Science.gov

Sample records for amylase

  1. Amylase - urine

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003607.htm Amylase - urine To use the sharing features on this ... is a test that measures the amount of amylase in urine. Amylase is an enzyme that helps ...

  2. Amylase Test

    MedlinePlus

    ... AACC products and services. Advertising & Sponsorship: Policy | Opportunities Amylase Share this page: Was this page helpful? Also known as: Amy Formal name: Amylase Related tests: Lipase , Trypsin , Trypsinogen At a Glance ...

  3. Amylase - blood

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003464.htm Amylase - blood To use the sharing features on this page, please enable JavaScript. Amylase is an enzyme that helps digest carbohydrates. It ...

  4. Advances in microbial amylases.

    PubMed

    Pandey, A; Nigam, P; Soccol, C R; Soccol, V T; Singh, D; Mohan, R

    2000-04-01

    This review makes a comprehensive survey of microbial amylases, i.e. alpha-amylase, beta-amylase and glucoamylase. Amylases are among the most important enzymes and are of great significance in present-day biotechnology. Although they can be derived from several sources, such as plants, animals and micro-organisms, the enzymes from microbial sources generally meet industrial demands. Microbial amylases could be potentially useful in the pharmaceutical and fine-chemical industries if enzymes with suitable properties could be prepared. With the advent of new frontiers in biotechnology, the spectrum of amylase application has widened in many other fields, such as clinical, medicinal and analytical chemistries, as well as their widespread application in starch saccharification and in the textile, food, brewing and distilling industries. In this review, after a brief description of the sources of amylases, we discuss the molecular biology of amylases, describing structures, cloning, sequences, and protoplast fusion and mutagenesis. This is followed by sections on their production and finally the properties of various amylases.

  5. Detergent-compatible bacterial amylases.

    PubMed

    Niyonzima, Francois N; More, Sunil S

    2014-10-01

    Proteases, lipases, amylases, and cellulases are enzymes used in detergent formulation to improve the detergency. The amylases are specifically supplemented to the detergent to digest starchy stains. Most of the solid and liquid detergents that are currently manufactured contain alkaline enzymes. The advantages of using alkaline enzymes in the detergent formulation are that they aid in removing tough stains and the process is environmentally friendly since they reduce the use of toxic detergent ingredients. Amylases active at low temperature are preferred as the energy consumption gets reduced, and the whole process becomes cost-effective. Most microbial alkaline amylases are used as detergent ingredients. Various reviews report on the production, purification, characterization, and application of amylases in different industry sectors, but there is no specific review on bacterial or fungal alkaline amylases or detergent-compatible amylases. In this mini-review, an overview on the production and property studies of the detergent bacterial amylases is given, and the stability and compatibility of the alkaline bacterial amylases in the presence of the detergents and the detergent components are highlighted.

  6. Acyclic peptide inhibitors of amylases.

    PubMed

    Pohl, Nicola

    2005-12-01

    In this issue of Chemistry and Biology, a library screening approach reveals a linear octapeptide inhibitor of alpha-amylases reached by de novo design . The selected molecule shares characteristics with naturally occurring protein inhibitors -- a result that suggests general rules for the design of peptide-based amylase inhibitors may be achievable.

  7. Marine Microbial Amylases: Properties and Applications.

    PubMed

    Suriya, J; Bharathiraja, S; Krishnan, M; Manivasagan, P; Kim, S-K

    2016-01-01

    Amylases are crucial enzymes which hydrolyze internal glycosidic linkages in starch and produce as primary products dextrins and oligosaccharides. Amylases are classified into α-amylase, β-amylase, and glucoamylase based on their three-dimensional structures, reaction mechanisms, and amino acid sequences. Amylases have innumerable applications in clinical, medical, and analytical chemistries as well as in food, detergent, textile, brewing, and distilling industries. Amylases can be produced from plants, animals, and microbial sources. Due to the advantages in microbial production, it meets commercial needs. The pervasive nature, easy production, and wide range of applications make amylase an industrially pivotal enzyme. This chapter will focus on amylases found in marine microorganisms, their potential industrial applications, and how these enzymes can be improved to the required bioprocessing conditions.

  8. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  9. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  10. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  11. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  12. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  13. Concerted evolution of human amylase genes

    SciTech Connect

    Gumucio, D.L.; Wiebauer, K.; Caldwell, R.M.; Samuelson, L.C.; Meisler, M.H.

    1988-03-01

    Cosmid clones containing 250 kilobases of genomic DNA from the human amylase gene cluster have been isolated. These clones contain seven distinct amylase genes which appear to comprise the complete multigene family. By sequence comparison with the cDNAs, the authors have identified two pancreatic amylase gene and three salivary amylase genes. Two truncated pseudogenes were also recovered. Intergenic distances of 17 to 22 kilobases separate the amylase gene copies. Within the past 10 million years, duplications, gene conversion, and unequal crossover events have resulted in a very high level of sequence similarity among human amylase gene copies. To identify sequence elements involved in tissue-specific expression and hormonal regulation, the promoter regions of the human amylase genes were sequenced and compared with those of the corresponding mouse genes. The promoters of the human and mouse pancreatic amylase genes are highly homologous between nucleotide - 160 and the cap site. Two sequence elements througth to influence pancreas-specific expression of the rodent genes are present in the human genes. In contrast, similarity in the 5' lanking sequences of the salivary amylase genes is limited to several short sequence elements whose positions and orientations differ in the two species. Some of these sequence elements are also associated with other parotid-specific genes and may be involved in their tissue-specific expression. A glucocorticoid response element and a general enhancer element are closely associated in several of the amylase promoters.

  14. Encapsulation of amylase in colloidosomes.

    PubMed

    Keen, Polly H R; Slater, Nigel K H; Routh, Alexander F

    2014-03-04

    Aqueous core colloidosomes encapsulating the enzyme amylase were manufactured with a shell comprising polymer latex particles of diameter 153 nm. The colloidosomes were sealed with calcium carbonate by precipitation between an inner phase of Na2CO3 and an outer phase of CaCl2. This seal allowed the retention of small molecules, such as dyes, as well as larger enzyme molecules, for several months. The encapsulated material could be released by dissolution of the CaCO3 with acid, upon a large dilution in water, or by applying a sufficient shear. The degree of release could be controlled since the greater the mass of CaCO3 precipitated onto the colloidosome shell, the greater the dilution or shear required to achieve release. The calcium carbonate seal protected encapsulated amylase from the detrimental effects of components in a liquid laundry detergent for several months so that, on triggered release, the enzyme retained its high activity.

  15. Exercise upregulates salivary amylase in humans (Review)

    PubMed Central

    KOIBUCHI, ERI; SUZUKI, YOSHIO

    2014-01-01

    The secretion of salivary α-amylase is influenced by adrenergic regulation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis; thus, exercise affects the levels of salivary α-amylase. Granger et al published a review in 2007 that focused attention on salivary α-amylase. In addition, a portable system for monitoring salivary α-amylase activity was launched in Japan at the end of 2005. The correlation between exercise and salivary α-amylase has since been extensively investigated. The present review summarizes relevant studies published in the English and Japanese literature after 2006. A search of the PubMed and CiNii databases identified 54 articles, from which 15 original articles were selected. The findings described in these publications indicate that exercise consistently increases mean salivary α-amylase activities and concentrations, particularly at an intensity of >70% VO2max in healthy young individuals. Thus, these studies have confirmed that salivary α-amylase levels markedly increase in response to physical stress. Salivary α-amylase levels may therefore serve as an effective indicator in the non-invasive assessment of physical stress. PMID:24669232

  16. Production of alpha-amylase by yeast

    SciTech Connect

    Thomse, K.K.

    1987-01-01

    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  17. Characterization of recombinant β-amylases from Oryza sativa.

    PubMed

    Koide, Tomojiro; Ohnishi, Yasuo; Horinouchi, Sueharu

    2011-01-01

    Four putative β-amylase genes found in the Oryza sativa cDNA sequence database (KOME) were expressed in Escherichia coli. Recombinant proteins from two of these genes showed β-amylase activity. Similarly to β-amylases from other plants, the optimum pH of the recombinant rice β-amylases was about 5.5-6.0, but they exhibited inferior heat stability to soybean β-amylase.

  18. Biotechnological Processes in Microbial Amylase Production

    PubMed Central

    Arshad, M. K. Md; Lakshmipriya, Thangavel; Hashim, Uda; Chinni, Suresh V.

    2017-01-01

    Amylase is an important and indispensable enzyme that plays a pivotal role in the field of biotechnology. It is produced mainly from microbial sources and is used in many industries. Industrial sectors with top-down and bottom-up approaches are currently focusing on improving microbial amylase production levels by implementing bioengineering technologies. The further support of energy consumption studies, such as those on thermodynamics, pinch technology, and environment-friendly technologies, has hastened the large-scale production of the enzyme. Herein, the importance of microbial (bacteria and fungi) amylase is discussed along with its production methods from the laboratory to industrial scales. PMID:28280725

  19. Some aspects of the mechanism of complexation of red kidney bean alpha-amylase inhibitor and alpha-amylase.

    PubMed

    Wilcox, E R; Whitaker, J R

    1984-04-10

    Bovine pancreatic alpha-amylase binds 1 mol of acarbose (a carbohydrate alpha-amylase inhibitor) per mol at the active site and also binds acarbose nonspecifically. The red kidney bean alpha-amylase inhibitor-bovine pancreatic alpha-amylase complex retained nonspecific binding for acarbose only. Binding of p-nitrophenyl alpha-D-maltoside to the final complex of red kidney bean alpha-amylase inhibitor and bovine pancreatic alpha-amylase has a beta Ks (Ks') value that is 3.4-fold greater than the Ks (16 mM) of alpha-amylase for p-nitrophenyl alpha-D-maltoside alone. The initial complex of alpha-amylase and inhibitor apparently hydrolyzes this substrate as rapidly as alpha-amylase alone. The complex retains affinity for substrates and competitive inhibitors, which, when present in high concentrations, cause dissociation of the complex. Maltose (0.5 M), a competitive inhibitor of alpha-amylase, caused dissociation of the red kidney bean alpha-amylase inhibitor--alpha-amylase complex. Interaction between red kidney bean (Phaseolus vulgaris) alpha-amylase inhibitor and porcine pancreatic alpha-amylase proceeds through two steps. The first step has a Keq of 3.1 X 10(-5) M. The second step (unimolecular; first order) has a forward rate constant of 3.05 min-1 at pH 6.9 and 30 degrees C. alpha-Amylase inhibitor combines with alpha-amylase, in the presence of p-nitrophenyl alpha-D-maltoside, noncompetitively. On the basis of the data presented, it is likely that alpha-amylase is inactivated by the alpha-amylase inhibitor through a conformational change. A kinetic model, in the presence and absence of substrate, is described for noncompetitive, slow, tight-binding inhibitors that proceed through two steps.

  20. Susceptibility to corrosion of laser welding composite arch wire in artificial saliva of salivary amylase and pancreatic amylase.

    PubMed

    Zhang, Chao; Liu, Jiming; Yu, Wenwen; Sun, Daqian; Sun, Xinhua

    2015-10-01

    In this study, laser-welded composite arch wire (CAW) with a copper interlayer was exposed to artificial saliva containing salivary amylase or pancreatic amylase, and the resultant corrosion behavior was studied. The purpose was to determine the mechanisms by which salivary amylase and pancreatic amylase contribute to corrosion. The effects of amylase on the electrochemical resistance of CAW were tested by potentiodynamic polarization measurements. The dissolved corrosion products were determined by ICP-OES, and the surfaces were analyzed by SEM, AFM and EDS. The results showed that both exposure to salivary amylase and pancreatic amylase significantly improved the corrosion resistance of CAW. Even isozyme could have different influences on the alloy surface. When performing in vitro research of materials to be used in oral cavity, the effect of α-amylase should be taken into account since a simple saline solution does not entirely simulate the physiological situation.

  1. [Microbe amylases: characteristic, properties and practical use].

    PubMed

    Kubrak, O I; Lushchak, V I

    2007-01-01

    Current data concerning structure, properties and methods of purification ofmicrobial amylolytic enzymes are summarized in this paper. A short characteristic of the main methods of amylase activity measuring is presented, the advantages and disadvantages of each method are shown. It is proposed that novel techniques of enzyme immobilization stabilize the structure of amylases and allow their multiple uses. Scientific interest to amylases is analyzed that is explained by a number of their unique properties such as thermostability and pH-tolerance. Authors have demonstrated some examples of the practical using ofamylases in different fields of industry: textile, paper, food industries, brewing and wine-making. The prospects of their possible using in detergent preparing for laundries and dishwashers are presented. It is supposed that future investigations in this trend for isolating new amrnylases from native producers will be developed.

  2. Detection of pulmonary amylase activity in exhaled breath condensate.

    PubMed

    Zweifel, M; Rechsteiner, T; Hofer, M; Boehler, A

    2013-12-01

    Amylase activity in exhaled breath condensate (EBC) is usually interpreted as an indication of oropharyngeal contamination despite the fact that amylase can be found in pulmonary excretions. The aim of this study was to recruit and refine an amylase assay in order to detect amylase activity in any EBC sample and to develop a method to identify EBC samples containing amylase of pulmonary origin. EBC was collected from 40 volunteers with an EcoScreen condenser. Amylase assays and methods to discriminate between oropharyngeal and pulmonary proteins were tested and developed using matched EBC and saliva samples. Our refined 2-chloro-4-nitrophenyl-α-D-maltotriosid (CNP-G3) assay was 40-fold more sensitive than the most sensitive commercial assay and allowed detection of amylase activity in 30 µl of EBC. We developed a dot-blot assay which allowed detection of salivary protein in saliva diluted up to 150 000-fold. By plotting amylase activity against staining intensity we identified a few EBC samples with high amylase activity which were aligned with diluted saliva. We believe that EBC samples aligned with diluted saliva contain amylase activity introduced during EBC collection and that all other EBC samples contain amylase activity of pulmonary origin and are basically free of oropharyngeal protein contamination.

  3. Expression of β-Amylase from Alfalfa Taproots1

    PubMed Central

    Gana, Joyce A.; Kalengamaliro, Newton E.; Cunningham, Suzanne M.; Volenec, Jeffrey J.

    1998-01-01

    Alfalfa (Medicago sativa L.) roots contain large quantities of β-amylase, but little is known about its role in vivo. We studied this by isolating a β-amylase cDNA and by examining signals that affect its expression. The β-amylase cDNA encoded a 55.95-kD polypeptide with a deduced amino acid sequence showing high similarity to other plant β-amylases. Starch concentrations, β-amylase activities, and β-amylase mRNA levels were measured in roots of alfalfa after defoliation, in suspension-cultured cells incubated in sucrose-rich or -deprived media, and in roots of cold-acclimated germ plasms. Starch levels, β-amylase activities, and β-amylase transcripts were reduced significantly in roots of defoliated plants and in sucrose-deprived cell cultures. β-Amylase transcript was high in roots of intact plants but could not be detected 2 to 8 d after defoliation. β-Amylase transcript levels increased in roots between September and October and then declined 10-fold in November and December after shoots were killed by frost. Alfalfa roots contain greater β-amylase transcript levels compared with roots of sweetclover (Melilotus officinalis L.), red clover (Trifolium pratense L.), and birdsfoot trefoil (Lotus corniculatus L.). Southern analysis indicated that β-amylase is present as a multigene family in alfalfa. Our results show no clear association between β-amylase activity or transcript abundance and starch hydrolysis in alfalfa roots. The great abundance of β-amylase and its unexpected patterns of gene expression and protein accumulation support our current belief that this protein serves a storage function in roots of this perennial species. PMID:9847126

  4. Characterization and Optimization of Amylase Production in WangLB, a High Amylase-Producing Strain of Bacillus.

    PubMed

    Wang, Shihui; Jeyaseelan, Jenasia; Liu, Yun; Qin, Wensheng

    2016-09-01

    The costs of amylase represent ca. 24 % of the expenditures in the starch industry and an increase in amylase production and/or activity will greatly cut down on production costs. In the present study, we obtained a high amylase-producing strain of bacteria, WangLB, and identified it as a member of the Bacillus genus based on 16S rDNA analysis. The fermentation conditions for amylase production in the strain were optimized, and the maximum amylase activity we obtained was 26,670 ± 1390 U/mL, under the optimized conditions of 48-h incubation in liquid starch medium, 35 °C, pH 10, 1 % v/v inoculum concentration, 20 g/L starch concentration, and 0.1 % w/v peptone. The influences of 16 small organic inducers on amylase production were tested, and the results showed that 20 mmol/L alanine greatly enhanced amylase production to 290 % of the baseline level. We also conducted an amylase enzymology analysis. The molecular weight of the amylase was 55 kD, determined by SDS-PAGE. The optimum temperature and pH for the amylase were 55 °C and pH 9, respectively. The enzyme also showed high activity over a wide range of temperatures (50-85 °C) and pH values (3-10), and the activity of the amylase was Ca(2+) independent. The kinetic parameters K m and V max were 0.37 ± 0.02 mg/mL and 233 U/mg, respectively. Finally, the amylase was applied to the hydrolysis of five different brands of starch. It was found that the hydrolyzability of the substrate by amylase increased along with starch solubility.

  5. Bakers' asthma caused by alpha amylase.

    PubMed

    Valdivieso, R; Subiza, J; Subiza, J L; Hinojosa, M; de Carlos, E; Subiza, E

    1994-10-01

    Two bakers with bronchial asthma and two with rhinoconjunctivitis are described. Prick and RAST tests were positive with wheat flour in all of them, but the challenge test (nasal or bronchial) with wheat flour extract was positive only in one asthmatic baker. The prick test, RAST, and nasal or bronchial challenge done with alpha amylase extract (a glycolytic enzyme obtained from Aspergillus oryzae and used as a flour additive) were positive in all four patients. Our results support previous data indicating that alpha amylase used in bakeries is an important antigen that could cause respiratory allergy in bakers. It can function as sole causative allergen or in addition with other allergens used in the baking industry.

  6. Abdominal pain and a raised amylase? It's not always pancreatitis. . .

    PubMed

    Oluwatowoju, I O; Abu, O E; Lawson, G

    2013-01-01

    We report the case of a 72 year old man with a history of COPD and heavy alcohol consumption who was initially diagnosed with acute pancreatitis based on a presentation with epigastric pain and elevated serum amylase. Review of his notes revealed several previous similar admissions and extensive normal investigations apart from persistently elevated amylase. Further analysis showed evidence of macroamylasaemia which accounted for the apparently high serum amylase level.

  7. Activated effect of lignin on α-amylase.

    PubMed

    Zhang, Juan; Cui, Jun-Hui; Yin, Tingting; Sun, Lizhou; Li, Genxi

    2013-12-01

    This paper reports a new kind of activator of α-amylase, lignin, which can greatly increase α-amylase activity. The promoted ratio of lignin is even much higher than that of chloride ion, the traditional activator of α-amylase. Further experimental results reveal that lignin may interact with α-amylase to form a 1:1 complex with a binding constant of 4.47×10(5) M(-1). The binding is spontaneous and lignin/α-amylase complex formation is an exothermal reaction. Hydrogen bonding plays a key role and non-radiation energy transfers from α-amylase to lignin in the binding process. Lignin, combining with α-amylase, conforms to a first-order exponential decay function. The formation of the lignin/α-amylase complex results in the reduction of α-helical content from 57.7% to 53.9%, the increase of the polarity around tryptophan residues, the decrease of the hydrophobicity, and the enlargement of protein granule volume. This work will give a deeper insight into lignin as a kind of dietary fibre, known as an important food functional factor. Furthermore, it also contributes to the exploration of an activator of α-amylase, used in the food industry.

  8. Thermal adaptation of α-amylases: a review.

    PubMed

    Hiteshi, Kalpana; Gupta, Reena

    2014-11-01

    The temperature adaptation of α-amylase can be gained by different adjustments in protein structure with consecutive effects on the stability and flexibility of the protein. In this review, meso, thermo and cold-active α-amylases have been compared with respect to their structure and intramolecular interactions. With decrease in temperature, the number of ionic interactions also decreases, leading to greater flexibility of proteins. It has also been observed that the proline and arginine content is higher in thermophilic amylases as compared to meso and psychrophilic amylases, increasing the rigidity and structural stability of protein molecule.

  9. Variation in amylase activities in radish (Raphanus sativus) cultivars.

    PubMed

    Hara, Masakazu; Ito, Fumio; Asai, Tatsuo; Kuboi, Toru

    2009-09-01

    The radish (Raphanus sativus) is a root vegetable of the Brassicaceae family which shows amylolytic activity in the taproot. However, there is little information about differences in these amylolytic activities among radish cultivars. We analyzed the amylase activities and starch contents of 7 kinds of radish cultivars. The Koshin cultivar showed the highest amylase activity, with a level approximately 6 times higher than that of the Sobutori cultivar, which had the lowest. Cultivars with higher amylase activities showed higher starch contents. These results suggest that there are intraspecies variations in amylolytic activities in radishes, and positive correlations between amylase activity and starch content.

  10. Effect of starch and amylase on the expression of amylase-binding protein A in Streptococcus gordonii.

    PubMed

    Nikitkova, A E; Haase, E M; Scannapieco, F A

    2012-08-01

    Streptococcus gordonii is a common oral commensal bacterial species in tooth biofilm (dental plaque) and specifically binds to salivary amylase through the surface exposed amylase-binding protein A (AbpA). When S. gordonii cells are pretreated with amylase, amylase bound to AbpA facilitates growth with starch as a primary nutrition source. The goal of this study was to explore possible regulatory effects of starch, starch metabolites and amylase on the expression of S. gordonii AbpA. An amylase ligand-binding assay was used to assess the expression of AbpA in culture supernatants and on bacterial cells from S. gordonii grown in defined medium supplemented with 1% starch, 0.5 mg ml(-1) amylase, with starch and amylase together, or with various linear malto-oligosaccharides. Transcription of abpA was determined by reverse transcription quantitative polymerase chain reaction. AbpA was not detectable in culture supernatants containing either starch alone or amylase alone. In contrast, the amount of AbpA was notably increased when starch and amylase were both present in the medium. The expression of abpA was significantly increased (P < 0.05) following 40 min of incubation in defined medium supplemented with starch and amylase. Similar results were obtained in the presence of maltose and other short-chain malto-oligosacchrides. These results suggest that the products of starch hydrolysis produced from the action of salivary α-amylase, particularly maltose and maltotriose, up-regulate AbpA expression in S. gordonii.

  11. Temperature impacts the multiple attack action of amylases.

    PubMed

    Bijttebier, Annabel; Goesaert, Hans; Delcour, Jan A

    2007-03-01

    The action pattern of several amylases was studied at 35, 50, and 70 degrees C using potato amylose, a soluble (Red Starch) and insoluble (cross-linked amylose) chromophoric substrate. With potato amylose as substrate, Bacillus stearothermophilus alpha-amylase (BStA) and porcine pancreatic alpha-amylase displayed a high degree of multiple attack (DMA, i.e., the number of bonds broken during the lifetime of an enzyme-substrate complex minus one), the fungal alpha-amylase from Aspergillus oryzae a low DMA, and the alpha-amylases from B. licheniformis, Thermoactinomyces vulgaris, B. amyloliquifaciens, and B. subtilis an intermediate DMA. These data are discussed in relation to structural properties of the enzymes. The level of multiple attack (LMA), based on the relation between the drop in iodine binding of amylose and the increase in total reducing value, proved to be a good alternative for DMA measurements. The LMA of the endo-amylases increased with temperature to a degree depending on the amylase. In contrast, BStA showed a decreased LMA when temperature was raised. Furthermore, different enzymes had different activities on Red Starch and cross-linked amylose. Hence, next to the temperature, the action pattern of alpha-amylases is influenced by structural parameters of the starch substrate.

  12. The Amylase Project: Creating a Classroom of Biotechnologists.

    ERIC Educational Resources Information Center

    Sweeney, Diane

    1998-01-01

    A biotechnologist-turned-teacher introduces a series of laboratory modules incorporating concepts from microbiology, cellular biology, molecular biology, biochemistry, and evolution. The Amylase Project aims to distill the biotechnology process into a few short steps using amylase, the easiest enzyme to detect of those commonly produced by…

  13. Method for using a yeast alpha-amylase promoter

    DOEpatents

    Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.

    2003-04-22

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  14. On the mechanism of alpha-amylase.

    PubMed

    Oudjeriouat, Naïma; Moreau, Yann; Santimone, Marius; Svensson, Birte; Marchis-Mouren, Guy; Desseaux, Véronique

    2003-10-01

    Two inhibitors, acarbose and cyclodextrins (CD), were used to investigate the active site structure and function of barley alpha-amylase isozymes, AMY1 and AMY2. The hydrolysis of DP 4900-amylose, reduced (r) DP18-maltodextrin and maltoheptaose (catalysed by AMY1 and AMY2) was followed in the absence and in the presence of inhibitor. Without inhibitor, the highest activity was obtained with amylose, kcat/Km decreased 103-fold using rDP18-maltodextrin and 10(5) to 10(6)-fold using maltoheptaose as substrate. Acarbose is an uncompetitive inhibitor with inhibition constant (L1i) for amylose and maltodextrin in the micromolar range. Acarbose did not bind to the active site of the enzyme, but to a secondary site to give an abortive ESI complex. Only AMY2 has a second secondary binding site corresponding to an ESI2 complex. In contrast, acarbose is a mixed noncompetitive inhibitor of maltoheptaose hydrolysis. Consequently, in the presence of this oligosaccharide substrate, acarbose bound both to the active site and to a secondary binding site. alpha-CD inhibited the AMY1 and AMY2 catalysed hydrolysis of amylose, but was a very weak inhibitor compared to acarbose.beta- and gamma-CD are not inhibitors. These results are different from those obtained previously with PPA. However in AMY1, as already shown for amylases of animal and bacterial origin, in addition to the active site, one secondary carbohydrate binding site (s1) was necessary for activity whereas two secondary sites (s1 and s2) were required for the AMY2 activity. The first secondary site in both AMY1 and AMY2 was only functional when substrate was bound in the active site. This appears to be a general feature of the alpha-amylase family.

  15. α-Amylase inhibitory triterpene from Abrus precatorius leaves.

    PubMed

    Yonemoto, Ryuta; Shimada, Miyuki; Gunawan-Puteri, Maria D P T; Kato, Eisuke; Kawabata, Jun

    2014-08-20

    In the screening experiments for porcine pancreatic α-amylase inhibitors in 18 plants obtained from Indonesia, a potent inhibitory activity was detected in the extract of leaves of Abrus precatorius. The enzyme assay-guided fractionation of the extract led to the isolation of a triterpene ketone, lupenone (1), as a potent α-amylase inhibitor, together with 24-methylenecycloartenone (2) and luteolin (3). The mode of inhibition of compound 1 against porcine pancreatic α-amylase was a mixed inhibition. This is the first report that describes the potent α-amylase inhibitory activity of the low-polar triterpene ketone similar to compound 1. A comparison of the activities of the isolate and related compounds indicated the importance of C-3 ketone and the lupane skeleton in the α-amylase inhibitory activity.

  16. [Mechanism of amylase action on glucoside starch bonds].

    PubMed

    Zherebtsov, N A; Zabelina, L F; Ektoba, A I

    1976-12-01

    Functional groups of glucoamylase and alpha-amylase from Asp. awamori, alpha-amylase from Asp. oryzae and alpha- and beta-amylases from barley malt are identified. Kinetic curves of the activity dependency on pH, values of ionization heats and photooxidative inactivation draw to the conclusion that carboxyl-imidazole system enters into the active site of the enzymes. A hypothetic mechanism of hydrolysis of alpha-1,4-glucoside bond in starch molecule by alpha- and beta-amylases and of alpha-1,4- and alpha-1,6-glucoside bonds by glucoamylase is given. A theory of induced correspondence of enzyme and substrate satisfactorily explains the specificity of the enzyme action and the cause of complete starch convertion into glucose under glucoamylase action and of terminal starch hydrolysis by alpha- and beta-amylases.

  17. The potato amylase inhibitor gene SbAI regulates cold-induced sweetening in potato tubers by modulating amylase activity.

    PubMed

    Zhang, Huiling; Liu, Jun; Hou, Juan; Yao, Ying; Lin, Yuan; Ou, Yongbin; Song, Botao; Xie, Conghua

    2014-09-01

    Potato cold-induced sweetening (CIS) is critical for the postharvest quality of potato tubers. Starch degradation is considered to be one of the key pathways in the CIS process. However, the functions of the genes that encode enzymes related to starch degradation in CIS and the activity regulation of these enzymes have received less attention. A potato amylase inhibitor gene known as SbAI was cloned from the wild potato species Solanum berthaultii. This genetic transformation confirmed that in contrast to the SbAI suppression in CIS-resistant potatoes, overexpressing SbAI in CIS-sensitive potatoes resulted in less amylase activity and a lower rate of starch degradation accompanied by a lower reducing sugar (RS) content in cold-stored tubers. This finding suggested that the SbAI gene may play crucial roles in potato CIS by modulating the amylase activity. Further investigations indicated that pairwise protein-protein interactions occurred between SbAI and α-amylase StAmy23, β-amylases StBAM1 and StBAM9. SbAI could inhibit the activities of both α-amylase and β-amylase in potato tubers primarily by repressing StAmy23 and StBAM1, respectively. These findings provide the first evidence that SbAI is a key regulator of the amylases that confer starch degradation and RS accumulation in cold-stored potato tubers.

  18. Activity and storage of commercial amylases in the 2013 Louisiana grinding season

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A current problem in the application of amylases at sugarcane factories is the existence of a wide variation in the activities and activity per unit cost of commercial amylases. The efficiency of amylase action to break down starch in the factory is related to the activity of the amylase used. Until...

  19. Bacillus thuringiensis HCB6 Amylase Immobilization by Chitosan Beads

    NASA Astrophysics Data System (ADS)

    Zusfahair; Ningsih, D. R.; Kartika, D.; Fatoni, A.; Zuliana, A. L.

    2017-02-01

    The purpose of this study was to optimize the amylase immobilization using a chitosan bead and to characterize immobilized amylase of Bacillus thuringiensis Bacteria HCB6. This study was started of amylase production, continued by immobilization optimization including ratio of chitosan:enzymes, enzyme-matrix contact time, substrate concentration, pH effect, incubation temperature effect, reaction time, and stability of immobilized enzyme. Amylase activity assay was dinitro salicylic (DNS) method. The results showed the optimum chitosan:enzyme ratio was 2.5: 1 (v/v), immobilization contact time of 18 hours and immobilization efficiency of 87.93%. Furthermore, immobilized amylase of B. thuringiensis HCB6 showed optimum substrate concentration of 1.5%, optimum pH of 6, optimum incubation temperature of 37 ° C, and the reaction time of 30 minutes. The Michaelis-Menten constant KM value for free and immobilized amylase were 5.30% and 1.33% respectively. Immobilized amylase can be used up to five times with the remaining activity of 43.3%.

  20. Antiviral Cystine Knot α-Amylase Inhibitors from Alstonia scholaris*

    PubMed Central

    Nguyen, Phuong Quoc Thuc; Ooi, Justin Seng Geap; Nguyen, Ngan Thi Kim; Wang, Shujing; Huang, Mei; Liu, Ding Xiang; Tam, James P.

    2015-01-01

    Cystine knot α-amylase inhibitors are cysteine-rich, proline-rich peptides found in the Amaranthaceae and Apocynaceae plant species. They are characterized by a pseudocyclic backbone with two to four prolines and three disulfides arranged in a knotted motif. Similar to other knottins, cystine knot α-amylase inhibitors are highly resistant to degradation by heat and protease treatments. Thus far, only the α-amylase inhibition activity has been described for members of this family. Here, we show that cystine knot α-amylase inhibitors named alstotides discovered from the Alstonia scholaris plant of the Apocynaceae family display antiviral activity. The alstotides (As1–As4) were characterized by both proteomic and genomic methods. All four alsotides are novel, heat-stable and enzyme-stable and contain 30 residues. NMR determination of As1 and As4 structures reveals their conserved structural fold and the presence of one or more cis-proline bonds, characteristics shared by other cystine knot α-amylase inhibitors. Genomic analysis showed that they contain a three-domain precursor, an arrangement common to other knottins. We also showed that alstotides are antiviral and cell-permeable to inhibit the early phase of infectious bronchitis virus and Dengue infection, in addition to their ability to inhibit α-amylase. Taken together, our results expand membership of cystine knot α-amylase inhibitors in the Apocynaceae family and their bioactivity, functional promiscuity that could be exploited as leads in developing therapeutics. PMID:26546678

  1. Activity and cellular localization of amylases of rabbit cecal bacteria.

    PubMed

    Sirotek, K; Marounek, M; Suchorská, O

    2006-01-01

    Five 11-week-old rabbits, fed a commercial granulated feed, were slaughtered and cecal starch-degrading bacteria enumerated; total concentration of cultivable bacteria utilizing starch averaged 5.5 x 10(10) CFU/g. The activity and cellular localization of amylases was determined in 9 bacteria identified as Actinomyces israeli (strains AA2 and AD4), Bacteroides spp. (strain AA3), Dichelobacter nodosus (strain AA4), Mitsuokella multiacidus (strain AA6), Eubacterium spp. (strains AA7 and AB2), Clostridium spp. (strains AD1 and AA5). Four strains (AA3, AA4, AA5, AD4) produced extracellular amylases with an activity of 26-35 micromol of reducing sugars per h per mg of protein; in five strains (AA2, AA6, AA7, AB2, AD1) amylases were membrane-bound with an activity of 14-18 micromol of reducing sugars per h per mg of protein. All strains exhibited a low intracellular amylolytic activity. The pH optimum of amylases was 6.8-7.0. In strains producing extracellular amylases a substantial loss of viscosity was observed during incubations of cultivation supernatant with starch, similar to viscosity reduction in starch solutions treated with alpha-amylase; this indicates an endo-type (random cleavage) of extracellular amylase reaction in the bacteria under study. No strain possessed glucoamylase activity.

  2. Expression of liver alpha-amylase in obese mouse hepatocytes

    PubMed Central

    Afsartala, Zohreh; Savabkar, Sanaz; Nazemalhosseini Mojarad, Ehsan; Assadollahi, Vahideh; Tanha, Shima; Bijangi, Khosro; Gholami, Mohammadreza

    2016-01-01

    Aim: The aim of this study is to demonstrate the relation between the expression of liver alpha-amylase and obesity. Background: Alpha-amylase catalyses the hydrolysis of 1, 4-alpha-glucosidic linkages in polysaccharides and has three main subtypes, including: salivary, pancreatic, and hepatic. Hepatic alpha-amylase is involved in glycogen metabolism, and has a role in obesity and its management. In this study, we aimed to analyze the expression of liver alpha-amylase in overweight and obese mouse. Material and methods: In this study, NMRI male mice were randomly divided into two groups. The sample group (obese) took a high-fat and carbohydrate diet, while the control group (normal) took a laboratory pellet chow for eight weeks. During this period, their weight was measured. After eight weeks, liver hepatocytes were isolated using an enzymatic digestion method. Immunocytochemistry (ICC) and flow cytometry analysis were performed to measure alpha amylase protein expression in mouse liver hepatocyte cells. Results: A significant difference in the body weight was observed between the two groups (p<0.05). The qualitative protein expression of liver alpha-amylase was found to be higher in the obese group in both tests (immunocytochemistry and flow cytometry). Animals from the test group presented higher alpha-amylase expression, which suggests that this hepatic protein may constitute a potential indicator of susceptibility for fat tissue accumulation and obesity. The present data demonstrates an increased expression of liver amylase in obese mice. Conclusion: These results suggest that liver amylase secretion might be useful for predicting susceptibility to obesity induced by consumption of a high-fat and carbohydrate diet. PMID:27895853

  3. Characterisation of three starch degrading enzymes: thermostable β-amylase, maltotetraogenic and maltogenic α-amylases.

    PubMed

    Derde, L J; Gomand, S V; Courtin, C M; Delcour, J A

    2012-11-15

    Maltogenic α-amylase from Bacillus stearothermophilus (BStA) is widely used as bread crumb anti-firming enzyme. A maltotetraose-forming α-amylase from Pseudomonas saccharophila (PSA) was recently proposed as alternative, hence the need to compare both exo-acting enzymes with some endo-action component. A purely exo-acting thermostable β-amylase from Clostridium thermosulfurogenes (CTB) was included for reference purposes. Under the experimental conditions used, temperature optima of the enzymes are rather similar (60-65 °C), but temperature stability decreased in the order BStA, PSA and CTB. The action of the enzymes on different substrates and their impact on the rheological behaviour of maize starch suspensions demonstrated that, while CTB acts exclusively through an exo-action mechanism, BStA displayed limited endo-action which became more pronounced at higher temperatures. PSA has more substantial endo-action than BStA, which is rather temperature independent. This is important for their impact in processes such as breadmaking, where temperature is gradually increased.

  4. Inhibition of Sunn pest, Eurygaster integriceps, α-amylases by α-amylase inhibitors (T-αAI) from Triticale.

    PubMed

    Mehrabadi, Mohammad; Bandani, Ali R; Saadati, Fatemeh

    2010-01-01

    The effect of triticale α-amylases inhibitors on starch hydrolysis catalyzed by the Sunn pest, Eurygaster integriceps Puton (Hemiptera: Scutelleridae) midgut amylases was examined. Biochemical studgawies showed that inhibitors from Triticale (a hybrid of wheat and rye) had inhibitiory effects on E. integriceps α-amylases. The effects of the triticale α-amylase inhibitor (T-αAI) on α-amylase of E. integriceps showed a dose dependent manner of inhibition, e.g. less inhibition of enzyme activity (around 10%) with a lower dose (0.25 mg protein) and high inhibition of enzyme activity (around 80%) when a high dose of inhibitor was used (1.5 mg protein). The enzyme kinetic studies using Michaelis-Menten and Lineweaver-Burk equations showed the K(m) remained constant (0.58%) but the maximum velocity (V(max)) decreased in the presence of a crude extract of Triticale inhibitors, indicating mixed inhibition. The temperature giving 50% inactivation of enzyme (T(50)) during a 30-min incubation at pH 7.0 was 73° C. The maximum inhibitory activity was achieved at 35° C and pH 5.0. Gel assays showed the meaningful inhibition of E. integriceps α-amylases by various concentrations of Triticale inhibitors. Based on the data presented in this study, it could be said that the T-αAI has good inhibitory activity on E. integriceps gut α-amylase.

  5. Inhibition of Sunn Pest, Eurygaster integriceps, α-Amylases by α-Amylase Inhibitors (T-αAI) from Triticale

    PubMed Central

    Mehrabadi, Mohammad; Bandani, Ali R.; Saadati, Fatemeh

    2010-01-01

    The effect of triticale α-amylases inhibitors on starch hydrolysis catalyzed by the Sunn pest, Eurygaster integriceps Puton (Hemiptera: Scutelleridae) midgut amylases was examined. Biochemical studgawies showed that inhibitors from Triticale (a hybrid of wheat and rye) had inhibitiory effects on E. integriceps α-amylases. The effects of the triticale α-amylase inhibitor (T-αAI) on α-amylase of E. integriceps showed a dose dependent manner of inhibition, e.g. less inhibition of enzyme activity (around 10%) with a lower dose (0.25 mg protein) and high inhibition of enzyme activity (around 80%) when a high dose of inhibitor was used (1.5 mg protein). The enzyme kinetic studies using Michaelis-Menten and Lineweaver-Burk equations showed the Km remained constant (0.58%) but the maximum velocity (Vmax) decreased in the presence of a crude extract of Triticale inhibitors, indicating mixed inhibition. The temperature giving 50% inactivation of enzyme (T50) during a 30-min incubation at pH 7.0 was 73° C. The maximum inhibitory activity was achieved at 35° C and pH 5.0. Gel assays showed the meaningful inhibition of E. integriceps α-amylases by various concentrations of Triticale inhibitors. Based on the data presented in this study, it could be said that the T-αAI has good inhibitory activity on E. integriceps gut α-amylase. PMID:21062146

  6. [Amylases of the fungus Aspergillus flavipes associated with Fucus evanescens].

    PubMed

    Frolova, G M; Sil'chenko, A S; Pivkin, M V; Mikhaĭlov, V V

    2002-01-01

    A promising producer of extracellular amylases, Aspergillus flavipes, was selected from 245 strains of marine fungi. Depending on the conditions of growth, this strain produced diverse amylolytic complexes. When grown on medium containing peptone and yeast extract (pH 7.0), A. flavipes synthesized three forms of amylase, differing in pH optimum (5.5, 6.0, and 7.5). A single form of the enzyme was synthesized either in the absence of peptone from the medium or at the initial pH value of the medium, equal to 8.6. The activity of the isolated amylase forms decreased in the presence of proteolytic enzymes. New, highly stable forms of amylase (with pH optima of 5.5 and 7.5 and maximum activity at 60-80 degrees C) were synthesized in the presence of diisopropyl fluorophosphate, an inhibitor of proteases.

  7. [Peritoneal mesothelioma with elevated amylase in the ascitic fluid].

    PubMed

    Carrión, A; Jover, R; Carnicer, F; García, M F; Aranda, F I; Martínez, J F; Griñó

    1995-03-01

    The case of a 42-year-old woman with no previous disease admitted for abdominal pain and ascites is presented. Analysis of the ascitic fluid demonstrated high concentrations of amylase with normal lipase. The diagnosis of peritoneal mesothelioma was obtained by laparotomy. This association has not been previously described. The authors suggest that this diagnostic possibility should be considered in patients without pancreatic disease and high amylase levels in ascitic fluid.

  8. Purification and Characterization of Pea Epicotyl beta-Amylase.

    PubMed

    Lizotte, P A; Henson, C A; Duke, S H

    1990-03-01

    The most abundant beta-amylase (EC 3.2.1.2) in pea (Pisum sativum L.) was purified greater than 880-fold from epicotyls of etiolated germinating seedlings by anion exchange and gel filtration chromatography, glycogen precipitation, and preparative electrophoresis. The electrophoretic mobility and relative abundance of this beta-amylase are the same as that of an exoamylase previously reported to be primarily vacuolar. The enzyme was determined to be a beta-amylase by end product analysis and by its inability to hydrolyze beta-limit dextrin and to release dye from starch azure. Pea beta-amylase is an approximate 55 to 57 kilodalton monomer with a pl of 4.35, a pH optimum of 6.0 (soluble starch substrate), an Arrhenius energy of activation of 6.28 kilocalories per mole, and a K(m) of 1.67 milligrams per milliliter (soluble starch). The enzyme is strongly inhibited by heavy metals, p-chloromer-curiphenylsulfonic acid and N-ethylmaleimide, but much less strongly by iodoacetamide and iodoacetic acid, indicating cysteinyl sulfhydryls are not directly involved in catalysis. Pea beta-amylase is competitively inhibited by its end product, maltose, with a K(i) of 11.5 millimolar. The enzyme is partially inhibited by Schardinger maltodextrins, with alpha-cyclohexaamylose being a stronger inhibitor than beta-cycloheptaamylose. Moderately branched glucans (e.g. amylopectin) were better substrates for pea beta-amylase than less branched or non-branched (amyloses) or highly branched (glycogens) glucans. The enzyme failed to hydrolyze native starch grains from pea and glucans smaller than maltotetraose. The mechanism of pea beta-amylase is the multichain type. Possible roles of pea beta-amylase in cellular glucan metabolism are discussed.

  9. Extracellular Transglucosylase and α-Amylase of Streptococcus equinus1

    PubMed Central

    Boyer, Ernest W.; Hartman, Paul A.

    1971-01-01

    Culture filtrates of Streptococcus equinus 1091 contained α-amylase and transglucosylase. The effects of calcium carbonate, age of inoculum, concentration of maltose, and duration of the fermentation on α-amylase and transglucosylase production were determined. The extracellular α-amylase was purified 48-fold and was free of transglucosylase activity. The α-amylase (amylose substrate) required Cl− for maximum activity; ethylenediaminetetraacetic acid (EDTA) partially inhibited activity, but CaCl2 prevented EDTA inhibition. The temperature optimum was 38 C at pH 7.0, and the pH optimum was 7.0 at 37 C in the presence of CaCl2. Predominant final products of amylose hydrolysis, in order of decreasing prevalence, were maltose, maltotriose, maltotetraose, and glucose. The α-amylase showed no evidence of multiple attack. The extracellular transglucosylase was purified 27-fold, but a small amount of α-amylase remained. Transglucosylase activity (amylose substrate) was not increased in the presence of CaCl2. The temperature optimum was 37 C at pH 6.5, and the pH optimum was 6.0 at 37 C. Carbohydrates that served as acceptors for the transglucosylase to degrade amylose were, in order of decreasing acceptor efficiency: d-glucose, d-mannose, l-sorbose, maltose, sucrose, and trehalose. The extracellular transglucosylase of S. equinus 1091 synthesized higher maltodextrins in the medium when the cells were grown in the presence of maltose. Images PMID:4995651

  10. Characterization of salivary alpha-amylase binding to Streptococcus sanguis

    SciTech Connect

    Scannapieco, F.A.; Bergey, E.J.; Reddy, M.S.; Levine, M.J. )

    1989-09-01

    The purpose of this study was to identify the major salivary components which interact with oral bacteria and to determine the mechanism(s) responsible for their binding to the bacterial surface. Strains of Streptococcus sanguis, Streptococcus mitis, Streptococcus mutans, and Actinomyces viscosus were incubated for 2 h in freshly collected human submandibular-sublingual saliva (HSMSL) or parotid saliva (HPS), and bound salivary components were eluted with 2% sodium dodecyl sulfate. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer, alpha-amylase was the prominent salivary component eluted from S. sanguis. Studies with {sup 125}I-labeled HSMSL or {sup 125}I-labeled HPS also demonstrated a component with an electrophoretic mobility identical to that of alpha-amylase which bound to S. sanguis. Purified alpha-amylase from human parotid saliva was radiolabeled and found to bind to strains of S. sanguis genotypes 1 and 3 and S. mitis genotype 2, but not to strains of other species of oral bacteria. Binding of ({sup 125}I)alpha-amylase to streptococci was saturable, calcium independent, and inhibitable by excess unlabeled alpha-amylases from a variety of sources, but not by secretory immunoglobulin A and the proline-rich glycoprotein from HPS. Reduced and alkylated alpha-amylase lost enzymatic and bacterial binding activities. Binding was inhibited by incubation with maltotriose, maltooligosaccharides, limit dextrins, and starch.

  11. [Purification and characterization of thermostable amylases from two bacterial species].

    PubMed

    Dong, Yongcun; Liu, Yang; Chen, Yuanyuan; Niu, Dandan; Zhang, Liang; Shi, Guiyang; Wang, Zhengxiang

    2008-02-01

    Two thermophilic bacterial isolates, strain 173 and strain 174, with raw starch-digesting activities were selected from thermophilic bacteria growing in hot spring of Tengchong County, Yunnan Province, China. By amplification, sequencing and alignment analysis of 16S ribosomal DNAs, they were identified as members of genus Geobacillus. In shaker flask culture Geobacillus sp. 173 produced 14.5 U/mL amylase and for Geobacillus sp. 174 with 12.9 U/mL. Both amylases were purified by starch absorption-desorption and chromatograph. The amylases from strain 173 and strain 174 purified to about 50 and 29 folds were respectively achieved with an overall yield of 34% and 41%. The maximum gelatinized-starch-digesting activity of the purified amylases were at 70 degrees C and pH 5.0 - 5.5. The high raw-starch-digesting activity of these enzymes were observed at 50 degrees C - 60 degrees C (from strain 173) and 40 degrees C - 60 degrees C (from strain 174). Both enzymes were not sensitive to ions including mental ions (Na+, K+, Mg2+, Ca2+, Mn2+, Zn2+) and others (EDTA, Citrate), but were slightly inhibited by ions such as Co2+, Cu2+ for amylase from strain 173 and Cu2+ for amylase from strain 174. Both enzyme had specificity of starch substrates.

  12. Alpha-amylases of the coffee berry borer (Hypothenemus hampei) and their inhibition by two plant amylase inhibitors.

    PubMed

    Valencia, A; Bustillo, A E; Ossa, G E; Chrispeels, M J

    2000-03-01

    The adult coffee berry borer (Hypothenemus hampei Ferrari [Coleoptera: Scolytidae]), a major insect pest of coffee, has two major digestive alpha-amylases that can be separated by isoelectric focusing. The alpha-amylase activity has a broad pH optimum between 4.0 and 7.0. Using pH indicators, the pH of the midgut was determined to be between 4.5 and 5.2. At pH 5.0, the coffee berry borer alpha-amylase activity is inhibited substantially (80%) by relatively low levels of the amylase inhibitor (alphaAI-1) from the common bean, Phaseolus vulgaris L., and much less so by the amylase inhibitor from Amaranthus. We used an in-gel zymogram assay to demonstrate that seed extracts can be screened to find suitable inhibitors of amylases. The prospect of using the genes that encode these inhibitors to make coffee resistant to the coffee berry borer via genetic engineering is discussed.

  13. Activity of alpha-amylase inhibitors from Phaseolus coccineus on digestive alpha-amylases of the coffee berry borer.

    PubMed

    Valencia-Jiménez, Arnubio; Arboleda Valencia, Jorge W; Grossi-De-Sá, Maria Fátima

    2008-04-09

    Seeds of scarlet runner bean ( Phaseolus coccineus L.) were analyzed for alpha-amylase inhibitor (alpha-AI) activity. Through the use of polyclonal antibodies raised against pure alpha-AI-1 from common bean ( Phaseolus vulgaris L.), typical alpha-AlphaIota polypeptides (Mr 14-18 kDa) as well as a large polypeptide of Mr 32000 Da, usually referred to as "amylase inhibitor like", were detected. The inhibitor activity present in four accessions of P. coccineus was examined, both in semiquantitative zymograms allowing the separation of different isoforms and in quantitative assays against human salivary amylase, porcine pancreatic amylase, and coffee berry borer, Hypothenemus hampei Ferrari (Coleoptera: Scolytidae) amylase. Differential inhibition curves lead to the suggestion that the gene encoding one of the inhibitors in P. coccineus (in accession G35590) would be a good candidate for genetic engineering of coffee resistance toward the coffee berry borer. An in vitro proteolytic digestion treatment of pure alpha-AlphaIota-1 resulted in a rapid loss of the inhibitory activity, seriously affecting its natural capacity to interact with mammalian alpha-amylases.

  14. Adsorption of amylase enzyme on ultrafiltration membranes.

    PubMed

    Beier, Søren Prip; Enevoldsen, Ann Dorrit; Kontogeorgis, Georgios M; Hansen, Ernst B; Jonsson, Gunnar

    2007-08-28

    A method to measure the static adsorption on membrane surfaces has been developed and described. The static adsorption of amylase-F has been measured on two different ultrafiltration membranes, both with a cutoff value of 10 kDa (a PES membrane and the ETNA10PP membrane, which is a surface-modified PVDF membrane). The adsorption follows the Langmuir adsorption theory. Thus, the static adsorption consists of monolayer coverage and is expressed both as a permeability drop and an adsorption resistance. From the adsorption isotherms, the maximum static permeability drops and the maximum static adsorption resistances are determined. The maximum static permeability drop for the hydrophobic PES membrane is 75%, and the maximum static adsorption resistance is 0.014 m2.h.bar/L. The maximum static permeability drop for the hydrophilic surface-modified PVDF membrane (ETNA10PP) is 23%, and the maximum static adsorption resistance is 0.0046 m2.h.bar/L. The difference in maximum static adsorption, by a factor of around 3, affects the performance during the filtration of a 5 g/L amylase-F solution at 2 bar. The two membranes behave very similarly during filtration with almost equal fluxes and retentions even though the initial water permeability of the PES membrane is around 3 times larger than the initial water permeability of the ETNA10PP membrane. This is mainly attributed to the larger maximum static adsorption of the PES membrane. The permeability drop during filtration exceeds the maximum static permeability drop, indicating that the buildup layer on the membranes during filtration exceeds monolayer coverage, which is also seen by the increase in fouling resistance during filtration. The accumulated layer on the membrane surface can be described as a continually increasing cake-layer thickness, which is independent of the membrane type. At higher concentrations of enzyme, concentration polarization effects cannot be neglected. Therefore, stagnant film theory and the osmotic

  15. Analysis on evolutionary relationship of amylases from archaea, bacteria and eukaryota.

    PubMed

    Yan, Shaomin; Wu, Guang

    2016-02-01

    Amylase is one of the earliest characterized enzymes and has many applications in clinical and industrial settings. In biotechnological industries, the amylase activity is enhanced through modifying amylase structure and through cloning and expressing targeted amylases in different species. It is important to understand how engineered amylases can survive from generation to generation. This study used phylogenetic and statistical approaches to explore general patterns of amylases evolution, including 3118 α-amylases and 280 β-amylases from archaea, eukaryota and bacteria with fully documented taxonomic lineage. First, the phylogenetic tree was created to analyze the evolution of amylases with focus on individual amylases used in biofuel industry. Second, the average pairwise p-distance was computed for each kingdom, phylum, class, order, family and genus, and its diversity implies multi-time and multi-clan evolution. Finally, the variance was further partitioned into inter-clan variance and intra-clan variance for each taxonomic group, and they represent horizontal and vertical gene transfer. Theoretically, the results show a full picture on the evolution of amylases in manners of vertical and horizontal gene transfer, and multi-time and multi-clan evolution as well. Practically, this study provides the information on the surviving chance of desired amylase in a given taxonomic group, which may potentially enhance the successful rate of cloning and expression of amylase gene in different species.

  16. Effects of a new microbial α-amylase inhibitor protein on Helicoverpa armigera larvae.

    PubMed

    Zeng, Fanrong; Wang, Xiaojing; Cui, Jinjie; Ma, Yan; Li, Qiannan

    2013-03-06

    A new microbial α-amylase inhibitor gene was cloned and characterized. The encoded, recombinant, α-amylase inhibitor protein was induced and expressed by isopropyl β-d-1-thiogalactopyranoside (IPTG) in Escherichia coli M15 cells. The effects of the α-amylase inhibitor protein on Helicoverpa armigera larvae were studied. Compared to the control, the weight of H. armigera larvae fed the diet with recombinant α-amylase inhibitor protein added at a concentration of 20 μg/g was reduced by 49.8%. The total soluble protein of H. armigera larvae fed the diet with the α-amylase inhibitor protein added was also reduced by 36.8% compared to the control. The recombinant α-amylase inhibitor protein showed inhibition activity against α-amylase of H. armigera. These results suggested that this α-amylase inhibitor protein may be a promising bioinsecticide candidate for controlling H. armigera.

  17. Computer-aided subsite mapping of α-amylases.

    PubMed

    Mótyán, János A; Gyémánt, Gyöngyi; Harangi, János; Bagossi, Péter

    2011-02-15

    Subsite mapping is a crucial procedure in the characterization of α-amylases (EC 3.2.1.1), which are extensively used in starch-based industries and in diagnosis of pancreatic and salivary glands disorders. A computer-aided method has been developed for subsite mapping of α-amylases, which substitutes the difficult, expensive, and time-consuming experimental determination of action patterns to crystal structures based energy calculations. Interaction energies between enzymes and carbohydrate substrates were calculated after short energy minimization by a molecular mechanics program. A training set of wild type and mutant amylases with known experimental action patterns of 13 enzymes of wide range of origin was used to set up the procedure. Calculations for training set resulted in good correlation in case of subsite binding energies (r(2)=0.827-0.929) and bond cleavage frequencies (r(2)=0.727-0.835). A set of eight novel barley amylase 1 mutants was used to test our model. Subsite binding energies were predicted with r(2)=0.502 correlation coefficient, while bond cleavage frequency prediction resulted in r(2)=0.538. Our computer-aided procedure may supplement the experimental subsite mapping methods to predict and understand characteristic features of α-amylases.

  18. Zinc oxide nanoparticles as novel alpha-amylase inhibitors

    NASA Astrophysics Data System (ADS)

    Dhobale, Sandip; Thite, Trupti; Laware, S. L.; Rode, C. V.; Koppikar, Soumya J.; Ghanekar, Ruchika-Kaul; Kale, S. N.

    2008-11-01

    Amylase inhibitors, also known as starch blockers, contain substances that prevent dietary starches from being absorbed by the body via inhibiting breakdown of complex sugars to simpler ones. In this sense, these materials are projected as having potential applications in diabetes control. In this context, we report on zinc oxide nanoparticles as possible alpha-amylase inhibitors. Zinc oxide nanoparticles have been synthesized using soft-chemistry approach and 1-thioglycerol was used as a surfactant to yield polycrystalline nanoparticles of size ˜18 nm, stabilized in wurtzite structure. Conjugation study and structural characterization have been done using x-ray diffraction technique, Fourier transform infrared spectroscopy, UV-visible spectroscopy, and transmission electron microscopy. Cytotoxicity studies on human fibrosarcoma (HT-1080) and skin carcinoma (A-431) cell lines as well as mouse primary fibroblast cells demonstrate that up to a dose of 20 μg/ml, ZnO nanoparticles are nontoxic to the cells. We report for the first time the alpha-amylase inhibitory activity of ZnO nanoparticles wherein an optimum dose of 20 μg/ml was sufficient to exhibit 49% glucose inhibition at neutral pH and 35 °C temperature. This inhibitory activity was similar to that obtained with acarbose (a standard alpha-amylase inhibitor), thereby projecting ZnO nanoparticles as novel alpha-amylase inhibitors.

  19. Alpha-amylase from the Hyperthermophilic Archaeon Thermococcus thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, E. C. M. J.; Pusey, M. L.; Ng, M. L.; Garriott, O. K.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments such as hot springs. The ability of survival at extreme conditions has rendered enzymes from extremophiles to be of interest in industrial applications. One approach to producing these extremozymes entails the expression of the enzyme-encoding gene in a mesophilic host such as E.coli. This method has been employed in the effort to produce an alpha-amylase from a hyperthermophile (an organism that displays optimal growth above 80 C) isolated from a hydrothermal vent at the Rainbow vent site in the Atlantic Ocean. alpha-amylases catalyze the hydrolysis of starch to produce smaller sugars and constitute a class of industrial enzymes having approximately 25% of the enzyme market. One application for thermostable alpha-amylases is the starch liquefaction process in which starch is converted into fructose and glucose syrups. The a-amylase encoding gene from the hyperthermophile Thermococcus thioreducens was cloned and sequenced, revealing high similarity with other archaeal hyperthermophilic a-amylases. The gene encoding the mature protein was expressed in E.coli. Initial characterization of this enzyme has revealed an optimal amylolytic activity between 85-90 C and around pH 5.3-6.0.

  20. Beta-amylase-resistant amylose. Effect of urea on the limited hydrolysis of amylose by beta-amylase.

    PubMed

    Patil, N B

    1976-02-01

    Amylose prepared from starch dispersed in 10M-urea, pH6.2, was found to be resistant to the action of beta-amylase and phosphorylase, though it was degraded by alpha-amylase. Amylose isolated by conventional methods was similarly refractory after urea treatment, and was hydrolysed by beta-amylase to the extent of 32-35%; it had no inhibitory effect towards beta-amylase. The physical and chemical properties of the modified amylose were in general comparable with those of normal amylose with a beta-amylolysis limit of 94-98%. Starch and amylopectin were unaffected by urea treatment, i.e. the presence of amylopectin protected amylose against changes induced in it by urea. It is speculated that urea treatment "freezes" amylose molecules in a conformation that renders non-reducing termini inaccessible to the active site of the exo-enzymes. Such changes may limit the degradative action of beta-amylase and phosphorylase.

  1. Immobilization of α-Amylase onto Luffa operculata Fibers

    PubMed Central

    Morais, Ricardo R.; Pascoal, Aline M.; Caramori, Samantha S.; Lopes, Flavio M.; Fernandes, Kátia F.

    2013-01-01

    A commercial amylase (amy) was immobilized by adsorption onto Luffa operculata fibers (LOFs). The derivative LOF-amy presented capacity to hydrolyze starch continuously and repeatedly for over three weeks, preserving more than 80% of the initial activity. This system hydrolyzed more than 97% of starch during 5 min, at room temperature. LOF-amy was capable to hydrolyze starch from different sources, such as maize (93.96%), wheat (85.24%), and cassava (79.03%). A semi-industrial scale reactor containing LOF-amy was prepared and showed the same yield of the laboratory-scale system. After five cycles of reuse, the LOF-amy reactor preserved over 80% of the initial amylase activity. Additionally, the LOF-amy was capable to operate as a kitchen grease trap component in a real situation during 30 days, preserving 30% of their initial amylase activity. PMID:23606948

  2. False-positive results with amylase testing of citrus fruits.

    PubMed

    Ricci, Ugo; Carboni, Ilaria; Torricelli, Francesca

    2014-09-01

    In a case of robbery in which the criminals passed through the garden adorned with calamondin trees (Citrus madurensis), the investigators found in the grass six calamondin fruits, some undamaged, while others apparently bitten. The fruits were collected and sent to the laboratory for DNA analysis to verify the presence of saliva and robbers' DNA profile. A specific immunochromatographic strip test for saliva confirmed the presence of human salivary α-amylase, but similar positive results were also observed for intact calamondin and other citrus fruits. Further analysis with a specific automated amylase test confirmed the absence of amylase activity. DNA quantification and typing using a specific forensic kit revealed no human DNA presence in any fruits. This case report demonstrates for the first time the occurrence of false positives when human saliva is sought on citrus fruits.

  3. Anaerobic threshold determination with analysis of salivary amylase.

    PubMed

    Calvo, F; Chicharro, J L; Bandrés, F; Lucía, A; Pérez, M; Alvarez, J; Mojares, L L; Vaquero, A F; Legido, J C

    1997-12-01

    The purpose of this study was to determine the anaerobic threshold from analysis of amylase concentration in total saliva during a laboratory exercise test. Each of 20 healthy young men performed both a submaximal and a maximal test on a treadmill. During the submaximal test, capillary blood and total saliva samples were collected for determination of anaerobic threshold (AT) and saliva threshold (Tsa), respectively. Tsa was defined as the point at which the first continuous increase in amylase concentration occurred during exercise. The results showed no significant difference between values of AT and Tsa when both were expressed either as running velocity or as heart rate. In addition, there existed a high correlation between AT and Tsa (r = .93, p < .001). It was therefore concluded that the analysis of amylase concentration in total saliva during exercise might be used as a valid new method for determining AT.

  4. 21 CFR 184.1012 - α-Amylase enzyme preparation from Bacillus stearothermophilus.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true α-Amylase enzyme preparation from Bacillus... preparation from Bacillus stearothermophilus. (a) α-Amylase enzyme preparation is obtained from the culture... Bacillus stearothermophilus. Its characterizing enzyme activity is α-amylase (1,4 α-D...

  5. Electrophoretically unique amylases in rat livers: phylogenic and ontogenic study on the mammalian liver.

    PubMed

    Koyama, Iwao; Komine, Shin-Ichi; Hokari, Shigeru; Matsunaga, Toshiyuki; Nakamura, Koh-Ich; Komoda, Tsugikazu

    2002-09-01

    Liver amylase activity in rodents was assayed with Blue Starch as substrate, and found to be higher than in humans or pigs. Based on the result of concanavalin A affinity chromatography, we found that the sugar moieties of amylase molecules increased in parallel with amylase activity in the tested mammals. However, the amounts of amylase proteins determined by Western bloting with anti-human salivary-type antibody as the probe, were similar to the levels in mammalian livers. Moreover, a similar expression of amylase mRNA was also detected in the mammalian livers by a reverse transcriptional-polymerase chain reaction using primers specific for the human salivary and/or pancreatic amylase complementary DNA (cDNA) sequences. The amylase was detected at the catalytic activity, protein molecule and mRNA levels in rat liver at all ages from fetus to adult. Salivary-type liver amylase activity increased up to one week after birth, and was maintained at the adult level thereafter. However, based on the results of the electrophoretic mobility test, livers with accelerated amylase activity, e.g., at 2-4 weeks after birth or during liver regeneration after partial hepatectomy, were also found to express an amylase electrophoretical identical to pancreatic-type amylase in addition to salivary-type activity. These results suggest that the liver may express an etopic amylase in a certain condition.

  6. 21 CFR 184.1012 - α-Amylase enzyme preparation from Bacillus stearothermophilus.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false α-Amylase enzyme preparation from Bacillus... GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1012 α-Amylase enzyme preparation from Bacillus stearothermophilus. (a) α-Amylase enzyme preparation is obtained from the...

  7. 21 CFR 184.1012 - α-Amylase enzyme preparation from Bacillus stearothermophilus.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false α-Amylase enzyme preparation from Bacillus... GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1012 α-Amylase enzyme preparation from Bacillus stearothermophilus. (a) α-Amylase enzyme preparation is obtained from the...

  8. 21 CFR 184.1012 - α-Amylase enzyme preparation from Bacillus stearothermophilus.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false α-Amylase enzyme preparation from Bacillus... GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1012 α-Amylase enzyme preparation from Bacillus stearothermophilus. (a) α-Amylase enzyme preparation is obtained from the...

  9. Molecular characterization of α-amylase from Staphylococcus aureus.

    PubMed

    Lakshmi, Hanumanthu Prasanna; Prasad, Uppu Venkateswara; Yeswanth, Sthanikam; Swarupa, Vimjam; Prasad, Osuru Hari; Narasu, Mangamoori Lakshmi; Sarma, Potukuchi Venkata Gurunadha Krishna

    2013-01-01

    Staphylococcus aureus is one of the prominent Gram positive human pathogen secretes many surface and secretary proteins including various enzymes and pathogenic factors that favour the successful colonization and infection of host tissue. α-amylase is one of the enzymes secreted by S. aureus which catalyses the breakdown of complex sugars to monosaccharides, which are required for colonization and survival of this pathogen in any anatomical locales. In the present study we have cloned, sequenced, expressed and characterized α-amylase gene from S. aureus ATCC12600. The recombinant enzyme has a molecular weight of 58kDa and the kinetics showed Vmax 0.0208±0.033 (mg/ml)/mg/min and Km 10.633±0.737mg/ml. The multiple sequence analysis showed α- amylase of S. aureus exhibited large differences with Bacillus subtilis and Streptococcus bovis. As the crystal structure of S. aureus α- amylase was unavailable, we used homology modelling method to build the structure. The built structure was validated by Ramachandran plot which showed 90% of the residues in the allowed region while no residue was found in the disallowed region and the built structure was close to the crystal structure with Z-Score: -6.85. The structural superimposition studies with α- amylases of Bacillus subtilis and Streptococcus bovis showed distinct differences with RMSD values of 18.158Åand 7.091Å respectively which correlated with enzyme kinetics, indicating α-amylase is different among these bacteria.

  10. Mango starch degradation. II. The binding of alpha-amylase and beta-amylase to the starch granule.

    PubMed

    Peroni, Fernanda Helena Gonçalves; Koike, Claudia; Louro, Ricardo Pereira; Purgatto, Eduardo; do Nascimento, João Roberto Oliveira; Lajolo, Franco Maria; Cordenunsi, Beatriz Rosana

    2008-08-27

    During mango ripening, soluble sugars that account for mango sweetening are accumulated through carbon supplied by both photosynthesis and starch degradation. The cultivar Keitt has a characteristic dependence on sugar accumulation during starch degradation, which takes place during ripening, only a few days after detachment from the tree. Most knowledge about starch degradation is based on seeds and leaves currently used as models. However, information about the mango fruit is scarce. This work presents the evaluation of alpha- and beta-amylases in the starch granule surface during fruit development and ripening. Extractable proteins were assayed for amylase activity and detected by immunofluorescence microscopy and correlated to gene expression. The results suggest that both amylases are involved in starch degradation during mango ripening, probably under the dependence of another signal triggered by the detachment from the mother-plant.

  11. Structure of amylase-binding protein A of Streptococcus gordonii: a potential receptor for human salivary α-amylase enzyme.

    PubMed

    Sethi, Ashish; Mohanty, Biswaranjan; Ramasubbu, Narayanan; Gooley, Paul R

    2015-06-01

    Amylase-binding protein A (AbpA) of a number of oral streptococci is essential for the colonization of the dental pellicle. We have determined the solution structure of residues 24-195 of AbpA of Streptococcus gordonii and show a well-defined core of five helices in the region of 45-115 and 135-145. (13) Cα/β chemical shift and heteronuclear (15) N-{(1) H} NOE data are consistent with this fold and that the remainder of the protein is unstructured. The structure will inform future molecular experiments in defining the mechanism of human salivary α-amylase binding and biofilm formation by streptococci.

  12. Clinical and immunological responses to occupational exposure to alpha-amylase in the baking industry.

    PubMed

    Brisman, J; Belin, L

    1991-09-01

    alpha-Amylase is a starch cleaving enzyme often used in the baking industry as a flour additive. It is usually of fungal origin, produced by Aspergillus oryzae. One previous report has shown IgE antibodies and positive skin prick test against alpha-amylase in asthmatic bakers. This paper describes four alpha-amylase sensitised index cases with occupational asthma or rhinitis and the results of a cross sectional study of 20 workers from the same factory who were also exposed to alpha-amylase powder. Air sampling detected airborne alpha-amylase at a concentration of 0.03 mg/m3. Significantly more work related symptoms such as rhinitis and dermatitis were found among the alpha-amylase exposed workers compared with referents. A skin prick test to alpha-amylase was positive in 30% (6/20) of the exposed workers. Most of the persons showing a positive skin prick test had work related symptoms and were also skin prick test positive to common allergens. Nasal challenge tests with amylase were performed in selected cases and validated three cases of alpha-amylase induced rhinitis. Two non-symptomatic workers had precipitins to alpha-amylase. Specific IgG antibodies were shown by two further serological techniques. The nature and relevance of these antibodies are currently being studied. It is concluded that alpha-amylase powder is a potent occupational sensitiser. Precautions should be taken when handling this allergenic enzyme.

  13. Occurrence of α-Amylase in the Axis of Germinating Peas

    PubMed Central

    Davis, Bill D.

    1977-01-01

    α-Amylase was found in the axis portion of ungerminated pea seeds (Pisum sativum var. Alaska). The occurrence of this enzyme was demonstrated with crude homogenates (also containing β-amylase) using three different methods: the hydrolysis of β-limit dextrin, the change in absorption spectra for the iodine-starch complex, and the increase in reducing materials relative to the decrease in starch. The first method was used to quantitate the changes in α-amylase activity during germination. The increase in total amylase activity (primarily β-amylase) paralleled germination; the accumulation of α-amylase activity was not initiated for an additional day. The increased α-amylase activity was related to epicotyl growth. Approximately half of this activity was found in the etiolated stem, the distribution being higher in growing than in nongrowing portions. PMID:16660127

  14. Screening of polysaccharides for preparation of α-amylase conjugate to enhance stability and storage life.

    PubMed

    Jadhav, Swati B; Singhal, Rekha S

    2013-02-15

    Nine polysaccharides differing in structure and chemical nature were screened for their ability to conjugate with α-amylase by covalent binding for enhancing the thermal and pH stability of α-amylase. Among these polysaccharides, agar, dextran, pectin and xanthan showed better results but dextran stood out among all the polysaccharide for providing both thermal and pH stability to α-amylase. α-Amylase conjugated with agar, dextran, pectin and xanthan showed antimicrobial property with added preservative (0.2% sodium benzoate) in liquid formulation of α-amylase challenged with Bacillus subtilis and Escherichia coli. Dextran was the only polysaccharide which showed significant reduction of microbial growth of challenged organisms and aerobic flora without any preservative added. Aerobic flora could flourish well in the liquid α-amylase, but low temperature (4 °C), dextran, and preservative showed synergistic effect in efficiently increasing the storage life of liquid α-amylase.

  15. Purification and characterization of camel (Camelus dromedarius) milk amylase.

    PubMed

    El-Fakharany, Esmail M; Serour, Ehab A; Abdelrahman, Aref M; Haroun, Bakry M; Redwan, El-Rashdy M

    2009-01-01

    Skimmed camel milk contains 59,900 U/L amylase, which is 39,363 times less than serum and plasma amylase. Camel milk beta-amylase was purified as a 61 KDa band using DEAE-Sepharose and Sephadex G-100 and yielded 561 U/mg. The optimum working pH, Km and temperature were 7.0, 13.6 mg/Lstarch, 30-40 degrees C, respectively. The enzyme has been shown higher affinity toward amylose and soluble starch than glycogen, amylopectin, dextrin, or pullulan. Magnesium chloride, CaCl(2) and NaCl activated the amylase, while EDTA and EGTA decreased its activity. While its activity was increased in the presence of Triton X-100 and Triton X-114. Phenylmethanesulfonyl fluoride did not show any effect on enzyme activity. However, the enzyme activity was inhibited by urea, SDS, DTNB, iodoacetamide, N-ethylmalimide, aprotinin, and trypsin inhibitor. It worked on starch to yield a maltose. Scanning electron microscope images demonstrated a nano-degrading ability on starch granules from various sources (potato, corn, cassava, and rice).

  16. Optimization of alpha-amylase application in raw sugar manufacture

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentration sin raw sugar if starch control is not improved. Most commercial alpha-amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to...

  17. Recommendations for Amylase Application in the 2008 Louisiana Grinding Season

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Unfortunately, the application of amylase (an enzyme) to break down long chains of unwanted starch in U.S. sugarcane factories is still not optimized because of misinformation about which enzyme to use, and how to add the enzyme. Two large factory trials were conducted at a Louisiana factory to opti...

  18. Characterization of the native form and the carboxy-terminally truncated halotolerant form of α-amylases from Bacillus subtilis strain FP-133.

    PubMed

    Takenaka, Shinji; Miyatake, Ayaka; Tanaka, Kosei; Kuntiya, Ampin; Techapun, Charin; Leksawasdi, Noppol; Seesuriyachan, Phisit; Chaiyaso, Thanongsak; Watanabe, Masanori; Yoshida, Ken-ichi

    2015-06-01

    Two amylases, amylase I and amylase II from Bacillus subtilis strain FP-133, were purified to homogeneity and characterized. Their stabilities toward temperature, pH, and organic solvents, and their substrate specificities toward polysaccharides and oligosaccharides were similar. Under moderately high salt conditions, both amylases were more stable than commercial B. licheniformis amylase, and amylase I retained higher amylase activity than amylase II. The N-terminal amino acid sequence, genomic southern blot analysis, and MALDI-TOFF-MS analysis indicated that the halotolerant amylase I was produced by limited carboxy-terminal truncation of the amylase II peptide. The deduced amino acid sequence of amylase II was >95% identical to that of previously reported B. subtilis α-amylases, but their carboxy-terminal truncation points differed. Three recombinant amylases--full-length amylase corresponding to amylase II, an artificially truncated amylase corresponding to amylase I, and an amylase with a larger artificial C-terminal truncation--were expressed in B. subtilis. The artificially truncated recombinant amylases had the same high amylase activity as amylase I under moderately high salt conditions. Sequence comparisons indicated that an increased ratio of Asp/Glu residues in the enzyme may be one factor responsible for increasing halotolerance.

  19. Digestive alpha-amylases from Tecia solanivora larvae (Lepidoptera: Gelechiidae): response to pH, temperature and plant amylase inhibitors.

    PubMed

    Valencia-Jiménez, A; Arboleda, J W; López Avila, A; Grossi-de-Sá, M F

    2008-12-01

    The biochemical properties of the digestive alpha-amylase from Tecia solanivora larvae, an important and invasive insect pest of potato (Solanum tuberosum), were studied. This insect has three major digestive alpha-amylases with isoelectric points 5.30, 5.70 and 5.98, respectively, which were separated using native and isoelectric focusing gels. The alpha-amylase activity has an optimum pH between 7.0 and 10.0 with a peak at pH 9.0. The enzymes are stable when heated to 50 degrees C and were inhibited by proteinaceous inhibitors from Phaseolus coccineus (70% inhibition) and P. vulgaris cv. Radical (87% inhibition) at pH 6.0. The inhibitors present in an amaranth hybrid inhibited 80% of the activity at pH 9.0. The results show that the alpha-amylase inhibitor from amaranth seeds may be a better candidate to make genetically-modified potatoes resistant to this insect than inhibitors from common bean seeds.

  20. Characterization of a Hydrophobic Amylase Inhibitor from Corn (Zea mays) Seeds with Activity Against Amylase from Fusarium verticillioides.

    PubMed

    Figueira, Edson L Z; Hirooka, Elisa Y; Mendiola-Olaya, Elizabeth; Blanco-Labra, Alejandro

    2003-08-01

    ABSTRACT A hydrophobic 19.7-kDa amylase inhibitor (AI) was purified from corn kernels by 95% ethanol extraction and anionic exchange chromatography. The AI has an isoelectric point of 3.6 and was very stable at different pH values and high temperatures, maintaining 47.6% activity after heating to 94 degrees C for 60 min. Amino acid analysis indicated high valine, leucine, glycine, alanine, and glutamic acid/glutamine content, and especially high valine content (41.2 mol%). This inhibitor is not a glycoprotein. It required 30-min preincubation to maximize complex enzyme-inhibitor formation when the amylase from Fusarium verticillioides was tested. The optimal pH of interaction was 6.5. It showed broad-spectrum activity including the following amylases: human saliva, porcine pancreas, F. verticillioides, as well as those from some insects of agricultural importance (Acanthoscelides obtectus, Zabrotes subfasciatus, Sitophilus zeamais, and Prostephanus truncatus). This novel hydrophobic protein not only inhibited the amylase from F. verticillioides but also decreased the conidia germination. Thus, this protein represents an approach to decrease the production of fumonisin in corn, either by using it as a molecular marker to detect fungal resistance or through genetic engineering.

  1. A chimera-like alpha-amylase inhibitor suggesting the evolution of Phaseolus vulgaris alpha-amylase inhibitor.

    PubMed

    Wato, S; Kamei, K; Arakawa, T; Philo, J S; Wen, J; Hara, S; Yamaguchi, H

    2000-07-01

    White kidney bean (Phaseolus vulgaris) contains two kinds of alpha-amylase inhibitors, one heat-stable (alpha AI-s) and one heat-labile (alpha AI-u). alpha AI-s has recently been revealed to be a tetrameric complex, alpha(2)beta(2), with two active sites [Kasahara et al. (1996) J. Biochem. 120, 177-183]. The present study was undertaken to reveal the molecular features of alpha AI-u, which is composed of three kinds of subunits, alpha, beta, and gamma. The gamma-subunit, in contrast to the alpha- and beta-subunits that are indistinguishable from the alpha- and beta-subunits of alpha AI-s, was found to correspond to a subunit of an alpha-amylase inhibitor-like protein, which has been identified as an inactive, evolutionary intermediate between arcelin and the alpha-amylase inhibitor in a P. vulgaris defense protein family. The polypeptide molecular weight of alpha AI-u determined by the light-scattering technique, together with the polypeptide molecular weights of the subunits, suggests that alpha AI-u is a trimeric complex, alpha beta gamma. The inhibition of alpha AI-u by increasing amounts of porcine pancreatic alpha-amylase (PPA) indicates that an inactive 1:1 complex is formed between alpha AI-u and PPA. Molecular weight estimation of the complex by the light-scattering technique confirmed that it is a complex of alpha AI-u with one PPA molecule. Thus it seems probable that alpha AI-u is an evolutionary intermediate of the P. vulgaris alpha-amylase inhibitor.

  2. Alpha-amylase inhibitor, CS-1036 binds to serum amylase in a concentration-dependent and saturable manner.

    PubMed

    Honda, Tomohiro; Kaneno-Urasaki, Yoko; Ito, Takashi; Kimura, Takako; Matsushima, Nobuko; Okabe, Hiromi; Yamasaki, Atsushi; Izumi, Takashi

    2014-03-01

    (2R,3R,4R)-4-hydroxy-2-(hydroxymethyl)pyrrolidin-3-yl 4-O-(6-deoxy-β-D-glucopyranosyl)-α-D-glucopyranoside (CS-1036), which is an α-amylase inhibitor, exhibited biphasic and sustained elimination with a long t1/2 (18.4-30.0 hours) in rats and monkeys, but exhibited a short t1/2 (3.7-7.9 hours) in humans. To clarify the species differences in the t1/2, the plasma protein binding of CS-1036 was evaluated by ultrafiltration. A concentration-dependent and saturable plasma protein binding of CS-1036 was observed in rats and monkeys with the dissociation rate constant (KD) of 8.95 and 27.2 nM, and maximal binding capacity (Bmax) of 52.8 and 22.1 nM, respectively. By the assessments of the recombinant amylase and immunoprecipitation, the major binding protein of CS-1036 in rats was identified as salivary amylase (KD 5.64 nM). CS-1036 also showed concentration-dependent and saturable binding to human salivary and pancreatic amylase, with similar binding affinity in rats. However, the protein binding of CS-1036 was constant in human plasma (≤10.2%) due to the lower serum amylase level compared with rats and monkeys. From the calculation of the unbound fraction (fu) in plasma based on in vitro KD and Bmax, the dose-dependent increase in fu after oral administration is speculated to lead to a dose-dependent increase in total body clearance and a high area under the curve/dose at lower doses, such as 0.3 mg/kg in rats.

  3. Structural relationship between the enzymatic and streptococcal binding sites of human salivary alpha-amylase.

    PubMed

    Scannapieco, F A; Bhandary, K; Ramasubbu, N; Levine, M J

    1990-12-31

    Previous studies have demonstrated that human salivary alpha-amylase specifically binds to the oral bacterium Streptococcus gordonii. This interaction is inhibited by substrates such as starch and maltotriose suggesting that bacterial binding may involve the enzymatic site of amylase. Experiments were performed to determine if amylase bound to the bacterial surface possessed enzymatic activity. It was found that over one-half of the bound amylase was enzymatically active. In addition, bacterial-bound amylase hydrolyzed starch to glucose which was then metabolized to lactic acid by the bacteria. In further studies, the role of amylase's histidine residues in streptococcal binding and enzymatic function was assessed after their selective modification with diethyl pyrocarbonate. DEP-modified amylase showed a marked reduction in both enzymatic and streptococcal binding activities. These effects were diminished when DEP modification occurred in the presence of maltotriose. DEP-modified amylase had a significantly altered secondary structure when compared with native enzyme or amylase modified in the presence of maltotriose. Collectively, these results suggest that human salivary alpha-amylase may possess multiple sites for bacterial binding and enzymatic activity which share structural similarities.

  4. Responses of midgut amylases of Helicoverpa armigera to feeding on various host plants.

    PubMed

    Kotkar, Hemlata M; Sarate, Priya J; Tamhane, Vaijayanti A; Gupta, Vidya S; Giri, Ashok P

    2009-08-01

    Midgut digestive amylases and proteinases of Helicoverpa armigera, a polyphagous and devastating insect pest of economic importance have been studied. We also identified the potential of a sorghum amylase inhibitor against H. armigera midgut amylase. Amylase activities were detected in all the larval instars, pupae, moths and eggs; early instars had lower amylase levels which steadily increased up to the sixth larval instar. Qualitative and quantitative differences in midgut amylases of H. armigera upon feeding on natural and artificial diets were evident. Natural diets were categorized as one or more members of legumes, vegetables, flowers and cereals belonging to different plant families. Amylase activity and isoform patterns varied depending on host plant and/or artificial diet. Artificial diet-fed H. armigera larvae had comparatively high amylase activity and several unique amylase isoforms. Correlation of amylase and proteinase activities of H. armigera with the protein and carbohydrate content of various diets suggested that H. armigera regulates the levels of these digestive enzymes in response to macromolecular composition of the diet. These adjustments in the digestive enzymes of H. armigera may be to obtain better nourishment from the diet and avoid toxicity due to nutritional imbalance. H. armigera, a generalist feeder experiences a great degree of nutritional heterogeneity in its diet. An investigation of the differences in enzyme levels in response to macronutrient balance and imbalance highlight their importance in insect nutrition.

  5. Interaction of natural polyphenols with α-amylase in vitro: molecular property-affinity relationship aspect.

    PubMed

    Xiao, Jianbo; Kai, Guoyin; Ni, Xiaoling; Yang, Fan; Chen, Xiaoqing

    2011-06-01

    The relationship between the structural properties of natural polyphenols and their affinities for α-amylase were investigated by fluorescence titration analysis. The binding process with α-amylase was strongly influenced by the structural differences of the compounds under study. For instance, the methylation of the hydroxyl group in flavonoids increased their binding affinities for α-amylase by 2.14 to 7.76 times. The hydroxylation on rings A, B, and C of flavonoids also significantly affected their affinities for α-amylase. The glycosylation of isoflavones and flavanones reduced their affinities for α-amylase and the glycosylation of flavones and flavonols enhanced their affinities for α-amylase. Hydrogenation of the C2=C3 double bond of flavonoids decreased the binding affinities. The galloylated catechins had higher binding affinities with α-amylase than non-galloylated catechins and the pyrogallol-type catechins had higher affinities than the catechol-type catechins. The presence of the galloyl moiety is the most decisive factor. The glycosylation of resveratrol decreased its affinity for α-amylase. The esterification of gallic acid significantly reduced the affinity for α-amylase. The binding interaction between polyphenols and α-amylase was mainly caused by hydrophobic forces.

  6. Amylases in Pea Tissues with Reduced Chloroplast Density and/or Function.

    PubMed

    Saeed, M; Duke, S H

    1990-12-01

    Pea (Pisum sativum L.) tissues with reduced chloroplast density (e.g. petals and stems) or function (i.e. senescent leaves and leaves darkened for prolonged periods) were surveyed to determine whether tissues with genetically or environmentally reduced chloroplast density and/or function also have significantly different amylolytic enzyme activities and/or isoform patterns than leaf tissues with totally competent chloroplasts. Native PAGE followed by electrophoretically blotting through a starch or beta-limit dextrin containing gel and KI/I(2) staining revealed that the primary amylases in leaves, stems, petals, and roots were the primarily vacuolar beta-amylase (EC 3.2.1.2) and the primarily apoplastic alpha-amylase (EC 3.2.1.1). Among tissues of light grown pea plants, petals contained the highest levels of total amylolytic (primarily beta-amylase) activity and considerably higher ratios of beta- to alpha-amylase. In aerial tissues there was an inverse relationship between chlorophyll and starch concentration, and beta-amylase activity. In sections of petals and stems there was a pronounced inverse relationship between chlorophyll concentration and the activity of alpha-amylase. Senescing leaves of pea, as determined by age, and protein and chlorophyll content, contained 3.8-fold (fresh weight basis) and 32-fold (protein basis) higher alpha-amylase activity than fully mature leaves. Leaves maintained in darkness for 12 days displayed a 14-fold (fresh weight basis) increase in alpha-amylase activity over those grown under continuous light. In senescence and prolonged darkness studies, the alpha-amylase that was greatly increased in activity was the primarily apoplastic alpha-amylase. These studies indicate that there is a pronounced inverse relationship between chloroplast function and levels of apoplastic alpha-amylase activity and in some cases an inverse relationship between chloroplast density and/or function and vacuolar beta-amylase activity.

  7. Studies on the Utility of B-Amylase1 IntronIII Sequences as Markers for B-Amylase Activity and Thermostability, Diastatic Power and Malt Quality

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The third intron of barley (Hordeum vulgare L.) ß-amylase 1 (Bmy1) is extremely polymorphic. The use of specific insertion/deletions (indels) in the third intron as markers for cultivar development has been recommended based on associations with ß-amylase activity and thermostability. The third in...

  8. Studies on the Utility of ß-amylase1 IntronIII Sequences as Markers for ß-amylase Activity and Thermostability, Diastatic Power and Malt Quality

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The third intron of barley (Hordeum vulgare L.) ß-amylase 1 (Bmy1) is extremely polymorphic. The use of specific insertion/deletions (indels) in the third intron as markers for cultivar development has been recommended based on associations with ß-amylase activity and thermostability. The third intr...

  9. Potential of the bean alpha-amylase inhibitor alpha-AI-1 to inhibit alpha-amylase activity in true bugs(Hemiptera)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    True bugs (Hemiptera) are an important pest complex not controlled by Bt crops. An alternative source of resistance includes inhibitors of digestive enzymes. aAI-1, an a-amylase inhibitor from the common bean, has been shown to inhibit a-amylases of bruchid pests of grain legumes. Here we quantify t...

  10. Characterization of the Activity and Stability of Amylase from Saliva and Detergent: Laboratory Practicals for Studying the Activity and Stability of Amylase from Saliva and Various Commercial Detergents

    ERIC Educational Resources Information Center

    Valls, Cristina; Rojas, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2012-01-01

    This article presents two integrated laboratory exercises intended to show students the role of [alpha]-amylases (AAMYs) in saliva and detergents. These laboratory practicals are based on the determination of the enzymatic activity of amylase from saliva and different detergents using the Phadebas test (quantitative) and the Lugol test…

  11. Compartmentalization of proteinases and amylases in Nauphoeta cinerea midgut.

    PubMed

    Elpidina, E N; Vinokurov, K S; Gromenko, V A; Rudenskaya, Y A; Dunaevsky, Y E; Zhuzhikov, D P

    2001-12-01

    Compartmentalization of proteinases, amylases, and pH in the midgut of Nauphoeta cinerea Oliv. (Blattoptera:Blaberidae) was studied in order to understand the organization of protein and starch digestion. Total proteolytic activity measured with azocasein was maximal at pH 11.5 both in anterior (AM) and posterior (PM) halves of the midgut, but the bulk of activity (67%) was found in PM. Total AM and PM preparations were fractionated on a Sephadex G-50 column and further analysed by means of activity electrophoresis and specific inhibitors and activators. The major activity in PM was classified as an unusual SH-dependent proteinase with M(r) 24,000 and pH optimum with synthetic substrate BApNA at 10.0. The enzyme was 43-fold activated in the presence of 1 mM DTT, insensitive to synthetic inhibitors of serine (PMSF, TLCK, TPCK) and cysteine (IAA, E-64) proteinases, strongly inhibited by STI, and displayed four active bands on zymograms. In PM, activities of trypsin-like, chymotrypsin-like, subtilisin-like, and cysteine proteinases were observed. Aspartic and metalloproteinases were not detected. In AM, activity of unusual SH-dependent proteinase also dominated and activity of chymotrypsin-like proteinase was observed, but their levels were much lower than in PM. Distribution of amylase activity, exhibiting an optimum at pH 6.0, was quite the opposite. The major part of it (67%) was located in AM. Treatment of amylase preparation with proteinases from AM and PM reduced amylase activity twofold. pH of the midgut contents was 6.0-7.2 in AM, 6.4-7.6 in the first and 8.8-9.3 in the second halves of PM. Thus, pH in AM is in good agreement with the optimal pH of amylase, located in this compartment, but the activity of proteinases, including the ability to degrade amylase, in such an environment is low. Active proteolysis takes place in the second half of PM, where pH of the gut is close to the optimal pH of proteinases.

  12. Is There Consistency between the Binding Affinity and Inhibitory Potential of Natural Polyphenols as α-amylase Inhibitors?

    PubMed

    Xu, Wei; Shao, Rong; Xiao, Jianbo

    2016-07-26

    The inhibitory potential of natural polyphenols for α-amylases has attracted great interests among researchers. The structure-affinity properties of natural polyphenols binding to α-amylase and the structure-activity relationship of dietary polyphenols inhibiting α-amylase were deeply investigated. There is a lack of consistency between the structure-affinity relationship and the structure-activity relationship of natural polyphenols as α-amylase inhibitors. Is it consistent between the binding affinity and inhibitory potential of natural polyphenols as with α-amylase inhibitors? It was found that the consistency between the binding affinity and inhibitory potential of natural polyphenols as with α-amylase inhibitors is not equivocal. For example, there is no consistency between the binding affinity and the inhibitory potential of quercetin and its glycosides as α-amylase inhibitors. However, catechins with higher α-amylase inhibitory potential exhibited higher affinity with α-amylase.

  13. Identification of alpha amylase inhibitors from Syzygium cumini Linn seeds.

    PubMed

    Karthic, K; Kirthiram, K S; Sadasivam, S; Thayumanavan, B

    2008-09-01

    The aqueous extract of S. cumini or Eugenia jambolana seeds and Psidium guajava leaves showed higher inhibition against the porcine pancreatic alpha-amylase among the medicinal plants studied. The alpha-amylase inhibitors from S. cumini seeds were separated from the extract by preparative thin layer chromatography into fractions with different Rf values. The fraction with Rf value between 0.285 and 0.43, which showed maximum inhibitory activity, was eluted and analyzed through LC-MS. The compounds identified from the seed extract ofS. cumini were betulinic acid and 3,5,7,4'-tetrahydroxy flavanone, which were reported earlier from S. formosanum and other plants. Dixon plot showed that the inhibition was noncompetitive in nature.

  14. Study of fluorescence quenching of Barley α-amylase

    NASA Astrophysics Data System (ADS)

    Bakkialakshmi, S.; Shanthi, B.; Bhuvanapriya, T.

    2012-05-01

    The fluorescence quenching of Barley α-amylase by acrylamide and succinimide has been studied in water using steady-state and time-resolved fluorescence techniques. The steady-state fluorescence quenching technique has been performed in three different pHs (i.e., 6, 7 and 8) of water. Ground state and excited state binding constants (Kg &Ke) have been calculated. From the calculated binding constants (Kg &Ke) the free energy changes for the ground (ΔGg) and excited (ΔGe) states have been calculated and are presented in tables. UV and FTIR spectra have also been recorded to prove the binding of Barley α-amylase with acrylamide and succinimide.

  15. Optimization of Amylase Production from B. amyloliquefaciens (MTCC 1270) Using Solid State Fermentation

    PubMed Central

    Saha, Koel; Maity, Sujan; Roy, Sudeshna; Pathak, Rishija; Majumdar, Susmita

    2014-01-01

    Demand for microbial amylase production persists because of its immense importance in wide spectrum industries. The present work has been initiated with a goal of optimization of solid state fermentation condition for amylase using agroindustrial waste and microbial strain like B. amyloliquefaciens (MTCC 1270). In an aim to improve the productivity of amylase, fermentation has been carried out in the presence of calcium (Ca+2), Nitrate (NO3−), and chloride ions (Cl−) as well as in the presence of D-inositol and mannitol. Amylase needs calcium ion for the preservation of its structure, activity and stability that proves beneficial also for amylase production using solid state fermentation. The inclusion of ions and sugars in the SSF media is promising which can be explained by the protection offered by them against thermal decay of amylase at various incubation periods at 37°C. PMID:24949017

  16. Digestive amylase of a primitive animal, the scorpion: purification and biochemical characterization.

    PubMed

    Louati, Hanen; Zouari, Nacim; Fendri, Ahmed; Gargouri, Youssef

    2010-04-01

    Scorpion, one of the most ancient invertebrates was chosen, as a model of a primitive animal, to purify and characterize an amylase located in the hepatopancreas. The scorpion digestive amylase (SDA) was purified. Pure SDA was obtained after heat treatment followed by ammonium sulfate fractionation and three steps of chromatography. The pure amylase is not glycosylated and has a molecular mass of 59,101 Da determined by MALDI-TOF MS analysis. The maximal amylase activity was measured at pH 7.0 and 50 degrees C, in the presence of Ca2+ and using potato starch as substrate. The enzyme was able to hydrolyze also, glycogen and amylose. The 23 NH2-terminal amino acid SDA residues were sequenced. The sequence obtained is similar to those of mammalian and avian pancreatic amylases. Nevertheless, polyclonal antibodies directed against SDA failed to recognize classical digestive amylases like the porcine pancreatic one.

  17. A heterotetrameric alpha-amylase inhibitor from emmer (Triticum dicoccon Schrank) seeds.

    PubMed

    Capocchi, A; Muccilli, V; Cunsolo, V; Saletti, R; Foti, S; Fontanini, D

    2013-04-01

    Plants have developed a constitutive defense system against pest attacks, which involves the expression of a set of inhibitors acting on heterologous amylases of different origins. Investigating the soluble protein complement of the hulled wheat emmer we have isolated and characterized a heterotetrameric α-amylase inhibitor (ETI). Based on mass spectrometry data, it is an assembly of proteins highly similar to the CM2/CM3/CM16 found in durum wheat. Our data indicate that these proteins can also inhibit exogenous α-amylases in binary assemblies. The calculated dissociation constants (K(i)) for the pancreatic porcine amylase- and human salivary amylase-ETI complexes are similar to those found in durum and soft wheat. Homology modeling of the CM subunits indicate structural similarities with other proteins belonging to the cereal family of trypsin/α-amylase inhibitors; a possible homology modeled structure for a tetrameric assembly of the subunits is proposed.

  18. Stabilization of α-amylase by using anionic surfactant during the immobilization process

    NASA Astrophysics Data System (ADS)

    El-Batal, A. I.; Atia, K. S.; Eid, M.

    2005-10-01

    This work describes the entrapment of α-amylase into butylacrylate-acrylic acid copolymer (BuA/AAc) using γ irradiation. The effect of an anionic surfactant (AOT), the reuse efficiency, and kinetic behavior of immobilized α-amylase were studied. Covering of α-amylase with bis-(2-ethylhexyl)sulfosuccinate sodium salt (AOT) made the enzyme more stable than the uncovered form. The hydrolytic activity of the pre-coated immobilized α-amylase was increased below the critical micelle concentration (cmc) (10 mmol/L). The results showed an increase in the relative activity with increase in the degree of hydration. The pre-coated immobilized α-amylase showed a higher k/K and lower activation energy compared to the free and uncoated-immobilized preparation, respectively. The results suggest that the immobilization of α-amylase is a potentially useful approach for commercial starch hydrolysis in two-phase systems.

  19. New substrate specificity of modified porcine pancreatic alpha-amylase.

    PubMed

    Ishikawa, K; Hirata, H

    1989-08-01

    Conversion of the substrate specificity of porcine pancreatic alpha-amylase (PPA) was studied using chemical modification of His residues. Diethyl pyrocarbonate modified His residues in PPA and the activity of the modified PPA for the hydrolysis of the alpha-D-(1,4)glucoside bond in starch or oligosaccharides decreased to less than 1% of that of the native enzyme. However, the activity for the hydrolysis of the bond between p-nitrophenol and oligosaccharides in p-nitrophenyl oligosaccharides was increased by chemical modification. When the modified PPA was incubated with a proteinaceous alpha-amylase inhibitor (Mr 60,000) purified from white kidney bean (Phaseolus vulgaris), it bound to the inhibitor. As a result, the remaining less than 1% hydrolytic activity of the modified PPA for starch disappeared completely but that for p-nitrophenyl oligosaccharides remained unaltered. The hydrolytic activity of the native PPA for the alpha-D-(1,4)glucoside bond in oligosaccharides was stronger than that between p-nitrophenyl and oligosaccharides in p-nitrophenyl oligosaccharides. Therefore, when p-nitrophenyl oligosaccharides (three to five glucose residues) were used as substrates for the native PPA, the alpha-D-(1,4)glucoside bonds in the oligosaccharides were hydrolyzed. However, the modified PPA-inhibitor complex hydrolyzed only the bond between p-nitrophenol and oligosaccharides in p-nitrophenyl oligosaccharides. The above results reveal that, by chemical modification with diethyl pyrocarbonate and biochemical modification with an amylase inhibitor, amylase can be converted to a new exo-type enzyme which hydrolyzes only the bond between p-nitrophenol and oligosaccharides in p-nitrophenyl oligosaccharides.

  20. Stability and kinetics of a bifunctional amylase/trypsin inhibitor.

    PubMed

    Alagiri, S; Singh, T P

    1993-11-10

    The stability of the bifunctional amylase/trypsin inhibitor from ragi (Indian finger millet, Eleusine coracana) has been studied by methods of circular dichroism, UV absorption and intrinsic fluorescence. The inhibitor is stable in 8 M urea and 6 M guanidine-HCl. In 150 mM NaCl, thermal denaturation does not occur up to 90 degrees C. However, it is irreversibly denatured in 5 mM NaCl if heated over 73 degrees C. The acidic denaturation is reversible in both high and low salt conditions, but it shows different behavior below pH 1.65 under similar salt conditions. The helical content is about 2-4% in the pH range of 7-9 at which the inhibitor is active maximally. The NaCl concentration does not have a significant effect on the secondary structure elements. The beta-strand form does not show much variation under various conditions. Arg34-Leu35 is the reactive peptide bond in the trypsin-binding site. Trp and Tyr are involved in the binding with amylase. The bifunctional inhibitor represents the sum of individual inhibitors of trypsin and amylase.

  1. Kinetic studies of amylase and biomass production by Calvatia gigantea

    SciTech Connect

    Kekos, D.; Macris, B.J.

    1987-01-01

    Production of alpha-amylase (alpha-4, glucan 4-glucanohydrolase, EC 3.2.1.1) by microorganisms has been practiced for many years in small and large scale operations and the literature on this enzyme is voluminous. Aspergillus niger and Aspergillus oryzae have been reported as the main fungal species used for commercial production of the enzyme. On the other hand, large volumes of low-cost agricultural products such as acorn (the perisperm-free dry seed contains approximately 60% starch) are wasted in many countries and provide a challenge to biotechnology to efficiently utilize these rich sources of starch for the production of high added value products like enzymes. C. gigantea is an edible puffball excreting high levels of alpha-amylase when cultivated on different sources of starch containing elevated quantities of toxic tannic compounds. This fungus has been employed for the production of microbial protein from wastes and acorns containing high levels of toxic tannic compounds. The same fungus was also reported to grow on both hydrolyzable and condensed tannins as sole carbon sources. The present work was undertaken to investigate certain kinetic characteristics of alpha-amylase and biomass production by C. gigantea grown on soluble and acorn starch in a lab fermenter. (Refs. 18).

  2. Measuring Stress and Ability to Recover from Stress with Salivary Alpha-Amylase Levels

    DTIC Science & Technology

    2011-04-01

    Ability to Recover from Stress with Salivary α- Amylase Levels Authors Brandon L. Mulrine Michael F. Sheehan Lolita M. Burrell Michael...TITLE AND SUBTITLE Measuring Stress and Ability to Recover from Stress with Salivary Alpha Amylase Levels 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c...stress-related conditions. The findings suggest that measuring salivary α- amylase levels may help to determine a Soldier’s resilience or risk of

  3. Production of fungal amylases using cheap, readily available agriresidues, for potential application in textile industry.

    PubMed

    Singh, Shalini; Singh, Sanamdeep; Bali, Vrinda; Sharma, Lovleen; Mangla, Jyoti

    2014-01-01

    The study aimed at isolation and screening of fungal amylase producer, optimization of solid state fermentation conditions for maximum amylase production by the best amylase producer, and characterization of the crude amylases, so produced. Aspergillus fumigatus NTCC1222 showed the highest amylase activity (164.1 U/mL) in secondary screening under SSF conditions and was selected for further studies. The test strain showed maximum amylase production (341.7 U/mL) and supernatant protein concentration (9.7 mg/mL) for incubation period (6 days), temperature (35 °C), initial pH (6.0), nutrient salt solution as moistening agent, and beef extract as nitrogen source. Pomegranate peel produced maximum amylase activity, but wheat bran (only slightly lesser amylase activity as compared to that of pomegranate peel) was chosen for further studies, keeping in mind the seasonal availability of pomegranate peel. TLC confirmed the amylase produced to be α -type and 60 kDa was the molecular weight of the partially purified amylase. The enzyme showed maximum enzyme activity at pH 6.0, temperature of 55 °C, and incubation time of 60 minutes. UV (616.0 U/mL) and chemical (814.2 U/mL) mutation enhanced amylase activity as compared to wild test strain. The study indicates that Aspergillus fumigatus NTCC1222 can be an important source of amylase and the crude enzyme, hence obtained, can be cost effectively applied in multiple sections of textile wet processing.

  4. Amylase and Lipase Detection in Hemorrhaged Animals Treated with HBOC-201

    DTIC Science & Technology

    2011-01-01

    4184 online DOl: 10.3109/10731199.2010.516260 inform a healthcare Amylase and Lipase Detection in Hemorrhaged Animals Treated with HBOC-201 Fran...Health Sciences, Bethesda, MD, USA Abstract: HBOC-201 may alter lipase and amylase detection on chemistry analyzers using optical methods and affect...pancreatic function after trauma. Amylase and lipase measurements were correlated against HBOC-201 to evaluate interference on samples spiked with

  5. Production of Fungal Amylases Using Cheap, Readily Available Agriresidues, for Potential Application in Textile Industry

    PubMed Central

    Singh, Sanamdeep; Bali, Vrinda; Mangla, Jyoti

    2014-01-01

    The study aimed at isolation and screening of fungal amylase producer, optimization of solid state fermentation conditions for maximum amylase production by the best amylase producer, and characterization of the crude amylases, so produced. Aspergillus fumigatus NTCC1222 showed the highest amylase activity (164.1 U/mL) in secondary screening under SSF conditions and was selected for further studies. The test strain showed maximum amylase production (341.7 U/mL) and supernatant protein concentration (9.7 mg/mL) for incubation period (6 days), temperature (35°C), initial pH (6.0), nutrient salt solution as moistening agent, and beef extract as nitrogen source. Pomegranate peel produced maximum amylase activity, but wheat bran (only slightly lesser amylase activity as compared to that of pomegranate peel) was chosen for further studies, keeping in mind the seasonal availability of pomegranate peel. TLC confirmed the amylase produced to be α-type and 60 kDa was the molecular weight of the partially purified amylase. The enzyme showed maximum enzyme activity at pH 6.0, temperature of 55°C, and incubation time of 60 minutes. UV (616.0 U/mL) and chemical (814.2 U/mL) mutation enhanced amylase activity as compared to wild test strain. The study indicates that Aspergillus fumigatus NTCC1222 can be an important source of amylase and the crude enzyme, hence obtained, can be cost effectively applied in multiple sections of textile wet processing. PMID:24527439

  6. Paper-based α-amylase detector for point-of-care diagnostics.

    PubMed

    Dutta, Satarupa; Mandal, Nilanjan; Bandyopadhyay, Dipankar

    2016-04-15

    We report the fabrication of a paper-sensor for quantitative detection of α-amylase activity in human blood serum. Pieces of filter papers were coated with starch-iodine solution leading to an intense blue coloration on the surface. Dispensing α-amylase solution on the starch-iodine coated paper reduced the intensity of the color because of starch-hydrolysis catalyzed by amylase. The variation in the intensity of the color with the concentration of amylase was estimated in three stages: (i) initially, the paper-surface was illuminated with a light emitting diode, (ii) then, the transmitted (reflected) rays emitted through (from) the paper were collected on a photoresistor, and (iii) the variations in the electrical resistance of the photoresistor were correlated with the amylase concentration in analyte. The resistance of photoresistor decreased monotonically with an increase in amylase concentration because the intensity of the reflected (transmitted) rays collected from (through) the paper increased with reduction in the color intensity on the paper surface. Since a specific bio-reaction was employed to detect the activity of amylase, the sensor was found to be equally efficient in detecting unknown quantities of amylase in human blood serum. The reported sensor has shown the potential to graduate into a point-of-care detection tool for α-amylase.

  7. Expression and Localization of α-amylase in the Submandibular and Sublingual Glands of Mice

    PubMed Central

    Yamagishi, Ryoko; Wakayama, Tomohiko; Nakata, Hiroki; Adthapanyawanich, Kannika; Kumchantuek, Tewarat; Yamamoto, Miyuki; Iseki, Shoichi

    2014-01-01

    In the major salivary glands of mice, acinar cells in the parotid gland (PG) are known to be the main site for the production of the digestive enzyme α-amylase, whereas α-amylase production in the submandibular gland (SMG) and sublingual gland (SLG), as well as the cell types responsible for α-amylase production, has been less firmly established. To clarify this issue, we examined the expression and localization of both the mRNA and protein of α-amylase in the major salivary glands of male and female mice by quantitative and histochemical methods. α-amylase mRNA levels were higher in the order of PG, SMG, and SLG. No sexual difference was observed in α-amylase mRNA levels in the PG and SLG, whereas α-amylase mRNA levels in the female SMG were approximately 30% those in the male SMG. Using in situ hybridization and immunohistochemistry, signals for α-amylase mRNA and protein were found to be strongly positive in acinar cells of the PG, serous demilune cells of the SLG, and granular convoluted tubule (GCT) cells of the male SMG, weakly positive in seromucous acinar cells of the male and female SMG, and negative in mucous acinar cells of the SLG. These results clarified that α-amylase is produced mainly by GCT cells and partly by acinar cells in the SMG, whereas it is produced exclusively by serous demilune cells in the SLG of mice. PMID:25320406

  8. Cloning and starch degradation profile of maltotriose-producing amylases from Streptomyces species.

    PubMed

    Kashiwagi, Norimasa; Miyake, Michiru; Hirose, Shuichi; Sota, Masahiro; Ogino, Chiaki; Kondo, Akihiko

    2014-11-01

    The end products from starch hydrolysis by amylases have important applications in various industries. Here, two amylases derived from two Streptomyces species that hydrolyze soluble starch from potato produced maltotriose as the primary maltooligosaccharide product. The genes, annotated as putative glycoside hydrolases, were cloned and expressed in Streptomyces lividans. These amylases displayed hydrolysis activity from pH 3 to 9.5 and were not affected by Ca(2+.) Optimal production of maltotriose was between 20 and 30 °C at pH 6.5. At the optimal temperature, both amylases produced maltotriose-rich end products rather than either maltose or maltotetraose.

  9. Continuous automated assay of alpha-amylase release from superfused rat salivary gland.

    PubMed

    Templeton, D

    1980-11-01

    A method of continuous automated amylase assay is described. This relies on the absorption of iodine by starch to produce a blue color that can be quantified colorimetrically. Digestion of the starch by amylase released from parotid tissue slices reduces the intensity of the color formed, allowing quantification of the amylase released. The assay in sensitive to 0.05 U/amylase/ml and linear up to 13 U/ml. Typical tissue responses to acetyl-beta-methylcholine and isoprenaline are presented.

  10. Isolation of a novel amylase and lipase-producing Pseudomonas luteola strain: study of amylase production conditions

    PubMed Central

    2014-01-01

    An amylase and lipase producing bacterium (strain C2) was enriched and isolated from soil regularly contaminated with olive washing wastewater in Sfax, Tunisia. Cell was aerobic, mesophilic, Gram-negative, motile, non-sporulating bacterium, capable of growing optimally at pH 7 and 30°C and tolerated maximally 10% (W/V) NaCl. The predominant fatty acids were found to be C18:1ω7c (32.8%), C16:1ω7c (27.3%) and C16:0 (23.1%). Phylogenetic analysis of the 16S rRNA gene revealed that this strain belonging to the genus Pseudomonas. Strain C2 was found to be closely related to Pseudomonas luteola with more than 99% of similarity. Amylase optimization extraction was carried out using Box Behnken Design (BBD). Its maximal activity was found when the pH and temperature ranged from 5.5 to 6.5 and from 33 to 37°C, respectively. Under these conditions, amylase activity was found to be about 9.48 U/ml. PMID:24405763

  11. Sequence-structural features and evolutionary relationships of family GH57 α-amylases and their putative α-amylase-like homologues.

    PubMed

    Janeček, Stefan; Blesák, Karol

    2011-08-01

    The glycoside hydrolase family 57 (GH57) contains α-amylase and a few other amylolytic specificities. It counts ~400 members from Archaea (1/4) and Bacteria (3/4), mostly of extremophilic prokaryotes. Only 17 GH57 enzymes have been biochemically characterized. The main goal of the present bioinformatics study was to analyze sequences having the clear GH57 α-amylase features. Of the 107 GH57 sequences, 59 were evaluated as α-amylases (containing both GH57 catalytic residues), whereas 48 were assigned as GH57 α-amylase-like proteins (having a substitution in one or both catalytic residues). Forty-eight of 59 α-amylases were from Archaea, but 42 of 48 α-amylase-like proteins were of bacterial origin. The catalytic residues were substituted in most cases in Bacteroides and Prevotella by serine (instead of catalytic nucleophile glutamate) and glutamate (instead of proton donor aspartate). The GH57 α-amylase specificity has thus been evolved and kept enzymatically active mainly in Archaea.

  12. Purification and characterization of α-Amylase from Miswak Salvadora persica

    PubMed Central

    2014-01-01

    Background The miswak (Salvadora persica) is a natural toothbrush. It is well known that very little information has been reported on enzymes in miswak as medicinal plant. Recently, we study peroxidase in miswak. In the present study, the main goal of this work is to purify and characterize α-amylase from miswak. The second goal is to study the storage stability of α-amylase in toothpaste. Method The purification method included chromatographaphy of miswak α-amylase on DEAE-Sepharose column and Sephacryl S-200 column. Molecular weight was determined by gel filtration and SDS-PAGE. Results Five α-amylases A1, A4a, A4b, A5a and A5b from miswak were purified and they had molecular weights of 14, 74, 16, 30 and 20 kDa, respectively. α-Amylases had optimum pH from 6 to 8. Affinity of the substrates toward all enzymes was studied. Miswak α-amylases A1, A4a, A4b, A5a and A5b had Km values for starch and glycogen of 3.7, 3.7, 7.1, 0.52, 4.3 mg/ml and 5.95, 5.9 4.16, 6.3, 6.49 mg/ml, respectively. The optimum temperature for five enzymes ranged 40°C- 60°C. Miswak α-amylases were stable up to 40°C- 60°C after incubation for 30 min. Ca+2 activated all the miswak α-amylases, while Ni2+, Co+2 and Zn+2 activated or inhibited some of these enzymes. The metal chelators, EDTA, sodium citrate and sodium oxalate had inhibitory effects on miswak α-amylases. PMSF, p-HMB, DTNB and 1,10 phenanthroline caused inhibitory effect on α-amylases. The analysis of hydrolytic products after starch hydrolysis by miswak α-amylases on paper chromatography revealed that glucose, maltose, maltotriose and oligosaccharide were the major products. Crude miswak α-amylase in the toothpaste retained 55% of its original activity after 10 months of storage at room temperature. Conclusions From these findings, α-amylases from miswak can be considered as beneficial enzymes for pharmaceuticals. Therefore, we study the storage stability of the crude α-amylase of miswak, which contained the five

  13. Biochemical properties of alpha-amylase from peel of Citrus sinensis cv. Abosora.

    PubMed

    Mohamed, Saleh Ahmed; Drees, Ehab A; El-Badry, Mohamed O; Fahmy, Afaf S

    2010-04-01

    alpha-Amylase activity was screened in the peel, as waste fruit, of 13 species and cultivars of Egyptian citrus. The species Citrus sinensis cv. Abosora had the highest activity. alpha-Amylase AI from Abosora peel was purified to homogeneity using anion and cation-exchange, and gel filtration chromatographies. Molecular weight of alpha-amylase AI was found to be 42 kDa. The hydrolysis properties of alpha-amylase AI toward different substrates indicated that corn starch is the best substrate. The alpha-amylase had the highest activity toward glycogen compared with amylopectin and dextrin. Potato starch had low affinity toward alpha-amylase AI but it did not hydrolyze beta-cyclodextrin and dextran. Apparent Km for alpha-amylase AI was 5 mg (0.5%) starch/ml. alpha-Amylase AI showed optimum activity at pH 5.6 and 40 degrees C. The enzyme was thermally stable up to 40 degrees C and inactivated at 70 degrees C. The effect of mono and divalent metal ions were tested for the alpha-amylase AI. Ba2+ was found to have activating effect, where as Li+ had negligible effect on activity. The other metals caused inhibition effect. Activity of the alpha-amylase AI was increased one and half in the presence of 4 mM Ca2+ and was found to be partially inactivated at 10 mM Ca2+. The reduction of starch viscosity indicated that the enzyme is endoamylase. The results suggested that, in addition to citrus peel is a rich source of pectins and flavanoids, alpha-amylase AI from orange peel could be involved in the development and ripening of citrus fruit and may be used for juice processing.

  14. GA Enhanced a-Amylase Synthesis in Halved Grains of Barley (Hordeum vulgare): A Simple Laboratory Demonstration

    ERIC Educational Resources Information Center

    Freeland, P. W.

    1972-01-01

    A laboratory demonstration is suggested for the formation of a-amylase enzyme in halved grains of barley. Data presented in the article provide some information of the pattern of a- and b-amylase activity during germination. (PS)

  15. An approach to remove alpha amylase for proteomic analysis of low abundance biomarkers in human saliva.

    PubMed

    Deutsch, Omer; Fleissig, Yoram; Zaks, Batia; Krief, Guy; Aframian, Doron J; Palmon, Aaron

    2008-11-01

    Proteomic characterization of human whole saliva for the identification of disease-specific biomarkers is guaranteed to be an easy-to-use and powerful diagnostic tool for defining the onset, progression and prognosis of human systemic diseases and, in particular, oral diseases. The high abundance of proteins, mainly alpha amylase, hampers the detection of low abundant proteins appearing in the disease state and therefore should be removed. In the present study a 2-DE was used to analyze human whole saliva following the removal of alpha amylase by affinity adsorption to potato starch. After alpha amylase removal whole saliva was analyzed by SDS-PAGE showing at least sixfold removal efficiency and by an alpha amylase activity assay showing 97% reduced activity. MS identification of the captured alpha amylase after elution demonstrated specific removal; 2-DE analysis showed the selective removal of alpha amylase and consequently increased gel resolution. MS identification of protein spots in the 60 kDa area revealed 15 proteins, which were masked before alpha amylase removal. In conclusion, treatment of human whole saliva with an alpha amylase removal device increases gel resolution and enables a higher protein sample for analysis.

  16. Oral Fusobacterium nucleatum subsp. polymorphum binds to human salivary α-amylase.

    PubMed

    Zulfiqar, M; Yamaguchi, T; Sato, S; Oho, T

    2013-12-01

    Fusobacterium nucleatum acts as an intermediate between early and late colonizers in the oral cavity. In this study, we showed that F. nucleatum subsp. polymorphum can bind to a salivary component with a molecular weight of approximately 110 kDa and identified the protein and another major factor of 55 kDa, as salivary α-amylase by time-of-flight mass spectrometry and immuno-reactions. Salivary α-amylase is present in both monomeric and dimeric forms and we found that formation of the dimer depends on copper ions. The F. nucleatum adhered to both monomeric and dimeric salivary α-amylases, but the numbers of bacteria bound to the dimeric form were more than those bound to the monomeric form. The degree of adherence of F. nucleatum to four α-amylases from different sources was almost the same, however its binding to β-amylase was considerably decreased. Among four α-amylase inhibitors tested, acarbose and type 1 and 3 inhibitors derived from wheat flour showed significant activity against the adhesion of F.nucleatum to monomeric and dimeric amylases, however voglibose had little effect. Moreover F. nucleatum cells inhibited the enzymatic activity of salivary α-amylase in a dose-dependent manner. These results suggest that F. nucleatum plays more important and positive role as an early colonizer for maturation of oral microbial colonization.

  17. Production and Partial Purification of Alpha Amylase from Bacillus subtilis (MTCC 121) Using Solid State Fermentation

    PubMed Central

    Raul, Dibyangana; Mukhopadhyay, Suchita; Kumar Das, Shrayan; Gupta, Suvroma

    2014-01-01

    Amylase is an enzyme that catalyzes the breakdown of starch into sugars and plays a pivotal role in a variety of areas like use as digestives, for the production of ethanol and high fructose corn syrup, detergents, desiring of textiles, modified starches, hydrolysis of oil-field drilling fluids, and paper recycling. In the present work, solid state fermentation (SSF) for α-amylase production has been used in lieu of submerged fermentation (SmF) due to its simple technique, low capital investment, lower levels of catabolite repression, and better product recovery. Bacillus subtilis has been well known as producer of alpha amylase and was tested using solid state fermentation for 48 hours at 37°C with wheat bran as substrate. Comparison between different fermentation hours demonstrated high yield of alpha amylase after 48 hours. This alpha amylase has optimum pH and temperature at 7.1 and 40°C, respectively. With the goal to purify alpha amylase, 30–70% (NH4)2SO4 cut concentrated the amylase activity threefold with respect to crude fermented extract. This was verified in quantitative DNS assay method as well as in zymogram gel profile. The exact molecular weight of the amylase is yet to be determined with the aid of other protein purification techniques. PMID:24672727

  18. Human Parotid Gland Alpha-Amylase Secretion as a Function of Chronic Hyperbaric Exposure

    DTIC Science & Technology

    1979-01-01

    parotid ...Pullman, WA 99163 Gilman, S. C, G. J. Fischer, R. J. Biersner, R. D. Thornton, and D. A. Miller. 1979. Human parotid gland alpha-amylase secretion...as a function of chronic hyperbaric exposure. Undersea Biomed. Res. 6(3):303-307.—Secretion of a-amylase by the human parotid gland increased

  19. Improved thermostable α-amylase activity of Bacillus amyloliquefaciens by low-energy ion implantation.

    PubMed

    Li, X Y; Zhang, J L; Zhu, S W

    2011-09-23

    Thermostable α-amylase is of great importance in the starch fermentation industry; it is extensively used in the manufacture of beverages, baby foods, medicines, and pharmaceuticals. Bacillus amyloliquefaciens produces thermostable α-amylase; however, production of thermostable α-amylase is limited. Ion-beam implantation is an effective method for mutation breeding in microbes. We conducted ion-beam implantation experiments using two different ions, Ar(+) and N(+), to determine the survival rate of and dose effect on a high α-amylase activity strain of B. amyloliquefaciens that had been isolated from soil samples. N(+) implantation resulted in a higher survival rate than Ar(+) implantation. The optimum implantation dose was 2.08 × 10(15) ions/cm(2). Under this implantation condition, we obtained a thermally and genetically stable mutant α-amylase strain (RL-1) with high enzyme activity for degrading α-amylase. Compared to the parental strain (RL), the RL-1 strain had a 57.1% increase in α-amylase activity. We conclude that ion implantation in B. amyloliquefaciens can produce strains with increased production of thermostable α-amylase.

  20. Use of activated carbons to remove undesirable residual amylase from factory and refinery streams

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years, there has been increased world-wide concern over residual (carry-over) activity of mostly high temperature (HT) and very high temperature (VHT) stable amylases in white, refined sugars from refineries to various food and end-user industries. HT and VHT stable amylases were develope...

  1. Further Experiments on Gibberellin-Stimulated Amylase Production in Cereal Grains

    ERIC Educational Resources Information Center

    Coppage, Jo; Hill, T. A.

    1973-01-01

    Experiments conducted on wheat and barley grains to analyze activities of alpha- and beta-amylase enzymes. Gibberellins were used exogenously. Techniques are described in detail. Results on different cultivars revealed that beta-amylase was not an invariable result of imbibition. Techniques employed can be used by school students. (PS)

  2. Use of activated carbon to remove undesirable residual amylase from refinery streams

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years, there has been increased world-wide concern over residual (carry-over)activity of mostly high temperature (HT) and very high temperature (VHT) stable amylases in white, refined sugars from refineries to various food and end-user industries. HT and VHT stable amylases were developed ...

  3. Structure of waxy maize starch hydrolyzed by maltogenic alpha-amylase in relation to its retrogradation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Maltogenic a-amylase is widely used as an antistaling agent in bakery foods. The objective of this study was to determine the degree of hydrolysis (DH) and starch structure after maltogenic amylase treatments in relation to its retrogradation. Waxy maize starch was cooked and hydrolyzed to different...

  4. Copy number polymorphism of the salivary amylase gene: implications in human nutrition research.

    PubMed

    Santos, J L; Saus, E; Smalley, S V; Cataldo, L R; Alberti, G; Parada, J; Gratacòs, M; Estivill, X

    2012-01-01

    The salivary α-amylase is a calcium-binding enzyme that initiates starch digestion in the oral cavity. The α-amylase genes are located in a cluster on the chromosome that includes salivary amylase genes (AMY1), two pancreatic α-amylase genes (AMY2A and AMY2B) and a related pseudogene. The AMY1 genes show extensive copy number variation which is directly proportional to the salivary α-amylase content in saliva. The α-amylase amount in saliva is also influenced by other factors, such as hydration status, psychosocial stress level, and short-term dietary habits. It has been shown that the average copy number of AMY1 gene is higher in populations that evolved under high-starch diets versus low-starch diets, reflecting an intense positive selection imposed by diet on amylase copy number during evolution. In this context, a number of different aspects can be considered in evaluating the possible impact of copy number variation of the AMY1 gene on nutrition research, such as issues related to human diet gene evolution, action on starch digestion, effect on glycemic response after starch consumption, modulation of the action of α-amylases inhibitors, effect on taste perception and satiety, influence on psychosocial stress and relation to oral health.

  5. Skin-prick tests for hypersensitivity to alpha-amylase preparations.

    PubMed

    Moneo, I; Alday, E; Sanchez-Agudo, L; Curiel, G; Lucena, R; Calatrava, J M

    1995-06-01

    Twenty-five asthmatic subjects with suspected alpha-amylase hypersensitivity were studied by skin-prick tests, a capture ELISA, immunoblotting and bronchial provocation tests. At the same time, different amylases were analysed by SDS-PAGE and immunoblotting using a polyclonal rabbit antiserum. Eight patients showed a positive bronchial response to amylase. Seven of them had positive skin-prick tests, with this method being the most sensitive approach for diagnosis. However, in four cases, skin tests were also positive although the patients had a negative provocation test, thus demonstrating that skin tests are not specific. ELISA and blotting showed similar results in terms of sensitivity and specificity. The enzymes used by the workers included several antigens besides alpha-amylase. The rabbit antiserum to alpha-amylase detected a protein in a wheat flour extract. In one case, the IgE antibodies were specific only for a contaminant of lower molecular weight than amylase. These facts suggest that proteins from the culture medium could be responsible for some cases of amylase hypersensitivity, making the diagnosis difficult. The presence of amylase in another enzymatic extract, a protease produced by Aspergillus oryzae, was proved by means of skin tests and immunoblotting, thus demonstrating the allergenic properties of this enzymatic preparation.

  6. Cloning of a yeast alpha-amylase promoter and its regulated heterologous expression

    DOEpatents

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR; Hooker, Brian S [Kennewick, WA; Anderson, Daniel B [Pasco, WA

    2003-04-01

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  7. Application of microbial α-amylase in industry – A review

    PubMed Central

    de Souza, Paula Monteiro; de Oliveira Magalhães, Pérola

    2010-01-01

    Amylases are one of the main enzymes used in industry. Such enzymes hydrolyze the starch molecules into polymers composed of glucose units. Amylases have potential application in a wide number of industrial processes such as food, fermentation and pharmaceutical industries. α-Amylases can be obtained from plants, animals and microorganisms. However, enzymes from fungal and bacterial sources have dominated applications in industrial sectors. The production of α-amylase is essential for conversion of starches into oligosaccharides. Starch is an important constituent of the human diet and is a major storage product of many economically important crops such as wheat, rice, maize, tapioca, and potato. Starch-converting enzymes are used in the production of maltodextrin, modified starches, or glucose and fructose syrups. A large number of microbial α-amylases has applications in different industrial sectors such as food, textile, paper and detergent industries. The production of α-amylases has generally been carried out using submerged fermentation, but solid state fermentation systems appear as a promising technology. The properties of each α-amylase such as thermostability, pH profile, pH stability, and Ca-independency are important in the development of fermentation process. This review focuses on the production of bacterial and fungal α-amylases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications. PMID:24031565

  8. Production and Partial Purification of Alpha Amylase from Bacillus subtilis (MTCC 121) Using Solid State Fermentation.

    PubMed

    Raul, Dibyangana; Biswas, Tania; Mukhopadhyay, Suchita; Kumar Das, Shrayan; Gupta, Suvroma

    2014-01-01

    Amylase is an enzyme that catalyzes the breakdown of starch into sugars and plays a pivotal role in a variety of areas like use as digestives, for the production of ethanol and high fructose corn syrup, detergents, desiring of textiles, modified starches, hydrolysis of oil-field drilling fluids, and paper recycling. In the present work, solid state fermentation (SSF) for α -amylase production has been used in lieu of submerged fermentation (SmF) due to its simple technique, low capital investment, lower levels of catabolite repression, and better product recovery. Bacillus subtilis has been well known as producer of alpha amylase and was tested using solid state fermentation for 48 hours at 37°C with wheat bran as substrate. Comparison between different fermentation hours demonstrated high yield of alpha amylase after 48 hours. This alpha amylase has optimum pH and temperature at 7.1 and 40°C, respectively. With the goal to purify alpha amylase, 30-70% (NH4)2SO4 cut concentrated the amylase activity threefold with respect to crude fermented extract. This was verified in quantitative DNS assay method as well as in zymogram gel profile. The exact molecular weight of the amylase is yet to be determined with the aid of other protein purification techniques.

  9. The evaluation of possible false positives with detergents when performing amylase serological testing on clothing.

    PubMed

    Feia, Andrea; Novroski, Nicole

    2013-01-01

    For almost 40 years, detergent companies have been adding enzymes such as amylases to their products as an effective method of breaking down tough stains created by polysaccharides and proteins. The possibility that α-amylases present in common household laundry detergents may contribute to the positive detection of α-amylase on evidentiary samples during forensic presumptive screening procedures is a potential problem that has not yet been investigated. To determine whether α-amylase detection is possible following routine laundering, five different fabrics were laundered in a variety of detergents, and presumptive testing using RSID(™)-Saliva and Phadebas(®) Amylase Test was conducted. Our results demonstrate that clothing laundered in detergents known to contain enzymes does not retain any detectable levels of α-amylase following a typical wash cycle. We also show that, unlike laundered clothing, undiluted detergents do contain detectable levels of α-amylase; however, these findings were only observed using the Phadebas(®) Amylase Test.

  10. Isolation of Mutants Defective in α-Amylase from Bacillus subtilis: Genetic Analyses

    PubMed Central

    Yamaguchi, Kazuo; Nagata, Yoshiho; Maruo, Bunji

    1974-01-01

    The rate of α-amylase (EC 3.2.1.1) synthesis in Bacillus subtilis is regulated by a gene, amyR, located near a structural gene, amyE, for the enzyme. To construct a fine map of the amyR-amyE region, we isolated 28 mutants defective in α-amylase activity. Eleven mutants out of 28 showed no α-amylase activity, whereas the other 17 showed less α-amylase activity than the parent. Out of 17 partially positive α-amylase mutants, 10 produced temperature-sensitive enzymes, and 4 produced immunologically altered enzymes, two of which are concurrently temperature-sensitive, and 5 produced smaller amounts of α-amylases which are indistinguishable from normal enzyme in their temperature sensitivity and immunological properties. Two out of 11 α-amylase-negative mutants produced material that cross-reacted with anti-amylase serum, and 3 mutants carried suppressible mutations by the suppressor described by Okubo. Mapping data indicate that all 28 mutation sites are located in the amyE region, and none of the groups of the mutants mentioned above contains lesions that are clustered in a single region of amyE. The amyR gene seems most likely to adjoin the terminal region of amyE. PMID:4212116

  11. alpha-Amylase: an ideal representative of thermostable enzymes.

    PubMed

    Prakash, Om; Jaiswal, Nivedita

    2010-04-01

    The conditions prevailing in the industrial applications in which enzymes are used are rather extreme, especially with respect to temperature and pH. Therefore, there is a continuing demand to improve the stability of enzymes and to meet the requirements set by specific applications. In this respect, thermostable enzymes have been proposed to be industrially relevant. In this review, alpha-amylase, a well-established representative of thermostable enzymes, providing an attractive model for the investigation of the structural basis of thermostability of proteins, has been discussed.

  12. Enzymatic detergent formulation containing amylase from Aspergillus niger: a comparative study with commercial detergent formulations.

    PubMed

    Mitidieri, Sydnei; Souza Martinelli, Anne Helene; Schrank, Augusto; Vainstein, Marilene Henning

    2006-07-01

    There is a wide range of biotechnological applications for amylases, including the textile, pharmaceutical, food and laundry industries. Hydrolytic enzymes are 100% biodegradable and enzymatic detergents can achieve effective cleaning with lukewarm water. Microorganisms and culture media were tested for amylase production and the best producer was Aspergillus niger L119 (3.9 U ml(-1) +/- 0.2) in submerged culture and its amylase demonstrated excellent activity at 50-55 degrees C and pH 4.0, remaining stable at 53 degrees C for up to 200 h. In order to establish the potential uses of this enzyme in detergents, different formulations were tested using the A. niger amylase extract. Enzyme activity was compared with three commercial formulations. The detergents are used in hospitals to clean surgical and endoscopy equipment. The presence of amylase in the formulation is because of its action within hospital drainage system, whether or not it has any function in cleaning the equipment.

  13. Structural basis for the inhibition of mammalian and insect alpha-amylases by plant protein inhibitors.

    PubMed

    Payan, Françoise

    2004-02-12

    Alpha-amylases are ubiquitous proteins which play an important role in the carbohydrate metabolism of microorganisms, animals and plants. Living organisms use protein inhibitors as a major tool to regulate the glycolytic activity of alpha-amylases. Most of the inhibitors for which three-dimensional (3-D) structures are available are directed against mammalian and insect alpha-amylases, interacting with the active sites in a substrate-like manner. In this review, we discuss the detailed inhibitory mechanism of these enzymes in light of the recent determination of the 3-D structures of pig pancreatic, human pancreatic, and yellow mealworm alpha-amylases in complex with plant protein inhibitors. In most cases, the mechanism of inhibition occurs through the direct blockage of the active center at several subsites of the enzyme. Inhibitors exhibiting "dual" activity against mammalian and insect alpha-amylases establish contacts of the same type in alternative ways.

  14. Amylase/creatinine clearance ratio in diabetic ketoacidosis: a case report.

    PubMed

    Boybeyi, Ozlem; Ergür, Ayça Törel; Dursun, Zarife Esra; Gülerman, Fulya

    2014-11-01

    Diabetic ketoacidosis (DKA) accompanies any other intra-abdominal pathology. Serum amylase/lipase levels are commonly used in order to rule out acute pancreatitis in patients having abdominal pain in DKA. A more specific and noninvasive diagnostic tool - amylase/creatinine clearance ratio (ACCR) - can be used to rule out pancreatitis in patients with DKA. A 14-year-old girl was admitted with abdominal pain and nausea. She had been followed up for type 1 diabetes mellitus for the last 5 years. The serum amylase levels were increased up to 687 U/L (normal: 28-120 U/L) on the third day of hospitalization. Simultaneous serum and urinary amylase concentrations were measured, and ACCR was calculated (1.2%). The diagnosis of pancreatitis was ruled out. The serum amylase levels decreased in the following days, and she was discharged. ACCR determination is a simple and specific test to diagnose pancreatitis, especially in patients with DKA.

  15. The use of the Rapignost strip for estimating urinary amylase levels.

    PubMed Central

    Touquet, V L; Wilcox, A H

    1985-01-01

    The Rapignost-Amylase urinary test strip (Behringwerke Laboratories) provides an estimation of urine amylase which takes a few minutes and is easy to perform. During a period of 9 months, 84 patients had their urine tested with this strip by casualty officers in the Accident and Emergency Department of St George's Hospital, London. In addition, urine amylase, and plasma amylase and creatinine were measured in the chemical pathology laboratory. In all but one instance, the result of the strip test agreed with the laboratory result. The Rapignost strip should prove useful in screening for acute pancreatitis in situations where there is likely to be a delay in obtaining a laboratory amylase result. PMID:2413872

  16. Structure activity relationships of flavonoids as potent alpha-amylase inhibitors.

    PubMed

    Yuan, Erdong; Liu, Benguo; Wei, Qingyi; Yang, Jiguo; Chen, Lei; Li, Qiong

    2014-08-01

    The effects of three flavonoids (quercetin, luteolin, diosmetin) on alpha-amylase were examined by enzymatic kinetics and fluorescence spectroscopy. The three test flavonoids were non-competitive inhibitors of the enzyme. Addition of flavonoids led to fluorescence quenching of alpha-amylase. The quenching was initiated from the formation of a complex between the flavonoids and the enzyme, corresponding to a static quenching process. An alpha-amylase molecule provides a binding site for the test flavonoid. The main binding force was hydrophobic. The decreasing order of inhibition of alpha-amylase by flavonoids and the binding force was luteolin, diosmetin, and quercetin. It is demonstrated that hydroxylation in ring C and methylation of the hydroxyl group in ring B of flavonoids may weaken the binding affinities to alpha-amylase.

  17. Sweet potato beta-amylase. Primary structure and identification of the active-site glutamyl residue.

    PubMed

    Toda, H; Nitta, Y; Asanami, S; Kim, J P; Sakiyama, F

    1993-08-15

    The complete amino acid sequence of a subunit of sweet potato beta-amylase, a homotetramer, was established by sequence analysis of peptides obtained by digestions with Achromobacter protease I and Staphylococcus aureus V8 protease and by cyanogen bromide cleavage of the S-carboxymethylated subunit. The subunit of the enzyme is a single polypeptide consisting of 498 amino acid residues. It showed 50-60% identity in the amino acid sequence with those of beta-amylases from soybean and barley, while it about 25% with those of three bacterial beta-amylases deduced from the cDNA sequences. Sweet potato beta-amylase was completely inactivated with 2,3-epoxypropyl alpha-D-[U-14C]glucopyranoside. Sequence analysis of the inactivated enzyme revealed that Glu187 was specifically esterified by the affinity labeling with the above reagent, proposing that Glu187 is a potent candidate involved directly in the catalysis with this plant beta-amylase.

  18. Improved detection of amylase activity by sodium dodecyl sulfate-polyacrylamide gel electrophoresis with copolymerized starch.

    PubMed

    Martínez, T F; Alarcón, F J; Díaz-López, M; Moyano, F J

    2000-08-01

    An improved method, based on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) for detection of amylase activity is described. This method will allow better characterization of certain amylases than that obtained by the Davis technique. The main features of the technique are: (i) identification of amylase bands and molecular mass determination are possible in the same gel; (ii) the hydrolysis of copolymerized substrate during electrophoretic separation is prevented using very low temperatures instead of inactivating agents such as chelating agents; and (iii) the technique is applicable to reveal amylase activity in a wide range of biological samples. The method is not useful for enzymes sensitive to SDS and for high molecular mass amylases.

  19. Salt-dependent thermo-reversible α-amylase: cloning and characterization of halophilic α-amylase from moderately halophilic bacterium, Kocuria varians.

    PubMed

    Yamaguchi, Rui; Tokunaga, Hiroko; Ishibashi, Matsujiro; Arakawa, Tsutomu; Tokunaga, Masao

    2011-02-01

    A moderately halophilic bacterium, Kocuria varians, was found to produce active α-amylase (K. varians α-amylase (KVA)). We have observed at least six different forms of α-amylase secreted by this bacterium into the culture medium. Characterization of these KVA forms and cloning of the corresponding gene revealed that KVA comprises pre-pro-precursor form of α-amylase catalytic domain followed by the tandem repeats, which show high similarity to each other and to the starch binding domain (SBD) of other α-amylases. The observed six forms were most likely derived by various processing of the protein product. Recombinant KVA protein was successfully expressed in Escherichia coli as a fusion protein and was purified with affinity chromatography after cleavage from fusion partner. The highly acidic amino acid composition of KVA and the highly negative electrostatic potential surface map of the modeled structure strongly suggested its halophilic nature. Indeed, KVA showed distinct salt- and time-dependent thermal reversibility: when α-amylase was heat denatured at 85°C for 3 min in the presence of 2 M NaCl, the activity was recovered upon incubation on ice (50% recovery after 15 min incubation). Conversely, KVA denatured in 0.1 M NaCl was not refolded at all, even after prolonged incubation. KVA activity was inhibited by proteinaceous α-amylase inhibitor from Streptomyces nitrosporeus, which had been implicated to inhibit only animal α-amylases. KVA with putative SBD regions was found to digest raw starch.

  20. Release and Activity of Bound beta-Amylase in a Germinating Barley Grain.

    PubMed

    Sopanen, T; Laurière, C

    1989-01-01

    In resting grains of Triumph barley (Hordeum vulgare L. cv Triumph) about 40% of the beta-amylase could be extracted with a saline solution, the remaining 60% being in a bound form. During seedling growth (20 degrees C), the bound form was released mainly between days 1 and 3. When a preparation containing bound beta-amylase was incubated with an extract made of endosperms separated from germinating grains, release of bound beta-amylase took place and could be studied in vitro. The release was almost completely prevented by leupeptin and antipain, specific inhibitors of a group of SH-proteinases, but it was not inhibited by pepstatin A or EDTA, which inhibit some other barley proteinases. It is thus very likely that in a whole grain, at least the bulk of the bound beta-amylase is released by the proteolytic action of one or several SH-proteinases. When the bound beta-amylase was released by papain, its molecular weight was about 5000 daltons smaller than that of beta-amylase released by dithiothreitol. This indicates that the release is due to removal of a sequence of beta-amylase itself. A similar decrease in size took place during seedling growth. Bound beta-amylase showed some activity against native starch and it hydrolyzed maltotetraose at a rate that was about 70% of the rate the same amount of bound beta-amylase gave after release. Bound beta-amylase is thus not inactive and it is likely that the slower rate of hydrolysis is due to steric hindrances which prevent substrates from reaching the active site.

  1. Exposure-sensitization relationship for alpha-amylase allergens in the baking industry.

    PubMed

    Houba, R; Heederik, D J; Doekes, G; van Run, P E

    1996-07-01

    Fungal alpha-amylase is an important occupational allergen in the bakery industry. Epidemiologic studies focusing on the relationship between alpha-amylase allergen exposure and work-related respiratory allergy, however, have not been reported yet. In this cross-sectional study, sensitization to occupational allergens and work-related symptoms were studied in 178 bakery workers and related to allergen exposure. Alpha-amylase allergen concentrations were measured in personal dust samples, using a sandwich enzyme immunoassay. All workers were categorized into groups on the basis of their job histories and the alpha-amylase exposure levels of their job titles. Of all workers 25% had one or more work-related symptoms. As much as 9% of the bakery workers showed a positive skin prick test reaction to fungal amylase, and in 8% amylase-specific IgE was demonstrated. Alpha-amylase exposure and atopy appeared to be the most important determinants of skin sensitization, with prevalence ratios for atopy of 20.8 (95% CI, 2.74 to 158) and for medium and high alpha-amylase exposure groups of 8.6 (95% CI, 1.01 to 74) and 15.9 (95% CI, 1.95 to 129), respectively. Furthermore, a positive association was found between positive skin prick tests to alpha-amylase and work-related respiratory symptoms. In conclusion, this study has shown that there is a strong and positive relationship between alpha-amylase allergen exposure levels in bakeries and specific sensitization in bakery workers.

  2. Low serum amylase and obesity, diabetes and metabolic syndrome: A novel interpretation

    PubMed Central

    Nakajima, Kei

    2016-01-01

    For the last decade, low serum amylase (hypoamylasemia) has been reported in certain common cardiometabolic conditions such as obesity, diabetes (regardless of type), and metabolic syndrome, all of which appear to have a common etiology of insufficient insulin action due to insulin resistance and/or diminished insulin secretion. Some clinical studies have shown that salivary amylase may be preferentially decreased in obese individuals, whereas others have revealed that pancreatic amylase may be preferentially decreased in diabetic subjects with insulin dependence. Despite this accumulated evidence, the clinical relevance of serum, salivary, and pancreatic amylase and the underlying mechanisms have not been fully elucidated. In recent years, copy number variations (CNVs) in the salivary amylase gene (AMY1), which range more broadly than the pancreatic amylase gene (AMY2A and AMY2B), have been shown to be well correlated with salivary and serum amylase levels. In addition, low CNV of AMY1, indicating low salivary amylase, was associated with insulin resistance, obesity, low taste perception/satiety, and postprandial hyperglycemia through impaired insulin secretion at early cephalic phase. In most populations, insulin-dependent diabetes is less prevalent (minor contribution) compared with insulin-independent diabetes, and obesity is highly prevalent compared with low body weight. Therefore, obesity as a condition that elicits cardiometabolic diseases relating to insulin resistance (major contribution) may be a common determinant for low serum amylase in a general population. In this review, the novel interpretation of low serum, salivary, and pancreas amylase is discussed in terms of major contributions of obesity, diabetes, and metabolic syndrome. PMID:27022442

  3. Study of conformation and thermodynamics of α-amylase interaction with ethylene in vitro.

    PubMed

    Hu, Yiwei; Zhang, Guangxian; Zhang, Fengxiu

    2016-10-01

    In this article, the conformation and thermodynamics of α-amylase interaction with ethylene in vitro were investigated. The ultraviolet (UV) absorption showed a strong peak of α-amylase treated with 6.04, 29.32 and 262.11μmolL(-1) ethylene appears at ~222nm and a weak peak at 278nm blue-shifted 1nm. Circular dichroism (CD) spectra indicated that the conformations of α-amylase treated with 29.32 and 262.11μmolL(-1) ethylene were obviously changed in which α-helix content were decreased by 20 and 31% respectively, and β-sheet, β-turn and random coil contents were increased by contrast. Fluorescence spectra suggested that the peak intensities of α-amylase at 342nm were obviously increased with the ethylene increase from 6.04 to 525.75μmolL(-1) and more than control group. The binding constants K between ethylene and α-amylase were 3.318×10(6), 4.407×10(6) and 5.125×10(6)Lmol(-1) at 288, 298 and 308K, respectively. And the calculated values of ΔH(0) and ΔS(0) are positive, which suggests that the interaction between ethylene and α-amylase is an endothermic reaction. The negative ΔG(0) values implied that the direct effect of ethylene on α-amylase conformation was spontaneous. The possible reason is that ethylene molecules were easily embedded into the interior of α-amylase in term of the hydrophobic force between α-amylase and ethylene, causing the conformation and thermodynamics changes of α-amylase.

  4. α-Amylase: an enzyme specificity found in various families of glycoside hydrolases.

    PubMed

    Janeček, Štefan; Svensson, Birte; MacGregor, E Ann

    2014-04-01

    α-Amylase (EC 3.2.1.1) represents the best known amylolytic enzyme. It catalyzes the hydrolysis of α-1,4-glucosidic bonds in starch and related α-glucans. In general, the α-amylase is an enzyme with a broad substrate preference and product specificity. In the sequence-based classification system of all carbohydrate-active enzymes, it is one of the most frequently occurring glycoside hydrolases (GH). α-Amylase is the main representative of family GH13, but it is probably also present in the families GH57 and GH119, and possibly even in GH126. Family GH13, known generally as the main α-amylase family, forms clan GH-H together with families GH70 and GH77 that, however, contain no α-amylase. Within the family GH13, the α-amylase specificity is currently present in several subfamilies, such as GH13_1, 5, 6, 7, 15, 24, 27, 28, 36, 37, and, possibly in a few more that are not yet defined. The α-amylases classified in family GH13 employ a reaction mechanism giving retention of configuration, share 4-7 conserved sequence regions (CSRs) and catalytic machinery, and adopt the (β/α)8-barrel catalytic domain. Although the family GH57 α-amylases also employ the retaining reaction mechanism, they possess their own five CSRs and catalytic machinery, and adopt a (β/α)7-barrel fold. These family GH57 attributes are likely to be characteristic of α-amylases from the family GH119, too. With regard to family GH126, confirmation of the unambiguous presence of the α-amylase specificity may need more biochemical investigation because of an obvious, but unexpected, homology with inverting β-glucan-active hydrolases.

  5. Structural and enzymatic analysis of soybean beta-amylase mutants with increased pH optimum.

    PubMed

    Hirata, Akira; Adachi, Motoyasu; Sekine, Atsushi; Kang, You-Na; Utsumi, Shigeru; Mikami, Bunzo

    2004-02-20

    Comparison of the architecture around the active site of soybean beta-amylase and Bacillus cereus beta-amylase showed that the hydrogen bond networks (Glu380-(Lys295-Met51) and Glu380-Asn340-Glu178) in soybean beta-amylase around the base catalytic residue, Glu380, seem to contribute to the lower pH optimum of soybean beta-amylase. To convert the pH optimum of soybean beta-amylase (pH 5.4) to that of the bacterial type enzyme (pH 6.7), three mutants of soybean beta-amylase, M51T, E178Y, and N340T, were constructed such that the hydrogen bond networks were removed by site-directed mutagenesis. The kinetic analysis showed that the pH optimum of all mutants shifted dramatically to a neutral pH (range, from 5.4 to 6.0-6.6). The Km values of the mutants were almost the same as that of soybean beta-amylase except in the case of M51T, while the Vmax values of all mutants were low compared with that of soybean beta-amylase. The crystal structure analysis of the wild type-maltose and mutant-maltose complexes showed that the direct hydrogen bond between Glu380 and Asn340 was completely disrupted in the mutants M51T, E178Y, and N340T. In the case of M51T, the hydrogen bond between Glu380 and Lys295 was also disrupted. These results indicated that the reduced pKa value of Glu380 is stabilized by the hydrogen bond network and is responsible for the lower pH optimum of soybean beta-amylase compared with that of the bacterial beta-amylase.

  6. Characterization of two coleopteran α-amylases and molecular insights into their differential inhibition by synthetic α-amylase inhibitor, acarbose.

    PubMed

    Channale, Sonal M; Bhide, Amey J; Yadav, Yashpal; Kashyap, Garima; Pawar, Pankaj K; Maheshwari, V L; Ramasamy, Sureshkumar; Giri, Ashok P

    2016-07-01

    Post-harvest insect infestation of stored grains makes them unfit for human consumption and leads to severe economic loss. Here, we report functional and structural characterization of two coleopteran α-amylases viz. Callosobruchus chinensis α-amylase (CcAmy) and Tribolium castaneum α-amylase (TcAmy) along with their interactions with proteinaceous and non-proteinaceous α-amylase inhibitors. Secondary structural alignment of CcAmy and TcAmy with other coleopteran α-amylases revealed conserved motifs, active sites, di-sulfide bonds and two point mutations at spatially conserved substrate or inhibitor-binding sites. Homology modeling and molecular docking showed structural differences between these two enzymes. Both the enzymes had similar optimum pH values but differed in their optimum temperature. Overall, pattern of enzyme stabilities were similar under various temperature and pH conditions. Further, CcAmy and TcAmy differed in their substrate affinity and catalytic efficiency towards starch and amylopectin. HPLC analysis detected common amylolytic products like maltose and malto-triose while glucose and malto-tetrose were unique in CcAmy and TcAmy catalyzed reactions respectively. At very low concentrations, wheat α-amylase inhibitor was found to be superior over the acarbose as far as complete inhibition of amylolytic activities of CcAmy and TcAmy was concerned. Mechanism underlying differential amylolytic reaction inhibition by acarbose was discussed.

  7. Salivary Alpha-Amylase Reactivity in Breast Cancer Survivors

    PubMed Central

    Wan, Cynthia; Couture-Lalande, Marie-Ève; Narain, Tasha A.; Lebel, Sophie; Bielajew, Catherine

    2016-01-01

    The two main components of the stress system are the hypothalamic-pituitary-adrenal (HPA) and sympathetic-adrenal-medullary (SAM) axes. While cortisol has been commonly used as a biomarker of HPA functioning, much less attention has been paid to the role of the SAM in this context. Studies have shown that long-term breast cancer survivors display abnormal reactive cortisol patterns, suggesting a dysregulation of their HPA axis. To fully understand the integrity of the stress response in this population, this paper explored the diurnal and acute alpha-amylase profiles of 22 breast cancer survivors and 26 women with no history of cancer. Results revealed that breast cancer survivors displayed identical but elevated patterns of alpha-amylase concentrations in both diurnal and acute profiles relative to that of healthy women, F (1, 39) = 17.95, p < 0.001 and F (1, 37) = 7.29, p = 0.010, respectively. The average area under the curve for the diurnal and reactive profiles was 631.54 ± 66.94 SEM and 1238.78 ± 111.84 SEM, respectively. This is in sharp contrast to their cortisol results, which showed normal diurnal and blunted acute patterns. The complexity of the stress system necessitates further investigation to understand the synergistic relationship of the HPA and SAM axes. PMID:27023572

  8. Antidiabetic Indian Plants: A Good Source of Potent Amylase Inhibitors

    PubMed Central

    Bhat, Menakshi; Zinjarde, Smita S.; Bhargava, Shobha Y.; Kumar, Ameeta Ravi; Joshi, Bimba N.

    2011-01-01

    Diabetes is known as a multifactorial disease. The treatment of diabetes (Type II) is complicated due to the inherent patho-physiological factors related to this disease. One of the complications of diabetes is post-prandial hyperglycemia (PPHG). Glucosidase inhibitors, particularly α-amylase inhibitors are a class of compounds that helps in managing PPHG. Six ethno-botanically known plants having antidiabetic property namely, Azadirachta indica Adr. Juss.; Murraya koenigii (L.) Sprengel; Ocimum tenuflorum (L.) (syn: Sanctum); Syzygium cumini (L.) Skeels (syn: Eugenia jambolana); Linum usitatissimum (L.) and Bougainvillea spectabilis were tested for their ability to inhibit glucosidase activity. The chloroform, methanol and aqueous extracts were prepared sequentially from either leaves or seeds of these plants. It was observed that the chloroform extract of O. tenuflorum; B. spectabilis; M. koenigii and S. cumini have significant α-amylase inhibitory property. Plants extracts were further tested against murine pancreatic, liver and small intestinal crude enzyme preparations for glucosidase inhibitory activity. The three extracts of O. tenuflorum and chloroform extract of M. koenigi showed good inhibition of murine pancreatic and intestinal glucosidases as compared with acarbose, a known glucosidase inhibitor. PMID:18955350

  9. α-Amylase-assisted extraction of polysaccharides from Panax ginseng.

    PubMed

    Sun, Lin; Wu, Di; Ning, Xin; Yang, Guang; Lin, Ziheng; Tian, Meihong; Zhou, Yifa

    2015-04-01

    In this paper, α-amylase-assisted extraction was used to isolate the polysaccharide that remained in hot water-extracted ginseng. The yield of the polysaccharide was 9.0%, almost equal to that of the hot water-extracted polysaccharide. Using anion exchange and gel permeation chromatography, the polysaccharide was fractionated into a neutral polysaccharide fraction and six pectic fractions. The neutral fraction accounted for 76% of the polysaccharide and contained both amylopectin and amylose. The pectic polysaccharide fractions were identified to be arabinogalactan, type-I rhamnogalacturonan and homogalacturonan-type pectin by high-performance liquid chromatography, Fourier transform-infrared and nuclear magnetic resonance analysis. Structural and lymphocyte proliferation activity results showed that these polysaccharides were different from those extracted by hot water, indicating that ginseng contains complex polysaccharides with diverse structures, which results in its diverse pharmacological activities. The α-amylase-assisted extraction is a novel method for preparing ginseng polysaccharides and could be applied toward the further study and exploration of ginseng. These findings provide technical and theoretical support for ginseng pharmacology.

  10. Effects of dietary amylase and sucrose on productivity of cows fed low-starch diets.

    PubMed

    Vargas-Rodriguez, C F; Engstrom, M; Azem, E; Bradford, B J

    2014-07-01

    Recent studies have observed positive effects of both sucrose and exogenous amylase on the productivity of dairy cattle. Our objective was to evaluate direct effects and interactions of amylase and sucrose on dry matter intake (DMI), milk production, and milk components. Forty-eight multiparous Holstein cows between 70 and 130 d in milk were randomly assigned to each of 4 pens (12 cows/pen). Pens were randomly assigned to treatment sequence in a 4 × 4 Latin square design, balanced for carryover effects. Treatment periods were 28 d, with 24 d for diet adaptation and 4d for sample and data collection. The treatments were a control diet (36% NDF and 21% starch), the control diet with amylase [0.5 g/kg of DM; Ronozyme RumiStar 600 (CT); DSM Nutritional Products Ltd., Basel, Switzerland], a diet with sucrose replacing corn grain at 2% of DM, and the sucrose diet with amylase (0.5 g/kg of DM). All data were analyzed with mixed models, including the fixed effects of sugar, amylase, and their interaction, and the random effects of period and pen. Milk data included the random effects of cow nested within pen and pen × period to provide the error term for the pen-level analysis. Dry matter intake was not affected by treatments. Milk yield and milk composition were not altered by the inclusion of sucrose or amylase; however, a tendency for an amylase × sucrose interaction was observed for milk protein content, reflecting slightly lower milk protein concentrations for amylase and sucrose treatments (3.00 and 2.99 ± 0.03%) compared with the control and amylase + sucrose treatments (3.02 and 3.03 ± 0.03%). Solids-corrected and fat-corrected milk yields were not significantly altered by treatment, although the direct effect of amylase approached significance for both variables, suggesting possible small increases with amylase supplementation (~0.5 kg/d). Feed efficiency (energy-corrected milk divided by dry matter intake) numerically increased with either amylase (1.57 ± 0

  11. A new group of glycoside hydrolase family 13 α-amylases with an aberrant catalytic triad

    PubMed Central

    Sarian, Fean D.; Janeček, Štefan; Pijning, Tjaard; Ihsanawati; Nurachman, Zeily; Radjasa, Ocky K.; Dijkhuizen, Lubbert; Natalia, Dessy; van der Maarel, Marc J. E. C.

    2017-01-01

    α-Amylases are glycoside hydrolase enzymes that act on the α(1→4) glycosidic linkages in glycogen, starch, and related α-glucans, and are ubiquitously present in Nature. Most α-amylases have been classified in glycoside hydrolase family 13 with a typical (β/α)8-barrel containing two aspartic acid and one glutamic acid residue that play an essential role in catalysis. An atypical α-amylase (BmaN1) with only two of the three invariant catalytic residues present was isolated from Bacillus megaterium strain NL3, a bacterial isolate from a sea anemone of Kakaban landlocked marine lake, Derawan Island, Indonesia. In BmaN1 the third residue, the aspartic acid that acts as the transition state stabilizer, was replaced by a histidine. Three-dimensional structure modeling of the BmaN1 amino acid sequence confirmed the aberrant catalytic triad. Glucose and maltose were found as products of the action of the novel α-amylase on soluble starch, demonstrating that it is active in spite of the peculiar catalytic triad. This novel BmaN1 α-amylase is part of a group of α-amylases that all have this atypical catalytic triad, consisting of aspartic acid, glutamic acid and histidine. Phylogenetic analysis showed that this group of α-amylases comprises a new subfamily of the glycoside hydrolase family 13. PMID:28287181

  12. An analytical method for measuring α-amylase activity in starch-containing foods.

    PubMed

    Koyama, Kazuo; Hirao, Takashi; Toriba, Akira; Hayakawa, Kazuichi

    2013-05-01

    The quality of starch-containing foods may be significantly impaired by contamination with very small amounts of α-amylase, which can enzymatically hydrolyze the starch and cause viscosity loss. Thus, for quality control, it is necessary to have an analytical method that can measure low amylase activity. We developed a sensitive analytical method for measuring the activity of α-amylase (from Bacillus subtilis) in starch-containing foods. The method consists of six steps: (1) crude extraction of α-amylase by centrifugation and filtration; (2) α-amylase purification by desalting and anion-exchange chromatography; (3) reaction of the purified amylase with boron-dipyrromethene (BODIPY)-labeled substrate, which releases a fluorescent fragment upon digestion of the substrate, thus avoiding interference from starch derivatives in the sample; (4) stopping the reaction with acetonitrile; (5) reversed-phase solid-phase extraction of the fluorescent substrate to remove contaminating dye and impurities; and (6) separation and measurement of BODIPY fluorescence by HPLC. The proposed method could quantify α-amylase activities as low as 10 mU/mL, which is enough to reduce the viscosity of starch-containing foods.

  13. Evaluation of amylase testing as a tool for saliva screening of crime scene trace swabs.

    PubMed

    Hedman, Johannes; Dalin, Erik; Rasmusson, Birgitta; Ansell, Ricky

    2011-06-01

    Amylase testing has been used as a presumptive test for crime scene saliva for over three decades, mainly to locate saliva stains on surfaces. We have developed a saliva screening application for crime scene trace swabs, utilising an amylase sensitive paper (Phadebas(®) Forensic Press test). Positive results were obtained for all tested dried saliva stains (0.5-32 μL) with high or intermediate amylase activity (840 and 290 kU/L). Results were typically obtained within 5 min, and all samples that produced DNA profiles were positive. However, salivary amylase activities, as well as DNA concentrations, vary significantly between individuals. We show that there is no correlation between amylase activity and amount of DNA in fresh saliva. Even so, a positive amylase result indicates presence of saliva, and thereby presence of DNA. Amylase testing may be useful for screening in investigations where the number of DNA analyses is limited due to cost, e.g., in volume crime.

  14. A new group of glycoside hydrolase family 13 α-amylases with an aberrant catalytic triad.

    PubMed

    Sarian, Fean D; Janeček, Štefan; Pijning, Tjaard; Ihsanawati; Nurachman, Zeily; Radjasa, Ocky K; Dijkhuizen, Lubbert; Natalia, Dessy; van der Maarel, Marc J E C

    2017-03-13

    α-Amylases are glycoside hydrolase enzymes that act on the α(1→4) glycosidic linkages in glycogen, starch, and related α-glucans, and are ubiquitously present in Nature. Most α-amylases have been classified in glycoside hydrolase family 13 with a typical (β/α)8-barrel containing two aspartic acid and one glutamic acid residue that play an essential role in catalysis. An atypical α-amylase (BmaN1) with only two of the three invariant catalytic residues present was isolated from Bacillus megaterium strain NL3, a bacterial isolate from a sea anemone of Kakaban landlocked marine lake, Derawan Island, Indonesia. In BmaN1 the third residue, the aspartic acid that acts as the transition state stabilizer, was replaced by a histidine. Three-dimensional structure modeling of the BmaN1 amino acid sequence confirmed the aberrant catalytic triad. Glucose and maltose were found as products of the action of the novel α-amylase on soluble starch, demonstrating that it is active in spite of the peculiar catalytic triad. This novel BmaN1 α-amylase is part of a group of α-amylases that all have this atypical catalytic triad, consisting of aspartic acid, glutamic acid and histidine. Phylogenetic analysis showed that this group of α-amylases comprises a new subfamily of the glycoside hydrolase family 13.

  15. Where do animal alpha-amylases come from? An interkingdom trip.

    PubMed

    Da Lage, Jean-Luc; Danchin, Etienne G J; Casane, Didier

    2007-08-21

    Alpha-amylases are widely found in eukaryotes and prokaryotes. Few amino acids are conserved among these organisms, but at an intra-kingdom level, conserved protein domains exist. In animals, numerous conserved stretches are considered as typical of animal alpha-amylases. Searching databases, we found no animal-type alpha-amylases outside the Bilateria. Instead, we found in the sponge Reniera sp. and in the sea anemone Nematostella vectensis, alpha-amylases whose most similar cognate was that of the amoeba Dictyostelium discoideum. We found that this "Dictyo-type" alpha-amylase was shared not only by these non-Bilaterian animals, but also by other Amoebozoa, Choanoflagellates, and Fungi. This suggested that the Dictyo-type alpha-amylase was present in the last common ancestor of Unikonts. The additional presence of the Dictyo-type in some Ciliates and Excavates, suggests that horizontal gene transfers may have occurred among Eukaryotes. We have also detected putative interkingdom transfers of amylase genes, which obscured the historical reconstitution. Several alternative scenarii are discussed.

  16. Role of parotid amylase in starch digestion in the gastro-intestinal tracts of diabetic rats.

    PubMed

    Kurahashi, M; Inomata, K

    1989-09-01

    In order for the role of parotid amylase in starch digestion in the gastro-intestinal tracts of diabetic rats to be clarified, this study investigated the effect of parotid-duct ligation on both amylase secretion from the parotid glands and pancreas into the gastro-intestinal tract and on starch digestion in the gastro-intestinal contents during feedings. In both diabetic rats and control rats, parotid-duct ligation reduced amylase activity in both the parotid glands during fasting and in the gastric contents after feeding. The amylase activity in the intestinal contents after feeding was reduced by parotid-duct ligation in the diabetic rats. Starch digestion in the gastro-intestinal tract after feeding was reduced by parotid-duct ligation in the diabetic rats. The results suggest that most of the amylase activity in the gastric contents and a large part of the amylase activity in the intestinal contents are derived from the parotid glands, and that parotid amylase plays an important role in starch digestion in the gastro-intestinal tracts of diabetic rats.

  17. Salivary alpha-amylase: role in dental plaque and caries formation.

    PubMed

    Scannapieco, F A; Torres, G; Levine, M J

    1993-01-01

    Salivary alpha-amylase, one of the most plentiful components in human saliva, has at least three distinct biological functions. The enzymatic activity of alpha-amylase undoubtedly plays a role in carbohydrate digestion. Amylase in solution binds with high affinity to a selected group of oral streptococci, a function that may contribute to bacterial clearance and nutrition. The fact that alpha-amylase is also found in acquired enamel pellicle suggests a role in the adhesion of alpha-amylase-binding bacteria. All of these biological activities seem to depend on an intact enzyme conformation. Binding of alpha-amylase to bacteria and teeth may have important implications for dental plaque and caries formation. alpha-Amylase bound to bacteria in plaque may facilitate dietary starch hydrolysis to provide additional glucose for metabolism by plaque microorganisms in close proximity to the tooth surface. The resulting lactic acid produced may be added to the pool of acid in plaque to contribute to tooth demineralization.

  18. Variation in Amylase Haplotypes among Congenic Lines of the House Mouse

    PubMed Central

    Nielsen, J. Tonnes

    1982-01-01

    Pancreatic amylase in the mouse displays considerable quantitative genetic variation. Agar gel electrophoresis reveals that homozygous animals have either one form of the enzyme, type A, or two forms, type AB. Only few animals have been found that contradict this statement, namely among Mus musculus castaneus from Thailand, which has a single-banded B type. Double-banded homozygous specimens of various origins have different relative proportions of the two isoenzymes. By measuring the A:B ratios in such animals, a number of distinct haplotypes or amylase complexes, determining ratios ranging from 61% A:39% B to 12% A:88% B, have been recognized. These complexes differ also with respect to the total amount of amylase produced. If the reference stock C3H/As is given the value 1, then other haplotypes have values ranging from 1.0 to 0.27. Nineteen amylase haplotypes have been established in congenic lines on a C3H/As background. Some of these lines contain at least four active pancreatic amylase structural genes and breeding experiments have demonstrated that the genetic elements regulating total amylase production and relative proportions of the isoenzymes are located within the amylase complex, cis-acting, and very closely linked to the structural genes. PMID:6184261

  19. Isolation and characterization of a novel thermostable alpha-amylase from Korean pine seeds.

    PubMed

    Azad, Md Abul Kalam; Bae, Jae-Han; Kim, Jong-Sang; Lim, Jin-Kyu; Song, Kyung-Sik; Shin, Beom-Soo; Kim, Hak-Ryul

    2009-10-31

    Amylases have significant importance in broad industrial application including bio-ethanol production. Although amylases are widely distributed in microbes, plants and animals, it has been sought for new amylases from various sources with special industrial potential. In this study we firstly isolated and characterized a novel thermostable alpha-amylase from Korean pine seed. Enzyme was purified to homogeneity level with purification fold of 1286.1 using several techniques such as self-precipitation, (NH(4))(2)SO(4) fractionation, DEAE anion exchange and starch affinity chromatography. The purified alpha-amylase showed two bands in SDS-PAGE with molecular weight of 44 and 45 kDa. The apparent molecular weight of native enzyme was calculated to be 46.7 kDa. Internal peptide sequencing confirmed that the purified alpha-amylase was a novel enzyme. The optimum pH and temperature for enzyme activity were pH 4.5 and 65 degrees C, respectively. This enzyme was fully stable for 48h at 50 degrees C and retained 80% activity up to 96h. The K(m) and V(max) were 0.84 mg/ml and 3.71 micromol/min, respectively. On the basis of high thermal stability and a broad range of pH stability, the pine seed alpha-amylase showed a good prospect of industrial application.

  20. Conjugation of α-amylase with dextran for enhanced stability: process details, kinetics and structural analysis.

    PubMed

    Jadhav, Swati B; Singhal, Rekha S

    2012-11-06

    The influence of enzyme polysaccharide interaction on enzyme stability and activity was elucidated by covalently binding dextran to a model enzyme, α-amylase. The conjugation process was optimized with respect to concentration of oxidizing agent, pH of enzyme solution, ratio of dextran to enzyme concentration, temperature and time of conjugate formation, and was found to affect the stability of α-amylase. α-Amylase conjugated under optimized conditions showed 5% loss of activity but with enhanced thermal and pH stability. Lower inactivation rate constant of conjugated α-amylase within the temperature range of 60-80 °C implied its better stability. Activation energy for denaturation of α-amylase increased by 8.81 kJ/mol on conjugation with dextran. Analysis of secondary structure of α-amylase after covalent binding with dextran showed helix to turn conversion without loss of functional properties of α-amylase. Covalent bonding was found to be mandatory for the formation of conjugate.

  1. Effects of Pulsed Electric Field (PEF) Treatment on Enhancing Activity and Conformation of α-Amylase.

    PubMed

    Tian, Mei-ling; Fang, Ting; Du, Mu-ying; Zhang, Fu-sheng

    2016-04-01

    To explore an efficient, safe, and speedy application of pulsed electric field (PEF) technology for enzymatic modification, effects of PEF treatment on the enzymatic activity, property and kinetic parameters of α-amylase were investigated. Conformational transitions were also studied with the aid of circular dichroism (CD) and fluorescence spectra. The maximum enzymatic activity of α-amylase was obtained under 15 kV/cm electric field intensity and 100 mL/min flow velocity PEF treatment, in which the enzymatic activity increased by 22.13 ± 1.14% compared with control. The activation effect could last for 18 h at 4 °C. PEF treatment could widen the range of optimum temperature for α-amylase, however, it barely exerted any effect on the optimum pH. On the other hand, α-amylase treated by PEF showed an increase of Vmax, t1/2 and ΔG, whereas a decrease of Km and k were observed. Furthermore, it can be observed from fluorescence and CD spectra that PEF treatment had increased the number of amino acid residues, especially that of tryptophan, on α-amylase surface with enhanced α-helices by 34.76% and decreased random coil by 12.04% on α-amylase when compared with that of untreated. These changes in structure had positive effect on enhancing α-amylase activity and property.

  2. Protein engineering in the alpha-amylase family: catalytic mechanism, substrate specificity, and stability.

    PubMed

    Svensson, B

    1994-05-01

    Most starch hydrolases and related enzymes belong to the alpha-amylase family which contains a characteristic catalytic (beta/alpha)8-barrel domain. Currently known primary structures that have sequence similarities represent 18 different specificities, including starch branching enzyme. Crystal structures have been reported in three of these enzyme classes: the alpha-amylases, the cyclodextrin glucanotransferases, and the oligo-1,6-glucosidases. Throughout the alpha-amylase family, only eight amino acid residues are invariant, seven at the active site and a glycine in a short turn. However, comparison of three-dimensional models with a multiple sequence alignment suggests that the diversity in specificity arises by variation in substrate binding at the beta-->alpha loops. Designed mutations thus have enhanced transferase activity and altered the oligosaccharide product patterns of alpha-amylases, changed the distribution of alpha-, beta- and gamma-cyclodextrin production by cyclodextrin glucanotransferases, and shifted the relative alpha-1,4:alpha-1,6 dual-bond specificity of neopullulanase. Barley alpha-amylase isozyme hybrids and Bacillus alpha-amylases demonstrate the impact of a small domain B protruding from the (beta/alpha)8-scaffold on the function and stability. Prospects for rational engineering in this family include important members of plant origin, such as alpha-amylase, starch branching and debranching enzymes, and amylomaltase.

  3. alpha. -Amylase of Clostridium thermosulfurogenes EM1: Nucleotide sequence of the gene, processing of the enzyme, and comparison to other. alpha. -amylases

    SciTech Connect

    Bahl, H.; Burchhardt, G.; Spreinat, A.; Haeckel, K.; Wienecke, A.; Antranikian, G.; Schmidt, B. )

    1991-05-01

    The nucleotide sequence of the {alpha}-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes Em1 suggested that the {alpha}-amylase is translated form mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature {alpha}-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 {alpha}-amylase with those from other bacterial and eukaryotic {alpha}-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca{sup 2+}-binding site (consensus region I) of this Ca{sub 2+}-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the {alpha}-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the {beta}-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains.

  4. A quantitative assessment of the importance of barley seed alpha-amylase, beta-amylase, debranching enzyme, and alpha-glucosidase in starch degradation.

    PubMed

    Sun, Z T; Henson, C A

    1991-02-01

    Extracts of germinated barley (Hordeum vulgare L.) seeds of 41 different genotypes were analyzed for their activities of alpha-amylase, beta-amylase, alpha-glucosidase, and debranching enzyme and for their abilities to hydrolyze boiled soluble starch, nonboiled soluble starch, and starch granules extracted from barley seeds with water. Linear correlation analysis, used to quantitate the interactions between the seven parameters, revealed that boiled soluble starch was not a good substrate for predicting activities of enzymes functioning in in vivo starch hydrolysis as the extracts' abilities to hydrolyze boiled soluble starch was not correlated with their abilities to hydrolyze native starch granules. Activities of alpha-amylase and alpha-glucosidase were positively and significantly correlated with the seed extracts' abilities to hydrolyze all three starches. beta-Amylase was only significantly correlated with hydrolysis of boiled soluble starch. No significant correlations existed between debranching enzyme activity and hydrolysis of any of the three starches. Interactions between the four enzymes as they functioned together to hydrolyze the three types of starch were evaluated by path coefficient analysis. alpha-Amylase contributed to hydrolyses of all three starches primarily by its direct effect (noninteractive component). This direct contribution increased as the substrate progressed from the completely artificial boiled soluble starch, to the most physiologically significant substrate, native starch granules. alpha-Glucosidase contributed to the hydrolysis of boiled soluble starch primarily by its direct effect (noninteractive) yet contributed to starch granule hydrolysis primarily via its interaction with alpha-amylase (indirect effect). The contribution of beta-amylase to hydrolysis of boiled soluble starch was direct and it did not contribute significantly to hydrolysis of native starch granules.

  5. alpha-Amylase of Clostridium thermosulfurogenes EM1: nucleotide sequence of the gene, processing of the enzyme, and comparison of other alpha-amylases.

    PubMed Central

    Bahl, H; Burchhardt, G; Spreinat, A; Haeckel, K; Wienecke, A; Schmidt, B; Antranikian, G

    1991-01-01

    The nucleotide sequence of the alpha-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes EM1 suggested that the alpha-amylase is translated from mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature alpha-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 alpha-amylase with those from other bacterial and eucaryotic alpha-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca(2+)-binding site (consensus region I) of this Ca(2+)-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the alpha-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the beta-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains. PMID:1854207

  6. Beta-AMYLASE4, a noncatalytic protein required for starch breakdown, acts upstream of three active beta-amylases in Arabidopsis chloroplasts.

    PubMed

    Fulton, Daniel C; Stettler, Michaela; Mettler, Tabea; Vaughan, Cara K; Li, Jing; Francisco, Perigio; Gil, Manuel; Reinhold, Heike; Eicke, Simona; Messerli, Gaëlle; Dorken, Gary; Halliday, Karen; Smith, Alison M; Smith, Steven M; Zeeman, Samuel C

    2008-04-01

    This work investigated the roles of beta-amylases in the breakdown of leaf starch. Of the nine beta-amylase (BAM)-like proteins encoded in the Arabidopsis thaliana genome, at least four (BAM1, -2, -3, and -4) are chloroplastic. When expressed as recombinant proteins in Escherichia coli, BAM1, BAM2, and BAM3 had measurable beta-amylase activity but BAM4 did not. BAM4 has multiple amino acid substitutions relative to characterized beta-amylases, including one of the two catalytic residues. Modeling predicts major differences between the glucan binding site of BAM4 and those of active beta-amylases. Thus, BAM4 probably lost its catalytic capacity during evolution. Total beta-amylase activity was reduced in leaves of bam1 and bam3 mutants but not in bam2 and bam4 mutants. The bam3 mutant had elevated starch levels and lower nighttime maltose levels than the wild type, whereas bam1 did not. However, the bam1 bam3 double mutant had a more severe phenotype than bam3, suggesting functional overlap between the two proteins. Surprisingly, bam4 mutants had elevated starch levels. Introduction of the bam4 mutation into the bam3 and bam1 bam3 backgrounds further elevated the starch levels in both cases. These data suggest that BAM4 facilitates or regulates starch breakdown and operates independently of BAM1 and BAM3. Together, our findings are consistent with the proposal that beta-amylase is a major enzyme of starch breakdown in leaves, but they reveal unexpected complexity in terms of the specialization of protein function.

  7. Various emetogens increase the secretion of salivary amylase in rats: a potential model in emesis research.

    PubMed

    Fukui, Hideo; Miwa, Eri; Iwachido, Takako; Kitaura, Harumi; Furukawa, Hatsue

    2010-01-01

    We investigated the effects of various emetic agents: cisplatin, apomorphine, lithium chloride (LiCl), rolipram, sibutramine, and the beta(3)-adrenoceptor (AR) agonist CL316243 on salivary amylase secretion in rats. We also determined the inhibitory effect of granisetron, a 5-HT(3)-receptor antagonist, on cisplatin-induced increased salivary amylase activity and the inhibitory effect of bilateral abdominal vagotomy on increases in salivary amylase activity induced by cisplatin and LiCl. Granisetron was administered 15 min before and 1 h after cisplatin administration. Cisplatin (10 - 15 mg/kg, i.v.) increased salivary amylase activity dose-dependently and induced an acute increase from 1.5 h post-treatment with 15 mg/kg. Apomorphine (1 - 3 mg/kg, s.c.), LiCl (120 mg/kg, i.p.), rolipram (3 - 10 mg/kg, p.o.), and sibutramine (10 mg/kg, p.o.) induced significant increases in salivary amylase secretion. On the other hand, CL316243 did not stimulate salivary amylase secretion. The increased amylase activity induced by cisplatin (15 mg/kg, i.v.) was inhibited significantly by granisetron (1 or 3 mg/kg x 2, i.v.) or tended to be inhibited by bilateral abdominal vagotomy, whereas an increase in amylase activity produced by LiCl was not inhibited by abdominal visceral nerve section. These results suggest that salivary amylase activity is useful as a marker for emesis in rats, a species that does not exhibit vomiting.

  8. Properties and synthesis de novo of auxin-induced α-amylase in pea cotyledons.

    PubMed

    Hirasawa, E; Yamamoto, S

    1991-07-01

    Analysis of starch-degrading enzymes in a crude extract of detached cotyledons of Pisum sativum L. by polyacrylamide gel electrophoresis (PAGE) demonstrated the presence of one band of α-amylase (EC 3.2.1.1) activity. The activity of only this amylase was promoted in cotyledons incubated with 2,4-dichlorophenoxyacetic acid (2,4-D). The auxin-induced α-amylase from pea cotyledons was purified to homogeneity, as judged by the criterion of a single band after PAGE. The relative molecular mass (Mr), estimated by gel filtration, was approx. 42 000 and the enzyme contained no carbohydrate moiety. Sodium dodecylsulfate-PAGE yielded a single band that corresponded to an Mr of 41 000. The isoelectric point was 5.85 and the aminoacid composition was similar to that of α-amylase from other plants. When [(3)H]leucine was fed to detached dry cotyledons prior to incubation, the radioactivity in α-amylase from cotyledons incubated in the presence of 2,4-D was found to be approx. 10-fold higher than that from cotyledons incubated in distilled water. When α-amylase from cotyledons incubated with (2)H2O that contained 2,4-D and the tritiated amylase were centrifuged together in a CsCl density gradient, the peak of enzymatic activity of deuterated α-amylase was shifted to a denser fraction than the peak of radioactivity of the tritiated enzyme. These results show that auxin-induced α-amylase in pea cotyledons is synthesized de novo.

  9. Biochemical characterization of the alpha-amylase inhibitor in mungbeans and its application in inhibiting the growth of Callosobruchus maculatus.

    PubMed

    Wisessing, Anussorn; Engkagul, Arunee; Wongpiyasatid, Arunee; Choowongkomon, Kiattawee

    2010-02-24

    The insect Callosobruchus maculatus causes considerable damage to harvested mungbean seeds every year, which leads to commercial losses. However, recent studies have revealed that mungbean seeds contain alpha-amylase inhibitors that can inhibit the protein C. maculatus, preventing growth and development of the insect larvae in the seed, thus preventing further damage. For this reason, the use of alpha-amylase inhibitors to interfere with the pest's digestion process has become an interesting alternative biocontrolling agent. In this study, we have isolated and purified the alpha-amylase inhibitor from mungbean seeds (KPS1) using ammonium sulfate precipitation, gel filtration chromatography and reversed phase HPLC. We found that the alpha-amylase inhibitor, isolated as a monomer, had a molecular weight of 27 kDa. The alpha-amylase inhibitor was purified 750-fold with a final yield of 0.4 mg of protein per 30 g of mungbean seeds. Its specific activity was determined at 14.5 U (mg of protein)(-1). Interestingly, we found that the isolated alpha-amylase inhibitor inhibits C. maculatus alpha-amylase but not human salivary alpha-amylase. After preincubation of the enzyme with the inhibitor, the mungbean alpha-amylase inhibitor inhibited C. maculatus alpha-amylase activity by decreasing V(max) while increasing the K(m) constant, indicating that the mungbean alpha-amylase is a mix noncompetitive inhibitor. The in vivo effect of alpha-amylase inhibitor on the mortality of C. maculatus shows that the alpha-amylase inhibitor acts on C. maculatus during the development stage, by reducing carbohydrate digestion necessary for growth and development, rather than during the end laying/hatching stage. Our results suggest that mungbean alpha-amylase inhibitor could be a useful future biocontrolling agent.

  10. Crystal and molecular structure of barley alpha-amylase.

    PubMed

    Kadziola, A; Abe, J; Svensson, B; Haser, R

    1994-05-27

    The three-dimensional structure of barley malt alpha-amylase (isoform AMY2-2) was determined by multiple isomorphous replacement using three heavy-atom derivatives and solvent flattening. The model was refined using a combination of simulated annealing and conventional restrained least-squares crystallographic refinement to an R-factor of 0.153 based on 18,303 independent reflections with F(o) > sigma(F(o)) between 10 and 2.8 A resolution, with root-mean-square deviations of 0.016 A and 3.3 degrees from ideal bond lengths and bond angles, respectively. The final model consists of 403 amino acid residues, three calcium ions and 153 water molecules. The polypeptide chain folds into three domains: a central domain forming a (beta alpha)8-barrel of 286 residues, with a protruding irregular structured loop domain of 64 residues (domain B) connecting strand beta 3 and helix alpha 3 of the barrel, and a C-terminal domain of 53 residues forming a five stranded anti-parallel beta-sheet. Unlike the previously known alpha-amylase structures, AMY2-2 contains three Ca2+ binding sites co-ordinated by seven or eight oxygen atoms from carboxylate groups, main-chain carbonyl atoms and water molecules, all calcium ions being bound to domain B and therefore essential for the structural integrity of that domain. Two of the Ca2+ sites are located only 7.0 A apart with one Asp residue serving as ligand for both. One Ca2+ site located at about 20 A from the other two was found to be exchangeable with Eu3+. By homology with other alpha-amylases, some important active site residues are identified as Asp179, Glu204 and Asp289, and are situated at the C-terminal end of the central beta-barrel. A starch granule binding site, previously identified as Trp276 and Trp277, is situated on alpha-helix 6 in the central (beta alpha)8-barrel, at the surface of the enzyme. This binding site region is associated with a considerable disruption of the (beta alpha)8-barrel 8-fold symmetry.

  11. Seeking new mutation clues from Bacillus licheniformis amylase by molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Lu, Tao

    2009-07-01

    Amylase is one of the most important industrial enzymes in the world. Researchers have been searching for a highly thermal stable mutant for many years, but most focus on point mutations of one or few nitrogenous bases. According to this molecular dynamic simulation of amylase from Bacillus licheniformis (BLA), the deletion of some nitrogenous bases would be more efficacious than point mutations. The simulation reveals strong fluctuation of the BLA structure at optimum temperature. The fluctuation of the outer domains of BLA is stronger than that of the core domain. Molecular simulation provides a clue to design thermal stable amylases through deletion mutations in the outer domain.

  12. Capillary electrophoresis as a screening tool for alpha amylase inhibitors in plant extracts

    PubMed Central

    Hamdan, Imad I.; Afifi, Fatima U.

    2010-01-01

    Capillary electrophoresis (CE) method was developed for screening plant extract for potential alpha amylase (AA) inhibitory activity. The method was validated against a well established UV method. Overall, the proposed method was shown able to detect plants with significant alpha amylase inhibitory activity but not those with rather clinically insignificant activities. Fifty plant species were screened using both the proposed CE method and the UV method and seven plant species were found to possess significant AA inhibitory activities. Two plant species were proved to have alpha amylase inhibitory activity for the first time. PMID:24115900

  13. Alpha-amylase production is induced by sulfuric acid in rice aleurone cells.

    PubMed

    Mitsunaga, Shin-ichiro; Kobayashi, Midori; Fukui, Satoe; Fukuoka, Kayoko; Kawakami, Osamu; Yamaguchi, Junji; Ohshima, Masahiro; Mitsui, Toshiaki

    2007-12-01

    The hydrolytic enzyme alpha-amylase (EC 3.2.1.1) is produced mainly in aleurone cells of germinating cereals, and the phytohormone gibberellin (GA) is essential for its induction. However, in rice (Oryza sativa L.), sulfuric acid (H(2)SO(4)) induces alpha-amylase production in aleurone tissue even in the absence of GA. Here, the pre-treatment of rice aleurone cells with H(2)SO(4) and incubation in water induced alpha-amylase activity, as if the cells had been incubated in GA solution.

  14. Effect of different amylases on the utilization of cornstarch in broiler chickens.

    PubMed

    Yuan, Jianmin; Wang, Xingyu; Yin, Dafei; Wang, Maofei; Yin, Xiaonan; Lei, Zhao; Guo, Yuming

    2016-09-23

    This study compared the effect of different amylases on the utilization of cornstarch in broiler chickens fed a corn-based diet. Three-day-old Arbor Acres plus male chickens were randomly divided into 7 treatments and fed a diet supplemented with different sources and concentrations of amylase: 1,500 U/kg and 3,000 U/kg α-1,4 amylase from Aspergillus oryzae (α-amylase A); 480 U/kg and 960 U/kg α-1,4 amylase from Bacillus subtilis (α-amylase B); 200 U/kg and 400 U/kg α-1,6 isoamylase from B. subtilis; and the control. The experimental period comprised 11 d, during which performance, nutrient digestibility, digestive enzyme activity, intestinal morphology, and glucose transporter transcription of the chickens were evaluated. The results indicated that 1,500 U/kg α-amylase improved the digestibility of energy and decreased the feed conversion rate compared to α-1,6 isoamylase (P < 0.05). Supplemental 400 U/kg α-1,6 isoamylase decreased ileal digestibility of amylopectin and total starch (P < 0.05) compared to 200 U/kg α-1,6 isoamylase, α-amylase A, α-amylase B, and the control (P < 0.05). Supplemental α-1,6 isoamylase decreased (P < 0.05) insulin content. Supplemental 3,000 U/kg α-amylase A and α-1,6 isoamylase increased (P < 0.05) the relative weight of the liver. In addition, 3,000 U/kg α-amylase A, 480 U/kg α-amylase B, and α-1,6 isoamylase decreased the V:C in the duodenum and ileum. α-amylase A increased sucrase activity in the jejunum (P < 0.05), whereas 400 U/kg α-1,6 isoamylase reduced maltase activity in the duodenum (P < 0.05). Furthermore, 3,000 U/kg α-amylase A and α-amylase B decreased (P < 0.05) sodium/glucose cotransporter 1 (SGLT1) mRNA expression in the duodenum and jejunum. However, 200 U/kg α-1,6 isoamylase increased glucose transporter 2 (GLUCT2) in the duodenum (P < 0.05). These results suggest that exogenous amylase affects the digestibility of starch by affecting disaccharidase activity in the

  15. Analysis of α-amylase inhibitor from corni fructus by coupling magnetic cross-linked enzyme aggregates of α-amylase with HPLC-MS.

    PubMed

    Liu, Liangliang; Cen, Yin; Liu, Fang; Yu, Jingang; Jiang, Xinyu; Chen, Xiaoqing

    2015-07-15

    As a carrier-free immobilization strategy, magnetic cross-linked enzyme aggregates (MCLEAs) showed improved enzyme activity, stability and magnetic response. In this study, MCLEAs of α-amylase (MCLEAs-amylase) was prepared under optimized conditions and characterized with scanning electron microscope and vibrating sample magnetometer. The prepared MCLEAs-amylase showed an amorphous structure and the saturation magnetization was 33.5emu/g, which was sufficient for magnetic separation. Then MCLEAs-amylase coupled with high performance liquid chromatography-mass spectrometry (HPLC-MS) was utilized to screen and identify α-amylase inhibitors from ethyl acetate extract of corni fructus. The experiment conditions were optimized. At the optimum conditions (incubation time: 10min, pH: 7.0 and temperature: 20°C), querciturone was successfully screened and identified with weak non-specific binding. The screening result was verified by inhibition assays and the IC50 value of querciturone was 22.5μg/mL. This method provided a rapid way to screen active compounds from natural products.

  16. Structure and sequence based analysis of alpha-amylase evolution.

    PubMed

    Singh, Swati; Guruprasad, Lalitha

    2014-01-01

    α-Amylases hydrolyze α- 1,4-glycosidic bonds during assimilation of biological macromolecules. The amino acid sequences of these enzymes in thousands of diverse organisms are known and the 3D structures of several proteins have been solved. The 3D structure analysis of these universal enzymes from diverse organisms has been studied by the generation of phylogenetic trees and structure based sequence analysis to generate a metric for the degree of conservation that is responsible for individual speciation. Greater similarities are observed between reference NCBI tree and structure based phylogenetic tree compared to sequence based phylogenetic tree indicating that structures truly represent the functional aspects of proteins than from the sequence information alone. We report differences in the profile specific conserved and insertion/deletion regions, factors responsible for the Ca(2+) and Cl(-) ion binding and the disulfide connectivity pattern that discriminate the enzymes over evolution.

  17. Ca-binding to Bacillus licheniformis alpha-amylase (BLA).

    PubMed

    Nazmi, Ali Reza; Reinisch, Timm; Hinz, Hans-Jürgen

    2006-09-01

    Ca-induced renaturation of Bacillus licheniformis alpha-amylase in the presence of urea has been employed to determine the binding constants of the ion. The native enzyme is folded at 3M urea while the Ca-depleted protein is largely unfolded at this denaturant concentration. Refolding of the protein has been monitored by circular dichroism and the titration curves have been analyzed assuming a model of three independent binding sites. The stoichiometry has been taken from X-ray studies. The refolded protein exhibits a secondary structure that is similar but not identical to that of the native protein. The binding constants have been used to construct a phase diagram that illustrates the contribution of Ca-binding to the resistance against urea unfolding.

  18. Aleppo tannin: structural analysis and salivary amylase inhibition.

    PubMed

    Zajácz, Agnes; Gyémánt, Gyöngyi; Vittori, Natale; Kandra, Lili

    2007-04-09

    The effectiveness and specificity of a tannin inhibition on human salivary amylase (HSA) catalyzed hydrolysis was studied using 2-chloro-4-nitrophenyl 4-O-beta-D-galactopyranosyl-alpha-maltoside (GalG(2)-CNP) and amylose substrates. Aleppo tannin was isolated from the gall nut of Aleppo oak. This tannin is a gallotannin, in which glucose is esterified with gallic acids. This is the first kinetic report, which details the inhibitory effects of this compound on HSA. A mixed non-competitive type inhibition has been observed on both substrates. The extent of inhibition is markedly dependent on the substrate-type. Kinetic constants were calculated from Lineweaver-Burk secondary plots for GalG(2)-CNP (K(EI) 0.82 microg mL(-1), K(ESI) 3.3 microg mL(-1)). This indicates a 1:1 binding ratio of inhibitor-enzyme and/or inhibitor-enzyme-substrate complex. When amylose was the substrate the binding ratio of inhibitor to enzyme-substrate complex was found to be 2:1, with the binding constants of K(EI) 17.4 microg mL(-1), K(ESI) 14.9 microg mL(-1), K(ESI(2)) 9.6 microg mL(-1). Presumably, the tannin inhibitor can bind not only to HSA, but to the amylose substrate, as well. Kinetic data suggest that Aleppo tannin is a more efficient amylase inhibitor than the recently studied other tannin with quinic acid core (GalG(2)-CNP: K(EI) 9.0 microg mL(-1), K(ESI) 47.9 microg mL(-1)).

  19. Characterization of a starch-hydrolyzing α-amylase produced by Aspergillus niger WLB42 mutated by ethyl methanesulfonate treatment

    PubMed Central

    Wang, Shihui; Lin, Chaoyang; Liu, Yun; Shen, Zhicheng; Jeyaseelan, Jenasia; Qin, Wensheng

    2016-01-01

    Aspergillus niger is the most commonly used fungus for commercial amylase production, the increase of amylase activity will be beneficial to the amylase industry. Herein we report a high α-amylase producing (HAP) A. niger WLB42 mutated from A. niger A4 by ethyl methanesulfonate treatment. The fermentation conditions for the amylase production were optimized. The results showed that both the amylase activity and total protein content reached highest after 48-h incubation in liquid medium using starch as the sole carbon source. The enzyme production reached maximum at temperature of 30°C, pH 7, with 40 g/L starch in the medium inoculated with 1.4% v/v spore. When 0.3% w/v urea was added to the liquid medium as a nitrogen source, the amylase activity was elevated by 20%. Nine monosaccharides and derivatives were tested for α-amylase induction, glucose was the best inducer. Furthermore, the enzymology characterization of amylase was conducted. The molecular weight of amylase was determined to be 50 kD by SDS-PAGE. The amylase had maximum activity at 45°C and pH 7. The activity could be dramatically triggered by adding 1 mM Co2+, increased to 250%. The activity was inhibited by detergents SDS and Triton X-100. Six different brands of starch were tested for amylase activity, the results demonstrated that the more soluble of the starch, the higher hydrolyzability of the substrate by amylase. PMID:27335681

  20. Characterization of extracellular amylase produced by haloalkalophilic strain Kocuria sp. HJ014.

    PubMed

    Soto-Padilla, Marisela Y; Gortáres-Moroyoqui, Pablo; Cira-Chávez, Luis A; Levasseur, Anthony; Dendooven, Luc; Estrada-Alvarado, María Isabel

    2016-08-01

    The haloalkaliphilic bacterium Kocuria sp. (HJ014) has the ability to produce extracellular amylase. The aim of this study was to purify and characterize this protein. The amylase enzyme with a specific activity of 753,502 U/mg was purified 5.7- fold using Sepharose 4B and Sephacryl S-300 gel filtration columns. The molecular weight of the enzyme was 45,000 Da as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The amylase showed maximum activity at pH 9 and 50°C in the presence of 3.5 M NaCl. The Km was 3.0 mg/ml and Vmax 90.09 U/ml. It was found that extracellular amylase from Kocuria sp. has a high industrial potential.

  1. Selective inhibition of histidine-modified pancreatic alpha-amylase by proteinaceous inhibitor from Phaseolus vulgaris.

    PubMed

    Nakatani, H

    1988-06-01

    Chemical modification of two histidine residues of porcine pancreatic alpha-amylase (EC 3.2.1.1) by diethyl pyrocarbonate in the presence of a high concentration of maltotriose caused a decrease of amylase activity and an increase of maltosidase activity (hydrolysis of p-nitrophenyl-alpha-maltoside). By binding a proteinaceous inhibitor from Phaseolus vulgaris (white kidney bean) with the modified enzyme, the amylase activity was further decreased but the maltosidase activity was retained to about 100% that of the native enzyme. Both amylase and maltosidase activities of the native enzyme were almost completely inhibited by the proteinaceous inhibitor. The increase of maltosidase activity by histidine modification was due to an increase of kcat, whereas the Km value was not changed; but binding of the proteinous inhibitor affected mainly the Km value of the modified enzyme.

  2. Biochemical features and kinetic properties of α-amylases from marine organisms.

    PubMed

    Homaei, Ahmad; Ghanbarzadeh, Mehri; Monsef, Ferial

    2016-02-01

    Marine organisms have the ability of producing enzymes with unique properties compared to those of the same enzymes from terrestrial organisms. α-Amylases are among the most important extracellular enzymes found in various groups of organisms such as plants, animals and microorganisms. They play important roles in their carbohydrates metabolism of each organism. Microbial production of α-amylases is more effective than other sources of the enzyme. Many microorganisms are known to produce α-amylase including bacteria, yeasts, fungi and actinomycetes. However, enzymes from fungal and bacterial sources have dominated applications in industrial sectors. This review deals with what is known about the kinetics, biochemical properties and applications of these enzymes that have only been found in them and not in other α-amylases, and discussing their mechanistic and regulatory implications.

  3. Purification of extrachloroplastic. beta. -amylase from leaves of starchless and wild type Arabidopsis

    SciTech Connect

    Somerville, C.; Monroe, J.; Preiss, J. )

    1989-04-01

    Amylase activity in crude leaf extracts from starchless mutants of Arabidopsis thaliana is 5 to 10 fold higher than in the wild type (WT) when plants are grown under a 12 h photoperiod. Visualized on native PAGE, the increased activity is attributed primarily to a previously characterized extrachloroplastic {beta}-(exo)amylase. The {beta}-amylases from phosoglucomutase deficient (starchless) and WT leaves were purified to homogeneity in two steps utilizing polyethylene glycol fractionation, and cyclohexaamylose affinity chromatography. The enzyme from both mutant and WT leaves had negligible activity toward either {beta}-limit dextrin or pullulan. The specific activities of both purified enzymes were similar indicating that the protein is over-expressed in the mutant. Preliminary antibody neutralization experiments suggest that the two {beta}-amylases are not different.

  4. Augmentation of cholinergic-mediated amylase release by forskolin in mouse parotid gland

    SciTech Connect

    Watson, E.L.; Singh, J.C.; Jacobson, K.L.

    1985-12-30

    Cholinergic-mediated amylase release in mouse parotid acini was augmented by forskolin; the potency but not the maximal response to carbachol was altered. Amylase released by carbachol plus forskolin was dependent on extracellular calcium and was mimicked by the calcium ionophore, A23187 plus forskolin. Forskolin was also shown to enhance carbachol-stimulated /sup 45/Ca/sup 2 +/ uptake into isolated acini. Hydroxylamine, nitroprusside, and 8-bromo-c-GMP each in combination with forskolin mimicked the effects of carbachol plus forskolin on amylase release. In the presence of carbachol (10/sup -8/M) forskolin did not augment c-AMP levels. However, in the presence of carbachol (5 x 10/sup -7/ M) or hydroxylamine (50 ..mu..M) forskolin did significantly augment c-AMP accumulation. These results suggest that calcium and c-GMP may mediate the augmentation of cholinergic-mediated amylase release by effects on c-AMP metabolism. 21 references, 1 figure, 3 tables.

  5. 21 CFR 184.1012 - α-Amylase enzyme preparation from Bacillus stearothermophilus.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... stearothermophilus. (a) α-Amylase enzyme preparation is obtained from the culture filtrate that results from a pure culture fermentation of a nonpathogenic and nontoxicogenic strain of Bacillus stearothermophilus....

  6. Structural and functional characterization of recombinant medaka fish alpha-amylase expressed in yeast Pichia pastoris.

    PubMed

    Mizutani, Kimihiko; Toyoda, Mayuko; Otake, Yuichiro; Yoshioka, Soshi; Takahashi, Nobuyuki; Mikami, Bunzo

    2012-08-01

    The medaka fish α-amylase was expressed and purified. The expression systems were constructed using methylotrophic yeast Pichia pastoris, and the recombinant proteins were secreted into the culture medium. Purified recombinant α-amylase exhibited starch hydrolysis activity. The optimal pH, denaturation temperature, and K(M) and V(max) values were determined; chloride ions were essential for enzyme activity. The purified protein was also crystallized and examined by X-ray crystallography. The structure has the (α/β)(8) barrel fold, as do other known α-amylases, and the overall structure is very similar to the structure of vertebrate (human and pig) α-amylases. A novel expression plasmid was developed. Using this plasmid, high-throughput construction of an expression system by homologous recombination in P. pastoris cells, previously reported for membrane proteins, was successfully applied to the secretory protein.

  7. [Study of the effect of Pb2+ on alpha-amylase activity by spectroscopy].

    PubMed

    Hong, Fa-shui

    2003-06-01

    The activity of alpha-amylase from porcine pancreas was enhanced under the treatment by Pb2+ at low concentration (0.5-4 mumol.L-1), but was inhibited by Pb2+ at high concentration (above 4 mumol.L-1). Pb2+ at high concentration could competitively displace Ca2+ from alpha-amylase. The EXAFS demonstrated that Pb2+ was bound to the active site of alpha-amylase, the coordination atom was oxygen, the coordination number was 2, and the Pb-O bond length was 0.234 nm. Circular dichroism spectra showed that the secondary structure of trypsin was greatly changed by Pb2+ at high concentration, as alpha-helix, beta-turn and random coil contents decreased, while beta-sheet, aromatic and disulfide bond contents increased. It was suggested that Pb2+ was bound to result in an alpha-amylase conformational change, and the enzyme activity decreased.

  8. From carbohydrates to drug-like fragments: Rational development of novel α-amylase inhibitors.

    PubMed

    Al-Asri, Jamil; Fazekas, Erika; Lehoczki, Gábor; Perdih, Andrej; Görick, Cornelia; Melzig, Matthias F; Gyémánt, Gyöngyi; Wolber, Gerhard; Mortier, Jérémie

    2015-10-15

    Starch catabolism leading to high glucose level in blood is highly problematic in chronic metabolic diseases, such as type II diabetes and obesity. α-Amylase catalyzes the hydrolysis of starch, increasing blood sugar concentration. Its inhibition represents a promising therapeutic approach to control hyperglycaemia. However, only few drug-like molecule inhibitors without sugar moieties have been discovered so far, and little information on the enzymatic mechanism is available. This work aims at the discovery of novel small α-amylase binders using a systematic in silico methodology. 3D-pharmacophore-based high throughput virtual screening of small compounds libraries was performed to identify compounds with high α-amylase affinity. Twenty-seven compounds were selected and biologically tested, revealing IC50 values in the micromolar range and ligand efficiency higher than the one of the bound form of acarbose, which is used as a reference for α-amylase inhibition.

  9. Synergistic action of. alpha. -amylase and glucoamylase on hydrolysis of starch

    SciTech Connect

    Fujii, M.; Kawamura, Y.

    1985-03-01

    Synergistic action of ..alpha..-amylase and glucoamylase on hydrolysis of starch is modeled by the kinetic equations presented in this paper. At the early stage of the reaction ..alpha..-amylase acts as a contributor of newly formed non-reducing ends of starch molecules to glucoamylase by splitting the original starch molecules. This is expressed by the simultaneous differential equations which consist of each rate equation for ..alpha.. amylase and glucoamylase. After the molecular weight of the substrate decreases to the value of about 5000, which is obtained experimentally in this work, the action of ..alpha.. amylase can be neglected and the rate of formation of glucose obeys only the rate equation for glucoamylase. 5 references.

  10. Relationship among physiological quality, heterosis, and amylase gene expression in maize seeds.

    PubMed

    Oliveira, G E; Von Pinho, E V R; Andrade, T; Souza, J C; Caixeta, F; Ferreira, R A D C

    2015-07-31

    In this study, we analyzed heterosis, amylase enzyme gene expression, and the physiological quality of maize seeds with different genotypes and sizes, which were subjected to aging and not subjected to aging. We used seeds from 2 maize lines that differed with regard to physiological quality, the hybrid, and the reciprocal hybrid; they were classified into 2 sizes and were subjected to aging and not subjected to aging. Physiological quality was assessed by performing tests for germination, emergence, emergence speed index, and artificial aging. Expressions of the genes alpha amylase B73, alpha amylase (LOC542522), isoamylase mRNA clone 353244, and the endogenous controls ubiquitin and alcohol dehydrogenase in the seeds were studied using quantitative real-time-polymerase chain reaction. We observed heterosis for seed quality and for expression of amylase genes in the genotypes studied. We found no difference in seed quality between large and small seeds.

  11. New perspectives on the role of α- and β-amylases in transient starch synthesis.

    PubMed

    Wu, Alex Chi; Ral, Jean-Philippe; Morell, Matthew K; Gilbert, Robert G

    2014-01-01

    Transient starch in leaves is synthesized by various biosynthetic enzymes in the chloroplasts during the light period. This paper presents the first mathematical model for the (bio)synthesis of the chain-length distribution (CLD) of transient starch to aid the understanding of this synthesis. The model expresses the rate of change of the CLD in terms of the actions of the enzymes involved. Using this to simulate the experimental CLD with different enzyme combinations is a new means to test for enzymes that are significant to the rate of change of the CLD during synthesis. Comparison between the simulated CLD from different enzyme combinations and the experimental CLD in the leaves of the model plant Arabidopsis thaliana indicate α-amylase, in addition to the core starch biosynthetic enzymes, is also involved in the modification of glucans for the synthesis of insoluble starch granules. The simulations suggest involvement of β-amylase, in the absence of α-amylase in mutants, slows the rate of attaining a crystalline-competent CLD for crystallization of glucans to form insoluble starch. This suggests a minor role of β-amylase in shaping normal starch synthesis. The model simulation predicts that debranching of glucans is an efficient mechanism for the attainment of crystalline-competent CLD; however, attaining this is still possible, albeit slower, through combinations of α- and β-amylase in the absence of isoamylase-type debranching enzyme. In Arabidopsis defective in one of the isoamylase-type debranching enzymes, the impact of α-amylase in starch synthesis is reduced, while β-amylase becomes significantly involved, slowing the rate of synthesis in this mutant. Modeling of transient starch CLD brings to light previously unrecognized but significant effects of α- and β-amylase on the rate of transient starch synthesis.

  12. Characterization of alpha-Amylase from Shoots and Cotyledons of Pea (Pisum sativum L.) Seedlings.

    PubMed

    Beers, E P; Duke, S H

    1990-04-01

    The most abundant alpha-amylase (EC 3.2.1.1) in shoots and cotyledons from pea (Pisum sativum L.) seedlings was purified 6700-and 850-fold, respectively, utilizing affinity (amylose and cycloheptaamylose) and gel filtration chromatography and ultrafiltration. This alpha-amylase contributed at least 79 and 15% of the total amylolytic activity in seedling cotyledons and shoots, respectively. The enzyme was identified as an alpha-amylase by polarimetry, substrate specificity, and end product analyses. The purified alpha-amylases from shoots and cotyledons appear identical. Both are 43.5 kilodalton monomers with pls of 4.5, broad pH activity optima from 5.5 to 6.5, and nearly identical substrate specificities. They produce identical one-dimensional peptide fingerprints following partial proteolysis in the presence of SDS. Calcium is required for activity and thermal stability of this amylase. The enzyme cannot attack maltodextrins with degrees of polymerization below that of maltotetraose, and hydrolysis of intact starch granules was detected only after prolonged incubation. It best utilizes soluble starch as substrate. Glucose and maltose are the major end products of the enzyme with amylose as substrate. This alpha-amylase appears to be secreted, in that it is at least partially localized in the apoplast of shoots. The native enzyme exhibits a high degree of resistance to degradation by proteinase K, trypsin/chymostrypsin, thermolysin, and Staphylococcus aureus V8 protease. It does not appear to be a high-mannose-type glycoprotein. Common cell wall constituents (e.g. beta-glucan) are not substrates of the enzyme. A very low amount of this alpha-amylase appears to be associated with chloroplasts; however, it is unclear whether this activity is contamination or alpha-amylase which is integrally associated with the chloroplast.

  13. The contribution of salivary amylase to glucose polymer hydrolysis in premature infants.

    PubMed

    Murray, R D; Kerzner, B; Sloan, H R; McClung, H J; Gilbert, M; Ailabouni, A

    1986-02-01

    To determine whether salivary amylase of premature infants can function as a surrogate for pancreatic amylase, we evaluated its production in the infant, acid resistance, and hydrolytic potency in a simulated oropharyngeal, gastric, and intestinal environment. The activity of salivary amylase in 11 prematures varied between 1 and 33 U/ml; the isozymic profile and acid resistance of the premature salivary amylase were identical to those of the enzyme of adults. A "modular" formula containing 7 g/dl of a 14C labeled long chain glucose polymer with degrees of polymerization ranging between 18 and 29 glucose units was prepared. Salivary amylase, 1.1 U/ml, was added to this formula. The progressive breakdown of the 14C polymers as the milk was subjected to oropharyngeal, gastric, and intestinal phase environments was evaluated by quantifying the liberation of short-chain oligomers from the 14C labeled substrates. The gastric pH was varied between 2 and 5 and the gastric incubation time was either 5 or 180 min. Substantial gastric phase breakdown only occurred after 3 h of exposure at the higher pHs of 4 (12%) and 5 (32%). During the intestinal phase, salivary amylase activity resumed. Prior gastric phase pH affected ultimate intestinal phase breakdown, p less than 0.001; after 5-min gastric phases at pHs ranging from 2 to 5, the intestinal phase breakdown ranged from 17 to 55%. We conclude that the limited salivary amylase in the saliva of premature infants can produce significant glucose polymer digestion in both the stomach and small intestine but the digestion falls substantially short of that accomplished by usual concentrations of pancreatic amylase.

  14. Expression and Characterization of Geobacillus stearothermophilus SR74 Recombinant α-Amylase in Pichia pastoris

    PubMed Central

    Gandhi, Sivasangkary; Salleh, Abu Bakar; Rahman, Raja Noor Zaliha Raja Abd; Chor Leow, Thean; Oslan, Siti Nurbaya

    2015-01-01

    Geobacillus stearothermophilus SR74 is a locally isolated thermophilic bacteria producing thermostable and thermoactive α-amylase. Increased production and commercialization of thermostable α-amylase strongly warrant the need of a suitable expression system. In this study, the gene encoding the thermostable α-amylase in G. stearothermophilus SR74 was amplified, sequenced, and subcloned into P. pastoris GS115 strain under the control of a methanol inducible promoter, alcohol oxidase (AOX). Methanol induced recombinant expression and secretion of the protein resulted in high levels of extracellular amylase production. YPTM medium supplemented with methanol (1% v/v) was the best medium and once optimized, the maximum recombinant α-amylase SR74 achieved in shake flask was 28.6 U mL−1 at 120 h after induction. The recombinant 59 kDa α-amylase SR74 was purified 1.9-fold using affinity chromatography with a product yield of 52.6% and a specific activity of 151.8 U mg−1. The optimum pH of α-amylase SR74 was 7.0 and the enzyme was stable between pH 6.0–8.0. The purified enzyme was thermostable and thermoactive, exhibiting maximum activity at 65°C with a half-life (t1/2) of 88 min at 60°C. In conclusion, thermostable α-amylase SR74 from G. stearothermophilus SR74 would be beneficial for industrial applications, especially in liquefying saccrification. PMID:26090417

  15. Alpha amylase is a major allergenic component in occupational asthma patients caused by porcine pancreatic extract.

    PubMed

    Park, Hae-Sim; Kim, Hee-Yeon; Suh, You-Jin; Lee, Soo-Jin; Lee, Soo-Keol; Kim, Sun-Sin; Nahm, Dong-Ho

    2002-09-01

    Porcine pancreatic extracts (PPE) are composed of alpha-amylase and lipase, which are common components of digestive enzymes. They have been known to cause occupational asthma in exposed workers in pharmaceutical and baking industries, as well as in a laboratory technician, but there has been no report of PPE-induced occupational asthma in medical personnel and their IgE binding components to each component. Four asthmatic subjects showing positive results on PPE-bronchoprovocation testing were enrolled. All of them were nurses working in a university hospital. Their job included grinding and mixing PPE powder for admitted patients. Serum-specific IgE antibodies to PPE, alpha-amylase, and lipase were measured by enzyme linked immunosorbent assay (ELISA). To confirm specificity of IgE binding and cross-allergenicity among the three extracts, ELISA inhibition tests were performed. In order to characterize allergenic components within these three extracts, SDS-PAGE and IgE immunoblot analysis were done. Specific IgE antibodies to PPE, alpha-amylase, and lipase were detectable by ELISA in all study subjects. An alpha-amylase ELISA inhibition test showed significant inhibitions by amylase and PPE, and minimal inhibition by lipase. However, a lipase ELISA inhibition test showed significant inhibitions by alpha-amylase and PPE with a lesser degree of inhibition by lipase. Furthermore, IgE immunoblot analysis showed one IgE binding component (55 kDa) within PPE, six components (55 kDa, 43 kDa, 41 kDa, 32 kDa, 31 kDa, 29 kDa) within alpha-amylase and two components (31 kDa, 29 kDa) within lipase extracts. Thesefindings suggest that inhalation of PPE powder can induce IgE-mediated bronchoconstriction in exposed nurses. Alpha-amylase is a major allergenic component within PPE.

  16. [Studies on determination of alpha-amylase with p-nitrophenyl-alpha-D-maltotetraoside].

    PubMed

    Kruse-Jarres, J D; Schott, F J; Klein, B; Rastetter, N; Wallenfels, K

    1982-11-01

    Nitrophenylmaltodextrins are alpha-amylase substrates which allow a continuous determination with a zero order kinetics over a period of at least 10 min, without deviations from linearity. Only one auxiliary enzyme is necessary. Practicability and clinical evidence of alpha-amylase determinations by means of p-nitrophenyl-alpha-D-maltotetraoside are demonstrated. The interserial precision of 0.84% cannot conceal an only moderate correlation with previous methods. This fact, however, does not negate the advantages.

  17. Expression and mutation of soybean beta-amylase in Escherichia coli.

    PubMed

    Totsuka, A; Fukazawa, C

    1993-06-15

    The cDNA clones corresponding to soybean beta-amylase mRNA were isolated and sequenced. The cDNA contained an open-reading frame composed of 496 amino acids. The comparison of the amino acid sequence deduced from the cDNA with the N-terminal peptide sequence from mature enzyme proved that beta-amylase had no leader sequence. Employing the cDNA, the beta-amylase was directly synthesized in Escherichia coli by the expression vector pKK233-2 controlled by the tac promoter. The enzyme activity detected in E. coli lysate drastically increased with a lower cultivation temperature, and the total activity and specific activity of the enzyme in E. coli lysate cultured at 13 degrees C was 130-fold and 280-fold, respectively, the value at 37 degrees C. The enzyme produced in E. coli was purified by the affinity column chromatography of cyclomaltohexaose-immobilized Sepharose 6B. Employing the established expression and purification system of the enzyme, the functional ionizable groups in the active site were searched. His93, involving an imidazole, and Asp348, involving a carboxylate, in the highly conserved regions within the beta-amylases were replaced by Arg (H93R) and Ash (D348N) by site-directed mutagenesis, respectively. All beta-amylases, including the non-mutant and mutant beta-amylases, produced in E. coli exhibited lower Vmax values than that of beta-amylase isolated conventionally from soybean seeds. Especially the Vmax value of [H93R]beta-amylase was reduced drastically compared to that of the non-mutant; however, none of them lost their enzyme activities completely. Therefore, neither His93 nor Asp348 may participate in the catalytic reaction directly.

  18. alpha-Amylase is not required for breakdown of transitory starch in Arabidopsis leaves.

    PubMed

    Yu, Tien-Shin; Zeeman, Samuel C; Thorneycroft, David; Fulton, Daniel C; Dunstan, Hannah; Lue, Wei-Ling; Hegemann, Björn; Tung, Shu-Yun; Umemoto, Takayuki; Chapple, Andrew; Tsai, Der-Long; Wang, Shue-Mei; Smith, Alison M; Chen, Jychian; Smith, Steven M

    2005-03-18

    The Arabidopsis thaliana genome encodes three alpha-amylase-like proteins (AtAMY1, AtAMY2, and AtAMY3). Only AtAMY3 has a predicted N-terminal transit peptide for plastidial localization. AtAMY3 is an unusually large alpha-amylase (93.5 kDa) with the C-terminal half showing similarity to other known alpha-amylases. When expressed in Escherichia coli, both the whole AtAMY3 protein and the C-terminal half alone show alpha-amylase activity. We show that AtAMY3 is localized in chloroplasts. The starch-excess mutant of Arabidopsis sex4, previously shown to have reduced plastidial alpha-amylase activity, is deficient in AtAMY3 protein. Unexpectedly, T-DNA knock-out mutants of AtAMY3 have the same diurnal pattern of transitory starch metabolism as the wild type. These results show that AtAMY3 is not required for transitory starch breakdown and that the starch-excess phenotype of the sex4 mutant is not caused simply by deficiency of AtAMY3 protein. Knock-out mutants in the predicted non-plastidial alpha-amylases AtAMY1 and AtAMY2 were also isolated, and these displayed normal starch breakdown in the dark as expected for extraplastidial amylases. Furthermore, all three AtAMY double knock-out mutant combinations and the triple knock-out degraded their leaf starch normally. We conclude that alpha-amylase is not necessary for transitory starch breakdown in Arabidopsis leaves.

  19. Expression and Characterization of Geobacillus stearothermophilus SR74 Recombinant α-Amylase in Pichia pastoris.

    PubMed

    Gandhi, Sivasangkary; Salleh, Abu Bakar; Rahman, Raja Noor Zaliha Raja Abd; Chor Leow, Thean; Oslan, Siti Nurbaya

    2015-01-01

    Geobacillus stearothermophilus SR74 is a locally isolated thermophilic bacteria producing thermostable and thermoactive α-amylase. Increased production and commercialization of thermostable α-amylase strongly warrant the need of a suitable expression system. In this study, the gene encoding the thermostable α-amylase in G. stearothermophilus SR74 was amplified, sequenced, and subcloned into P. pastoris GS115 strain under the control of a methanol inducible promoter, alcohol oxidase (AOX). Methanol induced recombinant expression and secretion of the protein resulted in high levels of extracellular amylase production. YPTM medium supplemented with methanol (1% v/v) was the best medium and once optimized, the maximum recombinant α-amylase SR74 achieved in shake flask was 28.6 U mL(-1) at 120 h after induction. The recombinant 59 kDa α-amylase SR74 was purified 1.9-fold using affinity chromatography with a product yield of 52.6% and a specific activity of 151.8 U mg(-1). The optimum pH of α-amylase SR74 was 7.0 and the enzyme was stable between pH 6.0-8.0. The purified enzyme was thermostable and thermoactive, exhibiting maximum activity at 65°C with a half-life (t₁/₂) of 88 min at 60°C. In conclusion, thermostable α-amylase SR74 from G. stearothermophilus SR74 would be beneficial for industrial applications, especially in liquefying saccrification.

  20. Extracellular production of beta-amylase by a halophilic isolate, Halobacillus sp. LY9.

    PubMed

    Li, Xin; Yu, Hui-Ying

    2011-11-01

    A moderately halophilic strain LY9 with high amylolytic activity was isolated from soil sample obtained from Yuncheng, China. Biochemical and physiological characterization along with 16S rRNA sequence analysis placed the isolate in the genus Halobacillus. Amylase production started from the post-exponential phase of bacterial growth and reached a maximum level during the early-stationary phase. The isolate LY9 was found to secrete the amylase, the production of which depended on the salinity of the growth medium. Maximum amylase production was observed in the presence of 10% KCl or 10% NaCl. Maltose was the main product of soluble starch hydrolysis, indicating a β-amylase activity. The enzyme showed optimal activity at 60°C, pH 8.0, and 10-12.5% of NaCl. It was highly active over broad temperature (50-70°C), NaCl concentration (5.0-20.0%), and pH (4.0-12.0) ranges, indicating its thermoactive and alkali-stable nature. However, activity dropped off dramatically at low NaCl concentrations, showing the amylase was halophilic. Ca(2+) was found to stimulate the β-amylase activity, whereas ethylenediaminetetraacetic acid (EDTA), phenylarsine oxide (PAO), and diethyl pyrocarbonate (DEPC) strongly inhibited the enzyme, indicating it probably was a metalloenzyme with cysteine and histidine residues located in its active site. Moreover, the enzyme exhibited remarkable stability towards sodium dodecyl sulfate (SDS) and Triton X-100. This is the first report of β-amylase production from moderate halophiles. The present study indicates that the extracellular β-amylase of Halobacillus sp. LY9 may have considerable potential for industrial application owing to its properties.

  1. High-resolution α-amylase assay combined with high-performance liquid chromatography-solid-phase extraction-nuclear magnetic resonance spectroscopy for expedited identification of α-amylase inhibitors: proof of concept and α-amylase inhibitor in cinnamon.

    PubMed

    Okutan, Leyla; Kongstad, Kenneth T; Jäger, Anna K; Staerk, Dan

    2014-11-26

    Type 2 diabetes affects millions of people worldwide, and new improved drugs or functional foods containing selective α-amylase inhibitors are needed for improved management of blood glucose. In this article the development of a microplate-based high-resolution α-amylase inhibition assay with direct photometric measurement of α-amylase activity is described. The inhibition assay is based on porcine pancreatic α-amylase with 2-chloro-4-nitrophenyl-α-D-maltotriose as substrate, which this gives a stable, sensitive, and cheap inhibition assay as requested for high-resolution purposes. In combination with HPLC-HRMS-SPE-NMR, this provides an analytical platform that allows simultaneous chemical and biological profiling of α-amylase inhibitors in plant extracts. Proof-of-concept with an artificial mixture of six compounds-of which three are known α-amylase inhibitors-showed that the high-resolution α-amylase inhibition profiles allowed detection of sub-microgram amounts of the α-amylase inhibitors. Furthermore, the high-resolution α-amylase inhibition assay/HPLC-HRMS-SPE-NMR platform allowed identification of cinnamaldehyde as the α-amylase inhibitor in cinnamon (Cinnamomum verum Presl.).

  2. MS characterization of multiple forms of alpha-amylase in human saliva.

    PubMed

    Hirtz, Christophe; Chevalier, François; Centeno, Delphine; Rofidal, Valerie; Egea, Jean-Christophe; Rossignol, Michel; Sommerer, Nicolas; Deville de Périère, Dominique

    2005-11-01

    Alpha-amylase is a major and well-characterized component of human saliva. Recent proteomic studies suggested that this protein could be observed in more than twenty spots on 2-D gels of salivary proteins. The aim of this work was to investigate this unexpected redundancy. 2-D gel electrophoresis was combined with systematic MALDI-TOF MS analysis. More than 140 protein spots identifying the alpha-amylase were shown to constitute a stable but very complex pattern. Careful analysis of mass spectra and simultaneous hierarchical clustering of the observed peptides and of the electrophoretic features of spots allowed one to define three major groups. A main class grouping 90 spots was shown to correspond to full length alpha-amylases that can be assumed to include isoforms and post-translationally modified forms, a subset of this class being demonstrated to be N-glycosylated. A second group included short alpha-amylases that are differently truncated in a non-random manner, very likely in the oral cavity. The last class grouped alpha-amylase forms showing both the N- and C-terminal sequences of the enzyme but displaying a molecular weight that was up to 50% lower than that of the native protein. It is speculated that the last group of alpha-amylase spots could correspond to proteins submitted to internal deletions prior to the secretion.

  3. Oral intercourse or secondary transfer? A Bayesian approach of salivary amylase and foreign DNA findings.

    PubMed

    Breathnach, Michelle; Moore, Elizabeth

    2013-06-10

    The Bayesian Approach allows forensic scientists to evaluate the significance of scientific evidence in light of two conflicting hypothesis. This aids the investigator to calculate a numerical value of the probability that the scientific findings support one hypothesis over conflicting opinions. In the case where oral intercourse is alleged, α-amylase, an indicator of saliva, is detected on penile swabs. The value of this finding is unknown as it may indicate the presence of saliva resulting from oral intercourse however it may also represent the presence of saliva due to innocent means such as background levels of salivary-α-amylase in the male population due to secondary transfer. Therefore, it is difficult to attach significance to this finding without background information and knowledge. A population study of the background levels of salivary-α-amylase was performed by analysing items of underwear worn under normal circumstances by 69 male volunteers. The Phadebas press test was used to screen the garments for amylase-containing stains and the positive areas were subjected to further confirmation of saliva by the RSID-Saliva kit. 44% of underwear screened had stains containing amylase. This study determined the background level of salivary-α-amylase and DNA on the inside front of male underwear which has potential implications on the interpretation of evidence in alleged oral intercourse.

  4. Physical and catalytic properties of alpha-amylase from Tenebrio molitor L. larvae.

    PubMed

    Buonocore, V; Poerio, E; Silano, V; Tomasi, M

    1976-03-01

    The amylase from Tenebrio molitor L. larvae (yellow mealworm) was characterized according to a number of its molecular and catalytic properties. The insect amylase is a single polypeptide chain with mol.wt. 68000, an isoelectric point of 4.0 and a very low content of sulphur-containing amino acids. The enzyme is a Ca2+-protein and behaves as an alpha-amylase. Removal of Ca2+ by exhaustive dialysis against water causes the irreversible inactivation of the enzyme. Moreover, the enzyme is activated by the presence in the assay mixture of Cl-, or some other inorganic anions that are less effective than Cl-, and is inhibited by F-. Optimal conditions of pH and temperature for the enzymic activity are 5.8 and 37 degrees C. The insect amylase exhibits an identical kinetic behaviour toward starch, amylose and amylopectin; the enzyme hydrolyses glycogen with a higher affinity constant. Compared with the non-insect alpha-amylases described in the literature, Tenebrio molitor amylase has a lower affinity for starch.

  5. [Microbial alpha-amylases: physicochemical properties, substrate specificity and domain structure].

    PubMed

    Avdiiuk, K V; Varbanets', L D

    2013-01-01

    The current literature data on producers, physico-chemical properties and substrate specificity of a-amylases produced by microbes from different taxonomic groups such as bacteria, fungi and yeasts are discussed in the survey. Synthesis of alpha-amylase majority is an inducible process which is stimulated in the presence of starch or products of its hydrolysis. It is possible to increase enzymes activity level by optimization of cultivation conditions of strains-producers. alpha-Amylases, isolated from different sources are distinguished in their physico-chemical properties, particularly in their molecular weights, pH- and thermooptimums, inhibitors and activators. The enzymes hydrolyse soluble starch, amylose, amylopectin, glycogen, maltodextrins, alpha- and beta3-cyclodextrins and other carbohydrate substrates. It is well known that alpha-amylases belong to GH-13 family of glycosyl-hydrolases, which contain the catalytic domain A as (beta/alpha)8-barrel. In addition to domain A, alpha-amylases contain two other domains: B and C, which are localized approximately on opposite sides of (beta/alpha)8-barrel. Most of the known alpha-amylases contain calcium ion, which is located on the surface between domains A and B and plays an important role in stability and activity of the enzyme.

  6. LEADER 3—Lipase and Amylase Activity in Subjects With Type 2 Diabetes

    PubMed Central

    Steinberg, William M.; Nauck, Michael A.; Zinman, Bernard; Daniels, Gilbert H.; Bergenstal, Richard M.; Mann, Johannes F.E.; Steen Ravn, Lasse; Moses, Alan C.; Stockner, Mette; Baeres, Florian M.M.; Marso, Steven P.; Buse, John B.

    2014-01-01

    Objectives This report from the LEADER (Liraglutide Effect and Action in Diabetes: Evaluation of Cardiovascular Outcome Results) trial describes baseline lipase and amylase activity in type 2 diabetic subjects without acute pancreatitis symptoms before randomization to the glucagonlike peptide analog liraglutide or placebo. Methods The LEADER is an international randomized placebo-controlled trial evaluating the cardiovascular safety of liraglutide in 9340 type 2 diabetic patients at high cardiovascular risk. Fasting lipase and amylase activity was assessed at baseline, before receiving liraglutide or placebo, using a commercial assay (Roche) with upper limit of normal values of 63 U/L for lipase and 100 U/L for amylase. Results Either or both enzymes were above the upper limit of normal in 22.7% of subjects; 16.6% (n = 1540) had an elevated lipase level (including 1.2% >3-fold elevated), and 11.8% (n = 1094) had an elevated amylase level (including 0.2% >3-fold elevated). In multivariable regression models, severely reduced kidney function was associated with the largest effect on increasing activity of both. However, even among subjects with normal kidney function, 12.2% and 7.7% had elevated lipase and amylase levels. Conclusions In this large study of type 2 diabetic patients, nearly 25% had elevated lipase or amylase levels without symptoms of acute pancreatitis. The clinician must take these data into account when evaluating abdominal symptoms in type 2 diabetic patients. PMID:25275271

  7. [Baking ingredients, especially alpha-amylase, as occupational inhalation allergens in the baking industry].

    PubMed

    Wüthrich, B; Baur, X

    1990-03-31

    Baker's asthma is the most frequent occupational lung disease in Switzerland and West Germany. Cereal flours, and more rarely flour parasites, are implicated as the responsible allergens. Based on an observation of a case of baker's asthma due to monovalent sensitization to alpha-amylase used as additive to flour, 31 bakers with occupational asthma and/or rhinitis were routinely tested by skin tests and serological RAST examinations for allergic sensitivity to flour, alpha-amylase and other bakery additives. 17/31 subjects (55%) reacted positively in scratch tests to a commercial powdered alpha-amylase and 13/20 (65%) to a lecithin preparation. 23/31 (74%) and 19/31 (61%) were RAST positive to wheat and to rye flour respectively. 32% had RAST specific IgE to alpha-amylase (from Aspergillus oryzae), 19.3% to soya bean flour and 16% to malt. 7/12 and 5/12 respectively reacted to trypsin inhibitor and lipoxidase, the main allergens in soya bean. In two patients monosensitization to alpha-amylase was present. In accordance with other reports we recommend that baking additives, especially alpha-amylase, should be tested in allergological diagnosis of occupational diseases in flour processing workers. Full declaration of all additives used in the bakery industry is needed.

  8. Screening, Gene Cloning, and Characterizations of an Acid-Stable α-Amylase.

    PubMed

    Liu, Xinyu; Jia, Wei; An, Yi; Cheng, Kun; Wang, Mingdao; Yang, Sen; Chen, Hongge

    2015-06-01

    Based on its α-amylase activity at pH 5.0 and optimal pH of the crude enzyme, a strain (named B-5) with acid α-amylase production was screened. The B-5 strain was identified as Bacillus amyloliquefaciens through morphological, physiological, and biochemical characteristics analysis, as well as 16S rDNA phylogenetic analysis. Its α-amylase gene of GenBank Accession No. GU318401 was cloned and expressed in Escherichia coli. The purified recombinant α-amylase AMY-Ba showed the optimal pH of 5.0, and was stable at a pH range of 4.0-6.0. When hydrolyzing soluble starch, amylose, and amylopectin, AMY-Ba released glucose and maltose as major end products. The α-amylase AMY-Ba in this work was a different type from the well-investigated J01542 (GenBank Accession No.)-type α-amylase from the same species. AMY-Ba exhibited notable adsorption and hydrolysis ability towards various raw starches. Structure analysis of AMY-Ba suggested the presence of a new starch-binding domain at its C-terminal region.

  9. Production of itaconic acid in Escherichia coli expressing recombinant α-amylase using starch as substrate.

    PubMed

    Okamoto, Shusuke; Chin, Taejun; Nagata, Keisuke; Takahashi, Tetsuya; Ohara, Hitomi; Aso, Yuji

    2015-05-01

    Several studies on fermentative production of a vinyl monomer itaconic acid from hydrolyzed starch using Aspergillus terreus have been reported. Herein, we report itaconic acid production by Escherichia coli expressing recombinant α-amylase, using soluble starch as its sole carbon source. To express α-amylase in E. coli, we first constructed recombinant plasmids expressing α-amylases by using cell surface display technology derived from two amylolytic bacteria, Bacillus amyloliquefaciens NBRC 15535(T) and Streptococcus bovis NRIC 1535. The recombinant α-amylase from S. bovis (SBA) showed activity at 28°C, which is the optimal temperature for production of itaconic acid, while α-amylase from B. amyloliquefaciens displayed no noticeable activity. E. coli cells expressing SBA produced 0.15 g/L itaconic acid after 69 h cultivation under pH-stat conditions, using 1% starch as the sole carbon source. In fact, E. coli cells expressing SBA had similar growth rates when grown in the presence of 1% glucose or starch, thereby highlighting the expression of an active α-amylase that enabled utilization of starch to produce itaconic acid in E. coli.

  10. Improved performance of α-amylase immobilized on poly(glycidyl methacrylate-co-ethylenedimethacrylate) beads.

    PubMed

    He, Tian; Tian, Yong-Le; Qi, Liang; Zhang, Jing; Zhang, Zhi-Qi

    2014-04-01

    α-Amylase was successfully immobilized onto poly(glycidyl methacrylate-co-ethylenedimethacrylate) (PGMA/EDMA) beads with high immobilization efficiency of 87.8%. PGMA/EDMA beads with a relatively uniform diameter of 2-3 μm were prepared by single-step swelling polymerization. After amination with ethanediamine and activation with glutaraldehyde, PGMA/EDMA beads showed commendable α-amylase immobilization capacity of 35.1 mg g(-1) carrier. Compared with free form, immobilized α-amylase had increasement of 12.94 mg mL(-1) for Km and 0.124 mmol mL(-1) min(-1) for Vmax, improved acid resistance (the optimal pH from 7 to 5), presented better thermal stability by retaining 61% activity than 40% at 90 °C, and displayed high operational reusability by retaining 58% of its initial activity after nine uses. Moreover, less than 10% of the free enzyme and more than 80% of the immobilized enzyme retained activity after 180 min pre-incubation at 50 °C. The easy modification, high immobilization efficiency and good properties of immobilized α-amylase in the present study indicate that PGMA/EDMA beads are suitable for α-amylase immobilization. The enhancement of acid resistance and thermo stability is doubtless of benefit for the industrial use of α-amylase.

  11. Immobilization of α-amylase onto a calix[4]arene derivative: Evaluation of its enzymatic activity.

    PubMed

    Veesar, Irshad Ali; Solangi, Imam Bakhsh; Memon, Shahabuddin

    2015-06-01

    In order to enhance the cost-effectiveness practicability of enzymes in many industries such as pharmaceutical, food, medical and some other technological processes, there is great need to immobilize them onto a solid supports. In this study, a new and efficient immobilization of α-amylase from Saccharomyces cerevisiae has been developed by using the surface functionalization of calix[4]arene as support. A glutaraldehyde-containing amino group functionalized calix[4]arene was used to immobilize α-amylase covalently. In this procedure, imide bonds are formed between amino groups on the protein and aldehyde groups on the calix[4]arene surface. The surface modified support was characterized using Fourier transform infrared spectroscopy (FT-IR), scanning electron microscopy (SEM). The effect of various preparation conditions on the immobilized α-amylase process such as immobilization time, enzyme concentration, temperature and pH were investigated. The influence of pH and temperature on the activity of free and immobilized α-amylase was also studied using starch as substrate. The optimum reaction temperature and pH value for the enzymatic conversion catalyzed by the immobilized α-amylase were 25°C and 7, respectively. Compared to the free enzyme, the immobilized α-amylase retained 85% of its original activity and exhibited significant thermal stability than the free one and excellent durability.

  12. Effect of an herb root extract, herbal dentifrice and synthetic dentifrice on human salivary amylase

    PubMed Central

    Sapra, Gaurav; Vyas, Yogesh Kumar; Agarwal, Rahul; Aggarwal, Ashish; Chandrashekar, K T; Sharma, Kanika

    2013-01-01

    Background: Salivary amylase is an enzyme, which plays a vital role in formation of dental plaque. It has the ability to bind on the bacterial surfaces and to hydrolyze starch, giving rise to products that are transformed into acids leading to dental caries. Suppression of salivary amylase activity can lead to decrease in risk of dental caries and plaque associated periodontal diseases. The aim of this study was to evaluate the effect of an herb, Spilanthes calva (in form of a test dentifrice) on human salivary amylase activity and to compare it with other dentifrices. Materials and Methods: A total of 80 subjects of age 18-35 years were randomly selected and divided equally into 4 groups. Group 1 subjects were assigned to use Test Dentifrice (with S. calva root extract), while Group 2, Group 3, and Group 4 subjects were assigned to use Herbal Dentifrice (Arodent™), Synthetic Dentifrice (Colgate®), and Control Dentifrice respectively. Salivary amylase activity was determined by Bernfeld method in each group, before and after using the given dentifrices. Results: Maximum inhibition of salivary amylase activity was found in the group using test dentifrice as compared to others. Conclusion: The present study indicates that, the root extract of S. calva possess significant inhibitory activity for salivary amylase. Use of S. calva root extract will provide a wider protection against different pathogenic oral microflora. Use of this extract singly or in combination is strongly recommended in the dentifrice formulations. PMID:24130585

  13. Cloning and Characterization of Cold-Adapted α-Amylase from Antarctic Arthrobacter agilis.

    PubMed

    Kim, Su-Mi; Park, Hyun; Choi, Jong-Il

    2017-03-01

    In this study, the gene encoding an α-amylase from a psychrophilic Arthrobacter agilis PAMC 27388 strain was cloned into a pET-28a(+) vector and heterologously expressed in Escherichia coli BL21(DE3). The recombinant α-amylase with a molecular mass of about 80 kDa was purified by using Ni(2+)-NTA affinity chromatography. This recombinant α-amylase exhibited optimal activity at pH 3.0 and 30 °C and was highly stable at varying temperatures (30-60 °C) and within the pH range of 4.0-8.0. Furthermore, α-amylase activity was enhanced in the presence of FeCl3 (1 mM) and β-mercaptoethanol (5 mM), while CoCl2 (1 mM), ammonium persulfate (5 mM), SDS (10 %), Triton X-100 (10 %), and urea (1 %) inhibited the enzymatic activity. Importantly, the presence of Ca(2+) ions and phenylmethylsulfonyl fluoride (PMSF) did not affect enzymatic activity. Thin layer chromatography (TLC) analysis showed that recombinant A. agilis α-amylase hydrolyzed starch, maltotetraose, and maltotriose, producing maltose as the major end product. These results make recombinant A. agilis α-amylase an attractive potential candidate for industrial applications in the textile, paper, detergent, and pharmaceutical industries.

  14. Molecular, Biochemical, and Dietary Regulation Features of α-Amylase in a Carnivorous Crustacean, the Spiny Lobster Panulirus argus.

    PubMed

    Rodríguez-Viera, Leandro; Perera, Erick; Martos-Sitcha, Juan Antonio; Perdomo-Morales, Rolando; Casuso, Antonio; Montero-Alejo, Vivian; García-Galano, Tsai; Martínez-Rodríguez, Gonzalo; Mancera, Juan Miguel

    2016-01-01

    Alpha-amylases are ubiquitously distributed throughout microbials, plants and animals. It is widely accepted that omnivorous crustaceans have higher α-amylase activity and number of isoforms than carnivorous, but contradictory results have been obtained in some species, and carnivorous crustaceans have been less studied. In addition, the physiological meaning of α-amylase polymorphism in crustaceans is not well understood. In this work we studied α-amylase in a carnivorous lobster at the gene, transcript, and protein levels. It was showed that α-amylase isoenzyme composition (i.e., phenotype) in lobster determines carbohydrate digestion efficiency. Most frequent α-amylase phenotype has the lowest digestion efficiency, suggesting this is a favoured trait. We revealed that gene and intron loss have occurred in lobster α-amylase, thus lobsters express a single 1830 bp cDNA encoding a highly conserved protein with 513 amino acids. This protein gives rise to two isoenzymes in some individuals by glycosylation but not by limited proteolysis. Only the glycosylated isoenzyme could be purified by chromatography, with biochemical features similar to other animal amylases. High carbohydrate content in diet down-regulates α-amylase gene expression in lobster. However, high α-amylase activity occurs in lobster gastric juice irrespective of diet and was proposed to function as an early sensor of the carbohydrate content of diet to regulate further gene expression. We concluded that gene/isoenzyme simplicity, post-translational modifications and low Km, coupled with a tight regulation of gene expression, have arose during evolution of α-amylase in the carnivorous lobster to control excessive carbohydrate digestion in the presence of an active α-amylase.

  15. Molecular, Biochemical, and Dietary Regulation Features of α-Amylase in a Carnivorous Crustacean, the Spiny Lobster Panulirus argus

    PubMed Central

    Martos-Sitcha, Juan Antonio; Perdomo-Morales, Rolando; Casuso, Antonio; Montero-Alejo, Vivian; García-Galano, Tsai; Martínez-Rodríguez, Gonzalo; Mancera, Juan Miguel

    2016-01-01

    Alpha-amylases are ubiquitously distributed throughout microbials, plants and animals. It is widely accepted that omnivorous crustaceans have higher α-amylase activity and number of isoforms than carnivorous, but contradictory results have been obtained in some species, and carnivorous crustaceans have been less studied. In addition, the physiological meaning of α-amylase polymorphism in crustaceans is not well understood. In this work we studied α-amylase in a carnivorous lobster at the gene, transcript, and protein levels. It was showed that α-amylase isoenzyme composition (i.e., phenotype) in lobster determines carbohydrate digestion efficiency. Most frequent α-amylase phenotype has the lowest digestion efficiency, suggesting this is a favoured trait. We revealed that gene and intron loss have occurred in lobster α-amylase, thus lobsters express a single 1830 bp cDNA encoding a highly conserved protein with 513 amino acids. This protein gives rise to two isoenzymes in some individuals by glycosylation but not by limited proteolysis. Only the glycosylated isoenzyme could be purified by chromatography, with biochemical features similar to other animal amylases. High carbohydrate content in diet down-regulates α-amylase gene expression in lobster. However, high α-amylase activity occurs in lobster gastric juice irrespective of diet and was proposed to function as an early sensor of the carbohydrate content of diet to regulate further gene expression. We concluded that gene/isoenzyme simplicity, post-translational modifications and low Km, coupled with a tight regulation of gene expression, have arose during evolution of α-amylase in the carnivorous lobster to control excessive carbohydrate digestion in the presence of an active α-amylase. PMID:27391425

  16. Regulation of the synthesis of barley aleurone. cap alpha. -amylase by gibberellic acid and calcium ions

    SciTech Connect

    Jones, R.L.; Carbonell, J.

    1984-09-01

    The effects of gibberellic acid (GA/sub 3/) and calcium ions on the production of ..cap alpha..-amylase and acid phosphatase by isolated aleurone layers of barley (Hordeum vulgare L. cv Himalaya) were studied. Aleurone layers not previously exposed to GA/sub 3/ or CA/sup 2 +/ show qualitative and quantitative changes in hydrolase production following incubation in either GA/sub 3/ or CA/sup 2 +/ or both. In cubation in H/sub 2/O or CA/sup 2 +/ results in the production of low levels of ..cap alpha..-amylase or acid phosphatase. The addition of GA/sub 3/ to the incubation medium causes 10- to 20-fold increase in the amounts of these enzymes released from the tissue, and addition of CA/sup 2 +/ at 10 millimolar causes a further 8- to 9-fold increase in ..cap alpha..-amylase release and a 75% increase in phosphatase release. Production of ..cap alpha..-amylase isoenzymes is also modified by the levels of GA/sub 3/ and CA/sup 2 +/ in the incubation medium. ..cap alpha..-amylase 2 is produced under all conditions of incubation, while ..cap alpha..-amylase 1 appears only when layers are incubated in GA/sub 3/ or GA/sub 3/ plus CA/sup 2 +/. The synthesis of ..cap alpha..-amylases 3 and 4 requires the presence of both GA/sub 3/ and CA/sup 2 +/ in the incubation medium. Laurell rocket immunoelectrophoresis shows that two distinct groups of ..cap alpha..-amylase antigens are present in incubation media of aleurone layers incubated with both GA/sub 3/ and CA/sup 2 +/, while only one group of antigens is found in media of layers incubated in GA/sub 3/ alone. Strontium ions can be substituted for CA/sup 2 +/ in increasing hydrolase production, although higher concentrations of Sr/sup 2 +/ are requried for maximal response. We conclude that GA/sub 3/ is required for the production of ..cap alpha..-amylase 1 and that both GA/sub 3/ and either CA/sup 2 +/ or Sr/sup 2 +/ are required for the production of isoenzymes 3 and 4 of barley aleurone ..cap alpha..-amylase. 22 references, 8

  17. Interaction of wheat monomeric and dimeric protein inhibitors with alpha-amylase from yellow mealworm (Tenebrio molitor L. larva).

    PubMed

    Buonocore, V; Gramenzi, F; Pace, W; Petrucci, T; Poerio, E; Silano, V

    1980-06-01

    The highly purified alpha-amylase from Tenebrio molitor L. larva (yellow mealworm) reversibly combines with two closely related homogeneous glycoprotein inhibitors, one dimeric (termed 'inhibitor 0.19') and one monomeric (termed 'inhibitor 0.28'), from wheat flour. As established by means of difference spectroscopy and kinetic studies, molar combining ratios for the amylase--inhibitor-0.19 and amylase-inhibitor-0.28 complexes were 1:1 and 1:2 respectively. Two amylase--inhibitor-0.19 complexes with slightly different retention volumes on Bio-Gel P-300 and only one amylase--inhibitor-0.28 complex were observed. Dissociation constants of the amylase--inhibitor-0.19 and amylase--inhibitor-0.28 complexes were 0.85 nM and 0.13 nM respectively. A strong tendency of both complexes to precipitate under an ultracentrifugal field was observed; the minimum molecular weight calculated for the two complexes under such conditions was approx. 95 000. The two complexes showed difference spectra indicating involvement of structurally related or identical tryptophyl side chains in the binding of inhibitors 0.28 and 0.19 to the amylase. A model summarizing the main features of the inhibition of the insect amylase by the two wheat protein inhibitors is proposed.

  18. Evidence that cleavage of the precursor enzyme by autocatalysis caused secretion of multiple amylases by Aspergillus niger.

    PubMed

    Ravi-Kumar, K; Venkatesh, K S; Umesh-Kumar, S

    2004-01-16

    The observation that a mutant strain of Aspergillus niger isolated for protease overproduction accumulated Taka-amylase supported an earlier report that processing of the precursor amylase by protease resulted in the secretion of multiple amylases. Studies using a mutant strain revealed that such processing was not due to aspergillopepsin but to autocatalysis by an inherent protease activity of the precursor and glucoamylase. Alignment of protease sequences with glucoamylase showed regions of consensus with serine carboxypeptidase of A. niger. Thus point mutations in this region due to ultraviolet radiation apparently caused the mutant to evolve with enhanced protease activity that degraded the precursor and accumulated Taka-amylase.

  19. Relationship between parotid amylase secretion and osmolality in the gastric contents of rats fed a pelleted or liquid diet.

    PubMed

    Kurahashi, M; Inomata, K

    1999-12-01

    The relationship between parotid amylase secretion and the osmolality in the gastric contents of rats fed a pelleted or liquid diet was investigated. In sham-operated rats fed a pelleted diet, amylase activity in the parotid glands decreased, amylase activity in the plasma increased, and there was strong amylase activity in the gastric contents. As a result, both reducing sugar concentration and osmolality in the gastric contents increased. In parotid duct-ligated rats, the feeding of a pelleted diet affected neither parotid nor plasma amylase activity and there was little amylase activity in the gastric contents; this resulted in decreased starch digestion. The amylase activity in the gastric contents of rats fed a liquid diet was lower than that of rats fed the pelleted diet. Both the reducing sugar concentration and osmolality in the gastric contents of rats fed the liquid diet were lower than those of rats fed the pelleted diet. However, both the reducing sugar concentration and osmolality in the gastric contents of rats fed the liquid diet were higher than those in the liquid diet itself. A small quantity of parotid amylase seems to effectively digest a large part of the starch in the stomaches of rats fed the liquid diet. These findings suggest that amylase secreted from parotid glands increases osmolality in the gastric contents via the production of reducing sugars from starch in rats when fed either pelleted or liquid diets.

  20. Alpha-Amylase Activity in Blood Increases after Pharmacological, But Not Psychological, Activation of the Adrenergic System

    PubMed Central

    Nater, Urs M.; La Marca, Roberto; Erni, Katja; Ehlert, Ulrike

    2015-01-01

    Background & Aim Alpha-amylase in both blood and saliva has been used as a diagnostic parameter. While studies examining alpha-amylase activity in saliva have shown that it is sensitive to physiological and psychological challenge of the adrenergic system, no challenge studies have attempted to elucidate the role of the adrenergic system in alpha-amylase activity in blood. We set out to examine the impact of psychological and pharmacological challenge on alpha-amylase in blood in two separate studies. Methods In study 1, healthy subjects were examined in a placebo-controlled, double-blind paradigm using yohimbine, an alpha2-adrenergic antagonist. In study 2, subjects were examined in a standardized rest-controlled psychosocial stress protocol. Alpha-amylase activity in blood was repeatedly measured in both studies. Results Results of study 1 showed that alpha-amylase in blood is subject to stronger increases after injection of yohimbine compared to placebo. In study 2, results showed that there was no significant effect of psychological stress compared to rest. Conclusions Alpha-amylase in blood increases after pharmacological activation of the adrenergic pathways suggesting that sympathetic receptors are responsible for these changes. Psychological stress, however, does not seem to have an impact on alpha-amylase in blood. Our findings provide insight into the mechanisms underlying activity changes in alpha-amylase in blood in healthy individuals. PMID:26110636

  1. Salivary amylase and stress during stressful environment: three Mars analog mission crews study.

    PubMed

    Rai, Balwant; Kaur, Jasdeep; Foing, Bernard H

    2012-06-14

    After the establishment of the space age physicians, human factors engineers, neurologist and psychologists and their special attention to work on people's capability to meet up the physical, psychological, neuroscience and interpersonal strains of working in space, it has been regarded as an issue that seeks urgent consideration. Not study was conducted on effect of simulated Mars analog environment on stress and salivary amylase. So, this study aimed to confirm whether salivary amylase is act as stress biomarker in crew members who took part in Mars analog mission in an isolated and stressful environment. The 18 crew members were selected who took part in Mars Analog Research Station, Utah. Salivary amylase was measured using a biosensor of salivary amylase monitor and State-Trait Anxiety Inventory score at pre-extravehicular activity, post-extravehicular activity and on before mission. The state and trait anxiety scores at pre-extravehicular activity for each commander were elevated as compared to after extravehicular activity. There were significant differences in the state and trait anxiety scores between before extravehicular activity and after extravehicular activity of Commander and other members, also there were significant differences in values of before-extravehicular activity between commanders and other members. There were significant differences in values of salivary amylase at before extravehicular activity and after extravehicular activity between commander group and other members. There was significant correlation between salivary amylase and state and trait anxiety scores in all groups. Measuring salivary amylase level could be useful for stress assessment of crew members and population working in a stressful and isolated environment.

  2. α-Amylase in Vaginal Fluid: Association With Conditions Favorable to Dominance of Lactobacillus.

    PubMed

    Nasioudis, Dimitrios; Beghini, Joziani; Bongiovanni, Ann Marie; Giraldo, Paulo C; Linhares, Iara M; Witkin, Steven S

    2015-11-01

    Vaginal glycogen is degraded by host α-amylase and then converted to lactic acid by Lactobacilli. This maintains the vaginal pH at ≤4.5 and prevents growth of other bacteria. Therefore, host α-amylase activity may promote dominance of Lactobacilli. We evaluated whether the α-amylase level in vaginal fluid is altered in women with bacterial vaginosis (BV) and vulvovaginal candidiasis (VVC) and whether its concentration was associated with levels of lactic acid isomers and host mediators. Vaginal fluid was obtained from 43 women with BV, 50 women with VVC, and 62 women with no vulvovaginal disorders. Vaginal fluid concentrations of α-amylase, secretory leukocyte protease inhibitor (SLPI), hyaluronan, hyaluronidase-1, β-defensin, and elafin were measured by enzyme-linked immunosorbent assay (ELISA). Vaginal concentrations of neutrophil gelatinase-associated lipocalin (NGAL), matrix metalloproteinase (MMP) 8, and d- and l-lactic acid levels in these patients were previously reported. The median vaginal fluid α-amylase level was 1.83 mU/mL in control women, 1.45 mU/mL in women with VVC, and 1.07 mU/mL in women with BV. Vaginal levels of α-amylase were correlated with d-lactic acid (P = .003) but not with l-lactic acid (P > .05) and with SLPI (P < .001), hyaluronidase-1 (P < .001), NGAL (P = .001), and MMP-8 (P = .005). The exfoliation of glycogen-rich epithelial cells into the vaginal lumen by hyaluronidase-1 and MMP-8 may increase glycogen availability and promote α-amylase activity. The subsequent enhanced availability of glycogen breakdown products would favor proliferation of Lactobacilli, the primary producers of d-lactic acid in the vagina. Concomitant production of NGAL and SLPI would retard growth of BV-related bacteria.

  3. Crystal structure of yellow meal worm alpha-amylase at 1.64 A resolution.

    PubMed

    Strobl, S; Maskos, K; Betz, M; Wiegand, G; Huber, R; Gomis-Rüth, F X; Glockshuber, R

    1998-05-08

    The three-dimensional structure of the alpha-amylase from Tenebrio molitor larvae (TMA) has been determined by molecular replacement techniques using diffraction data of a crystal of space group P212121 (a=51.24 A; b=93.46 A; c=96.95 A). The structure has been refined to a crystallographic R-factor of 17.7% for 58,219 independent reflections in the 7.0 to 1.64 A resolution range, with root-mean-square deviations of 0.008 A for bond lengths and 1.482 degrees for bond angles. The final model comprises all 471 residues of TMA, 261 water molecules, one calcium cation and one chloride anion. The electron density confirms that the N-terminal glutamine residue has undergone a post-transitional modification resulting in a stable 5-oxo-proline residue. The X-ray structure of TMA provides the first three-dimensional model of an insect alpha-amylase. The monomeric enzyme exhibits an elongated shape approximately 75 Ax46 Ax40 A and consists of three distinct domains, in line with models for alpha-amylases from microbial, plant and mammalian origin. However, the structure of TMA reflects in the substrate and inhibitor binding region a remarkable difference from mammalian alpha-amylases: the lack of a highly flexible, glycine-rich loop, which has been proposed to be involved in a "trap-release" mechanism of substrate hydrolysis by mammalian alpha-amylases. The structural differences between alpha-amylases of various origins might explain the specificity of inhibitors directed exclusively against insect alpha-amylases.

  4. One-step production of immobilized alpha-amylase in recombinant Escherichia coli.

    PubMed

    Rasiah, Indira A; Rehm, Bernd H A

    2009-04-01

    Industrial enzymes are often immobilized via chemical cross-linking onto solid supports to enhance stability and facilitate repeated use in bioreactors. For starch-degrading enzymes, immobilization usually places constraints on enzymatic conversion due to the limited diffusion of the macromolecular substrate through available supports. This study describes the one-step immobilization of a highly thermostable alpha-amylase (BLA) from Bacillus licheniformis and its functional display on the surface of polyester beads inside engineered Escherichia coli. An optimized BLA variant (Termamyl) was N-terminally fused to the polyester granule-forming enzyme PhaC of Cupriavidus necator. The fusion protein lacking the signal sequence mediated formation of stable polyester beads exhibiting alpha-amylase activity. The alpha-amylase beads were assessed with respect to alpha-amylase activity, which was demonstrated qualitatively and quantitatively. The immobilized alpha-amylase showed Michaelis-Menten enzyme kinetics exerting a V(max) of about 506 mU/mg of bead protein with a K(m) of about 5 microM, consistent with that of free alpha-amylase. The stability of the enzyme at 85 degrees C and the capacity for repeated usage in a starch liquefaction process were also demonstrated. In addition, structural integrity and functionality of the beads at extremes of pH and temperature, demonstrating their suitability for industrial use, were confirmed by electron microscopy and protein/enzyme analysis. This study proposes a novel, cost-effective method for the production of immobilized alpha-amylase in a single step by using the polyester granules forming protein PhaC as a fusion partner in engineered E. coli.

  5. Phylogenetic and Comparative Sequence Analysis of Thermostable Alpha Amylases of kingdom Archea, Prokaryotes and Eukaryotes.

    PubMed

    Huma, Tayyaba; Maryam, Arooma; Rehman, Shahid Ur; Qamar, Muhammad Tahir Ul; Shaheen, Tayyaba; Haque, Asma; Shaheen, Bushra

    2014-01-01

    Alpha amylase family is generally defined as a group of enzymes that can hydrolyse and transglycosylase α-(1, 4) or α-(1, 6) glycosidic bonds along with the preservation of anomeric configuration. For the comparative analysis of alpha amylase family, nucleotide sequences of seven thermo stable organisms of Kingdom Archea i.e. Pyrococcus furiosus (100-105°C), Kingdom Prokaryotes i.e. Bacillus licheniformis (90-95°C), Geobacillus stearothermophilus (75°C), Bacillus amyloliquefaciens (72°C), Bacillus subtilis (70°C) and Bacillus KSM K38 (55°C) and Eukaryotes i.e. Aspergillus oryzae (60°C) were selected from NCBI. Primary structure composition analysis and Conserved sequence analysis were conducted through Bio Edit tools. Results from BioEdit shown only three conserved regions of base pairs and least similarity in MSA of the above mentioned alpha amylases. In Mega 5.1 Phylogeny of thermo stable alpha amylases of Kingdom Archea, Prokaryotes and Eukaryote was handled by Neighbor-Joining (NJ) algorithm. Mega 5.1 phylogenetic results suggested that alpha amylases of thermo stable organisms i.e. Pyrococcus furiosus (100-105°C), Bacillus licheniformis (90-95°C), Geobacillus stearothermophilus (75°C) and Bacillus amyloliquefaciens (72°C) are more distantly related as compared to less thermo stable organisms. By keeping in mind the characteristics of most thermo stable alpha amylases novel and improved features can be introduced in less thermo stable alpha amylases so that they become more thermo tolerant and productive for industry.

  6. Phage display selects for amylases with improved low pH starch-binding.

    PubMed

    Verhaert, Raymond M D; Beekwilder, Jules; Olsthoorn, René; van Duin, Jan; Quax, Wim J

    2002-06-13

    Directed evolution of secreted industrial enzymes is hampered by the lack of powerful selection techniques. We have explored surface display to select for enzyme variants with improved binding performance on complex polymeric substrates. By a combination of saturation mutagenesis and phage display we selected alpha-amylase variants, which have the ability to bind starch substrate at industrially preferred low pH conditions. First we displayed active alpha-amylase on the surface of phage fd. Secondly we developed a selection system that is based on the ability of alpha-amylase displaying phages to bind to cross-linked starch. This system was used to probe the involvement of specific beta-strands in substrate interaction. Finally, a saturated library of alpha-amylase mutants with one or more amino acid residues changed in their Cbeta4 starch-binding domain was subjected to phage display selection. Mutant molecules with good starch-binding and hydrolytic capacity could be isolated from the phage library by repeated binding and elution of phage particles at lowered pH value. Apart from the wild type alpha-amylase a specific subset of variants, with only changes in three out of the seven possible positions, was selected. All selected variants could hydrolyse starch and heptamaltose at low pH. Interestingly, variants were found with a starch hydrolysis ratio at pH 4.5/7.5 that is improved relative to the wild type alpha-amylase. These data demonstrate that useful alpha-amylase mutants can be selected via surface display on the basis of their binding properties to starch at lowered pH values.

  7. Arabidopsis thaliana AMY3 Is a Unique Redox-regulated Chloroplastic α-Amylase*

    PubMed Central

    Seung, David; Thalmann, Matthias; Sparla, Francesca; Abou Hachem, Maher; Lee, Sang Kyu; Issakidis-Bourguet, Emmanuelle; Svensson, Birte; Zeeman, Samuel C.; Santelia, Diana

    2013-01-01

    α-Amylases are glucan hydrolases that cleave α-1,4-glucosidic bonds in starch. In vascular plants, α-amylases can be classified into three subfamilies. Arabidopsis has one member of each subfamily. Among them, only AtAMY3 is localized in the chloroplast. We expressed and purified AtAMY3 from Escherichia coli and carried out a biochemical characterization of the protein to find factors that regulate its activity. Recombinant AtAMY3 was active toward both insoluble starch granules and soluble substrates, with a strong preference for β-limit dextrin over amylopectin. Activity was shown to be dependent on a conserved aspartic acid residue (Asp666), identified as the catalytic nucleophile in other plant α-amylases such as the barley AMY1. AtAMY3 released small linear and branched glucans from Arabidopsis starch granules, and the proportion of branched glucans increased after the predigestion of starch with a β-amylase. Optimal rates of starch digestion in vitro was achieved when both AtAMY3 and β-amylase activities were present, suggesting that the two enzymes work synergistically at the granule surface. We also found that AtAMY3 has unique properties among other characterized plant α-amylases, with a pH optimum of 7.5–8, appropriate for activity in the chloroplast stroma. AtAMY3 is also redox-regulated, and the inactive oxidized form of AtAMY3 could be reactivated by reduced thioredoxins. Site-directed mutagenesis combined with mass spectrometry analysis showed that a disulfide bridge between Cys499 and Cys587 is central to this regulation. This work provides new insights into how α-amylase activity may be regulated in the chloroplast. PMID:24089528

  8. Chemical constituents of Swertia longifolia Boiss. with α-amylase inhibitory activity

    PubMed Central

    Saeidnia, Soodabeh; Ara, Leila; Hajimehdipoor, Homa; Read, Roger W.; Arshadi, Sattar; Nikan, Marjan

    2016-01-01

    α-Amylase inhibitors play a critical role in the control of diabetes and many of medicinal plants have been found to act as α-amylase inhibitors. Swertia genus, belonging to the family Gentianaceae, comprises different species most of which have been used in traditional medicine of several cultures as antidiabetic, anti-pyretic, analgesic, liver and gastrointestinal tonic. Swertia longifolia Boiss. is the only species of Swertia growing in Iran. In the present investigation, phytochemical study of S. longifolia was performed and α-amylase inhibitory effects of the plant fractions and purified compounds were determined. Aerial parts of the plant were extracted with hexane, chloroform, methanol and water, respectively. The components of the hexane and chloroform fractions were isolated by different chromatographic methods and their structures were determined by 1H NMR and 13C NMR data. α-Amylase inhibitory activity was determined by a colorimetric assay using 3,5-dinitro salysilic acid. During phytochemical examination, α-amyrin, β-amyrin and β-sitosterol were purified from the hexane fraction, while ursolic acid, daucosterol and swertiamarin were isolated from chloroform fraction. The results of the biochemical assay revealed α-amylase inhibitory activity of hexane, chloroform, methanol and water fractions, of which the chloroform and methanol fractions were more potent (IC50 16.8 and 18.1 mg/ml, respectively). Among examined compounds, daucosterol was found to be the most potent α-amylase inhibitor (57.5% in concentration 10 mg/ml). With regard to α-amylase inhibitory effects of the plant extracts, purified constituents, and antidiabetic application of the species of Swertia genus in traditional medicine of different countries, S. longifolia seems more appropriate species for further mechanistic antidiabetic evaluations. PMID:27051429

  9. Purification and characterization of the extracellular. alpha. -amylase from Clostridium acetobutylicum ATCC 824

    SciTech Connect

    Paquet, V.; Croux, C.; Goma, G.; Soucaille, P. )

    1991-01-01

    The extracellular {alpha}-amylase (1,4-{alpha}-D-glucanglucanohydrolase; EC 3.2.1.1) from Clostridium acetobutylicum ATCC 824 was purified to homogeneity by anion-exchange chromatography (Mono Q) and gel filtration (Superose 12). The enzyme had an isoelectric point of 4.7 and a molecular weight of 84,000, as estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. It was a monomeric protein, the 19-amino-acid N terminus of which displayed 42% homology with the Bacillus subtilis saccharifying {alpha}-amylase. The amino acid composition of the enzyme showed a high number of acidic and hydrophobic residues and only one cysteine residue per mole. The activity of the {alpha}-amylase was not stimulated by calcium ions (or other metal ions) or inhibited by EDTA, although the enzyme contained seven calcium atoms per molecule. {alpha}-Amylase activity on soluble starch was optimal at pH 5.6 and 45{degree}C. The {alpha}-amylase was stable at an acidic pH but very sensitive to thermal inactivation. It hydrolyzed soluble starch, with a K{sub m} of 3.6 g {center dot} liter{sup {minus}1} and a K{sub cat} of 122 mol of reducing sugars {center dot} s{sup {minus}1} {center dot} mol{sup {minus}1}. The {alpha}-amylase showed greater activity with high-molecular-weight substrates than with low-molecular-weight maltooligosaccharides, hydrolyzed glycogen and pullulan slowly, but did not hydrolyze dextran or cyclodextrins. The major end products of maltohexaose degradation were glucose, maltose, and maltotriose; maltotetraose and maltopentaose were formed as intermediate products. Twenty seven percent of the glucoamylase activity generally detected in the culture supernatant of C. acetobutylicum can be attributed to the {alpha}-amylase.

  10. Structural elucidation and molecular characterization of Marinobacter sp. α-amylase.

    PubMed

    Kumar, Sumit; Khan, Rizwan Hasan; Khare, S K

    2016-01-01

    Halophiles have been perceived as potential source of novel enzymes in recent years. The interest emanates from their ability to catalyze efficiently under high salt and organic solvents. Marinobacter sp. EMB8 α-amylase was found to be active and stable in salt and organic solvents. A study was carried out using circular dichroism (CD), fluorescence spectroscopy, and bioinformatics analysis of similar protein sequence to ascertain molecular basis of salt and solvent adaptability of α-amylase. Structural changes recorded in the presence of varying amounts of NaCl exhibited an increase in negative ellipticity as a function of salt, confirming that salt stabilizes the protein and increases the secondary structure, making it catalytically functional. The data of intrinsic and extrinsic fluorescence (using 1-anilinonaphthalene 8-sulfonate [ANS] as probe) further confirmed the role of salt. The α-amylase was active in the presence of nonpolar solvents, namely, hexane and decane, but inactivated by ethanol. The decrease in the activity was correlated with the loss of tertiary structure in the presence of ethanol. Guanidine hydrochloride and pH denaturation indicated the molten globule state at pH 4.0. Partial N-terminal amino acid sequence of the purified α-amylase revealed the relatedness to Pseudoalteromonas sp. α-amylase. "FVHLFEW" was found as the N-terminal signature sequence. Bioinformatics analysis was done using M. algicola α-amylase protein having the same N-terminal signature sequence. The three-dimensional structure of Marinobacter α-amylase was deduced using the I-TASSER server, which reflected the enrichment of acidic amino acids on the surface, imparting the stability in the presence of salt. Our study clearly indicate that salt is necessary for maintaining the secondary and tertiary structure of halophilic protein, which is a necessary prerequisite for catalysis.

  11. Arabidopsis thaliana AMY3 is a unique redox-regulated chloroplastic α-amylase.

    PubMed

    Seung, David; Thalmann, Matthias; Sparla, Francesca; Abou Hachem, Maher; Lee, Sang Kyu; Issakidis-Bourguet, Emmanuelle; Svensson, Birte; Zeeman, Samuel C; Santelia, Diana

    2013-11-22

    α-Amylases are glucan hydrolases that cleave α-1,4-glucosidic bonds in starch. In vascular plants, α-amylases can be classified into three subfamilies. Arabidopsis has one member of each subfamily. Among them, only AtAMY3 is localized in the chloroplast. We expressed and purified AtAMY3 from Escherichia coli and carried out a biochemical characterization of the protein to find factors that regulate its activity. Recombinant AtAMY3 was active toward both insoluble starch granules and soluble substrates, with a strong preference for β-limit dextrin over amylopectin. Activity was shown to be dependent on a conserved aspartic acid residue (Asp(666)), identified as the catalytic nucleophile in other plant α-amylases such as the barley AMY1. AtAMY3 released small linear and branched glucans from Arabidopsis starch granules, and the proportion of branched glucans increased after the predigestion of starch with a β-amylase. Optimal rates of starch digestion in vitro was achieved when both AtAMY3 and β-amylase activities were present, suggesting that the two enzymes work synergistically at the granule surface. We also found that AtAMY3 has unique properties among other characterized plant α-amylases, with a pH optimum of 7.5-8, appropriate for activity in the chloroplast stroma. AtAMY3 is also redox-regulated, and the inactive oxidized form of AtAMY3 could be reactivated by reduced thioredoxins. Site-directed mutagenesis combined with mass spectrometry analysis showed that a disulfide bridge between Cys(499) and Cys(587) is central to this regulation. This work provides new insights into how α-amylase activity may be regulated in the chloroplast.

  12. Crystal structure of a maltogenic amylase provides insights into a catalytic versatility.

    PubMed

    Kim, J S; Cha, S S; Kim, H J; Kim, T J; Ha, N C; Oh, S T; Cho, H S; Cho, M J; Kim, M J; Lee, H S; Kim, J W; Choi, K Y; Park, K H; Oh, B H

    1999-09-10

    Amylases catalyze the hydrolysis of starch material and play central roles in carbohydrate metabolism. Compared with many different amylases that are able to hydrolyze only alpha-D-(1,4)-glycosidic bonds, maltogenic amylases exhibit catalytic versatility: hydrolysis of alpha-D-(1,4)- and alpha-D-(1,6)-glycosidic bonds and transglycosylation of oligosaccharides to C3-, C4-, or C6-hydroxyl groups of various acceptor mono- or disaccharides. It has been speculated that the catalytic property of the enzymes is linked to the additional approximately 130 residues at the N terminus that are absent in other typical alpha-amylases. The crystal structure of a maltogenic amylase from a Thermus strain was determined at 2.8 A. The structure, an analytical centrifugation, and a size exclusion column chromatography proved that the enzyme is a dimer in solution. The N-terminal segment of the enzyme folds into a distinct domain and comprises the enzyme active site together with the central (alpha/beta)(8) barrel of the adjacent subunit. The active site is a narrow and deep cleft suitable for binding cyclodextrins, which are the preferred substrates to other starch materials. At the bottom of the active site cleft, an extra space, absent in the other typical alpha-amylases, is present whose size is comparable with that of a disaccharide. The space is most likely to host an acceptor molecule for the transglycosylation and to allow binding of a branched oligosaccharide for hydrolysis of alpha-D-(1,4)-glycosidic or alpha-D-(1,6)-glycosidic bond. The (alpha/beta)(8) barrel of the enzyme is the preserved scaffold in all the known amylases. The structure represents a novel example of how an enzyme acquires a different substrate profile and a catalytic versatility from a common active site and represents a framework for explaining the catalytic activities of transglycosylation and hydrolysis of alpha-D-(1,6)-glycosidic bond.

  13. Structure, specificity and function of cyclomaltodextrinase, a multispecific enzyme of the alpha-amylase family.

    PubMed

    Park, K H; Kim, T J; Cheong, T K; Kim, J W; Oh, B H; Svensson, B

    2000-05-23

    Cyclomaltodextrinase (CDase, EC 3.2.1.54), maltogenic amylase (EC 3. 2.1.133), and neopullulanase (EC 3.2.1.135) are reported to be capable of hydrolyzing all or two of the following three types of substrates: cyclomaltodextrins (CDs); pullulan; and starch. These enzymes hydrolyze CDs and starch to maltose and pullulan to panose by cleavage of alpha-1,4 glycosidic bonds whereas alpha-amylases essentially lack activity on CDs and pullulan. They also catalyze transglycosylation of oligosaccharides to the C3-, C4- or C6-hydroxyl groups of various acceptor sugar molecules. The present review surveys the biochemical, enzymatic, and structural properties of three types of such enzymes as defined based on the substrate specificity toward the CDs: type I, cyclomaltodextrinase and maltogenic amylase that hydrolyze CDs much faster than pullulan and starch; type II, Thermoactinomyces vulgaris amylase II (TVA II) that hydrolyzes CDs much less efficiently than pullulan; and type III, neopullulanase that hydrolyzes pullulan efficiently, but remains to be reported to hydrolyze CDs. These three types of enzymes exhibit 40-60% amino acid sequence identity. They occur in the cytoplasm of bacteria and have molecular masses from 62 to 90 kDa which are slightly larger than those of most alpha-amylases. Multiple amino acid sequence alignment and crystal structures of maltogenic amylase and TVA II reveal the presence of an N-terminal extension of approximately 130 residues not found in alpha-amylases. This unique N-terminal domain as seen in the crystal structures apparently contributes to the active site structure leading to the distinct substrate specificity through a dimer formation. In aqueous solution, most of these enzymes show a monomer-dimer equilibrium. The present review discusses the multiple specificity in the light of the oligomerization and the molecular structures arriving at a clarified enzyme classification. Finally, a physiological role of the enzymes is proposed.

  14. Inhibitory effects of tannin on human salivary alpha-amylase.

    PubMed

    Kandra, Lili; Gyémánt, Gyöngyi; Zajácz, Agnes; Batta, Gyula

    2004-07-09

    Here, we first report on the effectiveness and specificity of tannin inhibition of 2-chloro-4-nitrophenyl-4-O-beta-d-galactopyranosylmaltoside hydrolysis that is catalyzed by human salivary alpha-amylase (HSA). Tannin was gallotannin in which quinic acid was esterified with 2-7 units of gallic acid. A number of studies establish that polyphenols-like tannins-may prevent oral diseases, e.g., dental caries. Kinetic analyses confirmed that the inhibition of hydrolysis is a mixed non-competitive type and only one molecule of tannin binds to the active site or the secondary site of the enzyme. Since Dixon plots were linear, product formation could be excluded from the enzyme-substrate-inhibitor complex (ESI). Kinetic constants calculated from secondary plots and non-linear regression are almost identical, thereby confirming the suggested model. Kinetic constants (K(EI) = 9.03 microgmL(-1), K(ESI) = 47.84 microgmL(-1)) show that tannin is as an effective inhibitor of HSA as acarbose and indicate a higher stability for the enzyme-inhibitor complex than ESI.

  15. Immobilization of diastase α-amylase on nano zinc oxide.

    PubMed

    Antony, Navya; Balachandran, S; Mohanan, P V

    2016-11-15

    Diastase α-amylase extracted from malt, catalyses break down of starch into maltose. It is commonly used in food and fermentation industry. In the present study nano zinc oxide is used as support for this starch hydrolyzing enzyme. IR study revealed that the enzyme got adsorbed via electrostatic interaction with the functional groups on the support. The immobilized enzyme possessed a better heat-resistance than free enzyme. The kinetic parameters were determined using Lineweaver-Burk plot. The immobilized enzyme showed higher Km 2.08mg/ml than the free enzyme whose Km is 0.45±.05mg/ml. The Vmax of immobilized enzyme was about 2.92±.02mg/ml/min and that of free enzyme was 7.14±.02mg/ml/min, showing decrease in activity after immobilization. The immobilized enzyme showed 70% activity after 30days of storage while free enzyme lost its activity within 7days. About 80% of enzyme retained activity after 4 cycles of reuse.

  16. Obesity, starch digestion and amylase: association between copy number variants at human salivary (AMY1) and pancreatic (AMY2) amylase genes.

    PubMed

    Carpenter, Danielle; Dhar, Sugandha; Mitchell, Laura M; Fu, Beiyuan; Tyson, Jess; Shwan, Nzar A A; Yang, Fengtang; Thomas, Mark G; Armour, John A L

    2015-06-15

    The human salivary amylase genes display extensive copy number variation (CNV), and recent work has implicated this variation in adaptation to starch-rich diets, and in association with body mass index. In this work, we use paralogue ratio tests, microsatellite analysis, read depth and fibre-FISH to demonstrate that human amylase CNV is not a smooth continuum, but is instead partitioned into distinct haplotype classes. There is a fundamental structural distinction between haplotypes containing odd or even numbers of AMY1 gene units, in turn coupled to CNV in pancreatic amylase genes AMY2A and AMY2B. Most haplotypes have one copy each of AMY2A and AMY2B and contain an odd number of copies of AMY1; consequently, most individuals have an even total number of AMY1. In contrast, haplotypes carrying an even number of AMY1 genes have rearrangements leading to CNVs of AMY2A/AMY2B. Read-depth and experimental data show that different populations harbour different proportions of these basic haplotype classes. In Europeans, the copy numbers of AMY1 and AMY2A are correlated, so that phenotypic associations caused by variation in pancreatic amylase copy number could be detected indirectly as weak association with AMY1 copy number. We show that the quantitative polymerase chain reaction (qPCR) assay previously applied to the high-throughput measurement of AMY1 copy number is less accurate than the measures we use and that qPCR data in other studies have been further compromised by systematic miscalibration. Our results uncover new patterns in human amylase variation and imply a potential role for AMY2 CNV in functional associations.

  17. Production and Characterization of α-Amylase from an Extremely Halophilic Archaeon, Haloferax sp. HA10

    PubMed Central

    Bajpai, Bhakti; Chaudhary, Monika

    2015-01-01

    Summary Haloarchaea are found at very high concentrations in salt-conditioned environments, hence produce enzymes which are able to catalyze reactions under harsh conditions, typical of many industrial processes. In the present study, culture conditions for extracellular amylase production from Haloarchaea isolated from a solar saltern were optimized and the purified enzyme was characterized. Haloferax sp. HA10 showed maximum amylase production at 3 M NaCl, 37 °C, pH=7 and 1% starch content. Purified α-amylase was a calcium-dependent enzyme with an estimated molecular mass of about 66 kDa and many industrially useful properties. It was found to be stable in a broad range of pH (from 5 to 9) and NaCl concentrations (from 0.5 to 3.0 M), retaining 48% activity even at 4 M. The optimal temperature for Haloferax sp. HA10 amylase activity was 55 °C (99% activity), and 57% activity was retained at 80 °C, which dropped to 44% with the increase of temperature to 90 or 100 °C. It was able to sustain various surfactants and detergents. To the best of our knowledge the detergent-stable α-amylases from halophilic archaeon have not been reported yet. PMID:27904327

  18. Purification and Characterization of Midgut α-Amylase in a Predatory Bug, Andralus spinidens

    PubMed Central

    Sorkhabi-Abdolmaleki, Sahar; Zibaee, Arash; Hoda, Hassan; Fazeli-Dinan, Mahmoud

    2014-01-01

    α-Amylases are widespread enzymes that catalyze endohydrolysis of long α-1,4-glucan chains such as starch and glycogen. The highest amylolytic activity was found in 5th instar nymphs and midgut of the predatory bug, Andrallus spinidens F. (Hemiptera: Pentatomidae). The α-amylase was purified following a three-step procedure. The purified α-amylase had a specific activity of 13.46 U/mg protein, recovery of 4.21, purification fold of 13.87, and molecular weight of 21.3 kDa. The enzyme had optimal pH and temperature of 7 and 45°C, respectively. Na+, Mn+, Mg2+, and Zn2+ significantly decreased activity of the purified α-amylase, but some concentrations of K+, Ca2+, and Cu2+ had the opposite effect. EDTA, EGTA, and DTC significantly decreased enzymatic activity, showing the presence of metal ions in the catalytic site of the enzyme. Kinetic parameters of the purified α-amylase showed a Km of 3.71% in starch and 4.96% for glycogen, suggesting that the enzyme had a higher affinity for starch. PMID:25373212

  19. Rhizopus microsporus var. rhizopodiformis: a thermotolerant fungus with potential for production of thermostable amylases.

    PubMed

    Peixoto, Simone C; Jorge, João A; Terenzi, Héctor F; Polizeli, Maria de Lourdes T M

    2003-12-01

    The effect of several nutritional and environmental parameters on growth and amylase production from Rhizopus microsporus var. rhizopodiformis was analysed. This fungus was isolated from soil of the Brazilian "cerrado" and produced high levels of amylolytic activity at 45 degrees C in liquid medium supplemented with starch, sugar cane bagasse, oat meal or cassava flour. Glucose in the culture medium drastically repressed the amylolytic activity. The products of hydrolysis were analysed by thin layer chromatography, and glucose was detected as the main component. The amylolytic activity hydrolysed several substrates, such as amylopectin, amylase, glycogen, pullulan, starch, and maltose. Glucose was always the main end product detected by high-pressure liquid chromatography analysis. These results indicated that the amylolytic activity studied is a glucoamylase, but there were also low levels of alpha-amylase. As compared to other fungi, R. microsporus var. rhizopodiformis can be considered an efficient producer of thermostable amylases, using raw residues of low cost as substrates. This information is of technological value, considering the importance of amylases for industrial hydrolysis.

  20. Starch-binding domain affects catalysis in two Lactobacillus alpha-amylases.

    PubMed

    Rodríguez-Sanoja, R; Ruiz, B; Guyot, J P; Sanchez, S

    2005-01-01

    A new starch-binding domain (SBD) was recently described in alpha-amylases from three lactobacilli (Lactobacillus amylovorus, Lactobacillus plantarum, and Lactobacillus manihotivorans). Usually, the SBD is formed by 100 amino acids, but the SBD sequences of the mentioned lactobacillus alpha-amylases consist of almost 500 amino acids that are organized in tandem repeats. The three lactobacillus amylase genes share more than 98% sequence identity. In spite of this identity, the SBD structures seem to be quite different. To investigate whether the observed differences in the SBDs have an effect on the hydrolytic capability of the enzymes, a kinetic study of L. amylovorus and L. plantarum amylases was developed, with both enzymes acting on several starch sources in granular and gelatinized forms. Results showed that the amylolytic capacities of these enzymes are quite different; the L. amylovorus alpha-amylase is, on average, 10 times more efficient than the L. plantarum enzyme in hydrolyzing all the tested polymeric starches, with only a minor difference in the adsorption capacities.

  1. Purification and characterization of amylases from small abalone (Sulculus diversicolor aquatilis).

    PubMed

    Tsao, Ching-Yu; Pan, Yun-Zu; Jiang, Shann-Tzong

    2003-02-12

    Amylases II-1 and II-2 with molecular weights of 55.7 and 65 kDa, respectively, were purified to electrophoretical homogeneity from small abalone (Sulculus diversicolor aquatilis) by ammonium sulfate fractionation, Sepharose CL-6B, CM-Sepharose CL-6B, and Sephacryl S-100 chromatographs. They had optimal temperatures of 45 and 50 degrees C and an optimal pH of 6.0. The purified amylases were stable at pH 5.0-8.0 and 6.0-8.0, respectively. They were completely or partially inhibited by Hg(2+), Cu(2+), Cd(2+), Zn(2+), iodoacetamide, phenylmethanesulfonyl fluoride, and N-ethylmaleimide, suggesting the existence of cysteine at their active sites. Digestion tests against various polysaccharides suggested that the purified amylases II-1 and II-2 are neoamylases which can hydrolyze both alpha-1,4 and alpha-1,6 glucosidic bonds. Amylase II-2 might be an exo- and II-1 an endo-/exo-amylase.

  2. Existence of hydroxylated MWCNTs demotes the catalysis effect of amylases against starch degradation.

    PubMed

    Sekar, Gajalakshmi; Sivakumar, Amaravathy; Mukherjee, Amitava; Chandrasekaran, Natarajan

    2016-05-01

    Possible interaction between amylase and Multi Walled Carbon Nanotubes (MWCNTs) has been elucidated with spectroscopic methods. Hyperchromism of the UV-visible spectra of amylase-CNT conjugates suggested ground state complex formation between them. On contrary, the decreasing fluorescence emission spectra revealed the fate of quenching mechanism to be static. Stoke shift observed from the synchronous and 3D spectra suggested the possibilities of disturbances to the aromatic micro-environment of amylases by OH-MWCNTS. FTIR and FT-Raman spectra showed alteration in the amide I band, that corresponds to their effect on alpha-helical structures. Loss of alpha-helical structures and alteration in the dichroic band again revealed possible conformational change and effect towards the stability of polypeptide backbone structures. In addition, the shift observed in the SPR band and FTIR peaks of CNTs-amylase conjugates suggested possible alteration in their optical and structural properties. On the functional aspect, amylase activity on starch degradation and hydrolysis were found to be decreased in the presence of CNTs.

  3. Characterizing Novel Thermophilic Amylase Producing Bacteria From Taptapani Hot Spring, Odisha, India

    PubMed Central

    Sen, Sudip Kumar; Raut, Sangeeta; Satpathy, Soumya; Rout, Prangya Ranjan; Bandyopadhyay, Bidyut; Das Mohapatra, Pradeep Kumar

    2014-01-01

    Background: Amylases play a vital role in biotechnological studies and rank an important position in the world enzyme market (25% to 33%). Bioprocess method of amylase production is more effective than the other sources, since the technique is easy, cost effective, fast, and the enzymes of required properties can be procured. Objectives: The current study aimed to report the characteristics of novel amylase producing bacterial strains isolated from Taptapani hot spring, Odisha, India. Materials and Methods: Bacterial strains were isolated by dilution plating method from the water samples collected from Taptapani Hot Spring, Odisha and screened for amylase production through starch hydrolysis. The bacterial isolates were identified morphologically, biochemically, and finally by 16S rDNA profiling. Results: Based on the morphological, physiological, biochemical characteristics and the molecular characterization, the isolates SS1, SS2, and SS3 were identified as Bacillus barbaricus, Aeromonas veroni, and Stenotrophomonas maltophilia, respectively. The approximate molecular weight of enzymes from SS1, SS2, and SS3 strains were 19 kDa, 56 kDa and 49 kDa, respectively. Conclusions: The current report isolates, characterizes, and demonstrates the novel heat-adapted amylase-producing bacteria SS1, SS2 and SS3 from Taptapani hot spring, indicating its potentiality and stability under acidic conditions. PMID:25741425

  4. Integrable alpha-amylase plasmid for generating random transcriptional fusions in Bacillus subtilis.

    PubMed Central

    O'Kane, C; Stephens, M A; McConnell, D

    1986-01-01

    An integrable plasmid, pOK4, which replicated independently in Escherichia coli was constructed for generating transcriptional fusions in vivo in Bacillus DNA. It did not replicate independently in Bacillus subtilis, but it could be made to integrate into the chromosome of B. subtilis if sequences homologous to chromosomal sequences were inserted into it. It had a selectable marker for chloramphenicol resistance and carried unique sites for EcoRI and SmaI just to the 5' side of a promoterless alpha-amylase gene from Bacillus licheniformis. When B. subtilis DNA fragments were ligated into one of these sites and the ligation mixture was used to transform an alpha-amylase-negative B. subtilis strain, chloramphenicol-resistant transformants could be isolated conveniently. Many of these were alpha-amylase positive, owing to the fusion of the plasmid amylase gene to chromosomal operons. In principle, because integration need not be mutagenic, it is possible to obtain fusions to any chromosomal operon. The site of each integration can be mapped, and the flanking sequences can be cloned into E. coli. The alpha-amylase gene can be used to detect regulated genes. We used it as an indicator to detect operons which are DNA-damage-inducible (din), and we identified insertions in both SP beta and PBSX prophages. Images PMID:3096966

  5. Salivary cortisol and α-amylase: subclinical indicators of stress as cardiometabolic risk

    PubMed Central

    Cozma, S.; Dima-Cozma, L.C.; Ghiciuc, C.M.; Pasquali, V.; Saponaro, A.; Patacchioli, F.R.

    2017-01-01

    Currently, the potential for cardiovascular (CV) stress-induced risk is primarily based on the theoretical (obvious) side effects of stress on the CV system. Salivary cortisol and α-amylase, produced respectively by the hypothalamus-pituitary-adrenal (HPA) axis and the sympathetic-adrenomedullary (SAM) system during stress response, are still not included in the routine evaluation of CV risk and require additional and definitive validation. Therefore, this article overviews studies published between 2010 and 2015, in which salivary cortisol and α-amylase were measured as stress biomarkers to examine their associations with CV/CMR (cardiometabolic risk) clinical and subclinical indicators. A comprehensive search of PubMed, Web of Science and Scopus electronic databases was performed, and 54 key articles related to the use of salivary cortisol and α-amylase as subclinical indicators of stress and CV/CMR factors, including studies that emphasized methodological biases that could influence the accuracy of study outcomes, were ultimately identified. Overall, the biological impact of stress measured by salivary cortisol and α-amylase was associated with CV/CMR factors. Results supported the use of salivary cortisol and α-amylase as potential diagnostic tools for detecting stress-induced cardiac diseases and especially to describe the mechanisms by which stress potentially contributes to the pathogenesis and outcomes of CV diseases. PMID:28177057

  6. Crystal structure of α-amylase from Oryza sativa: molecular insights into enzyme activity and thermostability.

    PubMed

    Ochiai, Akihito; Sugai, Hiroshi; Harada, Kazuki; Tanaka, Seiya; Ishiyama, Yohei; Ito, Kosuke; Tanaka, Takaaki; Uchiumi, Toshio; Taniguchi, Masayuki; Mitsui, Toshiaki

    2014-01-01

    AmyI-1 is an α-amylase from Oryza sativa (rice) and plays a crucial role in degrading starch in various tissues and at various growth stages. This enzyme is a glycoprotein with an N-glycosylated carbohydrate chain, a unique characteristic among plant α-amylases. In this study, we report the first crystal structure of AmyI-1 at 2.2-Å resolution. The structure consists of a typical (β/α)8-barrel, which is well-conserved among most α-amylases in the glycoside hydrolase family-13. Structural superimposition indicated small variations in the catalytic domain and carbohydrate-binding sites between AmyI-1 and barley α-amylases. By contrast, regions around the N-linked glycosylation sites displayed lower conservation of amino acid residues, including Asn-263, Asn-265, Thr-307, Asn-342, Pro-373, and Ala-374 in AmyI-1, which are not conserved in barley α-amylases, suggesting that these residues may contribute to the construction of the structure of glycosylated AmyI-1. These results increase the depths of our understanding of the biological functions of AmyI-1.

  7. Identification of active site residues of Fenugreek β-amylase: chemical modification and in silico approach.

    PubMed

    Srivastava, Garima; Singh, Vinay K; Kayastha, Arvind M

    2014-10-01

    The amino acid sequence of Fenugreek β-amylase is not available in protein data bank. Therefore, an attempt has been made to identify the catalytic amino acid residues of enzyme by employing studies of pH dependence of enzyme catalysis, chemical modification and bioinformatics. Treatment of purified Fenugreek β-amylase with EDAC in presence of glycine methyl ester and sulfhydryl group specific reagents (IAA, NEM and p-CMB), followed a pseudo first-order kinetics and resulted in effective inactivation of enzyme. The reaction with EDAC in presence of NTEE (3-nitro-l-tyrosine ethylester) resulted into modification of two carboxyl groups per molecule of enzyme and presence of one accessible sulfhydryl group at the active site, per molecule of enzyme was ascertained by titration with DTNB. The above results were supported by the prevention of inactivation of enzyme in presence of substrate. Based on MALDI-TOF analysis of purified Fenugreek β-amylase and MASCOT search, β-amylase of Medicago sativa was found to be the best match. To further confirm the amino acid involved in catalysis, homology modelling of β-amylase of M. sativa was performed. The sequence alignment, superimposition of template and target models, along with study of interactions involved in docking of sucrose and maltose at the active site, led to identification of Glu187, Glu381 and Cys344 as active site residues.

  8. Progress of pancreatitis disease biomarker alpha amylase enzyme by new nano optical sensor.

    PubMed

    Attia, M S; Al-Radadi, Najlaa S

    2016-12-15

    A new nano optical sensor binuclear Pd-(2-aminothiazole) (urea), Pd(atz,ur) complex was prepared and characterized for the assessment of the activity of alpha amylase enzyme in urine and serum samples for early diagnosis of Pancreatitis disease. The assessment of alpha amylase activity is carried out by the quenching of the luminescence intensity of the nano optical sensor binuclear Pd(atz,ur) complex at 457nm by the 2-chloro-4-nitrophenol (2-CNP) which produced from the reaction of the enzyme with 2-chloro-4-nitrophenyl-α-d-maltotrioside (CNPG3) substrate. The remarkable quenching of the luminescence intensity at 457nm of nano Pd(atz,ur) doped in sol-gel matrix by various concentrations of the 2-CNP was successfully used as an optical sensor for the assessment of α-amylase activity. The calibration plot was achieved over the concentration range 8.5×10(-6) to 1.9×10(-9)molL(-1) 2-CNP with a correlation coefficient of (0.999) and a detection limit of (7.4×10(-10)molL(-1)). The method was used satisfactorily for the assessment of the α-amylase activity over activity range (3-321U/L) in different urine and serum samples of pancreatitis patients. The assessment of the alpha amylase biomarker by the proposed method increases its sensitivity (96.88%) and specificity (94.41%) for early diagnosis of pancreatitis diseases.

  9. Inhibition of α-amylase activity by cellulose: Kinetic analysis and nutritional implications.

    PubMed

    Dhital, Sushil; Gidley, Michael J; Warren, Frederick J

    2015-06-05

    We report on inhibition of α-amylase activity by cellulose based on in vitro experiments. The presence of cellulose in the hydrolysing medium reduced the initial velocity of starch hydrolysis in a concentration dependent manner. α-Amylase adsorption to cellulose was reversible, attaining equilibrium within 30min of incubation, and showed a higher affinity at 37°C compared to 20 and 0°C. The adsorption was almost unchanged in the presence of maltose (2.5-20mM) but was hindered in the presence of excess protein, suggesting non-specific adsorption of α-amylase to cellulose. Kinetic analyses of α-amylase hydrolysis of maize starch in the presence of cellulose showed that the inhibition is of a mixed type. The dissociation constant (Kic) of the EI complex was found to be ca. 3mg/mL. The observed inhibition of α-amylase activity suggests that cellulose in the diet can potentially attenuate starch hydrolysis.

  10. Purification and characterization of thermostable α-amylase from thermophilic Anoxybacillus flavithermus.

    PubMed

    Agüloğlu Fincan, S; Enez, B; Özdemir, S; Matpan Bekler, F

    2014-02-15

    This study reports on the purification and characterization of thermostable α-amylase (α-1-4 D-glucan glucanohydrolase EC 3.2.1.1) from a newly isolated Anoxybacillus flavithermus. A. flavithermus was used, which was isolated from hot water springs of Ömer, Afyonkarahisar, Turkey. The gram-positive, spore-forming, motile, moderately thermophilic bacteria were found to be a strain of A. flavithermus analysed by 16S rRNA comparison. The optimal conditions for bacterial growth were determined to be at 20 thh, 55 °C and pH 6.0. Maximum α-amylase activity was obtained at 55 °C at pH 7.0 after 24h of incubation. Thermostable α-amylase from A. flavithermus was purified by 70% (NH4)2SO4 and ion-exchange chromatography (5.2-fold; 65.8% yield). The molecular weight of α-amylase was 60 kDa, as estimated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). The α-amylase hydrolyzed soluble starch at 55 °C with Km: 0.005 mM and Vmax: 3.5 μmol min(-1).

  11. Macromolecular cross-linked enzyme aggregates (M-CLEAs) of α-amylase.

    PubMed

    Nadar, Shamraja S; Muley, Abhijeet B; Ladole, Mayur R; Joshi, Pranoti U

    2016-03-01

    Macromolecular cross-linked enzyme aggregates (M-CLEAs) of α-amylase were prepared by precipitation and subsequent cross-linking. The non-toxic, biodegradable, biocompatible, renewable polysaccharide based macromolecular cross-linkers viz. agar, chitosan, dextran, and gum arabic were used as a substitute for traditional glutaraldehyde to augment activity recovery toward macromolecular substrate. Macromolecular cross-linkers were prepared by periodate mediated controlled oxidation of polysaccharides. The effects of precipitating agent, concentration and different cross-linkers on activity recovery of α-amylase CLEAs were investigated. α-Amylase aggregated with ammonium sulphate and cross-linked by dextran showed 91% activity recovery, whereas glutaraldehyde CLEAs (G-CLEAs) exhibited 42% activity recovery. M-CLEAs exhibited higher thermal stability in correlation with α-amylase and G-CLEAs. Moreover, dextran and chitosan M-CLEAs showed same affinity for starch hydrolysis as of free α-amylase. The changes in secondary structures revealed the enhancements in structural and conformational rigidity attributed by cross-linkers. Finally, after five consecutive cycles dextran M-CLEAs retained 1.25 times higher initial activity than G-CLEAs.

  12. Salivary Alpha-Amylase and Cortisol Among Pentecostals on a Worship and Nonworship Day

    PubMed Central

    LYNN, CHRISTOPHER DANA; PARIS, JASON; FRYE, CHERYL ANNE; SCHELL, LAWRENCE M.

    2013-01-01

    Objectives This investigation used a biomarker of sympathetic nervous system activity novel to biocultural research to test the hypothesis that engaging in religious worship activities would reduce baseline stress levels on a non-worship day among Pentecostals. Methods As detailed in Lynn et al. (submitted for publication), stress was measured via salivary cortisol and α-amylase among 52 Apostolic Pentecostals in New York’s mid-Hudson Valley. Saliva samples were collected at four predetermined times on consecutive Sundays and Mondays to establish diurnal profiles and compare days of worship and non-worship. These data were reanalyzed using separate analyses of covariance on α-amylase and cortisol to control for individual variation in Pentecostal behavior, effects of Sunday biomarkers on Monday, and other covariates. Results There was a significant decrease in cortisol and an increase in α-amylase on a non-worship day compared with a service day. Models including engagement in Pentecostal worship behavior explained 62% of the change in non-service day cortisol and 73% of the change in non-service day α-amylase. Conclusions Engagement in Pentecostal worship may be associated with reductions in circulatory cortisol and enhancements in α-amylase activity. Am. J. Hum. Biol. 22:819–822, 2010. PMID:20878966

  13. Effects of dopamine on adenylyl cyclase activity and amylase secretion in rat parotid tissue.

    PubMed

    Hatta, S; Amemiya, N; Takemura, H; Ohshika, H

    1995-06-01

    Several previous studies have shown that dopamine causes amylase secretion from rat parotid tissue. However, the mechanism of this dopamine action is still unclear. The present study was designed to characterize dopamine action in rat parotid gland tissue by examining the effects of dopamine on cyclic AMP accumulation, adenylyl cyclase activity, and amylase release. Dopamine significantly enhanced accumulation of cyclic AMP in parotid slices and stimulated adenylyl cyclase activity in parotid membrane preparations. It also significantly stimulated amylase release from parotid slices. The stimulatory effects of dopamine on cyclic AMP accumulation, adenylyl cyclase activity, and amylase release were effectively blocked with propranolol, a beta-adrenergic antagonist, but not by either SCH 23390, a preferential D1 antagonist, or butaclamol, a preferential D2 antagonist. No substantial specific binding sites for D1 receptors were detectable by [3H]SCH 23390 binding in parotid membranes. These results suggest that the stimulatory effect of dopamine on amylase secretion in rat parotid tissue is not mediated through specific D1 dopamine receptors but rather through beta-adrenergic receptors.

  14. Phenotypic Variation for Diastatic power, ß-Amylase Activity, and ß-Amylase Thermostability vs. Allelic Variation at the Bmy1 Locus in a Sample of North American Barley Germplasm

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Malting quality data including diastatic power, ß-amylase activity, and ß-amylase thermostability, were collected on malts from three barley (Hordeum vulgare L.) breeding program trials containing two growth habits and 165 lines grown in multiple environments. We attempted to identify causal polymor...

  15. The need for and development of a method to measure carry-over amylase activity in raw and refined sugars

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years, there has been increased world-wide concern over carry-over activity of mostly high temperature (HT) and very high temperature (VHT) stable amylases in refined sugars to various food and end-user industries. HT and VHT stable amylases were developed for much larger markets than the...

  16. General Subject 1. Report to ICUMSA on the determination of commercial alpha-amylase activity by a spectrophotometric method

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A report is given on a new industrial method for the determination of the activity or strength of commercial alpha-amylase at a sugarcane factory or refinery, as well as a recommendation. At the present time, the activities or strengths of commercial alpha-amylases cannot be directly compared becau...

  17. Development of an industrial method to quantitatively measure carry-over amylase activity in raw and refined sugars

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years, there has been increased concern over carry-over activity of mostly high temperature (HT) and very high temperature (VHT) stable amylases in white, refined sugars from refineries to various food manufacturing industries and other end-users. HT and VHT stable amylases were developed...

  18. A comparison of currently used serum lipase and amylase procedures in the serial detection of enzyme elevations in acute pancreatitis.

    PubMed

    Hathaway, J A; Kitt, D; Wingate, B

    1983-10-14

    Twenty-eight patients having acute pancreatitis were followed during convalescence with serum amylase and lipase determinations. Starch and p-nitrophenyl-oligosaccharide substrates were used for amylase. Dimercaptotributyrate and triolein were employed for lipase. The extreme sensitivity of the lipase procedure using the tributyrate detected a persistent elevation of lipase when other parameters of measurement had returned to normal.

  19. Mechanism of removal of undesirable residual amylase, insoluble starch, and select colorants from refinery streams by powdered activated carbons

    Technology Transfer Automated Retrieval System (TEKTRAN)

    There is a need in the world-wide sugar industry to find a practical and economical solution to remove or inactivate residual alpha-amylase that are high temperature stable from factory or refinery streams. A survey of refineries that used amylase and had activated carbon systems for decolorization,...

  20. Recognition and binding of the PF2 lectin to α-amylase from Zabrotes subfasciatus (Coleoptera:Bruchidae) larval midgut.

    PubMed

    Lagarda-Diaz, I; Geiser, D; Guzman-Partida, A M; Winzerling, J; Vazquez-Moreno, L

    2014-01-01

    Amylases are an important family of enzymes involved in insect carbohydrate metabolism that are required for the survival of insect larvae. For this reason, enzymes from starch-dependent insects are targets for insecticidal control. PF2 (Olneya tesota) is a lectin that is toxic to Zabrotes subfasciatus (Coleoptera: Bruchidae) larvae. In this study, we evaluated recognition of the PF2 lectin to α-amylases from Z. subfasciatus midgut and the effect of PF2 on α-amylase activity. PF2 caused a decrease of total amylase activity in vitro. Subsequently, several α-amylase isoforms were isolated from insect midgut tissues using ion exchange chromatography. Three enzyme isoforms were verified by an in-gel assay for amylase activity; however, only one isoform was recognized by antiamylase serum and PF2. The identity of this Z. subfasciatus α-amylase was confirmed by liquid chromatography-tandem mass spectrometry. The findings strongly suggest that a glycosylated α-amylase isoform from larval Z. subfasciatus midgut interacts with PF2, which interferes with starch digestion.

  1. Interaction of europium and curium with alpha-amylase.

    PubMed

    Barkleit, Astrid; Heller, Anne; Ikeda-Ohno, Atsushi; Bernhard, Gert

    2016-06-07

    The complexation of Eu(iii) and Cm(iii) with the protein α-amylase (Amy), a major enzyme in saliva and pancreatic juice, was investigated over wide ranges of pH and concentration at both ambient and physiological temperatures. Macroscopic sorption experiments demonstrated a strong and fast binding of Eu(iii) to Amy between pH 5 and 8. The protein provides three independent, non-cooperative binding sites for Eu(iii). The overall association constant of these three binding sites on the protein was calculated to be log K = 6.4 ± 0.1 at ambient temperature. With potentiometric titration, the averaged deprotonation constant of the carboxyl groups (the aspartic and glutamic acid residues) of Amy was determined to be pKa = 5.23 ± 0.14 at 25 °C and 5.11 ± 0.24 at 37 °C. Time-resolved laser-induced fluorescence spectroscopy (TRLFS) revealed two different species for both Eu(iii) and Cm(iii) with Amy. In the case of the Eu(iii) species, the stability constants were determined to be log β11 = 4.7 ± 0.2 and log β13 = 12.0 ± 0.4 for Eu : Amy = 1 : 1 and 1 : 3 complexes, respectively, whereas the values for the respective Cm(iii) species were log β11 = 4.8 ± 0.1 and log β13 = 12.1 ± 0.1. Furthermore, the obtained stability constants were extrapolated to infinite dilution to make our data compatible with the existing thermodynamic database.

  2. Smart phone: a popular device supports amylase activity assay in fisheries research.

    PubMed

    Thongprajukaew, Karun; Choodum, Aree; Sa-E, Barunee; Hayee, Ummah

    2014-11-15

    Colourimetric determinations of amylase activity were developed based on a standard dinitrosalicylic acid (DNS) staining method, using maltose as the analyte. Intensities and absorbances of red, green and blue (RGB) were obtained with iPhone imaging and Adobe Photoshop image analysis. Correlation of green and analyte concentrations was highly significant, and the accuracy of the developed method was excellent in analytical performance. The common iPhone has sufficient imaging ability for accurate quantification of maltose concentrations. Detection limits, sensitivity and linearity were comparable to a spectrophotometric method, but provided better inter-day precision. In quantifying amylase specific activity from a commercial source (P>0.02) and fish samples (P>0.05), differences compared with spectrophotometric measurements were not significant. We have demonstrated that iPhone imaging with image analysis in Adobe Photoshop has potential for field and laboratory studies of amylase.

  3. Action of Bacillus subtilis alpha-amylase on native wheat starch.

    PubMed

    Colonna, P; Buléon, A; Lemarié, F

    1988-06-05

    Native starch granules from wheat have been subjected to enzymatic depolymerization with an alpha-amylase from Bacillus subtilis. Crystallites made from short-chain amylose and residues from mild acid hydrolysis have been also tested. Electron microscopy, particle size analysis, DSC, and x-ray diffractometry reveal that enzymatic degradation occurs granule by granule. Gel permeation chromatography shows off the macromolecular nature of the remaining material. In contrast, acid erodes simultaneously all the granules, leading to a splitting into small particles. Crystalline fractions are completely degraded by alpha-amylase. These results support evidence for an active disentanglement of chains, carried out by the different subsites of alpha-amylase molecules. A simple mathematical treatment is proposed to explain the results of the kinetics.

  4. Potent Human α-Amylase Inhibition by the β-Defensin-like Protein Helianthamide

    PubMed Central

    2016-01-01

    Selective inhibitors of human pancreatic α-amylase (HPA) are an effective means of controlling blood sugar levels in the management of diabetes. A high-throughput screen of marine natural product extracts led to the identification of a potent (Ki = 10 pM) peptidic HPA inhibitor, helianthamide, from the Caribbean sea anemone Stichodactyla helianthus. Active helianthamide was produced in Escherichia coli via secretion as a barnase fusion protein. X-ray crystallographic analysis of the complex of helianthamide with porcine pancreatic α-amylase revealed that helianthamide adopts a β-defensin fold and binds into and across the amylase active site, utilizing a contiguous YIYH inhibitory motif. Helianthamide represents the first of a novel class of glycosidase inhibitors and provides an unusual example of functional malleability of the β-defensin fold, which is rarely seen outside of its traditional role in antimicrobial peptides. PMID:27066537

  5. Bacterial and Archaeal α-Amylases: Diversity and Amelioration of the Desirable Characteristics for Industrial Applications.

    PubMed

    Mehta, Deepika; Satyanarayana, Tulasi

    2016-01-01

    Industrial enzyme market has been projected to reach US$ 6.2 billion by 2020. Major reasons for continuous rise in the global sales of microbial enzymes are because of increase in the demand for consumer goods and biofuels. Among major industrial enzymes that find applications in baking, alcohol, detergent, and textile industries are α-amylases. These are produced by a variety of microbes, which randomly cleave α-1,4-glycosidic linkages in starch leading to the formation of limit dextrins. α-Amylases from different microbial sources vary in their properties, thus, suit specific applications. This review focuses on the native and recombinant α-amylases from bacteria and archaea, their production and the advancements in the molecular biology, protein engineering and structural studies, which aid in ameliorating their properties to suit the targeted industrial applications.

  6. Purification and crystallization of α-amylases from mucoid and non-mucoid B. amyloliquefaciens strains

    NASA Astrophysics Data System (ADS)

    Sarikaya, Elif; Mikami, Bunzo

    2001-11-01

    The purified α-amylases from mucoid and non-mucoid B. amyloliquefaciens strains were crystallized in forms suitable for X-ray diffraction analysis. Crystals were grown by the hanging-drop vapor diffusion method. Very thin crystals of α-amylase of non-mucoid strain were obtained in the presence 15% propanol, 12% PEG 6000 and 0.1 M PIPES (pH: 7.1) at the end of 3 months and these were not suitable for X-ray diffraction analysis. Crystals of the mucoid strain of B. amyloliquefaciens α-amylase were obtained with 30% PEG 6000, 0.2 M (NH 4) 2SO 4 and 0.1 M PIPES (pH: 6.5) at the end of 3 months and these were suitable for X-ray diffraction analysis.

  7. Selective sweep on human amylase genes postdates the split with Neanderthals

    PubMed Central

    Inchley, Charlotte E.; Larbey, Cynthia D. A.; Shwan, Nzar A. A.; Pagani, Luca; Saag, Lauri; Antão, Tiago; Jacobs, Guy; Hudjashov, Georgi; Metspalu, Ene; Mitt, Mario; Eichstaedt, Christina A.; Malyarchuk, Boris; Derenko, Miroslava; Wee, Joseph; Abdullah, Syafiq; Ricaut, François-Xavier; Mormina, Maru; Mägi, Reedik; Villems, Richard; Metspalu, Mait; Jones, Martin K.; Armour, John A. L.; Kivisild, Toomas

    2016-01-01

    Humans have more copies of amylase genes than other primates. It is still poorly understood, however, when the copy number expansion occurred and whether its spread was enhanced by selection. Here we assess amylase copy numbers in a global sample of 480 high coverage genomes and find that regions flanking the amylase locus show notable depression of genetic diversity both in African and non-African populations. Analysis of genetic variation in these regions supports the model of an early selective sweep in the human lineage after the split of humans from Neanderthals which led to the fixation of multiple copies of AMY1 in place of a single copy. We find evidence of multiple secondary losses of copy number with the highest frequency (52%) of a deletion of AMY2A and associated low copy number of AMY1 in Northeast Siberian populations whose diet has been low in starch content. PMID:27853181

  8. Bacterial and Archaeal α-Amylases: Diversity and Amelioration of the Desirable Characteristics for Industrial Applications

    PubMed Central

    Mehta, Deepika; Satyanarayana, Tulasi

    2016-01-01

    Industrial enzyme market has been projected to reach US$ 6.2 billion by 2020. Major reasons for continuous rise in the global sales of microbial enzymes are because of increase in the demand for consumer goods and biofuels. Among major industrial enzymes that find applications in baking, alcohol, detergent, and textile industries are α-amylases. These are produced by a variety of microbes, which randomly cleave α-1,4-glycosidic linkages in starch leading to the formation of limit dextrins. α-Amylases from different microbial sources vary in their properties, thus, suit specific applications. This review focuses on the native and recombinant α-amylases from bacteria and archaea, their production and the advancements in the molecular biology, protein engineering and structural studies, which aid in ameliorating their properties to suit the targeted industrial applications. PMID:27516755

  9. Potent Human α-Amylase Inhibition by the β-Defensin-like Protein Helianthamide.

    PubMed

    Tysoe, Christina; Williams, Leslie K; Keyzers, Robert; Nguyen, Nham T; Tarling, Chris; Wicki, Jacqueline; Goddard-Borger, Ethan D; Aguda, Adeleke H; Perry, Suzanne; Foster, Leonard J; Andersen, Raymond J; Brayer, Gary D; Withers, Stephen G

    2016-03-23

    Selective inhibitors of human pancreatic α-amylase (HPA) are an effective means of controlling blood sugar levels in the management of diabetes. A high-throughput screen of marine natural product extracts led to the identification of a potent (Ki = 10 pM) peptidic HPA inhibitor, helianthamide, from the Caribbean sea anemone Stichodactyla helianthus. Active helianthamide was produced in Escherichia coli via secretion as a barnase fusion protein. X-ray crystallographic analysis of the complex of helianthamide with porcine pancreatic α-amylase revealed that helianthamide adopts a β-defensin fold and binds into and across the amylase active site, utilizing a contiguous YIYH inhibitory motif. Helianthamide represents the first of a novel class of glycosidase inhibitors and provides an unusual example of functional malleability of the β-defensin fold, which is rarely seen outside of its traditional role in antimicrobial peptides.

  10. An In Vitro and In Vivo Study of the α-Amylase Activity of Phaseolamin

    PubMed Central

    de Gouveia, Neire Moura; Alves, Fernanda Vieira; Furtado, Fabiana Barcelos; Scherer, Danielli Luana; Mundim, Antonio Vicente

    2014-01-01

    Abstract We evaluated the polypeptide profiles, inhibition of human salivary α-amylase activity, and hemagglutination properties of a commercial phaseolamin sample. We also performed an in vivo assay to investigate the effects of a commercial phaseolamin treatment (100, 500, or 1500 mg/kg) over 20 days on the glycemia, body weight, and serum biochemical parameters (total cholesterol, triglycerides, alanine aminotransferase, and aspartate aminotransferase) of nondiabetic and streptozotocin-induced diabetic rats. The in vitro evaluation showed defined protein profiles, low hemagglutination activity, and high α-amylase inhibition. None of the experimental groups treated with phaseolamin or acarbose showed decreases in body weight. Our data demonstrate that phaseolamin inhibits amylase activity in vitro, reduces blood glucose levels, decreases or attenuates some of the renal and hepatic effects of diabetes in streptozotocin-induced rats, and could therefore have therapeutic potential in the treatment or prevention of the complications of diabetes. PMID:24650210

  11. Metabolism of glycosylated human salivary amylase: in vivo plasma clearance by rat hepatic endothelial cells and in vitro receptor mediated pinocytosis by rat macrophages

    SciTech Connect

    Niesen, T.E.; Alpers, D.H.; Stahl, P.D.; Rosenblum, J.L.

    1984-09-01

    Salivary-type amylase normally comprises about 60% of the amylase activity in human serum, but only a small fraction is a glycosylated isoenzyme (amylase A). In contrast, 1/3 of amylase in human saliva is glycosylated. Since glycosylation can affect circulatory clearance, we studied the clearance of amylase A in rats and its uptake by rat alveolar macrophages. Following intravenous injection, /sup 125/I-labeled amylase A disappeared rapidly from plasma (t 1/2 . 9 min) and accumulated in the liver. Simultaneous injection of mannose-albumin slowed its clearance to a rate comparable to that of /sup 125/I-labeled nonglycosylated salivary amylase (t 1/2 . 45 min). In contrast, galactose-albumin had no effect. Electron microscope autoradiography of the liver following injection of /sup 125/I-labeled amylase A revealed a localization of grains over the hepatic endothelial cells. In vitro studies indicated that amylase A is taken up by alveolar macrophages via receptor-mediated pinocytosis. Uptake was linear over time, saturable, and inhibited by mannan and mannose-albumin, but not by galactose-albumin. We conclude that amylase A, which is a naturally occurring human glycoprotein with at most three terminal L-fucose residues per molecule, is recognized in rats by a mannose receptor located on hepatic endothelial cells. We speculate that this receptor, by rapidly clearing circulating amylase A, may be responsible for the low level of amylase A in human serum.

  12. Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

    PubMed Central

    Yamazaki, H; Ohmura, K; Nakayama, A; Takeichi, Y; Otozai, K; Yamasaki, M; Tamura, G; Yamane, K

    1983-01-01

    amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems. Images PMID:6413492

  13. Isolation and characterization of Taka-amylase A apoprotein deglycosylated by digestion with almond glycopeptidase immobilized on Sepharose.

    PubMed

    Takahashi, N; Toda, H; Nishibe, H; Yamamoto, K

    1982-10-05

    Taka-amylase A (1,4-alpha-D-glucan glucanohydrolase, EC 3.2.1.1), which contains a single asparagine-linked oligosaccharide unit, was digested with almond glycopeptidase immobilized on Sepharose 6B at 20 degrees C for 4 h. A maximum of 10% of the parent protein was isolated as apoprotein by column chromatography on Con-A Sepharose. The characteristics of the apoprotein were compared to those of the native Taka-amylase A. The removal of the sugar chain from Taka-amylase. A caused no change in the pH-activity profile or in kinetic parameters of the hydrolysis of soluble starch. The stability of the apoprotein toward changing pH and digestion by proteases did not show any appreciable difference from that of the native Taka-amylase. These results suggest that the carbohydrate moiety of Taka-amylase A is not an essential participant in the catalysis.

  14. Prevalence of the Amylase-Binding Protein A Gene (abpA) in Oral Streptococci

    PubMed Central

    Brown, Alan E.; Rogers, Jeffrey D.; Haase, Elaine M.; Zelasko, Peter M.; Scannapieco, Frank A.

    1999-01-01

    Salivary amylase binds specifically to a number of oral streptococcal species. This interaction may play an important role in dental plaque formation. Recently, a 585-bp gene was cloned and sequenced from Streptococcus gordonii Challis encoding a 20.5-kDa amylase-binding protein (AbpA). The goal of this study was to determine if related genes are present in other species of oral streptococci. Biotinylated abpA was used in Southern blot analysis to screen genomic DNA from several strains representing eight species of oral streptococci. This probe hybridized with a 4.0-kb HindIII restriction fragment from all 13 strains of S. gordonii tested. The probe did not appear to bind to any restriction fragments from other species of amylase-binding oral streptococci including Streptococcus mitis (with the exception of 1 of 14 strains), Streptococcus crista (3 strains), Streptococcus anginosus (1 strain), and Streptococcus parasanguinis (1 strain), or to non-amylase-binding oral streptococci including Streptococcus sanguinis (3 strains), Streptococcus oralis (4 strains), and Streptococcus mutans (1 strain). Primers homologous to sequences within the 3′ and 5′ ends of abpA yielded products of 400 bp following PCR of genomic DNA from the Southern blot-positive strains. Several of these PCR products were cloned and sequenced. The levels of similarity of these cloned products to the abpA of S. gordonii Challis ranged from 91 to 96%. These studies reveal that the abpA gene appears to be specific to S. gordonii and differs from genes encoding amylase-binding proteins from other species of amylase-binding streptococci. PMID:10565935

  15. [Alpha-amylase as an occupational allergen in baking industry employees].

    PubMed

    De Zotti, R; Larese, F; Molinari, S

    1994-01-01

    In a group of 226 bakers and pastry makers and in 88 students of a training school for bakers, we evaluated skin sensitization to the common allergens, wheat and alpha amylase. Skin prick tests were positive to the enzyme in 17 exposed subjects (7.5%) and in one student with previous occupational exposure as a baker; 27 exposed subjects (11.9%) and 2 students were sensitized to wheat. Among the 42 exposed workers who complained of work-related symptoms, 12 (28.6%) cases were skin positive to amylase and 17 (42.9%) to wheat. Among the 17 workers who were positive to amylase, 16 were also sensitized to wheat and/or common allergens, 12 complained of symptoms at work but since in many cases there was a positive response to wheat, too, it is impossible to speculate on the role of each allergen in inducing symptoms. One case, with work-related rhinoconjunctivitis, had skin sensitization only to alpha amylase but no specific IgE in the serum. These findings confirm that bakers are at risk of sensitization not only to wheat allergen but also to amylase from Aspergillus oryzae. The enzyme should be included in the list of substances to be tested among bakers in whom an occupational allergy is suspected, but particular care should be taken in evaluating the cutaneous response, especially if compared to wheat wheals. Further investigations are also needed to identify the source of risk and to better define the characteristics of the enzyme and the relationship between skin reaction to amylase, sensitization to wheat and atopy.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. Identification of a new oat β-amylase by functional proteomics.

    PubMed

    Ben Halima, Nihed; Khemakhem, Bassem; Fendri, Imen; Ogata, Hiroyuki; Baril, Patrick; Pichon, Chantal; Abdelkafi, Slim

    2016-01-01

    Oat (Avena sativa L.) seed extracts exhibited a high degree of catalytic activity including amylase activities. Proteins in the oat seed extracts were optimized for their amylolytic activities. Oat extract with amylolytic activity was separated by SDS-PAGE and a major protein band with an apparent molecular mass of 53 kDa was subjected to tryptic digestion. The generated amino acid sequences were analyzed by liquid chromatography–tandem mass spectrometry (LC/ESI/MS/MS) and database searches. These sequences were used to identify a partial cDNA from expressed sequence tags (ESTs) of A. sativa L. Based upon EST sequences, a predicted full-length gene was identified, with an open reading frame of 1464 bp encoding a protein of 488 amino acid residues (AsBAMY), with a theoretical molecular mass of 55 kDa identified as a β-amylase belonging to the plant β-amylase family. Primary structure of oat β-amylase (AsBAMY) protein indicated high similarity with other β-amylase from other cereals such as wheat (Triticum aestivum), barley (Hordeum vulgare), and rye (Secale cereale) with two conserved Glu residues (E184 and E378) assigned as the “putative” catalytic residues which would act as an acid and base pair in the catalytic process. In addition, a 3D-model of AsBAMY was built from known X-ray structures and sequence alignments. A similar core (β/α)8-barrel architecture was found in AsBAMY like the other cereal β-amylases with a specific location of the active site in a pocket-like cavity structure made at one end of this core (β/α)8-barrel domain suggesting an accessibility of the non-reducing end of the substrate and thus confirming the results of AsBAMY exo-acting hydrolase.

  17. Redox regulation of a novel plastid-targeted beta-amylase of Arabidopsis.

    PubMed

    Sparla, Francesca; Costa, Alex; Lo Schiavo, Fiorella; Pupillo, Paolo; Trost, Paolo

    2006-07-01

    Nine genes of Arabidopsis (Arabidopsis thaliana) encode for beta-amylase isozymes. Six members of the family are predicted to be extrachloroplastic isozymes and three contain predicted plastid transit peptides. Among the latter, chloroplast-targeted beta-amylase (At4g17090) and thioredoxin-regulated beta-amylase (TR-BAMY; At3g23920; this work) are experimentally demonstrated to be targeted to plastids. Recombinant TR-BAMY was catalytically active only when expressed as a mature protein, i.e. with no transit peptide. Mature TR-BAMY was a monomer of 60 kD, hydrolyzing soluble starch with optimal activity between pH 6.0 and 8.0. The activity of recombinant TR-BAMY was strictly dependent on redox potential with an Em,7.0 of -302 +/- 14 mV. Thioredoxins f1, m1, and y1 of Arabidopsis were all able to mediate the reductive activation of oxidized TR-BAMY. Site-specific mutants showed that TR-BAMY oxidative inhibition depended on the formation of a disulfide bridge between Cys-32 and Cys-470. Consistent with TR-BAMY redox dependency, total beta-amylase activity in Arabidopsis chloroplasts was partially redox regulated and required reducing conditions for full activation. In Arabidopsis, TR-BAMY transcripts were detected in leaves, roots, flowers, pollen, and seeds. TR-BAMY may be the only beta-amylase of nonphotosynthetic plastids suggesting a redox regulation of starch metabolism in these organelles. In leaves, where chloroplast-targeted beta-amylase is involved in physiological degradation of starch in the dark, TR-BAMY is proposed to participate to a redox-regulated pathway of starch degradation under specific stress conditions.

  18. Cloning, Purification and Characterization of a Highly Thermostable Amylase Gene of Thermotoga petrophila into Escherichia coli.

    PubMed

    Zafar, Asma; Aftab, Muhammad Nauman; ud Din, Zia; Aftab, Saima; Iqbal, Irfana; ul Haq, Ikram

    2016-02-01

    A putative α-amylase gene of Thermotoga petrophila was cloned and expressed in Escherichia coli BL21 (DE3) using pET-21a (+), as an expression vector. The growth conditions were optimized for maximal expression of the α-amylase using various parameters, such as pH, temperature, time of induction and addition of an inducer. The optimum temperature and pH for the maximum expression of α-amylase were 22 °C and 7.0 pH units, respectively. Purification of the recombinant enzyme was carried out by heat treatment method, followed by ion exchange chromatography with 34.6-fold purification having specific activity of 126.31 U mg(-1) and a recovery of 56.25%. Molecular weight of the purified α-amylase, 70 kDa, was determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The enzyme was stable at 100 °C temperature and at pH of 7.0. The enzyme activity was increased in the presence of metal ions especially Ca(+2) and decreased in the presence of EDTA indicating that the α-amylase was a metalloenzyme. However, addition of 1% Tween 20, Tween 80 and β-mercaptoethanol constrained the enzyme activity to 87, 96 and 89%, respectively. No considerable effect of organic solvents (ethanol, methanol, isopropanol, acetone and n-butanol) was observed on enzyme activity. With soluble starch as a substrate, the enzyme activity under optimized conditions was 73.8 U mg(-1). The α-amylase enzyme was active to hydrolyse starch forming maltose.

  19. Componential profile and amylase inhibiting activity of phenolic compounds from Calendula officinalis L. leaves.

    PubMed

    Olennikov, Daniil N; Kashchenko, Nina I

    2014-01-01

    An ethanolic extract and its ethyl acetate-soluble fraction from leaves of Calendula officinalis L. (Asteraceae) were found to show an inhibitory effect on amylase. From the crude extract fractions, one new phenolic acid glucoside, 6'-O-vanilloyl-β-D-glucopyranose, was isolated, together with twenty-four known compounds including five phenolic acid glucosides, five phenylpropanoids, five coumarins, and nine flavonoids. Their structures were elucidated based on chemical and spectral data. The main components, isoquercitrin, isorhamnetin-3-O-β-D-glucopyranoside, 3,5-di-O-caffeoylquinic acid, and quercetin-3-O-(6''-acetyl)-β-D-glucopyranoside, exhibited potent inhibitory effects on amylase.

  20. [Flow rate, amylase and protein content of parotid saliva in sialadenosis (author's transl)].

    PubMed

    Chilla, R; Opaitz, M; Arglebe, C

    1978-03-01

    Flow rate, protein concentration and amylase activity of parotid saliva were investigated in 17 patients with sialadenosis. The results were compared with the data obtained from 90 healthy controls. Total protein and amylase concentrations of saliva did not change although, under the influence of sialadenosis, the parotid gland clearly shows ultrastructural signs of disturbed protein secretion. Also the flow rates of parotid saliva were the same in sialadenosis patients and the control group. This can be explained by the patho-physiology of parotid secretion from the sialadenotic gland.

  1. Biochemical approaches of increasing thermostability of beta-amylase from Bacillus megaterium B6.

    PubMed

    Ray, R R; Jana, S C; Nanda, G

    1994-12-12

    Studies on the irreversible thermoinactivation of beta-amylase from Bacillus megaterium B6 exposed to 60 degrees C revealed that the deactivation mechanism probably results from the oxidation of thiols present at the active site of the enzyme. Several attempts were made to increase its thermostability, which indicated that Mn2+ played a key role in determining thermostability and partially reactivating the inactivated enzyme. Immobilization of beta-amylase through gel-entrapment and covalent crosslinking brought about a remarkable increase in thermotolerance with about a 14-fold increase in catalytic half-life.

  2. Partial Purification and Characterization of a Thermostable Actinomycete beta-Amylase.

    PubMed

    Obi, S K; Odibo, F J

    1984-03-01

    A thermostable amylase, possibly a beta-amylase from Thermoactinomyces sp. no. 2 isolated from soil, is reported. The enzyme was purified 36-fold by acetone precipitation, ion-exchange chromatography, and Sephadex G-200 gel filtration, and the molecular weight was estimated at 31,600. The enzyme was characterized by demonstration of optimum activity at 60 degrees C and pH 7 and by retention of 70% activity at 70 degrees C (30 min). It was stimulated by Mn and Fe but strongly inhibited by Hg. Maltose was the only detectable product of hydrolysis of starches and was quantitatively highest in plantain starch hydrolysate.

  3. Phenolic group on A-ring is key for dracoflavan B as a selective noncompetitive inhibitor of α-amylase.

    PubMed

    Toh, Zhi Siang; Wang, Hongyu; Yip, Yew Mun; Lu, Yuyun; Lim, Benedict Jeffrey Ang; Zhang, Daiwei; Huang, Dejian

    2015-12-15

    A high throughput assay was applied to guide the isolation of a new pancreatic α-amylase inhibitor, dracoflavan B, from the dragon's blood resin from Daemonorops draco. Applying C18 column, we successfully isolated both diastereomers and their structures verified by (1)H NMR spectra in comparison with the literature values. Their activity in inhibition of pancreatic α-amylase with comparable IC50 values of 23μM (A type) and 27μM (B type) that are similar to that of acarbose. Dracoflavan B shows much weaker activity in inhibiting bacterial α-amylase and no activity towards fungal α-amylase. Moreover, both isomers show no inhibitory activity towards mammalian α-glucosidase. Kinetic analysis revealed that using starch as the substrate, dracoflavan B was a non-competitive α-amylase inhibitor with a Ki value of 11.7μM. Lack of α-amylase inhibition for proanthocyanidin A2 dimer demonstrated that dracoflavan B hydrophobic nature of the B, A', C' and B' rings are important for its α-amylase inhibition. In addition, selective chemical modification studies revealed that the phenolic group is also vital to dracoflavan B for its pancreatic α-amylase inhibition activity. Without the A ring phenolic hydrogen bond donor, the derivatives of dracoflavan B showed detrimental α-amylase inhibition. On the contrary, galloylation on the A ring phenolic OH group enhanced the activity as shown by the low IC50 (12μM) against α-amylase which is 56% more potent as compared to dracoflavan B.

  4. Efficient synthesis and secretion of a thermophilic alpha-amylase by protein-producing Bacillus brevis 47 carrying the Bacillus stearothermophilus amylase gene.

    PubMed Central

    Tsukagoshi, N; Iritani, S; Sasaki, T; Takemura, T; Ihara, H; Idota, Y; Yamagata, H; Udaka, S

    1985-01-01

    Bacillus subtilis and Bacillus brevis 47-5, carrying the Bacillus stearothermophilus alpha-amylase gene on pUB110 (pBAM101), synthesized the same alpha-amylase as the donor strain as determined by the enzyme's thermal stability and NH2-terminal amino acid sequence. Regardless of the host, the 34-amino acid signal peptide of the enzyme was processed at exactly the same site between two alanine residues. B. brevis 47-5(pBAM101) secreted the enzyme most efficiently of the hosts examined, 100, 15, and 5 times more than B. stearothermophilus, Escherichia coli HB101(pH1301), and B. subtilis 1A289(pBAM101), respectively. The efficient secretion of the enzyme in B. brevis 47-5(pBAM101) was suggested to be due to the unique properties of the cell wall of this organism. Images PMID:2999073

  5. Dose- and tissue-specific interaction of monoterpenes with the gibberellin-mediated release of potato tuber bud dormancy, sprout growth and induction of α-amylases and β-amylases.

    PubMed

    Rentzsch, Sonja; Podzimska, Dagmara; Voegele, Antje; Imbeck, Madeleine; Müller, Kerstin; Linkies, Ada; Leubner-Metzger, Gerhard

    2012-01-01

    Gibberellins (GA) are involved in bud dormancy release in several species. We show here that GA-treatment released bud dormancy, initiated bud sprouting and promoted sprout growth of excised potato tuber bud discs ('eyes'). Monoterpenes from peppermint oil (PMO) and S-(+)-carvone (CAR) interact with the GA-mediated bud dormancy release in a hormesis-type response: low monoterpene concentrations enhance dormancy release and the initiation of bud sprouting, whereas high concentrations inhibit it. PMO and CAR did, however, not affect sprout growth rate after its onset. We further show that GA-induced dormancy release is associated with tissue-specific regulation of α- and β-amylases. Molecular phylogenetic analysis shows that potato α-amylases cluster into two distinct groups: α-AMY1 and α-AMY2. GA-treatment induced transcript accumulation of members of both α-amylase groups, as well as α- and β-amylase enzyme activity in sprout and 'sub-eye' tissues. In sprouts, CAR interacts with the GA-mediated accumulation of α-amylase transcripts in an α-AMY2-specific and dose-dependent manner. Low CAR concentrations enhance the accumulation of α-AMY2-type α-amylase transcripts, but do not affect the α-AMY1-type transcripts. Low CAR concentrations also enhance the accumulation of α- and β-amylase enzyme activity in sprouts, but not in 'sub-eye' tissues. In contrast, high CAR concentrations have no appreciable effect in sprouts on the enzyme activities and the α-amylase transcript abundances of either group. The dose-dependent effects on the enzyme activities and the α-AMY2-type α-amylase transcripts in sprouts are specific for CAR but not for PMO. Different monoterpenes therefore may have specific targets for their interaction with hormone signalling pathways.

  6. Occurrence of toxicity among protease, amylase, and color mutants of a nontoxic soy sauce koji mold

    SciTech Connect

    Kalayanamitr, A.; Bhumiratana, A.; Flegel, T.W.; Glinsukon, T.; Shinmyo, A.

    1987-08-01

    A soy sauce koji mold, Aspergillus flavus var. columnaris Raper and Fennel (ATCC 44310), was treated with UV irradiation to obtain mutant strains possessing high protease activities, high amylase activities, and light-colored conidia. Selected mutant strains were tested for toxicity, and some were found acutely toxic to weanling rats, although all were negative for aflatoxin production.

  7. Validation of an assay for quantification of alpha-amylase in saliva of sheep

    PubMed Central

    Fuentes-Rubio, Maria; Fuentes, Francisco; Otal, Julio; Quiles, Alberto; Hevia, María Luisa

    2016-01-01

    The objective of this study was to develop a time-resolved immunofluorometric assay (TR-IFMA) for quantification of salivary alpha-amylase in sheep. For that purpose, after the design of the assay, an analytical and a clinical validation were carried out. The analytical validation of the assay showed intra- and inter-assay coefficients of variation (CVs) of 6.1% and 10.57%, respectively and an analytical limit of detection of 0.09 ng/mL. The assay also demonstrated a high level of accuracy, as determined by linearity under dilution. For clinical validation, a model of acute stress testing was conducted to determine whether expected significant changes in alpha-amylase were picked up in the newly developed assay. In that model, 11 sheep were immobilized and confronted with a sheepdog to induce stress. Saliva samples were obtained before stress induction and 15, 30, and 60 min afterwards. Salivary cortisol was measured as a reference of stress level. The results of TR-IFMA showed a significant increase (P < 0.01) in the concentration of alpha-amylase in saliva after stress induction. The assay developed in this study could be used to measure salivary alpha-amylase in the saliva of sheep and this enzyme could be a possible noninvasive biomarker of stress in sheep. PMID:27408332

  8. Validation of an assay for quantification of alpha-amylase in saliva of sheep.

    PubMed

    Fuentes-Rubio, Maria; Fuentes, Francisco; Otal, Julio; Quiles, Alberto; Hevia, María Luisa

    2016-07-01

    The objective of this study was to develop a time-resolved immunofluorometric assay (TR-IFMA) for quantification of salivary alpha-amylase in sheep. For that purpose, after the design of the assay, an analytical and a clinical validation were carried out. The analytical validation of the assay showed intra- and inter-assay coefficients of variation (CVs) of 6.1% and 10.57%, respectively and an analytical limit of detection of 0.09 ng/mL. The assay also demonstrated a high level of accuracy, as determined by linearity under dilution. For clinical validation, a model of acute stress testing was conducted to determine whether expected significant changes in alpha-amylase were picked up in the newly developed assay. In that model, 11 sheep were immobilized and confronted with a sheepdog to induce stress. Saliva samples were obtained before stress induction and 15, 30, and 60 min afterwards. Salivary cortisol was measured as a reference of stress level. The results of TR-IFMA showed a significant increase (P < 0.01) in the concentration of alpha-amylase in saliva after stress induction. The assay developed in this study could be used to measure salivary alpha-amylase in the saliva of sheep and this enzyme could be a possible noninvasive biomarker of stress in sheep.

  9. How Do Detergents Work? A Qualitative Assay to Measure Amylase Activity

    ERIC Educational Resources Information Center

    Novo, M. Teresa; Casanoves, Marina; Garcia-Vallvé, Santi; Pujadas, Gerard; Mulero, Miquel; Valls, Cristina

    2016-01-01

    We present a practical activity focusing on two main goals: to give learners the opportunity to experience how the scientific method works and to increase their knowledge about enzymes in everyday situations. The exercise consists of determining the amylase activity of commercial detergents. The methodology is based on a qualitative assay using a…

  10. Cortisol and α-Amylase Secretion Patterns between and within Depressed and Non-Depressed Individuals

    PubMed Central

    Booij, Sanne H.; Bos, Elisabeth H.; Bouwmans, Mara E. J.; van Faassen, Martijn; Kema, Ido P.; Oldehinkel, Albertine J.; de Jonge, Peter

    2015-01-01

    Objectives Associations between biological stress markers and depression are inconsistent across studies. We assessed whether inter- and intra-individual variability explain these inconsistencies. Methods Pair-matched depressed and non-depressed participants (N = 30) collected saliva thrice a day for 30 days, resulting in 90 measurements per individual. The relationships between measures of stress-system function and depression were examined at the group level by means of mixed model analyses, and at the individual level by means of pair-matched comparisons. The analyses were repeated after adjusting for time-varying lifestyle factors by means of time-series regression analyses. Results Cortisol and α-amylase levels were higher, the α-amylase/cortisol ratio larger, and the daily cortisol slope steeper in the depressed compared to the non-depressed group. Adjusting for lifestyle factors and antidepressant use reduced the associations under study. In 40%–60% of the matched comparisons, depressed individuals had higher cortisol and α-amylase levels, a larger α-amylase/cortisol ratio, and a steeper daily slope than their non-depressed match, regardless of adjustment. Conclusions Our group-level findings were mostly in line with the literature but generalization to individuals appeared troublesome. Findings of studies on this topic should be interpreted with care, because in clinical practice the focus is on individuals instead of groups. PMID:26148294

  11. Scandium Stimulates the Production of Amylase and Bacilysin in Bacillus subtilis▿

    PubMed Central

    Inaoka, Takashi; Ochi, Kozo

    2011-01-01

    We investigated the effects of rare earth elements on enzyme production and secondary metabolism in Bacillus subtilis. Addition of scandium to the growth medium stimulated the production of both amylase and bacilysin at the transcriptional level, thus showing scandium to have a remarkable impact in B. subtilis. PMID:21948839

  12. Association of Novel Domain in Active Site of Archaic Hyperthermophilic Maltogenic Amylase from Staphylothermus marinus*

    PubMed Central

    Jung, Tae-Yang; Li, Dan; Park, Jong-Tae; Yoon, Se-Mi; Tran, Phuong Lan; Oh, Byung-Ha; Janeček, Štefan; Park, Sung Goo; Woo, Eui-Jeon; Park, Kwan-Hwa

    2012-01-01

    Staphylothermus marinus maltogenic amylase (SMMA) is a novel extreme thermophile maltogenic amylase with an optimal temperature of 100 °C, which hydrolyzes α-(1–4)-glycosyl linkages in cyclodextrins and in linear malto-oligosaccharides. This enzyme has a long N-terminal extension that is conserved among archaic hyperthermophilic amylases but is not found in other hydrolyzing enzymes from the glycoside hydrolase 13 family. The SMMA crystal structure revealed that the N-terminal extension forms an N′ domain that is similar to carbohydrate-binding module 48, with the strand-loop-strand region forming a part of the substrate binding pocket with several aromatic residues, including Phe-95, Phe-96, and Tyr-99. A structural comparison with conventional cyclodextrin-hydrolyzing enzymes revealed a striking resemblance between the SMMA N′ domain position and the dimeric N domain position in bacterial enzymes. This result suggests that extremophilic archaea that live at high temperatures may have adopted a novel domain arrangement that combines all of the substrate binding components within a monomeric subunit. The SMMA structure provides a molecular basis for the functional properties that are unique to hyperthermophile maltogenic amylases from archaea and that distinguish SMMA from moderate thermophilic or mesophilic bacterial enzymes. PMID:22223643

  13. Production, purification and characterization of an extracellular alpha-amylase enzyme isolated from Aspergillus flavus.

    PubMed

    Abou-Zeid, A M

    1997-01-01

    Filamentous fungi isolated from cereals were screened for their ability to produce alpha-amylase (1,4-alpha-glucan glucanohydrolase, EC 3.2.1.1). A selected strain identified as Aspergillus flavus showed high enzymatic activity. A single extracellular alpha-amylase was purified to homogeneity by a starch adsorption method. The molecular weight (M(r)) of the A. flavus alpha-amylase was approximately 75,000 +/- 3,000 by polyacrylamide gel electrophoresis (PAGE) and that of the subunit was approximately 75,000 +/- 3000 SDS-PAGE. The optimal activity of the purified enzyme was achieved at pH 7.0 and 30 degrees C. K+ ions increased the alpha-amylase activity, but Mg2+ did not greatly affect enzyme activity. Mn2+, Zn2+, Cu2+ and Fe3+ ions strongly inhibited the enzyme activity. The products of hydrolysis of native starch by the A. flavus enzyme were mainly glucose as well as unidentified oligosaccharides.

  14. Molecular cloning and characterization of amylase from soil metagenomic library derived from Northwestern Himalayas.

    PubMed

    Sharma, Sarika; Khan, Farrah Gul; Qazi, Ghulam Nabi

    2010-05-01

    The increasing demand for novel biocatalysts stimulates exploration of resources from soil. Metagenomics, a culture independent approach, represent a sheer unlimited resource for discovery of novel biocatalysts from uncultured microorganisms. In this study, a soil-derived metagenomic library containing 90,700 recombinants was constructed and screened for lipase, cellulase, protease and amylase activity. A gene (pAMY) of 909 bp encoding for amylase was found after the screening of 35,000 Escherichia coli clones. Amino acid sequence comparison and phylogenetic analysis indicated that pAMY was closely related to uncultured bacteria. The molecular mass of pAMY was estimated about 38 kDa by sodium dodecyl sulphate polyacrylamide gel electrophoresis. Amylase activity was determined using soluble starch, amylose, glycogen and maltose as substrates. The maximal activity (2.46 U/mg) was observed at 40 degrees C under nearly neutral pH conditions with amylose; whereas it retains 90% of its activity at low temperature with all the substrates used in this study. The ability of pAMY to work at low temperature is unique for amylases reported so far from microbes of cultured and uncultured division.

  15. The effect of glycemic control on CEA, CA 19-9, amylase and lipase levels

    PubMed Central

    Ata, Naim; Dal, Kürşat; Kucukazman, Metin; Karakaya, Serdar; Unsal, Oktay; Dagdeviren, Murat; Akın, Kadir O.; Baser, Salih; Beyan, Esin; Ertugrul, Derun T.

    2015-01-01

    Background Diabetes mellitus is closely related to pancreas cancer. In this study we aimed to investigate the effect of hyperglycemia on tumor and inflammation markers, as well as pancreatic exocrine functions. Methods A total of 98 consecutive diabetic patients with poor glycemic control, and 50 healthy controls were included in the study. We measured hsCRP, erythrocyte sedimentation rate (ESR), CA19-9, CEA, amylase and lipase in addition to routine biochemistry tests, before and after euglycemia was achieved. Results Fasting blood glucose, HbA1c, CA19-9, CEA, hsCRP, ESR, triglycerides, AST, ALT, GGT, ALP, total cholesterol and LDL-C levels decreased significantly with the regulation of glycemic control. Amylase and lipase levels increased with the regulation of glycemic control. After glycemic control, CA19-9 and CEA levels were still higher, whereas amylase and lipase levels were still lower in the diabetic group compared with the control group. Basal HbA1c showed significant correlation with CA19-9, CEA, amylase and lipase. Conclusions We propose to repeat observations of tumor markers after hyperglycemia is resolved, in order to avoid unnecessary invasive tests. Our data also suggest that pancreatic exocrine function was improved with lowering blood glucose in a short period of time. PMID:28352671

  16. Occurrence of toxicity among protease, amylase, and color mutants of a nontoxic soy sauce koji mold.

    PubMed Central

    Kalayanamitr, A; Bhumiratana, A; Flegel, T W; Glinsukon, T; Shinmyo, A

    1987-01-01

    A soy sauce koji mold, Aspergillus flavus var. columnaris Raper and Fennel (ATCC 44310), was treated with UV irradiation to obtain mutant strains possessing high protease activities, high amylase activities, and light-colored conidia. Selected mutant strains were tested for toxicity, and some were found acutely toxic to weanling rats, although all were negative for aflatoxin production. PMID:2444160

  17. Improvement of Starch Digestion Using α-Amylase Entrapped in Pectin-Polyvinyl Alcohol Blend

    PubMed Central

    Cruz, Maurício; Fernandes, Kátia; Cysneiros, Cristine; Nassar, Reginaldo; Caramori, Samantha

    2015-01-01

    Polyvinyl alcohol (PVA) and pectin blends were used to entrap α-amylase (Termamyl) using glutaraldehyde as a cross-linker. The effect of glutaraldehyde concentration (0.25, 0.5, 0.75, 1.0, and 1.25%) on the activity of the immobilized enzyme and rate of enzyme released was tested during a 24 h period. Characteristics of the material, such as scanning electron microscopy (SEM), tensile strength (TS), elongation, and rate of dissolution in water (pH 5.7), ruminal buffering solution (pH 7.0), and reactor containing 0.1 mol L−1 sodium phosphate buffer (pH 6.5), were also analyzed. SEM results showed that the surfaces of the pectin/PVA/amylase films were highly irregular and rough. TS values increased as a function of glutaraldehyde concentration, whereas percentage of elongation (%E) decreased. Pectin/PVA/amylase films presented similar values of solubility in the tested solvents. The material obtained with 0.25% glutaraldehyde performed best with repeated use (active for 24 h), in a phosphate buffer reactor. By contrast, the material obtained with 1.25% glutaraldehyde presented higher performance during in vitro testing using an artificial rumen. The results suggest that pectin/PVA/amylase is a highly promising material for biotechnological applications. PMID:25949991

  18. Coupled reactions of immobilized enzymes and immobilized substrates: clinical application as exemplified by amylase assay.

    PubMed

    Barabino, R C; Gray, D N; Keyes, M H

    1978-08-01

    We described a partitioned enzyme-sensor system, which incorporates an immoblized substrate and three or more discrete immobilized enzymes. This instrument measures alpha-amylase activity by passing the solution containing alpha-amylase over a column packed with immobilized starch. The resulting oligosaccharides are successively exposed to a column or columns containing immobolized glucose oxidase, catalase, glucoamylase or maltase, and glucose oxidase. The resulting hydrogen peroxide is detected by a three-electrode amperometric cell. All immobilized reagents were immobilized on a particulate, porous alumina to allow rapid and constant flow rate. With use of less than optimum immobilized reagents, alpha-amylase activity has been measured from about 5 to 200 kU/liter with a 50 microliter sample size. Lack of sensitivity is predominantly attributable to the low activity and low stability of immobilized maltase and glucoamylase. We believe that a clinical test using this system is feasible and desirable because the immobilized reagent system should allow for testing of alpha-amylase with excellent precision, convenience to the operator, and low cost.

  19. Amy63, a novel type of marine bacterial multifunctional enzyme possessing amylase, agarase and carrageenase activities

    PubMed Central

    Liu, Ge; Wu, Shimei; Jin, Weihua; Sun, Chaomin

    2016-01-01

    A multifunctional enzyme is one that performs multiple physiological functions, thus benefiting the organism. Characterization of multifunctional enzymes is important for researchers to understand how organisms adapt to different environmental challenges. In the present study, we report the discovery of a novel multifunctional enzyme Amy63 produced by marine bacterium Vibrio alginolyticus 63. Remarkably, Amy63 possesses amylase, agarase and carrageenase activities. Amy63 is a substrate promiscuous α-amylase, with the substrate priority order of starch, carrageenan and agar. Amy63 maintains considerable amylase, carrageenase and agarase activities and stabilities at wide temperature and pH ranges, and optimum activities are detected at temperature of 60 °C and pH of 6.0, respectively. Moreover, the heteroexpression of Amy63 dramatically enhances the ability of E. coli to degrade starch, carrageenan and agar. Motif searching shows three continuous glycosyl hydrolase 70 (GH70) family homologs existed in Amy63 encoding sequence. Combining serial deletions and phylogenetic analysis of Amy63, the GH70 homologs are proposed as the determinants of enzyme promiscuity. Notably, such enzymes exist in all kingdoms of life, thus providing an expanded perspective on studies of multifunctional enzymes. To our knowledge, this is the first report of an amylase having additional agarase and carrageenase activities. PMID:26725302

  20. Optimization of Amylase Applications in Raw Sugar Manufacture that Directly Concern Refiners

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentrations in raw sugar if starch control is not improved. Most commercial alpha-amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to...

  1. Optimization of Amylase Applications in Raw Sugar Manufacture that Directly Concern Refiners

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years there have been warnings by some US refineries that there may be a penalty for high starch concentrations in raw sugar if starch control is not improved. Most commercial alpha-amylases used by the US sugar industry to control starch have intermediate temperature stability (up to 85 ...

  2. Optimization of Alpha-Amylase Application in U.S. Factories

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentrations in raw sugar if starch control is not improved. Most commercial alpha-amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to...

  3. The noncatalytic triad of alpha-amylases: a novel structural motif involved in conformational stability.

    PubMed

    Marx, Jean-Claude; Poncin, Johan; Simorre, Jean-Pierre; Ramteke, Pramod W; Feller, Georges

    2008-02-01

    Chloride-activated alpha-amylases contain a noncatalytic triad, independent of the glycosidic active site, perfectly mimicking the catalytic triad of serine-proteases and of other active serine hydrolytic enzymes. Mutagenesis of Glu, His, and Ser residues in various alpha-amylases shows that this pattern is a structural determinant of the enzyme conformation that cannot be altered without losing the intrinsic stability of the protein. (1)H-(15)N NMR spectra of a bacterial alpha-amylase reveal proton signals that are identical with the NMR signature of catalytic triads and especially a deshielded proton involving a protonated histidine and displaying properties similar to that of a low barrier hydrogen bond. It is proposed that the H-bond between His and Glu of the noncatalytic triad is an unusually strong interaction, responsible for the observed NMR signal and for the weak stability of the triad mutants. Furthermore, a stringent template-based search of the Protein Data Bank demonstrated that this motif is not restricted to alpha-amylases, but is also found in 80 structures from 33 different proteins, amongst which SH2 domain-containing proteins are the best representatives.

  4. Optimization of Amylase Application in Raw Sugar Manufacture. Part II: Factory Trials

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentrations in raw sugar if starch control is not improved. Most commercial amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to 85 de...

  5. The bean. alpha. -amylase inhibitor is encoded by a lectin gene

    SciTech Connect

    Moreno, J.; Altabella, T.; Chrispeels, M.J. )

    1989-04-01

    The common bean, Phaseolus vulgaris, contains an inhibitor of insect and mammalian {alpha}-amylases that does not inhibit plant {alpha}-amylase. This inhibitor functions as an anti-feedant or seed-defense protein. We purified this inhibitor by affinity chromatography and found that it consists of a series of glycoforms of two polypeptides (Mr 14,000-19,000). Partial amino acid sequencing was carried out, and the sequences obtained are identical with portions of the derived amino acid sequence of a lectin-like gene. This lectin gene encodes a polypeptide of MW 28,000, and the primary in vitro translation product identified by antibodies to the {alpha}-amylase inhibitor has the same size. Co- and posttranslational processing of this polypeptide results in glycosylated polypeptides of 14-19 kDa. Our interpretation of these results is that the bean lectins constitute a gene family that encodes diverse plant defense proteins, including phytohemagglutinin, arcelin and {alpha}-amylase inhibitor.

  6. Enhancing Maritime Education and Training: Measuring a Ship Navigator's Stress Based on Salivary Amylase Activity

    ERIC Educational Resources Information Center

    Murai, Koji; Wakida, Shin-Ichi; Miyado, Takashi; Fukushi, Keiichi; Hayashi, Yuji; Stone, Laurie C.

    2009-01-01

    Purpose: The purpose of this paper is to propose that the measurement of salivary amylase activity is an effective index to evaluate the stress of a ship navigator for safe navigation training and education. Design/methodology/approach: Evaluation comes from the simulator and actual on-board experiments. The subjects are real captains who have…

  7. Partial characterization of cold active amylases and proteases of Streptomyces sp. from Antarctica

    PubMed Central

    Cotârleţ, Mihaela; Negoiţă, Teodor Gh.; Bahrim, Gabriela E.; Stougaard, Peter

    2011-01-01

    The aim of this study was to isolate novel enzyme-producing bacteria from vegetation samples from East Antarctica and also to characterize them genetically and biochemically in order to establish their phylogeny. The ability to grow at low temperature and to produce amylases and proteases cold-active was also tested. The results of the 16S rRNA gene sequence analysis showed that the 4 Alga rRNA was 100% identical to the sequences of Streptomyces sp. rRNA from Norway and from the Solomon Islands. The Streptomyces grew well in submerged system at 20°C, cells multiplication up to stationary phase being drastically increased after 120 h of submerged cultivation. The beta-amylase production reached a maximum peak after seven days, while alpha-amylase and proteases were performing biosynthesis after nine days of submerged cultivation at 20°C. Newly Streptomyces were able to produce amylase and proteases in a cold environment. The ability to adapt to low temperature of these enzymes could make them valuable ingredients for detergents, the food industry and bioremediation processes which require low temperatures. PMID:24031702

  8. Halotolerant Ability and α-Amylase Activity of Some Saltwater Fungal Isolates

    PubMed Central

    Niknejad, Farhad; Moshfegh, Mahsa; Najafzadeh, Mohammad Javad; Houbraken, Jos; Rezaei, Shahla; Zarrini, Gholamreza; Faramarzi, Mohammad Ali; Nafissi-Varcheh, Nastaran

    2013-01-01

    Four halotolerant fungal isolates originating from the saltwater Lake Urmia in Iran were selected during a screening program for salt resistance and α-amylase activity. The isolates were identified based on sequencing the ITS region and a part of the β-tubulin gene, as Penicillium chrysogenum (isolate U1; CBS 132820), Fusarium incarnatum (isolate U2; CBS 132821), and Penicillium polonicum (isolate U3; CBS 132822, and isolate U4; CBS 132823). The growth of these isolates was determined by measuring the colony diameter and mycelia dry weight in Sabouraud dextrose agar and yeast nitrogen base medium supplemented with NaCl, KCl, and LiCl. Isolate U4 showed a growth up in 15% NaCl and U1 was the only isolate that could grow in 20% KCl. None of the strains grew in a media containing LiCl. The salt supplemented medium did not increase the size of colony diameter in all isolates (p > 0.05). The ability of the selected isolates for amylase production was quantitatively tested and showed that P. polonicum isolate U4 was the most potent producer of amylase with a yield of 260.9 U/L after 60 h, whereas P. polonicum isolate U3 was the lowest one with a production level of 97.9 U/L after 48 h. P. polonicum isolate U4 could be a suitable candidate for production of amylase on an industrial scale after optimization. PMID:24250679

  9. The gastric/pancreatic amylase ratio predicts postoperative pancreatic fistula with high sensitivity and specificity.

    PubMed

    Jin, Shuo; Shi, Xiao-Ju; Sun, Xiao-Dong; Zhang, Ping; Lv, Guo-Yue; Du, Xiao-Hong; Wang, Si-Yuan; Wang, Guang-Yi

    2015-01-01

    This article aims to identify risk factors for postoperative pancreatic fistula (POPF) and evaluate the gastric/pancreatic amylase ratio (GPAR) on postoperative day (POD) 3 as a POPF predictor in patients who undergo pancreaticoduodenectomy (PD).POPF significantly contributes to mortality and morbidity in patients who undergo PD. Previously identified predictors for POPF often have low predictive accuracy. Therefore, accurate POPF predictors are needed.In this prospective cohort study, we measured the clinical and biochemical factors of 61 patients who underwent PD and diagnosed POPF according to the definition of the International Study Group of Pancreatic Fistula. We analyzed the association between POPF and various factors, identified POPF risk factors, and evaluated the predictive power of the GPAR on POD3 and the levels of serum and ascites amylase.Of the 61 patients, 21 developed POPF. The color of the pancreatic drain fluid, POD1 serum, POD1 median output of pancreatic drain fluid volume, and GPAR were significantly associated with POPF. The color of the pancreatic drain fluid and high GPAR were independent risk factors. Although serum and ascites amylase did not predict POPF accurately, the cutoff value was 1.24, and GPAR predicted POPF with high sensitivity and specificity.This is the first report demonstrating that high GPAR on POD3 is a risk factor for POPF and showing that GPAR is a more accurate predictor of POPF than the previously reported amylase markers.

  10. Improvement of starch digestion using α-amylase entrapped in pectin-polyvinyl alcohol blend.

    PubMed

    Cruz, Maurício; Fernandes, Kátia; Cysneiros, Cristine; Nassar, Reginaldo; Caramori, Samantha

    2015-01-01

    Polyvinyl alcohol (PVA) and pectin blends were used to entrap α-amylase (Termamyl) using glutaraldehyde as a cross-linker. The effect of glutaraldehyde concentration (0.25, 0.5, 0.75, 1.0, and 1.25%) on the activity of the immobilized enzyme and rate of enzyme released was tested during a 24 h period. Characteristics of the material, such as scanning electron microscopy (SEM), tensile strength (TS), elongation, and rate of dissolution in water (pH 5.7), ruminal buffering solution (pH 7.0), and reactor containing 0.1 mol L(-1) sodium phosphate buffer (pH 6.5), were also analyzed. SEM results showed that the surfaces of the pectin/PVA/amylase films were highly irregular and rough. TS values increased as a function of glutaraldehyde concentration, whereas percentage of elongation (%E) decreased. Pectin/PVA/amylase films presented similar values of solubility in the tested solvents. The material obtained with 0.25% glutaraldehyde performed best with repeated use (active for 24 h), in a phosphate buffer reactor. By contrast, the material obtained with 1.25% glutaraldehyde presented higher performance during in vitro testing using an artificial rumen. The results suggest that pectin/PVA/amylase is a highly promising material for biotechnological applications.

  11. The effect of oral stimulation on human parotid salivary flow rate and alpha-amylase secretion.

    PubMed

    Froehlich, D A; Pangborn, R M; Whitaker, J R

    1987-01-01

    Unilateral parotid saliva was collected from ten subjects following oral stimulation with water as baseline, and aqueous solutions of starch (2.5, 5.0, and 10%), sucrose (0.1, 0.2, and 0.4 M) sodium chloride (0.075, 0.15, and 0.30 M), and citric acid (0.005, 0.01, and 0.02 M). Salivary flow rate increased with increasing levels of each taste stimulus. At concentrations of equal taste intensity, citric acid evoked the highest flow rate, followed by sodium chloride and sucrose, while starch, in solution, had a minimal effect. Secretion rate patterns for total protein and alpha-amylase mirrored those of flow rate. The total protein and alpha-amylase concentrations of the saliva, and specific activity of alpha-amylase, were influenced by the type but not the concentration of stimulus, with citric acid stimulation resulting in the lowest concentrations and highest specific activity. Sodium ion (Na+) concentration generally increased with increasing stimulated flow rate, while K+, Ca++, and Mg++ concentrations remained relatively constant. Subjects with lower flow rates had a more concentrated saliva than those with high flow, except for Na+ concentration. Oral stimulation resulted in similar changes in protein and alpha-amylase secretion rates for the two groups.

  12. Interaction mechanism between green tea extract and human α-amylase for reducing starch digestion.

    PubMed

    Miao, Ming; Jiang, Bo; Jiang, Huan; Zhang, Tao; Li, Xingfeng

    2015-11-01

    This study evaluated the inhibitory effects of the green tea extract on human pancreatic α-amylase activity and its molecular mechanism. The green tea extract was composed of epicatechin (59.2%), epigallocatechin gallate (14.6%) and epicatechin gallate (26.2%) as determined by HPLC analysis. Enzyme activity measurement showed that % inhibition and IC50 of the green tea extract (10%, based on starch) were 63.5% and 2.07 mg/ml, respectively. The Michaelis-Menten constant remained unchanged but the maximal velocity decreased from 0.43 (control) to 0.07 mg/(ml × min) (4 mg/ml of the green tea extract), indicating that the green tea extract was an effective inhibitor against α-amylase with a non-competitive mode. The fluorescence data revealed that the green tea extract bound with α-amylase to form a new complex with static quenching mechanism. Docking study showed the epicatechin gallate in the green tea extract presented stronger affinity than epigallocatechin gallate, with more number of amino acid residues involved in amylase binding with hydrogen bonds and Van der Waals forces. Thus, the green tea extract could be used to manipulate starch digestion for potential health benefits.

  13. Inhibitory effect of hexane fraction from Myagropsis myagroides on pancreatic α-amylase in vitro.

    PubMed

    Pak, Won-Min; Kim, Koth-Bong-Woo Ri; Kim, Min-Ji; Cho, Ji-Young; Ahn, Dong-Hyun

    2015-03-01

    A Myagropsis myagroides (Mm) methanol extract showed α-amylase inhibitory activity of 13% at a concentration of 5 mg/ml. Results showed that the hexane fraction from the Mm methanol extract exhibited α-amylase inhibitory activity with an IC50 value of 4.24 mg/ml. The hexane fraction was separated using silica-gel column chromatography, and six subfractions were obtained. The fraction eluted with CHCl3:MeOH = 50:1 showed the highest α-amylase inhibitory activity with an IC50 value of 0.72 mg/ml. This fraction was purified using Sephadex LH-20 column chromatography and an octadecyl silica (ODS) Sepak cartridge, obtaining seven subfractions. Fraction (Fr.) 4 also showed a strong α-amylase inhibitory activity with an IC50 value of 0.75 mg/ml. Fr. 4 was purified by Sephadex LH-20 column chromatography and ODS Sepak cartridge, obtaining six subfractions. Fr. 4-2 was identified as sargachromanol I with an IC50 value of 0.40 mg/ml, and the inhibition pattern analyzed from Lineweaver-Burk plots revealed it to be an uncompetitive inhibitor. These results suggest that Mm has potential as a natural antidiabetes agent.

  14. Peer Victimization and Aggression: Moderation by Individual Differences in Salivary Cortisol and Alpha-Amylase

    ERIC Educational Resources Information Center

    Rudolph, Karen D.; Troop-Gordon, Wendy; Granger, Douglas A.

    2010-01-01

    This research examined whether variations in salivary measures of the hypothalamic-pituitary-adrenal axis (cortisol) and autonomic nervous system (alpha amylase [sAA]) contribute to individual differences in the association between peer victimization and aggression. Children (N = 132; M age = 9.46 years, SD = 0.33) completed a measure of peer…

  15. Chromosomal integration of recombinant alpha-amylase and glucoamylase genes in saccharomyces cerevisiae for starch conversion

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recombinant constructs of barley '-amylase and Lentinula edodes glucoamylase genes were integrated into the chromosomes of Saccharomyces cerevisiae. The insertion was confirmed by PCR amplification of the gene sequence in the chromosomes. The expression was analyzed by SDS-PAGE of the enzymes puri...

  16. Biochemistry, Structure and Function of Non-Wheat Proteins: Case Study of Barley ß-Amylase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The importance of a protein is not always evident and may be due to its multifunctional nature. ß-Amylase in seeds of barley (Hordeum vulgare L.) constitutes approximately 2% of the total protein in mature seeds and is assumed to be important when storage proteins are mobilized to support protein s...

  17. Fucoidan - An α-amylase inhibitor from Sargassum wightii with relevance to NIDDM.

    PubMed

    Lakshmana Senthil, S; Vinoth Kumar, T; Geetharamani, D; Suja, G; Yesudas, Rincy; Chacko, Amrutha

    2015-11-01

    The present experiment was conducted to screen the α-amylase inhibitory activity of fucoidan extracted from Sargassum wightii collected at the coastal area of Mandapam, Tamil Nadu, India. Fucoidan was extracted from the sporophyll of S. Wightii by ethanol and CaCl2 precipitation method. The average yield was 1.8±0.16% and the extracted fucoidan was found to contain 53±0.52% of fucose and 36±0.60% of sulphate. Structural elucidation (FT-IR and NMR) and in vitro α-amylase activity of purified fucoidon were performed. Fucoidan at the concentration of 62.5, 125 and 250μg exhibited 24.81, 62.50 and 99.24% inhibition against α-amylase, respectively, in a dose dependent manner. Fucoidan from S. wightii also inhibits α-glucosidase which clearly indicates dual inhibitory activity of the compound. The IC50 value against α-amylase of fucoidan is found to be 103.83μg which is more effective than that of acarbose (16mg).

  18. Extra EF hand unit (DX) mediated stabilization and calcium independency of α-amylase.

    PubMed

    Sadeghi, Leila; Khajeh, Khosro; Mollania, Nasrin; Dabirmanesh, Bahareh; Ranjbar, Bijan

    2013-03-01

    It is the common feature of α-amylases that calcium ion is required for their structural integrity and thermal stability. All amylases have at least one Ca(2+) per molecule; therefore amino acids involved in calcium binding are specific and conserved. In this study, sequence analysis revealed the presence of EF-hand-like motif in calcium-binding loop of Bacillus megaterium WHO (BMW)-amylase that was previously isolated from BMW. The EF-hand motif and its variants (EF-hand-like motif) are the most common calcium-binding motifs found in a large number of protein families. To investigate the effect of calcium ion on the thermal stability and activity of BMW-amylase, we used site-directed mutagenesis to replace histidine 58 with Asp (D), Ile (I), Tyr (Y), Phe (F), and Arg (R) at the seventh position of EF-hand-like motif. Upon the addition of an extra DX unit to the calcium-binding loop in H58D variant, thermal stability, catalytic activity, and chelating power of the enzyme improved due to higher affinity toward calcium. H58D variant demonstrated calcium independency compared to the wild type and other created mutants. Conformational changes in the presence and absence of Ca(2+) were monitored using fluorescence technique.

  19. Amylase and chitinase genes in Streptomyces lividans are regulated by reg1, a pleiotropic regulatory gene.

    PubMed Central

    Nguyen, J; Francou, F; Virolle, M J; Guérineau, M

    1997-01-01

    A regulatory gene, reg1, was identified in Streptomyces lividans. It encodes a 345-amino-acid protein (Reg1) which contains a helix-turn-helix DNA-binding motif in the N-terminal region. Reg1 exhibits similarity with the LacI/GalR family members over the entire sequence. It displays 95% identity with MalR (the repressor of malE in S. coelicolor), 65% identity with ORF-Sl (a putative regulatory gene of alpha-amylase of S. limosus), and 31% identity with CcpA (the carbon catabolite repressor in Bacillus subtilis). In S. lividans, the chromosomal disruption of reg1 affected the expression of several genes. The production of alpha-amylases of S. lividans and that of the alpha-amylase of S. limosus in S. lividans were enhanced in the reg1 mutant strains and relieved of carbon catabolite repression. As a result, the transcription level of the alpha-amylase of S. limosus was noticeably increased in the reg1 mutant strain. Moreover, the induction of chitinase production in S. lividans was relieved of carbon catabolite repression by glucose in the reg1 mutant strain, while the induction by chitin was lost. Therefore, reg1 can be regarded as a pleiotropic regulatory gene in S. lividans. PMID:9335287

  20. Production of α-amylase for the biosynthesis of gold nanoparticles using Streptomyces sp. MBRC-82.

    PubMed

    Manivasagan, Panchanathan; Venkatesan, Jayachandran; Kang, Kyong-Hwa; Sivakumar, Kannan; Park, Sun-Joo; Kim, Se-Kwon

    2015-01-01

    Marine actinobacterial synthesis of gold nanoparticles has good potential to develop simple, cost-effective and eco-friendly methods for production of important biomaterials. In this context, gold nanoparticles have attracted considerable attention in recent years, owing to their various applications. In this paper, we report on the production of α-amylase for the extracellular synthesis of gold nanoparticles using Streptomyces sp. MBRC-82. Medium composition and culture conditions for α-amylase production were statistically optimized. Plackett-Burman design was employed to find out the optimal medium constituents and culture conditions to enhance α-amylase production. Box-Behnken design revealed that three independent variables namely soluble starch (5.8484 g), peptone (3.5191 g), and NaCl (0.3829) significantly influenced α-amylase production. The gold nanoparticles were characterized by ultraviolet-visible (UV-vis) spectrometer, X-ray diffractometer (XRD), Fourier transform infrared spectroscopy (FTIR), scanning electron microscopy (SEM), energy dispersive X-ray analysis (EDXA), and transmission electron microscopy (TEM). The particles synthesized using the optimized enzyme activity ranged from 20 to 80 nm with an average particle size of 40 nm and therefore can be extended to various medicinal applications.

  1. Production of alpha-amylase from Aspergillus oryzae for several industrial applications in a single step.

    PubMed

    Porfirif, María C; Milatich, Esteban J; Farruggia, Beatriz M; Romanini, Diana

    2016-06-01

    A one-step method as a strategy of alpha-amylase concentration and purification was developed in this work. This methodology requires the use of a very low concentration of biodegradable polyelectrolyte (Eudragit(®) E-PO) and represents a low cost, fast, easy to scale up and non-polluting technology. Besides, this methodology allows recycling the polymer after precipitation. The formation of reversible soluble/insoluble complexes between alpha-amylase and the polymer Eudragit(®) E-PO was studied, and their precipitation in selected conditions was applied with bioseparation purposes. Turbidimetric assays allowed to determine the pH range where the complexes are insoluble (4.50-7.00); pH 5.50 yielded the highest turbidity of the system. The presence of NaCl (0.05M) in the medium totally dissociates the protein-polymer complexes. When the adequate concentration of polymer was added under these conditions to a liquid culture of Aspergillus oryzae, purification factors of alpha-amylase up to 7.43 and recoveries of 88% were obtained in a simple step without previous clarification. These results demonstrate that this methodology is suitable for the concentration and production of alpha-amylase from this source and could be applied at the beginning of downstream processing.

  2. Structure of Waxy Maize Starch Hydrolyzed by Maltogenic α-Amylase in Relation to Its Retrogradation.

    PubMed

    Grewal, Navneet; Faubion, Jon; Feng, Guohua; Kaufman, Rhett C; Wilson, Jeff D; Shi, Yong-Cheng

    2015-04-29

    Maltogenic α-amylase is widely used as an antistaling agent in bakery foods. The objective of this study was to determine the degree of hydrolysis (DH) and starch structure after maltogenic amylase treatments in relation to its retrogradation. Waxy maize starch was cooked and hydrolyzed to different degrees by a maltogenic amylase. High-performance anion-exchange chromatography and size exclusion chromatography were used to determine saccharides formed and the molecular weight (Mw) distributions of the residual starch structure, respectively. Chain length (CL) distributions of debranched starch samples were further related to amylopectin (AP) retrogradation. Differential scanning calorimetry (DSC) results showed the complete inhibition of retrogradation when starches were hydrolyzed to >20% DH. Mw and CL distributions of residual AP structure indicated that with an increase in %DH, a higher proportion of unit chains with degree of polymerization (DP) ≤9 and a lower proportion of unit chains with DP ≥17 were formed. A higher proportion of short outer AP chains that cannot participate in the formation of double helices supports the decrease in and eventual inhibition of retrogradation observed with the increase in %DH. These results suggest that the maltogenic amylase could play a powerful role in inhibiting the staling of baked products even at limited starch hydrolysis.

  3. Structural and biochemical features of acidic α-amylase of Bacillus acidicola.

    PubMed

    Sharma, Archana; Satyanarayana, T

    2013-10-01

    The investigation is aimed at understanding structure-function aspect of α-amylase of an acidophilic bacterium Bacillus acidicola (BAamy), which is Ca(2+)-independent and active at acidic pH of native starch, and thus, suits better in starch saccharification process. The CD spectroscopic data analysis revealed that the enzyme has 30% α-helices, 14.2% β-sheets, and 55.8% random coils at 60 °C and pH 4.0. Using Bacillus stearothermophilus α-amylase (BStA) as the template, 3-D structure of rBAamy has been proposed. A complete loss in α-amylase activity was recorded when the amino acid residues (D231, E261 and D328) were substituted that confirmed their role in catalysis. The CD studies indicated a decrease in the α-helices content below and beyond the optimum pH and temperature that suggests a critical role of α-helix in maintaining the structural conformation of the enzyme. Fluorescence-quenching by N-bromosuccinimide (NBS) suggested the role of tryptophan in maintaining structural integrity of α-amylase and that by acrylamide indicated interaction by simple collision process.

  4. A review on structure-activity relationship of dietary polyphenols inhibiting α-amylase.

    PubMed

    Xiao, Jianbo; Ni, Xiaoling; Kai, Guoyin; Chen, Xiaoqing

    2013-01-01

    The inhibitory effects of dietary polyphenols against α-amylase have attracted great interest among researchers. The aim of this review is to give an overview of the research reports on the structure-activity relationship of polyphenols inhibiting α-amylase. The molecular structures that influence the inhibition are the following: (1) The hydroxylation of flavonoids improved the inhibitory effect on α-amylase; (2) Presence of an unsaturated 2,3-bond in conjugation with a 4-carbonyl group has been associated with stronger inhibition; (3) The glycosylation of flavonoids decreased the inhibitory effect on α-amylase depending on the conjugation site and the class of sugar moiety; (4) The methylation and methoxylation of flavonoids obviously weakened the inhibitory effect; (5) The galloylated catechins have higher inhibition than nongalloylated catechins; the catechol-type catechins were stronger than the pyrogallol-type catechins; the inhibition activities of the catechins with 2,3-trans structure were higher than those of the catechins with 2,3-cis structure; (6) Cyanidin-3-glucoside showed higher inhibition against than cyanidin and cyanidin-3-galactoside and cyanidin-3,5-diglucoside had no inhibitory activity; (7) Ellagitannins with β-galloyl groups at glucose C-1 positions have higher inhibitory effect than the α-galloyl and nongalloyl compounds and the molecular weight of ellagitannins is not an important element.

  5. Homology modeling and molecular dynamics study on Schwanniomyces occidentalis alpha-amylase.

    PubMed

    Sefidbakht, Yahya; Ranaei Siadat, Omid; Taheri, Fatemeh

    2017-02-01

    With consumers growing increasingly aware of environmental issues, industries find enzymes as a reasonable alternative over physical conditions and chemical catalysts. Amylases are important hydrolase enzymes, which have been widely used in variety of industrial process such as pharmaceutical, food, and fermentation industries. Among amylases α-Amylase is in maximum demand due to its wide range of applications. The homology modeling study on Schwanniomyces occidentalis amylase (AMY1, UniProt identifier number: P19269) was performed by Modeller using Aspergillus oryzae (6TAA) as the template. The resulting structure was analyzed for validity and subjected to 14 ns of molecular dynamics (MD) simulation trough GROMACS. The validity of obtained model may represent that utilized OPLS force field is suitable for calcium-containing enzymes. DSSP secondary structure and contact map analysis represent the conservation of domain A TIM barrel feature together with calcium ion coordination sphere. Investigating the covariance matrix followed by principle component analyses for the first five eigenvectors of both trajectories indicate a little more flexibility for AMY1 structure. The electrostatic calculation for the final structures shows similar isoelectric point and superimposed buffering zone in the 5-8 pH range.

  6. Attenuation of Porphyromonas gingivalis oral infection by α-amylase and pentamidine.

    PubMed

    Li, Ying; Miao, Yu-Song; Fu, Yun; Li, Xi-Ting; Yu, Shao-Jie

    2015-08-01

    The Porphyromonas gingivalis bacterium is one of the most influential pathogens in oral infections. In the current study, the antimicrobial activity of α-amylase and pentamidine against Porphyromonas gingivalis was evaluated. Their in vitro inhibitory activity was investigated with the agar overlay technique, and the minimal inhibitory and bactericidal concentrations were determined. Using the bactericidal concentration, the antimicrobial actions of the inhibitors were investigated. In the present study, multiple techniques were utilized, including scanning electron microscopy (SEM), general structural analysis and differential gene expression analysis. The results obtained from SEM and bactericidal analysis indicated a notable observation; the pentamidine and α-amylase treatment destroyed the structure of the bacterial cell membranes, which led to cell death. These results were used to further explore these inhibitors and the mechanisms by which they act. Downregulated expression levels were observed for a number of genes coding for hemagglutinins and gingipains, and various genes involved in hemin uptake, chromosome replication and energy production. However, the expression levels of genes associated with iron storage and oxidative stress were upregulated by α-amylase and pentamidine. A greater effect was noted in response to pentamidine treatment. The results of the present study demonstrate promising therapeutic potential for α-amylases and pentamidine. These molecules have the potential to be used to develop novel drugs and broaden the availability of pharmacological tools for the attenuation of oral infections caused by Porphyromonas gingivalis.

  7. Allotides: Proline-Rich Cystine Knot α-Amylase Inhibitors from Allamanda cathartica.

    PubMed

    Nguyen, Phuong Q T; Luu, Thuy T; Bai, Yang; Nguyen, Giang K T; Pervushin, Konstantin; Tam, James P

    2015-04-24

    Cystine knot α-amylase inhibitors belong to a knottin family of peptidyl inhibitors of 30-32 residues and contain two to four prolines. Thus far, only four members of the group of cystine knot α-amylase inhibitors have been characterized. Herein, the discovery and characterization of five cystine knot α-amylase inhibitors, allotides C1-C5 (Ac1-Ac5) (1-5), from the medicinal plant Allamanda cathartica are reported using both proteomic and genomic methods. Proteomic analysis showed that 1-5 are 30 amino acids in length with three or four proline residues. NMR determination of 4 revealed that it has two cis- and one trans-proline residues and adopts two equally populated conformations in solution. Determination of disulfide connectivity of 2 by differential S-reduction and S-alkylation provided clues of its unfolding process. Genomic analysis showed that allotide precursors contain a three-domain arrangement commonly found in plant cystine knot peptides with conserved residues flanking the processing sites of the mature allotide domain. This work expands the number of known cystine knot α-amylase inhibitors and furthers the understanding of both the structural and biological diversity of this type of knottin family.

  8. Structure of Bacillus amyloliquefaciens alpha-amylase at high resolution: implications for thermal stability.

    PubMed

    Alikhajeh, Jahan; Khajeh, Khosro; Ranjbar, Bijan; Naderi-Manesh, Hossein; Lin, Yi Hung; Liu, Enhung; Guan, Hong Hsiang; Hsieh, Yin Cheng; Chuankhayan, Phimonphan; Huang, Yen Chieh; Jeyaraman, Jeyakanthan; Liu, Ming Yih; Chen, Chun Jung

    2010-02-01

    The crystal structure of Bacillus amyloliquefaciens alpha-amylase (BAA) at 1.4 A resolution revealed ambiguities in the thermal adaptation of homologous proteins in this family. The final model of BAA is composed of two molecules in a back-to-back orientation, which is likely to be a consequence of crystal packing. Despite a high degree of identity, comparison of the structure of BAA with those of other liquefying-type alpha-amylases indicated moderate discrepancies at the secondary-structural level. Moreover, a domain-displacement survey using anisotropic B-factor and domain-motion analyses implied a significant contribution of domain B to the total flexibility of BAA, while visual inspection of the structure superimposed with that of B. licheniformis alpha-amylase (BLA) indicated higher flexibility of the latter in the central domain A. Therefore, it is suggested that domain B may play an important role in liquefying alpha-amylases, as its rigidity offers a substantial improvement in thermostability in BLA compared with BAA.

  9. [Characteristics of alpha-amylase isozymes in cytologenetically different wheat cultivars].

    PubMed

    Netsvetaev, V P; Badaeva, E D

    2014-07-01

    The isoenzyme composition of alpha-amylase is studied by polyacrylamide gel electrophoresis in Tris-glycine (pH 8.3) system in wheat cultivars with different genome composition. We show that durum wheat (Triticum durum, 2n=4x=28, BBAA) lacks the isoenzymes encoded by 6D and 7D chromosomes that are present in common wheat zymograms (Triticum aestivum, 2n=6x=42, BBAADD). A similar pattern is observed in a synthetic allohexaploid carrying the BBAA genomes of wheat and the HchHch genome of barley (Hordeum chilense). Our method of electrophoresis fails to reveal additional variants of alpha-amylase encoded by the barley genome, although C-banding analysis confirms the genomic structure BBAAHChHCh of this allopolyploid. The electrophoretic spectrum of the spring common wheat cultivar Dobrynya with the wheat-Agropyron translocation 7DL-7AiL contains all of the alpha-amylase isoenzymes typical for common wheat (2n=6x=42, BBAADD) except for the zymotype encoded by the long arm of chromosome 7D. This observation confirms the results of cytogenetic analysis that identified a 7DL-7AiL translocation in this cultivar. No additional alpha-amylase isoenzymes encoded by Agropyron chromosome have been observed. Our data indicate that analysis of wheat-alien hybrids or introgressive forms should be carried out using a complex of different methods.

  10. Beta-thiomaltosides as active site probes for alpha-amylase.

    PubMed

    Stankiewicz, P J; Cascio, D; McPherson, A

    1983-12-01

    A series of substituted 1-thio-beta-D-maltopyranosides was synthesized and confirmed by elemental analysis, optical rotation, NMR, and liquid chromatography. These compounds were shown by several biochemical techniques to bind to the active site of alpha-amylase. Steady-state kinetic studies showed the compounds to be competitive inhibitors, with affinities lying within the range of the natural ligands, maltose and maltotriose. Affinity chromatography employing p-aminophenyl-1-thio-beta-D-maltopyranoside linked to Sepharose provides a relatively simple procedure for alpha-amylase purification. The binding of p-bromphenyl-1-thio-beta-D-maltoside was observed in crystals of alpha-amylase using X-ray crystallography, and through the use of difference Fourier analysis its interaction at 5.0-A resolution with the active site of the enzyme has been visualized. The inhibitor binds in a long, deep cleft that divides the two major domains of the enzyme. These studies are believed to provide a first step toward the rational design of ligands for the physiological regulation of starch breakdown and utilization through modulation of alpha-amylase activity.

  11. Two sulfhydryl groups near the active site of soybean beta-amylase.

    PubMed

    Mikami, B; Nomura, K; Morita, Y

    1994-01-01

    The less reactive SH groups of soybean beta-amylase, SH4, SH5, and SH6, were modified with p-chloromercuribenzoic acid or N-ethylmaleimide, after the reactive SH groups, SH1, SH2, and SH3, were blocked with 5,5'-dithiobis-(2-nitrobenzoic acid) and cyanide. The enzyme activity decreased, accompanied by the modification of SH4. alpha-Cyclodextrin protected SH4 from the modification more effectively than maltose. The SH4-modified enzyme still bound to glucose, maltose, and alpha-cyclodextrin. SH4 was concerned with neither the catalysis nor substrate binding but its large substituent affected the substrate binding site. The sequencing of the 5-(iodoacetoamidoethyl)-aminoaphthalene-1-sulfonate-labeled peptides showed that SH4, SH5, and SH6 are Cys343, Cys82, and Cys208, respectively. Comparison of the primary structure of beta-amylases also showed that the sequence around SH4 (Cys343), as well as SH2 (Cys95), is strongly conserved between higher plant and bacterial beta-amylases. These results agree with the structure model deduced from X-ray crystallography of soybean beta-amylase.

  12. Crystal structure of recombinant soybean beta-amylase complexed with beta-cyclodextrin.

    PubMed

    Adachi, M; Mikami, B; Katsube, T; Utsumi, S

    1998-07-31

    In order to study the interaction of soybean beta-amylase with substrate, we solved the crystal structure of beta-cyclodextrin-enzyme complex and compared it with that of alpha-cyclodextrin-enzyme complex. The enzyme was expressed in Escherichia coli at a high level as a soluble and catalytically active protein. The purified recombinant enzyme had properties nearly identical to those of native soybean beta-amylase and formed the same crystals as the native enzyme. The crystal structure of recombinant enzyme complexed with beta-cyclodextrin was refined at 2. 07-A resolution with a final crystallographic R value of 15.8% (Rfree = 21.1%). The root mean square deviation in the position of C-alpha atoms between this recombinant enzyme and the native enzyme was 0.22 A. These results indicate that the expression system established here is suitable for studying structure-function relationships of beta-amylase. The conformation of the bound beta-cyclodextrin takes an ellipsoid shape in contrast to the circular shape of the bound alpha-cyclodextrin. The cyclodextrins shared mainly two glucose binding sites, 3 and 4. The glucose residue 4 was slightly shifted from the maltose binding site. This suggests that the binding site of the cyclodextrins is important for its holding of a cleaved substrate, which enables the multiple attack mechanism of beta-amylase.

  13. Isolation and characterisation of a novel alpha-amylase from the extreme haloarchaeon Haloterrigena turkmenica.

    PubMed

    Santorelli, Marco; Maurelli, Luisa; Pocsfalvi, Gabriella; Fiume, Immacolata; Squillaci, Giuseppe; La Cara, Francesco; Del Monaco, Giovanni; Morana, Alessandra

    2016-11-01

    An extracellular halophilic alpha-amylase (AmyA) was produced by the haloarchaeon Haloterrigena turkmenica grown in medium enriched with 0.2% (w/v) starch. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and size exclusion chromatography (SEC) analyses showed a major band at 66.0kDa and a peak of 54.0kDa, respectively. Analysis of tryptic fragments of the protein present in the major SDS-PAGE band by nano-LC-ESI-MS/MS led to identification of the alpha-amylase catalytic region, encoded by the htur2110 gene, as the protein possessing the described activity. Optimal values for activity were 55°C, pH 8.5 and 2M NaCl, and high thermostability was showed at 55°C and 3M NaCl. AmyA activity was enhanced by Triton X-100 and was not influenced by n-hexane and chloroform. Starch hydrolysis produced different oligomers with maltose as the smallest end-product. The efficiency of AmyA in degrading starch contained in agronomic residues was tested in grape cane chosen as model substrate. Preliminary results showed that starch was degraded making the enzyme a potential candidate for utilization of agro-industrial waste in fuel and chemicals production. AmyA is one of the few investigated amylases produced by haloarchaea, and the first alpha-amylase described among microorganisms belonging to the genus Haloterrigena.

  14. Conquering the control of insoluble and soluble starch with novel applications of amylase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The new knowledge that there is markedly more insoluble starch than previously considered in products across both the sugarcane factory and refinery has processing implications. This includes the application of a-amylases in the factory to control not only soluble but insoluble starch. Studies wer...

  15. Kinetic Analysis of Amylase Using Quantitative Benedict's and Iodine Starch Reagents

    ERIC Educational Resources Information Center

    Cochran, Beverly; Lunday, Deborah; Miskevich, Frank

    2008-01-01

    Quantitative analysis of carbohydrates is a fundamental analytical tool used in many aspects of biology and chemistry. We have adapted a technique developed by Mathews et al. using an inexpensive scanner and open-source image analysis software to quantify amylase activity using both the breakdown of starch and the appearance of glucose. Breakdown…

  16. Investigating the Hydrolysis of Starch Using "a"-Amylase Contained in Dishwashing Detergent and Human Saliva

    ERIC Educational Resources Information Center

    Munegumi, Toratane; Inutsuka, Masato; Hayafuji, Yukitaka

    2016-01-01

    Although saliva has commonly been used to teach about digestion by organisms, the phenomenon of digestion is actually caused by enzymes as catalytic substances. This activity explores the hydrolysis of starch by "a"-amylase in cleaning materials as well as a comparison with the similar reaction using human saliva. The fact that the…

  17. Increased production of alpha-amylase by Bacillus amyloliquefaciens in the presence of glycine

    SciTech Connect

    Zhang, Q.; Tsukagoshi, N.; Miyashiro, S.; Udaka, S.

    1983-07-01

    The production of alpha-amylase by Bacillus amyloliquefaciens increased by a factor of 300 when glycine was added to a chemically defined simple medium at the early-logarithmic phase of growth. Glycine was not metabolized to a significant extent under the conditions used, but it considerably prevented the lowering of the pH of the culture. (Refs. 10).

  18. ALPHA-AMYLASE ACTIVITY IN VARIOUS CONCENTRATIONS OF THE IONIC LIQUID, 1-BUTYL-3-METHYLIMIDAZOLIUM CHLORIDE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Starch is an extremely abundant, economical and versatile industrial commodity. Many industrial uses of starch depend on hydrolyzing the polymer for the conversion of glucose and maltodextrins. Starch hydrolysis is frequently achieved by utilizing alpha-amylase, which is an endo-acting enzyme that...

  19. Dual feeding strategy for the production of alpha-amylase by Bacillus caldolyticus using complex media.

    PubMed

    Schwab, Karima; Bader, Johannes; Brokamp, Christian; Popović, Milan K; Bajpai, Rakesh; Berovic, Marin

    2009-10-01

    In this study, the objective was to investigate an exponential feeding strategy for fed-batch production of thermostable alpha-amylase (E.C. 3.2.1.1.) from the Bacillus caldolyticus (DSM405). The parameters for establishing compositions of feed media and feeding rate were obtained by statistical analysis of batch and continuous shake flask experiments. These parameters were casitone to starch ratio of 2.67g(casitone)g(starch)(-1), maintenance coefficient 0.174g(casitone)g(DW)(-1)h(-1), cell yield 0.62g(DW)g(casitone)(-1) and mu(opt)=0.2h(-1). The exponentially fed fermentation resulted in yield of 120Uml(-1) alpha-amylase that was thermostable up to 105 degrees C. Results of the exponentially fed fermentation have been discussed in the light of a feed-back controlled fed-batch fermentation reported earlier by the authors. A comparison of the temperature and pH effects on amylase produced by B. caldolyticus and on several other commercially available amylases has also been presented.

  20. Production of α-Amylase by Aspergillus terreus NCFT 4269.10 Using Pearl Millet and Its Structural Characterization

    PubMed Central

    Sethi, Bijay K.; Jana, Arijit; Nanda, Prativa K.; DasMohapatra, Pradeep K.; Sahoo, Santi L.; Patra, Jayanta Kumar

    2016-01-01

    In this investigation, Aspergillus terreus NCFT4269.10 was employed in liquid static surface (LSSF) and solid state (SSF) fermentation to assess the optimal conditions for α-amylase biosynthesis. One-variable-at-a-time approach (quasi-optimum protocol) was primarily used to investigate the effect of each parameter on production of amylase. The maximum amylase production was achieved using pearl millet (PM) as substrate by SSF (19.19 ± 0.9 Ug−1) and also in presence of 1 mM magnesium sulfate, 0.025% (w/v) gibberellic acid, and 30 mg/100 ml (w/v) of vitamin E (~60-fold higher production of amylase) with the initial medium pH of 7.0 and incubation at 30 °C for 96 h. In addition, maltose, gelatin and isoleucine also influenced the α-amylase production. Amylase was purified to homogeneity with molecular mass around 15.3 kDa. The enzyme comprised of a typical secondary structure containing α-helix (12.2%), β-pleated sheet (23.6%), and β-turn (27.4%). Exploitation of PM for α-amylase production with better downstream makes it the unique enzyme for various biotechnological applications. PMID:27242841

  1. CdTe/CdSe quantum dots improve the binding affinities between α-amylase and polyphenols.

    PubMed

    Ni, Xiaoling

    2012-03-01

    People exposed to engineered nanomaterials have potential health risks associated. Human α-amylase is one of the key enzymes in the digestive system. There are few reports about the influence of quantum dots (QDs) on the digestive enzymes and their inhibition system. This work focused on the toxic effect of CdTe/CdSe QDs on the interactions between α-amylase and its natural inhibitors. Thirty-six dietary polyphenols, natural α-amylase inhibitors from food, were studied for their affinities for α-amylase in the absence and presence of CdTe/CdSe QDs by a fluorescence quenching method. The magnitudes of apparent binding constants of polyphenols for α-amylase were almost in the range of 10(5)-10(7) L mol(-1) in the presence of CdTe/CdSe QDs, which were higher than the magnitudes of apparent binding constants in the absence of CdTe/CdSe QDs (10(4)-10(6) L mol(-1)). CdTe/CdSe QDs obviously improved the affinities of dietary polyphenols for α-amylase up to 389.04 times. It is possible that the binding interaction between polyphenols and α-amylase in the presence of CdTe/CdSe QDs was mainly caused by electrostatic interactions. QDs significantly influence the digestive enzymes and their inhibition system.

  2. Gellan gum microspheres containing a novel α-amylase from marine Nocardiopsis sp. strain B2 for immobilization.

    PubMed

    Chakraborty, Samrat; Jana, Sougata; Gandhi, Arijit; Sen, Kalyan Kumar; Zhiang, Wang; Kokare, Chandrakant

    2014-09-01

    A Nocardiopsis sp. stain B2 with an ability to produce stable α-amylase was isolated from marine sediments. The characterization of microorganism was done by biochemical tests and 16S rDNA sequencing. The α-amylase was purified by gel filtration chromatography by using sephadex G-75. The molecular mass of the amylase was found to be 45 kDa by SDS-PAGE and gel filtration chromatography. The isolated α-amylase was immobilized by ionotropic gelation technique using gellan gum (GG). These microspheres were spherical with average particle size of 375.62±21.76 to 492.54±32.18 μm. The entrapment efficiency of these α-amylase loaded GG microspheres was found 74.76±1.32 to 87.64±1.52%. Characterization of α-amylase-gellan gum microspheres was confirmed using FTIR and SEM analysis. The in vitro amylase release kinetic have been studied by various mathematical models that follow the Korsmeyer-Peppas model (R2=0.9804-0.9831) with anomalous (non-Fickian) diffusion release mechanism.

  3. Purification of a. beta. -amylase that accumulates in Arabidopsis thaliana mutants defective in starch metabolism. [Arabidopsis thaliana

    SciTech Connect

    Monroe, J.D.; Preiss, J. )

    1990-11-01

    Amylase activity is elevated 5- to 10-fold in leaves of several different Arabidopsis thaliana mutants defective in starch metabolism when they are grown under a 12-hour photoperiod. Activity is also increased when plants are grown under higher light intensity. It was previously determined that the elevated activity was an extrachloroplastic {beta}-(exo)amylase. Due to the location of this enzyme outside the chloroplast, its function is not known. The enzyme was purified to homogeneity from leaves of both a starchless mutant deficient in plastid phosphoglucomutase and from the wild type using polyethylene glycol fractionation and cyclohexaamylose affinity chromatography. The molecular mass of the {beta}-amylase from both sources was 55,000 daltons as determined by denaturing gel electrophoresis. Gel filtration studies indicated that the enzyme was a monomer. The specific activities of the purified protein from mutant and wild-type sources, their substrate specificities, and K{sub m} for amylopectin were identical. Based on these results it was concluded that the mutant contained an increased level of {beta}-amylase protein. Enzyme neutralization studies using a polyclonal antiserum raised to purified {beta}-amylase showed that in each of two starchless mutants, one starch deficient mutant and one starch overproducing mutant, the elevated amylase activity was due to elevated {beta}-amylase protein.

  4. High-throughput hydrolysis of starch during permeation across α-amylase-immobilized porous hollow-fiber membranes

    NASA Astrophysics Data System (ADS)

    Miura, Suguru; Kubota, Noboru; Kawakita, Hidetaka; Saito, Kyoichi; Sugita, Kazuyuki; Watanabe, Kohei; Sugo, Takanobu

    2002-02-01

    Two kinds of supporting porous membranes, ethanolamine (EA) and phenol (Ph) fibers, for immobilization of α-amylase were prepared by radiation-induced graft polymerization of an epoxy-group-containing monomer, glycidyl methacrylate, onto a porous hollow-fiber membrane, and subsequent ring-opening with EA and Ph, respectively. An α-amylase solution was forced to permeate radially outward through the pores of the EA and Ph fibers. α-Amylase was captured at a density of 0.15 and 6.6 g/L of the membrane by the graft chain containing 2-hydroxyethylamino and phenyl groups, respectively. A permeation pressure of 0.10 MPa provided a space velocity of 780 and 1500 h -1 for the α-amylase-immobilized EA and Ph fibers, respectively. Quantitative hydrolysis of starch during permeation of a 20 g/L starch solution in the buffer across the α-amylase-immobilized Ph fiber was attained up to a space velocity of about 2000 h -1; this was achieved because of negligible diffusional mass-transfer resistance of the starch to the α-amylase due to convective flow, whereas an enzyme reaction-controlled system was observed for the α-amylase-immobilized EA fiber.

  5. Production and Partial Characterization of α-Amylase Enzyme from Bacillus sp. BCC 01-50 and Potential Applications

    PubMed Central

    Qureshi, Abdul Sattar; Khushk, Imrana; Ali, Chaudhry Haider; Lashari, Safia; Bhutto, Muhammad Aqeel; Mangrio, Ghulam Sughra; Lu, Changrui

    2017-01-01

    Amylase is an industrially important enzyme and applied in many industrial processes such as saccharification of starchy materials, food, pharmaceutical, detergent, and textile industries. This research work deals with the optimization of fermentation conditions for α-amylase production from thermophilic bacterial strain Bacillus sp. BCC 01-50 and characterization of crude amylase. The time profile of bacterial growth and amylase production was investigated in synthetic medium and maximum enzyme titer was observed after 60 h. In addition, effects of different carbon sources were tested as a substrate for amylase production and molasses was found to be the best. Various organic and inorganic compounds, potassium nitrate, ammonium chloride, sodium nitrate, urea, yeast extract, tryptone, beef extract, and peptone, were used and beef extract was found to be the best among the nitrogen sources used. Temperature, pH, agitation speed, and size of inoculum were also optimized. Highest enzyme activity was obtained when the strain was cultured in molasses medium for 60 h in shaking incubator (150 rpm) at 50°C and pH 8. Crude amylase showed maximal activity at pH 9 and 65°C. Enzyme remained stable in alkaline pH range 9-10 and 60–70°C. Crude amylase showed great potential for its application in detergent industry and saccharification of starchy materials. PMID:28168200

  6. Effects of dietary consistency and water content on parotid amylase secretion and gastric starch digestion in rats.

    PubMed

    Kurahashi, M; Inomata, K

    1999-12-01

    The aim was to estimate the significance of oral sensation and mastication in inducing amylase secretion from the parotid gland and subsequent starch digestion in the stomach. Rats were fed three diets of similar chemical composition but different physical presentations. Two were solid, either pellets or powder, and one was liquid. Oral sensory activity would be greatest with the pellets and least with the liquid. Only the pellets would require significant mastication. Three criteria were used to estimate amylase secretion, amylase activity in the stomach, the depletion of glandular amylase activity and plasma amylase concentrations. Gastric starch digestion was estimated by measuring the concentration of reducing-sugars in the stomach contents. Parotid amylase secretion and gastric starch digestion were similar whether rats were fed pelleted or powdered solid food but much lower in rats fed a liquid diet. These findings support the view that it is the contact of dry food with the oral mucosa rather than the jaw movements involved in mastication that stimulates parotid amylase secretion.

  7. Production and Partial Characterization of α-Amylase Enzyme from Bacillus sp. BCC 01-50 and Potential Applications.

    PubMed

    Simair, Altaf Ahmed; Qureshi, Abdul Sattar; Khushk, Imrana; Ali, Chaudhry Haider; Lashari, Safia; Bhutto, Muhammad Aqeel; Mangrio, Ghulam Sughra; Lu, Changrui

    2017-01-01

    Amylase is an industrially important enzyme and applied in many industrial processes such as saccharification of starchy materials, food, pharmaceutical, detergent, and textile industries. This research work deals with the optimization of fermentation conditions for α-amylase production from thermophilic bacterial strain Bacillus sp. BCC 01-50 and characterization of crude amylase. The time profile of bacterial growth and amylase production was investigated in synthetic medium and maximum enzyme titer was observed after 60 h. In addition, effects of different carbon sources were tested as a substrate for amylase production and molasses was found to be the best. Various organic and inorganic compounds, potassium nitrate, ammonium chloride, sodium nitrate, urea, yeast extract, tryptone, beef extract, and peptone, were used and beef extract was found to be the best among the nitrogen sources used. Temperature, pH, agitation speed, and size of inoculum were also optimized. Highest enzyme activity was obtained when the strain was cultured in molasses medium for 60 h in shaking incubator (150 rpm) at 50°C and pH 8. Crude amylase showed maximal activity at pH 9 and 65°C. Enzyme remained stable in alkaline pH range 9-10 and 60-70°C. Crude amylase showed great potential for its application in detergent industry and saccharification of starchy materials.

  8. Polyaniline-graphene based α-amylase biosensor with a linear dynamic range in excess of 6 orders of magnitude.

    PubMed

    Teixeira, Sofia Rodrigues; Lloyd, Catherine; Yao, Seydou; Andrea Salvatore Gazze; Whitaker, Iain S; Francis, Lewis; Conlan, R Steven; Azzopardi, Ernest

    2016-11-15

    α-amylase is an established marker for diagnosis of pancreatic and salivary disease, and recent research has seen a substantial expansion of its use in therapeutic and diagnostic applications for infection, cancer and wound healing. The lack of bedside monitoring devices for α-amylase detection has hitherto restricted the clinical progress of such applications. We have developed a highly sensitive α-amylase immunosensor platform, produced via in situ electropolymerization of aniline onto a screen-printed graphene support (SPE). Covalently binding an α-amylase specific antibody to a polyaniline (PANI) layer and controlling device assembly using electrochemical impedance spectroscopy (EIS), we have achieved a highly linear response against α-amylase concentration. Each stage of the assembly was characterized using a suite of high-resolution topographical, chemical and mechanical techniques. Quantitative, highly sensitive detection was demonstrated using an artificially spiked human blood plasma samples. The device has a remarkably wide limit of quantification (0.025-1000IU/L) compared to α-amylase assays in current clinical use. With potential for simple scale up to volume manufacturing though standard semiconductor production techniques and subsequently clinical application, this biosensor will enable clinical benefit through early disease detection, and better informed administration of correct therapeutic dose of drugs used to treat α-amylase related diseases.

  9. Purification, sequencing, and biochemical characterization of a novel calcium-independent α-amylase AmyTVE from Thermoactinomyces vulgaris.

    PubMed

    El-Sayed, Ahmed K A; Abou Dobara, Mohamed I; El-Fallal, Amira A; Omar, Noha F

    2013-06-01

    α-Amylase from Thermoactinomyces vulgaris was highly purified 48.9-fold by ammonium sulfate precipitation, gel filtration on Sephadex G-50 column, and ion exchange chromatography column of DEAE-cellulose. The molecular weight of the enzyme was estimated to be 135 and 145 kDa by SDS-PAGE. Its high molecular weight is due to high glycosylation. The purified amylase exhibited maximal activity at pH 6.0 to 7.0 and was stable in the range of pH 4.0 to 9.0. The optimum temperature for its activity was 50 °C. The enzyme half-life time was 120 min at 50 °C, suggesting intermediate temperature stable α-amylase. The enzyme was sensitive to different metal ions, including NaCl, CoCl(2), and CaCl(2), and to different concentrations of EDTA. The enzyme activity was inhibited in the presence of 1 mM CaCl(2), suggesting that it is a calcium-independent α-amylase. The TLC showed that the amylase hydrolyzed starch to produce large maltooligosaccharides as the main products. A 1.1-kb DNA fragment of the putative α-amylase gene (amy TVE) from T. vulgaris was amplified by using two specific newly designed primers. Sequencing analysis showed 56.2 % similarity to other Thermoactinomyces α-amylases with two conserved active sites confirming its function.

  10. α-Amylase sensor based on the degradation of oligosaccharide hydrogel films monitored with a quartz crystal sensor.

    PubMed

    Gibbs, Martin John; Biela, Anna; Krause, Steffi

    2015-05-15

    α-Amylase hydrolyses starch molecules to produce smaller oligosaccharides and sugars. Amylases are of great importance in biotechnology and find application in fermentation, detergents, food and the paper industry. The measurement of α-amylase activity in serum and urine has been used in the diagnosis of acute pancreatitis. Salivary amylase has also been shown to be a stress indicator. Sensor coatings suitable for the detection of α-amylase activity have been developed. Oligosaccharides such as glycogen and amylopectin were spin-coated onto gold coated quartz crystals with a base frequency of 10 MHz. The films were subsequently cross-linked with hexamethylene diisocyanate. Film degradation was monitored with a quartz crystal microbalance (QCM) and electrochemical impedance measurements. The films were shown to be stable in phosphate buffered saline (PBS). Addition of α-amylase to the solution resulted in the rapid degradation of the films. The maximum rate of degradation was found to be strongly dependent on the amylase activity in the range typically found in serum when diagnosing pancreatitis (0.08-8 U/ml). Sensor responses in serum were found to be very similar to those obtained in buffer indicating the absence of non-specific binding.

  11. Characterization of a Digestive α-Amylase in the Midgut of Pieris brassicae L. (Lepidoptera: Pieridae)

    PubMed Central

    Sharifloo, Ali; Zibaee, Arash; Sendi, Jalal J.; Jahroumi, Khalil Talebi

    2016-01-01

    The current study deals with a digestive α-amylase in the larvae of Pieris brassicae L. through purification, enzymatic characterization, gene expression, and in vivo effect of a specific inhibitor, Acarbose. Although α-amylase activity was the highest in the whole gut homogenate of larvae but compartmentalization of amylolytic activity showed an equal activity in posterior midgut (PM) and anterior midgut (AM). A three step purification using ammonium sulfate, Sepharyl G-100 and DEAE-Cellulose Fast flow revealed an enzyme with a specific activity of 5.18 U/mg, recovery of 13.20, purification fold of 19.25 and molecular weight of 88 kDa. The purified α-amylase had the highest activity at optimal pH and temperature of 8 and 35°C. Also, the enzyme had Vmax values of 4.64 and 3.02 U/mg protein and Km values of 1.37 and 1.74% using starch and glycogen as substrates, respectively. Different concentrations of acarbose, ethylenediamine tetraacetic acid, and ethylene glycol-bis (β-aminoethylether) N, N, N′, N′-tetraacetic acid significantly decreased activity of the purified α-amylase. The 4th instar larvae of P. brassicae were fed on the treated leaves of Raphanus sativus L. with 0.22 mM of Acarbose to find in vivo effects on nutritional indices, α-amylase activity, and gene expression. The significant differences were only found in conversion efficiency of digested food, relative growth rate, and metabolic cost of control and fed larvae on Acarbose. Also, amylolytic activity significantly decreased in the treated larvae by both biochemical and native-PAGE experiments. Results of RT-PCR revealed a gene with 621 bp length responsible for α-amylase expression that had 75% identity with Papilio xuthus and P. polytes. Finally, qRT-PCR revealed higher expression of α-amylase in control larvae compared to acarbose-fed ones. PMID:27014094

  12. Concurrent attenuated reactivity of alpha-amylase and cortisol is related to disruptive behavior in male adolescents.

    PubMed

    de Vries-Bouw, Marjan; Jansen, Lucres; Vermeiren, Robert; Doreleijers, Theo; van de Ven, Peter; Popma, Arne

    2012-06-01

    Attenuated reactivity of salivary alpha-amylase has been proposed as a specific sympathetic marker of disruptive behavior in juveniles and may have additional value to studying other autonomic parameters and hypothalamic-pituitary-adrenal axis activity. Investigating the interrelationships between neurobiological parameters in relation to juvenile disruptive behavior may enhance insight into the complex mechanisms at play. We investigated salivary alpha-amylase, cortisol, heart rate (HR), and heart rate variability (HRV) in response to a standardized public speaking task, and examined interactions between these parameters in relation to disruptive behavior. Participants were 48 delinquent male adolescents (mean age 18.4 years, SD 0.9), with and without a disruptive behavior disorder (resp. DP+, DP-) and 16 matched normal controls (NC). A structured psychiatric interview as well as the Youth Self Report and Child Behavior Checklist were administered to assess disruptive behavior. Alpha-amylase and cortisol reactivity, but not HR or HRV, showed significant inverse associations with dimensional measures of disruptive behavior. Moreover, both cortisol and alpha-amylase reactivity were significantly lower in the DP+ group as compared to the NC group. The mentioned relationships remained present when nicotine use was entered as a covariate. Combining alpha-amylase and cortisol in one model explained a larger part of the variance of disruptive behavior than either single parameter. There were no interactions between alpha-amylase and cortisol or HRV in relation to disruptive behavior. Attenuated alpha-amylase responsivity to stress is a correlate of disruptive behavior in late-adolescent males. Although nicotine use explains a considerable part of the variance of disruptive behavior, both alpha-amylase and cortisol are related to disruptive behavior, over and above the effect of nicotine use. Combining alpha-amylase and cortisol improved insight into neurobiological

  13. Pancreatic α-Amylase Controls Glucose Assimilation by Duodenal Retrieval through N-Glycan-specific Binding, Endocytosis, and Degradation.

    PubMed

    Date, Kimie; Satoh, Ayano; Iida, Kaoruko; Ogawa, Haruko

    2015-07-10

    α-Amylase, a major pancreatic protein and starch hydrolase, is essential for energy acquisition. Mammalian pancreatic α-amylase binds specifically to glycoprotein N-glycans in the brush-border membrane to activate starch digestion, whereas it significantly inhibits glucose uptake by Na(+)/glucose cotransporter 1 (SGLT1) at high concentrations (Asanuma-Date, K., Hirano, Y., Le, N., Sano, K., Kawasaki, N., Hashii, N., Hiruta, Y., Nakayama, K., Umemura, M., Ishikawa, K., Sakagami, H., and Ogawa, H. (2012) Functional regulation of sugar assimilation by N-glycan-specific interaction of pancreatic α-amylase with glycoproteins of duodenal brush border membrane. J. Biol. Chem. 287, 23104-23118). However, how the inhibition is stopped was unknown. Here, we show a new mechanism for the regulation of intestinal glucose absorption. Immunohistochemistry revealed that α-amylase in the duodena of non-fasted, but not fasted, pigs was internalized from the pancreatic fluid and immunostained. We demonstrated that after N-glycan binding, pancreatic α-amylase underwent internalization into lysosomes in a process that was inhibited by α-mannoside. The internalized α-amylase was degraded, showing low enzymatic activity and molecular weight at the basolateral membrane. In a human intestinal Caco-2 cell line, Alexa Fluor 488-labeled pancreatic α-amylase bound to the cytomembrane was transported to lysosomes through the endocytic pathway and then disappeared, suggesting degradation. Our findings indicate that N-glycan recognition by α-amylase protects enterocytes against a sudden increase in glucose concentration and restores glucose uptake by gradual internalization, which homeostatically controls the postprandial blood glucose level. The internalization of α-amylase may also enhance the supply of amino acids required for the high turnover of small intestine epithelial cells. This study provides novel and significant insights into the control of blood sugar during the absorption

  14. Discovery and characterization of pseudocyclic cystine-knot α-amylase inhibitors with high resistance to heat and proteolytic degradation.

    PubMed

    Nguyen, Phuong Q T; Wang, Shujing; Kumar, Akshita; Yap, Li J; Luu, Thuy T; Lescar, Julien; Tam, James P

    2014-10-01

    Obesity and type 2 diabetes are chronic metabolic diseases, and those affected could benefit from the use of α-amylase inhibitors to manage starch intake. The pseudocyclics, wrightides Wr-AI1 to Wr-AI3, isolated from an Apocynaceae plant show promise for further development as orally active α-amylase inhibitors. These linear peptides retain the stability known for cystine-knot peptides in the presence of harsh treatment. They are resistant to heat treatment and endopeptidase and exopeptidase degradation, which is characteristic of cyclic cystine-knot peptides. Our NMR and crystallography analysis also showed that wrightides, which are currently the smallest proteinaceous α-amylase inhibitors reported, contain the backbone-twisting cis-proline, which is preceded by a nonaromatic residue rather than a conventional aromatic residue. The modeled structure and a molecular dynamics study of Wr-AI1 in complex with yellow mealworm α-amylase suggested that, despite having a similar structure and cystine-knot fold, the knottin-type α-amylase inhibitors may bind to insect α-amylase via a different set of interactions. Finally, we showed that the precursors of pseudocyclic cystine-knot α-amylase inhibitors and their biosynthesis in plants follow a secretory protein synthesis pathway. Together, our findings provide insights for the use of the pseudocyclic α-amylase inhibitors as useful leads for the development of orally active peptidyl bioactives, as well as an alternative scaffold for cyclic peptides for engineering metabolically stable human α-amylase inhibitors.

  15. Cloning and nucleotide sequence of the gene coding for enzymatically active fragments of the Bacillus polymyxa beta-amylase.

    PubMed

    Kawazu, T; Nakanishi, Y; Uozumi, N; Sasaki, T; Yamagata, H; Tsukagoshi, N; Udaka, S

    1987-04-01

    The gene encoding beta-amylase was cloned from Bacillus polymyxa 72 into Escherichia coli HB101 by inserting HindIII-generated DNA fragments into the HindIII site of pBR322. The 4.8-kilobase insert was shown to direct the synthesis of beta-amylase. A 1.8-kilobase AccI-AccI fragment of the donor strain DNA was sufficient for the beta-amylase synthesis. Homologous DNA was found by Southern blot analysis to be present only in B. polymyxa 72 and not in other bacteria such as E. coli or B. subtilis. B. polymyxa, as well as E. coli harboring the cloned DNA, was found to produce enzymatically active fragments of beta-amylases (70,000, 56,000, or 58,000, and 42,000 daltons), which were detected in situ by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Nucleotide sequence analysis of the cloned 3.1-kilobase DNA revealed that it contains one open reading frame of 2,808 nucleotides without a translational stop codon. The deduced amino acid sequence for these 2,808 nucleotides encoding a secretory precursor of the beta-amylase protein is 936 amino acids including a signal peptide of 33 or 35 residues at its amino-terminal end. The existence of a beta-amylase of larger than 100,000 daltons, which was predicted on the basis of the results of nucleotide sequence analysis of the gene, was confirmed by examining culture supernatants after various cultivation periods. It existed only transiently during cultivation, but the multiform beta-amylases described above existed for a long time. The large beta-amylase (approximately 160,000 daltons) existed for longer in the presence of a protease inhibitor such as chymostatin, suggesting that proteolytic cleavage is the cause of the formation of multiform beta-amylases.

  16. A simple one pot purification of bacterial amylase from fermented broth based on affinity toward starch-functionalized magnetic nanoparticle.

    PubMed

    Paul, Tanima; Chatterjee, Saptarshi; Bandyopadhyay, Arghya; Chattopadhyay, Dwiptirtha; Basu, Semanti; Sarkar, Keka

    2015-08-18

    Surface-functionalized adsorbant particles in combination with magnetic separation techniques have received considerable attention in recent years. Selective manipulation on such magnetic nanoparticles permits separation with high affinity in the presence of other suspended solids. Amylase is used extensively in food and allied industries. Purification of amylase from bacterial sources is a matter of concern because most of the industrial need for amylase is met by microbial sources. Here we report a simple, cost-effective, one-pot purification technique for bacterial amylase directly from fermented broth of Bacillus megaterium utilizing starch-coated superparamagnetic iron oxide nanoparticles (SPION). SPION was prepared by co-precipitation method and then functionalized by starch coating. The synthesized nanoparticles were characterized by transmission electron microscopy (TEM), a superconducting quantum interference device (SQUID, zeta potential, and ultraviolet-visible (UV-vis) and Fourier-transform infrared (FTIR) spectroscopy. The starch-coated nanoparticles efficiently purified amylase from bacterial fermented broth with 93.22% recovery and 12.57-fold purification. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) revealed that the molecular mass of the purified amylase was 67 kD, and native gel showed the retention of amylase activity even after purification. Optimum pH and temperature of the purified amylase were 7 and 50°C, respectively, and it was stable over a range of 20°C to 50°C. Hence, an improved one-pot bacterial amylase purification method was developed using starch-coated SPION.

  17. Thermodynamic stability of a cold-active alpha-amylase from the Antarctic bacterium Alteromonas haloplanctis.

    PubMed

    Feller, G; d'Amico, D; Gerday, C

    1999-04-06

    The thermal stability of the cold-active alpha-amylase (AHA) secreted by the Antarctic bacterium Alteromonas haloplanctis has been investigated by intrinsic fluorescence, circular dichroism, and differential scanning calorimetry. It was found that this heat-labile enzyme is the largest known multidomain protein exhibiting a reversible two-state unfolding, as demonstrated by the recovery of DeltaHcal values after consecutive calorimetric transitions, a DeltaHcal/DeltaHeff ratio close to unity, and the independence of unfolding thermodynamic parameters of scan rates. By contrast, the mesophilic alpha-amylases investigated here (from porcine pancreas, human salivary glands, yellow meal beetle, Bacillus amyloliquefaciens, and Bacillus licheniformis) unfold irreversibly according to a non-two-state mechanism. Unlike mesophilic alpha-amylases, the melting point of AHA is independent of calcium and chloride binding while the allosteric and structural functions of these ions are conserved. The thermostability of AHA at optimal conditions is characterized by a Tm of 43.7 degrees C, a DeltaHcal of 238 kcal mol-1, and a DeltaCp of 8.47 kcal mol-1 K-1. These values were used to calculate the Gibbs free energy of unfolding over a wide range of temperatures. This stability curve shows that (a) the specific DeltaGmax of AHA [22 cal (mol of residue)-1] is 4 times lower than that of mesophilic alpha-amylases, (b) group hydration plays a crucial role in the enzyme flexibility at low temperatures, (c) the temperature of cold unfolding closely corresponds to the lower limit of bacterial growth, and (d) the recombinant heat-labile enzyme can be expressed in mesophilic hosts at moderate temperatures. It is also argued that the cold-active alpha-amylase has evolved toward the lowest possible conformational stability of its native state.

  18. Study of serum lipase, alpha-amylase and pancreatic amylose in gall-stone diseases.

    PubMed

    Bera, Swati; Bhattacharyya, Swati; Ghose, Bikash C; Bera, Tapas; Mukhopadhyay, Surajit K; Saha, Mita

    2011-09-01

    Silent gall-stone causes significant morbidity and mortality and its incidence in India as well as in whole world is on the rise. It has positive correlation with development of carcinoma gall bladder. So far no predictive study has been done to show its correlation with biochemical markers. The present study has been aimed to establish whether simple enzymatic markers can predict association with cholelithiasis. Study group has been selected from the patients attending general surgery OPD of a tertiary healthcare centre with complaints of vague abdominal pain, flatulence and dyspepsia. A total of 61 cases (male = 18, female = 43) were studied and data matched with age and sex matched control. The biochemical markers studied are serum alkaline phosphatase, serum lipase, serum alpha-amylase and serum pancreatic amylase. Patients with obstructive cholelithiasis, duct stones, pancreatic insufficiency and malignancy are excluded from the study. The results were analysed by Student's t-test. Alkaline phosphatase in all the above mentioned cases was not significantly different from the control group (40 female, 21 male healthy individuals). A significant association was found out with serum alpha-amylase (p < 0.05) and a highly significant association was found out with pancreatic amylase (p < 0.001). Results of serum lipase however were inconclusive (p = 0.1). Pancreatic amylase can be estimated at a reasonable cost and costwise may prove to be a marker of gall-stone diseases which are in many cases silent preventing further complications and chances of Malignancy especially where alkaline phosphatase isinconclusive.

  19. Are salivary amylase and pH – Prognostic indicators of cancers?

    PubMed Central

    Ramya, Atmakuri Shanmukha; Uppala, Divya; Majumdar, Sumit; Surekha, Ch.; Deepak, K.G.K.

    2015-01-01

    Background Saliva, “Mirror of body's health” has long been of particular interest as a substitute for blood for disease diagnosis and monitoring. The radiation effects on salivary glands are of particular interest in which salivary amylase is a good indicator of salivary glands function. Thus, estimation of these parameters represents a reasonable approach in evaluation of patient's risk for disease occurrence, intensity and prognosis. Aim of study To evaluate and compare the pH and amylase levels in saliva of cancer patients prior to treatment, patients during treatment. Materials and methods Saliva samples of 90 individuals were taken which were divided into 3 groups - 30 individuals without cancer, 30 cancer patients prior treatment and 30 cancer patients during treatment. Materials used were pH strips and pH meter, Salivary Amylase assay. Results Statistical analysis – ANOVA with post-hoc Tukey's test. 1) Significant decrease in salivary amylase levels – in cancer patients, during treatment when compared to others. 2) Significant decrease in salivary pH levels in newly diagnosed cancer patients prior to treatment. Conclusion To conclude, pH strips and pH meter showed to be a useful tool in the measurement of pH of saliva in individuals with and without cancer. This study showed that cancer patients without treatment have a lower pH of saliva. Treatment increased the pH of the saliva to a more alkaline level whereas amylase levels decreased in those subjects. Therefore those parameters can be an area of further research with an increased sample size, which in-turn may help in opening the doors for new dimension in non invasive prognostic markers. PMID:26258019

  20. Engineering high α-amylase levels in wheat grain lowers Falling Number but improves baking properties.

    PubMed

    Ral, Jean-Philippe; Whan, Alex; Larroque, Oscar; Leyne, Emmett; Pritchard, Jeni; Dielen, Anne-Sophie; Howitt, Crispin A; Morell, Matthew K; Newberry, Marcus

    2016-01-01

    Late maturity α-amylase (LMA) and preharvest sprouting (PHS) are genetic defects in wheat. They are both characterized by the expression of specific isoforms of α-amylase in particular genotypes in the grain prior to harvest. The enhanced expression of α-amylase in both LMA and PHS results in a reduction in Falling Number (FN), a test of gel viscosity, and subsequent downgrading of the grain, along with a reduced price for growers. The FN test is unable to distinguish between LMA and PHS; thus, both defects are treated similarly when grain is traded. However, in PHS-affected grains, proteases and other degradative process are activated, and this has been shown to have a negative impact on end product quality. No studies have been conducted to determine whether LMA is detrimental to end product quality. This work demonstrated that wheat in which an isoform α-amylase (TaAmy3) was overexpressed in the endosperm of developing grain to levels of up to 100-fold higher than the wild-type resulted in low FN similar to those seen in LMA- or PHS-affected grains. This increase had no detrimental effect on starch structure, flour composition and enhanced baking quality, in small-scale 10-g baking tests. In these small-scale tests, overexpression of TaAmy3 led to increased loaf volume and Maillard-related browning to levels higher than those in control flours when baking improver was added. These findings raise questions as to the validity of the assumption that (i) LMA is detrimental to end product quality and (ii) a low FN is always indicative of a reduction in quality. This work suggests the need for a better understanding of the impact of elevated expression of specific α-amylase on end product quality.

  1. Effects of guanidine hydrochloride and high pressure on subsite flexibility of beta-amylase.

    PubMed

    Tanaka, Naoki; Kajimoto, Sachie; Mitani, Daisuke; Kunugi, Shigeru

    2002-04-29

    We investigated the effects of guanidine hydrochloride (GuHCl) and high pressure on the conformational flexibility of the active site of sweet potato beta-amylase by monitoring the sulfhydryl reaction and the enzymatic activity. The reactivity of Cys345 at the active site, one of six inert half cystine residues of this enzyme, was enhanced by GuHCl at concentrations below 0.5 M. A GuHCl-induced change of the active site was also observed through an intensity change in the near-UV circular dichroism (CD) spectrum. On the other hand, the native conformation of sweet potato beta-amylase observed through fluorescence polarization, far-UV CD spectrum and intrinsic fluorescence was not influenced by GuHCl at concentrations below 0.5 M. Therefore, Cys345 reaction caused by GuHCl was due to an alteration of the local conformation of the active site. GuHCl-induced reaction of Cys345, located in the vicinity of subsites 3 and 4, is attributed to enhanced subsite flexibility, which is responsible for substrate slipping in a single-chain attack mechanism. Due to the flexible conformation, the local region of the subsite is more susceptible to GuHCl perturbation than the molecule overall. The enzymatic activity of sweet potato beta-amylase was reversibly inhibited by GuHCl at concentrations below 0.5 M, and kinetic analysis of the enzymatic mechanism showed that GuHCl decreases the kcat value. High pressure below 400 MPa also inactivated sweet potato beta-amylase with an increase in Cys345 reactivity. These findings indicated that excessively enhanced subsite flexibility reduced the enzymatic activity of sweet potato beta-amylase.

  2. Two Strategies for Microbial Production of an Industrial Enzyme-Alpha-Amylase

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Garriott, Owen; Pusey, Marc L.; Ng, Joseph D.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments including hot springs, soda lakes and arctic water. This ability of survival at extreme conditions has rendered extremophiles to be of interest in astrobiology, evolutionary biology as well as in industrial applications. Of particular interest to the biotechnology industry are the biological catalysts of the extremophiles, the extremozymes, whose unique stabilities at extreme conditions make them potential sources of novel enzymes in industrial applications. There are two major approaches to microbial enzyme production. This entails enzyme isolation directly from the natural host or creating a recombinant expression system whereby the targeted enzyme can be overexpressed in a mesophilic host. We are employing both methods in the effort to produce alpha-amylases from a hyperthermophilic archaeon (Thermococcus) isolated from a hydrothermal vent in the Atlantic Ocean, as well as from alkaliphilic bacteria (Bacillus) isolated from a soda lake in Tanzania. Alpha-amylases catalyze the hydrolysis of internal alpha-1,4-glycosidic linkages in starch to produce smaller sugars. Thermostable alpha-amylases are used in the liquefaction of starch for production of fructose and glucose syrups, whereas alpha-amylases stable at high pH have potential as detergent additives. The alpha-amylase encoding gene from Thermococcus was PCR amplified using carefully designed primers and analyzed using bioinformatics tools such as BLAST and Multiple Sequence Alignment for cloning and expression in E.coli. Four strains of Bacillus were grown in alkaline starch-enriched medium of which the culture supernatant was used as enzyme source. Amylolytic activity was detected using the starch-iodine method.

  3. β-amylase 1 (BAM1) degrades transitory starch to sustain proline biosynthesis during drought stress.

    PubMed

    Zanella, Martina; Borghi, Gian Luca; Pirone, Claudia; Thalmann, Matthias; Pazmino, Diana; Costa, Alex; Santelia, Diana; Trost, Paolo; Sparla, Francesca

    2016-03-01

    During photosynthesis of higher plants, absorbed light energy is converted into chemical energy that, in part, is accumulated in the form of transitory starch within chloroplasts. In the following night, transitory starch is mobilized to sustain the heterotrophic metabolism of the plant. β-amylases are glucan hydrolases that cleave α-1,4-glycosidic bonds of starch and release maltose units from the non-reducing end of the polysaccharide chain. In Arabidopsis, nocturnal degradation of transitory starch involves mainly β-amylase-3 (BAM3). A second β-amylase isoform, β-amylase-1 (BAM1), is involved in diurnal starch degradation in guard cells, a process that sustains stomata opening. However, BAM1 also contributes to diurnal starch turnover in mesophyll cells under osmotic stress. With the aim of dissecting the role of β-amylases in osmotic stress responses in Arabidopsis, mutant plants lacking either BAM1 or BAM3 were subject to a mild (150mM mannitol) and prolonged (up to one week) osmotic stress. We show here that leaves of osmotically-stressed bam1 plants accumulated more starch and fewer soluble sugars than both wild-type and bam3 plants during the day. Moreover, bam1 mutants were impaired in proline accumulation and suffered from stronger lipid peroxidation, compared with both wild-type and bam3 plants. Taken together, these data strongly suggest that carbon skeletons deriving from BAM1 diurnal degradation of transitory starch support the biosynthesis of proline required to face the osmotic stress. We propose the transitory-starch/proline interplay as an interesting trait to be tackled by breeding technologies aimingto improve drought tolerance in relevant crops.

  4. Diurnal profiles of salivary cortisol and alpha-amylase change across the adult lifespan: evidence from repeated daily life assessments.

    PubMed

    Nater, Urs M; Hoppmann, Christiane A; Scott, Stacey B

    2013-12-01

    Salivary cortisol and alpha-amylase are known to have distinctive diurnal profiles. However, little is known about systematic changes in these biomarkers across the adult lifespan. In a study of 185 participants (aged 20-81 years), time-stamped salivary cortisol and alpha-amylase were collected 7 times/day over 10 days. Samples were taken upon waking, 30 min later, and then approximately every 3 h until 9 pm. Multilevel models showed that older age was associated with increased daily cortisol secretion as indicated by greater area under the curve, attenuated wake-evening slopes, and more pronounced cortisol awakening responses. Further, older age was related to greater daily alpha-amylase output and attenuated wake-evening slopes. No age differences were observed regarding the alpha-amylase awakening response. Our findings may contribute to a better understanding of age-related differences in functioning of stress-related systems.

  5. The Interaction of Genetic and Environmental Factors in the Control of Amylase Gene Expression in DROSOPHILA MELANOGASTER

    PubMed Central

    Benkel, Bernhard F.; Hickey, Donal A.

    1986-01-01

    A number of previous studies have established that amylase activity can vary between Drosophila strains which are maintained under identical laboratory conditions. In addition, we have recently shown that all strains examined so far are subject to glucose repression of amylase activity. In this study, we show that the degree of glucose repression can vary between strains. Moreover, the glucose repression effect is much more pronounced in larvae than in adult flies. Our results lead to the conclusion that the strain-specific differences in activity and the dietary effects are not independent phenomena. These results have implications for the interpretation of many studies on amylase activity variation, including those experiments which have been designed to link amylase activity variations with fitness differences in nature. A question that naturally arises concerns the molecular basis for these strain-specific variations in the degree of glucose repression of this eukaryotic gene. PMID:17246356

  6. Purification by expanded bed adsorption and characterization of an alpha-amylases FORILASE NTL from A. niger.

    PubMed

    Toledo, A L; Severo, J B; Souza, R R; Campos, E S; Santana, J C C; Tambourgi, E B

    2007-02-01

    In this work the purification and biochemistry characterization of alpha-amylases from Aspergillus niger (FORILASE NTL) were studied. The effects of expansion degree of resin bed on enzyme purification by expanded bed adsorption (EBA) have also been studied. Residence time distributions (RTD) studies were done to achieve the optimal conditions of the amylases recovery on ion-exchange resin, and glucose solution was used as a new tracer. Results showed that height equivalent of the theoretical plates (HETP), axial dispersion and the Prandt number increased with bed height, bed voidage and linear velocity. The adsorption capacity of alpha-amylases, on the resin, increased with bed height and the best condition was at four-expansion degree. alpha-Amylase characterization showed that this enzyme has high affinity with soluble starch, good hydrolysis potential and molecular weight of 116 kDa.

  7. Mixed-mode resins: taking shortcut in downstream processing of raw-starch digesting α-amylases.

    PubMed

    Lončar, Nikola; Šokarda Slavić, Marinela; Vujčić, Zoran; Božić, Nataša

    2015-10-23

    Bacillus licheniformis 9945a α-amylase is known as a potent enzyme for raw starch hydrolysis. In this paper, a mixed mode Nuvia cPrime™ resin is examined with the aim to improve the downstream processing of raw starch digesting amylases and exploit the hydrophobic patches on their surface. This resin combines hydrophobic interactions with cation exchange groups and as such the presence of salt facilitates hydrophobic interactions while the ion-exchange groups enable proper selectivity. α-Amylase was produced using an optimized fed-batch approach in a defined media and significant overexpression of 1.2 g L(-1) was achieved. This single step procedure enables simultaneous concentration, pigment removal as well as purification of amylase with yields of 96% directly from the fermentation broth.

  8. Improving Bread Quality with the Application of a Newly Purified Thermostable α-Amylase from Rhizopus oryzae FSIS4

    PubMed Central

    Ait Kaki El-Hadef El-Okki, Amel; Gagaoua, Mohammed; Bourekoua, Hayat; Hafid, Kahina; Bennamoun, Leila; Djekrif-Dakhmouche, Shahrazed; El-Hadef El-Okki, Mohamed; Meraihi, Zahia

    2017-01-01

    A new thermostable α-amylase from Rhizopus oryzae FSIS4 was purified for first time and recovered in a single step using a three-phase partitioning (TPP) system. The fungal α-amylase, at a concentration of 1.936 U per kg of flour, was used in bread-making and compared to the commercial enzyme. The results showed a significant effect of the recovered α-amylase in the prepared bread and allowed us to improve the quality of the bread. The study indicated clearly that the recovered α-amylase is a potential candidate for future applications in the bread-making industry and in other food biotechnology applications. PMID:28231081

  9. Pancreatic Amylase Is an Environmental Signal for Regulation of Biofilm Formation and Host Interaction in Campylobacter jejuni

    PubMed Central

    Jowiya, Waheed; Brunner, Katja; Abouelhadid, Sherif; Hussain, Haitham A.; Nair, Sean P.; Sadiq, Sohaib; Williams, Lisa K.; Trantham, Emma K.; Stephenson, Holly; Wren, Brendan W.; Bajaj-Elliott, Mona; Cogan, Tristan A.; Laws, Andrew P.; Wade, Jim; Dorrell, Nick

    2015-01-01

    Campylobacter jejuni is a commensal bacterium in the intestines of animals and birds and a major cause of food-borne gastroenteritis in humans worldwide. Here we show that exposure to pancreatic amylase leads to secretion of an α-dextran by C. jejuni and that a secreted protease, Cj0511, is required. Exposure of C. jejuni to pancreatic amylase promotes biofilm formation in vitro, increases interaction with human epithelial cell lines, increases virulence in the Galleria mellonella infection model, and promotes colonization of the chicken ileum. We also show that exposure to pancreatic amylase protects C. jejuni from stress conditions in vitro, suggesting that the induced α-dextran may be important during transmission between hosts. This is the first evidence that pancreatic amylase functions as an interkingdom signal in an enteric microorganism. PMID:26438798

  10. Pancreatic amylase is an environmental signal for regulation of biofilm formation and host interaction in Campylobacter jejuni.

    PubMed

    Jowiya, Waheed; Brunner, Katja; Abouelhadid, Sherif; Hussain, Haitham A; Nair, Sean P; Sadiq, Sohaib; Williams, Lisa K; Trantham, Emma K; Stephenson, Holly; Wren, Brendan W; Bajaj-Elliott, Mona; Cogan, Tristan A; Laws, Andrew P; Wade, Jim; Dorrell, Nick; Allan, Elaine

    2015-12-01

    Campylobacter jejuni is a commensal bacterium in the intestines of animals and birds and a major cause of food-borne gastroenteritis in humans worldwide. Here we show that exposure to pancreatic amylase leads to secretion of an α-dextran by C. jejuni and that a secreted protease, Cj0511, is required. Exposure of C. jejuni to pancreatic amylase promotes biofilm formation in vitro, increases interaction with human epithelial cell lines, increases virulence in the Galleria mellonella infection model, and promotes colonization of the chicken ileum. We also show that exposure to pancreatic amylase protects C. jejuni from stress conditions in vitro, suggesting that the induced α-dextran may be important during transmission between hosts. This is the first evidence that pancreatic amylase functions as an interkingdom signal in an enteric microorganism.

  11. Aspergillus 6V4, a Strain Isolated from Manipueira, Produces High Amylases Levels by Using Wheat Bran as a Substrate

    PubMed Central

    Celestino, Jessyca dos Reis; Duarte, Ana Caroline; Silva, Cláudia Maria de Melo; Sena, Hellen Holanda; Ferreira, Maria do Perpétuo Socorro Borges Carriço; Mallmann, Neila Hiraishi; Lima, Natacha Pinheiro Costa; Tavares, Chanderlei de Castro; de Souza, Rodrigo Otávio Silva; Souza, Érica Simplício; Souza, João Vicente Braga

    2014-01-01

    The aim of this study was screening fungi strains, isolated from manipueira (a liquid subproduct obtained from the flour production of Manihot esculenta), for amylases production and investigating production of these enzymes by the strain Aspergillus 6V4. The fungi isolated from manipueira belonged to Ascomycota phylum. The strain Aspergillus 6V4 was the best amylase producer in the screening assay of starch hydrolysis in petri dishes (ASHPD) and in the assay in submerged fermentation (ASbF). The strain Aspergillus 6V4 produced high amylase levels (335 UI/L) using wheat bran infusion as the exclusive substrate and the supplementation of this substrate with peptone decreased the production of this enzyme. The moisture content of 70% was the best condition for the production of Aspergillus 6V4 amylases (385 IU/g) in solid state fermentation (SSF). PMID:24724017

  12. In vitro α -amylase and α-glucosidase inhibitory potential of Trigonella foenum-graecum leaves extract.

    PubMed

    Ganeshpurkar, Aditya; Diwedi, Varsha; Bhardwaj, Yash

    2013-01-01

    Trigonella foenum-graecum is one of the widely used herbs in food and medicine. The seeds of the plants are investigated for antidiabetic potential; however, no efforts have been done to explore the potential of leaves to modify carbohydrate metabolizing enzymes viz. α-amylase and α-glucosidase. The present work was designed to investigate the inhibitory potential of ethyl acetate and water extract of T. foenum-graecum on enzymes α-amylase and α-glucosidase. Different concentrations of extracts were used to study inhibition of enzymatic activity of α-amylase and α-glucosidase. A dose dependent inhibitory effect on enzymes was observed. The current study, for the first time, revealed α-amylase and α-glucosidase inhibitory potential of T. foenum-graecum and the study could be helpful to isolate and characterize compounds responsible for it.

  13. A circularly permuted alpha-amylase-type alpha/beta-barrel structure in glucan-synthesizing glucosyltransferases.

    PubMed

    MacGregor, E A; Jespersen, H M; Svensson, B

    1996-01-15

    A motif of amino acid residues, located at the active site and specific beta-strands in alpha-amylases, is recognized in alpha-1,3- and alpha-1,6-glucan-synthesizing glucosyltransferases, leading to the conclusion that these enzymes contain an alpha/beta-barrel closely related to the (beta/alpha)8-fold of the alpha-amylase superfamily. The secondary structure elements of the transferase barrel, however, are circularly permuted to start with an alpha-helix equivalent to helix 3 in the alpha-amylases. Thus, the transferase counterpart of the long third beta-->alpha connection--constituting a domain in the alpha-amylases--is divided to precede and succeed the barrel. This architectural arrangement may be coupled to sucrose scission and glucosyl transfer. The involvement in the mechanism in glucosyltransferases of active site residues recurring in amylolytic enzymes is discussed.

  14. Production and biochemical characterization of a high maltotetraose (G4) producing amylase from Pseudomonas stutzeri AS22.

    PubMed

    Maalej, Hana; Ben Ayed, Hanen; Ghorbel-Bellaaj, Olfa; Nasri, Moncef; Hmidet, Noomen

    2014-01-01

    Amylase production and biochemical characterization of the crude enzyme preparation from Pseudomonas stutzeri AS22 were evaluated. The highest α-amylase production was achieved after 24 hours of incubation in a culture medium containing 10 g/L potato starch and 5 g/L yeast extract, with initial pH 8.0 at 30°C under continuous agitation at 200 rpm. The optimum temperature and pH for the crude α -amylase activity were 60°C and 8.0, respectively. The effect of different salts was evaluated and it was found that both α -amylase production and activity were Ca(2+)-dependent. The amylolytic preparation was found to catalyze exceptionally the formation of very high levels of maltotetraose from starch (98%, w/w) in the complete absence of glucose since the initial stages of starch hydrolysis (15 min) and hence would have a potential application in the manufacturing of maltotetraose syrups.

  15. Serum Amylase Levels in Relation to Islet β Cell Function in Patients with Early Type 2 Diabetes

    PubMed Central

    Zhuang, Lei; Su, Jian-bin; Zhang, Xiu-lin; Huang, Hai-yan; Zhao, Li-hua; Xu, Feng; Chen, Tong; Wang, Xue-qin; Wu, Gang; Wang, Xiao-hua

    2016-01-01

    Objective The insulin-pancreatic acinar axis may play a major role in pancreatic function. Amylase is an exocrine enzyme that is produced by pancreatic acinar cells, and low serum amylase levels may be associated with endocrine diseases, such as metabolic syndrome and diabetes. We hypothesized that low serum amylase levels may be associated with impaired islet β cell function in type 2 diabetes. Therefore, we investigated the relationship between the serum amylase levels and islet β cell function in patients with early type 2 diabetes. Methods The cross-sectional study recruited 2327 patients with a mean of 1.71±1.62 years since their diagnosis of type 2 diabetes, and all participants were treated with lifestyle intervention alone. Serum amylase levels, the 75-g oral glucose tolerance test (OGTT) and metabolic risk factors were examined in all participants. The insulin sensitivity index (Matsuda index, ISIMatsuda) and insulin secretion index (ratio of total area-under-the-insulin-curve to glucose-curve, AUCins/glu) were derived from the OGTT. Integrated islet β cell function was assessed by the Insulin Secretion-Sensitivity Index-2 (ISSI-2) (ISIMatsuda multiplied by AUCins/glu). Results Serum amylase levels in the normal range were significantly correlated with ISIMatsuda, AUCins/glu and ISSI-2 (r = 0.203, 0.246 and 0.413, respectively, p<0.001). The association of the serum amylase levels with ISSI-2 (adjusted r = 0.363, p<0.001) was closer than the association with ISIMatsuda (adjusted r = 0.191, p<0.001) and AUCins/glu (adjusted r = 0.174, p<0.001) after adjusting for the anthropometric indices, time since the diagnosis of diabetes, lipid profiles, uric acid levels, estimated glomerular filtration rate, HbA1c levels, smoking and drinking using the partial correlation test. After adjusting for these metabolic risk factors in the multivariate regression analysis with the amylase levels as the dependent variable, ISSI-2 was the major independent contributor to

  16. Isolation, purification and characterization of β-amylase from Dioscorea hispida Dennst

    NASA Astrophysics Data System (ADS)

    Oktiarni, Dwita; Lusiana, Simamora, Febri Yanti; Gaol, Jusni M. Lumban

    2015-09-01

    β-amylase (E.C 3.2.1.2) is an enzyme commonly found in plants and bacteria. The enzyme is an exo-acting carbohydrolase which hydrolyzes α-1.4-glucosidic linkages of starch, removing maltose units from the non-reducing end of the polysaccharide chain, producing β-maltose and β-limit dextrin as the final product. β-amylase is widely distributed in the higher plants such as sweet potato. Besides the use in starch hydrolysis, starch-converting enzymes are also used in a number of other industrial applications, such as laundry and porcelain detergents or as anti-stalling agents in baking. This enzyme was extracted from Dioscorea hispida Dennst in 0.05 M acetate buffer pH 4.8 and followed by ammonium sulfate fractionation at cold temperature (10°C). Ammonium sulfate fractionation was shared into fraction of 0-60%, 60-70%, 70-80% and 80-100%. The fraction containing high of specific activity (determined by Somogyi-Nelson and Lowry methods) was futher purified by dialysis. Fraction with high enzyme activity of β-amylase were fraction 60-70% and 70-80%, with specific activity of Dioscorea hispida Dennst were 1.32 and 1.55 mg sugar.mg protein-1.minute-1, whereas specific activity of crude extract enzyme was 0.21 mg sugar.mg protein-1.minute-1. After purified with dialysis, fraction with high enzyme activity of β-amylase were fraction of 60-70% and 70-80%, with specific activity of Dioscorea hispida Dennst was 2.72 and 4.24 mg sugar.mg protein-1.minute-1. The purified Dioscorea hispida Dennst β-amylase from dialysis showed increasing in spesific activity the crude enzyme as much as 24 folds. The characterization of enzyme showed that Dioscorea hispida Dennst derived enzyme had optimum pH of 5.5 and temperature of 70°C. The kinetic parameters of purified Dioscorea hispida Dennst β-amylase showed that the KMapp, Vmaxapp value and Hill constant were 0.0211 mg/ml, 9.63 mg sugar.minute-1 and 1.34, respectively.

  17. Phospholipase A2 as a point of care alternative to serum amylase and pancreatic lipase

    NASA Astrophysics Data System (ADS)

    Liu, Nathan J.; Chapman, Robert; Lin, Yiyang; Bentham, Andrew; Tyreman, Matthew; Philips, Natalie; Khan, Shahid A.; Stevens, Molly M.

    2016-06-01

    Acute pancreatitis is a relatively common and potentially fatal condition, but the presenting symptoms are non-specific and diagnosis relies largely on the measurement of amylase activity by the hospital clinical laboratory. In this work we develop a point of care test for pancreatitis measuring concentration of secretory phospholipase A2 group IB (sPLA2-IB). Novel antibodies for sPLA2-IB were raised and used to design an ELISA and a lateral flow device (LFD) for the point of care measurement of sPLA2-IB concentration, which was compared to pancreatic amylase activity, lipase activity, and sPLA2-IB activity in 153 serum samples. 98 of these samples were obtained from the pathology unit of a major hospital and classified retrospectively according to presence or absence of pancreatitis, and the remaining 55 were obtained from commercial sources to serve as high lipase (n = 20), CA19-9 positive (n = 15), and healthy (n = 20) controls. sPLA2-IB concentration correlated well with the serum activity of both amylase and lipase, and performed at least as well as either markers in the differentiation of pancreatitis from controls.Acute pancreatitis is a relatively common and potentially fatal condition, but the presenting symptoms are non-specific and diagnosis relies largely on the measurement of amylase activity by the hospital clinical laboratory. In this work we develop a point of care test for pancreatitis measuring concentration of secretory phospholipase A2 group IB (sPLA2-IB). Novel antibodies for sPLA2-IB were raised and used to design an ELISA and a lateral flow device (LFD) for the point of care measurement of sPLA2-IB concentration, which was compared to pancreatic amylase activity, lipase activity, and sPLA2-IB activity in 153 serum samples. 98 of these samples were obtained from the pathology unit of a major hospital and classified retrospectively according to presence or absence of pancreatitis, and the remaining 55 were obtained from commercial sources to

  18. α-Amylase inhibitor-1 gene from Phaseolus vulgaris expressed in Coffea arabica plants inhibits α-amylases from the coffee berry borer pest

    PubMed Central

    2010-01-01

    Background Coffee is an important crop and is crucial to the economy of many developing countries, generating around US$70 billion per year. There are 115 species in the Coffea genus, but only two, C. arabica and C. canephora, are commercially cultivated. Coffee plants are attacked by many pathogens and insect-pests, which affect not only the production of coffee but also its grain quality, reducing the commercial value of the product. The main insect-pest, the coffee berry borer (Hypotheneumus hampei), is responsible for worldwide annual losses of around US$500 million. The coffee berry borer exclusively damages the coffee berries, and it is mainly controlled by organochlorine insecticides that are both toxic and carcinogenic. Unfortunately, natural resistance in the genus Coffea to H. hampei has not been documented. To overcome these problems, biotechnological strategies can be used to introduce an α-amylase inhibitor gene (α-AI1), which confers resistance against the coffee berry borer insect-pest, into C. arabica plants. Results We transformed C. arabica with the α-amylase inhibitor-1 gene (α-AI1) from the common bean, Phaseolus vulgaris, under control of the seed-specific phytohemagglutinin promoter (PHA-L). The presence of the α-AI1 gene in six regenerated transgenic T1 coffee plants was identified by PCR and Southern blotting. Immunoblotting and ELISA experiments using antibodies against α-AI1 inhibitor showed a maximum α-AI1 concentration of 0.29% in crude seed extracts. Inhibitory in vitro assays of the α-AI1 protein against H. hampei α-amylases in transgenic seed extracts showed up to 88% inhibition of enzyme activity. Conclusions This is the first report showing the production of transgenic coffee plants with the biotechnological potential to control the coffee berry borer, the most important insect-pest of crop coffee. PMID:20565807

  19. Possible involvement of β₁ receptors in various emetogen-induced increases in salivary amylase activity in rats.

    PubMed

    Fukui, Hideo; Suyama, Yoshimi; Iwachido, Takako; Miwa, Eri

    2011-01-01

    We investigated the inhibitory effects of β₁- or β₂-adrenoceptor (AR) antagonists on salivary amylase secretion produced by various emetic agents, such as cisplatin, apomorphine, and lithium chloride (LiCl), or the non-emetic agent β(½)-AR agonist isoprenaline in rats. We also determined the inhibitory effect of metoclopramide, a dopamine D₂-receptor antagonist, on increases in the salivary amylase activity induced by apomorphine or granisetron, a 5-HT(3)-receptor antagonist, on LiCl-induced increased salivary amylase activity. Isoprenaline (0.01 mg/kg, s.c.) produced an increase in salivary amylase and the increase was inhibited by the β(½)-AR antagonist propranolol (5 mg/kg, s.c.) and β₁-AR antagonist atenolol (2 mg/kg, s.c.) but not by the β₂-AR antagonist butoxamine (8 mg/kg, s.c.). The increased amylase activity induced by cisplatin (15 mg/kg, i.v.), apomorphine (3 mg/kg, s.c.), or LiCl (120 mg/kg, i.p.) was inhibited significantly by atenolol (2 mg/kg, s.c.) but not by butoxamine (8 mg/kg, s.c.). In addition, increases in amylase activities induced by apomorphine and LiCl were inhibited significantly by metoclopramide (10 mg/kg, i.v.) and granisetron (3 mg/kg, i.v.), respectively. These results suggest that salivary amylase secretion induced by various emetogens is involved in β₁-adrenoceptor activity and that salivary amylase activity is useful to detect emetogens with no direct β₁-AR activation in rats, a species that does not exhibit vomiting.

  20. Development and validation of a monoclonal based immunoassay for the measurement of fungal alpha-amylase: focus on peak exposures.

    PubMed

    Elms, J; Denniss, S; Smith, M; Evans, P G; Wiley, K; Griffin, P; Curran, A D

    2001-03-01

    The inhalation of flour dust has been implicated in the induction of sensitisation and elicitation of respiratory symptoms, such as asthma in bakers. In addition to the cereal allergens present in wheat flour, enzymes in flour improvers, in particular fungal alpha-amylase, are now known to be a significant cause of respiratory allergy in the baking industry.A monoclonal antibody based enzyme-linked immunoassay (ELISA) was developed using two monoclonal antibodies that recognised two distinct epitopes of the fungal alpha-amylase enzyme. The ELISA had an inter-assay variation of 12.0% at 1360 pg/ml and 12.8% at 564 pg/ml and intra-assay variation of 4.9% at 1340 pg/ml and 6.1% at 504 pg/ml. The assay had a sensitivity of 200 pg/ml. Competitive inhibition assays confirmed that the monoclonal antibodies had no cross reactivity with other enzymes used in the baking industry and could distinguish added fungal alpha-amylase from cereal amylase. We assessed the levels of exposure to dust, total protein and fungal alpha-amylase in four UK bakeries ranging in size and technical capabilities. Within the bakeries we surveyed, workers were exposed to variable levels of inhalable dust (0.8-39.8 mg/m3), total protein (0-5.7 mg/m3) and fungal alpha-amylase (0-29.8 ng/m3). Consecutive 15 min personal samples taken over a 1 h period demonstrated that the ELISA could measure fungal alpha-amylase exposure in such a 15 min period. Short term peak exposures to fungal alpha-amylase could be identified which may contribute to the sensitisation in individuals who appear to have low exposure levels if measured over a full shift period.

  1. The production of a new fungal alpha-amylase degraded the raw starch by means of solid-state fermentation.

    PubMed

    Balkan, Bilal; Ertan, Figen

    2010-01-01

    In this study, it was intended to produce a new fungal amylase by solid-state fermentation and purification and also to determine some of its biochemical properties. It was found that Penicillium brevicompactum had the best enzyme activity according to screening methods with amylase degrading raw starch, and P. brevicompactum was selected as the amylase source. Wheat bran, rice husks, and sunflower oil meal were tested to determine the best solid substrate. Wheat bran was determined as the best of these. The fermentation conditions were optimized for the production of amylase. The optimum fermentation conditions were found to be an initial moisture level for the solid substrate of 55%, moistening agent of 0.1 M sodium phosphate buffer (pH 5.0), incubation period of 7 d, inoculum concentration of 2.5 mL, and incubation temperature at 30 degrees C. Penicillium brevicompactum alpha-amylase was purified 45.98 times by the starch affinity method. The K(m) and V(max) values of alpha-amylase for soluble starch were 5.71 mg/mL and 666.6 U/mL, respectively. This amylase showed maximum activity at between 30 and 50 degrees C and at pH 5.0. Initial enzyme activity was kept at 100% after incubation at 30 degrees C for 45 min. Enzyme was stable in the pH range of 4.0-5.0. This enzyme was activated by Mn(2+), Cu(2+), and Na(+) ions, and was inhibited by Mg(2+), K(+), Fe(3+), and ethylenediamine tetraacetic acid (EDTA). The molecular mass of P. brevicompactum alpha-amylase was found to be 32.5 kD by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis.

  2. Chloride Activated Halophilic α-Amylase from Marinobacter sp. EMB8: Production Optimization and Nanoimmobilization for Efficient Starch Hydrolysis

    PubMed Central

    Kumar, Sumit; Khare, S. K.

    2015-01-01

    Halophiles have been perceived as potential source of novel enzymes in recent years. The interest emanates from their ability to catalyze efficiently under high salt and organic solvents. Present work encompasses production optimization and nanoimmobilization of an α-amylase from moderately halophilic Marinobacter sp. EMB8. Media ingredients and culture conditions were optimized by “one-at-a-time approach.” Starch was found to be the best carbon source at 5% (w/v) concentration. Glucose acted as catabolic repressor for amylase production. Salt proved critical for amylase production and maximum production was attained at 5% (w/v) NaCl. Optimization of various culture parameters resulted in 48.0 IU/mL amylase production, a 12-fold increase over that of unoptimized condition (4.0 IU/mL). α-Amylase was immobilized on 3-aminopropyl functionalized silica nanoparticles using glutaraldehyde as cross-linking agent. Optimization of various parameters resulted in 96% immobilization efficiency. Starch hydrolyzing efficiency of immobilized enzyme was comparatively better. Immobilized α-amylase retained 75% of its activity after 5th cycle of repeated use. PMID:25667773

  3. Effects of metals on {alpha}-amylase activity in the digestive gland of the green mussel, Perna viridis L.

    SciTech Connect

    Yan, T.; Teo, L.H.; Sin, Y.M.

    1996-04-01

    A number of digestive enzymes in the green mussel, Perna viridis L., have been reported, and {alpha}-amylase is believed to have a higher activity than the others. Small plankton, on which the green mussel feeds, may supply plenty of starch and glycogen. They may be an important source of nutrients for the green mussel and the ability of the latter to make good use of them depends mainly on the activities of amylase. The effect of heavy metals on amylase activity is also important as the ability of the mussel`s digestive gland to accumulate these metals is well known. High concentrations of heavy metals, especially lead, have been observed in the water around Singapore. The in vitro inhibition of some metals on the activities of digestive enzymes from the green mussel has been observed, but kinetic properties of the inhibition and the in vivo inhibition of the heavy metals on digestive enzymes are little understood. In the present study, in vitro inhibition of four metals (Pb, Cd, Zn and Hg) on the activity of {alpha}-amylase from the digestive gland of the green mussel will be compared. Their effects on the K{sub M} and V{sub max} values of {alpha}-amylase will also be compared. Finally, lead is either added to the food or water, to see how it affects the activity of {alpha}-amylase and how this effect acts in combination with starvation. 12 refs., 3 figs., 3 tabs.

  4. Utilization of a maltotetraose-producing amylase as a whole wheat bread improver: dough rheology and baking performance.

    PubMed

    Bae, Woosung; Lee, Sung Ho; Yoo, Sang-Ho; Lee, Suyong

    2014-08-01

    A maltotetraose-producing enzyme (G4-amylase) was utilized to improve the baking performance of whole-grain wheat flour. Whole-grain bread dough prepared with G4-amylase showed reduced water absorption and increased development time, while the dough stability was not affected. Also, the G4-amylase-treated samples exhibited lower Mixolab torque values than the control upon heating and cooling. Rheological measurements showed the decreased ratio of Rmax /E and increased tan δ, clearly demonstrating that the viscous characteristics of whole-grain bread dough became dominant with increasing levels of G4-amylase. The use of G4-amylase produced whole-grain wheat breads with a variety of maltooligosaccharides, primarily maltotetraose that positively contributed to the bread volume (1.2-fold higher than the control). Moreover, G4-amylase delayed the crumb firming of whole-grain wheat bread during a 7-d storage period, showing that it can function as an antiretrogradation agent to enhance the quality attributes of whole-grain wheat bread.

  5. Three alpha-amylases from malted finger millet (Ragi, Eleusine coracana, Indaf-15)--purification and partial characterization.

    PubMed

    Nirmala, M; Muralikrishna, G

    2003-01-01

    Three alpha-amylases (E.C. 3.2.1.1) were purified to apparent homogeneity from 72 h finger millet malt by three step purification via fractional acetone precipitation, DEAE-Sephacel ion exchange and Sephacryl S-200 gel permeation chromatographies with a recovery of 6.5, 2.9, 9.6% and fold purification of 26, 17 and 31, respectively. alpha-Nature of these amylases was identified by their ability to rapidly reduce the viscosity of starch solution and also in liberating oligosaccharides of higher D.P. and were accordingly designated as amylases alpha-1((b)), alpha-2 and alpha-3, respectively. These amylases, having a molecular weight of 45+/-2 kDa were found to be monomeric. The pH and temperature optima of these alpha-amylases were found to be in the range of 5.0-5.5 and 45-50 degrees C, respectively. K(m) values of these amylases for various cereal starches varied between 0.59 and 1.43%. Carbodiimide (50 mM) and metal ions such as Al(3+), Fe(2+), and Hg(2+) (5 mM) have completely inhibited these enzymes at 45 degrees C. Amino acid analysis of these enzymes indicated high amounts of glycine which is an unusual feature of these enzymes.

  6. Engineering α-amylase levels in wheat grain suggests a highly sophisticated level of carbohydrate regulation during development

    PubMed Central

    Whan, Alex; Dielen, Anne-Sophie; Mieog, Jos; Bowerman, Andrew F.; Robinson, Hannah M.; Byrne, Keren; Colgrave, Michelle; Larkin, Philip J.; Howitt, Crispin A.; Morell, Matthew K.; Ral, Jean-Philippe

    2014-01-01

    Wheat starch degradation requires the synergistic action of different amylolytic enzymes. Our spatio-temporal study of wheat α-amylases throughout grain development shows that AMY3 is the most abundant isoform compared with the other known α-amylases. Endosperm-specific over-expression of AMY3 resulted in an increase of total α-amylase activity in harvested grains. Unexpectedly, increased activity did not have a significant impact on starch content or composition but led to an increase of soluble carbohydrate (mainly sucrose) in dry grain. In AMY3 overexpression lines (A3OE), germination was slightly delayed and triacylglycerol (TAG) content was increased in the endosperm of mature grain. Despite increased AMY3 transcript and protein content throughout grain development, alterations of α-amylase activity and starch granule degradation were not detected until grain maturation, suggesting a post-translational inhibition of α-amylase activity in the endosperm during the starch filling period. These findings show unexpected effects of a high level of α-amylase on grain development and composition, notably in carbon partitioning and TAG accumulation, and suggest the presence of a hitherto unknown regulatory pathway during grain filling. PMID:25053646

  7. Alpha-amylase and alpha-glucosidase inhibition is differentially modulated by fucoidan obtained from Fucus vesiculosus and Ascophyllum nodosum.

    PubMed

    Kim, Kyung-Tae; Rioux, Laurie-Eve; Turgeon, Sylvie L

    2014-02-01

    Fucoidan is a water-soluble, negatively charged, biologically active polysaccharide found in great abundance in brown marine algae. However, the inhibition of α-amylase and α-glucosidase by fucoidan derived from two algal species (Ascophyllum nodosum and Fucus vesiculosus) harvested at different periods (accounting for seasonal and yearly variations) has never been investigated. It was found that fucoidans inhibited α-glucosidase differently, depending on the algal species from which it was extracted and the algae's season of harvest. Fucoidan extracted from A. nodosum was a more potent inhibitor of α-glucosidase, with an IC50 ranging from 0.013 to 0.047 mg/mL, than the inhibition by fucoidan extracted from F. vesiculosus (IC50=0.049 mg/mL). In contrast, fucoidan extracted from F. vesiculosus did not inhibit α-amylase activity, while fucoidan from A. nodosum decreased α-amylase activity by 7-100% at 5 mg/mL depending upon the algae harvest period. An IC50 of 0.12-4.64 mg/mL for fucoidan from A. nodosum was found for the α-amylase inhibition. The ability of fucoidan to inhibit α-amylase and α-glucosidase thus varies according to the algae species and harvest period. A. nodosum is more suitable than F. vesiculosus as a source of fucoidan to inhibit α-amylase and α-glucosidase activities. Their potential benefits towards Type 2 diabetes management should be further investigated.

  8. Screening alpha-glucosidase and alpha-amylase inhibitors from natural compounds by molecular docking in silico.

    PubMed

    Jhong, Chien-Hung; Riyaphan, Jirawat; Lin, Shih-Hung; Chia, Yi-Chen; Weng, Ching-Feng

    2015-01-01

    The alpha-glucosidase inhibitor is a common oral anti-diabetic drug used for controlling carbohydrates normally converted into simple sugars and absorbed by the intestines. However, some adverse clinical effects have been observed. The present study seeks an alternative drug that can regulate the hyperglycemia by down-regulating alpha-glucosidase and alpha-amylase activity by molecular docking approach to screen the hyperglycemia antagonist against alpha-glucosidase and alpha-amylase activities from the 47 natural compounds. The docking data showed that Curcumin, 16-hydroxy-cleroda-3,13-dine-16,15-olide (16-H), Docosanol, Tetracosanol, Antroquinonol, Berberine, Catechin, Quercetin, Actinodaphnine, and Rutin from 47 natural compounds had binding ability towards alpha-amylase and alpha-glucosidase as well. Curcumin had a better biding ability of alpha-amylase than the other natural compounds. Analyzed alpha-glucosidase activity reveals natural compound inhibitors (below 0.5 mM) are Curcumin, Actinodaphnine, 16-H, Quercetin, Berberine, and Catechin when compared to the commercial drug Acarbose (3 mM). A natural compound with alpha-amylase inhibitors (below 0.5 mM) includes Curcumin, Berberine, Docosanol, 16-H, Actinodaphnine/Tetracosanol, Catechin, and Quercetin when compared to Acarbose (1 mM). When taken together, the implication is that molecular docking is a fast and effective way to screen alpha-glucosidase and alpha-amylase inhibitors as lead compounds of natural sources isolated from medicinal plants.

  9. Alpha-amylase from mung beans (Vigna radiata)--correlation of biochemical properties and tertiary structure by homology modelling.

    PubMed

    Tripathi, Pallavi; Lo Leggio, Leila; Mansfeld, Johanna; Ulbrich-Hofmann, Renate; Kayastha, Arvind M

    2007-06-01

    Alpha-amylase from germinated mung beans (Vigna radiata) has been purified 600-fold to electrophoretic homogeneity and a final specific activity of 437 U/mg. SDS-PAGE of the final preparation revealed a single protein band of 46 kDa. The optimum pH was 5.6. The energy of activation was determined to be 7.03 kcal/mol in the temperature range 15-55 degrees C. Km for starch was 1.6 mg/mL in 50 mM sodium acetate buffer, pH 5.5. Thermal inactivation studies at 70 degrees C showed first-order kinetics with rate constant (k) equal to 0.005 min(-1). Mung bean alpha-amylase showed high specificity for its primary substrate starch. Addition of EDTA (10 mM) caused irreversible loss of activity. Mung bean alpha-amylase is inhibited in a non-competitive manner by heavy metal ions, for example, mercury with a Ki of 110 microM. Homology modelling studies with mung bean alpha-amylase using barley alpha-amylases Amy 1 and Amy 2 as templates showed a very similar structure as expected from the high sequence identity. The model showed that alpha-amylase from mung beans has no sugar-binding site, instead it has a methionine. Furthermore, instead of two tryptophans, it has Val(277) and Lys(278), which are the conserved residues, important for proper folding and conformational stability.

  10. Cloning, enhanced expression and characterization of an α-amylase gene from a wild strain in B. subtilis WB800.

    PubMed

    Chen, Jing; Chen, Xianghua; Dai, Jun; Xie, Guangrong; Yan, Luying; Lu, Lina; Chen, Jianhua

    2015-09-01

    A Bacillus strain with high productivity of α-amylase isolated from a starch farm was identified as Bacillus amyloliquefaciens. The α-amylase encoding gene amy1 was cloned into pMD18-T vector and amplified in E. coli DH5α. Shuttle vector pP43MNX was reconstructed to obtain vector pP43X for heterologous expression of the α-amylase in B. subtilis WB800. Recombinant enzyme was sufficiently purified by precipitation, gel filtration and anion exchange with a specific activity of 5566 U/mg. The α-amylase sequence contains an open reading frame of 1545 bp, which encodes a protein of 514 amino acid residues with a predicted molecular mass of 58.4 kDa. The enzyme exhibited maximal activity at pH 6.0 and 60 °C. Catalytic efficiency of the recombinant α-amylase was inhibited by Hg(2+), Pb(2+) and Cu(2+), but stimulated by Li(+), Mn(2+) and Ca(2+). The purified enzyme showed decreased activity toward detergents (SDS, Tween 20 and Triton X-100). Compared with production by the wild strain, there was a 1.48-fold increase in the productivity of α-amylase in recombinant B. subtilis WB800.

  11. Control of. cap alpha. -amylase mRNA accumulation by gibberellic acid and calcium in barley aleurone layers

    SciTech Connect

    Deikman, J.; Jones, R.L.

    1985-01-01

    Pulse-labeling of barley (Hordeum vulgare L. cv Himalaya) aleurone layers incubated for 13 hours in 2.5 micromolar gibberellic acid (GA/sub 3/) with or without 5 millimolar CaCl/sub 2/ shows that ..cap alpha..-amylase isozymes 3 and 4 are not synthesized in vivo in the absence of Ca/sup 2 +/. No difference was observed in ..cap alpha..-amylase mRNA levels between layers incubated for 12 hours in 2.5 micromolar GA/sub 3/ with 5 millimolar CaCl/sub 2/ and layers incubated in GA/sub 3/ alone. RNA isolated from layers incubated for 12 hours in GA/sub 3/ with and without CA/sup 2 +/. A cDNA clone for ..cap alpha..-amylase was isolated and used to measure ..cap alpha..-amylase mRNA levels in aleurone layers incubated in the presence and absence of Ca/sup 2 +/ was translated in vitro and was found to produce the same complement of translation products regardless of the presence of Ca/sup 2 +/ in the incubation medium. Immunoprecipitation of translation products showed that the RNA for ..cap alpha..-amylase synthesized in Ca/sup 2 +/-deprived aleurone layers was translatable. Ca/sup 2 +/ is required for the synthesis of ..cap alpha..-amylase isozymes 3 and 4 at a step after mRNA accumulation and processing.

  12. Engineering α-amylase levels in wheat grain suggests a highly sophisticated level of carbohydrate regulation during development.

    PubMed

    Whan, Alex; Dielen, Anne-Sophie; Mieog, Jos; Bowerman, Andrew F; Robinson, Hannah M; Byrne, Keren; Colgrave, Michelle; Larkin, Philip J; Howitt, Crispin A; Morell, Matthew K; Ral, Jean-Philippe

    2014-10-01

    Wheat starch degradation requires the synergistic action of different amylolytic enzymes. Our spatio-temporal study of wheat α-amylases throughout grain development shows that AMY3 is the most abundant isoform compared with the other known α-amylases. Endosperm-specific over-expression of AMY3 resulted in an increase of total α-amylase activity in harvested grains. Unexpectedly, increased activity did not have a significant impact on starch content or composition but led to an increase of soluble carbohydrate (mainly sucrose) in dry grain. In AMY3 overexpression lines (A3OE), germination was slightly delayed and triacylglycerol (TAG) content was increased in the endosperm of mature grain. Despite increased AMY3 transcript and protein content throughout grain development, alterations of α-amylase activity and starch granule degradation were not detected until grain maturation, suggesting a post-translational inhibition of α-amylase activity in the endosperm during the starch filling period. These findings show unexpected effects of a high level of α-amylase on grain development and composition, notably in carbon partitioning and TAG accumulation, and suggest the presence of a hitherto unknown regulatory pathway during grain filling.

  13. Purification and characterisation of α-amylase produced by mutant strain of Aspergillus oryzae EMS-18.

    PubMed

    Abdullah, Roheena; Ikram-ul-Haq

    2015-01-01

    α-Amylase produced by a mutant strain of Aspergillus oryzae EMS-18 has been purified to homogeneity as judged by sodium dodecyle sulphate polyacrylamide gel electrophoresis (SDS-PAGE). The enzyme was purified by using 70% ammonium sulphate precipitation followed by anion exchange chromatography on DEAE-Sephadex column and gel filtration on Sephadex G-100. An enzyme purification factor of 9.5-fold was achieved with a final specific activity of 1987.7 U/mg protein and overall yield of 23.8%. The molecular weight of purified α-amylase was estimated to be 48 kDa by SDS-PAGE. The purified enzyme revealed an optimum assay temperature and pH 40°C and 5.0, respectively. Except Ca(++) all other metal ions such as Mg, Mn, Na, Zn, Ni, Fe, Cu, Co and Ba were found to be inhibitory to enzyme activity.

  14. Electron microscopic investigation of the diffusion of Bacillus licheniformis alpha-amylase into corn starch granules.

    PubMed

    Helbert, W; Schülein, M; Henrissat, B

    1996-10-01

    A method for the direct electron microscopic observation of amylases in interaction with starch granules is presented. The technique involves immuno-gold labeling of the enzymes and cross-sectioning of hydrated starch granules. This approach allows the analysis of the internal degradation of starch with a concomitant visualization of enzymes at the sites of hydrolysis. The visualization of enzymes at the surface, inside the channel and inside the core of the degraded granules shows that the alpha-amylase molecules first proceed from the surface toward the center (centripetal hydrolysis). Then the core is completely degraded from within by erosion of its periphery (centrifugal hydrolysis). In the first case (centripetal hydrolysis), the enzymes act by progressing along the polysaccharide chains. By contrast, the centrifugal hydrolysis leads to even erosion, indicative of a more diffusive motion of the enzymes.

  15. Production of saccharogenic and dextrinogenic amylases by Rhizomucor pusillus A 13.36.

    PubMed

    Silva, Tony M; Attili-Angeli, Derlene; Carvalho, Ana Flavia Azeved; Da Silva, Roberto; Boscolo, Mauricio; Gomes, Eleni

    2005-12-01

    A newly-isolated thermophilic strain of the zygomycete fungus Rhizomucor pusillus 13.36 produced highly active dextrinogenic and saccharogenic enzymes. Cassava pulp was a good alternative substrate for amylase production. Dextrinogenic and saccharogenic amylases exhibited optimum activities at a pH of 4.0-4.5 and 5.0 respectively and at a temperature of 75 degrees C. The enzymes were highly thermostable, with no detectable loss of saccharogenic or dextrinogenic activity after 1 h and 6 h at 60 degrees C, respectively. The saccharogenic activity was inhibited by Ca(2+) while the dextrinogenic was indifferent to this ion. Both activities were inhibited by Fe(2+) and Cu(2+) Hydrolysis of soluble starch by the crude enzyme yielded 66% glucose, 19.5% maltose, 7.7% maltotriose and 6.6% oligosaccharides.

  16. Temperature adaptations in psychrophilic, mesophilic and thermophilic chloride-dependent alpha-amylases.

    PubMed

    Cipolla, Alexandre; Delbrassine, François; Da Lage, Jean-Luc; Feller, Georges

    2012-09-01

    The functional and structural adaptations to temperature have been addressed in homologous chloride-dependent α-amylases from a psychrophilic Antarctic bacterium, the ectothermic fruit fly, the homeothermic pig and from a thermophilic actinomycete. This series covers nearly all temperatures encountered by living organisms. We report a striking continuum in the functional properties of these enzymes coupled to their structural stability and related to the thermal regime of the source organism. In particular, thermal stability recorded by intrinsic fluorescence, circular dichroism and differential scanning calorimetry appears to be a compromise between the requirement for a stable native state and the proper structural dynamics to sustain the function at the environmental/physiological temperatures. The thermodependence of activity, the kinetic parameters, the activations parameters and fluorescence quenching support these activity-stability relationships in the investigated α-amylases.

  17. Functionalized graphene sheets as immobilization matrix for Fenugreek β-amylase: enzyme kinetics and stability studies.

    PubMed

    Srivastava, Garima; Singh, Kritika; Talat, Mahe; Srivastava, Onkar Nath; Kayastha, Arvind M

    2014-01-01

    β-Amylase finds application in food and pharmaceutical industries. Functionalized graphene sheets were customised as a matrix for covalent immobilization of Fenugreek β-amylase using glutaraldehyde as a cross-linker. The factors affecting the process were optimized using Response Surface Methodology based Box-Behnken design of experiment which resulted in 84% immobilization efficiency. Scanning and Transmission Electron Microscopy (SEM, TEM) and Fourier Tansform Infrared (FTIR) spectroscopy were employed for the purpose of characterization of attachment of enzyme on the graphene. The enzyme kinetic studies were carried out for obtaining best catalytic performance and enhanced reusability. Optimum temperature remained unchanged, whereas optimum pH showed shift towards acidic range for immobilized enzyme. Increase in thermal stability of immobilized enzyme and non-toxic nature of functionalized graphene can be exploited for production of maltose in food and pharmaceutical industries.

  18. Production and characterization of a thermostable alpha-amylase from Nocardiopsis sp. endophyte of yam bean.

    PubMed

    Stamford, T L; Stamford, N P; Coelho, L C; Araújo, J M

    2001-01-01

    Thermostable amylolytic enzymes have been currently investigated to improve industrial processes of starch degradation. Studies on production of alpha-amylase by Nocardiopsis sp., an endophytic actinomycete isolated from yam bean (Pachyrhizus erosus L. Urban), showed that higher enzyme levels were obtained at the end of the logarithmic growth phase after incubation for 72 h at pH 8.6. Maximum activity of alpha-amylase was obtained at pH 5.0 and 70 degrees C. The isolated enzyme exhibited thermostable properties as indicated by retention of 100% of residual activity at 70 degrees C, and 50% of residual activity at 90 degrees C for 10 min. Extracellular enzyme from Nocardiopsis sp. was purified by fractional precipitation with ammonium sulphate. After 60% saturation produced 1130 U mg-1 protein and yield was 28% with purification 2.7-fold. The enzyme produced by Nocardiopsis sp. has potential for industrial applications.

  19. Amylase production by solid-state fermentation of agro-industrial wastes using Bacillus sp.

    PubMed Central

    Saxena, Rajshree; Singh, Rajni

    2011-01-01

    Solid state fermentation was carried out using various agro- industrial wastes with the best amylase producing strain isolated from soil. Different physicochemical conditions were varied for maximum enzyme production. The strain produced about 5400 units/g of amylase at 1:3 moisture content, 20% inoculum, after 72 h of incubation with Mustard Oil seed cake as the substrate. The optimum temperature and pH of the enzyme activity were found to be 50°C and 6 respectively. The enzyme was found to be thermostable at 70°C for about 2 h without any salt. It showed stability at pH range 5–7. The metal ions as Na+, Ca++, Mg++ and Co++ enhanced the enzyme activity. PMID:24031761

  20. Amylase production by solid-state fermentation of agro-industrial wastes using Bacillus sp.

    PubMed

    Saxena, Rajshree; Singh, Rajni

    2011-10-01

    Solid state fermentation was carried out using various agro- industrial wastes with the best amylase producing strain isolated from soil. Different physicochemical conditions were varied for maximum enzyme production. The strain produced about 5400 units/g of amylase at 1:3 moisture content, 20% inoculum, after 72 h of incubation with Mustard Oil seed cake as the substrate. The optimum temperature and pH of the enzyme activity were found to be 50°C and 6 respectively. The enzyme was found to be thermostable at 70°C for about 2 h without any salt. It showed stability at pH range 5-7. The metal ions as Na(+), Ca(++), Mg(++) and Co(++) enhanced the enzyme activity.

  1. Characterization and Application of BiLA, a Psychrophilic α-Amylase from Bifidobacterium longum.

    PubMed

    Lee, Hye-Won; Jeon, Hye-Yeon; Choi, Hye-Jeong; Kim, Na-Ri; Choung, Woo-Jae; Koo, Ye-Seul; Ko, Dam-Seul; You, SangGuan; Shim, Jae-Hoon

    2016-04-06

    In this study, a novel α-amylase was cloned from Bifidobacterium longum and named BiLA. The enzyme exhibited optimal activity at 20 °C and a pH value of 5.0. Kinetic analysis using various carbohydrate substrates revealed that BiLA had the highest k(cat/)K(m) value for amylose. Interestingly, analysis of the enzymatic reaction products demonstrated that BiLA specifically catalyzed the hydrolysis of oligosaccharides and starches up to G5 from the nonreducing ends. To determine whether BiLA can be used to generate slowly digestible starch (SDS), starch was treated with BiLA, and the kinetic parameters were analyzed using porcine pancreatic α-amylase (PPA) and amyloglucosidase (AMG). Compared to normal starch, BiLA-treated starch showed lower k(cat)/K(m) values with PPA and AMG, suggesting that BiLA is a potential candidate for the production of SDS.

  2. α-amylase crystal growth investigated by in situ atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Astier, J. P.; Bokern, D.; Lapena, L.; Veesler, S.

    2001-06-01

    The growth behavior of porcine pancreatic α-amylase at defined supersaturation has been investigated by means of temperature controlled in situ atomic force microscopy (AFM). The step velocities measured by AFM were in overall agreement with the normal growth rates of an individual face measured by optical microscopy. In addition, highly local growth dynamics could be visualized. Imaging in tapping mode revealed crystalline amylase aggregates attached to the basal face and their subsequent incorporation into growing terraces producing a macrodefect. At high supersaturation ( β=1.6) 2-D nucleation was found to be the dominating growth mechanism, whereas at lower supersaturation ( β=1.3) the growth process appears to be defect controlled (spiral growth). The analysis of step heights on 2-D nucleation islands (monomolecular protein layers) and growth steps (two molecules in height) in combination with results from light scattering experiments suggest that a single protein molecule is the basic growth unit.

  3. Morphology and solubility of multiple crystal forms of Taka-amylase A

    NASA Astrophysics Data System (ADS)

    Ninomiya, Kumiko; Yamamoto, Tenyu; Oheda, Tadashi; Sato, Kiyotaka; Sazaki, Gen; Matsuura, Yoshiki

    2001-01-01

    An α-amylase originating from a mold Aspergillus oryzae, Taka-amylase A (Mr of 52 kDa, pI of 3.8), has been purified to an electrophoretically single band grade. Crystallization behaviors were investigated using ammonium sulfate and polyethleneglycol 8000 as precipitants. The variations in the morphology of the crystals obtained with changing crystallization parameters are described. Five apparently different crystal forms were obtained, and their morphology and crystallographic data have been determined. Solubility values of four typical forms were measured using a Michelson-type two-beam interferometer. The results of these experiments showed that this protein can be a potentially interesting and useful model for crystal growth study with a gram-amount availability of pure protein sample.

  4. Purification and characterization of a liquefying α-amylase from alkalophilic thermophilic Bacillus sp. AAH-31.

    PubMed

    Kim, Dae Hoon; Morimoto, Naoki; Saburi, Wataru; Mukai, Atsushi; Imoto, Koji; Takehana, Toshihiko; Koike, Seiji; Mori, Haruhide; Matsui, Hirokazu

    2012-01-01

    α-Amylase (EC 3.2.1.1) hydrolyzes an internal α-1,4-glucosidic linkage of starch and related glucans. Alkalophilic liquefying enzymes from Bacillus species are utilized as additives in dishwashing and laundry detergents. In this study, we found that Bacillus sp. AAH-31, isolated from soil, produced an alkalophilic liquefying α-amylase with high thermostability. Extracellular α-amylase from Bacillus sp. AAH-31 (AmyL) was purified in seven steps. The purified enzyme showed a single band of 91 kDa on SDS-PAGE. Its specific activity of hydrolysis of 0.5% soluble starch was 16.7 U/mg. Its optimum pH and temperature were 8.5 and 70 °C respectively. It was stable in a pH range of 6.4-10.3 and below 60 °C. The calcium ion did not affect its thermostability, unlike typical α-amylases. It showed 84.9% of residual activity after incubation in the presence of 0.1% w/v of EDTA at 60 °C for 1 h. Other chelating reagents (nitrilotriacetic acid and tripolyphosphate) did not affect the activity at all. AmyL was fully stable in 1% w/v of Tween 20, Tween 80, and Triton X-100, and 0.1% w/v of SDS and commercial detergents. It showed higher activity towards amylose than towards amylopectin or glycogen. Its hydrolytic activity towards γ-cyclodextin was as high as towards short-chain amylose. Maltotriose was its minimum substrate, and maltose and maltotriose accumulated in the hydrolysis of maltooligosaccharides longer than maltotriose and soluble starch.

  5. Purification and Characteristics of an Endogenous α-Amylase Inhibitor from Barley Kernels 1

    PubMed Central

    Weselake, Randall J.; MacGregor, Alexander W.; Hill, Robert D.; Duckworth, Harry W.

    1983-01-01

    An inhibitor of malted barley (Hordeum vulgare cv Conquest) α-amylase II was purified 125-fold from a crude extract of barley kernels by (NH4)2SO4 fractionation, ion exchange chromatography on DEAE-Sephacel, and gel filtration on Bio-Gel P 60. The inhibitor was a protein with an approximate molecular weight of 20,000 daltons and an isoelectric point of 7.3. The protein was homogeneous, as assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Amino acid analysis indicated the presence of about 9 half-cystine residues per mole. The neutral isoelectric point of the inhibitor suggested that some of the apparently acidic residues (glutamic and aspartic) existed in the amide form. The first twenty N-terminal amino acids were sequenced. Some homology appeared to exist between the α-amylase II inhibitor and trypsin inhibitor from barley. Complex formation between α-amylase II and the inhibitor was detected by the appearance of a new molecular weight species after gel filtration on Bio-Gel P 100. Enzyme and inhibitor had to be preincubated for 5 min, prior to assaying for enzyme activity before maximum inhibition was attained. Inhibition increased at higher pH values. At pH 5.5, an approximately 1100 molar excess of inhibitor over α-amylase II produced 40% inhibition, whereas, at pH 8.0, a 1:1 molar ratio of inhibitor to enzyme produced the same degree of inhibition. PMID:16663319

  6. Comparison of Antibodies with Amylase Activity from Cerebrospinal Fluid and Serum of Patients with Multiple Sclerosis

    PubMed Central

    Doronin, Vasilii B.; Parkhomenko, Taisiya A.; Castellazzi, Massimiliano; Cesnik, Edward; Buneva, Valentina N.; Granieri, Enrico; Nevinsky, Georgy A.

    2016-01-01

    We have recently shown that IgGs from serum and cerebrospinal fluid (CSF) of MS patients are active in hydrolysis of DNA and myelin basic protein. According to literature data, anti-DNA and anti-MBP abzymes may promote important neuropathologic mechanisms in this chronic inflammatory disorder and in MS pathogenesis development. At the same time, the involvement of antibodies with amylase activity in the pathogenesis of any autoimmune disease has not yet been identified. Electrophoretically and immunologically homogeneous IgGs were obtained by a sequential affinity chromatography of the CSF proteins on protein G-Sepharose and FPLC gel filtration. We are able to present the first unpredictable evidence showing that IgGs from CSF possess amylase activity and efficiently hydrolyze maltoheptaose; their average specific Ab activity is ~30-fold higher than that of antibodies from sera of the same MS patients. Specific average RA (SAA) for IgGs from healthy volunteers was approximately ~1000 lower than that for MS patients. In addition, it was shown that a relative SAA of total proteins of CSF (including Abs) ~15-fold lower than that for purified IgGs, while the relative SAA of the total sera protein is higher than that of sera IgGs by a factor of 1033. This result speaks in favor of the fact that amylolytic activity of CSF proteins is mainly caused by the activity of amylase abzymes. One cannot exclude, that amylase abzymes of CSF can play a, as yet unknown, role in the pathogenesis of MS. Some possible reasons of these findings are discussed. PMID:27196086

  7. Chewing bread: impact on alpha-amylase secretion and oral digestion.

    PubMed

    Joubert, Marianne; Septier, Chantal; Brignot, Hélène; Salles, Christian; Panouillé, Maud; Feron, Gilles; Tournier, Carole

    2017-02-22

    During chewing, saliva helps in preparing the food bolus by agglomerating the formed particles, and it initiates enzymatic food breakdown. However, limited information is actually available on the adaptation of saliva composition during the oral processing of complex foods, especially for foods that are sensitive to salivary enzymes. We addressed this question in the context of starch-based products and salivary alpha-amylase. The objectives were two-fold: (1) to determine if salivary alpha-amylase secretion can be modulated by the bread type and (2) to evaluate the contribution of the oral phase in bread enzymatic breakdown. Mouthfuls of three different wheat breads (industrial, artisan and whole-meal breads) were chewed by twelve subjects. Saliva samples were collected at rest and at different times corresponding to 33, 66 and 100% of the individual's chewing sequence. Alpha-amylase activity and total protein content were determined for all saliva samples that were collected. Additionally, the salivary maltose concentration was measured as a marker of bread enzymatic digestion. Boluses were collected at the swallowing time to evaluate the saliva uptake. Chewing industrial bread induced higher saliva uptake than the other breads despite a similar chewing duration. The evolution of salivary amylase activity tended to depend on the type of bread and was highly influenced by a large degree of inter- and intra-subject variability. The protein and maltose concentration steadily increased during chewing as a result of bread breakdown. The salivary protein concentration was mainly affected by the release of the water-soluble proteins of the bread. The salivary maltose concentration was found to be significantly lower for the whole-meal bread. When considering the weight of the mouthful, enzymatic breakdown was found to be most efficient for the breads ranking from industrial > artisan > whole-meal.

  8. Activities of amylase, proteinase, and lipase enzymes from Lactococcus chungangensis and its application in dairy products.

    PubMed

    Konkit, Maytiya; Kim, Wonyong

    2016-07-01

    Several enzymes are involved in the process of converting milk to lactic acid and coagulated milk to curd and, therefore, are important in dairy fermented products. Amylase, proteinase, and lipase are enzymes that play an important role in degrading milk into monomeric molecules such as oligosaccharides, amino acids, and fatty acids, which are the main molecules responsible for flavors in cheese. In the current study, we determined the amylase, proteinase, and lipase activities of Lactococcus chungangensis CAU 28(T), a bacterial strain of nondairy origin, and compared them with those of the reference strain, Lactococcus lactis ssp. lactis KCTC 3769(T), which is commonly used in the dairy industry. Lactococcus chungangensis CAU 28(T) and L. lactis ssp. lactis KCTC 3769(T) were both found to have amylase, proteinase, and lipase activities in broth culture, cream cheese, and yogurt. Notably, the proteinase and lipase activities of L. chungangensis CAU 28(T) were higher than those of L. lactis ssp. lactis KCTC 3769(T), with proteinase activity of 10.50 U/mL in tryptic soy broth and 8.64 U/mL in cream cheese, and lipase activity of 100 U/mL of tryptic soy broth, and 100 U/mL of cream cheese. In contrast, the amylase activity was low, with 5.28 U/mL in tryptic soy broth and 8.86 U/mL in cream cheese. These enzyme activities in L. chungangensis CAU 28(T) suggest that this strain has potential to be used for manufacturing dairy fermented products, even though the strain is of nondairy origin.

  9. Molecular structure of a barley alpha-amylase-inhibitor complex: implications for starch binding and catalysis.

    PubMed

    Kadziola, A; Søgaard, M; Svensson, B; Haser, R

    1998-04-24

    alpha-Amylases are widely occurring, multidomain proteins with a catalytic (beta/alpha)8-barrel. In barley alpha-amylase, insight into the catalytic mechanism is gained from the X-ray crystal structure of its molecular complex with acarbose, a pseudotetrasaccharide that acts like a transition-state analogue and which is shown to bind at two specific regions of the enzyme. The structure of the complex has been refined to an R-factor of 15.1% for all observations with Fo>sigma(Fo) between 10 and 2.8 A resolution. A difference Fourier map produced after refinement of the native structure against the data of the acarbose complex clearly revealed density corresponding to two oligosaccharide-binding sites. One of these is defined as the surface-located starch granule-binding site characteristic of cereal alpha-amylases. It involves stacking of two acarbose rings on Trp276 and Trp277. The other binding region is the active site covering subsites -1, +1 and +2. Here, Glu204 is positioned to act in general acid/base catalysis protonating the glucosidic oxygen atom assisted by Asp289. A water molecule that bridges Glu204 and Asp289 is found at the entrance cavity containing a total of five water molecules. This water molecule is proposed to reprotonate Glu204 and supply the hydroxyl ion for nucleophilic attack on the glucosyl C1 atom. Asp 179 acts as the nucleophile that can bind covalently to the substrate intermediate after bond cleavage. The present complex structure together with the conservation of active-site residues among alpha-amylases and related enzymes, are consistent with a common catalytic mechanism for this class of retaining carbohydrases.

  10. Structure of raw starch-digesting Bacillus cereus beta-amylase complexed with maltose.

    PubMed

    Mikami, B; Adachi, M; Kage, T; Sarikaya, E; Nanmori, T; Shinke, R; Utsumi, S

    1999-06-01

    The crystals of beta-amylase from Bacillus cereus belong to space group P21 with the following cell dimensions: a = 57.70 A, b = 92.87 A, c = 65.93 A, and beta =101.95 degrees. The structures of free and maltose-bound beta-amylases were determined by X-ray crystallography at 2.1 and 2.5 A with R-factors of 0.170 and 0.164, respectively. The final model of the maltose-bound form comprises 516 amino acid residues, four maltose molecules, 275 water molecules, one Ca2+, one acetate, and one sulfate ion. The enzyme consists of a core (beta/alpha)8-barrel domain (residues 5-434) and a C-terminal starch-binding domain (residues 435-613). Besides the active site in the core where two maltose molecules are bound in tandem, two novel maltose-binding sites were found in the core L4 region and in the C-terminal domain. The structure of the core domain is similar to that of soybean beta-amylase except for the L4 maltose-binding site, whereas the C-terminal domain has the same secondary structure as domain E of cyclodextrin glucosyltransferase. These two maltose-binding sites are 32-36 A apart from the active site. These results indicate that the ability of B. cereus beta-amylase to digest raw starch can be attributed to the additional two maltose-binding sites.

  11. Diet and the evolution of human amylase gene copy number variation

    PubMed Central

    Perry, George H.; Dominy, Nathaniel J.; Claw, Katrina G.; Lee, Arthur S.; Fiegler, Heike; Redon, Richard; Werner, John; Villanea, Fernando A.; Mountain, Joanna L.; Misra, Rajeev; Carter, Nigel P.; Lee, Charles; Stone, Anne C.

    2008-01-01

    Starch consumption is a prominent characteristic of agricultural societies and hunter-gatherers in arid environments. In contrast, rainforest and circum-arctic hunter-gatherers and some pastoralists consume much less starch1-3. This behavioral variation raises the possibility that different selective pressures have acted on amylase, the enzyme responsible for starch hydrolysis4. We found that salivary amylase gene (AMY1) copy number is correlated positively with salivary amylase protein levels, and that individuals from populations with high-starch diets have on average more AMY1 copies than those with traditionally low-starch diets. Comparisons with other loci in a subset of these populations suggest that the level of AMY1 copy number differentiation is unusual. This example of positive selection on a copy number variable gene is one of the first in the human genome. Higher AMY1 copy numbers and protein levels likely improve the digestion of starchy foods, and may buffer against the fitness-reducing effects of intestinal disease. PMID:17828263

  12. Application of decolourized and partially purified polygalacturonase and α-amylase in apple juice clarification

    PubMed Central

    Dey, Tapati Bhanja; Banerjee, Rintu

    2014-01-01

    Polygalacturonase and α-amylase play vital role in fruit juice industry. In the present study, polygalacturonase was produced by Aspergillus awamori Nakazawa MTCC 6652 utilizing apple pomace and mosambi orange (Citrus sinensis var mosambi) peels as solid substrate whereas, α-amylase was produced from A. oryzae (IFO-30103) using wheat bran by solid state fermentation (SSF) process. These carbohydrases were decolourized and purified 8.6-fold, 34.8-fold and 3.5-fold, respectively by activated charcoal powder in a single step with 65.1%, 69.8% and 60% recoveries, respectively. Apple juice was clarified by these decolourized and partially purified enzymes. In presence of 1% polygalacturonase from mosambi peels (9.87 U/mL) and 0.4% α-amylase (899 U/mL), maximum clarity (%T660nm = 97.0%) of juice was attained after 2 h of incubation at 50 °C in presence of 10 mM CaCl2. Total phenolic content of juice was reduced by 19.8% after clarification, yet with slightly higher %DPPH radical scavenging property. PMID:24948919

  13. Identification and Characterization of Useful Fungi with α-Amylase Activity from the Korean Traditional Nuruk

    PubMed Central

    Kim, Hye-Ryun; Kim, Jae-Ho; Bai, Dong-Hoon

    2011-01-01

    The objective of this study was to find useful fungi with α-amylase activity from the Korean traditional nuruk for the quality of traditional Korean alcoholic beverage. In this study, 165 samples of traditional nuruk were collected from 170 regions throughout Korea and the fungi were isolated to a total of 384 strains. In order to investigate the effect of microflora on nuruk, α-amylase activity, saccharogenic power (SP), starch hydrolysis activity and acid producing activity were evaluated. Ten strains were selected by α-amylase activity, which ranged from 458.47 to 1,202.75 U/g. The size of the discolored zone for the starch hydrolysis activity of each fungus ranged from 0.3 to 2 cm. The SP of the 10 strains ranged from 228.8 to 433.4 SP. Of the 10 stains, three were identified as Aspergillus oryzae, two as Aspergillus flavus, two as Lichtheimia sp., one as Rhizopus oryzae and two as other strains. The total aflatoxins present in the nuruks were examined using enzyme-linked immunosorbent assay. The 10 nuruks had less than 1.11 ppb of aflatoxins. PMID:22783116

  14. Impact of amylases on biopolymer dynamics during storage of straight-dough wheat bread.

    PubMed

    Bosmans, Geertrui M; Lagrain, Bert; Fierens, Ellen; Delcour, Jan A

    2013-07-03

    When Bacillus stearothermophilus α-amylase (BStA), Pseudomonas saccharophila α-amylase (PSA), or Bacillus subtilis α-amylase (BSuA) was added to a bread recipe to impact bread firming, amylose crystal formation was facilitated, leading to lower initial crumb resilience. Bread loaves that best retained their quality were those obtained when BStA was used. The enzyme hindered formation of an extended starch network, resulting in less water immobilization and smaller changes in crumb firmness and resilience. BSuA led to extensive degradation of the starch network during bread storage with release of immobilized water, eventually resulting in partial structure collapse and poor crumb resilience. The most important effect of PSA was an increased bread volume, resulting in smaller changes in crumb firmness and resilience. A negative linear relation was found between NMR proton mobilities of water and biopolymers in the crumb and crumb firmness. The slope of that relation gave an indication of the strength of the starch network.

  15. An analysis of temperature adaptation in cold active, mesophilic and thermophilic Bacillus α-amylases.

    PubMed

    Mahdavi, Atiyeh; Sajedi, Reza H; Asghari, S Mohsen; Taghdir, Majid; Rassa, Mehdi

    2011-12-01

    A comparative biochemical and structural study was performed on a cold active α-amylase from Bacillus cereus (BCA) and two well-known homologous mesophilic and thermophilic α-amylases from Bacillus amyloliquefaciens (BAA) and Bacillus licheniformis (BLA). In spite of a high degree of sequence and structural similarity, drastic variations were found for T(opt) as 50, 70 and 90°C for BCA, BAA and BLA, respectively. The half-lives of thermoinactivation were 1 and 9 min for BCA and BAA at 80°C respectively, whilst there was no inactivation for BLA at this temperature. Thermodynamic studies on inactivation process suggested that lower thermostability of BCA is due to lower inactivation slope of the Arrhenius plots and subsequently, lower E(a) and ΔH(#). Increased K(m) and accessible surface area for catalytic residues along with a decreased number of internal interactions in this region in BCA compared to BLA suggest that BCA substrate-binding site might be temperature sensitive and is probably more flexible. On the other hand, fewer ion pairs, destructive substitutions and disruption of aromatic interaction networks in structurally critical regions of Bacillus α-amylases result in a severe decrease in BCA thermostability compared to its mesophilic and thermophilic homologues.

  16. Pea starch (Pisum sativum L.) with slow digestion property produced using β-amylase and transglucosidase.

    PubMed

    Shi, Miaomiao; Zhang, Zhiheng; Yu, Shujuan; Wang, Kai; Gilbert, Robert G; Gao, Qunyu

    2014-12-01

    Starches extracted from wrinkled (WP) and smooth (SP) peas were treated using β-amylase (B) alone and also with a combination of β-amylase and transglucosidase (BT). After enzymatic treatment, the proportions of slowly digested starch in WP-B, WP-BT, SP-B and SP-BT samples were increased by 6%, 9%, 9% and 12%, respectively. Starches treated by a combination of β-amylase and transglucosidase exhibited a smaller amount of longer amylopectin chains, a larger amount of short amylopectin chains, and higher branching fraction. The branching fraction was significantly increased, with an increase of 8%, 10%, 13% and 14% for WP-B, WP-BT, SP-B and SP-BT, respectively. The maximum absorbance and iodine binding of enzyme-treated starches were reduced compared with their native starch parents. The C-type crystalline structure completely disappeared after enzymatic treatment. The results support previous findings that increases in the amount of shorter amylopectin chains and branch fraction are likely to contribute to the slow digestion of starch.

  17. Antidiabetic Activity of Gnidia glauca and Dioscorea bulbifera: Potent Amylase and Glucosidase Inhibitors

    PubMed Central

    Ghosh, Sougata; Ahire, Mehul; Patil, Sumersing; Jabgunde, Amit; Bhat Dusane, Meenakshi; Joshi, Bimba N.; Pardesi, Karishma; Jachak, Sanjay; Dhavale, Dilip D.; Chopade, Balu A.

    2012-01-01

    Diabetes is a metabolic disorder affecting about 220 million people worldwide. One of the most critical complications of diabetes is post-prandial hyper-glycemia (PPHG). Glucosidase inhibitor and α-amylase inhibitors are class of compounds that help in managing PPHG. Low-cost herbal treatment is recommended due to their lesser side effect for treatment of diabetes. Two plants with significant traditional therapeutic potential, namely, Gnidia glauca and Dioscorea bulbifera, were tested for their efficiency to inhibit α-amylase and α-glucosidase. Stem, leaf, and flower of G. glauca and bulb of D. bulbifera were sequentially extracted with petroleum ether, ethyl acetate, and methanol as well as separately with 70% ethanol. Petroleum ether extract of flower of G. glauca was found to inhibit α-amylase significantly (78.56%). Extracts were further tested against crude murine pancreatic, small intestinal, and liver glucosidase enzyme which revealed excellent inhibitory properties. α-glucosidase inhibition provided a strong in vitro evidence for confirmation of both G. glauca and D. bulbifera as excellent antidiabetic remedy. This is the first report of its kind that provides a strong biochemical basis for management of type II diabetes using G. glauca and D. bulbifera. These results provide intense rationale for further in vivo and clinical study. PMID:21785651

  18. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  19. Optimizing of the formation of active BMW-amylase after in vitro refolding.

    PubMed

    Nasrollahi, Parisa; Khajeh, Khosro; Akbari, Neda

    2012-09-01

    This study was carried out to determine the optimal folding condition of α-amylase from Bacillus megaterium WHO using response surface methodology (RSM). A first-order model showed that three factors namely glycerol, Ca(2+) and protein concentration had the most significant effect on refolding. Analysis of the results showed that glycerol was better than the other polyols due to its effect on protein stability. Since α-amylases are known to contain calcium ions in their structure, the presence of calcium in the refolding buffer was compulsory. The concentration of protein had the most significant quadratic effect on the response studied. A second-order polynomial model was developed to quantify the relationships between variables. It was shown that the combination of 20%(v/v) glycerol, 25 mM Ca(2+) and 0.3 (mg/ml) protein was the most efficient condition for in vitro refolding of α-amylase. Under the optimal condition the yield of refolding was enhanced up to 7-fold. In order to analysis the size distribution in optimized and basic medium, dynamic light scattering (DLS) was fulfilled. The information gathered in this study showed that the use of solvent engineering and optimization procedure can be a general method for protein refolding.

  20. Artificial chaperone-assisted refolding of chemically denatured alpha-amylase.

    PubMed

    Yazdanparast, Razieh; Khodagholi, Fariba; Khodarahmi, Reza

    2005-06-01

    It is now well established that alpha-cyclodextrin (alpha-CD) is a valuable folding agent in refolding processes of several denatured enzyme solutions. The refolding of Gu-HCl denatured alpha-amylase in the dilution-additive mode revealed that alpha-CD enhanced the refolding yield by 20-30% depending upon alpha-CD concentration. However, the refolding efficiency of the Gu-HCl denatured alpha-amylase through the artificial chaperone-assisted method indicated that alpha-CD enhanced the activity recovery of denatured alpha-amylase by almost 50% and also increased the reactivation rate constant relative to the unassisted control sample. The higher refolding efficiency should be due to different mechanism played by alpha-CD in this technique. In addition, our data indicated that higher refolding yields are obtained when the residual Gu-HCl concentration is low in the refolding environment and when the capture agent is removed not in a stepwise manner from the protein-detergent complexes in the stripping step of the whole process. Collectively, the results of this investigation expand the range of procedural variations used to refold different denatured proteins through artificial chaperone-assisted method.

  1. Rice proteins, extracted by alkali and α-amylase, differently affect in vitro antioxidant activity.

    PubMed

    Wang, Zhengxuan; Liu, Ye; Li, Hui; Yang, Lin

    2016-09-01

    Alkali treatment and α-amylase degradation are different processes for rice protein (RP) isolation. The major aim of this study was to determine the influence of two different extraction methods on the antioxidant capacities of RPA, extracted by alkaline (0.2% NaOH), and RPE, extracted by α-amylase, during in vitro digestion for 2h with pepsin and for 3h with pancreatin. Upon pepsin-pancreatin digestion, the protein hydrolysates (RPA-S, RPE-S), which were the supernatants in the absence of undigested residue, and the whole protein digests (RPA, RPE), in which undigested residue remained, were measured. RPE exhibited the stronger antioxidant responses to free radical scavenging activity, metal chelating activity, and reducing power, whereas the weakest antioxidant capacities were produced by RPE-S. In contrast, no significant differences in antioxidant activity were observed between RPA and RPA-S. The present study demonstrated that the in vitro antioxidant responses induced by the hydrolysates and the protein digests of RPs could be affected differently by alkali treatment and α-amylase degradation, suggesting that the extraction is a vital processing step to modify the antioxidant capacities of RPs. The results of the current study indicated that the protein digests, in which undigested residues remained, could exhibit more efficacious antioxidant activity compared to the hydrolysates.

  2. Structural and catalytic properties of immobilized α-amylase from Laceyella sacchari TSI-2.

    PubMed

    Shukla, Rushit J; Singh, Satya P

    2016-04-01

    One of the approaches to address the issues of the cost of production, recovery and reusability of the extremozymes can be immobilization. In this report, we describe immobilization of an α-amylase from Laceyella sacchari TSI-2 and characterization of the immobilized enzyme. The enzyme was immobilized on 6 different matrices using entrapment, ionic binding and surface adsorption. The DEAE cellulose with glutaraldehyde crosslinking appeared most effective for the immobilization with high operational stability. While the temperature optima and thermal stability of the immobilized α-amylase shifted from 60 to 70°C with increased half-life, the pH optima remain unaltered while pH stability was shifted from 6 to 7. The stability of the immobilized enzyme improved in solvents. The enzyme catalysis in surfactants enhanced, while the Km and Vmax were reduced after immobilization. The structural features of the immobilized enzyme as probed by FT-IR established the role of aliphatic amines, esters and alkenes in immobilization. The starch hydrolysis efficiency of the immobilized enzyme was 15.55%. The immobilized enzyme in various detergents was highly efficient in removing the starch stain from cotton cloth. Taken together, the α-amylase turned more stable after immobilization and can be a favored choice for applications.

  3. Kinetic study of the thermal denaturation of a hyperthermostable extracellular α-amylase from Pyrococcus furiosus.

    PubMed

    Brown, I; Dafforn, T R; Fryer, P J; Cox, P W

    2013-12-01

    Hyperthermophilic enzymes are of industrial importance and interest, especially due to their denaturation kinetics at commercial sterilisation temperatures inside safety indicating time-temperature integrators (TTIs). The thermal stability and irreversible thermal inactivation of native extracellular Pyrococcus furiosus α-amylase were investigated using differential scanning calorimetry, circular dichroism and Fourier transform infrared spectroscopy. Denaturation of the amylase was irreversible above a Tm of approximately 106°C and could be described by a one-step irreversible model. The activation energy at 121°C was found to be 316kJ/mol. Using CD and FT-IR spectroscopy it was shown that folding and stability greatly increase with temperature. Under an isothermal holding temperature of 121°C, the structure of the PFA changes during denaturation from an α-helical structure, through a β-sheet structure to an aggregated protein. Such data reinforces the use of P. furiosus α-amylase as a labile species in TTIs.

  4. Effect of ultrasound on the activity and conformation of α-amylase, papain and pepsin.

    PubMed

    Yu, Zhi-Long; Zeng, Wei-Cai; Zhang, Wen-Hua; Liao, Xue-Pin; Shi, Bi

    2014-05-01

    The effect of ultrasound on the activity of α-amylase, papain and pepsin was investigated and the mechanism of the effect was explored by determining their conformational changes. With the irradiation of power ultrasound, the activity of α-amylase and papain was inhibited, while the activity of pepsin was activated. According to the analysis of circular dichroism, Fourier transform infrared and fluorescence spectroscopy, the πo → π(∗) amide transitions and secondary structural components, especially β-sheet, of these three enzymes were significantly influenced by ultrasound. The tryptophan fluorescence intensity of the three enzymes was also observed to be affected by sonication. Furthermore, it was found that the pepsin molecule might gradually be resistant to prolonged ultrasonic treatment and recover from the ultrasound-induced damage to its original structure. The results suggested that the activity of α-amylase, papain and pepsin could be modified by ultrasonic treatment mainly due to the variation of their secondary and tertiary structures.

  5. Crystal structure of a compact α-amylase from Geobacillus thermoleovorans.

    PubMed

    Mok, Sook-Chen; Teh, Aik-Hong; Saito, Jennifer A; Najimudin, Nazalan; Alam, Maqsudul

    2013-06-10

    A truncated form of an α-amylase, GTA, from thermophilic Geobacillus thermoleovorans CCB_US3_UF5 was biochemically and structurally characterized. The recombinant GTA, which lacked both the N- and C-terminal transmembrane regions, functioned optimally at 70°C and pH 6.0. While enzyme activity was not enhanced by the addition of CaCl2, GTA's thermostability was significantly improved in the presence of CaCl2. The structure, in complex with an acarbose-derived pseudo-hexasaccharide, consists of the typical three domains and binds one Ca(2+) ion. This Ca(2+) ion was strongly bound and not chelated by EDTA. A predicted second Ca(2+)-binding site, however, was disordered. With limited subsites, two novel substrate-binding residues, Y147 and Y182, may help increase substrate affinity. No distinct starch-binding domain is present, although two regions rich in aromatic residues have been observed. GTA, with a smaller domain B and several shorter loops compared to other α-amylases, has one of the most compact α-amylase folds that may contribute greatly to its tight Ca(2+) binding and thermostability.

  6. Kinetic Study of the Active Site Structure of β-Amylase from Bacillus cereus var. mycoides.

    PubMed

    Nitta, Y; Shirakawa, M; Takasaki, Y

    1996-01-01

    The subsite affinities of the active site of β-amylase from Bacillus cereus var. mycoides were evaluated based on Hiromi's theory, using (14)C-radiolabeled maltooligosaccharides as substrate. It was estimated that the active site consisted of six subsites, and all subsite affinities could be evaluated. The active site had a common subsite arrangement with those of β -amylases from soybean and wheat bran. The intrinsic breakdown rate constant of α-1,4 glucosidic linkage (kint) was five to seven times as large as those of the other enzymes.From the pH dependence of log[k0/Km], pK values of two functional ionizable groups were pK1 =4.0 and pK2 = 8.4. The pK values were 0.5-0.6 units for pK1 and 0.2-0.3 units for pK2 larger than those of the other enzymes. For the affinity-labeling of this enzyme by 2, 3 epoxypropyl α-D-glucopyranoside (α-EPG), the binding affinity of α-EPG was 1-1.6kcal/mol larger than those of the other β-amylases.

  7. Structural forms of the human amylase locus and their relationships to SNPs, haplotypes, and obesity

    PubMed Central

    Usher, Christina L; Handsaker, Robert E; Esko, Tõnu; Tuke, Marcus A; Weedon, Michael N; Hastie, Alex R; Cao, Han; Moon, Jennifer E; Kashin, Seva; Fuchsberger, Christian; Metspalu, Andres; Pato, Carlos N; Pato, Michele T; McCarthy, Mark I; Boehnke, Michael; Altshuler, David M; Frayling, Timothy M; Hirschhorn, Joel N; McCarroll, Steven A

    2016-01-01

    Hundreds of genes reside in structurally complex, poorly understood regions of the human genome1-3. One such region contains the three amylase genes (AMY2B, AMY2A, and AMY1) responsible for digesting starch into sugar. The copy number of AMY1 is reported to be the genome’s largest influence on obesity4, though genome-wide association studies for obesity have found this locus unremarkable. Using whole genome sequence analysis3,5, droplet digital PCR6, and genome mapping7, we identified eight common structural haplotypes of the amylase locus that suggest its mutational history. We found that AMY1 copy number in individuals’ genomes is generally even (rather than odd) and partially correlates to nearby SNPs, which do not associate with BMI. We measured amylase gene copy number in 1,000 obese or lean Estonians and in two other cohorts totaling ~3,500 individuals. We had 99% power to detect the lower bound of the reported effects on BMI4, yet found no association. PMID:26098870

  8. Cloning and Characterization of an alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Mark L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    The gene encoding an extracellular alpha-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  9. Cloning and Characterization of an Alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Marc L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    The gene encoding an extracellular a-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  10. Production and properties of alpha-amylase from Penicillium chrysogenum and its application in starch hydrolysis.

    PubMed

    Balkan, Bilal; Ertan, Figen

    2005-01-01

    Fungi were screened for their ability to produce alpha-amylase by a plate culture method. Penicillium chrysogenum showed high enzymatic activity. Alpha-amylase production by P. chrysogenum cultivated in liquid media containing maltose (2%) reached its maximum at 6-8 days, at 30 degrees C, with a level of 155 U ml(-1). Some general properties of the enzyme were investigated. The optimum reaction pH and temperature were 5.0 and 30-40 degrees C, respectively. The enzyme was stable at a pH range from 5.0-6.0 and at 30 degrees C for 20 min and the enzyme's 92.1% activity's was retained at 40 degrees C for 20 min without substrate. Hydrolysis products of the enzyme were maltose, unidefined oligosaccharides, and a trace amount of glucose. Alpha-amylase of P. chrysogenum hydrolysed starches from different sources. The best hydrolysis was determined (98.69%) in soluble starch for 15 minute at 30 degrees C.

  11. Enhanced maltose production through mutagenesis of acceptor binding subsite +2 in Bacillus stearothermophilus maltogenic amylase.

    PubMed

    Sun, Yecheng; Duan, Xuguo; Wang, Lei; Wu, Jing

    2016-01-10

    Maltogenic amylases are used to decrease the maltotriose content of high maltose syrups. However, due to the interplay between the hydrolysis and transglycosylation activities of maltogenic amylases, the maltotriose contents of these syrups are still greater than that necessary for pure maltose preparation. In this study, the maltogenic amylase from Bacillus stearothermophilus was engineered to decrease its transglycosylation activity with the expectation that this would enhance maltose production. Site-directed mutagenesis was used to generate Trp 177 variants W177F, W177Y, W177L, W177N, and W177S. The transglycosylation activities of the mutant enzymes decreased as the hydrophilicity of the residue at position 177 increased. The mutant enzymes exhibited notable enhancements in maltose production, with a minimum of maltotriose contents of 0.2%, compared with 3.2% for the wild-type enzyme. Detailed characterization of the mutant enzymes suggests that the best of them, W177S, will deliver performance superior to that of the wild-type under industrial conditions.

  12. [Influence of amaranth on the production of alpha-amylase using Aspergillus niger NRRL 3112].

    PubMed

    Mariani, D D; Lorda, G; Balatti, A P

    2000-01-01

    In this paper the influence of the amaranth seed meal and the aeration conditions on the alpha-amylase production by Aspergillus niger NRRL 3112 were studied. The assays of selection of culture medium were carried out in a rotary shaker at 250 rpm and 2.5 cm stroke. The aeration conditions were studied in a mechanically stirred fermentor New Brunswick type. A concentration of alpha-amylase of 2750 U.Dun/ml was achieved at 120 h with a dry weight of 8.0 g/l, using a base medium with 5.0 g/l Amaranthus cruentus seed meal. In the experiment performed in a New Brunswick fermentor, the highest value was 2806 U.Dun/ml. This result was obtained after 120 h, operating at 300 rpm and an airflow of 1 l/l. min. in a limited dissolved oxygen concentration. It was determined that the increase in the agitation rate was not favorable to the enzyme production, despite that an increase was verified in the dissolved oxygen. The morphology of the microorganism, in long and ramified hyphae, was the critical factor to obtain higher levels of alpha-amylase.

  13. Purification and characterisation of a novel amylase enzyme from red pitaya (Hylocereus polyrhizus) peel.

    PubMed

    Amid, Mehrnoush; Abd Manap, Mohd Yazid

    2014-12-15

    An amylase enzyme from pitaya peel was purified 234.2-folds with 72.1% recovery using ammonium sulphate precipitation, gel filtration and ion exchange chromatography. Gel filtration chromatography and SDS-PAGE revealed that the enzyme is monomeric with a molecular weight of 42.1kDa. The apparent Km and Vmax of the amylase were 2.7 mg/ml and 34.30 u/min/mg of protein, respectively. The enzyme was highly active and stable over a wide pH range from pH 3 to pH 11.0, with optimum activity being observed at pH 5.0. The enzyme was highly selective for soluble starch, amylopectin, glycogen and pulullan. The purified amylase did not require calcium and displayed extreme stability with regard to surfactants and oxidising agents. EDTA, a powerful chelating agent, did not have any significant effect on the stability of the enzyme. Such characteristics have not been previously reported for this type of enzyme from fruit peel. This enzyme, which possesses unique properties, could be widely used in different types of industries, especially in food and biotechnological applications.

  14. Complete sequence, subunit structure, and complexes with pancreatic alpha-amylase of an alpha-amylase inhibitor from Phaseolus vulgaris white kidney beans.

    PubMed

    Kasahara, K; Hayashi, K; Arakawa, T; Philo, J S; Wen, J; Hara, S; Yamaguchi, H

    1996-07-01

    The complete amino acid sequence of a white kidney bean (Phaseolus vulgaris) alpha-amylase inhibitor (PHA-I), which is composed of two kinds of glycopolypeptide subunits, alpha and beta, was established by conventional methods. The polypeptide molecular weight of PHA-I determined by the light-scattering technique, considered together with the sequence molecular weights revealed for the subunits, indicated that PHA-I has the subunit stoichiometry of (alpha beta)2 complex. Inhibition test of PHA-I with increasing amounts of porcine pancreatic alpha-amylase (PPA) suggested that an inactive 2:1 complex is formed between PPA and PHA-I. In fact, two complexes differing from each other in the molar ratio of PPA to PHA-I were separated by gel filtration, and molecular weight estimation by the light-scattering technique confirmed that they are complexes of PHA-I with one or two PPA molecules. The binding of PPA to PHA-I appeared to follow simple binomial statistics, suggesting that two binding sites on PHA-I are independent and of high affinity for PPA.

  15. Structural characterization of an alpha-amylase inhibitor from a wild common bean (Phaseolus vulgaris): insight into the common structural features of leguminous alpha-amylase inhibitors.

    PubMed

    Nakaguchi, T; Arakawa, T; Philo, J S; Wen, J; Ishimoto, M; Yamaguchi, H

    1997-02-01

    The primary structures of two subunits of an alpha-amylase inhibitor (alpha AI-2) from a wild common bean (Phaseolus vulgaris) were revealed by a comparison of the amino acid sequence previously deduced from the nucleotide sequence with the amino- and carboxyl-terminal amino acid sequences determined by conventional methods. The polypeptide molecular weight of alpha AI-2 obtained by the light-scattering technique, considered together with the sequence molecular weights revealed for the subunits, indicated that alpha AI-2 has the subunit stoichiometry of an alpha 2 beta 2 complex. These structural features were closely similar to those recently elucidated for a white kidney bean (P. vulgaris) alpha-amylase inhibitor, which is quite different in the inhibitory specificity from alpha AI-2. The post-translational processing of the precursor glycoproteins to form the tetrameric structure appeared to require an Arg residue close to the processing site. Further, the proper associations of the subunits into the tetrameric structures seemed to be strictly controlled by a few amino acids on the subunit interfaces.

  16. Characterization of the activity and stability of amylase from saliva and detergent: laboratory practicals for studying the activity and stability of amylase from saliva and various commercial detergents.

    PubMed

    Valls, Cristina; Rojas, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2012-07-01

    This article presents two integrated laboratory exercises intended to show students the role of α-amylases (AAMYs) in saliva and detergents. These laboratory practicals are based on the determination of the enzymatic activity of amylase from saliva and different detergents using the Phadebas test (quantitative) and the Lugol test (qualitative) under different conditions (e.g. variations in temperature and alkalinity). This work also proposes the study of enzyme stability in the presence of several surfactants and oxidizing agents using the same technical approach. The proposed laboratory exercises promote the understanding of the physiological function of this enzyme and the biotechnological applications of AAMYs in the detergent industry. The exercises also promote the understanding that the enzymatic stability and performance are dependent on the organism of origin, and if necessary, these properties could be modified by genetic engineering. In addition, this article reinforces the development of laboratory skills, problem-solving capabilities, and the ability to write a laboratory report. The exercises are proposed primarily as an undergraduate project for advanced students in the biochemical and biotechnological sciences. These laboratory practicals are complementary to the previously published BAMBED article (Biochemistry and Molecular Biology Education Vol. 39, No. 4, pp. 280-290, 2011) on detergent proteases.

  17. Solution structure of the main alpha-amylase inhibitor from amaranth seeds.

    PubMed

    Martins, J C; Enassar, M; Willem, R; Wieruzeski, J M; Lippens, G; Wodak, S J

    2001-04-01

    The most abundant alpha-amylase inhibitor (AAI) present in the seeds of Amaranthus hypochondriacus, a variety of the Mexican crop plant amaranth, is the smallest polypeptide (32 residues) known to inhibit alpha-amylase activity of insect larvae while leaving that of mammals unaffected. In solution, 1H NMR reveals that AAI isolated from amaranth seeds adopts a major trans (70%) and minor cis (30%) conformation, resulting from slow cis-trans isomerization of the Val15-Pro16 peptide bond. Both solution structures have been determined using 2D 1H-NMR spectroscopy and XPLOR followed by restrained energy refinement in the consistent-valence force field. For the major isomer, a total of 563 distance restraints, including 55 medium-range and 173 long-range ones, were available from the NOESY spectra. This rather large number of constraints from a protein of such a small size results from a compact fold, imposed through three disulfide bridges arranged in a cysteine-knot motif. The structure of the minor cis isomer has also been determined using a smaller constraint set. It reveals a different backbone conformation in the Pro10-Pro20 segment, while preserving the overall global fold. The energy-refined ensemble of the major isomer, consisting of 20 low-energy conformers with an average backbone rmsd of 0.29 +/- 0.19 A and no violations larger than 0.4 A, represents a considerable improvement in precision over a previously reported and independently performed calculation on AAI obtained through solid-phase synthesis, which was determined with only half the number of medium-range and long-range restraints reported here, and featured the trans isomer only. The resulting differences in ensemble precision have been quantified locally and globally, indicating that, for regions of the backbone and a good fraction of the side chains, the conformation is better defined in the new solution structure. Structural comparison of the solution structure with the X-ray structure of the

  18. Transformation of Bacillus subtilis in alpha-amylase productivity by deoxyribonucleic acid from B. subtilis var. amylosacchariticus.

    PubMed

    Yoneda, Y; Yamane, K; Yamaguchi, K; Nagata, Y; Maruo, B

    1974-12-01

    Deoxyribonucleic acid (DNA) of Bacillus subtilis var. amylosacchariticus showed almost the same ability as B. subtilis Marburg to induce transfer of several genetic markers in DNA-mediated transformation. DNA-DNA hybridization data also showed an intimate relationship between the two strains. Genetic elements involved in the production of extracellular alpha-amylase (EC 3.2.1.1.) in B. subtilis var. amylosacchariticus were studied by using DNA-mediated transformation. Two Marburg derivatives, NA20(amyR2) and NA20-22(amyR1), produced about 50 and 10 U of alpha-amylase per mg of cells, respectively, whereas B. subtilis var. amylosacchariticus produced as much as 150 U of the enzyme per mg of cells. When B. subtilis var. amylosacchariticus was crossed with strain NA20-22 as recipient, transformants that acquired high alpha-amylase productivity (about 50 U/mg of cells) were obtained. Genetic analysis revealed that a regulator gene (amyR) for alpha-amylase synthesis was found in B. subtilis var. amylosacchariticus, as in the case of B. natto 1212 (amyR2) and B. subtilis Marburg (amyR1). The allele was designated amyR3; it is phenotypically indistinguishable from amyR2, but is readily distinguishable from amyR1. The presence of amyR3 was not sufficient for an organism to render production of an exceptional amount of alpha-amylase. Extra-high alpha-amylase producers could be obtained by crossing B. subtilis var. amylosacchariticus as donor with strain NA20 as recipient. The transformants produced the same or even greater amounts of the enzyme than the donor strain. Results suggest the presence of another gene that is involved in the production of the exceptional amount of alpha-amylase.

  19. Digestive alpha-amylases of the flour moth Ephestia kuehniella--adaptation to alkaline environment and plant inhibitors.

    PubMed

    Pytelková, Jana; Hubert, Jan; Lepsík, Martin; Sobotník, Jan; Sindelka, Radek; Krízková, Iva; Horn, Martin; Mares, Michael

    2009-07-01

    The digestive tract of lepidopteran insects is extremely alkaline. In the present work, molecular adaptation of amylolytic enzymes to this environment was investigated in the flour moth Ephestia kuehniella, an important stored-product pest. Three digestive alpha-amylases [Ephestia kuehniella alpha-amylase isoenzymes 1-3 (EkAmy1-3)] with an alkaline pH optimum were purified from larvae and biochemically characterized. These isoenzymes differ significantly in their sensitivity to alpha-amylase inhibitors of plant origin that are directed against herbivores as antifeedants. Such functional variability renders the amylolytic system less vulnerable to suppression by plant defensive molecules. Moreover, we found that expression of alpha-amylases is upregulated in larvae feeding on a diet enriched with an alpha-amylase inhibitor. The alpha-amylases are secreted into the larval midgut by an exocytotic mechanism, as revealed by immunogold microscopy. The cDNA sequence of EkAmy3 was determined, and a homology model of EkAmy3 was built in order to analyze the structural features responsible for adaptation to alkaline pH. First, the overall fold was found to be stabilized by remodeling of ion pairs. Second, molecular simulations supported by activity measurements showed that EkAmy3 does not bind a Cl(-), owing to an Arg-to-Gln mutation in a conserved binding site. The Cl(-)-binding residues are in contact with the catalytic residues, and this change might help to fine-tune the catalytic pK(a) values to an alkaline pH optimum. We conclude that lepidopteran alpha-amylases are evolutionarily adapted in terms of structure and expression dynamics for effective functioning in the digestive system.

  20. Amylase addition increases starch ruminal digestion in first-lactation cows fed high and low starch diets.

    PubMed

    Nozière, P; Steinberg, W; Silberberg, M; Morgavi, D P

    2014-01-01

    The objective of this study was to evaluate the effect of an exogenous amylase preparation on digestion of low- and high-starch diets in dairy cattle. Rumen and total-tract nutrient digestibility were measured in a 4×4 Latin square design with 28-d periods using 4 first-lactation cows cannulated at the rumen and duodenum. Corn silage-based diets had 20 or 30% starch, attained by changing the composition of concentrate, with or without addition of an exogenous amylase preparation. Effects of the enzyme additive were observed on ruminal digestibility but not at the total-tract level. Ruminal digestibility of starch increased from 75% in control to 81% with amylase supplementation. This difference in ruminal starch digestion was compensated postruminally, so that the total-tract digestibility of starch was almost complete and did not differ between treatments. The amylase supplement also increased the true ruminal digestibility of organic matter but did not affect microbial N flow to the duodenum. Amylase supplement reduced the proportion of acetate and butyrate and increased that of propionate, particularly in the high-starch diet, where it tended to increase the concentration of total volatile fatty acids in the rumen. Other effects were a higher amylase activity in the solid-associated microbial community and a tendency for lower numbers of protozoa. In contrast, we observed no changes in intake, production, dry matter and fiber (neutral detergent fiber and acid detergent fiber) digestibility, or ruminal digestion, and no or small changes on selected fibrolytic and amylolytic bacteria and on the microbial community in general. We conclude that the exogenous amylase improved starch digestion in the rumen in first-lactation cows with moderate intake and production levels.

  1. Improved α-amylase production by Aspergillus oryzae after a double deletion of genes involved in carbon catabolite repression.

    PubMed

    Ichinose, Sakurako; Tanaka, Mizuki; Shintani, Takahiro; Gomi, Katsuya

    2014-01-01

    In filamentous fungi, the expression of secretory glycoside hydrolase encoding genes, such as those for amylases, cellulases, and xylanases, is generally repressed in the presence of glucose. CreA and CreB have been observed to be regulating factors for carbon catabolite repression. In this study, we generated single and double deletion creA and/or creB mutants in Aspergillus oryzae. The α-amylase activities of each strain were compared under various culture conditions. For the wild-type strain, mRNA levels of α-amylase were markedly decreased in the later stage of submerged culture under inducing conditions, whereas this reduced expression was not observed for single creA and double creA/creB deletion mutants. In addition, α-amylase activity of the wild-type strain was reduced in submerged culture containing high concentrations of inducing sugars, whereas all constructed mutants showed higher α-amylase activities. In particular, the α-amylase activity of the double deletion mutant in a medium containing 5% starch was >10-fold higher than that of the wild-type strain under the same culture conditions. In solid-state cultures using wheat bran as a substrate, the α-amylase activities of single creA and double deletion mutants were >2-fold higher than that of the wild-type strain. These results suggested that deleting both creA and creB resulted in dramatic improvements in the production of secretory glycoside hydrolases in filamentous fungi.

  2. The S-layer from Bacillus stearothermophilus DSM 2358 functions as an adhesion site for a high-molecular-weight amylase.

    PubMed Central

    Egelseer, E; Schocher, I; Sára, M; Sleytr, U B

    1995-01-01

    The S-layer lattice from Bacillus stearothermophilus DSM 2358 completely covers the cell surface and exhibits oblique symmetry. During growth of B. stearothermophilus DSM 2358 on starch medium, three amylases with molecular weights of 58,000, 98,000, and 184,000 were secreted into the culture fluid, but only the high-molecular-weight enzyme was found to be cell associated. Studies of interactions between cell wall components and amylases revealed no affinity of the high-molecular-weight amylase to isolated peptidoglycan. On the other hand, this enzyme was always found to be associated with S-layer self-assembly products or S-layer fragments released during preparation of spheroplasts by treatment of whole cells with lysozyme. The molar ratio of S-layer subunits to the bound amylase was approximately 8:1, which corresponded to one enzyme molecule per four morphological subunits. Immunoblotting experiments with polyclonal antisera against the high-molecular-weight amylase revealed a strong immunological signal in response to the enzyme but no cross-reaction with the S-layer protein or the smaller amylases. Immunogold labeling of whole cells with anti-amylase antiserum showed that the high-molecular-weight amylase is located on the outer face of the S-layer lattice. Because extraction of the amylase was possible without disintegration of the S-layer lattice into its constituent subunits, it can be excluded that the enzyme is incorporated into the crystal lattice and participates in the self-assembly process. Affinity experiments strongly suggest the presence of a specific recognition mechanism between the amylase molecules and S-layer protein domains either exposed on the outermost surface or inside the pores. In summary, results obtained in this study confirmed that the S-layer protein from B. stearothermophilus DSM 2358 functions as an adhesion site for a high-molecular-weight amylase. PMID:7533757

  3. Evaluation of Biochemical Markers Serum Amylase and Serum Lipase for the Assessment of Pancreatic Exocrine Function in Diabetes Mellitus

    PubMed Central

    Iyer, Chandrashekhar M; Madivalar, Mamatha Thimmanna; Wadde, Satish Kishanrao; Howale, Deepak Sadashiv

    2016-01-01

    Introduction Diabetes mellitus (DM), a metabolic disorder characterized by hyperglycaemia, associated with deficiency or resistance to insulin indicates endocrinal abnormality of the pancreas. Amylase and lipase are enzymes secreted by the exocrine portion of the pancreas. Endocrinal derangement observed in diabetes may interfere with the exocrine function of the pancreas. Aim To estimate the levels of fasting blood sugar, serum lipase, serum amylase in patients of type 1 and type 2 DM. Than comparing them with healthy controls and to study the effect of type 1 and type 2 DM on pancreatic exocrine function using serum levels of amylase and lipase as biochemical marker. Materials and Methods This study was conducted at GMERS Medical College and Hospital from Dec 2015 to July 2016. Thirty patients of type 1 DM and 30 patients of type 2 DM, who were already diagnosed and taking treatment, were included in this study. A total number of 30 apparently healthy individuals were recruited as the control group in our study. Fasting venous blood samples were collected from the cases as well as the controls and they were analysed by using semi auto analyser for blood glucose, serum amylase and serum lipase. The results were analysed statistically by using SPSS software. Values were expressed as means ± SD. Results We found statistically significant (p<0.01) low values for serum amylase and serum lipase in patients with type 1 and type 2 DM as compared to healthy controls. Fasting blood sugar was significantly higher in cases as compared to controls. We found negative correlation of fasting blood sugar level with serum amylase and serum lipase and positive correlation of serum amylase with serum lipase in both type 1 and type 2 DM. Conclusion Our study clearly demonstrated that in type 1 and type 2 DM, there was increase in fasting blood sugar with decrease in serum amylase and serum lipase which signifies the derangement of endocrine-exocrine axis of the pancreas. Serum

  4. Enhanced production of α-amylase by Penicillium chrysogenum in liquid culture by modifying the process parameters.

    PubMed

    Dar, Gowhar H; Kamili, Azra N; Nazir, Ruqeya; Bandh, Suhaib A; Jan, Tariq R; Chishti, Mohammad Z

    2015-11-01

    In this paper, we have assessed the role of changing physicochemical parameters and substrate types on the production of α-amylase enzyme from Penicillium chrysogenum, with a view to determining the optimal conditions required for its maximum production. The findings of this research revealed that, at pH 6 using linseed oil cake as substratum, α-amylase enzyme production was maximum (550.0 U/mL), when the fungi was incubated for 6 days at 30 °C in 0.1 M acetate buffer. Further, reasonably good production of the α-amylase enzyme was also observed at pH 9 with all the experimented carbon sources as substrates. Moreover, statistical analysis, using analysis of variance (ANOVA) carried out to study the impact of different studied parameters on the α-amylase enzyme production revealed that incubation period of 6-18 days is highly significant (p = 0.01) factor in amylotic activity of the P. chrysogenum. Under the researched out optimal conditions, P. chrysogenum is an economically viable option for the industrial and biotechnological production of α-amylase enzyme.

  5. An exceptionally cold-adapted alpha-amylase from a metagenomic library of a cold and alkaline environment.

    PubMed

    Vester, Jan Kjølhede; Glaring, Mikkel Andreas; Stougaard, Peter

    2015-01-01

    A cold-active α-amylase, AmyI3C6, identified by a functional metagenomics approach was expressed in Escherichia coli and purified to homogeneity. Sequence analysis showed that the AmyI3C6 amylase was similar to α-amylases from the class Clostridia and revealed classical characteristics of cold-adapted enzymes, as did comparison of the kinetic parameters K m and k cat to a mesophilic α-amylase. AmyI3C6 was shown to be heat-labile. Temperature optimum was at 10-15 °C, and more than 70 % of the relative activity was retained at 1 °C. The pH optimum of AmyI3C6 was at pH 8-9, and the enzyme displayed activity in two commercial detergents tested, suggesting that the AmyI3C6 α-amylase may be useful as a detergent enzyme in environmentally friendly, low-temperature laundry processes.

  6. A Proposed Mechanism for the Thermal Denaturation of a Recombinant Bacillus Halmapalus Alpha-amylase - the Effect of Calcium Ions

    NASA Technical Reports Server (NTRS)

    Nielsen, Anders D.; Pusey, Marc L.; Fuglsang, Claus C.; Westh, Peter

    2003-01-01

    The thermal stability of a recombinant alpha-amylase from Bacillus halmapalus alpha-amylase (BHA) has been investigated using circular dichroism spectroscopy (CD) and differential scanning calorimetry (DSC). This alpha-amylase is homologous to other Bacillus alpha-amylases where previous crystallographic studies have identified the existence of 3 calcium binding sites in the structure. Denaturation of BHA is irreversible with a Tm of approximately 89 C, and DSC thermograms can be described using a one-step irreversible model. A 5 C increase in T(sub m) in the presence of 10 fold excess CaCl2 was observed. However, a concomitant increase in the tendency to aggregate was also observed. The presence of 30-40 fold excess calcium chelator (EDTA or EGTA) results in a large destabilization of BHA corresponding to about 40 C lower T(sub m), as determined by both CD and DSC. Ten fold excess EGTA reveals complex DSC thermograms corresponding to both reversible and irreversible transitions, which possibly originate from different populations of BHA:calcium complexes. The observations in the present study have, in combination with structural information of homologous alpha-amylases, provided the basis for the proposal of a simple denaturation mechanism of BHA. The proposed mechanism describes the irreversible thermal denaturation of different BHA:calcium complexes and the calcium binding equilibrium involved. Furthermore, the model accounts for a temperature induced reversible structural change associated with calcium binding.

  7. Analysis of a preferential action of α-amylase from B. licheniformis towards amorphous regions of waxy maize starch.

    PubMed

    Foresti, María Laura; Williams, María del Pilar; Martínez-García, Ricardo; Vázquez, Analía

    2014-02-15

    Waxy maize starch was subjected to α-amylase (Bacillus licheniformis) hydrolysis in buffered medium to determine the evolution of reaction in quantitative terms and also in terms of the morphology and crystallinity of the partially hydrolyzed starch granules. Gathered data allowed studying the pattern of action of this α-amylase over waxy maize starch granules, with particular focus on a preferential hydrolysis of the amorphous regions of starch. Results showed that waxy maize starch hydrolysis followed a two-stage kinetic profile with an initial stage characterized by high reaction rate, followed by a slower second stage. The change of hydrolysis rate occurred at approximately 6h of reaction, a time for which X-ray diffraction data quantitatively analyzed by three different techniques showed a maximum of crystallinity in partially hydrolyzed granules. Scanning electron microscopy images illustrated the action of α-amylases which implied the exoerosion of the granules surface, the entry of α-amylases into the granules through radial channels, their endoerosion towards the granule exterior, and their fragmentation. Fragmentation of waxy maize starch granules revealed internal layered structures of starch which were interpreted as hydrolyzed/non-hydrolyzed growth rings. Under the conditions chosen, kinetic, electron microscopy and X-ray data all gave evidence of a preferential action of α-amylase from Bacillus licheniformis towards the less ordered regions of waxy maize starch. Results showed that, provided the proper hydrolysis time is chosen, starch granules with increased crystallinity can be obtained by a pure enzymatic treatment.

  8. Pouteria torta epicarp as a useful source of α-amylase inhibitor in the control of type 2 diabetes.

    PubMed

    de Sales, Paloma Michelle; de Souza, Paula Monteiro; Dartora, Mariana; Resck, Inês Sabioni; Simeoni, Luiz Alberto; Fonseca-Bazzo, Yris Maria; de Oliveira Magalhães, Pérola; Silveira, Dâmaris

    2017-03-10

    Type 2 diabetes plays a major role in public health, affecting about 400 million adults. One of the used strategies to control type 2 diabetes is the inhibition of α-amylase activity to reduce post-prandial blood glucose levels. Therefore, in past decades, the search of new α-amylase inhibitors has led to the evaluation of natural products as a source of these compounds. Pouteria torta (Sapotaceae) is widespread in Brazil and bears edible fruits. Epicarp and pulp crude extracts of fresh fruits were studied for in vitro α-amylase inhibition activity. The pulp did not present activity while epicarp, usually considered as waste, showed a high α-amylase inhibitory capacity when compared with acarbose and Triticum aestivum. Therefore, an assay-guided fractionation study of epicarp crude extract was performed. Fraction VI shows very high inhibitory activity with IC50 of 9 μg/mL. However, subsequent fractionation led to lower inhibition potential (IC50 of 22.1 μg/mL). The qualitative characterization of fraction VI were performed by chromatographic and spectrometric analysis and showed the presence of epicatechin, catechin, sucrose, glucose, and fructose. Total phenolic and flavonoid contents and antioxidant capacity were also assessed and there seemed to be no correlation between phenolic or flavonoids-rich fractions and antioxidant capacity or α-amylase inhibitory activity.

  9. Effects of Oolong tea polyphenols, EGCG, and EGCG3″Me on pancreatic α-amylase activity in vitro.

    PubMed

    Fei, Qunqin; Gao, Yuan; Zhang, Xin; Sun, Yi; Hu, Bing; Zhou, Li; Jabbar, Saqib; Zeng, Xiaoxiong

    2014-10-01

    In order to investigate the inhibitory effects and possible mechanisms of Oolong tea polyphenols, (-)-epigallocatechin gallate (EGCG) and (-)-epigallocatechin 3-O-(3-O-methyl) gallate (EGCG3″Me) on pancreatic α-amylase, the inhibition, enzyme kinetics, ultraviolet (UV) absorption spectrum and fluorescence spectrum of α-amylase were investigated. The results showed that Oolong tea polyphenols, EGCG, and EGCG3″Me all exhibited inhibitory effects against α-amylase, and their half inhibitory concentration (IC50) values were 0.375, 0.350, and 0.572 mg/mL, respectively. The results of Lineweaver-Burk double reciprocal plot indicated that the inhibitory types of Oolong tea polyphenols and EGCG were competitive, whereas EGCG3″Me was in a noncompetitive pattern. Oolong tea polyphenols, EGCG, and EGCG3″Me all induced red-shift of UV absorbance and quenching of fluorescence of α-amylase, suggesting possible changes in the conformation of α-amylase. The differences of inhibitory effects and inhibition types for EGCG and EGCG3″Me might be due to their structural difference (the hydroxyl group at C-3 in D ring of EGCG substituted by methoxy group, forming EGCG3″Me).

  10. Improvement of thermal stability of a mutagenised α-amylase by manipulation of the calcium-binding site.

    PubMed

    Ghollasi, Marzieh; Ghanbari-Safari, Maryam; Khajeh, Khosro

    2013-12-10

    Site-directed mutagenesis of an α-amylase isolated from Bacillus megaterium WHO has been performed to evaluate the roles of the calcium binding site residues in enzyme thermostability. The strategy used was to replace residues in the hypothetical calcium binding loops of B. megaterium WHO α-amylase (BMW-amylase) by equivalent positions at Halothermothrix orenii α-amylase (AmyA) as a thermophilic amylase by QuikChange site directed mutagenesis. Asn-75, Ser-76, and His-77 were mutated in the second calcium binding site which resulted in an increase in thermostability. All mutants retained their hydrolytic activity although their kcat parameter decreased in compare to the wild type and in the presence of calcium ions. In S76P and H77E, the Km for starch decreases while overall activity (kcat/Km) was increased. In the presence of calcium, conversion of His-77 to Glu resulted in a 4-fold enhancement in enzyme half life and a 9°C upward shift in T50, which was observed in compare to the wild type. Further analysis suggested the H77E mutant as the most stable which increased the affinity of the enzyme for calcium ion and its optimum temperature was 5°C higher than the wild type.

  11. α-Glucosidase and α-amylase inhibitors from seed oil: a review of liposoluble substance to treat diabetes.

    PubMed

    Teng, Hui; Chen, Lei

    2016-02-06

    One of the effective managements of diabetes mellitus, in particular, non-insulin-dependent diabetes mellitus, is to retard the absorption of glucose by inhibition of carbohydrate hydrolyzing enzymes, such as α-glucosidase and α-amylase, in the digestive organs. Currently, there is renewed interest in plant-based medicines and functional foods modulating physiological effects in the inhibition of α-glucosidase and α-amylase. Accordingly, inhibitors of α-glucosidase or α-amylase derived from various sources have also been isolated, majority of phenolic compounds, and their effects have been investigated in animals as well. As such, when the presence of α-glucosidase inhibitor in many foodstuffs was screened for, we found that vegetable seed oil also strongly inhibited α-glucosidase and α-amylase. Seed oil is an important source of liposoluble constituents with potential for inhibition of these enzymes can also be used as therapeutic or functional food sources. Therefore, this review is aimed at highlighting the main liposoluble classes of α-glucosidase and α-amylase inhibitors, but it is not intended to be an exhaustive review on the subject.

  12. Estimation of Salivary Amylase in Diabetic Patients and Saliva as a Diagnostic Tool in Early Diabetic Patients

    PubMed Central

    Malathi, L.; Masthan, K.M.K.; Balachander, N.; Babu, N. Aravindha; Rajesh, E.

    2013-01-01

    Aim: The aim of this study was to estimate the salivary amylase levels in non-insulin dependent diabetes mellitus patients and to correlate these findings with those in normal individuals, in order to provide salivary amylase level as a bio-chemical indicator for diagnosing and monitoring the glucose levels. Material and Methods: The study samples consisted of 60 individuals. Both males and females participated in the study. Thirty non-insulin dependent diabetes mellitus patients of age group of 30 to 60 years and healthy individuals of same number and age group were included in this study. The data obtained in this study were statistically analyzed by using Student’s t–test. Results: In estimation of salivary amylase levels, the comparison of mean and standard deviation showed the highest mean score (2739.48 +1525.20) among the diabetic patients and lowest mean score (1740.38 + 638.51) among the non-diabetic patients. The p-value obtained was less than 0.01. Hence, a highly significant difference in the mean scores regarding salivary amylase (u/l) was found among the two groups. Conclusion: The mean scores of age, fasting blood sugar, post prandial blood sugar, HbA1c and salivary amylase levels were greater in diabetic patients than in non-diabetic patients. PMID:24392426

  13. Antidiabetic Activity of Ruellia tuberosa L., Role of α-Amylase Inhibitor: In Silico, In Vitro, and In Vivo Approaches

    PubMed Central

    Ratna Wulan, Dyah; Priyo Utomo, Edi; Mahdi, Chanif

    2015-01-01

    Ruellia tuberosa L. is a folk remedy in the treatment of diabetes mellitus. However, its hypoglycemic activity has not been investigated so far. In the present study, the antidiabetic mechanism of the n-hexane fraction of methanolic extract (HFME) of this plant was investigated in silico, in vitro, and in vivo. In silico study was performed using AutoDock4.2 software. In vitro  α-amylase inhibitory activity was investigated by starch-iodine method. A single dose of 450 mg/kg HFME for 14 days was subjected to an antidiabetic screening in vivo by a multiple low dose streptozotocin (MLD-STZ) induced rats. Molecular modeling results show that Betulin exhibited noncompetitive α-amylase inhibitory activities. The effect of HFME elicited significant reductions of diabetic rat blood glucose. A single dose administration of HFME inhibited α-amylase activity in vivo (P < 0.01) compared to a diabetic control group. Moreover, this extract strongly inhibited the α-amylase activity in vitro (IC50 0.14 ± 0.005 mg/mL). It is concluded that HFME exerted an antidiabetic effect via α-amylase inhibitor. Our findings provide a possible hypoglycemic action of R. tuberosa L. as an alternative therapy in the management of diabetes. PMID:26576302

  14. Two tandemly located promoters, artificially constructed, are active in a Bacillus subtilis alpha-amylase secretion vector.

    PubMed

    Furusato, T; Takano, J; Jigami, Y; Tanaka, H; Yamane, K

    1986-04-01

    An 85 bp DNA fragment, the nucleotide sequence of which had 84% homology with the sequence for the promoter, ribosome binding site and NH2-terminal five amino acids of the Bacillus amyloliquefaciens alpha-amylase gene, was chemically synthesized. In order to analyze the promoter activity of a Bacillus subtilis alpha-amylase secretion vector, the fragment was inserted between the promoter and signal peptide-coding region of Bacillus subtilis alpha-amylase gene. Both promoters, tandemly repeated, functioned in transcribing the B. subtilis alpha-amylase signal peptide-coding region followed by the Escherichia coli beta-lactamase structural gene. The transcription initiation sites were determined by the primer extension method. The extracellular production of beta-lactamase was stimulated by two promoters as compared with that by the plasmids containing either promoter region alone. The change of two amino acids in the NH2-terminal region of the B. subtilis alpha-amylase signal peptide had no effect on the secretion of beta-lactamase from B. subtilis cells.

  15. Effect of limited proteolysis in the 8th loop of the barrel and of antibodies on porcine pancreas amylase activity.

    PubMed

    Desseaux, V; Payan, F; Ajandouz, E H; Svensson, B; Haser, R; Marchis-Mouren, G

    1991-11-15

    The porcine pancreatic alpha-amylase is a (beta/alpha)8-barrel protein, containing domains A and B (peptide sequence 1-403) and a distinct C-domain (peptide sequence 404-496). Separation of the terminal C-domain from the A and B domains has been attempted by limited proteolysis in the hinge region. Subtilisin was found to hydrolyse amylase between residues 369 and 370 situated in the loop between the eighth beta-strand and alpha-helix. The cleaved amylase was isolated by chromatofocusing and found to retain about 60% of the activity of the native enzyme, while the isolated fragments were inactive. Antigen binding fragments prepared from polyclonal antibodies to native amylase and the CNBr-fragment P1 (peptide sequence 395-496) respectively, were tested for influence on the enzyme activity. Antibodies directed against P1 had no effect whereas antibodies against the peptide sequence 1-394 and amylase respectively inhibited hydrolysis of substrates having four or more glucose residues but not of shorter oligomaltosides. Crystallographic analysis revealed that changes in the region of residue 369 might affect the conformation of the active site as well as of a second binding site. This site, located on the enzyme surface, is proposed to be required for the hydrolysis of larger substrates.

  16. Β-amylase from starchless seeds of Trigonella foenum-graecum and its localization in germinating seeds.

    PubMed

    Srivastava, Garima; Kayastha, Arvind M

    2014-01-01

    Fenugreek (Trigonella foenum-graecum) seeds do not contain starch as carbohydrate reserve. Synthesis of starch is initiated after germination. A β-amylase from ungerminated fenugreek seeds was purified to apparent electrophoretic homogeneity. The enzyme was purified 210 fold with specific activity of 732.59 units/mg. Mr of the denatured enzyme as determined from SDS-PAGE was 58 kD while that of native enzyme calculated from size exclusion chromatography was 56 kD. Furthermore, its identity was confirmed to be β-amylase from MALDI-TOF analysis. The optimum pH and temperature was found to be 5.0 and 50°C, respectively. Starch was hydrolyzed at highest rate and enzyme showed a Km of 1.58 mg/mL with it. Antibodies against purified Fenugreek β-amylase were generated in rabbits. These antibodies were used for localization of enzyme in the cotyledon during different stages of germination using fluorescence and confocal microscopy. Fenugreek β-amylase was found to be the major starch degrading enzyme depending on the high amount of enzyme present as compared to α-amylase and also its localization at the periphery of amyloplasts. A new finding in terms of its association with protophloem was observed. Thus, this enzyme appears to be important for germination of seeds.

  17. Gene cloning and characterization of a thermostable organic-tolerant α-amylase from Bacillus subtilis DR8806.

    PubMed

    Emtenani, Shamsi; Asoodeh, Ahmad; Emtenani, Shirin

    2015-01-01

    The gene encoding an extracellular α-amylase from Bacillus subtilis DR8806 was cloned into pET28a(+) vector and expressed in Escherichia coli BL21 (DE3). The recombinant enzyme with molecular mass of 76 kDa exhibited optimal activity at pH 5.0 and 70 °C with high stability in pH and temperature ranges of 4.0-9.0 and 45-75 °C. The enzyme showed a half-life of 125 min at 70 °C. The α-amylase activity enhanced in the presence of Na(+), K(+), and Ca(2+) ions, while Zn(2+), Pb(2+), and Hg(2+) ions inhibited the activity. The recombinant α-amylase exhibited high stability towards ioninc detergents sodium dodecyl sulfate (SDS) and cetyl trimethylammonium bromide (CTAB). Organic solvents in reaction media increased the α-amylase activity. TLC analysis showed that maltoriose and maltose were the major end products of enzymatic starch hydrolysis. Presenting various properties of recombinant α-amylase makes it well suited as a potential candidate for industrial usages.

  18. Characterization of a thermostable raw-starch hydrolyzing α-amylase from deep-sea thermophile Geobacillus sp.

    PubMed

    Jiang, Tao; Cai, Menghao; Huang, Mengmeng; He, Hao; Lu, Jian; Zhou, Xiangshan; Zhang, Yuanxing

    2015-10-01

    A deep-sea thermophile, Geobacillus sp. 4j, was identified to grow on starch and produce thermostable amylase. N-terminally truncated form of Geobacillus sp. 4j α-amylase (Gs4j-amyA) was fused at its N-terminal end with the signal peptide of outer membrane protein A (OmpA) of Escherichia coli. The enzyme was over-expressed in E. coli BL21 with a maximum extracellular production of 130U/ml in shake flask. The yield of the transformant increased 22-fold as compared with that of the wild strain. The recombinant enzyme purified to apparent homogeneity by metal-affinity chromatography, exhibited a molecular mass of 62kDa. It displayed the maximal activity at 60-65°C and pH 5.5. Its half-life (t1/2) at 80°C was 4.25h with a temperature deactivation energy of 166.3kJ/mol. Compared to three commonly used commercial α-amylases, the Gs4j-amyA exhibited similar thermostable performance to BLA but better than BAA and BSA. It also showed a universally efficient raw starch hydrolysis performance superior to commercial α-amylases at an acidic pH approaching nature of starch slurry. As a new acidic-resistant thermostable α-amylase, it has the potential to bypass the industrial gelatinization step in raw starch hydrolysis.

  19. Enhanced production and characterization of a solvent stable amylase from solvent tolerant Bacillus tequilensis RG-01: thermostable and surfactant resistant.

    PubMed

    Tiwari, Soni; Shukla, Neha; Mishra, Pooja; Gaur, Rajeeva

    2014-01-01

    Ten bacterial strains isolated from the soil samples in the presence of cyclohexane were screened for amylase production. Among them, culture RG-01 was adjudged as the best amylase producer and was identified as Bacillus tequilensis from MTCC, Chandigarh. The isolate showed maximum amylase production (8100 U/mL) in the presence of starch, peptone, and Ca(2+) ions at 55°C pH 7.0 within 24 h of incubation. The enzyme was stable in the presence of n-dodecane, isooctane, n-decane, xylene, toluene, n-hexane, n-butanol, and cyclohexane, respectively. The presence of benzene, methanol, and ethanol marginally reduced the amylase stability, respectively. The enzyme was showed it 100% activity at 55°C and pH 7.0 with 119% and 127% stability at 55°C and pH 7.0, respectively. The enzyme was also stable in the presence of SDS, Tween-40, Tween-60, and Tween-80 (1%) and was found stimulatory effect, respectively. Only Triton-X-100 showed a moderate inhibitory effect (5%) on amylase activity. This isolate (Bacillus tequilensis RG-01) may be useful in several industrial applications owing to its thermotolerant and organic solvents and surfactants resistance characteristics.

  20. Characterization of a Novel Maltose-Forming α-Amylase from Lactobacillus plantarum subsp. plantarum ST-III.

    PubMed

    Jeon, Hye-Yeon; Kim, Na-Ri; Lee, Hye-Won; Choi, Hye-Jeong; Choung, Woo-Jae; Koo, Ye-Seul; Ko, Dam-Seul; Shim, Jae-Hoon

    2016-03-23

    A novel maltose (G2)-forming α-amylase from Lactobacillus plantarum subsp. plantarum ST-III was expressed in Escherichia coli and characterized. Analysis of conserved amino acid sequence alignments showed that L. plantarum maltose-producing α-amylase (LpMA) belongs to glycoside hydrolase family 13. The recombinant enzyme (LpMA) was a novel G2-producing α-amylase. The properties of purified LpMA were investigated following enzyme purification. LpMA exhibited optimal activity at 30 °C and pH 3.0. It produced only G2 from the hydrolysis of various substrates, including maltotriose (G3), maltopentaose (G5), maltosyl β-cyclodextrin (G2-β-CD), amylose, amylopectin, and starch. However, LpMA was unable to hydrolyze cyclodextrins. Reaction pattern analysis using 4-nitrophenyl-α-d-maltopentaoside (pNPG5) demonstrated that LpMA hydrolyzed pNPG5 from the nonreducing end, indicating that LpMA is an exotype α-amylase. Kinetic analysis revealed that LpMA had the highest catalytic efficiency (kcat/Km ratio) toward G2-β-CD. Compared with β-amylase, a well-known G2-producing enzyme, LpMA produced G2 more efficiently from liquefied corn starch due to its ability to hydrolyze G3.

  1. Microencapsulation of purified amylase enzyme from pitaya (Hylocereus polyrhizus) peel in Arabic gum-chitosan using freeze drying.

    PubMed

    Amid, Mehrnoush; Manap, Yazid; Zohdi, Nor Khanani

    2014-03-24

    Amylase is one of the most important enzymes in the world due to its wide application in various industries and biotechnological processes. In this study, amylase enzyme from Hylocereus polyrhizus was encapsulated for the first time in an Arabic gum-chitosan matrix using freeze drying. The encapsulated amylase retained complete biocatalytic activity and exhibited a shift in the optimum temperature and considerable increase in the pH and temperature stabilities compared to the free enzyme. Encapsulation of the enzyme protected the activity in the presence of ionic and non-ionic surfactants and oxidizing agents (H₂O₂) and enhanced the shelf life. The storage stability of amylase is found to markedly increase after immobilization and the freeze dried amylase exhibited maximum encapsulation efficiency value (96.2%) after the encapsulation process. Therefore, the present study demonstrated that the encapsulation of the enzyme in a coating agent using freeze drying is an efficient method to keep the enzyme active and stable until required in industry.

  2. Differential RNA Expression of Bmy1 During Late Seed Development in Wild and Cultivated Barley and the Association With ß-Amylase Activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Four genotypes carrying different ß-amylase 1 (Bmy1) intron III alleles (Bmy1.a, Bmy1.b, Bmy1.c, and Bmy1.d) were analyzed for differences in Bmy1 DNA sequence, Bmy1 RNA expression, ß-amylase activity and protein, and total protein during late seed development. Wild barleys Ashqelon (Bmy1.c) and PI...

  3. Comparisons of amylolytic enzyme activities and ß-amylases with differing Bmy1 intron III alleles to sugar production during congress mashing with North American barley cultivars

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study was conducted to determine the relationships between patterns of activity development of malt amylolytic enzymes (a-amylase, ß-amylase, and limit dextrinase) and sugar production in two- and six-row North American cultivars during the course of Congress mashing and to test two hypotheses:...

  4. Isolation and characterization of a proteinaceous α-amylase inhibitor AAI-CC5 from Streptomyces sp. CC5, and its gene cloning and expression.

    PubMed

    Sun, Zhibin; Lu, Weihao; Liu, Pingping; Wang, Hui; Huang, Yan; Zhao, Yuguo; Kong, Yi; Cui, Zhongli

    2015-02-01

    An α-amylase inhibitor producing Streptomyces sp. strain CC5 was isolated from soil. A proteinaceous α-amylase inhibitor AAI-CC5 was purified from strain CC5. AAI-CC5 specifically inhibited mammalian α-amylases. The molecular weight of the inhibitor was determined to be 8,212 Da by MALDI-TOF Mass Spectrum. The N-terminal 15 amino acid residues of the purified AAI-CC5 were DTGSPAPECVEYFQS, which is dissimilar to other reported proteinaceous α-amylase inhibitors. AAI-CC5 is a pH insensitive and heat-stable protein, and cannot be hydrolysed by trypsin. AAI-CC5 was cloned and expressed in Escherichia coli BL21 (DE3) with a hexa-histidine tag on the C terminal. AAI-CC5 shared 82 % identity with Parvulustat. The recombinant α-amylase inhibitor was purified to homogeneity by one-step affinity chromatography using Ni(2+)-NTA resin with molecular mass of 9,404 Da. Steady state kinetics studies of α-amylase and the inhibitor revealed an irreversible, non-competitive inhibition mechanism with IC50 and Ki value of 6.43 ×1 10(-11) and 4.45 × 10(-11) M respectively. These results suggest this novel α-amylase inhibitor possessed powerful inhibitory activity for α-amylase, and it may be a candidate in research of diabetes therapy and obesity treatment.

  5. Alpha-amylase from germinating soybean (Glycine max) seeds--purification, characterization and sequential similarity of conserved and catalytic amino acid residues.

    PubMed

    Kumari, Arpana; Singh, Vinay Kumar; Fitter, Jörg; Polen, Tino; Kayastha, Arvind M

    2010-10-01

    Starch hydrolyzing amylase from germinated soybeans seeds (Glycine max) has been purified 400-fold to electrophoretic homogeneity with a final specific activity of 384 units/mg. SDS-PAGE of the final preparation revealed a single protein band of 100 kDa, whereas molecular mass was determined to be 84 kDa by MALDI-TOF and gel filtration on Superdex-200 (FPLC). The enzyme exhibited maximum activity at pH 5.5 and a pI value of 4.85. The energy of activation was determined to be 6.09 kcal/mol in the temperature range 25-85 degrees C. Apparent Michaelis constant (K(m)((app))) for starch was 0.71 mg/mL and turnover number (k(cat)) was 280 s(-1) in 50 mM sodium acetate buffer, pH 5.5. Thermal inactivation studies at 85 degrees C showed first-order kinetics with rate constant (k) equal to 0.0063 min(-1). Soybean alpha-amylase showed high specificity for its primary substrate starch. High similarity of soybean alpha-amylase with known amylases suggests that this alpha-amylase belongs to glycosyl hydrolase family 13. Cereal alpha-amylases have gained importance due to their compatibility for biotechnological applications. Wide availability and easy purification protocol make soybean as an attractive alternative for plant alpha-amylase. Soybean can be used as commercially viable source of alpha-amylase for various industrial applications.

  6. AmyM, a Novel Maltohexaose-Forming α-Amylase from Corallococcus sp. Strain EGB

    PubMed Central

    Li, Zhoukun; Wu, Jiale; Zhang, Biying; Wang, Fei; Ye, Xianfeng; Huang, Yan; Huang, Qiang

    2015-01-01

    A novel α-amylase, AmyM, was purified from the culture supernatant of Corallococcus sp. strain EGB. AmyM is a maltohexaose-forming exoamylase with an apparent molecular mass of 43 kDa. Based on the results of matrix-assisted laser desorption ionization–time of flight mass spectrometry and peptide mass fingerprinting of AmyM and by comparison to the genome sequence of Corallococcus coralloides DSM 2259, the AmyM gene was identified and cloned into Escherichia coli. amyM encodes a secretory amylase with a predicted signal peptide of 23 amino acid residues, which showed no significant identity with known and functionally verified amylases. amyM was expressed in E. coli BL21(DE3) cells with a hexahistidine tag. The signal peptide efficiently induced the secretion of mature AmyM in E. coli. Recombinant AmyM (rAmyM) was purified by Ni-nitrilotriacetic acid (NTA) affinity chromatography, with a specific activity of up to 14,000 U/mg. rAmyM was optimally active at 50°C in Tris-HCl buffer (50 mM; pH 7.0) and stable at temperatures of <50°C. rAmyM was stable over a wide range of pH values (from pH 5.0 to 10.0) and highly tolerant to high concentrations of salts, detergents, and various organic solvents. Its activity toward starch was independent of calcium ions. The Km and Vmax of recombinant AmyM for soluble starch were 6.61 mg ml−1 and 44,301.5 μmol min−1 mg−1, respectively. End product analysis showed that maltohexaose accounted for 59.4% of the maltooligosaccharides produced. These characteristics indicate that AmyM has great potential in industrial applications. PMID:25576603

  7. Multiple time courses of salivary alpha-amylase and dimensions of affect in adolescence.

    PubMed

    Doane, Leah D; Van Lenten, Scott A

    2014-11-01

    Previous research has illustrated associations among daily experiences, emotions and stress-responding physiological systems. Recently, investigators have examined salivary alpha-amylase (sAA), a surrogate marker of the autonomic nervous system, and its associations with affect. The current study examined associations among affective valence, arousal and sAA across three different time courses at the momentary, daily and inter-individual level to understand varying influences of adolescents' daily emotional experiences on sAA reactivity and diurnal sAA activity. Adolescents (N=82) provided salivary samples and diary reports of affect and experiences five times a day for three consecutive days. They also completed self-report questionnaires on trait affect. Findings from multilevel growth curves demonstrated that adolescents in our sample displayed typical sAA diurnal rhythms with levels dropping 30 min after waking and then increasing across the day to a peak in the late afternoon. Within person momentary experiences of high arousal positive affect were associated with momentary sAA reactivity. Prior day experiences of high arousal negative affect were associated with a greater amylase awakening response (i.e., greater decrease) and flatter slopes the next day. Trait positive affect was also associated with flatter sAA slopes. Our findings suggest that both affective arousal and valence should be accounted for when examining differences in sAA reactivity and diurnal patterns. Further, our results indicated that emotion-physiology transactions among adolescents occur over varying time scales for salivary alpha-amylase as well as cortisol.

  8. Protein structures of common bean (Phaseolus vulgaris) alpha-amylase inhibitors.

    PubMed

    Lee, Shih-Chieh; Gepts, Paul L; Whitaker, John R

    2002-10-23

    Two nucleotide sequences for genes that encode alpha-amylase inhibitor 4 (alphaAI-4) from white kidney bean (WKB) cv. 858, designated gene alphaAI-4 (Accession No. ), and alpha-amylase inhibitor 5 (alphaAI-5) from black bean (BB), designated gene alphaAI-5 (Accession No. ), were determined. Genes alphaAI-4 and alphaAI-5 encode 244 amino acid prepro-alphaAI-4 and prepro-alphaAI-5 polypeptides that are 93 and 95% identical with alpha-amylase inhibitor l (alphaAI-l; Hoffman, L. M.; Ma, Y.; Barker, R. F. Nucleic Acids Res. 1982, 10, 7819-7828), 40 and 43% identical with red kidney bean lectin, and 52 and 55% identical with arcelin l of wild-type bean. The high degree of sequence similarity indicates the evolutionary relationship among these genes. PCR analysis of genomic DNA purified from six genotypes of Phaseolus vulgaris showed very similar band patterns in 2% agarose gel, another indication of the conserved size homology among these genes. Proteolytic processing sites were located between Asn77 and Ser78 for pro-alphaAI-4 and pro-alphaAI-5. A bend next to Asn77 in three-dimensional model structures of alphaAI-4 and alphaAI-5 proinhibitors indicates that the proteolytic cleavage is necessary to remove the conformational constraint for activation to the mature protein. Mature WKB alphaAI-4 was composed of four subunits (2alpha2beta) and had a molecular weight of 50000 determined by multiangle laser light scattering and 56714 determined by laser-assisted time-of-flight mass spectrometry.

  9. Activation of bean (Phaseolus vulgaris) [alpha]-amylase inhibitor requires proteolytic processing of the proprotein

    SciTech Connect

    Pueyo, J.J.; Hunt, D.C.; Chrispeels, M.J. )

    1993-04-01

    Seeds of the common bean (Phaseolus vulgaris) contain a plant defense protein that inhibits the [alpha]-amylases of mammals and insects. This [alpha]-amylase inhibitor ([alpha]Al) is synthesized as a proprotein on the endoplasmic reticulum and is proteolytically processed after arrival in the protein storage vacuoles to polypeptides of relative molecular weight (M[sub r]) 15,000 to 18,000. The authors report two types of evidence that proteolytic processing is linked to activation of the inhibitory activity. First, by surveying seed extracts of wild accessions of P. vulgaris and other species in the genus Phaseolus, they found that antibodies to [alpha]Al recognize large (M[sub r] 30,000-35,000) polypeptides as well as typical [alpha]Al processing products (M[sub r] 15,000-18,000). [alpha]Al activity was found in all extracts that had the typical [alpha]Al processed polypeptides, but was absent from seed extracts that lacked such polypeptides. Second, they made a mutant [alpha]Al in which asparagine-77 is changed to aspartic acid-77. This mutation slows down the proteolytic processing of pro-[alpha]Al when the gene is expressed in tobacco. When pro-[alpha]Al was separated from mature [alpha]Al by gel filtration, pro-[alpha]Al was found not to have [alpha]-amylase inhibitory activity. The authors interpret these results to mean that formation of the active inhibitor is causally related to proteolytic processing of the proprotein. They suggest that the polypeptide cleavage removes a conformation constraint on the precursor to produce the biochemically active molecule. 43 refs., 5 figs., 1 tab.

  10. Structural elements of thermostability in the maltogenic amylase of Geobacillus thermoleovorans.

    PubMed

    Mehta, Deepika; Satyanarayana, T

    2015-08-01

    Maltogenic amylase of Geobacillus thermoleovorans (Gt-MamyIII), which has the highest thermostability among bacterial maltogenic amylases, has been used as a model enzyme to understand the role of networked salt bridges in thermoadaptation. The role of intra-chain cross-domain salt bridge networks in the thermostabilization of maltogenic amylase of G. thermoleovorans was confirmed by site-directed mutagenesis and CD analysis. The amino acid pairs in seven salt bridges have been mutated singly and pair-wise, and their free energy of thermal inactivation has been calculated. Among seven, single and double mutations in the amino acids corresponding to four salt bridges (lys306.glu336, arg403.asp65, arg497.glu523 and lys524.glu523) decrease T1/2 and Tm of Gt-MamyIII significantly. Moreover, glu523 forms networked salt bridges with arg497 and lys524. OE1 of glu523 forms electrostatic interactions with NH1 of arg497, NH2 of arg497 and NZ of lys524 at a distance of 2.33, 2.02 and 0.33Å, respectively. The mutations in three buried amino acids led to a decline in T1/2 and Tm. The buried as well as networked cross-domain salt bridges thus appear to play a significant role in the thermostabilization of Gt-MamyIII. The salt bridges lys306.glu336 and arg403.asp65, which are isolated and partially accessible, play a minor role in its thermostabilization.

  11. Evaluation of Ten Wild Nigerian Mushrooms for Amylase and Cellulase Activities

    PubMed Central

    Adeoyo, Olusegun Richard

    2011-01-01

    Amylases and cellulases are important enzymes that can be utilized for various biological activities. Ten different wild Nigerian mushrooms (Agaricus blazei, Agaricus sp., Corilopsis occidentalis, Coriolus versicolor, Termitomyces clypeatus, Termitomyces globulus, Pleurotus tuber-regium, Podoscypha bolleana, Pogonomyces hydnoides, and Nothopanus hygrophanus) were assayed for production of these secondary metabolites. The results revealed that most of the tested wild fungi demonstrated very good amylase and cellulase activities. With the incorporation of carboxymethyl-cellulose (a carbon source) into the culture medium, Agaricus blazei had the highest amylolytic activity of 0.60 unit/mL (at 25℃, pH 6.8). This was followed in order by P. tuber-regium and Agaricus sp. with 0.42 and 0.39 unit/mL, respectively (p ≤ 0.05). Maltose and sucrose supplementation into the submerged liquid medium made N. hygrophanus and P. hydnoides to exhibit very low amylase activities of 0.09 and 0.11 unit/mL, respectively. Introducing peptone (an organic nitrogen source) into the basal medium enhanced the ability of C. versicolor to produce a cellulase value of 0.74 unit/mL. Other organic nitrogen sources that supported good cellulase activities were yeast extract and urea. Sodium nitrate (inorganic nitrogen source) generally inhibited cellulase production in all mushrooms. The best carbon source was carboxymethyl-cellulose, which promoted very high cellulase activity of 0.67 unit/mL in C. versicolor, which was followed in order by P. tuber-regium, T. chypeatus, and C. occidentalis (p ≤ 0.05). Sucrose was the poorest carbon compound, supporting the lowest values of 0.01, 0.01, and 0.14 unit/mL in P. hydnoides, A. blazei, and Agaricus sp., respectively. PMID:22783085

  12. The starch-bound alpha-amylase/trypsin-inhibitors in Avena.

    PubMed

    Gazza, Laura; Gazzelloni, Gloria; Taddei, Federica; Latini, Arianna; Muccilli, Vera; Alfieri, Michela; Conti, Salvatore; Redaelli, Rita; Pogna, Norberto E

    2016-12-01

    Oat kernels exhibit an extra-soft texture, a trait recently demonstrated to be largely modulated by starch-bound tryptophan-rich 2S proteins, the vromindolines. In this study, fractionation by two-dimensional electrophoresis of starch-bound proteins in 25 oat (Avena sativa) cultivars and 11 diploid or tetraploid Avena species revealed novel 2S proteins called Avena α-amylase/trypsin-inhibitors (AATI) because of their sequence similarity with wheat α-amylase/trypsin inhibitors. Thirty-seven AATI polypeptides, about 14 kDa in size, were split into three families named AATI-1, AATI-2, and AATI-3 with different primary structures and isoelectric points. AATI-1 and AATI-2 proteins showed 55.5-60.0 % sequence similarity with wheat α-amylase inhibitors CM1, CM2, and CM16, which have been found to cause innate immunity responses in celiac disease and non-celiac gluten sensitivity. Diploid A-genome and tetraploid AC-genome oat species possess three and five genes encoding for the AATI proteins, respectively, whereas hexaploid A. sativa exhibits 12 genes dispersed over the A-, C-, and D-genomes. Some AATI proteins expressed in hexaploid oats were assigned to the A-genome based on similarity to their counterparts in diploid species, contributing to further clarify the genetic origin of hexaploid oats. Moreover, AATI may interact with starch-bound vromindolines in determining the extra-soft texture of oat kernels and, due to their balanced amino acid compositions, may contribute to the biological value of oat proteins in a positive manner.

  13. Properties and applications of starch-converting enzymes of the alpha-amylase family.

    PubMed

    van der Maarel, Marc J E C; van der Veen, Bart; Uitdehaag, Joost C M; Leemhuis, Hans; Dijkhuizen, L

    2002-03-28

    Starch is a major storage product of many economically important crops such as wheat, rice, maize, tapioca, and potato. A large-scale starch processing industry has emerged in the last century. In the past decades, we have seen a shift from the acid hydrolysis of starch to the use of starch-converting enzymes in the production of maltodextrin, modified starches, or glucose and fructose syrups. Currently, these enzymes comprise about 30% of the world's enzyme production. Besides the use in starch hydrolysis, starch-converting enzymes are also used in a number of other industrial applications, such as laundry and porcelain detergents or as anti-staling agents in baking. A number of these starch-converting enzymes belong to a single family: the alpha-amylase family or family13 glycosyl hydrolases. This group of enzymes share a number of common characteristics such as a (beta/alpha)(8) barrel structure, the hydrolysis or formation of glycosidic bonds in the alpha conformation, and a number of conserved amino acid residues in the active site. As many as 21 different reaction and product specificities are found in this family. Currently, 25 three-dimensional (3D) structures of a few members of the alpha-amylase family have been determined using protein crystallization and X-ray crystallography. These data in combination with site-directed mutagenesis studies have helped to better understand the interactions between the substrate or product molecule and the different amino acids found in and around the active site. This review illustrates the reaction and product diversity found within the alpha-amylase family, the mechanistic principles deduced from structure-function relationship structures, and the use of the enzymes of this family in industrial applications.

  14. Cyclomaltodextrinase, neopullulanase, and maltogenic amylase are nearly indistinguishable from each other.

    PubMed

    Lee, Hee-Seob; Kim, Min-Sung; Cho, Hyun-Soo; Kim, Jung-In; Kim, Tae-Jip; Choi, Ji-Hye; Park, Cheonseok; Lee, Heung-Soo; Oh, Byung-Ha; Park, Kwan-Hwa

    2002-06-14

    Over 20 enzymes denoted as cyclomaltodextrinase, maltogenic amylase, or neopullulanase that share 40-86% sequence identity with each other are found in public data bases. These enzymes are distinguished from typical alpha-amylases by containing a novel N-terminal domain and exhibiting preferential substrate specificities for cyclomaltodextrins (CDs) over starch. In this research field, a great deal of confusion exists regarding the features distinguishing the three groups of enzymes from one another. Although a different enzyme code has been assigned to each of the three different enzyme names, even a single differentiating enzymatic property has not been documented in the literature. On the other hand, an outstanding question related to this issue concerns the structural basis for the preference of these enzymes for CDs. To clarify the confusion and to address this question, we have determined the structures of two enzymes, one from alkalophilic Bacillus sp. I-5 and named cyclomaltodextrinase and the other from a Thermus species and named maltogenic amylase. The structure of the Bacillus enzyme reveals a dodecameric assembly composed of six copies of the dimer, which is the structural and functional unit of the Thermus enzyme and an enzyme named neopullulanase. The structure of the Thermus enzyme in complex with beta-CD led to the conclusion that Trp47, a well conserved N-terminal domain residue, contributes greatly to the preference for beta-CD. The common dimer formation through the novel N-terminal domain, which contributes to the preference for CDs by lining the active-site cavity, convincingly indicates that the three groups of enzymes are not different enough to preserve the different names and enzyme codes.

  15. Maltose-forming α-amylase from the hyperthermophilic archaeon Pyrococcus sp. ST04.

    PubMed

    Jung, Jong-Hyun; Seo, Dong-Ho; Holden, James F; Park, Cheon-Seok

    2014-03-01

    The deduced amino acid sequence from a gene of the hyperthermophilic archaeon Pyrococcus sp. ST04 (Py04_0872) contained a conserved glycoside hydrolase family 57 (GH57) motif, but showed <13% sequence identity with other known Pyrococcus GH57 enzymes, such as 4-α-glucanotransferase (EC 2.4.1.25), amylopullulanase (EC 3.2.1.41), and branching enzyme (EC 2.4.1.18). This gene was cloned and expressed in Escherichia coli, and the recombinant product (Pyrococcus sp. ST04 maltose-forming α-amylase, PSMA) was a novel 70-kDa maltose-forming α-amylase. PSMA only recognized maltose (G2) units with α-1,4 and α-1,6 linkages in polysaccharides (e.g., starch, amylopectin, and glycogen) and hydrolyzed pullulan very poorly. G2 was the primary end product of hydrolysis. Branched cyclodextrin (CD) was only hydrolyzed along its branched maltooligosaccharides. 6-O-glucosyl-β-cyclodextrin (G1-β-CD) and β-cyclodextrin (β-CD) were resistant to PSMA suggesting that PSMA is an exo-type glucan hydrolase with α-1,4- and α-1,6-glucan hydrolytic activities. The half-saturation value (Km) for the α-1,4 linkage of maltotriose (G3) was 8.4 mM while that of the α-1,6 linkage of 6-O-maltosyl-β-cyclodextrin (G2-β-CD) was 0.3 mM. The kcat values were 381.0 min(-1) for G3 and 1,545.0 min(-1) for G2-β-CD. The enzyme was inhibited competitively by the reaction product G2, and the Ki constant was 0.7 mM. PSMA bridges the gap between amylases that hydrolyze larger maltodextrins and α-glucosidase that feeds G2 into glycolysis by hydrolyzing smaller glucans into G2 units.

  16. The alpha-amylase from the yellow meal worm: complete primary structure, crystallization and preliminary X-ray analysis.

    PubMed

    Strobl, S; Gomis-Rüth, F X; Maskos, K; Frank, G; Huber, R; Glockshuber, R

    1997-06-02

    The alpha-amylase from Tenebrio molitor larvae (TMA) was purified from a crude larval extract. After removal of the N-terminal pyroglutamate residue and identification of the following 17 residues by Edman sequencing, the cDNA of mature TMA was cloned from larval mRNA. The encoded enzyme consists of 471 amino acid residues and has 57-79% sequence identity to other insect alpha-amylases and also shows high homology to the mammalian enzymes. TMA was crystallized in form of well-ordered orthorhombic crystals of space group P2(1)2(1)2(1) diffracting beyond 1.6 A resolution with unit cell dimensions of a = 51.24 A, b = 93.46 A, c = 96.95 A. TMA may serve as model system for the future analysis of interactions between insect alpha-amylase and proteinaceous plant inhibitors on the molecular level.

  17. The effect of calcium binding on the unfolding barrier: A kinetic study on homologous alpha-amylases.

    PubMed

    Kumari, Arpana; Rosenkranz, Tobias; Kayastha, Arvind M; Fitter, Jörg

    2010-09-01

    Extreme thermostabilities of proteins can be achieved by binding co-factors to the protein structures. For various alpha-amylases protein stabilization upon calcium binding is a well-known phenomenon. In the present study the mechanism of stabilization of three homologous alpha-amylases was investigated by measuring the unfolding kinetics with CD spectroscopy. For this purpose thermal unfolding kinetics of calcium saturated and calcium depleted enzymes were analyzed by means of Eyring-plots. The free energy change between the native and the transition state which characterized the unfolding barrier height was found to be proportional to the number of calcium ions bound to the protein structures. For the most thermostable alpha-amylases calcium binding caused a significant increase in the enthalpy change, which was partly compensated by increased entropy changes.

  18. Glucosyl epi-cyclophellitol allows mechanism-based inactivation and structural analysis of human pancreatic α-amylase.

    PubMed

    Caner, Sami; Zhang, Xiaohua; Jiang, Jianbing; Chen, Hong-Ming; Nguyen, Nham T; Overkleeft, Hermen; Brayer, Gary D; Withers, Stephen G

    2016-04-01

    As part of a search for selective, mechanism-based covalent inhibitors of human pancreatic α-amylase we describe the chemoenzymatic synthesis of the disaccharide analog α-glucosyl epi-cyclophellitol, demonstrate its stoichiometric reaction with human pancreatic α-amylase and evaluate the time dependence of its inhibition. X-ray crystallographic analysis of the covalent derivative so formed confirms its reaction at the active site with formation of a covalent bond to the catalytic nucleophile D197. The structure illuminates the interactions with the active site and confirms OH4' on the nonreducing end sugar as a good site for attachment of fluorescent tags in generating probes for localization and quantitation of amylase in vivo.

  19. Impact of α-amylase combined with hydrochloric acid hydrolysis on structure and digestion of waxy rice starch.

    PubMed

    Li, Hongyan; Zhu, Yanqiao; Jiao, Aiquan; Zhao, Jianwei; Chen, Xiaoming; Wei, Benxi; Hu, Xiuting; Wu, Chunsen; Jin, Zhengyu; Tian, Yaoqi

    2013-04-01

    The structure and in vitro digestibility of native waxy rice starch by the combined hydrolysis of α-amylase and hydrochloric acid were investigated in this study. The combined hydrolysis technique generated higher hydrolysis rate and extent than the enzymatic hydrolysis. The granular appearance and chromatograph profile demonstrated that α-amylase and hydrochloric acid exhibited different patterns of hydrolysis. The rise in the ratio of absorbance 1047/1022cm(-1), the melting temperature range (Tc-To), and the melting enthalpy (ΔH) were observed during the combined hydrolysis. These results suggest that α-amylase simultaneously cleaves the amorphous and crystalline regions, whereas the amorphous regions of starch granules are preferentially hydrolyzed during the acid hydrolysis. Furthermore, the combined hydrolysis increased rapidly digestible starch (RDS) while decreased slowly digestible starch (SDS) and resistant starch (RS), indicating that the hydrolysis mode affected the digestion property of native waxy rice starch.

  20. Purification and characterization of a thiol amylase over produced by a non-cereal non-leguminous plant, Tinospora cordifolia.

    PubMed

    Mukherjee, Abhishek; Ghosh, Anil K; Sengupta, Subhabrata

    2010-12-10

    A 43kDa α-amylase was purified from Tinospora cordifolia by glycogen precipitation, ammonium sulfate precipitation, gel filtration chromatography, and HPGPLC. The enzyme was optimally active in pH 6.0 at 60°C and had specific activity of 546.2U/mg of protein. Activity was stable in the pH range of 4-7 and at temperatures up to 60°C. PCMB, iodoacetic acid, iodoacetamide, DTNB, and heavy metal ions Hg(2+)>Ag(+)>Cd(2+) inhibited enzyme activity while Ca(2+) improved both activity and thermostability. The enzyme was a thiol amylase (3 SH group/mole) and DTNB inhibition of activity was released by cysteine. N-terminal sequence of the enzyme had poor similarity (12-24%) with those of plant and microbial amylases. The enzyme was equally active on soluble starch and amylopectin and released maltose as the major end product.

  1. Synthesis and Evaluation of a Series of Oleanolic Acid Saponins as α-Glucosidase and α-Amylase Inhibitors.

    PubMed

    Guo, Tiantian; Wu, Shaoping; Guo, Sen; Bai, Lu; Liu, Qingchao; Bai, Naisheng

    2015-09-01

    Sixteen naturally occurring oleanolic acid saponins and their derivatives were synthesized in an efficient and practical strategy, and their inhibitory activities against α-glucosidase and α-amylase were evaluated in vitro. Among all the compounds, 28-O-monoglucoside 8 exhibited remarkably potent inhibitory activity against α-glucosidase with an IC50 value of 87.3 µM, which was fivefold stronger than that of the antidiabetic acarbose. Based on the preliminary structure-activity relationships, for 28-O-monoglucosides, the presence of a terminal α-l-rhamnopyranosyl residue enhanced the α-glucosidase and α-amylase inhibitory activities. Furthermore, for 3,28-O-bidesmosides, sugar-substituted moieties attached to the C-3 and C-28 positions of the oleanolic acid scaffold are helpful to increase the inhibitory activities against α-amylase and α-glucosidase.

  2. Purification, crystallization and preliminary X-ray crystallographic analysis of rice bifunctional α-amylase/subtilisin inhibitor from Oryza sativa

    SciTech Connect

    Lin, Yi-Hung; Peng, Wen-Yan; Huang, Yen-Chieh; Guan, Hong-Hsiang; Hsieh, Ying-Cheng; Liu, Ming-Yih; Chang, Tschining; Chen, Chun-Jung

    2006-08-01

    The crystallization of rice α-amylase/subtilisin bifunctional inhibitor is reported. Rice bifunctional α-amylase/subtilisin inhibitor (RASI) can inhibit both α-amylase from larvae of the red flour beetle (Tribolium castaneum) and subtilisin from Bacillus subtilis. The synthesis of RASI is up-regulated during the late milky stage in developing seeds. The 8.9 kDa molecular-weight RASI from rice has been crystallized using the hanging-drop vapour-diffusion method. According to 1.81 Å resolution X-ray diffraction data from rice RASI crystals, the crystal belongs to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 79.99, b = 62.95, c = 66.70 Å. Preliminary analysis indicates two RASI molecules in an asymmetric unit with a solvent content of 44%.

  3. Tracking amylolytic enzyme activities during congress mashing with North American barley cultivars: Comparisons of patterns of activity and ß-amylases with differing Bmy1 ...correlations of amylolytic enzyme activities

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study was conducted to test three hypotheses: 1) that a-amylase will have less consistent patterns of activity during mashing than ß-amylase and limit dextrinase 2) that differing ß-amylase 1 intron III alleles (Bmy1.a and Bmy1.b) would not be useful in predicting high or low activities or th...

  4. [Effect of dental alloys on salivary alkaline and acid phosphatase, alpha amylase K+, Na+, and Cl-].

    PubMed

    Todorov, I; Saprjanova, M

    1977-04-01

    Comparative studied were performed in healthy subjects without metals in their oral cavities and in individuals having different metal alloys (gold, steel, amalgam) in their mouths and presenting with various complaints such as xerostomia, burning mucosa, etc. It was found that the contents of alkaline and acid phosphatases, alpha-amylase, K+, Na+ and Cl- in saliva increased significantly with the increase in total corrosion potential when non-precious metal alloys, especially different types of alloys, were present. Parallel to this, the frequency and the intensity of the complaints increased.

  5. Effect of ionic liquids on the structure, stability and activity of two related α-amylases.

    PubMed

    Dabirmanesh, Bahareh; Daneshjou, Sara; Sepahi, Abbas Akhavan; Ranjbar, Bijan; Khavari-Nejad, Ramazan Ali; Gill, Pooria; Heydari, Akbar; Khajeh, Khosro

    2011-01-01

    Ionic liquids are recognized as green solvents for carbohydrates dissolution. However, only a limited number of studies have been carried out to investigate their effect on carbohydrate hydrolyzing enzymes. We have investigated the influence of two water miscible ionic liquids on the activity, stability and structure of two related α-amylases from Bacillus amyloliquefaciens and Bacillus lichiniformis. Upon changes in ionic liquids concentrations, both enzymes activity and stability were reduced. Associated thermodynamic and conformational changes were observed using differential scanning calorimetry and fluorescence techniques. Thermal denaturation was accompanied by aggregation in both aqueous buffer and [BMIm][Cl] but [HMIm][Cl] significantly suppressed aggregation.

  6. Potent α-amylase inhibitory activity of Indian Ayurvedic medicinal plants

    PubMed Central

    2011-01-01

    Background Indian medicinal plants used in the Ayurvedic traditional system to treat diabetes are a valuable source of novel anti-diabetic agents. Pancreatic α-amylase inhibitors offer an effective strategy to lower the levels of post-prandial hyperglycemia via control of starch breakdown. In this study, seventeen Indian medicinal plants with known hypoglycemic properties were subjected to sequential solvent extraction and tested for α-amylase inhibition, in order to assess and evaluate their inhibitory potential on PPA (porcine pancreatic α-amylase). Preliminary phytochemical analysis of the lead extracts was performed in order to determine the probable constituents. Methods Analysis of the 126 extracts, obtained from 17 plants (Aloe vera (L.) Burm.f., Adansonia digitata L., Allium sativum L., Casia fistula L., Catharanthus roseus (L.) G. Don., Cinnamomum verum Persl., Coccinia grandis (L.) Voigt., Linum usitatisumum L., Mangifera indica L., Morus alba L., Nerium oleander L., Ocimum tenuiflorum L., Piper nigrum L., Terminalia chebula Retz., Tinospora cordifolia (Willd.) Miers., Trigonella foenum-graceum L., Zingiber officinale Rosc.) for PPA inhibition was initially performed qualitatively by starch-iodine colour assay. The lead extracts were further quantified with respect to PPA inhibition using the chromogenic DNSA (3, 5-dinitrosalicylic acid) method. Phytochemical constituents of the extracts exhibiting≥ 50% inhibition were analysed qualitatively as well as by GC-MS (Gas chromatography-Mass spectrometry). Results Of the 126 extracts obtained from 17 plants, 17 extracts exhibited PPA inhibitory potential to varying degrees (10%-60.5%) while 4 extracts showed low inhibition (< 10%). However, strong porcine pancreatic amylase inhibitory activity (> 50%) was obtained with 3 isopropanol extracts. All these 3 extracts exhibited concentration dependent inhibition with IC50 values, viz., seeds of Linum usitatisumum (540 μgml-1), leaves of Morus alba (1440

  7. Effect of neohesperidin dihydrochalcone on the activity and stability of alpha-amylase: a comparative study on bacterial, fungal, and mammalian enzymes.

    PubMed

    Kashani-Amin, Elaheh; Ebrahim-Habibi, Azadeh; Larijani, Bagher; Moosavi-Movahedi, Ali Akbar

    2015-10-01

    Neohesperidin dihydrochalcone (NHDC) was recently introduced as an activator of mammalian alpha-amylase. In the current study, the effect of NHDC has been investigated on bacterial and fungal alpha-amylases. Enzyme assays and kinetic analysis demonstrated the capability of NHDC to significantly activate both tested alpha-amylases. The ligand activation pattern was found to be more similar between the fungal and mammalian enzyme in comparison with the bacterial one. Further, thermostability experiments indicated a stability increase in the presence of NHDC for the bacterial enzyme. In silico (docking) test locates a putative binding site for NHDC on alpha-amylase surface in domain B. This domain shows differences in various alpha-amylase types, and the different behavior of the ligand toward the studied enzymes may be attributed to this fact.

  8. Ligase-independent cloning of amylase gene from a local Bacillus subtilis isolate and biochemical characterization of the purified enzyme.

    PubMed

    Tuzlakoglu Ozturk, Merve; Akbulut, Nagihan; Issever Ozturk, Saliha; Gumusel, Fusun

    2013-09-01

    Five hundred ninety-seven bacterial isolates from Turkish hot spring water sources were screened for their ability to produce extracellular α-amylase. Among them, a high enzyme-producing Bacillus subtilis isolate, A28, was selected, and its α-amylase gene was cloned and expressed in Escherichia coli by a ligase-independent method. α-Amylase from the recombinant strain was purified to homogeneity by Q-Sepharose anion exchange and Sephacryl S-100 gel filtration chromatographies. The final yield of the enzyme was about 22.5 % of the initial activity, with a 16.4-fold increase in specific activity compared with the culture lysate. The optimum temperature and pH of the enzyme were 70 °C and 6.0, respectively. The enzyme was highly active at acidic-neutral pH range of 4.5-7.0. The amy28 α-amylase retained 100 % of its activity after incubation at 50 °C for 90 min. Co(+2), Cu(2+), Fe(2+), Fe(3+), Ni(+2), and Zn(+2) caused significant inhibition in enzyme activity, which was not affected by Na(+), Mg(2+), Li(+), and Ba(2+). The activity was inhibited about 70 % upon treatment of the enzyme with 10 mM ethylenediaminetetraacetic acid. However, Ca(2+) ions known as high temperature stabilizer for other amylases did not stimulate the activity of the enzyme. Due to pH stability and thermostability of the recombinant amylase, this enzyme may be suitable in starch processing, brewing, and food industries.

  9. Local entropy difference upon a substrate binding of a psychrophilic α-amylase and a mesophilic homologue

    NASA Astrophysics Data System (ADS)

    Kosugi, Takahiro; Hayashi, Shigehiko

    2011-01-01

    Psychrophilic α-amylase from the antarctic bacterium pseudoalteromonashaloplanktis (AHA) and its mesophilic homologue, porcine pancreatic α-amylase (PPA) are theoretically investigated with molecular dynamics (MD) simulations. We carried out 240-ns MD simulations for four systems, AHA and PPA with/without the bound substrate, and examined protein conformational entropy changes upon the substrate binding. We developed an analysis that decomposes the entropy changes into contributions of individual amino acids, and successfully identified protein regions responsible for the entropy changes. The results provide a molecular insight into the structural flexibilities of those enzymes related to the temperature dependences of the enzymatic activity.

  10. Construction of an amylolytic industrial strain of Saccharomyces cerevisiae containing the Schwanniomyces occidentalis alpha-amylase gene.

    PubMed

    Kang, Na-Young; Park, Jeong-Nam; Chin, Jong-Eon; Lee, Hwanghee Blaise; Im, Suhn-Young; Bai, Suk

    2003-11-01

    The gene encoding Schwanniomyces occidentalis alpha-amylase (AMY) was introduced into the chromosomal delta sequences of an industrial strain of Saccharomyces cerevisiae. To obtain a strain suitable for commercial use, an delta-integrative cassette devoid of bacterial DNA sequences was constructed that contains the AMY gene and aureobasidin A resistance gene (AUR1-C) as the selection marker. The AMY gene was expressed under the control of the alcohol dehydrogenase gene promoter (ADC1p). The alpha-amylase activity of Sacc. cerevisiae transformed with this integrative cassette was 6 times higher than that of Sch. occidentalis. The transformants (integrants) were mitotically stable after 100 generations in nonselective medium.

  11. Stable yeast transformants that secrete functional. cap alpha. -amylase encoded by cloned mouse pancreatic cDNA

    SciTech Connect

    Filho, S.A.; Galembeck, E.V.; Faria, J.B.; Frascino, A.C.S.

    1986-04-01

    Mouse pancreatic ..cap alpha..-amylase complementary DNA was inserted into a yeast shuttle vector after the Saccharomyces cerevisiae MF..cap alpha..1 promoter and secretion signals coding sequences. When transformed with the recombinant plasmid, S. cerevisiae cells were able to synthesize and secrete functional ..cap alpha..-amylase, efficiently hydrolyzing starch present in the culture medium. Stable amylolytic cells were obtained from different yeast strains. This work represents a significant step towards producing yeast that can convert starchy materials directly to ethanol.

  12. Quantitative digital image analysis of chromogenic assays for high throughput screening of alpha-amylase mutant libraries.

    PubMed

    Shankar, Manoharan; Priyadharshini, Ramachandran; Gunasekaran, Paramasamy

    2009-08-01

    An image analysis-based method for high throughput screening of an alpha-amylase mutant library using chromogenic assays was developed. Assays were performed in microplates and high resolution images of the assay plates were read using the Virtual Microplate Reader (VMR) script to quantify the concentration of the chromogen. This method is fast and sensitive in quantifying 0.025-0.3 mg starch/ml as well as 0.05-0.75 mg glucose/ml. It was also an effective screening method for improved alpha-amylase activity with a coefficient of variance of 18%.

  13. Inhibition of α-amylase and glucoamylase by tannins extracted from cocoa, pomegranates, cranberries, and grapes.

    PubMed

    Barrett, Ann; Ndou, Tshinanne; Hughey, Christine A; Straut, Christine; Howell, Amy; Dai, Zifei; Kaletunc, Gonul

    2013-02-20

    Proanthocyanidins and ellagitannins, referred to as "tannins", exist in many plant sources. These compounds interact with proteins due to their numerous hydroxyl groups, which are suitable for hydrophobic associations. It was hypothesized that tannins could bind to the digestive enzymes α-amylase and glucoamylase, thereby inhibiting starch hydrolysis. Slowed starch digestion can theoretically increase satiety by modulating glucose "spiking" and depletion that occurs after carbohydrate-rich meals. Tannins were isolated from extracts of pomegranate, cranberry, grape, and cocoa and these isolates tested for effectiveness to inhibit the activity of α-amylase and glucoamylase in vitro. The compositions of the isolates were confirmed by NMR and LC/MS analysis, and tannin-protein interactions were investigated using relevant enzyme assays and differential scanning calorimetry (DSC). The results demonstrated inhibition of each enzyme by each tannin, but with variation in magnitude. In general, larger and more complex tannins, such as those in pomegranate and cranberry, more effectively inhibited the enzymes than did less polymerized cocoa tannins. Interaction of the tannins with the enzymes was confirmed through calorimetric measurements of changes in enzyme thermal stability.

  14. Inhibition of Porcine Pancreatic Amylase Activity by Sulfamethoxazole: Structural and Functional Aspect.

    PubMed

    Maity, Sujan; Mukherjee, Koel; Banerjee, Amrita; Mukherjee, Suman; Dasgupta, Dipak; Gupta, Suvroma

    2016-06-01

    Combating Type-2 diabetes mellitus is a pivotal challenge in front of the present world. Several lines of therapy are in practice for resisting this deadly disease which often culminates with cardiovascular complexities, neuropathy and retinopathy. Among various therapies, administration of alpha glucosidase inhibitors is common and widely practiced. Sulfonylurea category of anti diabetic drug often suffers from cross reactivity with sulfamethoxazole (SMX), a common drug in use to treat a handful of microbial infections. However the specific cellular target generating postprandial hypoglycemia on SMX administration is till date unraveled. The present work has been initiated to elucidate the effects of a group of sulfonamide drugs inclusive of SMX for their amylase inhibitory role. SMX inhibits porcine pancreatic amylase (PPA) in a noncompetitive mode with an average IC50 value 0.94 mM respectively. Interaction of SMX with PPA is manifested with gradual quenching of tryptophan fluorescence with concomitant shift in lambda max value (λmax). Binding is governed by entropy driven factor (24.8 cal mol(-1) K(-1)) with unfavorable contribution from enthalpy change. SMX interferes with the activity of acarbose in a synergistic mode to reduce the effective dose of acarbose as evident from the in vitro PPA inhibition study. In summary, loss of PPA activity in presence of SMX is indicative of structural changes of PPA which is further augmented in the presence of acarbose as explained in the schematic model and docking study.

  15. Alpha amylase assisted synthesis of TiO₂ nanoparticles: structural characterization and application as antibacterial agents.

    PubMed

    Ahmad, Razi; Mohsin, Mohd; Ahmad, Tokeer; Sardar, Meryam

    2015-01-01

    The enzyme alpha amylase was used as the sole reducing and capping agent for the synthesis of TiO2 nanoparticles. The biosynthesized nanoparticles were characterized by X-ray diffraction (XRD) and transmission electron microscopic (TEM) methods. The XRD data confirms the monophasic crystalline nature of the nanoparticles formed. TEM data shows that the morphology of nanoparticles depends upon the enzyme concentration used at the time of synthesis. The presence of alpha amylase on TiO2 nanoparticles was confirmed by FTIR. The nanoparticles were investigated for their antibacterial effect on Staphylococcus aureus and Escherichia coli. The minimum inhibitory concentration value of the TiO2 nanoparticles was found to be 62.50 μg/ml for both the bacterial strains. The inhibition was further confirmed using disc diffusion assay. It is evident from the zone of inhibition that TiO2 nanoparticles possess potent bactericidal activity. Further, growth curve study shows effect of inhibitory concentration of TiO2 nanoparticles against S. aureus and E. coli. Confocal microscopy and TEM investigation confirm that nanoparticles were disrupting the bacterial cell wall.

  16. Production of Chimeric Acidic α-Amylase by the Recombinant Pichia pastoris and Its Applications

    PubMed Central

    Parashar, Deepak; Satyanarayana, Tulasi

    2017-01-01

    Recombinant chimeric α-amylase (Ba-Gt-amy) has been produced extracellularly in Pichia pastoris under AOX promoter. Clones of P. pastoris with multiple gene copies have been generated by multiple transformations and post-transformational vector amplification, which led to 10.7-fold enhancement in α-amylase titre as compared to a clone with a copy of the gene. The recombinant P. pastoris integrated eight copies of Ba-Gt-amy in the genome of P. pastoris, as revealed by real time PCR data analysis. Heterologous protein expression as well as mRNA level of Ba-Gt-amy was higher in multi-copy clone than that with single copy. The pure Ba-Gt-amy expressed in P. pastoris is a glycoprotein of 75 kDa, which is optimally active at pH 4.0 and 60°C with T1/2 of 40 min at 70°C. The Kinetic parameters and end product analysis suggested that glycosylation has no effect on catalytic properties of Ba-Gt-amy. The enzyme saccharifies soluble as well as raw starches efficiently and generates maltose and maltooligosaccharides, thus, useful in baking and sugar syrup industries. The strategy for generating multi-copy clones is being reported for the first time, which could be useful in enhancing the production of other recombinant proteins. PMID:28382032

  17. A comparison of ghrelin, glucose, alpha-amylase and protein levels in saliva from diabetics.

    PubMed

    Aydin, Suleyman

    2007-01-31

    During the past decade, many salivary parameters have been used to characterize disease states. Ghrelin (GAH) is recently-discovered peptide hormone secreted mainly from the stomach but also produced in a number of other tissues including salivary glands. The aim of this work was to examine the relationship between active (aGAH) and inactive (dGAH) ghrelin in the saliva and other salivary parameters in type II diabetic patients and healthy controls. Salivary parameters were assessed in a single measurement of unstimulated whole saliva from 20 obese and 20 non-obese type II diabetes patients, and in 22 healthy controls. Total protein and alpha-amylase were determined by colorimetric methods, and glucose by the glucose-oxidase method. Saliva aGAH and dGAH levels were measured using a commercial radioimmunoassay (RIA) kit. Salivary concentrations of aGAH and dGAH ghrelin were more markedly decreased in obese diabetic subjects than in the two other groups. Glucose and alpha-amylase levels were higher in diabetic subjects than in controls. Furthermore, there were correlations between GAH levels and BMI, and between GAH and blood pressure. However, there was no marked variability in saliva flow rates among the groups. These results indicate that measurement of salivary GAH and its relationship to other salivary parameters might help to provide insight into the role of ghrelin in diabetes.

  18. Bean amylase inhibitor and other carbohydrate absorption blockers: effects on diabesity and general health.

    PubMed

    Preuss, Harry G

    2009-06-01

    Many believe that excessive intake of refined carbohydrates (CHO) plays a major role in the development of obesity/overweight, type 2 diabetes mellitus and insulin resistance, a collection of events commonly referred to as "diabesity," and have sought natural means to overcome these linked perturbations. As a first approach, planned diets with low portions of refined CHO have become popular. However, these diets do not satisfy everyone; and many are concerned over replacing CHO with more fats. As a second option, addition of soluble fiber to the diet can slow absorption of refined CHO, i.e., lower the glycemic index of foods and overcome or at least ameliorate many of the adverse reactions resulting from increased refined CHO ingestion. Unfortunately, the general public does not favor diets high in fiber content, and various fibers can lead to gastrointestinal problems such as gas and diarrhea. A third choice to favorably influence CHO absorption is to use natural dietary supplements that block or slow CHO absorption in the gastrointestinal tract via inhibiting enzymes necessary for CHO absorption -amylase and alpha-glucosidases. Although a number of natural supplements with anti-amylase activity have been recognized, the most studied and favored one is white kidney bean extract. Animal and human studies clearly show that this agent works in vivo and has clinical utility. This paper reviews many aspects of diabesity and the use of "carb blockers" to prevent and ameliorate the situation. In many respects, carb blockers mimic the beneficial effects of fibers.

  19. Population Genetics of Drosophila Amylase. II. Geographic Patterns in D. PSEUDOOBSCURA

    PubMed Central

    Powell, Jeffrey R.

    1979-01-01

    Morph frequencies of three related polymorphisms were determined in ten natural populations of Drosophila pseudoobscura. They are the well-known inversion polymorphism of the third chromosome and the polymorphism for α-amylase produced by the structural gene Amy (which resides on the third chromosome). The third polymorphism was for tissue-specific expression of Amy in adult midguts; a total of 13 different patterns of activity have been observed. The preceding paper (Powell and Lichtenfels 1979) reports evidence that the variation in Amy expression is under polygenic control. Here we show that the polymorphism for midgut activity patterns occurs in natural populations and is not an artifact of laboratory rearing.—From population to population, Amy allele freuencies and frequencies of inversions belonging to different phylads vary coordinately. The geographic variation in α-amylase midgut activity patterns is uncorrelated with that for the other two types of polymorphisms. Furthermore, no correlation was detected between activity pattern(s) and Amy genotype(s) when both were assayed in the same individual.—These results imply that whatever the evolutionary-ecological forces are that control frequencies of the structural gene variants, they are not the same factors that control the frequencies of polymorphic genetic factors responsible for the tissue-specific expression of the enzyme. PMID:488707

  20. Characterization of commercial amylases for the removal of filter cake on petroleum wells.

    PubMed

    Kyaw, Nattascha; de Mesquita, Rafael Fonseca; Kameda, Etel; Neto, João Crisósthomo de Queiroz; Langone, Marta Antunes Pereira; Coelho, Maria Alice Zarur

    2010-05-01

    Drilling fluid has many functions, such as carry cuttings from the hole permitting their separation at the surface, cool and clean the bit, reduce friction between the drill pipe and wellbore, maintain the stability of the wellbore, and prevent the inflow of fluids from the wellbore and form a thin, low-permeable filter cake. Filter cake removal is an important step concerning both production and injection in wells, mainly concerning horizontal completion. The drilling fluids are typically comprised of starch, the most important component of the filter cake. A common approach to remove this filter cake is the use of acid solutions. However, these are non-specific reactants. A possible alternative is the use of enzymatic preparations, like amylases, that are able to hydrolyze starch. Wells usually operate in drastic conditions for enzymatic preparations, such as high temperature, high salt concentration, and high pressure. Thus, the main objective of this work was to characterize four enzymatic preparations for filter cake removal under open hole conditions. The results showed that high salt concentrations (204,000 ppm NaCl) in completion fluid decreased amylolytic activity. All enzymatic preparations were able to catalyze starch hydrolysis at all temperatures tested (30, 65, 80, and 95 degrees C). An increase of amylolytic activity was observed with the increase of pressure (100, 500 and 1,000 psi) for one commercial amylase.