Science.gov

Sample records for amphibia forms voltage-dependent

  1. Voltage-dependent gap junction channels are formed by connexin32, the major gap junction protein of rat liver.

    PubMed Central

    Moreno, A P; de Carvalho, A C; Verselis, V; Eghbali, B; Spray, D C

    1991-01-01

    We report here experiments undertaken in pairs of hepatocytes that demonstrate a marked voltage sensivity of junctional conductance and, thus, contradict earlier findings reported by this laboratory (Spray, D.C., R.D.ginzberg, E.A., E. A. Morales, Z. Gatmaitan and I.M. Arias, 1986, J. Cell Biol. 101:135-144; Spray C.D. R.L. White, A.C. Campos de Carvalho, and M.V.L. Bennett. 1984. Biophys. J. 45:219-230) and by others (Dahl, G., T. Moller, D. Paul, R. Voellmy, and R. Werner. 1987. Science [Wash. DC] 236:1290-1293; Riverdin, E.C., and R. Weingart. 1988. Am. J. Physiol. 254:C226-C234). Expression in exogenous systems, lipid bilayers in which fragments of isolated gap junction membranes were incorporated (Young, J.D.-E., Z. Cohn, and N.B. Gilula. 1987. Cell. 48:733-743.) and noncommunicating cells transfected with connexin32 cDNA (Eghbali, B., J.A. Kessler, and D.C. Spray. 1990. Proc. Natl. Acad. Sci. USA. 87:1328-1331), support these findings and indicate that the voltage-dependent channel is composed of connexin32, the major gap junction protein of rat liver (Paul, D. 1986. J. Cell Biol. 103:123-134). PMID:1648416

  2. Voltage Dependence of a Neuromodulator-Activated Ionic Current.

    PubMed

    Gray, Michael; Golowasch, Jorge

    2016-01-01

    The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca(2+), but that, in conditions of low Ca(2+), calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca(2+)/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR.

  3. Voltage Dependence of a Neuromodulator-Activated Ionic Current123

    PubMed Central

    2016-01-01

    Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

  4. In vivo analysis of voltage-dependent calcium channels.

    PubMed

    Liu, Ling; Zwingman, Theresa A; Fletcher, Colin F

    2003-12-01

    The molecular cloning of calcium channel subunits has identified an unexpectedly large number of genes and splicing variants, many of whichhave complex expression patterns: a central problem of calcium channel biology is to understand the functional significance of this genetic complexity. The genetic analysis of voltage-dependent calcium channels (VDCCs) provides an approach to defining channel function that is complimentary to pharmacological, electrophysiological, and other molecular methods. By discovering or creating alleles of VDCC genes, one can gain an understanding of the VDCC function at the whole animal level. Of particular interest are mutations in the alpha1 genes that encode the pore forming subunits, as they define the specific channel subtypes. In fact, a variety of calcium channelopathies and targeted mutations have been described for these genes in the last 6 years. The mutant alleles described below illustrate how phenotype analysis of these alleles has uncovered very specific functional roles that can be localized to specific synapses or cells.

  5. Voltage dependence of the Na-K pump.

    PubMed

    De Weer, P; Gadsby, D C; Rakowski, R F

    1988-01-01

    Present evidence demonstrates that the Na-K pump rate is voltage dependent, whereas early work was largely inconclusive. The I-V relationship has a positive slope over a wide voltage range, and the existence of a negative slope region is now doubtful. Monotonic voltage dependence is consistent with the reaction cycle containing a single voltage-dependent step. Recent measurements suggest that this voltage-dependent step occurs during Na translocation and may be deocclusion of Na+. In addition, two results suggest that K translocation is voltage insensitive: (a) large positive potentials appear to have no influence on Rb-Rb exchange or associated conformational transitions; and (b) transient currents associated with Na translocation appear to involve movement of a single charge, which is sufficient for a 3Na-2K cycle. The simplest interpretation is that the pump's cation binding sites supply two negative charges. Pre-steady-state measurements demonstrate that Na translocation precedes the pump cycle's rate-limiting step, presumably K translocation. But, because K translocation seems voltage insensitive, the voltage dependence of the steady-state pump rate probably reflects that of the concentration of the intermediate entering this slow step. Further pump current and flux data (both transient and steady-state), carefully determined over a range of conditions, should increase our understanding of the voltage-dependent step(s) in the Na-K pump cycle.

  6. Osteological Variation among Extreme Morphological Forms in the Mexican Salamander Genus Chiropterotriton (Amphibia: Plethodontidae): Morphological Evolution And Homoplasy

    PubMed Central

    Darda, David M.; Wake, David B.

    2015-01-01

    Osteological variation is recorded among and within four of the most distinctive species of the Mexican salamander genus Chiropterotriton. Analysis of the data is consistent with the monophyletic status of the genus and documents previously unrecorded intraspecific and interspecific variation. Most of the recorded variation involves qualitative and quantitative proportional differences, but four fixed differences constitute autapomorphic states that affirm and diagnose some species (C. dimidiatus, C. magnipes). Osteological variation in 15 characters is analyzed with respect to predictions generated from four hypotheses: 1) phylogeny, 2) adaptation to specific habitats (the four species include cave-dwelling, terrestrial, and arboreal forms), 3) size-free shape, and 4) size. High levels of intraspecific variation suggest that the characters studied are not subject to rigid functional constraints in salamanders, regardless of size. The pattern predicted by the hypothesis based on size differences seen among these four Chiropterotriton species matches most closely the observed pattern of relative skull robustness. Since size change and heterochrony are often associated in plethodontid evolution, it is likely that changes in developmental timing play a role in the morphological transitions among these morphologically diverse taxa. Webbed feet, miniaturization, body shape, and an unusual tarsal arrangement are morphologies exhibited in species of Chiropterotrition that are shown to be homoplastic with other clades of tropical plethodontids. Although extensive homoplasy in salamanders might be seen as a roadblock to unraveling phylogenetic hypotheses, the homologous developmental systems that appear to underlie such homoplasy may reveal common and consistent evolutionary processes at work. PMID:26060996

  7. Osteological Variation among Extreme Morphological Forms in the Mexican Salamander Genus Chiropterotriton (Amphibia: Plethodontidae): Morphological Evolution And Homoplasy.

    PubMed

    Darda, David M; Wake, David B

    2015-01-01

    Osteological variation is recorded among and within four of the most distinctive species of the Mexican salamander genus Chiropterotriton. Analysis of the data is consistent with the monophyletic status of the genus and documents previously unrecorded intraspecific and interspecific variation. Most of the recorded variation involves qualitative and quantitative proportional differences, but four fixed differences constitute autapomorphic states that affirm and diagnose some species (C. dimidiatus, C. magnipes). Osteological variation in 15 characters is analyzed with respect to predictions generated from four hypotheses: 1) phylogeny, 2) adaptation to specific habitats (the four species include cave-dwelling, terrestrial, and arboreal forms), 3) size-free shape, and 4) size. High levels of intraspecific variation suggest that the characters studied are not subject to rigid functional constraints in salamanders, regardless of size. The pattern predicted by the hypothesis based on size differences seen among these four Chiropterotriton species matches most closely the observed pattern of relative skull robustness. Since size change and heterochrony are often associated in plethodontid evolution, it is likely that changes in developmental timing play a role in the morphological transitions among these morphologically diverse taxa. Webbed feet, miniaturization, body shape, and an unusual tarsal arrangement are morphologies exhibited in species of Chiropterotrition that are shown to be homoplastic with other clades of tropical plethodontids. Although extensive homoplasy in salamanders might be seen as a roadblock to unraveling phylogenetic hypotheses, the homologous developmental systems that appear to underlie such homoplasy may reveal common and consistent evolutionary processes at work.

  8. A marriage of convenience: beta-subunits and voltage-dependent K+ channels.

    PubMed

    Torres, Yolima P; Morera, Francisco J; Carvacho, Ingrid; Latorre, Ramon

    2007-08-24

    The movement of ions across cell membranes is essential for a wide variety of fundamental physiological processes, including secretion, muscle contraction, and neuronal excitation. This movement is possible because of the presence in the cell membrane of a class of integral membrane proteins dubbed ion channels. Ion channels, thanks to the presence of aqueous pores in their structure, catalyze the passage of ions across the otherwise ion-impermeable lipid bilayer. Ion conduction across ion channels is highly regulated, and in the case of voltage-dependent K(+) channels, the molecular foundations of the voltage-dependent conformational changes leading to the their open (conducting) configuration have provided most of the driving force for research in ion channel biophysics since the pioneering work of Hodgkin and Huxley (Hodgkin, A. L., and Huxley, A. F. (1952) J. Physiol. 117, 500-544). The voltage-dependent K(+) channels are the prototypical voltage-gated channels and govern the resting membrane potential. They are responsible for returning the membrane potential to its resting state at the termination of each action potential in excitable membranes. The pore-forming subunits (alpha) of many voltage-dependent K(+) channels and modulatory beta-subunits exist in the membrane as one component of macromolecular complexes, able to integrate a myriad of cellular signals that regulate ion channel behavior. In this review, we have focused on the modulatory effects of beta-subunits on the voltage-dependent K(+) (Kv) channel and on the large conductance Ca(2+)- and voltage-dependent (BK(Ca)) channel.

  9. Bio-inspired voltage-dependent calcium channel blockers.

    PubMed

    Yang, Tingting; He, Lin-Ling; Chen, Ming; Fang, Kun; Colecraft, Henry M

    2013-01-01

    Ca(2+) influx via voltage-dependent CaV1/CaV2 channels couples electrical signals to biological responses in excitable cells. CaV1/CaV2 channel blockers have broad biotechnological and therapeutic applications. Here we report a general method for developing novel genetically encoded calcium channel blockers inspired by Rem, a small G-protein that constitutively inhibits CaV1/CaV2 channels. We show that diverse cytosolic proteins (CaVβ, 14-3-3, calmodulin and CaMKII) that bind pore-forming α1-subunits can be converted into calcium channel blockers with tunable selectivity, kinetics and potency, simply by anchoring them to the plasma membrane. We term this method 'channel inactivation induced by membrane-tethering of an associated protein' (ChIMP). ChIMP is potentially extendable to small-molecule drug discovery, as engineering FK506-binding protein into intracellular sites within CaV1.2-α1C permits heterodimerization-initiated channel inhibition with rapamycin. The results reveal a universal method for developing novel calcium channel blockers that may be extended to develop probes for a broad cohort of unrelated ion channels.

  10. Elevations of intracellular calcium reflect normal voltage-dependent behavior, and not constitutive activity, of voltage-dependent calcium channels in gastrointestinal and vascular smooth muscle.

    PubMed

    McCarron, John G; Olson, Marnie L; Currie, Susan; Wright, Amanda J; Anderson, Kurt I; Girkin, John M

    2009-04-01

    In smooth muscle, the gating of dihydropyridine-sensitive Ca(2+) channels may either be stochastic and voltage dependent or coordinated among channels and constitutively active. Each form of gating has been proposed to be largely responsible for Ca(2+) influx and determining the bulk average cytoplasmic Ca(2+) concentration. Here, the contribution of voltage-dependent and constitutively active channel behavior to Ca(2+) signaling has been studied in voltage-clamped single vascular and gastrointestinal smooth muscle cells using wide-field epifluorescence with near simultaneous total internal reflection fluorescence microscopy. Depolarization (-70 to +10 mV) activated a dihydropyridine-sensitive voltage-dependent Ca(2+) current (I(Ca)) and evoked a rise in [Ca(2+)] in each of the subplasma membrane space and bulk cytoplasm. In various regions of the bulk cytoplasm the [Ca(2+)] increase ([Ca(2+)](c)) was approximately uniform, whereas that of the subplasma membrane space ([Ca(2+)](PM)) had a wide range of amplitudes and time courses. The variations that occurred in the subplasma membrane space presumably reflected an uneven distribution of active Ca(2+) channels (clusters) across the sarcolemma, and their activation appeared consistent with normal voltage-dependent behavior. Indeed, in the present study, dihydropyridine-sensitive Ca(2+) channels were not normally constitutively active. The repetitive localized [Ca(2+)](PM) rises ("persistent Ca(2+) sparklets") that characterize constitutively active channels were observed rarely (2 of 306 cells). Neither did dihydropyridine-sensitive constitutively active Ca(2+) channels regulate the bulk average [Ca(2+)](c). A dihydropyridine blocker of Ca(2+) channels, nimodipine, which blocked I(Ca) and accompanying [Ca(2+)](c) rise, reduced neither the resting bulk average [Ca(2+)](c) (at -70 mV) nor the rise in [Ca(2+)](c), which accompanied an increased electrochemical driving force on the ion by hyperpolarization (-130 m

  11. Voltage-dependent conformational changes in connexin channels✩

    PubMed Central

    Bargiello, Thaddeus A.; Tang, Qingxiu; Oh, Seunghoon; Kwon, Taekyung

    2011-01-01

    Channels formed by connexins display two distinct types of voltage-dependent gating, termed Vj- or fast-gating and loop- or slow-gating. Recent studies, using metal bridge formation and chemical cross-linking have identified a region within the channel pore that contributes to the formation of the loop-gate permeability barrier. The conformational changes are remarkably large, reducing the channel pore diameter from 15 to 20 Å to less than 4 Å. Surprisingly, the largest conformational change occurs in the most stable region of the channel pore, the 310 or parahelix formed by amino acids in the 42–51 segment. The data provide a set of positional constraints that can be used to model the structure of the loop-gate closed state. Less is known about the conformation of the Vj-gate closed state. There appear to be two different mechanisms; one in which conformational changes in channel structure are linked to a voltage sensor contained in the N-terminus of Cx26 and Cx32 and a second in which the C-terminus of Cx43 and Cx40 may act either as a gating particle to block the channel pore or alternatively to stabilize the closed state. The later mechanismutilizes the same domains as implicated in effecting pH gating of Cx43 channels. It is unclear if the two Vj-gating mechanisms are related or if they represent different gating mechanisms that operate separately in different subsets of connexin channels. A model of the Vj-closed state of Cx26 hemichannel that is based on the X-ray structure of Cx26 and electron crystallographic structures of a Cx26 mutation suggests that the permeability barrier for Vj-gating is formed exclusively by the N-terminus, but recent information suggests that this conformation may not represent a voltage-closed state. Closed state models are considered from a thermodynamic perspective based on information from the 3.5 Å Cx26 crystal structure and molecular dynamics (MD) simulations. The applications of computational and experimental methods to

  12. Helix O modulates voltage dependency of CLC-1.

    PubMed

    Seong, Ju Yong; Ha, Kotdaji; Hong, Chansik; Myeong, Jongyun; Lim, Hyun-Ho; Yang, Dongki; So, Insuk

    2017-02-01

    The chloride channel (CLC) family of proteins consists of channels and transporters that share similarities in architecture and play essential roles in physiological functions. Among the CLC family, CLC-1 channels have the representative homodimeric double-barreled structure carrying two gating processes. One is protopore gating that acts on each pore independently by glutamate residue (Eext). The other is common gating that closes both pores simultaneously in association with large conformational changes across each subunit. In skeletal muscle, CLC-1 is associated with maintaining normal sarcolemmal excitability, and a number of myotonic mutants were reported to modify the channel gating of CLC-1. In this study, we characterized highly conserved helix O as a key determinant of structural stability in CLC-1. Supporting this hypothesis, myotonic mutant (G523D) at N-terminal of helix O showed the activation at hyperpolarizing membrane potentials with a reversed voltage dependency. However, introducing glutamate at serine residue (S537) at the C-terminal of the helix O on G523D restored WT-like voltage dependency of the common gate and showed proton insensitive voltage dependency. To further validate this significant site, site-specific mutagenesis experiments was performed on V292 that is highly conserved as glutamate in antiporter and closely located to S537 and showed that this area is essential for channel function. Taken together, the results of our study suggest the importance of helix O as the main contributor for stable structure of evolutionary conserved CLC proteins and its key role in voltage dependency of the CLC-1. Furthermore, the C-terminal of the helix O can offer a clue for possible proton involvement in CLC-1 channel.

  13. Voltage dependence of Na-Ca exchanger conformational currents.

    PubMed Central

    Niggli, E; Lipp, P

    1994-01-01

    Properties of a transient current (Icont) believed to reflect a conformational change of the Na-Ca exchanger molecules after Ca2+ binding were investigated. Intracellular Ca2+ concentration jumps in isolated cardiac myocytes were generated with flash photolysis of caged Ca2+ dimethoxynitrophenamine, and membrane currents were simultaneously measured using the whole-cell variant of the patch-clamp technique. A previously unresolved shallow voltage dependence of Icont was revealed after developing an experimental protocol designed to compensate for the photoconsumption of the caged compound. This voltage dependence can be interpreted to reflect the distribution of Na-Ca exchanger conformational states with the Ca2+ binding site exposed to the inside of the cell immediately before the flash. Analysis performed by fitting a Boltzmann distribution to the observed data suggests that under control conditions most exchanger molecules reside in states with the Ca2+ binding site facing the outside of the cell. Dialysis of the cytosol with 3',4'-dichlorobenzamil, an organic inhibitor of the Na-Ca exchange, increased the magnitude of Icont and changed the voltage dependence, consistent with a parallel shift of the charge/voltage curve. This shift may result from intracellular DCB interfering with an Na(+)-binding or Na(+)-translocating step. These observations are consistent with Icont arising from a charge movement mediated by the Na-Ca exchanger molecules after binding of Ca2+. PMID:7819485

  14. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    PubMed Central

    Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

    2012-01-01

    The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

  15. Voltage-dependent absorbance change of carotenoids in halophilic archaebacteria.

    PubMed

    Seki, S I; Sasabe, H; Tomioka, H

    1996-10-02

    Membrane vesicles of wild-type Halobacterium sp. mex strain show a wavy absorbance change which has not been so far reported in halophilic archaebacteria. A white mutant strain lacking carotenoids did not show the wavy absorbance change. The wavy absorbance change in the range of 440-590 nm was induced by a red flash (600-640 nm), which photoexcited electrogenic ion pumps, mex bacteriorhodopsin and mex halorhodopsin but not carotenoids. The wavy change was also caused by K+ diffusion potentials without light. These results suggest that the wavy absorbance change in the membrane vesicles is the voltage-dependent absorbance change of the carotenoids.

  16. Voltage-dependent properties of DNA origami nanopores.

    PubMed

    Hernández-Ainsa, Silvia; Misiunas, Karolis; Thacker, Vivek V; Hemmig, Elisa A; Keyser, Ulrich F

    2014-03-12

    We show DNA origami nanopores that respond to high voltages by a change in conformation on glass nanocapillaries. Our DNA origami nanopores are voltage sensitive as two distinct states are found as a function of the applied voltage. We suggest that the origin of these states is a mechanical distortion of the DNA origami. A simple model predicts the voltage dependence of the structural change. We show that our responsive DNA origami nanopores can be used to lower the frequency of DNA translocation by 1 order of magnitude.

  17. Voltage-Dependent Calcium Channels in Glial Cells

    NASA Astrophysics Data System (ADS)

    MacVicar, B. A.

    1984-12-01

    The electrophysiological properties of glial cells were examined in primary culture in the presence of tetraethylammonium and Ba2+, a treatment that reduces K+ permeability of the membrane and enhances currents through voltage-dependent Ca2+ channels. Under these conditions, glial cells showed both spontaneous action potentials and action potentials evoked by the injections of current. These responses appear to represent entry of Ba2+ through Ca2+ channels because they were resistant to tetrodotoxin but were blocked by Mn2+ or Cd2+.

  18. Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

    PubMed Central

    Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

    2012-01-01

    The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

  19. Purification and Characterization of Two Voltage-Dependent Anion Channel Isoforms from Plant Seeds1

    PubMed Central

    Abrecht, Helge; Wattiez, Ruddy; Ruysschaert, Jean-Marie; Homblé, Fabrice

    2000-01-01

    Mitochondria were isolated from imbibed seeds of lentil (Lens culinaris) and Phaseolus vulgaris. We copurified two voltage-dependent anion channel from detergent solubilized mitochondria in a single purification step using hydroxyapatite. The two isoforms from P. vulgaris were separated by chromatofocusing chromatography in 4 m urea without any loss of channel activity. Channel activity of each isoform was characterized upon reconstitution into diphytanoyl phosphatidylcholine planar lipid bilayers. Both isoforms form large conductance channels that are slightly anion selective and display cation selective substates. PMID:11080295

  20. Voltage Dependent Charge Storage Modes and Capacity in Subnanometer Pores

    SciTech Connect

    Qiao, Rui; Meunier, V.; Huang, Jingsong; Wu, Peng; Sumpter, Bobby G

    2012-01-01

    Using molecular dynamics simulations, we show that charge storage in subnanometer pores follows a distinct voltage-dependent behavior. Specifically, at lower voltages, charge storage is achieved by swapping co-ions in the pore with counterions in the bulk electrolyte. As voltage increases, further charge storage is due mainly to the removal of co-ions from the pore, leading to a capacitance increase. The capacitance eventually reaches a maximum when all co-ions are expelled from the pore. At even higher electrode voltages, additional charge storage is realized by counterion insertion into the pore, accompanied by a reduction of capacitance. The molecular mechanisms of these observations are elucidated and provide useful insight for optimizing energy storage based on supercapacitors.

  1. Voltage dependence of membrane properties of trigeminal root ganglion neurons.

    PubMed

    Puil, E; Gimbarzevsky, B; Miura, R M

    1987-07-01

    1. Membrane potentials of trigeminal root ganglion neurons were varied systematically by intracellular injections of long-lasting step currents to determine the voltage dependence of their membrane electrical properties. The complex impedance and impedance magnitude functions were first determined using oscillatory input currents superimposed on these step currents. 2. Systematic step variations in the membrane potential led to qualitative changes in the impedance magnitude functions. Depolarization of neurons exhibiting resonance at their initial resting membrane potentials resulted in a reduction in the resonance behavior. Hyperpolarization of these neurons to membrane potentials of about -80 to -90 mV led to a disappearance of the resonant peak but increased the maximum of the impedance magnitude. 3. The complex impedance data were fitted with a neuronal model derived from linearized Hodgkin-Huxley-like equations, yielding estimates for the membrane properties. The four parameters of the model were 1) a time invariant, resting membrane conductance, Gr, 2) a voltage- and time-dependent conductance, GL, 3) a time constant, tau u, for the unknown ionic channels that are activated by the 2- to 5-mV oscillatory perturbation of the stepped membrane potential, and 4) Ci, the input capacitance. 4. The results of the curve-fitting procedures suggested that all parameters depended on membrane voltage. The most voltage-dependent parameters were GL and tau u throughout a 25- to 30-mV range that was subthreshold to the production of action potentials. Both Gr and GL increased with subthreshold depolarization. 5. These impedance data suggest the very important role of the membrane potential of the trigeminal root ganglion neurons on their abilities to synthesize and filter inputted electrical signals.

  2. Importance of the Voltage Dependence of Cardiac Na/K ATPase Isozymes

    PubMed Central

    Stanley, Christopher M.; Gagnon, Dominique G.; Bernal, Adam; Meyer, Dylan J.; Rosenthal, Joshua J.; Artigas, Pablo

    2015-01-01

    Cardiac cells express more than one isoform of the Na, K-ATPase (NKA), the heteromeric enzyme that creates the Na+ and K+ gradients across the plasmalemma. Cardiac isozymes contain one catalytic α-subunit isoform (α1, α2, or α3) associated with an auxiliary β-subunit isoform (β1 or β2). Past studies using biochemical approaches have revealed minor kinetic differences between isozymes formed by different α-β isoform combinations; these results make it difficult to understand the physiological requirement for multiple isoforms. In intact cells, however, NKA enzymes operate in a more complex environment, which includes a substantial transmembrane potential. We evaluated the voltage dependence of human cardiac NKA isozymes expressed in Xenopus oocytes, and of native NKA isozymes in rat ventricular myocytes, using normal mammalian physiological concentrations of Na+o and K+o. We demonstrate that although α1 and α3 pumps are functional at all physiologically relevant voltages, α2β1 pumps and α2β2 pumps are inhibited by ∼75% and ∼95%, respectively, at resting membrane potentials, and only activate appreciably upon depolarization. Furthermore, phospholemman (FXYD1) inhibits pump function without significantly altering the pump’s voltage dependence. Our observations provide a simple explanation for the physiological relevance of the α2 subunit (∼20% of total α subunits in rat ventricle): they act as a reserve and are recruited into action for extra pumping during the long-lasting cardiac action potential, where most of the Na+ entry occurs. This strong voltage dependence of α2 pumps also helps explain how cardiotonic steroids, which block NKA pumps, can be a beneficial treatment for heart failure: by only inhibiting the α2 pumps, they selectively reduce NKA activity during the cardiac action potential, leading to an increase in systolic Ca2+, due to reduced extrusion through the Na/Ca exchanger, without affecting resting Na+ and Ca2

  3. Importance of the Voltage Dependence of Cardiac Na/K ATPase Isozymes.

    PubMed

    Stanley, Christopher M; Gagnon, Dominique G; Bernal, Adam; Meyer, Dylan J; Rosenthal, Joshua J; Artigas, Pablo

    2015-11-03

    Cardiac cells express more than one isoform of the Na, K-ATPase (NKA), the heteromeric enzyme that creates the Na(+) and K(+) gradients across the plasmalemma. Cardiac isozymes contain one catalytic α-subunit isoform (α1, α2, or α3) associated with an auxiliary β-subunit isoform (β1 or β2). Past studies using biochemical approaches have revealed minor kinetic differences between isozymes formed by different α-β isoform combinations; these results make it difficult to understand the physiological requirement for multiple isoforms. In intact cells, however, NKA enzymes operate in a more complex environment, which includes a substantial transmembrane potential. We evaluated the voltage dependence of human cardiac NKA isozymes expressed in Xenopus oocytes, and of native NKA isozymes in rat ventricular myocytes, using normal mammalian physiological concentrations of Na(+)o and K(+)o. We demonstrate that although α1 and α3 pumps are functional at all physiologically relevant voltages, α2β1 pumps and α2β2 pumps are inhibited by ∼75% and ∼95%, respectively, at resting membrane potentials, and only activate appreciably upon depolarization. Furthermore, phospholemman (FXYD1) inhibits pump function without significantly altering the pump's voltage dependence. Our observations provide a simple explanation for the physiological relevance of the α2 subunit (∼20% of total α subunits in rat ventricle): they act as a reserve and are recruited into action for extra pumping during the long-lasting cardiac action potential, where most of the Na(+) entry occurs. This strong voltage dependence of α2 pumps also helps explain how cardiotonic steroids, which block NKA pumps, can be a beneficial treatment for heart failure: by only inhibiting the α2 pumps, they selectively reduce NKA activity during the cardiac action potential, leading to an increase in systolic Ca(2+), due to reduced extrusion through the Na/Ca exchanger, without affecting resting Na(+) and Ca(2

  4. Calcium channel beta subunit promotes voltage-dependent modulation of alpha 1 B by G beta gamma.

    PubMed Central

    Meir, A; Bell, D C; Stephens, G J; Page, K M; Dolphin, A C

    2000-01-01

    Voltage-dependent calcium channels (VDCCs) are heteromultimers composed of a pore-forming alpha1 subunit and auxiliary subunits, including the intracellular beta subunit, which has a strong influence on the channel properties. Voltage-dependent inhibitory modulation of neuronal VDCCs occurs primarily by activation of G-proteins and elevation of the free G beta gamma dimer concentration. Here we have examined the interaction between the regulation of N-type (alpha 1 B) channels by their beta subunits and by G beta gamma dimers, heterologously expressed in COS-7 cells. In contrast to previous studies suggesting antagonism of G protein inhibition by the VDCC beta subunit, we found a significantly larger G beta gamma-dependent inhibition of alpha 1 B channel activation when the VDCC alpha 1 B and beta subunits were coexpressed. In the absence of coexpressed VDCC beta subunit, the G beta gamma dimers, either expressed tonically or elevated via receptor activation, did not produce the expected features of voltage-dependent G protein modulation of N-type channels, including slowed activation and prepulse facilitation, while VDCC beta subunit coexpression restored all of the hallmarks of G beta gamma modulation. These results suggest that the VDCC beta subunit must be present for G beta gamma to induce voltage-dependent modulation of N-type calcium channels. PMID:10920007

  5. The voltage dependence of the chloride conductance of frog muscle

    PubMed Central

    Hutter, O. F.; Warner, Anne E.

    1972-01-01

    1. The effect of extracellular pH changes on the voltage—current relation of frog muscle membrane has been studied using intracellular microelectrodes. To reduce the cation conductance of the membrane, potassium in Ringer solution was replaced by rubidium. 2. When the relatively impermeant methyl sulphate ion replaced extracellular chloride the membrane conductance was low, time independent and little influenced by extracellular pH changes. The voltage—current relation was linear at both high and low pH values. 3. In rubidium Ringer solution at pH 7·4 the membrane conductance fell as the inside of the fibre was made more negative, in a manner consistent with the predictions of the constant field theory. 4. At a high pH value (9·8) the resting conductance was high, but it fell steeply as the membrane potential was increased; for large hyperpolarizing voltages the membrane current tended to a limiting value. The voltage—current relation crossed those recorded at pH 7·4 and 5·0. 5. In acid Ringer solution (pH 5·0) the resting membrane conductance was low and remained constant until the membrane potential was hyperpolarized more than 30 mV beyond the resting value; the conductance then rose as the membrane potential was further increased. For large hyperpolarizations the membrane conductance was higher at pH 5·0 than at pH 9·8. 6. Experiments using two successive, identical, constant current pulses suggested that the membrane conductance altered during the passage of current across the membrane; in alkaline solution the conductance fell with time, in acid solution it rose. 7. Because no time or voltage dependence of the membrane conductance was seen in the absence of chloride ions it is inferred that the movements of chloride ions across the muscle membrane are responsible for both the time and voltage dependent alterations in membrane conductance seen at different pH values. PMID:4539587

  6. Voltage dependence of ATP secretion in mammalian taste cells.

    PubMed

    Romanov, Roman A; Rogachevskaja, Olga A; Khokhlov, Alexander A; Kolesnikov, Stanislav S

    2008-12-01

    Mammalian type II taste cells release the afferent neurotransmitter adenosine triphosphate (ATP) through ATP-permeable ion channels, most likely to be connexin (Cx) and/or pannexin hemichannels. Here, we show that ion channels responsible for voltage-gated (VG) outward currents in type II cells are ATP permeable and demonstrate a strong correlation between the magnitude of the VG current and the intensity of ATP release. These findings suggest that slowly deactivating ion channels transporting the VG outward currents can also mediate ATP secretion in type II cells. In line with this inference, we studied a dependence of ATP secretion on membrane voltage with a cellular ATP sensor using different pulse protocols. These were designed on the basis of predictions of a model of voltage-dependent transient ATP efflux. Consistently with curves that were simulated for ATP release mediated by ATP-permeable channels deactivating slowly, the bell-like and Langmuir isotherm-like potential dependencies were characteristic of ATP secretion obtained for prolonged and short electrical stimulations of taste cells, respectively. These observations strongly support the idea that ATP is primarily released via slowly deactivating channels. Depolarizing voltage pulses produced negligible Ca(2+) transients in the cytoplasm of cells releasing ATP, suggesting that ATP secretion is mainly governed by membrane voltage under our recording conditions. With the proviso that natural connexons and pannexons are kinetically similar to exogenously expressed hemichannels, our findings suggest that VG ATP release in type II cells is primarily mediated by Cx hemichannels.

  7. Voltage dependence of acetylcholine receptor channel gating in rat myoballs

    PubMed Central

    1992-01-01

    Whole-cell currents from nicotinic acetylcholine receptor (AChR) channels were studied in rat myoballs using a light-activated agonist to determine the voltage dependence of the macroscopic opening and closing rate constants. Myoballs were bathed in a solution containing a low concentration of the inactive isomer of the photoisomerizable azobenzene derivative, cis-Bis-Q. A light flash was then presented to produce a known concentration jump of agonist, trans-Bis-Q, across a wide range of membrane potentials in symmetrical solutions (NaCl or CsCl on both sides) or asymmetrical solutions (NaCl in the bath and CsCl in the pipette). At the low agonist concentration used in this study, the reciprocal of the macroscopic time constants gives an unambiguous measure of the effective closing rate. It showed an exponential decrease with membrane hyperpolarization between +20 and - 100 mV, but tended to level off at more depolarized and at more hyperpolarized membrane potentials. The relative effective opening rate was derived from the steady-state conductance, the single-channel conductance, and the apparent closing rate; it decreased sharply in the depolarizing region and tended to level off and then turn up in the hyperpolarizing region. The two effective rate constants were shown to depend on the first, second, and third power of membrane potential. PMID:1460456

  8. Are ion channels voltage-dependent "transfer-enzymes"?

    NASA Astrophysics Data System (ADS)

    Nelson, Peter Hugo

    2002-04-01

    The known structure of the KcsA channel selectivity filter is used to derive a novel ion permeation theory for K channels. The simplified model has only two adjustable parameters: a maximum ion transfer rate and a binding coefficient - that explicitly appear in the Michaelis-Menten equation governing the concentration dependence of the zero-voltage conductivity. A third parameter is the relative distance between two K+ ions in the selectivity filter of KcsA. This parameter is obtained directly from the X-ray structure [Doyle et al., Science 280 (1998) 69-77] and successfully predicts the experimentally observed voltage dependence of K+ ion permeation [Meuser et al., FEBS Lett. 462 (1999) 447-452][LeMasurier et al., J. Gen. Physiol. 118 (2001) 303-313], suggesting a quantitative relationship between the KcsA X-ray structure and its function. The same theory also successfully models all experimentally observed aspects of Cl- and SCN- permeation through GlyR and GABAR channels [Bormann et al., J. Physiol. 385 (1987) 243-286] including the so-called 'anomalous mole fraction effect'. This work is supported by NIH Post-Doctoral Fellowship GM20584.

  9. Conductance hysteresis in the voltage-dependent anion channel.

    PubMed

    Rappaport, Shay M; Teijido, Oscar; Hoogerheide, David P; Rostovtseva, Tatiana K; Berezhkovskii, Alexander M; Bezrukov, Sergey M

    2015-09-01

    Hysteresis in the conductance of voltage-sensitive ion channels is observed when the transmembrane voltage is periodically varied with time. Although this phenomenon has been used in studies of gating of the voltage-dependent anion channel, VDAC, from the outer mitochondrial membrane for nearly four decades, full hysteresis curves have never been reported, because the focus was solely on the channel opening branches of the hysteresis loops. We studied the hysteretic response of a multichannel VDAC system to a triangular voltage ramp the frequency of which was varied over three orders of magnitude, from 0.5 mHz to 0.2 Hz. We found that in this wide frequency range the area encircled by the hysteresis curves changes by less than a factor of three, suggesting broad distribution of the characteristic times and strongly non-equilibrium behavior. At the same time, quasi-equilibrium two-state behavior is observed for hysteresis branches corresponding to VDAC opening. This enables calculation of the usual equilibrium gating parameters, gating charge and voltage of equipartitioning, which were found to be almost insensitive to the ramp frequency. To rationalize this peculiarity, we hypothesize that during voltage-induced closure and opening the system explores different regions of the complex free energy landscape, and, in the opening branch, follows quasi-equilibrium paths.

  10. [Role of voltage-dependent ion channels in epileptogenesis].

    PubMed

    Ricard-Mousnier, B; Couraud, F

    1993-10-01

    The aim of this review is to gather information in favour of the involvement of voltage-dependent ion channels in epileptogenesis. Although, up to now, no study has shown that epilepsy is accompanied by a modification in the activity to these channels, the recently acquired knowledge of their physiology allows to presume would favor their involvement in epileptogenesis. The results from electrophysiological studies are as follows: a persistent sodium current increases neuronal excitability whereas potassium currents have an inhibitory role. In particular, calcium-dependent potassium current are involved in the post-hyperpolarization phases which follows PDS. Calcium currents are also involved in the genesis of the "bursting pacemaker" activity displayed by the neurons presumed to be inducers of the epileptic activity. Biochemical data has shown that as a consequence of epileptic activity, sodium and calcium channels are down regulated. This down-regulation could be a way to reduces neuronal hyperexcitability. Pharmacological data demonstrate the drugs which activate calcium channels or which inhibit potassium channels have a convusilvant effect. On the contrary, agents which block calcium or sodium channels or which properties. Among the latter ones, some antiepileptic drugs can be found. In summary situations which lead to increase in calcium and sodium currents and/or to an inhibition in potassium currents are potentially epileptogenic.

  11. AmphibiaChina: an online database of Chinese Amphibians.

    PubMed

    Che, Jing; Wang, Kai

    2016-01-18

    AmphibiaChina, an open-access, web-based database, is designed to provide comprehensive and up-to-date information on Chinese amphibians. It offers an integrated module with six major sections. Compared to other known databases including AmphibiaWeb and Amphibian Species of the World, AmphibiaChina has the following new functions: (1) online species identification based on DNA barcode sequences; (2) comparisons and discussions of different major taxonomic systems; and (3) phylogenetic progress on Chinese amphibians. This database offers a window for the world to access available information of Chinese amphibians. AmphibiaChina with its Chinese version can be accessed at http://www.amphibiachina.org.

  12. The voltage dependence of Ih in human myelinated axons

    PubMed Central

    Howells, James; Trevillion, Louise; Bostock, Hugh; Burke, David

    2012-01-01

    HCN channels are responsible for Ih, a voltage-gated inwardly rectifying current activated by hyperpolarization. This current appears to be more active in human sensory axons than motor and may play a role in the determination of threshold. Differences in Ih are likely to be responsible for the high variability in accommodation to hyperpolarization seen in different subjects. The aim of this study was to characterise this current in human axons, both motor and sensory. Recordings of multiple axonal excitability properties were performed in 10 subjects, with a focus on the changes in threshold evoked by longer and stronger hyperpolarizing currents than normally studied. The findings confirm that accommodation to hyperpolarization is greater in sensory than motor axons in all subjects, but the variability between subjects was greater than the modality difference. An existing model of motor axons was modified to take into account the behaviour seen with longer and stronger hyperpolarization, and a mathematical model of human sensory axons was developed based on the data collected. The differences in behaviour of sensory and motor axons and the differences between different subjects are best explained by modulation of the voltage dependence, along with a modest increase of expression of the underlying conductance of Ih. Accommodation to hyperpolarization for the mean sensory data is fitted well with a value of −94.2 mV for the mid-point of activation (V0.5) of Ih as compared to −107.3 mV for the mean motor data. The variation in response to hyperpolarization between subjects is accounted for by varying this parameter for each modality (sensory: −89.2 to −104.2 mV; motor −87.3 to −127.3 mV). These voltage differences are within the range that has been described for physiological modulation of Ih function. The presence of slowly activated Ih isoforms on both motor and sensory axons was suggested by modelling a large internodal leak current and a masking of

  13. G protein-induced trafficking of voltage-dependent calcium channels.

    PubMed

    Tombler, Eugene; Cabanilla, Nory Jun; Carman, Paul; Permaul, Natasha; Hall, John J; Richman, Ryan W; Lee, Jessica; Rodriguez, Jennifer; Felsenfeld, Dan P; Hennigan, Robert F; Diversé-Pierluissi, María A

    2006-01-20

    Calcium channels are well known targets for inhibition by G protein-coupled receptors, and multiple forms of inhibition have been described. Here we report a novel mechanism for G protein-mediated modulation of neuronal voltage-dependent calcium channels that involves the destabilization and subsequent removal of calcium channels from the plasma membrane. Imaging experiments in living sensory neurons show that, within seconds of receptor activation, calcium channels are cleared from the membrane and sequestered in clathrin-coated vesicles. Disruption of the L1-CAM-ankyrin B complex with the calcium channel mimics transmitter-induced trafficking of the channels, reduces calcium influx, and decreases exocytosis. Our results suggest that G protein-induced removal of plasma membrane calcium channels is a consequence of disrupting channel-cytoskeleton interactions and might represent a novel mechanism of presynaptic inhibition.

  14. Precipitation-Induced Voltage-Dependent Ion Current Fluctuations in Conical Nanopores

    SciTech Connect

    Vlassiouk, Ivan V

    2010-01-01

    Single conically shaped nanopores produce stable ion current fluctuations when in contact with weakly soluble salts, such as calcium hydrogen phosphate (CaHPO{sub 4}) and cobalt hydrogen phosphate (CoHPO{sub 4}). The pore spontaneously switches between high and low conductance states, called open and closed states, respectively. Pore opening and closing are linked to the dynamic formation of the calcium and cobalt precipitates at the small opening of the pore. The probabilities of pore opening and closing are voltage-dependent, and this characteristic of ion current signal is known for biological voltage-gated channels. We show that new types of ion current fluctuations are obtained in conditions at which precipitates of CaHPO{sub 4} and CoHPO{sub 4} can form in the pore at the same time.

  15. The spleen pigment cells in some amphibia.

    PubMed

    Scalia, Marina; Di Pietro, Cinzia; Poma, Mariangela; Ragusa, Marco; Sichel, Giovanni; Corsaro, Concetta

    2004-04-01

    It was demonstrated that the spleen pigment cells of Amphibia are macrophages: they show an ultrastructurally distinctive morphology, are able to phagocytose and react positively for non-specific esterases. These pigmented macrophages express mRNA for tyrosinase and also they show dopa oxidase activity; therefore they are able to synthesize melanins, as Kupffer cells do.

  16. Voltage-dependent potassium channels in activated rat microglia.

    PubMed Central

    Nörenberg, W; Gebicke-Haerter, P J; Illes, P

    1994-01-01

    1. Voltage-dependent currents of untreated (proliferating) and lipopolysaccharide (LPS)-treated rat microglial cells in culture were recorded using the whole-cell patch-clamp technique. 2. Membrane potentials showed prominent peaks at -35 mV and -70 mV. Membrane potentials of LPS-treated cells alternated between the two values. This may be due to a negative slope region of the I-V relation resulting in two zero current potentials. 3. From a holding potential of -70 mV, hyperpolarizing steps evoked an inwardly rectifying current both in proliferating and in LPS-treated cells, while depolarizing steps below -50 mV evoked an outwardly rectifying current only in LPS-treated microglia. The currents were K+ selective, as indicated by their reversal potential of approximately 0 mV in symmetric K+ concentrations (150 mM both intra- and extracellularly) and the reversal potential of the outward tail currents of approximately -90 mV at a normal extracellular K+ concentration (4.5 mM). 4. The activation of the outward current could be fitted by Hodgkin-Huxley-type n4 kinetics. The time constant of activation depended on voltage. 5. The inactivation of the inward and outward currents could be fitted by a single exponential. The time constant of the inward current inactivation was dependent on voltage, whereas the time constant of the outward current inactivation was virtually independent of voltage, except near the threshold of activation. Recovery of the outward from inactivation was slow and could be fitted by two exponentials. Responses to depolarizing steps were stable at 0.125 Hz, but greatly decreased from the first to the second pulse at 1 Hz. 6. The inactivation of the inward, but not of the outward, current disappeared in a low Na(+)-containing medium (5 mM). The inward current was selectively inhibited by extracellular Cs+ and Ba2+. The outward current was selectively inhibited by Cd2+, 4-aminopyridine and charybdotoxin. Replacement of intracellular K+ by an

  17. The Mechanism of Voltage Dependent Gating of the NaChBac Prokaryotic Sodium Channel

    NASA Astrophysics Data System (ADS)

    Decaen, Paul G.

    Electrical signaling in cells depends on selective conductance of ions through membrane proteins called 'voltage gated ion channels'. These channels are characterized by their ability turn on and off the flow of ionic current by opening and closing their conductive pore in response to changes in membrane potential. The opening and closing of the pore is a mechanically linked to conformational movement of the positively charged fourth transmembrane segment (S4) in 'the voltage sensor' region. How the S4 moves in response to membrane potential is a controversial subject. In this thesis, we used the prokaryotic sodium channel NaChBac as our model sodium channel to study voltage dependent movement of the S4 in the voltage sensor. We use a disulfide-locking method where we introduced pairs of cysteines in the voltage sensor that crosslink and trap the S4 in its path after depolarization. We screened over one hundred mutations of the NaChBac channel in the whole cell patch clamp assay and demonstrated discrete and sequential voltage dependent ion pair interactions that occur in at least three states between the positively charged residues of the S4 segment and the acidic residues in the S1, S2 and S3 segments. In conjunction with structural modeling of the voltage sensor and our disulfide locking data, we propose that the S4 moves in and out of the plane of the membrane 8-13 A, forming distinct gating charge interactions with counter charges of the voltage sensor and adopts a 310 helix over a portion of its structure during activation. These findings are compatible with the sliding helix model and refine our understanding of the structural determinates of voltage sensor function in voltage gated ion channels.

  18. Crystallization and preliminary X-ray crystallographic studies of human voltage-dependent anion channel isoform I (HVDAC1)

    SciTech Connect

    Meins, Thomas; Vonrhein, Clemens; Zeth, Kornelius

    2008-07-01

    The human voltage-dependent anion channel was overproduced in bacteria and refolded with the help of detergents. Extensive screening of crystallization conditions resulted in the first crystals to be obtained of this voltage-dependent anion-channel type. The crystals diffracted to a resolution of 3.6 Å. The major channel by which metabolites can pass through the outer mitochondrial membrane is formed by the voltage-dependent anion-channel (VDAC) family. Functionally, VDAC is involved in the limited exchange of ATP, ADP and small hydrophilic molecules across the outer membrane. Moreover, there is compelling evidence that VDAC isoforms in mammals may act in the cross-talk between mitochondria and the cytoplasm by direct interaction with enzymes involved in energy metabolism and proteins involved in mitochondrial-induced apoptosis. To obtain a high-resolution structure of this channel, human VDAC protein isoform I was overproduced in Escherichia coli. After refolding and testing the correct fold using circular dichroism, a subsequent broad-range screening in different detergents resulted in a variety of crystals which diffracted to 3.5 Å resolution. The crystal lattice belongs to the trigonal space group P321, with unit-cell parameters a = 78.9, c = 165.7 Å and one monomer in the asymmetric unit.

  19. Voltage-dependant anion channels: Novel insights into isoform function through genetic models☆

    PubMed Central

    Raghavan, Adithya; Sheiko, Tatiana; Graham, Brett H.; Craigen, William J.

    2014-01-01

    Voltage-dependant Anion Channels, also known as mitochondrial porins, are pore-forming proteins located in the mitochondrial outer membrane (MOM) that, in addition to forming complexes with other proteins that localize to the MOM, also function as the main conduit for transporting metabolites between the cytoplasm and mitochondria. VDACs are encoded by a multi-member gene family, and the number of isoforms and specific functions of VDACs varies between species. Translating the well-described in vitro characteristics of the VDAC isoforms into in vivo functions has been a challenge, with the generation of animal models of VDAC deficiency providing much of the available information about isoform-specific roles in biology. Here, we review the approaches used to create these insect and mammalian animal models, and the conclusions reached by studying the consequences of loss of function mutations on the genetic, physiologic, and biochemical properties of the resulting models. This article is part of a Special Issue entitled: VDAC structure, function, and regulation of mitochondrial metabolism. PMID:22051019

  20. Voltage-dependent facilitation of Cx46 hemichannels

    PubMed Central

    Yin, ShengYong; Altenberg, Guillermo A.; Reuss, Luis

    2010-01-01

    Gap junction channels are formed by two hemichannels in series (one from each neighboring cell), which are in turn connexin hexamers. Under normal conditions, hemichannels at the plasma membrane are mostly closed but can be opened by changes in membrane voltage, extracellular divalent ion concentration, phosphorylation, pH, and redox potential. Recently, interactions between channels have been found to modulate the activity of several ion channels, including gap junction channels. Here, we studied whether connexin46 (Cx46) hemichannels display such behavior. We studied the response of the Cx46 hemichannels expressed in Xenopus laevis oocytes to consecutive depolarization pulses. Hemichannels formed by wild-type Cx46 and a COOH-terminal domain truncation mutant (Cx46ΔCT) were activated by voltage pulses. When the hemichannels were depolarized repeatedly from −60 mV to +80 mV, the amplitude of the outward and tail currents increased progressively with successive pulses. This phenomenon (“current facilitation”) depended on the amplitude of the depolarization, reaching a maximum at approximately +60 mV in oocytes expressing Cx46, and on the interval between pulses, disappearing with intervals longer than about 20 s. The current facilitation was also present in oocytes expressing Cx46ΔCT, ruling out a primary role of this domain in the facilitation. Nominal removal of divalent cations from the extracellular side caused maximal current activation of Cx46 and Cx46ΔCT hemichannels and prevented facilitation. The results suggest that Cx46 hemichannels show a cooperative activation independent of their COOH-terminal domain. PMID:19889966

  1. A novel mouse mitochondrial voltage-dependent anion channel gene localizes to chromosome 8

    SciTech Connect

    Sampson, M.J.; Lovell, R.S.; Craigen, W.J.; Davison, D.B.

    1996-08-15

    Voltage-dependent anion channels (VDACs) are small pore-forming channels found in the outer membrane of mitochondria. VDACs translocate adenine nucleotides and are the binding sites for several cytosolic kinases important in intermediary metabolism. Recently two human VDAC cDNAs (HVDAC1 and EIVDAC2) were isolated, and possible orthologues of these genes have been isolated from mouse, bovine, and rat tissues. We report the isolation of a novel third VDAC cDNA from the mouse, designated MVDAC3. The deduced MVDAC3 protein is approximately 70% identical to the previously isolated NIVDAC1 and MVDAC2 proteins. The MVDAC3 gene was mapped by an interspecies backcross panel to mouse chromosome 8. A database search using the mouse VDACs identified a second yeast VDAC-like gene that retains about 20% amino acid sequence identity with the mouse VDAC genes and 50% identity with the previously isolated yeast VDAC gene. The phylogenetic relationship of the eukaryotic VDAC genes is presented. 27 refs., 2 figs.

  2. Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel

    PubMed Central

    Nozaki, Tomohiro; Ozawa, Shin-ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

    2016-01-01

    Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD. PMID:27853286

  3. Voltage-dependent anion channels (VDACs) recruit Parkin to defective mitochondria to promote mitochondrial autophagy.

    PubMed

    Sun, Yu; Vashisht, Ajay A; Tchieu, Jason; Wohlschlegel, James A; Dreier, Lars

    2012-11-23

    Parkin is recruited to defective mitochondria to promote degradation by an autophagy mechanism (mitophagy). VDACs specifically interact with Parkin on defective mitochondria and are required for efficient targeting of Parkin to mitochondria and subsequent mitophagy. VDACs recruit Parkin to defective mitochondria. A novel mechanistic aspect of Parkin-dependent mitophagy is proposed that may be relevant to Parkinson disease. Mutations in the ubiquitin ligase Parkin and the serine/threonine kinase PINK1 can cause Parkinson disease. Both proteins function in the elimination of defective mitochondria by autophagy. In this process, activation of PINK1 mediates translocation of Parkin from the cytosol to mitochondria by an unknown mechanism. To better understand how Parkin is targeted to defective mitochondria, we purified affinity-tagged Parkin from mitochondria and identified Parkin-associated proteins by mass spectrometry. The three most abundant interacting proteins were the voltage-dependent anion channels 1, 2, and 3 (VDACs 1, 2, and 3), pore-forming proteins in the outer mitochondrial membrane. We demonstrate that Parkin specifically interacts with VDACs when the function of mitochondria is disrupted by treating cells with the proton uncoupler carbonyl cyanide p-chlorophenylhydrazone. In the absence of all three VDACs, the recruitment of Parkin to defective mitochondria and subsequent mitophagy are impaired. Each VDAC is sufficient to support Parkin recruitment and mitophagy, suggesting that VDACs can function redundantly. We hypothesize that VDACs serve as mitochondrial docking sites to recruit Parkin from the cytosol to defective mitochondria.

  4. Voltage-dependent switching of sensorimotor integration by a lobster central pattern generator.

    PubMed

    Nargeot, Romuald

    2003-06-15

    Behavioral adaptations and the underlying neural plasticity may not simply result from peripheral information conveyed by sensory inputs. Central neuronal networks often spontaneously generate neuronal activity patterns that may also contribute to sensorimotor integration and behavioral adaptations. The present study explored a novel form of sensory-induced plasticity by which the resulting changes in motor output depend essentially on the preexisting functional state of an identified neuron of an endogenously active central network. In the isolated lobster stomatogastric nervous system, electrical stimulation of a mechanosensory nerve transiently inactivated rhythmic spike bursting in the lateral pyloric (LP) neuron of the pyloric motor pattern-generating network. Repeated sensory nerve stimulation gradually and long-lastingly strengthened the bursting of the LP neuron to the detriment of sensory-elicited inactivation. This strengthening of pyloric-timed rhythmic activity was enhanced by experimental depolarization of the neuron. Conversely, when the LP neuron was hyperpolarized, the same sensory stimulation paradigm now gradually increased the susceptibility of the pyloric-timed bursting of the network neuron to sensory-elicited inactivation. Modulation of depolarization-activated and hyperpolarization-activated ionic conductances that underlie the intrinsic bursting properties of the LP neuron may contribute via differential voltage-dependent recruitment and effects to the respective adaptive processes. These data therefore suggest a novel state-dependent mechanism by which an endogenously active central network can decrease or increase its responsiveness to the same sensory input.

  5. pH- and voltage-dependent conductances in toad skin.

    PubMed

    Lacaz-Vieira, F

    1995-11-01

    The present study focuses on two closely related topics on ion conductance in toad skins: (i) the interaction of apical protons with the apical voltage-dependent Cl(-)-activated channels of the mitochondria-rich cells, and (ii) the description and characterization of a novel subject, a voltage-dependent H(+)-activated conductance. The Cl- conductance (GCl) is activated by tissue hyperpolarization (which leads to apical membrane depolarization) and the presence of Cl- ions in the apical solution. Increasing apical proton concentration (from pH 8 to pH 4) impairs the process of activation of the Cl- conductive pathway, slowing the kinetics of It activation and reducing the steady-stage values of Gt and It. This effect is markedly voltage-dependent since no effect is seen at Vt = -100 mv and is fully present at -50 mV. The voltage-dependence of the pH effect suggests that the critical protonation sites of the apical Cl- channels are not freely exposed to the apical solution but dwell within the membrane electric field. An also coherent interpretation is that titration of apical proton binding sites affects the gating of the voltage-dependent Cl- channels, shifting the conductance-vs.-voltage curve to more negative clamping potentials. Tissue conductance in the absence of apical Cl- ions can be importantly affected by the pH of the apical solution (pHa), the effect being markedly dependent on the clamping potential. Generally speaking, the effect of rising apical proton concentration can be conspicuous at negative clamping potentials, while at positive potentials changes in tissue conductance were never observed. For a clamping potential of -100 mV, a turning point somewhere between pHa = 4 and pHa = 3 was observed. Apical acidification to pH 4 has no effect upon tissue conductance while apical acidification to pH 3 leads to a marked, slow and reversible increase of tissue conductance. A striking similitude exists between the voltage-dependent Cl(-)-gated conductance

  6. Voltage-dependent K(+) channels improve the energy efficiency of signalling in blowfly photoreceptors.

    PubMed

    Heras, Francisco J H; Anderson, John; Laughlin, Simon B; Niven, Jeremy E

    2017-04-01

    Voltage-dependent conductances in many spiking neurons are tuned to reduce action potential energy consumption, so improving the energy efficiency of spike coding. However, the contribution of voltage-dependent conductances to the energy efficiency of analogue coding, by graded potentials in dendrites and non-spiking neurons, remains unclear. We investigate the contribution of voltage-dependent conductances to the energy efficiency of analogue coding by modelling blowfly R1-6 photoreceptor membrane. Two voltage-dependent delayed rectifier K(+) conductances (DRs) shape the membrane's voltage response and contribute to light adaptation. They make two types of energy saving. By reducing membrane resistance upon depolarization they convert the cheap, low bandwidth membrane needed in dim light to the expensive high bandwidth membrane needed in bright light. This investment of energy in bandwidth according to functional requirements can halve daily energy consumption. Second, DRs produce negative feedback that reduces membrane impedance and increases bandwidth. This negative feedback allows an active membrane with DRs to consume at least 30% less energy than a passive membrane with the same capacitance and bandwidth. Voltage-dependent conductances in other non-spiking neurons, and in dendrites, might be organized to make similar savings.

  7. On the voltage-dependent Ca2+ block of serotonin 5-HT3 receptors: a critical role of intracellular phosphates

    PubMed Central

    Noam, Yoav; Wadman, Wytse J; van Hooft, Johannes A

    2008-01-01

    Natively expressed serotonin 5-HT3 receptors typically possess a negative-slope conductance region in their I–V curve, due to a voltage-dependent block by external Ca2+ ions. However, in almost all studies performed with heterologously expressed 5-HT3 receptors, this feature was not observed. Here we show that mere addition of ATP to the pipette solution is sufficient to reliably observe a voltage-dependent block in homomeric (h5-HT3A) and heteromeric (h5-HT3AB) receptors expressed in HEK293 cells. A similar block was observed with a plethora of molecules containing a phosphate moiety, thus excluding a role of phosphorylation. A substitution of three arginines in the intracellular vestibule of 5-HT3A with their counterpart residues from the 5-HT3B subunit (RRR-QDA) was previously shown to dramatically increase single channel conductance. We find this mutant to have a linear I–V curve that is unaffected by the presence of ATP, with a fractional Ca2+ current (Pf%) that is reduced (1.8 ± 0.2%) compared to that of the homomeric receptor (4.1 ± 0.2%), and similar to that of the heteromeric form (2.0 ± 0.3%). Moreover, whereas ATP decreased the Pf% of the homomeric receptor, this was not observed with the RRR-QDA mutant. Finally, ATP was found to be critical for voltage-dependent channel block also in hippocampal interneurons that natively express 5-HT3 receptors. Taken together, our results indicate a novel mechanism by which ATP, and similar molecules, modulate 5-HT3 receptors via interactions with the intracellular vestibule of the receptor. PMID:18566001

  8. Modification of the cell based assay for brevetoxins using human cardiac voltage dependent sodium channels expressed in HEK-293 cells.

    PubMed

    Fairey, E R; Bottein Dechraoui, M Y; Sheets, M F; Ramsdell, J S

    2001-09-01

    Assays using living cells provide an effective means to generate activity measurements of toxins, especially in situations where the toxins are part of a complex mixture or in an unfamiliar form such as natural or synthetic derivatives or bioactive metabolites. An important step in the refinement of cell based assays is to simplify the cellular reactions needed or required to generate the functional response of interest. Advances in the engineering of functional responses in cells provide a means to direct the response to given toxins. In this report, we describe the homogeneous high level expression of the initial target for brevetoxin, the voltage dependent sodium channel in human embryonic kidney cells (HEK-293). HEK cells stably transfected with a 6.208 kb cDNA of human heart voltage-dependent Na(+) channel (hH1a) were examined as an alternative to mouse neuroblastoma cells (N2A). The HEK-hH1a cells showed a reduced dependence on cofactors, increased sensitivity to brevetoxin and a useful means to assure absolute selectivity to the sodium channel. We next assessed the assay in a reporter gene format. Expression of a panel of minimal response elements as well as the c-fos promoter failed to provide a response to brevetoxin, indicating that the HEK cells lack a necessary intermediate signaling component. The expression of voltage dependent sodium channels in HEK cells is anticipated to provide enhanced performance for cell-based detection of toxins for drug and natural product discovery, biomonitoring and environmental monitoring.

  9. Voltage-dependent calcium channels from brain incorporated into planar lipid bilayers.

    PubMed

    Nelson, M T; French, R J; Krueger, B K

    Many important physiological processes, including neurotransmitter release and muscle contraction, are regulated by the concentration of Ca2+ ions in the cell. Levels of cytoplasmic Ca2+ can be elevated by the entry of Ca2+ ions through voltage-dependent channels which are selective for Ca2+, Ba2+ and Sr2+ ions. We have measured currents through single, voltage-dependent calcium channels from rat brain that have been incorporated into planar lipid bilayers. Channel gating was voltage-dependent: membrane depolarization increased the channel open times and decreased the closed times. The channels were selective for divalent cations over monovalent ions. The well-known calcium channel blockers, lanthanum and cadmium, produced a concentration-dependent reduction of the apparent single-channel conductance. Contrary to expectations, the nature of the divalent cation carrying current through the channel affected not only the single-channel conductance, but also the channel open times, with mean open times being shortest for barium.

  10. Voltage-Dependent K+-Channel in Protoplasmic Droplets of Chara corallina1

    PubMed Central

    Homblé, Fabrice; Ferrier, Jack M.; Dainty, Jack

    1987-01-01

    Passive transport of potassium through the plasma membrane of a protoplasmic droplet isolated from large internodal cells of Chara corallina Klein ex Willd., em, R.D.W. has been investigated using the patchclamp technique. When the membrane is hyperpolarized the conductance of a single K+-channel is of the order of magnitude of 100 picoSiemens and is reduced by tetraethylammonium chloride. Its open time is voltage dependent. This voltage-dependent K+-channel displays rectifying properties. The channel density is about 0.1 channel per square micrometer of membrane. When the membrane is depolarized the conductance of a single channel is of the order of magnitude of 30 picoSiemens and is insensitive to tetraethylammonium chloride. These results suggest that K+-channels are incorporated in the plasma membrane during membranogenesis of a protoplasmic droplet. They constitute further evidence for the existence of voltage-dependent K+-channels in plant cells. PMID:16665215

  11. Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

    SciTech Connect

    Manipatruni, Sasikanth Nikonov, Dmitri E.; Young, Ian A.

    2014-05-07

    Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects.

  12. Nonequilibrium gating and voltage dependence of the ClC-0 Cl- channel

    PubMed Central

    1996-01-01

    The gating of ClC-0, the voltage-dependent Cl- channel from Torpedo electric organ, is strongly influenced by Cl- ions in the external solution. Raising external Cl- over the range 1-600 mM favors the fast- gating open state and disfavors the slow-gating inactivated state. Analysis of purified single ClC-0 channels reconstituted into planar lipid bilayers was used to identify the role of Cl- ions in the channel's fast voltage-dependent gating process. External, but not internal, Cl- had a major effect on the channel's opening rate constant. The closing rate was more sensitive to internal Cl- than to external Cl-. Both opening and closing rates varied with voltage. A model was derived that postulates (a) that in the channel's closed state, Cl- is accessible to a site located at the outer end of the conduction pore, where it binds in a voltage-independent fashion, (b) that this closed conformation can open, whether liganded by Cl- or not, in a weakly voltage-dependent fashion, (c) that the Cl(-)-liganded closed channel undergoes a conformational change to a different closed state, such that concomitant with this change, Cl- ion moves inward, conferring voltage-dependence to this step, and (d) that this new Cl(-)- liganded closed state opens with a very high rate. According to this picture, Cl- movement within the pre-open channel is the major source of voltage dependence, and charge movement intrinsic to the channel protein contributes very little to voltage-dependent gating of ClC-0. Moreover, since the Cl- activation site is probably located in the ion conduction pathway, the fast gating of ClC-0 is necessarily coupled to ion conduction, a nonequilibrium process. PMID:8894974

  13. Crystal structural characterization reveals novel oligomeric interactions of human voltage-dependent anion channel 1.

    PubMed

    Hosaka, Toshiaki; Okazaki, Masateru; Kimura-Someya, Tomomi; Ishizuka-Katsura, Yoshiko; Ito, Kaori; Yokoyama, Shigeyuki; Dodo, Kosuke; Sodeoka, Mikiko; Shirouzu, Mikako

    2017-09-01

    Voltage-dependent anion channel 1 (VDAC1), which is located in the outer mitochondrial membrane, plays important roles in various cellular processes. For example, oligomerization of VDAC1 is involved in the release of cytochrome c to the cytoplasm, leading to apoptosis. However, it is unknown how VDAC1 oligomerization occurs in the membrane. In the present study, we determined high-resolution crystal structures of oligomeric human VDAC1 (hVDAC1) prepared by using an Escherichia coli cell-free protein synthesis system, which avoided the need for denaturation and refolding of the protein. Broad-range screening using a bicelle crystallization method produced crystals in space groups C222 and P221 21 , which diffracted to a resolution of 3.10 and 3.15 Å, respectively. Each crystal contained two hVDAC1 protomers in the asymmetric unit. Dimer within the asymmetrical unit of the crystal in space group C222 were oriented parallel, whereas those of the crystal in space group P221 21 were oriented anti-parallel. From a model of the crystal in space group C222, which we constructed by using crystal symmetry operators, a heptameric structure with eight patterns of interaction between protomers, including hydrophobic interactions with β-strands, hydrophilic interactions with loop regions, and protein-lipid interactions, was observed. It is possible that by having multiple patterns of interaction, VDAC1 can form homo- or hetero-oligomers not only with other VDAC1 protomers but also with other proteins such as VDAC2, VDAC3 and apoptosis-regulating proteins in the Bcl-2 family. © 2017 The Protein Society.

  14. Voltage-dependent currents in microvillar receptor cells of the frog vomeronasal organ.

    PubMed

    Trotier, D; Døving, K B; Rosin, J F

    1993-08-01

    Vomeronasal receptor cells are differentiated bipolar neurons with a long dendrite bearing numerous microvilli. Isolated cells (with a mean dendritic length of 65 microns) and cells in mucosal slices were studied using whole-cell and Nystatin-perforated patch-clamp recordings. At rest, the membrane potential was -61 +/- 13 mV (mean +/- SD; n = 61). Sixty-four per cent of the cells had a resting potential in the range of -60 to -86 mV, with almost no spontaneous action potential. The input resistance was in the G omega range and overshooting repetitive action potentials were elicited by injecting depolarizing current pulses in the range of 2-10 pA. Voltage-dependent currents were characterized under voltage-clamp conditions. A transient fast inward current activating near -45 mV was blocked by tetrodotoxin. In isolated cells, it was half-deactivated at a membrane potential near -75 mV. An outward K+ current was blocked by internal Cs+ ions or by external tetraethylammonium or Ba2+ ions. A calcium-activated voltage-dependent potassium current was blocked by external Cd2+ ions. A voltage-dependent Ca2+ current was observed in an iso-osmotic BaCl2 solution. Finally, a hyperpolarization-activated inward current was recorded. Voltage-dependent currents in these microvillar olfactory receptor neurons appear qualitatively similar to those already described in ciliated olfactory receptor cells located in the principal olfactory epithelium.

  15. Expression of voltage dependent potassium currents in freshly dissociated rat articular chondrocytes.

    PubMed

    Ponce, Arturo

    2006-01-01

    The electrophysiological properties of voltage dependent potassium channels from freshly dissociated rat articular chondrocytes were studied. The resting membrane potential (-42.7+/-2.0 mV) was significantly depolarized by increasing concentrations of external potassium. No change was observed when external chloride concentration was varied. Addition of TEA, 4AP, alpha-Dendrotoxin and charybdotoxin depolarized resting membrane potential. Whole cell patch clamp studies revealed the presence of outwardly rectifying currents whose kinetic and pharmacological properties suggest the expression of voltage dependent potassium channels. Two kinds of currents were observed under the same experimental conditions. The first one, most frequently observed (80%), starts activating near -50 mV, with V(1/2)=-18 mV, G(max)=0.30 pS/pF. The second kind was observed in only 10% of cases; It activates near -40 mV, with(1/2)=+28.35 mV, G(max)=0.28 pS/pF pA/pF and does not inactivates. Inactivating currents were significantly inhibited by TEA (IC(50)=1.45 mM), 4AP (IC(50)=0.64 mM), CTX (IC(50) = 10 nM), alpha-Dendrotoxin (IC(50) < 100 nM) and Margatoxin (IC(50)=28.5 nM). These results show that rat chondrocytes express voltage dependent potassium currents and suggest a role of voltage-dependent potassium channels in regulating membrane potential of rat chondrocytes.

  16. Eugenol dilates rat cerebral arteries by inhibiting smooth muscle cell voltage-dependent calcium channels.

    PubMed

    Peixoto-Neves, Dieniffer; Leal-Cardoso, Jose Henrique; Jaggar, Jonathan H

    2014-11-01

    Plants high in eugenol, a phenylpropanoid compound, are used as folk medicines to alleviate diseases including hypertension. Eugenol has been demonstrated to relax conduit and ear arteries and reduce systemic blood pressure, but mechanisms involved are unclear. Here, we studied eugenol regulation of resistance-size cerebral arteries that control regional brain blood pressure and flow and investigated mechanisms involved. We demonstrate that eugenol dilates arteries constricted by either pressure or membrane depolarization (60 mM K) in a concentration-dependent manner. Experiments performed using patch-clamp electrophysiology demonstrated that eugenol inhibited voltage-dependent calcium (Ca) currents, when using Ba as a charge carrier, in isolated cerebral artery smooth muscle cells. Eugenol inhibition of voltage-dependent Ca currents involved pore block, a hyperpolarizing shift (∼-10 mV) in voltage-dependent inactivation, an increase in the proportion of steady-state inactivating current, and acceleration of inactivation rate. In summary, our data indicate that eugenol dilates cerebral arteries by means of multimodal inhibition of voltage-dependent Ca channels.

  17. Voltage-dependent gating of NR1/2B NMDA receptors

    PubMed Central

    Clarke, Richard J; Johnson, Jon W

    2008-01-01

    Ligand-gated ion channels are activated by agonist binding, but may also be modulated by membrane voltage. N-Methyl-d-aspartate receptors (NMDARs) exhibit especially strong voltage dependence due to channel block by external Mg2+ (Mgo2+). Here we demonstrate that activity of NMDARs composed of NR1 and NR2B subunits (NR1/2B receptors) is enhanced by depolarization even in 0 Mgo2+, causing slow current relaxations in response to rapid voltage changes. We present a kinetic model of receptor activation that incorporates voltage-dependent gating-associated NR2B subunit conformational changes. The model accurately reproduces current relaxations during depolarizations and subsequent repolarizations in 0 Mgo2+. Model simulations in physiological Mgo2+ concentrations show that voltage-dependent receptor gating also underlies the slow component of Mgo2+ unblock, a phenomenon that previously was shown to influence Mgo2+ unblock kinetics during dendritic spikes. We propose that voltage-dependent gating of NR1/2B receptors confers enhanced voltage and time dependence on NMDAR-mediated signalling. PMID:18936081

  18. Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

    SciTech Connect

    Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe; Clare, Jeffrey J.; Debanne, Dominique; Alcaraz, Gisele

    2011-07-29

    Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

  19. Molecular basis of voltage dependence of connexin channels: an integrative appraisal.

    PubMed

    González, Daniel; Gómez-Hernández, Juan M; Barrio, Luis C

    2007-01-01

    The importance of electrical and molecular signaling through connexin (Cx) channels is now widely recognized. The transfer of ions and other small molecules between adjacent cells is regulated by multiple stimuli, including voltage. Indeed, Cx channels typically exhibit complex voltage sensitivity. Most channels are sensitive to the voltage difference between the cell interiors (or transjunctional voltage, V(j)), while other channels are also sensitive to absolute inside-outside voltage (i.e., the membrane potential, V(m)). The first part of this review is focused on the description of the distinct forms of voltage sensitivity and the gating mechanisms that regulate hemichannel activity, both individually and as components of homotypic and heterotypic gap junctions. We then provide an up to date and precise picture of the molecular and structural aspects of how V(j) and V(m) are sensed, and how they, therefore, control channel opening and closing. Mutagenic strategies coupled with structural, biochemical and electrophysical studies are providing significant insights into how distinct forms of voltage dependence are brought about. The emerging picture indicates that Cx channels can undergo transitions between multiple conductance states driven by distinct voltage-gating mechanisms. Each hemichannel may contain a set of two V(j) gates, one fast and one slow, which mediate the transitions between the main open state to the residual state and to the fully closed state, respectively. Eventually, a V(m) gate regulates channel transitions between the open and closed states. Clusters of charged residues within separate domains of the Cx molecule have been identified as integral parts of the V(j) and V(m) sensors. The charges at the first positions of the amino terminal cytoplasmic domain determine the magnitude and polarity of the sensitivity to fast V(j)-gating, as well as contributing to the V(j)-rectifying properties of ion permeation. Additionally, important advances

  20. Barbiturates increase the rate of voltage-dependent inactivation of the calcium current in snail neurones.

    PubMed Central

    Nishi, K.; Oyama, Y.

    1983-01-01

    Effects of barbiturates (thiopentone, pentobarbitone, phenobarbitone and barbitone) on the calcium current (ICa) in identified Helix neurones were studied, using a conventional suction pipette technique. Barbiturates depressed the maximal peak amplitudes (MPA) of ICa in a dose-dependent manner without shifting the current-voltage relationships along the voltage axis. Barbiturates accelerated the decay phase of ICa at high concentrations (1 X 10(-4) to 3 X 10(-3) M), at which concentrations double-pulse experiments showed the increased rate of a voltage-dependent inactivation of ICa. It is concluded that the acceleration of the decay phase of ICa by barbiturates may be due to the increased rate of the voltage-dependent inactivation of ICa. PMID:6100847

  1. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

    NASA Astrophysics Data System (ADS)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

    1988-08-01

    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  2. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

    PubMed Central

    White, William E.

    2013-01-01

    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  3. Voltage-dependent calcium-permeable channels in the plasma membrane of a higher plant cell.

    PubMed Central

    Thuleau, P; Ward, J M; Ranjeva, R; Schroeder, J I

    1994-01-01

    Numerous biological assays and pharmacological studies on various higher plant tissues have led to the suggestion that voltage-dependent plasma membrane Ca2+ channels play prominent roles in initiating signal transduction processes during plant growth and development. However, to date no direct evidence has been obtained for the existence of such depolarization-activated Ca2+ channels in the plasma membrane of higher plant cells. Carrot suspension cells (Daucus carota L.) provide a well-suited system to determine whether voltage-dependent Ca2+ channels are present in the plasma membrane of higher plants and to characterize the properties of putative Ca2+ channels. It is known that both depolarization, caused by raising extracellular K+, and exposure to fungal toxins or oligogalacturonides induce Ca2+ influx into carrot cells. By direct application of patch-clamp techniques to isolated carrot protoplasts, we show here that depolarization of the plasma membrane positive to -135 mV activates Ca(2+)-permeable channels. These voltage-dependent ion channels were more permeable to Ca2+ than K+, while displaying large permeabilities to Ba2+ and Mg2+ ions. Ca(2+)-permeable channels showed slow and reversible inactivation. The single-channel conductance was 13 pS in 40 mM CaCl2. These data provide direct evidence for the existence of voltage-dependent Ca2+ channels in the plasma membrane of a higher plant cell and point to physiological mechanisms for plant Ca2+ channel regulation. The depolarization-activated Ca(2+)-permeable channels identified here could constitute a regulated pathway for Ca2+ influx in response to physiologically occurring stimulus-induced depolarizations in higher plant cells. PMID:8039493

  4. The voltage-dependent proton pumping in bacteriorhodopsin is characterized by optoelectric behavior.

    PubMed

    Geibel, S; Friedrich, T; Ormos, P; Wood, P G; Nagel, G; Bamberg, E

    2001-10-01

    The light-driven proton pump bacteriorhodopsin (bR) was functionally expressed in Xenopus laevis oocytes and in HEK-293 cells. The latter expression system allowed high time resolution of light-induced current signals. A detailed voltage clamp and patch clamp study was performed to investigate the DeltapH versus Deltapsi dependence of the pump current. The following results were obtained. The current voltage behavior of bR is linear in the measurable range between -160 mV and +60 mV. The pH dependence is less than expected from thermodynamic principles, i.e., one DeltapH unit produces a shift of the apparent reversal potential of 34 mV (and not 58 mV). The M(2)-BR decay shows a significant voltage dependence with time constants changing from 20 ms at +60 mV to 80 ms at -160 mV. The linear I-V curve can be reconstructed by this behavior. However, the slope of the decay rate shows a weaker voltage dependence than the stationary photocurrent, indicating that an additional process must be involved in the voltage dependence of the pump. A slowly decaying M intermediate (decay time > 100 ms) could already be detected at zero voltage by electrical and spectroscopic means. In effect, bR shows optoelectric behavior. The long-lived M can be transferred into the active photocycle by depolarizing voltage pulses. This is experimentally demonstrated by a distinct charge displacement. From the results we conclude that the transport cycle of bR branches via a long-lived M(1)* in a voltage-dependent manner into a nontransporting cycle, where the proton release and uptake occur on the extracellular side.

  5. A comparative study of the action of tolperisone on seven different voltage dependent sodium channel isoforms.

    PubMed

    Hofer, Doris; Lohberger, Birgit; Steinecker, Bibiane; Schmidt, Kurt; Quasthoff, Stefan; Schreibmayer, Wolfgang

    2006-05-24

    The specific, acute interaction of tolperisone, an agent used as a muscle relaxant and for the treatment of chronic pain conditions, with the Na(v1.2), Na(v1.3), Na(v1.4), Na(v1.5), Na(v1.6), Na(v1.7), and Na(v1.8) isoforms of voltage dependent sodium channels was investigated and compared to that of lidocaine. Voltage dependent sodium channels were expressed in the Xenopus laevis oocyte expression system and sodium currents were recorded with the two electrode voltage clamp technique. Cumulative dose response relations revealed marked differences in IC(50) values between the two drugs on identical isoforms, as well as between isoforms. A detailed kinetic analysis uncovered that tolperisone as well as lidocaine exhibited their blocking action not only via state dependent association/dissociation with voltage dependent sodium channels, but a considerable fraction of inhibition is tonic, i.e. permanent and basic in nature. Voltage dependent activation was affected to a minor extent only. A shift in steady-state inactivation to more negative potentials could be observed for most drug/isoform combinations. The contribution of this shift to overall block was, however, small at drug concentrations resulting in considerable overall block. Recovery from inactivation was affected notably by both drugs. Lidocaine application led to a pronounced prolongation of the time constant of the fast recovery process for the Na(v1.3), Na(v1.5), and Na(v1.7) isoforms, indicating common structural properties in the local anesthetic receptor site of these three proteins. Interestingly, this characteristic drug action was not observed for tolperisone.

  6. Proper Voltage-Dependent Ion Channel Function in Dysferlin-Deficient Cardiomyocytes.

    PubMed

    Rubi, Lena; Gawali, Vaibhavkumar S; Kubista, Helmut; Todt, Hannes; Hilber, Karlheinz; Koenig, Xaver

    2015-01-01

    Dysferlin plays a decisive role in calcium-dependent membrane repair in myocytes. Mutations in the encoding DYSF gene cause a number of myopathies, e.g. limb-girdle muscular dystrophy type 2B (LGMD2B). Besides skeletal muscle degenerative processes, dysferlin deficiency is also associated with cardiac complications. Thus, both LGMD2B patients and dysferlin-deficient mice develop a dilated cardiomyopathy. We and others have recently reported that dystrophin-deficient ventricular cardiomyocytes from mouse models of Duchenne muscular dystrophy show significant abnormalities in voltage-dependent ion channels, which may contribute to the pathophysiology in dystrophic cardiomyopathy. The aim of the present study was to investigate if dysferlin, like dystrophin, is a regulator of cardiac ion channels. By using the whole cell patch-clamp technique, we compared the properties of voltage-dependent calcium and sodium channels, as well as action potentials in ventricular cardiomyocytes isolated from the hearts of normal and dysferlin-deficient (dysf) mice. In contrast to dystrophin deficiency, the lack of dysferlin did not impair the ion channel properties and left action potential parameters unaltered. In connection with normal ECGs in dysf mice these results suggest that dysferlin deficiency does not perturb cardiac electrophysiology. Our study demonstrates that dysferlin does not regulate cardiac voltage-dependent ion channels, and implies that abnormalities in cardiac ion channels are not a universal characteristic of all muscular dystrophy types. © 2015 S. Karger AG, Basel.

  7. Endocytic regulation of voltage-dependent potassium channels in the heart.

    PubMed

    Ishii, Kuniaki; Norota, Ikuo; Obara, Yutaro

    2012-01-01

    Understanding the regulation of cardiac ion channels is critical for the prevention of arrhythmia caused by abnormal excitability. Ion channels can be regulated by a change in function (qualitative) and a change in number (quantitative). Functional changes have been extensively investigated for many ion channels including cardiac voltage-dependent potassium channels. By contrast, the regulation of ion channel numbers has not been widely examined, particularly with respect to acute modulation of ion channels. This article briefly summarizes stimulus-induced endocytic regulation of major voltage-dependent potassium channels in the heart. The stimuli known to cause their endocytosis include receptor activation, drugs, and low extracellular [K(+)], following which the potassium channels undergo either clathrin-mediated or caveolin-mediated endocytosis. Receptor-mediated endocytic regulation has been demonstrated for Kv1.2, Kv1.5, KCNQ1 (Kv7.1), and Kv4.3, while drug-induced endocytosis has been demonstrated for Kv1.5 and hERG. Low [K(+)](o)-induced endocytosis might be unique for hERG channels, whose electrophysiological characteristics are known to be under strong influence of [K(+)](o). Although the precise mechanisms have not been elucidated, it is obvious that major cardiac voltage-dependent potassium channels are modulated by endocytosis, which leads to changes in cardiac excitability.

  8. Voltage-dependent calcium channels from brain incorporated into planar lipid bilayers

    NASA Astrophysics Data System (ADS)

    Nelson, Mark T.; French, Robert J.; Krueger, Bruce K.

    1984-03-01

    Many important physiological processes, including neurotransmitter release and muscle contraction1-3, are regulated by the concentration of Ca2+ ions in the cell. Levels of cytoplasmic Ca2+ can be elevated by the entry of Ca2+ ions through voltage-dependent channels which are selective for Ca2+, Ba2+ and Sr2+ ions4-14. We have measured currents through single, voltage-dependent calcium channels from rat brain that have been incorporated into planar lipid bilayers. Channel gating was voltage-dependent: membrane depolarization increased the channel open times and decreased the closed times. The channels were selective for divalent cations over monovalent ions. The well-known calcium channel blockers, lanthanum and cadmium, produced a concentration-dependent reduction of the apparent single-channel conductance. Contrary to expectations14, the nature of the divalent cation carrying current through the channel affected not only the single-channel conductance, but also the channel open times, with mean open times being shortest for barium.

  9. Voltage dependence of Na translocation by the Na/K pump.

    PubMed

    Nakao, M; Gadsby, D C

    During each complete reaction cycle, the Na/K pump transports three Na ions out across the cell membrane and two K ions in. The resulting net extrusion of positive charge generates outward membrane current but, until now, it was unclear how that net charge movement occurs. Reasonable possibilities included a single positive charge moving outwards during Na translocation; or a single negative charge moving inwards during K translocation; or either positive or negative charges moving during both translocation steps, but in unequal quantities. Any step that involves net charge movement through the membrane must have voltage-dependent transition rates. Here we report measurements of transient, voltage-dependent, displacement currents generated by the pump when its normal Na/K transport cycle has been interrupted by removal of external K and it is thus constrained to carry out Na/Na exchange. The quantity and voltage sensitivity of the charge moved during these transient currents suggests that Na translocation includes a voltage-dependent transition involving movement of one positive charge across the membrane. This single step can thus fully account for the electrogenic nature of Na/K exchange. The result provides important new insight into the molecular mechanism of active cation transport.

  10. Hypotonicity activates a voltage-dependent membrane conductance in N2a neuroblastoma cells.

    PubMed

    Taruno, Akiyuki; Marunaka, Yoshinori

    2017-03-04

    To maintain cellular and bodily homeostasis, cells respond to extracellular stimuli including osmotic stress by activating various ion channels, which have been implicated in many physiological and pathophysiological conditions. However, cellular osmosensory mechanisms remain elusive. Here, we report a novel voltage-dependent current in N2a cells activated by exposure to hypotonic stress. After a hypotonic challenge, N2a cells sequentially develop two distinct currents. The volume-regulated anion channel (VRAC) current emerges first and, after a delay, activation of a previously uncharacterized strongly outwardly rectifying current follows. The latter, delayed current (Id) is insensitive to NPPB, a nonspecific blocker of Cl(-) channels, and intracellular Mg(2+), which inhibits VRAC and swelling-activated TRPM3 and TRPM7 channels. Replacement of extracellular Na(+) with NMDG(+) reduces inward tail currents, suggesting that Id is mediated by cations. Finally, Id shows voltage-dependent activation with slow activation kinetics and half-maximal activation at +76 mV. These pharmacological and biophysical characteristics of Id are distinct from those of known osmotic cell swelling-activated ion channels. In conclusion, our data identify and characterize a novel osmotically-activated, voltage-dependent ion channel in N2a cells.

  11. Development of voltage-dependent calcium, sodium, and potassium currents in Xenopus spinal neurons.

    PubMed

    O'Dowd, D K; Ribera, A B; Spitzer, N C

    1988-03-01

    Action potentials of embryonic nerve and muscle cells often have a different ionic dependence and longer duration than those of mature cells. The action potential of spinal cord neurons from Xenopus laevis exhibits a prominent calcium component at early stages of development that diminishes with age as the impulse becomes principally sodium dependent. Whole-cell voltage-clamp analysis has been undertaken to characterize the changes in membrane currents during development of these neurons in culture. Four voltage-dependent currents of cells were identified and examined during the first day in vitro, when most of the change in the action potential occurs. There are no changes in the peak density of the calcium current (ICa), its voltage dependence, or time to half-maximal activation; a small increase in inactivation is apparent. The major change in sodium current (INa) is a 2-fold increase in its density. In addition, more subtle changes in the kinetics of the macroscopic sodium current were noted. The peak density of voltage-dependent potassium current (IKv) increases 3-fold, and this current becomes activated almost twice as fast. No changes were noted in the extent of its inactivation. The calcium-dependent potassium current (IKc) consists of an inactivating and a sustained component. The former increases 2-fold in peak current density, and the latter increases similarly at less depolarized voltages. The changes in these currents contribute to the decrease in duration and the change in ionic dependence of the impulse.

  12. Beta-scorpion toxin effects suggest electrostatic interactions in domain II of voltage-dependent sodium channels.

    PubMed

    Mantegazza, Massimo; Cestèle, Sandrine

    2005-10-01

    Beta-scorpion toxins specifically modulate the voltage dependence of sodium channel activation by acting through a voltage-sensor trapping model. We used mutagenesis, functional analysis and the action of beta-toxin as tools to investigate the existence and role in channel activation of molecular interactions between the charged residues of the S2, S3 and S4 segments in domain II of sodium channels. Mutating to arginine the acidic residues of the S2 and S3 transmembrane segments in domain II, or making charge-reversal mutation of the two outermost gating charges of the IIS4 voltage sensor, shifts the voltage dependence of channel activation to more positive potentials and enhances the effect of beta-scorpion toxin. Thus, mutations of acidic residues in IIS2 and IIS3 segments are able to promote voltage-sensor trapping in a way that is similar to the mutations of the arginines in the IIS4 segment. In order to disclose the network of interactions among acidic and basic residues we performed functional analysis of charge-inversion double mutants: our data suggest that the first arginine of the voltage sensor S4 in domain II (R850) interacts specifically with E805, D814 and E821 in the S2 and S3 segments, whereas the second arginine (R853) only interacts with D827 in the S3 segment. Our results suggest that the S2, S3 and S4 segments in domain II form a voltage-sensing structure, and that molecular interactions between the charged residues of this structure modulate the availability of the IIS4 voltage sensor for trapping by beta-toxins. They also provide unique insights into the molecular events that occur during channel activation, as well as into the structure of the channel.

  13. Voltage dependence of Hodgkin-Huxley rate functions for a multistage K^{+} channel voltage sensor within a membrane.

    PubMed

    Vaccaro, S R

    2014-11-01

    The activation of a K^{+} channel sensor in two sequential stages during a voltage clamp may be described as the translocation of a Brownian particle in an energy landscape with two large barriers between states. A solution of the Smoluchowski equation for a square-well approximation to the potential function of the S4 voltage sensor satisfies a master equation and has two frequencies that may be determined from the forward and backward rate functions. When the higher-frequency terms have small amplitude, the solution reduces to the relaxation of a rate equation, where the derived two-state rate functions are dependent on the relative magnitude of the forward rates (α and γ) and the backward rates (β and δ) for each stage. In particular, the voltage dependence of the Hodgkin-Huxley rate functions for a K^{+} channel may be derived by assuming that the rate functions of the first stage are large relative to those of the second stage-α≫γ and β≫δ. For a Shaker IR K^{+} channel, the first forward and backward transitions are rate limiting (α<γ and δ≪β), and for an activation process with either two or three stages, the derived two-state rate functions also have a voltage dependence that is of a similar form to that determined for the squid axon. The potential variation generated by the interaction between a two-stage K^{+} ion channel and a noninactivating Na^{+} ion channel is determined by the master equation for K^{+} channel activation and the ionic current equation when the Na^{+} channel activation time is small, and if β≪δ and α≪γ, the system may exhibit a small amplitude oscillation between spikes, or mixed-mode oscillation, in which the slow closed state modulates the K^{+} ion channel conductance in the membrane.

  14. Voltage dependence of Hodgkin-Huxley rate functions for a multistage K+ channel voltage sensor within a membrane

    NASA Astrophysics Data System (ADS)

    Vaccaro, S. R.

    2014-11-01

    The activation of a K+channel sensor in two sequential stages during a voltage clamp may be described as the translocation of a Brownian particle in an energy landscape with two large barriers between states. A solution of the Smoluchowski equation for a square-well approximation to the potential function of the S4 voltage sensor satisfies a master equation and has two frequencies that may be determined from the forward and backward rate functions. When the higher-frequency terms have small amplitude, the solution reduces to the relaxation of a rate equation, where the derived two-state rate functions are dependent on the relative magnitude of the forward rates (α and γ ) and the backward rates (β and δ ) for each stage. In particular, the voltage dependence of the Hodgkin-Huxley rate functions for a K+channel may be derived by assuming that the rate functions of the first stage are large relative to those of the second stage—α ≫γ and β ≫δ . For a Shaker IR K+ channel, the first forward and backward transitions are rate limiting (α <γ and δ ≪β ), and for an activation process with either two or three stages, the derived two-state rate functions also have a voltage dependence that is of a similar form to that determined for the squid axon. The potential variation generated by the interaction between a two-stage K+ ion channel and a noninactivating Na+ ion channel is determined by the master equation for K+channel activation and the ionic current equation when the Na+channel activation time is small, and if β ≪δ and α ≪γ , the system may exhibit a small amplitude oscillation between spikes, or mixed-mode oscillation, in which the slow closed state modulates the K+ ion channel conductance in the membrane.

  15. Voltage dependence of the Ca(2+)-activated K(+) channel K(Ca)3.1 in human erythroleukemia cells.

    PubMed

    Stoneking, Colin J; Shivakumar, Oshini; Thomas, David Nicholson; Colledge, William H; Mason, Michael J

    2013-05-01

    We have isolated a K(+)-selective, Ca(2+)-dependent whole cell current and single-channel correlate in the human erythroleukemia (HEL) cell line. The whole cell current was inhibited by the intermediate-conductance KCa3.1 inhibitors clotrimazole, TRAM-34, and charybdotoxin, unaffected by the small-conductance KCa2 family inhibitor apamin and the large-conductance KCa1.1 inhibitors paxilline and iberiotoxin, and augmented by NS309. The single-channel correlate of the whole cell current was blocked by TRAM-34 and clotrimazole, insensitive to paxilline, and augmented by NS309 and had a single-channel conductance in physiological K(+) gradients of ~9 pS. RT-PCR revealed that the KCa3.1 gene, but not the KCa1.1 gene, was expressed in HEL cells. The KCa3.1 current, isolated in HEL cells under whole cell patch-clamp conditions, displayed an activated current component during depolarizing voltage steps from hyperpolarized holding potentials and tail currents upon repolarization, consistent with voltage-dependent modulation. This activated current increased with increasing voltage steps above -40 mV and was sensitive to inhibition by clotrimazole, TRAM-34, and charybdotoxin and insensitive to apamin, paxilline, and iberiotoxin. In single-channel experiments, depolarization resulted in an increase in open channel probability (Po) of KCa3.1, with no increase in channel number. The voltage modulation of Po was an increasing monotonic function of voltage. In the absence of elevated Ca(2+), voltage was ineffective at inducing channel activity in whole cell and single-channel experiments. These data indicate that KCa3.1 in HEL cells displays a unique form of voltage dependence modulating Po.

  16. β-Scorpion toxin effects suggest electrostatic interactions in domain II of voltage-dependent sodium channels

    PubMed Central

    Mantegazza, Massimo; Cestèle, Sandrine

    2005-01-01

    β-Scorpion toxins specifically modulate the voltage dependence of sodium channel activation by acting through a voltage-sensor trapping model. We used mutagenesis, functional analysis and the action of β-toxin as tools to investigate the existence and role in channel activation of molecular interactions between the charged residues of the S2, S3 and S4 segments in domain II of sodium channels. Mutating to arginine the acidic residues of the S2 and S3 transmembrane segments in domain II, or making charge-reversal mutation of the two outermost gating charges of the IIS4 voltage sensor, shifts the voltage dependence of channel activation to more positive potentials and enhances the effect of β-scorpion toxin. Thus, mutations of acidic residues in IIS2 and IIS3 segments are able to promote voltage-sensor trapping in a way that is similar to the mutations of the arginines in the IIS4 segment. In order to disclose the network of interactions among acidic and basic residues we performed functional analysis of charge-inversion double mutants: our data suggest that the first arginine of the voltage sensor S4 in domain II (R850) interacts specifically with E805, D814 and E821 in the S2 and S3 segments, whereas the second arginine (R853) only interacts with D827 in the S3 segment. Our results suggest that the S2, S3 and S4 segments in domain II form a voltage-sensing structure, and that molecular interactions between the charged residues of this structure modulate the availability of the IIS4 voltage sensor for trapping by β-toxins. They also provide unique insights into the molecular events that occur during channel activation, as well as into the structure of the channel. PMID:16020455

  17. Characterisation of Kupffer cells in some Amphibia

    PubMed Central

    CORSARO, CONCETTA; SCALIA, MARINA; LEOTTA, NICOLA; MONDIO, FILIPPO; SICHEL, GIOVANNI

    2000-01-01

    A study on the Kupffer cells (KCs) of Amphibia was undertaken in order to compare these cells with those of endothermic animals. Liver tissue and isolated and cultured KCs were studied by light microscopy and by transmission and scanning electron microscopy. We have shown that amphibian KCs can be divided into 2 principal types: ‘small’ and ‘large’. Both cell types possess the distinctive KC morphology. They show nonspecific esterase activity, weak endogenous peroxidase activity in the nuclear envelope and in the rough endoplasmic reticulum, and the ability to engulf naturally present cell debris or experimentally administered zymosan or latex particles. The principal difference between the small and the large cells consists in the substantial quantity of inclusion bodies that exist only in the latter. We conclude that amphibian KCs, apart from their ability to build melanosomes and synthesise melanins, are very similar to mammalian KCs. PMID:10739021

  18. The voltage-dependent step of the chloride transporter of Valonia utricularis encounters a Nernst-Planck and not an Eyring type of potential energy barrier

    PubMed Central

    Wang, Jianning; Zimmermann, Ulrich; Benz, Roland

    1993-01-01

    Voltage-clamp experiments were performed on cells of the giant marine alga Valonia utricularis to study the voltage dependence of the previously postulated chloride transporter (Wang, J., G. Wehner, R. Benz, and U. Zimmermann. 1991. Biophys. J. 59:235-248). Only one exponential current relaxation (apart from the capacitive spike) could be resolved up to a clamp voltage of ∼120 mV within the time resolution of our experimental instrumentation (100 μs). This means that the rate constants of the heterogeneous complexation, kR (association) and kD (dissociation), were too fast to be resolved. Therefore, the “Läuger” model for carrier-mediated ion transport with equilibrium heterogeneous surface reaction was used to fit the experimental results. The voltage dependence of the initial membrane conductance was used for the evaluation of the voltage dependence of the translocation rate constant of the complexed carriers, kAS. The initial conductance was found to be independent on the clamp voltage, which means that the translocation rate constant kAS is a linear function of the applied voltage and that the voltage dependence of the translocation of charged carriers through the plasmalemma could be explained by a square-type Nernst-Planck barrier. The movement of the complexed form of the carrier through the membrane may be explained by a diffusion process rather than by simple first-order kinetic jump across an Eyring-type potential well. The current relaxation after a voltage clamp was studied as a function of the external chloride concentration. The results allowed an estimation of the stability constant, K, of the heterogeneous complexation reaction and a calculation of the translocation rate constants of the free and the complexed carriers, ks and kAS, respectively. PMID:19431881

  19. Effect of fluoxetine on a neuronal, voltage-dependent potassium channel (Kv1.1)

    PubMed Central

    Tytgat, J; Maertens, Ch; Daenens, P

    1997-01-01

    Fluoxetine (Prozac) is widely used as an antidepressant drug and is assumed to be a selective 5-hydroxytryptamine (5-HT) reuptake inhibitor (SSRI). Claims that its beneficial psychotropic effects extend beyond those in treatment of depression have drawn clinical and popular attention to this compound, raising the question of whether there is anything exceptional about the supposed selective actions.We have used the voltage clamp technique to study the effect of fluoxetine on a neuronal, voltage-dependent potassium (K+) channel (RCK1; Kv1.1), expressed in Xenopus laevis oocytes. This channel subunit is abundantly expressed in the central nervous system and K+ channels containing this subunit are involved in the repolarization process of many types of neurones.Blockade of the K+ currents by fluoxetine was found to be use- and dose-dependent. Wash-out of this compound could not be achieved. Fluoxetine did not affect the ion selectivity of this K+ channel, as the reversal potential was unaltered.Slowing of both activation and deactivation kinetics of the channel by fluoxetine was observed, including tail current crossover upon repolarization.Hodgkin-Huxley type of models and more generalized Markov chain models were used to fit the kinetics of the data. Based upon a Markov kinetic scheme, our data can be interpreted to mean that blockade of fluoxetine consists of two components: a voltage-independent occurring in the last closed, but available state of the channel, and a voltage-dependent occurring in the open state.This study describes the first biophysical working model for the mechanism of action of fluoxetine on a neuronal, voltage-dependent K+ channel, RCK1. Although this channel is not very potently blocked by fluoxetine when expressed in oocytes, this study may help us to understand some of the clinical symptoms seen with elevated serum concentrations of this SSRI. PMID:9421290

  20. Effect of fluoxetine on a neuronal, voltage-dependent potassium channel (Kv1.1).

    PubMed

    Tytgat, J; Maertens, C; Daenens, P

    1997-12-01

    1. Fluoxetine (Prozac) is widely used as an antidepressant drug and is assumed to be a selective 5-hydroxytryptamine (5-HT) reuptake inhibitor (SSRI). Claims that its beneficial psychotropic effects extend beyond those in treatment of depression have drawn clinical and popular attention to this compound, raising the question of whether there is anything exceptional about the supposed selective actions. 2. We have used the voltage clamp technique to study the effect of fluoxetine on a neuronal, voltage-dependent potassium (K+) channel (RCK1; Kv1.1), expressed in p6nopus laevis oocytes. This channel subunit is abundantly expressed in the central nervous system and K+ channels containing this subunit are involved in the repolarization process of many types of neurones. 3. Blockade of the K+ currents by fluoxetine was found to be use- and dose-dependent. Wash-out of this compound could not be achieved. Fluoxetine did not affect the ion selectivity of this K+ channel, as the reversal potential was unaltered. 4. Slowing of both activation and deactivation kinetics of the channel by fluoxetine was observed, including tail current crossover upon repolarization. 5. Hodgkin-Huxley type of models and more generalized Markov chain models were used to fit the kinetics of the data. Based upon a Markov kinetic scheme, our data can be interpreted to mean that blockade of fluoxetine consists of two components: a voltage-independent occurring in the last closed, but available state of the channel, and a voltage-dependent occurring in the open state. 6. This study describes the first biophysical working model for the mechanism of action of fluoxetine on a neuronal, voltage-dependent K+ channel, RCK1. Although this channel is not very potently blocked by fluoxetine when expressed in oocytes, this study may help us to understand some of the clinical symptoms seen with elevated serum concentrations of this SSRI.

  1. Voltage-dependent metabolic regulation of Kv2.1 channels in pancreatic beta-cells.

    PubMed

    Yoshida, Masashi; Nakata, Masanori; Yamato, Shiho; Dezaki, Katsuya; Sugawara, Hitoshi; Ishikawa, San-e; Kawakami, Masanobu; Yada, Toshihiko; Kakei, Masafumi

    2010-05-28

    Voltage-gated potassium channels (Kv channels) play a crucial role in formation of action potentials in response to glucose stimulation in pancreatic beta-ells. We previously reported that the Kv channel is regulated by glucose metabolism, particularly by MgATP. We examined whether the regulation of Kv channels is voltage-dependent and mechanistically related with phosphorylation of the channels. In rat pancreatic beta-cells, suppression of glucose metabolism with low glucose concentrations of 2.8mM or less or by metabolic inhibitors decreased the Kv2.1-channel activity at positive membrane potentials, while increased it at potentials negative to -10 mV, suggesting that modulation of Kv channels by glucose metabolism is voltage-dependent. Similarly, in HEK293 cells expressing the recombinant Kv2.1 channels, 0mM but not 10mM MgATP modulated the channel activity in a manner similar to that in beta-cells. Both steady-state activation and inactivation kinetics of the channel were shifted toward the negative potential in association with the voltage-dependent modulation of the channels by cytosolic dialysis of alkaline phosphatase in beta-cells. The modulation of Kv-channel current-voltage relations were also observed during and after glucose-stimulated electrical excitation. These results suggest that the cellular metabolism including MgATP production and/or channel phosphorylation/dephosphorylation underlie the physiological modulation of Kv2.1 channels during glucose-induced insulin secretion.

  2. Novel expression and regulation of voltage-dependent potassium channels in placentas from women with preeclampsia.

    PubMed

    Mistry, Hiten D; McCallum, Laura A; Kurlak, Lesia O; Greenwood, Iain A; Broughton Pipkin, Fiona; Tribe, Rachel M

    2011-09-01

    Preeclampsia is associated with structural/functional alterations in placental and maternal vasculature. Voltage-dependant potassium channels encoded by KCNQ1-5 genes have been detected in several types of blood vessels where they promote vascular relaxation. Voltage-dependant potassium channel function can be modulated by KCNE1-5-encoded accessory proteins. The aim of this study was to determine whether KCNQ and KCNE genes are differentially expressed in placentas from women with preeclampsia compared with normotensive controls and to examine any differences in those who delivered preterm (<37 weeks) or term. Placental biopsies (from midway between the cord and periphery) were obtained, with consent, from white European control (n=24; term) and preeclamptic (n=22; of whom 8 delivered before 37 weeks' gestation) women. KCNQ/KCNE and GAPDH mRNA expressions were determined by quantitative RT-PCR. Protein expression/localization was assessed using immunohistochemistry. KCNQ3 and KCNE5 mRNA expressions were significantly upregulated in preeclampsia (median [interquartile range]: 1.942 [0.905 to 3.379]) versus controls (0.159 [0.088 to 0.288]; P=0.001) and exhibited a strong positive correlation with each other (P<0.001), suggesting a novel heterodimer. Enhanced protein expression of KCNQ3 and KCNE5 in preeclampsia was confirmed with localization mainly restricted to the syncytiotrophoblast. KCNQ4 and KCNE1 isoforms were suppressed in placentas from term preeclamptic women versus controls (P≤0.05). KCNQ1 mRNA expression was increased and KCNQ5 decreased in the preterm preeclamptic group versus controls (P<0.05). In summary, voltage-dependant potassium channels are expressed and markedly modulated in placentas from preeclamptic women. Differential expression of isoforms may lead to altered cell proliferation. The correlation between KCNQ3 and KCNE5 expression is indicative of a novel channel complex and warrants further investigation.

  3. Admittance Spectroscopy in CZTSSe: Metastability Behavior and Voltage Dependent Defect Study

    SciTech Connect

    Koeper, Mark J.; Hages, Charles J.; Li, Jian V.; Levi, Dean; Agrawal, Rakesh

    2016-11-21

    Admittance spectroscopy has been performed on a CZTSSe device with a carrier injection pretreatment and under electronically relaxed conditions to demonstrate metastability behavior. We show that the measurements with the carrier injection pretreatment demonstrate two admittance signatures while the relaxed measurement demonstrates only one admittance signature with a different activation energy. Additionally, voltage dependent admittance spectroscopy was performed using the carrier injection pretreatment method at each of the applied voltage bias. The activation energies of the two admittance signatures were calculated and are shown to be independent of the voltage bias.

  4. Voltage-dependent gating mechanism for single fast chloride channels from rat skeletal muscle.

    PubMed Central

    Weiss, D S; Magleby, K L

    1992-01-01

    1. A voltage-dependent gating mechanism for the fast Cl- channel was developed from the analysis of single-channel current records obtained with the patch clamp technique from primary cultures of rat skeletal muscle. Up to 10(6) open and shut intervals were analysed from each of five different excised patches of membrane containing a single fast Cl- channel. 2. Rate constants for a kinetic scheme with six closed and two open states (scheme I) were estimated at a given voltage by maximum likelihood fitting of open and closed dwell-time distributions obtained at that voltage. This procedure was then repeated for data obtained at each of three to eight different membrane potentials for each channel. 3. Plots of the estimated rate constants against membrane potential typically appeared linear on semilogarithmic co-ordinates, consistent with rate constants that are exponentially dependent on voltage. 4. Regression analysis of these plots yielded two parameters for each rate constant: the value of the rate constant at -50 mV (B) and its voltage sensitivity (A). The dwell-time distributions predicted with these parameters and scheme I gave a good description of the experimental dwell-time distributions at all the studied voltages, lending further support for an exponential dependence of rate constants on membrane potential. 5. Estimates of A and B were also obtained by simultaneously fitting dwell-time distributions obtained at three to eight different voltages, in order to better define these parameters. Predicted dwell-time distributions obtained with these estimates and scheme I could approach the theoretical best description of the data for discrete-state Markov models. 6. Eight to twelve of the fourteen rate constants in scheme I appeared voltage sensitive, with effective gating charges ranging from about -1.5 to +1.0 units of electronic charge. 7. The estimated rate constants and their voltage sensitivities for the five analysed channels were generally similar, but

  5. Eag1 Voltage-Dependent Potassium Channels: Structure, Electrophysiological Characteristics, and Function in Cancer.

    PubMed

    Wang, Xuzhao; Chen, Yafei; Zhang, Yuhong; Guo, Shuai; Mo, Li; An, Hailong; Zhan, Yong

    2017-02-03

    Eag1 (ether-à-go-go-1), a member of the voltage-dependent potassium channel family, is expressed mainly in the brain, and at low levels in placenta, testis, and adrenal gland, and only transiently in myoblasts. Recently, several studies have suggested that Eag1 is selectively expressed in various tumor tissues. Eag1 plays important roles in tumor proliferation, malignant transformation, invasion, metastasis, recurrence, and prognosis. Therefore, it has become a new molecular target for tumor diagnosis, prognosis evaluation, and tumor-targeted therapy. This review provides information about the current progress in understanding Eag1 structure, electrophysiological characteristics, and role in cancer.

  6. Voltage-dependent calcium and calcium-activated potassium currents of a molluscan photoreceptor.

    PubMed

    Alkon, D L; Farley, J; Sakakibara, M; Hay, B

    1984-11-01

    Two-microelectrode voltage clamp studies were performed on the somata of Hermissenda Type B photoreceptors that had been isolated by axotomy from all synaptic interaction as well as any impulse-generating (i.e., active) membrane. In the presence of 2-10 mM 4-aminopyridine (4-AP) and 100 mM tetraethylammonium ion (TEA), which eliminated two previously described voltage-dependent potassium currents (IA and the delayed rectifier), a voltage-dependent outward current was apparent in the steady state responses to command voltage steps more positive than -40 mV (absolute). This current increased with increasing external Ca++. The magnitude of the outward current decreased and an inward current became apparent following EGTA injection. Substitution of external Ba++ for Ca++ also made the inward current more apparent. This inward current, which was almost eliminated after being exposed for approximately 5 min to a solution in which external Ca++ was replaced with Cd++, was maximally activated at approximately 0 mV. Elevation of external potassium allowed the calcium (ICa++) and calcium-dependent K+ (IC) currents to be substantially separated. Command pulses to 0 mV elicited maximal ICa++ but no IC because no K+ currents flowed at their new reversal potential (0 mV) in 300 mM K+. At a holding potential of -60 mV, which was now more negative than the potassium equilibrium potential, EK+, in 300 mM K+, IC appeared as an inward tail current after positive command steps. The voltage dependence of ICa++ was demonstrated with positive steps in 100 mM Ba++, 4-AP, and TEA. Other data indicated that in 10 mM Ca++, IC underwent pronounced and prolonged inactivation whereas ICa++ did not. When the photoreceptor was stimulated with a light step (with the membrane potential held at -60 mV), there was also a prolonged inactivation of IC. In elevated external Ca++, ICa++ also showed similar inactivation. These data suggest that IC may undergo prolonged inactivation due to a direct effect

  7. Voltage-dependent calcium and calcium-activated potassium currents of a molluscan photoreceptor.

    PubMed Central

    Alkon, D L; Farley, J; Sakakibara, M; Hay, B

    1984-01-01

    Two-microelectrode voltage clamp studies were performed on the somata of Hermissenda Type B photoreceptors that had been isolated by axotomy from all synaptic interaction as well as any impulse-generating (i.e., active) membrane. In the presence of 2-10 mM 4-aminopyridine (4-AP) and 100 mM tetraethylammonium ion (TEA), which eliminated two previously described voltage-dependent potassium currents (IA and the delayed rectifier), a voltage-dependent outward current was apparent in the steady state responses to command voltage steps more positive than -40 mV (absolute). This current increased with increasing external Ca++. The magnitude of the outward current decreased and an inward current became apparent following EGTA injection. Substitution of external Ba++ for Ca++ also made the inward current more apparent. This inward current, which was almost eliminated after being exposed for approximately 5 min to a solution in which external Ca++ was replaced with Cd++, was maximally activated at approximately 0 mV. Elevation of external potassium allowed the calcium (ICa++) and calcium-dependent K+ (IC) currents to be substantially separated. Command pulses to 0 mV elicited maximal ICa++ but no IC because no K+ currents flowed at their new reversal potential (0 mV) in 300 mM K+. At a holding potential of -60 mV, which was now more negative than the potassium equilibrium potential, EK+, in 300 mM K+, IC appeared as an inward tail current after positive command steps. The voltage dependence of ICa++ was demonstrated with positive steps in 100 mM Ba++, 4-AP, and TEA. Other data indicated that in 10 mM Ca++, IC underwent pronounced and prolonged inactivation whereas ICa++ did not. When the photoreceptor was stimulated with a light step (with the membrane potential held at -60 mV), there was also a prolonged inactivation of IC. In elevated external Ca++, ICa++ also showed similar inactivation. These data suggest that IC may undergo prolonged inactivation due to a direct effect

  8. Two Separate Interfaces between the Voltage Sensor and Pore Are Required for the Function of Voltage-Dependent K+ Channels

    PubMed Central

    MacKinnon, Roderick

    2009-01-01

    Voltage-dependent K+ (Kv) channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors), which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate. PMID:19260762

  9. Collapse of Conductance Is Prevented by a Glutamate Residue Conserved in Voltage-Dependent K+ Channels

    PubMed Central

    Ortega-Sáenz, Patricia; Pardal, Ricardo; Castellano, Antonio; López-Barneo, José

    2000-01-01

    Voltage-dependent K+ channel gating is influenced by the permeating ions. Extracellular K+ determines the occupation of sites in the channels where the cation interferes with the motion of the gates. When external [K+] decreases, some K+ channels open too briefly to allow the conduction of measurable current. Given that extracellular K+ is normally low, we have studied if negatively charged amino acids in the extracellular loops of Shaker K+ channels contribute to increase the local [K+]. Surprisingly, neutralization of the charge of most acidic residues has minor effects on gating. However, a glutamate residue (E418) located at the external end of the membrane spanning segment S5 is absolutely required for keeping channels active at the normal external [K+]. E418 is conserved in all families of voltage-dependent K+ channels. Although the channel mutant E418Q has kinetic properties resembling those produced by removal of K+ from the pore, it seems that E418 is not simply concentrating cations near the channel mouth, but has a direct and critical role in gating. Our data suggest that E418 contributes to stabilize the S4 voltage sensor in the depolarized position, thus permitting maintenance of the channel open conformation. PMID:10919865

  10. Cloning and functional expression of a plant voltage-dependent chloride channel.

    PubMed Central

    Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

    1996-01-01

    Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

  11. Mechanistic basis for low threshold mechanosensitivity in voltage-dependent K+ channels

    PubMed Central

    Schmidt, Daniel; del Mármol, Josefina; MacKinnon, Roderick

    2012-01-01

    Living cells respond to mechanical forces applied to their outer membrane through processes referred to as “mechanosensation”. Faced with hypotonic shock, to circumvent cell lysis, bacteria open large solute-passing channels to reduce the osmotic pressure gradient. In the vascular beds of vertebrate animals blood flow is regulated directly through mechanical distention-induced opening of stretch-activated channels in smooth muscle cells. Touch sensation is thought to originate in mechanically sensitive ion channels in nerve endings, and hearing in mechanically sensitive ion channels located in specialized cells of the ear. While the ubiquity of mechanosensation in living cells is evident, the ion channels underlying the transduction events in vertebrate animals have remained elusive. Here we demonstrate through electrophysiological recordings that voltage-dependent K+ (Kv) channels exhibit exquisite sensitivity to small (physiologically relevant in magnitude) mechanical perturbations of the cell membrane. The demonstrated mechanosensitivity is quantitatively consistent with membrane tension acting on a late-opening transition through stabilization of a dilated pore. This effect causes a shift in the voltage range over which Kv channels open as well as an increase in the maximum open probability. This mechanically induced shift could allow Kv channels and perhaps other voltage-dependent ion channels to play a role in mechanosensation. PMID:22675122

  12. Calix[4]arene-based conical-shaped ligands for voltage-dependent potassium channels

    PubMed Central

    Martos, Vera; Bell, Sarah C.; Santos, Eva; Isacoff, Ehud Y.; Trauner, Dirk; de Mendoza, Javier

    2009-01-01

    Potassium channels are among the core functional elements of life because they underpin essential cellular functions including excitability, homeostasis, and secretion. We present here a series of multivalent calix[4]arene ligands that bind to the surface of voltage-dependent potassium channels (Kv1.x) in a reversible manner. Molecular modeling correctly predicts the best candidates with a conical C4 symmetry for optimal binding, and the effects on channel function are assessed electrophysiologically. Reversible inhibition was observed, without noticeable damage of the oocytes, for tetraacylguanidinium or tetraarginine members of the series with small lower rim O-substituents. Apparent binding constants were in the low micromolar range and had Hill coefficients of 1, consistent with a single site of binding. Suppression of current amplitude was accompanied by a positive shift in the voltage dependence of gating and slowing of both voltage sensor motion and channel opening. These effects are in keeping with expectations for docking in the central pore and interaction with the pore domain “turret.” PMID:19435843

  13. Characterization of a voltage-dependent conductance in the basolateral membrane of leech skin epithelium.

    PubMed

    Schnizler, M; Clauss, W

    1998-05-01

    Voltage clamp studies were performed on the dorsal integument of Hirudo medicinalis. Under apical calcium-free conditions an inward-directed component of transepithelial current was activated by changes of transepithelial voltage. Depolarization caused up to 50% increase of the transepithelial sodium current. Hyperpolarization had no comparable effects. With calcium (1.8 mM) or amiloride (100 microM) in the apical solution and in sodium-free solutions the inward-directed current failed to increase after depolarization. Activation also occurred under chloride-free conditions. Permeabilization of the apical membrane by nystatin (5 microM) increased the current activation significantly. After nystatin, calcium as well as amiloride lost their inhibitory effects. This indicates a basolateral localization of the voltage-dependent conductance. Vesicle insertion or cytoskeletal structures are probably not involved in regulation, as seen by the lack of effects of brefeldin A and the cytochalasins B and D. However, serosal hyposmolar solutions (170 mosmol.1(-1)) caused a reinforced activation of the current. Our results indicate a voltage-dependent conductance in a tight sodium-absorbing epithelium.

  14. Effect of lanthanum on voltage-dependent gating of a cloned mammalian neuronal potassium channel.

    PubMed

    Tytgat, J; Daenens, P

    1997-02-28

    The effect of the trivalent cation lanthanum (La3+) on voltage-dependent gating of a cloned mammalian neuronal Kv1.1 potassium channel was studied under whole-cell voltage-clamp conditions in oocytes of Xenopus laevis. La3+ (100 microM) was found to decrease the potassium currents at all test potentials and to shift the midpoint of the fraction open channels/membrane voltage curve by approximately +20 mV. The opening and closing time constants of Kv1.1 channels were empirically fitted with a 4th power Hodgkin-Huxley formalism, or with mono- and multi-exponentials. It was found that La3+ slowed down the kinetics of activation, speeded up those of deactivation, and shifted the opening kinetics by approximately + 60 mV. Interestingly, all these parameters of channel gating were not affected equally by La3+. Furthermore, amplitudes of the inward tail currents evoked at potentials more negative than the potassium equilibrium potential (E(K+)) were more strongly inhibited by La3+ than those of the outward tail currents evoked at potentials more positive than E(K+). This suggests voltage-dependent block and binding of La3+ to the Kv1.1 channel protein. We conclude that these actions cannot be explained in terms of surface charge considerations alone. Our results provide evidence for a direct interaction with the potassium channel protein, shedding new light on the mechanism of action of this lanthanide.

  15. Fast and slow activation of voltage-dependent ion channels in radish vacuoles.

    PubMed Central

    Gambale, F; Cantu, A M; Carpaneto, A; Keller, B U

    1993-01-01

    The molecular processes associated with voltage-dependent opening and closing (gating) of ion channels were investigated using a new preparation from plant cells, i.e., voltage and calcium-activated ion channels in radish root vacuoles. These channels display a main single channel conductance of approximately 90 pS and are characterized by long activation times lasting several hundreds of milliseconds. Here, we demonstrate that these channels have a second kinetically distinct activation mode which is characterized by even longer activation times. Different membrane potential protocols allowed to switch between the fast and the slow mode in a controlled and reversible manner. At transmembrane potentials of -100 mV, the ratio between the fast and slow activation time constant was around 1:5. Correspondingly, activation times lasting several seconds were observed in the slow mode. The molecular process controlling fast and slow activation may represent an effective modulator of voltage-dependent gating of ion channels in other plant and animal systems. PMID:7507716

  16. Do voltage-dependent K+ channels require Ca2+? A critical test employing a heterologous expression system.

    PubMed Central

    Armstrong, C M; Miller, C

    1990-01-01

    Removal of Ca2+ from the solution bathing neurons is known in many cases to alter the gating properties of voltage-dependent K+ channels and to induce a large, nonselective "leak" conductance. We used a heterologous expression system to test whether the leak conductance observed in neurons is mediated by voltage-dependent K+ channels in an altered, debased conformation. Voltage-dependent K+ channels were expressed in an insect cell line infected with a recombinant baculovirus carrying the cDNA for Drosophila Shaker "A-type" K+ channels. These expressed channels respond to low Ca2+ identically to voltage-dependent K+ channels in native neuronal membranes; upon removal of external Ca2+, Shaker K+ currents disappear and are replaced by a steady, nonselective leak conductance. However, control cells devoid of Shaker channels were free of any voltage-dependent conductances and did not generate a leak when external Ca2+ was removed. These results show that Ca2+ is essential for proper function of voltage-dependent K+ channels and is required to stabilize the native conformations of these membrane proteins. PMID:2217187

  17. Sodium channel from rat brain. Reconstitution of voltage-dependent scorpion toxin binding in vesicles of defined lipid composition

    SciTech Connect

    Feller, D.J.; Talvenheimo, J.A.; Catterall, W.A.

    1985-09-25

    Purified sodium channels incorporated into phosphatidylcholine (PC) vesicles mediate neurotoxin-activated SSNa influx but do not bind the alpha-scorpion toxin from Leiurus quinquestriatus (LqTx) with high affinity. Addition of phosphatidylethanolamine (PE) or phosphatidylserine to the reconstitution mixture restores high affinity LqTx binding with KD = 1.9 nM for PC/PE vesicles at -90 mV and 36 degrees C in sucrose-substituted medium. Other lipids tested were markedly less effective. The binding of LqTx in vesicles of PC/PE (65:35) is sensitive to both the membrane potential formed by sodium gradients across the reconstituted vesicle membrane and the cation concentration in the extravesicular medium. Binding of LqTx is reduced 3- to 4-fold upon depolarization to 0 mV from -50 to -60 mV in experiments in which (Na+)out/(Na+)in is varied by changing (Na+)in or (Na+)out at constant extravesicular ionic strength. It is concluded that the purified sodium channel contains the receptor site for LqTx in functional form and that restoration of high affinity, voltage-dependent binding of LqTx by the purified sodium channel requires an appropriate ratio of PC to PE and/or phosphatidylserine in the vesicle membrane.

  18. Mutation E87Q of the β1-subunit impairs the maturation of the cardiac voltage-dependent sodium channel.

    PubMed

    Baroni, Debora; Picco, Cristiana; Moran, Oscar

    2017-09-06

    Voltage-dependent sodium channels are responsible of the rising phase of the action potential in excitable cells. These membrane integral proteins are composed by a pore-forming α-subunit, and one or more auxiliary β subunits. Mutation E87Q of the β1 subunit is correlated with Brugada syndrome, a genetic disease characterised by ventricular fibrillation, right precordial ST segment elevation on ECG and sudden cardiac death. Heterologous expression of E87Q-β1 subunit in CHO cells determines a reduced sodium channel functional expression. The effect the E87Q mutation of the β1 subunit on sodium currents and α protein expression is correlated with a reduced availability of the mature form of the α subunit in the plasma membrane. This finding offers a new target for the treatment of the Brugada syndrome, based on protein maturation management. This work highlights the role played by the β1 subunit in the maturation and expression of the entire sodium channel complex and underlines how the defective interaction between the sodium channel constituents could lead to a disabling pathological condition.

  19. The Eag Domain Regulates the Voltage-Dependent Inactivation of Rat Eag1 K+ Channels

    PubMed Central

    Lin, Ting-Feng; Jow, Guey-Mei; Fang, Hsin-Yu; Fu, Ssu-Ju; Wu, Hao-Han; Chiu, Mei-Miao; Jeng, Chung-Jiuan

    2014-01-01

    Eag (Kv10) and Erg (Kv11) belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH). While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N)-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1) and human Erg (hERG1) channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4–S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels. PMID:25333352

  20. Voltage-dependent Dynamic FRET Signals from the Transverse Tubules in Mammalian Skeletal Muscle Fibers

    PubMed Central

    DiFranco, Marino; Capote, Joana; Quiñonez, Marbella; Vergara, Julio L.

    2007-01-01

    Two hybrid voltage-sensing systems based on fluorescence resonance energy transfer (FRET) were used to record membrane potential changes in the transverse tubular system (TTS) and surface membranes of adult mice skeletal muscle fibers. Farnesylated EGFP or ECFP (EGFP-F and ECFP-F) were used as immobile FRET donors, and either non-fluorescent (dipicrylamine [DPA]) or fluorescent (oxonol dye DiBAC4(5)) lipophilic anions were used as mobile energy acceptors. Flexor digitorum brevis (FDB) muscles were transfected by in vivo electroporation with pEGFP-F and pECFP-F. Farnesylated fluorescent proteins were efficiently expressed in the TTS and surface membranes. Voltage-dependent optical signals resulting from resonance energy transfer from fluorescent proteins to DPA were named QRET transients, to distinguish them from FRET transients recorded using DiBAC4(5). The peak ΔF/F of QRET transients elicited by action potential stimulation is twice larger in fibers expressing ECFP-F as those with EGFP-F (7.1% vs. 3.6%). These data provide a unique experimental demonstration of the importance of the spectral overlap in FRET. The voltage sensitivity of QRET and FRET signals was demonstrated to correspond to the voltage-dependent translocation of the charged acceptors, which manifest as nonlinear components in current records. For DPA, both electrical and QRET data were predicted by radial cable model simulations in which the maximal time constant of charge translocation was 0.6 ms. FRET signals recorded in response to action potentials in fibers stained with DiBAC4(5) exhibit ΔF/F amplitudes as large as 28%, but their rising phase was slower than those of QRET signals. Model simulations require a time constant for charge translocation of 1.6 ms in order to predict current and FRET data. Our results provide the basis for the potential use of lipophilic ions as tools to test for fast voltage-dependent conformational changes of membrane proteins in the TTS. PMID:18040060

  1. A non-linear voltage dependent charge movement in frog skeletal muscle.

    PubMed Central

    Chandler, W K; Rakowski, R F; Schneider, M F

    1976-01-01

    1. Voltage-clamp experiments were carried out using the three microelectrode technique. Using this method membrane current density at V1 is proportional to deltaV( = V2 - V1) where V1 and V2 are voltages at distances 1 and 21 from the end of a fibre. Voltage dependent sodium currents were blocked by tetrodotoxin, potassium by tetraethylammonium ions and rubidium. Contraction was blocked by adding sucrose, 467 mM. 2. The current deltaV (control) associated with a positive voltage step from a hyperpolarized conditioning voltage to the holding potential, -80 mV, showed two components, a capacitative transient which decayed rapidly and a maintained steady level... PMID:1082506

  2. Current State of Theoretical and Experimental Studies of the Voltage-Dependent Anion Channel (VDAC)

    PubMed Central

    Noskov, Sergei Yu.; Rostovtseva, Tatiana K.; Chamberlin, Adam C.; Teijido, Oscar; Jiang, Wei; Bezrukov, Sergey M.

    2016-01-01

    Voltage-dependent anion channel (VDAC), the major channel of the mitochondrial outer membrane provides a controlled pathway for respiratory metabolites in and out of the mitochondria. In spite of the wealth of experimental data from structural, biochemical, and biophysical investigations, the exact mechanisms governing selective ion and metabolite transport, especially the role of titratable charged residues and interactions with soluble cytosolic proteins, remain hotly debated in the field. The computational advances hold a promise to provide a much sought-after solution to many of the scientific disputes around solute and ion transport through VDAC and hence, across the mitochondrial outer membrane. In this review, we examine how Molecular Dynamics, Free Energy, and Brownian Dynamics simulations of the large β-barrel channel, VDAC, advanced our understanding. We will provide a short overview of non-conventional techniques and also discuss examples of how the modeling excursions into VDAC biophysics prospectively aid experimental efforts. PMID:26940625

  3. Calcium-mediated decrease of a voltage-dependent potassium current.

    PubMed Central

    Alkon, D L; Shoukimas, J J; Heldman, E

    1982-01-01

    Elevated intracellular Ca++ concentration reduces the amplitude of an early, voltage-dependent K+ current (IA) in the Type B photoreceptor of Hermissenda crassicornis. Internal Ca++ is increased by activating a voltage and light-dependent Ca++ current present in these cells or by direct iontophoresis of Ca++ ions. Substitution of Ba++ for Ca++ or elimination of Ca++ from the sea water bathing the cells abolishes the reduction in IA during paired light and depolarizing voltage steps. The delayed K+ current (IB) in these cells is also reduced during paired light and voltage steps, but this decrease of IB is not affected by removal of extracellular Ca++. IB (but not IA), apparently much less dependent on intracellular Ca++ levels, is reduced by light alone. Ca++ iontophoresis also abolishes the light-dependent Na+ current, which recovers with a time course of minutes. PMID:7183338

  4. Identification of PN1, a Predominant Voltage-Dependent Sodium Channel Expressed Principally in Peripheral Neurons

    NASA Astrophysics Data System (ADS)

    Toledo-Aral, Juan J.; Moss, Brenda L.; He, Zhi-Jun; Koszowski, Adam G.; Whisenand, Teri; Levinson, Simon R.; Wolf, John J.; Silos-Santiago, Inmaculada; Halegoua, Simon; Mandel, Gail

    1997-02-01

    Membrane excitability in different tissues is due, in large part, to the selective expression of distinct genes encoding the voltage-dependent sodium channel. Although the predominant sodium channels in brain, skeletal muscle, and cardiac muscle have been identified, the major sodium channel types responsible for excitability within the peripheral nervous system have remained elusive. We now describe the deduced primary structure of a sodium channel, peripheral nerve type 1 (PN1), which is expressed at high levels throughout the peripheral nervous system and is targeted to nerve terminals of cultured dorsal root ganglion neurons. Studies using cultured PC12 cells indicate that both expression and targeting of PN1 is induced by treatment of the cells with nerve growth factor. The preferential localization suggests that the PN1 sodium channel plays a specific role in nerve excitability.

  5. Modulation of the mitochondrial voltage dependent anion channel (VDAC) by curcumin.

    PubMed

    Tewari, Debanjan; Ahmed, Tofayel; Chirasani, Venkat R; Singh, Pradeep K; Maji, Samir K; Senapati, Sanjib; Bera, Amal Kanti

    2015-01-01

    Voltage dependent anion channel (VDAC) of mitochondria plays a crucial role in apoptosis. Human VDAC-1, reconstituted in planar lipid bilayer showed reduced conductance when treated with curcumin. Curcumin interacts with residues in the α helical N-terminus of VDAC and in the channel wall, as revealed by molecular docking, followed by mutational analysis. N-terminus mimicking peptide showed conformational changes in circular dichroism, upon curcumin treatment. We propose that the interaction of curcumin with amino acids in N-terminus and in channel wall fixes the α helix in closed conformation. This restricts its movement which is required for the opening of the channel. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Functional ion channels in human pulmonary artery smooth muscle cells: Voltage-dependent cation channels

    PubMed Central

    Firth, Amy L.; Remillard, Carmelle V.; Platoshyn, Oleksandr; Fantozzi, Ivana; Ko, Eun A.; Yuan, Jason X.-J.

    2011-01-01

    The activity of voltage-gated ion channels is critical for the maintenance of cellular membrane potential and generation of action potentials. In turn, membrane potential regulates cellular ion homeostasis, triggering the opening and closing of ion channels in the plasma membrane and, thus, enabling ion transport across the membrane. Such transmembrane ion fluxes are important for excitation–contraction coupling in pulmonary artery smooth muscle cells (PASMC). Families of voltage-dependent cation channels known to be present in PASMC include voltage-gated K+ (Kv) channels, voltage-dependent Ca2+-activated K+ (Kca) channels, L- and T- type voltage-dependent Ca2+ channels, voltage-gated Na+ channels and voltage-gated proton channels. When cells are dialyzed with Ca2+-free K+- solutions, depolarization elicits four components of 4-aminopyridine (4-AP)-sensitive Kvcurrents based on the kinetics of current activation and inactivation. In cell-attached membrane patches, depolarization elicits a wide range of single-channel K+ currents, with conductances ranging between 6 and 290 pS. Macroscopic 4-AP-sensitive Kv currents and iberiotoxin-sensitive Kca currents are also observed. Transcripts of (a) two Na+ channel α-subunit genes (SCN5A and SCN6A), (b) six Ca2+ channel α–subunit genes (α1A, α1B, α1X, α1D, α1Eand α1G) and many regulatory subunits (α2δ1, β1-4, and γ6), (c) 22 Kv channel α–subunit genes (Kv1.1 - Kv1.7, Kv1.10, Kv2.1, Kv3.1, Kv3.3, Kv3.4, Kv4.1, Kv4.2, Kv5.1, Kv 6.1-Kv6.3, Kv9.1, Kv9.3, Kv10.1 and Kv11.1) and three Kv channel β-subunit genes (Kvβ1-3) and (d) four Kca channel α–subunit genes (Sloα1 and SK2-SK4) and four Kca channel β-subunit genes (Kcaβ1-4) have been detected in PASMC. Tetrodotoxin-sensitive and rapidly inactivating Na+ currents have been recorded with properties similar to those in cardiac myocytes. In the presence of 20 mM external Ca2+, membrane depolarization from a holding potential of -100 mV elicits a rapidly

  7. Presence of a voltage-dependent anion channel 1 in the rat postsynaptic density fraction.

    PubMed

    Moon, J I; Jung, Y W; Ko, B H; De Pinto, V; Jin, I; Moon, I S

    1999-02-25

    Little is known about the molecular organization and functions of the postsynaptic density (PSD), a cytoskeletal specialization on the postsynaptic membrane. In an attempt to elucidate the protein composition of PSD, we have sequenced a 35 kDa protein of the rat forebrain PSD fraction. Amino acid sequence information of the tryptic peptides and immunoblot analyses revealed that the protein is a voltage-dependent anion channel 1 (VDAC1). VDAC1 was enriched in the PSD fraction and was partially soluble in 1% n-octyl glucoside (NOG) or Triton X-100. Our data indicate that VDAC1, which is originally found in the outer mitochondrial membrane, is also present in the central nervous system (CNS) synapses in association with the PSD 'core'.

  8. A voltage-dependent chloride channel fine-tunes photosynthesis in plants

    PubMed Central

    Herdean, Andrei; Teardo, Enrico; Nilsson, Anders K.; Pfeil, Bernard E.; Johansson, Oskar N.; Ünnep, Renáta; Nagy, Gergely; Zsiros, Ottó; Dana, Somnath; Solymosi, Katalin; Garab, Győző; Szabó, Ildikó; Spetea, Cornelia; Lundin, Björn

    2016-01-01

    In natural habitats, plants frequently experience rapid changes in the intensity of sunlight. To cope with these changes and maximize growth, plants adjust photosynthetic light utilization in electron transport and photoprotective mechanisms. This involves a proton motive force (PMF) across the thylakoid membrane, postulated to be affected by unknown anion (Cl−) channels. Here we report that a bestrophin-like protein from Arabidopsis thaliana functions as a voltage-dependent Cl− channel in electrophysiological experiments. AtVCCN1 localizes to the thylakoid membrane, and fine-tunes PMF by anion influx into the lumen during illumination, adjusting electron transport and the photoprotective mechanisms. The activity of AtVCCN1 accelerates the activation of photoprotective mechanisms on sudden shifts to high light. Our results reveal that AtVCCN1, a member of a conserved anion channel family, acts as an early component in the rapid adjustment of photosynthesis in variable light environments. PMID:27216227

  9. Time and voltage dependences of nanoscale dielectric constant modulation on indium tin oxide films

    NASA Astrophysics Data System (ADS)

    Li, Liang; Hao, Haoyue; Zhao, Hua

    2017-01-01

    The modulation of indium tin oxide (ITO) films through surface charge accumulation plays an important role in many different applications. In order to elaborately study the modulation, we measured the dielectric constant of the modulated layer through examining the excitation of surface plasmon polaritons. Charges were pumped on the surfaces of ITO films through applying high voltage in appropriate directions. Experiments unveiled that the dielectric constant of the modulated layer had large variation along with the nanoscale charge accumulation. Corresponding numerical results were worked out through combining Drude model and Mayadas-Shatzkes model. Based on the above results, we deduced the time and voltage dependences of accumulated charge density, which revealed a long-time charge accumulation process.

  10. Voltage-dependent charge movement associated with activation of the CLC-5 2Cl−/1H+ exchanger

    PubMed Central

    Smith, Andrew J.; Lippiat, Jonathan D.

    2010-01-01

    The family of CLC proteins comprises both Cl− channels and Cl−/H+ exchange transporters with varying degrees of voltage dependence. The human CLC-5 is an electrogenic voltage-dependent 2Cl−/1H+ exchanger that gives rise to strongly outwardly rectifying currents when expressed. We conducted whole-cell recordings from HEK293 cells transiently transfected with either wild-type CLC-5 or a permeation-deficient mutant, E268A. With E268A CLC-5 we recorded transient voltage-dependent currents that represent the gating currents associated with CLC-5 activation and had kinetics that could be described by voltage-dependent forward and reverse transition rates. In extracellular solutions rich in Cl− or Br−, CLC-5 exhibited a gating charge of 1.3, but this was reduced to 0.9 in solutions comprising the impermeant anions aspartate, methanesulfonate, sulfate, or HEPES. Extracellular ion depletion by local perfusion with isotonic mannitol failed to reduce the gating charge further. Lowering intracellular pH from 7.4 to 5.4 did not shift the voltage-dependence of the gating currents, but reducing and increasing intracellular Cl− shifted the charge-voltage relationship to more negative and positive potentials, respectively. Our data suggest that voltage sensing is an intrinsic property of the CLC-5 protein and that permeant anions, particularly Cl−, modulate a voltage-dependent transition to an activated state from which Cl−/H+ exchange can occur.—Smith, A. J., Lippiat, J. D. Voltage-dependent charge movement associated with activation of the CLC-5 2Cl−/1H+ exchanger. PMID:20501796

  11. Immunomodulation of voltage-dependent K+ channels in macrophages: molecular and biophysical consequences.

    PubMed

    Villalonga, Núria; David, Miren; Bielanska, Joanna; Vicente, Rubén; Comes, Núria; Valenzuela, Carmen; Felipe, Antonio

    2010-02-01

    Voltage-dependent potassium (K(v)) channels play a pivotal role in the modulation of macrophage physiology. Macrophages are professional antigen-presenting cells and produce inflammatory and immunoactive substances that modulate the immune response. Blockage of K(v) channels by specific antagonists decreases macrophage cytokine production and inhibits proliferation. Numerous pharmacological agents exert their effects on specific target cells by modifying the activity of their plasma membrane ion channels. Investigation of the mechanisms involved in the regulation of potassium ion conduction is, therefore, essential to the understanding of potassium channel functions in the immune response to infection and inflammation. Here, we demonstrate that the biophysical properties of voltage-dependent K(+) currents are modified upon activation or immunosuppression in macrophages. This regulation is in accordance with changes in the molecular characteristics of the heterotetrameric K(v)1.3/K(v)1.5 channels, which generate the main K(v) in macrophages. An increase in K(+) current amplitude in lipopolysaccharide-activated macrophages is characterized by a faster C-type inactivation, a greater percentage of cumulative inactivation, and a more effective margatoxin (MgTx) inhibition than control cells. These biophysical parameters are related to an increase in K(v)1.3 subunits in the K(v)1.3/K(v)1.5 hybrid channel. In contrast, dexamethasone decreased the C-type inactivation, the cumulative inactivation, and the sensitivity to MgTx concomitantly with a decrease in K(v)1.3 expression. Neither of these treatments apparently altered the expression of K(v)1.5. Our results demonstrate that the immunomodulation of macrophages triggers molecular and biophysical consequences in K(v)1.3/K(v)1.5 hybrid channels by altering the subunit stoichiometry.

  12. The Role of Voltage-Dependence of the NMDA Receptor in Cellular and Network Oscillation

    PubMed Central

    Martell, Amber L.; Ramirez, Jan-Marino; Lasky, Robert E.; Dwyer, Jennifer E.; Kohrman, Michael; van Drongelen, Wim

    2012-01-01

    Unraveling the mechanisms underlying oscillatory behavior is critical for understanding normal and pathological brain processes. Here we used electrophysiology in mouse neocortical slices and principles of nonlinear dynamics to demonstrate how an increase in the N-methyl-D-aspartic acid receptor (NMDAR) conductance can create a nonlinear whole-cell current-voltage ( I – V ) relationship, which leads to changes in cellular stability. We discovered two behaviorally and morphologically distinct pyramidal cell populations. Under control conditions, both cell types responded to depolarizing current injection with regular spiking patterns. However, upon NMDAR activation, an intrinsic oscillatory (IO) cell type (n = 44) showed a nonlinear whole-cell I – V relationship, intrinsic voltage-dependent oscillations plus amplification of alternating input current, and these properties persisted after disabling action potential generation with TTX. The other non-oscillatory (NO) neuronal population (n = 24) demonstrated none of these behaviors. Simultaneous intra- and extracellular recordings demonstrated the NMDAR’s capacity to promote low-frequency seizure-like network oscillations via its effects on intrinsic neuronal properties. The two pyramidal cell types demonstrated different relationships with network oscillation: the IO cells were leaders that were activated early in the population activity cycle while the activation of the NO cell type was distributed across network bursts. The properties of IO neurons disappeared in a low magnesium environment where the voltage-dependence of the receptor is abolished; concurrently, the cellular contribution to network oscillation switched to synchronous firing. Thus, depending upon the efficacy of NMDAR in altering the linearity of the whole-cell current-voltage relationship, the two cell populations played different roles in sustaining network oscillation. PMID:22805058

  13. Voltage dependence and pH regulation of human polycystin-2-mediated cation channel activity.

    PubMed

    Gonzalez-Perrett, Silvia; Batelli, Marisa; Kim, Keetae; Essafi, Makram; Timpanaro, Gustavo; Moltabetti, Nicolas; Reisin, Ignacio L; Arnaout, M Amin; Cantiello, Horacio F

    2002-07-12

    Polycystin-2, the product of the human PKD2 gene, whose mutations cause autosomal dominant polycystic kidney disease, is a large conductance, Ca(2+)-permeable non-selective cation channel. Polycystin-2 is functionally expressed in the apical membrane of the human syncytiotrophoblast, where it may play a role in the control of fetal electrolyte homeostasis. Little is known, however, about the mechanisms that regulate polycystin-2 channel function. In this study, the role of pH in the regulation of polycystin-2 was assessed by ion channel reconstitution of both apical membranes of human syncytiotrophoblast and the purified FLAG-tagged protein from in vitro transcribed/translated material. A kinetic analysis of single channel currents, including dwell time histograms, confirmed two open and two close states for spontaneous channel behavior and a strong voltage dependence of the open probability of the channel (P(o)). A reduction of cis pH (pH(cis)) decreased P(o) and shifted the voltage dependence of channel function but had no effect on the single channel conductance. An increase in pH(cis), in contrast, increased NP(o) (channel number times P(o)). Elimination of the H(+) chemical gradient did not reverse the low pH(cis) inhibition of polycystin-2. Similar findings confirmed the pH effect on the in vitro translated, FLAG-tagged purified polycystin-2. The data indicate the presence of an H(+) ion regulatory site in the channel protein, which is accessible from the cytoplasmic side of the protein. This protonation site controls polycystin-2 cation-selective channel activity.

  14. Myosin light chain kinase controls voltage-dependent calcium channels in vascular smooth muscle.

    PubMed

    Martinsen, A; Schakman, O; Yerna, X; Dessy, C; Morel, N

    2014-07-01

    The Ca(2+)-dependent kinase myosin light chain kinase (MLCK) is the activator of smooth muscle contraction. In addition, it has been reported to be involved in Ca(2+) channel regulation in cultured cells, and we previously showed that the MLCK inhibitor ML-7 decreases arginine vasopressin (AVP)-induced Ca(2+) influx in rat aorta. This study was designed to investigate whether MLCK is involved in Ca(2+) regulation in resistance artery smooth muscle cell, which plays a major role in the control of blood pressure. As ML compounds were shown to have off-target effects, MLCK was downregulated by transfection with a small interfering RNA targeting MLCK (MLCK-siRNA) in rat small resistance mesenteric artery (RMA) and in the rat embryonic aortic cell line A7r5. Noradrenaline-induced contraction and Ca(2+) signal were significantly depressed in MLCK-siRNA compared to scramble-siRNA-transfected RMA. Contraction and Ca(2+) signal induced by high KCl and voltage-activated Ca(2+) current were also significantly decreased in MLCK-siRNA-transfected RMA, suggesting that MLCK depletion modifies voltage-operated Ca(2+) channels. KCl- and AVP-induced Ca(2+) signals and voltage-activated Ca(2+) current were decreased in MLCK-depleted A7r5 cells. Eventually, real-time quantitative PCR analysis indicated that in A7r5, MLCK controlled mRNA expression of CaV1.2 (L-type) and CaV3.1 (T-type) voltage-dependent Ca(2+) channels. Our results suggest that MLCK controls the transcription of voltage-dependent Ca(2+) channels in vascular smooth muscle cells.

  15. Gating characteristics of a steeply voltage-dependent gap junction channel in rat Schwann cells

    PubMed Central

    1993-01-01

    The gating properties of macroscopic and microscopic gap junctional currents were compared by applying the dual whole cell patch clamp technique to pairs of neonatal rat Schwann cells. In response to transjunctional voltage pulses (Vj), macroscopic gap junctional currents decayed exponentially with time constants ranging from < 1 to < 10 s before reaching steady-state levels. The relationship between normalized steady-state junctional conductance (Gss) and (Vj) was well described by a Boltzmann relationship with e-fold decay per 10.4 mV, representing an equivalent gating charge of 2.4. At Vj > 60 mV, Gss was virtually zero, a property that is unique among the gap junctions characterized to date. Determination of opening and closing rate constants for this process indicated that the voltage dependence of macroscopic conductance was governed predominantly by the closing rate constant. In 78% of the experiments, a single population of unitary junctional currents was detected corresponding to an unitary channel conductance of approximately 40 pS. The presence of only a limited number of junctional channels with identical unitary conductances made it possible to analyze their kinetics at the single channel level. Gating at the single channel level was further studied using a stochastic model to determine the open probability (Po) of individual channels in a multiple channel preparation. Po decreased with increasing Vj following a Boltzmann relationship similar to that describing the macroscopic Gss voltage dependence. These results indicate that, for Vj of a single polarity, the gating of the 40 pS gap junction channels expressed by Schwann cells can be described by a first order kinetic model of channel transitions between open and closed states. PMID:8301264

  16. Acidification asymmetrically affects voltage-dependent anion channel implicating the involvement of salt bridges.

    PubMed

    Teijido, Oscar; Rappaport, Shay M; Chamberlin, Adam; Noskov, Sergei Y; Aguilella, Vicente M; Rostovtseva, Tatiana K; Bezrukov, Sergey M

    2014-08-22

    The voltage-dependent anion channel (VDAC) is the major pathway for ATP, ADP, and other respiratory substrates through the mitochondrial outer membrane, constituting a crucial point of mitochondrial metabolism regulation. VDAC is characterized by its ability to "gate" between an open and several "closed" states under applied voltage. In the early stages of tumorigenesis or during ischemia, partial or total absence of oxygen supply to cells results in cytosolic acidification. Motivated by these facts, we investigated the effects of pH variations on VDAC gating properties. We reconstituted VDAC into planar lipid membranes and found that acidification reversibly increases its voltage-dependent gating. Furthermore, both VDAC anion selectivity and single channel conductance increased with acidification, in agreement with the titration of the negatively charged VDAC residues at low pH values. Analysis of the pH dependences of the gating and open channel parameters yielded similar pKa values close to 4.0. We also found that the response of VDAC gating to acidification was highly asymmetric. The presumably cytosolic (cis) side of the channel was the most sensitive to acidification, whereas the mitochondrial intermembrane space (trans) side barely responded to pH changes. Molecular dynamic simulations suggested that stable salt bridges at the cis side, which are susceptible to disruption upon acidification, contribute to this asymmetry. The pronounced sensitivity of the cis side to pH variations found here in vitro might provide helpful insights into the regulatory role of VDAC in the protective effect of cytosolic acidification during ischemia in vivo. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. PIP2 regulation of KCNQ channels: biophysical and molecular mechanisms for lipid modulation of voltage-dependent gating.

    PubMed

    Zaydman, Mark A; Cui, Jianmin

    2014-01-01

    Voltage-gated potassium (Kv) channels contain voltage-sensing (VSD) and pore-gate (PGD) structural domains. During voltage-dependent gating, conformational changes in the two domains are coupled giving rise to voltage-dependent opening of the channel. In addition to membrane voltage, KCNQ (Kv7) channel opening requires the membrane lipid phosphatidylinositol 4,5-bisphosphate (PIP2). Recent studies suggest that PIP2 serves as a cofactor to mediate VSD-PGD coupling in KCNQ1 channels. In this review, we put these findings in the context of the current understanding of voltage-dependent gating, lipid modulation of Kv channel activation, and PIP2-regulation of KCNQ channels. We suggest that lipid-mediated coupling of functional domains is a common mechanism among KCNQ channels that may be applicable to other Kv channels and membrane proteins.

  18. PIP2 regulation of KCNQ channels: biophysical and molecular mechanisms for lipid modulation of voltage-dependent gating

    PubMed Central

    Zaydman, Mark A.; Cui, Jianmin

    2014-01-01

    Voltage-gated potassium (Kv) channels contain voltage-sensing (VSD) and pore-gate (PGD) structural domains. During voltage-dependent gating, conformational changes in the two domains are coupled giving rise to voltage-dependent opening of the channel. In addition to membrane voltage, KCNQ (Kv7) channel opening requires the membrane lipid phosphatidylinositol 4,5-bisphosphate (PIP2). Recent studies suggest that PIP2 serves as a cofactor to mediate VSD-PGD coupling in KCNQ1 channels. In this review, we put these findings in the context of the current understanding of voltage-dependent gating, lipid modulation of Kv channel activation, and PIP2-regulation of KCNQ channels. We suggest that lipid-mediated coupling of functional domains is a common mechanism among KCNQ channels that may be applicable to other Kv channels and membrane proteins. PMID:24904429

  19. Characterization of voltage-dependent calcium channel blocking peptides from the venom of the tarantula Grammostola rosea.

    PubMed

    Ono, Seigo; Kimura, Tadashi; Kubo, Tai

    2011-09-01

    Voltage-dependent calcium channel blocking peptides were purified and sequenced from the venom of the tarantula, Grammostola rosea. cDNAs encoding the peptide sequences were cloned from the venom gland cDNA library. The electrophysiological effects of the peptides on several types of voltage-dependent calcium channels were evaluated using a Xenopus laevis oocyte expression system. A peptide contained in one of the HPLC peak fractions inhibited P/Q type voltage-dependent calcium channels (Ca(v)2.1). The amino acid sequence of this peptide is identical to that of ω-grammotoxin SIA. A peptide from another discrete peak, which is identical to GsAFII except for one tryptophan residue in the C-terminus, inhibited L-type voltage-dependent calcium channels (Ca(v)1.2). A novel peptide, named GTx1-15 (Accession number, AB201016), shows 76.5% sequence homology with the sodium channel blocker phrixotoxin 3, however, GTx1-15 preferentially inhibited T-type voltage-dependent calcium channels (Ca(v)3.1). In silico secondary and tertiary structure prediction revealed that GTx1-15 and sodium channel blockers such as hainantoxin-IV, phrixotoxin 3, and ceratotoxin 2 show very similar β-strand composition, distribution of Optimal Docking Areas (continuous surface patches likely to be involved in protein-protein interactions), and surface electrostatic potential. These findings suggest that these peptide toxins evolved from common ancestors by gene duplication to maintain surface atmospheres appropriate for interaction with low-voltage-dependent ion channels. Copyright © 2011 Elsevier Ltd. All rights reserved.

  20. Voltage dependence of proton pumping by bacteriorhodopsin mutants with altered lifetime of the M intermediate.

    PubMed

    Geibel, Sven; Lörinczi, Éva; Bamberg, Ernst; Friedrich, Thomas

    2013-01-01

    The light-driven proton pump bacteriorhodopsin (BR) from Halobacterium salinarum is tightly regulated by the [H(+)] gradient and transmembrane potential. BR exhibits optoelectric properties, since spectral changes during the photocycle are kinetically controlled by voltage, which predestines BR for optical storage or processing devices. BR mutants with prolonged lifetime of the blue-shifted M intermediate would be advantageous, but the optoelectric properties of such mutants are still elusive. Using expression in Xenopus oocytes and two-electrode voltage-clamping, we analyzed photocurrents of BR mutants with kinetically destabilized (F171C, F219L) or stabilized (D96N, D96G) M intermediate in response to green light (to probe H(+) pumping) and blue laser flashes (to probe accumulation/decay of M). These mutants have divergent M lifetimes. As for BR-WT, this strictly correlates with the voltage dependence of H(+) pumping. BR-F171C and BR-F219L showed photocurrents similar to BR-WT. Yet, BR-F171C showed a weaker voltage dependence of proton pumping. For both mutants, blue laser flashes applied during and after green-light illumination showed reduced M accumulation and shorter M lifetime. In contrast, BR-D96G and BR-D96N exhibited small photocurrents, with nonlinear current-voltage curves, which increased strongly in the presence of azide. Blue laser flashes showed heavy M accumulation and prolonged M lifetime, which accounts for the strongly reduced H(+) pumping rate. Hyperpolarizing potentials augmented these effects. The combination of M-stabilizing and -destabilizing mutations in BR-D96G/F171C/F219L (BR-tri) shows that disruption of the primary proton donor Asp-96 is fatal for BR as a proton pump. Mechanistically, M destabilizing mutations cannot compensate for the disruption of Asp-96. Accordingly, BR-tri and BR-D96G photocurrents were similar. However, BR-tri showed negative blue laser flash-induced currents even without actinic green light, indicating that

  1. Voltage Dependence of Proton Pumping by Bacteriorhodopsin Mutants with Altered Lifetime of the M Intermediate

    PubMed Central

    Geibel, Sven; Lörinczi, Èva; Bamberg, Ernst; Friedrich, Thomas

    2013-01-01

    The light-driven proton pump bacteriorhodopsin (BR) from Halobacterium salinarum is tightly regulated by the [H+] gradient and transmembrane potential. BR exhibits optoelectric properties, since spectral changes during the photocycle are kinetically controlled by voltage, which predestines BR for optical storage or processing devices. BR mutants with prolonged lifetime of the blue-shifted M intermediate would be advantageous, but the optoelectric properties of such mutants are still elusive. Using expression in Xenopus oocytes and two-electrode voltage-clamping, we analyzed photocurrents of BR mutants with kinetically destabilized (F171C, F219L) or stabilized (D96N, D96G) M intermediate in response to green light (to probe H+ pumping) and blue laser flashes (to probe accumulation/decay of M). These mutants have divergent M lifetimes. As for BR-WT, this strictly correlates with the voltage dependence of H+ pumping. BR-F171C and BR-F219L showed photocurrents similar to BR-WT. Yet, BR-F171C showed a weaker voltage dependence of proton pumping. For both mutants, blue laser flashes applied during and after green-light illumination showed reduced M accumulation and shorter M lifetime. In contrast, BR-D96G and BR-D96N exhibited small photocurrents, with nonlinear current-voltage curves, which increased strongly in the presence of azide. Blue laser flashes showed heavy M accumulation and prolonged M lifetime, which accounts for the strongly reduced H+ pumping rate. Hyperpolarizing potentials augmented these effects. The combination of M-stabilizing and -destabilizing mutations in BR-D96G/F171C/F219L (BR-tri) shows that disruption of the primary proton donor Asp-96 is fatal for BR as a proton pump. Mechanistically, M destabilizing mutations cannot compensate for the disruption of Asp-96. Accordingly, BR-tri and BR-D96G photocurrents were similar. However, BR-tri showed negative blue laser flash-induced currents even without actinic green light, indicating that Schiff base

  2. Voltage dependence of two inward currents carried by calcium and barium in the ciliate Stylonychia mytilus.

    PubMed Central

    Deitmer, J W

    1986-01-01

    Two voltage-dependent inward currents in the fresh-water hypotrichous ciliate Stylonychia mytilus have been investigated, using two intracellular micro-electrodes, when either Ca ions or Ba ions are the charge carriers. In cells bathed in Ca-free Ba solution the two inward currents, named current I and current II, could be identified and studied in the absence of outward currents. The two inward currents could also be separated by addition of the plant lectin concanavalin A (0.5 microgram/ml) to the external medium, which resulted in the selective inhibition of current I. When the holding potential was set at values between -45 and -65 mV (normal resting potential is -50 mV), current I was shifted parallel to the holding potential along the voltage axis. This shift was 7.6 mV per 10 mV change in holding potential. The amplitude and voltage relationship of current II was not affected by these changes in the holding potential. The amplitude of current I in Ba solution was maximal when the membrane potential was held at -55 mV; it decreased with higher and lower holding potentials. The rate of activation of current I remained virtually unaffected at holding potentials between -45 and -60 mV, and was somewhat reduced at a holding potential of -65 mV. When the extracellular Ca concentration was varied between 0.1 and 5.0 mM, or when the cells were loaded with EGTA to reduce the intracellular level of ionized Ca, the resting membrane potential and the voltage relationships of both current I and II and of the outward current were shifted along the voltage axis according to the expected changes in membrane surface potential. Double-pulse experiments with varying interval potentials suggested voltage-dependent inactivation of current I and Ca-dependent inactivation of current II. Pre-hyperpolarizing steps of only 1 mV amplitude and 30 ms duration could result in the activation of current I, indicating that the activation voltage of current I closely followed the actual

  3. Voltage-dependent currents of vertebrate neurons and their role in membrane excitability.

    PubMed

    Adams, P R; Galvan, M

    1986-01-01

    This chapter reviews what is known of the voltage-dependent conductances of three classes of vertebrate nerve cell, as assessed by somatic voltage clamping. These classes are: (1) bullfrog paravertebral sympathetic ganglion cells; (2) rodent superior cervical sympathetic ganglion cells; and (3) rodent hippocampal pyramidal cells. Of these, bullfrog neurons are the most thoroughly characterized. They possess at least seven distinct voltage-activated conductances. Two of these, called GNa and GCa, carry inward, depolarizing current. They both activate rapidly, and can, under appropriate conditions, generate action potentials. The remaining five conductances are all potassium-mediated, and can thus in principle produce hyperpolarizations or repolarize the action potential. However, because each of these potassium conductances have different sizes, speeds, and voltage thresholds, they play a variety of hyperpolarizing, stabilizing, or braking roles. IC is large, fast, and voltage dependent. Action potentials trigger calcium influx, which rapidly turns on IC. This repolarizes the action potential and turns off IC. However another Ca-dependent current, IAHP, remains active even at negative potentials and leads to a prolonged hyperpolarization. If IC is blocked, spike repolarization slows somewhat, allowing the Hodgkin-Huxley delayed rectifier current IK to develop. This is also large enough to repolarize the spike rapidly, although it is normally preempted by IC. IA and IM are other small potassium currents that activate at more negative potentials than do IC, IK, and IAHP. IA is a transient outward current that mainly influences voltage trajectories following hyperpolarizing current pulses. IM activates progressively during prolonged depolarizing current pulses, and, together with IAHP, explains most of the adaptation seen in these cells. The harmonious counterpoint of this septet of currents explains most of the electrical excitability properties of these cells

  4. Involvement of voltage-dependent anion channel (VDAC) in dengue infection

    PubMed Central

    Jitobaom, Kunlakanya; Tongluan, Natthida; Smith, Duncan R.

    2016-01-01

    During infection, dengue virus (DENV) proteins interact with host cellular constituents promoting the remodeling of the cell to facilitate virus production. While a number of interacting proteins have been identified for DENV non-structural proteins, far fewer interacting partners have been identified for the DENV structural proteins. One protein that has been identified as a DENV E protein interacting protein is the cellular chaperone GRP78. GRP78 has been shown to have a number of cellular interacting partners including the voltage-dependent anion channel (VDAC). In this study we confirmed the interactions between GRP78 and DENV E protein and between GRP78 and VDAC. VDAC was shown to be re-localized during DENV infection, with no change in levels of protein expression. VDAC is predominantly located on the outer membrane of mitochondria and our result is consistent with movement of the mitochondria towards the ER during DENV infection. Down regulation of VDAC through siRNA significantly reduced DENV protein expression, as well as the percentage infection and output virus titer. Our results suggest that VDAC plays an important role in DENV infection. PMID:27779201

  5. Optogenetic Control of Ca(2+) and Voltage-Dependent Large Conductance (BK) Potassium Channels.

    PubMed

    Mager, Thomas; Wood, Phillip G; Bamberg, Ernst

    2017-03-24

    Ca(2+) concentration jumps for the activation of Ca(2+)-dependent ion channels or transporters can be obtained either by fast solution exchange or by the use of caged Ca(2+). Here, we report on an alternate optogenetic method for the activation of Ca(2+) and voltage-dependent large conductance (BK) potassium channels. This was achieved through the use of the light-gated channelrhodopsin 2 variant, CatCh(Calcium translocating Channelrhodopsin) with enhanced Ca, which produces locally [Ca(2+)] in the μM range on the inner side of the membrane, without significant [Ca(2+)] increase in the cytosol. BK channel subunits α and β1 were expressed together with CatCh in HEK293 cells, and voltage and Ca(2+) dependence were analyzed. Light activation of endogenous BK channels under native conditions in astrocytes and glioma cells was also investigated. Additionally, BK channels were used as sensors for the calibration of the [Ca(2+)] on the inner surface of the cell membrane. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  6. Voltage-dependent Ca2+ channel and Na+ channel in frog taste cells.

    PubMed

    Kashiwayanagi, M; Miyake, M; Kurihara, K

    1983-01-01

    Frog taste cells were hyperpolarized by injecting an inward current pulse, and regenerative anode-break potentials were observed at the termination of the current pulse. The results obtained are as follows. 1) The magnitude of the anode-break potentials increased with the extent of hyperpolarization of taste cells and reached a saturation level around -200 mV. 2) The magnitudes of the anode-break potentials observed in 80 different taste cells hyperpolarized to about -200 mV were distributed widely from cell to cell. The average magnitude was 39 mV. 3) The anode-break potentials were recorded after the lingual artery was perfused with artificial solutions containing various channel blockers. The results indicated that the anode-break potentials are composed of Na+ and Ca2+ components. 4) The slope of the current-voltage relation obtained with cells hyperpolarized to 100 mV was appreciably decreased above -50 mV by application of tetrodotoxin to the perfusing solution. Discussion was made on possible roles of the voltage-dependent Na+ and Ca2+ channels in the electrotonic spreading of the depolarization at the receptor membranes to the synaptic area and in releasing a chemical transmitter.

  7. [Changes in the expression of voltage-dependent ca2+ channels in asthenospermia].

    PubMed

    Li, Lu; Liu, Ji-hong

    2007-08-01

    To study the relationship between the expression of voltage-dependent Ca2+ channels (VDCCs) cal mRNA and asthenospermia. Based on the WHO criteria, we filtered the donated semen by computer-aided sperm analysis (CASA), optimized the ejaculated sperm by discontinuous Percoll grads centrifugation, and examined and quantitated the multitype VDCCs alpha1 mRNA expressions in the sperm of normal men and asthenospermia patients using reverse transcription polymerase chain reaction (RT-PCR). Compared with the normal sperm, there were significant differences among the expressions of alpha1B (39.40 +/- 9.47), alpha1C (48.30 +/- 11.60), alpha1E (3.20 +/- 0.78), alpha1G (8.40 +/- 2.03) and alpha1H (5.70 +/- 1.47) mRNA messages in asthenospermia (P < 0.01). The abnormal expression of L-type and/or non-L-type VDCCs' mRNAs may be one of the causes of asthenospermia.

  8. Regulation of Mitochondrial Function by Voltage Dependent Anion Channels in Ethanol Metabolism and the Warburg Effect

    PubMed Central

    Lemasters, John J.; Holmuhamedov, Ekhson L.; Czerny, Christoph; Zhong, Zhi; Maldonado, Eduardo N.

    2012-01-01

    Voltage dependent anion channels (VDAC) are highly conserved proteins that are responsible for permeability of the mitochondrial outer membrane to hydrophilic metabolites like ATP, ADP and respiratory substrates. Although previously assumed to remain open, VDAC closure is emerging as an important mechanism for regulation of global mitochondrial metabolism in apoptotic cells and also in cells that are not dying. During hepatic ethanol oxidation to acetaldehyde, VDAC closure suppresses exchange of mitochondrial metabolites, resulting in inhibition of ureagenesis. In vivo, VDAC closure after ethanol occurs coordinately with mitochondrial uncoupling. Since acetaldehyde passes through membranes independently of channels and transporters, VDAC closure and uncoupling together foster selective and more rapid oxidative metabolism of toxic acetaldehyde to nontoxic acetate by mitochondrial aldehyde dehydrogenase. In single reconstituted VDAC, tubulin decreases VDAC conductance, and in HepG2 hepatoma cells, free tubulin negatively modulates mitochondrial membrane potential, an effect enhanced by protein kinase A. Tubulin-dependent closure of VDAC in cancer cells contributes to suppression of mitochondrial metabolism and may underlie the Warburg phenomenon of aerobic glycolysis. PMID:22172804

  9. Applied voltage dependence of nano-oxidation of ferromagnetic thin films using atomic force microscope

    NASA Astrophysics Data System (ADS)

    Takemura, Yasushi; Kidaka, Seiichi; Watanabe, Keizo; Nasu, Yasuaki; Yamada, Tsutomu; Shirakashi, Jun-ichi

    2003-05-01

    Nanodots of Ni, CoFe, and Cr oxide were fabricated by the nano-oxidation technique using atomic force microscope. The dot size was controlled from 40 to 200 nm by changing the pulse voltage applied to the cantilever from 2 to 10 V. In order to evaluate the size of the nanostructures quantitatively, the electric field emitted from the cantilever was calculated. The threshold electric field strength was defined as the minimum strength to promote the oxidation. The threshold field strength of the order of 107 V/m was derived by fitting the experimental results. The voltage dependence of the size of fabricated Cr-oxide dots was fitted well by the calculation. The dot size of the ferromagnet-based oxide was fluctuating and did not agree with the calculation. From the theoretical analysis, it was suggested that the size of the nanostructures did not depend on the distance between the cantilever and film surface, but significantly depended on the curvature radius of the cantilever.

  10. Stochastic diffusion model of multistep activation in a voltage-dependent K channel

    NASA Astrophysics Data System (ADS)

    Vaccaro, S. R.

    2010-04-01

    The energy barrier to the activated state for the S4 voltage sensor of a K channel is dependent on the electrostatic force between positively charged S4 residues and negatively charged groups on neighboring segments, the potential difference across the membrane, and the dielectric boundary force on the charged residues near the interface between the solvent and the low dielectric region of the membrane gating pore. The variation of the potential function with transverse displacement and rotation of the S4 sensor across the membrane may be derived from a solution of Poisson's equation for the electrostatic potential. By approximating the energy of an S4 sensor along a path between stationary states by a piecewise linear function of the transverse displacement, the dynamics of slow activation, in the millisecond range, may be described by the lowest frequency component of an analytical solution of interacting diffusion equations of Fokker-Planck type for resting and barrier regions. The solution of the Smoluchowski equations for an S4 sensor in an energy landscape with several barriers is in accord with an empirical master equation for multistep activation in a voltage-dependent K channel.

  11. Voltage-dependent calcium and chloride currents in S17 bone marrow stromal cell line.

    PubMed

    Silva, Henrique B; Medei, Emiliano; Rodrigues, Deivid C; Rondinelli, Edson; Almeida, Norma A S; Goldenberg, Regina C S; de Carvalho, Antonio C Campos; Nascimento, José H M

    2010-04-01

    The bone marrow stromal cell line S17 has been used to study hematopoiesis in vitro. In this study, we demonstrate the presence of calcium and chloride currents in cultured S17 cells. Calcium currents were of low amplitude or barely detectable (50-100 pA). Hence to amplify the currents, we have used barium as a charge carrier. Barium currents were identified based on their distinct voltage-dependence, and sensitivity to dihydropyridines. S17 cells also exhibited a slowly activating outward current without inactivation, most commonly seen when the sodium of the extracellular solution was replaced either by TEA (TEA/Cs saline) or NMDG (NMDG saline), or by addition of amiloride to the extracellular solution. This current was abolished either by 500 microM SITS (4,4'-diisothiocyanatostilbene-2-2'-disulfonic acid) or 500 microM DPC (diphenylamine-2-carboxylic acid) a cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel blocker, identifying it as a Cl(-) current. RT-PCR identified the presence of ENaC and CFTR transcripts. CFTR blockade reduced cell proliferation, suggesting that this channel plays a physiological role in regulation of S17 cell proliferation.

  12. Modulation of the voltage-dependent anion channel of mitochondria by elaidic acid.

    PubMed

    Tewari, Debanjan; Bera, Amal Kanti

    2016-08-26

    Dietary trans fatty acids (TFAs) are known to increase the risk of cardiovascular diseases by altering plasma lipid profile and activating various inflammatory signaling pathways. Here we show that elaidic acid (EA), the most abundant TFA in diet, alters the electrophysiological properties of voltage-dependent anion channel (VDAC) of mitochondria. Purified bovine brain VDAC, when incorporated in the planar lipid bilayer (PLB) composed of 1,2-diphytanoyl-sn-glycero-3 phosphatidyl choline (DPhPC) and EA in a 9 to 1 ratio (wt/wt), exhibited complete closing events at different voltages. The closing events were observed at even -10 mV, a voltage at which VDAC usually remains fully open all the time. Additionally, the voltage sensitivity of VDAC was lost in presence of EA; the channel conductance did not decrease with increasing voltages. In identical experimental conditions, membrane containing oleic acid (OA), the cis isomer of EA did not produce any such effect. We propose that EA possibly exerts its adverse effect by modulating VDAC. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Nortriptyline, a tricyclic antidepressant, inhibits voltage-dependent K+ channels in coronary arterial smooth muscle cells

    PubMed Central

    Shin, Sung Eun; Li, Hongliang; Kim, Han Sol; Kim, Hye Won; Seo, Mi Seon; Ha, Kwon-Soo; Han, Eun-Taek; Hong, Seok-Ho; Firth, Amy L.; Choi, Il-Whan; Bae, Young Min

    2017-01-01

    We demonstrated the effect of nortriptyline, a tricyclic antidepressant drug and serotonin reuptake inhibitor, on voltage-dependent K+ (Kv) channels in freshly isolated rabbit coronary arterial smooth muscle cells using a whole-cell patch clamp technique. Nortriptyline inhibited Kv currents in a concentration-dependent manner, with an apparent IC50 value of 2.86±0.52 µM and a Hill coefficient of 0.77±0.1. Although application of nortriptyline did not change the activation curve, nortriptyline shifted the inactivation current toward a more negative potential. Application of train pulses (1 or 2 Hz) did not change the nortriptyline-induced Kv channel inhibition, suggesting that the effects of nortiprtyline were not use-dependent. Preincubation with the Kv1.5 and Kv2.1/2.2 inhibitors, DPO-1 and guangxitoxin did not affect nortriptyline inhibition of Kv channels. From these results, we concluded that nortriptyline inhibited Kv channels in a concentration-dependent and state-independent manner independently of serotonin reuptake. PMID:28280416

  14. Structure and expression of mouse mitochondrial voltage dependent anion channel genes

    SciTech Connect

    Craigen, W.J.; Lovell, R.S.; Sampson, M.J.

    1994-09-01

    Voltage dependent anion channels (VDACs) are small abundant proteins of the outer mitochondrial membrane that interact with the adenine nucleotide translocater and bind glycerol kinase and hexokinase. Kinase binding is developmentally regulated, tissue specific, and increased in various tumor cell lines. VDACs are also components of the peripheral benzodiazepine receptor and GABA{sub A} receptor. Two human VDAC cDNAs have previously been reported, and expression of these isoforms appears ubiquitous. Genomic Southern analysis suggests the presence of other as yet uncharacterised VDAC genes. To study VDAC function in a mammal more amenable to experimental manipulation, we have isolated three mouse VDAC genes by cDNA cloning from a mouse brain cDNA library. DNA sequencing of the cDNAs shows that they share 65-75% amino acid identity. Northern analysis indicates that MVDAC1 is expressed most highly in kidney, heart, and brain. Using an MVDAC3 3{prime} untranslated exon as a probe, three distinct transcripts can be detected. The gene structure for MVDAC3 and MVDAC2 has been completed and suggests that the VDAC isoforms did not arise by gene duplication and divergence. The intron/exon boundaries are not conserved between MVDAC1 and MVDAC3, and MVDAC2 appears to be encoded by a single intronless gene.

  15. Regulation of mitochondrial function by voltage dependent anion channels in ethanol metabolism and the Warburg effect.

    PubMed

    Lemasters, John J; Holmuhamedov, Ekhson L; Czerny, Christoph; Zhong, Zhi; Maldonado, Eduardo N

    2012-06-01

    Voltage dependent anion channels (VDAC) are highly conserved proteins that are responsible for permeability of the mitochondrial outer membrane to hydrophilic metabolites like ATP, ADP and respiratory substrates. Although previously assumed to remain open, VDAC closure is emerging as an important mechanism for regulation of global mitochondrial metabolism in apoptotic cells and also in cells that are not dying. During hepatic ethanol oxidation to acetaldehyde, VDAC closure suppresses exchange of mitochondrial metabolites, resulting in inhibition of ureagenesis. In vivo, VDAC closure after ethanol occurs coordinately with mitochondrial uncoupling. Since acetaldehyde passes through membranes independently of channels and transporters, VDAC closure and uncoupling together foster selective and more rapid oxidative metabolism of toxic acetaldehyde to nontoxic acetate by mitochondrial aldehyde dehydrogenase. In single reconstituted VDAC, tubulin decreases VDAC conductance, and in HepG2 hepatoma cells, free tubulin negatively modulates mitochondrial membrane potential, an effect enhanced by protein kinase A. Tubulin-dependent closure of VDAC in cancer cells contributes to suppression of mitochondrial metabolism and may underlie the Warburg phenomenon of aerobic glycolysis. This article is part of a Special Issue entitled: VDAC structure, function, and regulation of mitochondrial metabolism.

  16. Pharmacological investigation of voltage-dependent Ca2+ channels in human ejaculatory sperm in vitro.

    PubMed

    Li, Lu; Liu, Jihong; Li, Jiagui; Ye, Zhangqun

    2006-01-01

    The types of the voltage-dependent calcium channels (VDCCs) in human ejaculatory sperm and the effects of calcium channel blocker (CCB) on human sperm motility parameters in vitro were investigated. The human sperm motility parameters in vitro in response to the pharmacological agents nifedipine (NIF, inhibitor of L-type VDCC) and co-conotoxin (GVIA, inhibitor of N-type VDCC) were compared and analyzed statistically. The results showed that NIF (1, 5, 10 micromol/L) could not only significantly affect human sperm's shape but also spermatozoa motility after incubated at least 10 min in vitro (P<0.001). GVIA (0.1, 0.5 and 1 micromol/L) could just only significantly affect human sperm's progressive motility (a %+b %) after incubated for 20 min in vitro (P<0.01), but they both could not significantly affect spermic abnormality rate. It is suggested that L-type VDCC, non L-type VDCCs and isoform of L-type VDCC exist in the cell membrane of human sperm solely or together, and they participate in the spermic physiological processes especially the spermic motility.

  17. Cortisone dissociates voltage-dependent K+ channel from its beta subunit

    PubMed Central

    Pan, Yaping; Weng, Jun; Kabaleeswaran, Venkataraman; Li, Huiguang; Cao, Yu; Bhosle, Rahul C.; Zhou, Ming

    2009-01-01

    The Shaker family voltage-dependent potassium channels (Kv1) are expressed in a wide variety of cells and essential for cellular excitability. In humans, loss-of-function mutations of Kv1 channels lead to hyperexcitability and are directly linked to episodic ataxia and atrial fibrillation. All Kv1 channels assemble with beta subunits (Kvβ) and certain Kvβs, for example Kvβ1, have an N-terminal segment that closes a channel by the N-type inactivation mechanism. In principle dissociation of Kvβ1, although never reported, should eliminate inactivation and thus potentiate Kv1 current. We found that cortisone increases mammalian (rat) Kv1 channel activity by binding to Kvβ1. A crystal structure of the Kvβ-cortisone complex was solved to 1.82 Å resolution and revealed novel cortisone binding sites. Further studies demonstrated that cortisone promotes dissociation of Kvβ. The new mode of channel modulation may be explored by native or synthetic ligands to fine tune cellular excitability. PMID:18806782

  18. Complex voltage-dependent behavior of single unliganded calcium-sensitive potassium channels.

    PubMed Central

    Talukder, G; Aldrich, R W

    2000-01-01

    study and characterization of unliganded openings is of central significance for the elucidation of gating mechanisms for allosteric ligand-gated ion channels. Unliganded openings have been reported for many channel types, but their low open probability can make it difficult to study their kinetics in detail. Because the large conductance calcium-activated potassium channel mSlo is sensitive to both intracellular calcium and to membrane potential, we have been able to obtain stable unliganded single-channel recordings of mSlo with relatively high opening probability. We have found that the single-channel gating behavior of mSlo is complex, with multiple open and closed states, even when no ligand is present. Our results rule out a Monod-Wyman-Changeux allosteric mechanism with a central voltage-dependent concerted step, and they support the existence of quaternary states with less than the full number of voltage sensors activated, as has been suggested by previous work involving measurements of gating currents. PMID:10653789

  19. Functional unit size of the neurotoxin receptors on the voltage-dependent sodium channel.

    PubMed

    Angelides, K J; Nutter, T J; Elmer, L W; Kempner, E S

    1985-03-25

    Radiation inactivation was used in situ to determine the functional unit sizes of the neurotoxin receptors of the voltage-dependent sodium channel from rat brain. Frozen or lyophilized synaptosomes were irradiated with high energy electrons generated by a linear accelerator and assayed for [3H]saxitoxin, 125I-Leiurus quinquestriatus quinquestriatus (alpha-scorpion toxin), 125I-Centruroides suffusus suffusus (beta-scorpion toxin), and batrachotoxinin-A 20 alpha-[3H]benzoate binding activity. The functional unit size of the neurotoxin receptors determined in situ by target analysis are 220,000 for saxitoxin, 263,000 for alpha-scorpion toxin, and 45,000 for beta-scorpion toxin. Analysis of the inactivation curve for batrachotoxinin-A 20 alpha-benzoate binding to the channel yields two target sizes of Mr approximately 287,000 (50%) and approximately 51,000 (50%). The results are independent of the purity of the membrane preparation. Comparison of the radiation inactivation data with the protein composition of the rat brain sodium channel indicates that there are at least two functional components.

  20. Selective pressure modulation of synaptic voltage-dependent calcium channels-involvement in HPNS mechanism.

    PubMed

    Aviner, Ben; Gradwohl, Gideon; Bliznyuk, Alice; Grossman, Yoram

    2016-10-01

    Exposure to hyperbaric pressure (HP) exceeding 100 msw (1.1 MPa) is known to cause a constellation of motor and cognitive impairments named high-pressure neurological syndrome (HPNS), considered to be the result of synaptic transmission alteration. Long periods of repetitive HP exposure could be an occupational risk for professional deep-sea divers. Previous studies have indicated the modulation of presynaptic Ca(2+) currents based on synaptic activity modified by HP. We have recently demonstrated that currents in genetically identified cellular voltage-dependent Ca(2+) channels (VDCCs), CaV 1.2 and CaV 3.2 are selectively affected by HP. This work further elucidates the HPNS mechanism by examining HP effect on Ca(2+) currents in neuronal VDCCs, CaV 2.2 and CaV 2.1, which are prevalent in presynaptic terminals, expressed in Xenopus oocytes. HP augmented the CaV 2.2 current amplitude, much less so in a channel variation containing an additional modulatory subunit, and had almost no effect on the CaV 2.1 currents. HP differentially affected the channels' kinetics. It is, therefore, suggested that HPNS signs and symptoms arise, at least in part, from pressure modulation of various VDCCs. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  1. Voltage-dependent potassium currents in cochlear hair cells of the embryonic chick.

    PubMed

    Griguer, C; Fuchs, P A

    1996-01-01

    1. Hair cells were isolated from apical and basal regions of the embryonic chick's cochlea. Outward potassium currents were recorded using whole cell tight-seal voltage clamp. 2. Outward currents in basal hair cells activated and inactivated rapidly. The average time to half-maximum at 0 mV was 2.9 ms. The time constant of inactivation at 0 mV was 71 ms. Boltzmann fits to conductance-voltage curves gave an average half-activation voltage of -36 mV, and steady-state inactivation was half-maximal at -62 mV. 3. Potassium currents in apical hair cells had slower kinetics, with a time to half-maximum of 6.7 ms and an inactivation time constant of 242 ms at + 10 mV. The half-activation voltage derived from Boltzmann fits was -16 mV and that for inactivation was -43 mV. 4. With respect to kinetic and voltage-dependent properties, the rapidly and slowly activating potassium currents of embryonic cells were similar to the rapidly inactivating "A" current of mature short hair cells and to the delayed rectifier of mature tall hair cells. However, unlike the adult currents, the embryonic currents did not show differential sensitivities to tetraethylammonium chloride and 4-aminopyridine. As early as the tenth day of embryogenesis, hair cells at the apical and basal extremes of the cochlea produced functionally distinct voltage-gated potassium currents.

  2. Gate-voltage-dependent charge transport in multi-dispersed polymer thin films

    NASA Astrophysics Data System (ADS)

    Zhou, Ling; Bu, Laju; Li, Dongfan; Lu, Guanghao

    2017-02-01

    In semiconductor polymers, charge transport usually occurs via hopping between localized states, which are generally multi-dispersed due to multi-dispersed chemical structures, crystallinities, and phase segregations. We report a combined modeling and experimental study to investigate gate-voltage-dependent charge transport in field-effect transistors based on multi-dispersed polymers including semiconductor:semiconductor and semiconductor:insulator blends. Film-depth-dependent charge accumulation and transport are correlated with vertical composition profiles and film-depth-dependent energetic distribution of localized states. Even low gate-voltage could accumulate charges in any depth of the films, greatly increasing charge density in some (sub-) components for effective charge transport. Therefore, neither overall high crystallinity nor molecular ordering near the semiconductor-dielectric interface is necessarily required for high field-effect mobility (μFET). This study not only proposes a model for high effective μFET recently reported in some nearly amorphous polymer films and the "bislope feature" in their transfer characteristics but also helps improve transistor performances and exploit transistor operations via manipulating charge distribution in multi-dispersed films.

  3. Fractal analysis of a voltage-dependent potassium channel from cultured mouse hippocampal neurons.

    PubMed Central

    Liebovitch, L S; Sullivan, J M

    1987-01-01

    The kinetics of ion channels have been widely modeled as a Markov process. In these models it is assumed that the channel protein has a small number of discrete conformational states and the kinetic rate constants connecting these states are constant. In the alternative fractal model the spontaneous fluctuations of the channel protein at many different time scales are represented by a kinetic rate constant k = At1-D, where A is the kinetic setpoint and D the fractal dimension. Single-channel currents were recorded at 146 mM external K+ from an inwardly rectifying, 120 pS, K+ selective, voltage-sensitive channel in cultured mouse hippocampal neurons. The kinetics of these channels were found to be statistically self-similar at different time scales as predicted by the fractal model. The fractal dimensions were approximately 2 for the closed times and approximately 1 for the open times and did not depend on voltage. For both the open and closed times the logarithm of the kinetic setpoint was found to be proportional to the applied voltage, which indicates that the gating of this channel involves the net inward movement of approximately one negative charge when this channel opens. Thus, the open and closed times and the voltage dependence of the gating of this channel are well described by the fractal model. PMID:2447974

  4. Kramers' diffusion theory applied to gating kinetics of voltage-dependent ion channels.

    PubMed Central

    Sigg, D; Qian, H; Bezanilla, F

    1999-01-01

    Kramers' diffusion theory of reaction rates in the condensed phase is considered as an alternative to the traditional discrete-state Markov (DSM) model in describing ion channel gating current kinetics. Diffusion theory can be expected to be particularly relevant in describing high-frequency (>100 kHz) events in channel activation. The generalized voltage sensor of a voltage-dependent ion channel is treated as a Brownian motion particle undergoing spatial diffusion along a one-dimensional energy landscape. Two classes of energy landscapes are considered. The first class contains large barriers, which give rise to gating currents with two distinct time scales: the usual low-frequency decay, which can modeled with a DSM scheme, and a high-frequency component arising from intrastate relaxation. Large depolarizations reduce potential barriers to such a degree that activation rates are diffusion limited, causing the two time scales to merge. Landscapes of the second class are either featureless or contain barriers that are small compared to kT; these are termed "drift landscapes." These landscapes require a larger friction coefficient to generate slow gating kinetics. The high-frequency component that appears with barrier models is not present in pure drift motion. The presence of a high-frequency component can be tested experimentally with large-bandwidth recordings of gating currents. Topics such as frequency domain analysis, spatial dependence of the friction coefficient, methods for determining the adequacy of a DSM model, and the development of physical models of gating are explored. PMID:9929481

  5. Balanced ionotropic receptor dynamics support signal estimation via voltage-dependent membrane noise

    PubMed Central

    Marcoux, Curtis M.; Clarke, Stephen E.; Nesse, William H.; Longtin, Andre

    2015-01-01

    Encoding behaviorally relevant stimuli in a noisy background is critical for animals to survive in their natural environment. We identify core biophysical and synaptic mechanisms that permit the encoding of low-frequency signals in pyramidal neurons of the weakly electric fish Apteronotus leptorhynchus, an animal that can accurately encode even miniscule amplitude modulations of its self-generated electric field. We demonstrate that slow NMDA receptor (NMDA-R)-mediated excitatory postsynaptic potentials (EPSPs) are able to summate over many interspike intervals (ISIs) of the primary electrosensory afferents (EAs), effectively eliminating the baseline EA ISI correlations from the pyramidal cell input. Together with a dynamic balance of NMDA-R and GABA-A-R currents, this permits stimulus-evoked changes in EA spiking to be transmitted efficiently to target electrosensory lobe (ELL) pyramidal cells, for encoding low-frequency signals. Interestingly, AMPA-R activity is depressed and appears to play a negligible role in the generation of action potentials. Instead, we hypothesize that cell-intrinsic voltage-dependent membrane noise supports the encoding of perithreshold sensory input; this noise drives a significant proportion of pyramidal cell spikes. Together, these mechanisms may be sufficient for the ELL to encode signals near the threshold of behavioral detection. PMID:26561607

  6. Balanced ionotropic receptor dynamics support signal estimation via voltage-dependent membrane noise.

    PubMed

    Marcoux, Curtis M; Clarke, Stephen E; Nesse, William H; Longtin, Andre; Maler, Leonard

    2016-01-01

    Encoding behaviorally relevant stimuli in a noisy background is critical for animals to survive in their natural environment. We identify core biophysical and synaptic mechanisms that permit the encoding of low-frequency signals in pyramidal neurons of the weakly electric fish Apteronotus leptorhynchus, an animal that can accurately encode even miniscule amplitude modulations of its self-generated electric field. We demonstrate that slow NMDA receptor (NMDA-R)-mediated excitatory postsynaptic potentials (EPSPs) are able to summate over many interspike intervals (ISIs) of the primary electrosensory afferents (EAs), effectively eliminating the baseline EA ISI correlations from the pyramidal cell input. Together with a dynamic balance of NMDA-R and GABA-A-R currents, this permits stimulus-evoked changes in EA spiking to be transmitted efficiently to target electrosensory lobe (ELL) pyramidal cells, for encoding low-frequency signals. Interestingly, AMPA-R activity is depressed and appears to play a negligible role in the generation of action potentials. Instead, we hypothesize that cell-intrinsic voltage-dependent membrane noise supports the encoding of perithreshold sensory input; this noise drives a significant proportion of pyramidal cell spikes. Together, these mechanisms may be sufficient for the ELL to encode signals near the threshold of behavioral detection.

  7. Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

    PubMed

    Held, Katharina; Voets, Thomas; Vriens, Joris

    2016-01-01

    Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

  8. Functional coupling between large-conductance potassium channels and Cav3.2 voltage-dependent calcium channels participates in prostate cancer cell growth

    PubMed Central

    Gackière, Florian; Warnier, Marine; Katsogiannou, Maria; Derouiche, Sandra; Delcourt, Philippe; Dewailly, Etienne; Slomianny, Christian; Humez, Sandrine; Prevarskaya, Natalia; Roudbaraki, Morad; Mariot, Pascal

    2013-01-01

    Summary It is strongly suspected that potassium (K+) channels are involved in various aspects of prostate cancer development, such as cell growth. However, the molecular nature of those K+ channels implicated in prostate cancer cell proliferation and the mechanisms through which they control proliferation are still unknown. This study uses pharmacological, biophysical and molecular approaches to show that the main voltage-dependent K+ current in prostate cancer LNCaP cells is carried by large-conductance BK channels. Indeed, most of the voltage-dependent current was inhibited by inhibitors of BK channels (paxillin and iberiotoxin) and by siRNA targeting BK channels. In addition, we reveal that BK channels constitute the main K+ channel family involved in setting the resting membrane potential in LNCaP cells at around −40 mV. This consequently promotes a constitutive calcium entry through T-type Cav3.2 calcium channels. We demonstrate, using single-channel recording, confocal imaging and co-immunoprecipitation approaches, that both channels form macromolecular complexes. Finally, using flow cytometry cell cycle measurements, cell survival assays and Ki67 immunofluorescent staining, we show that both BK and Cav3.2 channels participate in the proliferation of prostate cancer cells. PMID:24143281

  9. The Voltage-dependent Anion Channel 1 Mediates Amyloid β Toxicity and Represents a Potential Target for Alzheimer Disease Therapy.

    PubMed

    Smilansky, Angela; Dangoor, Liron; Nakdimon, Itay; Ben-Hail, Danya; Mizrachi, Dario; Shoshan-Barmatz, Varda

    2015-12-25

    The voltage-dependent anion channel 1 (VDAC1), found in the mitochondrial outer membrane, forms the main interface between mitochondrial and cellular metabolisms, mediates the passage of a variety of molecules across the mitochondrial outer membrane, and is central to mitochondria-mediated apoptosis. VDAC1 is overexpressed in post-mortem brains of Alzheimer disease (AD) patients. The development and progress of AD are associated with mitochondrial dysfunction resulting from the cytotoxic effects of accumulated amyloid β (Aβ). In this study we demonstrate the involvement of VDAC1 and a VDAC1 N-terminal peptide (VDAC1-N-Ter) in Aβ cell penetration and cell death induction. Aβ directly interacted with VDAC1 and VDAC1-N-Ter, as monitored by VDAC1 channel conductance, surface plasmon resonance, and microscale thermophoresis. Preincubated Aβ interacted with bilayer-reconstituted VDAC1 and increased its conductance ∼ 2-fold. Incubation of cells with Aβ resulted in mitochondria-mediated apoptotic cell death. However, the presence of non-cell-penetrating VDAC1-N-Ter peptide prevented Aβ cellular entry and Aβ-induced mitochondria-mediated apoptosis. Likewise, silencing VDAC1 expression by specific siRNA prevented Aβ entry into the cytosol as well as Aβ-induced toxicity. Finally, the mode of Aβ-mediated action involves detachment of mitochondria-bound hexokinase, induction of VDAC1 oligomerization, and cytochrome c release, a sequence of events leading to apoptosis. As such, we suggest that Aβ-mediated toxicity involves mitochondrial and plasma membrane VDAC1, leading to mitochondrial dysfunction and apoptosis induction. The VDAC1-N-Ter peptide targeting Aβ cytotoxicity is thus a potential new therapeutic strategy for AD treatment.

  10. Charged Residues Distribution Modulates Selectivity of the Open State of Human Isoforms of the Voltage Dependent Anion-Selective Channel

    PubMed Central

    Messina, Angela; De Pinto, Vito; Ceccarelli, Matteo

    2014-01-01

    Voltage Dependent Anion-selective Channels (VDACs) are pore-forming proteins located in the outer mitochondrial membrane. They are responsible for the access of ions and energetic metabolites into the inner membrane transport systems. Three VDAC isoforms exist in mammalian, but their specific role is unknown. In this work we have performed extensive (overall ∼5 µs) Molecular Dynamics (MD) simulations of the human VDAC isoforms to detect structural and conformational variations among them, possibly related to specific functional roles of these proteins. Secondary structure analysis of the N-terminal domain shows a high similarity among the three human isoforms of VDAC but with a different plasticity. In particular, the N-terminal domain of the hVDAC1 is characterized by a higher plasticity, with a ∼20% occurrence for the ‘unstructured’ conformation throughout the folded segment, while hVDAC2, containing a peculiar extension of 11 amino acids at the N-terminal end, presents an additional 310-helical folded portion comprising residues 10′ to 3, adhering to the barrel wall. The N-terminal sequences of hVDAC isoforms are predicted to have a low flexibility, with possible consequences in the dynamics of the human VDACs. Clear differences were found between hVDAC1 and hVDAC3 against hVDAC2: a significantly modified dynamics with possible important consequence on the voltage-gating mechanism. Charge distribution inside and at the mouth of the pore is responsible for a different preferential localization of ions with opposite charge and provide a valuable rationale for hVDAC1 and hVDAC3 having a Cl−/K+ selectivity ratio of 1.8, whereas hVDAC2 of 1.4. Our conclusion is that hVDAC isoforms, despite sharing a similar scaffold, have modified working features and a biological work is now requested to give evidence to the described dissimilarities. PMID:25084457

  11. Charged residues distribution modulates selectivity of the open state of human isoforms of the voltage dependent anion-selective channel.

    PubMed

    Amodeo, Giuseppe Federico; Scorciapino, Mariano Andrea; Messina, Angela; De Pinto, Vito; Ceccarelli, Matteo

    2014-01-01

    Voltage Dependent Anion-selective Channels (VDACs) are pore-forming proteins located in the outer mitochondrial membrane. They are responsible for the access of ions and energetic metabolites into the inner membrane transport systems. Three VDAC isoforms exist in mammalian, but their specific role is unknown. In this work we have performed extensive (overall ∼5 µs) Molecular Dynamics (MD) simulations of the human VDAC isoforms to detect structural and conformational variations among them, possibly related to specific functional roles of these proteins. Secondary structure analysis of the N-terminal domain shows a high similarity among the three human isoforms of VDAC but with a different plasticity. In particular, the N-terminal domain of the hVDAC1 is characterized by a higher plasticity, with a ∼20% occurrence for the 'unstructured' conformation throughout the folded segment, while hVDAC2, containing a peculiar extension of 11 amino acids at the N-terminal end, presents an additional 310-helical folded portion comprising residues 10' to 3, adhering to the barrel wall. The N-terminal sequences of hVDAC isoforms are predicted to have a low flexibility, with possible consequences in the dynamics of the human VDACs. Clear differences were found between hVDAC1 and hVDAC3 against hVDAC2: a significantly modified dynamics with possible important consequence on the voltage-gating mechanism. Charge distribution inside and at the mouth of the pore is responsible for a different preferential localization of ions with opposite charge and provide a valuable rationale for hVDAC1 and hVDAC3 having a Cl-/K+ selectivity ratio of 1.8, whereas hVDAC2 of 1.4. Our conclusion is that hVDAC isoforms, despite sharing a similar scaffold, have modified working features and a biological work is now requested to give evidence to the described dissimilarities.

  12. Voltage-dependent K+ channel gating and voltage sensor toxin sensitivity depend on the mechanical state of the lipid membrane

    PubMed Central

    Schmidt, Daniel; MacKinnon, Roderick

    2008-01-01

    Voltage-dependent K+ (Kv) channels underlie action potentials through gating conformational changes that are driven by membrane voltage. In this study of the paddle chimera Kv channel, we demonstrate that the rate of channel opening, the voltage dependence of the open probability, and the maximum achievable open probability depend on the lipid membrane environment. The activity of the voltage sensor toxin VsTx1, which interferes with voltage-dependent gating by partitioning into the membrane and binding to the channel, also depends on the membrane. Membrane environmental factors that influence channel function are divisible into two general categories: lipid compositional and mechanical state. The mechanical state can have a surprisingly large effect on the function of a voltage-dependent K+ channel, including its pharmacological interaction with voltage sensor toxins. The dependence of VSTx1 activity on the mechanical state of the membrane leads us to hypothesize that voltage sensor toxins exert their effect by perturbing the interaction forces that exist between the channel and the membrane. PMID:19050073

  13. Origin of the voltage dependence of G-protein regulation of P/Q-type Ca2+ channels.

    PubMed

    Zhang, Yun; Chen, Yu-Hang; Bangaru, Saroja D; He, Linling; Abele, Kathryn; Tanabe, Shihori; Kozasa, Tohru; Yang, Jian

    2008-12-24

    G-protein (Gbetagamma)-mediated voltage-dependent inhibition of N- and P/Q-type Ca(2+) channels contributes to presynaptic inhibition and short-term synaptic plasticity. The voltage dependence derives from the dissociation of Gbetagamma from the inhibited channels, but the underlying molecular and biophysical mechanisms remain largely unclear. In this study we investigated the role in this process of Ca(2+) channel beta subunit (Ca(v)beta) and a rigid alpha-helical structure between the alpha-interacting domain (AID), the primary Ca(v)beta docking site on the channel alpha(1) subunit, and the pore-lining IS6 segment. Gbetagamma inhibition of P/Q-type channels was reconstituted in giant inside-out membrane patches from Xenopus oocytes. Large populations of channels devoid of Ca(v)beta were produced by washing out a mutant Ca(v)beta with a reduced affinity for the AID. These beta-less channels were still inhibited by Gbetagamma, but without any voltage dependence, indicating that Ca(v)beta is indispensable for voltage-dependent Gbetagamma inhibition. A truncated Ca(v)beta containing only the AID-binding guanylate kinase (GK) domain could fully confer voltage dependence to Gbetagamma inhibition. Gbetagamma did not alter inactivation properties, and channels recovered from Gbetagamma inhibition exhibited the same activation property as un-inhibited channels, indicating that Gbetagamma does not dislodge Ca(v)beta from the inhibited channel. Furthermore, voltage-dependent Gbetagamma inhibition was abolished when the rigid alpha-helix between the AID and IS6 was disrupted by insertion of multiple glycines, which also eliminated Ca(v)beta regulation of channel gating, revealing a pivotal role of this rigid alpha-helix in both processes. These results suggest that depolarization-triggered movement of IS6, coupled to the subsequent conformational change of the Gbetagamma-binding pocket through a rigid alpha-helix induced partly by the Ca(v)beta GK domain, causes the

  14. Participation of fast-activating, voltage-dependent K currents in electrical slow waves of colonic circular muscle.

    PubMed

    Thornbury, K D; Ward, S M; Sanders, K M

    1992-07-01

    The plateau phase of electrical slow waves in phasic gastrointestinal muscles is critical for excitation-contraction coupling. The plateau appears to depend upon a balance between inward Ca2+ current and outward K+ currents that is sustained for several seconds. Voltage-dependent, non-Ca(2+)-dependent K currents were studied in canine colonic circular muscle cells using the whole cell patch-clamp technique. At room temperature, depolarization activated a slow outward current that showed little inactivation during 500 ms. Increasing the temperature to 37 degrees C significantly increased the rate of activation of voltage-dependent outward current. The onset of the outward current overlapped the transient inward Ca2+ current, suggesting that this K current may act as a brake on the upstroke depolarization of electrical slow waves in intact muscles. Voltage-dependent outward current was sustained for the duration of test pulses. This current balanced the sustained inward current that was also activated at physiological test potentials. The outward current evoked by test pulses positive to -20 mV inactivated by at least 50% within 500 ms. Half inactivation occurred at -36 mV. Voltage-dependent K current was reduced by 4-aminopyridine (4-AP; 1-5 mM), but difference currents obtained by subtracting currents elicited from holding potentials of -45 mV from currents obtained from holding potentials of -100 mV were not affected by 4-AP (1 mM). Studies were also performed on intact muscles to test the effects of 4-AP on electrical slow waves. 4-AP increased the amplitude and rate of rise of the upstroke potential and increased the amplitude and prolonged the plateau phase of slow waves. These data suggest that a rapidly activating, inactivating, voltage-dependent K current participates in electrical slow waves of colonic circular smooth muscles.

  15. Pacemaking in dopaminergic ventral tegmental area neurons: depolarizing drive from background and voltage-dependent sodium conductances

    PubMed Central

    Khaliq, Zayd M.; Bean, Bruce P.

    2010-01-01

    Dopaminergic neurons in the ventral tegmental area (VTA) fire spontaneously in a pacemaker-like manner. We analyzed the ionic currents that drive pacemaking in dopaminergic VTA neurons, studied in mouse brain slices. Pacemaking was not inhibited by blocking hyperpolarization-activated cation current (Ih) or blocking all calcium current by Mg2+ replacement of Ca2+. Tetrodotoxin (TTX) stopped spontaneous activity and usually resulted in stable resting potentials near −60 mV to −55 mV, 10–15 mV below the action potential threshold. When external sodium was replaced by N-methyl-D-glucamine (NMDG) with TTX present, cells hyperpolarized by an average of −11 mV, suggesting a significant resting sodium conductance not sensitive to TTX. Voltage-clamp experiments using slow (10 mV/s) ramps showed a steady-state, steeply voltage-dependent current blocked by TTX that activates near −60 mV, as well as a sodium “background” current with little voltage-sensitivity, revealed by NMDG replacement for sodium with TTX present. We quantified these two components of sodium current during the pacemaking trajectory using action potential clamp. The initial phase of depolarization, up to about −55 mV, is driven mainly by non-voltage-dependent sodium background current. Above −55 mV, TTX-sensitive voltage-dependent “persistent” Na current helps drive the final phase of depolarization to the spike threshold. Voltage-dependent calcium current is small at all subthreshold voltages. The pacemaking mechanism in VTA neurons differs from that in substantia nigra pars compacta (SNc) neurons, where subthreshold calcium current plays a dominant role. In addition, we found that non-voltage-dependent background sodium current is much smaller in SNc neurons than VTA neurons. PMID:20505107

  16. A whole-cell and single-channel study of the voltage-dependent outward potassium current in avian hepatocytes

    PubMed Central

    1988-01-01

    Voltage-dependent membrane currents were studied in dissociated hepatocytes from chick, using the patch-clamp technique. All cells had voltage-dependent outward K+ currents; in 10% of the cells, a fast, transient, tetrodotoxin-sensitive Na+ current was identified. None of the cells had voltage-dependent inward Ca2+ currents. The K+ current activated at a membrane potential of about -10 mV, had a sigmoidal time course, and did not inactivate in 500 ms. The maximum outward conductance was 6.6 +/- 2.4 nS in 18 cells. The reversal potential, estimated from tail current measurements, shifted by 50 mV per 10-fold increase in the external K+ concentration. The current traces were fitted by n2 kinetics with voltage-dependent time constants. Omitting Ca2+ from the external bath or buffering the internal Ca2+ with EGTA did not alter the outward current, which shows that Ca2+-activated K+ currents were not present. 1-5 mM 4-aminopyridine, 0.5-2 mM BaCl2, and 0.1-1 mM CdCl2 reversibly inhibited the current. The block caused by Ba was voltage dependent. Single-channel currents were recorded in cell- attached and outside-out patches. The mean unitary conductance was 7 pS, and the channels displayed bursting kinetics. Thus, avian hepatocytes have a single type of K+ channel belonging to the delayed rectifier class of K+ channels. PMID:2453605

  17. Stoichiometry and voltage dependence of the sodium pump in voltage- clamped, internally dialyzed squid giant axon

    PubMed Central

    1989-01-01

    The stoichiometry and voltage dependence of the Na/K pump were studied in internally dialyzed, voltage-clamped squid giant axons by simultaneously measuring, at various membrane potentials, the changes in Na efflux (delta phi Na) and holding current (delta I) induced by dihydrodigitoxigenin (H2DTG). H2DTG stops the Na/K pump without directly affecting other current pathways: (a) it causes no delta I when the pump lacks Na, K, Mg, or ATP, and (b) ouabain causes no delta I or delta phi Na in the presence of saturating H2DTG. External K (Ko) activates Na efflux with Michaelis-Menten kinetics (Km = 0.45 +/- 0.06 mM [SEM]) in Na-free seawater (SW), but with sigmoid kinetics in approximately 400 mM Na SW (Hill coefficient = 1.53 +/- 0.08, K1/2 = 3.92 +/- 0.29 mM). H2DTG inhibits less strongly (Ki = 6.1 +/- 0.3 microM) in 1 or 10 mM K Na-free SW than in 10 mM K, 390 mM Na SW (1.8 +/- 0.2 microM). Dialysis with 5 mM each ATP, phosphoenolpyruvate, and phosphoarginine reduced Na/Na exchange to at most 2% of the H2DTG- sensitive Na efflux. H2DTG sensitive but nonpump current caused by periaxonal K accumulation upon stopping the pump, was minimized by the K channel blockers 3,4-diaminopyridine (1 mM), tetraethylammonium (approximately 200 mM), and phenylpropyltriethylammonium (20-25 mM) whose adequacy was tested by varying [K]o (0-10 mM) with H2DTG present. Two ancillary clamp circuits suppressed stray current from the axon ends. Current and flux measured from the center pool derive from the same membrane area since, over the voltage range -60 to +20 mV, tetrodotoxin-sensitive current and Na efflux into Na-free SW, under K- free conditions, were equal. The stoichiometry and voltage dependence of pump Na/K exchange were examined at near-saturating [ATP], [K]o and [Na]i in both Na-free and 390 mM Na SW. The H2DTG-sensitive F delta phi Na/delta I ratio (F is Faraday's constant) of paired measurements corrected for membrane area match, was 2.86 +/- 0.09 (n = 8) at 0 mV and 3

  18. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    PubMed

    Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie

    2014-01-01

    Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  19. Aqueous cigarette smoke extract induces a voltage-dependent inhibition of CFTR expressed in Xenopus oocytes

    PubMed Central

    Moran, A. R.; Norimatsu, Y.; Dawson, D. C.

    2013-01-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel inhabits the apical membrane of airway epithelia, where its function is essential for mucus hydration, mucociliary clearance, and airway defense. Chronic obstructive pulmonary disease (COPD), most often a consequence of cigarette smoke (CS) exposure, affects 15 million persons in the US. Clinically, COPD is characterized by many of the salient features of cystic fibrosis lung disease, where CFTR is either absent or reduced in function. CS is an acidic aerosol (pH 5.3 to 6.3) reported to contain over 4,000 constituents. Acute CS exposure has been reported to decrease airway transepithelial voltage in vivo and short-circuit current in vitro; however, the mechanistic basis of these effects is uncertain. The goal of the studies described here was to develop a bioassay to characterize the effects of aqueous CS preparations on the channel function of CFTR. We studied aqueous CS extract (CSE) prepared in our laboratory, as well as commercial cigarette smoke condensate (CSC) in Xenopus oocytes expressing human CFTR. Application of CSE at pH 5.3 produced a reversible, voltage-dependent inhibition of CFTR conductance. CSE neutralized to pH 7.3 produced less inhibition of CFTR conductance. Serial dilution of CSE revealed a dose-dependent effect at acidic and neutral pH. In contrast, CSC did not inhibit CFTR conductance in oocytes. We conclude that one or more components of CSE inhibits CFTR in a manner similar to diphenylamine-2-carboxylate, a negatively charged, open-channel blocker. PMID:24318115

  20. Tubulin binding blocks mitochondrial voltage-dependent anion channel and regulates respiration

    PubMed Central

    Rostovtseva, Tatiana K.; Sheldon, Kely L.; Hassanzadeh, Elnaz; Monge, Claire; Saks, Valdur; Bezrukov, Sergey M.; Sackett, Dan L.

    2008-01-01

    Regulation of mitochondrial outer membrane (MOM) permeability has dual importance: in normal metabolite and energy exchange between mitochondria and cytoplasm and thus in control of respiration, and in apoptosis by release of apoptogenic factors into the cytosol. However, the mechanism of this regulation, dependent on the voltage-dependent anion channel (VDAC), the major channel of MOM, remains controversial. A long-standing puzzle is that in permeabilized cells, adenine nucleotide translocase (ANT) is less accessible to cytosolic ADP than in isolated mitochondria. We solve this puzzle by finding a missing player in the regulation of MOM permeability: the cytoskeletal protein tubulin. We show that nanomolar concentrations of dimeric tubulin induce voltage-sensitive reversible closure of VDAC reconstituted into planar phospholipid membranes. Tubulin strikingly increases VDAC voltage sensitivity and at physiological salt conditions could induce VDAC closure at <10 mV transmembrane potentials. Experiments with isolated mitochondria confirm these findings. Tubulin added to isolated mitochondria decreases ADP availability to ANT, partially restoring the low MOM permeability (high apparent Km for ADP) found in permeabilized cells. Our findings suggest a previously unknown mechanism of regulation of mitochondrial energetics, governed by VDAC and tubulin at the mitochondria–cytosol interface. This tubulin–VDAC interaction requires tubulin anionic C-terminal tail (CTT) peptides. The significance of this interaction may be reflected in the evolutionary conservation of length and anionic charge in CTT throughout eukaryotes, despite wide changes in the exact sequence. Additionally, tubulins that have lost significant length or anionic character are only found in cells that do not have mitochondria. PMID:19033201

  1. Voltage-dependent membrane potential oscillations of rat striatal fast-spiking interneurons

    PubMed Central

    Bracci, Enrico; Centonze, Diego; Bernardi, Giorgio; Calabresi, Paolo

    2003-01-01

    We used whole-cell recordings to investigate subthreshold membrane potential oscillations and their relationship with intermittent firing in striatal fast-spiking interneurons. During current injections (100–500 pA, 1 s), these cells displayed a highly variable pattern of spike bursts (comprising 1–30 action potentials) interspersed with membrane potential oscillations. The oscillation threshold was −42 ± 10 mV, and coincided with that for action potentials. The oscillation frequency was voltage dependent and ranged between 20 and 100 Hz. Oscillations were unaffected by the calcium channel blockers cadmium and nickel and by blockers of ionotropic glutamate and GABA receptors. Conversely, the sodium channel blocker tetrodotoxin fully abolished the oscillations and the spike bursts. The first spike of a burst appeared to be triggered by an oscillation, since the timing and rate of rise of the membrane potential in the subthreshold voltage region was similar for the two events. Conversely, the second spike (and the subsequent ones) displayed much faster depolarisations in the subthreshold voltage range, indicating that they were generated by a different mechanism. Consistent with these notions, a small pulse of intracellular current delivered during the oscillation was effective in triggering a burst of action potentials that largely outlasted the pulse. We conclude that fast-spiking interneuron oscillations are generated by an intrinsic membrane mechanism that does not require fast synaptic transmission, and which depends on sodium conductance but not calcium conductance, and that such oscillations are responsible for triggering the intermittent spike bursts that are typical of these neurons. PMID:12665602

  2. Voltage-dependent sodium (NaV) channels in group IV sensory afferents

    PubMed Central

    Elmslie, Keith S

    2016-01-01

    Patients with intermittent claudication suffer from both muscle pain and an exacerbated exercise pressor reflex. Excitability of the group III and group IV afferent fibers mediating these functions is controlled in part by voltage-dependent sodium (NaV) channels. We previously found tetrodotoxin-resistant NaV1.8 channels to be the primary type in muscle afferent somata. However, action potentials in group III and IV afferent axons are blocked by TTX, supporting a minimal role of NaV1.8 channels. To address these apparent differences in NaV channel expression between axon and soma, we used immunohistochemistry to identify the NaV channels expressed in group IV axons within the gastrocnemius muscle and the dorsal root ganglia sections. Positive labeling by an antibody against the neurofilament protein peripherin was used to identify group IV neurons and axons. We show that >67% of group IV fibers express NaV1.8, NaV1.6, or NaV1.7. Interestingly, expression of NaV1.8 channels in group IV somata was significantly higher than in the fibers, whereas there were no significant differences for either NaV1.6 or NaV1.7. When combined with previous work, our results suggest that NaV1.8 channels are expressed in most group IV axons, but that, under normal conditions, NaV1.6 and/or NaV1.7 play a more important role in action potential generation to signal muscle pain and the exercise pressor reflex. PMID:27385723

  3. Alpha 1-adrenergic agonists selectively suppress voltage-dependent K+ current in rat ventricular myocytes.

    PubMed Central

    Apkon, M; Nerbonne, J M

    1988-01-01

    The effects of alpha 1-adrenergic agonists on the waveforms of action potentials and voltage-gated ionic currents were examined in isolated adult rat ventricular myocytes by the whole-cell patch-clamp recording technique. After "puffer" applications of either of two alpha 1 agonists, phenylephrine and methoxamine, action-potential durations were increased. In voltage-clamped cells, phenylephrine (5-20 microM) or methoxamine (5-10 microM) reduced the amplitudes of Ca2+-independent voltage-activated outward K+ currents (Iout); neither the kinetics nor the voltage-dependent properties of Iout were significantly affected. The effects of phenylephrine or methoxamine on Iout were larger and longer-lasting at higher concentrations and after prolonged or repeated exposures; in all experiments, however, Iout recovered completely when puffer applications were discontinued. The suppression of Iout is attributed to the activation of alpha 1-adrenergic receptors, as neither beta- nor alpha 2-adrenergic agonists had measurable effects on Iout; in addition, the effect of phenylephrine was attenuated in the presence of the alpha antagonist phentolamine (10 microM), but not in the presence of the beta antagonist propranolol (10 microM). Voltage-gated Ca2+ currents, in contrast, were not altered measurably by phenylephrine or methoxamine and no currents were activated directly by these agents. Suppression of Iout was also observed during puffer applications of either of two protein kinase C activators, phorbol 12-myristate 13-acetate (10 nM-1 microM) and 1-oleoyl-2-acetylglycerol (60 microM). We conclude that the activation of alpha 1-adrenergic receptors in adult rat ventricular myocytes leads to action-potential prolongation as a result of the specific suppression of Iout and that this effect may be mediated by activation of protein kinase C. PMID:2903506

  4. Voltage-Dependent Anion Channel-1, a Possible Ligand of Plasminogen Kringle 5

    PubMed Central

    Liang, Yin-ku; Bian, Liu-jiao

    2016-01-01

    Kringle 5, the fifth fragment of plasminogen, is known to be important for inhibiting the proliferation and migration of vascular endothelial cell (VEC), while not having any effects on normal endothelial cells. Therefore, it may be a potential tumor therapy candidate. However, the ligand of the Kringle 5 in VEC has not yet been identified. In this study, the possible ligand of Kringle 5 in vitro was screened and validated using Ph.D.-7 phage display peptide library with molecular docking, along with surface plasma resonance (SPR). After four rounds of panning, the specific clones of Kringle 5 were confirmed using enzyme-linked immunosorbent assay (ELISA). The gene sequence analysis showed that they expressed the common amino sequence IGNSNTL. Then, using a NCBI BLAST, 103 matching sequences were found. Following the molecular docking evaluation and considering the acting function and pathway of the plasminogen Kringle 5 in the human body, the most promising candidate was determined to be voltage-dependent anion channel-1 (VDAC-1), which was able to bind to Kringle 5 at -822.65 J·mol-1 of the binding energy at the residues of Lys12, Thr19, Ser57, Thr188, Arg139, Asn214, Ser240 and Lys274. A strong dose-dependent interaction occurred between the VDAC-1 and Kringle 5 (binding constant 2.43 × 103 L·mol-1) in SPR observation. Therefore, this study proposed that VDAC-1 was a potential ligand of plasminogen Kringle 5, and also demonstrated that the screening and validation of protein ligand using phage display peptide library with the molecular docking, along with SPR, was a practicable application. PMID:27749918

  5. Wnt signalling suppresses voltage-dependent Na⁺ channel expression in postnatal rat cardiomyocytes.

    PubMed

    Liang, Wenbin; Cho, Hee Cheol; Marbán, Eduardo

    2015-03-01

    Wnt signalling plays crucial roles in heart development, but is normally suppressed postnatally. In arrhythmogenic conditions, such as cardiac hypertrophy and heart failure, Wnt signalling is reactivated. To explore the potential role of Wnt signalling in arrhythmogenic electrical remodelling, we examined voltage-dependent ion channels in cardiomyocytes. Treatment of neonatal rat ventricular myocytes with either recombinant Wnt3a protein or CHIR-99021 (CHIR, a glycogen synthase kinase-3β inhibitor) caused a dose-dependent increase in Wnt target gene expression (Axin2 and Lef1), indicating activation of the Wnt/β-catenin pathway. Cardiac Na(+) current (INa) density was reduced by Wnt3a (-20 ± 4 vs. control -59 ± 7 pA pF(-1) , at -30 mV) or CHIR (-22 ± 5 pA pF(-1) ), without changes in steady-state activation, inactivation or repriming kinetics. Wnt3a and CHIR also produced dose-dependent reductions in the mRNA level of Scn5a (the cardiac Na(+) channel α subunit gene), as well as a 56% reduction (by Wnt3a) in the Nav 1.5 protein level. Consistent with INa reduction, action potentials in Wnt3a-treated neonatal rat ventricular myocytes had a lower upstroke amplitude (91 ± 3 vs. control 137 ± 2 mV) and decreased maximum upstroke velocity (70 ± 10 vs. control 163 ± 15 V s(-1)). In contrast, inward rectifier K(+) current and L-type Ca(2+) channels were not affected by Wnt3a treatment. Taken together, our data indicate that the Wnt/β-catenin pathway suppresses INa in postnatal cardiomyocytes and may contribute to ion channel remodelling in heart disease.

  6. Tubulin binding blocks mitochondrial voltage-dependent anion channel and regulates respiration.

    PubMed

    Rostovtseva, Tatiana K; Sheldon, Kely L; Hassanzadeh, Elnaz; Monge, Claire; Saks, Valdur; Bezrukov, Sergey M; Sackett, Dan L

    2008-12-02

    Regulation of mitochondrial outer membrane (MOM) permeability has dual importance: in normal metabolite and energy exchange between mitochondria and cytoplasm and thus in control of respiration, and in apoptosis by release of apoptogenic factors into the cytosol. However, the mechanism of this regulation, dependent on the voltage-dependent anion channel (VDAC), the major channel of MOM, remains controversial. A long-standing puzzle is that in permeabilized cells, adenine nucleotide translocase (ANT) is less accessible to cytosolic ADP than in isolated mitochondria. We solve this puzzle by finding a missing player in the regulation of MOM permeability: the cytoskeletal protein tubulin. We show that nanomolar concentrations of dimeric tubulin induce voltage-sensitive reversible closure of VDAC reconstituted into planar phospholipid membranes. Tubulin strikingly increases VDAC voltage sensitivity and at physiological salt conditions could induce VDAC closure at <10 mV transmembrane potentials. Experiments with isolated mitochondria confirm these findings. Tubulin added to isolated mitochondria decreases ADP availability to ANT, partially restoring the low MOM permeability (high apparent K(m) for ADP) found in permeabilized cells. Our findings suggest a previously unknown mechanism of regulation of mitochondrial energetics, governed by VDAC and tubulin at the mitochondria-cytosol interface. This tubulin-VDAC interaction requires tubulin anionic C-terminal tail (CTT) peptides. The significance of this interaction may be reflected in the evolutionary conservation of length and anionic charge in CTT throughout eukaryotes, despite wide changes in the exact sequence. Additionally, tubulins that have lost significant length or anionic character are only found in cells that do not have mitochondria.

  7. Molecular basis of voltage-dependent potassium currents in porcine granulosa cells.

    PubMed

    Mason, Diane E; Mitchell, Kathy E; Li, Yan; Finley, Melissa R; Freeman, Lisa C

    2002-01-01

    The major objective of this study was to elucidate the molecular bases for K(+) current diversity in porcine granulosa cells (GC). Two delayed rectifier K(+) currents with distinct electrophysiological and pharmacological properties were recorded from porcine GC by using whole-cell patch clamp: 1) a slowly activating, noninactivating current (I(Ks)) antagonized by clofilium, 293B, L-735,821, and L-768,673; and 2) an ultrarapidly activating, slowly inactivating current (I(Kur)) antagonized completely by clofilium and 4-aminopyridine and partially by tetraethylammonium, charybdotoxin, dendrotoxin, and kaliotoxin. The molecular identity of the K(+) channel genes underlying I(Ks) and I(Kur) was examined using reverse transcription-polymerase chain reaction and immunoblotting to detect K(+) channel transcripts and proteins. We found that GC could express multiple voltage-dependent K(+) (Kv) channel subunits, including KCNQ1, KCNE1, Kv1.1, Kv1.2, Kv1.3, Kv1.4, Kv1.5, Kv1.6, Kvbeta1.3, and Kvbeta2. Coimmunoprecipitation was used to establish the hetero-oligomeric nature of granulosa cell Kv channels. KCNE1 and KCNQ1 were coassociated in GC, and their expression coincided with the expression of I(Ks). Extensive coassociation of the various Kv alpha- and beta-subunits was also documented, suggesting that the diverse electrophysiological and pharmacological properties of I(Kur) currents may reflect variation in the composition and stoichiometry of the channel assemblies, as well as differences in post-translational modification of contributing Kv channel subunits. Our findings provide an essential background for experimental definition of granulosa K(+) channel function(s). It will be critical to define the functional roles of specific GC K(+) channels, because these proteins may represent either novel targets for assisted reproduction or potential sites of drug toxicity.

  8. Hippocampal hypoglycaemia-activated K+ channels: single-channel analysis of glucose and voltage dependence.

    PubMed

    Tromba, C; Salvaggio, A; Racagni, G; Volterra, A

    1994-11-01

    The effect of glucose on kinetics and the voltage-dependent characteristics of glucose-sensitive channels in hippocampal neurons were examined with the cell-attached mode of the patch-clamp technique. Recordings of a 100-pS K+ channel in the presence or absence of glucose demonstrate that the increase in channel open state probability (Po) induced by glucose deprivation (40- to 400-times the control in high-glucose medium) was largely due to a decrease in the global amount of time spent by the channel in a long-lived closed state. The Po value of the same 100-pS channel was also found to increase (by approx. 80-times) following a depolarization of 40 mV from rest, the main factor responsible for this being a dramatic shortening of the long closed-times on depolarization. Another glucose-sensitive channel of smaller conductance (approx. 10 pS) showed a similar dependence of Po on glucose, but different dependence on voltage, with long openings at the same hyperpolarized potentials where the 100-pS channel was almost always closed. Our results indicate that the action of glucose on the kinetics of hippocampal channels closely resembles that of ATP-sensitive channels in pancreatic beta-cells. Furthermore, they indicate that the two types of glucose-sensitive channels found in hippocampal neurons, differing not only in their single-channel conductance but also in the dependence on voltage, could play different roles in the responses of these cells to modified energetic supply.

  9. Voltage-dependent blockade of normal and mutant muscle sodium channels by benzylalcohol

    PubMed Central

    Haeseler, G; Mamarvar, M; Bufler, J; Dengler, R; Hecker, H; Aronson, J K; Piepenbrock, S; Leuwer, M

    2000-01-01

    We studied the effects of benzylalcohol on heterologously expressed wild type (WT), paramyotonia congenita (R1448H) and hyperkalaemic periodic paralysis (M1360V) mutant α-subunits of human skeletal muscle sodium channels.Benzylalcohol blocked rested channels at −150 mV membrane potential, with an ECR50 of 5.3 mM in wild type, 5.1 mM in R1448H, and 6.2 mM in M1360V. When blockade was assessed at −100 mV, the ECR50 was reduced in R1448H (2 mM) compared with both wild type (4.3 mM; P<0.01) and M1360V (4.3 mM).Membrane depolarization before the test depolarization significantly promoted benzylalcohol-induced sodium channel blockade. The values of KD for the fast-inactivated state derived from benzylalcohol-induced shifts in steady-state availability curves were 0.66 mM in wild type and 0.58 mM in R1448H. In the presence of slow inactivation induced by 2.5 s depolarizing prepulses, the ECI50 for benzylalcohol-induced current inhibition was 0.59 mM in wild type and 0.53 mM in R1448H.Recovery from fast inactivation was prolonged in the presence of drug in all clones.Benzylalcohol induced significant frequency-dependent block at stimulating frequencies of 10, 50, and 100 Hz in all clones.Our results clearly show that benzylalcohol is an effective blocker of muscle sodium channels in conditions that are associated with membrane depolarization. Mutants that enter voltage-dependent inactivation at more hyperpolarized membrane potentials compared with wild type are more sensitive to inhibitory effects at the normal resting potential. PMID:10903972

  10. Voltage-dependent inhibition of recombinant NMDA receptor-mediated currents by 5-hydroxytryptamine

    PubMed Central

    Kloda, Anna; Adams, David J

    2005-01-01

    The effect of 5-HT and related indolealkylamines on heteromeric recombinant NMDA receptors expressed in Xenopus oocytes was investigated using the two-electrode voltage-clamp recording technique. In the absence of external Mg2+ ions, 5-HT inhibited NMDA receptor-mediated currents in a concentration-dependent manner. The inhibitory effect of 5-HT was independent of the NR1a and NR2 subunit combination. The inhibition of glutamate-evoked currents by 5-HT was use- and voltage-dependent. The voltage sensitivity of inhibition for NR1a+NR2 subunit combinations by 5-HT was similar, exhibiting an e-fold change per ∼20 mV, indicating that 5-HT binds to a site deep within the membrane electric field. The inhibition of the open NMDA receptor by external Mg2+ and 5-HT was not additive, suggesting competition between Mg2+ and 5-HT for a binding site in the NMDA receptor channel. The concentration-dependence curves for 5-HT and 5-methoxytryptamine (5-MeOT) inhibition of NMDA receptor-mediated currents are shifted to the right in the presence of external Mg2+. The related indolealkylamines inhibited glutamate-evoked currents with the following order of inhibitory potency: 5-MeOT=5-methyltryptamine>tryptamine>7-methyltryptamine>5-HT≫tryptophan=melatonin. Taken together, these data suggest that 5-HT and related compounds can attenuate glutamate-mediated excitatory synaptic responses and may provide a basis for drug treatment of excitoxic neurodegeneration. PMID:15655527

  11. Lavender Oil-Potent Anxiolytic Properties via Modulating Voltage Dependent Calcium Channels

    PubMed Central

    Schuwald, Anita M.; Nöldner, Michael; Wilmes, Thomas; Klugbauer, Norbert; Leuner, Kristina; Müller, Walter E.

    2013-01-01

    Recent clinical data support the clinical use of oral lavender oil in patients suffering from subsyndromal anxiety. We identified the molecular mechanism of action that will alter the perception of lavender oil as a nonspecific ingredient of aromatherapy to a potent anxiolytic inhibiting voltage dependent calcium channels (VOCCs) as highly selective drug target. In contrast to previous publications where exorbitant high concentrations were used, the effects of lavender oil in behavioral, biochemical, and electrophysiological experiments were investigated in physiological concentrations in the nanomolar range, which correlate to a single dosage of 80 mg/d in humans that was used in clinical trials. We show for the first time that lavender oil bears some similarities with the established anxiolytic pregabalin. Lavender oil inhibits VOCCs in synaptosomes, primary hippocampal neurons and stably overexpressing cell lines in the same range such as pregabalin. Interestingly, Silexan does not primarily bind to P/Q type calcium channels such as pregabalin and does not interact with the binding site of pregabalin, the α2δ subunit of VOCCs. Lavender oil reduces non-selectively the calcium influx through several different types of VOCCs such as the N-type, P/Q-type and T-type VOCCs. In the hippocampus, one brain region important for anxiety disorders, we show that inhibition by lavender oil is mainly mediated via N-type and P/Q-type VOCCs. Taken together, we provide a pharmacological and molecular rationale for the clinical use of the oral application of lavender oil in patients suffering from anxiety. PMID:23637742

  12. Effective gating charges per channel in voltage-dependent K+ and Ca2+ channels

    PubMed Central

    1996-01-01

    In voltage-dependent ion channels, the gating of the channels is determined by the movement of the voltage sensor. This movement reflects the rearrangement of the protein in response to a voltage stimulus, and it can be thought of as a net displacement of elementary charges (e0) through the membrane (z: effective number of elementary charges). In this paper, we measured z in Shaker IR (inactivation removed) K+ channels, neuronal alpha 1E and alpha 1A, and cardiac alpha 1C Ca2+ channels using two methods: (a) limiting slope analysis of the conductance-voltage relationship and (b) variance analysis, to evaluate the number of active channels in a patch, combined with the measurement of charge movement in the same patch. We found that in Shaker IR K+ channels the two methods agreed with a z congruent to 13. This suggests that all the channels that gate can open and that all the measured charge is coupled to pore opening in a strictly sequential kinetic model. For all Ca2+ channels the limiting slope method gave consistent results regardless of the presence or type of beta subunit tested (z = 8.6). However, as seen with alpha 1E, the variance analysis gave different results depending on the beta subunit used. alpha 1E and alpha 1E beta 1a gave higher z values (z = 14.77 and z = 15.13 respectively) than alpha 1E beta 2a (z = 9.50, which is similar to the limiting slope results). Both the beta 1a and beta 2a subunits, coexpressed with alpha 1E Ca2+ channels facilitated channel opening by shifting the activation curve to more negative potentials, but only the beta 2a subunit increased the maximum open probability. The higher z using variance analysis in alpha 1E and alpha 1E beta 1a can be explained by a set of charges not coupled to pore opening. This set of charges moves in transitions leading to nulls thus not contributing to the ionic current fluctuations but eliciting gating currents. Coexpression of the beta 2a subunit would minimize the fraction of nulls leading to

  13. Functional and molecular analysis of transient voltage-dependent K+ currents in rat hippocampal granule cells

    PubMed Central

    Riazanski, Vladimir; Becker, Albert; Chen, Jian; Sochivko, Dmitry; Lie, Ailing; Wiestler, Otmar D; Elger, Christian E; Beck, Heinz

    2001-01-01

    We have investigated voltage-dependent outward K+ currents of dentate granule cells (DGCs) in acute brain slices from young and adult rats using nucleated and outside-out patch recordings. In adult DGCs, the outward current pattern was dominated by a transient K+ current component. One portion of this current (∼60 %) was blocked by micromolar concentrations of tetraethylammonium (TEA; IC50 42 μm) and BDS-I, a specific blocker of Kv3.4 subunits (2.5 μm). A second component was insensitive to tetraethylammonium (10 mm) and BDS-I. The transient outward current could be completely blocked by 4-aminopyridine (IC50 296 μm). The TEA- and BDS-I-sensitive and the TEA-resistant current components were isolated pharmacologically. The current component that was blocked by BDS-I and TEA showed a depolarized threshold of activation (∼-30 mV) reminiscent of Kv3.4 subunits, while the current component resistant to TEA activated at more hyperpolarized potentials (∼-60 mV). In nucleated patches obtained by placing the patch pipette adjacent to the apical dendrite, only small Na+ currents and small BDS-I-sensitive transient currents were detected. Nucleated patches obtained from either the cell soma (see above) or the axon hillock showed significantly larger amplitude Na+ currents as well as larger BDS-I-sensitive currents, indicating that this current was predominantly localized within the axosomatic compartment. This result was in good agreement with the distribution of Kv3.4 protein as determined by immunohistochemistry. Current-clamp as well as mock action potential-clamp experiments revealed that the BDS-sensitive current component contributes to action potential repolarization. A comparison of the two age groups (4-10 days and 60-100 days) revealed a marked developmental up-regulation of the BDS-I-sensitive component. These functional changes are paralleled by a developmental increase in Kv3.4 mRNA expression determined by quantitative real-time RT-PCR, as well as a

  14. Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane.

    PubMed

    Vaccaro, S R

    2011-09-07

    The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

  15. The voltage-dependent gate in MthK potassium channels is located at the selectivity filter

    PubMed Central

    Posson, David J.; McCoy, Jason G.; Nimigean, Crina M.

    2012-01-01

    Understanding how ion channels open and close their pores is crucial for understanding their physiological roles. We used intracellular quaternary ammonium blockers to locate the voltage-dependent gate in MthK potassium channels from Methanobacterium thermoautotrophicum with electrophysiology and X-ray crystallography. Blockers bind in an aqueous cavity between two putative gates, an intracellular gate and the selectivity filter. Thus, these blockers directly probe gate location: an intracellular gate will prevent binding when closed, whereas a selectivity filter gate will always allow binding. A kinetic analysis of tetrabutylammonium block of single MthK channels combined with X-ray crystallographic analysis of the pore with tetrabutylantimony unequivocally determined that the voltage-dependent gate, like the C-type inactivation gate in eukaryotic channels, is located at the selectivity filter. State-dependent binding kinetics suggests that MthK inactivation leads to conformational changes within the cavity and intracellular pore entrance. PMID:23262489

  16. The voltage-dependent gate in MthK potassium channels is located at the selectivity filter.

    PubMed

    Posson, David J; McCoy, Jason G; Nimigean, Crina M

    2013-02-01

    Understanding how ion channels open and close their pores is crucial for comprehending their physiological roles. We used intracellular quaternary ammonium blockers, electrophysiology and X-ray crystallography to locate the voltage-dependent gate in MthK potassium channels from Methanobacterium thermoautotrophicum. Blockers bind in an aqueous cavity between two putative gates: an intracellular gate and the selectivity filter. Thus, these blockers directly probe gate location--an intracellular gate will prevent binding when closed, whereas a selectivity filter gate will always allow binding. Kinetic analysis of tetrabutylammonium block of single MthK channels combined with X-ray crystallographic analysis of the pore with tetrabutyl antimony unequivocally determined that the voltage-dependent gate, like the C-type inactivation gate in eukaryotic channels, is located at the selectivity filter. State-dependent binding kinetics suggest that MthK inactivation leads to conformational changes within the cavity and intracellular pore entrance.

  17. Origin of the potassium and voltage dependence of the cardiac inwardly rectifying K-current (IK1).

    PubMed Central

    Pennefather, P; Oliva, C; Mulrine, N

    1992-01-01

    Using various voltage clamp protocols, we have examined the activation and deactivation kinetics of IK1 recorded in dissociated myocytes obtained from canine purkinje fibers. Exponential current relaxations following step changes of the membrane potential were characterized at several different K levels (5, 12, 42, and 82 mM) and several voltages (K reversal potential +/- 40 mV). We have interpreted our data according to a K-activated, K-channel model of IK1 gating. Our data suggests that at least two binding sites for extracellular K must be occupied before the channel opens and occupancy of about three more higher affinity sites for K on the open channel will slow the closing of that channel. In our model, the voltage dependency of gating arises from a combination of three voltage dependent steps: (a) isomerization between open and closed states, (b) binding of K, and (c) occupancy of the channel by internal Mg. Lowering internal K to 40 mM causes major changes in the voltage and K dependence of IK1 gating. However, these changes could be accounted for in our model by relatively small (approximately 20 to 30 mV) shifts in the voltage dependence of several of the steps that govern gating. Our data further suggest that there is an interaction between both extracellular and intracellular K levels and the ability of intracellular Mg to block the IK1 channel. PMID:1547332

  18. Sodium current in single cells from bullfrog atrium: voltage dependence and ion transfer properties.

    PubMed Central

    Clark, R B; Giles, W

    1987-01-01

    1. Whole-cell and patch-clamp techniques (Hamill, Marty, Neher, Sakmann & Sigworth, 1981) have been used to make quantitative measurements of the transient inward sodium current (INa) in single cells from bullfrog atrium. This preparation is particularly suitable for the study of INa: (i) the current density is relatively low, (ii) the cells lack a transverse tubule system, (iii) isolated myocytes can be maintained at reduced temperatures (approximately 8-12 degrees C); therefore kinetics can be studied quantitatively. 2. INa was pharmacologically and kinetically isolated from other transmembrane currents by blocking ICa with CdCl2 (0.2-0.5 mM) or LaCl3 (5 x 10(-6) M), and by using only relatively short voltage-clamp depolarizations which did not activate IK (the delayed rectifier). 3. The voltage dependence of INa in bullfrog atrium is similar to that in amphibian node of Ranvier or fast skeletal muscle. The threshold for activation is approximately -50 mV. The peak of the INa vs. membrane potential relation is near -5 to -10 mV. The reversal potential in 'normal' (115 mM-Na+) Ringer solution is +59.0 mV (S.D. +/- 3.4, n = 10). Reduction of external Na+ concentration to one-third of normal resulted in an approximately -27 mV shift of the reversal potential, close to that expected for a highly Na+-selective conductance. 4. Steady-state inactivation of INa (h infinity), measured with a conventional two-pulse voltage-clamp protocol, spanned the membrane potential range from -90 to -50 mV. The potential dependence of h infinity was well described by a single Boltzmann function with half-inactivation at -71 mV and maximum slope of 6.0 mV. 5. Steady-state activation of INa (m infinity) was determined from fits of INa records to a Hodgkin-Huxley model. The potential dependence of m infinity was fitted to a Boltzmann function with half-activation at -33 mV and maximum slope of 9.5 mV. Thus at temperatures around 10 degrees C there was very little overlap of the m infinity

  19. Voltage-dependent and calcium-dependent inactivation of calcium channel current in identified snail neurones.

    PubMed Central

    Gutnick, M J; Lux, H D; Swandulla, D; Zucker, H

    1989-01-01

    inactivation was enhanced in neurones that had been injected with Ca2+ chelator. 6. We conclude that inactivation of Ca2+ channels in these neurones depends on both [Ca2+]i and membrane potential. The voltage-dependent process may serve as a mechanism to quickly recover inactivated Ca2+ channels during repetitive firing despite considerable Ca2+ influx. 7. The results are discussed in the framework of a model which is based on two states of inactivation, INV and INCA, which represent different conformations of the inactivating substrate, and which are both reached from a lumped state of activation (A). Inactivation leads to high occupancy of INV during depolarization.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:2557426

  20. Phosphoinositide 5- and 3-phosphatase activities of a voltage-sensing phosphatase in living cells show identical voltage dependence.

    PubMed

    Keum, Dongil; Kruse, Martin; Kim, Dong-Il; Hille, Bertil; Suh, Byung-Chang

    2016-06-28

    Voltage-sensing phosphatases (VSPs) are homologs of phosphatase and tensin homolog (PTEN), a phosphatidylinositol 3,4-bisphosphate [PI(3,4)P2] and phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P3] 3-phosphatase. However, VSPs have a wider range of substrates, cleaving 3-phosphate from PI(3,4)P2 and probably PI(3,4,5)P3 as well as 5-phosphate from phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] and PI(3,4,5)P3 in response to membrane depolarization. Recent proposals say these reactions have differing voltage dependence. Using Förster resonance energy transfer probes specific for different PIs in living cells with zebrafish VSP, we quantitate both voltage-dependent 5- and 3-phosphatase subreactions against endogenous substrates. These activities become apparent with different voltage thresholds, voltage sensitivities, and catalytic rates. As an analytical tool, we refine a kinetic model that includes the endogenous pools of phosphoinositides, endogenous phosphatase and kinase reactions connecting them, and four exogenous voltage-dependent 5- and 3-phosphatase subreactions of VSP. We show that apparent voltage threshold differences for seeing effects of the 5- and 3-phosphatase activities in cells are not due to different intrinsic voltage dependence of these reactions. Rather, the reactions have a common voltage dependence, and apparent differences arise only because each VSP subreaction has a different absolute catalytic rate that begins to surpass the respective endogenous enzyme activities at different voltages. For zebrafish VSP, our modeling revealed that 3-phosphatase activity against PI(3,4,5)P3 is 55-fold slower than 5-phosphatase activity against PI(4,5)P2; thus, PI(4,5)P2 generated more slowly from dephosphorylating PI(3,4,5)P3 might never accumulate. When 5-phosphatase activity was counteracted by coexpression of a phosphatidylinositol 4-phosphate 5-kinase, there was accumulation of PI(4,5)P2 in parallel to PI(3,4,5)P3 dephosphorylation

  1. Phosphoinositide 5- and 3-phosphatase activities of a voltage-sensing phosphatase in living cells show identical voltage dependence

    PubMed Central

    Keum, Dongil; Kim, Dong-Il; Suh, Byung-Chang

    2016-01-01

    Voltage-sensing phosphatases (VSPs) are homologs of phosphatase and tensin homolog (PTEN), a phosphatidylinositol 3,4-bisphosphate [PI(3,4)P2] and phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P3] 3-phosphatase. However, VSPs have a wider range of substrates, cleaving 3-phosphate from PI(3,4)P2 and probably PI(3,4,5)P3 as well as 5-phosphate from phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] and PI(3,4,5)P3 in response to membrane depolarization. Recent proposals say these reactions have differing voltage dependence. Using Förster resonance energy transfer probes specific for different PIs in living cells with zebrafish VSP, we quantitate both voltage-dependent 5- and 3-phosphatase subreactions against endogenous substrates. These activities become apparent with different voltage thresholds, voltage sensitivities, and catalytic rates. As an analytical tool, we refine a kinetic model that includes the endogenous pools of phosphoinositides, endogenous phosphatase and kinase reactions connecting them, and four exogenous voltage-dependent 5- and 3-phosphatase subreactions of VSP. We show that apparent voltage threshold differences for seeing effects of the 5- and 3-phosphatase activities in cells are not due to different intrinsic voltage dependence of these reactions. Rather, the reactions have a common voltage dependence, and apparent differences arise only because each VSP subreaction has a different absolute catalytic rate that begins to surpass the respective endogenous enzyme activities at different voltages. For zebrafish VSP, our modeling revealed that 3-phosphatase activity against PI(3,4,5)P3 is 55-fold slower than 5-phosphatase activity against PI(4,5)P2; thus, PI(4,5)P2 generated more slowly from dephosphorylating PI(3,4,5)P3 might never accumulate. When 5-phosphatase activity was counteracted by coexpression of a phosphatidylinositol 4-phosphate 5-kinase, there was accumulation of PI(4,5)P2 in parallel to PI(3,4,5)P3 dephosphorylation

  2. Chromosome banding in Amphibia. XVII. First demonstration of multiple sex chromosomes in amphibians: Eleutherodactylus maussi (Anura, leptodactylidae).

    PubMed

    Schmid, M; Steinlein, C; Feichtinger, W

    1992-03-01

    A cytogenetic study performed on a population of the South American leptodactylid frog Eleutherodactylus maussi revealed multiple sex chromosomes of the X1X1X2X2 female/X1X2Y male (= XXAA female/XXAY male) type. The diploid chromosome number is 2n = 36 in all females and 2n = 35 in most males. The multiple sex chromosomes originated by a centric fusion between the original Y chromosome and a large autosome. In male meiosis the X1X2Y (= XXAY) multiple sex chromosomes form a classical trivalent configuration. E. maussi is the first species discovered in the class Amphibia that is distinguished by a system of multiple sex chromosomes. Only one single male was found in the population with 2n = 36 chromosomes and lacking the Y-autosomal fusion. This karyotype (XYAA male) is interpreted as the ancestral condition, preceding the occurrence of the Y-autosome fusion.

  3. Estimating the voltage-dependent free energy change of ion channels using the median voltage for activation.

    PubMed

    Chowdhury, Sandipan; Chanda, Baron

    2012-01-01

    Voltage-gated ion channels are crucial for electrical activity and chemical signaling in a variety of cell types. Structure-activity studies involving electrophysiological characterization of mutants are widely used and allow us to quickly realize the energetic effects of a mutation by measuring macroscopic currents and fitting the observed voltage dependence of conductance to a Boltzmann equation. However, such an approach is somewhat limiting, principally because of the inherent assumption that the channel activation is a two-state process. In this analysis, we show that the area delineated by the gating charge displacement curve and its ordinate axis is related to the free energy of activation of a voltage-gated ion channel. We derive a parameter, the median voltage of charge transfer (V(m)), which is proportional to this area, and prove that the chemical component of free energy change of a system can be obtained from the knowledge of V(m) and the maximum number of charges transferred. Our method is not constrained by the number or connectivity of intermediate states and is applicable to instances in which the observed responses show a multiphasic behavior. We consider various models of ion channel gating with voltage-dependent steps, latent charge movement, inactivation, etc. and discuss the applicability of this approach in each case. Notably, our method estimates a net free energy change of approximately -14 kcal/mol associated with the full-scale activation of the Shaker potassium channel, in contrast to -2 to -3 kcal/mol estimated from a single Boltzmann fit. Our estimate of the net free energy change in the system is consistent with those derived from detailed kinetic models (Zagotta et al. 1994. J. Gen. Physiol. doi:10.1085/jgp.103.2.321). The median voltage method can reliably quantify the magnitude of free energy change associated with activation of a voltage-dependent system from macroscopic equilibrium measurements. This will be particularly useful

  4. Estimating the voltage-dependent free energy change of ion channels using the median voltage for activation

    PubMed Central

    Chowdhury, Sandipan

    2012-01-01

    Voltage-gated ion channels are crucial for electrical activity and chemical signaling in a variety of cell types. Structure-activity studies involving electrophysiological characterization of mutants are widely used and allow us to quickly realize the energetic effects of a mutation by measuring macroscopic currents and fitting the observed voltage dependence of conductance to a Boltzmann equation. However, such an approach is somewhat limiting, principally because of the inherent assumption that the channel activation is a two-state process. In this analysis, we show that the area delineated by the gating charge displacement curve and its ordinate axis is related to the free energy of activation of a voltage-gated ion channel. We derive a parameter, the median voltage of charge transfer (Vm), which is proportional to this area, and prove that the chemical component of free energy change of a system can be obtained from the knowledge of Vm and the maximum number of charges transferred. Our method is not constrained by the number or connectivity of intermediate states and is applicable to instances in which the observed responses show a multiphasic behavior. We consider various models of ion channel gating with voltage-dependent steps, latent charge movement, inactivation, etc. and discuss the applicability of this approach in each case. Notably, our method estimates a net free energy change of approximately −14 kcal/mol associated with the full-scale activation of the Shaker potassium channel, in contrast to −2 to −3 kcal/mol estimated from a single Boltzmann fit. Our estimate of the net free energy change in the system is consistent with those derived from detailed kinetic models (Zagotta et al. 1994. J. Gen. Physiol. doi:10.1085/jgp.103.2.321). The median voltage method can reliably quantify the magnitude of free energy change associated with activation of a voltage-dependent system from macroscopic equilibrium measurements. This will be particularly useful

  5. Effect of angiotensin II-induced arterial hypertension on the voltage-dependent contractions of mouse arteries.

    PubMed

    Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W

    2016-02-01

    Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.

  6. Voltage-Dependent Inactivation of MscS Occurs Independently of the Positively Charged Residues in the Transmembrane Domain

    PubMed Central

    Sokabe, Masahiro; Yoshimura, Kenjiro

    2016-01-01

    MscS (mechanosensitive channel of small conductance) is ubiquitously found among bacteria and plays a major role in avoiding cell lysis upon rapid osmotic downshock. The gating of MscS is modulated by voltage, but little is known about how MscS senses membrane potential. Three arginine residues (Arg-46, Arg-54, and Arg-74) in the transmembrane (TM) domain are possible to respond to voltage judging from the MscS structure. To examine whether these residues are involved in the voltage dependence of MscS, we neutralized the charge of each residue by substituting with asparagine (R46N, R54N, and R74N). Mechanical threshold for the opening of the expressed wild-type MscS and asparagine mutants did not change with voltage in the range from −40 to +100 mV. By contrast, inactivation process of wild-type MscS was strongly affected by voltage. The wild-type MscS inactivated at +60 to +80 mV but not at −60 to +40 mV. The voltage dependence of the inactivation rate of all mutants tested, that is, R46N, R54N, R74N, and R46N/R74N MscS, was almost indistinguishable from that of the wild-type MscS. These findings indicate that the voltage dependence of the inactivation occurs independently of the positive charges of R46, R54, and R74. PMID:28101504

  7. Interaction of anionic and cationic currents leads to a voltage dependence in the odor response of olfactory receptor neurons.

    PubMed

    Firestein, S; Shepherd, G M

    1995-02-01

    1. We recorded odor-induced currents from isolated olfactory receptor neurons of the land phase tiger salamander (Ambystoma tigrinum) with the whole cell patch clamp. 2. In a subset of cells the current-voltage relation for the odor-induced current showed a strong rectification with, in some cells, a negative resistance slope between about -45 and -25 mV. In these cells there was little or no odor-induced current at -55 mV, the average resting potential of olfactory neurons. 3. Depolarizing the membrane to +20 mV revealed a large outward current, and on repolarizing the membrane to -55 mV we could observe a large inward current. This current was not observed in the absence of the depolarizing step or in the absence of odor stimuli. 4. This odor-induced tail current was dependent on extracellular Ca2+ and voltage, activating with increased depolarization. The reversal potential was sensitive to the chloride equilibrium potential and it could be significantly blocked by niflumic acid, a blocker of calcium-activated chloride currents. The voltage dependence could result from either the voltage-dependent block of adenosine 3',5'-cyclic monophosphate-gated cation channels known to be activated by odorants and permeable to Ca2+, or from an inherent voltage dependence in the chloride channel gating. 5. The current appears to function as a regenerative mechanism that might increase the amplitude and duration of the odor-induced current, especially to low concentrations of stimulus.

  8. D242N, a KV7.1 LQTS mutation uncovers a key residue for IKs voltage dependence.

    PubMed

    Moreno, Cristina; Oliveras, Anna; Bartolucci, Chiara; Muñoz, Carmen; de la Cruz, Alicia; Peraza, Diego A; Gimeno, Juan R; Martín-Martínez, Mercedes; Severi, Stefano; Felipe, Antonio; Lambiase, Pier D; Gonzalez, Teresa; Valenzuela, Carmen

    2017-09-01

    KV7.1 and KCNE1 co-assemble to give rise to the IKs current, one of the most important repolarizing currents of the cardiac action potential. Its relevance is underscored by the identification of >500 mutations in KV7.1 and, at least, 36 in KCNE1, that cause Long QT Syndrome (LQTS). The aim of this study was to characterize the biophysical and cellular consequences of the D242N KV7.1 mutation associated with the LQTS. The mutation is located in the S4 transmembrane segment, within the voltage sensor of the KV7.1 channel, disrupting the conserved charge balance of this region. Perforated patch-clamp experiments show that, unexpectedly, the mutation did not disrupt the voltage-dependent activation but it removed the inactivation and slowed the activation kinetics of D242N KV7.1 channels. Biotinylation of cell-surface protein and co-immunoprecipitation experiments revealed that neither plasma membrane targeting nor co-assembly between KV7.1 and KCNE1 was altered by the mutation. However, the association of D242N KV7.1 with KCNE1 strongly shifted the voltage dependence of activation to more depolarized potentials (+50mV), hindering IKs current at physiologically relevant membrane potentials. Both functional and computational analysis suggest that the clinical phenotype of the LQTS patients carrying the D242N mutation is due to impaired action potential adaptation to exercise and, in particular, to increase in heart rate. Moreover, our data identify D242 aminoacidic position as a potential residue involved in the KCNE1-mediated regulation of the voltage dependence of activation of the KV7.1 channel. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Voltage-dependent gating rearrangements in the intracellular T1-T1 interface of a K+ channel.

    PubMed

    Wang, Guangyu; Covarrubias, Manuel

    2006-04-01

    The intracellular tetramerization domain (T1) of most eukaryotic voltage-gated potassium channels (Kv channels) exists as a "hanging gondola" below the transmembrane regions that directly control activation gating via the electromechanical coupling between the S4 voltage sensor and the main S6 gate. However, much less is known about the putative contribution of the T1 domain to Kv channel gating. This possibility is mechanistically intriguing because the T1-S1 linker connects the T1 domain to the voltage-sensing domain. Previously, we demonstrated that thiol-specific reagents inhibit Kv4.1 channels by reacting in a state-dependent manner with native Zn(2+) site thiolate groups in the T1-T1 interface; therefore, we concluded that the T1-T1 interface is functionally active and not protected by Zn(2+) (Wang, G., M. Shahidullah, C.A. Rocha, C. Strang, P.J. Pfaffinger, and M. Covarrubias. 2005. J. Gen. Physiol. 126:55-69). Here, we co-expressed Kv4.1 channels and auxiliary subunits (KChIP-1 and DPPX-S) to investigate the state and voltage dependence of the accessibility of MTSET to the three interfacial cysteines in the T1 domain. The results showed that the average MTSET modification rate constant (k(MTSET)) is dramatically enhanced in the activated state relative to the resting and inactivated states (approximately 260- and approximately 47-fold, respectively). Crucially, under three separate conditions that produce distinct activation profiles, k(MTSET) is steeply voltage dependent in a manner that is precisely correlated with the peak conductance-voltage relations. These observations strongly suggest that Kv4 channel gating is tightly coupled to voltage-dependent accessibility changes of native T1 cysteines in the intersubunit Zn(2+) site. Furthermore, cross-linking of cysteine pairs across the T1-T1 interface induced substantial inhibition of the channel, which supports the functionally dynamic role of T1 in channel gating. Therefore, we conclude that the complex

  10. Faster voltage-dependent activation of Na+ channels in growth cones versus somata of neuroblastoma N1E-115 cells.

    PubMed Central

    Zhang, J; Loew, L M; Davidson, R M

    1996-01-01

    Kinetics of voltage-gated ionic channels fundamentally reflect the response of the channels to local electric fields. In this report cell-attached patch-clamp studies reveal that the voltage-dependent activation rate of sodium channels residing in the growth cone membrane differs from that of soma sodium channels in differentiating N1E-115 neuroblastoma cells. Because other electrophysiological properties of these channels do not differ, this finding may be a reflection of the difference in intramembrane electric field in these two regions of the cell. This represents a new mechanism for channels to attain a range of activities both within and between cells. PMID:8913589

  11. Antibodies against the voltage-dependent anion channel (VDAC) and its protective ligand hexokinase I in children with autism

    PubMed Central

    Gonzalez-Gronow, Mario; Cuchacovich, Miguel; Francos, Rina; Cuchacovich, Stephanie; Fernandez, Maria del Pilar; Blanco, Angel; Bowers, Edith V.; Kaczowka, Steven; Pizzo, Salvatore V.

    2010-01-01

    Autistic children show elevated serum levels of autoantibodies to several proteins essential for the function of normal brains. The voltage-dependent anion channel, VDAC, and hexokinase-I, a VDAC protective ligand, were identified as targets of this autoimmunity in autistic children. These autoantibodies were purified using immunoaffinity chromatographic techniques. Both antibodies induce apoptosis of cultured human neuroblastoma cells. Because VDAC and hexokinase-I are essential for brain protection from ischemic damage, the presence of these autoantibodies suggests a possible causal role in the neurologic pathogenesis of autism. PMID:20576296

  12. Development of a voltage-dependent current noise algorithm for conductance-based stochastic modelling of auditory nerve fibres.

    PubMed

    Badenhorst, Werner; Hanekom, Tania; Hanekom, Johan J

    2016-12-01

    This study presents the development of an alternative noise current term and novel voltage-dependent current noise algorithm for conductance-based stochastic auditory nerve fibre (ANF) models. ANFs are known to have significant variance in threshold stimulus which affects temporal characteristics such as latency. This variance is primarily caused by the stochastic behaviour or microscopic fluctuations of the node of Ranvier's voltage-dependent sodium channels of which the intensity is a function of membrane voltage. Though easy to implement and low in computational cost, existing current noise models have two deficiencies: it is independent of membrane voltage, and it is unable to inherently determine the noise intensity required to produce in vivo measured discharge probability functions. The proposed algorithm overcomes these deficiencies while maintaining its low computational cost and ease of implementation compared to other conductance and Markovian-based stochastic models. The algorithm is applied to a Hodgkin-Huxley-based compartmental cat ANF model and validated via comparison of the threshold probability and latency distributions to measured cat ANF data. Simulation results show the algorithm's adherence to in vivo stochastic fibre characteristics such as an exponential relationship between the membrane noise and transmembrane voltage, a negative linear relationship between the log of the relative spread of the discharge probability and the log of the fibre diameter and a decrease in latency with an increase in stimulus intensity.

  13. Inhibition of the voltage-dependent chloride channel of Torpedo electric organ by diisopropylfluorophosphate and its reversal by oximes

    SciTech Connect

    Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.

    1986-05-01

    Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of (/sup 35/S)t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 ..mu..M. The binding sites of (/sup 35/S)TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of (/sup 35/S)TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of (/sup 35/S)TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel.

  14. Sulfate Is Both a Substrate and an Activator of the Voltage-Dependent Anion Channel of Arabidopsis Hypocotyl Cells1

    PubMed Central

    Frachisse, Jean-Marie; Thomine, Sébastien; Colcombet, Jean; Guern, Jean; Barbier-Brygoo, Hélène

    1999-01-01

    On the basis of the anion content of in vitro-cultured Arabidopsis plantlets, we explored the selectivity of the voltage-dependent anion channel of the plasma membrane of hypocotyl cells. In the whole-cell configuration, substitution of cytosolic Cl− by different anions led to the following sequence of relative permeabilities: NO3− (2.6) ≥ SO42− (2.0) > Cl− (1.0) > HCO3− (0.8) ≫ malate2− (0.03). Large whole-cell currents were measured for NO3− and SO42−, about five to six times higher than the equivalent Cl− currents. Since SO42− is usually considered to be a weakly permeant or non-permeant ion, the components of the large whole-cell current were explored in more detail. Aside from its permeation through the channel with a unitary conductance, about two-thirds that of Cl−, SO42− had a regulatory effect on channel activity by preventing the run-down of the anion current both in the whole-cell and the outside-out configuration, increasing markedly the whole-cell current. The fact that the voltage-dependent plasma membrane anion channel of hypocotyl cells can mediate large NO3− and SO42− currents and is regulated by nucleotides favors the idea that this anion channel can contribute to the cellular homeostasis of important metabolized anions. PMID:10482681

  15. Inhibition of the voltage-dependent calcium currents in isolated frog sensory neurons by GABA-related agonistic compounds.

    PubMed

    Maruyama, T; Behrends, J C; Akaike, N

    1988-12-01

    Effects of GABAA-, barbiturate- and benzodiazepine receptor agonists and GABAB agonist, baclofen, on voltage-dependent Ca2+ current (ICa) were studied in isolated frog sensory neurons after suppression of Na+ and K+ currents using single-electrode voltage-clamp. GABA, muscimol, taurine and pentobarbital (PB) dose-dependently induced a transient Cl- current (ICl), while baclofen and diazepam (DZP) did not elicit any currents. With GABAA agonists such as GABA, muscimol and taurine, ICa was suppressed transiently, and the maximum inhibition of ICa occurred within 1 min. The suppression of ICa by all GABAA agonists was neither voltage dependent nor attenuated in the presence of either bicuculline or picrotoxin. In addition, there was no correlation between GABA- and baclofen-induced suppressions of ICa. The results suggest that the inhibition of ICa by GABAA receptor agonists is not due to either GABAA or GABAB receptor activation at least. The inhibition of ICa by baclofen, PB and DZP was persistent. PB suppressed the amplitude of ICa and also facilitated the inactivation process, suggesting that PB behaves as a Ca channel blocker. However, the mechanisms of ICa suppression by baclofen and DZP are the subject for a future study. The potency order of the drugs in reducing ICa was muscimol greater than GABA = DZP greater than baclofen greater than PB greater than taurine.

  16. Voltage-dependent calcium channels in skeletal muscle transverse tubules. Measurements of calcium efflux in membrane vesicles

    SciTech Connect

    Dunn, S.M. )

    1989-07-05

    Transverse tubule membranes isolated from rabbit skeletal muscle consist mainly of sealed vesicles that are oriented primarily inside out. These membranes contain a high density of binding sites for 1,4-dihydropyridine calcium channel antagonists. The presence of functional voltage-dependent calcium channels in these membranes has been demonstrated by their ability to mediate {sup 45}Ca2+ efflux in response to changes in membrane potential. Fluorescence changes of the voltage-sensitive dye, 3,3'-dipropyl-2,2'-thiadicarbocyanine, have shown that transverse tubule vesicles may generate and maintain membrane potentials in response to establishing potassium gradients across the membrane in the presence of valinomycin. A two-step procedure has been developed to measure voltage-dependent calcium fluxes. Vesicles loaded with {sup 45}Ca2+ are first diluted into a buffer designed to generate a membrane potential mimicking the resting state of the cell and to reduce the extravesicular Ca2+ to sub-micromolar levels. {sup 45}Ca2+ efflux is then measured upon subsequent depolarization. Flux responses are modulated with appropriate pharmacological specificity by 1,4-dihydropyridines and are inhibited by other calcium channel antagonists such as lanthanum and verapamil.

  17. Voltage-dependent calcium signaling in rat cerebellar unipolar brush cells.

    PubMed

    Birnstiel, S; Slater, N T; McCrimmon, D R; Mugnaini, E; Hartell, N A

    2009-09-01

    Unipolar brush cells (UBCs) are a class of excitatory interneuron found in the granule cell layer of the vestibulocerebellum. Mossy fibers form excitatory inputs on to the paint brush shaped dendrioles in the form of giant, glutamatergic synapses, activation of which results in prolonged bursts of action potentials in the postsynaptic UBC. The axons of UBCs themselves form mossy fiber contacts with other UBCs and granule cells, forming an excitatory, intrinsic cerebellar network that has the capacity to synchronize and amplify mossy fiber inputs to potentially large populations of granule cells. In this paper, we demonstrate that UBCs in rat cerebellar slices express low voltage activated (LVA) fast-inactivating and high voltage activated (HVA) slowly inactivating calcium channels. LVA calcium currents are mediated by T-type calcium channels and they are associated with calcium increases in the dendrites and to a lesser extent the cell soma. HVA currents, mediated by L-type calcium channels, are slowly inactivating and they produce larger overall increases in intracellular calcium but with a similar distribution pattern. We review these observations alongside several recent papers that examine how intrinsic membrane properties influence UBCs firing patterns and we discuss how UBC signaling may affect downstream cerebellar processing.

  18. Displacing hexokinase from mitochondrial voltage-dependent anion channel impairs GLT-1-mediated glutamate uptake but does not disrupt interactions between GLT-1 and mitochondrial proteins.

    PubMed

    Jackson, Joshua G; O'Donnell, John C; Krizman, Elizabeth; Robinson, Michael B

    2015-07-01

    The glutamate transporter GLT-1 is the major route for the clearance of extracellular glutamate in the forebrain, and most GLT-1 protein is found in astrocytes. This protein is coupled to the Na(+) electrochemical gradient, supporting the active intracellular accumulation of glutamate. We recently used a proteomic approach to identify proteins that may interact with GLT-1 in rat cortex, including the Na(+)/K(+) -ATPase, most glycolytic enzymes, and several mitochondrial proteins. We also showed that most GLT-1 puncta (∼ 70%) are overlapped by mitochondria in astroglial processes in organotypic slices. From this analysis, we proposed that the glycolytic enzyme hexokinase (HK)-1 might physically form a scaffold to link GLT-1 and mitochondria because HK1 is known to interact with the outer mitochondrial membrane protein voltage-dependent anion channel (VDAC). The current study validates the interactions among HK-1, VDAC, and GLT-1 by using forward and reverse immunoprecipitations and provides evidence that a subfraction of HK1 colocalizes with GLT-1 in vivo. A peptide known to disrupt the interaction between HK and VDAC did not disrupt interactions between GLT-1 and several mitochondrial proteins. In parallel experiments, displacement of HK from VDAC reduced GLT-1-mediated glutamate uptake. These results suggest that, although HK1 forms coimmunoprecipitatable complexes with both VDAC and GLT-1, it does not physically link GLT-1 to mitochondrial proteins. However, the interaction of HK1 with VDAC supports GLT-1-mediated transport activity. © 2014 Wiley Periodicals, Inc.

  19. The authorships and dates of the specific nomina Megophrys shuichengensis and Pseudohynobius shuichengensis (Amphibia).

    PubMed

    Ohler, Annemarie; Frétey, Thierry; Dubois, Alain

    2015-05-28

    Two amphibian species from China are designated by the specific nomen shuichengensis, which refers to the Shuicheng County (26°34'N, 104°51'E), south of the city of Liupanshui in the province of Guizhou: Megophrys shuichengensis (Amphibia, Anura) and Pseudohynobius shuichengensis (Amphibia, Urodela). The holotypes (holophoronts) of both species were deposited in Department of Biology of the Liupanshui Teachers Higher College (LTHC below). Both species share the particularity of having been described as new twice, at different dates, in different journals and with different authorships. Although this has been acknowledged for the salamander, it has not yet been so for the frog.

  20. Voltage-dependent calcium currents are enhanced in dorsal root ganglion neurones from the Bio Bred/Worchester diabetic rat.

    PubMed Central

    Hall, K E; Sima, A A; Wiley, J W

    1995-01-01

    1. Whole-cell, high-threshold, voltage-dependent calcium currents (ICa) were enhanced in acutely dissociated, capsaicin-sensitive dorsal root ganglion neurones from diabetic Bio Bred/Worchester (BB/W) rats, compared with those from age-matched, non-diabetic controls. The magnitude of the enhancement increased with the duration of diabetes, and reached significance at diabetic durations of 6 months (diabetic: 6.3 +/- 0.4 nA; current density (CD), 157 +/- 12 pA pF-1; means +/- S.E.M., n = 9, P < 0.01; control: 3.9 +/- 0.6 nA; CD, 116 +/- 11 pA pF-1; n = 18) and 8 months (diabetic: 7.6 +/- 0.4 nA; CD, 177 +/- 25 pA pF-1; n = 11, P < 0.005; control: 5.1 +/- 0.5 nA; CD, 111 +/- 26 pA pF-1; n = 15). Low-threshold, voltage-dependent ICa were also enhanced in neurones from animals diabetic for 8 months (diabetic: 2.5 +/- 0.7 nA, n = 4, P < 0.05; control: 0.7 +/- 0.5 nA, n = 6). 2. The ICa enhancement was prevented by long-term treatment of diabetic animals with an aldose reductase inhibitor (ARI; peak ICa at 6 months: 4.41 +/- 0.48 nA, n = 2; at 8 months: 4.32 +/- 0.60 nA, n = 9). 3. The ICa enhancement was not due to a shift in the voltage dependence of either the current-voltage relationship or steady-state inactivation. 4. The L channel antagonist nifedipine and preferential N channel antagonist omega-conotoxin GVIA (omega-CgTX) caused a greater inhibition of high-threshold ICa in diabetic neurones compared with controls (nifedipine: control: 25 +/- 3%, n = 26; diabetic: 36 +/- 7%, n = 11; omega-CgTX: control: 40 +/- 4%, n = 21; diabetic: 50 +/- 7%, n = 7). Diabetic neurones also demonstrated a significantly greater residual current (2.44 +/- 0.34 nA, n = 7) in the presence of both antagonists vs. controls (1.28 +/- 0.30 nA, n = 8, P < 0.05), suggesting that N-, L- and additional non-N-, non-L-type high-threshold ICa were enhanced. Images Figure 2 PMID:7473199

  1. [Role of calcineurin in down-regulation of left ventricular transmural voltage- dependent K(+) currents in mice with heart failure].

    PubMed

    Shi, Chen-Xia; Dong, Fang; Chang, Yan-Chao; Wang, Xiao-Feng; Xu, Yan-Fang

    2015-08-25

    The aim of the present study was to investigate the role of calcineurin in the down-regulation of left ventricular transmural voltage-dependent K(+) currents in heart failure. Transverse aorta was banded by using microsurgical techniques to create mouse heart failure model. Sham-operated (Sham) or aorta banded (Band) mice were randomized to receive calcineurin inhibitor cyclosporine A (CsA) or vehicle. The densities and kinetic properties of voltage-dependent K(+) currents, as well as action potential (AP), of left ventricular subendocardial (Endo) and subepicardial (Epi) myocytes were determined by using whole-cell patch-clamp technique. The results showed that calcineurin activity was significant higher in Endo myocytes than that in Epi ones in all the groups. Compared with Sham group, Band mice showed significantly increased calcineurin activity both in Endo and Epi myocytes. CsA significantly reduced calcineurin activity in Band mice. CsA treatment in Band mice partially reversed the down-regulation of Ito density, completely reversed the down-regulation of IK,slow density both in Endo and Epi myocytes, and Iss density in Endo myocytes. In addition, CsA treatment in Band mice partially antagonized the prolongation of action potential duration (APD), and APD at 50% (APD50) and 90% repolarization (APD90) were significantly reduced. Because of non-parallel shortening of APD in Endo and Epi myocytes, the ratio of Endo/Epi APD90 was reduced from 4.8:1 in Band mice to 2.6:1 in CsA-treated mice, which was close to that in Sham mice. The results suggest that non-parallel activation of calcineurin in Endo and Epi myocytes contributes to the down-regulation of transmural voltage-dependent K(+) currents and the amplification of transmural dispersion of repolarization (TDR) in left ventricular failure hearts. Inhibition of calcineurin may be a potential new therapeutic strategy to prevent and cure arrhythmias and sudden death in heart failure.

  2. Selective serotonin reuptake inhibitor sertraline inhibits voltage-dependent K+ channels in rabbit coronary arterial smooth muscle cells.

    PubMed

    Kim, Han Sol; Li, Hongliang; Kim, Hye Won; Shin, Sung Eun; Choi, Il-Whan; Firth, Amy L; Bang, Hyoweon; Bae, Young Min; Park, Won Sun

    2016-12-01

    We examined the effects of the selective serotonin reuptake inhibitor (SSRI) sertraline on voltage-dependent K+ (Kv) channels in freshly isolated rabbit coronary arterial smooth muscle cells using the voltage-clamp technique. Sertraline decreased the Kv channel current in a dose-dependent manner, with an IC50 value of 0.18 mu M and a slope value (Hill coefficient) of 0.61. Although the application of 1 mu M sertraline did not affect the steady-state activation curves, sertraline caused a significant, negative shift in the inactivation curves. Pretreatment with another SSRI, paroxetine, had no significant effect on Kv currents and did not alter the inhibitory effects of sertraline on Kv currents. From these results, we concluded that sertraline dose-dependently inhibited Kv currents independently of serotonin reuptake inhibition by shifting inactivation curves to a more negative potential.

  3. Selective modulation of cellular voltage-dependent calcium channels by hyperbaric pressure—a suggested HPNS partial mechanism

    PubMed Central

    Aviner, Ben; Gradwohl, Gideon; Mor Aviner, Merav; Levy, Shiri; Grossman, Yoram

    2014-01-01

    Professional deep sea divers experience motor and cognitive impairment, known as High Pressure Neurological Syndrome (HPNS), when exposed to pressures of 100 msw (1.1 MPa) and above, considered to be the result of synaptic transmission alteration. Previous studies have indicated modulation of presynaptic Ca2+ currents at high pressure. We directly measured for the first time pressure effects on the currents of voltage dependent Ca2+ channels (VDCCs) expressed in Xenopus oocytes. Pressure selectivity augmented the current in CaV1.2 and depressed it in CaV3.2 channels. Pressure application also affected the channels' kinetics, such as ƮRise, ƮDecay. Pressure modulation of VDCCs seems to play an important role in generation of HPNS signs and symptoms. PMID:24904281

  4. The effects of low calcium on the voltage-dependent conductances involved in tuning of turtle hair cells.

    PubMed

    Art, J J; Fettiplace, R; Wu, Y C

    1993-10-01

    1. The voltage-dependent conductances of turtle cochlear hair cells of known resonant frequency were characterized by tight-seal, whole-cell recording during superfusion with solutions containing normal (2.8 mM) and reduced (0.1-10 microM) Ca2+. 2. In 1 microM Ca2+, the current flowing through the voltage-dependent Ca2+ channels was increased roughly fivefold and had a reversal potential near 0 mV. This observation may be explained by the Ca2+ channels becoming non-selectively permeable to monovalent cations in low-Ca2+ solutions. Lowering the Ca2+ further to 0.1 microM produced little increase in the current. 3. The size of the non-selective current increased systematically with the resonant frequency of the hair cell over the range from 10 to 320 Hz. This suggests that hair cells tuned to higher frequencies contain more voltage-dependent Ca2+ channels. 4. There was a good correlation between the amplitudes of the non-selective current and the K+ current which underlies electrical tuning of these hair cells. The amplitude of the K+ current also increased systematically with resonant frequency. 5. In cells with resonant frequencies between 120 and 320 Hz, the K+ current was completely abolished in 1 microM Ca2+, consistent with prior evidence that this current flows through Ca2+ activated K+ channels. In a majority of cells tuned between 50 and 120 Hz, the K+ current was incompletely blocked in 1 microM Ca2+, but was eliminated in 0.1 microM Ca2+. In all hair cells the K+ current was abolished by 25 mM tetraethylammonium chloride. 6. In cells tuned to 10-20 Hz, the K+ current was not substantially diminished even in 0.1 microM Ca2+, which argues that it may not be Ca2+ activated. 7. In cells tuned to frequencies above 100 Hz, the K+ current could still be evoked by depolarization during superfusion with 10 microM Ca2+. However, its half-activation voltage was shifted to more depolarized levels and its maximum amplitude was systematically reduced with increasing

  5. A theoretical model of slow wave regulation using voltage-dependent synthesis of inositol 1,4,5-trisphosphate.

    PubMed Central

    Imtiaz, Mohammad S; Smith, David W; van Helden, Dirk F

    2002-01-01

    A qualitative mathematical model is presented that examines membrane potential feedback on synthesis of inositol 1,4,5-trisphosphate (IP(3)), and its role in generation and modulation of slow waves. Previous experimental studies indicate that slow waves show voltage dependence, and this is likely to result through membrane potential modulation of IP(3). It is proposed that the observed response of the tissue to current pulse, pulse train, and maintained current injection can be explained by changes in IP(3), modulated through a voltage-IP(3) feedback loop. Differences underlying the tissue responses to current injections of opposite polarities are shown to be due to the sequence of events following such currents. Results from this model are consistent with experimental findings and provide further understanding of these experimental observations. Specifically, we find that membrane potential can induce, abolish, and modulate slow wave frequency by altering the excitability of the tissue through the voltage-IP(3) feedback loop. PMID:12324409

  6. Properties of single voltage-dependent K+ channels in dendrites of CA1 pyramidal neurones of rat hippocampus

    PubMed Central

    Chen, Xixi; Johnston, Daniel

    2004-01-01

    Voltage-dependent K+ channels in the apical dendrites of CA1 pyramidal neurones play important roles in regulating dendritic excitability, synaptic integration, and synaptic plasticity. Using cell-attached, voltage-clamp recordings, we found a large variability in the waveforms of macroscopic K+ currents in the dendrites. With single-channel analysis, however, we were able to identify four types of voltage-dependent K+ channels and we categorized them as belonging to delayed-rectifier, M-, D-, or A-type K+ channels previously described from whole-cell recordings. Delayed-rectifier-type K+ channels had a single-channel conductance of 19 ± 0.5 pS, and made up the majority of the sustained K+ current uniformly distributed along the apical dendrites. The M-type K+ channels had a single-channel conductance of 11 ± 0.8 pS, did not inactivate with prolonged membrane depolarization, deactivated with slow kinetics (time constant 100 ± 6 ms at −40 mV), and were inhibited by bath-applied muscarinic agonist carbachol (10 μm). The D-type K+ channels had a single-channel conductance of around 18 pS, and inactivated with a time constant of 98 ± 4 ms at +54 mV. The A-type K+ channels had a single-channel conductance of 6 ± 0.6 pS, inactivated with a time constant of 23 ± 2 ms at +54 mV, and contributed to the majority of the transient K+ current previously described. These results suggest both functional and molecular complexity for K+ channels in dendrites of CA1 pyramidal neurones. PMID:15218076

  7. Functional coupling between sodium-activated potassium channels and voltage-dependent persistent sodium currents in cricket Kenyon cells.

    PubMed

    Takahashi, Izumi; Yoshino, Masami

    2015-10-01

    In this study, we examined the functional coupling between Na(+)-activated potassium (KNa) channels and Na(+) influx through voltage-dependent Na(+) channels in Kenyon cells isolated from the mushroom body of the cricket Gryllus bimaculatus. Single-channel activity of KNa channels was recorded with the cell-attached patch configuration. The open probability (Po) of KNa channels increased with increasing Na(+) concentration in a bath solution, whereas it decreased by the substitution of Na(+) with an equimolar concentration of Li(+). The Po of KNa channels was also found to be reduced by bath application of a high concentration of TTX (1 μM) and riluzole (100 μM), which inhibits both fast (INaf) and persistent (INaP) Na(+) currents, whereas it was unaffected by a low concentration of TTX (10 nM), which selectively blocks INaf. Bath application of Cd(2+) at a low concentration (50 μM), as an inhibitor of INaP, also decreased the Po of KNa channels. Conversely, bath application of the inorganic Ca(2+)-channel blockers Co(2+) and Ni(2+) at high concentrations (500 μM) had little effect on the Po of KNa channels, although Cd(2+) (500 μM) reduced the Po of KNa channels. Perforated whole cell clamp analysis further indicated the presence of sustained outward currents for which amplitude was dependent on the amount of Na(+) influx. Taken together, these results indicate that KNa channels could be activated by Na(+) influx passing through voltage-dependent persistent Na(+) channels. The functional significance of this coupling mechanism was discussed in relation to the membrane excitability of Kenyon cells and its possible role in the formation of long-term memory. Copyright © 2015 the American Physiological Society.

  8. Voltage-dependent antagonist/agonist actions of taurine on Ca(2+)-activated potassium channels of rat skeletal muscle fibers.

    PubMed

    Tricarico, D; Barbieri, M; Conte Camerino, D

    2001-09-01

    Emerging evidence supports the idea that taurine exerts some of its actions through inhibition of inward rectifier K(+) channels, ATP-sensitive K(+) channels, and voltage-dependent K(+) channels. However, to date not much is known about the effects of this sulfonic amino acid on Ca(2+)-activated K(+) (K(Ca(2+))) channels, which are widely expressed in various tissues, including skeletal muscle. In the present work, the effects of taurine on K(Ca(2+)) channels of rat skeletal muscle fibers were investigated using the patch-clamp technique. The application of the amino acid to the internal side of the excised macropatches induced a dose-dependent decrease in the outward K(Ca(2+)) currents recorded at positive membrane potentials in the presence of 8 to 16 microM concentrations of free Ca(2+) ions in the bath with an IC(50) of 31.9. 10(-3) +/- 1 M (slope factor = 1.2) (n = 11 patches). In contrast, at negative membrane potentials taurine caused an enhancement of the muscular inward K(Ca(2+)) currents with a DE(50) (drug concentration needed to enhance the current by 50%) of 46.7. 10(-3) +/- 2 M (slope factor = 1.3) (n = 9 patches). Single channel analysis revealed that this effect was mediated by changes in the reversal potential of the K(Ca(2+)) channel for K(+) ions with no changes in the gating properties or in the sensitivity of the channel to Ca(2+) ions. Taurine also did not affect the single channel conductance. In conclusion, taurine shows a voltage-dependent dualistic action on K(Ca(2+)) channels, being an inhibitor of the channel at positive membrane potentials and an activator at negative membrane potentials.

  9. Amine blockers of the cytoplasmic mouth of sodium channels: a small structural change can abolish voltage dependence.

    PubMed Central

    Zamponi, G W; French, R J

    1994-01-01

    Many drugs block sodium channels from the cytoplasmic end (Moczydlowski, E., A. Uehara, X, Guo, and J. Heiny. 1986. Isochannels and blocking modes of voltage-dependent sodium channels. Ann. N.Y. Acad. Sci. 479:269-292.). Lidocaine, applied to either side of the membrane, induces two blocking modes, a rapid, voltage-dependent open-channel block, and a block of the inactivated channel that occurs on a 1000-fold slower timescale. Here we describe the actions of several lidocaine-related amines on batrachotoxin(BTX)-activated bovine cardiac sodium channels incorporated into planar lipid bilayers. We applied blocking amines from the intracellular side and examined the structural determinants of fast, open-channel block. Neither hydroxyl nor carbonyl groups, present in the aryl-amine link of lidocaine, were necessary, indicating that hydrogen bonding between structures in the aryl-amine link and the channel is not required. Block, however, was significantly enhanced by addition of an aromatic ring, or by the lengthening of aliphatic side chains, suggesting that a hydrophobic domain strengthens binding while the amine group blocks the pore. For most blockers, depolarizing potentials enhanced block, with the charged amine group apparently traversing 45-60% of the transmembrane voltage. By contrast, block by phenylhydrazine was essentially voltage-independent. The relatively rigid planar structure of phenylhydrazine may prevent the charged amino end from entering the electric field when the aromatic ring is bound. The relation between structural features of different blockers and their sensitivity to voltage suggests that the transmembrane voltage drops completely over less than 5 A. We raise the possibility that the proposed hydrophobic binding domain overlaps the endogenous receptor for the inactivation gate. If so, our data place limits on the distance between this receptor and the intrapore site at which charged amines bind. PMID:7811912

  10. Multiple calcium channels in synaptosomes: voltage dependence of 1,4-dihydropyridine binding and effects on function

    SciTech Connect

    Dunn, S.M.J.

    1988-07-12

    The voltage dependence of binding of the calcium channel antagonist, (+)-(/sup 3/H)PN200-110, to rat brain synaptosomes and the effects of dihydropyridines on /sup 45/Ca/sup 2 +/ uptake have been investigated. Under nondepolarizing conditions (+)-(/sup 3/H)PN200-110 binds to a single class of sites with a K/sub d/ of 0.07 nM and a binding capacity of 182 fmol/mg of protein. When the synaptosomal membrane potential was dissipated either by osmotic lysis of the synaptosomes or by depolarization induced by raising the external K/sup +/ concentration, there was a decrease in affinity with no change in the number of sites. The effects of calcium channel ligands on /sup 45/Ca/sup 2 +/ uptake by synaptosomes have been measured as a function of external potassium concentration, i.e., membrane potential. Depolarization led to a rapid influx of /sup 45/Ca/sup 2 +/ whose magnitude was voltage-dependent. Verapamil almost completely inhibited calcium uptake at all potassium concentrations studies. In contrast, the effects of dihydropyridines (2 ..mu..M) appear to be voltage-sensitive. At relatively low levels of depolarization nitrendipine and PN200-110 completely inhibited /sup 45/Ca/sup 2 +/ influx, whereas the agonist Bay K8644 slightly potentiated the response. At higher K/sup +/ concentrations an additional dihydropyridine-insensitive component of calcium uptake was observed. These results provide evidence for the presence of dihydropyridine-sensitive calcium channels in synaptosomes which may be activated under conditions of partial depolarization.

  11. Phosphorylation by Nek1 regulates opening and closing of voltage dependent anion channel 1

    SciTech Connect

    Chen, Yumay; Gaczynska, Maria; Osmulski, Pawel; Polci, Rosaria; Riley, Daniel J.

    2010-04-09

    VDAC1 is a key component of the mitochondrial permeability transition pore. To initiate apoptosis and certain other forms of cell death, mitochondria become permeable such that cytochrome c and other pre-apoptotic molecules resident inside the mitochondria enter the cytosol and activate apoptotic cascades. We have shown recently that VDAC1 interacts directly with never-in-mitosis A related kinase 1 (Nek1), and that Nek1 phosphorylates VDAC1 on Ser193 to prevent excessive cell death after injury. How this phosphorylation regulates the activity of VDAC1, however, has not yet been reported. Here, we use atomic force microscopy (AFM) and cytochrome c conductance studies to examine the configuration of VDAC1 before and after phosphorylation by Nek1. Wild-type VDAC1 assumes an open configuration, but closes and prevents cytochrome c efflux when phosphorylated by Nek1. A VDAC1-Ser193Ala mutant, which cannot be phosphorylated by Nek1 under identical conditions, remains open and constitutively allows cytochrome c efflux. Conversely, a VDAC1-Ser193Glu mutant, which mimics constitutive phosphorylation by Nek1, remains closed by AFM and prevents cytochrome c leakage in the same liposome assays. Our data provide a mechanism to explain how Nek1 regulates cell death by affecting the opening and closing of VDAC1.

  12. Molecular design of the voltage-dependent, anion-selective channel in the mitochondrial outer membrane.

    PubMed

    Guo, X W; Smith, P R; Cognon, B; D'Arcangelis, D; Dolginova, E; Mannella, C A

    1995-01-01

    The mitochondrial outer membrane contains numerous copies of a channel protein, VDAC, that is thought to be the main permeability pathway through this membrane for polar molecules and ions. Low-dose electron microscopy has been used to obtain images of two-dimensional crystals of this channel (produced by treating outer membranes from fungal mitochondria with phospholipase A2) embedded in vitreous ice or aurothioglucose. The angular orientation of the channels in the unit cell of one type of array has been determined by rotational correlation analysis. The location of the amino-terminal segment of the protein (which, according to circular dichroism, forms an alpha-helix in nonpolar solvents and detergent solutions) has been determined by labeling arrays with Fab prepared from antibodies directed against residues 1-20. The three-dimensional structure of the channel has been obtained by applying Fourier reconstruction methods to projections of tilted crystals embedded in aurothioglucose, followed by averaging of the three non-symmetry-related channels in the unit cell. The results of this study indicate that the wall of VDAC's lumen has several irregular features (uneven height, grooves) and that the aminoterminal segment extends away from the lumen in this crystalline state.

  13. Voltage-dependent insertion of alamethicin at phospholipid/water and octane/water interfaces.

    PubMed Central

    Tieleman, D P; Berendsen, H J; Sansom, M S

    2001-01-01

    Understanding the binding and insertion of peptides in lipid bilayers is a prerequisite for understanding phenomena such as antimicrobial activity and membrane-protein folding. We describe molecular dynamics simulations of the antimicrobial peptide alamethicin in lipid/water and octane/water environments, taking into account an external electric field to mimic the membrane potential. At cis-positive potentials, alamethicin does not insert into a phospholipid bilayer in 10 ns of simulation, due to the slow dynamics of the peptide and lipids. However, in octane N-terminal insertion occurs at field strengths from 0.33 V/nm and higher, in simulations of up to 100 ns duration. Insertion of alamethicin occurs in two steps, corresponding to desolvation of the Gln7 side chain, and the backbone of Aib10 and Gly11. The proline induced helix kink angle does not change significantly during insertion. Polyalanine and alamethicin form stable helices both when inserted in octane and at the water/octane interface, where they partition in the same location. In water, both polyalanine and alamethicin partially unfold in multiple simulations. We present a detailed analysis of the insertion of alamethicin into the octane slab and the influence of the external field on the peptide structure. Our findings give new insight into the mechanism of channel formation by alamethicin and the structure and dynamics of membrane-associated helices. PMID:11159406

  14. Voltage-dependent dye coupling at a rectifying electrotonic synapse of the crayfish.

    PubMed Central

    Giaume, C; Korn, H

    1984-01-01

    At the crayfish giant motor synapse, the lateral giant axon (l.g.a.) and the giant motor fibre (g.m.f.) form an electrotonic junction which exhibits two states of ionic coupling (Furshpan & Potter, 1959a; Giaume & Korn, 1983). Junctional conductance is low at resting membrane potentials (i.e. with lateral axon more negative than the motor fibre) and high when the polarity of the voltage difference (delta V) across the synapse is reversed. For these two states of conductance, junctional permeability was investigated using the intercellular tracer Lucifer Yellow. The dye was ionophoretically injected into either the presynaptic (l.g.a.) or the post-synaptic (g.m.f.) cell. In the high conductance state (delta V greater than 0), fluorescence was detected in both neurones whether Lucifer Yellow had been injected pre- or post-synaptically. By contrast, at the resting junctional polarization (delta V less than 0) Lucifer Yellow spread from the giant axon to the g.m.f., but not from the g.m.f. to the giant axons. These data demonstrate that dye transfer at the giant motor synapse, like ionic coupling, is sensitive to junctional polarization and is more marked in the high conductance state. Possible explanations for the asymmetry observed in the low conductance state are discussed. Images PLATE 1 PLATE 2 PLATE 3 PMID:6097668

  15. Phylogenetic relationships linking Duttaphrynus (Amphibia: Anura: Bufonidae) species based on 12S and 16S rDNA sequences.

    PubMed

    Pratihar, Suman; Bhattacharya, Manojit; Deuti, Kaushik

    2016-07-01

    Genus Duttaphrynus (Amphibia: Anura: Bufonidae) is endemic to southwestern and southern China and throughout southern Asia. Duttaphrynus phylogeny was also under debate for many years. 12S and 16S rDNAs help us to elucidate Duttaphrynus phylogeny.

  16. Mefloquine inhibits voltage dependent Nav1.4 channel by overlapping the local anaesthetic binding site.

    PubMed

    Paiz-Candia, Bertin; Islas, Angel A; Sánchez-Solano, Alfredo; Mancilla-Simbro, Claudia; Scior, Thomas; Millan-PerezPeña, Lourdes; Salinas-Stefanon, Eduardo M

    2017-02-05

    Mefloquine constitutes a multitarget antimalaric that inhibits cation currents. However, the effect and the binding site of this compound on Na(+) channels is unknown. To address the mechanism of action of mefloquine, we employed two-electrode voltage clamp recordings on Xenopus laevis oocytes, site-directed mutagenesis of the rat Na(+) channel, and a combined in silico approach using Molecular Dynamics and docking protocols. We found that mefloquine: i) inhibited Nav1.4 currents (IC50 =60μM), ii) significantly delayed fast inactivation but did not affect recovery from inactivation, iii) markedly the shifted steady-state inactivation curve to more hyperpolarized potentials. The presence of the β1 subunit significantly reduced mefloquine potency, but the drug induced a significant frequency-independent rundown upon repetitive depolarisations. Computational and experimental results indicate that mefloquine overlaps the local anaesthetic binding site by docking at a hydrophobic cavity between domains DIII and DIV that communicates the local anaesthetic binding site with the selectivity filter. This is supported by the fact that mefloquine potency significantly decreased on mutant Nav1.4 channel F1579A and significantly increased on K1237S channels. In silico this compound docked above F1579 forming stable π-π interactions with this residue. We provide structure-activity insights into how cationic amphiphilic compounds may exert inhibitory effects by docking between the local anaesthetic binding site and the selectivity filter of a mammalian Na(+) channel. Our proposed synergistic cycle of experimental and computational studies may be useful for elucidating binding sites of other drugs, thereby saving in vitro and in silico resources.

  17. Voltage-dependent gating of single gap junction channels in an insect cell line.

    PubMed Central

    Bukauskas, F F; Weingart, R

    1994-01-01

    De novo formation of cell pairs was used to examine the gating properties of single gap junction channels. Two separate cells of an insect cell line (clone C6/36, derived from the mosquito Aedes albopictus) were pushed against each other to provoke formation of gap junction channels. A dual voltage-clamp method was used to control the voltage gradient between the cells (Vj) and measure the intercellular current (Ij). The first sign of channel activity was apparent 4.7 min after cell contact. Steady-state coupling reached after 30 min revealed a conductance of 8.7 nS. Channel formation involved no leak between the intra- and extracellular space. The first opening of a newly formed channel was slow (25-28 ms). Each preparation passed through a phase with only one operational gap junction channel. This period was exploited to examine the single channel properties. We found that single channels exhibit several conductance states with different conductances gamma j; a fully open state (gamma j(main state)), several substates (gamma j(substates)), a residual state (gamma j(residual)) and a closed state (gamma j(closed)). The gamma j(main state) was 375 pS, and gamma j(residual) ranged from 30 to 90 pS. The transitions between adjacent substates were 1/7-1/4 of gamma j(main state). Vj had no effect on gamma j(main state), but slightly affected gamma j (residual). The lj transitions involving gamma j(closed) were slow (15-60 ms), whereas those not involving gamma j(closed) were fast (< 2 ms). An increase in Vj led to a decrease in open channel probability. Depolarization of the membrane potential (Vm) increased the incidence of slow transitions leading to gamma j(closed). We conclude that insect gap junctions possess two gates, a fast gate controlled by Vj and giving rise to gamma j(substates) and gamma j(residual), and a slow gate sensitive to Vm and able to close the channel completely. PMID:7524710

  18. Molecular characterization and functional expression of the Apis mellifera voltage-dependent Ca2+ channels.

    PubMed

    Cens, Thierry; Rousset, Matthieu; Collet, Claude; Charreton, Mercedes; Garnery, Lionel; Le Conte, Yves; Chahine, Mohamed; Sandoz, Jean-Christophe; Charnet, Pierre

    2015-03-01

    Voltage-gated Ca(2+) channels allow the influx of Ca(2+) ions from the extracellular space upon membrane depolarization and thus serve as a transducer between membrane potential and cellular events initiated by Ca(2+) transients. Most insects are predicted to possess three genes encoding Cavα, the main subunit of Ca(2+) channels, and several genes encoding the two auxiliary subunits, Cavβ and Cavα2δ; however very few of these genes have been cloned so far. Here, we cloned three full-length cDNAs encoding the three Cavα subunits (AmelCav1a, AmelCav2a and AmelCav3a), a cDNA encoding a novel variant of the Cavβ subunit (AmelCavβc), and three full-length cDNAs encoding three Cavα2δ subunits (AmelCavα2δ1 to 3) of the honeybee Apis mellifera. We identified several alternative or mutually exclusive exons in the sequence of the AmelCav2 and AmelCav3 genes. Moreover, we detected a stretch of glutamine residues in the C-terminus of the AmelCav1 subunit that is reminiscent of the motif found in the human Cav2.1 subunit of patients with Spinocerebellar Ataxia type 6. All these subunits contain structural domains that have been identified as functionally important in their mammalian homologues. For the first time, we could express three insect Cavα subunits in Xenopus oocytes and we show that AmelCav1a, 2a and 3a form Ca(2+) channels with distinctive properties. Notably, the co-expression of AmelCav1a or AmelCav2a with AmelCavβc and AmCavα2δ1 produces High Voltage-Activated Ca(2+) channels. On the other hand, expression of AmelCav3a alone leads to Low Voltage-Activated Ca(2+) channels.

  19. Conducting and voltage-dependent behaviors of potassium ion channels reconstituted from diaphragm sarcoplasmic reticulum: comparison with the cardiac isoform.

    PubMed

    Picher, M; Decrouy, A; Rousseau, E

    1996-02-21

    Sarcoplasmic reticulum (SR) K+ channels from canine diaphragm were studied upon fusion of longitudinal and junctional membrane vesicles into planar lipid bilayers (PLB). The large-conductance cation selective channel (gamma(max) = 250 pS; Km = 33 mM) displays long-lasting open events which are much more frequent at positive than at negative voltages. A major subconducting state about 45% of the fully-open state current amplitude was occasionally observed at all voltages. The voltage-dependence of the open probability displays a sigmoid relationship that was fitted by the Boltzmann equation and expressed in terms of thermodynamic parameters, namely the free energy (delta Gi) and the effective gating charge (Zs): delta Gi = 0.27 kcal/mol and Zs = -1.19 in 250 mM potassium gluconate (K-gluconate). Kinetic analyses also confirmed the voltage-dependent gating behavior of this channel, and indicate the implication of at least two open and three closed states. The diaphragm SR K+ channel shares several biophysical properties with the cardiac isoform: g = 180 pS, delta Gi = 0.75 kcal/mol, Zs = -1.45 in 150 mM K-gluconate, and a similar sigmoid P(o)/voltage relationship. Little is known about the regulation of the diaphragm and cardiac SR K+ channels. The conductance and gating of these channels were not influenced by physiological concentrations of Ca2+ (0.1 microM-1 mM) or Mg2+ (0.25-1 mM), as well as by cGMP (25-100 microM), lemakalim (1-100 microM), glyburide (up to 10 microM) or charybdotoxin (45-200 nM), added either to the cis or to the trans chamber. The apparent lack of biochemical or pharmacological modulation of these channels implies that they are not related to any of the well characterized surface membrane K+ channels. On the other hand, their voltage sensitivity strongly suggests that their activity could be modulated by putative changes in SR membrane potential that might occur during calcium fluxes.

  20. Reduced temperature and bias-voltage dependence of the magnetoresistance in magnetic tunnel junctions with Hf-inserted Al2O3 barrier

    NASA Astrophysics Data System (ADS)

    Park, Byong Guk; Lee, Taek Dong

    2002-09-01

    A modified tunnel barrier structure for the magnetic tunnel junction (MTJ) was fabricated by inserting a Hf layer in the middle of the Al2O3 tunnel barrier. MTJs with the Hf-inserted barrier show a higher tunnel mangnetoresistance (TMR) ratio and weaker temperature and bias-voltage dependence of TMR compared to the MTJs with a conventional Al2O3 barrier. The enhancement of the TMR ratio and the reduction of the temperature and bias-voltage dependence were attributed to the reduction of defects in the barrier.

  1. Displacing hexokinase from mitochondrial voltage-dependent anion channel (VDAC) impairs GLT-1-mediated glutamate uptake but does not disrupt interactions between GLT-1 and mitochondrial proteins

    PubMed Central

    Jackson, Joshua G.; O’Donnell, John C.; Krizman, Elizabeth; Robinson, Michael B.

    2014-01-01

    The glutamate transporter GLT-1 is the major route for the clearance of extracellular glutamate in the forebrain, and most GLT-1 protein is found in astrocytes. This protein is coupled to the Na+-electrochemical gradient, supporting the active intracellular accumulation of glutamate. We recently used a proteomic approach to identify proteins that may interact with GLT-1 in rat cortex, including the Na+/K+-ATPase, most glycolytic enzymes, and several mitochondrial proteins. We also showed that most GLT-1 puncta (~70%) are overlapped by mitochondria in astroglial processes in organotypic slices. Based on this analysis, we proposed that the glycolytic enzyme hexokinase 1 (HK1) might physically form a scaffold to link GLT-1 and mitochondria because HK1 is known to interact with the outer mitochondrial membrane protein, voltage-dependent anion channel (VDAC). In the present study, we first validated the interactions between HK-1, VDAC and GLT-1 using forward and reverse immunoprecipitations. We also provided evidence that a subfraction of HK1 co-localizes with GLT-1 in vivo. We found that a peptide, known to disrupt the interaction between HK and VDAC, did not disrupt interactions between GLT-1 and several mitochondrial proteins. In parallel experiments, we found that displacement of HK from VDAC reduced GLT-1-mediated glutamate uptake. These results suggest that although HK1 forms co-immunoprecipitatable complexes with both VDAC and GLT-1, it does not physically link GLT-1 to mitochondrial proteins. However, the interaction of HK1 with VDAC supports GLT-1-mediated transport activity. PMID:25546576

  2. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

    PubMed Central

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-01-01

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  3. Regulation by second messengers of the slowly activating, voltage-dependent potassium current expressed in Xenopus oocytes.

    PubMed Central

    Busch, A E; Kavanaugh, M P; Varnum, M D; Adelman, J P; North, R A

    1992-01-01

    1. Voltage-clamp recordings of membrane current were made from Xenopus oocytes that had been injected with RNA which had been transcribed in vitro from a cloned complementary DNA. 2. Depolarization from -80 mV evoked outward potassium currents that developed very slowly. At -20 mV the time constant for activation was about 50 s, and at +40 mV about 6 s. 3. The potassium current was increased by the calcium ionophore A23187 or by intracellular injection of inositol 1,4,5-trisphosphate (IP3), each of which should increase the intracellular calcium concentration ([Ca2+]i). The current was decreased by injection of BAPTA (1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid). The current was also reduced by phorbol esters; this effect was blocked by staurosporine. 4. In oocytes that had also been injected with RNA encoding the 5-hydroxytryptamine (5-HT2) receptor, 5-HT increased the potassium current. After caffeine pretreatment, to block the release of intracellular calcium, 5-HT decreased the current; this decrease was prevented by staurosporine. 5. It is concluded that the slowly activating, voltage-dependent potassium current expressed in Xenopus oocytes is increased by increases in [Ca2+]i and is decreased by activation of protein kinase C. Stimulation of 5-HT2 receptors can have both these effects, but the former normally predominates. Images Fig. 4 PMID:1432714

  4. Voltage-dependent anion channels (VDACs, porin) expressed in the plasma membrane regulate the differentiation and function of human osteoclasts.

    PubMed

    Kotake, Shigeru; Yago, Toru; Kawamoto, Manabu; Nanke, Yuki

    2013-01-01

    Fewer molecules have been identified on human than murine osteoclasts, the former differing from murine osteoclasts in many ways. We show that voltage-dependent anion channels (VDACs, porin) are expressed in the plasma membrane of human osteoclasts. A search for novel proteins expressed in the plasma membrane of human osteoclasts identified VDAC. Anti-VDAC antibodies inhibited human osteoclastogenesis in vitro. VDAC expression was detected in membranes by immunoelectron microscopy and immunocytochemical double staining. The VDAC protein functions as a Cl(-) channel. VDACs regulate bone resorption, which show using Osteologic™ plates. The epitope of the antibody lay within a 10-amino acid sequence in the VDAC. The findings suggest that the VDAC is, at least partly, a novel Cl(-) channel regulating the differentiation and function of human osteoclasts. VDACs may play a crucial role in acidifying the resorption lacunae between osteoclasts and bone. Inhibitors of VDACs could be used to treat diseases involving increased resorption, such as osteoporosis, rheumatoid arthritis, and Paget's disease. © 2012 International Federation for Cell Biology.

  5. Local mitochondrial-endolysosomal microfusion cleaves voltage-dependent anion channel 1 to promote survival in hypoxia.

    PubMed

    Brahimi-Horn, M Christiane; Lacas-Gervais, Sandra; Adaixo, Ricardo; Ilc, Karine; Rouleau, Matthieu; Notte, Annick; Dieu, Marc; Michiels, Carine; Voeltzel, Thibault; Maguer-Satta, Véronique; Pelletier, Joffrey; Ilie, Marius; Hofman, Paul; Manoury, Bénédicte; Schmidt, Alexander; Hiller, Sebastian; Pouysségur, Jacques; Mazure, Nathalie M

    2015-05-01

    The oxygen-limiting (hypoxic) microenvironment of tumors induces metabolic reprogramming and cell survival, but the underlying mechanisms involving mitochondria remain poorly understood. We previously demonstrated that hypoxia-inducible factor 1 mediates the hyperfusion of mitochondria by inducing Bcl-2/adenovirus E1B 19-kDa interacting protein 3 and posttranslational truncation of the mitochondrial ATP transporter outer membrane voltage-dependent anion channel 1 in hypoxic cells. In addition, we showed that truncation is associated with increased resistance to drug-induced apoptosis and is indicative of increased patient chemoresistance. We now show that silencing of the tumor suppressor TP53 decreases truncation and increases drug-induced apoptosis. We also show that TP53 regulates truncation through induction of the mitochondrial protein Mieap. While we found that truncation was independent of mitophagy, we observed local microfusion between mitochondria and endolysosomes in hypoxic cells in culture and in patients' tumor tissues. Since we found that the endolysosomal asparagine endopeptidase was responsible for truncation, we propose that it is a readout of mitochondrial-endolysosomal microfusion in hypoxia. These novel findings provide the framework for a better understanding of hypoxic cell metabolism and cell survival through mitochondrial-endolysosomal microfusion regulated by hypoxia-inducible factor 1 and TP53.

  6. The voltage-dependent K+ channels Kv1.3 and Kv1.5 in human cancer

    PubMed Central

    Comes, Núria; Bielanska, Joanna; Vallejo-Gracia, Albert; Serrano-Albarrás, Antonio; Marruecos, Laura; Gómez, Diana; Soler, Concepció; Condom, Enric; Ramón y Cajal, Santiago; Hernández-Losa, Javier; Ferreres, Joan C.; Felipe, Antonio

    2013-01-01

    Voltage-dependent K+ channels (Kv) are involved in a number of physiological processes, including immunomodulation, cell volume regulation, apoptosis as well as differentiation. Some Kv channels participate in the proliferation and migration of normal and tumor cells, contributing to metastasis. Altered expression of Kv1.3 and Kv1.5 channels has been found in several types of tumors and cancer cells. In general, while the expression of Kv1.3 apparently exhibits no clear pattern, Kv1.5 is induced in many of the analyzed metastatic tissues. Interestingly, evidence indicates that Kv1.5 channel shows inversed correlation with malignancy in some gliomas and non-Hodgkin's lymphomas. However, Kv1.3 and Kv1.5 are similarly remodeled in some cancers. For instance, expression of Kv1.3 and Kv1.5 correlates with a certain grade of tumorigenicity in muscle sarcomas. Differential remodeling of Kv1.3 and Kv1.5 expression in human cancers may indicate their role in tumor growth and their importance as potential tumor markers. However, despite of this increasing body of information, which considers Kv1.3 and Kv1.5 as emerging tumoral markers, further research must be performed to reach any conclusion. In this review, we summarize what it has been lately documented about Kv1.3 and Kv1.5 channels in human cancer. PMID:24133455

  7. The voltage-dependent K(+) channels Kv1.3 and Kv1.5 in human cancer.

    PubMed

    Comes, Núria; Bielanska, Joanna; Vallejo-Gracia, Albert; Serrano-Albarrás, Antonio; Marruecos, Laura; Gómez, Diana; Soler, Concepció; Condom, Enric; Ramón Y Cajal, Santiago; Hernández-Losa, Javier; Ferreres, Joan C; Felipe, Antonio

    2013-10-10

    Voltage-dependent K(+) channels (Kv) are involved in a number of physiological processes, including immunomodulation, cell volume regulation, apoptosis as well as differentiation. Some Kv channels participate in the proliferation and migration of normal and tumor cells, contributing to metastasis. Altered expression of Kv1.3 and Kv1.5 channels has been found in several types of tumors and cancer cells. In general, while the expression of Kv1.3 apparently exhibits no clear pattern, Kv1.5 is induced in many of the analyzed metastatic tissues. Interestingly, evidence indicates that Kv1.5 channel shows inversed correlation with malignancy in some gliomas and non-Hodgkin's lymphomas. However, Kv1.3 and Kv1.5 are similarly remodeled in some cancers. For instance, expression of Kv1.3 and Kv1.5 correlates with a certain grade of tumorigenicity in muscle sarcomas. Differential remodeling of Kv1.3 and Kv1.5 expression in human cancers may indicate their role in tumor growth and their importance as potential tumor markers. However, despite of this increasing body of information, which considers Kv1.3 and Kv1.5 as emerging tumoral markers, further research must be performed to reach any conclusion. In this review, we summarize what it has been lately documented about Kv1.3 and Kv1.5 channels in human cancer.

  8. Voltage-Dependent Anion Channel 1(VDAC1) Participates the Apoptosis of the Mitochondrial Dysfunction in Desminopathy

    PubMed Central

    Mo, Yanqing; Gong, Qi; Jiang, Aihua; Zhao, Jing

    2016-01-01

    Desminopathies caused by the mutation in the gene coding for desmin are genetically protein aggregation myopathies. Mitochondrial dysfunction is one of pathological changes in the desminopathies at the earliest stage. The molecular mechanisms of mitochondria dysfunction in desminopathies remain exclusive. VDAC1 regulates mitochondrial uptake across the outer membrane and mitochondrial outer membrane permeabilization (MOMP). Relationships between desminopathies and Voltage-dependent anion channel 1 (VDAC1) remain unclear. Here we successfully constructed the desminopathy rat model, evaluated with conventional stains, containing hematoxylin and eosin (HE), Gomori Trichrome (MGT), (PAS), red oil (ORO), NADH-TR, SDH staining and immunohistochemistry. Immunofluorescence results showed that VDAC1 was accumulated in the desmin highly stained area of muscle fibers of desminopathy patients or desminopathy rat model compared to the normal ones. Meanwhile apoptosis related proteins bax and ATF2 were involved in desminopathy patients and desminopathy rat model, but not bcl-2, bcl-xl or HK2.VDAC1 and desmin are closely relevant in the tissue splices of deminopathies patients and rats with desminopathy at protein lever. Moreover, apoptotic proteins are also involved in the desminopathies, like bax, ATF2, but not bcl-2, bcl-xl or HK2. This pathological analysis presents the correlation between VDAC1 and desmin, and apoptosis related proteins are correlated in the desminopathy. Furthermore, we provide a rat model of desminopathy for the investigation of desmin related myopathy. PMID:27941998

  9. Correlation character of ionic current fluctuations: analysis of ion current through a voltage-dependent potassium single channel.

    PubMed

    Tong-Han, Lan; Huang, Xi; Jia-Rui, Lin

    2005-10-03

    The gating of ion channels has widely been modeled by assuming the transition between open and closed states is a memoryless process. Nevertheless, the statistical analysis of an ionic current signal recorded from voltage dependence K(+) single channel is presented. Calculating the sample auto-correlation function of the ionic current based on the digitized signals, rather than the sequence of open and closed states duration time. The results provide evidence for the existence of memory. For different voltages, the ion channel current fluctuation has different correlation attributions. The correlations in data generated by simulation of two Markov models, on one hand, auto-correlation function of the ionic current shows a weaker memory, after a delayed period of time, the attribute of memory does not exist; on the other hand, the correlation depends on the number of states in the Markov model. For V(p)=-60 mV pipette potential, spectral analysis of ion channel current was conducted, the result indicates that the spectrum is not a flat spectrum, the data set from ionic current fluctuations shows considerable variability with a broad 1/f -like spectrum, alpha=1.261+/-0.24. Thus the ion current fluctuations give information about the kinetics of the channel protein, the results suggest the correlation character of ion channel protein nonlinear kinetics regardless of whether the channel is in open or closed state.

  10. Spexin Enhances Bowel Movement through Activating L-type Voltage-dependent Calcium Channel via Galanin Receptor 2 in Mice

    PubMed Central

    Lin, Cheng-yuan; Zhang, Man; Huang, Tao; Yang, Li-ling; Fu, Hai-bo; Zhao, Ling; Zhong, Linda LD; Mu, Huai-xue; Shi, Xiao-ke; Leung, Christina FP; Fan, Bao-min; Jiang, Miao; Lu, Ai-ping; Zhu, Li-xin; Bian, Zhao-xiang

    2015-01-01

    A novel neuropeptide spexin was found to be broadly expressed in various endocrine and nervous tissues while little is known about its functions. This study investigated the role of spexin in bowel movement and the underlying mechanisms. In functional constipation (FC) patients, serum spexin levels were significantly decreased. Consistently, in starved mice, the mRNA of spexin was significantly decreased in intestine and colon. Spexin injection increased the velocity of carbon powder propulsion in small intestine and decreased the glass beads expulsion time in distal colon in mice. Further, spexin dose-dependently stimulated the intestinal/colonic smooth muscle contraction. Galanin receptor 2 (GALR2) antagonist M871, but not Galanin receptor 3 (GALR3) antagonist SNAP37899, effectively suppressed the stimulatory effects of spexin on intestinal/colonic smooth muscle contraction, which could be eliminated by extracellular [Ca2+] removal and L-type voltage-dependentCa2+ channel (VDCC) inhibitor nifedipine. Besides, spexin dramatically increased the [Ca2+]i in isolated colonic smooth muscle cells. These data indicate that spexin can act on GALR2 receptor to regulate bowel motility by activating L-type VDCC. Our findings provide evidence for important physiological roles of spexin in GI functions. Selective action on spexin pathway might have therapeutic effects on GI diseases with motility disorders. PMID:26160593

  11. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

    PubMed

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-07-05

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  12. Kynurenine causes vasodilation and hypotension induced by activation of KCNQ-encoded voltage-dependent K(+) channels.

    PubMed

    Sakakibara, Kensuke; Feng, Guo-Gang; Li, Jiazheng; Akahori, Takahiko; Yasuda, Yoshitaka; Nakamura, Emi; Hatakeyama, Noboru; Fujiwara, Yoshihiro; Kinoshita, Hiroyuki

    2015-09-01

    Kynurenine is a potential contributor to hypotension in animal and human sepsis. The present study was designed to examine whether the voltage-dependent K(+) channels encoded by the KCNQ gene family (Kv7 channels) mediate vasodilator effects of kynurenine and whether modulation of these channels ameliorates hypotension caused by this compound. Rat aortas and mesenteric arteries or human omental arteries without endothelium were used. Some rings were incubated with the selective Kv7 channel inhibitor linopirdine (10 μM). l-Kynurenine (10 μM-1 mM) induced concentration-dependent relaxation in rat aortas and mesenteric arteries as well as human omental arteries, whereas linopirdine abolished the relaxation. l-Kynurenine (1 mM) produced hyperpolarization of vascular smooth muscle, which was reversed by linopirdine (10 μM). Wistar rats received l-kynurenine (1 mM) iv and subsequent linopirdine (10 μM) iv under 3% sevoflurane inhalation. l-Kynurenine iv caused hypotension, whereas linopirdine iv partially reversed it. In conclusion, kynurenine dilates arteries from rats as well as humans via Kv7 channels in the vascular smooth muscle. In rats, this tryptophan metabolite causes hypotension, which is partly counteracted by Kv7 channel inhibition. These results suggest that modulation of Kv7 channels may be a novel strategy to treat hypotension induced by the kynurenine. Copyright © 2015. Production and hosting by Elsevier B.V.

  13. W-7 inhibits voltage-dependent K(+) channels independent of calmodulin activity in rabbit coronary arterial smooth muscle cells.

    PubMed

    Li, Hongliang; Choi, Il-Whan; Hong, Da Hye; Son, Youn Kyoung; Na, Sung Hun; Jung, Won-Kyo; Firth, Amy L; Jung, In Duk; Park, Yeong-Min; Park, Won Sun

    2015-03-05

    We investigated the effect of W-7, a calmodulin inhibitor, on voltage-dependent K(+) (Kv) channels in freshly isolated coronary arterial smooth muscle cells using the whole-cell patch clamp technique. The amplitude of Kv currents was inhibited by W-7 in a concentration-dependent manner, with an IC50 value of 3.38±0.47μM and a Hill coefficient of 0.84±0.10. W-7 shifted the activation curve to a more positive potential but had no significant effect on the inactivation curve, which indicated that W-7 inhibited the Kv current in a closed state of the Kv channel. Another calmodulin inhibitor, W-13, had no significant effect on Kv currents and did not change the inhibitory effect of W-7 on Kv channels. From these results, we conclude that W-7 inhibited the Kv current in a dose-dependent manner, but this inhibition occurred independent of calmodulin activity and in a closed (inactivated) state of the Kv channels. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. The selective serotonin reuptake inhibitor dapoxetine inhibits voltage-dependent K(+) channels in rabbit coronary arterial smooth muscle cells.

    PubMed

    Kim, Han Sol; Li, Hongliang; Kim, Hye Won; Shin, Sung Eun; Jung, Won-Kyo; Ha, Kwon-Soo; Han, Eun-Taek; Hong, Seok-Ho; Firth, Amy L; Choi, Il-Whan; Park, Won Sun

    2017-04-01

    We investigated the inhibitory effect of dapoxetine, a selective serotonin reuptake inhibitor (SSRI), on voltage-dependent K(+) (Kv) channels using native smooth muscle cells from rabbit coronary arteries. Dapoxetine inhibited Kv channel currents in a concentration-dependent manner, with an IC50 value of 2.68±0.94 μmol/L and a slope value (Hill coefficient) of 0.63±0.11. Application of 10 μmol/L dapoxetine accelerated the rate of inactivation of Kv currents. Although dapoxetine did not modify current activation kinetics, it caused a significant negative shift in the inactivation curves. Application of train step (1 or 2 Hz) progressively increased the inhibitory effect of dapoxetine on Kv channels. In addition, the recovery time constant was extended in its presence, suggesting that the longer recovery time constant from inactivation underlies a use-dependent inhibition of the channel. From these results, we conclude that dapoxetine inhibits Kv channels in a dose-, time-, use-, and state (open)-dependent manner, independent of serotonin reuptake inhibition.

  15. Oligomerization of the mitochondrial protein voltage-dependent anion channel is coupled to the induction of apoptosis.

    PubMed

    Keinan, Nurit; Tyomkin, Dalia; Shoshan-Barmatz, Varda

    2010-12-01

    Accumulating evidence implicates that the voltage-dependent anion channel (VDAC) functions in mitochondrion-mediated apoptosis and as a critical player in the release of apoptogenic proteins, such as cytochrome c, triggering caspase activation and apoptosis. The mechanisms regulating cytochrome c release and the molecular architecture of the cytochrome c-conducting channel remain unknown. Here the relationship between VDAC oligomerization and the induction of apoptosis was examined. We demonstrated that apoptosis induction by various stimuli was accompanied by highly increased VDAC oligomerization, as revealed by cross-linking and directly monitored in living cells using bioluminescence resonance energy transfer technology. VDAC oligomerization was induced in all cell types and with all apoptosis inducers used, including staurosporine, curcumin, As(2)O(3), etoposide, cisplatin, selenite, tumor necrosis factor alpha (TNF-α), H(2)O(2), and UV irradiation, all acting through different mechanisms yet all involving mitochondria. Moreover, correlation between the levels of VDAC oligomerization and apoptosis was observed. Furthermore, the apoptosis inhibitor 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS) inhibited VDAC oligomerization. Finally, a caspase inhibitor had no effect on VDAC oligomerization and cytochrome c release. We propose that VDAC oligomerization is involved in mitochondrion-mediated apoptosis and may represent a general mechanism common to numerous apoptogens acting via different initiating cascades. Thus, targeting the oligomeric status of VDAC, and hence apoptosis, offers a therapeutic strategy for combating cancers and neurodegenerative diseases.

  16. Oligomerization of the Mitochondrial Protein Voltage-Dependent Anion Channel Is Coupled to the Induction of Apoptosis ▿

    PubMed Central

    Keinan, Nurit; Tyomkin, Dalia; Shoshan-Barmatz, Varda

    2010-01-01

    Accumulating evidence implicates that the voltage-dependent anion channel (VDAC) functions in mitochondrion-mediated apoptosis and as a critical player in the release of apoptogenic proteins, such as cytochrome c, triggering caspase activation and apoptosis. The mechanisms regulating cytochrome c release and the molecular architecture of the cytochrome c-conducting channel remain unknown. Here the relationship between VDAC oligomerization and the induction of apoptosis was examined. We demonstrated that apoptosis induction by various stimuli was accompanied by highly increased VDAC oligomerization, as revealed by cross-linking and directly monitored in living cells using bioluminescence resonance energy transfer technology. VDAC oligomerization was induced in all cell types and with all apoptosis inducers used, including staurosporine, curcumin, As2O3, etoposide, cisplatin, selenite, tumor necrosis factor alpha (TNF-α), H2O2, and UV irradiation, all acting through different mechanisms yet all involving mitochondria. Moreover, correlation between the levels of VDAC oligomerization and apoptosis was observed. Furthermore, the apoptosis inhibitor 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid (DIDS) inhibited VDAC oligomerization. Finally, a caspase inhibitor had no effect on VDAC oligomerization and cytochrome c release. We propose that VDAC oligomerization is involved in mitochondrion-mediated apoptosis and may represent a general mechanism common to numerous apoptogens acting via different initiating cascades. Thus, targeting the oligomeric status of VDAC, and hence apoptosis, offers a therapeutic strategy for combating cancers and neurodegenerative diseases. PMID:20937774

  17. Structure of a pore-blocking toxin in complex with a eukaryotic voltage-dependent K+ channel

    PubMed Central

    Banerjee, Anirban; Lee, Alice; Campbell, Ernest; MacKinnon, Roderick

    2013-01-01

    Pore-blocking toxins inhibit voltage-dependent K+ channels (Kv channels) by plugging the ion-conduction pathway. We have solved the crystal structure of paddle chimera, a Kv channel in complex with charybdotoxin (CTX), a pore-blocking toxin. The toxin binds to the extracellular pore entryway without producing discernable alteration of the selectivity filter structure and is oriented to project its Lys27 into the pore. The most extracellular K+ binding site (S1) is devoid of K+ electron-density when wild-type CTX is bound, but K+ density is present to some extent in a Lys27Met mutant. In crystals with Cs+ replacing K+, S1 electron-density is present even in the presence of Lys27, a finding compatible with the differential effects of Cs+ vs K+ on CTX affinity for the channel. Together, these results show that CTX binds to a K+ channel in a lock and key manner and interacts directly with conducting ions inside the selectivity filter. DOI: http://dx.doi.org/10.7554/eLife.00594.001 PMID:23705070

  18. Voltage-dependent anion channels modulate mitochondrial metabolism in cancer cells: regulation by free tubulin and erastin.

    PubMed

    Maldonado, Eduardo N; Sheldon, Kely L; DeHart, David N; Patnaik, Jyoti; Manevich, Yefim; Townsend, Danyelle M; Bezrukov, Sergey M; Rostovtseva, Tatiana K; Lemasters, John J

    2013-04-26

    Respiratory substrates and adenine nucleotides cross the mitochondrial outer membrane through the voltage-dependent anion channel (VDAC), comprising three isoforms--VDAC1, 2, and 3. We characterized the role of individual isoforms in mitochondrial metabolism by HepG2 human hepatoma cells using siRNA. With VDAC3 to the greatest extent, all VDAC isoforms contributed to the maintenance of mitochondrial membrane potential, but only VDAC3 knockdown decreased ATP, ADP, NAD(P)H, and mitochondrial redox state. Cells expressing predominantly VDAC3 were least sensitive to depolarization induced by increased free tubulin. In planar lipid bilayers, free tubulin inhibited VDAC1 and VDAC2 but not VDAC3. Erastin, a compound that interacts with VDAC, blocked and reversed mitochondrial depolarization after microtubule destabilizers in intact cells and antagonized tubulin-induced VDAC blockage in planar bilayers. In conclusion, free tubulin inhibits VDAC1/2 and limits mitochondrial metabolism in HepG2 cells, contributing to the Warburg phenomenon. Reversal of tubulin-VDAC interaction by erastin antagonizes Warburg metabolism and restores oxidative mitochondrial metabolism.

  19. Complex I generated, mitochondrial matrix-directed superoxide is released from the mitochondria through voltage dependent anion channels.

    PubMed

    Lustgarten, Michael S; Bhattacharya, Arunabh; Muller, Florian L; Jang, Youngmok C; Shimizu, Takahiko; Shirasawa, Takuji; Richardson, Arlan; Van Remmen, Holly

    2012-06-08

    Mitochondrial complex I has previously been shown to release superoxide exclusively towards the mitochondrial matrix, whereas complex III releases superoxide to both the matrix and the cytosol. Superoxide produced at complex III has been shown to exit the mitochondria through voltage dependent anion channels (VDAC). To test whether complex I-derived, mitochondrial matrix-directed superoxide can be released to the cytosol, we measured superoxide generation in mitochondria isolated from wild type and from mice genetically altered to be deficient in MnSOD activity (TnIFastCreSod2(fl/fl)). Under experimental conditions that produce superoxide primarily by complex I (glutamate/malate plus rotenone, GM+R), MnSOD-deficient mitochondria release ∼4-fold more superoxide than mitochondria isolated from wild type mice. Exogenous CuZnSOD completely abolished the EPR-derived GM+R signal in mitochondria isolated from both genotypes, evidence that confirms mitochondrial superoxide release. Addition of the VDAC inhibitor DIDS significantly reduced mitochondrial superoxide release (∼75%) in mitochondria from either genotype respiring on GM+R. Conversely, inhibition of potential inner membrane sites of superoxide exit, including the matrix face of the mitochondrial permeability transition pore and the inner membrane anion channel did not reduce mitochondrial superoxide release in the presence of GM+R in mitochondria isolated from either genotype. These data support the concept that complex I-derived mitochondrial superoxide release does indeed occur and that the majority of this release occurs through VDACs.

  20. Voltage-dependent potassium currents during fast spikes of rat cerebellar Purkinje neurons: inhibition by BDS-I toxin.

    PubMed

    Martina, Marco; Metz, Alexia E; Bean, Bruce P

    2007-01-01

    We characterized the kinetics and pharmacological properties of voltage-activated potassium currents in rat cerebellar Purkinje neurons using recordings from nucleated patches, which allowed high resolution of activation and deactivation kinetics. Activation was exceptionally rapid, with 10-90% activation in about 400 mus at +30 mV, near the peak of the spike. Deactivation was also extremely rapid, with a decay time constant of about 300 mus near -80 mV. These rapid activation and deactivation kinetics are consistent with mediation by Kv3-family channels but are even faster than reported for Kv3-family channels in other neurons. The peptide toxin BDS-I had very little blocking effect on potassium currents elicited by 100-ms depolarizing steps, but the potassium current evoked by action potential waveforms was inhibited nearly completely. The mechanism of inhibition by BDS-I involves slowing of activation rather than total channel block, consistent with the effects described in cloned Kv3-family channels and this explains the dramatically different effects on currents evoked by short spikes versus voltage steps. As predicted from this mechanism, the effects of toxin on spike width were relatively modest (broadening by roughly 25%). These results show that BDS-I-sensitive channels with ultrafast activation and deactivation kinetics carry virtually all of the voltage-dependent potassium current underlying repolarization during normal Purkinje cell spikes.

  1. Toward First Principles Prediction of Voltage Dependences of Electrolyte/Electrolyte Interfacial Processes in Lithium Ion Batteries

    SciTech Connect

    Leung, Kevin; Tenney, Craig M.

    2013-11-21

    In lithium ion batteries, Li+ intercalation into electrodes is induced by applied voltages, which are in turn associated with free energy changes of Li+ transfer (ΔGt) between the solid and liquid phases. Using ab initio molecular dynamics (AIMD) and thermodynamic integration techniques, we compute ΔGt for the virtual transfer of a Li+ from a LiC6 anode slab, with pristine basal planes exposed, to liquid ethylene carbonate confined in a nanogap. The onset of delithiation, at ΔGt = 0, is found to occur on LiC6 anodes with negatively charged basal surfaces. These negative surface charges are evidently needed to retain Li+ inside the electrode and should affect passivation (“SEI”) film formation processes. Fast electrolyte decomposition is observed at even larger electron surface densities. By assigning the experimentally known voltage (0.1 V vs Li+/Li metal) to the predicted delithiation onset, an absolute potential scale is obtained. This enables voltage calibrations in simulation cells used in AIMD studies and paves the way for future prediction of voltage dependences in interfacial processes in batteries.

  2. Probing the gate--voltage-dependent surface potential of individual InAs nanowires using random telegraph signals.

    PubMed

    Salfi, Joe; Paradiso, Nicola; Roddaro, Stefano; Heun, Stefan; Nair, Selvakumar V; Savelyev, Igor G; Blumin, Marina; Beltram, Fabio; Ruda, Harry E

    2011-03-22

    We report a novel method for probing the gate-voltage dependence of the surface potential of individual semiconductor nanowires. The statistics of electronic occupation of a single defect on the surface of the nanowire, determined from a random telegraph signal, is used as a measure for the local potential. The method is demonstrated for the case of one or two switching defects in indium arsenide (InAs) nanowire field effect transistors at temperatures T=25-77 K. Comparison with a self-consistent model shows that surface potential variation is retarded in the conducting regime due to screening by surface states with density Dss≈10(12) cm(-2) eV(-1). Temperature-dependent dynamics of electron capture and emission producing the random telegraph signals are also analyzed, and multiphonon emission is identified as the process responsible for capture and emission of electrons from the surface traps. Two defects studied in detail had capture activation energies of EB≈50 meV and EB≈110 meV and cross sections of σ∞≈3×10(-19) cm2 and σ∞≈2×10(-17) cm2, respectively. A lattice relaxation energy of Sℏω=187±15 meV was found for the first defect.

  3. Effects of the endogenous cannabinoid anandamide on voltage-dependent sodium and calcium channels in rat ventricular myocytes

    PubMed Central

    Al Kury, Lina T; Voitychuk, Oleg I; Yang, Keun-Hang Susan; Thayyullathil, Faisal T; Doroshenko, Petro; Ramez, Ali M; Shuba, Yaroslav M; Galadari, Sehamuddin; Howarth, Frank Christopher; Oz, Murat

    2014-01-01

    BACKGROUND AND PURPOSE The endocannabinoid anandamide (N-arachidonoyl ethanolamide; AEA) exerts negative inotropic and antiarrhythmic effects in ventricular myocytes. EXPERIMENTAL APPROACH Whole-cell patch-clamp technique and radioligand-binding methods were used to analyse the effects of anandamide in rat ventricular myocytes. KEY RESULTS In the presence of 1–10 μM AEA, suppression of both Na+ and L-type Ca2+ channels was observed. Inhibition of Na+ channels was voltage and Pertussis toxin (PTX) – independent. Radioligand-binding studies indicated that specific binding of [3H] batrachotoxin (BTX) to ventricular muscle membranes was also inhibited significantly by 10 μM metAEA, a non-metabolized AEA analogue, with a marked decrease in Bmax values but no change in Kd. Further studies on L-type Ca2+ channels indicated that AEA potently inhibited these channels (IC50 0.1 μM) in a voltage- and PTX-independent manner. AEA inhibited maximal amplitudes without affecting the kinetics of Ba2+ currents. MetAEA also inhibited Na+ and L-type Ca2+ currents. Radioligand studies indicated that specific binding of [3H]isradipine, was inhibited significantly by metAEA. (10 μM), changing Bmax but not Kd. CONCLUSION AND IMPLICATIONS Results indicate that AEA inhibited the function of voltage-dependent Na+ and L-type Ca2+ channels in rat ventricular myocytes, independent of CB1 and CB2 receptor activation. PMID:24758718

  4. Effects of ethanol and other intoxicant-anesthetics on voltage-dependent sodium channels of brain synaptosomes.

    PubMed

    Harris, R A; Bruno, P

    1985-02-01

    Ethanol, diethylether, halothane and enflurane inhibited the veratridine-dependent uptake of 24Na by synaptosomes isolated from rodent brain. The inhibitory action of ethanol was similar for uptake periods of 1 to 10 sec and also was observed with batrachotoxin-stimulated sodium uptake, demonstrating an inhibition of sodium influx through voltage-dependent channels. The inhibitory action of tetrodotoxin on sodium uptake was not altered by ethanol, indicating this site on the sodium channel was not altered by ethanol. The action of ethanol was selective for different brain regions and was more potent in inhibiting sodium uptake in cortex than in cerebellum. Investigation of the effects of temperature on veratridine-stimulated uptake and ethanol actions demonstrated that an increase in temperature (13 degrees-33 degrees C) decreased both the apparent KD of veratridine and the Vmax of the uptake. Ethanol decreased the apparent Vmax at all temperatures and decreased the apparent KD at low 13 degrees and 18 degrees C) but not at higher (30 degrees and 33 degrees C) temperatures. Thus, an increase in temperature mimicked some, but not all, of the effects of ethanol. These results, together with those from other studies, suggest that the disordering of membrane lipids by ethanol and other intoxicant-anesthetic drugs is an important factor in the inhibition of sodium channel function by these drugs.

  5. Propagation in the transverse tubular system and voltage dependence of calcium release in normal and mdx mouse muscle fibres

    PubMed Central

    Woods, Christopher E; Novo, David; DiFranco, Marino; Capote, Joana; Vergara, Julio L

    2005-01-01

    Using a two-microelectrode voltage clamp technique, we investigated possible mechanisms underlying the impaired excitation–contraction coupling in skeletal muscle fibres of the mdx mouse, a model of the human disease Duchenne muscular dystrophy. We evaluated the role of the transverse tubular system (T-system) by using the potentiometric indicator di-8 ANEPPS, and that of the sarcoplasmic reticulum (SR) Ca2+ release by measuring Ca2+ transients with a low affinity indicator in the presence of high EGTA concentrations under voltage clamp conditions. We observed minimal differences in the T-system structure and the T-system electrical propagation was not different between normal and mdx mice. Whereas the maximum Ca2+ release elicited by voltage pulses was reduced by ∼67% in mdx fibres, in agreement with previous results obtained using AP stimulation, the voltage dependence of SR Ca2+ release was identical to that seen in normal fibres. Taken together, our data suggest that the intrinsic ability of the sarcoplasmic reticulum to release Ca2+ may be altered in the mdx mouse. PMID:16123111

  6. ClC-3 is an intracellular chloride/proton exchanger with large voltage-dependent nonlinear capacitance.

    PubMed

    Guzman, Raul E; Grieschat, Matthias; Fahlke, Christoph; Alekov, Alexi K

    2013-06-19

    The chloride/proton exchangers ClC-3, ClC-4 and ClC-5 are localized in distinct intracellular compartments and regulate their luminal acidity. We used electrophysiology combined with fluorescence pH measurements to compare the functions of these three transporters. Since the expression of WT ClC-3 in the surface membrane was negligible, we removed an N-terminal retention signal for standard electrophysiological characterization of this isoform. This construct (ClC-313-19A) mediated outwardly rectifying coupled Cl(-)/H(+) antiport resembling the properties of ClC-4 and ClC-5. In addition, ClC-3 exhibited large electric capacitance, exceeding the nonlinear capacitances of ClC-4 and ClC-5. Mutations of the proton glutamate, a conserved residue at the internal side of the protein, decreased ion transport but increased nonlinear capacitances in all three isoforms. This suggests that nonlinear capacitances in mammalian ClC transporters are regulated in a similar manner. However, the voltage dependence and the amplitudes of these capacitances differed strongly between the investigated isoforms. Our results indicate that ClC-3 is specialized in mainly performing incomplete capacitive nontransporting cycles, that ClC-4 is an effective coupled transporter, and that ClC-5 displays an intermediate phenotype. Mathematical modeling showed that such functional differences would allow differential regulation of luminal acidification and chloride concentration in intracellular compartments.

  7. Synthetic Ubiquinones Specifically Bind to Mitochondrial Voltage-Dependent Anion Channel 1 (VDAC1) in Saccharomyces cerevisiae Mitochondria.

    PubMed

    Murai, Masatoshi; Okuda, Ayaka; Yamamoto, Takenori; Shinohara, Yasuo; Miyoshi, Hideto

    2017-01-31

    The role of the voltage-dependent anion channel (VDAC) as a metabolic gate of the mitochondrial outer membrane has been firmly established; however, its involvement in the regulation of mitochondrial permeability transition (PT) remains extremely controversial. Although some low-molecular-weight chemicals have been proposed to modulate the regulatory role of VDAC in the induction of PT, direct binding between these chemicals and VDAC has not yet been demonstrated. In the present study, we investigated whether the ubiquinone molecule directly binds to VDAC in Saccharomyces cerevisiae mitochondria through a photoaffinity labeling technique using two photoreactive ubiquinones (PUQ-1 and PUQ-2). The results of the labeling experiments demonstrated that PUQ-1 and PUQ-2 specifically bind to VDAC1 and that the labeled position is located in the C-terminal region Phe221-Lys234, connecting the 15th and 16th β-strand sheets. Mutations introduced in this region (R224A, Y225A, D228A, and Y225A/D228A) hardly affected the binding affinity of PUQ-1. PUQ-1 and PUQ-2 both significantly suppressed the Ca(2+)-induced mitochondrial PT (monitored by mitochondrial swelling) at the one digit μM level. Thus, the results of the present study provided, for the first time to our knowledge, direct evidence indicating that the ubiquinone molecule specifically binds to VDAC1 through its quinone-head ring.

  8. The sea anemone Bunodosoma caissarum toxin BcIII modulates the sodium current kinetics of rat dorsal root ganglia neurons and is displaced in a voltage-dependent manner.

    PubMed

    Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique

    2010-03-01

    Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.

  9. The different meanings of the nomen Amphibia: a correction.

    PubMed

    Dubois, Alain

    2015-07-17

    I recently published a survey of the different meanings of the nomen Amphibia in taxonomic publications since 1758 (Dubois 2015). The 'meaning' of a nomen in zoological nomenclature depends on the system used for the allocation of nomina to taxa, and several such systems can be used (see e.g. Dubois 2006a-b). In the paper at stake, I used the 'orostensional nomenclatural system' (OONS) for class-series nomenclature. In this system, a class-series nomen-i.e., a nomen above the rank superfamily, therefore one whose taxonomic allocation is not regulated by the Code (Anonymous 1999)-applies, in a given classification, to the most inclusive class-series taxon that includes all its originally expressly included nominal genera (conucleogenera) and excludes all its originally expressly excluded nominal genera (alienogenera)-if such a taxon indeed exists in this classification. However, if one a least of the alienogenera is now part of the most inclusive taxon including all the conucleogenera, the nomen cannot be taxonomically allocated and qualifies as an anaptonym in the classification used as reference (Dubois 2006a-b, 2011), although it may not be so under another taxonomic frame.

  10. Mitochondrial evidence on the phylogenetic position of caecilians (Amphibia: Gymnophiona).

    PubMed Central

    Zardoya, R; Meyer, A

    2000-01-01

    The complete nucleotide sequence (17,005 bp) of the mitochondrial genome of the caecilian Typhlonectes natans (Gymnophiona, Amphibia) was determined. This molecule is characterized by two distinctive genomic features: there are seven large 109-bp tandem repeats in the control region, and the sequence for the putative origin of replication of the L strand can potentially fold into two alternative secondary structures (one including part of the tRNA(Cys)). The new sequence data were used to assess the phylogenetic position of caecilians and to gain insights into the origin of living amphibians (frogs, salamanders, and caecilians). Phylogenetic analyses of two data sets-one combining protein-coding genes and the other combining tRNA genes-strongly supported a caecilian + frog clade and, hence, monophyly of modern amphibians. These two data sets could not further resolve relationships among the coelacanth, lungfishes, and tetrapods, but strongly supported diapsid affinities of turtles. Phylogenetic relationships among a larger set of species of frogs, salamanders, and caecilians were estimated with a mitochondrial rRNA data set. Maximum parsimony analysis of this latter data set also recovered monophyly of living amphibians and favored a frog + salamander (Batrachia) relationship. However, bootstrap support was only moderate at these nodes. This is likely due to an extensive among-site rate heterogeneity in the rRNA data set and the narrow window of time in which the three main groups of living amphibians were originated. PMID:10835397

  11. Ultrastructure of the mature spermatozoa of caecilians (Amphibia: Gymnophiona).

    PubMed

    Scheltinga, David M; Wilkinson, Mark; Jamieson, Barrie G M; Oommen, Oommen V

    2003-11-01

    The spermatozoa of Gymnophiona show the following autapomorphies: 1) penetration of the distal centriole by the axial fiber; 2) presence of an acrosomal baseplate; 3) presence of an acrosome seat (flattened apical end of nucleus); and 4) absence of juxta-axonemal fibers. The wide separation of the plasma membrane bounding the undulating membrane is here also considered to be apomorphic. Three plesiomorphic spermatozoal characters are recognized that are not seen in other Amphibia but occur in basal amniotes: 1) presence of mitochondria with a delicate array of concentric cristae (concentric cristae of salamander spermatozoa differ in lacking the delicate array); 2) presence of peripheral dense fibers associated with the triplets of the distal centriole; and 3) presence of a simple annulus (a highly modified, elongate annulus is present in salamander sperm). The presence of an endonuclear canal containing a perforatorium is a plesiomorphic feature of caecilian spermatozoa that is shared with urodeles, some basal anurans, sarcopterygian fish, and some amniotes. Spermatozoal synapomorphies are identified for 1) the Uraeotyphlidae and Ichthyophiidae, and 2) the Caeciliidae and Typhlonectidae, suggesting that the members of each pair of families are more closely related to each other than to other caecilians. Although caecilian spermatozoa exhibit the clear amphibian synapomorphy of the unilateral location of the undulating membrane and its axial fiber, they have no apomorphic characters that suggest a closer relationship to either the Urodela or Anura.

  12. Mitochondrial evidence on the phylogenetic position of caecilians (Amphibia: Gymnophiona).

    PubMed

    Zardoya, R; Meyer, A

    2000-06-01

    The complete nucleotide sequence (17,005 bp) of the mitochondrial genome of the caecilian Typhlonectes natans (Gymnophiona, Amphibia) was determined. This molecule is characterized by two distinctive genomic features: there are seven large 109-bp tandem repeats in the control region, and the sequence for the putative origin of replication of the L strand can potentially fold into two alternative secondary structures (one including part of the tRNA(Cys)). The new sequence data were used to assess the phylogenetic position of caecilians and to gain insights into the origin of living amphibians (frogs, salamanders, and caecilians). Phylogenetic analyses of two data sets-one combining protein-coding genes and the other combining tRNA genes-strongly supported a caecilian + frog clade and, hence, monophyly of modern amphibians. These two data sets could not further resolve relationships among the coelacanth, lungfishes, and tetrapods, but strongly supported diapsid affinities of turtles. Phylogenetic relationships among a larger set of species of frogs, salamanders, and caecilians were estimated with a mitochondrial rRNA data set. Maximum parsimony analysis of this latter data set also recovered monophyly of living amphibians and favored a frog + salamander (Batrachia) relationship. However, bootstrap support was only moderate at these nodes. This is likely due to an extensive among-site rate heterogeneity in the rRNA data set and the narrow window of time in which the three main groups of living amphibians were originated.

  13. Delta receptors are required for full inhibitory coupling of mu-receptors to voltage-dependent Ca(2+) channels in dorsal root ganglion neurons.

    PubMed

    Walwyn, Wendy; John, Scott; Maga, Matthew; Evans, Christopher J; Hales, Tim G

    2009-07-01

    Recombinant micro and delta opioid receptors expressed in cell lines can form heterodimers with distinctive properties and trafficking. However, a role for opioid receptor heterodimerization in neurons has yet to be identified. The inhibitory coupling of opioid receptors to voltage-dependent Ca(2+) channels (VDCCs) is a relatively inefficient process and therefore provides a sensitive assay of altered opioid receptor function and expression. We examined micro-receptor coupling to VDCCs in dorsal root ganglion neurons of delta(+/+), delta(+/-), and delta(-/-) mice. Neurons deficient in delta receptors exhibited reduced inhibition of VDCCs by morphine and [D-Ala(2),Phe(4),Gly(5)-ol]-enkephalin (DAMGO). An absence of delta receptors caused reduced efficacy of DAMGO without affecting potency. An absence of delta receptors reduced neither the density of VDCCs nor their inhibition by either the GABA(B) receptor agonist baclofen or intracellular guanosine 5'-O-(3-thio)triphosphate. Flow cytometry revealed a reduction in micro-receptor surface expression in delta(-/-) neurons without altered DAMGO-induced internalization. There was no change in micro-receptor mRNA levels. D-Phe-Cys-Tyr-D-Trp-Arg-Thr-Pen-Thr-NH(2)-sensitive mu-receptor-coupling efficacy was fully restored to delta(+/+) levels in delta(-/-) neurons by expression of recombinant delta receptors. However, the dimerization-deficient delta-15 construct expressed in delta(-/-) neurons failed to fully restore the inhibitory coupling of micro-receptors compared with that seen in delta(+/+) neurons, suggesting that, although not essential for micro-receptor function, micro-delta receptor dimerization contributes to full micro-agonist efficacy. Because DAMGO exhibited a similar potency in delta(+/+) and delta(-/-) neurons and caused similar levels of internalization, the role for heterodimerization is probably at the level of receptor biosynthesis.

  14. Bias voltage dependence of the electron spin depolarization in quantum wires in the quantum Hall regime detected by the resistively detected NMR

    SciTech Connect

    Chida, K.; Yamauchi, Y.; Arakawa, T.; Kobayashi, K.; Ono, T.; Hashisaka, M.; Nakamura, S.; Machida, T.

    2013-12-04

    We performed the resistively-detected nuclear magnetic resonance (RDNMR) to study the electron spin polarization in the non-equilibrium quantum Hall regime. By measuring the Knight shift, we derive source-drain bias voltage dependence of the electron spin polarization in quantum wires. The electron spin polarization shows minimum value around the threshold voltage of the dynamic nuclear polarization.

  15. Mild Alkalization Acutely Triggers the Warburg Effect by Enhancing Hexokinase Activity via Voltage-Dependent Anion Channel Binding.

    PubMed

    Quach, Cung Hoa Thien; Jung, Kyung-Ho; Lee, Jin Hee; Park, Jin Won; Moon, Seung Hwan; Cho, Young Seok; Choe, Yearn Seong; Lee, Kyung-Han

    2016-01-01

    To fully understand the glycolytic behavior of cancer cells, it is important to recognize how it is linked to pH dynamics. Here, we evaluated the acute effects of mild acidification and alkalization on cancer cell glucose uptake and glycolytic flux and investigated the role of hexokinase (HK). Cancer cells exposed to buffers with graded pH were measured for 18F-fluorodeoxyglucose (FDG) uptake, lactate production and HK activity. Subcellular localization of HK protein was assessed by western blots and confocal microscopy. The interior of T47D breast cancer cells was mildly alkalized to pH 7.5 by a buffer pH of 7.8, and this was accompanied by rapid increases of FDG uptake and lactate extrusion. This shift toward glycolytic flux led to the prompt recovery of a reversed pH gradient. In contrast, mild acidification rapidly reduced cellular FDG uptake and lactate production. Mild acidification decreased and mild alkalization increased mitochondrial HK translocation and enzyme activity. Cells transfected with specific siRNA against HK-1, HK-2 and voltage-dependent anion channel (VDAC)1 displayed significant attenuation of pH-induced changes in FDG uptake. Confocal microscopy showed increased co-localization of HK-1 and HK-2 with VDAC1 by alkaline treatment. In isolated mitochondria, acidic pH increased and alkaline pH decreased release of free HK-1 and HK-2 from the mitochondrial pellet into the supernatant. Furthermore, experiments using purified proteins showed that alkaline pH promoted co-immunoprecipitation of HK with VDAC protein. These findings demonstrate that mild alkalization is sufficient to acutely trigger cancer cell glycolytic flux through enhanced activity of HK by promoting its mitochondrial translocation and VDAC binding. This process might serve as a mechanism through which cancer cells trigger the Warburg effect to maintain a dysregulated pH.

  16. Voltage-dependent ionic channels in differentiating neural precursor cells collected from adult mouse brains six hours post-mortem.

    PubMed

    Bellardita, Carmelo; Bolzoni, Francesco; Sorosina, Melissa; Marfia, Giovanni; Carelli, Stephana; Gorio, Alfredo; Formenti, Alessandro

    2012-04-01

    A novel type of adult neural precursor cells (NPCs) has been isolated from the subventricular zone of the mouse 6 hr after animal death (T6-NPCs). This condition is supposed to select hypoxia-resistant cells of scientific and clinical interest. Ionic channels are ultimately the expression of the functional maturation of neurons, so the aim of this research was to characterize the pattern of the main voltage-dependent ionic channels in T6-NPCs differentiating to a neuronal phenotype, comparing it with NPCs isolated soon after death (T0-NPCs). T6- and T0-NPCs grow in medium containing epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF). Differentiation was performed in small wells without the addition of growth factors, in the presence of adhesion molecules, fetal bovine serum, and leukemia inhibitory factor. Ionic currents, recorded by means of whole-cell patch-clamp, namely, I(Ca2+) HVA, both L- and non-L-type, I(K+) delayed rectifying, I(K+) inward rectifier, transient I(K+A) , and TTX-sensitive I(Na+) have been found, although Na(+) currents were found in only a small percentage of cells and after the fifth week of differentiation. No significant differences in current types, density, orcell capacitance were observed between T6-NPCs and T0-NPCs. The sequence in which the markers appear in new neural cells is not necessarily a fixed program, but the discrepancies in morphological, biochemical, and electrophysiological maturation of mouse NPCs to neurons, possibly different in vivo, suggest that the various steps of the differentiation are independently regulated. Therefore, in addition to morphological and biochemical data, functional tests should be considered for characterizing the maturation of neurons.

  17. Biophysical and Pharmacological Characterization of Nav1.9 Voltage Dependent Sodium Channels Stably Expressed in HEK-293 Cells

    PubMed Central

    Santos, Sonia; Padilla, Karen; Printzenhoff, David; Castle, Neil A.

    2016-01-01

    The voltage dependent sodium channel Nav1.9, is expressed preferentially in peripheral sensory neurons and has been linked to human genetic pain disorders, which makes it target of interest for the development of new pain therapeutics. However, characterization of Nav1.9 pharmacology has been limited due in part to the historical difficulty of functionally expressing recombinant channels. Here we report the successful generation and characterization of human, mouse and rat Nav1.9 stably expressed in human HEK-293 cells. These cells exhibit slowly activating and inactivating inward sodium channel currents that have characteristics of native Nav1.9. Optimal functional expression was achieved by coexpression of Nav1.9 with β1/β2 subunits. While recombinantly expressed Nav1.9 was found to be sensitive to sodium channel inhibitors TC-N 1752 and tetracaine, potency was up to 100-fold less than reported for other Nav channel subtypes despite evidence to support an interaction with the canonical local anesthetic (LA) binding region on Domain 4 S6. Nav1.9 Domain 2 S6 pore domain contains a unique lysine residue (K799) which is predicted to be spatially near the local anesthetic interaction site. Mutation of this residue to the consensus asparagine (K799N) resulted in an increase in potency for tetracaine, but a decrease for TC-N 1752, suggesting that this residue can influence interaction of inhibitors with the Nav1.9 pore. In summary, we have shown that stable functional expression of Nav1.9 in the widely used HEK-293 cells is possible, which opens up opportunities to better understand channel properties and may potentially aid identification of novel Nav1.9 based pharmacotherapies. PMID:27556810

  18. Antispasmodic and vasodilator activities of Morinda citrifolia root extract are mediated through blockade of voltage dependent calcium channels.

    PubMed

    Gilani, Anwarul Hassan; Mandukhail, Saf-ur-Rehman; Iqbal, Javeid; Yasinzai, Masoom; Aziz, Nauman; Khan, Aslam; Najeeb-ur-Rehman

    2010-01-13

    Morinda citrifolia (Noni) is an edible plant with wide range of medicinal uses. It occurs exclusively in tropical climate zone from India through Southeast Asia and Australia to Eastern Polynesia and Hawaii. The objective of this study was to explore the possible mode(s) of action for its antispasmodic, vasodilator and cardio-suppressant effects to rationalize its medicinal use in gut and cardiovascular disorders. Isolated tissue preparations such as, rabbit jejunum, rat and rabbit aorta and guinea pig atria were used to test the antispasmodic and cardiovascular relaxant effects and the possible mode of action(s) of the 70% aqueous-ethanolic extract of Morinda citrifolia roots (Mc.Cr). The Mc.Cr produced a concentration-dependent relaxation of spontaneous and high K(+) induced contractions in isolated rabbit jejunum preparations. It also caused right ward shift in the concentration response curves of Ca(++), similar to that of verapamil. In guinea-pig right atria, Mc.Cr caused inhibition of both atrial force and rate of spontaneous contractions. In rabbit thoracic aortic preparations, Mc.Cr also suppressed contractions induced by phenylephrine (1.0 μM) in normal- Ca(++) and Ca(++)-free kreb solutions and by high K(+), similar to that of verapamil. In rat thoracic aortic preparations, Mc.Cr also relaxed the phenylephrine (1.0 μM)-induced contractions. The vasodilatory responses were not altered in the presence of L-NAME (0.1 mM) or atropine (1.0 μM) and removal of endothelium. These results suggest that the spasmolytic and vasodilator effects of Mc.Cr root extract are mediated possibly through blockade of voltage-dependent calcium channels and release of intracellular calcium, which may explain the medicinal use of Morinda citrifolia in diarrhea and hypertension. However, more detailed studies are required to assess the safety and efficacy of this plant.

  19. Antispasmodic and vasodilator activities of Morinda citrifolia root extract are mediated through blockade of voltage dependent calcium channels

    PubMed Central

    2010-01-01

    Background Morinda citrifolia (Noni) is an edible plant with wide range of medicinal uses. It occurs exclusively in tropical climate zone from India through Southeast Asia and Australia to Eastern Polynesia and Hawaii. The objective of this study was to explore the possible mode(s) of action for its antispasmodic, vasodilator and cardio-suppressant effects to rationalize its medicinal use in gut and cardiovascular disorders. Methods Isolated tissue preparations such as, rabbit jejunum, rat and rabbit aorta and guinea pig atria were used to test the antispasmodic and cardiovascular relaxant effects and the possible mode of action(s) of the 70% aqueous-ethanolic extract of Morinda citrifolia roots (Mc.Cr). Results The Mc.Cr produced a concentration-dependent relaxation of spontaneous and high K+ induced contractions in isolated rabbit jejunum preparations. It also caused right ward shift in the concentration response curves of Ca++, similar to that of verapamil. In guinea-pig right atria, Mc.Cr caused inhibition of both atrial force and rate of spontaneous contractions. In rabbit thoracic aortic preparations, Mc.Cr also suppressed contractions induced by phenylephrine (1.0 μM) in normal- Ca++ and Ca++-free Kerb's solutions and by high K+, similar to that of verapamil. In rat thoracic aortic preparations, Mc.Cr also relaxed the phenylephrine (1.0 μM)-induced contractions. The vasodilatory responses were not altered in the presence of L-NAME (0.1 mM) or atropine (1.0 μM) and removal of endothelium. Conclusions These results suggest that the spasmolytic and vasodilator effects of Mc.Cr root extract are mediated possibly through blockade of voltage-dependent calcium channels and release of intracellular calcium, which may explain the medicinal use of Morinda citrifolia in diarrhea and hypertension. However, more detailed studies are required to assess the safety and efficacy of this plant. PMID:20070879

  20. Adenosine inhibits voltage-dependent Ca2+ influx in cone photoreceptor terminals of the tiger salamander retina.

    PubMed

    Stella, Salvatore L; Hu, Wanda D; Vila, Alejandro; Brecha, Nicholas C

    2007-04-01

    Endogenous adenosine has already been shown to inhibit transmitter release from the rod synapse by suppressing Ca(2+) influx through voltage-gated Ca(2+) channels. However, it is not clear how adenosine modulates the cone synapse. Cone photoreceptors, like rod photoreceptors, also possess L-type Ca(2+) channels that regulate the release of L-glutamate. To assess the impact of adenosine on Ca(2+) influx though voltage-gated Ca(2+) channels in cone terminals, whole-cell perforated-patch clamp recording and Ca(2+) imaging with fluo-4 were used on isolated cones and salamander retinal slices. Synaptic markers (VAMP and piccolo) and activity-dependent dye labeling revealed that tiger salamander cone terminals contain a broad, vesicle-filled cytoplasmic extension at the base of the somatic compartment, which is unlike rod terminals that contain one or more thin axons, each terminating in a large bulbous synaptic terminal. The spatiotemporal Ca(2+) responses of the cone terminals do not differ significantly from the Ca(2+) responses of the soma or inner segment like that observed in rods. Whole-cell recording of cone I(Ca) and Ca(2+) imaging of synaptic terminals in cones demonstrate that adenosine inhibited both I(Ca) and the depolarization-evoked Ca(2+) increase in cone terminals in a dose-dependent manner from 1 to 50 muM. These results indicate that, as in rods, adenosine's ability to suppress voltage-dependent Ca(2+) channels at the cone synapse will limit the amount of L-glutamate released. Therefore, adenosine has an inhibitory effect on L-glutamate release at the first synapse, which likely favors elevated adenosine levels in the dark or during dark-adapted conditions.

  1. Characterization of Oyster Voltage-Dependent Anion Channel 2 (VDAC2) Suggests Its Involvement in Apoptosis and Host Defense

    PubMed Central

    Li, Yingxiang; Zhang, Linlin; Qu, Tao; Li, Li; Zhang, Guofan

    2016-01-01

    Genomic and transcriptomic studies have revealed a sophisticated and powerful apoptosis regulation network in oyster, highlighting its adaptation to sessile life in a highly stressful intertidal environment. However, the functional molecular basis of apoptosis remains largely unexplored in oysters. In this study, we focused on a representative apoptotic gene encoding voltage-dependent anion channel 2 (VDAC2), a porin that abounds at the mitochondrial outer membrane. This is the first report on the identification and characterization of a VDAC gene in the Pacific oyster, Crassostrea gigas (CgVDAC2). The full length of CgVDAC2 was 1,738 bp with an open reading frame of 843 bp that encoded a protein of 281 amino acids. A four-element eukaryotic porin signature motif, a conserved ATP binding motif, and a VKAKV-like sequence were identified in the predicted CgVDAC2. Expression pattern analysis in different tissues and developmental stages as well as upon infection by ostreid herpesvirus 1 revealed the energy supply-related and immunity-related expression of CgVDAC2. CgVDAC2 was co-localized with mitochondria when it was transiently transfected into HeLa cells. Overexpression of CgVDAC2 in HEK293T cells suppressed the UV irradiation-induced apoptosis by inhibiting the pro-apoptotic function of CgBak. RNA interference induced reduction in CgVDAC2 expression showed a promoted apoptosis level upon UV light irradiation in hemocytes. The yeast two-hybrid system and co-immunoprecipitation assay indicated a direct interaction between CgVDAC2 and the pro-apoptotic protein CgBak. This study revealed the function of VDAC2 in oyster and provided new insights into its involvement in apoptosis modulation and host defense in mollusks. PMID:26727366

  2. In self-defence: hexokinase promotes voltage-dependent anion channel closure and prevents mitochondria-mediated apoptotic cell death.

    PubMed

    Azoulay-Zohar, Heftsi; Israelson, Adrian; Abu-Hamad, Salah; Shoshan-Barmatz, Varda

    2004-01-15

    In tumour cells, elevated levels of mitochondria-bound isoforms of hexokinase (HK-I and HK-II) result in the evasion of apoptosis, thereby allowing the cells to continue proliferating. The molecular mechanisms by which bound HK promotes cell survival are not yet fully understood. Our studies relying on the purified mitochondrial outer membrane protein VDAC (voltage-dependent anion channel), isolated mitochondria or cells in culture suggested that the anti-apoptotic activity of HK-I occurs via modulation of the mitochondrial phase of apoptosis. In the present paper, a direct interaction of HK-I with bilayer-reconstituted purified VDAC, inducing channel closure, is demonstrated for the first time. Moreover, HK-I prevented the Ca(2+)-dependent opening of the mitochondrial PTP (permeability transition pore) and release of the pro-apoptotic protein cytochrome c. The effects of HK-I on VDAC activity and PTP opening were prevented by the HK reaction product glucose 6-phosphate, a metabolic intermediate in most biosynthetic pathways. Furthermore, glucose 6-phosphate re-opened both the VDAC and the PTP closed by HK-I. The HK-I-mediated effects on VDAC and PTP were not observed using either yeast HK or HK-I lacking the N-terminal hydrophobic peptide responsible for binding to mitochondria, or in the presence of an antibody specific for the N-terminus of HK-I. Finally, HK-I overexpression in leukaemia-derived U-937 or vascular smooth muscle cells protected against staurosporine-induced apoptosis, with a decrease of up to 70% in cell death. These results offer insight into the mechanisms by which bound HK promotes tumour cell survival, and suggests that its overexpression not only ensures supplies of energy and phosphometabolites, but also reflects an anti-apoptotic defence mechanism.

  3. Photoaffinity labeling with cholesterol analogues precisely maps a cholesterol-binding site in voltage-dependent anion channel-1.

    PubMed

    Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S

    2017-06-02

    Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI-tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr(83) and Glu(73), respectively. When Glu(73) was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr(62) within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu(73) residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Structural basis of binding and inhibition of novel tarantula toxins in mammalian voltage-dependent potassium channels.

    PubMed

    Shiau, Yu-Shuan; Huang, Po-Tsang; Liou, Horng-Huei; Liaw, Yen-Chywan; Shiau, Yuh-Yuan; Lou, Kuo-Long

    2003-10-01

    Voltage-dependent potassium channel Kv2.1 is widely expressed in mammalian neurons and was suggested responsible for mediating the delayed rectifier (I(K)) currents. Further investigation of the central role of this channel requires the development of specific pharmacology, for instance, the utilization of spider venom toxins. Most of these toxins belong to the same structural family with a short peptide reticulated by disulfide bridges and share a similar mode of action. Hanatoxin 1 (HaTx1) from a Chilean tarantula was one of the earliest discussed tools regarding this and has been intensively applied to characterize the channel blocking not through the pore domain. Recently, more related novel toxins from African tarantulas such as heteroscordratoxins (HmTx) and stromatoxin 1 (ScTx1) were isolated and shown to act as gating modifiers such as HaTx on Kv2.1 channels with electrophysiological recordings. However, further interaction details are unavailable due to the lack of high-resolution structures of voltage-sensing domains in such mammalian Kv channels. Therefore, in the present study, we explored structural observation via molecular docking simulation between toxins and Kv2.1 channels based upon the solution structures of HaTx1 and a theoretical basis of an individual S3(C) helical channel fragment in combination with homology modeling for other novel toxins. Our results provide precise chemical details for the interactions between these tarantula toxins and channel, reasonably correlating the previously reported pharmacological properties to the three-dimensional structural interpretation. In addition, it is suggested that certain subtle structural variations on the interaction surface of toxins may discriminate between the related toxins with different affinities for Kv channels. Evolutionary links between spider peptide toxins and a "voltage sensor paddles" mechanism most recently found in the crystal structure of an archaebacterial K(+) channel, KvAP, are

  5. Characterization of Oyster Voltage-Dependent Anion Channel 2 (VDAC2) Suggests Its Involvement in Apoptosis and Host Defense.

    PubMed

    Li, Yingxiang; Zhang, Linlin; Qu, Tao; Li, Li; Zhang, Guofan

    2016-01-01

    Genomic and transcriptomic studies have revealed a sophisticated and powerful apoptosis regulation network in oyster, highlighting its adaptation to sessile life in a highly stressful intertidal environment. However, the functional molecular basis of apoptosis remains largely unexplored in oysters. In this study, we focused on a representative apoptotic gene encoding voltage-dependent anion channel 2 (VDAC2), a porin that abounds at the mitochondrial outer membrane. This is the first report on the identification and characterization of a VDAC gene in the Pacific oyster, Crassostrea gigas (CgVDAC2). The full length of CgVDAC2 was 1,738 bp with an open reading frame of 843 bp that encoded a protein of 281 amino acids. A four-element eukaryotic porin signature motif, a conserved ATP binding motif, and a VKAKV-like sequence were identified in the predicted CgVDAC2. Expression pattern analysis in different tissues and developmental stages as well as upon infection by ostreid herpesvirus 1 revealed the energy supply-related and immunity-related expression of CgVDAC2. CgVDAC2 was co-localized with mitochondria when it was transiently transfected into HeLa cells. Overexpression of CgVDAC2 in HEK293T cells suppressed the UV irradiation-induced apoptosis by inhibiting the pro-apoptotic function of CgBak. RNA interference induced reduction in CgVDAC2 expression showed a promoted apoptosis level upon UV light irradiation in hemocytes. The yeast two-hybrid system and co-immunoprecipitation assay indicated a direct interaction between CgVDAC2 and the pro-apoptotic protein CgBak. This study revealed the function of VDAC2 in oyster and provided new insights into its involvement in apoptosis modulation and host defense in mollusks.

  6. Guanosine-5'-O-(3-thiotriphosphate) modifies kinetics of voltage-dependent calcium current in chick sensory neurons.

    PubMed Central

    Marchetti, C; Robello, M

    1989-01-01

    Internal perfusion with the G-protein activator guanosine-5'-O-(3-thiotriphosphate) (GTP-gamma S) mimics the effect of noradrenaline and dopamine on the voltage-dependent calcium current in chick dorsal root ganglion (DRG) cells. With 100 microM GTP-gamma S in the pipette, the current at +10 mV was depressed by approximately 50%, with a 10-fold increase of its time to peak. The activation time course of the control calcium current could be approximated with a single exponential curve, whereas with GTP-gamma S the activation time course was double exponential, with time constants tau 1 and tau 2. 2 mM Mg-ATP in the pipette prevented the GTP-gamma S-induced current decrease in 70% of the cells, but the time course of the current was always double exponential. From -50 mV, the current at +10 mV was best fitted with tau 1 = 1.7 +/- 0.5 and tau 2 = 25.6 +/- 5.5 in seven cells. Both time constants decreased with increasing depolarizations. In the first 2 min of recording, the current changed with time. However, both tau 1 and tau 2 were constant, whereas the relative contribution of the slow component increased from 10 to 70%. In addition, the effect was independent of the holding potential in the range from -100 to -30 mV. These results suggest that the activation of a G-protein causes a fraction of the high-threshold calcium channels to switch to a new closed state, with slower opening kinetics. PMID:2558735

  7. Alterations of voltage-dependent K(+) channels in the mesenteric artery during the early and chronic phases of diabetes.

    PubMed

    Hong, Da Hye; Li, Hongliang; Kim, Hye Won; Kim, Han Sol; Son, Youn Kyoung; Yang, Se-Ran; Park, Jeong-Ran; Ha, Kwon-Soo; Han, Eun-Taek; Hong, Seok-Ho; Firth, Amy L; Na, Sung Hun; Park, Won Sun

    2016-09-01

    This study investigated the alteration of voltage-dependent K(+) (Kv) channels in mesenteric arterial smooth muscle cells from control (Long-Evans Tokushima Otsuka [LETO]) and diabetic (Otsuka Long-Evans Tokushima Fatty [OLETF]) rats during the early and chronic phases of diabetes. We demonstrated alterations in the mesenteric Kv channels during the early and chronic phase of diabetes using the patch-clamp technique, the arterial tone measurement system, and RT-PCR in Long-Evans Tokushima (LETO; for control) and Otsuka Long-Evans Tokushima Fatty (OLETF; for diabetes) type 2 diabetic model rats. In the early phase of diabetes, the amplitude of mesenteric Kv currents induced by depolarizing pulses was greater in OLETF rats than in LETO rats. The contractile response of the mesenteric artery induced by the Kv inhibitor, 4-aminopyridine (4-AP), was also greater in OLETF rats. The expression of most Kv subtypes- including Kv1.1, Kv1.2, Kv1.4, Kv1.5, Kv1.6, Kv2.1, Kv3.2, Kv4.1, Kv4.3, Kv5.1, Kv6.2, Kv8.1, Kv9.3, and Kv10.1-were increased in mesenteric arterial smooth muscle from OLETF rats compared with LETO rats. However, in the chronic phase of diabetes, the Kv current amplitude did not differ between LETO and OLETF rats. In addition, the 4-AP-induced contractile response of the mesenteric artery and the expression of Kv subtypes did not differ between the two groups. The increased Kv current amplitude and Kv channel-related contractile response were attributable to the increase in Kv channel expression during the early phase of diabetes. The increased Kv current amplitude and Kv channel-related contractile response were reversed during the chronic phase of diabetes.

  8. Voltage-dependent modulation of single N-Type Ca2+ channel kinetics by receptor agonists in IMR32 cells.

    PubMed Central

    Carabelli, V; Lovallo, M; Magnelli, V; Zucker, H; Carbone, E

    1996-01-01

    The voltage-dependent inhibition of single N-type Ca(2+) channels by noradrenaline (NA) and the delta-opioid agonist D-Pen(2)-D-Pen (5)-enkephalin (DPDPE) was investigated in cell-attached patches of human neuroblastoma IMR32 cells with 100 mM Ba(2+) and 5 microM nifedipine to block L-type channels. In 70% of patches, addition of 20 microM NA + 1 microM DPDPE delayed markedly the first channel openings, causing a four- to fivefold increase of the first latency at +20 mV. The two agonists or NA alone decreased also by 35% the open probability (P(o)), prolonged partially the mean closed time, and increased the number of null sweeps. In contrast, NA + DPDPE had little action on the single-channel conductance (19 versus 19.2 pS) and minor effects on the mean open time. Similarly to macroscopic Ba(2+) currents, the ensemble currents were fast activating at control but slowly activating and depressed with the two agonists. Inhibition of single N-type channels was effectively removed (facilitated) by short and large depolarizations. Facilitatory pre-pulses increased P(o) significantly and decreased fourfold the first latency. Ensemble currents were small and slowly activating before pre-pulses and became threefold larger and fast decaying after facilitation. Our data suggest that slowdown of Ca(2+) channel activation by transmitters is mostly due to delayed transitions from a modified to a normal (facilitated) gating mode. This single-channel gating modulation could be well simulated by a Monte Carlo method using previously proposed kinetic models predicting marked prolongation of first channel openings. Images FIGURE 3 FIGURE 4 FIGURE 7 PMID:9172738

  9. Thiazolidinedione insulin sensitizers alter lipid bilayer properties and voltage-dependent sodium channel function: implications for drug discovery

    PubMed Central

    Herold, Karl F.; Sanford, R. Lea; Greathouse, Denise V.; Hemmings, Hugh C.; Andersen, Olaf S.

    2011-01-01

    The thiazolidinediones (TZDs) are used in the treatment of diabetes mellitus type 2. Their canonical effects are mediated by activation of the peroxisome proliferator–activated receptor γ (PPARγ) transcription factor. In addition to effects mediated by gene activation, the TZDs cause acute, transcription-independent changes in various membrane transport processes, including glucose transport, and they alter the function of a diverse group of membrane proteins, including ion channels. The basis for these off-target effects is unknown, but the TZDs are hydrophobic/amphiphilic and adsorb to the bilayer–water interface, which will alter bilayer properties, meaning that the TZDs may alter membrane protein function by bilayer-mediated mechanisms. We therefore explored whether the TZDs alter lipid bilayer properties sufficiently to be sensed by bilayer-spanning proteins, using gramicidin A (gA) channels as probes. The TZDs altered bilayer elastic properties with potencies that did not correlate with their affinity for PPARγ. At concentrations where they altered gA channel function, they also altered the function of voltage-dependent sodium channels, producing a prepulse-dependent current inhibition and hyperpolarizing shift in the steady-state inactivation curve. The shifts in the inactivation curve produced by the TZDs and other amphiphiles can be superimposed by plotting them as a function of the changes in gA channel lifetimes. The TZDs’ partition coefficients into lipid bilayers were measured using isothermal titration calorimetry. The most potent bilayer modifier, troglitazone, alters bilayer properties at clinically relevant free concentrations; the least potent bilayer modifiers, pioglitazone and rosiglitazone, do not. Unlike other TZDs tested, ciglitazone behaves like a hydrophobic anion and alters the gA monomer–dimer equilibrium by more than one mechanism. Our results provide a possible mechanism for some off-target effects of an important group of

  10. Mild Alkalization Acutely Triggers the Warburg Effect by Enhancing Hexokinase Activity via Voltage-Dependent Anion Channel Binding

    PubMed Central

    Lee, Jin Hee; Park, Jin Won; Moon, Seung Hwan; Cho, Young Seok; Choe, Yearn Seong; Lee, Kyung-Han

    2016-01-01

    To fully understand the glycolytic behavior of cancer cells, it is important to recognize how it is linked to pH dynamics. Here, we evaluated the acute effects of mild acidification and alkalization on cancer cell glucose uptake and glycolytic flux and investigated the role of hexokinase (HK). Cancer cells exposed to buffers with graded pH were measured for 18F-fluorodeoxyglucose (FDG) uptake, lactate production and HK activity. Subcellular localization of HK protein was assessed by western blots and confocal microscopy. The interior of T47D breast cancer cells was mildly alkalized to pH 7.5 by a buffer pH of 7.8, and this was accompanied by rapid increases of FDG uptake and lactate extrusion. This shift toward glycolytic flux led to the prompt recovery of a reversed pH gradient. In contrast, mild acidification rapidly reduced cellular FDG uptake and lactate production. Mild acidification decreased and mild alkalization increased mitochondrial HK translocation and enzyme activity. Cells transfected with specific siRNA against HK-1, HK-2 and voltage-dependent anion channel (VDAC)1 displayed significant attenuation of pH-induced changes in FDG uptake. Confocal microscopy showed increased co-localization of HK-1 and HK-2 with VDAC1 by alkaline treatment. In isolated mitochondria, acidic pH increased and alkaline pH decreased release of free HK-1 and HK-2 from the mitochondrial pellet into the supernatant. Furthermore, experiments using purified proteins showed that alkaline pH promoted co-immunoprecipitation of HK with VDAC protein. These findings demonstrate that mild alkalization is sufficient to acutely trigger cancer cell glycolytic flux through enhanced activity of HK by promoting its mitochondrial translocation and VDAC binding. This process might serve as a mechanism through which cancer cells trigger the Warburg effect to maintain a dysregulated pH. PMID:27479079

  11. Developmental acquisition of voltage-dependent conductances and sensory signaling in hair cells of the embryonic mouse inner ear.

    PubMed

    Géléoc, Gwenaëlle S G; Risner, Jessica R; Holt, Jeffrey R

    2004-12-08

    How and when sensory hair cells acquire the remarkable ability to detect and transmit mechanical information carried by sound and head movements has not been illuminated. Previously, we defined the onset of mechanotransduction in embryonic hair cells of mouse vestibular organs to be at approximately embryonic day 16 (E16). Here we examine the functional maturation of hair cells in intact sensory epithelia excised from the inner ears of embryonic mice. Hair cells were studied at stages between E14 and postnatal day 2 using the whole-cell, tight-seal recording technique. We tracked the developmental acquisition of four voltage-dependent conductances. We found a delayed rectifier potassium conductance that appeared as early as E14 and grew in amplitude over the subsequent prenatal week. Interestingly, we also found a low-voltage-activated potassium conductance present at E18, approximately 1 week earlier than reported previously. An inward rectifier conductance appeared at approximately E15 and doubled in size over the next few days. We also noted transient expression of a voltage-gated sodium conductance that peaked between E16 and E18 and then declined to near zero at birth. We propose that hair cells undergo a stereotyped developmental pattern of ion channel acquisition and that the precise pattern may underlie other developmental processes such as synaptogenesis and functional differentiation into type I and type II hair cells. In addition, we find that the developmental acquisition of basolateral conductances shapes the hair cell receptor potential and therefore comprises an important step in the signal cascade from mechanotransduction to neurotransmission.

  12. Expression Profiling of Mitochondrial Voltage-Dependent Anion Channel-1 Associated Genes Predicts Recurrence-Free Survival in Human Carcinomas

    PubMed Central

    Lim, Inja; Zhou, Tong; Bang, Hyoweon

    2014-01-01

    Background Mitochondrial voltage-dependent anion channels (VDACs) play a key role in mitochondria-mediated apoptosis. Both in vivo and in vitro evidences indicate that VDACs are actively involved in tumor progression. Specifically, VDAC-1, one member of the VDAC family, was thought to be a potential anti-cancer therapeutic target. Our previous study demonstrated that the human gene VDAC1 (encoding the VDAC-1 isoform) was significantly up-regulated in lung tumor tissue compared with normal tissue. Also, we found a significant positive correlation between the gene expression of VDAC1 and histological grade in breast cancer. However, the prognostic power of VDAC1 and its associated genes in human cancers is largely unknown. Methods We systematically analyzed the expression pattern of VDAC1 and its interacting genes in breast, colon, liver, lung, pancreatic, and thyroid cancers. The genes differentially expressed between normal and tumor tissues in human carcinomas were identified. Results The expression level of VDAC1 was uniformly up-regulated in tumor tissue compared with normal tissue in breast, colon, liver, lung, pancreatic, and thyroid cancers. Forty-four VDAC1 interacting genes were identified as being commonly differentially expressed between normal and tumor tissues in human carcinomas. We designated VDAC1 and the 44 dysregulated interacting genes as the VDAC1 associated gene signature (VAG). We demonstrate that the VAG signature is a robust prognostic biomarker to predict recurrence-free survival in breast, colon, and lung cancers, and is independent of standard clinical and pathological prognostic factors. Conclusions VAG represents a promising prognostic biomarker in human cancers, which may enhance prediction accuracy in identifying patients at higher risk for recurrence. Future therapies aimed specifically at VDAC1 associated genes may lead to novel agents in the treatment of cancer. PMID:25333947

  13. Chloride ions in the pore of glycine and GABA channels shape the time course and voltage dependence of agonist currents

    PubMed Central

    Moroni, Mirko; Biro, Istvan; Giugliano, Michele; Vijayan, Ranjit; Biggin, Philip C.; Beato, Marco; Sivilotti, Lucia G.

    2011-01-01

    In the vertebrate CNS, fast synaptic inhibition is mediated by GABA and glycine receptors. We recently reported that the time course of these synaptic currents is slower when intracellular chloride is high. Here we extend these findings to measure the effects of both extracellular and intracellular chloride on the deactivation of glycine and GABA currents at both negative and positive holding potentials. Currents were elicited by fast agonist application to outside-out patches from HEK293 cells expressing rat glycine or GABA receptors. The slowing effect of high extracellular chloride on current decay was detectable only in low intracellular chloride (4 mM). Our main finding is that glycine and GABA receptors “sense” chloride concentrations because of interactions between the M2 pore-lining domain and the permeating ions. This hypothesis is supported by the observation that the sensitivity of channel gating to intracellular chloride is abolished if the channel is engineered to become cation-selective, or if positive charges in the external pore vestibule are eliminated by mutagenesis. The appropriate interaction between permeating ions and channel pore is also necessary to maintain the channel voltage sensitivity of gating, which prolongs current decay at depolarized potentials. Voltage-dependence is abolished by the same mutations that suppress the effect of intracellular chloride and also by replacing chloride with another permeant ion, thiocyanate. These observations suggest that permeant chloride affects gating by a foot-in-the-door effect, binding to a channel site with asymmetrical access from the intracellular and extracellular sides of the membrane. PMID:21976494

  14. Voltage-dependent block of the cystic fibrosis transmembrane conductance regulator Cl- channel by two closely related arylaminobenzoates

    PubMed Central

    1993-01-01

    The gene defective in cystic fibrosis encodes a Cl- channel, the cystic fibrosis transmembrane conductance regulator (CFTR). CFTR is blocked by diphenylamine-2-carboxylate (DPC) when applied extracellularly at millimolar concentrations. We studied the block of CFTR expressed in Xenopus oocytes by DPC or by a closely related molecule, flufenamic acid (FFA). Block of whole-cell CFTR currents by bath-applied DPC or by FFA, both at 200 microM, requires several minutes to reach full effect. Blockade is voltage dependent, suggesting open-channel block: currents at positive potentials are not affected but currents at negative potentials are reduced. The binding site for both drugs senses approximately 40% of the electric field across the membrane, measured from the inside. In single-channel recordings from excised patches without blockers, the conductance was 8.0 +/- 0.4 pS in symmetric 150 mM Cl-. A subconductance state, measuring approximately 60% of the main conductance, was often observed. Bursts to the full open state lasting up to tens of seconds were uninterrupted at depolarizing membrane voltages. At hyperpolarizing voltages, bursts were interrupted by brief closures. Either DPC or FFA (50 microM) applied to the cytoplasmic or extracellular face of the channel led to an increase in flicker at Vm = -100 mV and not at Vm = +100 mV, in agreement with whole-cell experiments. DPC induced a higher frequency of flickers from the cytoplasmic side than the extracellular side. FFA produced longer closures than DPC; the FFA closed time was roughly equal (approximately 1.2 ms) at -100 mV with application from either side. In cell-attached patch recordings with DPC or FFA applied to the bath, there was flickery block at Vm = -100 mV, confirming that the drugs permeate through the membrane to reach the binding site. The data are consistent with the presence of a single binding site for both drugs, reached from either end of the channel. Open-channel block by DPC or FFA may

  15. Voltage-Dependent Anion Channel 1 As an Emerging Drug Target for Novel Anti-Cancer Therapeutics

    PubMed Central

    Shoshan-Barmatz, Varda; Krelin, Yakov; Shteinfer-Kuzmine, Anna; Arif, Tasleem

    2017-01-01

    Cancer cells share several properties, high proliferation potential, reprogramed metabolism, and resistance to apoptotic cues. Acquiring these hallmarks involves changes in key oncogenes and non-oncogenes essential for cancer cell survival and prosperity, and is accompanied by the increased energy requirements of proliferating cells. Mitochondria occupy a central position in cell life and death with mitochondrial bioenergetics, biosynthesis, and signaling are critical for tumorigenesis. Voltage-dependent anion channel 1 (VDAC1) is situated in the outer mitochondrial membrane (OMM) and serving as a mitochondrial gatekeeper. VDAC1 allowing the transfer of metabolites, fatty acid ions, Ca2+, reactive oxygen species, and cholesterol across the OMM and is a key player in mitochondrial-mediate apoptosis. Moreover, VDAC1 serves as a hub protein, interacting with diverse sets of proteins from the cytosol, endoplasmic reticulum, and mitochondria that together regulate metabolic and signaling pathways. The observation that VDAC1 is over-expressed in many cancers suggests that the protein may play a pivotal role in cancer cell survival. However, VDAC1 is also important in mitochondria-mediated apoptosis, mediating release of apoptotic proteins and interacting with anti-apoptotic proteins, such as B-cell lymphoma 2 (Bcl-2), Bcl-xL, and hexokinase (HK), which are also highly expressed in many cancers. Strategically located in a “bottleneck” position, controlling metabolic homeostasis and apoptosis, VDAC1 thus represents an emerging target for anti-cancer drugs. This review presents an overview on the multi-functional mitochondrial protein VDAC1 performing several functions and interacting with distinct sets of partners to regulate both cell life and death, and highlights the importance of the protein for cancer cell survival. We address recent results related to the mechanisms of VDAC1-mediated apoptosis and the potential of associated proteins to modulate of VDAC1 activity

  16. Voltage-dependent block of the cystic fibrosis transmembrane conductance regulator Cl- channel by two closely related arylaminobenzoates.

    PubMed

    McCarty, N A; McDonough, S; Cohen, B N; Riordan, J R; Davidson, N; Lester, H A

    1993-07-01

    The gene defective in cystic fibrosis encodes a Cl- channel, the cystic fibrosis transmembrane conductance regulator (CFTR). CFTR is blocked by diphenylamine-2-carboxylate (DPC) when applied extracellularly at millimolar concentrations. We studied the block of CFTR expressed in Xenopus oocytes by DPC or by a closely related molecule, flufenamic acid (FFA). Block of whole-cell CFTR currents by bath-applied DPC or by FFA, both at 200 microM, requires several minutes to reach full effect. Blockade is voltage dependent, suggesting open-channel block: currents at positive potentials are not affected but currents at negative potentials are reduced. The binding site for both drugs senses approximately 40% of the electric field across the membrane, measured from the inside. In single-channel recordings from excised patches without blockers, the conductance was 8.0 +/- 0.4 pS in symmetric 150 mM Cl-. A subconductance state, measuring approximately 60% of the main conductance, was often observed. Bursts to the full open state lasting up to tens of seconds were uninterrupted at depolarizing membrane voltages. At hyperpolarizing voltages, bursts were interrupted by brief closures. Either DPC or FFA (50 microM) applied to the cytoplasmic or extracellular face of the channel led to an increase in flicker at Vm = -100 mV and not at Vm = +100 mV, in agreement with whole-cell experiments. DPC induced a higher frequency of flickers from the cytoplasmic side than the extracellular side. FFA produced longer closures than DPC; the FFA closed time was roughly equal (approximately 1.2 ms) at -100 mV with application from either side. In cell-attached patch recordings with DPC or FFA applied to the bath, there was flickery block at Vm = -100 mV, confirming that the drugs permeate through the membrane to reach the binding site. The data are consistent with the presence of a single binding site for both drugs, reached from either end of the channel. Open-channel block by DPC or FFA may

  17. Histamine H3-receptor activation augments voltage-dependent Ca2+ current via GTP hydrolysis in rabbit saphenous artery.

    PubMed

    Oike, M; Kitamura, K; Kuriyama, H

    1992-03-01

    1. Actions of histamine on the voltage-dependent Ba2+(Ca2+) currents (IBa, ICa) were investigated using the whole-cell patch-clamp technique on dispersed smooth muscle cells from the rabbit saphenous artery. 2. Histamine (half-maximal dose, EC50 = 530 nM) augmented the IBa evoked by a brief depolarizing pulse (100 ms duration; to +10 mV from a holding potential of -80 mV) in a concentration-dependent manner. The maximum augmentation was obtained with 30 microM-histamine (1.29 times control). This augmentation of IBa was inhibited by the H3-antagonist, thioperamide (Ki = 30 nM, slope of the Schild plot = 1.0), but not by H1- or H2-antagonists (mepyramine or diphenhydramine, or cimetidine, respectively). 3. An H3-agonist, R alpha-methylhistamine (EC50 = 93 nM), also augmented IBa in a concentration-dependent manner at a holding potential of -80 mV and the maximum augmentation (1.25 times control) was obtained with 10 microM. This augmentation was also inhibited by thioperamide, but not by the above H1- and H2- antagonists. 4. Intracellularly applied 500 microM-guanosine 5'-triphosphate (GTP) enhanced, but 1 mM-guanosine 5'-O-(2-thiodiphosphate) (GDP beta S) abolished, the histamine-induced augmentation of IBa. When one of the non-hydrolysable GTP analogues, guanosine 5'-O-(3-thiotriphosphate) (GTP gamma S; greater than 5 microM), guanylyl-imidodiphosphate (GMP-PNP; 200 microM) or guanylyl (beta, gamma-methylene)-diphosphonate (GMP-PCP; 1 mM) was intracellularly applied, the IBa amplitude evoked without the application of histamine was not affected, but the excitatory effect of histamine on IBa was reversed to an inhibition. Pre-treatment with pertussis toxin (PTX: 300 ng/ml and 3 micrograms/ml) did not modify the histamine-induced responses in the absence or presence of GTP gamma S. 5. 4 beta-Phorbol 12,13-dibutylate (PDBu) increased the amplitude of IBa. However, this action of PDBu was not enhanced by the application of GTP (500 microM) in the pipette, but

  18. Voltage-dependent interaction of open-channel blocking molecules with gating of NMDA receptors in rat cortical neurons.

    PubMed Central

    Antonov, S M; Johnson, J W

    1996-01-01

    1. The mechanisms by which four adamantane derivatives (IEM-1857, -1592, -1460 and -1754) block the open NMDA-activated channel were studied at membrane voltages (Vm) from -170 to +30 mV. The rate constants of channel block (k+) and of channel unblock (k-) were measured from the fully resolvable flicker of single-channel currents induced by each compound. 2. The k+ of each compound exhibited a similar exponential dependence on voltage over the Vm range studied. 3. The k- of IEM-1857 and IEM-1592 over the Vm range studied, and of IEM-1754 and IEM-1460 from -30 to -90 mV, exhibited similar exponential dependencies on voltage. However, the k- of IEM-1754 and IEM-1460 at Vm values more hyperpolarized than -90 mV were much more steeply voltage dependent, suggesting that at these Vm values the two drugs can occupy a deeper binding site. 4. Each of the drugs induced a concentration-dependent prolongation of the mean burst length at -90 mV, suggesting that while blocking they can interfere with channel closure. 5. The prolongation of mean burst length induced by the largest drug (IEM-1857) increased with hyperpolarization. The increase was consistent at each Vm with the predictions of the sequential scheme of block, suggesting that channel closure is prevented when IEM-1857 is bound. The prolongation of burst length induced by the smallest drug (IEM-1754) was less than predicted by the sequential scheme and the deviation increased with hyperpolarization. 6. The IEM-1857 concentration-dependence of number of blockages per unit open time had a slope equal to k+ at -150 mV. The IEM-1754 concentration-dependence of number of blockages per unit open time revealed a slope about two times less than k+ for this compound at -150 mV. 7. The mean patch current was not significantly altered by 3 microM IEM-1857 at Vm values from -90 to -150 mV, as expected of a drug that prevents channel closure when blocking. Mean patch current significantly decreased with hyperpolarization beyond

  19. [Helminth fauna of amphibians (Vertebrata: Amphibia) in the Republic of Belarus].

    PubMed

    Shimalov, V V

    2009-01-01

    Historical review of the investigations of helminth fauna in amphibians from Belarus is presented. In 12 amphibian species examined by different authors 46 helminth species were found, including 29 Trematoda, 13 Nematoda, 1 Monogenea, 2 Cestoda, and 1 Acanthocephala. Original data on helminths parasitizing Amphibia in Byelorussian Polesie, by the results of long-term investigations in 1986-2004 are given. Distribution of 40 helminth species by hosts and respective infestation rates are reported.

  20. Species-specificity of amphibia carbohydrate chains: the Bufo viridis case study.

    PubMed

    Coppin, Alexandra; Maes, Emmanuel; Strecker, Gérard

    2002-02-05

    The jelly coat surrounding the eggs of amphibia is composed of oviducal mucins and plays an important role in the fertilization process. From a structural and chemical point of view, these jellies are very different from one species to another. Bufo viridis is the 13th amphibia species studied in term of carbohydrate structural analysis. The oligosaccharides have been released from the oviducal mucins by reductive beta elimination, purified by various chromatography procedures and analyzed by (1)H and (13)C 1D-2D NMR spectroscopy. Among the 15 compounds, ten have novel structures, although they possess some well-known structural patterns as blood group epitopes (Le(x), Le(y)) or other sequences already observed in other amphibia species. These results reinforce our hypothesis about the strict species-specificity of these carbohydrate chains. It must be noted that such species-specificity does not depend on one particular monosaccharide but it is rather due to a set of particular tri- or tetrasaccharide sequences. Hence, B. viridis species could be characterized by the simultaneous presence of a 2,3,6-trisubstituted galactosyl residue, the GlcNAc(beta 1-3)[Fuc(alpha 1-4)]GlcNAc beta sequence and the Le(x), Le(y) or Cad determinants. The anionic charge of the oligosaccharides is carried only by sialic acid alpha-(2-->6)-linked to GalNAc-ol residue as in Bufo bufo or in Bufo arenarum.

  1. Time-resolved photoluminescence measurements for determining voltage-dependent charge-separation efficiencies of subcells in triple-junction solar cells

    SciTech Connect

    Tex, David M.; Ihara, Toshiyuki; Kanemitsu, Yoshihiko; Akiyama, Hidefumi; Imaizumi, Mitsuru

    2015-01-05

    Conventional external quantum-efficiency measurement of solar cells provides charge-collection efficiency for approximate short-circuit conditions. Because this differs from actual operating voltages, the optimization of high-quality tandem solar cells is especially complicated. Here, we propose a contactless method, which allows for the determination of the voltage dependence of charge-collection efficiency for each subcell independently. By investigating the power dependence of photoluminescence decays, charge-separation and recombination-loss time constants are obtained. The upper limit of the charge-collection efficiencies at the operating points is then obtained by applying the uniform field model. This technique may complement electrical characterization of the voltage dependence of charge collection, since subcells are directly accessible.

  2. Time-resolved photoluminescence measurements for determining voltage-dependent charge-separation efficiencies of subcells in triple-junction solar cells

    NASA Astrophysics Data System (ADS)

    Tex, David M.; Ihara, Toshiyuki; Akiyama, Hidefumi; Imaizumi, Mitsuru; Kanemitsu, Yoshihiko

    2015-01-01

    Conventional external quantum-efficiency measurement of solar cells provides charge-collection efficiency for approximate short-circuit conditions. Because this differs from actual operating voltages, the optimization of high-quality tandem solar cells is especially complicated. Here, we propose a contactless method, which allows for the determination of the voltage dependence of charge-collection efficiency for each subcell independently. By investigating the power dependence of photoluminescence decays, charge-separation and recombination-loss time constants are obtained. The upper limit of the charge-collection efficiencies at the operating points is then obtained by applying the uniform field model. This technique may complement electrical characterization of the voltage dependence of charge collection, since subcells are directly accessible.

  3. [Rhythmic bioelectrical activity of the cerebral cortex analyzed with allowance for the nonlinear voltage dependence of excitatory postsynaptic potentials induced by neocortical neurons].

    PubMed

    Bakharev, B V

    2008-01-01

    A nonlinear voltage dependence between the membrane and excitatory postsynaptic potentials coming via corticocortical connections was derived based on literature data. The existence of a region of stability of oscillations with increasing mean value of nonspecific afferent input was shown. As the afferent input strongly increases, a high-frequency component of oscillations (40-60 Hz), appeas which may result in the instability of oscillations and initiation of abnormal brain activity.

  4. Transcriptional upregulation of α2δ-1 elevates arterial smooth muscle cell voltage-dependent Ca2+ channel surface expression and cerebrovascular constriction in genetic hypertension.

    PubMed

    Bannister, John P; Bulley, Simon; Narayanan, Damodaran; Thomas-Gatewood, Candice; Luzny, Patrik; Pachuau, Judith; Jaggar, Jonathan H

    2012-10-01

    A hallmark of hypertension is an increase in arterial myocyte voltage-dependent Ca2+ (CaV1.2) currents that induces pathological vasoconstriction. CaV1.2 channels are heteromeric complexes composed of a pore-forming CaV1.2α1 with auxiliary α2δ and β subunits. Molecular mechanisms that elevate CaV1.2 currents during hypertension and the potential contribution of CaV1.2 auxiliary subunits are unclear. Here, we investigated the pathological significance of α2δ subunits in vasoconstriction associated with hypertension. Age-dependent development of hypertension in spontaneously hypertensive rats was associated with an unequal elevation in α2δ-1 and CaV1.2α1 mRNA and protein in cerebral artery myocytes, with α2δ-1 increasing more than CaV1.2α1. Other α2δ isoforms did not emerge in hypertension. Myocytes and arteries of hypertensive spontaneously hypertensive rats displayed higher surface-localized α2δ-1 and CaV1.2α1 proteins, surface α2δ-1:CaV1.2α1 ratio, CaV1.2 current density and noninactivating current, and pressure- and depolarization-induced vasoconstriction than those of Wistar-Kyoto controls. Pregabalin, an α2δ-1 ligand, did not alter α2δ-1 or CaV1.2α1 total protein but normalized α2δ-1 and CaV1.2α1 surface expression, surface α2δ-1:CaV1.2α1, CaV1.2 current density and inactivation, and vasoconstriction in myocytes and arteries of hypertensive rats to control levels. Genetic hypertension is associated with an elevation in α2δ-1 expression that promotes surface trafficking of CaV1.2 channels in cerebral artery myocytes. This leads to an increase in CaV1.2 current-density and a reduction in current inactivation that induces vasoconstriction. Data also suggest that α2δ-1 targeting is a novel strategy that may be used to reverse pathological CaV1.2 channel trafficking to induce cerebrovascular dilation in hypertension.

  5. Voltage-dependent regulation of CaV2.2 channels by Gq-coupled receptor is facilitated by membrane-localized β subunit.

    PubMed

    Keum, Dongil; Baek, Christina; Kim, Dong-Il; Kweon, Hae-Jin; Suh, Byung-Chang

    2014-10-01

    G protein-coupled receptors (GPCRs) signal through molecular messengers, such as Gβγ, Ca(2+), and phosphatidylinositol 4,5-bisphosphate (PIP2), to modulate N-type voltage-gated Ca(2+) (CaV2.2) channels, playing a crucial role in regulating synaptic transmission. However, the cellular pathways through which GqPCRs inhibit CaV2.2 channel current are not completely understood. Here, we report that the location of CaV β subunits is key to determining the voltage dependence of CaV2.2 channel modulation by GqPCRs. Application of the muscarinic agonist oxotremorine-M to tsA-201 cells expressing M1 receptors, together with CaV N-type α1B, α2δ1, and membrane-localized β2a subunits, shifted the current-voltage relationship for CaV2.2 activation 5 mV to the right and slowed current activation. Muscarinic suppression of CaV2.2 activity was relieved by strong depolarizing prepulses. Moreover, when the C terminus of β-adrenergic receptor kinase (which binds Gβγ) was coexpressed with N-type channels, inhibition of CaV2.2 current after M1 receptor activation was markedly reduced and delayed, whereas the delay between PIP2 hydrolysis and inhibition of CaV2.2 current was decreased. When the Gβγ-insensitive CaV2.2 α1C-1B chimera was expressed, voltage-dependent inhibition of calcium current was virtually abolished, suggesting that M1 receptors act through Gβγ to inhibit CaV2.2 channels bearing membrane-localized CaV β2a subunits. Expression of cytosolic β subunits such as β2b and β3, as well as the palmitoylation-negative mutant β2a(C3,4S), reduced the voltage dependence of M1 muscarinic inhibition of CaV2.2 channels, whereas it increased inhibition mediated by PIP2 depletion. Together, our results indicate that, with membrane-localized CaV β subunits, CaV2.2 channels are subject to Gβγ-mediated voltage-dependent inhibition, whereas cytosol-localized β subunits confer more effective PIP2-mediated voltage-independent regulation. Thus, the voltage dependence of

  6. Inhibitory action of betaxolol, a beta 1-selective adrenoceptor antagonist, on voltage-dependent calcium channels in guinea-pig artery and vein.

    PubMed Central

    Setoguchi, M.; Ohya, Y.; Abe, I.; Fujishima, M.

    1995-01-01

    1. The effects of betaxolol, (+/-)-1-[4-[2-(cyclopropylmethoxy) ethyl] phenoxy]-3-(isopropylamino)-2-propanol hydrochloride, a beta 1-selective adrenoceptor antagonist, on voltage-dependent Ca2+ channels were investigated in single smooth muscle cells from guinea-pig mesenteric artery and portal vein using a whole-cell variant of the patch-clamp technique. Ca2+ channel currents were recorded with bath solutions contained 10 mM Ba2+ for arterial cells and 2 mM Ca2+ for venous cells. 2. Betaxolol inhibited Ca2+ channel currents dose-dependently in both mesenteric artery cells and portal vein cells. The two isomers, (+)-betaxolol and (-)-betaxolol (relative beta-antagonistic efficacies of 0.1 and 1, respectively), had similar potencies for inhibiting Ca2+ channel currents in portal vein cells. Propranolol did not inhibit the currents. Thus the inhibitory action of betaxolol on Ca2+ channel currents was independent of the beta-adrenoceptor. 3. The inhibitory action of betaxolol on Ca2+ channel currents was compared with that of diltiazem and of nifedipine in mesenteric artery cells. The current inhibition depended on the stimulation frequency with all drugs (use-dependent block). All drugs also accelerated the current decay and shifted the voltage-dependent inactivation curve in a negative direction. 4. In conclusion, betaxolol inhibited Ca2+ channel currents in vascular smooth muscle cells. The mode of inhibitory action was similar to that of diltiazem and nifedipine. Our results suggest that betaxolol is a unique beta-adrenoceptor antagonist that has a direct inhibitory action on voltage-dependent Ca2+ channels in vascular smooth muscle cells. PMID:7647977

  7. The voltage dependence of the TMEM16B/anoctamin2 calcium-activated chloride channel is modified by mutations in the first putative intracellular loop

    PubMed Central

    Cenedese, Valentina; Betto, Giulia; Celsi, Fulvio; Cherian, O. Lijo; Pifferi, Simone

    2012-01-01

    Ca2+-activated Cl− channels (CaCCs) are involved in several physiological processes. Recently, TMEM16A/anoctamin1 and TMEM16B/anoctamin2 have been shown to function as CaCCs, but very little information is available on the structure–function relations of these channels. TMEM16B is expressed in the cilia of olfactory sensory neurons, in microvilli of vomeronasal sensory neurons, and in the synaptic terminals of retinal photoreceptors. Here, we have performed the first site-directed mutagenesis study on TMEM16B to understand the molecular mechanisms of voltage and Ca2+ dependence. We have mutated amino acids in the first putative intracellular loop and measured the properties of the wild-type and mutant TMEM16B channels expressed in HEK 293T cells using the whole cell voltage-clamp technique in the presence of various intracellular Ca2+ concentrations. We mutated E367 into glutamine or deleted the five consecutive glutamates 386EEEEE390 and 399EYE401. The EYE deletion did not significantly modify the apparent Ca2+ dependence nor the voltage dependence of channel activation. E367Q and deletion of the five glutamates did not greatly affect the apparent Ca2+ affinity but modified the voltage dependence, shifting the conductance–voltage relations toward more positive voltages. These findings indicate that glutamates E367 and 386EEEEE390 in the first intracellular putative loop play an important role in the voltage dependence of TMEM16B, thus providing an initial structure–function study for this channel. PMID:22412191

  8. Rab3 interacting molecule 3 mutations associated with autism alter regulation of voltage-dependent Ca²⁺ channels.

    PubMed

    Takada, Yoshinori; Hirano, Mitsuru; Kiyonaka, Shigeki; Ueda, Yoshifumi; Yamaguchi, Kazuma; Nakahara, Keiko; Mori, Masayuki X; Mori, Yasuo

    2015-09-01

    Autism is a neurodevelopmental psychiatric disorder characterized by impaired reciprocal social interaction, disrupted communication, and restricted and stereotyped patterns of interests. Autism is known to have a strong genetic component. Although mutations in several genes account for only a small proportion of individuals with autism, they provide insight into potential biological mechanisms that underlie autism, such as dysfunction in Ca(2+) signaling, synaptic dysfunction, and abnormal brain connectivity. In autism patients, two mutations have been reported in the Rab3 interacting molecule 3 (RIM3) gene. We have previously demonstrated that RIM3 physically and functionally interacts with voltage-dependent Ca(2+) channels (VDCCs) expressed in neurons via the β subunits, and increases neurotransmitter release. Here, by introducing corresponding autism-associated mutations that replace glutamic acid residue 176 with alanine (E176A) and methionine residue 259 with valine (M259V) into the C2B domain of mouse RIM3, we demonstrate that both mutations partly cancel the suppressive RIM3 effect on voltage-dependent inactivation of Ba(2+) currents through P/Q-type CaV2.1 recombinantly expressed in HEK293 cells. In recombinant N-type CaV2.2 VDCCs, the attenuation of the suppressive RIM3 effect on voltage-dependent inactivation is conserved for M259V but not E176A. Slowing of activation speed of P/Q-type CaV2.1 currents by RIM3 is abolished in E176A, while the physical interaction between RIM3 and β subunits is significantly attenuated in M259V. Moreover, increases by RIM3 in depolarization-induced Ca(2+) influx and acetylcholine release are significantly attenuated by E176A in rat pheochromocytoma PC12 cells. Thus, our data raise the interesting possibility that autism phenotypes are elicited by synaptic dysfunction via altered regulation of presynaptic VDCC function and neurotransmitter release. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. The voltage-dependent L-type Ca2+ (CaV1.2) channel C-terminus fragment is a bi-modal vasodilator.

    PubMed

    Bannister, John P; Leo, Marie Dennis; Narayanan, Damodaran; Jangsangthong, Wanchana; Nair, Anitha; Evanson, Kirk W; Pachuau, Judith; Gabrick, Kyle S; Boop, Frederick A; Jaggar, Jonathan H

    2013-06-15

    Voltage-dependent L-type Ca(2+) channels (CaV1.2) are the primary Ca(2+) entry pathway in vascular smooth muscle cells (myocytes). CaV1.2 channels control systemic blood pressure and organ blood flow and are pathologically altered in vascular diseases, which modifies vessel contractility. The CaV1.2 distal C-terminus is susceptible to proteolytic cleavage, which yields a truncated CaV1.2 subunit and a cleaved C-terminal fragment (CCt). Previous studies in cardiac myocytes and neurons have identified CCt as both a transcription factor and CaV1.2 channel inhibitor, with different signalling mechanisms proposed to underlie some of these effects. CCt existence and physiological functions in arterial myocytes are unclear, but important to study given the functional significance of CaV1.2 channels. Here, we show that CCt exists in myocytes of both rat and human resistance-size cerebral arteries, where it locates to both the nucleus and plasma membrane. Recombinant CCt expression in arterial myocytes inhibited CaV1.2 transcription and reduced CaV1.2 protein. CCt induced a depolarizing shift in the voltage dependence of both CaV1.2 current activation and inactivation, and reduced non-inactivating current in myocytes. Recombinant truncated CCt lacking a putative nuclear localization sequence (92CCt) did not locate to the nucleus and had no effect on arterial CaV1.2 transcription or protein. However, 92CCt shifted the voltage dependence of CaV1.2 activation and inactivation similarly to CCt. CCt and 92CCt both inhibited pressure- and depolarization-induced vasoconstriction, although CCt was a far more effective vasodilator. These data demonstrate that endogenous CCt exists and reduces both CaV1.2 channel expression and voltage sensitivity in arterial myocytes. Thus, CCt is a bi-modal vasodilator.

  10. Rhabdias kongmongthaensis sp. n. (Nematoda: Rhabdiasidae) from Polypedates leucomystax (Amphibia: Anura: Rhacophoridae) in Thailand.

    PubMed

    Kuzmin, Yuriy; Tkach, Vasyl V; Vaughan, Jefferson A

    2005-11-01

    Rhabdias kongmongthaensis sp. n. is described based on specimens found in the lungs of the tree frog Polypedates leucomystax (Gravenhorst) (Amphibia: Rhacophoridae) from Kanchanaburi Province, western Thailand. The new species is similar to two North-American species, Rhabdias ranae and R. americanus, by presence of two lateral pseudolabia, each with two inner submedian protuberances. R. kongmongthaensis differs from both species by relative length and shape of the tail, and by its distribution and host specificity. Presence of lateral pseudolabia distinguishes the new species from the geographically closest Rhabdias species as well as from those parasitizing other rhacophorid frogs.

  11. Cosmocercoides himalayanus sp. nov. (Nematoda, Cosmocercidae) in Duttaphrynus himalayanus (Amphibia, Anura) from Dehradun (Uttarakhand), India.

    PubMed

    Rizvi, Anjum N; Bursey, Charles R

    2014-03-01

    Cosmocercoides himalayanus sp. nov. (Nematoda, Cosmocercidae) from the large intestine of Duttaphrynus himalayanus (Amphibia, Anura) from Dehradun, India is described and illustrated. Cosmocercoides himalayanus sp. nov. represents the 21st species assigned to the genus and the 9th species from the Oriental biogeographical region. Cosmocercoides himalayanus sp. nov. differs from the previously described Oriental species in number and position of rosette papillae; it is the only species possessing 24 or more rosette papillae to have 4 postcloacal papillae. In addition, a list of species assigned to Cosmocercoides is provided; however, C. fotedari Arya, 1992 is removed from the genus and until further study is considered a species inquirenda.

  12. ELF magnetic fields tuned to ion parametric resonance conditions do not affect TEA-sensitive voltage-dependent outward K(+) currents in a human neural cell line.

    PubMed

    Gavoçi, Entelë; Zironi, Isabella; Remondini, Daniel; Virelli, Angela; Castellani, Gastone; Del Re, Brunella; Giorgi, Gianfranco; Aicardi, Giorgio; Bersani, Ferdinando

    2013-12-01

    Despite the experimental evidence of significant biological effects of extremely low frequency (ELF) magnetic fields (MFs), the underlying mechanisms are still unclear. Among the few mechanisms proposed, of particular interest is the so called "ion parametric resonance (IPR)" hypothesis, frequently referred to as theoretical support for medical applications. We studied the effect of different combinations of static (DC) and alternating (AC) ELF MFs tuned on resonance conditions for potassium (K(+)) on TEA-sensitive voltage-dependent outward K(+) currents in the human neuroblastoma BE(2)C cell line. Currents through the cell membrane were measured by whole-cell patch clamp before, during, and after exposure to MF. No significant changes in K(+) current density were found. This study does not confirm the IPR hypothesis at the level of TEA-sensitive voltage-dependent outward K(+) currents in our experimental conditions. However, this is not a direct disprove of the hypothesis, which should be investigated on other ion channels and at single channel levels also. © 2013 Wiley Periodicals, Inc.

  13. Unique Bell-shaped Voltage-dependent Modulation of Na+ Channel Gating by Novel Insect-selective Toxins from the Spider Agelena orientalis*

    PubMed Central

    Billen, Bert; Vassilevski, Alexander; Nikolsky, Anton; Debaveye, Sarah; Tytgat, Jan; Grishin, Eugene

    2010-01-01

    Spider venoms provide a highly valuable source of peptide toxins that act on a wide diversity of membrane-bound receptors and ion channels. In this work, we report isolation, biochemical analysis, and pharmacological characterization of a novel family of spider peptide toxins, designated β/δ-agatoxins. These toxins consist of 36–38 amino acid residues and originate from the venom of the agelenid funnel-web spider Agelena orientalis. The presented toxins show considerable amino acid sequence similarity to other known toxins such as μ-agatoxins, curtatoxins, and δ-palutoxins-IT from the related spiders Agelenopsis aperta, Hololena curta, and Paracoelotes luctuosus. β/δ-Agatoxins modulate the insect NaV channel (DmNaV1/tipE) in a unique manner, with both the activation and inactivation processes being affected. The voltage dependence of activation is shifted toward more hyperpolarized potentials (analogous to site 4 toxins) and a non-inactivating persistent Na+ current is induced (site 3-like action). Interestingly, both effects take place in a voltage-dependent manner, producing a bell-shaped curve between −80 and 0 mV, and they are absent in mammalian NaV channels. To the best of our knowledge, this is the first detailed report of peptide toxins with such a peculiar pharmacological behavior, clearly indicating that traditional classification of toxins according to their binding sites may not be as exclusive as previously assumed. PMID:20385552

  14. Unique bell-shaped voltage-dependent modulation of Na+ channel gating by novel insect-selective toxins from the spider Agelena orientalis.

    PubMed

    Billen, Bert; Vassilevski, Alexander; Nikolsky, Anton; Debaveye, Sarah; Tytgat, Jan; Grishin, Eugene

    2010-06-11

    Spider venoms provide a highly valuable source of peptide toxins that act on a wide diversity of membrane-bound receptors and ion channels. In this work, we report isolation, biochemical analysis, and pharmacological characterization of a novel family of spider peptide toxins, designated beta/delta-agatoxins. These toxins consist of 36-38 amino acid residues and originate from the venom of the agelenid funnel-web spider Agelena orientalis. The presented toxins show considerable amino acid sequence similarity to other known toxins such as mu-agatoxins, curtatoxins, and delta-palutoxins-IT from the related spiders Agelenopsis aperta, Hololena curta, and Paracoelotes luctuosus. beta/delta-Agatoxins modulate the insect Na(V) channel (DmNa(V)1/tipE) in a unique manner, with both the activation and inactivation processes being affected. The voltage dependence of activation is shifted toward more hyperpolarized potentials (analogous to site 4 toxins) and a non-inactivating persistent Na(+) current is induced (site 3-like action). Interestingly, both effects take place in a voltage-dependent manner, producing a bell-shaped curve between -80 and 0 mV, and they are absent in mammalian Na(V) channels. To the best of our knowledge, this is the first detailed report of peptide toxins with such a peculiar pharmacological behavior, clearly indicating that traditional classification of toxins according to their binding sites may not be as exclusive as previously assumed.

  15. Effects of in vitro and in vivo lead exposure on voltage-dependent calcium channels in central neurons of Lymnaea stagnalis.

    PubMed

    Audesirk, G

    1987-01-01

    Currents through calcium channels of members of an identified cluster of neurons (B cells) in the pond snail Lymnaea stagnalis were studied under voltage clamp. The normal physiological saline was modified to maximize the visibility of voltage-dependent calcium currents and minimize contamination by other currents. Barium was used as the charge carrier for the calcium channels. Depolarizing voltage steps induce an inward current, the magnitude of which varies with the barium concentration. In brains taken from animals not exposed in vivo to lead, in vitro addition of lead acetate to the recording medium (0.25 to 14 microM) inhibits the barium current by 59 +/- 14% (mean +/- s.d.), in a manner that is independent of the lead concentration. The magnitude of the residual current still varies with the barium concentration. The voltage dependence of the current appears to be unaffected by lead. In contrast to some other calcium-channel blockers, such as cobalt, the inhibition of barium currents by in vitro lead exposure is irreversible, at least in short-term experiments. Contrary to expectations based on these in vitro results, barium currents in B cells of animals exposed to 5 microM lead for 6 to 12 weeks in vivo were approximately twice as large as barium currents in B cells from unexposed controls, when both were recorded in lead-free saline. It is possible that chronic in vivo lead exposure causes an increase in the number of calcium channels in these neurons.

  16. Structural mapping of the voltage-dependent sodium channel. Distance between the tetrodotoxin and Centruroides suffusus suffusus II beta-scorpion toxin receptors.

    PubMed

    Darbon, H; Angelides, K J

    1984-05-25

    A 7- dimethylaminocoumarin -4-acetate fluorescent derivative of toxin II from the venom of the scorpion Centruroides suffusus suffusus (Css II) has been prepared to study the structural, conformational, and cellular properties of the beta-neurotoxin receptor site on the voltage-dependent sodium channel. The derivative retains high affinity for its receptor site on the synaptosomal sodium channel with a KD of 7 nM and site capacity of 1.5 pmol/mg of synaptosomal protein. The fluorescent toxin is very environmentally sensitive and the fluorescence emission upon binding indicates that the Css II receptor is largely hydrophobic. Binding of tetrodotoxin or batrachotoxin does not alter the spectroscopic properties of bound Css II, whereas toxin V from Leiurus quinquestriatus effects a 10-nm blue shift to a more hydrophobic environment. This is the first direct indication of conformational coupling between these separate neurotoxin receptor sites. The distance between the tetrodotoxin and Css II scorpion toxin receptors on the sodium channel was measured by fluorescence resonance energy transfer. Efficiencies were measured by both donor quenching and acceptor-sensitized emission. The distance between these two neurotoxin sites is about 34 A. The implications of these receptor locations together with other known molecular distances are discussed in terms of a molecular structure of the voltage-dependent sodium channel.

  17. Concentration-jump analysis of voltage-dependent conductances activated by glutamate and kainate in neurons of the avian cochlear nucleus.

    PubMed Central

    Raman, I M; Trussell, L O

    1995-01-01

    We have examined the mechanisms underlying the voltage sensitivity of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptors in voltage-clamped outside-out patches and whole cells taken from the nucleus magnocellularis of the chick. Responses to either glutamate or kainate had outwardly rectifying current-voltage relations. The rate and extent of desensitization during prolonged exposure to agonist, and the rate of deactivation after brief exposure to agonist, decreased at positive potentials, suggesting that a kinetic transition was sensitive to membrane potential. Voltage dependence of the peak conductance and of the deactivation kinetics persisted when desensitization was reduced with aniracetam or blocked with cyclothiazide. Furthermore, the rate of recovery from desensitization to glutamate was not voltage dependent. Upon reduction of extracellular divalent cation concentration, kainate-evoked currents increased but preserved rectifying current-voltage relations. Rectification was strongest at lower kainate concentrations. Surprisingly, nonstationary variance analysis of desensitizing responses to glutamate or of the current deactivation after kainate removal revealed an increase in the mean single-channel conductance with more positive membrane potentials. These data indicate that the rectification of the peak response to a high agonist concentration reflects an increase in channel conductance, whereas rectification of steady-state current is dominated by voltage-sensitive channel kinetics. Images FIGURE 2 FIGURE 3 PMID:8580330

  18. Effects of semiconductor substrate and glia-free culture on the development of voltage-dependent currents in rat striatal neurones.

    PubMed

    Parak, W J; George, M; Kudera, M; Gaub, H E; Behrends, J C

    2001-01-01

    An essential requirement for successful long-term coupling between neuronal assemblies and semiconductor devices is that the neurones must be able to fully develop their electrogenic repertoire when growing on semiconductor (silicon) substrates. While it has for some time been known that neurones may be cultured on silicon wafers insulated with SiO2 and Si3N4, an electrophysiological characterisation of their development under such conditions is lacking. The development of voltage-dependent membrane currents, especially of the rapid sodium inward current underlying the action potential, is of particular importance because the conductance change during the action potential determines the quality of cell-semiconductor coupling. We have cultured rat striatal neurones on either glass coverslips or silicon wafers insulated with SiO2 and Si3N4 using both serum-containing and serum-free media. We here report evidence that not only serum-free culture media but also growth on semiconductor surfaces may negatively affect the development of voltage-dependent currents in neurones. Furthermore, using surface-charge measurements with the atomic force microscope, we demonstrate a reduced negativity of the semiconductor surface compared to glass. The reduced surface charge may affect cellular development through an effect on the binding and/or orientation of extracellular matrix proteins, such as laminin. Our findings therefore suggest that semiconductor substrates are not entirely equivalent to glass in terms of their effects on neuronal cell growth and differentiation.

  19. The voltage-dependent Cl− channel ClC-5 and plasma membrane Cl− conductances of mouse renal collecting duct cells (mIMCD-3)

    PubMed Central

    Sayer, J A; Stewart, G S; Boese, S H; Gray, M A; Pearce, S H S; Goodship, T H J; Simmons, N L

    2001-01-01

    We have tested the hypothesis that the voltage-dependent Cl− channel, ClC-5 functions as a plasma membrane Cl− conductance in renal inner medullary collecting duct cells. Full-length mouse kidney ClC-5 (mClC-5) was cloned and transiently expressed in CHO-K1 cells. Fast whole-cell patch-clamp recordings confirmed that mClC-5 expression produces a voltage-dependent, strongly outwardly rectifying Cl− conductance that was unaffected by external DIDS. Slow whole-cell recordings, using nystatin-perforated patches from transfected CHO-K1 cells, also produced voltage-dependent Cl− currents consistent with ClC-5 expression. However, under this recording configuration an endogenous DIDS-sensitive Ca2+-activated Cl− conductance was also evident, which appeared to be activated by green fluorescent protein (GFP) transfection. A mClC-5-GFP fusion protein was transiently expressed in CHO-K1 cells; confocal laser scanning microscopy (CLSM) showed localization at the plasma membrane, consistent with patch-clamp experiments. Endogenous expression of mClC-5 was demonstrated in mouse renal collecting duct cells (mIMCD-3) by RT-PCR and by immunocytochemistry. Using slow whole-cell current recordings, mIMCD-3 cells displayed three biophysically distinct Cl−-selective currents, which were all inhibited by DIDS. However, no cells exhibited whole-cell currents that had mClC-5 characteristics. Transient transfection of mIMCD-3 cells with antisense mClC-5 had no effect on the endogenous Cl− conductances. Transient transfection with sense mClC-5 failed to induce the Cl− conductance seen in CHO-K1 cells but stimulated levels of the endogenous Ca2+-activated Cl− conductance 24 h post-transfection. Confocal laser scanning microscopy of mIMCD-3 cells transfected with mClC-5-GFP showed that the protein was absent from the plasma membrane and was instead localized to acidic endosomal compartments. These data discount a major role for ClC-5 as a plasma membrane Cl− conductance in

  20. Comparative morphometric study of the vestibular system of the vertebrata: reptilia, aves, amphibia, and pisces.

    PubMed

    Ramprashad, F; Landolt, J P; Money, K E; Laufer, J

    1986-01-01

    Morphometric measurements were made from serial sections of the vestibular system in four classes of vertebrates: Reptilia, Aves, Amphibia, and Pisces. Representative species of reptile studied were the lizard (Gekko gecko), the common garter snake (Thamnophis sp.), and the common turtle (Chelonia sp.). The budgie (Melopsittacus undulatas), the common pigeon (Columba domestica), the yellow-bellied sapsucker (Sphyrapicus varius), and the horned owl (Bubo virginianus) were chosen as representative of the bird. For the amphibian, the leopard frog (Rana pipiens), and the mud puppy (Necturus maculatus) were chosen for study. As representative of the fish, the goldfish (Carassius auratus), the tilapia (Tilapia mossambica), the guppy (Lebistes sp.), and the sea horse (Hippocampus sp.) were used in these measurements. The morphometric data obtained were then used in estimates of the time constants in the Steinhausen equation which describes the biophysics of fluid flow in the semicircular canals. In general, the time constants (theta/II in the Steinhausen equation) of these representatives of Reptilia, Aves, and Amphibia were of magnitude similar to those reported in mammals, despite the dissimilarities in the diameters of the ducts, the duct radii of curvature, the dimensions of the cristae ampullares and the utricle, and volumes of endolymph within the vestibular system. However, the short-time constants in Pisces were larger (therefore providing a slower response) than those in other vertebrates, and were similar to that of the turtle and the mud puppy.

  1. Gate voltage dependent characteristics of p-n diodes and bipolar transistors based on multiwall CN(x)/carbon nanotube intramolecular junctions.

    PubMed

    Zhang, W J; Zhang, Q F; Chai, Y; Shen, X; Wu, J L

    2007-10-03

    The electrical transport characteristics of multiwall CN(x)/carbon nanotube intramolecular junctions were studied. The junctions could be used as diodes. We found that the rectification resulted from p-n junctions, not from metal-semiconductor junctions. The gate effect was very weak when the diodes were reverse biased. At forward bias, however, some of the p-n diodes could be n-type transistors. Experimental results supported the opinion that the gate voltage dependent property is derived from the Schottky barrier between the CN(x) part and the electrode. Using p-n diodes, a bipolar transistor with nanoscale components was built, whose behavior was very similar to that of a conventional planar bipolar transistor.

  2. The Effects of the Selective Serotonin Reuptake Inhibitor Fluvoxamine on Voltage-Dependent K(+) Channels in Rabbit Coronary Arterial Smooth Muscle Cells.

    PubMed

    Hong, Da Hye; Li, Hongliang; Kim, Han Sol; Kim, Hye Won; Shin, Sung Eun; Jung, Won-Kyo; Na, Sung Hun; Choi, Il-Whan; Firth, Amy Leanne; Park, Won Sun; Kim, Dae-Joong

    2015-01-01

    We demonstrated the inhibitory effect of fluvoxamine, a selective serotonin reuptake inhibitor (SSRI), on voltage-dependent K(+) (Kv) channels in freshly isolated rabbit coronary arterial smooth muscle cells using a whole-cell patch clamp technique. Fluvoxamine reduced the amplitude of Kv currents in a concentration-dependent manner with an IC50 value of 3.71±1.09 µM and a Hill coefficient of 0.62±0.14. Although fluvoxamine did not significantly affect the steady-state activation curve, it shifted the steady-state inactivation curve toward a more negative potential. Pretreatment with another SSRI, paroxetine, did not affect the basal Kv current and did not alter the inhibitory effect of fluvoxamine on Kv channels. We concluded that fluvoxamine inhibits the Kv current in a concentration-dependent manner and in a closed (inactivated) state of the Kv channels independent of serotonin reuptake inhibition.

  3. Physics-Based Compact Model for CIGS and CdTe Solar Cells: From Voltage-Dependent Carrier Collection to Light-Enhanced Reverse Breakdown: Preprint

    SciTech Connect

    Sun, Xingshu; Alam, Muhammad Ashraful; Raguse, John; Garris, Rebekah; Deline, Chris; Silverman, Timothy

    2015-10-15

    In this paper, we develop a physics-based compact model for copper indium gallium diselenide (CIGS) and cadmium telluride (CdTe) heterojunction solar cells that attributes the failure of superposition to voltage-dependent carrier collection in the absorber layer, and interprets light-enhanced reverse breakdown as a consequence of tunneling-assisted Poole-Frenkel conduction. The temperature dependence of the model is validated against both simulation and experimental data for the entire range of bias conditions. The model can be used to characterize device parameters, optimize new designs, and most importantly, predict performance and reliability of solar panels including the effects of self-heating and reverse breakdown due to partial-shading degradation.

  4. A Tight-Seal Whole Cell Study of the Voltage-Dependent Gating Mechanism of K+-Channels of Protoplasmic Droplets of Chara corallina1

    PubMed Central

    Homblé, Fabrice

    1987-01-01

    The biophysical properties of voltage-dependent K+-channels of protoplasmic droplets of Chara corallina Klein ex Willd., em, R.D.W. were investigated using the tight-seal whole cell method. Two potassium currents were observed in voltage-clamp mode and they can be used to explain the transient membrane potential time course observed in current-clamp mode. The K+-channels are identified by the effect of tetraethylammonium chloride which blocks both currents. A two-state, constant dipole moment model is used to fit the voltage-conductance curve. From this model the minimum equivalent gating charge involved in the gating mechanism of K+-channels of Chara can be estimated. PMID:16665457

  5. 4-Aminopyridine, A Blocker of Voltage-Dependent K+ Channels, Restores Blood Pressure and Improves Survival in the Wistar Rat Model of Anaphylactic Shock.

    PubMed

    Bellou, Abdelouahab; Al-Hammadi, Suleiman; Aburawi, Elhadi H; Dhanasekaran, Subramanian; Nemmar, Abderrahim; Oulhaj, Abderrahim; Shafiuallah, Mohamed; Zerrouki, Moufida; Yasin, Javed; Bellou, Leila; Alper, Seth L; Bellou, Sirine; Kazzam, Elsadig

    2016-11-01

    Anaphylactic shock is associated with severe hypotension. Potassium channel blockers, such as 4-aminopyridine, induce vasoconstriction. The objective of this study was to test the ability of 4-aminopyridine to restore blood pressure and increase survival in anaphylactic shock. Experimental study. Physiology laboratory. Adult male Wistar rats. Rats were sensitized with ovalbumin (1 mg SC), and anaphylactic shock was induced by IV injection of ovalbumin (1 mg). Experimental groups included non-allergic rats (NA) (n = 6); allergic rats (Controls) (n = 6); allergic rats treated with 4-aminopyridine (4-aminopyridine) (1 mg/kg) (n = 6); and allergic rats treated with epinephrine (EPI) (10 µg/kg) (n = 6). Treatments were administered 1 minute after induction of anaphylactic shock. Mean arterial blood pressure, heart rate, and survival were measured for 60 minutes. Plasma levels of histamine, leukotriene B4, prostaglandin E2, prostaglandin F2, pH, and HCO3 were measured. Mean arterial blood pressure was normal in the NA group; severe hypotension and high mortality were observed in controls; normalization of mean arterial blood pressure, heart rate, and increased survival were observed in 4-aminopyridine and EPI groups. All allergic 4-aminopyridine-treated rats survived after the induction of anaphylactic shock. Histamine level was higher in controls and the 4-aminopyridine group but reduced in the EPI group. Prostaglandin E2 increased in controls and EPI group and decreased in 4-aminopyridine group; prostaglandin F2 increased in controls but decreased in 4-aminopyridine and EPI groups. Leukotriene B4 decreased in 4-aminopyridine and EPI groups. Metabolic acidosis was prevented in the 4-aminopyridine group. Our data suggest that voltage-dependent K+ channel inhibition with 4-aminopyridine treatment restores blood pressure and increases survival in the Wistar rat model of anaphylactic shock. 4-aminopyridine or related voltage-dependent K channel blockers could be a

  6. Involvement of presynaptic voltage-dependent Kv3 channel in endothelin-1-induced inhibition of noradrenaline release from rat gastric sympathetic nerves.

    PubMed

    Nakamura, Kumiko; Shimizu, Takahiro; Tanaka, Kenjiro; Taniuchi, Keisuke; Yokotani, Kunihiko

    2012-11-05

    We previously reported that two types of K(+) channels, the BK type Ca(2+)-activated K(+) channel coupled with phospholipase C (PLC) and the voltage-dependent K(+) channel (Kv channel), are, respectively, involved in the prostanoid TP receptor- and muscarinic M(2) receptor-mediated inhibition of noradrenaline (NA) release from rat gastric sympathetic nerves. In the present study, therefore, we examined whether these K(+) channels are involved in endothelin-1-induced inhibition of NA release, using an isolated, vascularly perfused rat stomach. The gastric sympathetic postganglionic nerves around the left gastric artery were electrically stimulated twice at 2.5 Hz for 1 min, and endothelin-1 was added during the second stimulation. Endothelin-1 (1, 2 and 10 nM) dose-dependently inhibited gastric NA release. Endothelin-1 (2 nM)-induced inhibition of NA release was neither attenuated by PLC inhibitors [U-73122 (3 μM) and ET-18-OCH(3) (3 μM)] nor by Ca(2+)-activated K(+) channel blockers [charybdotoxin (0.1 μM) (a blocker of BK type K(+) channel) and apamin (0.3 μM) (a blocker of SK type K(+) channel)]. The endothelin-1-induced inhibitory response was also not attenuated by α-dendrotoxin (0.1 μM) (a selective inhibitor of Kv1 channel), but abolished by 4-aminopyridine (20 μM) (a selectively inhibitory dose for Kv3 channel). These results suggest the involvement of a voltage-dependent Kv3 channel in the endothelin-1-induced inhibition of NA release from the gastric sympathetic nerves in rats.

  7. Molecular mechanisms of regulation of fast-inactivating voltage-dependent transient outward K+ current in mouse heart by cell volume changes

    PubMed Central

    Wang, Guan-Lei; Wang, Ge-Xin; Yamamoto, Shintaro; Ye, Linda; Baxter, Heather; Hume, Joseph R; Duan, Dayue

    2005-01-01

    The Kv4.2/4.3 channels are the primary subunits that contribute to the fast-inactivating, voltage-dependent transient outward K+ current (Ito,fast) in the heart. Ito,fast is the critical determinant of the early repolarization of the cardiac action potential and plays an important role in the adaptive remodelling of cardiac myocytes, which usually causes cell volume changes, during myocardial ischaemia, hypertrophy and heart failure. It is not known, however, whether Ito,fast is regulated by cell volume changes. In this study we investigated the molecular mechanism for cell volume regulation of Ito,fast in native mouse left ventricular myocytes. Hyposmotic cell swelling caused a marked increase in densities of the peak Ito,fast and a significant shortening in phase 1 repolarization of the action potential duration. The voltage-dependent gating properties of Ito,fast were, however, not altered by changes in cell volume. In the presence of either protein kinase C (PKC) activator (12,13-dibutyrate) or phosphatase inhibitors (calyculin A and okadaic acid), hyposmotic cell swelling failed to further up-regulate Ito,fast. When expressed in NIH/3T3 cells, both Kv4.2 and Kv4.3 channels were also strongly regulated by cell volume in the same voltage-independent but PKC- and phosphatase-dependent manner as seen in Ito,fast in the native cardiac myocytes. We conclude that Kv4.2/4.3 channels in the heart are regulated by cell volume through a phosphorylation/dephosphorylation pathway mediated by PKC and serine/threonine phosphatase(s). These findings suggest a novel role of Kv4.2/4.3 channels in the adaptive electrical and structural remodelling of cardiac myocytes in response to myocardial hypertrophy, ischaemia and reperfusion. PMID:16081489

  8. Cyanocobalamin, vitamin B12, depresses glutamate release through inhibition of voltage-dependent Ca2+ influx in rat cerebrocortical nerve terminals (synaptosomes).

    PubMed

    Hung, Kun-Long; Wang, Chia-Chuan; Huang, Chia-Yu; Wang, Su-Jane

    2009-01-14

    The effect of cyanocobalamin, vitamin B12, on glutamate release in isolated nerve terminals (synaptosomes) prepared from rat prefrontal cortex was examined. Cyanocobalamin inhibited the release of glutamate evoked by 4-aminopyridine in a concentration-dependent manner. The inhibitory action of cyanocobalamin was blocked by the vesicular transporter inhibitor bafilomycin A1, not by the glutamate transporter inhibitor L-transpyrrolidine-2,4-dicarboxylic acid or the nontransportable glutamate inhibitor DL-threo-beta-benzyloxyaspartate, indicating that this release inhibition results from a reduction of vesicular exocytosis and not from an inhibition of Ca(2+)-independent efflux via glutamate transporter. Examination of the effect of cyanocobalamin on cytosolic free Ca(2+) concentration revealed that the inhibition of glutamate release could be attributed to a reduction in voltage-dependent Ca(2+) influx. Consistent with this, the N- and P/Q-type Ca(2+) channel blocker omega-conotoxin MVIIC, largely attenuated the inhibitory effect of cyanocobalamin on 4-aminopyridine-evoked glutamate release, but the Ca(2+) release inhibitor dantrolene had no effect. Cyanocobalamin did not alter the resting synaptosomal membrane potential or 4-aminopyridine-mediated depolarization; thus, the inhibition of 4-aminopyridine-evoked Ca(2+) influx and glutamate release produced by cyanocobalamin was not due to its decreasing synaptosomal excitability. In addition, cyanocobalamin-mediated inhibition of 4-aminopyridine-evoked Ca(2+) influx and glutamate release was significantly attenuated by protein kinase C inhibitors GF109203X and Ro318220. Furthermore, 4-aminopyridine-induced phosphorylation of protein kinase C was significantly reduced by cyanocobalamin. These results suggest that cyanocobalamin effects a decrease in protein kinase C activation, which subsequently reduces the Ca(2+) entry through voltage-dependent N- and P/Q-type Ca(2+) channels to cause a decrease in evoked glutamate

  9. The effect of Cyclin-dependent kinase 5 on voltage-dependent calcium channels in PC12 cells varies according to channel type and cell differentiation state.

    PubMed

    Furusawa, Kotaro; Asada, Akiko; Saito, Taro; Hisanaga, Shin-ichi

    2014-08-01

    Cyclin-dependent kinase 5 (Cdk5) is a Ser/Thr kinase that plays an important role in the release of neurotransmitter from pre-synaptic terminals triggered by Ca(2+) influx into the pre-synaptic cytoplasm through voltage-dependent Ca(2+) channels (VDCCs). It is reported that Cdk5 regulates L-, P/Q-, or N-type VDCC, but there is conflicting data as to the effect of Cdk5 on VDCC activity. To clarify the mechanisms involved, we examined the role of Cdk5 in regulating the Ca(2+) -channel property of VDCCs, using PC12 cells expressing endogenous, functional L-, P/Q-, and N-type VDCCs. The Ca(2+) influx, induced by membrane depolarization with high K(+) , was monitored with a fluorescent Ca(2+) indicator protein in both undifferentiated and nerve growth factor (NGF)-differentiated PC12 cells. Overall, Ca(2+) influx was increased by expression of Cdk5-p35 in undifferentiated PC12 cells but suppressed in differentiated PC12 cells. Moreover, we found that different VDCCs are distinctly regulated by Cdk5-p35 depending on the differentiation states of PC12 cells. These results indicate that Cdk5-p35 regulates L-, P/Q-, or N-type VDCCs in a cellular context-dependent manner. Calcium (Ca(2+) ) influx through voltage-dependent Ca(2+) channels (VDCCs) triggers neurotransmitter release from pre-synaptic terminal of neurons. The channel activity of VDCCs is regulated by Cdk5-p35, a neuronal Ser/Thr kinase. However, there have been debates about the regulation of VDCCs by Cdk5. Using PC12 cells, we show that Cdk5-p35 regulates VDCCs in a type (L, P/Q, and N) and differentiation-dependent manner. NGF = nerve growth factor.

  10. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition123

    PubMed Central

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F.; Zhang, Ruli

    2016-01-01

    Abstract The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property. PMID:27275007

  11. Expansion of Voltage-dependent Na+ Channel Gene Family in Early Tetrapods Coincided with the Emergence of Terrestriality and Increased Brain Complexity

    PubMed Central

    Zakon, Harold H.; Jost, Manda C.; Lu, Ying

    2011-01-01

    Mammals have ten voltage-dependent sodium (Nav) channel genes. Nav channels are expressed in different cell types with different subcellular distributions and are critical for many aspects of neuronal processing. The last common ancestor of teleosts and tetrapods had four Nav channel genes, presumably on four different chromosomes. In the lineage leading to mammals, a series of tandem duplications on two of these chromosomes more than doubled the number of Nav channel genes. It is unknown when these duplications occurred and whether they occurred against a backdrop of duplication of flanking genes on their chromosomes or as an expansion of ion channel genes in general. We estimated key dates of the Nav channel gene family expansion by phylogenetic analysis using teleost, elasmobranch, lungfish, amphibian, avian, lizard, and mammalian Nav channel sequences, as well as chromosomal synteny for tetrapod genes. We tested, and exclude, the null hypothesis that Nav channel genes reside in regions of chromosomes prone to duplication by demonstrating the lack of duplication or duplicate retention of surrounding genes. We also find no comparable expansion in other voltage-dependent ion channel gene families of tetrapods following the teleost–tetrapod divergence. We posit a specific expansion of the Nav channel gene family in the Devonian and Carboniferous periods when tetrapods evolved, diversified, and invaded the terrestrial habitat. During this time, the amniote forebrain evolved greater anatomical complexity and novel tactile sensory receptors appeared. The duplication of Nav channel genes allowed for greater regional specialization in Nav channel expression, variation in subcellular localization, and enhanced processing of somatosensory input. PMID:21148285

  12. Voltage-dependent and -independent titration of specific residues accounts for complex gating of a ClC chloride channel by extracellular protons

    PubMed Central

    Niemeyer, María Isabel; Cid, L Pablo; Yusef, Yamil R; Briones, Rodolfo; Sepúlveda, Francisco V

    2009-01-01

    The ClC transport protein family comprises both Cl− ion channel and H+/Cl− and H+/NO3− exchanger members. Structural studies on a bacterial ClC transporter reveal a pore obstructed at its external opening by a glutamate side-chain which acts as a gate for Cl− passage and in addition serves as a staging post for H+ exchange. This same conserved glutamate acts as a gate to regulate Cl− flow in ClC channels. The activity of ClC-2, a genuine Cl− channel, has a biphasic response to extracellular pH with activation by moderate acidification followed by abrupt channel closure at pH values lower than ∼7. We have now investigated the molecular basis of this complex gating behaviour. First, we identify a sensor that couples extracellular acidification to complete closure of the channel. This is extracellularly-facing histidine 532 at the N-terminus of transmembrane helix Q whose neutralisation leads to channel closure in a cooperative manner. We go on to show that acidification-dependent activation of ClC-2 is voltage dependent and probably mediated by protonation of pore gate glutamate 207. Intracellular Cl− acts as a voltage-independent modulator, as though regulating the pKa of the protonatable residue. Our results suggest that voltage dependence of ClC-2 is given by hyperpolarisation-dependent penetration of protons from the extracellular side to neutralise the glutamate gate deep within the channel, which allows Cl− efflux. This is reminiscent of a partial exchanger cycle, suggesting that the ClC-2 channel evolved from its transporter counterparts. PMID:19153159

  13. Differential effects of short and prolonged exposure to carvedilol on voltage-dependent Na(+) channels in cultured bovine adrenal medullary cells.

    PubMed

    Kajiwara, Koji; Yanagita, Toshihiko; Nakashima, Yasuhide; Wada, Akihiko; Izumi, Futoshi; Yanagihara, Nobuyuki

    2002-07-01

    We examined the effects of short and prolonged exposure to carvedilol, an antihypertensive and beta-adrenoceptor blocking drug, on voltage-dependent Na(+) channels in cultured bovine adrenal medullary cells. Carvedilol (1-100 microM) reduced (22)Na(+) influx induced by veratridine, an activator of voltage-dependent Na(+) channels. Carvedilol also suppressed veratridine-induced (45)Ca(2+) influx and catecholamine secretion in a concentration-dependent manner similar to that of (22)Na(+) influx. Prolonged exposure of the cells to 10 microM carvedilol increased [(3)H]saxitoxin ([(3)H]STX) binding, which reached a plateau at 12 h and was still observed at 48 to 72 h. Scatchard analysis of [(3)H]STX binding revealed that carvedilol increased the B(max) value (control, 14.9 +/- 0.9 fmol/10(6) cells; carvedilol, 23.8 +/- 1.2 fmol/10(6) cells) (n = 3, P < 0.05) without altering the K(d) value, suggesting a rise in the number of cell surface Na(+) channels. The increase in [(3)H]STX binding by carvedilol was prevented by cycloheximide, an inhibitor of protein synthesis, whereas carvedilol changed neither alpha- nor beta(1)-subunit mRNA levels of Na(+) channels. The carvedilol-induced increase of [(3)H]STX binding was abolished by brefeldin A and H-89, inhibitors of intracellular vesicular trafficking of proteins from the trans-Golgi network and of cyclic AMP-dependent protein kinase (protein kinase A), respectively. The present findings suggest that short-term treatment with carvedilol reduces the activity of Na(+) channels, whereas prolonged exposure to carvedilol up-regulates cell surface Na(+) channels. This may add new pharmacological effects of carvedilol to our understanding in the treatment of heart failure and hypertension.

  14. Intramitochondrial accumulation of cationic Atto520-biotin proceeds via voltage-dependent slow permeation through lipid membrane.

    PubMed

    Antonenko, Yuri N; Nechaeva, Natalya L; Baksheeva, Victoria E; Rokitskaya, Tatyana I; Plotnikov, Egor Y; Kotova, Elena A; Zorov, Dmitry B

    2015-06-01

    Conjugation to penetrating cations is a general approach for intramitochondrial delivery of physiologically active compounds, supported by a high membrane potential of mitochondria having negative sign on the matrix side. By using fluorescence correlation spectroscopy, we found here that Atto520-biotin, a conjugate of a fluorescent cationic rhodamine-based dye with the membrane-impermeable vitamin biotin, accumulated in energized mitochondria in contrast to biotin-rhodamine 110. The energy-dependent uptake of Atto520-biotin by mitochondria, being slower than that of the conventional mitochondrial dye tetramethyl-rhodamine ethyl ester, was enhanced by the hydrophobic anion tetraphenylborate (TPB). Atto520-biotin also exhibited accumulation in liposomes driven by membrane potential resulting from potassium ion gradient in the presence valinomycin. The induction of electrical current across planar bilayer lipid membrane by Atto520-biotin proved the ability of the compound to permeate through lipid membrane in a cationic form. Atto520-biotin stained mitochondria in a culture of L929 cells, and the staining was enhanced in the presence of TPB. Therefore, the fluorescent Atto520 moiety can serve as a vehicle for intramitochondrial delivery of hydrophilic drugs. Of importance for biotin-streptavidin technology, binding of Atto520-biotin to streptavidin was found to cause quenching of its fluorescence similar to the case of fluorescein-4-biotin.

  15. Post-translational cleavage of Hv1 in human sperm tunes pH- and voltage-dependent gating.

    PubMed

    Berger, Thomas K; Fußhöller, David M; Goodwin, Normann; Bönigk, Wolfgang; Müller, Astrid; Dokani Khesroshahi, Nasim; Brenker, Christoph; Wachten, Dagmar; Krause, Eberhard; Kaupp, U Benjamin; Strünker, Timo

    2017-03-01

    In human sperm, proton flux across the membrane is controlled by the voltage-gated proton channel Hv1. We show that sperm harbour both Hv1 and an N-terminally cleaved isoform termed Hv1Sper. The pH-control of Hv1Sper and Hv1 is distinctively different. Hv1Sper and Hv1 can form heterodimers that combine features of both constituents. Cleavage and heterodimerization of Hv1 might represent an adaptation to the specific requirements of pH control in sperm. In human sperm, the voltage-gated proton channel Hv1 controls the flux of protons across the flagellar membrane. Here, we show that sperm harbour Hv1 and a shorter isoform, termed Hv1Sper. Hv1Sper is generated from Hv1 by removal of 68 amino acids from the N-terminus by post-translational proteolytic cleavage. The pH-dependent gating of the channel isoforms is distinctly different. In both Hv1 and Hv1Sper, the conductance-voltage relationship is determined by the pH difference across the membrane (∆pH). However, simultaneous changes in intracellular and extracellular pH that leave ΔpH constant strongly shift the activation curve of Hv1Sper but not that of Hv1, demonstrating that cleavage of the N-terminus tunes pH sensing in Hv1. Moreover, we show that Hv1 and Hv1Sper assemble as heterodimers that combine features of both constituents. We suggest that cleavage and heterodimerization of Hv1 represents an adaptation to the specific requirements of pH control in sperm. © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.

  16. Multiple open channel states revealed by lidocaine and QX-314 on rat brain voltage-dependent sodium channels

    PubMed Central

    1996-01-01

    We have recently reported that brain sodium channels display periods with high (low-Kd) and low (high-Kd) levels of lidocaine-induced open channel block (Salazar, B.C., D.O. Flash, J.L. Walewski, and E. Recio- Pinto. 1995. Brain Res. 699:305-314). In the present study, we further characterize this phenomenon by studying the effects of the permanently charged lidocaine analogue, QX-314. We found that the detection of high- and low-Kd periods does not require the presence of the uncharged form of lidocaine. The level of block, for either period, at various QX-314 concentrations indicated the presence of a single local anesthetic binding site. Increasing the concentration of QX-314 decreased the lifetime of the high-Kd periods while it increased the lifetime of the low-Kd periods. These results could be best fitted to a model with two open channel conformations that display different local anesthetic Kd values (low and high Kd), and in which the channel area defining the local anesthetic Kd consists of multiple interacting regions. Amplitude distribution analysis showed that changes in the Kd values reflected changes in the kon rates, without changes in the koff rates. Both lidocaine and QX-314 were found to be incapable of blocking small- channel subconductance states (5-6 pS). Changes in the local anesthetic kon rates for blocking the fully open state and the lack of local anesthetic block of the small subconductance state are consistent with the presence of channel conformational changes involving the intracellular permeation pathway leading to the local anesthetic binding site. PMID:8783074

  17. Proton pump-driven cutaneous chloride uptake in anuran amphibia.

    PubMed

    Jensen, Lars Jørn; Willumsen, Niels Johannes; Amstrup, Jan; Larsen, Erik Hviid

    2003-12-30

    Krogh introduced the concept of active ion uptake across surface epithelia of freshwater animals, and proved independent transports of Na(+) and Cl(-) in anuran skin and fish gill. He suggested that the fluxes of Na(+) and Cl(-) involve exchanges with ions of similar charge. In the so-called Krogh model, Cl(-)/HCO(3)(-) and Na(+)/H(+) antiporters are located in the apical membrane of the osmoregulatory epithelium. More recent studies have shown that H(+) excretion in anuran skin is due to a V-ATPase in mitochondria-rich (MR) cells. The pump has been localized by immunostaining and H(+) fluxes estimated by pH-stat titration and mathematical modelling of pH-profiles in the unstirred layer on the external side of the epithelium. H(+) secretion is voltage-dependent, sensitive to carbonic-anhydrase inhibitors, and rheogenic with a charge/ion-flux ratio of unity. Cl(-) uptake from freshwater is saturating, voltage independent, and sensitive to DIDS and carbonic-anhydrase inhibitors. Depending on anuran species and probably on acid/base balance of the animal, apical exit of protons is coupled to an exchange of Cl(-) with base (HCO(3)(-)) either in the apical membrane (gamma-type of MR cell) or in the basolateral membrane (alpha-type MR cell). The gamma-cell model accounts for the rheogenic active uptake of Cl(-) observed in several anuran species. There is indirect evidence also for non-rheogenic active uptake accomplished by a beta-type MR cell with apical base secretion and basolateral proton pumping. Several studies have indicated that the transport modes of MR cells are regulated via ion- and acid/base balance of the animal, but the signalling mechanisms have not been investigated. Estimates of energy consumption by the H(+)-ATPase and the Na(+)/K(+)-ATPase indicate that the gamma-cell accomplishes uptake of NaCl in normal and diluted freshwater. Under common freshwater conditions with serosa-positive or zero V(t), the K(+) conductance of the basolateral membrane

  18. Chromosome banding in amphibia. XXIII. Giant W sex chromosomes and extremely small genomes in Eleutherodactylus euphronides and Eleutherodactylus shrevei (Anura, Leptodactylidae).

    PubMed

    Schmid, M; Feichtinger, W; Steinlein, C; Rupprecht, A; Haaf, T; Kaiser, H

    2002-01-01

    Highly differentiated, heteromorphic ZZ female symbol /ZW male symbol sex chromosomes were found in the karyotypes of the neotropical leptodactylid frogs Eleutherodactylus euphronides and E. shrevei. The W chromosomes are the largest heterochromatic, female-specific chromosomes so far discovered in the class Amphibia. The analyses of the banding patterns with AT- and GC base-pair specific fluorochromes show that the constitutive heterochromatin in the giant W chromosomes consists of various categories of repetitive DNA sequences. The W chromosomes of both species are similar in size, morphology and banding patterns, whereas their Z chromosomes exhibit conspicuous differences. In the cell nuclei of female animals, the W chromosomes form very prominent chromatin bodies (W chromatin). DNA flow cytometric measurements demonstrate clear differences in the DNA content of male and female erythrocytes caused by the giant W chromosome, and also shows that these Eleutherodactylus genomes are among the smallest of all amphibian genomes. The importance of the heteromorphic ZW sex chromosomes for the study of Z-linked genes, the similarities and differences of the two karyotypes, and the significance of the exceptionally small genomes are discussed.

  19. Time course and voltage dependence of expressed HERG current compared with native "rapid" delayed rectifier K current during the cardiac ventricular action potential.

    PubMed

    Hancox, J C; Levi, A J; Witchel, H J

    1998-11-01

    It is widely believed that HERG (human ether-a-go-go-related gene) encodes the major subunit of the cardiac "rapid" delayed rectifier K channel. The aims of the present study were threefold: (1) to record directly the time course and voltage dependence of expressed HERG current in a mammalian cell line, during an imposed ventricular action potential (AP); (2) to compare this with native rapid delayed rectifier current (IKr) elicited by applying an AP command to isolated guinea-pig ventricular myocytes; (3) to provide mechanistic information regarding the profile of HERG/IKr during the AP. We used the AP clamp technique and conventional whole-cell patch-clamp recordings at 32-34 degreesC. HERG was transiently expressed in Chinese hamster ovary (CHO) cells. There was an outward current in transfected CHO cells, which developed progressively during the AP plateau and slow repolarisation phase. The instantaneous current-voltage (I-V) relation for both leak-subtracted HERG current (n=10) and E-4031-sensitive current (n=6) during AP repolarisation was maximal between -30 mV and -40 mV. The conductance-voltage (G-V) relation was maximal at potentials between -60 and -75 mV. A similar voltage dependence for HERG current was observed during a descending ramp from +60 to -80 mV (n=5), but not during either an ascending ramp (n=5), or a reversed AP waveform (n=8). These data suggest that instantaneous HERG current during the AP does not depend on the instantaneous command voltage alone, but upon the previous voltages during the applied waveform. The time course of activation of HERG current at potentials near the AP plateau was rapid. Tail currents recorded on premature repolarisation at different time points in the AP showed directly that HERG also activates rapidly during the AP. The I-V profiles of fully activated HERG and of current during the AP were very similar. IKr from guinea-pig ventricular myocytes was measured as E-4031-sensitive current during the AP clamp

  20. Involvement of inositol 1,4,5-trisphosphate formation in the voltage-dependent regulation of the Ca(2+) concentration in porcine coronary arterial smooth muscle cells.

    PubMed

    Yamamura, Hisao; Ohya, Susumu; Muraki, Katsuhiko; Imaizumi, Yuji

    2012-08-01

    The involvement of inositol 1,4,5-trisphosphate (IP(3)) formation in the voltage-dependent regulation of intracellular Ca(2+) concentration ([Ca(2+)](i)) was examined in smooth muscle cells of the porcine coronary artery. Slow ramp depolarization from -90 to 0 mV induced progressive [Ca(2+)](i) increase. The slope was reduced or increased in the presence of Cd(2+) or (±)-1,4-dihydro-2,6-dimethyl-5-nitro-4-(2-[trifluoromethyl]-phenyl)pyridine-3-carboxlic acid methyl ester (Bay K 8644), respectively. The decrease in [Ca(2+)](i) via the membrane hyperpolarization induced by K(+) channel openers (levcromakalim and Evans blue) under current clamp was identical to that under voltage clamp. The step hyperpolarization from -40 to -80 mV reduced [Ca(2+)](i) uniformly over the whole-cell area with a time constant of ∼10 s. The [Ca(2+)](i) at either potential was unaffected by heparin, an inhibitor of IP(3) receptors. Alternatively, [Ca(2+)](i) rapidly increased in the peripheral regions by depolarization from -80 to 0 mV and stayed at that level (∼400 nM) during a 60-s pulse. When the pipette solution contained IP(3) pathway blockers [heparin, 2-aminoethoxydiphenylborate, xestospongin C, or 1-[6-[((17β)-3-methoxyestra-1,3,5[10]-trien-17-yl)amino]hexyl]-1H-pyrrole-2,5-dione (U73122)], the peak [Ca(2+)](i) was unchanged, but the sustained [Ca(2+)](i) was gradually reduced by ∼250 nM within 30 s. In the presence of Cd(2+), a long depolarization period slightly increased the [Ca(2+)](i), which was lower than that in the presence of heparin alone. In coronary arterial myocytes, the sustained increase in the [Ca(2+)](i) during depolarization was partly caused by the Ca(2+) release mediated by the enhanced formation of IP(3). The initial [Ca(2+)](i) elevation triggered by the Ca(2+) influx though voltage-dependent Ca(2+) channels may be predominantly responsible for the activation of phospholipase C for IP(3) formation.

  1. Direct modulation of the outer mitochondrial membrane channel, voltage-dependent anion channel 1 (VDAC1) by cannabidiol: a novel mechanism for cannabinoid-induced cell death

    PubMed Central

    Rimmerman, N; Ben-Hail, D; Porat, Z; Juknat, A; Kozela, E; Daniels, M P; Connelly, P S; Leishman, E; Bradshaw, H B; Shoshan-Barmatz, V; Vogel, Z

    2013-01-01

    Cannabidiol (CBD) is a non-psychoactive plant cannabinoid that inhibits cell proliferation and induces cell death of cancer cells and activated immune cells. It is not an agonist of the classical CB1/CB2 cannabinoid receptors and the mechanism by which it functions is unknown. Here, we studied the effects of CBD on various mitochondrial functions in BV-2 microglial cells. Our findings indicate that CBD treatment leads to a biphasic increase in intracellular calcium levels and to changes in mitochondrial function and morphology leading to cell death. Density gradient fractionation analysis by mass spectrometry and western blotting showed colocalization of CBD with protein markers of mitochondria. Single-channel recordings of the outer-mitochondrial membrane protein, the voltage-dependent anion channel 1 (VDAC1) functioning in cell energy, metabolic homeostasis and apoptosis revealed that CBD markedly decreases channel conductance. Finally, using microscale thermophoresis, we showed a direct interaction between purified fluorescently labeled VDAC1 and CBD. Thus, VDAC1 seems to serve as a novel mitochondrial target for CBD. The inhibition of VDAC1 by CBD may be responsible for the immunosuppressive and anticancer effects of CBD. PMID:24309936

  2. Glucocorticoid receptor activation lowers the threshold for NMDA-receptor-dependent homosynaptic long-term depression in the hippocampus through activation of voltage-dependent calcium channels.

    PubMed

    Coussens, C M; Kerr, D S; Abraham, W C

    1997-07-01

    The effects of the glucocorticoid receptor agonist RU-28362 on homosynaptic long-term depression (LTD) were examined in hippocampal slices obtained from adrenal-intact adult male rats. Field excitatory postsynaptic potentials were evoked by stimulation of the Schaffer collateral/commissural pathway and recorded in stratum radiatum of area CA1. Low-frequency stimulation (LFS) was delivered at LTD threshold (2 bouts of 600 pulses, 1 Hz, at baseline stimulation intensity). LFS of the Schaffer collaterals did not produce significant homosynaptic LTD in control slices. However, identical conditioning in the presence of the glucocorticoid receptor agonist RU-28362 (10 microM) produced a robust LTD, which was blocked by the selective glucocorticoid antagonist RU-38486. The LTD induced by glucocorticoid receptor activation was dependent on N-methyl-D-aspartate (NMDA) receptor activity, because the specific NMDA receptor antagonist D(-)-2-amino-5-phosphonopentanoic acid (D-AP5) blocked the facilitation. However, the facilitation of LTD was not due to a potentiation of the isolated NMDA receptor potential by RU-28362. The facilitation of LTD by RU-28362 was also blocked by coincubation of the L-type voltage-dependent calcium channel (VDCC) antagonist nimodipine. Selective activation of the L-type VDCCs by the agonist Bay K 8644 also facilitated LTD induction. Both nimodipine and D-AP5 were effective in blocking the facilitation of LTD by Bay K 8644. These results indicate that L-type VDCCs can contribute to NMDA-receptor-dependent LTD induction.

  3. Memory reconsolidation and its maintenance depend on L-voltage-dependent calcium channels and CaMKII functions regulating protein turnover in the hippocampus.

    PubMed

    Da Silva, Weber Cláudio; Cardoso, Gabriela; Bonini, Juliana Sartori; Benetti, Fernando; Izquierdo, Ivan

    2013-04-16

    Immediate postretrieval bilateral blockade of long-acting voltage-dependent calcium channels (L-VDCCs), but not of glutamatergic NMDA receptors, in the dorsal CA1 region of the hippocampus hinders retention of long-term spatial memory in the Morris water maze. Immediate postretrieval bilateral inhibition of calcium/calmodulin-dependent protein kinase (CaMK) II in dorsal CA1 does not affect retention of this task 24 h later but does hinder it 5 d later. These two distinct amnesic effects are abolished if protein degradation by proteasomes is inhibited concomitantly. These results indicate that spatial memory reconsolidation depends on the functionality of L-VDCC in dorsal CA1, that maintenance of subsequent reconsolidated memory trace depends on CaMKII, and these results also suggest that the role played by both L-VDCC and CaMKII is to promote the retrieval-dependent, synaptically localized enhancement of protein synthesis necessary to counteract a retrieval-dependent, synaptic-localized enhancement of protein degradation, which has been described as underlying the characteristic labilization of the memory trace triggered by retrieval. Thus, conceivably, L-VDCC and CaMKII would enhance activity-dependent localized protein renewal, which may account for the improvement of the long-term efficiency of the synapses responsible for the maintenance of reactivated long-term spatial memory.

  4. Forgetting of long-term memory requires activation of NMDA receptors, L-type voltage-dependent Ca2+ channels, and calcineurin

    PubMed Central

    Sachser, Ricardo Marcelo; Santana, Fabiana; Crestani, Ana Paula; Lunardi, Paula; Pedraza, Lizeth Katherine; Quillfeldt, Jorge Alberto; Hardt, Oliver; de Oliveira Alvares, Lucas

    2016-01-01

    In the past decades, the cellular and molecular mechanisms underlying memory consolidation, reconsolidation, and extinction have been well characterized. However, the neurobiological underpinnings of forgetting processes remain to be elucidated. Here we used behavioral, pharmacological and electrophysiological approaches to explore mechanisms controlling forgetting. We found that post-acquisition chronic inhibition of the N-methyl-D-aspartate receptor (NMDAR), L-type voltage-dependent Ca2+ channel (LVDCC), and protein phosphatase calcineurin (CaN), maintains long-term object location memory that otherwise would have been forgotten. We further show that NMDAR activation is necessary to induce forgetting of object recognition memory. Studying the role of NMDAR activation in the decay of the early phase of long-term potentiation (E-LTP) in the hippocampus, we found that ifenprodil infused 30 min after LTP induction in vivo blocks the decay of CA1-evoked postsynaptic plasticity, suggesting that GluN2B-containing NMDARs activation are critical to promote LTP decay. Taken together, these findings indicate that a well-regulated forgetting process, initiated by Ca2+ influx through LVDCCs and GluN2B-NMDARs followed by CaN activation, controls the maintenance of hippocampal LTP and long-term memories over time. PMID:26947131

  5. Modeling and measurement of vesicle pools at the cone ribbon synapse: Changes in release probability are solely responsible for voltage-dependent changes in release.

    PubMed

    Thoreson, Wallace B; Van Hook, Matthew J; Parmelee, Caitlyn; Curto, Carina

    2016-01-01

    Postsynaptic responses are a product of quantal amplitude (Q), size of the releasable vesicle pool (N), and release probability (P). Voltage-dependent changes in presynaptic Ca(2+) entry alter postsynaptic responses primarily by changing P but have also been shown to influence N. With simultaneous whole cell recordings from cone photoreceptors and horizontal cells in tiger salamander retinal slices, we measured N and P at cone ribbon synapses by using a train of depolarizing pulses to stimulate release and deplete the pool. We developed an analytical model that calculates the total pool size contributing to release under different stimulus conditions by taking into account the prior history of release and empirically determined properties of replenishment. The model provided a formula that calculates vesicle pool size from measurements of the initial postsynaptic response and limiting rate of release evoked by a train of pulses, the fraction of release sites available for replenishment, and the time constant for replenishment. Results of the model showed that weak and strong depolarizing stimuli evoked release with differing probabilities but the same size vesicle pool. Enhancing intraterminal Ca(2+) spread by lowering Ca(2+) buffering or applying BayK8644 did not increase PSCs evoked with strong test steps, showing there is a fixed upper limit to pool size. Together, these results suggest that light-evoked changes in cone membrane potential alter synaptic release solely by changing release probability.

  6. L-Type Voltage-Dependent Calcium Channel Currents of Cerebral Arterial Smooth Muscle Cells are Increased by 2-Week Hindlimb Unweighting in Rats

    NASA Astrophysics Data System (ADS)

    Tang, Hao; Xue, Jun-Hui; Bai, Yun-Gang; Xie, Man-Jiang; Bao, Jun-Xiang; Ma, Jin

    2008-06-01

    To investigate alterations of L-type voltage-dependent calcium channel (CaL) in cerebral vascular smooth muscle cells isolated from rats subjected to a two-week simulated weightlessness, and influence of Bay K 8644 (an agonist of CaL) to the channel currents. Tail-suspended rat model was used to simulate the effects of microgravity. Whole-cell patch-clamp technique was used to record CaL currents before and after Bay K 8644 treatment, with intracellular Ca2+ concentration maintained physiological level. The corresponding parameters such as steady state activation and inactivation curves were also recorded. Whole-cell CaL current densities increased obviously, and sensitivity of CaL to Bay K 8644 also increased in cerebral vascular smooth muscle cells from suspension group. But membrane capacitance (Cm), access resistance (Ra), and other parameters of CaL such as steady state activation / inactivation curves have no significant changes compared with those of control group. These results suggest that enhanced CaL function of cerebrovascular smooth muscle cells induced by simulated microgravity may be one of the electrophysiological mechanisms that mediate enhanced vasoreactivity of cerebrovascular smooth muscle cells during adaptation to simulated weightlessness in rats.

  7. Identification of mud crab reovirus VP12 and its interaction with the voltage-dependent anion-selective channel protein of mud crab Scylla paramamosain.

    PubMed

    Xu, Hai-Dong; Su, Hong-Jun; Zou, Wei-Bin; Liu, Shan-Shan; Yan, Wen-Rui; Wang, Qian-Qian; Yuan, Li-Li; Chan, Siuming Francis; Yu, Xiao-Qiang; He, Jian-Guo; Weng, Shao-Ping

    2015-05-01

    Mud crab reovirus (MCRV) is the causative agent of a severe disease in cultured mud crab (Scylla paramamosain), which has caused huge economic losses in China. MCRV is a double-stranded RNA virus with 12 genomic segments. In this paper, SDS-PAGE, mass spectrometry and Western blot analyses revealed that the VP12 protein encoded by S12 gene is a structural protein of MCRV. Immune electron microscopy assay indicated that MCRV VP12 is a component of MCRV outer shell capsid. Yeast two hybrid cDNA library of mud crab was constructed and mud crab voltage-dependent anion-selective channel (mcVDAC) was obtained by MCRV VP12 screening. The full length of mcVDAC was 1180 bp with an open reading frame (ORF) of 849 bp encoding a 282 amino acid protein. The mcVDAC had a constitutive expression pattern in different tissues of mud crab. The interaction between MCRV VP12 and mcVDAC was determined by co-immunoprecipitation assay. The results of this study have provided an insight on the mechanisms of MCRV infection and the interactions between the virus and mud crab. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Frequency and voltage-dependent electrical and dielectric properties of Al/Co-doped PVA/p-Si structures at room temperature

    NASA Astrophysics Data System (ADS)

    Ibrahim, Yücedağ; Ahmet, Kaya; Şemsettin, Altındal; Ibrahim, Uslu

    2014-04-01

    In order to investigate of cobalt-doped interfacial polyvinyl alcohol (PVA) layer and interface trap (Dit) effects, Al/p-Si Schottky barrier diodes (SBDs) are fabricated, and their electrical and dielectric properties are investigated at room temperature. The forward and reverse admittance measurements are carried out in the frequency and voltage ranges of 30 kHz-300 kHz and -5 V-6 V, respectively. C-V or ɛ'-V plots exhibit two distinct peaks corresponding to inversion and accumulation regions. The first peak is attributed to the existence of Dit, the other to the series resistance (Rs), and interfacial layer. Both the real and imaginary parts of dielectric constant (ɛ' and ɛ″) and electric modulus (M' and M″), loss tangent (tan δ), and AC electrical conductivity (σac) are investigated, each as a function of frequency and applied bias voltage. Each of the M' versus V and M″ versus V plots shows a peak and the magnitude of peak increases with the increasing of frequency. Especially due to the Dit and interfacial PVA layer, both capacitance (C) and conductance (G/w) values are strongly affected, which consequently contributes to deviation from both the electrical and dielectric properties of Al/Co-doped PVA/p-Si (MPS) type SBD. In addition, the voltage-dependent profile of Dit is obtained from the low-high frequency capacitance (CLF-CHF) method.

  9. Restricted ADP movement in cardiomyocytes: Cytosolic diffusion obstacles are complemented with a small number of open mitochondrial voltage-dependent anion channels.

    PubMed

    Simson, Päivo; Jepihhina, Natalja; Laasmaa, Martin; Peterson, Pearu; Birkedal, Rikke; Vendelin, Marko

    2016-08-01

    Adequate intracellular energy transfer is crucial for proper cardiac function. In energy starved failing hearts, partial restoration of energy transfer can rescue mechanical performance. There are two types of diffusion obstacles that interfere with energy transfer from mitochondria to ATPases: mitochondrial outer membrane (MOM) with voltage-dependent anion channel (VDAC) permeable to small hydrophilic molecules and cytoplasmatic diffusion barriers grouping ATP-producers and -consumers. So far, there is no method developed to clearly distinguish the contributions of cytoplasmatic barriers and MOM to the overall diffusion restriction. Furthermore, the number of open VDACs in vivo remains unknown. The aim of this work was to establish the partitioning of intracellular diffusion obstacles in cardiomyocytes. We studied the response of mitochondrial oxidative phosphorylation of permeabilized rat cardiomyocytes to changes in extracellular ADP by recording 3D image stacks of NADH autofluorescence. Using cell-specific mathematical models, we determined the permeability of MOM and cytoplasmatic barriers. We found that only ~2% of VDACs are accessible to cytosolic ADP and cytoplasmatic diffusion barriers reduce the apparent diffusion coefficient by 6-10×. In cardiomyocytes, diffusion barriers in the cytoplasm and by the MOM restrict ADP/ATP diffusion to similar extents suggesting a major role of both barriers in energy transfer and other intracellular processes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Distinct roles of L- and T-type voltage-dependent Ca2+ channels in regulation of lymphatic vessel contractile activity

    PubMed Central

    Lee, Stewart; Roizes, Simon; von der Weid, Pierre-Yves

    2014-01-01

    Lymph drainage maintains tissue fluid homeostasis and facilitates immune response. It is promoted by phasic contractions of collecting lymphatic vessels through which lymph is propelled back into the blood circulation. This rhythmic contractile activity (i.e. lymphatic pumping) increases in rate with increase in luminal pressure and relies on activation of nifedipine-sensitive voltage-dependent Ca2+ channels (VDCCs). Despite their importance, these channels have not been characterized in lymphatic vessels. We used pressure- and wire-myography as well as intracellular microelectrode electrophysiology to characterize the pharmacological and electrophysiological properties of L-type and T-type VDCCs in rat mesenteric lymphatic vessels and evaluated their particular role in the regulation of lymphatic pumping by stretch. We complemented our study with PCR and confocal immunofluorescence imaging to investigate the expression and localization of these channels in lymphatic vessels. Our data suggest a delineating role of VDCCs in stretch-induced lymphatic vessel contractions, as the stretch-induced increase in force of lymphatic vessel contractions was significantly attenuated in the presence of L-type VDCC blockers nifedipine and diltiazem, while the stretch-induced increase in contraction frequency was significantly decreased by the T-type VDCC blockers mibefradil and nickel. The latter effect was correlated with a hyperpolarization. We propose that activation of T-type VDCCs depolarizes membrane potential, regulating the frequency of lymphatic contractions via opening of L-type VDCCs, which drive the strength of contractions. PMID:25326448

  11. Forgetting of long-term memory requires activation of NMDA receptors, L-type voltage-dependent Ca2+ channels, and calcineurin.

    PubMed

    Sachser, Ricardo Marcelo; Santana, Fabiana; Crestani, Ana Paula; Lunardi, Paula; Pedraza, Lizeth Katherine; Quillfeldt, Jorge Alberto; Hardt, Oliver; Alvares, Lucas de Oliveira

    2016-03-07

    In the past decades, the cellular and molecular mechanisms underlying memory consolidation, reconsolidation, and extinction have been well characterized. However, the neurobiological underpinnings of forgetting processes remain to be elucidated. Here we used behavioral, pharmacological and electrophysiological approaches to explore mechanisms controlling forgetting. We found that post-acquisition chronic inhibition of the N-methyl-D-aspartate receptor (NMDAR), L-type voltage-dependent Ca(2+) channel (LVDCC), and protein phosphatase calcineurin (CaN), maintains long-term object location memory that otherwise would have been forgotten. We further show that NMDAR activation is necessary to induce forgetting of object recognition memory. Studying the role of NMDAR activation in the decay of the early phase of long-term potentiation (E-LTP) in the hippocampus, we found that ifenprodil infused 30 min after LTP induction in vivo blocks the decay of CA1-evoked postsynaptic plasticity, suggesting that GluN2B-containing NMDARs activation are critical to promote LTP decay. Taken together, these findings indicate that a well-regulated forgetting process, initiated by Ca(2+) influx through LVDCCs and GluN2B-NMDARs followed by CaN activation, controls the maintenance of hippocampal LTP and long-term memories over time.

  12. The class III anti-arrhythmic agent, amiodarone, inhibits voltage-dependent K(+) channels in rabbit coronary arterial smooth muscle cells.

    PubMed

    Li, Hongliang; Kim, Han Sol; Kim, Hye Won; Shin, Sung Eun; Jung, Won-Kyo; Ha, Kwon-Soo; Han, Eun-Taek; Hong, Seok-Ho; Firth, Amy L; Bae, Young Min; Choi, Il-Whan; Park, Won Sun

    2016-07-01

    We examined the inhibitory effect of amiodarone, a class III anti-arrhythmic agent, on voltage-dependent K(+) (Kv) currents in freshly isolated rabbit coronary arterial smooth muscle cells, using a whole-cell patch clamp technique. Amiodarone inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC50) value of 3.9 ± 1.44 μM and a Hill coefficient of 0.45 ± 0.14. Amiodarone did not have a significant effect on the steady-state activation of Kv channels, but shifted the inactivation current toward a more negative potential. Application of consecutive pulses progressively augmented the amiodarone-induced Kv channel inhibition. Another class III anti-arrhythmic agent, dofetilide, did not inhibit the Kv current or change the inhibitory effect of amiodarone on Kv channels. Therefore, these results strongly suggest that amiodarone inhibits Kv currents in a concentration- and state-dependent manner.

  13. Cisapride, a selective serotonin 5-HT4-receptor agonist, inhibits voltage-dependent K(+) channels in rabbit coronary arterial smooth muscle cells.

    PubMed

    Kim, Hye Won; Li, Hongliang; Kim, Han Sol; Shin, Sung Eun; Jung, Won-Kyo; Ha, Kwon-Soo; Han, Eun-Taek; Hong, Seok-Ho; Choi, Il-Whan; Park, Won Sun

    2016-09-23

    We investigated the effect of cisapride, a selective serotonin 5-HT4-receptor agonist, on voltage-dependent K(+) (Kv) channels using freshly isolated smooth muscle cells from the coronary arteries of rabbits. The amplitude of Kv currents was reduced by cisapride in a concentration-dependent manner, with an IC50 value of 6.77 ± 6.01 μM and a Hill coefficient of 0.51 ± 0.18. The application of cisapride shifted the steady-state inactivation curve toward a more negative potential, but had no significant effect on the steady-state activation curve. This suggested that cisapride inhibited the Kv channel in a closed state by changing the voltage sensitivity of Kv channels. The application of another selective serotonin 5-HT4-receptor agonist, prucalopride, did not affect the basal Kv current and did not alter the inhibitory effect of cisapride on Kv channels. From these results, we concluded that cisapride inhibited vascular Kv current in a concentration-dependent manner by shifting the steady-state inactivation curve, independent of its own function as a selective serotonin 5-HT4-receptor agonist. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Direct modulation of the outer mitochondrial membrane channel, voltage-dependent anion channel 1 (VDAC1) by cannabidiol: a novel mechanism for cannabinoid-induced cell death.

    PubMed

    Rimmerman, N; Ben-Hail, D; Porat, Z; Juknat, A; Kozela, E; Daniels, M P; Connelly, P S; Leishman, E; Bradshaw, H B; Shoshan-Barmatz, V; Vogel, Z

    2013-12-05

    Cannabidiol (CBD) is a non-psychoactive plant cannabinoid that inhibits cell proliferation and induces cell death of cancer cells and activated immune cells. It is not an agonist of the classical CB1/CB2 cannabinoid receptors and the mechanism by which it functions is unknown. Here, we studied the effects of CBD on various mitochondrial functions in BV-2 microglial cells. Our findings indicate that CBD treatment leads to a biphasic increase in intracellular calcium levels and to changes in mitochondrial function and morphology leading to cell death. Density gradient fractionation analysis by mass spectrometry and western blotting showed colocalization of CBD with protein markers of mitochondria. Single-channel recordings of the outer-mitochondrial membrane protein, the voltage-dependent anion channel 1 (VDAC1) functioning in cell energy, metabolic homeostasis and apoptosis revealed that CBD markedly decreases channel conductance. Finally, using microscale thermophoresis, we showed a direct interaction between purified fluorescently labeled VDAC1 and CBD. Thus, VDAC1 seems to serve as a novel mitochondrial target for CBD. The inhibition of VDAC1 by CBD may be responsible for the immunosuppressive and anticancer effects of CBD.

  15. Functional Apical Large Conductance, Ca2+-activated, and Voltage-dependent K+ Channels Are Required for Maintenance of Airway Surface Liquid Volume*

    PubMed Central

    Manzanares, Dahis; Gonzalez, Carlos; Ivonnet, Pedro; Chen, Ren-Shiang; Valencia-Gattas, Monica; Conner, Gregory E.; Larsson, H. Peter; Salathe, Matthias

    2011-01-01

    Large conductance, Ca2+-activated, and voltage-dependent K+ (BK) channels control a variety of physiological processes in nervous, muscular, and renal epithelial tissues. In bronchial airway epithelia, extracellular ATP-mediated, apical increases in intracellular Ca2+ are important signals for ion movement through the apical membrane and regulation of water secretion. Although other, mainly basolaterally expressed K+ channels are recognized as modulators of ion transport in airway epithelial cells, the role of BK in this process, especially as a regulator of airway surface liquid volume, has not been examined. Using patch clamp and Ussing chamber approaches, this study reveals that BK channels are present and functional at the apical membrane of airway epithelial cells. BK channels open in response to ATP stimulation at the apical membrane and allow K+ flux to the airway surface liquid, whereas no functional BK channels were found basolaterally. Ion transport modeling supports the notion that apically expressed BK channels are part of an apical loop current, favoring apical Cl− efflux. Importantly, apical BK channels were found to be critical for the maintenance of adequate airway surface liquid volume because continuous inhibition of BK channels or knockdown of KCNMA1, the gene coding for the BK α subunit (KCNMA1), lead to airway surface dehydration and thus periciliary fluid height collapse revealed by low ciliary beat frequency that could be fully rescued by addition of apical fluid. Thus, apical BK channels play an important, previously unrecognized role in maintaining adequate airway surface hydration. PMID:21454692

  16. Modeling and measurement of vesicle pools at the cone ribbon synapse: changes in release probability are solely responsible for voltage-dependent changes in release

    PubMed Central

    Thoreson, Wallace B.; Van Hook, Matthew J.; Parmelee, Caitlyn; Curto, Carina

    2015-01-01

    Post-synaptic responses are a product of quantal amplitude (Q), size of the releasable vesicle pool (N), and release probability (P). Voltage-dependent changes in presynaptic Ca2+ entry alter post-synaptic responses primarily by changing P but have also been shown to influence N. With simultaneous whole cell recordings from cone photoreceptors and horizontal cells in tiger salamander retinal slices, we measured N and P at cone ribbon synapses by using a train of depolarizing pulses to stimulate release and deplete the pool. We developed an analytical model that calculates the total pool size contributing to release under different stimulus conditions by taking into account the prior history of release and empirically-determined properties of replenishment. The model provided a formula that calculates vesicle pool size from measurements of the initial post-synaptic response and limiting rate of release evoked by a train of pulses, the fraction of release sites available for replenishment, and the time constant for replenishment. Results of the model showed that weak and strong depolarizing stimuli evoked release with differing probabilities but the same size vesicle pool. Enhancing intraterminal Ca2+ spread by lowering Ca2+ buffering or applying BayK8644 did not increase PSCs evoked with strong test steps showing there is a fixed upper limit to pool size. Together, these results suggest that light-evoked changes in cone membrane potential alter synaptic release solely by changing release probability. PMID:26541100

  17. α-Synuclein Shows High Affinity Interaction with Voltage-dependent Anion Channel, Suggesting Mechanisms of Mitochondrial Regulation and Toxicity in Parkinson Disease.

    PubMed

    Rostovtseva, Tatiana K; Gurnev, Philip A; Protchenko, Olga; Hoogerheide, David P; Yap, Thai Leong; Philpott, Caroline C; Lee, Jennifer C; Bezrukov, Sergey M

    2015-07-24

    Participation of the small, intrinsically disordered protein α-synuclein (α-syn) in Parkinson disease (PD) pathogenesis has been well documented. Although recent research demonstrates the involvement of α-syn in mitochondrial dysfunction in neurodegeneration and suggests direct interaction of α-syn with mitochondria, the molecular mechanism(s) of α-syn toxicity and its effect on neuronal mitochondria remain vague. Here we report that at nanomolar concentrations, α-syn reversibly blocks the voltage-dependent anion channel (VDAC), the major channel of the mitochondrial outer membrane that controls most of the metabolite fluxes in and out of the mitochondria. Detailed analysis of the blockage kinetics of VDAC reconstituted into planar lipid membranes suggests that α-syn is able to translocate through the channel and thus target complexes of the mitochondrial respiratory chain in the inner mitochondrial membrane. Supporting our in vitro experiments, a yeast model of PD shows that α-syn toxicity in yeast depends on VDAC. The functional interactions between VDAC and α-syn, revealed by the present study, point toward the long sought after physiological and pathophysiological roles for monomeric α-syn in PD and in other α-synucleinopathies.

  18. Ca2+ channel inhibitor NNC 55-0396 inhibits voltage-dependent K+ channels in rabbit coronary arterial smooth muscle cells.

    PubMed

    Son, Youn Kyoung; Hong, Da Hye; Li, Hongliang; Kim, Dae-Joong; Na, Sung Hun; Park, Hongzoo; Jung, Won-Kyo; Choi, Il-Whan; Park, Won Sun

    2014-01-01

    We demonstrated the inhibitory effect of NNC 55-0396, a T-type Ca(2+) channel inhibitor, on voltage-dependent K(+) (K(V)) channels in freshly isolated rabbit coronary arterial smooth muscle cells. NNC 55-0396 decreased the amplitude of K(V) currents in a concentration-dependent manner, with an IC(50) of 0.080 μM and a Hill coefficient of 0.76.NNC 55-0396 did not affect steady-state activation and inactivation curves, indicating that the compound does not affect the voltage sensitivity of K(V) channel gating. Both the K(V) currents and the inhibitory effect of NNC 55-0396 on K(V) channels were not altered by depletion of extracellular Ca(2+) or intracellular ATP, suggesting that the inhibitory effect of NNC 55-0396 is independent of Ca(2+)-channel activity and phosphorylation-dependent signaling cascades. From these results, we concluded that NNC 55-0396 dosedependently inhibits K(V) currents, independently of Ca(2+)-channel activity and intracellular signaling cascades.

  19. A Single Talent Immunogenic Membrane Antigen and Novel Prognostic Predictor: voltage-dependent anion channel 1 (VDAC1) in Pancreatic Cancer

    PubMed Central

    Wang, Weibin; Zhang, Taiping; Zhao, Wenjing; Xu, Lai; Yang, Yu; Liao, Quan; Zhao, Yupei

    2016-01-01

    Immunogenic membrane antigens associated with multiple biological functions of human cancer cells, have significant value in molecule diagnosis and targeted therapy. Here we screened immunogenic membrane antigens in pancreatic cancer by immunobloting IgG purified from sera of 66 pancreatic cancer patients with membrane proteins separated from two-dimensional PAGE of human pancreatic cancer cell line SWl990, and identified voltage-dependent anion channel 1 (VDAC1) as one of the potential immunogenic membrane antigens. Further studies focusing on VDAC1 demonstrated that VDAC1 mRNA and protein were significantly expressed in the tested pancreatic cancer cell lines. VDAC1 silencing with RNAi significantly decreased cell growth, invasion and migration in the pancreatic cancer cell line Capan-1. Additionally, VDAC1 expression was upregulated in pancreatic cancer tissue compared with normal pancreas samples and patients with low VDAC1 expression had a significantly greater median survival compared to those with high expression (27.0 months vs. 17.8 months, P = 0.039). In multivariable analysis, VDAC1 staining was an independent prognostic factor for survival [(Hazard-Ratio) HR = 1.544, 95% CI = 0.794–3.0, P = 0.021]. These results demonstrated that VDAC1 may be a candidate immunogenic membrane antigen for pancreatic cancer, a potential independent prognostic marker, and an ideal drug target. PMID:27659305

  20. Correlation between Barrier Width, Barrier Height, and DC Bias Voltage Dependences on the Magnetoresistance Ratio in Ir-Mn Exchange Biased Single and Double Tunnel Junctions

    NASA Astrophysics Data System (ADS)

    Saito, Yoshiaki; Amano, Minoru; Nakajima, Kentaro; Takahashi, Shigeki; Sagoi, Masayuki; Inomata, Koichiro

    2000-10-01

    Dual spin-valve-type double tunnel junctions (DTJs) of Ir-Mn/CoFe/AlOx/Co90Fe10/AlOx/CoFe/Ir-Mn and spin-valve-type single tunnel junctions (STJs) of Ir-Mn/CoFe/AlOx/CoFe/Ni-Fe were fabricated using an ultrahigh vacuum sputtering system, conventional photolithography and ion-beam milling. The STJs could be fabricated with various barrier heights by changing the oxidization conditions during deposition and changing the annealing temperature after deposition, while the AlOx layer thickness remained unchanged. There was a correlation between barrier width, height estimated using Simmons’ expressions, and dc bias voltage dependence on the MR ratio. The VB dependence on the tunneling magnetoresistance (TMR) ratio was mainly related to the barrier width, and the decrease in the TMR ratio with increasing bias voltage is well explained, taking into account the spin-independent two-step tunneling via defect states in the barrier, as a main mechanism, at room temperature. Under optimized oxidization and annealing conditions, the maximum TMR ratio at a low bias voltage, and the dc bias voltage value at which the TMR ratio decreases in value by half (V1/2) were 42.4% and 952 mV in DTJs, and 49.0% and 425 mV in STJs, respectively.

  1. A slow voltage-dependent Na(+)-current induced by 5-hydroxytryptamine and the G-protein-coupled activation mechanism in the ganglion cells of Aplysia.

    PubMed

    Kudo, A; Sasaki, K; Tamazawa, Y; Matsumoto, M

    1991-01-01

    Application of 5-hydroxytryptamine (5HT) induces a slowly depolarizing response in the neurons of Aplysia abdominal ganglion. In voltage-clamped cells, 5HT induced a slow inward current that increased steeply with membrane depolarization from -85 mV showing a negative slope conductance, but never reversed into outward when hyperpolarized beyond the equilibrium potential for K+. The 5HT-induced response was markedly augmented in Ca(2+)-free media, but depressed in Na(+)-free media, and unaffected by a change in external potassium. Intracellular injection of guanosine 5'-O-(2-thiodiphosphate) (GDP beta S) significantly depressed the 5HT response in a dose-dependent way. Injection of cholera toxin (CTX) selectively blocked the 5HT-induced response, the effect being irreversible. Neither 3'-deoxyadenosine, an inhibitor of adenylate cyclase, nor H-8, an inhibitor of protein kinase A, depressed the 5HT response. 3-Isobutyl-1-methylxanthine (IBMX) did not augment the 5HT response appreciably. The 5HT responses were not depressed at all during a saturated response to Br-cyclic AMP injected intracellularly. It was concluded that the 5HT response is produced by opening of the voltage-dependent Na(+)-channels with activation of CTX-sensitive G-protein but not necessarily with an increase in intracellular cyclic AMP.

  2. L-type voltage-dependent calcium channel is involved in the snake venom group IA secretory phospholipase A2-induced neuronal apoptosis.

    PubMed

    Yagami, Tatsurou; Yamamoto, Yasuhiro; Kohma, Hiromi; Nakamura, Tsutomu; Takasu, Nobuo; Okamura, Noboru

    2013-03-01

    Snake venom group IA secretory phospholipase A2 (sPLA2-IA) is known as a neurotoxin. Snake venom sPLA2s are neurotoxic in vivo and in vitro, causing synergistic neurotoxicity to cortical cultures when applied with toxic concentrations of glutamate. However, it has not yet been cleared sufficiently how sPLA2-IA exerts neurotoxicity. Here, we found sPLA2-IA induced neuronal cell death in a concentration-dependent manner. This death was a delayed response requiring a latent time for 6h. sPLA2-IA-induced neuronal cell death was accompanied with apoptotic blebbing, condensed chromatin, and fragmented DNA, exhibiting apoptotic features. NMDA receptor blockers suppressed the neurotoxicity of sPLA2-IA, but an AMPA receptor blocker did not. Interestingly, L-type voltage-dependent Ca(2+) channel (L-VDCC) blocker significantly protected neurons from the sPLA2-IA-induced apoptosis. On the other hand, neither N-VDCC blockers nor P/Q-VDCC blocker did. In conclusion, we demonstrated that sPLA2-IA induced neuronal cell death via apoptosis. Furthermore, the present study suggests that not only NMDA receptor but also L-VDCC contributed to the neurotoxicity of snake venom sPLA2-IA.

  3. Frequency and voltage dependence dielectric properties, ac electrical conductivity and electric modulus profiles in Al/Co3O4-PVA/p-Si structures

    NASA Astrophysics Data System (ADS)

    Bilkan, Çiğdem; Azizian-Kalandaragh, Yashar; Altındal, Şemsettin; Shokrani-Havigh, Roya

    2016-11-01

    In this research a simple microwave-assisted method have been used for preparation of cobalt oxide nanostructures. The as-prepared sample has been investigated by UV-vis spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM). On the other hand, frequency and voltage dependence of both the real and imaginary parts of dielectric constants (ε‧, ε″) and electric modulus (M‧ and M″), loss tangent (tanδ), and ac electrical conductivity (σac) values of Al/Co3O4-PVA/p-Si structures were obtained in the wide range of frequency and voltage using capacitance (C) and conductance (G/ω) data at room temperature. The values of ε‧, ε″ and tanδ were found to decrease with increasing frequency almost for each applied bias voltage, but the changes in these parameters become more effective in the depletion region at low frequencies due to the charges at surface states and their relaxation time and polarization effect. While the value of σ is almost constant at low frequency, increases almost as exponentially at high frequency which are corresponding to σdc and σac, respectively. The M‧ and M″ have low values at low frequencies region and then an increase with frequency due to short-range mobility of charge carriers. While the value of M‧ increase with increasing frequency, the value of M″ shows two peak and the peaks positions shifts to higher frequency with increasing applied voltage due to the decrease of the polarization and Nss effects with increasing frequency.

  4. Phosphorylation of rat brain purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal kinase-3 modifies open-channel noise.

    PubMed

    Gupta, Rajeev

    2017-09-02

    The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value < 0.5 for JNK3 phosphorylated VDAC at both positive and negative voltage. It is proposed that 1/f(1) power law in native VDAC open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Mitochondria-associated endoplasmic reticulum membrane (MAM) regulates steroidogenic activity via steroidogenic acute regulatory protein (StAR)-voltage-dependent anion channel 2 (VDAC2) interaction.

    PubMed

    Prasad, Manoj; Kaur, Jasmeet; Pawlak, Kevin J; Bose, Mahuya; Whittal, Randy M; Bose, Himangshu S

    2015-01-30

    Steroid hormones are essential for carbohydrate metabolism, stress management, and reproduction and are synthesized from cholesterol in mitochondria of adrenal glands and gonads/ovaries. In acute stress or hormonal stimulation, steroidogenic acute regulatory protein (StAR) transports substrate cholesterol into the mitochondria for steroidogenesis by an unknown mechanism. Here, we report for the first time that StAR interacts with voltage-dependent anion channel 2 (VDAC2) at the mitochondria-associated endoplasmic reticulum membrane (MAM) prior to its translocation to the mitochondrial matrix. In the MAM, StAR interacts with mitochondrial proteins Tom22 and VDAC2. However, Tom22 knockdown by siRNA had no effect on pregnenolone synthesis. In the absence of VDAC2, StAR was expressed but not processed into the mitochondria as a mature 30-kDa protein. VDAC2 interacted with StAR via its C-terminal 20 amino acids and N-terminal amino acids 221-229, regulating the mitochondrial processing of StAR into the mature protein. In the absence of VDAC2, StAR could not enter the mitochondria or interact with MAM-associated proteins, and therefore steroidogenesis was inhibited. Furthermore, the N terminus was not essential for StAR activity, and the N-terminal deletion mutant continued to interact with VDAC2. The endoplasmic reticulum-targeting prolactin signal sequence did not affect StAR association with the MAM and thus its mitochondrial targeting. Therefore, VDAC2 controls StAR processing and activity, and MAM is thus a central location for initiating mitochondrial steroidogenesis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. The episodic ataxia type 1 mutation I262T alters voltage-dependent gating and disrupts protein biosynthesis of human Kv1.1 potassium channels.

    PubMed

    Chen, Szu-Han; Fu, Ssu-Ju; Huang, Jing-Jia; Tang, Chih-Yung

    2016-01-18

    Voltage-gated potassium (Kv) channels are essential for setting neuronal membrane excitability. Mutations in human Kv1.1 channels are linked to episodic ataxia type 1 (EA1). The EA1-associated mutation I262T was identified from a patient with atypical phenotypes. Although a previous report has characterized its suppression effect, several key questions regarding the impact of the I262T mutation on Kv1.1 as well as other members of the Kv1 subfamily remain unanswered. Herein we show that the dominant-negative effect of I262T on Kv1.1 current expression is not reversed by co-expression with Kvβ1.1 or Kvβ2 subunits. Biochemical examinations indicate that I262T displays enhanced protein degradation and impedes membrane trafficking of Kv1.1 wild-type subunits. I262T appears to be the first EA1 mutation directly associated with impaired protein stability. Further functional analyses demonstrate that I262T changes the voltage-dependent activation and Kvβ1.1-mediated inactivation, uncouples inactivation from activation gating, and decelerates the kinetics of cumulative inactivation of Kv1.1 channels. I262T also exerts similar dominant effects on the gating of Kv1.2 and Kv1.4 channels. Together our data suggest that I262T confers altered channel gating and reduced functional expression of Kv1 channels, which may account for some of the phenotypes of the EA1 patient.

  7. The adenylyl cyclase inhibitor MDL-12,330A potentiates insulin secretion via blockade of voltage-dependent K(+) channels in pancreatic beta cells.

    PubMed

    Li, Xiaodong; Guo, Qing; Gao, Jingying; Yang, Jing; Zhang, Wan; Liang, Yueqin; Wu, Dongmei; Liu, Yunfeng; Weng, Jianping; Li, Qingshan; Zhang, Yi

    2013-01-01

    Adenylyl cyclases (ACs) play important role in regulating pancreatic beta cell growth, survival and secretion through the synthesis of cyclic AMP (cAMP). MDL-12,330A and SQ 22536 are two AC inhibitors used widely to establish the role of ACs. The goal of this study was to examine the effects of MDL-12,330A and SQ 22536 on insulin secretion and underlying mechanisms. Patch-clamp recording, Ca(2+) fluorescence imaging and radioimmunoassay were used to measure outward K(+) currents, action potentials (APs), intracellular Ca(2+) ([Ca(2+)]i) and insulin secretion from rat pancreatic beta cells. MDL-12,330A (10 µmol/l) potentiated insulin secretion to 1.7 times of control in the presence of 8.3 mmol/l glucose, while SQ 22536 did not show significant effect on insulin secretion. MDL-12,330A prolonged AP durations (APDs) by inhibiting voltage-dependent K(+) (KV) channels, leading to an increase in [Ca(2+)]i levels. It appeared that these effects induced by MDL-12,330A did not result from AC inhibition, since SQ 22536 did not show such effects. Furthermore, inhibition of the downstream effectors of AC/cAMP signaling by PKA inhibitor H89 and Epac inhibitor ESI-09, did not affect KV channels and insulin secretion. The putative AC inhibitor MDL-12,330A enhances [Ca(2+)]i and insulin secretion via inhibition of KV channels rather than AC antagonism in beta cells, suggesting that the non-specific effects is needed to be considered for the right interpretation of the experimental results using this agent in the analyses of the role of AC in cell function.

  8. Calcium-activated potassium channels in the luminal membrane of Amphiuma diluting segment: voltage-dependent block by intracellular Na+ upon depolarisation.

    PubMed

    Kawahara, K; Hunter, M; Giebisch, G

    1990-06-01

    Calcium-activated potassium channels in the luminal membrane of Amphiuma diluting segment were studied using the patch-clamp technique in both the cell-attached and inside-out configurations. The open probability (Po) of the channel is sensitive to both membrane potential and cytoplasmic calcium activity; depolarizing potentials and high calcium concentrations leading to an increased Po. In the cell-attached condition, channel openings were observed between pipette potentials of -100 and -240 mV. As the driving force for potassium exit from the cell into the pipette is increased the single channel currents show a biphasic response. First, the currents increase as expected; however, the single channel currents diminish in magnitude at pipette potentials more negative than -120 mV. We propose that this reduction is due to rapid blockade of the potassium channel by intracellular sodium. This proposal is supported by two facts: (a) using inside-out patches it was possible to reduce the single channel currents in a concentration- and voltage-dependent manner, similar to that observed in the cell-attached condition, by raising the sodium concentration of the fluid bathing the cytoplasmic face of the patch; (b) pretreatment of tubules with the loop-acting diuretic furosemide (10(-5) M), an agent known to decrease the intracellular sodium activity, caused an attenuation of the reduction in single channel current seen under control conditions. Given the very low Po of the channels at the resting membrane potential and the sensitivity of the channels to intracellular sodium, it is unlikely that blockade of these channels by intracellular sodium would lead to a physiological regulation of the apical K conductance.

  9. The N-Terminal Peptides of the Three Human Isoforms of the Mitochondrial Voltage-Dependent Anion Channel Have Different Helical Propensities.

    PubMed

    Guardiani, Carlo; Scorciapino, Mariano Andrea; Amodeo, Giuseppe Federico; Grdadolnik, Joze; Pappalardo, Giuseppe; De Pinto, Vito; Ceccarelli, Matteo; Casu, Mariano

    2015-09-15

    The voltage-dependent anion channel (VDAC) is the main mitochondrial porin allowing the exchange of ions and metabolites between the cytosol and the mitochondrion. In addition, VDAC was found to actively interact with proteins playing a fundamental role in the regulation of apoptosis and being of central interest in cancer research. VDAC is a large transmembrane β-barrel channel, whose N-terminal helical fragment adheres to the channel interior, partially closing the pore. This fragment is considered to play a key role in protein stability and function as well as in the interaction with apoptosis-related proteins. Three VDAC isoforms are differently expressed in higher eukaryotes, for which distinct and complementary roles are proposed. In this work, the folding propensity of their N-terminal fragments has been compared. By using multiple spectroscopic techniques, and complementing the experimental results with theoretical computer-assisted approaches, we have characterized their conformational equilibrium. Significant differences were found in the intrinsic helical propensity of the three peptides, decreasing in the following order: hVDAC2 > hVDAC3 > hVDAC1. In light of the models proposed in the literature to explain voltage gating, selectivity, and permeability, as well as interactions with functionally related proteins, our results suggest that the different chemicophysical properties of the N-terminal domain are possibly correlated to different functions for the three isoforms. The overall emerging picture is that a similar transmembrane water accessible conduit has been equipped with not identical domains, whose differences can modulate the functional roles of the three VDAC isoforms.

  10. The episodic ataxia type 1 mutation I262T alters voltage-dependent gating and disrupts protein biosynthesis of human Kv1.1 potassium channels

    PubMed Central

    Chen, Szu-Han; Fu, Ssu-Ju; Huang, Jing-Jia; Tang, Chih-Yung

    2016-01-01

    Voltage-gated potassium (Kv) channels are essential for setting neuronal membrane excitability. Mutations in human Kv1.1 channels are linked to episodic ataxia type 1 (EA1). The EA1-associated mutation I262T was identified from a patient with atypical phenotypes. Although a previous report has characterized its suppression effect, several key questions regarding the impact of the I262T mutation on Kv1.1 as well as other members of the Kv1 subfamily remain unanswered. Herein we show that the dominant-negative effect of I262T on Kv1.1 current expression is not reversed by co-expression with Kvβ1.1 or Kvβ2 subunits. Biochemical examinations indicate that I262T displays enhanced protein degradation and impedes membrane trafficking of Kv1.1 wild-type subunits. I262T appears to be the first EA1 mutation directly associated with impaired protein stability. Further functional analyses demonstrate that I262T changes the voltage-dependent activation and Kvβ1.1-mediated inactivation, uncouples inactivation from activation gating, and decelerates the kinetics of cumulative inactivation of Kv1.1 channels. I262T also exerts similar dominant effects on the gating of Kv1.2 and Kv1.4 channels. Together our data suggest that I262T confers altered channel gating and reduced functional expression of Kv1 channels, which may account for some of the phenotypes of the EA1 patient. PMID:26778656

  11. IgG anti-GalNAc-GD1a antibody inhibits the voltage-dependent calcium channel currents in PC12 pheochromocytoma cells.

    PubMed

    Nakatani, Yoshihiko; Nagaoka, Takumi; Hotta, Sayako; Utsunomiya, Iku; Yoshino, Hiide; Miyatake, Tadashi; Hoshi, Keiko; Taguchi, Kyoji

    2007-03-01

    We investigated the effects of IgG anti-GalNAc-GD1a antibodies, produced by immunizing rabbits with GalNAc-GD1a, on the voltage-dependent calcium channel (VDCCs) currents in nerve growth factor (NGF)-differentiated PC12 pheochromocytoma cells. VDCCs currents in NGF-differentiated PC12 cells were recorded using the whole-cell patch-clamp technique. Immunized rabbit serum that had a high titer of anti-GalNAc-GD1a antibodies inhibited the VDCCs currents in the NGF-differentiated PC12 cells (36.0+/-9.6% reduction). The inhibitory effect of this serum was reversed to some degree within 3-4 min by washing with bath solution. Similarly, application of purified IgG from rabbit serum immunized with GalNAc-GD1a significantly inhibited the VDCCs currents in PC12 cells (30.6+/-2.5% reduction), and this inhibition was recovered by washing with bath solution. Furthermore, the inhibitory effect was also observed in the GalNAc-GD1a affinity column binding fraction (reduction of 31.1+/-9.85%), while the GalNAc-GD1a affinity column pass-through fraction attenuated the inhibitory effect on VDCCs currents. Normal rabbit serum and normal rabbit IgG did not affect the VDCCs currents in the PC12 cells. In an immunocytochemical study using fluorescence staining, the PC12 cells were stained using GalNAc-GD1a binding fraction. These results indicate that anti-GalNAc-GD1a antibodies inhibit the VDCCs currents in NGF-differentiated PC12 cells.

  12. Pumiliotoxin B binds to a site on the voltage-dependent sodium channel that is allosterically coupled to other binding sites.

    PubMed Central

    Gusovsky, F; Rossignol, D P; McNeal, E T; Daly, J W

    1988-01-01

    Pumiliotoxin B (PTX-B), an alkaloid that has cardiotonic and myotonic activity, increases sodium influx in guinea pig cerebral cortical synaptoneurosomes. In the presence of scorpion venom (Leiurus) or purified alpha-scorpion toxin, the PTX-B-induced sodium influx is enhanced severalfold. PTX-B alone has no effect on sodium flux in N18 neuroblastoma cells but, in the presence of alpha-scorpion toxin, stimulation of sodium influx by PTX-B reaches levels comparable to that attained with the sodium channel activator veratridine. In neuroblastoma LV9 cells, a variant mutant that lacks sodium channels, neither veratridine nor PTX-B induces sodium fluxes in either the presence or absence of alpha-scorpion toxin. In synaptoneurosomes and in N18 cells, the sodium influx induced by the combination of PTX-B and alpha-scorpion toxin is inhibited by tetrodotoxin and local anesthetics. PTX-B does not interact with two of the known toxin sites on the sodium channel, as evidenced by a lack of effect on binding of [3H]saxitoxin or [3H]batrachotoxinin A benzoate to brain synaptoneurosomes. Synergistic effects on sodium influx with alpha-scorpion toxin, beta-scorpion toxin, and brevetoxin indicate that PTX-B does not interact directly with three other toxin sites on the sodium channel. Thus, PTX-B appears to activate sodium influx by interacting with yet another site on the voltage-dependent sodium channel, a site that is coupled allosterically to sites for alpha-scorpion toxin, beta-scorpion toxin, and brevetoxin. PMID:2448797

  13. Magic Angle Spinning Nuclear Magnetic Resonance Characterization of Voltage-Dependent Anion Channel Gating in Two-Dimensional Lipid Crystalline Bilayers

    PubMed Central

    2015-01-01

    The N-terminus of the voltage-dependent anion channel (VDAC) has been proposed to contain the mechanistically important gating helices that modulate channel opening and closing. In this study, we utilize magic angle spinning nuclear magnetic resonance (MAS NMR) to determine the location and structure of the N-terminus for functional channels in lipid bilayers by measuring long-range 13C–13C distances between residues in the N-terminus and other domains of VDAC reconstituted into DMPC lipid bilayers. Our structural studies show that the distance between A14 Cβ in the N-terminal helix and S193 Cβ is ∼4–6 Å. Furthermore, VDAC phosphorylation by a mitochondrial kinase at residue S193 has been claimed to delay mitochondrial cell death by causing a conformational change that closes the channel, and a VDAC-Ser193Glu mutant has been reported to show properties very similar to those of phosphorylated VDAC in a cellular context. We expressed VDAC-S193E and reconstituted it into DMPC lipid bilayers. Two-dimensional 13C–13C correlation experiments showed chemical shift perturbations for residues located in the N-terminus, indicating possible structural perturbations to that region. However, electrophysiological data recorded on VDAC-S193E showed that channel characteristics were identical to those of wild type samples, indicating that phosphorylation of S193 does not directly affect channel gating. The combination of NMR and electrophysiological results allows us to discuss the validity of proposed gating models. PMID:25545271

  14. Voltage-dependent anion channels (VDACs) promote mitophagy to protect neuron from death in an early brain injury following a subarachnoid hemorrhage in rats.

    PubMed

    Li, Jian; Lu, Jianfei; Mi, Yongjie; Shi, Zhao; Chen, Chunhua; Riley, John; Zhou, Changman

    2014-07-21

    The term mitophagy is coined to describe the selective removal of mitochondria by autophagy but the process itself is still contentious, especially in the early period following subarachnoid hemorrhage (SAH). In the present study, we investigated the role of mitophagy following 48h after SAH injury in rats. Specifically evaluating whether mitophagy, through voltage dependant anion channels (VDACs) interacting with microtubule-associated protein 1 light chain 3, could orchestrate the induction of apoptotic and necrotic cell death in neurons, a VDAC1siRNA and an activitor Rapamycian (RAPA), were engaged. One hundred and twelve male Sprague-Dawley rats were randomly divided into 4 groups: Sham, SAH, SAH+VDAC1siRNA, and SAH+RAPA. Outcomes measured included mortality rate, brain edema, BBB disruption, and neurobehavioral testing. We also used western blotting techniques to analyze the expressions of key mitophagic/autophagic proteins and pro-apoptotic protein such as ROS, VDAC1, LC-3II and Caspase-3. Rapamycin treatment significantly improved the mortality rate, cerebral edema, and neurobehavioral deficits; apoptotic and necrotic cell death in neurons were reduced by Rapamycin following SAH injury. However, VDAC1siRNA worsened the brain injury following SAH. Immunohistochemical staining and western blot analysis demonstrated a decreased expression of VDAC1, LC3II, and an increase of ROS and Caspase-3 followed by VDAC1siRNA administration. In conclusion, mitophagy induced by VDAC1 following SAH injury may in fact play a significant role in neuroprotection, the mechanism which may be through the attenuation of the apoptosic and necrosic molecular pathways. This translates a preservation of functional integrity and an improvement in mortality.

  15. Voltage dependence of proton pumping by bacteriorhodopsin is regulated by the voltage-sensitive ratio of M1 to M2.

    PubMed Central

    Nagel, G; Kelety, B; Möckel, B; Büldt, G; Bamberg, E

    1998-01-01

    The voltage dependence of light-induced proton pumping was studied with bacteriorhodopsin (bR) from Halobacterium salinarum, expressed in the plasma membrane of oocytes from Xenopus laevis in the range -160 mV to +60 mV at different light intensities. Depending on the applied field, the quenching effect by blue light, which bypasses the normal photo and transport cycle, is drastically increased at inhibiting (negative) potentials, and is diminished at pump current increasing (positive) potentials. At any potential, two processes with different time constants for the M --> bR decay of approximately 5 ms (tau1) and approximately 20 ms (tau2) are obtained. At pump-inhibiting potentials, a third, long-lasting process with tau3 approximately 300 ms at neutral pH is observed. The fast processes (tau1, tau2) can be assigned to the decay of M2 in the normal pump cycle, i.e., to the reprotonation of the Schiff base via the cytoplasmic side, whereas tau3 is due to the decay of M1 without net pumping, i.e., the reprotonation of the Schiff base via the extracellular side. The results are supported by determination of photocurrents induced by bR on planar lipid films. The pH dependence of the slow decay of M1 is fully in agreement with the interpretation that the reprotonation of the Schiff base occurs from the extracellular side. The results give strong evidence that an externally applied electrical field changes the ratio of the M1 and the M2 intermediate. As a consequence, the transport cycle branches into a nontransporting cycle at negative potentials. This interpretation explains the current-voltage behavior of bR on a new basis, but agrees with the isomerisation, switch, transfer model for vectorial transport. PMID:9449340

  16. The calmodulin inhibitor CGS 9343B inhibits voltage-dependent K{sup +} channels in rabbit coronary arterial smooth muscle cells

    SciTech Connect

    Li, Hongliang; Hong, Da Hye; Kim, Han Sol; Kim, Hye Won; Jung, Won-Kyo; Na, Sung Hun; Jung, In Duk; Park, Yeong-Min; Choi, Il-Whan; Park, Won Sun

    2015-06-15

    We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivation curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.

  17. Mutations associated with Dent's disease affect gating and voltage dependence of the human anion/proton exchanger ClC-5.

    PubMed

    Alekov, Alexi K

    2015-01-01

    Dent's disease is associated with impaired renal endocytosis and endosomal acidification. It is linked to mutations in the membrane chloride/proton exchanger ClC-5; however, a direct link between localization in the protein and functional phenotype of the mutants has not been established until now. Here, two Dent's disease mutations, G212A and E267A, were investigated using heterologous expression in HEK293T cells, patch-clamp measurements and confocal imaging. WT and mutant ClC-5 exhibited mixed cell membrane and vesicular distribution. Reduced ion currents were measured for both mutants and both exhibited reduced capability to support endosomal acidification. Functionally, mutation G212A was capable of mediating anion/proton antiport but dramatically shifted the activation of ClC-5 toward more depolarized potentials. The shift can be explained by impeded movements of the neighboring gating glutamate Gluext, a residue that confers major part of the voltage dependence of ClC-5 and serves as a gate at the extracellular entrance of the anion transport pathway. Cell surface abundance of E267A was reduced by ~50% but also dramatically increased gating currents were detected for this mutant and accordingly reduced probability to undergoing cycles associated with electrogenic ion transport. Structurally, the gating alternations correlate to the proximity of E267A to the proton glutamate Gluin that serves as intracellular gate in the proton transport pathway and regulates the open probability of ClC-5. Remarkably, two other mammalian isoforms, ClC-3 and ClC-4, also differ from ClC-5 in gating characteristics affected by the here investigated disease-causing mutations. This evolutionary specialization, together with the functional defects arising from mutations G212A and E267A, demonstrate that the complex gating behavior exhibited by most of the mammalian CLC transporters is an important determinant of their cellular function.

  18. Mitochondria-associated Endoplasmic Reticulum Membrane (MAM) Regulates Steroidogenic Activity via Steroidogenic Acute Regulatory Protein (StAR)-Voltage-dependent Anion Channel 2 (VDAC2) Interaction*

    PubMed Central

    Prasad, Manoj; Kaur, Jasmeet; Pawlak, Kevin J.; Bose, Mahuya; Whittal, Randy M.; Bose, Himangshu S.

    2015-01-01

    Steroid hormones are essential for carbohydrate metabolism, stress management, and reproduction and are synthesized from cholesterol in mitochondria of adrenal glands and gonads/ovaries. In acute stress or hormonal stimulation, steroidogenic acute regulatory protein (StAR) transports substrate cholesterol into the mitochondria for steroidogenesis by an unknown mechanism. Here, we report for the first time that StAR interacts with voltage-dependent anion channel 2 (VDAC2) at the mitochondria-associated endoplasmic reticulum membrane (MAM) prior to its translocation to the mitochondrial matrix. In the MAM, StAR interacts with mitochondrial proteins Tom22 and VDAC2. However, Tom22 knockdown by siRNA had no effect on pregnenolone synthesis. In the absence of VDAC2, StAR was expressed but not processed into the mitochondria as a mature 30-kDa protein. VDAC2 interacted with StAR via its C-terminal 20 amino acids and N-terminal amino acids 221–229, regulating the mitochondrial processing of StAR into the mature protein. In the absence of VDAC2, StAR could not enter the mitochondria or interact with MAM-associated proteins, and therefore steroidogenesis was inhibited. Furthermore, the N terminus was not essential for StAR activity, and the N-terminal deletion mutant continued to interact with VDAC2. The endoplasmic reticulum-targeting prolactin signal sequence did not affect StAR association with the MAM and thus its mitochondrial targeting. Therefore, VDAC2 controls StAR processing and activity, and MAM is thus a central location for initiating mitochondrial steroidogenesis. PMID:25505173

  19. Chronic Ca2+ influx through voltage-dependent Ca2+ channels enhance delayed rectifier K+ currents via activating Src family tyrosine kinase in rat hippocampal neurons

    PubMed Central

    Yang, Yoon-Sil; Jeon, Sang-Chan; Kim, Dong-Kwan; Eun, Su-Yong

    2017-01-01

    Excessive influx and the subsequent rapid cytosolic elevation of Ca2+ in neurons is the major cause to induce hyperexcitability and irreversible cell damage although it is an essential ion for cellular signalings. Therefore, most neurons exhibit several cellular mechanisms to homeostatically regulate cytosolic Ca2+ level in normal as well as pathological conditions. Delayed rectifier K+ channels (IDR channels) play a role to suppress membrane excitability by inducing K+ outflow in various conditions, indicating their potential role in preventing pathogenic conditions and cell damage under Ca2+-mediated excitotoxic conditions. In the present study, we electrophysiologically evaluated the response of IDR channels to hyperexcitable conditions induced by high Ca2+ pretreatment (3.6 mM, for 24 hours) in cultured hippocampal neurons. In results, high Ca2+-treatment significantly increased the amplitude of IDR without changes of gating kinetics. Nimodipine but not APV blocked Ca2+-induced IDR enhancement, confirming that the change of IDR might be targeted by Ca2+ influx through voltage-dependent Ca2+ channels (VDCCs) rather than NMDA receptors (NMDARs). The VDCC-mediated IDR enhancement was not affected by either Ca2+-induced Ca2+ release (CICR) or small conductance Ca2+-activated K+ channels (SK channels). Furthermore, PP2 but not H89 completely abolished IDR enhancement under high Ca2+ condition, indicating that the activation of Src family tyrosine kinases (SFKs) is required for Ca2+-mediated IDR enhancement. Thus, SFKs may be sensitive to excessive Ca2+ influx through VDCCs and enhance IDR to activate a neuroprotective mechanism against Ca2+-mediated hyperexcitability in neurons. PMID:28280420

  20. Role of spinal voltage-dependent calcium channel alpha 2 delta-1 subunit in the expression of a neuropathic pain-like state in mice.

    PubMed

    Narita, Minoru; Nakajima, Mayumi; Miyoshi, Kan; Narita, Michiko; Nagumo, Yasuyuki; Miyatake, Mayumi; Yajima, Yoshinori; Yanagida, Kiyomi; Yamazaki, Mitsuaki; Suzuki, Tsutomu

    2007-05-08

    The present study was undertaken to investigate the role of spinal voltage-dependent calcium channel alpha(2)delta-1 subunit in the expression of a neuropathic pain-like state induced by partial sciatic nerve ligation in mice. In cultured spinal neurons, gabapentin (GBP), which displays the inhibitory effect of alpha(2)delta-1 subunit, suppressed the extracellular Ca(2+) influx induced by KCl, whereas it failed to inhibit the intracellular Ca(2+) release induced by inositol-1,4,5-triphosphate. Seven days after sciatic nerve ligation, the protein level of alpha(2)delta-1 subunit in the ipsilateral spinal cord was clearly increased compared to that observed in sham-operated mice. In addition, the mRNA level of alpha(2)delta-1 subunit was significantly increased in the dorsal root ganglion, but not in the spinal cord, of nerve-ligated mice. Under these conditions, a marked decrease in the latency of paw-withdrawal against a thermal stimulation and tactile stimulation, induced by sciatic nerve ligation was abolished by repeated intrathecal (i.t.) treatment with GBP. Additionally, the persistent reduction in the nociceptive threshold by i.t. treatment with GBP at the early stage of the neuropathic pain-like state was maintained for 7 days even after GBP withdrawal. It is of interest to note that a single i.t. post-injection of GBP showed a marked and transient inhibitory effect on the developed neuropathic pain-like state, whereas repeated i.t. post-treatment with GBP produced a persistent inhibitory effect during the treatment. In conclusion, we propose here that the neuropathic pain-like state with sciatic nerve ligation is associated with the increased level of the alpha(2)delta-1 subunit of Ca(2+) channels at the sensory nerve terminal in the spinal dorsal horn of mice. Furthermore, the present data provide evidence that the neuropathic pain may be effectively controlled by repeated treatment with GBP at the early stage.

  1. Enhanced contractility in pregnancy is associated with augmented TRPC3, L-type, and T-type voltage-dependent calcium channel function in rat uterine radial artery.

    PubMed

    Senadheera, Sevvandi; Bertrand, Paul P; Grayson, T Hilton; Leader, Leo; Tare, Marianne; Murphy, Timothy V; Sandow, Shaun L

    2013-10-15

    In pregnancy, α-adrenoceptor-mediated vasoconstriction is augmented in uterine radial arteries and is accompanied by underlying changes in smooth muscle (SM) Ca(2+) activity. This study aims to determine the Ca(2+) entry channels associated with altered vasoconstriction in pregnancy, with the hypothesis that augmented vasoconstriction involves transient receptor potential canonical type-3 (TRPC3) and L- and T-type voltage-dependent Ca(2+) channels. Immunohistochemistry showed TRPC3, L-type Cav1.2 (as the α1C subunit), T-type Cav3.1 (α1G), and Cav3.2 (α1H) localization to the uterine radial artery SM. Fluorescence intensity of TRPC3, Cav1.2, and Cav3.2 was increased, and Cav3.1 decreased in radial artery SM from pregnant rats. Western blot analysis confirmed increased TRPC3 protein expression in the radial artery from pregnant rats. Pressure myography incorporating pharmacological intervention to examine the role of these channels in uterine radial arteries showed an attenuation of phenylephrine (PE)-induced constriction with Pyr3 {1-[4-[(2,3,3-trichloro-1-oxo-2-propen-1-yl)amino]phenyl]-5-(trifluoromethyl)-1H-pyrazole-4-carboxylic acid}-mediated TRPC3 inhibition or with nifedipine-mediated L-type channel block alone in vessels from pregnant rats; both effects of which were diminished in radial arteries from nonpregnant rats. Combined TRPC3 and L-type inhibition attenuated PE-induced constriction in radial arteries, and the residual vasoconstriction was reduced and abolished with T-type channel block with NNC 55-0396 in arteries from nonpregnant and pregnant rats, respectively. With SM Ca(2+) stores depleted and in the presence of PE, nifedipine, and NNC 55-0396, blockade of TRPC3 reversed PE-induced constriction. These data suggest that TRPC3 channels act synergistically with L- and T-type channels to modulate radial artery vasoconstriction, with the mechanism being augmented in pregnancy.

  2. Voltage-dependent sodium channels in human small-cell lung cancer cells: role in action potentials and inhibition by Lambert-Eaton syndrome IgG.

    PubMed

    Blandino, J K; Viglione, M P; Bradley, W A; Oie, H K; Kim, Y I

    1995-01-01

    Sodium channels of human small-cell lung cancer (SCLC) cells were examined with whole-cell and single-channel patch clamp methods. In the tumor cells from SCLC cell line NCI-H146, the majority of the voltage-gated Na+ channels are only weakly tetrodotoxin (TTX)-sensitive (Kd = 215 nM). With the membrane potential maintained at -60 to -80 mV, these cells produced all-or-nothing action potentials in response to depolarizing current injection (> 20 pA). Similar all-or-nothing spikes were also observed with anodal break excitation. Removal of external Ca2+ did not affect the action potential production, whereas 5 microM TTX or substitution of Na+ with choline abolished it. Action potentials elicited in the Ca(2+)-free condition were reversibly blocked by 4 mM MnCl2 due to the Mn(2+)-induced inhibition of voltage-dependent sodium currents (INa). Therefore, Na+ channels, not Ca2+ channels, underlie the excitability of SCLC cells. Whole-cell INa was maximal with step-depolarizing stimulations to 0 mV, and reversed at +45.2 mV, in accord with the predicted Nernst equilibrium potential for a Na(+)-selective channel. INa evoked by depolarizing test potentials (-60 to +40 mV) exhibited a transient time course and activation/inactivation kinetics typical of neuronal excitable membranes; the plot of the Hodgkin-Huxley parameters, m infinity and h infinity, also revealed biophysical similarity between SCLC and neuronal Na+ channels. The single channel current amplitude, as measured with the inside-out patch configuration, was 1.0 pA at -20 mV with a slope conductance of 12.1 pS. The autoantibodies implicated in the Lambert-Eaton myasthenic syndrome (LES), which are known to inhibit ICa and INa in bovine adrenal chromaffin cells, also significantly inhibited INa in SCLC cells. These results indicate that (i) action potentials in human SCLC cells result from the regenerative increase in voltage-gated Na+ channel conductance; (ii) fundamental characteristics of SCLC Na+ channels

  3. Temperature and voltage dependence of barrier height and ideality factor in Au/0.07 graphene-doped PVA/n-Si structures

    NASA Astrophysics Data System (ADS)

    Altındal Yerişkin, S.; Balbaşı, M.; Demirezen, S.

    2017-01-01

    In this study, Au/0.07 graphene-doped PVA/n-Si structures were fabricated and current conduction mechanism in these structures were investigated in the temperature range of 80-380 K through forward bias current-voltage (I-V) measurements. Main electrical parameters were extracted from I-V data. Zero-bias barrier height (overline{Φ}_{B0} ) and ideality factor (n) were found strong functions of temperature and their values ranged from 0.234 eV and 4.98 (at 80 K) to 0.882 eV and 1.15 (at 380 K), respectively. Φ ap versus q/2kT plot was drawn to obtain an evidence of a Gaussian distribution of the barrier heights (BHs) and it revealed two distinct linear regions with different slopes and intercepts. The mean values of BH (Φ Bo) and zero-bias standard deviation (σ s ) were obtained from the intercept and slope of the linear regions of this plot as 1.30 eV and 0.16 V for the first region (280-380 K) and 0.74 eV and 0.085 V for the second region (80-240 K), respectively. Thus, the values of overline{Φ}_{B0} and effective Richardson constant (A*) were also found from the intercept and slope of the modified Richardson plot [ln(I s /T 2) - q 2 σ {/o 2} /2k 2 T 2 vs q/kT] as 1.31 eV and 130 A/cm2 K2 for the first region and 0.76 eV and 922 A/cm2 K2 for the second region, respectively. The value of A* for the first region was very close to the theoretical value for n-Si (112 A/cm2 K2). The energy density distribution profile of surface states (Nss) was also extracted from the forward bias I-V data by taking into account voltage dependent effective BH (Φe) and n.

  4. R-phenibut binds to the α2-δ subunit of voltage-dependent calcium channels and exerts gabapentin-like anti-nociceptive effects.

    PubMed

    Zvejniece, Liga; Vavers, Edijs; Svalbe, Baiba; Veinberg, Grigory; Rizhanova, Kristina; Liepins, Vilnis; Kalvinsh, Ivars; Dambrova, Maija

    2015-10-01

    Phenibut is clinically used anxiolytic, mood elevator and nootropic drug. R-phenibut is responsible for the pharmacological activity of racemic phenibut, and this activity correlates with its binding affinity for GABAB receptors. In contrast, S-phenibut does not bind to GABAB receptors. In this study, we assessed the binding affinities of R-phenibut, S-phenibut, baclofen and gabapentin (GBP) for the α2-δ subunit of the voltage-dependent calcium channel (VDCC) using a subunit-selective ligand, radiolabelled GBP. Binding experiments using rat brain membrane preparations revealed that the equilibrium dissociation constants (Kis) for R-phenibut, S-phenibut, baclofen and GBP were 23, 39, 156 and 0.05μM, respectively. In the pentylenetetrazole (PTZ)-induced seizure test, we found that at doses up to 100mg/kg, R-phenibut did not affect PTZ-induced seizures. The anti-nociceptive effects of R-phenibut were assessed using the formalin-induced paw-licking test and the chronic constriction injury (CCI) of the sciatic nerve model. Pre-treatment with R-phenibut dose-dependently decreased the nociceptive response during both phases of the test. The anti-nociceptive effects of R-phenibut in the formalin-induced paw-licking test were not blocked by the GABAB receptor-selective antagonist CGP35348. In addition, treatment with R- and S-phenibut alleviated the mechanical and thermal allodynia induced by CCI of the sciatic nerve. Our data suggest that the binding affinity of R-phenibut for the α2-δ subunit of the VDCC is 4 times higher than its affinity for the GABAB receptor. The anti-nociceptive effects of R-phenibut observed in the tests of formalin-induced paw licking and CCI of the sciatic nerve were associated with its effect on the α2-δ subunit of the VDCC rather than with its effects on GABAB receptors. In conclusion, our results provide experimental evidence for GBP-like, anti-nociceptive properties of R-phenibut, which might be used clinically to treat neuropathic pain

  5. Facilitation of T-type calcium current in bullfrog atrial cells: voltage-dependent relief of a G protein inhibitory tone.

    PubMed Central

    Alvarez, J L; Rubio, L S; Vassort, G

    1996-01-01

    1. The properties of the low-threshold calcium current, ICa,T, were investigated in bullfrog isolated atrial cardiomyocytes using the whole-cell, patch-clamp technique under control conditions and during beta-adrenergic stimulation. 2. The intracellular application of GTP gamma S or adenosine-5'-O-3-thiotriphosphate (ATP gamma S), poorly hydrolysable analogues of GTP and ATP, respectively, barely affected ICa,T amplitude in control conditions. beta-Adrenergic stimulation effects were more marked in the presence of ATP gamma S. 3. The intracellular application of GDP beta S and ADP reduced ICa,T amplitude. In cells pretreated with pertussis toxin, ICa,T amplitude was significantly increased. In both conditions, the addition of isoprenaline was without effect. 4. Under both control and beta-adrenergic-stimulated conditions, a conditioning prepulse to +70 mV did not fully inactivate ICa,T; rather ICa,T facilitation often occurred after beta-adrenergic stimulation. 5. In GTP gamma S- and ATP gamma S-dialysed cells, ICa,T facilitation was generally observed after a prepulse; it was larger in the ATP gamma S dialysis. Facilitation was sustained but ended immediately upon cessation of conditioning prepulses. After beta-adrenergic stimulation, facilitation was more marked in GTP gamma S- than in ATP gamma S-dialysed cells. 6. ICa,T facilitation was prevented by the intracellular application of GDP beta S and by pertussis toxin pretreatment. 7. ICa,T facilitation developed markedly in the presence of intracellular cyclic AMP. This effect was prevented by pertussis toxin pretreatment of the cells. 8. It is thus proposed that ICa,T is under a double antagonistic control by both a Gs and a Gi protein. Furthermore, the double-pulse-induced facilitation of ICa,T results from a voltage-dependent relief of the Gi protein inhibitory tone. Such an effect is increased by protein kinase A-dependent phosphorylation, presumably of the Gi protein. PMID:8866857

  6. Temperature and voltage dependence of barrier height and ideality factor in Au/0.07 graphene-doped PVA/n-Si structures

    NASA Astrophysics Data System (ADS)

    Altındal Yerişkin, S.; Balbaşı, M.; Demirezen, S.

    2017-04-01

    In this study, Au/0.07 graphene-doped PVA/n-Si structures were fabricated and current conduction mechanism in these structures were investigated in the temperature range of 80-380 K through forward bias current-voltage ( I- V) measurements. Main electrical parameters were extracted from I-V data. Zero-bias barrier height (\\overline{Φ}_{B0}) and ideality factor (n) were found strong functions of temperature and their values ranged from 0.234 eV and 4.98 (at 80 K) to 0.882 eV and 1.15 (at 380 K), respectively. Φ ap versus q/2k T plot was drawn to obtain an evidence of a Gaussian distribution of the barrier heights (BHs) and it revealed two distinct linear regions with different slopes and intercepts. The mean values of BH ( Φ Bo) and zero-bias standard deviation (σ s ) were obtained from the intercept and slope of the linear regions of this plot as 1.30 eV and 0.16 V for the first region (280-380 K) and 0.74 eV and 0.085 V for the second region (80-240 K), respectively. Thus, the values of \\overline{Φ}_{B0} and effective Richardson constant ( A*) were also found from the intercept and slope of the modified Richardson plot [ln( I s /T 2) - q 2 σ o 2 /2k 2 T 2 vs q/ kT] as 1.31 eV and 130 A/cm2 K2 for the first region and 0.76 eV and 922 A/cm2 K2 for the second region, respectively. The value of A* for the first region was very close to the theoretical value for n-Si (112 A/cm2 K2). The energy density distribution profile of surface states (Nss) was also extracted from the forward bias I-V data by taking into account voltage dependent effective BH (Φe) and n.

  7. Inflammatory cytokine signaling in insulin producing beta-cells enhances the colocalization correlation coefficient between L-type voltage-dependent calcium channel and calcium-sensing receptor.

    PubMed

    Parkash, Jai

    2008-08-01

    The immunological processes in type 1 diabetes and metabolic/inflammatory disorder in type 2 diabetes converge on common signaling pathway(s) leading to beta-cell death in these two diseases. The cytokine-mediated beta-cell death seems to be dependent on voltage-dependent calcium channel (VDCC)-mediated Ca2+ entry. The Ca2+ handling molecular networks control the homeostasis of [Ca2+]i in the beta-cell. The activity and membrane density of VDCC are regulated by several mechanisms including G protein-coupled receptors (GPCRs). CaR is a 123-kDa seven transmembrane extracellular Ca2+ sensing protein that belongs to GPCR family C. Tumor necrosis factor-alpha (TNF-alpha), is a cytokine widely known to activate nuclear factor-kappaB (NF-kappaB) transcription in beta-cells. To obtain a better understanding of TNF-alpha-induced molecular interactions between CaR and VDCC, confocal fluorescence measurements were performed on insulin-producing beta-cells exposed to varying concentrations of TNF-alpha and the results are discussed in the light of increased colocalization correlation coefficient. The insulin producing beta-cells were exposed to 5, 10, 20, 30, and 50 ng/ml TNF-alpha for 24 h at 37 degrees . The cells were then immunolabelled with antibodies directed against CaR, VDCC, and NF-kappaB. The confocal fluorescence imaging data showed enhancement in the colocalization correlation coefficient between CaR and VDCC in beta-cells exposed to TNF-alpha thereby indicating increased membrane delimited spatial interactions between these two membrane proteins. TNF-alpha-induced colocalization of VDCC with CaR was inhibited by nimodipine, an inhibitor of L-type VDCC thereby suggesting that VDCC activity is required for spatial interactions with CaR. The 3-D confocal fluorescence imaging data also demonstrated that addition of TNF-alpha to RIN cells led to the translocation of NF-kappaB from the cytoplasm to the nucleus. Such molecular interactions between CaR and VDCC in tissues

  8. The biology of some intraerythrocytic parasites of fishes, amphibia and reptiles.

    PubMed

    Davies, A J; Johnston, M R

    2000-01-01

    Fishes, amphibia and reptiles, the ectothermic vertebrates, are hosts for a variety of intraerythrocytic parasites including protists, prokaryotes, viruses and structures of uncertain status. These parasites may experience host temperature fluctuations, host reproductive strategies, population genetics, host habitat and migratory behaviour quite unlike those of endothermic hosts. Few blood infections of fishes, amphibia and reptiles have proven pathogenicity, in contrast to the many intraerythrocytic parasites of mammals and some birds which harm their hosts. Although not given the attention afforded to intraerythrocytic parasites of endotherms, those of ectotherms have been studied for more than a century. This review reports on the diversity, general biology and phylogeny of intraerythrocytic parasites of ectotherms. The existence of taxonomic confusion is emphasized and the main taxonomic features of most of the 23 better characterized genera, particularly the kinetoplastid and apicomplexan protists, are summarized. Transmission of protistan infections of aquatic ectotherms is also discussed. Leeches can transfer sporozoties or merozoites to the vertebrate host during feeding. Dormant sporozoites of Lankesterella may permit transmission of species of this genus between vertebrates by predation. The fish haemogregarine, Haemogregarina bigemina, probably has gnathiid isopods, rather than leeches, as its definitive hosts. Hepatozoon spp. in aquatic hosts, and Progarnia of caiman, may also use invertebrate hosts other than leeches. Protistan infections of terrestrial or semi-terrestrial hosts are transmitted by a variety of arthropods, or, in some cases, leeches, contaminated paratenic hosts, or sporocysts free in water. Transfer of protists between vertebrates by predation and congenitally may also occur. The biology of the host cells of these infections, the red blood cells of ectotherm vertebrates, is summarized and compared with that of mammalian erythrocytes

  9. A new lungless caecilian (Amphibia: Gymnophiona) from Guyana

    PubMed Central

    Wake, Marvalee H.; Donnelly, Maureen A.

    2010-01-01

    We report the discovery of a single specimen of a small, terrestrial, lungless caecilian, the second known taxon of lungless caecilians. It differs from all other caecilians in lacking open external nares, and from the large aquatic lungless species described by Nussbaum & Wilkinson (Nussbaum, R. A. & Wilkinson, M. 1995 Proc. R. Soc. Lond. B 261, 331–335) in having no significant skull modifications. All modifications are of ‘soft morphology’ (covered external nares and choanae, lung and pulmonary vessel loss, etc.). A new genus and species are described to accommodate this form. Aspects of its skull and visceral morphology are described and considered in terms of the possible life history and evolution of the species, and compared with those of other lungless amphibians. PMID:19923127

  10. A new lungless caecilian (Amphibia: Gymnophiona) from Guyana.

    PubMed

    Wake, Marvalee H; Donnelly, Maureen A

    2010-03-22

    We report the discovery of a single specimen of a small, terrestrial, lungless caecilian, the second known taxon of lungless caecilians. It differs from all other caecilians in lacking open external nares, and from the large aquatic lungless species described by Nussbaum & Wilkinson (Nussbaum, R. A. & Wilkinson, M. 1995 Proc. R. Soc. Lond. B 261, 331-335) in having no significant skull modifications. All modifications are of 'soft morphology' (covered external nares and choanae, lung and pulmonary vessel loss, etc.). A new genus and species are described to accommodate this form. Aspects of its skull and visceral morphology are described and considered in terms of the possible life history and evolution of the species, and compared with those of other lungless amphibians.

  11. Splice-variant changes of the Ca(V)3.2 T-type calcium channel mediate voltage-dependent facilitation and associate with cardiac hypertrophy and development.

    PubMed

    David, Laurence S; Garcia, Esperanza; Cain, Stuart M; Thau, Elana; Tyson, John R; Snutch, Terrance P

    2010-01-01

    Low voltage-activated T-type calcium (Ca) channels contribute to the normal development of the heart and are also implicated in pathophysiological states such as cardiac hypertrophy. Functionally distinct T-type Ca channel isoforms can be generated by alternative splicing from each of three different T-type genes (Ca(V)3.1, Ca(V)3.2,Ca(V)3.3), although it remains to be described whether specific splice variants are associated with developmental states and pathological conditions. We aimed to identify and functionally characterize Ca(V)3.2 T-type Ca channel alternatively spliced variants from newborn animals and to compare with adult normotensive and spontaneously hypertensive rats (SHR). DNA sequence analysis of full-length Ca(V)3.2 cDNA generated from newborn heart tissue identified ten major regions of alternative splicing, the more common variants of which were analyzed by quantitative real-time PCR (qRT-PCR) and also subject to functional examination by whole-cell patch clamp. The main findings are that: (1) cardiac Ca(V)3.2 T-type Ca channels are subject to considerable alternative splicing, (2) there is preferential expression of Ca(V)3.2(-25) splice variant channels in newborn rat heart with a developmental shift in adult heart that results in approximately equal levels of expression of both (+25) and (-25) exon variants, (3) in the adult stage of hypertensive rats there is a both an increase in overall Ca(V)3.2 expression and a shift towards expression of Ca(V)3.2(+25) containing channels as the predominant form, and (4) alternative splicing confers a variant-specific voltage-dependent facilitation of Ca(V)3.2 channels. We conclude that Ca(V)3.2 alternative splicing generates significant T-type Ca channel structural and functional diversity with potential implications relevant to cardiac developmental and pathophysiological states.

  12. A new species of Mesocoelium (Digenea: Mesocoeliidae) found in Rhinella marina (Amphibia: Bufonidae) from Brazilian Amazonia.

    PubMed

    Gomes, Tássia F F; Melo, Francisco T V; Giese, Elane G; Furtado, Adriano P; Gonçalves, Evonnildo C; Santos, Jeannie N

    2013-04-01

    Mesocoelium lanfrediae sp. nov. (Digenea: Mesocoeliidae) inhabits the small intestine of Rhinella marina (Amphibia: Bufonidae) and is described here, with illustrations provided by light, scanning electron microscopy and molecular approachs. M. lanfrediae sp. nov. presents the typical characteristics of the genus, but is morphometrically and morphologically different from the species described previously. The main diagnostic characteristics of M. lanfrediae sp. nov. are (i) seven pairs of regularly-distributed spherical papillae on the oral sucker, (ii) ventral sucker outlined by four pairs of papillae distributed in a uniform pattern and interspersed with numerous spines, which are larger at the posterior margin and (iii) small, rounded tegumentary papillae around the opening of the oral sucker, which are morphologically different from those of the oral sucker itself, some of which are randomly disposed in the ventrolateral tegumentary region of the anterior third of the body. Addionally, based on SSU rDNA, a phylogenetic analysis including Brachycoeliidae and Mesocoeliidae taxa available on GenBank established the close relationship between M. lanfrediae sp. nov. and Mesocoelium sp.

  13. A new species of Mesocoelium (Digenea: Mesocoeliidae) found in Rhinella marina (Amphibia: Bufonidae) from Brazilian Amazonia

    PubMed Central

    Gomes, Tássia FF; Melo, Francisco TV; Giese, Elane G; Furtado, Adriano P; Gonçalves, Evonnildo C; Santos, Jeannie N

    2013-01-01

    Mesocoelium lanfrediaesp. nov. (Digenea: Mesocoeliidae) inhabits the small intestine of Rhinella marina (Amphibia: Bufonidae) and is described here, with illustrations provided by light, scanning electron microscopy and molecular approachs. M. lanfrediae sp. nov. presents the typical characteristics of the genus, but is morphometrically and morphologically different from the species described previously. The main diagnostic characteristics of M. lanfrediae sp. nov. are (i) seven pairs of regularly-distributed spherical papillae on the oral sucker, (ii) ventral sucker outlined by four pairs of papillae distributed in a uniform pattern and interspersed with numerous spines, which are larger at the posterior margin and (iii) small, rounded tegumentary papillae around the opening of the oral sucker, which are morphologically different from those of the oral sucker itself, some of which are randomly disposed in the ventrolateral tegumentary region of the anterior third of the body. Addionally, based on SSU rDNA, a phylogenetic analysis including Brachycoeliidae and Mesocoeliidae taxa available on GenBank established the close relationship between M. lanfrediae sp. nov. and Mesocoelium sp. PMID:23579798

  14. A new species of Odorrana (Amphibia: Anura: Ranidae) from Vietnam.

    PubMed

    Pham, Cuong The; Nguyen, Truong Quang; Le, Minh Duc; Bonkowski, Michael; Ziegler, Thomas

    2016-02-26

    A new species of Odorrana is described from the karst forests in northeastern Vietnam based on morphological differences and molecular divergence. Morphologically, the new species is distinguishable from its congeners on the basis of a combination of the following diagnostic characters: (1) size large (SVL 85.9-91.6 mm in males, 108.7-110.1 mm in females); (2) head longer than wide; (3) vomerine teeth present; (4) external vocal sacs absent; (5) snout short (SL/SVL 0.16-0.17); (6) tympanum large (TD/ED 0.70 in males, 0.68 in females); (7) dorsal surface of head and anterior part of body smooth, posterior part of body and flanks with small tubercles; (8) supratympanic fold present; (9) dorsolateral fold absent; (10) webbing formula I0-0II0-0III0-1/2IV1/2-0V; (11) in life, dorsum green with dark brown spots; (12) flanks greyish brown with dark brown spots; (13) throat and chest grey, underside of limbs with large dark brown spots, edged in white, forming a network. In the phylogenetic analyses, the new species is unambiguously nested within the O. andersonii group, and placed as the sister taxon to O. wuchuanensis.

  15. The incretin hormone glucagon-like peptide 1 increases mitral cell excitability by decreasing conductance of a voltage-dependent potassium channel.

    PubMed

    Thiebaud, Nicolas; Llewellyn-Smith, Ida J; Gribble, Fiona; Reimann, Frank; Trapp, Stefan; Fadool, Debra Ann

    2016-05-15

    The gut hormone called glucagon-like peptide 1 (GLP-1) is a strong moderator of energy homeostasis and communication between the peripheral organs and the brain. GLP-1 signalling occurs in the brain; using a newly developed genetic reporter line of mice, we have discovered GLP-synthesizing cells in the olfactory bulb. GLP-1 increases the firing frequency of neurons (mitral cells) that encode olfactory information by decreasing activity of voltage-dependent K channels (Kv1.3). Modifying GLP-1 levels, either therapeutically or following the ingestion of food, could alter the excitability of neurons in the olfactory bulb in a nutrition or energy state-dependent manner to influence olfactory detection or metabolic sensing. The results of the present study uncover a new function for an olfactory bulb neuron (deep short axon cells, Cajal cells) that could be capable of modifying mitral cell activity through the release of GLP-1. This might be of relevance for the action of GLP-1 mimetics now widely used in the treatment of diabetes. The olfactory system is intricately linked with the endocrine system where it may serve as a detector of the internal metabolic state or energy homeostasis in addition to its classical function as a sensor of external olfactory information. The recent development of transgenic mGLU-yellow fluorescent protein mice that express a genetic reporter under the control of the preproglucagon reporter suggested the presence of the gut hormone, glucagon-like peptide (GLP-1), in deep short axon cells (Cajal cells) of the olfactory bulb and its neuromodulatory effect on mitral cell (MC) first-order neurons. A MC target for the peptide was determined using GLP-1 receptor binding assays, immunocytochemistry for the receptor and injection of fluorescence-labelled GLP-1 analogue exendin-4. Using patch clamp recording of olfactory bulb slices in the whole-cell configuration, we report that GLP-1 and its stable analogue exendin-4 increase the action potential

  16. Growth Arrest and DNA-damage-inducible Protein 45β-mediated DNA Demethylation of Voltage-dependent T-type Calcium Channel 3.2 Subunit Enhances Neuropathic Allodynia after Nerve Injury in Rats.

    PubMed

    Lai, Cheng-Yuan; Hsieh, Ming-Chun; Ho, Yu-Cheng; Lee, An-Sheng; Wang, Hsueh-Hsiao; Cheng, Jen-Kun; Chau, Yat-Pang; Peng, Hsien-Yu

    2017-06-01

    Growth arrest and DNA-damage-inducible protein 45β reactivates methylation-silenced neural plasticity-associated genes through DNA demethylation. However, growth arrest and DNA-damage-inducible protein 45β-dependent demethylation contributes to neuropathic allodynia-associated spinal plasticity remains unclear. Adult male Sprague-Dawley rats (654 out of 659) received a spinal nerve ligation or a sham operation with or without intrathecal application of one of the following: growth arrest and DNA-damage-inducible protein 45β messenger RNA-targeted small interfering RNA, lentiviral vector expressing growth arrest and DNA-damage-inducible protein 45β, Ro 25-6981 (an NR2B-bearing N-methyl-D-aspartate receptor antagonist), or KN-93 (a calmodulin-dependent protein kinase II antagonist) were used for behavioral measurements, Western blotting, immunofluorescence, dot blots, detection of unmodified cytosine enrichment at cytosine-phosphate-guanine site, chromatin immunoprecipitation quantitative polymerase chain reaction analysis, and slice recordings. Nerve ligation-enhanced growth arrest and DNA-damage-inducible protein 45β expression (n = 6) in ipsilateral dorsal horn neurons accompanied with behavioral allodynia (n = 7). Focal knockdown of growth arrest and DNA-damage-inducible protein 45β expression attenuated ligation-induced allodynia (n = 7) by reducing the binding of growth arrest and DNA-damage-inducible protein 45β to the voltage-dependent T-type calcium channel 3.2 subunit promoter (n = 6) that decreased expression of and current mediated by the voltage-dependent T-type calcium channel 3.2 subunit (both n = 6). In addition, NR2B-bearing N-methyl-D-aspartate receptors and calmodulin-dependent protein kinase II act in an upstream cascade to increase growth arrest and DNA-damage-inducible protein 45β expression, hence enhancing demethylation at the voltage-dependent T-type calcium channel 3.2 subunit promoter and up-regulating voltage-dependent T

  17. Co-localization of L-type voltage dependent calcium channel alpha 1D subunit (Ca(v)1.3) and calbindin (CB) in the mouse central nervous system.

    PubMed

    Xu, Jie Hua; Yang, Zhen Bang; Wang, Hui; Tang, Feng-Ru

    2014-02-21

    Previous study has shown that the co-localization of calbindin (CB) with L-type voltage dependent Ca(2+) channel (VDCC) alpha 1C subunit (Ca(v)1.2) in the rat insulinoma 1046-38 (RIN) beta cells may play an important regulatory role in Ca(2+) influx and exocytosis of insulin granules. In the present study, L-type voltage dependent Ca(2+) channel (VDCC) and calbindin (CB) were demonstrated in different regions of the mouse central nervous system (CNS). Double labeling immunofluorescence staining showed a co-localization of Ca(v)1.3 and CB. The co-localization of Ca(v)1.3 and CB in certain brain regions such as the hippocampus suggests their important roles in neuroplasticity. The relative high percentages of co-localization of Ca(v)1.3 with CB in the laminae II of the dorsal horn of the spinal cord indicate that the regulation mechanism of nociceptive transmission may be related with both VDCC and Ca(2+) binding protein.

  18. Morphology, ultrastructure and molecular characterisation of Spiroxys japonica Morishita, 1926 (Spirurida: Gnathostomatidae) from Pelophylax nigromaculatus (Hallowell) (Amphibia: Ranidae).

    PubMed

    Li, Liang; Hasegawa, Hideo; Roca, Vicente; Xu, Zhen; Guo, Yan-Ning; Sato, Akiko; Zhang, Lu-Ping

    2014-03-01

    Gnathostomatid nematodes identified morphologically as Spiroxys japonica Morishita, 1926 were collected from the dark-spotted frog Pelophylax nigromaculatus (Hallowell) (Amphibia: Ranidae) in China. Light and scanning electron microscopy were used to study the morphology of this species in detail. Previously unreported morphological features are revealed and others corrected. In addition, adult nematodes of S. japonica collected from P. nigromaculatus and Spiroxys hanzaki Hasegawa, Miyata & Doi, 1998 collected from Andrias japonicus (Temminck) (Caudata: Cryptobranchidae) in China and Japan, respectively, and the third-stage larva of S. japonica collected from Lithobates catesbeianus (Shaw) (Anura: Ranidae) in Japan, were characterised using molecular methods by sequencing and analysing ribosomal [large ribosomal DNA (18S) and internal transcribed space] and mitochondrial [cytochrome c oxidase subunit 1] target regions, respectively. The new morphological and genetic data contributes to a more accurate diagnosis of this hitherto little known nematode genus.

  19. Complete mitochondrial genome of the Seoul frog Rana chosenica (Amphibia, Ranidae): comparison of R. chosenica and R. plancyi.

    PubMed

    Ryu, Shi Hyun; Hwang, Ui Wook

    2011-06-01

    Here, we have sequenced the complete mitochondrial genome of the Seoul frog Rana chosenica (Amphibia, Ranidae), which is known as a Korean endemic species. It is listed as a vulnerable species by IUCN Red List and also an endangered species in South Korea. The complete mitochondrial genome of R. chosenica consists of 18,357 bp. Its gene arrangement pattern was identical with those of other Rana frogs. We compared the mitochondrial genome of R. chosenica with that of the Peking frog Rana plancyi that has been known closely related to R. chosenica. Nucleotide sequence similarity between the two whole mitochondrial genomes was 95.7%, and the relatively low similarity seems to indicate that the two species are distinctly separated on the species level. The information of mitochondrial genome comparison of the two species was discussed in detail.

  20. Montagnuphilones A-G, Azaphilones from Montagnulaceae sp. DM0194, a Fungal Endophyte of Submerged Roots of Persicaria amphibia.

    PubMed

    Luo, Jian-Guang; Xu, Ya-Ming; Sandberg, Dustin C; Arnold, A Elizabeth; Gunatilaka, A A Leslie

    2017-01-27

    Seven azaphilones, montagnuphilones A-G (1-7), together with previously known azaphilones 8-11, were encountered in Montagnulaceae sp. DM0194, an endophytic fungus isolated from submerged roots of Persicaria amphibia. The structures of 1-7 were elucidated on the basis of their MS and NMR spectroscopic analysis. Compounds 1-8 were evaluated for their cytotoxicity and ability to inhibit nitric oxide (NO) production in lipopolysaccharide-activated RAW264.7 macrophage cells. Among these, none were found to be cytotoxic to RAW264.7 cells up to 100.0 μM, but 8, 5, and 2 showed NO inhibitory activity with IC50 values of 9.2 ± 0.9, 25.5 ± 1.1, and 39.6 ± 1.8 μM, respectively.

  1. Carnosine in the brain and olfactory system of amphibia and reptilia: a comparative study using immunocytochemical and biochemical methods.

    PubMed

    Artero, C; Martì, E; Biffo, S; Mulatero, B; Andreone, C; Margolis, F L; Fasolo, A

    1991-09-16

    The pattern of distribution of carnosine-like immunoreactivity and its relation to glial fibrillary acidic protein immunoreactivity have been studied in two lizards (Gallotia galloti and Tarentola delalandii) and in two anuran amphibians (Rana esculenta and Xenopus laevis) using immunocytochemical techniques. Biochemical data obtained by paper electrophoresis show that the dipeptides carnosine and homocarnosine are both present in the brain of all the species examined. In the central nervous system of both anurans and reptilians, carnosine immunoreactivity is localized in glial cells. An important species difference is, however, seen in the olfactory system since primary olfactory neurons and their processes extending to the olfactory bulb are carnosine positive in reptiles, whereas they are not immunostained in anurans. Thus, the cellular distribution of carnosine immunoreactivity in reptilians is very similar to that observed in birds and mammals and is distinct from that seen in amphibia.

  2. Effects of a glyphosate-based herbicide on the development of Common toads (Bufo bufo L.; Amphibia) at different temperatures

    NASA Astrophysics Data System (ADS)

    Baier, Fabian; Gruber, Edith; Spangl, Bernhard; Zaller, Johann G.

    2016-04-01

    Herbicides based on the active ingredient glyphosate are frequently applied in agriculture, horticulture and private gardens all over the world. Recently, leaching of glyphosate or its metabolite (AMPA) into water bodies inhabited by amphibians has been reported. However, very little is known about non-target effects of these herbicides on amphibians and even less is known to what extent different temperatures might alter these effects. Using climate chambers, we investigated the effects of the glyphosate-based herbicide Roundup PowerFlex® (480 g L-1 glyphosate, formulated as 588 g L-1 potassium salt) on the larval development of Common toads (Bufo bufo L.; Amphibia: Anura) under different temperature regimes (15°C vs. 20°C). We established five herbicide concentrations: 0, 1.5, 3, 4 mg acid equivalent L-1 and a 4 mg a.e. L-1 pulse treatment (totally three applications of 1.5, 1.5 and another 1 mg a.e. L-1) at each temperature in a full-factorial design. Each treatment combination was replicated five times, the experiment ran for 24 days. Results showed a highly significant effect of temperature on body length and body width but no effect of herbicide concentration on these growth parameters. Moreover, highly significant interactions between herbicide and temperature on body length and body width were observed suggesting that herbicides had different effects on different temperatures. In conclusion, although Roundup PowerFlex® at the tested concentrations appeared to have no acute toxicity to larvae of Common toads, the observed effects on tadpole morphology will potentially affect competitive interactions in spawning ponds of amphibia. Our findings of herbicide x temperature interactions might become more prevalent when human-induced climate change will lead to more extreme temperatures.

  3. Immunohistochemical localization of insulin-like growth factor I and II in the endocrine pancreas of birds, reptiles, and amphibia.

    PubMed

    Reinecke, M; Broger, I; Brun, R; Zapf, J; Maake, C

    1995-12-01

    Immunoreactive insulin-like growth factors I and II (IGF-I, IGF-II) were sought in the endocrine pancreas of representative birds, reptiles, and amphibia using antisera specific for mammalian IGF-I and IGF-II and the classical islet hormones insulin (INS), glucagon (GLUC), somatostatin (SOM), and pancreatic polypeptide (PP) in double immunofluorescence. Both IGF-I and IGF-II immunoreactivities were present in the endocrine pancreas of all species. IGF-II immunoreactivity was exclusively found in INS-immunoreactive (-IR) cells, indicating evolutionary conservation of the islet IGF-II system. In contrast, IGF-I immunoreactivity was distributed differently among the species and never occurred in INS-IR cells. In the anuran Xenopus laevis, IGF-I immunoreactivity was present in islet cells showing coexistence of GLUC and PP immunoreactivities. In reptiles, the lizards (Lacerta viridis, Scincus officinalis) exhibited IGF-I immunoreactivity in PP-IR and SOM-IR cells and the snakes (Psamophis leniolatum, Coluber ravergieri) in SOM-IR and GLUC-IR cells. In birds, IGF-I immunoreactivity was located either in SOM-IR cells only (Gallus g. domesticus, Streptopelia roseogrisea) or in PP-IR and SOM-IR cells (Coturnix c. japonica). Thus, the distribution patterns of islet IGF-I immunoreactivities in birds, reptiles, and amphibia are equivalent to those in mammals and most bony fish. They differ, however, from those found in cartilaginous fish, cyclostomes, and protochordates, where a total or partial coexistence of IGF-I and INS immunoreactivities has been obtained. Therefore, the divergence of IGF-I and INS seems to have occurred early in vertebrate phylogeny. Furthermore, the existence of IGF-I immunoreactivity likely is common in the islets of all vertebrates. Finally, no phylogenetic trend to concentrate IGF-I immunoreactivity in a particular islet cell type is apparent.

  4. Chromosomal localization of the human genes for {alpha}{sub 1A}, {alpha}{sub 1B}, and {alpha}{sub 1E} voltage-dependent Ca{sup 2+} channel subunits

    SciTech Connect

    Diriong, S.; Lory, P.; Taviaux, S.

    1995-12-10

    The {alpha}{sub 1} subunit genes encoding voltage-dependent Ca{sup 2+} channels are members of a gene family. We have used human brain cDNA probes to localize the neuronal isoform genes CACNL1A4 ({alpha}{sub 1A}), CACNL1A5 ({alpha}{sub 1B}), and CACNL1A6 ({alpha}{sub 1E}) to 19p13, 9q34, and 1q25-q31, respectively, using fluorescene in situ hybridization on human chromosomes. These genes are particularly interesting gene candidates in the pathogenesis of neuronal disorders. Although genetic disorders have been linked to loci 9q34 and 19p13, no genetic disease related to Ca{sup 2+} signaling defects has yet been linked to these loci. 22 refs., 2 figs., 1 tab.

  5. Localization of the gene encoding the [alpha][sub 2]/[delta] subunit (CACNL2A) of the human skeletal muscle voltage-dependent Ca[sup 2+] channel to chromosome 7q21-q22 by somatic cell hybrid analysis

    SciTech Connect

    Powers, P.A.; Hogan, K.; Gregg, R.G. ); Scherer, S.W.; Tsui, L.C. Hospital for Sick Children, Ontario )

    1994-01-01

    Activation of voltage-dependent calcium channels (VDCCs) by membrane depolarization triggers key cellular responses such as contraction, secretion, excitation, and electrical signaling. The skeletal muscle L-type VDCC is a heteromultimer complex containing four subunits, [alpha][sub 1],[alpha][sub 2]/[delta],[beta][sub 1], and [gamma]. The [alpha][sub 2]/[delta] subunit, an integral component of the VDCC, appears to modulate the channel kinetics. The [alpha][sub 2]/[delta] gene is expressed in many tissues, including skeletal muscle, brain, heart, and lung, and cDNAs representing the skeletal muscle and brain isoforms have been isolated. DNA sequence comparisons indicate that these cDNAs are encoding by a single gene. 15 refs., 1 fig.

  6. Chronic hypoxia selectively enhances L- and T-type voltage-dependent Ca2+ channel activity in pulmonary artery by upregulating Cav1.2 and Cav3.2

    PubMed Central

    Wan, Jun; Yamamura, Aya; Zimnicka, Adriana M.; Voiriot, Guillaume; Smith, Kimberly A.; Tang, Haiyang; Ayon, Ramon J.; Choudhury, Moumita S. R.; Ko, Eun A.; Wang, Jun; Wang, Chen; Makino, Ayako

    2013-01-01

    Hypoxia-induced pulmonary hypertension (HPH) is characterized by sustained pulmonary vasoconstriction and vascular remodeling, both of which are mediated by pulmonary artery smooth muscle cell (PASMC) contraction and proliferation, respectively. An increase in cytosolic Ca2+ concentration ([Ca2+]cyt) is a major trigger for pulmonary vasoconstriction and an important stimulus for cell proliferation in PASMCs. Ca2+ influx through voltage-dependent Ca2+ channels (VDCC) is an important pathway for the regulation of [Ca2+]cyt. The potential role for L- and T-type VDCC in the development of HPH is still unclear. Using a hypoxic-induced pulmonary hypertension mouse model, we undertook this study to identify if VDCC in pulmonary artery (PA) are functionally upregulated and determine which type of VDCC are altered in HPH. Mice subjected to chronic hypoxia developed pulmonary hypertension within 4 wk, and high-K+- and U-46619-induced contraction of PA was greater in chronic hypoxic mice than that in normoxic control mice. Additionally, we demonstrate that high-K+- and U-46619-induced Ca2+ influx in PASMC is significantly increased in the hypoxic group. The VDCC activator, Bay K8864, induced greater contraction of the PA of hypoxic mice than in that of normoxic mice in isometric force measurements. L-type and T-type VDCC blockers significantly attenuated absolute contraction of the PA in hypoxic mice. Chronic hypoxia did not increase high-K+- and U-46619-induced contraction of mesenteric artery (MA). Compared with MA, PA displayed higher expression of calcium channel voltage-dependent L-type α1C-subunit (Cav1.2) and T-type α1H-subunit (Cav3.2) upon exposure to chronic hypoxia. In conclusion, both L-type and T-type VDCC were functionally upregulated in PA, but not MA, in HPH mice, which could result from selectively increased expression of Cav1.2 and Cav3.2. PMID:23686856

  7. Quantification of the Mg2+-induced potency shift of amantadine and memantine voltage-dependent block in human recombinant GluN1/GluN2A NMDARs.

    PubMed

    Otton, H J; Lawson McLean, A; Pannozzo, M A; Davies, C H; Wyllie, D J A

    2011-01-01

    Clinically, amantadine and memantine are drugs whose therapeutic utility is linked to their ability to block N-methyl-D-aspartate receptors (NMDARs) in a voltage-dependent manner. Nevertheless many studies that have characterized the pharmacological actions of amantadine and memantine have done so in the absence of physiological levels of Mg(2+) ions. This study quantifies the extent to which Mg(2+) alters the potency of the block produced by both amantadine and memantine at human recombinant GluN1/GluN2A NMDARs. Human recombinant GluN1/GluN2A NMDARs were expressed in Xenopus laevis oocytes and two-electrode voltage-clamp recordings were made at -80, -60 and -40 mV to quantify amantadine and memantine block in the absence and presence of Mg(2+). Amantadine and memantine blocked human GluN1/GluN2A NMDARs in a voltage-dependent manner with IC(50) values (at -80 mV) of 49 ± 6 μM (n = 7) and 1.0 ± 0.3 μM (n = 7), respectively. In the presence of Mg(2+) (1mM) the equivalent IC(50) values were 165 ± 10 μM (n=6) and 6.6 ± 0.3 μM (n = 5). Similarly in the presence of amantadine or memantine the potency of Mg(2+) in blocking GluN1/GluN2A NMDARs was reduced. The decrease in the potencies of both amantadine and memantine in the presence of physiological concentrations of Mg(2+) indicates that other targets (e.g. α7-nicotinic acetylcholine receptors and 5-HT(3) receptors) in addition to NMDARs may well be sites of the therapeutic action of these channel blockers.

  8. Characterization of the Ca2+-Gated and Voltage-Dependent K+-Channel Slo-1 of Nematodes and Its Interaction with Emodepside

    PubMed Central

    Kulke, Daniel; von Samson-Himmelstjerna, Georg; Miltsch, Sandra M.; Wolstenholme, Adrian J.; Jex, Aaron R.; Gasser, Robin B.; Ballesteros, Cristina; Geary, Timothy G.; Keiser, Jennifer; Townson, Simon; Harder, Achim; Krücken, Jürgen

    2014-01-01

    The cyclooctadepsipeptide emodepside and its parent compound PF1022A are broad-spectrum nematicidal drugs which are able to eliminate nematodes resistant to other anthelmintics. The mode of action of cyclooctadepsipeptides is only partially understood, but involves the latrophilin Lat-1 receptor and the voltage- and calcium-activated potassium channel Slo-1. Genetic evidence suggests that emodepside exerts its anthelmintic activity predominantly through Slo-1. Indeed, slo-1 deficient Caenorhabditis elegans strains are completely emodepside resistant. However, direct effects of emodepside on Slo-1 have not been reported and these channels have only been characterized for C. elegans and related Strongylida. Molecular and bioinformatic analyses identified full-length Slo-1 cDNAs of Ascaris suum, Parascaris equorum, Toxocara canis, Dirofilaria immitis, Brugia malayi, Onchocerca gutturosa and Strongyloides ratti. Two paralogs were identified in the trichocephalids Trichuris muris, Trichuris suis and Trichinella spiralis. Several splice variants encoding truncated channels were identified in Trichuris spp. Slo-1 channels of trichocephalids form a monophyletic group, showing that duplication occurred after the divergence of Enoplea and Chromadorea. To explore the function of a representative protein, C. elegans Slo-1a was expressed in Xenopus laevis oocytes and studied in electrophysiological (voltage-clamp) experiments. Incubation of oocytes with 1-10 µM emodepside caused significantly increased currents over a wide range of step potentials in the absence of experimentally increased intracellular Ca2+, suggesting that emodepside directly opens C. elegans Slo-1a. Emodepside wash-out did not reverse the effect and the Slo-1 inhibitor verruculogen was only effective when applied before, but not after, emodepside. The identification of several splice variants and paralogs in some parasitic nematodes suggests that there are substantial differences in channel properties among

  9. Characterization of the Ca2+-gated and voltage-dependent K+-channel Slo-1 of nematodes and its interaction with emodepside.

    PubMed

    Kulke, Daniel; von Samson-Himmelstjerna, Georg; Miltsch, Sandra M; Wolstenholme, Adrian J; Jex, Aaron R; Gasser, Robin B; Ballesteros, Cristina; Geary, Timothy G; Keiser, Jennifer; Townson, Simon; Harder, Achim; Krücken, Jürgen

    2014-12-01

    The cyclooctadepsipeptide emodepside and its parent compound PF1022A are broad-spectrum nematicidal drugs which are able to eliminate nematodes resistant to other anthelmintics. The mode of action of cyclooctadepsipeptides is only partially understood, but involves the latrophilin Lat-1 receptor and the voltage- and calcium-activated potassium channel Slo-1. Genetic evidence suggests that emodepside exerts its anthelmintic activity predominantly through Slo-1. Indeed, slo-1 deficient Caenorhabditis elegans strains are completely emodepside resistant. However, direct effects of emodepside on Slo-1 have not been reported and these channels have only been characterized for C. elegans and related Strongylida. Molecular and bioinformatic analyses identified full-length Slo-1 cDNAs of Ascaris suum, Parascaris equorum, Toxocara canis, Dirofilaria immitis, Brugia malayi, Onchocerca gutturosa and Strongyloides ratti. Two paralogs were identified in the trichocephalids Trichuris muris, Trichuris suis and Trichinella spiralis. Several splice variants encoding truncated channels were identified in Trichuris spp. Slo-1 channels of trichocephalids form a monophyletic group, showing that duplication occurred after the divergence of Enoplea and Chromadorea. To explore the function of a representative protein, C. elegans Slo-1a was expressed in Xenopus laevis oocytes and studied in electrophysiological (voltage-clamp) experiments. Incubation of oocytes with 1-10 µM emodepside caused significantly increased currents over a wide range of step potentials in the absence of experimentally increased intracellular Ca2+, suggesting that emodepside directly opens C. elegans Slo-1a. Emodepside wash-out did not reverse the effect and the Slo-1 inhibitor verruculogen was only effective when applied before, but not after, emodepside. The identification of several splice variants and paralogs in some parasitic nematodes suggests that there are substantial differences in channel properties among

  10. Common Gating of Both CLC Transporter Subunits Underlies Voltage-dependent Activation of the 2Cl−/1H+ Exchanger ClC-7/Ostm1*

    PubMed Central

    Ludwig, Carmen F.; Ullrich, Florian; Leisle, Lilia; Stauber, Tobias; Jentsch, Thomas J.

    2013-01-01

    CLC anion transporters form dimers that function either as Cl− channels or as electrogenic Cl−/H+ exchangers. CLC channels display two different types of “gates,” “protopore” gates that open and close the two pores of a CLC dimer independently of each other and common gates that act on both pores simultaneously. ClC-7/Ostm1 is a lysosomal 2Cl−/1H+ exchanger that is slowly activated by depolarization. This gating process is drastically accelerated by many CLCN7 mutations underlying human osteopetrosis. Making use of some of these mutants, we now investigate whether slow voltage activation of plasma membrane-targeted ClC-7/Ostm1 involves protopore or common gates. Voltage activation of wild-type ClC-7 subunits was accelerated by co-expressing an excess of ClC-7 subunits carrying an accelerating mutation together with a point mutation rendering these subunits transport-deficient. Conversely, voltage activation of a fast ClC-7 mutant could be slowed by co-expressing an excess of a transport-deficient mutant. These effects did not depend on whether the accelerating mutation localized to the transmembrane part or to cytoplasmic cystathionine-β-synthase (CBS) domains of ClC-7. Combining accelerating mutations in the same subunit did not speed up gating further. No currents were observed when ClC-7 was truncated after the last intramembrane helix. Currents and slow gating were restored when the C terminus was co-expressed by itself or fused to the C terminus of the β-subunit Ostm1. We conclude that common gating underlies the slow voltage activation of ClC-7. It depends on the CBS domain-containing C terminus that does not require covalent binding to the membrane domain of ClC-7. PMID:23983121

  11. Common gating of both CLC transporter subunits underlies voltage-dependent activation of the 2Cl-/1H+ exchanger ClC-7/Ostm1.

    PubMed

    Ludwig, Carmen F; Ullrich, Florian; Leisle, Lilia; Stauber, Tobias; Jentsch, Thomas J

    2013-10-04

    CLC anion transporters form dimers that function either as Cl(-) channels or as electrogenic Cl(-)/H(+) exchangers. CLC channels display two different types of "gates," "protopore" gates that open and close the two pores of a CLC dimer independently of each other and common gates that act on both pores simultaneously. ClC-7/Ostm1 is a lysosomal 2Cl(-)/1H(+) exchanger that is slowly activated by depolarization. This gating process is drastically accelerated by many CLCN7 mutations underlying human osteopetrosis. Making use of some of these mutants, we now investigate whether slow voltage activation of plasma membrane-targeted ClC-7/Ostm1 involves protopore or common gates. Voltage activation of wild-type ClC-7 subunits was accelerated by co-expressing an excess of ClC-7 subunits carrying an accelerating mutation together with a point mutation rendering these subunits transport-deficient. Conversely, voltage activation of a fast ClC-7 mutant could be slowed by co-expressing an excess of a transport-deficient mutant. These effects did not depend on whether the accelerating mutation localized to the transmembrane part or to cytoplasmic cystathionine-β-synthase (CBS) domains of ClC-7. Combining accelerating mutations in the same subunit did not speed up gating further. No currents were observed when ClC-7 was truncated after the last intramembrane helix. Currents and slow gating were restored when the C terminus was co-expressed by itself or fused to the C terminus of the β-subunit Ostm1. We conclude that common gating underlies the slow voltage activation of ClC-7. It depends on the CBS domain-containing C terminus that does not require covalent binding to the membrane domain of ClC-7.

  12. Potentiation of prolactin secretion following lactotrope escape from dopamine action. II. Phosphorylation of the alpha(1) subunit of L-type, voltage-dependent calcium channels.

    PubMed

    Hernández, M E; del Mar Hernández, M; Díaz-Muñoz, M; Clapp, C; de la Escalera, G M

    1999-07-01

    Modulation of Ca(2+) channels has been shown to alter cellular functions. It can play an important role in the amplification of signals in the endocrine system, including the pleiotropically regulated pituitary lactotropes. Prolactin (PRL) secretion is tonically inhibited by dopamine (DA), the escape from which triggers acute episodes of hormone secretion. The magnitude of these episodes is explained by a potentiation of the PRL-releasing action of secretagogues such as thyrotropin-releasing hormone (TRH). While the mechanisms of this potentiation are not fully understood, it is known to be mimicked by the dihydropyridine, L-type Ca(2+) channel agonist Bay K 8644 and blocked by nifedipine and methoxyverapamil. The potentiation is also blocked by inhibitors of cyclic AMP-dependent protein kinase and protein kinase C. We recently described that the escape from tonic actions of DA results in increased macroscopic Ca(2+) currents in GH(4)C(1) lactotropic clonal cells transfected with a cDNA encoding the long form of the human D(2)-DA receptor. Here we show that the withdrawal from DA potentiates the PRL-releasing action of TRH in GH(4)C(1)/D(2)-DAR cells to the same extent as in enriched lactotropes in primary culture. In both experimental models a low density of dihydropyridine receptors was shown by (+)-[(3)H]PN200-110 binding. Photoaffinity labelling with the dihydropyridine [(3)H]azidopine revealed a protein consistent with the alpha(1) subunit of L-type Ca(2+) channels of 165-170 kDa. In both experimental models, the facilitation of TRH action triggered by the escape from DA was correlated with an enhanced rate of phosphorylation of this putative alpha(1) subunit, the nature of which was further supported by immunoprecipitation with selective antibodies directed against the alpha(1C) and alpha(1D) subunit of voltage-gated calcium channels. We propose that PKA- and PKC-dependent phosphorylation of the alpha(1) subunit of high voltage activated, L-type Ca(2

  13. Regulation of Voltage-Dependent Channel Function

    DTIC Science & Technology

    1988-08-01

    Tempeqrgature__effects on the elect rical proerie of I.. and._I We have done research on maricultured Aplygia during the last three summers. The reproducibility...obtained from mariculture alcohol and temperature upon lipid lateral diffusi- facilities at the Marine Biological Laboratory at bility in the plasma

  14. Chronic hypoxia selectively enhances L- and T-type voltage-dependent Ca2+ channel activity in pulmonary artery by upregulating Cav1.2 and Cav3.2.

    PubMed

    Wan, Jun; Yamamura, Aya; Zimnicka, Adriana M; Voiriot, Guillaume; Smith, Kimberly A; Tang, Haiyang; Ayon, Ramon J; Choudhury, Moumita S R; Ko, Eun A; Wang, Jun; Wang, Chen; Makino, Ayako; Yuan, Jason X-J

    2013-07-15

    Hypoxia-induced pulmonary hypertension (HPH) is characterized by sustained pulmonary vasoconstriction and vascular remodeling, both of which are mediated by pulmonary artery smooth muscle cell (PASMC) contraction and proliferation, respectively. An increase in cytosolic Ca²⁺ concentration ([Ca²⁺]cyt) is a major trigger for pulmonary vasoconstriction and an important stimulus for cell proliferation in PASMCs. Ca²⁺ influx through voltage-dependent Ca²⁺ channels (VDCC) is an important pathway for the regulation of [Ca²⁺]cyt. The potential role for L- and T-type VDCC in the development of HPH is still unclear. Using a hypoxic-induced pulmonary hypertension mouse model, we undertook this study to identify if VDCC in pulmonary artery (PA) are functionally upregulated and determine which type of VDCC are altered in HPH. Mice subjected to chronic hypoxia developed pulmonary hypertension within 4 wk, and high-K⁺- and U-46619-induced contraction of PA was greater in chronic hypoxic mice than that in normoxic control mice. Additionally, we demonstrate that high-K⁺- and U-46619-induced Ca²⁺ influx in PASMC is significantly increased in the hypoxic group. The VDCC activator, Bay K8864, induced greater contraction of the PA of hypoxic mice than in that of normoxic mice in isometric force measurements. L-type and T-type VDCC blockers significantly attenuated absolute contraction of the PA in hypoxic mice. Chronic hypoxia did not increase high-K⁺- and U-46619-induced contraction of mesenteric artery (MA). Compared with MA, PA displayed higher expression of calcium channel voltage-dependent L-type α1C-subunit (Cav1.2) and T-type α1H-subunit (Cav3.2) upon exposure to chronic hypoxia. In conclusion, both L-type and T-type VDCC were functionally upregulated in PA, but not MA, in HPH mice, which could result from selectively increased expression of Cav1.2 and Cav3.2.

  15. Trans-Channel Interactions in Batrachotoxin-Modified Skeletal Muscle Sodium Channels: Voltage-Dependent Block by Cytoplasmic Amines, and the Influence of μ-Conotoxin GIIIA Derivatives and Permeant Ions

    PubMed Central

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.

    2008-01-01

    External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222

  16. Ornithodoros faccinii n. sp. (Acari: Ixodida: Argasidae) parasitizing the frog Thoropa miliaris (Amphibia: Anura: Cycloramphidae) in Brazil.

    PubMed

    Barros-Battesti, Darci Moraes; Landulfo, Gabriel Alves; Luz, Hermes Ribeiro; Marcili, Arlei; Onofrio, Valeria Castilho; Famadas, Kátia Maria

    2015-05-13

    Most argasid ticks from the Neotropical region are parasites of mammals and birds, with a few records from reptiles. Many species of the genus Ornithodoros are known only through larval descriptions, and their chaetotaxy and morphological characteristics have been used to separate the taxa. In the present study, we describe the larva and the nymph of first instar of a new species of the genus Ornithodoros that was collected from frogs of the species Thoropa miliaris. Larvae of Ornithodoros were collected from frogs of the species T. miliaris at waterfalls in the state of Rio de Janeiro, southeastern Brazil. The larval and nymphal description was based on optical and scanning electron microscopy. Molecular analysis using the argasid 16S rRNA sequences available in GenBank was also conducted. Ornithodoros faccinii sp. n. is closely related to Ornithodoros clarki Jones & Clifford, Ornithodoros marinkellei Kohls, Clifford & Jones, Ornithodoros capensis Neumann and Ornithodoros sawaii Kitaoka & Susuki. However, the larval morphology of the new species is unique. The mitochondrial 16S rDNA partial sequence of O. faccinii generated in the present study was deposited in GenBank under the number KP861242. The larvae collected from Thoropa miliaris are a new species, Ornithodoros faccinii n. sp. This is the first report of argasid ticks on frogs in Brazil, the second on frogs and the third on Amphibia in the Neotropical region.

  17. CLONING AND EXPRESSION OF THE TRANSLOCATOR PROTEIN (18 KDA), VOLTAGE-DEPENDENT ANION CHANNEL, AND DIAZEPAM BINDING INHIBITOR IN THE GONAD OF LARGEMOUTH BASS (MICROPTERUS SALMOIDES) ACROSS THE REPRODUCTIVE CYCLE

    PubMed Central

    Doperalski, Nicholas J.; Martyniuk, Christopher J.; Prucha, Melinda S.; Kroll, Kevin J.; Denslow, Nancy D.; Barber, David S.

    2011-01-01

    Cholesterol transport across the mitochondrial membrane is rate-limiting for steroidogenesis in vertebrates. Previous studies in fish have characterized expression of the steroidogenic acute regulatory protein, however the function and regulation of other genes and proteins involved in piscine cholesterol transport have not been evaluated. In the current study, mRNA sequences of the 18 kDa translocator protein (tspo; formerly peripheral benzodiazepine receptor), voltage-dependent anion channel (vdac), and diazepam binding inhibitor (dbi; also acyl-CoA binding protein) were cloned from largemouth bass. Gonadal expression was examined across reproductive stages to determine if expression is correlated with changes in steroid levels and with indicators of reproductive maturation. In testis, transcript abundance of tspo and dbi increased with reproductive maturation (6- and 23-fold maximal increase, respectively) and expression of tspo and dbi was positively correlated with reproductive stage, gonadosomatic index (GSI), and circulating levels of testosterone. Testis vdac expression was positively correlated with reproductive stage and GSI. In females, gonadal tspo and vdac expression was negatively correlated with GSI and levels of plasma testosterone and 17β-estradiol. Ovarian dbi expression was not correlated with indicators of reproductive maturation. These studies represent the first investigation of the steroidogenic role of tspo, vdac, and dbi in fish. Findings suggest that cholesterol transport in largemouth bass testis, but not ovary, may be transcriptionally-regulated, however further investigation will be necessary to fully elucidate the role of these genes in largemouth bass steroidogenesis. PMID:21600210

  18. Airway Surface Dehydration by Transforming Growth Factor β (TGF-β) in Cystic Fibrosis Is Due to Decreased Function of a Voltage-dependent Potassium Channel and Can Be Rescued by the Drug Pirfenidone*

    PubMed Central

    Manzanares, Dahis; Krick, Stefanie; Baumlin, Nathalie; Dennis, John S.; Tyrrell, Jean; Tarran, Robert; Salathe, Matthias

    2015-01-01

    Transforming growth factor β1 (TGF-β1) is not only elevated in airways of cystic fibrosis (CF) patients, whose airways are characterized by abnormal ion transport and mucociliary clearance, but TGF-β1 is also associated with worse clinical outcomes. Effective mucociliary clearance depends on adequate airway hydration, governed by ion transport. Apically expressed, large-conductance, Ca2+- and voltage-dependent K+ (BK) channels play an important role in this process. In this study, TGF-β1 decreased airway surface liquid volume, ciliary beat frequency, and BK activity in fully differentiated CF bronchial epithelial cells by reducing mRNA expression of the BK γ subunit leucine-rich repeat-containing protein 26 (LRRC26) and its function. Although LRRC26 knockdown itself reduced BK activity, LRRC26 overexpression partially reversed TGF-β1-induced BK dysfunction. TGF-β1-induced airway surface liquid volume hyper-absorption was reversed by the BK opener mallotoxin and the clinically useful TGF-β signaling inhibitor pirfenidone. The latter increased BK activity via rescue of LRRC26. Therefore, we propose that TGF-β1-induced mucociliary dysfunction in CF airways is associated with BK inactivation related to a LRRC26 decrease and is amenable to treatment with clinically useful TGF-β1 inhibitors. PMID:26338706

  19. Genotypic to expression profiling of bovine calcium channel, voltage-dependent, alpha-2/delta subunit 1 gene, and their association with bovine mastitis among Frieswal (HFX Sahiwal) crossbred cattle of Indian origin.

    PubMed

    Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava

    2014-04-03

    Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.

  20. On the Frequency and Voltage-Dependent Profiles of the Surface States and Series Resistance of Au/ZnO/n-Si Structures in a Wide Range of Frequency and Voltage

    NASA Astrophysics Data System (ADS)

    Nikravan, Afsoun; Badali, Yosef; Altındal, Şemsettin; Uslu, İbrahim; Orak, İkram

    2017-06-01

    In order to interpret the electrical characteristics of fabricated Au/ZnO/n-Si structures as a function of frequency and voltage well, their capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements were carried out in a wide range of frequencies (0.7 kHz-2 MHz) and voltages (± 6 V) by 50 mV steps at room temperature. Both the C-V and G/ω-V plots have reverse, depletion, and accumulation regions such as a metal-insulator/oxide semiconductor (MIS or MOS) structures. The values of doped-donor atoms (N D), Fermi energy level (E F), barrier height (ΦB), and series resistance (R s) of the structure were obtained as a function of frequency and voltage. While the value of N D decreases with increasing frequency almost as exponentially, the value of depletion width (W D) increases. The values of C and G/ω increase with decreasing frequency because the surface states (N ss) are able to follow the alternating current (AC) signal, resulting in excess capacitance (C ex) and conductance (G ex/ω), which depends on their relaxation time and the frequency of the AC signal. The voltage-dependent profiles of N ss were obtained from both the high-low frequency capacitance and Hill-Colleman methods. The other important parameter R s of the structure was also obtained from the Nicollian and Brews methods as a function of voltage.

  1. On the Frequency and Voltage-Dependent Profiles of the Surface States and Series Resistance of Au/ZnO/n-Si Structures in a Wide Range of Frequency and Voltage

    NASA Astrophysics Data System (ADS)

    Nikravan, Afsoun; Badali, Yosef; Altındal, Şemsettin; Uslu, İbrahim; Orak, İkram

    2017-10-01

    In order to interpret the electrical characteristics of fabricated Au/ZnO/n-Si structures as a function of frequency and voltage well, their capacitance-voltage ( C- V) and conductance-voltage ( G/ ω- V) measurements were carried out in a wide range of frequencies (0.7 kHz-2 MHz) and voltages (± 6 V) by 50 mV steps at room temperature. Both the C- V and G/ ω- V plots have reverse, depletion, and accumulation regions such as a metal-insulator/oxide semiconductor (MIS or MOS) structures. The values of doped-donor atoms ( N D), Fermi energy level ( E F), barrier height (ΦB), and series resistance ( R s) of the structure were obtained as a function of frequency and voltage. While the value of N D decreases with increasing frequency almost as exponentially, the value of depletion width ( W D) increases. The values of C and G/ ω increase with decreasing frequency because the surface states ( N ss) are able to follow the alternating current (AC) signal, resulting in excess capacitance ( C ex) and conductance ( G ex/ ω), which depends on their relaxation time and the frequency of the AC signal. The voltage-dependent profiles of N ss were obtained from both the high-low frequency capacitance and Hill-Colleman methods. The other important parameter R s of the structure was also obtained from the Nicollian and Brews methods as a function of voltage.

  2. The activity of cAMP-dependent protein kinase is required at a posttranslational level for induction of voltage-dependent sodium channels by peptide growth factors in PC12 cells

    PubMed Central

    1992-01-01

    The synthesis and expression of voltage-dependent sodium (Na) channels is a crucial aspect of neuronal differentiation because of the central role these ion channels play in the generation of action potentials and the transfer of information in the nervous system. We have used rat pheochromocytoma (PC12) cell lines deficient in cAMP-dependent protein kinase (PKA) activity to examine the role of PKA in the induction of Na channel expression by nerve growth factor (NGF) and basic FGF (bFGF). In the parental PC12 cell line both NGF and bFGF elicit an increase in the density of functional Na channels, as determined from whole-cell patch clamp recordings. This increase does not occur in two PC12 cell lines deficient in both isozymes of PKA (PKAI and PKAII), and is strongly reduced in a third line deficient in PKAII, but not PKAI. Despite the inability of the neurotrophic factors to induce functional Na channel expression in the PKA-deficient cells, Northern blot hybridization studies and saxitoxin binding assays of intact cells indicate that NGF and bFGF are still capable of eliciting increases in both Na channel mRNA and Na channel protein in the membrane. Thus, PKA activity appears to be necessary at a posttranslational step in the synthesis and expression of functional Na channels, and thereby plays an important role in determining neuronal excitability. PMID:1311713

  3. Frequency and voltage dependence of electric and dielectric properties of Au/TiO2/n-4H-SiC (metal-insulator-semiconductor) type Schottky barrier diodes

    NASA Astrophysics Data System (ADS)

    Tanrıkulu, E. E.; Yıldız, D. E.; Günen, A.; Altındal, Ş.

    2015-09-01

    The main electrical and dielectric properties of Au/TiO2/n-4H-SiC (MIS) type Schottky barrier diodes (SBDs) have been investigated as functions of frequency and applied bias voltage. We believe that the use of high dielectric interfacial layer between metal and semiconductor can improve the performance of Schottky diodes. From the experimental data, both electrical and dielectric parameters were found as strong function of frequency and applied bias voltage. The Fermi energy level (EF), the concentration of doping donor atoms (P), barrier height (ΦB) and series resistance (Rs) values were obtained from reverse and forward bias C-V characteristics. The changes in EF and ND with frequency are considerably low. Therefore, their values were taken at about constant. The real and imaginary parts of dielectric constant (\\varepsilon \\prime , \\varepsilon \\prime\\prime ), tangent loss (tanδ), ac electrical conductivity (σac), and real and imaginary parts of electric modulus (M‧ and M″) values were also obtained from reverse and forward bias C-V and G/ω-V characteristics. In addition, the voltage dependent profiles of all these electrical and dielectric parameters were drawn for each frequency. These results confirmed that both electrical and dielectric properties of Au/TiO2/n-4H-SiC (MIS) type SBD are quite sensitive to both the frequency and applied bias voltage due to surface polarization, density distribution of interface traps (Dit), and interfacial layer.

  4. Cloning and expression of the translocator protein (18 kDa), voltage-dependent anion channel, and diazepam binding inhibitor in the gonad of largemouth bass (Micropterus salmoides) across the reproductive cycle.

    PubMed

    Doperalski, Nicholas J; Martyniuk, Christopher J; Prucha, Melinda S; Kroll, Kevin J; Denslow, Nancy D; Barber, David S

    2011-08-01

    Cholesterol transport across the mitochondrial membrane is rate-limiting for steroidogenesis in vertebrates. Previous studies in fish have characterized expression of the steroidogenic acute regulatory protein, however the function and regulation of other genes and proteins involved in piscine cholesterol transport have not been evaluated. In the current study, mRNA sequences of the 18 kDa translocator protein (tspo; formerly peripheral benzodiazepine receptor), voltage-dependent anion channel (vdac), and diazepam binding inhibitor (dbi; also acyl-CoA binding protein) were cloned from largemouth bass. Gonadal expression was examined across reproductive stages to determine if expression is correlated with changes in steroid levels and with indicators of reproductive maturation. In testis, transcript abundance of tspo and dbi increased with reproductive maturation (6- and 23-fold maximal increase, respectively) and expression of tspo and dbi was positively correlated with reproductive stage, gonadosomatic index (GSI), and circulating levels of testosterone. Testis vdac expression was positively correlated with reproductive stage and GSI. In females, gonadal tspo and vdac expression was negatively correlated with GSI and levels of plasma testosterone and 17β-estradiol. Ovarian dbi expression was not correlated with indicators of reproductive maturation. These studies represent the first investigation of the steroidogenic role of tspo, vdac, and dbi in fish. Findings suggest that cholesterol transport in largemouth bass testis, but not in ovary, may be transcriptionally-regulated, however further investigation will be necessary to fully elucidate the role of these genes in largemouth bass steroidogenesis.

  5. Actions of Two Main Metabolites of Propiverine (M-1 and M-2) on Voltage-Dependent L-Type Ca2+ Currents and Ca2+ Transients in Murine Urinary Bladder Myocytes

    PubMed Central

    Zhu, Hai-Lei; Brain, Keith L.; Aishima, Manami; Shibata, Atsushi; Young, John S.; Sueishi, Katsuo; Teramoto, Noriyoshi

    2008-01-01

    The anticholinergic propiverine, used for the treatment of overactive bladder (OAB) syndrome, has functionally active metabolites (M-1 and M-2), but the site of actions of these metabolites is uncertain. Propiverine is rapidly absorbed after oral administration and is extensively biotransformed in the liver, giving rise to several active metabolites (M-1, the propiverine N-oxide, and M-2, the N-oxide lacking the aliphatic side chain). This study determines the effect of M-1 and M-2 on voltage-dependent nifedipine-sensitive inward Ca2+ currents (ICa) using patch-clamp techniques and fluorescent Ca2+ imaging (following electrical field stimulation (EFS) and acetylcholine (ACh)) in the murine urinary bladder. In conventional whole-cell recording, propiverine and M-1 but not M-2 inhibited the peak amplitude of ICa in a concentration-dependent manner at a holding potential of −60 mV (propiverine, Ki = 10 μM; M-1, Ki = 118 μM). M-1 shifted the steady-state inactivation curve of ICa to the left at −90 mV by 7 mV. Carbachol (CCh) reversibly inhibited ICa. This inhibition probably occurred through muscarinic type 3 receptors, coupling with G-proteins, since nanomolar concentrations of 4-DAMP greatly reduced this inhibition, while pirenzepine or AF-DX 116 at concentrations up to 1 μM were almost ineffective. In the presence of M-2, the CCh-induced inhibition of ICa was blocked. In fluorescent Ca2+ imaging, M-2 inhibited EFS-induced and ACh-induced Ca2+ transients. These results suggest that M-1 acts, at least in part, as a Ca2+ channel antagonist (as it inhibited ICa), while M-2 has more direct antimuscarinic actions. PMID:17928569

  6. Dissecting the age-related decline on spatial learning and memory tasks in rodent models: N-methyl-D-aspartate receptors and voltage-dependent Ca2+ channels in senescent synaptic plasticity

    PubMed Central

    Foster, Thomas C.

    2012-01-01

    In humans, heterogeneity in the decline of hippocampal-dependent episodic memory is observed during aging. Rodents have been employed as models of age-related cognitive decline and the spatial water maze has been used to show variability in the emergence and extent of impaired hippocampal-dependent memory. Impairment in the consolidation of intermediate-term memory for rapidly acquired and flexible spatial information emerges early, in middle-age. As aging proceeds, deficits may broaden to include impaired incremental learning of a spatial reference memory. The extent and time course of impairment has been be linked to senescence of calcium (Ca2+) regulation and Ca2+-dependent synaptic plasticity mechanisms in region CA1. Specifically, aging is associated with altered function of N-methyl-D-aspartate receptors (NMDARs), voltage-dependent Ca2+ channels (VDCCs), and ryanodine receptors (RyRs) linked to intracellular Ca2+ stores (ICS). In young animals, NMDAR activation induces long-term potentiation of synaptic transmission (NMDAR-LTP), which is thought to mediate the rapid consolidation of intermediate-term memory. Oxidative stress, starting in middle-age, reduces NMDAR function. In addition, VDCCs and ICS can actively inhibit NMDAR-dependent LTP and oxidative stress enhances the role of VDCC and RyR-ICS in regulating synaptic plasticity. Blockade of L-type VDCCs promotes NMDAR-LTP and memory in older animals. Interestingly, pharmacological or genetic manipulations to reduce hippocampal NMDAR function readily impair memory consolidation or rapid learning, generally leaving incremental learning intact. Finally, evidence is mounting to indicate a role for VDCC-dependent synaptic plasticity in associative learning and the consolidation of remote memories. Thus, VDCC-dependent synaptic plasticity and extrahippocampal systems may contribute to incremental learning deficits observed with advanced aging. PMID:22307057

  7. Cannabinoid receptor type 1 activation by arachidonylcyclopropylamide in rat aortic rings causes vasorelaxation involving calcium-activated potassium channel subunit alpha-1 and calcium channel, voltage-dependent, L type, alpha 1C subunit.

    PubMed

    Sánchez-Pastor, E; Andrade, F; Sánchez-Pastor, J M; Elizalde, A; Huerta, M; Virgen-Ortiz, A; Trujillo, X; Rodríguez-Hernández, A

    2014-04-15

    Cannabinoids are key regulators of vascular tone, some of the mechanisms involved include the activation of cannabinoid receptor types 1 and 2 (CB); the transient receptor potential cation channel, subfamily V, member 1 (TRPV1); and non-(CB(1))/non-CB2 receptors. Here, we used the potent, selective CB(1) agonist arachidonylcyclopropylamide (ACPA) to elucidate the mechanism underlying vascular tone regulation. Immunohistochemistry and confocal microscopy revealed that CB(1) was expressed in smooth muscle and endothelial cells in rat aorta. We performed isometric tension recordings in aortic rings that had been pre-contracted with phenylephrine. In these conditions, ACPA caused vasorelaxation in an endothelium-independent manner. To confirm that the effect of ACPA was mediated by CB(1) receptor, we repeated the experiment after blocking these receptors with a selective antagonist, AM281. In these conditions, ACPA did not cause vasorelaxation. We explored the role of K(+) channels in the effect of ACPA by applying high-K(+) solution to induce contraction in aortic rings. In these conditions, the ACPA-induced vasorelaxation was about half that observed with phenylephrine-induced contraction. Thus, K(+) channels were involved in the ACPA effect. Furthermore, the vasorelaxation effect was similarly reduced when we specifically blocked calcium-activated potassium channel subunit alpha-1 (KCa1.1) (MaxiK; BKCa) prior to adding ACPA. Finally, ACPA-induced vasorelaxation was also diminished when we specifically blocked the calcium channel, voltage-dependent, L type, alpha 1C subunit (Ca(v)1.2). These results showed that ACPA activation of CB(1) in smooth muscle caused vasorelaxation of aortic rings through a mechanism involving the activation of K(Ca)1.1 and the inhibition of Ca(v)1.2.

  8. Quantitative Localization of Cav2.1 (P/Q-Type) Voltage-Dependent Calcium Channels in Purkinje Cells: Somatodendritic Gradient and Distinct Somatic Coclustering with Calcium-Activated Potassium Channels

    PubMed Central

    Indriati, Dwi Wahyu; Kamasawa, Naomi; Matsui, Ko; Meredith, Andrea L.; Watanabe, Masahiko; Shigemoto, Ryuichi

    2014-01-01

    P/Q-type voltage-dependent calcium channels play key roles in transmitter release, integration of dendritic signals, generation of dendritic spikes, and gene expression. High intracellular calcium concentration transient produced by these channels is restricted to tens to hundreds of nanometers from the channels. Therefore, precise localization of these channels along the plasma membrane was long sought to decipher how each neuronal cell function is controlled. Here, we analyzed the distribution of Cav2.1 subunit of the P/Q-type channel using highly sensitive SDS-digested freeze-fracture replica labeling in the rat cerebellar Purkinje cells. The labeling efficiency was such that the number of immunogold particles in each parallel fiber active zone was comparable to that of functional channels calculated from previous reports. Two distinct patterns of Cav2.1 distribution, scattered and clustered, were found in Purkinje cells. The scattered Cav2.1 had a somatodendritic gradient with the density of immunogold particles increasing 2.5-fold from soma to distal dendrites. The other population with 74-fold higher density than the scattered particles was found within clusters of intramembrane particles on the P-face of soma and primary dendrites. Both populations of Cav2.1 were found as early as P3 and increased in the second postnatal week to a mature level. Using double immunogold labeling, we found that virtually all of the Cav2.1 clusters were colocalized with two types of calcium-activated potassium channels, BK and SK2, with the nearest neighbor distance of ~40 nm. Calcium nanodomain created by the opening of Cav2.1 channels likely activates the two channels that limit the extent of depolarization. PMID:23426693

  9. Static osteogenesis does not precede dynamic osteogenesis in periosteal ossification of Pleurodeles (Caudata, Amphibia) and Pogona (Squamata, Lepidosauria).

    PubMed

    Cubo, Jorge; Hui, Mylaine; Clarac, François; Quilhac, Alexandra

    2017-02-01

    Two successive mechanisms have been described in perichondral ossification: (1) in static osteogenesis, mesenchymal cells differentiate into stationary osteoblasts oriented randomly, which differentiate into osteocytes in the same site; (2) in dynamic osteogenesis, mesenchymal cells differentiate into osteoblasts that are all oriented in the same direction and move back as they secrete collagen fibers. This study is aimed at testing the hypothesis that the ontogenetic sequence static then dynamic osteogenesis observed in the chicken and in the rabbit is homologous and was acquired by the last common ancestor of amniotes or at a more inclusive node. For this we analyze the developmental patterns of Pleurodeles (Caudata, Amphibia) and those of the lizard Pogona (Squamata, Lepidosauria). We processed Pleurodeles larvae and Pogona embryos, prepared thin and ultrathin sections of appendicular bones, and analyzed them using light and transmission electron microscopy. We show that static osteogenesis does not precede dynamic osteogenesis in periosteal ossification of Pleurodeles and Pogona. Therefore, the null hypothesis is rejected and according to the parsimony method the ontogenetic sequence observed in the chicken and in the rabbit are convergent. In Pleurodeles and Pogona dynamic osteogenesis occur without a previous rigid mineralized framework, whereas in the chicken and in the rabbit dynamic osteogenesis seems to take place over a mineralized support whether bone (in perichondral ossification) or calcified cartilage (in endochondral ossification). Interestingly, in typical dynamic osteogenesis, osteoblasts show an axis (basal nucleus-distal endoplasmic reticulum) perpendicular to the front of secreted unmineralized bone matrix, whereas in Pleurodeles and Pogona this axis is parallel to the bone matrix.

  10. Blockade of T-type voltage-dependent Ca2+ channels by benidipine, a dihydropyridine calcium channel blocker, inhibits aldosterone production in human adrenocortical cell line NCI-H295R.

    PubMed

    Akizuki, Osamu; Inayoshi, Atsushi; Kitayama, Tetsuya; Yao, Kozo; Shirakura, Shiro; Sasaki, Katsutoshi; Kusaka, Hideaki; Matsubara, Masahiro

    2008-04-28

    Benidipine, a long-lasting dihydropyridine calcium channel blocker, is used for treatment of hypertension and angina. Benidipine exerts pleiotropic pharmacological features, such as renoprotective and cardioprotective effects. In pathophysiological conditions, the antidiuretic hormone aldosterone causes development of renal and cardiovascular diseases. In adrenal glomerulosa cells, aldosterone is produced in response to extracellular potassium, which is mainly mediated by T-type voltage-dependent Ca2+ channels. More recently, it has been demonstrated that benidipine inhibits T-type Ca2+ channels in addition to L-type Ca2+ channels. Therefore, effect of calcium channel blockers, including benidipine, on aldosterone production and T-type Ca2+ channels using human adrenocortical cell line NCI-H295R was investigated. Benidipine efficiently inhibited KCl-induced aldosterone production at low concentration (3 and 10 nM), with inhibitory activity more potent than other calcium channel blockers. Patch clamp analysis indicated that benidipine concentration-dependently inhibited T-type Ca2+ currents at 10, 100 and 1000 nM. As for examined calcium channel blockers, inhibitory activity for T-type Ca2+ currents was well correlated with aldosterone production. L-type specific calcium channel blockers calciseptine and nifedipine showed no effect in both assays. These results indicate that inhibition of T-type Ca2+ channels is responsible for inhibition of aldosterone production in NCI-H295R cells. Benidipine efficiently inhibited KCl-induced upregulation of 11-beta-hydroxylase mRNA and aldosterone synthase mRNA as well as KCl-induced Ca2+ influx, indicating it as the most likely inhibition mechanism. Benidipine partially inhibited angiotensin II-induced aldosterone production, plus showed additive effects when used in combination with the angiotensin II type I receptor blocker valsartan. Benidipine also partially inhibited angiotensin II-induced upregulation of the above m

  11. A new species of Rhabdias Stiles et Hassall, 1905 (Nematoda: Rhabdiasidae) from Blommersia domerguei (Guibé) (Amphibia: Mantellidae) in Madagascar.

    PubMed

    Kuzmin, Yuriy; Junker, Kerstin; du Preez, Louis; Bain, Odile

    2013-11-01

    Rhabdias blommersiae sp. n. (Nematoda: Rhabdiasidae) is described from the lungs of Domergue's Madagascar frog, Blommersia domerguei (Guibé) (Amphibia: Mantellidae), in Madagascar. The new species differs from congeners parasitizing amphibians in having a smaller body and buccal capsule, six equal lips, large excretory glands of unequal length and a posteriorly inflated body vesicle. A combination of characters distinguishes it from Afromalagasy species of Rhabdias Stiles et Hassall, 1905. Rhabdias blommersiae is the third species of the genus described from amphibians in Madagascar. Close similarities in the number and shape of circumoral structures in two Rhabdias species described from mantellid hosts in Madagascar suggest a close relationship and common origin of the two species, with subsequent adaptation to separate hosts within the Mantellidae.

  12. Phylogenetic relationships of Oriental torrent frogs in the genus Amolops and its allies (Amphibia, Anura, Ranidae).

    PubMed

    Matsui, Masafumi; Shimada, Tomohiko; Liu, Wan-Zhao; Maryati, Mohamed; Khonsue, Wichase; Orlov, Nikolai

    2006-03-01

    We investigated the phylogenetic relationships among 20 species of Oriental torrent frogs in the genus Amolops and its allies from China and Southeast Asia based on 1346-bp sequences of the mitochondrial 12S and 16S rRNA genes. Oriental species of the tribe Ranini form a monophyletic group containing 11 clades (Rana temporaria + Pseudoamolops, R. chalconota, four clades of Amolops, Meristogenys, three clades of Huia species, and Staurois) for which the phylogenetic relationships are unresolved. The genus Amolops consists of southern Chinese, southwestern Chinese, Thai, and Vietnamese-Malaysian lineages, but their relationships are also unresolved. The separation of southern and southwestern lineages within China conforms to previous morphological and karyological results. Species of Huia do not form a monophyletic group, whereas those of Meristogenys are monophyletic. Because P. sauteri is a sister species of R. temporaria, distinct generic status of Pseudoamolops is unwarranted.

  13. One hundred million years of skin feeding? Extended parental care in a Neotropical caecilian (Amphibia: Gymnophiona).

    PubMed

    Wilkinson, Mark; Kupfer, Alexander; Marques-Porto, Rafael; Jeffkins, Hilary; Antoniazzi, Marta M; Jared, Carlos

    2008-08-23

    Maternal dermatophagy, the eating of maternal skin by offspring, is an unusual form of parental investment involving co-evolved specializations of both maternal skin and offspring dentition, which has been recently discovered in an African caecilian amphibian. Here we report the discovery of this form of parental care in a second, distantly related Neotropical species Siphonops annulatus, where it is characterized by the same syndrome of maternal and offspring specializations. The detailed similarities of skin feeding in different caecilian species provide strong evidence of its homology, implying its presence in the last common ancestor of these species. Biogeographic considerations, the separation of Africa and South American land masses and inferred timescales of amphibian diversification all suggest that skin feeding is an ancient form of parental care in caecilians, which has probably persisted in multiple lineages for more than 100 Myr. These inferences support the hypotheses that (i) maternal dermatophagy is widespread in oviparous direct-developing caecilians, and (ii) that viviparous caecilians that feed on the hypertrophied maternal oviduct evolved from skin-feeding ancestors. In addition to skin-feeding, young S. annulatus were observed to congregate around, and imbibe liquid exuded from, the maternal cloacal opening.

  14. Three new species of the salamander genus Hynobius (Amphibia, Urodela, Hynobiidae) from Kyushu, Japan.

    PubMed

    Nishikawa, Kanto; Matsui, Masafumi

    2014-08-14

    Three new species of lotic breeding Hynobius, formerly assigned to H. boulengeri, are described from the Kyushu region, southwestern Japan. They differ from all the known congeners by a unique combination of body size, character ratios, coloration, mtDNA, and allozymic characteristics. Together with H. stejnegeri they form a clade, which is not a sister group of H. boulengeri, and their speciation in Kyushu is surmised to have occurred at the end of Miocene, accompanied by differentiations in larval period and metamorphosing size. Measures of conservation of these new species are discussed briefly. 

  15. A new species of Microcaecilia Taylor, 1968 (Amphibia: Gymnophiona: Siphonopidae) from Amazonian Brazil.

    PubMed

    Wilkinson, Mark; Antoniazzi, Marta Maria; Jared, Carlos

    2015-01-13

    A new species of siphonopid caecilian, Microcaecilia butantan sp. nov., is described based on four specimens from Belterra, in the State of Pará, Brazil. The new species differs from all other Microcaecilia in having a combination of more than 135 primary annuli and long premaxillary-maxillary tooth series that extend posteriorly beyond the choanae. Some specimens were dug from soil in a cupuaçu (Theobroma grandiflorum) plantation suggesting that this form of agriculture provides an environment suitable for at least some caecilians.

  16. A New Basal Salamandroid (Amphibia, Urodela) from the Late Jurassic of Qinglong, Hebei Province, China

    PubMed Central

    Jia, Jia; Gao, Ke-Qin

    2016-01-01

    A new salamandroid salamander, Qinglongtriton gangouensis (gen. et sp. nov.), is named and described based on 46 fossil specimens of juveniles and adults collected from the Upper Jurassic (Oxfordian) Tiaojishan Formation cropping out in Hebei Province, China. The new salamander displays several ontogenetically and taxonomically significant features, most prominently the presence of a toothed palatine, toothed coronoid, and a unique pattern of the hyobranchium in adults. Comparative study of the new salamander with previously known fossil and extant salamandroids sheds new light on the early evolution of the Salamandroidea, the most species-diverse clade in the Urodela. Cladistic analysis places the new salamander as the sister taxon to Beiyanerpeton, and the two taxa together form the basalmost clade within the Salamandroidea. Along with recently reported Beiyanerpeton from the same geological formation in the neighboring Liaoning Province, the discovery of Qinglongtriton indicates that morphological disparity had been underway for the salamandroid clade by early Late Jurassic (Oxfordian) time. PMID:27144770

  17. Neoteny and progenesis as two heterochronic processes involved in paedomorphosis in Triturus alpestris (Amphibia: Caudata).

    PubMed Central

    Denoël, M; Joly, P

    2000-01-01

    Current theories on the evolution of paedomorphosis suppose that several ontogenetic pathways have appeared according to different selective pressures. The aim of this study was to find out whether two distinct processes can lead to paedomorphosis in the Alpine newt, Triturus alpestris. In this respect, we compared age structures of paedomorphic and metamorphic individuals in two newt populations where the two forms lived syntopically. Whereas paedomorphosis resulted in a slower rate of somatic development in one population, it resulted in an acceleration of sexual maturation in the other population. These processes correspond to neoteny and progenesis, respectively. These results suggest that phenotypic plasticity can result from contrasted ontogenetic pathways between two populations of the same species. They give support to models that consider gonadic development as the target of selection under different environmental pressures. PMID:10983835

  18. Histology of the trachea and lung of Siphonops annulatus (Amphibia, Gymnophiona).

    PubMed

    Kuehne, B; Junqueira, L C

    2000-02-01

    The structure of the trachea and lung of Siphonops annulatus was studied in ten specimens of routinely fed animals. The trachea is constituted mainly by incomplete cartilage rings lined by a respiratory epithelium (ciliated and mucous cells) with variable morphology according to the region observed. A rich vascularization of this organ suggests its participation in blood-air gas exchange. The right lung in this species is developed and the left one is atrophied. This organ is constituted mainly by longitudinal septa formed by connective tissue, smooth muscle cells and blood capillaries. These structures are covered by pneumocytes of one type only, which present cytoplasmic particles that have been related with surfactant activity described in the lung of Gymnophiona.

  19. A new species of salamander of the genus Hynobius from Central Honshu, Japan (Amphibia, Urodela).

    PubMed

    Matsui, Masafumi; Kokuryo, Yasuhiro; Misawa, Yasuchika; Nishikawa, Kanto

    2004-06-01

    We describe a small salamander from south Central Honshu, Japan, as a new species, Hynobius katoi. The genetic distances between this species and several named species, including sympatric H. kimurae, derived from allozyme data from a starch gel electrophoresis, proved to be sufficiently large to differentiate it at a specific rank. Distribution of this species is confined to the montane regions of Shizuoka and Nagano Prefectures, on the Akaishi Mountains of the Chubu District, central Japan. It is regarded as a member of the naevius group of Hynobius, characterized by small number of large, pigmentless ova. The species differs from the other species of the naevius group by the combination of relatively small body size, nearly spotless body, relatively few vomerine teeth forming moderately shallow series, and unique electrophoretic pattern of isozymes.

  20. Oviduct modifications in foam-nesting frogs, with emphasis on the genus Leptodactylus (Amphibia, Leptodactylidae)

    USGS Publications Warehouse

    Furness, Andrew I.; McDiarmid, Roy W.; Heyer, W. Ronald; Zug, George R.

    2010-01-01

    Various species of frogs produce foam nests that hold their eggs during development. We examined the external morphology and histology of structures associated with foam nest production in frogs of the genus Leptodactylus and a few other taxa. We found that the posterior convolutions of the oviducts in all mature female foam-nesting frogs that we examined were enlarged and compressed into globular structures. This organ-like portion of the oviduct has been called a "foam gland" and these structures almost certainly produce the secretion that is beaten by rhythmic limb movements into foam that forms the nest. However, the label "foam gland" is a misnomer because the structures are simply enlarged and tightly folded regions of the pars convoluta of the oviduct, rather than a separate structure; we suggest the name pars convoluta dilata (PCD) for this feature. Although all the foam-nesters we examined had a pars convoluta dilata, its size and shape showed considerable interspecific variation. Some of this variation likely reflects differences in the breeding behaviors among species and in the size, type, and placement of their foam nests. Other variation, particularly in size, may be associated with the physiological periodicity and reproductive state of the female, her age, and/or the number of times she has laid eggs.

  1. Cytonuclear discordance and historical demography of two brown frogs, Rana tagoi and R. sakuraii (Amphibia: Ranidae).

    PubMed

    Eto, Koshiro; Matsui, Masafumi

    2014-10-01

    Prior studies of mitochondrial genomic variation reveal that the Japanese brown frog Rana tagoi comprises a complex of cryptic species lineages, and that R. sakuraii arose from within this complex. Neither species forms a monophyletic group on the mitochondrial haplotype tree, precluding a simple explanation for the evolutionary origins of R. sakuraii. We present a more complete sampling of mitochondrial haplotypic variation (from the ND1 and 16S genes) plus DNA sequence variation for five nuclear loci (from the genes encoding NCX1, NFIA, POMC, SLC8A3, and TYR) to resolve the evolutionary histories of these species. We test hypotheses of population assignment (STRUCTURE) and isolation-with-migration (IM) using the more slowly evolving nuclear markers. These demographic analyses of nuclear genetic variation confirm species-level distinctness and integrity of R. sakuraii despite its apparent polyphyly on the mitochondrial haplotype tree. Divergence-time estimates from both the mitochondrial haplotypes and nuclear genomic markers suggest that R. sakuraii originated approximately one million years ago, and that incomplete sorting of mitochondrial haplotype lineages best explains non-monophyly of R. sakuraii mitochondrial haplotypes. Cytonuclear discordance elsewhere in R. tagoi reveals a case of mitochondrial introgression between two species lineages on Honshu. The earliest phylogenetic divergence within this species group occurred approximately four million years ago, followed by cladogenetic events in the Pliocene and early Pleistocene yielding 10-13 extant species lineages, including R. sakuraii as one of the youngest.

  2. A newly identified Rab-GDI paralogue has a role in neural development in amphibia.

    PubMed

    Nazlamova, Liliya; Noble, Anna; Schubert, Frank R; McGeehan, John; Myers, Fiona; Guille, Matt; Scarlett, Garry

    2017-01-30

    Vesicle shuttling is critical for many cellular and organismal processes, including embryonic development. GDI proteins contribute to vesicle shuttling by regulating the activity of Rab GTPases, controlling their cycling between the inactive cytosol and active membrane bound states. While identifying genes controlled by A-form DNA sequences we discovered a previously unknown member of the GDI family, GDI3. The GDI3 gene is found only in amphibians and fish and is developmentally expressed in Xenopus from neurula stages onwards in the neural plate, and subsequently in both dorsal and anterior structures. Depletion or over-expression of the GDI3 protein in Xenopus embryos gives rise to very similar phenotypes, suggesting that strict control of GDI3 protein levels is required for correct embryonic development. Our analysis suggests the evolutionary origins of GDI3 and that it is functionally distinct from GDI1. Predicted structural analysis of GDI3 suggests that the key difference between GDI1 and GDI3 lies in their lipid binding pockets. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  3. Two new Salamanders of the genus Onychodactylus from Eastern Honshu, Japan (Amphibia, Caudata, Hynobiidae).

    PubMed

    Yoshikawa, Natsuhiko; Matsui, Masafumi

    2014-09-22

    We describe two new species of hynobiid salamanders in the genus Onychodactylus from eastern Honshu, Japan, based on the morphological and genetic evidence. Onychodactylus intermedius sp. nov. is distributed in southern part of Tohoku District and northern Ibaraki and Niigata Prefectures, and was previously reported as S-Tohoku group. Onychodactylus intermedius belongs to the O. japonicus species complex, and differs from the other congeners in having relatively long tail, narrow head, short snout, 18 presacral vertebrae, and distinctly curved vomerine tooth series without gap. Onychodactylus fuscus sp. nov. is known from only four localities in Fukushima and Niigata Prefectures of Tohoku and Hokuriku Districts. It also belongs to the O. japonicus complex, but lacks the dorsal stripe, which is a diagnostic character of the species complex. In other characteristics, O. fuscus differs from the other congeners in having comparatively long tail, wide head and internarial space, shallowly curved vomerine tooth series with gap, and relatively few vomerine teeth. Both species described here breed in winter. Phylogenetically, the two new species are closely related to each other, forming a well-supported clade with O. tsukubaensis as their sister species. Onychodactylus intermedius sp. nov. is known to be parapatric with O. japonicus and O. nipponoborealis without hybridization, whereas O. fuscus sp. nov. is sympatric with O. japonicus at least in a single known locality, and analysis of microsatellite loci indicates they are reproductively isolated.

  4. Helminth parasites of the leopard frog Lithobates sp. Colima (Amphibia: Ranidae) from Colima, Mexico.

    PubMed

    Cabrera-Guzmán, Elisa; Garrido-Olvera, Lorena; León-Règagnon, Virginia

    2010-08-01

    The helminth fauna inhabiting Lithobates sp. Colima from Ticuizitán, Colima, Mexico, comprises 10 species: 4 digeneans ( Clinostomum sp., Glypthelmins quieta , Haematoloechus sp., and Langeronia macrocirra ), 5 nematodes ( Aplectana itzocanensis , Cosmocerca podicipinus , Foleyellides striatus , Oswaldocruzia subauricularis , and Rhabdias sp.), and 1 cestode (Cyclophyllidea). Glypthelmins quieta , L. macrocirra , and A. itzocanensis represent new host records. These observations, added to previous records from Acapulco, Guerrero, Mexico, indicate that the helminth fauna of Lithobates sp. from Colima comprises 25 taxa. Frogs are being parasitized by 3 infection routes: ingestion of intermediate host, skin penetration by larval forms, and transmission by vectors. Species of Aplectana , Cosmocerca , Foleyellides , and Oswaldocruzia occurred in high prevalence in Colima, similar to a previous study on the same frog species from Guerrero. In Colima, Glypthelmins , Haematoloechus , and Rhabdias also occurred in high prevalence. Haematoloechus species reached the highest mean intensity in both localities. The semiaquatic habits of this species of frog and the availability of particular feeding resources appear to determine the helminth composition and infection levels; however, co-speciation events also play an important role structuring these helminth communities.

  5. Molecular phylogeny and diversification of the genus Odorrana (Amphibia, Anura, Ranidae) inferred from two mitochondrial genes.

    PubMed

    Chen, Xiaohong; Chen, Zhuo; Jiang, Jianping; Qiao, Liang; Lu, Youqiang; Zhou, Kaiya; Zheng, Guangmei; Zhai, Xiaofei; Liu, Jianxin

    2013-12-01

    A diversity of hypotheses have been proposed for phylogenetic relationships and taxonomy within the genus Odorrana, and great progress has been made over the past several decades. However, there is still some controversy concerning relationships among Odorrana species. Here, we used many paratypes and topotypes and utilized 1.81 kb of mitochondrial sequence data to generate a phylogeny for approximately 4/5 of Odorrana species, and Odorrana haplotypes form a strongly supported monophyletic group relative to the other genera sampled. The deepest phylogenetic divergences within Odorrana separate 3 lineages whose interrelationships are not recovered with strong support. These lineages include the ancestral lineage of O. chapaensis, the ancestral lineage of a strongly supported clade comprising many western species, and the ancestral lineage of a strongly supported clade comprising all other Odorrana sampled. Within the latter clade, the first phylogenetic split separates O. ishikawae from a well-supported clade comprising its other species. These divergences likely occurred in the middle Miocene, approximately 12-15 million years ago. Separation of the ancestral lineage of Odorrana from its closest relative, Babina in our study, likely occurred in the early Miocene or possibly late Oligocene. Rates of lineage accumulation remained high from the middle Miocene through the Pleistocene. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Reduced genetic variation in the Japanese giant salamander, Andrias japonicus (Amphibia: Caudata).

    PubMed

    Matsui, Masafumi; Tominaga, Atsushi; Liu, Wan-zhao; Tanaka-Ueno, Tomoko

    2008-10-01

    The phylogenetic relationships among 46 samples from 27 populations of the Japanese giant salamander, Andriasjaponicus and its congener, A. davidianus from China was investigated, using 3664 bp sequences of the mitochondrial genes NADH1, NADH3, cyt b and CR, partial NADH6 and intervening genes. In phylogenetic trees constructed by MP, ML, and Bayesian methods, the family Cryptobranchidae and the genus Andrias both form monophyletic groups. Japanese A. japonicus and Chinese A. davidianus are sister taxa and can be regarded as separate species despite a small degree of genetic differentiation. Andriasjaponicus is divided into central and western clades, but the phylogenetic relationships within the latter clade are unresolved. As previously reported from allozyme analyses, A. japonicus exhibits little genetic differentiation, in strong contrast to salamanders of the genus Hynobius with which their distributions overlap. This reduced genetic variability in A. japonicus is attributable to a unique mating system of polygyny, delayed sexual maturity, notable longevity, life in a stable aquatic environment, and gigantism, as well as bottleneck effects following habitat fragmentation and extinction of local populations during Quaternary glaciations. The species is thus susceptible to extinction by potential environmental fluctuations, and requires extensive conservation measures.

  7. Molecular systematics of caeciliid caecilians (Amphibia: Gymnophiona) of the Western Ghats, India.

    PubMed

    Gower, David J; San Mauro, Diego; Giri, Varad; Bhatta, Gopalakrishna; Govindappa, Venu; Kotharambath, Ramachandran; Oommen, Oommen V; Fatih, Farrah A; Mackenzie-Dodds, Jacqueline A; Nussbaum, Ronald A; Biju, S D; Shouche, Yogesh S; Wilkinson, Mark

    2011-06-01

    Together, Indian plus Seychelles caeciliid caecilian amphibians (Gymnophiona) constitute approximately 10% of the extant species of this order. A molecular phylogenetic analysis of all but one (or two) nominal species (16, in five genera) is presented based on mitochondrial (12S, 16S, cytb, cox1) and nuclear (RAG1) sequence data. Results strongly support monophyly of both Seychelles and peninsular Indian caeciliids, and their sister-group status. Within the Indian caeciliids, Indotyphlus and Gegeneophis are monophyletic sister genera. The phylogenetic position of Gegeneophis ramaswamii, Gegeneophis seshachari, and Gegeneophis carnosus are not well resolved, but all lie outside a well-supported clade of most northern Western Ghats Gegeneophis (madhavai, mhadeiensis, goaensis, danieli/nadkarnii). Most nominal species of Indian caeciliid are diagnosed by robust haplotype clades, though the systematics of G. carnosus-like forms in northern Kerala and southern Karnataka requires substantial further investigation. For the most part, Indian caeciliid species comprise narrowly distributed, allopatric taxa with low genetic diversity. Much greater geographic genetic diversity exists among populations referred to G. seshachari, such that some populations likely represent undescribed species. This, the first phylogenetic analysis of Indian caeciliids, generally provides additional support for recent increases in described species (eight since 1999), and a framework for ongoing taxonomic revision.

  8. Patterns of peripheral innervation of the tongue and hyobranchial apparatus in caecilians (Amphibia: Gymnophiona).

    PubMed

    Wake, M H

    1992-04-01

    The innervation of the musculature of the tongue and the hyobranchial apparatus of caecilians has long been assumed to be simple and to exhibit little interspecific variation. A study of 14 genera representing all six families of caecilians demonstrates that general patterns of innervation by the trigeminal, facial, glossopharyngeal, and vagus nerves are similar across taxa but that the composition of the "hypoglossal" nerve is highly variable. Probably in all caecilians, spinal nerves 1 and 2 contribute to the hypoglossal. In addition, in certain taxa, an "occipital," the vagus, and/or spinal 3 appear to contribute fibers to the composition of the hypoglossal nerve. These patterns, the lengths of fusion of the contributing elements, and the branching patterns of the hypoglossal are assessed according to the currently accepted hypothesis of phylogenetic relationships of caecilians, and of amphibians. An hypothesis is proposed that limblessness and a simple tongue, with concomitant reduced complexity of innervation of muscles associated with limbs and the tongue, has released a constraint on pattern of innervation. As a consequence, a greater diversity and, in several taxa, greater complexity of neuroanatomical associations of nerve roots to form the hypoglossal are expressed.

  9. A molecular assessment of phylogenetic relationships and lineage accumulation rates within the family Salamandridae (Amphibia, Caudata).

    PubMed

    Weisrock, David W; Papenfuss, Theodore J; Macey, J Robert; Litvinchuk, Spartak N; Polymeni, Rosa; Ugurtas, Ismail H; Zhao, Ermi; Jowkar, Houman; Larson, Allan

    2006-11-01

    We examine phylogenetic relationships among salamanders of the family Salamandridae using approximately 2700 bases of new mtDNA sequence data (the tRNALeu, ND1, tRNAIle, tRNAGln, tRNAMet, ND2, tRNATrp, tRNAAla, tRNAAsn, tRNACys, tRNATyr, and COI genes and the origin for light-strand replication) collected from 96 individuals representing 61 of the 66 recognized salamandrid species and outgroups. Phylogenetic analyses using maximum parsimony and Bayesian analysis are performed on the new data alone and combined with previously reported sequences from other parts of the mitochondrial genome. The basal phylogenetic split is a polytomy of lineages ancestral to (1) the Italian newt Salamandrina terdigitata, (2) a strongly supported clade comprising the "true" salamanders (genera Chioglossa, Mertensiella, Lyciasalamandra, and Salamandra), and (3) a strongly supported clade comprising all newts except S. terdigitata. Strongly supported clades within the true salamanders include monophyly of each genus and grouping Chioglossa and Mertensiella as the sister taxon to a clade comprising Lyciasalamandra and Salamandra. Among newts, genera Echinotriton, Pleurodeles, and Tylototriton form a strongly supported clade whose sister taxon comprises the genera Calotriton, Cynops, Euproctus, Neurergus, Notophthalmus, Pachytriton, Paramesotriton, Taricha, and Triturus. Our results strongly support monophyly of all polytypic newt genera except Paramesotriton and Triturus, which appear paraphyletic, and Calotriton, for which only one of the two species is sampled. Other well-supported clades within newts include (1) Asian genera Cynops, Pachytriton, and Paramesotriton, (2) North American genera Notophthalmus and Taricha, (3) the Triturus vulgaris species group, and (4) the Triturus cristatus species group; some additional groupings appear strong in Bayesian but not parsimony analyses. Rates of lineage accumulation through time are evaluated using this nearly comprehensive sampling of

  10. Morphology of the kidney in the West African caecilian, Geotrypetes seraphini (Amphibia, Gymnophiona, Caeciliidae).

    PubMed

    Møbjerg, N; Jespersen, A; Wilkinson, M

    2004-11-01

    This study deals with the morphology and ultrastructure of the mesonephros in adult caecilians of the species Geotrypetes seraphini. Based on serial sections in paraffin and araldite, nephrons are reconstructed and the cellular characteristics of different nephron segments described. The long and slender mesonephric kidneys of G. seraphini are broadest caudally and taper toward the front, where the organs are divided into smaller segmental divisions. Two nephron types can be distinguished on the basis of their connections to the coelom and their position within the nephric tissue: ventral nephrons connect to the coelom via a ciliated peritoneal funnel, whereas medial nephrons lack this connection. Both nephron types are composed of a filtration unit, the Malpighian corpuscle, and a renal tubule, which can be divided into six morphologically distinct segments: neck segment, proximal tubule, intermediate segment, early distal tubule, late distal tubule, and collecting tubule. Collecting tubules merge and form a branch system that opens into collecting ducts. Collecting ducts empty into the Wolffian duct. Proximal tubules of nephrons in the frontal divisions are morphologically different from the proximal tubules of more caudal kidney regions. Distal tubule subdivision is only clearly recognizable at the electron microscopic level. The length of each nephron segment is calculated from a ventral nephron with a total length of approximately 3.8 mm, and the course of the segments within the nephric tissue is reported. The number of nephrons was estimated at 1,700 units in each kidney. The segmentation and ultrastructure of the mesonephric nephrons in G. seraphini are discussed in relation to nephron descriptions from other caecilians and we further discuss the evolutionary origin of the amphibian nephron.

  11. Autoradiographic localization of voltage-dependent sodium channels on the mouse neuromuscular junction using /sup 125/I-alpha scorpion toxin. I. Preferential labeling of glial cells on the presynaptic side

    SciTech Connect

    Boudier, J.L.; Jover, E.; Cau, P.

    1988-05-01

    Alpha-scorpion toxins bind specifically to the voltage-sensitive sodium channel in excitable membranes, and binding is potential-dependent. The radioiodinated toxin II from the scorpion Androctonus australis Hector (alpha ScTx) was used to localize voltage-sensitive sodium channels on the presynaptic side of mouse neuromuscular junctions (NMJ) by autoradiography using both light and electron microscopy. Silver grain localization was analyzed by the cross-fire method. At the light-microscopic level, grain density over NMJ appeared 6-8x higher than over nonjunctional muscle membrane. The specificity of labeling was verified by competition/displacement with an excess of native alpha ScTx. Labeling was also inhibited by incubation in depolarizing conditions, showing its potential-dependence. At the electron-microscopic level, analysis showed that voltage-sensitive sodium channels labeled with alpha ScTx were almost exclusively localized on membranes, as expected. Due to washout after incubation, appreciable numbers of binding sites were not found on the postsynaptic membranes. However, on the presynaptic side, alpha ScTx-labeled voltage-sensitive sodium channels were localized on the membrane of non-myelin-forming Schwann cells covering NMJ. The axonal presynaptic membrane was not labeled. These results show that voltage-sensitive sodium channels are present on glial cells in vivo, as already demonstrated in vitro. It is proposed that these glial channels could be indirectly involved in the ionic homeostasis of the axonal environment.

  12. Antagonism of 4-substituted 1,4-dihydropyridine-3,5-dicarboxylates toward voltage-dependent L-type Ca2+ channels Ca V 1.3 and Ca V 1.2.

    PubMed

    Chang, Che-Chien; Cao, Song; Kang, Soosung; Kai, Li; Tian, Xinyong; Pandey, Prativa; Dunne, Sara Fernandez; Luan, Chi-Hao; Surmeier, D James; Silverman, Richard B

    2010-05-01

    L-type Ca(2+) channels in mammalian brain neurons have either a Ca(V)1.2 or Ca(V)1.3 pore-forming subunit. Recently, it was shown that Ca(V)1.3 Ca(2+) channels underlie autonomous pacemaking in adult dopaminergic neurons in the substantia nigra pars compacta, and this reliance renders them sensitive to toxins used to create animal models of Parkinson's disease. Antagonism of these channels with the dihydropyridine antihypertensive drug isradipine diminishes the reliance on Ca(2+) and the sensitivity of these neurons to toxins, pointing to a potential neuroprotective strategy. However, for neuroprotection without an antihypertensive side effect, selective Ca(V)1.3 channel antagonists are required. In an attempt to identify potent and selective antagonists of Ca(V)1.3 channels, 124 dihydropyridines (4-substituted-1,4-dihydropyridine-3,5-dicarboxylic diesters) were synthesized. The antagonism of heterologously expressed Ca(V)1.2 and Ca(V)1.3 channels was then tested using electrophysiological approaches and the FLIPR Calcium 4 assay. Despite the large diversity in substitution on the dihydropyridine scaffold, the most Ca(V)1.3 selectivity was only about twofold. These results support a highly similar dihydropyridine binding site at both Ca(V)1.2 and Ca(V)1.3 channels and suggests that other classes of compounds need to be identified for Ca(V)1.3 selectivity.

  13. The evolution from asparagine or threonine to cysteine in position 146 contributes to generation of a more efficient and stable form of muscle creatine kinase in higher vertebrates.

    PubMed

    Zhao, Tong-Jin; Liu, Yang; Chen, Zhao; Yan, Yong-Bin; Zhou, Hai-Meng

    2006-01-01

    Creatine kinase, a key enzyme in vertebrate excitable tissues that require large energy fluxes, catalyzes the reversible transfer of phosphate between adenosine triphosphate and creatine. Sequence alignment indicated that the 146th amino acid is cysteine in the muscle creatine kinase of higher vertebrates including Amphibia, Reptilia, Aves and Mammalia. In fishes, it is cysteine in Agnatha and Chondrichthyes, and asparagine or threonine in Osteichthyes, which is the ancestor of Amphibia, Reptilia, Aves and Mammalia. To explore the structural and functional role of this special residue, a series of site-directed mutants of rabbit muscle creatine kinase were constructed, including C146S, C146N, C146T, C146G, C146A, C146D and C146R. A detailed comparison was made between wild-type creatine kinase and the mutants in catalytic activity, physico-chemical properties and structural stability against thermal inactivation and guanidine hydrochloride denaturation. It was found that except for C146S, the mutants had relatively lower catalytic activity and structural stability than Wt-CK. Wt-CK and C146S were the most stable ones, followed by C146N and C146T, and then C146G and C146A, and C146D and C146R were the least stable mutants. These results suggested that the 146th residue plays a crucial role in maintaining the structural stability of creatine kinase, and that the evolution in this amino acid from asparagine or threonine to cysteine contributes to the generation of a more efficient and more stable form of creatine kinase in higher vertebrates.

  14. β1a490-508, a 19-residue peptide from C-terminal tail of Cav1.1 β1a subunit, potentiates voltage-dependent calcium release in adult skeletal muscle fibers.

    PubMed

    Hernández-Ochoa, Erick O; Olojo, Rotimi O; Rebbeck, Robyn T; Dulhunty, Angela F; Schneider, Martin F

    2014-02-04

    The α1 and β1a subunits of the skeletal muscle calcium channel, Cav1.1, as well as the Ca(2+) release channel, ryanodine receptor (RyR1), are essential for excitation-contraction coupling. RyR1 channel activity is modulated by the β1a subunit and this effect can be mimicked by a peptide (β1a490-524) corresponding to the 35-residue C-terminal tail of the β1a subunit. Protein-protein interaction assays confirmed a high-affinity interaction between the C-terminal tail of the β1a and RyR1. Based on previous results using overlapping peptides tested on isolated RyR1, we hypothesized that a 19-amino-acid residue peptide (β1a490-508) is sufficient to reproduce activating effects of β1a490-524. Here we examined the effects of β1a490-508 on Ca(2+) release and Ca(2+) currents in adult skeletal muscle fibers subjected to voltage-clamp and on RyR1 channel activity after incorporating sarcoplasmic reticulum vesicles into lipid bilayers. β1a490-508 (25 nM) increased the peak Ca(2+) release flux by 49% in muscle fibers. Considerably fewer activating effects were observed using 6.25, 100, and 400 nM of β1a490-508 in fibers. β1a490-508 also increased RyR1 channel activity in bilayers and Cav1.1 currents in fibers. A scrambled form of β1a490-508 peptide was used as negative control and produced negligible effects on Ca(2+) release flux and RyR1 activity. Our results show that the β1a490-508 peptide contains molecular components sufficient to modulate excitation-contraction coupling in adult muscle fibers.

  15. Voltage-Dependent Intrinsic Bursting in Olfactory Bulb Golgi Cells

    ERIC Educational Resources Information Center

    Pressler, R. Todd; Rozman, Peter A.; Strowbridge, Ben W.

    2013-01-01

    In the mammalian olfactory bulb (OB), local synaptic circuits modulate the evolving pattern of activity in mitral and tufted cells following olfactory sensory stimulation. GABAergic granule cells, the most numerous interneuron subtype in this brain region, have been extensively studied. However, classic studies using Golgi staining methods…

  16. Coarse Grained Model for Exploring Voltage Dependent Ion Channels

    PubMed Central

    Dryga, Anatoly; Chakrabarty, Suman; Vicatos, Spyridon; Warshel, Arieh

    2011-01-01

    The relationship between the membrane voltage and the gating of voltage activated ion channels and other systems have been a problem of great current interest. Unfortunately, reliable molecular simulations of external voltage effects present a major challenge, since meaningful converging microscopic simulations are not yet available and macroscopic treatments involve major uncertainties in terms of the dielectric used and other key features. This work extends our coarse grained (CG) model to simulations of membrane/protein systems under external potential. Special attention has been devoted to a consistent modeling of the effect of external potential due to the electrodes, emphasizing semimacroscopic description of the electrolytes in the solution regions between the membranes and the electrodes, as well as the coupling between the combined potential from the electrodes and electrolytes, and the protein ionization states. We also provide a clear connection to microscopic treatment of the electrolytes and thus can explore possible conceptual problems that are hard to resolve by other current approaches. For example, we obtain a clear description of the charge distribution in the entire electrolyte system, including near the electrodes in membrane/electrodes systems (where continuum models do not seem to provide the relevant results). Furthermore, the present treatment provides an insight on the distribution of the electrolyte charges before and after equilibration across the membrane, and thus on the nature of the gating charge. The different aspects of the model have been carefully validated by considering problems ranging for the simple Debye-Huckel, Gouy-Chapman models to the evaluation of the electrolyte distribution between two electrodes, as well as the effect of extending the simulation system by periodic replicas. Overall the clear connection to microscopic descriptions combined with the power of the CG modeling seems to offer a powerful tool for exploring the balance between the protein conformational energy and the interaction with the external potential in voltage activated channels. With this in mind we present a preliminary study of the gating charge in the voltage activated Kv1.2 channel, using the actual change in the electrolyte charge distribution rather than the conventional macroscopic estimate. We also discuss other special features of the model, which include the ability to capture the effect of changes in the protonation states of the protein residues during the open to close voltage induced transition. PMID:21843502

  17. Evolutionarily conserved intracellular gate of voltage-dependent sodium channels

    NASA Astrophysics Data System (ADS)

    Oelstrom, Kevin; Goldschen-Ohm, Marcel P.; Holmgren, Miguel; Chanda, Baron

    2014-03-01

    Members of the voltage-gated ion channel superfamily (VGIC) regulate ion flux and generate electrical signals in excitable cells by opening and closing pore gates. The location of the gate in voltage-gated sodium channels, a founding member of this superfamily, remains unresolved. Here we explore the chemical modification rates of introduced cysteines along the S6 helix of domain IV in an inactivation-removed background. We find that state-dependent accessibility is demarcated by an S6 hydrophobic residue; substituted cysteines above this site are not modified by charged thiol reagents when the channel is closed. These accessibilities are consistent with those inferred from open- and closed-state structures of prokaryotic sodium channels. Our findings suggest that an intracellular gate composed of a ring of hydrophobic residues is not only responsible for regulating access to the pore of sodium channels, but is also a conserved feature within canonical members of the VGIC superfamily.

  18. Dose-voltage dependence of coaxial Bremsstrahlung diodes

    NASA Astrophysics Data System (ADS)

    Sanford, T. W. L.; Halbleib, J. A.; Poukey, J. W.; Heath, C. E.; Mock, R.

    1988-09-01

    The relation ∝ IV2.65 is widely used to estimate the on-axis radiation-dose rate for flash X-ray sources, as a function of diode current, I, and voltage, V, 1 m downstream of an optimized bremsstrahlung target. This relation is valid only for pencil beams. In this paper, we show that for diodes having beams with finite spatial and angular extent, this relation can still be used if the power 2.65 is modified. Using particle-in-cell and radiation-transport codes, this modification is evaluated for a diode proposed for the 20-MeV HERMES III accelerator that is currently under construction. Predictions of the calculational model are compared with measurements obtained from experiments on the existing 3-MeV HELIA accelerator and are found to be in good agreement. These results are characteristic of finite-area coaxial diodes in general and show the trend of the deviation from 2.65 for such sources.

  19. Voltage-Dependent Luminescence Properties of Molecularly Doped Polymer System

    NASA Astrophysics Data System (ADS)

    Mingliang, Wang; Junxiang, Zhang; Juzheng, Liu; Chunxiang, Xu

    2001-05-01

    Single-layer light-emitting diodes (LEDs) are fabricated using a mixture of a blue-emitting polymer and green-emitting 9, 10-bis(phenylethynyl)anthracene as emitting layer. The blend device with these two components in the emitting layer exhibits voltage-induced evolution of the electroluminescence. But when polystyrene is also blended into the emitting layer, the EL spectra show emission bands from both ether-PPV and BPEA in proportion to concentrations of the two materials, and the spectra exhibit no change with applied voltage. This implies that doping inert polymer is helpful in suppressing voltage-induced evolution of electroluminescence in LED blends.

  20. Voltage-dependent capacitance in lipid bilayers made from monolayers.

    PubMed Central

    Alvarez, O; Latorre, R

    1978-01-01

    Electrocompression has been measured in lipid bilayers made by apposition of two monolayers. The capacitance C(V), as a function of membrane potential, V, was found to be well described by C(V) = C(O) [1 + alpha(V + delta psi)2] where C(O) is the capacitance at V = O, alpha is the fractional increase in capacitance per square volt, and delta psi is the surface potential difference. In lipid bilayers made from monolayers alpha has a value of 0.02 V-2, which is ca. 500-fold smaller than the value found in solvent containing membranes. In asymmetric bilayers made of one neutral and one negatively charged monolayer, delta psi values were found to be those expected from independent measurements of surface charge density. If the fractional increase in capacitance found here is a good approximation to that of biological membranes, nonlinear capacitative charge displacement derived from electrostriction is expected to be less than 1% of the total gating charge displacement found in squid axons. PMID:620076

  1. Evolutionarily conserved intracellular gate of voltage-dependent sodium channels

    PubMed Central

    Oelstrom, Kevin; Goldschen-Ohm, Marcel P.; Holmgren, Miguel; Chanda, Baron

    2014-01-01

    Members of the voltage-gated ion channel superfamily (VGIC) regulate ion flux and generate electrical signals in excitable cells by opening and closing pore gates. The location of the gate in voltage-gated sodium channels, a founding member of this superfamily, remains unresolved. Here we explore the chemical modification rates of introduced cysteines along the S6 helix of domain IV in an inactivation-removed background. We find that state-dependent accessibility is demarcated by an S6 hydrophobic residue; substituted cysteines above this site are not modified by charged thiol reagents when the channel is closed. These accessibilities are consistent with those inferred from open- and closed-state structures of prokaryotic sodium channels. Our findings suggest that an intracellular gate composed of a ring of hydrophobic residues is not only responsible for regulating access to the pore of sodium channels, but is also a conserved feature within canonical members of the VGIC superfamily. PMID:24619022

  2. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  3. Voltage-Dependent Intrinsic Bursting in Olfactory Bulb Golgi Cells

    ERIC Educational Resources Information Center

    Pressler, R. Todd; Rozman, Peter A.; Strowbridge, Ben W.

    2013-01-01

    In the mammalian olfactory bulb (OB), local synaptic circuits modulate the evolving pattern of activity in mitral and tufted cells following olfactory sensory stimulation. GABAergic granule cells, the most numerous interneuron subtype in this brain region, have been extensively studied. However, classic studies using Golgi staining methods…

  4. Neuroinflammation alters voltage-dependent conductance in striatal astrocytes

    PubMed Central

    Karpuk, Nikolay; Burkovetskaya, Maria

    2012-01-01

    Neuroinflammation has the capacity to alter normal central nervous system (CNS) homeostasis and function. The objective of the present study was to examine the effects of an inflammatory milieu on the electrophysiological properties of striatal astrocyte subpopulations with a mouse bacterial brain abscess model. Whole cell patch-clamp recordings were performed in striatal glial fibrillary acidic protein (GFAP)-green fluorescent protein (GFP)+ astrocytes neighboring abscesses at postinfection days 3 or 7 in adult mice. Cell input conductance (Gi) measurements spanning a membrane potential (Vm) surrounding resting membrane potential (RMP) revealed two prevalent astrocyte subsets. A1 and A2 astrocytes were identified by negative and positive Gi increments vs. Vm, respectively. A1 and A2 astrocytes displayed significantly different RMP, Gi, and cell membrane capacitance that were influenced by both time after bacterial exposure and astrocyte proximity to the inflammatory site. Specifically, the percentage of A1 astrocytes was decreased immediately surrounding the inflammatory lesion, whereas A2 cells were increased. These changes were particularly evident at postinfection day 7, revealing increased cell numbers with an outward current component. Furthermore, RMP was inversely modified in A1 and A2 astrocytes during neuroinflammation, and resting Gi was increased from 21 to 30 nS in the latter. In contrast, gap junction communication was significantly decreased in all astrocyte populations associated with inflamed tissues. Collectively, these findings demonstrate the heterogeneity of striatal astrocyte populations, which experience distinct electrophysiological modifications in response to CNS inflammation. PMID:22457466

  5. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    PubMed Central

    Tae, Han-Shen; Smith, Kelly M.; Phillips, A. Marie; Boyle, Kieran A.; Li, Melody; Forster, Ian C.; Hatch, Robert J.; Richardson, Robert; Hughes, David I.; Graham, Brett A.; Petrou, Steven; Reid, Christopher A.

    2017-01-01

    Gabapentin (GBP) is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN) channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+) or calretinin positive (CR+) inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM) caused a hyperpolarizing shift in the voltage of half activation (V1/2) thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP. PMID:28871229

  6. Non-target effects of a glyphosate-based herbicide on Common toad larvae (Bufo bufo, Amphibia) and associated algae are altered by temperature.

    PubMed

    Baier, Fabian; Gruber, Edith; Hein, Thomas; Bondar-Kunze, Elisabeth; Ivanković, Marina; Mentler, Axel; Brühl, Carsten A; Spangl, Bernhard; Zaller, Johann G

    2016-01-01

    Glyphosate-based herbicides are the most widely used pesticides in agriculture, horticulture, municipalities and private gardens that can potentially contaminate nearby water bodies inhabited by amphibians and algae. Moreover, the development and diversity of these aquatic organisms could also be affected by human-induced climate change that might lead to more periods with extreme temperatures. However, to what extent non-target effects of these herbicides on amphibians or algae are altered by varying temperature is not well known. We studied effects of five concentrations of the glyphosate-based herbicide formulation Roundup PowerFlex (0, 1.5, 3, 4 mg acid equivalent glyphosate L(-1) as a one time addition and a pulse treatment of totally 4 mg a.e. glyphosate L(-1)) on larval development of Common toads (Bufo bufo, L.; Amphibia: Anura) and associated algae communities under two temperature regimes (15 vs. 20 °C). Herbicide contamination reduced tail growth (-8%), induced the occurrence of tail deformations (i.e. lacerated or crooked tails) and reduced algae diversity (-6%). Higher water temperature increased tadpole growth (tail and body length (tl/bl) +66%, length-to-width ratio +4%) and decreased algae diversity (-21%). No clear relation between herbicide concentrations and tadpole growth or algae density or diversity was observed. Interactive effects of herbicides and temperature affected growth parameters, tail deformation and tadpole mortality indicating that the herbicide effects are temperature-dependent. Remarka