-inducing 5-HT receptors, we cloned two cDNAs (Cv5-ht2α, Cv5-ht7) that share high similarity with mammalian 5-HT(2) and 5-HT(7) receptor genes, respectively. RT-PCR demonstrated that both receptors are expressed in the salivary glands and brain. Stimulation of Cv5-ht2α-transfected mammalian cells with 5-HT elevates cytosolic [Ca(2+)] in a dose-dependent manner (EC(50) = 24 nM). In Cv5-ht7-transfected cells, 5-HT produces a dose-dependent increase in [cAMP](i) (EC(50) = 4 nM). We studied the pharmacological profile for both receptors. Substances that appear to act as specific ligands of either Cv5-HT(2α) or Cv5-HT(7) in the heterologous expression system were also tested in intact blowfly salivary gland preparations. We observed that 5-methoxytryptamine (100 nM) activates only the Cv5-HT(2α) receptor, 5-carboxamidotryptamine (300 nM) activates only the Cv5-HT(7) receptor, and clozapine (1 µM) antagonizes the effects of 5-HT via Cv5-HT(7) in blowfly salivary glands, providing means for the selective activation of each of the two 5-HT receptor subtypes. This study represents the first comprehensive molecular and pharmacological characterization of two 5-HT receptors in the blowfly and permits the analysis of the physiological role of these receptors, even when co-expressed in cells, and of the modes of interaction between the Ca(2+)- and cAMP-signalling cascades.

  5. Molecular and Pharmacological Characterization of Serotonin 5-HT2α and 5-HT7 Receptors in the Salivary Glands of the Blowfly Calliphora vicina

    PubMed Central

    Röser, Claudia; Jordan, Nadine; Balfanz, Sabine; Baumann, Arnd; Walz, Bernd; Baumann, Otto; Blenau, Wolfgang

    2012-01-01

    Secretion in blowfly (Calliphora vicina) salivary glands is stimulated by the biogenic amine serotonin (5-hydroxytryptamine, 5-HT), which activates both inositol 1,4,5-trisphosphate (InsP3)/Ca2+ and cyclic adenosine 3′,5′-monophosphate (cAMP) signalling pathways in the secretory cells. In order to characterize the signal-inducing 5-HT receptors, we cloned two cDNAs (Cv5-ht2α, Cv5-ht7) that share high similarity with mammalian 5-HT2 and 5-HT7 receptor genes, respectively. RT-PCR demonstrated that both receptors are expressed in the salivary glands and brain. Stimulation of Cv5-ht2α-transfected mammalian cells with 5-HT elevates cytosolic [Ca2+] in a dose-dependent manner (EC50 = 24 nM). In Cv5-ht7-transfected cells, 5-HT produces a dose-dependent increase in [cAMP]i (EC50 = 4 nM). We studied the pharmacological profile for both receptors. Substances that appear to act as specific ligands of either Cv5-HT2α or Cv5-HT7 in the heterologous expression system were also tested in intact blowfly salivary gland preparations. We observed that 5-methoxytryptamine (100 nM) activates only the Cv5-HT2α receptor, 5-carboxamidotryptamine (300 nM) activates only the Cv5-HT7 receptor, and clozapine (1 µM) antagonizes the effects of 5-HT via Cv5-HT7 in blowfly salivary glands, providing means for the selective activation of each of the two 5-HT receptor subtypes. This study represents the first comprehensive molecular and pharmacological characterization of two 5-HT receptors in the blowfly and permits the analysis of the physiological role of these receptors, even when co-expressed in cells, and of the modes of interaction between the Ca2+- and cAMP-signalling cascades. PMID:23145175

  6. Distribution of Extended-Spectrum β-Lactamases, AmpC β-Lactamases, and Carbapenemases among Enterobacteriaceae Isolates Causing Intra-Abdominal Infections in the Asia-Pacific Region: Results of the Study for Monitoring Antimicrobial Resistance Trends (SMART)

    PubMed Central

    Sheng, Wang-Huei; Badal, Robert E.

    2013-01-01

    The increasing trend of β-lactam resistance among Enterobacteriaceae is a worldwide threat. Enterobacteriaceae isolates causing intra-abdominal infections (IAI) from the Study for Monitoring Antimicrobial Resistance Trends (SMART) collected in 2008 and 2009 from the Asia-Pacific region were investigated. Detection of extended-spectrum β-lactamases (ESBLs), AmpC β-lactamases, and carbapenemases was performed by multiplex PCR. A total of 699 Enterobacteriaceae isolates with positive genotypic results, included Escherichia coli (n = 443), Klebsiella pneumoniae (n = 187), Enterobacter cloacae (n = 45), Klebsiella oxytoca (n = 9), Citrobacter freundii (n = 5), Proteus mirabilis (n = 3), Enterobacter aerogenes (n = 2), Morganella morganii (n = 2), and one each of Enterobacter asburiae, Proteus vulgaris, and Providencia rettgeri were analyzed. Nearly 20% of these β-lactamase-producing Enterobacteriaceae isolates were from community-associated IAI. CTX-M (588 isolates, including 428 [72.8%] with CTX-M-15) was the most common ESBL, followed by SHV (n = 59) and TEM (n = 4). CMY (n = 110, including 102 [92.7%] with CMY-2) was the most common AmpC β-lactamase, followed by DHA (n = 46) and ACT/MIR (n = 40). NDM (n = 65, including 62 [95.4%] with NDM-1) was the most common carbapenemase, followed by IMP (n = 7) and OXA (n = 7). Isolates from hospital-associated IAI had more complicated β-lactamase combinations than isolates from the community. Carbapenemases were all exclusively detected in Enterobacteriaceae isolates from India, except that IMP β-lactamases were also detected in Philippines and Australia. CTX-M β-lactamases were the predominant ESBLs produced by Enterobacteriaceae causing IAI in the Asia-Pacific region. Emergence of CTX-M-15-, CMY-2-, and NDM-1-producing Enterobacteriaceae isolates is of major concern and highlights the need for further surveillance in this area. PMID:23587958

  7. Molecular cloning and characterization of chicken prostaglandin E receptor subtypes 2 and 4 (EP2 and EP4).

    PubMed

    Kwok, Amy Ho Yan; Wang, Yajun; Wang, Crystal Ying; Leung, Frederick C

    2008-06-01

    Prostaglandin E(2) (PGE(2)) is an important chemical mediator responsible for regulation of many vital physiological processes. Four receptor subtypes have been identified to mediate its biological actions. Among these subtypes, prostaglandin E receptor subtypes 2 and 4 (EP(2) and EP(4)), both coupled to cAMP-protein kinase A (cAMP-PKA) signaling pathway, are proposed to play crucial roles under both physiological and pathological conditions. Though both receptors were extensively studied in mammals, little is known about their functionality and expression in non-mammalian species including chicken. In present study, the full-length cDNAs for chicken EP(2) and EP(4) receptors were first cloned from adult chicken ovary and testis, respectively. Chicken EP(2) is 356 amino acids in length and shows high amino acid identity to that of human (61%), mouse (63%), and rat (61%). On the other hand, the full-length cDNA of EP(4) gene encodes a precursor of 475 amino acids with a high degree of amino acid identity to that of mammals, including human (87%), mouse (86%), rat (84%), dog (85%), and cattle (83%), and a comparatively lower sequence identity to zebrafish (52%). RT-PCR assays revealed that EP(2) mRNA was expressed in all tissues examined including the oviduct, while EP(4) expression was detected only in a few tissues. Using the pGL3-CRE-luciferase reporter system, we also demonstrated that PGE(2) could induce luciferase activity in DF-1 cells expressing EP(2) and EP(4) in dose-dependent manners (EC(50): <1 nM), confirming that both receptors could be activated by PGE(2) and functionally coupled to the cAMP-PKA signaling pathway. Together, our study establishes a molecular basis to understand the physiological roles of PGE(2) in target tissues of chicken.

  8. Performance of parasitological and molecular techniques for the diagnosis and surveillance of gambiense sleeping sickness.

    PubMed

    Mumba Ngoyi, Dieudonné; Ali Ekangu, Rosine; Mumvemba Kodi, Marie France; Pyana, Patient Pati; Balharbi, Fatima; Decq, Mélanie; Kande Betu, Victor; Van der Veken, Wim; Sese, Claude; Menten, Joris; Büscher, Philippe; Lejon, Veerle

    2014-06-01

    Recently, improvements have been made to diagnostics for gambiense sleeping sickness control but their performance remains poorly documented and may depend on specimen processing prior to examination. In a prospective study in the Democratic Republic of the Congo, we compared the diagnostic performance of several parasite detection techniques, immune trypanolysis and of m18S PCR on whole blood stored in a stabilisation buffer or dried on filter paper. Individuals with CATT whole blood (WB) titer ≥1∶4 or with clinical signs indicative for sleeping sickness were examined for presence of trypanosomes in lymph node aspirate (LNA) and/or in blood. Blood was examined with Capillary Centrifugation Technique (CTC), mini-Anion Exchange Centrifugation Technique (mAECT) and mAECT on buffy coat (BC). PCR was performed on whole blood (i) stored in guanidine hydrochloride EDTA (GE) stabilisation buffer and (ii) dried on filter paper, and repeatability and reproducibility were assessed. Immune trypanolysis (TL) was performed on plasma. A total of 237 persons were included. Among 143 parasitologically confirmed cases, 85.3% had a CATT-WB titre of ≥1/8, 39.2% were positive in LNA, 47.5% in CTC, 80.4% in mAECT-WB, 90.9% in mAECT-BC, 95.1% in TL and up to 89.5% in PCR on GE-stabilised blood. PCR on GE-stabilised blood showed highest repeatability (87.8%) and inter-laboratory reproducibility (86.9%). Of the 94 non-confirmed suspects, respectively 39.4% and 23.4% were TL or PCR positive. Suboptimal specificity of PCR and TL was also suggested by latent class analysis. The combination of LNA examination with mAECT-BC offered excellent diagnostic sensitivity. For PCR, storage of blood in stabilisation buffer is to be preferred over filter paper. TL as well as PCR are useful for remote diagnosis but are not more sensitive than mAECT-BC. For TL and PCR, the specificity, and thus usefulness for management of non-confirmed suspects remain to be determined.

  9. Performance of Parasitological and Molecular Techniques for the Diagnosis and Surveillance of Gambiense Sleeping Sickness

    PubMed Central

    Mumba Ngoyi, Dieudonné; Ali Ekangu, Rosine; Mumvemba Kodi, Marie France; Pyana, Patient Pati; Balharbi, Fatima; Decq, Mélanie; Kande Betu, Victor; Van der Veken, Wim; Sese, Claude; Menten, Joris; Büscher, Philippe; Lejon, Veerle

    2014-01-01

    Objectives Recently, improvements have been made to diagnostics for gambiense sleeping sickness control but their performance remains poorly documented and may depend on specimen processing prior to examination. In a prospective study in the Democratic Republic of the Congo, we compared the diagnostic performance of several parasite detection techniques, immune trypanolysis and of m18S PCR on whole blood stored in a stabilisation buffer or dried on filter paper. Methods Individuals with CATT whole blood (WB) titer ≥1∶4 or with clinical signs indicative for sleeping sickness were examined for presence of trypanosomes in lymph node aspirate (LNA) and/or in blood. Blood was examined with Capillary Centrifugation Technique (CTC), mini-Anion Exchange Centrifugation Technique (mAECT) and mAECT on buffy coat (BC). PCR was performed on whole blood (i) stored in guanidine hydrochloride EDTA (GE) stabilisation buffer and (ii) dried on filter paper, and repeatability and reproducibility were assessed. Immune trypanolysis (TL) was performed on plasma. Results A total of 237 persons were included. Among 143 parasitologically confirmed cases, 85.3% had a CATT-WB titre of ≥1/8, 39.2% were positive in LNA, 47.5% in CTC, 80.4% in mAECT-WB, 90.9% in mAECT-BC, 95.1% in TL and up to 89.5% in PCR on GE-stabilised blood. PCR on GE-stabilised blood showed highest repeatability (87.8%) and inter-laboratory reproducibility (86.9%). Of the 94 non-confirmed suspects, respectively 39.4% and 23.4% were TL or PCR positive. Suboptimal specificity of PCR and TL was also suggested by latent class analysis. Conclusion The combination of LNA examination with mAECT-BC offered excellent diagnostic sensitivity. For PCR, storage of blood in stabilisation buffer is to be preferred over filter paper. TL as well as PCR are useful for remote diagnosis but are not more sensitive than mAECT-BC. For TL and PCR, the specificity, and thus usefulness for management of non-confirmed suspects remain to be determined. PMID:24921941

  10. Development and characterization of a synthetic DNA, NUversa, to be used as a standard in quantitative polymerase chain reactions for molecular pneumococcal serotyping.

    PubMed

    Sakai, Fuminori; Sonaty, Griffin; Watson, David; Klugman, Keith P; Vidal, Jorge E

    2017-09-15

    Identification of Streptococcus pneumoniae and its more than 90 serotypes is routinely conducted by culture and Quellung reactions. Quantitative polymerase chain reactions (qPCRs) have been developed for molecular detection, including a pan-pneumococcus lytA assay, and assays targeting 79 serotypes. Reactions require genomic DNA from every target to prepare standards, which can be time consuming. In this study, we have developed a synthetic DNA molecule as a surrogate for genomic DNA and present new single-plex qPCR reactions to increase molecular detection to 94 pneumococcal serotypes. Specificity of these new reactions was confirmed with a limit of detection between 2 and 20 genome equivalents/reaction. A synthetic DNA (NUversa, ∼8.2 kb) was then engineered to contain all available qPCR targets for serotyping and lytA. NUversa was cloned into pUC57-Amp-modified to generate pNUversa (∼10.2 kb). Standards prepared from pNUversa and NUversa were compared against standards made out of genomic DNA. Linearity [NUversa (R2 > 0.982); pNUversa (R2 > 0.991)] and efficiency of qPCR reactions were similar to those utilizing chromosomal DNA (R2 > 0.981). Quantification with plasmid pNUversa was affected, however, whereas quantification with synthetic NUversa was comparable to that of genomic DNA. Therefore, NUversa may be utilized as DNA standard in single-plex assays of the currently known 94 pneumococcal serotypes. © FEMS 2017.

  11. DNA and bone structure preservation in medieval human skeletons.

    PubMed

    Coulson-Thomas, Yvette M; Norton, Andrew L; Coulson-Thomas, Vivien J; Florencio-Silva, Rinaldo; Ali, Nadir; Elmrghni, Samir; Gil, Cristiane D; Sasso, Gisela R S; Dixon, Ronald A; Nader, Helena B

    2015-06-01

    Morphological and ultrastructural data from archaeological human bones are scarce, particularly data that have been correlated with information on the preservation of molecules such as DNA. Here we examine the bone structure of macroscopically well-preserved medieval human skeletons by transmission electron microscopy and immunohistochemistry, and the quantity and quality of DNA extracted from these skeletons. DNA technology has been increasingly used for analyzing physical evidence in archaeological forensics; however, the isolation of ancient DNA is difficult since it is highly degraded, extraction yields are low and the co-extraction of PCR inhibitors is a problem. We adapted and optimised a method that is frequently used for isolating DNA from modern samples, Chelex(®) 100 (Bio-Rad) extraction, for isolating DNA from archaeological human bones and teeth. The isolated DNA was analysed by real-time PCR using primers targeting the sex determining region on the Y chromosome (SRY) and STR typing using the AmpFlSTR(®) Identifiler PCR Amplification kit. Our results clearly show the preservation of bone matrix in medieval bones and the presence of intact osteocytes with well preserved encapsulated nuclei. In addition, we show how effective Chelex(®) 100 is for isolating ancient DNA from archaeological bones and teeth. This optimised method is suitable for STR typing using kits aimed specifically at degraded and difficult DNA templates since amplicons of up to 250bp were successfully amplified. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  12. The use of singleplex and nested PCR to detect Batrachochytrium dendrobatidis in free-living frogs.

    PubMed

    Coutinho, Selene Dall'Acqua; Burke, Julieta Catarina; de Paula, Catia Dejuste; Rodrigues, Miguel Trefaut; Catão-Dias, José Luiz

    2015-06-01

    Many microorganisms are able to cause diseases in amphibians, and in the past few years one of the most reported has been Batrachochytrium dendrobatidis. This fungus was first reported in Brazil in 2005; following this, other reports were made in specimens deposited in museum collections, captive and free-living frogs. The aim of this study was to compare singleplex and nested-PCR techniques to detect B. dendrobatidis in free-living and apparently healthy adult frogs from the Brazilian Atlantic Forest. The sample collection area was a protected government park, with no general entrance permitted and no management of the animals there. Swabs were taken from the skin of 107 animals without macroscopic lesions and they were maintained in ethanol p.a. Fungal DNA was extracted and identification of B. dendrobatidis was performed using singleplex and nested-PCR techniques, employing specific primers sequences. B. dendrobatidis was detected in 61/107 (57%) and 18/107 (17%) animals, respectively by nested and singleplex-PCR. Nested-PCR was statistically more sensible than the conventional for the detection of B. dendrobatidis (Chi-square = 37.1; α = 1%) and the agreement between both techniques was considered just fair (Kappa = 0.27). The high prevalence obtained confirms that these fungi occur in free-living frogs from the Brazilian Atlantic Forest with no macroscopic lesions, characterizing the state of asymptomatic carrier. We concluded that the nested-PCR technique, due to its ease of execution and reproducibility, can be recommended as one of the alternatives in epidemiological surveys to detect B. dendrobatidis in healthy free-living frog populations.

  13. Antimicrobial peptide from mucus of Andrias davidianus: screening and purification by magnetic cell membrane separation technique.

    PubMed

    Pei, Jinjin; Jiang, Lei

    2017-07-01

    Andrias davidianus, the Chinese giant salamander, has been used in traditional Chinese medicine for many decades. However, no antimicrobial peptides (AMPs) have been described from A. davidianus until now. Here we describe a novel AMP (andricin 01) isolated from the mucus of A. davidianus. The peptide was recovered using an innovative magnetic cell membrane separation technique and was characterised using mass spectrometry and circular dichroism (CD) spectroscopy. Andricin 01 is comprised of ten amino acid residues with a total molecular mass of 955.1 Da. CD spectrum analysis gave results similar to the archetypal random coil spectrum, consistent with the three-dimensional rendering calculated by current bioinformatics tools. Andricin 01 was found to be inhibitory both to Gram-negative and Gram-positive bacteria. Furthermore, the peptide at the minimal bacterial concentration did not show cell cytotoxicity against human hepatocytes or renal cells and did not show haemolytic activity against red blood cells, indicating that is potentially safe and effective for human use. Andricin 01 shows promise as a novel antibacterial that may provide an insight into the development of new drugs. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  14. Characterization of the Saccharomyces cerevisiae ATP-Interactome using the iTRAQ-SPROX Technique

    NASA Astrophysics Data System (ADS)

    Geer, M. Ariel; Fitzgerald, Michael C.

    2016-02-01

    The stability of proteins from rates of oxidation (SPROX) technique was used in combination with an isobaric mass tagging strategy to identify adenosine triphosphate (ATP) interacting proteins in the Saccharomyces cerevisiae proteome. The SPROX methodology utilized in this work enabled 373 proteins in a yeast cell lysate to be assayed for ATP interactions (both direct and indirect) using the non-hydrolyzable ATP analog, adenylyl imidodiphosphate (AMP-PNP). A total of 28 proteins were identified with AMP-PNP-induced thermodynamic stability changes. These protein hits included 14 proteins that were previously annotated as ATP-binding proteins in the Saccharomyces Genome Database (SGD). The 14 non-annotated ATP-binding proteins included nine proteins that were previously found to be ATP-sensitive in an earlier SPROX study using a stable isotope labeling with amino acids in cell culture (SILAC)-based approach. A bioinformatics analysis of the protein hits identified here and in the earlier SILAC-SPROX experiments revealed that many of the previously annotated ATP-binding protein hits were kinases, ligases, and chaperones. In contrast, many of the newly discovered ATP-sensitive proteins were not from these protein classes, but rather were hydrolases, oxidoreductases, and nucleic acid-binding proteins.

  15. Off-target effect of the Epac agonist 8-pCPT-2'-O-Me-cAMP on P2Y12 receptors in blood platelets.

    PubMed

    Herfindal, Lars; Nygaard, Gyrid; Kopperud, Reidun; Krakstad, Camilla; Døskeland, Stein Ove; Selheim, Frode

    2013-08-09

    The primary target of the cAMP analogue 8-pCPT-2'-O-Me-cAMP is exchange protein directly activated by cAMP (Epac). Here we tested potential off-target effects of the Epac activator on blood platelet activation signalling. We found that the Epac analogue 8-pCPT-2'-O-Me-cAMP inhibits agonist-induced-GPCR-stimulated, but not collagen-stimulated, P-selectin surface expression on Epac1 deficient platelets. In human platelets, 8-pCPT-2'-O-Me-cAMP inhibited P-selectin expression elicited by the PKC activator PMA. This effect was abolished in the presence of the extracellular ADP scavenger system CP/CPK. In silico modelling of 8-pCPT-2'O-Me-cAMP binding into the purinergic platelet receptor P2Y12 revealed that the analogue docks similar to the P2Y12 antagonist 2MeSAMP. The 8-pCPT-2'-O-Me-cAMP analogue per se, did not provoke Rap 1 (Rap 1-GTP) activation or phosphorylation on the vasodilator-stimulated phosphoprotein (VASP) at Ser-157. In addition, the protein kinase A (PKA) antagonists Rp-cAMPS and Rp-8-Br-cAMPS failed to block the inhibitory effect of 8-pCPT-2'-O-Me-cAMP on thrombin- and TRAP-induced Rap 1 activation, thus suggesting that PKA is not involved. We conclude that the 8-pCPT-2'-O-Me-cAMP analogue is able to inhibit agonist-induced-GPCR-stimulated P-selectin independent from Epac1; the off-target effect of the analogue appears to be mediated by antagonistic P2Y12 receptor binding. This has implications when using cAMP analogues on specialised system involving such receptors. We found, however that the Epac agonist 8-Br-2'-O-Me-cAMP did not affect platelet activation at similar concentrations. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Effects of adenosine 5'-monophosphate on epidermal turnover.

    PubMed

    Furukawa, Fukumi; Kanehara, Shoko; Harano, Fumiki; Shinohara, Shigeo; Kamimura, Junko; Kawabata, Shigekatsu; Igarashi, Sachiyo; Kawamura, Mitsuaki; Yamamoto, Yuki; Miyachi, Yoshiki

    2008-10-01

    The structure and function of the epidermis is maintained by cell renewal based on epidermal turnover. Epidermal turnover is delayed by aging, and it is thought that the delay of the epidermal turnover is a cause of aging alternation of skin. The epidermal turnover is related to the energy metabolism of epidermal basal cells. Adenosine 5'-triphosphate (ATP) is needed for cell renewal: cell division, and adenosine 5'-monophosphate (AMP) increases the amount of intracellular ATP. These findings suggest that AMP accelerates the epidermal turnover delayed by aging. This study investigated whether AMP and adenosine 5'-monophosphate disodium salt (AMP2Na) accelerates the epidermal turnover. An effect of AMP2Na on cell proliferation was examined by our counting of keratinocytes. An effect of AMP2Na on cell cycle was examined by our counting of basal cells in DNA synthetic period of hairless rats. The effects of AMP2Na (or AMP) on the epidermal turnover were examined by our measuring stratum corneum transit time by use of guinea pigs, and by our measuring stratum corneum surface area by use of hairless rats and in a clinical pharmacological study. The AMP2Na showed two different profiles on the proliferation of primary cultured keratinocytes. At a low concentration it induced cell growth, whereas at a high concentration it inhibited cell growth. The number of basal cells in the DNA synthetic period of AMP2Na was significantly higher than that of the vehicle in hairless rats. The stratum corneum transit time of AMP2Na was significantly shorter than that of the vehicle in guinea pigs. The corneocyte surface area of emulsion containing AMP2Na was significantly smaller than that of the vehicle in volunteers. We conclude that AMP promotes the cell proliferation and the cell cycle progression of epidermal basal cells and accelerates epidermal turnover safely. In addition, AMP is useful for skin rejuvenation in dermatology and aesthetic dermatology.

  17. Distinct pools of cAMP centre on different isoforms of adenylyl cyclase in pituitary-derived GH3B6 cells.

    PubMed

    Wachten, Sebastian; Masada, Nanako; Ayling, Laura-Jo; Ciruela, Antonio; Nikolaev, Viacheslav O; Lohse, Martin J; Cooper, Dermot M F

    2010-01-01

    Microdomains have been proposed to explain specificity in the myriad of possible cellular targets of cAMP. Local differences in cAMP levels can be generated by phosphodiesterases, which control the diffusion of cAMP. Here, we address the possibility that adenylyl cyclases, the source of cAMP, can be primary architects of such microdomains. Distinctly regulated adenylyl cyclases often contribute to total cAMP levels in endogenous cellular settings, making it virtually impossible to determine the contribution of a specific isoform. To investigate cAMP dynamics with high precision at the single-isoform level, we developed a targeted version of Epac2-camps, a cAMP sensor, in which the sensor was tagged to a catalytically inactive version of the Ca(2+)-stimulable adenylyl cyclase 8 (AC8). This sensor, and less stringently targeted versions of Epac2-camps, revealed opposite regulation of cAMP synthesis in response to Ca(2+) in GH(3)B(6) pituitary cells. Ca(2+) release triggered by thyrotropin-releasing hormone stimulated the minor endogenous AC8 species. cAMP levels were decreased by inhibition of AC5 and AC6, and simultaneous activation of phosphodiesterases, in different compartments of the same cell. These findings demonstrate the existence of distinct adenylyl-cyclase-centered cAMP microdomains in live cells and open the door to their molecular micro-dissection.

  18. Optimization of the Divergent method for genotyping single nucleotide variations using SYBR Green-based single-tube real-time PCR.

    PubMed

    Gentilini, Fabio; Turba, Maria E

    2014-01-01

    A novel technique, called Divergent, for single-tube real-time PCR genotyping of point mutations without the use of fluorescently labeled probes has recently been reported. This novel PCR technique utilizes a set of four primers and a particular denaturation temperature for simultaneously amplifying two different amplicons which extend in opposite directions from the point mutation. The two amplicons can readily be detected using the melt curve analysis downstream to a closed-tube real-time PCR. In the present study, some critical aspects of the original method were specifically addressed to further implement the technique for genotyping the DNM1 c.G767T mutation responsible for exercise-induced collapse in Labrador retriever dogs. The improved Divergent assay was easily set up using a standard two-step real-time PCR protocol. The melting temperature difference between the mutated and the wild-type amplicons was approximately 5°C which could be promptly detected by all the thermal cyclers. The upgraded assay yielded accurate results with 157pg of genomic DNA per reaction. This optimized technique represents a flexible and inexpensive alternative to the minor grove binder fluorescently labeled method and to high resolution melt analysis for high-throughput, robust and cheap genotyping of single nucleotide variations. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Evaluation of Polymerase Chain Reaction (PCR) with Slit Skin Smear Examination (SSS) to Confirm Clinical Diagnosis of Leprosy in Eastern Nepal

    PubMed Central

    Rai, Keshav; Bhattarai, Narayan Raj; Agarwal, Sudha; Khanal, Basudha

    2016-01-01

    Background Detection of Mycobacterium leprae in slit skin smear (SSS) is a gold standard technique for the leprosy diagnosis. Over recent years, molecular diagnosis by using PCR has been increasingly used as an alternative for its diagnosis due to its higher sensitivity. This study was carried out for comparative evaluation of PCR and SSS microscopy in a cohort of new leprosy cases diagnosed in B. P. Koirala Institute of health Sciences, Dharan, Nepal. Methodology/Principal Findings In this prospective crossectional study, 50 new clinically diagnosed cases of leprosy were included. DNA was extracted from SSS and PCR was carried out to amplify 129 bp sequence of M. leprae repetitive element. Sensitivity of SSS and PCR was 18% and 72% respectively. Improvement of 54% case detection by PCR clearly showed its advantage over SSS. Furthermore, PCR could confirm the leprosy diagnosis in 66% of AFB negative cases indicating its superiority over SSS. In the paucibacillary (PB) patients, whose BI was zero; sensitivity of PCR was 44%, whereas it was 78% in the multibacillary patients. Conclusions/Significance Our study showed PCR to be more sensitive than SSS microscopy in diagnosing leprosy. Moreover, it explored the characteristic feature of PCR which detected higher level of early stage(PB) cases tested negative by SSS. Being an expensive technique, PCR may not be feasible in all the cases, however, it would be useful in diagnosis of early cases of leprosy as opposed to SSS. PMID:28027305

  20. Evaluation of Polymerase Chain Reaction (PCR) with Slit Skin Smear Examination (SSS) to Confirm Clinical Diagnosis of Leprosy in Eastern Nepal.

    PubMed

    Siwakoti, Shraddha; Rai, Keshav; Bhattarai, Narayan Raj; Agarwal, Sudha; Khanal, Basudha

    2016-12-01

    Detection of Mycobacterium leprae in slit skin smear (SSS) is a gold standard technique for the leprosy diagnosis. Over recent years, molecular diagnosis by using PCR has been increasingly used as an alternative for its diagnosis due to its higher sensitivity. This study was carried out for comparative evaluation of PCR and SSS microscopy in a cohort of new leprosy cases diagnosed in B. P. Koirala Institute of health Sciences, Dharan, Nepal. In this prospective crossectional study, 50 new clinically diagnosed cases of leprosy were included. DNA was extracted from SSS and PCR was carried out to amplify 129 bp sequence of M. leprae repetitive element. Sensitivity of SSS and PCR was 18% and 72% respectively. Improvement of 54% case detection by PCR clearly showed its advantage over SSS. Furthermore, PCR could confirm the leprosy diagnosis in 66% of AFB negative cases indicating its superiority over SSS. In the paucibacillary (PB) patients, whose BI was zero; sensitivity of PCR was 44%, whereas it was 78% in the multibacillary patients. Our study showed PCR to be more sensitive than SSS microscopy in diagnosing leprosy. Moreover, it explored the characteristic feature of PCR which detected higher level of early stage(PB) cases tested negative by SSS. Being an expensive technique, PCR may not be feasible in all the cases, however, it would be useful in diagnosis of early cases of leprosy as opposed to SSS.

Top