Science.gov

Sample records for amylase

  1. Amylase - urine

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003607.htm Amylase - urine To use the sharing features on this ... is a test that measures the amount of amylase in urine. Amylase is an enzyme that helps ...

  2. Amylase Test

    MedlinePlus

    ... AACC products and services. Advertising & Sponsorship: Policy | Opportunities Amylase Share this page: Was this page helpful? Also known as: Amy Formal name: Amylase Related tests: Lipase , Trypsin , Trypsinogen At a Glance ...

  3. Amylase - blood

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003464.htm Amylase - blood To use the sharing features on this page, please enable JavaScript. Amylase is an enzyme that helps digest carbohydrates. It ...

  4. Advances in microbial amylases.

    PubMed

    Pandey, A; Nigam, P; Soccol, C R; Soccol, V T; Singh, D; Mohan, R

    2000-04-01

    This review makes a comprehensive survey of microbial amylases, i.e. alpha-amylase, beta-amylase and glucoamylase. Amylases are among the most important enzymes and are of great significance in present-day biotechnology. Although they can be derived from several sources, such as plants, animals and micro-organisms, the enzymes from microbial sources generally meet industrial demands. Microbial amylases could be potentially useful in the pharmaceutical and fine-chemical industries if enzymes with suitable properties could be prepared. With the advent of new frontiers in biotechnology, the spectrum of amylase application has widened in many other fields, such as clinical, medicinal and analytical chemistries, as well as their widespread application in starch saccharification and in the textile, food, brewing and distilling industries. In this review, after a brief description of the sources of amylases, we discuss the molecular biology of amylases, describing structures, cloning, sequences, and protoplast fusion and mutagenesis. This is followed by sections on their production and finally the properties of various amylases.

  5. Detergent-compatible bacterial amylases.

    PubMed

    Niyonzima, Francois N; More, Sunil S

    2014-10-01

    Proteases, lipases, amylases, and cellulases are enzymes used in detergent formulation to improve the detergency. The amylases are specifically supplemented to the detergent to digest starchy stains. Most of the solid and liquid detergents that are currently manufactured contain alkaline enzymes. The advantages of using alkaline enzymes in the detergent formulation are that they aid in removing tough stains and the process is environmentally friendly since they reduce the use of toxic detergent ingredients. Amylases active at low temperature are preferred as the energy consumption gets reduced, and the whole process becomes cost-effective. Most microbial alkaline amylases are used as detergent ingredients. Various reviews report on the production, purification, characterization, and application of amylases in different industry sectors, but there is no specific review on bacterial or fungal alkaline amylases or detergent-compatible amylases. In this mini-review, an overview on the production and property studies of the detergent bacterial amylases is given, and the stability and compatibility of the alkaline bacterial amylases in the presence of the detergents and the detergent components are highlighted.

  6. Acyclic peptide inhibitors of amylases.

    PubMed

    Pohl, Nicola

    2005-12-01

    In this issue of Chemistry and Biology, a library screening approach reveals a linear octapeptide inhibitor of alpha-amylases reached by de novo design . The selected molecule shares characteristics with naturally occurring protein inhibitors -- a result that suggests general rules for the design of peptide-based amylase inhibitors may be achievable.

  7. [Advances of alkaline amylase production and applications].

    PubMed

    Yang, Haiquan; Liu, Long; Li, Jianghua; Du, Guocheng; Chen, Jian

    2012-04-01

    Alkaline amylase is one of alkaline enzymes with optimum pH in the alkaline range, and it could keep stability and efficiently hydrolyze starch under alkaline conditions. Alkaline amylase finds wide applications in textile, detergent, pharmaceutical, food and other fields. Alkaline amylases could be produced by alkaliphilic microorganisms. In this work, the advances of alkaline amylase production and applications were reviewed.

  8. Marine Microbial Amylases: Properties and Applications.

    PubMed

    Suriya, J; Bharathiraja, S; Krishnan, M; Manivasagan, P; Kim, S-K

    Amylases are crucial enzymes which hydrolyze internal glycosidic linkages in starch and produce as primary products dextrins and oligosaccharides. Amylases are classified into α-amylase, β-amylase, and glucoamylase based on their three-dimensional structures, reaction mechanisms, and amino acid sequences. Amylases have innumerable applications in clinical, medical, and analytical chemistries as well as in food, detergent, textile, brewing, and distilling industries. Amylases can be produced from plants, animals, and microbial sources. Due to the advantages in microbial production, it meets commercial needs. The pervasive nature, easy production, and wide range of applications make amylase an industrially pivotal enzyme. This chapter will focus on amylases found in marine microorganisms, their potential industrial applications, and how these enzymes can be improved to the required bioprocessing conditions. © 2016 Elsevier Inc. All rights reserved.

  9. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  10. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  11. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  12. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Amylase test system. 862.1070 Section 862.1070....1070 Amylase test system. (a) Identification. An amylase test system is a device intended to measure the activity of the enzyme amylase in serum and urine. Amylase measurements are used primarily for...

  13. Concerted evolution of human amylase genes

    SciTech Connect

    Gumucio, D.L.; Wiebauer, K.; Caldwell, R.M.; Samuelson, L.C.; Meisler, M.H.

    1988-03-01

    Cosmid clones containing 250 kilobases of genomic DNA from the human amylase gene cluster have been isolated. These clones contain seven distinct amylase genes which appear to comprise the complete multigene family. By sequence comparison with the cDNAs, the authors have identified two pancreatic amylase gene and three salivary amylase genes. Two truncated pseudogenes were also recovered. Intergenic distances of 17 to 22 kilobases separate the amylase gene copies. Within the past 10 million years, duplications, gene conversion, and unequal crossover events have resulted in a very high level of sequence similarity among human amylase gene copies. To identify sequence elements involved in tissue-specific expression and hormonal regulation, the promoter regions of the human amylase genes were sequenced and compared with those of the corresponding mouse genes. The promoters of the human and mouse pancreatic amylase genes are highly homologous between nucleotide - 160 and the cap site. Two sequence elements througth to influence pancreas-specific expression of the rodent genes are present in the human genes. In contrast, similarity in the 5' lanking sequences of the salivary amylase genes is limited to several short sequence elements whose positions and orientations differ in the two species. Some of these sequence elements are also associated with other parotid-specific genes and may be involved in their tissue-specific expression. A glucocorticoid response element and a general enhancer element are closely associated in several of the amylase promoters.

  14. Salivary Amylase: Digestion and Metabolic Syndrome.

    PubMed

    Peyrot des Gachons, Catherine; Breslin, Paul A S

    2016-10-01

    Salivary amylase is a glucose-polymer cleavage enzyme that is produced by the salivary glands. It comprises a small portion of the total amylase excreted, which is mostly made by the pancreas. Amylases digest starch into smaller molecules, ultimately yielding maltose, which in turn is cleaved into two glucose molecules by maltase. Starch comprises a significant portion of the typical human diet for most nationalities. Given that salivary amylase is such a small portion of total amylase, it is unclear why it exists and whether it conveys an evolutionary advantage when ingesting starch. This review will consider the impact of salivary amylase on oral perception, nutrient signaling, anticipatory metabolic reflexes, blood sugar, and its clinical implications for preventing metabolic syndrome and obesity.

  15. Immunochemical Studies on α-Amylase III. Immunochemical Relationships Among Amylases from Various Microorganisms1

    PubMed Central

    Sirisinha, Stitaya; Allen, Peter Z.

    1965-01-01

    Sirishinha, Stitaya (University of Rochester School of Medicine and Dentistry, Rochester, N.Y.), and Peter Z. Allen. Immunochemical studies on α-amylase. III. Immunochemical relationships among amylases from various microorganisms. J. Bacteriol. 90:1120–1128. 1965.—Immunochemical relationships among amylases obtained from a selected group of microorganisms were examined, and a cross-reaction was detected between the α-amylases of Bacillus stearothermophilus and B. subtilis. Immunodiffusion and quantitative precipitin studies, as well as cross-neutralization tests, indicate that B. stearothermophilus α-amylase reacts with a portion of antibody present in antisera to crystalline B. subtilis α-amylase. Amylases from these two species thus have some aspects of structure in common. Limited data obtained by immunodiffusion suggest that groupings which confer cross-reactivity to the B. stearothermophilus enzyme are lost after exposure to mercaptoethanol in the presence of ethylenediamine-tetraacetate, followed by treatment with iodoacetamide. With the antisera employed and within the concentration range examined, no immunochemical cross-reaction was observed among amylases from Aspergillus oryzae, B. subtilis, B. polymyxa, B. macerans, Pseudomonas saccharophila, and Euglena sanguinis. Immunoelectrophoresis of partially purified B. stearothermophilus α-amylase by use of antiserum to the crude enzyme, together with localization of amylase activity in immunoelectrophoretic plates, suggests that B. stearothermophilus α-amylase is antigenic in the rabbit. Images PMID:5847799

  16. Exercise upregulates salivary amylase in humans (Review)

    PubMed Central

    KOIBUCHI, ERI; SUZUKI, YOSHIO

    2014-01-01

    The secretion of salivary α-amylase is influenced by adrenergic regulation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis; thus, exercise affects the levels of salivary α-amylase. Granger et al published a review in 2007 that focused attention on salivary α-amylase. In addition, a portable system for monitoring salivary α-amylase activity was launched in Japan at the end of 2005. The correlation between exercise and salivary α-amylase has since been extensively investigated. The present review summarizes relevant studies published in the English and Japanese literature after 2006. A search of the PubMed and CiNii databases identified 54 articles, from which 15 original articles were selected. The findings described in these publications indicate that exercise consistently increases mean salivary α-amylase activities and concentrations, particularly at an intensity of >70% VO2max in healthy young individuals. Thus, these studies have confirmed that salivary α-amylase levels markedly increase in response to physical stress. Salivary α-amylase levels may therefore serve as an effective indicator in the non-invasive assessment of physical stress. PMID:24669232

  17. Amylase activity in substrate deficiency aerobic granules.

    PubMed

    Lee, Chuen-Chi; Lee, Duu-Jong; Lai, Juin-Yih

    2009-01-01

    Immunohistochemical staining was applied together with the multicolor fluorescent scheme to demonstrate the amylase activity for polysaccharide hydrolysis in stored or starved aerobic granules that are in substrate deficiency. If sufficient nutrients were present, alpha-amylase and beta-amylase were found close to the surface layer of the original granules. Following storage or starvation during which most external nutrients were depleted, the alpha-amylase and beta-amylase were distributed over the entire granule interior, suggesting endogenous respiration at the core of the granule. In particular, the fluorescent intensities of alpha-amylase and beta-amylase were enriched 5-20 microm from the edge of the internal cavity, suggesting the strong correlation between polysaccharide hydrolysis and the formation of interior cavities. The secreted amylase was located near the living cells, suggesting that the polysaccharide hydrolysis is restricted to local environment that occurs near the functional strains. Internal hydrolysis within the core, for the case of both proteins and polysaccharides should correspond in principle to the loss of granule stability.

  18. [The polymorphism of alpha-amylase].

    PubMed

    Baltova, S; Popov, K; Kynchev, V

    1990-01-01

    Individual phenotypes, phenotypic and genetic frequencies of alpha-amylase enzyme were determined by means of population genetic study. The results of this study revealed absence of genetic linkage between alpha-amylase phenotypes, haptoglobins and serum factor G1m(1) of gammaglobulin system (Gm).

  19. Production of alpha-amylase by yeast

    SciTech Connect

    Thomse, K.K.

    1987-01-01

    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  20. Clinical applications of amylase: Novel perspectives.

    PubMed

    Azzopardi, Ernest; Lloyd, Catherine; Teixeira, Sofia Rodrigues; Conlan, R Steven; Whitaker, Iain S

    2016-07-01

    Amylase was the first enzyme to be characterized, and for the previous 200 years, its clinical role has been restricted to a diagnostic aid. Recent interface research has led to a substantial expansion of its role into novel, viable diagnostic, and therapeutic applications to cancer, infection, and wound healing. This review provides a concise "state-of-the-art" overview of the genetics, structure, distribution, and localization of amylase in humans. A first-generation literature search was performed with the MeSH search string "Amylase AND (diagnost∗ OR therapeut$)" on OVIDSP and PUBMED platforms. A second-generation search was then performed by forward and backward referencing on Web of Knowledge™ and manual indexing, limited to the English Language. "State of the Art" in amylase genetics, structure, function distribution, localisation and detection of amylase in humans is provided. To the 4 classic patterns of hyperamylasemia (pancreatic, salivary, macroamylasemia, and combinations) a fifth, the localized targeting of amylase to specific foci of infection, is proposed. The implications are directed at novel therapeutic and diagnostic clinical applications of amylase such as the novel therapeutic drug classes capable of targeted delivery and "smart release" in areas of clinical need. Future directions of research in areas of high clinical benefit are reported. Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.

  1. Characterization of recombinant β-amylases from Oryza sativa.

    PubMed

    Koide, Tomojiro; Ohnishi, Yasuo; Horinouchi, Sueharu

    2011-01-01

    Four putative β-amylase genes found in the Oryza sativa cDNA sequence database (KOME) were expressed in Escherichia coli. Recombinant proteins from two of these genes showed β-amylase activity. Similarly to β-amylases from other plants, the optimum pH of the recombinant rice β-amylases was about 5.5-6.0, but they exhibited inferior heat stability to soybean β-amylase.

  2. Biotechnological Processes in Microbial Amylase Production

    PubMed Central

    Arshad, M. K. Md; Lakshmipriya, Thangavel; Hashim, Uda; Chinni, Suresh V.

    2017-01-01

    Amylase is an important and indispensable enzyme that plays a pivotal role in the field of biotechnology. It is produced mainly from microbial sources and is used in many industries. Industrial sectors with top-down and bottom-up approaches are currently focusing on improving microbial amylase production levels by implementing bioengineering technologies. The further support of energy consumption studies, such as those on thermodynamics, pinch technology, and environment-friendly technologies, has hastened the large-scale production of the enzyme. Herein, the importance of microbial (bacteria and fungi) amylase is discussed along with its production methods from the laboratory to industrial scales. PMID:28280725

  3. Differential Heat Stabilities of Bacillus Amylases

    PubMed Central

    Bliesmer, Barry O.; Hartman, Paul A.

    1973-01-01

    Seventeen cultures representing eight strains of Bacillus coagulans and twelve cultures representing eight strains of Bacillus stearothermophilus did not yield a culture that would produce amylase at both 37 and 55 C. PMID:4688668

  4. Some aspects of the mechanism of complexation of red kidney bean alpha-amylase inhibitor and alpha-amylase.

    PubMed

    Wilcox, E R; Whitaker, J R

    1984-04-10

    Bovine pancreatic alpha-amylase binds 1 mol of acarbose (a carbohydrate alpha-amylase inhibitor) per mol at the active site and also binds acarbose nonspecifically. The red kidney bean alpha-amylase inhibitor-bovine pancreatic alpha-amylase complex retained nonspecific binding for acarbose only. Binding of p-nitrophenyl alpha-D-maltoside to the final complex of red kidney bean alpha-amylase inhibitor and bovine pancreatic alpha-amylase has a beta Ks (Ks') value that is 3.4-fold greater than the Ks (16 mM) of alpha-amylase for p-nitrophenyl alpha-D-maltoside alone. The initial complex of alpha-amylase and inhibitor apparently hydrolyzes this substrate as rapidly as alpha-amylase alone. The complex retains affinity for substrates and competitive inhibitors, which, when present in high concentrations, cause dissociation of the complex. Maltose (0.5 M), a competitive inhibitor of alpha-amylase, caused dissociation of the red kidney bean alpha-amylase inhibitor--alpha-amylase complex. Interaction between red kidney bean (Phaseolus vulgaris) alpha-amylase inhibitor and porcine pancreatic alpha-amylase proceeds through two steps. The first step has a Keq of 3.1 X 10(-5) M. The second step (unimolecular; first order) has a forward rate constant of 3.05 min-1 at pH 6.9 and 30 degrees C. alpha-Amylase inhibitor combines with alpha-amylase, in the presence of p-nitrophenyl alpha-D-maltoside, noncompetitively. On the basis of the data presented, it is likely that alpha-amylase is inactivated by the alpha-amylase inhibitor through a conformational change. A kinetic model, in the presence and absence of substrate, is described for noncompetitive, slow, tight-binding inhibitors that proceed through two steps.

  5. Immunohistochemical analysis of amylase isoenzymes in thyroid cancer.

    PubMed Central

    Higashiyama, M; Doi, S; Tomita, N; Monden, T; Murotani, M; Kawasaki, Y; Kobayashi, T; Shimano, T; Ogawa, M; Takai, S

    1991-01-01

    The expression of amylase in various histological types of thyroid cancer was studied by an immunohistochemical technique, using a polyclonal antiamylase antiserum and two monoclonal antibodies specific for salivary and pancreatic-type amylases, respectively. Amylase was expressed in 21 of 24 (88%) thyroid cancers by polyclonal antiserum analysis. Analysis by monoclonal antibodies, however, showed that only 13 (54%) cases and three (13%) cases contained salivary-type and pancreatic-type amylases, respectively. Moreover, immunoreactivity for pancreatic-type amylase was detected only in medullary carcinoma; other histological types were positive for salivary-type amylase. These results show that thyroid cancer frequently expresses amylase, and suggest that the differences between amylase isoenzymes in thyroid cancer may correlate with those found between cellular origin of tumour. Images PMID:1713922

  6. Susceptibility to corrosion of laser welding composite arch wire in artificial saliva of salivary amylase and pancreatic amylase.

    PubMed

    Zhang, Chao; Liu, Jiming; Yu, Wenwen; Sun, Daqian; Sun, Xinhua

    2015-10-01

    In this study, laser-welded composite arch wire (CAW) with a copper interlayer was exposed to artificial saliva containing salivary amylase or pancreatic amylase, and the resultant corrosion behavior was studied. The purpose was to determine the mechanisms by which salivary amylase and pancreatic amylase contribute to corrosion. The effects of amylase on the electrochemical resistance of CAW were tested by potentiodynamic polarization measurements. The dissolved corrosion products were determined by ICP-OES, and the surfaces were analyzed by SEM, AFM and EDS. The results showed that both exposure to salivary amylase and pancreatic amylase significantly improved the corrosion resistance of CAW. Even isozyme could have different influences on the alloy surface. When performing in vitro research of materials to be used in oral cavity, the effect of α-amylase should be taken into account since a simple saline solution does not entirely simulate the physiological situation. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. [Microbe amylases: characteristic, properties and practical use].

    PubMed

    Kubrak, O I; Lushchak, V I

    2007-01-01

    Current data concerning structure, properties and methods of purification ofmicrobial amylolytic enzymes are summarized in this paper. A short characteristic of the main methods of amylase activity measuring is presented, the advantages and disadvantages of each method are shown. It is proposed that novel techniques of enzyme immobilization stabilize the structure of amylases and allow their multiple uses. Scientific interest to amylases is analyzed that is explained by a number of their unique properties such as thermostability and pH-tolerance. Authors have demonstrated some examples of the practical using ofamylases in different fields of industry: textile, paper, food industries, brewing and wine-making. The prospects of their possible using in detergent preparing for laundries and dishwashers are presented. It is supposed that future investigations in this trend for isolating new amrnylases from native producers will be developed.

  8. Properties of Thermosensitive Extracellular α-Amylases of Bacillus subtilis

    PubMed Central

    Yamane, Kunio; Maruo, Bunji

    1974-01-01

    Enzymological properties of four thermosensitive α-amylases (M3, M9, M18, and M20) brought by different mutation sites in α-amylase structural gene of Bacillus subtilis were compared with those of the parental α-amylase NA64. Two thermosensitive α-amylases (M9 and M20) were altered not only in their thermosensitivity but also in their immunological properties, catalytic properties, molecular weights determined by the gel filtration on a Bio-Gel P-100 column, and others. The other two thermosensitive α-amylases (M3 and M18) were altered only in their thermosensitivity. Images PMID:4218234

  9. Amylases and Their Importance during Glycan Degradation: Genome Sequence Release of Salmonella Amylase Knockout Strains.

    PubMed

    Arabyan, Narine; Huang, Bihua C; Weimer, Bart C

    2017-05-18

    Amylases catalyze the cleavage of α-d-1,4 and α-d-1,6-glycosidic bonds in starch and related carbohydrates. Amylases are widely distributed in nature and are important in carbohydrate metabolism. This is the release of four single and two double deletions in Salmonella enterica serovar Typhimurium LT2 that are important for glycan degradation during infection. Copyright © 2017 Arabyan et al.

  10. Detection of pulmonary amylase activity in exhaled breath condensate.

    PubMed

    Zweifel, M; Rechsteiner, T; Hofer, M; Boehler, A

    2013-12-01

    Amylase activity in exhaled breath condensate (EBC) is usually interpreted as an indication of oropharyngeal contamination despite the fact that amylase can be found in pulmonary excretions. The aim of this study was to recruit and refine an amylase assay in order to detect amylase activity in any EBC sample and to develop a method to identify EBC samples containing amylase of pulmonary origin. EBC was collected from 40 volunteers with an EcoScreen condenser. Amylase assays and methods to discriminate between oropharyngeal and pulmonary proteins were tested and developed using matched EBC and saliva samples. Our refined 2-chloro-4-nitrophenyl-α-D-maltotriosid (CNP-G3) assay was 40-fold more sensitive than the most sensitive commercial assay and allowed detection of amylase activity in 30 µl of EBC. We developed a dot-blot assay which allowed detection of salivary protein in saliva diluted up to 150 000-fold. By plotting amylase activity against staining intensity we identified a few EBC samples with high amylase activity which were aligned with diluted saliva. We believe that EBC samples aligned with diluted saliva contain amylase activity introduced during EBC collection and that all other EBC samples contain amylase activity of pulmonary origin and are basically free of oropharyngeal protein contamination.

  11. Influence of amylase assay technique on renal clearance of amylase-creatinine ratio.

    PubMed

    Levitt, M D; Johnson, S G; Ellis, C J; Engel, R R

    1977-06-01

    The influence of amylase assay technique on the renal amylase/creatinine clearance measurement was determined by analysis of serum and urine specimens obtained from 10 normal subjects. CAm/CCr averaged 2.19 +/- 0.18% with a saccharogenic technique, 1.52 +/- 0.2% with an iodometric technique, and 0.80 +/- 0.08% with a chromogenic technique. Each of these values differed significantly (P less than 0.05) from the other two. Recovery studies were carried out by adding partially purified human salivary or pancreatic amylase to human newborn serum or urine (which contain minimal endogenous amylase). Equal amylase activity was recovered from serum and urine by the saccharogenic technique whereas recovery from urine was less than 50% of that from serum using the iodometric and chromogenic techniques. The accuracy of the chromogenic technique is markedly improved by the addition of albumin to the urine assay system. Although it appears that only the saccharogenic method provides an accurate estimate of CAm/CCr, each assay technique distinguished the elevated CAm/CCr of patients with pancreatitis from the normal range established for that technique. Accurate clinical interpretation of CAm/CCr measurment requires knowledge of the amylase assay technique used.

  12. Expression of β-Amylase from Alfalfa Taproots1

    PubMed Central

    Gana, Joyce A.; Kalengamaliro, Newton E.; Cunningham, Suzanne M.; Volenec, Jeffrey J.

    1998-01-01

    Alfalfa (Medicago sativa L.) roots contain large quantities of β-amylase, but little is known about its role in vivo. We studied this by isolating a β-amylase cDNA and by examining signals that affect its expression. The β-amylase cDNA encoded a 55.95-kD polypeptide with a deduced amino acid sequence showing high similarity to other plant β-amylases. Starch concentrations, β-amylase activities, and β-amylase mRNA levels were measured in roots of alfalfa after defoliation, in suspension-cultured cells incubated in sucrose-rich or -deprived media, and in roots of cold-acclimated germ plasms. Starch levels, β-amylase activities, and β-amylase transcripts were reduced significantly in roots of defoliated plants and in sucrose-deprived cell cultures. β-Amylase transcript was high in roots of intact plants but could not be detected 2 to 8 d after defoliation. β-Amylase transcript levels increased in roots between September and October and then declined 10-fold in November and December after shoots were killed by frost. Alfalfa roots contain greater β-amylase transcript levels compared with roots of sweetclover (Melilotus officinalis L.), red clover (Trifolium pratense L.), and birdsfoot trefoil (Lotus corniculatus L.). Southern analysis indicated that β-amylase is present as a multigene family in alfalfa. Our results show no clear association between β-amylase activity or transcript abundance and starch hydrolysis in alfalfa roots. The great abundance of β-amylase and its unexpected patterns of gene expression and protein accumulation support our current belief that this protein serves a storage function in roots of this perennial species. PMID:9847126

  13. Screening of marine actinobacteria for amylase enzymes inhibitors.

    PubMed

    Raja, S; Ganesan, S; Sivakumar, K; Thangaradjou, T

    2010-06-01

    Amylase inhibitor producing actinobacteria were isolated and characterized from terrestrial environment and there is no much report found from marine environment, hence in the present study, 17 strains isolated from the rhizosphere sediments of mangroves were tested for their amylase inhibition ability. Seawater requirement test for the growth of actinobacteria found that the strains SSR-3, SSR-12 and SSR-16 requires at least 50% and SSR-6 requires at least 25% seawater for their growth. The inhibition activity of both prokaryotic and eukaryotic amylase was tested by using Bacillus subtilis and Aspergillus niger. The maximum amylase activity (40mm) produced by the A. niger was taken as positive control, when the test actinobacteria strains grown in the medium they inhibited amylase activity and was evidenced by the reduction in inhibition zone (14-37 mm) similarly the amylase produced by the Bacillus subtilis was also recorded maximum (35 mm) amylase activity and was taken as positive control, and the test atinobacterial strains reduced enzyme action(12-33 mm) it varied levals. This indicates that the actinobacteria strains were controlled amylase enzyme activity in both the cases. The strain SSR-10 was highly effective and SSR-8 was less effective in inhibiting eukaryotic amylase produced by A. niger. The strain SSR-2 was effective and SSR-6 showed very less effect in inhibiting the prokaryotic amylase produced by the B subtilis.

  14. Characterization and Optimization of Amylase Production in WangLB, a High Amylase-Producing Strain of Bacillus.

    PubMed

    Wang, Shihui; Jeyaseelan, Jenasia; Liu, Yun; Qin, Wensheng

    2016-09-01

    The costs of amylase represent ca. 24 % of the expenditures in the starch industry and an increase in amylase production and/or activity will greatly cut down on production costs. In the present study, we obtained a high amylase-producing strain of bacteria, WangLB, and identified it as a member of the Bacillus genus based on 16S rDNA analysis. The fermentation conditions for amylase production in the strain were optimized, and the maximum amylase activity we obtained was 26,670 ± 1390 U/mL, under the optimized conditions of 48-h incubation in liquid starch medium, 35 °C, pH 10, 1 % v/v inoculum concentration, 20 g/L starch concentration, and 0.1 % w/v peptone. The influences of 16 small organic inducers on amylase production were tested, and the results showed that 20 mmol/L alanine greatly enhanced amylase production to 290 % of the baseline level. We also conducted an amylase enzymology analysis. The molecular weight of the amylase was 55 kD, determined by SDS-PAGE. The optimum temperature and pH for the amylase were 55 °C and pH 9, respectively. The enzyme also showed high activity over a wide range of temperatures (50-85 °C) and pH values (3-10), and the activity of the amylase was Ca(2+) independent. The kinetic parameters K m and V max were 0.37 ± 0.02 mg/mL and 233 U/mg, respectively. Finally, the amylase was applied to the hydrolysis of five different brands of starch. It was found that the hydrolyzability of the substrate by amylase increased along with starch solubility.

  15. Effect of tetracycline administration on serum amylase activity in calves.

    PubMed

    Zendehbad, Bamdad; Alipour, Adeleh; Zendehbad, Hussein

    2013-01-01

    Tetracycline and related compounds are used extensively as broad spectrum antibiotics in the treatment of bacterial infections in ruminants. Tetracycline may cause acute pancreatitis which may result in increased serum amylase activity. However, it has been shown that administration of oxytetracycline in human results in decrease serum amylase activity. In this study changes in serum amylase activity were measured in 20 clinically healthy calves following intravenous injection of oxytetracycline hydrochloride at 10 mg/kg of body weight. Blood samples were collected at 30, 60, and 120 minutes after oxytetracycline injection. Serum amylase activity was measured using the amyloclastic assay. The activity of serum amylase was increased significantly (P < 0.05) at 30 (40.5%), 60 (35.1%), and 120 (39.3%) minutes after oxytetracycline hydrochloride administration. To the authors' knowledge this is the first study on the acute effect of tetracycline administration on serum amylase activity in calves.

  16. Bakers' asthma caused by alpha amylase.

    PubMed

    Valdivieso, R; Subiza, J; Subiza, J L; Hinojosa, M; de Carlos, E; Subiza, E

    1994-10-01

    Two bakers with bronchial asthma and two with rhinoconjunctivitis are described. Prick and RAST tests were positive with wheat flour in all of them, but the challenge test (nasal or bronchial) with wheat flour extract was positive only in one asthmatic baker. The prick test, RAST, and nasal or bronchial challenge done with alpha amylase extract (a glycolytic enzyme obtained from Aspergillus oryzae and used as a flour additive) were positive in all four patients. Our results support previous data indicating that alpha amylase used in bakeries is an important antigen that could cause respiratory allergy in bakers. It can function as sole causative allergen or in addition with other allergens used in the baking industry.

  17. Carbodiimide for Covalent α-Amylase Immobilization onto Magnetic Nanoparticles

    NASA Astrophysics Data System (ADS)

    Milani, Zeinab Mortazavi; Jalal, Razieh; Goharshadi, Elaheh K.

    Covalent cross-linking of enzymes to magnetite (Fe3O4) nanoparticles (MNPs) is one of the useful enzyme immobilization methods which provides repeated use of the catalyst, facilitates enzyme separation from the reaction mixture, and sometimes improves biocatalysts stability. The aim of this study was to immobilize α-amylase onto MNPs via covalent attachment using carbodiimide (CDI) molecules. MNPs were synthesized by the co-precipitation method. The size and the structure of the particles were characterized by X-ray diffraction and transmission electron microscopy. The effects of different operational conditions of direct α-amylase binding on MNPs in the presence of CDI were investigated by using the shaking method. Fourier transform infrared spectroscopy was used to confirm the success of immobilization. The optimum conditions and catalytic properties of immobilized α-amylase were also evaluated. The efficiency of immobilization and the residual activity of the immobilized α-amylase were dependent on the mass ratio of MNPs: CDI: α-amylase and the immobilization temperature. The optimum pH for the free and immobilized amylase was 6. The free and immobilized α-amylase showed maximum activity at 20∘C and 35∘C, respectively. The immobilized α-amylase was more thermostable than the free one. The retained activity for free α-amylase after 19 storage days was 57.7% whereas it was 100% for the immobilized α-amylase. In repeated batch experiments, the immobilized α-amylase retained a residual activity of 45% after 11 repeated uses. The Km and Vmax values for the immobilized enzyme were larger than those of the free enzyme. The immobilization of α-amylase on MNPs using CDI improves its stability and reusability.

  18. Abdominal pain and a raised amylase? It's not always pancreatitis. . .

    PubMed

    Oluwatowoju, I O; Abu, O E; Lawson, G

    2013-01-01

    We report the case of a 72 year old man with a history of COPD and heavy alcohol consumption who was initially diagnosed with acute pancreatitis based on a presentation with epigastric pain and elevated serum amylase. Review of his notes revealed several previous similar admissions and extensive normal investigations apart from persistently elevated amylase. Further analysis showed evidence of macroamylasaemia which accounted for the apparently high serum amylase level.

  19. Simultaneous study of the metabolic turnover and renal excretion of salivary amylase-125I and pancreatic amylase-131I in the baboon

    PubMed Central

    Duane, William C.; Frerichs, Roger; Levitt, Michael D.

    1972-01-01

    The metabolic turnover of salivary and pancreatic amylase was studied in the baboon, an animal with a serum amylase level and renal clearance of amylase similar to man. Purified amylase was electrolytically iodinated. Although iodinated and uniodinated amylase had similar gel filtration, electrophoretic, enzymatic, glycogen precipitation characteristics, the labeled enzyme was cleared less rapidly by the kidney than was the unlabeled material. However, urinary iodinated amylase which had been biologically screened by the kidney had a renal clearance and serum disappearance rate indistinguishable from unlabeled amylase and thus can serve as a tracer in metabolic turnover studies. Administration of a mixture of salivary amylase-125I and pancreatic amylase-131I made it possible to simultaneously measure the serum disappearance and renal clearance of these two isoenzymes. The metabolic clearance of both isoenzymes was extremely rapid with half-times of about 130 min. This rapid turnover of serum amylase probably accounts for the transient nature of serum amylase elevation which frequently occurs in pancreatitis. Pancreatic amylase-131I was consistently cleared more rapidly (mean clearance ratio: 1.8) by the kidney than was salivary amylase-125I. This more rapid renal clearance of pancreatic amylase may help to explain the disproportionate elevation of urinary amylase relative to serum amylase observed in pancreatitis. PMID:5024043

  20. Activated effect of lignin on α-amylase.

    PubMed

    Zhang, Juan; Cui, Jun-Hui; Yin, Tingting; Sun, Lizhou; Li, Genxi

    2013-12-01

    This paper reports a new kind of activator of α-amylase, lignin, which can greatly increase α-amylase activity. The promoted ratio of lignin is even much higher than that of chloride ion, the traditional activator of α-amylase. Further experimental results reveal that lignin may interact with α-amylase to form a 1:1 complex with a binding constant of 4.47×10(5) M(-1). The binding is spontaneous and lignin/α-amylase complex formation is an exothermal reaction. Hydrogen bonding plays a key role and non-radiation energy transfers from α-amylase to lignin in the binding process. Lignin, combining with α-amylase, conforms to a first-order exponential decay function. The formation of the lignin/α-amylase complex results in the reduction of α-helical content from 57.7% to 53.9%, the increase of the polarity around tryptophan residues, the decrease of the hydrophobicity, and the enlargement of protein granule volume. This work will give a deeper insight into lignin as a kind of dietary fibre, known as an important food functional factor. Furthermore, it also contributes to the exploration of an activator of α-amylase, used in the food industry. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Thermal adaptation of α-amylases: a review.

    PubMed

    Hiteshi, Kalpana; Gupta, Reena

    2014-11-01

    The temperature adaptation of α-amylase can be gained by different adjustments in protein structure with consecutive effects on the stability and flexibility of the protein. In this review, meso, thermo and cold-active α-amylases have been compared with respect to their structure and intramolecular interactions. With decrease in temperature, the number of ionic interactions also decreases, leading to greater flexibility of proteins. It has also been observed that the proline and arginine content is higher in thermophilic amylases as compared to meso and psychrophilic amylases, increasing the rigidity and structural stability of protein molecule.

  2. Variation in amylase activities in radish (Raphanus sativus) cultivars.

    PubMed

    Hara, Masakazu; Ito, Fumio; Asai, Tatsuo; Kuboi, Toru

    2009-09-01

    The radish (Raphanus sativus) is a root vegetable of the Brassicaceae family which shows amylolytic activity in the taproot. However, there is little information about differences in these amylolytic activities among radish cultivars. We analyzed the amylase activities and starch contents of 7 kinds of radish cultivars. The Koshin cultivar showed the highest amylase activity, with a level approximately 6 times higher than that of the Sobutori cultivar, which had the lowest. Cultivars with higher amylase activities showed higher starch contents. These results suggest that there are intraspecies variations in amylolytic activities in radishes, and positive correlations between amylase activity and starch content.

  3. The cell-bound α-amylases of Streptococcus bovis

    PubMed Central

    Walker, Gwen J.

    1965-01-01

    1. The cell-bound α-amylase of Streptococcus bovis has been isolated from other carbohydrases in the cell extract by chromatography on DEAE-cellulose. The enzyme has been compared with the extracellular α-amylase produced by this organism. 2. The two amylases had similar action patterns on amylose, the main product being maltotriose with smaller amounts of maltose and a little glucose. 3. The cell-bound amylase hydrolysed maltopentaose and maltohexaose at a similar rate to the hydrolysis of amylose. Maltotetraose was hydrolysed six times more slowly, and maltotriose 280 times more slowly, than amylose. 4. Studies with end-labelled maltodextrins revealed that the cell-bound α-amylase preferentially hydrolysed the third linkage from the non-reducing end, liberating maltotriose. The linkage at the reducing end of maltotriose was more easily hydrolysed than the other. 5. Egg-white lysozyme and the extracellular enzymes of Streptomyces albus lysed the cell walls of Streptococcus bovis, releasing amylase into the medium. In the presence of 0·6 m-sucrose 10% of the maximal amylase activity was released by lysozyme. Suspension of the spheroplasts in dilute buffer caused the rupture of the cytoplasmic membrane and the liberation of amylase. 6. A sensitive method for determining the ability of amylases to degrade starch granules is described. PMID:14346085

  4. Effect of starch and amylase on the expression of amylase-binding protein A in Streptococcus gordonii.

    PubMed

    Nikitkova, A E; Haase, E M; Scannapieco, F A

    2012-08-01

    Streptococcus gordonii is a common oral commensal bacterial species in tooth biofilm (dental plaque) and specifically binds to salivary amylase through the surface exposed amylase-binding protein A (AbpA). When S. gordonii cells are pretreated with amylase, amylase bound to AbpA facilitates growth with starch as a primary nutrition source. The goal of this study was to explore possible regulatory effects of starch, starch metabolites and amylase on the expression of S. gordonii AbpA. An amylase ligand-binding assay was used to assess the expression of AbpA in culture supernatants and on bacterial cells from S. gordonii grown in defined medium supplemented with 1% starch, 0.5 mg ml(-1) amylase, with starch and amylase together, or with various linear malto-oligosaccharides. Transcription of abpA was determined by reverse transcription quantitative polymerase chain reaction. AbpA was not detectable in culture supernatants containing either starch alone or amylase alone. In contrast, the amount of AbpA was notably increased when starch and amylase were both present in the medium. The expression of abpA was significantly increased (P < 0.05) following 40 min of incubation in defined medium supplemented with starch and amylase. Similar results were obtained in the presence of maltose and other short-chain malto-oligosacchrides. These results suggest that the products of starch hydrolysis produced from the action of salivary α-amylase, particularly maltose and maltotriose, up-regulate AbpA expression in S. gordonii.

  5. Effect of starch and amylase on the expression of amylase-binding protein A in Streptococcus gordonii

    PubMed Central

    Nikitkova, A.E.; Haase, E.M.; Scannapieco, F.A.

    2012-01-01

    SUMMARY Streptococcus gordonii is a common oral commensal bacterial species in tooth biofilm (dental plaque) and specifically binds to salivary amylase through the surface exposed amylase-binding protein A (AbpA). When S. gordonii cells are pretreated with amylase, amylase bound to AbpA facilitates growth with starch as a primary nutrition source. The goal of this study was to explore possible regulatory effects of starch, starch metabolites and amylase on the expression of S. gordonii AbpA. An amylase ligand-binding assay was used to assess the expression of AbpA in culture supernatants and on bacterial cells from S. gordonii grown in defined medium supplemented with 1% starch, 0.5 mg ml−1 amylase, with starch and amylase together, or with various linear malto-oligosaccharides. Transcription of abpA was determined by reverse transcription quantitative polymerase chain reaction. AbpA was not detectable in culture supernatants containing either starch alone or amylase alone. In contrast, the amount of AbpA was notably increased when starch and amylase were both present in the medium. The expression of abpA was significantly increased (P < 0.05) following 40 min of incubation in defined medium supplemented with starch and amylase. Similar results were obtained in the presence of maltose and other short-chain malto-oligosacchrides. These results suggest that the products of starch hydrolysis produced from the action of salivary α-amylase, particularly maltose and maltotriose, regulate AbpA expression in S. gordonii. PMID:22759313

  6. Method for using a yeast alpha-amylase promoter

    DOEpatents

    Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.

    2003-04-22

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  7. Temperature impacts the multiple attack action of amylases.

    PubMed

    Bijttebier, Annabel; Goesaert, Hans; Delcour, Jan A

    2007-03-01

    The action pattern of several amylases was studied at 35, 50, and 70 degrees C using potato amylose, a soluble (Red Starch) and insoluble (cross-linked amylose) chromophoric substrate. With potato amylose as substrate, Bacillus stearothermophilus alpha-amylase (BStA) and porcine pancreatic alpha-amylase displayed a high degree of multiple attack (DMA, i.e., the number of bonds broken during the lifetime of an enzyme-substrate complex minus one), the fungal alpha-amylase from Aspergillus oryzae a low DMA, and the alpha-amylases from B. licheniformis, Thermoactinomyces vulgaris, B. amyloliquifaciens, and B. subtilis an intermediate DMA. These data are discussed in relation to structural properties of the enzymes. The level of multiple attack (LMA), based on the relation between the drop in iodine binding of amylose and the increase in total reducing value, proved to be a good alternative for DMA measurements. The LMA of the endo-amylases increased with temperature to a degree depending on the amylase. In contrast, BStA showed a decreased LMA when temperature was raised. Furthermore, different enzymes had different activities on Red Starch and cross-linked amylose. Hence, next to the temperature, the action pattern of alpha-amylases is influenced by structural parameters of the starch substrate.

  8. The Amylase Project: Creating a Classroom of Biotechnologists.

    ERIC Educational Resources Information Center

    Sweeney, Diane

    1998-01-01

    A biotechnologist-turned-teacher introduces a series of laboratory modules incorporating concepts from microbiology, cellular biology, molecular biology, biochemistry, and evolution. The Amylase Project aims to distill the biotechnology process into a few short steps using amylase, the easiest enzyme to detect of those commonly produced by…

  9. Routine Measurement of Serum Amylase in Acute Abdomen.

    PubMed

    Ghimire, R; Thapa, A S; Karki, D; Shrestha, D K

    2014-01-01

    Acute abdominal pain is a common condition presenting to both the emergency department (ED) and surgical admission unit. Increase in serum amylase levels are found in much gastrointestinal pathology. Serum amylase level is consistently high in acute pancreatitis though high values are not pathognomonic of pancreatitis .The aim of this study to assess the level of serum amylase in various diseases presenting with acute abdominal pain and to evaluate the role of routine measurement of serum amylase in the screening of patient with acute abdominal pain for the diagnosis of acute pancreatitis in a prospective series. A prospective observational study was performed from 15th May 2014 - 15th Nov 2014 (6 months) at Department of Surgery of Kathmandu medical College Teaching Hospital; Kathmandu. All consecutive patients presented at emergency department and required admissions in surgical ward were included. A multivariate analysis was performed to assess the level of serum amylase in various diseases presenting with acute abdominal pain including acute pancreatitis. Overall, 318 patients were included during a period of 6 months among them 48 patients were excluded. 34 cases (12.6 %) were diagnosed of acute pancreatitis. three cases (1.1%) of non pancreatic pathology with raised serum amylase level (> 1000 U\\L). Routine assessment of serum amylase is helpful in excluding differential diagnosis of patient presenting with acute abdomen and this study identified serum amylase as a good screening tool if done in cases with clinical suspicion.

  10. The Amylase Project: Creating a Classroom of Biotechnologists.

    ERIC Educational Resources Information Center

    Sweeney, Diane

    1998-01-01

    A biotechnologist-turned-teacher introduces a series of laboratory modules incorporating concepts from microbiology, cellular biology, molecular biology, biochemistry, and evolution. The Amylase Project aims to distill the biotechnology process into a few short steps using amylase, the easiest enzyme to detect of those commonly produced by…

  11. On the mechanism of alpha-amylase.

    PubMed

    Oudjeriouat, Naïma; Moreau, Yann; Santimone, Marius; Svensson, Birte; Marchis-Mouren, Guy; Desseaux, Véronique

    2003-10-01

    Two inhibitors, acarbose and cyclodextrins (CD), were used to investigate the active site structure and function of barley alpha-amylase isozymes, AMY1 and AMY2. The hydrolysis of DP 4900-amylose, reduced (r) DP18-maltodextrin and maltoheptaose (catalysed by AMY1 and AMY2) was followed in the absence and in the presence of inhibitor. Without inhibitor, the highest activity was obtained with amylose, kcat/Km decreased 103-fold using rDP18-maltodextrin and 10(5) to 10(6)-fold using maltoheptaose as substrate. Acarbose is an uncompetitive inhibitor with inhibition constant (L1i) for amylose and maltodextrin in the micromolar range. Acarbose did not bind to the active site of the enzyme, but to a secondary site to give an abortive ESI complex. Only AMY2 has a second secondary binding site corresponding to an ESI2 complex. In contrast, acarbose is a mixed noncompetitive inhibitor of maltoheptaose hydrolysis. Consequently, in the presence of this oligosaccharide substrate, acarbose bound both to the active site and to a secondary binding site. alpha-CD inhibited the AMY1 and AMY2 catalysed hydrolysis of amylose, but was a very weak inhibitor compared to acarbose.beta- and gamma-CD are not inhibitors. These results are different from those obtained previously with PPA. However in AMY1, as already shown for amylases of animal and bacterial origin, in addition to the active site, one secondary carbohydrate binding site (s1) was necessary for activity whereas two secondary sites (s1 and s2) were required for the AMY2 activity. The first secondary site in both AMY1 and AMY2 was only functional when substrate was bound in the active site. This appears to be a general feature of the alpha-amylase family.

  12. α-Amylase inhibitory triterpene from Abrus precatorius leaves.

    PubMed

    Yonemoto, Ryuta; Shimada, Miyuki; Gunawan-Puteri, Maria D P T; Kato, Eisuke; Kawabata, Jun

    2014-08-20

    In the screening experiments for porcine pancreatic α-amylase inhibitors in 18 plants obtained from Indonesia, a potent inhibitory activity was detected in the extract of leaves of Abrus precatorius. The enzyme assay-guided fractionation of the extract led to the isolation of a triterpene ketone, lupenone (1), as a potent α-amylase inhibitor, together with 24-methylenecycloartenone (2) and luteolin (3). The mode of inhibition of compound 1 against porcine pancreatic α-amylase was a mixed inhibition. This is the first report that describes the potent α-amylase inhibitory activity of the low-polar triterpene ketone similar to compound 1. A comparison of the activities of the isolate and related compounds indicated the importance of C-3 ketone and the lupane skeleton in the α-amylase inhibitory activity.

  13. [Mechanism of amylase action on glucoside starch bonds].

    PubMed

    Zherebtsov, N A; Zabelina, L F; Ektoba, A I

    1976-12-01

    Functional groups of glucoamylase and alpha-amylase from Asp. awamori, alpha-amylase from Asp. oryzae and alpha- and beta-amylases from barley malt are identified. Kinetic curves of the activity dependency on pH, values of ionization heats and photooxidative inactivation draw to the conclusion that carboxyl-imidazole system enters into the active site of the enzymes. A hypothetic mechanism of hydrolysis of alpha-1,4-glucoside bond in starch molecule by alpha- and beta-amylases and of alpha-1,4- and alpha-1,6-glucoside bonds by glucoamylase is given. A theory of induced correspondence of enzyme and substrate satisfactorily explains the specificity of the enzyme action and the cause of complete starch convertion into glucose under glucoamylase action and of terminal starch hydrolysis by alpha- and beta-amylases.

  14. [Measurement of amylase in saliva collected by salivette].

    PubMed

    Park, Jung Ran; Kim, Mi Hye; Woo, Jungmin; Lee, Seung Jae; Song, Kyung Eun

    2008-12-01

    Saliva is increasingly being used as a specimen for systemic disease as well as for oral health status. Especially, salivary amylase has been studied as an excellent index for psychological stress. Authors evaluated the measurement of salivary amylase activities collected by Salivettes (Sarstedt, Germany). Saliva specimens were collected from 13 healthy adults between 10:00 and 11:00 a.m. Participants were asked to gently chew tampons of Salivettes for 1 min. Immediately after collection, all specimens were stored frozen. On the day of testing, they were centrifuged after thawing and diluted with distilled water. Amylase was measured by Dimension RxL Max (Dade Behring Inc., USA). We evaluated precision, linearity, and recovery rate of Salivette. Amylase activities between collection of saliva by Salivette and passive drool were compared, and also the changes of amylase by the storage temperature were evaluated. Intra-run CVs for three levels of amylase were excellent. Between-day CVs and total CVs were good only for mid and high levels. A good linear relationship was found at all diluted levels. Dosing Salivettes with 2 mL, 1.5 mL, and 1 mL yielded sample recovery 85.5+/-2.4%, 82.4+/-1.5%, and 72.2+/-3.1%, respectively and amylase recovery 78.9+/-10.9%, 74.1+/-13.7%, and 37.3+/-26.9%, respectively. Amylase by Salivette and passive drool were correlated well (r=0.757), although they showed a significant difference. Amylase activity was not affected by the storage temperature. Measurement of salivary amylase using Salivette could be a useful test having good intra-run CVs and linearity. More than 1.5 mL of saliva would be needed to have more than 70% recovery of Salivette.

  15. The potato amylase inhibitor gene SbAI regulates cold-induced sweetening in potato tubers by modulating amylase activity.

    PubMed

    Zhang, Huiling; Liu, Jun; Hou, Juan; Yao, Ying; Lin, Yuan; Ou, Yongbin; Song, Botao; Xie, Conghua

    2014-09-01

    Potato cold-induced sweetening (CIS) is critical for the postharvest quality of potato tubers. Starch degradation is considered to be one of the key pathways in the CIS process. However, the functions of the genes that encode enzymes related to starch degradation in CIS and the activity regulation of these enzymes have received less attention. A potato amylase inhibitor gene known as SbAI was cloned from the wild potato species Solanum berthaultii. This genetic transformation confirmed that in contrast to the SbAI suppression in CIS-resistant potatoes, overexpressing SbAI in CIS-sensitive potatoes resulted in less amylase activity and a lower rate of starch degradation accompanied by a lower reducing sugar (RS) content in cold-stored tubers. This finding suggested that the SbAI gene may play crucial roles in potato CIS by modulating the amylase activity. Further investigations indicated that pairwise protein-protein interactions occurred between SbAI and α-amylase StAmy23, β-amylases StBAM1 and StBAM9. SbAI could inhibit the activities of both α-amylase and β-amylase in potato tubers primarily by repressing StAmy23 and StBAM1, respectively. These findings provide the first evidence that SbAI is a key regulator of the amylases that confer starch degradation and RS accumulation in cold-stored potato tubers.

  16. Activity and storage of commercial amylases in the 2013 Louisiana grinding season

    USDA-ARS?s Scientific Manuscript database

    A current problem in the application of amylases at sugarcane factories is the existence of a wide variation in the activities and activity per unit cost of commercial amylases. The efficiency of amylase action to break down starch in the factory is related to the activity of the amylase used. Until...

  17. Structural features, substrate specificity, kinetic properties of insect α-amylase and specificity of plant α-amylase inhibitors.

    PubMed

    Kaur, Rimaljeet; Kaur, Narinder; Gupta, Anil Kumar

    2014-11-01

    α-Amylase is an important digestive enzyme required for the optimal growth and development of insects. Several insect α-amylases had been purified and their physical and chemical properties were characterized. Insect α-amylases of different orders display variability in structure, properties and substrate specificity. Such diverse properties of amylases could be due to different feeding habits and gut environment of insects. In this review, structural features and properties of several insect α-amylases were compared. This could be helpful in exploring the diversity in characteristics of α-amylase between the members of the same class (insecta). Properties like pH optima are reflected in enzyme structural features. In plants, α-amylase inhibitors (α-AIs) occur as part of natural defense mechanisms against pests by interfering in their digestion process and thus could also provide access to new pest management strategies. AIs are quite specific in their action; therefore, these could be employed according to their effectiveness against target amylases. Potential of transgenics with α-AIs has also been discussed for insect resistance and controlling infestation. The differences in structural features of insect α-amylases provided reasons for their efficient functioning at different pH and the specificity towards various substrates. Various proteinaceous and non-proteinaceous inhibitors discussed could be helpful in controlling pest infestation. In depth detailed studies are required on proteinaceous α-AI-α-amylase interaction at different pH's as well as the insect proteinase action on these inhibitors before selecting the α-AI for making transgenics resistant to particular insect. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Immunochemical relationship between alpha-amylases of rat liver, serum, pancreas and parotid gland.

    PubMed Central

    Messer, M; Dean, R T

    1975-01-01

    1. Rabbit antisera to purified rat parotid alpha-amylase were prepared. 2. The relationships between rat parotid-gland, pancreatic, serum and liver amylase were investigated by using the antisera in immunodiffusion, immunoelectrophoresis and immunoinhibition experiments. 3. Serum and liver amylase were identical, and very similar to parotid-gland amylase; pancreatic amylase was, however, quite distinct, and showed only some of the determinants present on parotid-gland amylase. 4. The data strengthen the suggestion that the liver is the main source of serum amylase. Images PLATE 1 PLATE 2 PLATE 3 PMID:55120

  19. Rat parotid gland amylase: evidence for alterations in an exocrine protein with increased age.

    PubMed

    Baum, B J; Levine, R L; Kuyatt, B L; Sogin, D B

    1982-05-01

    The content of alpha-amylase, the major exocrine secretory protein from rat parotid glands, was studied in young adult and aged rat tissue. alpha-Amylase protein was determined with an enzyme-linked immunosorbent assay. This employed antisera, produced against alpha-amylase purified from young adult rats, but which recognized and precipitated alpha-amylase enzyme activity equally well from both age groups. The parotid gland content of alpha-amylase was reduced about 50% in aged rats. Furthermore, the percentage of total gland protein which was alpha-amylase was decreased about 40% in aged animals. The data suggest that a somewhat specific alteration in alpha-amylase production (synthesis and/or degradation) occurs in parotid glands from aged rats. In addition, alpha-amylase functional activity was followed. The specific enzyme activity (U amylase activity per mg immunoreactive amylase) was about 35% higher in extracts from aged rat parotid glands compared to that of young adult glands.

  20. Serum amylase and lipase and urinary trypsinogen and amylase for diagnosis of acute pancreatitis.

    PubMed

    Rompianesi, Gianluca; Hann, Angus; Komolafe, Oluyemi; Pereira, Stephen P; Davidson, Brian R; Gurusamy, Kurinchi Selvan

    2017-04-21

    The treatment of people with acute abdominal pain differs if they have acute pancreatitis. It is important to know the diagnostic accuracy of serum amylase, serum lipase, urinary trypsinogen-2, and urinary amylase for the diagnosis of acute pancreatitis, so that an informed decision can be made as to whether the person with abdominal pain has acute pancreatitis. There is currently no Cochrane review of the diagnostic test accuracy of serum amylase, serum lipase, urinary trypsinogen-2, and urinary amylase for the diagnosis of acute pancreatitis. To compare the diagnostic accuracy of serum amylase, serum lipase, urinary trypsinogen-2, and urinary amylase, either alone or in combination, in the diagnosis of acute pancreatitis in people with acute onset of a persistent, severe epigastric pain or diffuse abdominal pain. We searched MEDLINE, Embase, Science Citation Index Expanded, National Institute for Health Research (NIHR HTA and DARE), and other databases until March 2017. We searched the references of the included studies to identify additional studies. We did not restrict studies based on language or publication status, or whether data were collected prospectively or retrospectively. We also performed a 'related search' and 'citing reference' search in MEDLINE and Embase. We included all studies that evaluated the diagnostic test accuracy of serum amylase, serum lipase, urinary trypsinogen-2, and urinary amylase for the diagnosis of acute pancreatitis. We excluded case-control studies because these studies are prone to bias. We accepted any of the following reference standards: biopsy, consensus conference definition, radiological features of acute pancreatitis, diagnosis of acute pancreatitis during laparotomy or autopsy, and organ failure. At least two review authors independently searched and screened the references located by the search to identify relevant studies. Two review authors independently extracted data from the included studies. The thresholds used

  1. Activity and cellular localization of amylases of rabbit cecal bacteria.

    PubMed

    Sirotek, K; Marounek, M; Suchorská, O

    2006-01-01

    Five 11-week-old rabbits, fed a commercial granulated feed, were slaughtered and cecal starch-degrading bacteria enumerated; total concentration of cultivable bacteria utilizing starch averaged 5.5 x 10(10) CFU/g. The activity and cellular localization of amylases was determined in 9 bacteria identified as Actinomyces israeli (strains AA2 and AD4), Bacteroides spp. (strain AA3), Dichelobacter nodosus (strain AA4), Mitsuokella multiacidus (strain AA6), Eubacterium spp. (strains AA7 and AB2), Clostridium spp. (strains AD1 and AA5). Four strains (AA3, AA4, AA5, AD4) produced extracellular amylases with an activity of 26-35 micromol of reducing sugars per h per mg of protein; in five strains (AA2, AA6, AA7, AB2, AD1) amylases were membrane-bound with an activity of 14-18 micromol of reducing sugars per h per mg of protein. All strains exhibited a low intracellular amylolytic activity. The pH optimum of amylases was 6.8-7.0. In strains producing extracellular amylases a substantial loss of viscosity was observed during incubations of cultivation supernatant with starch, similar to viscosity reduction in starch solutions treated with alpha-amylase; this indicates an endo-type (random cleavage) of extracellular amylase reaction in the bacteria under study. No strain possessed glucoamylase activity.

  2. Drain amylase aids detection of anastomotic leak after esophagectomy

    PubMed Central

    Baker, Erin H.; Hill, Joshua S.; Reames, Mark K.; Symanowski, James; Hurley, Susie C.

    2016-01-01

    Background Anastomotic leak following esophagectomy is associated with significant morbidity and mortality. As hospital length of stay decreases, the timely diagnosis of leak becomes more important. We evaluated CT esophagram, white blood count (WBC), and drain amylase levels in the early detection of anastomotic leak. Methods The diagnostic performance of CT esophagram, drain amylase >800 IU/L, and WBC >12,000/µL within the first 10 days after surgery in predicting leak at any time after esophagectomy was calculated. Results Anastomotic leak occurred in 13 patients (13%). CT esophagram performed within 10 days of surgery diagnosed six of these leaks with a sensitivity of 0.54. Elevation in drain amylase level within 10 days of surgery diagnosed anastomotic leak with a sensitivity of 0.38. When the CT esophagram and drain amylase were combined, the sensitivity rose to 0.69 with a specificity of 0.98. WBC elevation had a sensitivity of 0.92, with a specificity of 0.34. Among 30 patients with normal drain amylase and a normal WBC, one developed an anastomotic leak. Conclusions Drain amylase adds to the sensitivity of CT esophagram in the early detection of anastomotic leak. Selected patients with normal drain amylase levels and normal WBC may be able to safely forgo CT esophagram. PMID:27034784

  3. Antiviral Cystine Knot α-Amylase Inhibitors from Alstonia scholaris*

    PubMed Central

    Nguyen, Phuong Quoc Thuc; Ooi, Justin Seng Geap; Nguyen, Ngan Thi Kim; Wang, Shujing; Huang, Mei; Liu, Ding Xiang; Tam, James P.

    2015-01-01

    Cystine knot α-amylase inhibitors are cysteine-rich, proline-rich peptides found in the Amaranthaceae and Apocynaceae plant species. They are characterized by a pseudocyclic backbone with two to four prolines and three disulfides arranged in a knotted motif. Similar to other knottins, cystine knot α-amylase inhibitors are highly resistant to degradation by heat and protease treatments. Thus far, only the α-amylase inhibition activity has been described for members of this family. Here, we show that cystine knot α-amylase inhibitors named alstotides discovered from the Alstonia scholaris plant of the Apocynaceae family display antiviral activity. The alstotides (As1–As4) were characterized by both proteomic and genomic methods. All four alsotides are novel, heat-stable and enzyme-stable and contain 30 residues. NMR determination of As1 and As4 structures reveals their conserved structural fold and the presence of one or more cis-proline bonds, characteristics shared by other cystine knot α-amylase inhibitors. Genomic analysis showed that they contain a three-domain precursor, an arrangement common to other knottins. We also showed that alstotides are antiviral and cell-permeable to inhibit the early phase of infectious bronchitis virus and Dengue infection, in addition to their ability to inhibit α-amylase. Taken together, our results expand membership of cystine knot α-amylase inhibitors in the Apocynaceae family and their bioactivity, functional promiscuity that could be exploited as leads in developing therapeutics. PMID:26546678

  4. Bacillus thuringiensis HCB6 Amylase Immobilization by Chitosan Beads

    NASA Astrophysics Data System (ADS)

    Zusfahair; Ningsih, D. R.; Kartika, D.; Fatoni, A.; Zuliana, A. L.

    2017-02-01

    The purpose of this study was to optimize the amylase immobilization using a chitosan bead and to characterize immobilized amylase of Bacillus thuringiensis Bacteria HCB6. This study was started of amylase production, continued by immobilization optimization including ratio of chitosan:enzymes, enzyme-matrix contact time, substrate concentration, pH effect, incubation temperature effect, reaction time, and stability of immobilized enzyme. Amylase activity assay was dinitro salicylic (DNS) method. The results showed the optimum chitosan:enzyme ratio was 2.5: 1 (v/v), immobilization contact time of 18 hours and immobilization efficiency of 87.93%. Furthermore, immobilized amylase of B. thuringiensis HCB6 showed optimum substrate concentration of 1.5%, optimum pH of 6, optimum incubation temperature of 37 ° C, and the reaction time of 30 minutes. The Michaelis-Menten constant KM value for free and immobilized amylase were 5.30% and 1.33% respectively. Immobilized amylase can be used up to five times with the remaining activity of 43.3%.

  5. Expression of liver alpha-amylase in obese mouse hepatocytes

    PubMed Central

    Afsartala, Zohreh; Savabkar, Sanaz; Nazemalhosseini Mojarad, Ehsan; Assadollahi, Vahideh; Tanha, Shima; Bijangi, Khosro; Gholami, Mohammadreza

    2016-01-01

    Aim: The aim of this study is to demonstrate the relation between the expression of liver alpha-amylase and obesity. Background: Alpha-amylase catalyses the hydrolysis of 1, 4-alpha-glucosidic linkages in polysaccharides and has three main subtypes, including: salivary, pancreatic, and hepatic. Hepatic alpha-amylase is involved in glycogen metabolism, and has a role in obesity and its management. In this study, we aimed to analyze the expression of liver alpha-amylase in overweight and obese mouse. Material and methods: In this study, NMRI male mice were randomly divided into two groups. The sample group (obese) took a high-fat and carbohydrate diet, while the control group (normal) took a laboratory pellet chow for eight weeks. During this period, their weight was measured. After eight weeks, liver hepatocytes were isolated using an enzymatic digestion method. Immunocytochemistry (ICC) and flow cytometry analysis were performed to measure alpha amylase protein expression in mouse liver hepatocyte cells. Results: A significant difference in the body weight was observed between the two groups (p<0.05). The qualitative protein expression of liver alpha-amylase was found to be higher in the obese group in both tests (immunocytochemistry and flow cytometry). Animals from the test group presented higher alpha-amylase expression, which suggests that this hepatic protein may constitute a potential indicator of susceptibility for fat tissue accumulation and obesity. The present data demonstrates an increased expression of liver amylase in obese mice. Conclusion: These results suggest that liver amylase secretion might be useful for predicting susceptibility to obesity induced by consumption of a high-fat and carbohydrate diet. PMID:27895853

  6. Salivary amylase - The enzyme of unspecialized euryphagous animals.

    PubMed

    Boehlke, Carolin; Zierau, Oliver; Hannig, Christian

    2015-08-01

    Alpha-amylase (EC 3.2.1.1) is the most abundant enzyme in the saliva of man and of several vertebrates. In humans, salivary amylase is mainly formed in the parotid gland; its activity is of high inter-individual and intra-individual variability. The physiological functions of α-amylase have not yet been explored completely. It is well known that the enzyme cleaves the α-(1,4)-glycosidic bonds of polysaccharides. Furthermore it plays an important role in initial bioadhesion in man, facilitating carbohydrate metabolism and bacterial adherence at the tooth surface and therewith caries initiation. Nevertheless, it is still a matter of interest why humans have such high amounts of salivary amylase. The review presents an evolutionary approach by considering salivary amylase in the animal kingdom with special focus on mammalians divided into the three main nutritional types carnivores, herbivores, and omnivores; it was postulated that for most mammalian animals salivary α-amylase is essential. The enzyme has been detected in saliva of some herbivores and many omnivorous animals, but not in pure carnivores. Focusing on ruminants, negligible levels or an absence of α-amylase was determined. Presence and activity probably differ depending on the species-specific diet. Animals feeding on unripe fruits, seeds, roots and bulbs exhibit higher activity of salivary α-amylase than species consuming ripe fruits, insects, and vertebrates. In contrast to carnivores and most herbivores, omnivores have considerable amounts of amylase in their saliva. Though, the starch-digesting enzyme has been investigated well, the physiological function of amylase in saliva has not yet been explored completely. It can be hypothesized that nutritional habits affect expression of enzymes in the saliva of animals. It has to be verified, whether α-amylase is genetically or epigenetically determined. As a consequence of the development of agriculture, and following dietary changes, amylase can be

  7. Characterisation of three starch degrading enzymes: thermostable β-amylase, maltotetraogenic and maltogenic α-amylases.

    PubMed

    Derde, L J; Gomand, S V; Courtin, C M; Delcour, J A

    2012-11-15

    Maltogenic α-amylase from Bacillus stearothermophilus (BStA) is widely used as bread crumb anti-firming enzyme. A maltotetraose-forming α-amylase from Pseudomonas saccharophila (PSA) was recently proposed as alternative, hence the need to compare both exo-acting enzymes with some endo-action component. A purely exo-acting thermostable β-amylase from Clostridium thermosulfurogenes (CTB) was included for reference purposes. Under the experimental conditions used, temperature optima of the enzymes are rather similar (60-65 °C), but temperature stability decreased in the order BStA, PSA and CTB. The action of the enzymes on different substrates and their impact on the rheological behaviour of maize starch suspensions demonstrated that, while CTB acts exclusively through an exo-action mechanism, BStA displayed limited endo-action which became more pronounced at higher temperatures. PSA has more substantial endo-action than BStA, which is rather temperature independent. This is important for their impact in processes such as breadmaking, where temperature is gradually increased. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Inhibition of Sunn pest, Eurygaster integriceps, α-amylases by α-amylase inhibitors (T-αAI) from Triticale.

    PubMed

    Mehrabadi, Mohammad; Bandani, Ali R; Saadati, Fatemeh

    2010-01-01

    The effect of triticale α-amylases inhibitors on starch hydrolysis catalyzed by the Sunn pest, Eurygaster integriceps Puton (Hemiptera: Scutelleridae) midgut amylases was examined. Biochemical studgawies showed that inhibitors from Triticale (a hybrid of wheat and rye) had inhibitiory effects on E. integriceps α-amylases. The effects of the triticale α-amylase inhibitor (T-αAI) on α-amylase of E. integriceps showed a dose dependent manner of inhibition, e.g. less inhibition of enzyme activity (around 10%) with a lower dose (0.25 mg protein) and high inhibition of enzyme activity (around 80%) when a high dose of inhibitor was used (1.5 mg protein). The enzyme kinetic studies using Michaelis-Menten and Lineweaver-Burk equations showed the K(m) remained constant (0.58%) but the maximum velocity (V(max)) decreased in the presence of a crude extract of Triticale inhibitors, indicating mixed inhibition. The temperature giving 50% inactivation of enzyme (T(50)) during a 30-min incubation at pH 7.0 was 73° C. The maximum inhibitory activity was achieved at 35° C and pH 5.0. Gel assays showed the meaningful inhibition of E. integriceps α-amylases by various concentrations of Triticale inhibitors. Based on the data presented in this study, it could be said that the T-αAI has good inhibitory activity on E. integriceps gut α-amylase.

  9. Inhibition of Sunn Pest, Eurygaster integriceps, α-Amylases by α-Amylase Inhibitors (T-αAI) from Triticale

    PubMed Central

    Mehrabadi, Mohammad; Bandani, Ali R.; Saadati, Fatemeh

    2010-01-01

    The effect of triticale α-amylases inhibitors on starch hydrolysis catalyzed by the Sunn pest, Eurygaster integriceps Puton (Hemiptera: Scutelleridae) midgut amylases was examined. Biochemical studgawies showed that inhibitors from Triticale (a hybrid of wheat and rye) had inhibitiory effects on E. integriceps α-amylases. The effects of the triticale α-amylase inhibitor (T-αAI) on α-amylase of E. integriceps showed a dose dependent manner of inhibition, e.g. less inhibition of enzyme activity (around 10%) with a lower dose (0.25 mg protein) and high inhibition of enzyme activity (around 80%) when a high dose of inhibitor was used (1.5 mg protein). The enzyme kinetic studies using Michaelis-Menten and Lineweaver-Burk equations showed the Km remained constant (0.58%) but the maximum velocity (Vmax) decreased in the presence of a crude extract of Triticale inhibitors, indicating mixed inhibition. The temperature giving 50% inactivation of enzyme (T50) during a 30-min incubation at pH 7.0 was 73° C. The maximum inhibitory activity was achieved at 35° C and pH 5.0. Gel assays showed the meaningful inhibition of E. integriceps α-amylases by various concentrations of Triticale inhibitors. Based on the data presented in this study, it could be said that the T-αAI has good inhibitory activity on E. integriceps gut α-amylase. PMID:21062146

  10. Beta-amylase gene variability in introgressive wheat lines.

    PubMed

    Antonyuk, Maksym; Navalikhina, Anastasiia; Ternovska, Tamara

    2017-05-01

    Variability of the beta-amylase gene in bread wheat, artificial amphidiploids, and derived introgression wheat lines was analyzed. Variation in homeologous beta-amylase sequences caused by the presence of MITE (Miniature Inverted-Repeat Transposable Element) and its footprint has been identified in bread wheat. The previously unknown location of MITE in Triticum urartu and T. aestivum L. beta-amylase gene has been found. These species have a MITE sequence in the third intron of beta-amylase, as opposed to Aegilops comosa and a number of other Triticeae species, which have it in the fourth intron. These two MITEs from Ae. comosa and T. aestivum were shown to have low identity scores. Miosa, an artificial amphidiploid, which has the M genome from Ae. comosa was shown to lose the MITE sequences. This loss might be caused by genomic shock due to allopolyploidization.

  11. Formation of amyloid fibrils from β-amylase.

    PubMed

    Luo, Jian-Chau; Wang, Shing-Chuen; Jian, Wei-Bang; Chen, Chien-Hsing; Tang, Jaw-Luen; Lee, Cheng-I

    2012-03-23

    Fibril formation has been considered a significant feature of amyloid proteins. However, it has been proposed that fibril formation is a common property of many proteins under appropriate conditions. We studied the fibril formation of β-amylase, a non-amyloid protein rich in α-helical structure, because the secondary structure of β-amylase is similar to that of prions. With the conditions for the fibril formation of prions, β-amylase proteins were converted into amyloid fibrils. The features of β-amylase proteins and fibrils are compared to prion proteins and fibrils. Furthermore, the cause of neurotoxicity in amyloid diseases is discussed. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  12. [Amylases of the fungus Aspergillus flavipes associated with Fucus evanescens].

    PubMed

    Frolova, G M; Sil'chenko, A S; Pivkin, M V; Mikhaĭlov, V V

    2002-01-01

    A promising producer of extracellular amylases, Aspergillus flavipes, was selected from 245 strains of marine fungi. Depending on the conditions of growth, this strain produced diverse amylolytic complexes. When grown on medium containing peptone and yeast extract (pH 7.0), A. flavipes synthesized three forms of amylase, differing in pH optimum (5.5, 6.0, and 7.5). A single form of the enzyme was synthesized either in the absence of peptone from the medium or at the initial pH value of the medium, equal to 8.6. The activity of the isolated amylase forms decreased in the presence of proteolytic enzymes. New, highly stable forms of amylase (with pH optima of 5.5 and 7.5 and maximum activity at 60-80 degrees C) were synthesized in the presence of diisopropyl fluorophosphate, an inhibitor of proteases.

  13. An Amylase-Responsive Bolaform Supra-Amphiphile.

    PubMed

    Kang, Yuetong; Cai, Zhengguo; Tang, Xiaoyan; Liu, Kai; Wang, Guangtong; Zhang, Xi

    2016-02-01

    An amylase-responsive bolaform supra-amphiphile was constructed by the complexation between β-cyclodextrin and a bolaform covalent amphiphile on the basis of host-guest interaction. The bolaform covalent amphiphile could self-assemble in solution, forming sheet-like aggregates and displaying weak fluorescence because of aggregation-induced quenching. The addition of β-cyclodextrin led to the formation of the bolaform supra-amphiphile, prohibiting the aggregation of the bolaform covalent amphiphile and accompanying with the significant recovery of fluorescence. Upon the addition of α-amylase, with the degradation β-cyclodextrin, the fluorescence of the supra-amphiphile would quench gradually and significantly, and the quenching rate linearly correlated to the concentration of α-amylase. This study enriches the field of supra-amphiphiles on the basis of noncovalent interactions, and moreover, it may provide a facile way to estimate the activity of α-amylase.

  14. Purification and Characterization of Pea Epicotyl beta-Amylase.

    PubMed

    Lizotte, P A; Henson, C A; Duke, S H

    1990-03-01

    The most abundant beta-amylase (EC 3.2.1.2) in pea (Pisum sativum L.) was purified greater than 880-fold from epicotyls of etiolated germinating seedlings by anion exchange and gel filtration chromatography, glycogen precipitation, and preparative electrophoresis. The electrophoretic mobility and relative abundance of this beta-amylase are the same as that of an exoamylase previously reported to be primarily vacuolar. The enzyme was determined to be a beta-amylase by end product analysis and by its inability to hydrolyze beta-limit dextrin and to release dye from starch azure. Pea beta-amylase is an approximate 55 to 57 kilodalton monomer with a pl of 4.35, a pH optimum of 6.0 (soluble starch substrate), an Arrhenius energy of activation of 6.28 kilocalories per mole, and a K(m) of 1.67 milligrams per milliliter (soluble starch). The enzyme is strongly inhibited by heavy metals, p-chloromer-curiphenylsulfonic acid and N-ethylmaleimide, but much less strongly by iodoacetamide and iodoacetic acid, indicating cysteinyl sulfhydryls are not directly involved in catalysis. Pea beta-amylase is competitively inhibited by its end product, maltose, with a K(i) of 11.5 millimolar. The enzyme is partially inhibited by Schardinger maltodextrins, with alpha-cyclohexaamylose being a stronger inhibitor than beta-cycloheptaamylose. Moderately branched glucans (e.g. amylopectin) were better substrates for pea beta-amylase than less branched or non-branched (amyloses) or highly branched (glycogens) glucans. The enzyme failed to hydrolyze native starch grains from pea and glucans smaller than maltotetraose. The mechanism of pea beta-amylase is the multichain type. Possible roles of pea beta-amylase in cellular glucan metabolism are discussed.

  15. [Peritoneal mesothelioma with elevated amylase in the ascitic fluid].

    PubMed

    Carrión, A; Jover, R; Carnicer, F; García, M F; Aranda, F I; Martínez, J F; Griñó

    1995-03-01

    The case of a 42-year-old woman with no previous disease admitted for abdominal pain and ascites is presented. Analysis of the ascitic fluid demonstrated high concentrations of amylase with normal lipase. The diagnosis of peritoneal mesothelioma was obtained by laparotomy. This association has not been previously described. The authors suggest that this diagnostic possibility should be considered in patients without pancreatic disease and high amylase levels in ascitic fluid.

  16. Alpha-amylase supplementation of broiler diets based on corn.

    PubMed

    Gracia, M I; Araníbar, M J; Lázaro, R; Medel, P; Mateos, G G

    2003-03-01

    A 42-d trial was conducted to study the influence of exogenous alpha-amylase on digestive and performance traits in broilers fed a corn-soybean meal diet. There were two treatments (control and alpha-amylase supplemented diet) and six replicates (14 Cobb male chicks caged together) per treatment. At 7 d of age, alpha-amylase supplementation improved daily gain by 9.4% (P < or = 0.05) and feed conversion by 4.2% (P < or = 0.01). At the end of the trial, birds fed the alpha-amylase-supplemented diet ate more and grew faster (P < or = 0.05) and hadbetter feed conversion (P < or = 0.10) than broilers fed the control diet. Also, alpha-amylase supplementation improved apparent fecal digestibility of organic matter and starch (P < or = 0.01) and AMEn of the diet (P < or = 0.001). However, no effects were detected for CP or fat digestibility. Nutrient digestibility and AMEn of the diet increased with age (P < or = 0.001); however, no interactions of alpha-amylase x age were observed for any trait. Coefficients of apparent ileal and fecal digestibility of starch at 28 d of age were similar, which indicated that most of the undigested starch was not fermented in the hindgut of the chick. alpha-Amylase supplementation reduced relative pancreas weight (P < or = 0.001) but did not affect the weight of the remaining organs. Age consistently reduced intestinal viscosity and relative weights of all the organs (P < or = 0.001). The data indicated that alpha-amylase supplementation of a corn-soybean meal diet improved digestibility of nutrients and performance of broilers.

  17. Some studies of alpha-amylase production using Aspergillus oryzae.

    PubMed

    Esfahanibolandbalaie, Z; Rostami, K; Mirdamadi, S S

    2008-11-15

    The extracellular alpha-amylase production by Aspergillus oryzae was studied in submerged fermentation using an Adlof-Kuhner orbital shaker. The effect of initial pH values in the range of 4 to 7.5 on enzyme production was investigated and initial pH medium of 6.2 +/- 0.1 resulted in enhanced alpha-amylase production. The effect of carbon and nitrogen source and composition was examined and it has been observed that corn starch concentration of 15 g L(-1) has sound effect on enzyme production. The medium containing corn starch, sodium nitrate resulted in considerable higher enzyme production. Further, the yeast extract of 2.5 g L(-1) in the medium produced higher enzyme in view to other organic nitrogen sources. The effect of temperature on alpha-amylase production from 20 to 40 degrees C has been studied and at 35 +/- 1 degrees C higher alpha-amylase has been obtained. The effect of shaker's speed on alpha-amylase production from 50 to 200 rpm was investigated. And at about 180 rpm higher enzyme production has been observed. In the present study, it has been found that glucose has repressing effect on a-amylase production using A. oryzae PTCC5164.

  18. Characterization of salivary alpha-amylase binding to Streptococcus sanguis

    SciTech Connect

    Scannapieco, F.A.; Bergey, E.J.; Reddy, M.S.; Levine, M.J. )

    1989-09-01

    The purpose of this study was to identify the major salivary components which interact with oral bacteria and to determine the mechanism(s) responsible for their binding to the bacterial surface. Strains of Streptococcus sanguis, Streptococcus mitis, Streptococcus mutans, and Actinomyces viscosus were incubated for 2 h in freshly collected human submandibular-sublingual saliva (HSMSL) or parotid saliva (HPS), and bound salivary components were eluted with 2% sodium dodecyl sulfate. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer, alpha-amylase was the prominent salivary component eluted from S. sanguis. Studies with {sup 125}I-labeled HSMSL or {sup 125}I-labeled HPS also demonstrated a component with an electrophoretic mobility identical to that of alpha-amylase which bound to S. sanguis. Purified alpha-amylase from human parotid saliva was radiolabeled and found to bind to strains of S. sanguis genotypes 1 and 3 and S. mitis genotype 2, but not to strains of other species of oral bacteria. Binding of ({sup 125}I)alpha-amylase to streptococci was saturable, calcium independent, and inhibitable by excess unlabeled alpha-amylases from a variety of sources, but not by secretory immunoglobulin A and the proline-rich glycoprotein from HPS. Reduced and alkylated alpha-amylase lost enzymatic and bacterial binding activities. Binding was inhibited by incubation with maltotriose, maltooligosaccharides, limit dextrins, and starch.

  19. [Purification and characterization of thermostable amylases from two bacterial species].

    PubMed

    Dong, Yongcun; Liu, Yang; Chen, Yuanyuan; Niu, Dandan; Zhang, Liang; Shi, Guiyang; Wang, Zhengxiang

    2008-02-01

    Two thermophilic bacterial isolates, strain 173 and strain 174, with raw starch-digesting activities were selected from thermophilic bacteria growing in hot spring of Tengchong County, Yunnan Province, China. By amplification, sequencing and alignment analysis of 16S ribosomal DNAs, they were identified as members of genus Geobacillus. In shaker flask culture Geobacillus sp. 173 produced 14.5 U/mL amylase and for Geobacillus sp. 174 with 12.9 U/mL. Both amylases were purified by starch absorption-desorption and chromatograph. The amylases from strain 173 and strain 174 purified to about 50 and 29 folds were respectively achieved with an overall yield of 34% and 41%. The maximum gelatinized-starch-digesting activity of the purified amylases were at 70 degrees C and pH 5.0 - 5.5. The high raw-starch-digesting activity of these enzymes were observed at 50 degrees C - 60 degrees C (from strain 173) and 40 degrees C - 60 degrees C (from strain 174). Both enzymes were not sensitive to ions including mental ions (Na+, K+, Mg2+, Ca2+, Mn2+, Zn2+) and others (EDTA, Citrate), but were slightly inhibited by ions such as Co2+, Cu2+ for amylase from strain 173 and Cu2+ for amylase from strain 174. Both enzyme had specificity of starch substrates.

  20. Relationship between salivary mucin or amylase and the periodontal status.

    PubMed

    Sánchez, G A; Miozza, V A; Delgado, A; Busch, L

    2013-09-01

    Here we determine the relationship between salivary levels of mucin and amylase and the clinical parameters of periodontal disease before and after periodontal treatment. Ninety two subjects were clinically examined and distributed into four groups namely clinically healthy, mild, moderate and severe periodontitis, according to the periodontal status, classified according the values of clinical attachment level (CAL) and probing pocket depth (PPD). Unstimulated saliva was collected for 5 min. Salivary proteins, amylase and mucin were determined by colorimetric methods. A significant positive correlation (P < 0.0001) was observed between salivary mucin, amylase or protein and PPD or CAL before periodontal treatment while flow rate showed a negative correlation. Mucin and amylase output also showed a positive correlation with PPD or CAL. After treatment, the improvement of clinical parameters was accompanied by a diminution of salivary mucin, amylase or protein concentration and output in moderate and severe group. The increment of mucin and amylase output in relation to periodontal status indicates that salivary glands respond to the disease by increasing the protective potential of saliva when necessary and return to the normal rate of secretion after the resolution of the inflammatory process. © 2012 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Extracellular Transglucosylase and α-Amylase of Streptococcus equinus1

    PubMed Central

    Boyer, Ernest W.; Hartman, Paul A.

    1971-01-01

    Culture filtrates of Streptococcus equinus 1091 contained α-amylase and transglucosylase. The effects of calcium carbonate, age of inoculum, concentration of maltose, and duration of the fermentation on α-amylase and transglucosylase production were determined. The extracellular α-amylase was purified 48-fold and was free of transglucosylase activity. The α-amylase (amylose substrate) required Cl− for maximum activity; ethylenediaminetetraacetic acid (EDTA) partially inhibited activity, but CaCl2 prevented EDTA inhibition. The temperature optimum was 38 C at pH 7.0, and the pH optimum was 7.0 at 37 C in the presence of CaCl2. Predominant final products of amylose hydrolysis, in order of decreasing prevalence, were maltose, maltotriose, maltotetraose, and glucose. The α-amylase showed no evidence of multiple attack. The extracellular transglucosylase was purified 27-fold, but a small amount of α-amylase remained. Transglucosylase activity (amylose substrate) was not increased in the presence of CaCl2. The temperature optimum was 37 C at pH 6.5, and the pH optimum was 6.0 at 37 C. Carbohydrates that served as acceptors for the transglucosylase to degrade amylose were, in order of decreasing acceptor efficiency: d-glucose, d-mannose, l-sorbose, maltose, sucrose, and trehalose. The extracellular transglucosylase of S. equinus 1091 synthesized higher maltodextrins in the medium when the cells were grown in the presence of maltose. Images PMID:4995651

  2. Activity of alpha-amylase inhibitors from Phaseolus coccineus on digestive alpha-amylases of the coffee berry borer.

    PubMed

    Valencia-Jiménez, Arnubio; Arboleda Valencia, Jorge W; Grossi-De-Sá, Maria Fátima

    2008-04-09

    Seeds of scarlet runner bean ( Phaseolus coccineus L.) were analyzed for alpha-amylase inhibitor (alpha-AI) activity. Through the use of polyclonal antibodies raised against pure alpha-AI-1 from common bean ( Phaseolus vulgaris L.), typical alpha-AlphaIota polypeptides (Mr 14-18 kDa) as well as a large polypeptide of Mr 32000 Da, usually referred to as "amylase inhibitor like", were detected. The inhibitor activity present in four accessions of P. coccineus was examined, both in semiquantitative zymograms allowing the separation of different isoforms and in quantitative assays against human salivary amylase, porcine pancreatic amylase, and coffee berry borer, Hypothenemus hampei Ferrari (Coleoptera: Scolytidae) amylase. Differential inhibition curves lead to the suggestion that the gene encoding one of the inhibitors in P. coccineus (in accession G35590) would be a good candidate for genetic engineering of coffee resistance toward the coffee berry borer. An in vitro proteolytic digestion treatment of pure alpha-AlphaIota-1 resulted in a rapid loss of the inhibitory activity, seriously affecting its natural capacity to interact with mammalian alpha-amylases.

  3. Alpha-amylases of the coffee berry borer (Hypothenemus hampei) and their inhibition by two plant amylase inhibitors.

    PubMed

    Valencia, A; Bustillo, A E; Ossa, G E; Chrispeels, M J

    2000-03-01

    The adult coffee berry borer (Hypothenemus hampei Ferrari [Coleoptera: Scolytidae]), a major insect pest of coffee, has two major digestive alpha-amylases that can be separated by isoelectric focusing. The alpha-amylase activity has a broad pH optimum between 4.0 and 7.0. Using pH indicators, the pH of the midgut was determined to be between 4.5 and 5.2. At pH 5.0, the coffee berry borer alpha-amylase activity is inhibited substantially (80%) by relatively low levels of the amylase inhibitor (alphaAI-1) from the common bean, Phaseolus vulgaris L., and much less so by the amylase inhibitor from Amaranthus. We used an in-gel zymogram assay to demonstrate that seed extracts can be screened to find suitable inhibitors of amylases. The prospect of using the genes that encode these inhibitors to make coffee resistant to the coffee berry borer via genetic engineering is discussed.

  4. Parotid secretion of fluid and amylase in rabbits during feeding.

    PubMed Central

    Gjörstrup, P

    1980-01-01

    Saliva has been collected from conscious rabbits in response to feeding pellets and carrots and amylase concentrations and flow-rates were measured. Saliva was collected from a polythene tube permanently inserted into the main duct, which, in most cases, kept patent for about a fortnight without any obvious decrease in the secretory capacity of the glands. 2. With pellets the flow-rate varied between 50 and 1250 microliter./min, and the corresponding amylase concentration was relatively constant around 250 units/ml. When carrots were fed, the flow-rates were about threefold lower, but the amylase concentration was raised to a mean value around 1000 units/ml. In spite of the differences in flow-rates, the two kinds of food promoted the same maximum output of amylase, and the output for both kinds of food promoted the same maximum output of amylase, and the output for both kinds of food was found to increase with the flow-rate. 3. The amylase concentration in the saliva decreased after pre- or post-ganglionic sympathetic denervation, reducing the output of amylase by about 50%. However, the amylase concentration was further lowered by beta-adrenoceptor block, which decreased the output by an additional 25%, suggesting that circulating catecholamines contributed to the secretion of amylase. 4. The fluid secretion in response to pellets and carrots was mainly dependent on parasympathetic activity, and for both kinds of food the range of flow-rates was unaltered by sympathectomy or beta-adrenoceptor block. However, at flow-rates below 50 microliter./min, where 25% of all samples with carrots were obtained, sympathetic activity may have contributed significantly to the fluid secretion. 5. In experiments on anaesthetized rabbits, frequency-response curves for amylase and fluid secretion in response to parasympathetic and sympathetic activation were obtained. A comparison between these observations and those obtained in the conscious animals during feeding suggests a

  5. Adsorption of amylase enzyme on ultrafiltration membranes.

    PubMed

    Beier, Søren Prip; Enevoldsen, Ann Dorrit; Kontogeorgis, Georgios M; Hansen, Ernst B; Jonsson, Gunnar

    2007-08-28

    A method to measure the static adsorption on membrane surfaces has been developed and described. The static adsorption of amylase-F has been measured on two different ultrafiltration membranes, both with a cutoff value of 10 kDa (a PES membrane and the ETNA10PP membrane, which is a surface-modified PVDF membrane). The adsorption follows the Langmuir adsorption theory. Thus, the static adsorption consists of monolayer coverage and is expressed both as a permeability drop and an adsorption resistance. From the adsorption isotherms, the maximum static permeability drops and the maximum static adsorption resistances are determined. The maximum static permeability drop for the hydrophobic PES membrane is 75%, and the maximum static adsorption resistance is 0.014 m2.h.bar/L. The maximum static permeability drop for the hydrophilic surface-modified PVDF membrane (ETNA10PP) is 23%, and the maximum static adsorption resistance is 0.0046 m2.h.bar/L. The difference in maximum static adsorption, by a factor of around 3, affects the performance during the filtration of a 5 g/L amylase-F solution at 2 bar. The two membranes behave very similarly during filtration with almost equal fluxes and retentions even though the initial water permeability of the PES membrane is around 3 times larger than the initial water permeability of the ETNA10PP membrane. This is mainly attributed to the larger maximum static adsorption of the PES membrane. The permeability drop during filtration exceeds the maximum static permeability drop, indicating that the buildup layer on the membranes during filtration exceeds monolayer coverage, which is also seen by the increase in fouling resistance during filtration. The accumulated layer on the membrane surface can be described as a continually increasing cake-layer thickness, which is independent of the membrane type. At higher concentrations of enzyme, concentration polarization effects cannot be neglected. Therefore, stagnant film theory and the osmotic

  6. Amylase expression in taste receptor cells of rat circumvallate papillae.

    PubMed

    Merigo, Flavia; Benati, Donatella; Cecchini, Maria Paola; Cristofoletti, Mirko; Osculati, Francesco; Sbarbati, Andrea

    2009-06-01

    The chemical composition of the luminal content is now accepted to have a profound influence on the performance of chemosensory receptors. Gustatory and intestinal chemoreceptors have in common their expression of molecules involved in taste sensing and signal transduction pathways. The recent finding that enterocytes of the duodenal epithelium are capable of expressing luminal pancreatic amylase suggests that taste cells of the gustatory epithelium might, in the same way, express salivary amylase in the oral cavity. Therefore, we investigated amylase expression in rat circumvallate papillae by using analyses involving immunohistochemistry, Western blot, and reverse transcription with the polymerase chain reaction. In addition, we used double-labeling confocal laser microscopy to compare amylase immunolabeling with that of the following markers: protein gene product 9.5 (PGP 9.5) and chromogranin A (CgA) for endocrine cells, alpha-gustducin and phospholipase C beta 2 (PLC beta 2) as taste-signaling molecules, and cystic fibrosis transmembrane regulator (CFTR) and Clara-cell-specific secretory protein of 10-kDa (CC10) as secretory markers. The results showed that amylase was present in some taste bud cells; its immunoreactivity was observed in subsets of cells that expressed CgA, alpha-gustducin, PLC beta 2, CFTR, or CC10. PGP 9.5 immunoreactivity was never colocalized with amylase. The data suggest that amylase-positive cells constitute an additional subset of taste receptor cells also associated with chemoreceptorial and/or secretory molecules, confirming the occurrence of various pathways in taste buds.

  7. Antiviral Cystine Knot α-Amylase Inhibitors from Alstonia scholaris.

    PubMed

    Nguyen, Phuong Quoc Thuc; Ooi, Justin Seng Geap; Nguyen, Ngan Thi Kim; Wang, Shujing; Huang, Mei; Liu, Ding Xiang; Tam, James P

    2015-12-25

    Cystine knot α-amylase inhibitors are cysteine-rich, proline-rich peptides found in the Amaranthaceae and Apocynaceae plant species. They are characterized by a pseudocyclic backbone with two to four prolines and three disulfides arranged in a knotted motif. Similar to other knottins, cystine knot α-amylase inhibitors are highly resistant to degradation by heat and protease treatments. Thus far, only the α-amylase inhibition activity has been described for members of this family. Here, we show that cystine knot α-amylase inhibitors named alstotides discovered from the Alstonia scholaris plant of the Apocynaceae family display antiviral activity. The alstotides (As1-As4) were characterized by both proteomic and genomic methods. All four alsotides are novel, heat-stable and enzyme-stable and contain 30 residues. NMR determination of As1 and As4 structures reveals their conserved structural fold and the presence of one or more cis-proline bonds, characteristics shared by other cystine knot α-amylase inhibitors. Genomic analysis showed that they contain a three-domain precursor, an arrangement common to other knottins. We also showed that alstotides are antiviral and cell-permeable to inhibit the early phase of infectious bronchitis virus and Dengue infection, in addition to their ability to inhibit α-amylase. Taken together, our results expand membership of cystine knot α-amylase inhibitors in the Apocynaceae family and their bioactivity, functional promiscuity that could be exploited as leads in developing therapeutics. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Analysis on evolutionary relationship of amylases from archaea, bacteria and eukaryota.

    PubMed

    Yan, Shaomin; Wu, Guang

    2016-02-01

    Amylase is one of the earliest characterized enzymes and has many applications in clinical and industrial settings. In biotechnological industries, the amylase activity is enhanced through modifying amylase structure and through cloning and expressing targeted amylases in different species. It is important to understand how engineered amylases can survive from generation to generation. This study used phylogenetic and statistical approaches to explore general patterns of amylases evolution, including 3118 α-amylases and 280 β-amylases from archaea, eukaryota and bacteria with fully documented taxonomic lineage. First, the phylogenetic tree was created to analyze the evolution of amylases with focus on individual amylases used in biofuel industry. Second, the average pairwise p-distance was computed for each kingdom, phylum, class, order, family and genus, and its diversity implies multi-time and multi-clan evolution. Finally, the variance was further partitioned into inter-clan variance and intra-clan variance for each taxonomic group, and they represent horizontal and vertical gene transfer. Theoretically, the results show a full picture on the evolution of amylases in manners of vertical and horizontal gene transfer, and multi-time and multi-clan evolution as well. Practically, this study provides the information on the surviving chance of desired amylase in a given taxonomic group, which may potentially enhance the successful rate of cloning and expression of amylase gene in different species.

  9. Elevated Gene Copy Number Does Not Always Explain Elevated Amylase Activities in Fishes.

    PubMed

    German, Donovan P; Foti, Dolly M; Heras, Joseph; Amerkhanian, Hooree; Lockwood, Brent L

    2016-01-01

    Amylase activity variation in the guts of several model organisms appears to be explained by amylase gene copy number variation. We tested the hypothesis that amylase gene copy number is always elevated in animals with high amylolytic activity. We therefore sequenced the amylase genes and examined amylase gene copy number in prickleback fishes (family Stichaeidae) with different diets including two species of convergently evolved herbivores with the elevated amylase activity phenotype. We found elevated amylase gene copy number (six haploid copies) with sequence variation among copies in one herbivore (Cebidichthys violaceus) and modest gene copy number (two to three haploid copies) with little sequence variation in the remaining taxa, which included herbivores, omnivores, and a carnivore. Few functional differences in amylase biochemistry were observed, and previous investigations showed similar digestibility among the convergently evolved herbivores with differing amylase genetics. Hence, the phenotype of elevated amylase activity can be achieved by different mechanisms (i.e., elevated expression of fewer genes, increased gene copy number, or expression of more efficient amylase proteins) with similar results. Phylogenetic and comparative genomic analyses of available fish amylase genes show mostly lineage-specific duplication events leading to gene copy number variation, although a whole-genome duplication event or chromosomal translocation may have produced multiple amylase copies in the Ostariophysi, again showing multiple routes to the same result.

  10. Effects of a new microbial α-amylase inhibitor protein on Helicoverpa armigera larvae.

    PubMed

    Zeng, Fanrong; Wang, Xiaojing; Cui, Jinjie; Ma, Yan; Li, Qiannan

    2013-03-06

    A new microbial α-amylase inhibitor gene was cloned and characterized. The encoded, recombinant, α-amylase inhibitor protein was induced and expressed by isopropyl β-d-1-thiogalactopyranoside (IPTG) in Escherichia coli M15 cells. The effects of the α-amylase inhibitor protein on Helicoverpa armigera larvae were studied. Compared to the control, the weight of H. armigera larvae fed the diet with recombinant α-amylase inhibitor protein added at a concentration of 20 μg/g was reduced by 49.8%. The total soluble protein of H. armigera larvae fed the diet with the α-amylase inhibitor protein added was also reduced by 36.8% compared to the control. The recombinant α-amylase inhibitor protein showed inhibition activity against α-amylase of H. armigera. These results suggested that this α-amylase inhibitor protein may be a promising bioinsecticide candidate for controlling H. armigera.

  11. Zinc oxide nanoparticles as novel alpha-amylase inhibitors

    NASA Astrophysics Data System (ADS)

    Dhobale, Sandip; Thite, Trupti; Laware, S. L.; Rode, C. V.; Koppikar, Soumya J.; Ghanekar, Ruchika-Kaul; Kale, S. N.

    2008-11-01

    Amylase inhibitors, also known as starch blockers, contain substances that prevent dietary starches from being absorbed by the body via inhibiting breakdown of complex sugars to simpler ones. In this sense, these materials are projected as having potential applications in diabetes control. In this context, we report on zinc oxide nanoparticles as possible alpha-amylase inhibitors. Zinc oxide nanoparticles have been synthesized using soft-chemistry approach and 1-thioglycerol was used as a surfactant to yield polycrystalline nanoparticles of size ˜18 nm, stabilized in wurtzite structure. Conjugation study and structural characterization have been done using x-ray diffraction technique, Fourier transform infrared spectroscopy, UV-visible spectroscopy, and transmission electron microscopy. Cytotoxicity studies on human fibrosarcoma (HT-1080) and skin carcinoma (A-431) cell lines as well as mouse primary fibroblast cells demonstrate that up to a dose of 20 μg/ml, ZnO nanoparticles are nontoxic to the cells. We report for the first time the alpha-amylase inhibitory activity of ZnO nanoparticles wherein an optimum dose of 20 μg/ml was sufficient to exhibit 49% glucose inhibition at neutral pH and 35 °C temperature. This inhibitory activity was similar to that obtained with acarbose (a standard alpha-amylase inhibitor), thereby projecting ZnO nanoparticles as novel alpha-amylase inhibitors.

  12. Alpha-amylase from the Hyperthermophilic Archaeon Thermococcus thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, E. C. M. J.; Pusey, M. L.; Ng, M. L.; Garriott, O. K.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments such as hot springs. The ability of survival at extreme conditions has rendered enzymes from extremophiles to be of interest in industrial applications. One approach to producing these extremozymes entails the expression of the enzyme-encoding gene in a mesophilic host such as E.coli. This method has been employed in the effort to produce an alpha-amylase from a hyperthermophile (an organism that displays optimal growth above 80 C) isolated from a hydrothermal vent at the Rainbow vent site in the Atlantic Ocean. alpha-amylases catalyze the hydrolysis of starch to produce smaller sugars and constitute a class of industrial enzymes having approximately 25% of the enzyme market. One application for thermostable alpha-amylases is the starch liquefaction process in which starch is converted into fructose and glucose syrups. The a-amylase encoding gene from the hyperthermophile Thermococcus thioreducens was cloned and sequenced, revealing high similarity with other archaeal hyperthermophilic a-amylases. The gene encoding the mature protein was expressed in E.coli. Initial characterization of this enzyme has revealed an optimal amylolytic activity between 85-90 C and around pH 5.3-6.0.

  13. A novel electrochemical method to determine α-amylase activity.

    PubMed

    Zhang, Juan; Cui, Junhui; Liu, Ying; Chen, Yangyang; Li, Genxi

    2014-07-07

    In this paper, we report a novel electrochemical method that can be developed as a biosensor for simple and direct determination of α-amylase activity. The method is based on the hydrolysis of maltopentaose, the substrate of the enzyme, which is immobilized on the surface of a gold electrode, and the induced charge changes of the substrate-modified electrode. Specifically, the substrate maltopentaose is immobilized onto a gold electrode surface via a simple and direct immobilization technique that involves a one-step and site-specific attachment of unmodified maltopentaose to the hydrazide-derivatized surface. So, by analyzing the electrochemical signal obtained from the electro-active molecule [Ru(NH3)5Cl](2+) during the hydrolysis of maltopentaose, the determination of α-amylase activity is achieved. Under optimized conditions, α-amylase activity can be assayed with a detection limit of 0.022 U mL(-1). The biosensor exhibits a rapid response, good stability and anti-interference ability. Furthermore, the biosensor has also been successfully applied to detect α-amylase in human serum, which shows acceptable accuracy compared to the currently used clinical method. The proposed method in this work may also have potential application of α-amylase determination in real blood samples, diagnostics and food production in the future.

  14. Computer-aided subsite mapping of α-amylases.

    PubMed

    Mótyán, János A; Gyémánt, Gyöngyi; Harangi, János; Bagossi, Péter

    2011-02-15

    Subsite mapping is a crucial procedure in the characterization of α-amylases (EC 3.2.1.1), which are extensively used in starch-based industries and in diagnosis of pancreatic and salivary glands disorders. A computer-aided method has been developed for subsite mapping of α-amylases, which substitutes the difficult, expensive, and time-consuming experimental determination of action patterns to crystal structures based energy calculations. Interaction energies between enzymes and carbohydrate substrates were calculated after short energy minimization by a molecular mechanics program. A training set of wild type and mutant amylases with known experimental action patterns of 13 enzymes of wide range of origin was used to set up the procedure. Calculations for training set resulted in good correlation in case of subsite binding energies (r(2)=0.827-0.929) and bond cleavage frequencies (r(2)=0.727-0.835). A set of eight novel barley amylase 1 mutants was used to test our model. Subsite binding energies were predicted with r(2)=0.502 correlation coefficient, while bond cleavage frequency prediction resulted in r(2)=0.538. Our computer-aided procedure may supplement the experimental subsite mapping methods to predict and understand characteristic features of α-amylases.

  15. Alpha-amylase from the Hyperthermophilic Archaeon Thermococcus thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, E. C. M. J.; Pusey, M. L.; Ng, M. L.; Garriott, O. K.

    2003-01-01

    Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments such as hot springs. The ability of survival at extreme conditions has rendered enzymes from extremophiles to be of interest in industrial applications. One approach to producing these extremozymes entails the expression of the enzyme-encoding gene in a mesophilic host such as E.coli. This method has been employed in the effort to produce an alpha-amylase from a hyperthermophile (an organism that displays optimal growth above 80 C) isolated from a hydrothermal vent at the Rainbow vent site in the Atlantic Ocean. alpha-amylases catalyze the hydrolysis of starch to produce smaller sugars and constitute a class of industrial enzymes having approximately 25% of the enzyme market. One application for thermostable alpha-amylases is the starch liquefaction process in which starch is converted into fructose and glucose syrups. The a-amylase encoding gene from the hyperthermophile Thermococcus thioreducens was cloned and sequenced, revealing high similarity with other archaeal hyperthermophilic a-amylases. The gene encoding the mature protein was expressed in E.coli. Initial characterization of this enzyme has revealed an optimal amylolytic activity between 85-90 C and around pH 5.3-6.0.

  16. Production of Amylase in Liquid Culture by a Strain of Aspergillus oryzae

    PubMed Central

    Kundu, A. K.; Das, S.

    1970-01-01

    The effect of different media and pH on the formation of amylase by Aspergillus oryzae EI 212 is described. Depending upon the composition of the medium and growth conditions, the fungus was found to secrete α- or β-amylase, or both. Some of the properties of the partially purified α-amylase were found to be different from α-amylases from other sources. PMID:5418942

  17. Beta-amylase-resistant amylose. Effect of urea on the limited hydrolysis of amylose by beta-amylase.

    PubMed

    Patil, N B

    1976-02-01

    Amylose prepared from starch dispersed in 10M-urea, pH6.2, was found to be resistant to the action of beta-amylase and phosphorylase, though it was degraded by alpha-amylase. Amylose isolated by conventional methods was similarly refractory after urea treatment, and was hydrolysed by beta-amylase to the extent of 32-35%; it had no inhibitory effect towards beta-amylase. The physical and chemical properties of the modified amylose were in general comparable with those of normal amylose with a beta-amylolysis limit of 94-98%. Starch and amylopectin were unaffected by urea treatment, i.e. the presence of amylopectin protected amylose against changes induced in it by urea. It is speculated that urea treatment "freezes" amylose molecules in a conformation that renders non-reducing termini inaccessible to the active site of the exo-enzymes. Such changes may limit the degradative action of beta-amylase and phosphorylase.

  18. 21 CFR 184.1012 - α-Amylase enzyme preparation from Bacillus stearothermophilus.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false α-Amylase enzyme preparation from Bacillus... GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1012 α-Amylase enzyme preparation from Bacillus stearothermophilus. (a) α-Amylase enzyme preparation is obtained from the...

  19. 21 CFR 184.1012 - α-Amylase enzyme preparation from Bacillus stearothermophilus.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false α-Amylase enzyme preparation from Bacillus... GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1012 α-Amylase enzyme preparation from Bacillus stearothermophilus. (a) α-Amylase enzyme preparation is obtained from the...

  20. 21 CFR 184.1012 - α-Amylase enzyme preparation from Bacillus stearothermophilus.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false α-Amylase enzyme preparation from Bacillus... GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1012 α-Amylase enzyme preparation from Bacillus stearothermophilus. (a) α-Amylase enzyme preparation is obtained from the...

  1. 21 CFR 184.1012 - α-Amylase enzyme preparation from Bacillus stearothermophilus.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true α-Amylase enzyme preparation from Bacillus... GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1012 α-Amylase enzyme preparation from Bacillus stearothermophilus. (a) α-Amylase enzyme preparation is obtained from the...

  2. Electrophoretically unique amylases in rat livers: phylogenic and ontogenic study on the mammalian liver.

    PubMed

    Koyama, Iwao; Komine, Shin-Ichi; Hokari, Shigeru; Matsunaga, Toshiyuki; Nakamura, Koh-Ich; Komoda, Tsugikazu

    2002-09-01

    Liver amylase activity in rodents was assayed with Blue Starch as substrate, and found to be higher than in humans or pigs. Based on the result of concanavalin A affinity chromatography, we found that the sugar moieties of amylase molecules increased in parallel with amylase activity in the tested mammals. However, the amounts of amylase proteins determined by Western bloting with anti-human salivary-type antibody as the probe, were similar to the levels in mammalian livers. Moreover, a similar expression of amylase mRNA was also detected in the mammalian livers by a reverse transcriptional-polymerase chain reaction using primers specific for the human salivary and/or pancreatic amylase complementary DNA (cDNA) sequences. The amylase was detected at the catalytic activity, protein molecule and mRNA levels in rat liver at all ages from fetus to adult. Salivary-type liver amylase activity increased up to one week after birth, and was maintained at the adult level thereafter. However, based on the results of the electrophoretic mobility test, livers with accelerated amylase activity, e.g., at 2-4 weeks after birth or during liver regeneration after partial hepatectomy, were also found to express an amylase electrophoretical identical to pancreatic-type amylase in addition to salivary-type activity. These results suggest that the liver may express an etopic amylase in a certain condition.

  3. Characterization of alpha-amylase inhibitor from Palo Fierro seeds.

    PubMed

    Guzman-Partida, A M; Jatomea-Fino, O; Robles-Burgueño, M R; Ortega-Nieblas, M; Vazquez-Moreno, L

    2007-09-01

    Alpha amylase inhibitor from Palo Fierro seeds (alphaAI-PF) was purified using affinity chromatography on a fetuin-fractogel column followed by anionic exchange chromatography. AlphaAI-PF has a molecular mass of 77kDa with two subunits (15.8 and 17.4 kDa), it is nonglycosylated and has pI of 4.7. AlphaAI-PF inhibited porcine pancreatic alpha-amylase (PPA) (1,4-alpha-D-glucan glucanohydrolase; EC 3.2.1.1), but was almost devoid of inhibitory activity on alpha-amylase extracts from Zabrotes subfasciatus (ZSA). Analysis of alphaAI-PF peptides showed a high homology to alphaAI-1 from Phaseolus vulgaris that also inhibits PPA.

  4. [The β-amylase polymorphism of winter common wheat grains].

    PubMed

    Netsvetaev, V P; Akinshina, O V; Bondarenko, L S; Motorina, I P

    2012-02-01

    The polymorphism of winter common wheat with respect to β-amylase isoenzymes has been analyzed using electrophoresis in polyacrylamide gel (PAAG) buffered with a Tris-glycine system (pH 8.3). Seven β-amylase isoenzymes have been found in wheat cultivars and the breeding stock. Isoenzymes A, B, and C are the most frequent in Russian and Ukrainian cultivars (51.7 4.7, 30.7 3.8, and 11.9 2.5%, respectively). Two alleles of the β-Amy-D1 locus of the long arm of chromosome 4D have been identified. The substrate-enzyme affine effect can be used to locate the zones of activity of this enzyme by means of staining for proteins. It has been determined that β-amylase zymotypes may play a role in the aggregating capacity of the grain protein complex via the formation of S-S bonds.

  5. False-positive results with amylase testing of citrus fruits.

    PubMed

    Ricci, Ugo; Carboni, Ilaria; Torricelli, Francesca

    2014-09-01

    In a case of robbery in which the criminals passed through the garden adorned with calamondin trees (Citrus madurensis), the investigators found in the grass six calamondin fruits, some undamaged, while others apparently bitten. The fruits were collected and sent to the laboratory for DNA analysis to verify the presence of saliva and robbers' DNA profile. A specific immunochromatographic strip test for saliva confirmed the presence of human salivary α-amylase, but similar positive results were also observed for intact calamondin and other citrus fruits. Further analysis with a specific automated amylase test confirmed the absence of amylase activity. DNA quantification and typing using a specific forensic kit revealed no human DNA presence in any fruits. This case report demonstrates for the first time the occurrence of false positives when human saliva is sought on citrus fruits. © 2014 American Academy of Forensic Sciences.

  6. Immobilization of α-Amylase onto Luffa operculata Fibers

    PubMed Central

    Morais, Ricardo R.; Pascoal, Aline M.; Caramori, Samantha S.; Lopes, Flavio M.; Fernandes, Kátia F.

    2013-01-01

    A commercial amylase (amy) was immobilized by adsorption onto Luffa operculata fibers (LOFs). The derivative LOF-amy presented capacity to hydrolyze starch continuously and repeatedly for over three weeks, preserving more than 80% of the initial activity. This system hydrolyzed more than 97% of starch during 5 min, at room temperature. LOF-amy was capable to hydrolyze starch from different sources, such as maize (93.96%), wheat (85.24%), and cassava (79.03%). A semi-industrial scale reactor containing LOF-amy was prepared and showed the same yield of the laboratory-scale system. After five cycles of reuse, the LOF-amy reactor preserved over 80% of the initial amylase activity. Additionally, the LOF-amy was capable to operate as a kitchen grease trap component in a real situation during 30 days, preserving 30% of their initial amylase activity. PMID:23606948

  7. Anaerobic threshold determination with analysis of salivary amylase.

    PubMed

    Calvo, F; Chicharro, J L; Bandrés, F; Lucía, A; Pérez, M; Alvarez, J; Mojares, L L; Vaquero, A F; Legido, J C

    1997-12-01

    The purpose of this study was to determine the anaerobic threshold from analysis of amylase concentration in total saliva during a laboratory exercise test. Each of 20 healthy young men performed both a submaximal and a maximal test on a treadmill. During the submaximal test, capillary blood and total saliva samples were collected for determination of anaerobic threshold (AT) and saliva threshold (Tsa), respectively. Tsa was defined as the point at which the first continuous increase in amylase concentration occurred during exercise. The results showed no significant difference between values of AT and Tsa when both were expressed either as running velocity or as heart rate. In addition, there existed a high correlation between AT and Tsa (r = .93, p < .001). It was therefore concluded that the analysis of amylase concentration in total saliva during exercise might be used as a valid new method for determining AT.

  8. Cloning and expression of a chicken alpha-amylase gene.

    PubMed

    Benkel, B F; Nguyen, T; Ahluwalia, N; Benkel, K I; Hickey, D A

    1997-06-19

    We have isolated and sequenced a genomic clone for a pancreatic alpha-amylase gene (amy) of the chicken (Gallus gallus). The gene is interrupted by nine introns, spans over 4 kb, and encodes a protein (AMY) of 512 aa that is 83% identical to the human pancreatic alpha-amylase enzyme. Southern blot analysis of chicken DNA revealed two distinct pancreatic amy loci. In addition, we have generated a cDNA from chicken pancreatic RNA corresponding to the coding sequence of the genomic clone. The cDNA was inserted into a yeast expression vector, and the resulting construct used to transform Saccharomyces cerevisiae cells. Transformed yeast cells synthesized and secreted active AMY enzyme, and the gel migration pattern of the alpha-amylase produced by the yeast cells was identical to that of the native chicken enzyme.

  9. Molecular characterization of α-amylase from Staphylococcus aureus.

    PubMed

    Lakshmi, Hanumanthu Prasanna; Prasad, Uppu Venkateswara; Yeswanth, Sthanikam; Swarupa, Vimjam; Prasad, Osuru Hari; Narasu, Mangamoori Lakshmi; Sarma, Potukuchi Venkata Gurunadha Krishna

    2013-01-01

    Staphylococcus aureus is one of the prominent Gram positive human pathogen secretes many surface and secretary proteins including various enzymes and pathogenic factors that favour the successful colonization and infection of host tissue. α-amylase is one of the enzymes secreted by S. aureus which catalyses the breakdown of complex sugars to monosaccharides, which are required for colonization and survival of this pathogen in any anatomical locales. In the present study we have cloned, sequenced, expressed and characterized α-amylase gene from S. aureus ATCC12600. The recombinant enzyme has a molecular weight of 58kDa and the kinetics showed Vmax 0.0208±0.033 (mg/ml)/mg/min and Km 10.633±0.737mg/ml. The multiple sequence analysis showed α- amylase of S. aureus exhibited large differences with Bacillus subtilis and Streptococcus bovis. As the crystal structure of S. aureus α- amylase was unavailable, we used homology modelling method to build the structure. The built structure was validated by Ramachandran plot which showed 90% of the residues in the allowed region while no residue was found in the disallowed region and the built structure was close to the crystal structure with Z-Score: -6.85. The structural superimposition studies with α- amylases of Bacillus subtilis and Streptococcus bovis showed distinct differences with RMSD values of 18.158Åand 7.091Å respectively which correlated with enzyme kinetics, indicating α-amylase is different among these bacteria.

  10. Molecular characterization of α-amylase from Staphylococcus aureus

    PubMed Central

    Lakshmi, Hanumanthu Prasanna; Prasad, Uppu Venkateswara; Yeswanth, Sthanikam; Swarupa, Vimjam; Prasad, Osuru Hari; Narasu, Mangamoori Lakshmi; Sarma, Potukuchi Venkata Gurunadha Krishna

    2013-01-01

    Staphylococcus aureus is one of the prominent Gram positive human pathogen secretes many surface and secretary proteins including various enzymes and pathogenic factors that favour the successful colonization and infection of host tissue. α-amylase is one of the enzymes secreted by S. aureus which catalyses the breakdown of complex sugars to monosaccharides, which are required for colonization and survival of this pathogen in any anatomical locales. In the present study we have cloned, sequenced, expressed and characterized α-amylase gene from S. aureus ATCC12600. The recombinant enzyme has a molecular weight of 58kDa and the kinetics showed Vmax 0.0208±0.033 (mg/ml)/mg/min and Km 10.633±0.737mg/ml. The multiple sequence analysis showed α- amylase of S. aureus exhibited large differences with Bacillus subtilis and Streptococcus bovis. As the crystal structure of S. aureus α- amylase was unavailable, we used homology modelling method to build the structure. The built structure was validated by Ramachandran plot which showed 90% of the residues in the allowed region while no residue was found in the disallowed region and the built structure was close to the crystal structure with Z-Score: -6.85. The structural superimposition studies with α- amylases of Bacillus subtilis and Streptococcus bovis showed distinct differences with RMSD values of 18.158Åand 7.091Å respectively which correlated with enzyme kinetics, indicating α-amylase is different among these bacteria. PMID:23559746

  11. Magnetic alginate microparticles for purification of alpha-amylases.

    PubMed

    Safaríková, M; Roy, I; Gupta, M N; Safarík, I

    2003-11-06

    Spherical magnetic alginate microparticles (25-60 microm in diameter) were prepared using the microemulsion system, with water-saturated 1-pentanol as the organic phase. The limited solubility of 1-pentanol in water enabled simple removal of the organic solvent from the prepared beads with water solution. The prepared alginate microparticles were used as magnetic affinity adsorbents for specific purification of alpha-amylases. Enzyme activity was eluted by 1.0 M maltose. alpha-Amylases from Bacillus amyloliquefaciens and porcine pancreatic acetone powder were purified 9- and 12-fold with 88 and 96% activity recovery, respectively.

  12. Mango starch degradation. II. The binding of alpha-amylase and beta-amylase to the starch granule.

    PubMed

    Peroni, Fernanda Helena Gonçalves; Koike, Claudia; Louro, Ricardo Pereira; Purgatto, Eduardo; do Nascimento, João Roberto Oliveira; Lajolo, Franco Maria; Cordenunsi, Beatriz Rosana

    2008-08-27

    During mango ripening, soluble sugars that account for mango sweetening are accumulated through carbon supplied by both photosynthesis and starch degradation. The cultivar Keitt has a characteristic dependence on sugar accumulation during starch degradation, which takes place during ripening, only a few days after detachment from the tree. Most knowledge about starch degradation is based on seeds and leaves currently used as models. However, information about the mango fruit is scarce. This work presents the evaluation of alpha- and beta-amylases in the starch granule surface during fruit development and ripening. Extractable proteins were assayed for amylase activity and detected by immunofluorescence microscopy and correlated to gene expression. The results suggest that both amylases are involved in starch degradation during mango ripening, probably under the dependence of another signal triggered by the detachment from the mother-plant.

  13. [Alpha-amylase polymorphism. 1. A comparative study of alpha-amylase Hp and Gm].

    PubMed

    Baltova, S; Popov, K; Kŭnchev, V

    1989-01-01

    Individual phenotypes, phenotypical and genetic frequencies of the alpha-amylase enzyme have been established by means of populational genetic researches. The most common phenotype is AmylA Amyl2A (85.15%) followed by AmylA Amyl2A 2B (6.27%), AmylAIB Amyl2A (5.37%), Amyl IA Amyl2A 2B (2.15%), AmylA Amyl2B (0.53%), AmylC Amyl2B (0.35%), AmylC Amyl2A 2B (0.18%). The difference between the observed and theoretically expected phenotypes of Amy, Hp and M Gm(1) is insignificant. The examined contingent from the Bulgarian population is found to be in genetic balance. Statistical analysis of the reuö results does not prove a genetic link between Amy, Hp and Gm (1).

  14. Close relationship of a novel Flavobacteriaceae α-amylase with archaeal α-amylases and good potentials for industrial applications.

    PubMed

    Li, Chunfang; Du, Miaofen; Cheng, Bin; Wang, Lushan; Liu, Xinqiang; Ma, Cuiqing; Yang, Chunyu; Xu, Ping

    2014-01-31

    Bioethanol production from various starchy materials has received much attention in recent years. α-Amylases are key enzymes in the bioconversion process of starchy biomass to biofuels, food or other products. The properties of thermostability, pH stability, and Ca-independency are important in the development of such fermentation process. A novel Flavobacteriaceae Sinomicrobium α-amylase (FSA) was identified and characterized from genomic analysis of a novel Flavobacteriaceae species. It is closely related with archaeal α-amylases in the GH13_7 subfamily, but is evolutionary distant with other bacterial α-amylases. Based on the conserved sequence alignment and homology modeling, with minor variation, the Zn2+- and Ca2+-binding sites of FSA were predicated to be the same as those of the archaeal thermophilic α-amylases. The recombinant α-amylase was highly expressed and biochemically characterized. It showed optimum activity at pH 6.0, high enzyme stability at pH 6.0 to 11.0, but weak thermostability. A disulfide bond was introduced by site-directed mutagenesis in domain C and resulted in the apparent improvement of the enzyme activity at high temperature and broad pH range. Moreover, about 50% of the enzyme activity was detected under 100°C condition, whereas no activity was observed for the wild type enzyme. Its thermostability was also enhanced to some extent, with the half-life time increasing from 25 to 55 minutes at 50°C. In addition, after the introduction of the disulfide bond, the protein became a Ca-independent enzyme. The improved stability of FSA suggested that the domain C contributes to the overall stability of the enzyme under extreme conditions. In addition, successfully directed modification and special evolutionary status of FSA imply its directional reconstruction potentials for bioethanol production, as well as for other industrial applications.

  15. Close relationship of a novel Flavobacteriaceae α-amylase with archaeal α-amylases and good potentials for industrial applications

    PubMed Central

    2014-01-01

    Background Bioethanol production from various starchy materials has received much attention in recent years. α-Amylases are key enzymes in the bioconversion process of starchy biomass to biofuels, food or other products. The properties of thermostability, pH stability, and Ca-independency are important in the development of such fermentation process. Results A novel Flavobacteriaceae Sinomicrobium α-amylase (FSA) was identified and characterized from genomic analysis of a novel Flavobacteriaceae species. It is closely related with archaeal α-amylases in the GH13_7 subfamily, but is evolutionary distant with other bacterial α-amylases. Based on the conserved sequence alignment and homology modeling, with minor variation, the Zn2+- and Ca2+-binding sites of FSA were predicated to be the same as those of the archaeal thermophilic α-amylases. The recombinant α-amylase was highly expressed and biochemically characterized. It showed optimum activity at pH 6.0, high enzyme stability at pH 6.0 to 11.0, but weak thermostability. A disulfide bond was introduced by site-directed mutagenesis in domain C and resulted in the apparent improvement of the enzyme activity at high temperature and broad pH range. Moreover, about 50% of the enzyme activity was detected under 100°C condition, whereas no activity was observed for the wild type enzyme. Its thermostability was also enhanced to some extent, with the half-life time increasing from 25 to 55 minutes at 50°C. In addition, after the introduction of the disulfide bond, the protein became a Ca-independent enzyme. Conclusions The improved stability of FSA suggested that the domain C contributes to the overall stability of the enzyme under extreme conditions. In addition, successfully directed modification and special evolutionary status of FSA imply its directional reconstruction potentials for bioethanol production, as well as for other industrial applications. PMID:24485248

  16. Glucose released by hydrolytic activity of amylase influences the pigment synthesis in Penicillium sp NIOM-02.

    PubMed

    Puttananjaiah, Mohan-Kumari H; Dhale, Mohan A

    2013-01-01

    Carbon catabolite repression is generally considered as a regulatory mechanism to ensure sequential synthesis of secondary metabolites. In this study we made an attempt to understand the influence of amylase activity on pigment synthesis in Penicillium sp NIOM-02. The amylase activity is inversely proportional to pigment production. The high performance liquid chromatography analysis of amylase reaction revealed glucose as the major product of starch hydrolysis. The fungus grown in acarbose (inhibitor of amylase) incorporated media produced higher quantities of pigments. Apparently, glucose released due to amylase activity influenced the pigment synthesis by cAMP signaling pathway. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Synthesis and secretion of wheat alpha-amylase in Saccharomyces cerevisiae.

    PubMed

    Rothstein, S J; Lahners, K N; Lazarus, C M; Baulcombe, D C; Gatenby, A A

    1987-01-01

    A wheat alpha-amylase cDNA clone has been fused to the phosphoglycerate kinase initiator methionine to enable synthesis in the yeast Saccharomyces cerevisiae of an alpha-amylase enzyme that is identical in size to the wild-type alpha-amylase. The alpha-amylase is synthesized with an N-terminal plant signal peptide which is recognized in the yeast host, leading to efficient processing and secretion into the medium. The secretion of alpha-amylase into the medium is quite efficient in rich medium, but barely detectable in a minimal medium.

  18. Effects of infrared radiation, solar cooking and microwave cooking on alpha-amylase inhibitor in sorghum (Sorghum bicolor L.).

    PubMed

    Mulimani, V H; Supriya, D

    1994-10-01

    Three domestic cooking methods were studied in alpha-amylase inhibitory activity in sorghum grains. In all the treatments, overnight soaked seeds lost amylase inhibitory activity much faster. All the three treatments reduced the inhibitory activity. Use of solar cooker for reducing amylase inhibitory activity works out very economically and efficiently. Microwave cooking eliminates amylase inhibitory activity within 5 minutes.

  19. Cloning and sequencing of the gene encoding thermophilic beta-amylase of Clostridium thermosulfurogenes.

    PubMed Central

    Kitamoto, N; Yamagata, H; Kato, T; Tsukagoshi, N; Udaka, S

    1988-01-01

    A gene coding for thermophilic beta-amylase of Clostridium thermosulfurogenes was cloned into Bacillus subtilis, and its nucleotide sequence was determined. The nucleotide sequence suggested that the thermophilic beta-amylase is translated from monocistronic mRNA as a secretory precursor with a signal peptide of 32 amino acid residues. The deduced amino acid sequence of the mature beta-amylase contained 519 residues with a molecular weight of 57,167. The amino acid sequence of the C. thermosulfurogenes beta-amylase showed 54, 32, and 32% homology with those of the Bacillus polymyxa, soybean, and barley beta-amylases, respectively. Twelve well-conserved regions were found among the amino acid sequences of the four beta-amylases. To elucidate the mechanism rendering the C. thermosulfurogenes beta-amylase thermophilic, its amino acid sequence was compared with that of the B. polymyxa beta-amylase. The C. thermosulfurogenes beta-amyulase contained more Cys residues and fewer hydrophilic amino acid residues than the B. polymyxa beta-amylase did. Several regions were found in the amino acid sequence of the C. thermosulfurogenes beta-amylase, where the hydrophobicity was remarkably high as compared with that of the corresponding regions of the B. polymyxa beta-amylase. PMID:2461360

  20. Clinical and immunological responses to occupational exposure to alpha-amylase in the baking industry.

    PubMed

    Brisman, J; Belin, L

    1991-09-01

    alpha-Amylase is a starch cleaving enzyme often used in the baking industry as a flour additive. It is usually of fungal origin, produced by Aspergillus oryzae. One previous report has shown IgE antibodies and positive skin prick test against alpha-amylase in asthmatic bakers. This paper describes four alpha-amylase sensitised index cases with occupational asthma or rhinitis and the results of a cross sectional study of 20 workers from the same factory who were also exposed to alpha-amylase powder. Air sampling detected airborne alpha-amylase at a concentration of 0.03 mg/m3. Significantly more work related symptoms such as rhinitis and dermatitis were found among the alpha-amylase exposed workers compared with referents. A skin prick test to alpha-amylase was positive in 30% (6/20) of the exposed workers. Most of the persons showing a positive skin prick test had work related symptoms and were also skin prick test positive to common allergens. Nasal challenge tests with amylase were performed in selected cases and validated three cases of alpha-amylase induced rhinitis. Two non-symptomatic workers had precipitins to alpha-amylase. Specific IgG antibodies were shown by two further serological techniques. The nature and relevance of these antibodies are currently being studied. It is concluded that alpha-amylase powder is a potent occupational sensitiser. Precautions should be taken when handling this allergenic enzyme.

  1. Genetic Variation in Amount of Salivary Amylase in the Bank Vole, CLETHRIONOMYS GLAREOLA

    PubMed Central

    Hjorth, J. Peter; Meisler, Miriam; Nielsen, J. Tønnes

    1979-01-01

    Several investigated bank vole populations are polymorphic for the number of salivary amylase loci, and individual chromosomes may carry one, two or three linked amylase structural genes. In the present study, we have used bank vole stocks homozygous for different chromosomes to investigate the relationship between amylase production and gene number. By measuring the amylase activity in parotid glands and the percentage of amylase protein in saliva, we have been able to demonstrate that the amount of salivary amylase is directly proportional to the proposed gene number. The paper also describes the allele, AmySu, which codes for a heat-labile salivary amylase. The relative amounts of the heat-labile isozyme have been determined in different heterozygotes containing this allele, and these results also support the multiple locus model. Finally, a stock devoid of salivary amylase activity was established. Animals from this strain have, however, a protein in the parotid glands and in saliva that is very similar to amylase in molecular weight, amino acid composition and in its binding to glycogen and cyclohepta-amylose. In genetic crosses, the protein segregates as an amylase allele. Therefore, this protein, encoded by the functionally null allele AmyN, may represent an incorrectly processed amylase precursor. PMID:94023

  2. Screening of polysaccharides for preparation of α-amylase conjugate to enhance stability and storage life.

    PubMed

    Jadhav, Swati B; Singhal, Rekha S

    2013-02-15

    Nine polysaccharides differing in structure and chemical nature were screened for their ability to conjugate with α-amylase by covalent binding for enhancing the thermal and pH stability of α-amylase. Among these polysaccharides, agar, dextran, pectin and xanthan showed better results but dextran stood out among all the polysaccharide for providing both thermal and pH stability to α-amylase. α-Amylase conjugated with agar, dextran, pectin and xanthan showed antimicrobial property with added preservative (0.2% sodium benzoate) in liquid formulation of α-amylase challenged with Bacillus subtilis and Escherichia coli. Dextran was the only polysaccharide which showed significant reduction of microbial growth of challenged organisms and aerobic flora without any preservative added. Aerobic flora could flourish well in the liquid α-amylase, but low temperature (4 °C), dextran, and preservative showed synergistic effect in efficiently increasing the storage life of liquid α-amylase.

  3. Occurrence of α-Amylase in the Axis of Germinating Peas

    PubMed Central

    Davis, Bill D.

    1977-01-01

    α-Amylase was found in the axis portion of ungerminated pea seeds (Pisum sativum var. Alaska). The occurrence of this enzyme was demonstrated with crude homogenates (also containing β-amylase) using three different methods: the hydrolysis of β-limit dextrin, the change in absorption spectra for the iodine-starch complex, and the increase in reducing materials relative to the decrease in starch. The first method was used to quantitate the changes in α-amylase activity during germination. The increase in total amylase activity (primarily β-amylase) paralleled germination; the accumulation of α-amylase activity was not initiated for an additional day. The increased α-amylase activity was related to epicotyl growth. Approximately half of this activity was found in the etiolated stem, the distribution being higher in growing than in nongrowing portions. PMID:16660127

  4. 21 CFR 862.1070 - Amylase test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Amylase test system. 862.1070 Section 862.1070 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862...

  5. Optimization of alpha-amylase application in raw sugar manufacture

    USDA-ARS?s Scientific Manuscript database

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentration sin raw sugar if starch control is not improved. Most commercial alpha-amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to...

  6. Recommendations for Amylase Application in the 2008 Louisiana Grinding Season

    USDA-ARS?s Scientific Manuscript database

    Unfortunately, the application of amylase (an enzyme) to break down long chains of unwanted starch in U.S. sugarcane factories is still not optimized because of misinformation about which enzyme to use, and how to add the enzyme. Two large factory trials were conducted at a Louisiana factory to opti...

  7. Purification and characterization of camel (Camelus dromedarius) milk amylase.

    PubMed

    El-Fakharany, Esmail M; Serour, Ehab A; Abdelrahman, Aref M; Haroun, Bakry M; Redwan, El-Rashdy M

    2009-01-01

    Skimmed camel milk contains 59,900 U/L amylase, which is 39,363 times less than serum and plasma amylase. Camel milk beta-amylase was purified as a 61 KDa band using DEAE-Sepharose and Sephadex G-100 and yielded 561 U/mg. The optimum working pH, Km and temperature were 7.0, 13.6 mg/Lstarch, 30-40 degrees C, respectively. The enzyme has been shown higher affinity toward amylose and soluble starch than glycogen, amylopectin, dextrin, or pullulan. Magnesium chloride, CaCl(2) and NaCl activated the amylase, while EDTA and EGTA decreased its activity. While its activity was increased in the presence of Triton X-100 and Triton X-114. Phenylmethanesulfonyl fluoride did not show any effect on enzyme activity. However, the enzyme activity was inhibited by urea, SDS, DTNB, iodoacetamide, N-ethylmalimide, aprotinin, and trypsin inhibitor. It worked on starch to yield a maltose. Scanning electron microscope images demonstrated a nano-degrading ability on starch granules from various sources (potato, corn, cassava, and rice).

  8. Sugar modulation of alpha-amylase genes under anoxia.

    PubMed

    Loreti, Elena; Yamaguchi, Junji; Alpi, Amedeo; Perata, Pierdomenico

    2003-01-01

    Tolerance to low oxygen availability is likely to be due to the interaction of several factors. Sugar availability is one of the elements required to support anaerobic metabolism. In cereal grains the availability of soluble sugars is limited, while starch is stored in large amounts. Degradation of starch under anoxia is therefore needed to avoid sugar starvation leading to rapid cell death. The striking difference in the ability to produce alpha-amylase when comparing the anoxia-tolerant rice (Oryza sativa L.) grains with grains of other cereals is not easily explained. Rice is able to respond to gibberellins under anoxia, but the response is too slow to explain the rapid production of alpha-amylase enzyme. In the present work we demonstrated that alpha-amylase production during the first 2 d after imbibition is mostly due to the activity of the Ramy3D gene, encoding for the G and H isoforms of alpha-amylase. The induction of Ramy3D transcription is likely to result from a low sugar content in the grains incubated under anoxia. The ability of rice embryos to sense sugars under anoxia is reported.

  9. Characterization of the native form and the carboxy-terminally truncated halotolerant form of α-amylases from Bacillus subtilis strain FP-133.

    PubMed

    Takenaka, Shinji; Miyatake, Ayaka; Tanaka, Kosei; Kuntiya, Ampin; Techapun, Charin; Leksawasdi, Noppol; Seesuriyachan, Phisit; Chaiyaso, Thanongsak; Watanabe, Masanori; Yoshida, Ken-ichi

    2015-06-01

    Two amylases, amylase I and amylase II from Bacillus subtilis strain FP-133, were purified to homogeneity and characterized. Their stabilities toward temperature, pH, and organic solvents, and their substrate specificities toward polysaccharides and oligosaccharides were similar. Under moderately high salt conditions, both amylases were more stable than commercial B. licheniformis amylase, and amylase I retained higher amylase activity than amylase II. The N-terminal amino acid sequence, genomic southern blot analysis, and MALDI-TOFF-MS analysis indicated that the halotolerant amylase I was produced by limited carboxy-terminal truncation of the amylase II peptide. The deduced amino acid sequence of amylase II was >95% identical to that of previously reported B. subtilis α-amylases, but their carboxy-terminal truncation points differed. Three recombinant amylases--full-length amylase corresponding to amylase II, an artificially truncated amylase corresponding to amylase I, and an amylase with a larger artificial C-terminal truncation--were expressed in B. subtilis. The artificially truncated recombinant amylases had the same high amylase activity as amylase I under moderately high salt conditions. Sequence comparisons indicated that an increased ratio of Asp/Glu residues in the enzyme may be one factor responsible for increasing halotolerance. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Digestive alpha-amylases from Tecia solanivora larvae (Lepidoptera: Gelechiidae): response to pH, temperature and plant amylase inhibitors.

    PubMed

    Valencia-Jiménez, A; Arboleda, J W; López Avila, A; Grossi-de-Sá, M F

    2008-12-01

    The biochemical properties of the digestive alpha-amylase from Tecia solanivora larvae, an important and invasive insect pest of potato (Solanum tuberosum), were studied. This insect has three major digestive alpha-amylases with isoelectric points 5.30, 5.70 and 5.98, respectively, which were separated using native and isoelectric focusing gels. The alpha-amylase activity has an optimum pH between 7.0 and 10.0 with a peak at pH 9.0. The enzymes are stable when heated to 50 degrees C and were inhibited by proteinaceous inhibitors from Phaseolus coccineus (70% inhibition) and P. vulgaris cv. Radical (87% inhibition) at pH 6.0. The inhibitors present in an amaranth hybrid inhibited 80% of the activity at pH 9.0. The results show that the alpha-amylase inhibitor from amaranth seeds may be a better candidate to make genetically-modified potatoes resistant to this insect than inhibitors from common bean seeds.

  11. Expression of the human amylase genes: Recent origin of a salivary amylase promoter from an actin pseudogene

    SciTech Connect

    Samuelson, L.C.; Gumucio, D.L.; Meisler, M.H. ); Wiebauer, K. )

    1988-09-12

    The human genes encoding salivary amylase (AMY1) and pancreatic amylase (AMY2) are nearly identical in structure and sequence. The authors have used ribonuclease protection studies to identify the functional gene copies in this multigene family. Riboprobes derived from each gene were hybridized to RNA from human pancreas, parotid and liver. The sizes of the protected fragments demonstrated that both pancreatic genes are expressed in pancreas. One of the pancreatic genes, AMY2B, is also transcribed at a low level in liver, but not from the promoter used in pancreas. AMY1 transcripts were detected in parotid, but not in pancreas or liver. Unexpected fragments protected by liver RNA led to the discovery that the 5{prime} regions of the five human amylase genes contain a processed {gamma}-actin pseudogene. The promoter and start site for transcription of AMY1 are recently derived from the 3{prime} untranslated region of {gamma}-actin. In addition, insertion of an endogenous retrovirus has interrupted the {gamma}-actin pseudogene in four of the five amylase genes.

  12. Characterization of a Hydrophobic Amylase Inhibitor from Corn (Zea mays) Seeds with Activity Against Amylase from Fusarium verticillioides.

    PubMed

    Figueira, Edson L Z; Hirooka, Elisa Y; Mendiola-Olaya, Elizabeth; Blanco-Labra, Alejandro

    2003-08-01

    ABSTRACT A hydrophobic 19.7-kDa amylase inhibitor (AI) was purified from corn kernels by 95% ethanol extraction and anionic exchange chromatography. The AI has an isoelectric point of 3.6 and was very stable at different pH values and high temperatures, maintaining 47.6% activity after heating to 94 degrees C for 60 min. Amino acid analysis indicated high valine, leucine, glycine, alanine, and glutamic acid/glutamine content, and especially high valine content (41.2 mol%). This inhibitor is not a glycoprotein. It required 30-min preincubation to maximize complex enzyme-inhibitor formation when the amylase from Fusarium verticillioides was tested. The optimal pH of interaction was 6.5. It showed broad-spectrum activity including the following amylases: human saliva, porcine pancreas, F. verticillioides, as well as those from some insects of agricultural importance (Acanthoscelides obtectus, Zabrotes subfasciatus, Sitophilus zeamais, and Prostephanus truncatus). This novel hydrophobic protein not only inhibited the amylase from F. verticillioides but also decreased the conidia germination. Thus, this protein represents an approach to decrease the production of fumonisin in corn, either by using it as a molecular marker to detect fungal resistance or through genetic engineering.

  13. Alpha-amylase inhibitor, CS-1036 binds to serum amylase in a concentration-dependent and saturable manner.

    PubMed

    Honda, Tomohiro; Kaneno-Urasaki, Yoko; Ito, Takashi; Kimura, Takako; Matsushima, Nobuko; Okabe, Hiromi; Yamasaki, Atsushi; Izumi, Takashi

    2014-03-01

    (2R,3R,4R)-4-hydroxy-2-(hydroxymethyl)pyrrolidin-3-yl 4-O-(6-deoxy-β-D-glucopyranosyl)-α-D-glucopyranoside (CS-1036), which is an α-amylase inhibitor, exhibited biphasic and sustained elimination with a long t1/2 (18.4-30.0 hours) in rats and monkeys, but exhibited a short t1/2 (3.7-7.9 hours) in humans. To clarify the species differences in the t1/2, the plasma protein binding of CS-1036 was evaluated by ultrafiltration. A concentration-dependent and saturable plasma protein binding of CS-1036 was observed in rats and monkeys with the dissociation rate constant (KD) of 8.95 and 27.2 nM, and maximal binding capacity (Bmax) of 52.8 and 22.1 nM, respectively. By the assessments of the recombinant amylase and immunoprecipitation, the major binding protein of CS-1036 in rats was identified as salivary amylase (KD 5.64 nM). CS-1036 also showed concentration-dependent and saturable binding to human salivary and pancreatic amylase, with similar binding affinity in rats. However, the protein binding of CS-1036 was constant in human plasma (≤10.2%) due to the lower serum amylase level compared with rats and monkeys. From the calculation of the unbound fraction (fu) in plasma based on in vitro KD and Bmax, the dose-dependent increase in fu after oral administration is speculated to lead to a dose-dependent increase in total body clearance and a high area under the curve/dose at lower doses, such as 0.3 mg/kg in rats.

  14. A chimera-like alpha-amylase inhibitor suggesting the evolution of Phaseolus vulgaris alpha-amylase inhibitor.

    PubMed

    Wato, S; Kamei, K; Arakawa, T; Philo, J S; Wen, J; Hara, S; Yamaguchi, H

    2000-07-01

    White kidney bean (Phaseolus vulgaris) contains two kinds of alpha-amylase inhibitors, one heat-stable (alpha AI-s) and one heat-labile (alpha AI-u). alpha AI-s has recently been revealed to be a tetrameric complex, alpha(2)beta(2), with two active sites [Kasahara et al. (1996) J. Biochem. 120, 177-183]. The present study was undertaken to reveal the molecular features of alpha AI-u, which is composed of three kinds of subunits, alpha, beta, and gamma. The gamma-subunit, in contrast to the alpha- and beta-subunits that are indistinguishable from the alpha- and beta-subunits of alpha AI-s, was found to correspond to a subunit of an alpha-amylase inhibitor-like protein, which has been identified as an inactive, evolutionary intermediate between arcelin and the alpha-amylase inhibitor in a P. vulgaris defense protein family. The polypeptide molecular weight of alpha AI-u determined by the light-scattering technique, together with the polypeptide molecular weights of the subunits, suggests that alpha AI-u is a trimeric complex, alpha beta gamma. The inhibition of alpha AI-u by increasing amounts of porcine pancreatic alpha-amylase (PPA) indicates that an inactive 1:1 complex is formed between alpha AI-u and PPA. Molecular weight estimation of the complex by the light-scattering technique confirmed that it is a complex of alpha AI-u with one PPA molecule. Thus it seems probable that alpha AI-u is an evolutionary intermediate of the P. vulgaris alpha-amylase inhibitor.

  15. Novel assay procedures for the measurement of α-amylase in weather-damaged wheat.

    PubMed

    Cornaggia, Claudio; Ivory, Ruth; Mangan, David; McCleary, Barry V

    2016-01-30

    The measurement of α-amylase (EC 3.2.1.1) in sprout-damaged grains is a crucial analysis yet a problematic one owing to the typically low α-amylase levels in ground wheat samples. A number of standardised methods such as the Falling Number method and the Ceralpha method exist which are routinely used for the assay of α-amylase. These methods, however, are either highly substrate-dependent or lack the required sensitivity to assess sprout damage. Novel colorimetric and fluorometric reagents have been prepared (Amylase HR, Amylase SD, BzCNPG7 reagent and BzMUG7 reagent) for the direct and specific assay of α-amylase activity in sprout-damaged wheat. Assays employing these reagents have been developed and optimised to include a decolourisation step using activated charcoal. When used in a convenient assay format, Amylase SD--containing EtNPG7 (II) as the colorimetric substrate and α-glucosidase as the ancillary enzyme--was found to be an excellent reagent for the assessment of sprout damage in wheat with incubation times as short as 5 min. The assay using Amylase SD is completely specific for α-amylase. The use of the Amylase SD assay represents a sensitive and valid alternative to the traditionally used Falling Number values for the assessment of sprout damage in wheat samples. © 2015 Society of Chemical Industry.

  16. Responses of midgut amylases of Helicoverpa armigera to feeding on various host plants.

    PubMed

    Kotkar, Hemlata M; Sarate, Priya J; Tamhane, Vaijayanti A; Gupta, Vidya S; Giri, Ashok P

    2009-08-01

    Midgut digestive amylases and proteinases of Helicoverpa armigera, a polyphagous and devastating insect pest of economic importance have been studied. We also identified the potential of a sorghum amylase inhibitor against H. armigera midgut amylase. Amylase activities were detected in all the larval instars, pupae, moths and eggs; early instars had lower amylase levels which steadily increased up to the sixth larval instar. Qualitative and quantitative differences in midgut amylases of H. armigera upon feeding on natural and artificial diets were evident. Natural diets were categorized as one or more members of legumes, vegetables, flowers and cereals belonging to different plant families. Amylase activity and isoform patterns varied depending on host plant and/or artificial diet. Artificial diet-fed H. armigera larvae had comparatively high amylase activity and several unique amylase isoforms. Correlation of amylase and proteinase activities of H. armigera with the protein and carbohydrate content of various diets suggested that H. armigera regulates the levels of these digestive enzymes in response to macromolecular composition of the diet. These adjustments in the digestive enzymes of H. armigera may be to obtain better nourishment from the diet and avoid toxicity due to nutritional imbalance. H. armigera, a generalist feeder experiences a great degree of nutritional heterogeneity in its diet. An investigation of the differences in enzyme levels in response to macronutrient balance and imbalance highlight their importance in insect nutrition.

  17. Structural relationship between the enzymatic and streptococcal binding sites of human salivary alpha-amylase.

    PubMed

    Scannapieco, F A; Bhandary, K; Ramasubbu, N; Levine, M J

    1990-12-31

    Previous studies have demonstrated that human salivary alpha-amylase specifically binds to the oral bacterium Streptococcus gordonii. This interaction is inhibited by substrates such as starch and maltotriose suggesting that bacterial binding may involve the enzymatic site of amylase. Experiments were performed to determine if amylase bound to the bacterial surface possessed enzymatic activity. It was found that over one-half of the bound amylase was enzymatically active. In addition, bacterial-bound amylase hydrolyzed starch to glucose which was then metabolized to lactic acid by the bacteria. In further studies, the role of amylase's histidine residues in streptococcal binding and enzymatic function was assessed after their selective modification with diethyl pyrocarbonate. DEP-modified amylase showed a marked reduction in both enzymatic and streptococcal binding activities. These effects were diminished when DEP modification occurred in the presence of maltotriose. DEP-modified amylase had a significantly altered secondary structure when compared with native enzyme or amylase modified in the presence of maltotriose. Collectively, these results suggest that human salivary alpha-amylase may possess multiple sites for bacterial binding and enzymatic activity which share structural similarities.

  18. Interaction of natural polyphenols with α-amylase in vitro: molecular property-affinity relationship aspect.

    PubMed

    Xiao, Jianbo; Kai, Guoyin; Ni, Xiaoling; Yang, Fan; Chen, Xiaoqing

    2011-06-01

    The relationship between the structural properties of natural polyphenols and their affinities for α-amylase were investigated by fluorescence titration analysis. The binding process with α-amylase was strongly influenced by the structural differences of the compounds under study. For instance, the methylation of the hydroxyl group in flavonoids increased their binding affinities for α-amylase by 2.14 to 7.76 times. The hydroxylation on rings A, B, and C of flavonoids also significantly affected their affinities for α-amylase. The glycosylation of isoflavones and flavanones reduced their affinities for α-amylase and the glycosylation of flavones and flavonols enhanced their affinities for α-amylase. Hydrogenation of the C2=C3 double bond of flavonoids decreased the binding affinities. The galloylated catechins had higher binding affinities with α-amylase than non-galloylated catechins and the pyrogallol-type catechins had higher affinities than the catechol-type catechins. The presence of the galloyl moiety is the most decisive factor. The glycosylation of resveratrol decreased its affinity for α-amylase. The esterification of gallic acid significantly reduced the affinity for α-amylase. The binding interaction between polyphenols and α-amylase was mainly caused by hydrophobic forces.

  19. Interactions of alpha-amylase and calcium chelator during neutral detergent fiber analysis.

    PubMed

    Brougher, Daniel S; Oleas, Telmo B; Kohn, Richard A

    2005-07-13

    Amylase and calcium chelators, such as disodium ethylene diaminotetraacetate (EDTA), are used in analysis of neutral detergent fiber (NDF) to dissolve starch and pectin, respectively. However, these reagents may interfere with each other's activity. Six combinations of alpha-amylase and EDTA were examined for determining NDF values of beet pulp (Beta vulgaris), ground corn (Zea mays L.), timothy hay (Phleum pratense), and soybean meal (Glycine max L). For treatment A, 2.5 mL of alpha-amylase was added 5 min after boiling. Other treatments differed as follows: (B) 4.5 mL of alpha-amylase, (C) 4.5 mL of alpha-amylase added 30 min after boiling, (D) delayed addition of EDTA to 30 min after boiling, (E) no EDTA, and (F) no alpha-amylase. Inclusion of EDTA interfered with amylase activity in corn grain samples, and addition of amylase to beet pulp and soybean meal samples reduced the effectiveness of EDTA and increased ash in the NDF residue. Amylase should not be used for samples that do not contain starch. Calculating NDF on an ash-free basis minimized the negative effects of amylase on EDTA activity.

  20. Genetic and Biochemical Studies on Cell-Bound α-Amylase in Bacillus subtilis Marburg

    PubMed Central

    Nagata, Yoshiho; Yamaguchi, Kazuo; Maruo, Bunji

    1974-01-01

    A small but significant amount of α-amylase activity was detected in the cells of Bacillus subtilis Marburg. The cell-associated activity was almost constant regardless of the level of extracellular α-amylase activity. The cell-bound amylase activity could be separated into three components, upon Sephadex G-75 chromatography, referred to as components A, B, and C. Component C showed the same properties as the extracellular α-amylases so far examined. Component A had a molecular weight greater than 70,000, as judged from the elution position on Sephadex G-75, and became smaller upon treatment with trypsin but was still larger than that of component C. An α-amylase mutant that lacked extracellular α-amylase completely because of a mutation within the structural gene of the enzyme was found to lose all three cell-bound amylase components simultaneously. These data suggest strongly that the cell-bound amylase components are precursors of the extracellular α-amylase and that the α-amylase of this organism is produced under the direction of the same gene whether the enzyme is within or outside the cell. PMID:4212029

  1. Amylases in Pea Tissues with Reduced Chloroplast Density and/or Function.

    PubMed

    Saeed, M; Duke, S H

    1990-12-01

    Pea (Pisum sativum L.) tissues with reduced chloroplast density (e.g. petals and stems) or function (i.e. senescent leaves and leaves darkened for prolonged periods) were surveyed to determine whether tissues with genetically or environmentally reduced chloroplast density and/or function also have significantly different amylolytic enzyme activities and/or isoform patterns than leaf tissues with totally competent chloroplasts. Native PAGE followed by electrophoretically blotting through a starch or beta-limit dextrin containing gel and KI/I(2) staining revealed that the primary amylases in leaves, stems, petals, and roots were the primarily vacuolar beta-amylase (EC 3.2.1.2) and the primarily apoplastic alpha-amylase (EC 3.2.1.1). Among tissues of light grown pea plants, petals contained the highest levels of total amylolytic (primarily beta-amylase) activity and considerably higher ratios of beta- to alpha-amylase. In aerial tissues there was an inverse relationship between chlorophyll and starch concentration, and beta-amylase activity. In sections of petals and stems there was a pronounced inverse relationship between chlorophyll concentration and the activity of alpha-amylase. Senescing leaves of pea, as determined by age, and protein and chlorophyll content, contained 3.8-fold (fresh weight basis) and 32-fold (protein basis) higher alpha-amylase activity than fully mature leaves. Leaves maintained in darkness for 12 days displayed a 14-fold (fresh weight basis) increase in alpha-amylase activity over those grown under continuous light. In senescence and prolonged darkness studies, the alpha-amylase that was greatly increased in activity was the primarily apoplastic alpha-amylase. These studies indicate that there is a pronounced inverse relationship between chloroplast function and levels of apoplastic alpha-amylase activity and in some cases an inverse relationship between chloroplast density and/or function and vacuolar beta-amylase activity.

  2. Characterization of the Activity and Stability of Amylase from Saliva and Detergent: Laboratory Practicals for Studying the Activity and Stability of Amylase from Saliva and Various Commercial Detergents

    ERIC Educational Resources Information Center

    Valls, Cristina; Rojas, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2012-01-01

    This article presents two integrated laboratory exercises intended to show students the role of [alpha]-amylases (AAMYs) in saliva and detergents. These laboratory practicals are based on the determination of the enzymatic activity of amylase from saliva and different detergents using the Phadebas test (quantitative) and the Lugol test…

  3. Potential of the bean alpha-amylase inhibitor alpha-AI-1 to inhibit alpha-amylase activity in true bugs(Hemiptera)

    USDA-ARS?s Scientific Manuscript database

    True bugs (Hemiptera) are an important pest complex not controlled by Bt crops. An alternative source of resistance includes inhibitors of digestive enzymes. aAI-1, an a-amylase inhibitor from the common bean, has been shown to inhibit a-amylases of bruchid pests of grain legumes. Here we quantify t...

  4. Studies on the Utility of B-Amylase1 IntronIII Sequences as Markers for B-Amylase Activity and Thermostability, Diastatic Power and Malt Quality

    USDA-ARS?s Scientific Manuscript database

    The third intron of barley (Hordeum vulgare L.) ß-amylase 1 (Bmy1) is extremely polymorphic. The use of specific insertion/deletions (indels) in the third intron as markers for cultivar development has been recommended based on associations with ß-amylase activity and thermostability. The third in...

  5. Studies on the Utility of ß-amylase1 IntronIII Sequences as Markers for ß-amylase Activity and Thermostability, Diastatic Power and Malt Quality

    USDA-ARS?s Scientific Manuscript database

    The third intron of barley (Hordeum vulgare L.) ß-amylase 1 (Bmy1) is extremely polymorphic. The use of specific insertion/deletions (indels) in the third intron as markers for cultivar development has been recommended based on associations with ß-amylase activity and thermostability. The third intr...

  6. Characterization of the Activity and Stability of Amylase from Saliva and Detergent: Laboratory Practicals for Studying the Activity and Stability of Amylase from Saliva and Various Commercial Detergents

    ERIC Educational Resources Information Center

    Valls, Cristina; Rojas, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2012-01-01

    This article presents two integrated laboratory exercises intended to show students the role of [alpha]-amylases (AAMYs) in saliva and detergents. These laboratory practicals are based on the determination of the enzymatic activity of amylase from saliva and different detergents using the Phadebas test (quantitative) and the Lugol test…

  7. Compartmentalization of proteinases and amylases in Nauphoeta cinerea midgut.

    PubMed

    Elpidina, E N; Vinokurov, K S; Gromenko, V A; Rudenskaya, Y A; Dunaevsky, Y E; Zhuzhikov, D P

    2001-12-01

    Compartmentalization of proteinases, amylases, and pH in the midgut of Nauphoeta cinerea Oliv. (Blattoptera:Blaberidae) was studied in order to understand the organization of protein and starch digestion. Total proteolytic activity measured with azocasein was maximal at pH 11.5 both in anterior (AM) and posterior (PM) halves of the midgut, but the bulk of activity (67%) was found in PM. Total AM and PM preparations were fractionated on a Sephadex G-50 column and further analysed by means of activity electrophoresis and specific inhibitors and activators. The major activity in PM was classified as an unusual SH-dependent proteinase with M(r) 24,000 and pH optimum with synthetic substrate BApNA at 10.0. The enzyme was 43-fold activated in the presence of 1 mM DTT, insensitive to synthetic inhibitors of serine (PMSF, TLCK, TPCK) and cysteine (IAA, E-64) proteinases, strongly inhibited by STI, and displayed four active bands on zymograms. In PM, activities of trypsin-like, chymotrypsin-like, subtilisin-like, and cysteine proteinases were observed. Aspartic and metalloproteinases were not detected. In AM, activity of unusual SH-dependent proteinase also dominated and activity of chymotrypsin-like proteinase was observed, but their levels were much lower than in PM. Distribution of amylase activity, exhibiting an optimum at pH 6.0, was quite the opposite. The major part of it (67%) was located in AM. Treatment of amylase preparation with proteinases from AM and PM reduced amylase activity twofold. pH of the midgut contents was 6.0-7.2 in AM, 6.4-7.6 in the first and 8.8-9.3 in the second halves of PM. Thus, pH in AM is in good agreement with the optimal pH of amylase, located in this compartment, but the activity of proteinases, including the ability to degrade amylase, in such an environment is low. Active proteolysis takes place in the second half of PM, where pH of the gut is close to the optimal pH of proteinases. Copyright 2001 Wiley-Liss, Inc.

  8. Is There Consistency between the Binding Affinity and Inhibitory Potential of Natural Polyphenols as α-amylase Inhibitors?

    PubMed

    Xu, Wei; Shao, Rong; Xiao, Jianbo

    2016-07-26

    The inhibitory potential of natural polyphenols for α-amylases has attracted great interests among researchers. The structure-affinity properties of natural polyphenols binding to α-amylase and the structure-activity relationship of dietary polyphenols inhibiting α-amylase were deeply investigated. There is a lack of consistency between the structure-affinity relationship and the structure-activity relationship of natural polyphenols as α-amylase inhibitors. Is it consistent between the binding affinity and inhibitory potential of natural polyphenols as with α-amylase inhibitors? It was found that the consistency between the binding affinity and inhibitory potential of natural polyphenols as with α-amylase inhibitors is not equivocal. For example, there is no consistency between the binding affinity and the inhibitory potential of quercetin and its glycosides as α-amylase inhibitors. However, catechins with higher α-amylase inhibitory potential exhibited higher affinity with α-amylase.

  9. Stabilization of α-amylase by using anionic surfactant during the immobilization process

    NASA Astrophysics Data System (ADS)

    El-Batal, A. I.; Atia, K. S.; Eid, M.

    2005-10-01

    This work describes the entrapment of α-amylase into butylacrylate-acrylic acid copolymer (BuA/AAc) using γ irradiation. The effect of an anionic surfactant (AOT), the reuse efficiency, and kinetic behavior of immobilized α-amylase were studied. Covering of α-amylase with bis-(2-ethylhexyl)sulfosuccinate sodium salt (AOT) made the enzyme more stable than the uncovered form. The hydrolytic activity of the pre-coated immobilized α-amylase was increased below the critical micelle concentration (cmc) (10 mmol/L). The results showed an increase in the relative activity with increase in the degree of hydration. The pre-coated immobilized α-amylase showed a higher k/K and lower activation energy compared to the free and uncoated-immobilized preparation, respectively. The results suggest that the immobilization of α-amylase is a potentially useful approach for commercial starch hydrolysis in two-phase systems.

  10. A heterotetrameric alpha-amylase inhibitor from emmer (Triticum dicoccon Schrank) seeds.

    PubMed

    Capocchi, A; Muccilli, V; Cunsolo, V; Saletti, R; Foti, S; Fontanini, D

    2013-04-01

    Plants have developed a constitutive defense system against pest attacks, which involves the expression of a set of inhibitors acting on heterologous amylases of different origins. Investigating the soluble protein complement of the hulled wheat emmer we have isolated and characterized a heterotetrameric α-amylase inhibitor (ETI). Based on mass spectrometry data, it is an assembly of proteins highly similar to the CM2/CM3/CM16 found in durum wheat. Our data indicate that these proteins can also inhibit exogenous α-amylases in binary assemblies. The calculated dissociation constants (K(i)) for the pancreatic porcine amylase- and human salivary amylase-ETI complexes are similar to those found in durum and soft wheat. Homology modeling of the CM subunits indicate structural similarities with other proteins belonging to the cereal family of trypsin/α-amylase inhibitors; a possible homology modeled structure for a tetrameric assembly of the subunits is proposed.

  11. Optimization of Amylase Production from B. amyloliquefaciens (MTCC 1270) Using Solid State Fermentation

    PubMed Central

    Saha, Koel; Maity, Sujan; Roy, Sudeshna; Pathak, Rishija; Majumdar, Susmita

    2014-01-01

    Demand for microbial amylase production persists because of its immense importance in wide spectrum industries. The present work has been initiated with a goal of optimization of solid state fermentation condition for amylase using agroindustrial waste and microbial strain like B. amyloliquefaciens (MTCC 1270). In an aim to improve the productivity of amylase, fermentation has been carried out in the presence of calcium (Ca+2), Nitrate (NO3−), and chloride ions (Cl−) as well as in the presence of D-inositol and mannitol. Amylase needs calcium ion for the preservation of its structure, activity and stability that proves beneficial also for amylase production using solid state fermentation. The inclusion of ions and sugars in the SSF media is promising which can be explained by the protection offered by them against thermal decay of amylase at various incubation periods at 37°C. PMID:24949017

  12. Evaluation of alpha- amylase inhibition by Urtica dioica and Juglans regia extracts.

    PubMed

    Rahimzadeh, Mahsa; Jahanshahi, Samaneh; Moein, Soheila; Moein, Mahmood Reza

    2014-06-01

    One strategy for the treatment of diabetes is inhibition of pancreatic α- amylase. Plants contains different chemical constituents with potential for inhibition of α-amylase and hence maybe used as therapeutic. Urtica dioica and Juglans regia Linn were tested for α-amylase inhibition. Different concentrations of leaf aqueous extracts were incubated with enzyme substrate solution and the activity of enzyme was measured. For determination of the type of inhibition, Dixon plot was depicted. Acarbose was used as the standard inhibitor. Both plant extracts showed time and concentration dependent inhibition of α-amylase. 60% inhibition was seen with 2 mg/ml of U. dioica and 0.4 mg/ml of J. regia aqueous extract. Dixon plots revealed the type of α-amylase inhibition by these two extracts as competitive inhibition. Determination of the type of α-amylase inhibition by these plant extracts could provide by successful use of plant chemicals as drug targets.

  13. Digestive amylase of a primitive animal, the scorpion: purification and biochemical characterization.

    PubMed

    Louati, Hanen; Zouari, Nacim; Fendri, Ahmed; Gargouri, Youssef

    2010-04-01

    Scorpion, one of the most ancient invertebrates was chosen, as a model of a primitive animal, to purify and characterize an amylase located in the hepatopancreas. The scorpion digestive amylase (SDA) was purified. Pure SDA was obtained after heat treatment followed by ammonium sulfate fractionation and three steps of chromatography. The pure amylase is not glycosylated and has a molecular mass of 59,101 Da determined by MALDI-TOF MS analysis. The maximal amylase activity was measured at pH 7.0 and 50 degrees C, in the presence of Ca2+ and using potato starch as substrate. The enzyme was able to hydrolyze also, glycogen and amylose. The 23 NH2-terminal amino acid SDA residues were sequenced. The sequence obtained is similar to those of mammalian and avian pancreatic amylases. Nevertheless, polyclonal antibodies directed against SDA failed to recognize classical digestive amylases like the porcine pancreatic one. 2010 Elsevier B.V. All rights reserved.

  14. Study of fluorescence quenching of Barley α-amylase

    NASA Astrophysics Data System (ADS)

    Bakkialakshmi, S.; Shanthi, B.; Bhuvanapriya, T.

    2012-05-01

    The fluorescence quenching of Barley α-amylase by acrylamide and succinimide has been studied in water using steady-state and time-resolved fluorescence techniques. The steady-state fluorescence quenching technique has been performed in three different pHs (i.e., 6, 7 and 8) of water. Ground state and excited state binding constants (Kg &Ke) have been calculated. From the calculated binding constants (Kg &Ke) the free energy changes for the ground (ΔGg) and excited (ΔGe) states have been calculated and are presented in tables. UV and FTIR spectra have also been recorded to prove the binding of Barley α-amylase with acrylamide and succinimide.

  15. Identification of alpha amylase inhibitors from Syzygium cumini Linn seeds.

    PubMed

    Karthic, K; Kirthiram, K S; Sadasivam, S; Thayumanavan, B

    2008-09-01

    The aqueous extract of S. cumini or Eugenia jambolana seeds and Psidium guajava leaves showed higher inhibition against the porcine pancreatic alpha-amylase among the medicinal plants studied. The alpha-amylase inhibitors from S. cumini seeds were separated from the extract by preparative thin layer chromatography into fractions with different Rf values. The fraction with Rf value between 0.285 and 0.43, which showed maximum inhibitory activity, was eluted and analyzed through LC-MS. The compounds identified from the seed extract ofS. cumini were betulinic acid and 3,5,7,4'-tetrahydroxy flavanone, which were reported earlier from S. formosanum and other plants. Dixon plot showed that the inhibition was noncompetitive in nature.

  16. An ideal substrate for the measurement of pancreatic amylase?

    PubMed

    Lorentz, Klaus

    2002-08-01

    The advanced knowledge on substrate cleavage by human alpha-amylases promotes the development of chromogenic maltotriosides exclusively cleaved at the aglycone bond. Three essentials are required for this type of binding at the active site of the enzyme: (i) A minimal hydrophobic modification at the ultimate glucose unit to exclude the condensation of reaction products, (ii) a non-ionic substituent in the 2-position of the phenolic chromophore, and (iii) pertinent effectors to accomodate the aglycone at subsite +1. The novel substrate 2-chloro-4-nitrophenyl-alpha-D-maltotrioside (acG3-CNP) is presented as an example together with measurement conditions which allow a direct, sensitive and specific measurement of pancreatic amylase without stoichiometric calculations.

  17. New substrate specificity of modified porcine pancreatic alpha-amylase.

    PubMed

    Ishikawa, K; Hirata, H

    1989-08-01

    Conversion of the substrate specificity of porcine pancreatic alpha-amylase (PPA) was studied using chemical modification of His residues. Diethyl pyrocarbonate modified His residues in PPA and the activity of the modified PPA for the hydrolysis of the alpha-D-(1,4)glucoside bond in starch or oligosaccharides decreased to less than 1% of that of the native enzyme. However, the activity for the hydrolysis of the bond between p-nitrophenol and oligosaccharides in p-nitrophenyl oligosaccharides was increased by chemical modification. When the modified PPA was incubated with a proteinaceous alpha-amylase inhibitor (Mr 60,000) purified from white kidney bean (Phaseolus vulgaris), it bound to the inhibitor. As a result, the remaining less than 1% hydrolytic activity of the modified PPA for starch disappeared completely but that for p-nitrophenyl oligosaccharides remained unaltered. The hydrolytic activity of the native PPA for the alpha-D-(1,4)glucoside bond in oligosaccharides was stronger than that between p-nitrophenyl and oligosaccharides in p-nitrophenyl oligosaccharides. Therefore, when p-nitrophenyl oligosaccharides (three to five glucose residues) were used as substrates for the native PPA, the alpha-D-(1,4)glucoside bonds in the oligosaccharides were hydrolyzed. However, the modified PPA-inhibitor complex hydrolyzed only the bond between p-nitrophenol and oligosaccharides in p-nitrophenyl oligosaccharides. The above results reveal that, by chemical modification with diethyl pyrocarbonate and biochemical modification with an amylase inhibitor, amylase can be converted to a new exo-type enzyme which hydrolyzes only the bond between p-nitrophenol and oligosaccharides in p-nitrophenyl oligosaccharides.

  18. Production of fungal amylases using cheap, readily available agriresidues, for potential application in textile industry.

    PubMed

    Singh, Shalini; Singh, Sanamdeep; Bali, Vrinda; Sharma, Lovleen; Mangla, Jyoti

    2014-01-01

    The study aimed at isolation and screening of fungal amylase producer, optimization of solid state fermentation conditions for maximum amylase production by the best amylase producer, and characterization of the crude amylases, so produced. Aspergillus fumigatus NTCC1222 showed the highest amylase activity (164.1 U/mL) in secondary screening under SSF conditions and was selected for further studies. The test strain showed maximum amylase production (341.7 U/mL) and supernatant protein concentration (9.7 mg/mL) for incubation period (6 days), temperature (35 °C), initial pH (6.0), nutrient salt solution as moistening agent, and beef extract as nitrogen source. Pomegranate peel produced maximum amylase activity, but wheat bran (only slightly lesser amylase activity as compared to that of pomegranate peel) was chosen for further studies, keeping in mind the seasonal availability of pomegranate peel. TLC confirmed the amylase produced to be α -type and 60 kDa was the molecular weight of the partially purified amylase. The enzyme showed maximum enzyme activity at pH 6.0, temperature of 55 °C, and incubation time of 60 minutes. UV (616.0 U/mL) and chemical (814.2 U/mL) mutation enhanced amylase activity as compared to wild test strain. The study indicates that Aspergillus fumigatus NTCC1222 can be an important source of amylase and the crude enzyme, hence obtained, can be cost effectively applied in multiple sections of textile wet processing.

  19. Amylase and Lipase Detection in Hemorrhaged Animals Treated with HBOC-201

    DTIC Science & Technology

    2011-01-01

    4184 online DOl: 10.3109/10731199.2010.516260 inform a healthcare Amylase and Lipase Detection in Hemorrhaged Animals Treated with HBOC-201 Fran...Health Sciences, Bethesda, MD, USA Abstract: HBOC-201 may alter lipase and amylase detection on chemistry analyzers using optical methods and affect...pancreatic function after trauma. Amylase and lipase measurements were correlated against HBOC-201 to evaluate interference on samples spiked with

  20. Measuring Stress and Ability to Recover from Stress with Salivary Alpha-Amylase Levels

    DTIC Science & Technology

    2011-04-01

    Ability to Recover from Stress with Salivary α- Amylase Levels Authors Brandon L. Mulrine Michael F. Sheehan Lolita M. Burrell Michael...TITLE AND SUBTITLE Measuring Stress and Ability to Recover from Stress with Salivary Alpha Amylase Levels 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c...stress-related conditions. The findings suggest that measuring salivary α- amylase levels may help to determine a Soldier’s resilience or risk of

  1. Response of Fatty Acid Synthesis Genes to the Binding of Human Salivary Amylase by Streptococcus gordonii

    PubMed Central

    Nikitkova, Anna E.; Haase, Elaine M.; Vickerman, M. Margaret; Gill, Steven R.

    2012-01-01

    Streptococcus gordonii, an important primary colonizer of dental plaque biofilm, specifically binds to salivary amylase via the surface-associated amylase-binding protein A (AbpA). We hypothesized that a function of amylase binding to S. gordonii may be to modulate the expression of chromosomal genes, which could influence bacterial survival and persistence in the oral cavity. Gene expression profiling by microarray analysis was performed to detect genes in S. gordonii strain CH1 that were differentially expressed in response to the binding of purified human salivary amylase versus exposure to purified heat-denatured amylase. Selected genes found to be differentially expressed were validated by quantitative reverse transcription-PCR (qRT-PCR). Five genes from the fatty acid synthesis (FAS) cluster were highly (10- to 35-fold) upregulated in S. gordonii CH1 cells treated with native amylase relative to those treated with denatured amylase. An abpA-deficient strain of S. gordonii exposed to amylase failed to show a response in FAS gene expression similar to that observed in the parental strain. Predicted phenotypic effects of amylase binding to S. gordonii strain CH1 (associated with increased expression of FAS genes, leading to changes in fatty acid synthesis) were noted; these included increased bacterial growth, survival at low pH, and resistance to triclosan. These changes were not observed in the amylase-exposed abpA-deficient strain, suggesting a role for AbpA in the amylase-induced phenotype. These results provide evidence that the binding of salivary amylase elicits a differential gene response in S. gordonii, resulting in a phenotypic adjustment that is potentially advantageous for bacterial survival in the oral environment. PMID:22247133

  2. Production of Fungal Amylases Using Cheap, Readily Available Agriresidues, for Potential Application in Textile Industry

    PubMed Central

    Singh, Sanamdeep; Bali, Vrinda; Mangla, Jyoti

    2014-01-01

    The study aimed at isolation and screening of fungal amylase producer, optimization of solid state fermentation conditions for maximum amylase production by the best amylase producer, and characterization of the crude amylases, so produced. Aspergillus fumigatus NTCC1222 showed the highest amylase activity (164.1 U/mL) in secondary screening under SSF conditions and was selected for further studies. The test strain showed maximum amylase production (341.7 U/mL) and supernatant protein concentration (9.7 mg/mL) for incubation period (6 days), temperature (35°C), initial pH (6.0), nutrient salt solution as moistening agent, and beef extract as nitrogen source. Pomegranate peel produced maximum amylase activity, but wheat bran (only slightly lesser amylase activity as compared to that of pomegranate peel) was chosen for further studies, keeping in mind the seasonal availability of pomegranate peel. TLC confirmed the amylase produced to be α-type and 60 kDa was the molecular weight of the partially purified amylase. The enzyme showed maximum enzyme activity at pH 6.0, temperature of 55°C, and incubation time of 60 minutes. UV (616.0 U/mL) and chemical (814.2 U/mL) mutation enhanced amylase activity as compared to wild test strain. The study indicates that Aspergillus fumigatus NTCC1222 can be an important source of amylase and the crude enzyme, hence obtained, can be cost effectively applied in multiple sections of textile wet processing. PMID:24527439

  3. Kinetic studies of amylase and biomass production by Calvatia gigantea

    SciTech Connect

    Kekos, D.; Macris, B.J.

    1987-01-01

    Production of alpha-amylase (alpha-4, glucan 4-glucanohydrolase, EC 3.2.1.1) by microorganisms has been practiced for many years in small and large scale operations and the literature on this enzyme is voluminous. Aspergillus niger and Aspergillus oryzae have been reported as the main fungal species used for commercial production of the enzyme. On the other hand, large volumes of low-cost agricultural products such as acorn (the perisperm-free dry seed contains approximately 60% starch) are wasted in many countries and provide a challenge to biotechnology to efficiently utilize these rich sources of starch for the production of high added value products like enzymes. C. gigantea is an edible puffball excreting high levels of alpha-amylase when cultivated on different sources of starch containing elevated quantities of toxic tannic compounds. This fungus has been employed for the production of microbial protein from wastes and acorns containing high levels of toxic tannic compounds. The same fungus was also reported to grow on both hydrolyzable and condensed tannins as sole carbon sources. The present work was undertaken to investigate certain kinetic characteristics of alpha-amylase and biomass production by C. gigantea grown on soluble and acorn starch in a lab fermenter. (Refs. 18).

  4. Characterization of thermostable β-amylase isozymes from Lactobacillus fermentum.

    PubMed

    Kocabay, Samet; Çetinkaya, Serap; Akkaya, Birnur; Yenidünya, Ali Fazil

    2016-12-01

    A strain of Lactobacillus fermentum producing two isozymes of a 20kDa β-amylase was isolated from the faecal sample of a newborn. The starin was identified by sequencing its 16S rRNA gene. The two β-amylase isozymes were resolved and visualized by two dimensional protein gel electrophoresis (2-D gel electrophoresis). Some of the physical and biochemical properties of the enzymes were characterized. The β-amylase displayed two optimum pH s, 5.0 and 10.0 and two optimum temperatures, 45°C and 37°C, respectively. The isozymes hydrolyzed different substrates: glycogen at pH 5.0, and corn starch at pH 10.0. The activity did not require Ca(2+), though the activity at pH 10.0 was enhanced in the presence of 5.0mM and 10.0mM CaCl2, 110% and 130%, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Stability and kinetics of a bifunctional amylase/trypsin inhibitor.

    PubMed

    Alagiri, S; Singh, T P

    1993-11-10

    The stability of the bifunctional amylase/trypsin inhibitor from ragi (Indian finger millet, Eleusine coracana) has been studied by methods of circular dichroism, UV absorption and intrinsic fluorescence. The inhibitor is stable in 8 M urea and 6 M guanidine-HCl. In 150 mM NaCl, thermal denaturation does not occur up to 90 degrees C. However, it is irreversibly denatured in 5 mM NaCl if heated over 73 degrees C. The acidic denaturation is reversible in both high and low salt conditions, but it shows different behavior below pH 1.65 under similar salt conditions. The helical content is about 2-4% in the pH range of 7-9 at which the inhibitor is active maximally. The NaCl concentration does not have a significant effect on the secondary structure elements. The beta-strand form does not show much variation under various conditions. Arg34-Leu35 is the reactive peptide bond in the trypsin-binding site. Trp and Tyr are involved in the binding with amylase. The bifunctional inhibitor represents the sum of individual inhibitors of trypsin and amylase.

  6. Cloning and starch degradation profile of maltotriose-producing amylases from Streptomyces species.

    PubMed

    Kashiwagi, Norimasa; Miyake, Michiru; Hirose, Shuichi; Sota, Masahiro; Ogino, Chiaki; Kondo, Akihiko

    2014-11-01

    The end products from starch hydrolysis by amylases have important applications in various industries. Here, two amylases derived from two Streptomyces species that hydrolyze soluble starch from potato produced maltotriose as the primary maltooligosaccharide product. The genes, annotated as putative glycoside hydrolases, were cloned and expressed in Streptomyces lividans. These amylases displayed hydrolysis activity from pH 3 to 9.5 and were not affected by Ca(2+.) Optimal production of maltotriose was between 20 and 30 °C at pH 6.5. At the optimal temperature, both amylases produced maltotriose-rich end products rather than either maltose or maltotetraose.

  7. Continuous automated assay of alpha-amylase release from superfused rat salivary gland.

    PubMed

    Templeton, D

    1980-11-01

    A method of continuous automated amylase assay is described. This relies on the absorption of iodine by starch to produce a blue color that can be quantified colorimetrically. Digestion of the starch by amylase released from parotid tissue slices reduces the intensity of the color formed, allowing quantification of the amylase released. The assay in sensitive to 0.05 U/amylase/ml and linear up to 13 U/ml. Typical tissue responses to acetyl-beta-methylcholine and isoprenaline are presented.

  8. The purification of a novel amylase from Bacillus subtilis and its inhibition by wheat proteins.

    PubMed Central

    Orlando, A R; Ade, P; Di Maggio, D; Fanelli, C; Vittozzi, L

    1983-01-01

    A new alpha-amylase (EC 3.2.1.1) from Bacillus subtilis was purified by affinity chromatography. The molecular weight of the purified enzyme, estimated from sodium dodecyl sulphate/polyacrylamide-gel electrophoresis, was 93000, which is very different from the molecular weights of two well-characterized amylases from B. subtilis. Electrofocusing showed an isoelectric point of 5. Amylase shows a broad maximum of activity between pH 6 and 7; maximal inhibition of enzyme by wheat-protein alpha-amylase inhibitors is displayed at pH 7. Images Fig. 1. PMID:6189482

  9. Expression and Localization of α-amylase in the Submandibular and Sublingual Glands of Mice

    PubMed Central

    Yamagishi, Ryoko; Wakayama, Tomohiko; Nakata, Hiroki; Adthapanyawanich, Kannika; Kumchantuek, Tewarat; Yamamoto, Miyuki; Iseki, Shoichi

    2014-01-01

    In the major salivary glands of mice, acinar cells in the parotid gland (PG) are known to be the main site for the production of the digestive enzyme α-amylase, whereas α-amylase production in the submandibular gland (SMG) and sublingual gland (SLG), as well as the cell types responsible for α-amylase production, has been less firmly established. To clarify this issue, we examined the expression and localization of both the mRNA and protein of α-amylase in the major salivary glands of male and female mice by quantitative and histochemical methods. α-amylase mRNA levels were higher in the order of PG, SMG, and SLG. No sexual difference was observed in α-amylase mRNA levels in the PG and SLG, whereas α-amylase mRNA levels in the female SMG were approximately 30% those in the male SMG. Using in situ hybridization and immunohistochemistry, signals for α-amylase mRNA and protein were found to be strongly positive in acinar cells of the PG, serous demilune cells of the SLG, and granular convoluted tubule (GCT) cells of the male SMG, weakly positive in seromucous acinar cells of the male and female SMG, and negative in mucous acinar cells of the SLG. These results clarified that α-amylase is produced mainly by GCT cells and partly by acinar cells in the SMG, whereas it is produced exclusively by serous demilune cells in the SLG of mice. PMID:25320406

  10. The α-amylase of the beetle Callosobruchus chinensis. Purification and action pattern

    PubMed Central

    Podoler, H.; Applebaum, S. W.

    1971-01-01

    Callosobruchus chinensis larval amylase was isolated and purified in five steps, which included co-precipitation with glycogen and column chromatography on ECTEOLA-cellulose. The enzyme was homogeneous by disc gel electrophoresis on polyacrylamide. The α-amylase nature was evidenced by the action on amylopectin β-amylase limit-dextrin, by the effect on the substrate–iodine complex and by the action pattern on several polysaccharide substrates. These action patterns are compared with those of other α-amylases. PMID:5117033

  11. Transport of alpha-amylase across the basolateral membrane of the pancreatic acinar cell.

    PubMed Central

    Isenman, L D; Rothman, S S

    1977-01-01

    The flux of alpha-amylase (1,4-alpha-D-glucan glucanohydrolase; EC 3.2.1.1) across the basolateral membrane of the acinar cell was measured in the cell-to-bath direction using the whole rabbit pancreas in organ culture. This in vitro preparation is polarized so that apical and basolateral secretions can be collected separately. The unstimulated amylase flux from cell to bath was substantial at the initial rate (approximately three times the concurrent apical flux). With time, bath amylase approached a steady-state concentration, suggesting an equilbrating process. During the same time interval, ductal amylase secretion remained constant. At the steady state, the amylase concentration in the bath was at least an order of magnitude less than its ductal concentration. Hourly replacement of bathing medium reproduced the initial rate of amylase release into the bath for five consecutive hours. Pancreozymin (cholecystokinin), a peptide hormone, did not alter the steady-state bath amylase content, although it greatly augmented ductal amylase secretion. In contrast, a cholinergic agonist greatly increased both the flux from the cell to bath and the ductal secretion of amylase. Taken together, these results indicate a natural bidirectional permeability of the basolateral membrane to digestive enzyme and support evidence previously obtained suggesting that such a permeability might exist. PMID:302947

  12. Paper-based α-amylase detector for point-of-care diagnostics.

    PubMed

    Dutta, Satarupa; Mandal, Nilanjan; Bandyopadhyay, Dipankar

    2016-04-15

    We report the fabrication of a paper-sensor for quantitative detection of α-amylase activity in human blood serum. Pieces of filter papers were coated with starch-iodine solution leading to an intense blue coloration on the surface. Dispensing α-amylase solution on the starch-iodine coated paper reduced the intensity of the color because of starch-hydrolysis catalyzed by amylase. The variation in the intensity of the color with the concentration of amylase was estimated in three stages: (i) initially, the paper-surface was illuminated with a light emitting diode, (ii) then, the transmitted (reflected) rays emitted through (from) the paper were collected on a photoresistor, and (iii) the variations in the electrical resistance of the photoresistor were correlated with the amylase concentration in analyte. The resistance of photoresistor decreased monotonically with an increase in amylase concentration because the intensity of the reflected (transmitted) rays collected from (through) the paper increased with reduction in the color intensity on the paper surface. Since a specific bio-reaction was employed to detect the activity of amylase, the sensor was found to be equally efficient in detecting unknown quantities of amylase in human blood serum. The reported sensor has shown the potential to graduate into a point-of-care detection tool for α-amylase.

  13. Structure of amylase-binding protein A of Streptococcus gordonii: a potential receptor for human salivary α-amylase enzyme.

    PubMed

    Sethi, Ashish; Mohanty, Biswaranjan; Ramasubbu, Narayanan; Gooley, Paul R

    2015-06-01

    Amylase-binding protein A (AbpA) of a number of oral streptococci is essential for the colonization of the dental pellicle. We have determined the solution structure of residues 24-195 of AbpA of Streptococcus gordonii and show a well-defined core of five helices in the region of 45-115 and 135-145. (13) Cα/β chemical shift and heteronuclear (15) N-{(1) H} NOE data are consistent with this fold and that the remainder of the protein is unstructured. The structure will inform future molecular experiments in defining the mechanism of human salivary α-amylase binding and biofilm formation by streptococci. © 2015 The Protein Society.

  14. Structure of amylase-binding protein A of Streptococcus gordonii: A potential receptor for human salivary α-amylase enzyme

    PubMed Central

    Sethi, Ashish; Mohanty, Biswaranjan; Ramasubbu, Narayanan; Gooley, Paul R

    2015-01-01

    Amylase-binding protein A (AbpA) of a number of oral streptococci is essential for the colonization of the dental pellicle. We have determined the solution structure of residues 24–195 of AbpA of Streptococcus gordonii and show a well-defined core of five helices in the region of 45–115 and 135–145. 13Cα/β chemical shift and heteronuclear 15N-{1H} NOE data are consistent with this fold and that the remainder of the protein is unstructured. The structure will inform future molecular experiments in defining the mechanism of human salivary α-amylase binding and biofilm formation by streptococci. PMID:25739638

  15. Properties of an amylase from thermophilic Bacillus SP

    PubMed Central

    de Carvalho, Raquel Vieira; Côrrea, Thamy Lívia Ribeiro; da Silva, Júlia Caroline Matos; de Oliveira Mansur, Luciana Ribeiro Coutinho; Martins, Meire Lelis Leal

    2008-01-01

    α-Amylase production by thermophilic Bacillus sp strain SMIA-2 cultivated in liquid cultures containing soluble starch as a carbon source and supplemented with 0.05% whey protein and 0.2% peptone reached a maximum activity at 32 h, with levels of 37 U/mL. Studies on the amylase characterization revealed that the optimum temperature of this enzyme was 90°C. The enzyme was stable for 1 h at temperatures ranging from 40-50°C while at 90°C, 66% of its maximum activity was lost. However, in the presence of 5 mM CaCl2, the enzyme was stable at 90°C for 30 min and retained about 58% residual activity after 1 h. The optimum pH of the enzyme was found to be 8.5. After incubation of enzyme for 2 h at pH 9.5 and 11.0 was observed a decrease of about 6.3% and 16.5% of its original activity. At pH 6.0 the enzyme lost about 36% of its original activity. The enzyme was strongly inhibited by Co2+, Cu2+ and Ba2+, but less affected by Mg2+, Na+ and K+. In the presence of 2.0 M NaCl, 63% of amylase activity was retained after 2 h incubation at 45°C. The amylase exhibited more than 70% activity when incubated for 1 h at 50°C with sodium dodecyl sulphate. However, very little residual activity was obtained with sodium hypochlorite and with hydrogen peroxide the enzyme was completely inhibited. The compatibility of Bacillus sp SMIA-2 amylase with certain commercial detergents was shown to be good as the enzyme retained 86%, 85% and 75% of its activity after 20 min incubation at 50°C in the presence of the detergent brands Omo®, Campeiro® and Tide®, respectively. PMID:24031188

  16. Isolation of a novel amylase and lipase-producing Pseudomonas luteola strain: study of amylase production conditions

    PubMed Central

    2014-01-01

    An amylase and lipase producing bacterium (strain C2) was enriched and isolated from soil regularly contaminated with olive washing wastewater in Sfax, Tunisia. Cell was aerobic, mesophilic, Gram-negative, motile, non-sporulating bacterium, capable of growing optimally at pH 7 and 30°C and tolerated maximally 10% (W/V) NaCl. The predominant fatty acids were found to be C18:1ω7c (32.8%), C16:1ω7c (27.3%) and C16:0 (23.1%). Phylogenetic analysis of the 16S rRNA gene revealed that this strain belonging to the genus Pseudomonas. Strain C2 was found to be closely related to Pseudomonas luteola with more than 99% of similarity. Amylase optimization extraction was carried out using Box Behnken Design (BBD). Its maximal activity was found when the pH and temperature ranged from 5.5 to 6.5 and from 33 to 37°C, respectively. Under these conditions, amylase activity was found to be about 9.48 U/ml. PMID:24405763

  17. Starch supplementation modulates amylase enzymatic properties and amylase B mRNA level in the digestive gland of the Pacific oyster Crassostrea gigas.

    PubMed

    Huvet, A; Jeffroy, F; Daniel, J Y; Quéré, C; Le Souchu, P; Van Wormhoudt, A; Boudry, P; Moal, J; Samain, J F

    2012-09-01

    In the oyster Crassostrea gigas consumption-related traits, amylase properties and growth were found to be linked through genotypes that differed for polymorphism in the two amylase genes AMYA and AMYB. Modulation of AMYA mRNA level had already been observed in response to food availability, whereas the functional role of AMYB was still unknown. To improve knowledge about the regulation of amylase expression in C. gigas and the respective roles of the two genes, we made an assay of amylase expression at mRNA and enzymatic levels in the digestive gland of oysters that had received dietary supplements of starch. After 18 days, a significant increase of translatable mRNA for AMYB was observed, with a correlated increase in Michaelis-Menten constant Km values and a decrease in total amylase activity. This modulation is the first evidence of observable functioning of AMYB in digestive processes. Amylase B is suggested to display a higher Km than amylase A, offering a means of adapting to high substrate concentrations. The highest starch supplement level (10 mgL(-1)) induced alteration in oyster physiology. The 1 mgL(-1) treatment should be tested as a practical food supplement that could lead to growth benefits for oysters. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Sequence-structural features and evolutionary relationships of family GH57 α-amylases and their putative α-amylase-like homologues.

    PubMed

    Janeček, Stefan; Blesák, Karol

    2011-08-01

    The glycoside hydrolase family 57 (GH57) contains α-amylase and a few other amylolytic specificities. It counts ~400 members from Archaea (1/4) and Bacteria (3/4), mostly of extremophilic prokaryotes. Only 17 GH57 enzymes have been biochemically characterized. The main goal of the present bioinformatics study was to analyze sequences having the clear GH57 α-amylase features. Of the 107 GH57 sequences, 59 were evaluated as α-amylases (containing both GH57 catalytic residues), whereas 48 were assigned as GH57 α-amylase-like proteins (having a substitution in one or both catalytic residues). Forty-eight of 59 α-amylases were from Archaea, but 42 of 48 α-amylase-like proteins were of bacterial origin. The catalytic residues were substituted in most cases in Bacteroides and Prevotella by serine (instead of catalytic nucleophile glutamate) and glutamate (instead of proton donor aspartate). The GH57 α-amylase specificity has thus been evolved and kept enzymatically active mainly in Archaea.

  19. A single gene directs synthesis of a precursor protein with beta- and alpha-amylase activities in Bacillus polymyxa.

    PubMed Central

    Uozumi, N; Sakurai, K; Sasaki, T; Takekawa, S; Yamagata, H; Tsukagoshi, N; Udaka, S

    1989-01-01

    The Bacillus polymyxa amylase gene comprises 3,588 nucleotides. The mature amylase comprises 1,161 amino acids with a molecular weight of 127,314. The gene appeared to be divided into two portions by the direct-repeat sequence located at almost the middle of the gene. The 5' region upstream of the direct-repeat sequence was shown to be responsible for the synthesis of beta-amylase. The 3' region downstream of the direct-repeat sequence contained four sequences homologous with those in other alpha-amylases, such as Taka-amylase A. The 48-kilodalton (kDa) amylase isolated from B. polymyxa was proven to have alpha-amylase activity. The amino acid sequences of the peptides generated from the 48-kDa amylase showed complete agreement with the predicted amino acid sequence of the C-terminal portion. The B. polymyxa amylase gene was therefore concluded to contain in-phase beta- and alpha-amylase-coding sequences in the 5' and 3' regions, respectively. A precursor protein, a 130-kDa amylase, directed by a plasmid, pYN520, carrying the entire amylase gene, had both beta- and alpha-amylase activities. This represents the first report of a single protein precursor in procaryotes that gives rise to two enzymes. Images PMID:2464578

  20. Purification and characterization of α-Amylase from Miswak Salvadora persica

    PubMed Central

    2014-01-01

    Background The miswak (Salvadora persica) is a natural toothbrush. It is well known that very little information has been reported on enzymes in miswak as medicinal plant. Recently, we study peroxidase in miswak. In the present study, the main goal of this work is to purify and characterize α-amylase from miswak. The second goal is to study the storage stability of α-amylase in toothpaste. Method The purification method included chromatographaphy of miswak α-amylase on DEAE-Sepharose column and Sephacryl S-200 column. Molecular weight was determined by gel filtration and SDS-PAGE. Results Five α-amylases A1, A4a, A4b, A5a and A5b from miswak were purified and they had molecular weights of 14, 74, 16, 30 and 20 kDa, respectively. α-Amylases had optimum pH from 6 to 8. Affinity of the substrates toward all enzymes was studied. Miswak α-amylases A1, A4a, A4b, A5a and A5b had Km values for starch and glycogen of 3.7, 3.7, 7.1, 0.52, 4.3 mg/ml and 5.95, 5.9 4.16, 6.3, 6.49 mg/ml, respectively. The optimum temperature for five enzymes ranged 40°C- 60°C. Miswak α-amylases were stable up to 40°C- 60°C after incubation for 30 min. Ca+2 activated all the miswak α-amylases, while Ni2+, Co+2 and Zn+2 activated or inhibited some of these enzymes. The metal chelators, EDTA, sodium citrate and sodium oxalate had inhibitory effects on miswak α-amylases. PMSF, p-HMB, DTNB and 1,10 phenanthroline caused inhibitory effect on α-amylases. The analysis of hydrolytic products after starch hydrolysis by miswak α-amylases on paper chromatography revealed that glucose, maltose, maltotriose and oligosaccharide were the major products. Crude miswak α-amylase in the toothpaste retained 55% of its original activity after 10 months of storage at room temperature. Conclusions From these findings, α-amylases from miswak can be considered as beneficial enzymes for pharmaceuticals. Therefore, we study the storage stability of the crude α-amylase of miswak, which contained the five

  1. Purification and characterization of α-Amylase from Miswak Salvadora persica.

    PubMed

    Mohamed, Saleh A; Almulaiky, Yaaser Q; Ahmed, Youssri M; Al-Bar, Omar A M; Ibrahim, Ibrahim H

    2014-04-01

    The miswak (Salvadora persica) is a natural toothbrush. It is well known that very little information has been reported on enzymes in miswak as medicinal plant. Recently, we study peroxidase in miswak. In the present study, the main goal of this work is to purify and characterize α-amylase from miswak. The second goal is to study the storage stability of α-amylase in toothpaste. The purification method included chromatography of miswak α-amylase on DEAE-Sepharose column and Sephacryl S-200 column. Molecular weight was determined by gel filtration and SDS-PAGE. Five α-amylases A1, A4a, A4b, A5a and A5b from miswak were purified and they had molecular weights of 14, 74, 16, 30 and 20 kDa, respectively. α-Amylases had optimum pH from 6 to 8. Affinity of the substrates toward all enzymes was studied. Miswak α-amylases A1, A4a, A4b, A5a and A5b had Km values for starch and glycogen of 3.7, 3.7, 7.1, 0.52, 4.3 mg/ml and 5.95, 5.9 4.16, 6.3, 6.49 mg/ml, respectively. The optimum temperature for five enzymes ranged 40°C- 60°C. Miswak α-amylases were stable up to 40°C- 60°C after incubation for 30 min. Ca+2 activated all the miswak α-amylases, while Ni2+, Co+2 and Zn+2 activated or inhibited some of these enzymes. The metal chelators, EDTA, sodium citrate and sodium oxalate had inhibitory effects on miswak α-amylases. PMSF, p-HMB, DTNB and 1,10 phenanthroline caused inhibitory effect on α-amylases. The analysis of hydrolytic products after starch hydrolysis by miswak α-amylases on paper chromatography revealed that glucose, maltose, maltotriose and oligosaccharide were the major products. Crude miswak α-amylase in the toothpaste retained 55% of its original activity after 10 months of storage at room temperature. From these findings, α-amylases from miswak can be considered as beneficial enzymes for pharmaceuticals. Therefore, we study the storage stability of the crude α-amylase of miswak, which contained the five α-amylases, in toothpaste. The enzyme in

  2. Biochemical properties of alpha-amylase from peel of Citrus sinensis cv. Abosora.

    PubMed

    Mohamed, Saleh Ahmed; Drees, Ehab A; El-Badry, Mohamed O; Fahmy, Afaf S

    2010-04-01

    alpha-Amylase activity was screened in the peel, as waste fruit, of 13 species and cultivars of Egyptian citrus. The species Citrus sinensis cv. Abosora had the highest activity. alpha-Amylase AI from Abosora peel was purified to homogeneity using anion and cation-exchange, and gel filtration chromatographies. Molecular weight of alpha-amylase AI was found to be 42 kDa. The hydrolysis properties of alpha-amylase AI toward different substrates indicated that corn starch is the best substrate. The alpha-amylase had the highest activity toward glycogen compared with amylopectin and dextrin. Potato starch had low affinity toward alpha-amylase AI but it did not hydrolyze beta-cyclodextrin and dextran. Apparent Km for alpha-amylase AI was 5 mg (0.5%) starch/ml. alpha-Amylase AI showed optimum activity at pH 5.6 and 40 degrees C. The enzyme was thermally stable up to 40 degrees C and inactivated at 70 degrees C. The effect of mono and divalent metal ions were tested for the alpha-amylase AI. Ba2+ was found to have activating effect, where as Li+ had negligible effect on activity. The other metals caused inhibition effect. Activity of the alpha-amylase AI was increased one and half in the presence of 4 mM Ca2+ and was found to be partially inactivated at 10 mM Ca2+. The reduction of starch viscosity indicated that the enzyme is endoamylase. The results suggested that, in addition to citrus peel is a rich source of pectins and flavanoids, alpha-amylase AI from orange peel could be involved in the development and ripening of citrus fruit and may be used for juice processing.

  3. Parallel beta/alpha-barrels of alpha-amylase, cyclodextrin glycosyltransferase and oligo-1,6-glucosidase versus the barrel of beta-amylase: evolutionary distance is a reflection of unrelated sequences.

    PubMed

    Janecek, S

    1994-10-17

    The structures of functionally related beta/alpha-barrel starch hydrolases, alpha-amylase, beta-amylase, cyclodextrin glycosyltransferase and oligo-1,6-glucosidase, are discussed, their mutual sequence similarities being emphasized. Since these enzymes (except for beta-amylase) along with the predicted set of more than ten beta/alpha-barrels from the alpha-amylase enzyme superfamily fulfil the criteria characteristic of the products of divergent evolution, their unrooted distance tree is presented.

  4. GA Enhanced a-Amylase Synthesis in Halved Grains of Barley (Hordeum vulgare): A Simple Laboratory Demonstration

    ERIC Educational Resources Information Center

    Freeland, P. W.

    1972-01-01

    A laboratory demonstration is suggested for the formation of a-amylase enzyme in halved grains of barley. Data presented in the article provide some information of the pattern of a- and b-amylase activity during germination. (PS)

  5. GA Enhanced a-Amylase Synthesis in Halved Grains of Barley (Hordeum vulgare): A Simple Laboratory Demonstration

    ERIC Educational Resources Information Center

    Freeland, P. W.

    1972-01-01

    A laboratory demonstration is suggested for the formation of a-amylase enzyme in halved grains of barley. Data presented in the article provide some information of the pattern of a- and b-amylase activity during germination. (PS)

  6. Production and Partial Purification of Alpha Amylase from Bacillus subtilis (MTCC 121) Using Solid State Fermentation.

    PubMed

    Raul, Dibyangana; Biswas, Tania; Mukhopadhyay, Suchita; Kumar Das, Shrayan; Gupta, Suvroma

    2014-01-01

    Amylase is an enzyme that catalyzes the breakdown of starch into sugars and plays a pivotal role in a variety of areas like use as digestives, for the production of ethanol and high fructose corn syrup, detergents, desiring of textiles, modified starches, hydrolysis of oil-field drilling fluids, and paper recycling. In the present work, solid state fermentation (SSF) for α -amylase production has been used in lieu of submerged fermentation (SmF) due to its simple technique, low capital investment, lower levels of catabolite repression, and better product recovery. Bacillus subtilis has been well known as producer of alpha amylase and was tested using solid state fermentation for 48 hours at 37°C with wheat bran as substrate. Comparison between different fermentation hours demonstrated high yield of alpha amylase after 48 hours. This alpha amylase has optimum pH and temperature at 7.1 and 40°C, respectively. With the goal to purify alpha amylase, 30-70% (NH4)2SO4 cut concentrated the amylase activity threefold with respect to crude fermented extract. This was verified in quantitative DNS assay method as well as in zymogram gel profile. The exact molecular weight of the amylase is yet to be determined with the aid of other protein purification techniques.

  7. Cloning of a yeast alpha-amylase promoter and its regulated heterologous expression

    DOEpatents

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR; Hooker, Brian S [Kennewick, WA; Anderson, Daniel B [Pasco, WA

    2003-04-01

    The present invention provides the promoter clone discovery of an alpha-amylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated alpha-amylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  8. Application of microbial α-amylase in industry – A review

    PubMed Central

    de Souza, Paula Monteiro; de Oliveira Magalhães, Pérola

    2010-01-01

    Amylases are one of the main enzymes used in industry. Such enzymes hydrolyze the starch molecules into polymers composed of glucose units. Amylases have potential application in a wide number of industrial processes such as food, fermentation and pharmaceutical industries. α-Amylases can be obtained from plants, animals and microorganisms. However, enzymes from fungal and bacterial sources have dominated applications in industrial sectors. The production of α-amylase is essential for conversion of starches into oligosaccharides. Starch is an important constituent of the human diet and is a major storage product of many economically important crops such as wheat, rice, maize, tapioca, and potato. Starch-converting enzymes are used in the production of maltodextrin, modified starches, or glucose and fructose syrups. A large number of microbial α-amylases has applications in different industrial sectors such as food, textile, paper and detergent industries. The production of α-amylases has generally been carried out using submerged fermentation, but solid state fermentation systems appear as a promising technology. The properties of each α-amylase such as thermostability, pH profile, pH stability, and Ca-independency are important in the development of fermentation process. This review focuses on the production of bacterial and fungal α-amylases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications. PMID:24031565

  9. Structure of waxy maize starch hydrolyzed by maltogenic alpha-amylase in relation to its retrogradation

    USDA-ARS?s Scientific Manuscript database

    Maltogenic a-amylase is widely used as an antistaling agent in bakery foods. The objective of this study was to determine the degree of hydrolysis (DH) and starch structure after maltogenic amylase treatments in relation to its retrogradation. Waxy maize starch was cooked and hydrolyzed to different...

  10. Use of activated carbons to remove undesirable residual amylase from factory and refinery streams

    USDA-ARS?s Scientific Manuscript database

    In recent years, there has been increased world-wide concern over residual (carry-over) activity of mostly high temperature (HT) and very high temperature (VHT) stable amylases in white, refined sugars from refineries to various food and end-user industries. HT and VHT stable amylases were develope...

  11. Use of activated carbon to remove undesirable residual amylase from refinery streams

    USDA-ARS?s Scientific Manuscript database

    In recent years, there has been increased world-wide concern over residual (carry-over)activity of mostly high temperature (HT) and very high temperature (VHT) stable amylases in white, refined sugars from refineries to various food and end-user industries. HT and VHT stable amylases were developed ...

  12. Further Experiments on Gibberellin-Stimulated Amylase Production in Cereal Grains

    ERIC Educational Resources Information Center

    Coppage, Jo; Hill, T. A.

    1973-01-01

    Experiments conducted on wheat and barley grains to analyze activities of alpha- and beta-amylase enzymes. Gibberellins were used exogenously. Techniques are described in detail. Results on different cultivars revealed that beta-amylase was not an invariable result of imbibition. Techniques employed can be used by school students. (PS)

  13. Skin-prick tests for hypersensitivity to alpha-amylase preparations.

    PubMed

    Moneo, I; Alday, E; Sanchez-Agudo, L; Curiel, G; Lucena, R; Calatrava, J M

    1995-06-01

    Twenty-five asthmatic subjects with suspected alpha-amylase hypersensitivity were studied by skin-prick tests, a capture ELISA, immunoblotting and bronchial provocation tests. At the same time, different amylases were analysed by SDS-PAGE and immunoblotting using a polyclonal rabbit antiserum. Eight patients showed a positive bronchial response to amylase. Seven of them had positive skin-prick tests, with this method being the most sensitive approach for diagnosis. However, in four cases, skin tests were also positive although the patients had a negative provocation test, thus demonstrating that skin tests are not specific. ELISA and blotting showed similar results in terms of sensitivity and specificity. The enzymes used by the workers included several antigens besides alpha-amylase. The rabbit antiserum to alpha-amylase detected a protein in a wheat flour extract. In one case, the IgE antibodies were specific only for a contaminant of lower molecular weight than amylase. These facts suggest that proteins from the culture medium could be responsible for some cases of amylase hypersensitivity, making the diagnosis difficult. The presence of amylase in another enzymatic extract, a protease produced by Aspergillus oryzae, was proved by means of skin tests and immunoblotting, thus demonstrating the allergenic properties of this enzymatic preparation.

  14. Copy number polymorphism of the salivary amylase gene: implications in human nutrition research.

    PubMed

    Santos, J L; Saus, E; Smalley, S V; Cataldo, L R; Alberti, G; Parada, J; Gratacòs, M; Estivill, X

    2012-01-01

    The salivary α-amylase is a calcium-binding enzyme that initiates starch digestion in the oral cavity. The α-amylase genes are located in a cluster on the chromosome that includes salivary amylase genes (AMY1), two pancreatic α-amylase genes (AMY2A and AMY2B) and a related pseudogene. The AMY1 genes show extensive copy number variation which is directly proportional to the salivary α-amylase content in saliva. The α-amylase amount in saliva is also influenced by other factors, such as hydration status, psychosocial stress level, and short-term dietary habits. It has been shown that the average copy number of AMY1 gene is higher in populations that evolved under high-starch diets versus low-starch diets, reflecting an intense positive selection imposed by diet on amylase copy number during evolution. In this context, a number of different aspects can be considered in evaluating the possible impact of copy number variation of the AMY1 gene on nutrition research, such as issues related to human diet gene evolution, action on starch digestion, effect on glycemic response after starch consumption, modulation of the action of α-amylases inhibitors, effect on taste perception and satiety, influence on psychosocial stress and relation to oral health.

  15. An approach to remove alpha amylase for proteomic analysis of low abundance biomarkers in human saliva.

    PubMed

    Deutsch, Omer; Fleissig, Yoram; Zaks, Batia; Krief, Guy; Aframian, Doron J; Palmon, Aaron

    2008-11-01

    Proteomic characterization of human whole saliva for the identification of disease-specific biomarkers is guaranteed to be an easy-to-use and powerful diagnostic tool for defining the onset, progression and prognosis of human systemic diseases and, in particular, oral diseases. The high abundance of proteins, mainly alpha amylase, hampers the detection of low abundant proteins appearing in the disease state and therefore should be removed. In the present study a 2-DE was used to analyze human whole saliva following the removal of alpha amylase by affinity adsorption to potato starch. After alpha amylase removal whole saliva was analyzed by SDS-PAGE showing at least sixfold removal efficiency and by an alpha amylase activity assay showing 97% reduced activity. MS identification of the captured alpha amylase after elution demonstrated specific removal; 2-DE analysis showed the selective removal of alpha amylase and consequently increased gel resolution. MS identification of protein spots in the 60 kDa area revealed 15 proteins, which were masked before alpha amylase removal. In conclusion, treatment of human whole saliva with an alpha amylase removal device increases gel resolution and enables a higher protein sample for analysis.

  16. A comparison between amylase levels from peritonsillar, dental and neck abscesses.

    PubMed

    El-Saied, S; Kaplan, D M; Zlotnik, A; Abu Tailakh, M; Kordeluk, S; Joshua, B-Z

    2014-12-01

    Pus of peritonsillar abscess (PTA) contains very high amylase levels in some patients. The objective of this study was to further test this finding and to check whether high amylase levels in peritonsillar abscess originate from contamination by saliva during aspiration. Prospective study. Tertiary care university hospital. The study includes 64 patients with PTA, 8 patients with a neck abscess and 12 patients with a dental abscess. Amylase levels of pus and serum were compared between the groups. Clinical data regarding hospitalisation length, recurrence rate and previous antibiotic treatment were also collected. Mean amylase levels in the pus of the PTA group were 3045 U/L (median 59 U/L), 13 U/L in the neck abscess group (P = 0.001) and 22 U/L in the dental abscess group (P = 0.001). Mean serum amylase was higher in the PTA group; PTA - 50 U/L, neck abscess - 37 U/L (P = 0.002) and dental abscess - 26 U/L (P < 0.002). All of the patients with amylase levels above 65 U/L had a first episode of PTA. In contrast, 40% of patients with amylase lower than 65 U/L had recurrent PTA (P = 0.003). A clear association is seen between minor salivary glands and peritonsillar abscess. The high amylase level in peritonsillar pus is not from contamination with saliva. © 2014 John Wiley & Sons Ltd.

  17. Oral Fusobacterium nucleatum subsp. polymorphum binds to human salivary α-amylase.

    PubMed

    Zulfiqar, M; Yamaguchi, T; Sato, S; Oho, T

    2013-12-01

    Fusobacterium nucleatum acts as an intermediate between early and late colonizers in the oral cavity. In this study, we showed that F. nucleatum subsp. polymorphum can bind to a salivary component with a molecular weight of approximately 110 kDa and identified the protein and another major factor of 55 kDa, as salivary α-amylase by time-of-flight mass spectrometry and immuno-reactions. Salivary α-amylase is present in both monomeric and dimeric forms and we found that formation of the dimer depends on copper ions. The F. nucleatum adhered to both monomeric and dimeric salivary α-amylases, but the numbers of bacteria bound to the dimeric form were more than those bound to the monomeric form. The degree of adherence of F. nucleatum to four α-amylases from different sources was almost the same, however its binding to β-amylase was considerably decreased. Among four α-amylase inhibitors tested, acarbose and type 1 and 3 inhibitors derived from wheat flour showed significant activity against the adhesion of F.nucleatum to monomeric and dimeric amylases, however voglibose had little effect. Moreover F. nucleatum cells inhibited the enzymatic activity of salivary α-amylase in a dose-dependent manner. These results suggest that F. nucleatum plays more important and positive role as an early colonizer for maturation of oral microbial colonization. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Improved thermostable α-amylase activity of Bacillus amyloliquefaciens by low-energy ion implantation.

    PubMed

    Li, X Y; Zhang, J L; Zhu, S W

    2011-09-23

    Thermostable α-amylase is of great importance in the starch fermentation industry; it is extensively used in the manufacture of beverages, baby foods, medicines, and pharmaceuticals. Bacillus amyloliquefaciens produces thermostable α-amylase; however, production of thermostable α-amylase is limited. Ion-beam implantation is an effective method for mutation breeding in microbes. We conducted ion-beam implantation experiments using two different ions, Ar(+) and N(+), to determine the survival rate of and dose effect on a high α-amylase activity strain of B. amyloliquefaciens that had been isolated from soil samples. N(+) implantation resulted in a higher survival rate than Ar(+) implantation. The optimum implantation dose was 2.08 × 10(15) ions/cm(2). Under this implantation condition, we obtained a thermally and genetically stable mutant α-amylase strain (RL-1) with high enzyme activity for degrading α-amylase. Compared to the parental strain (RL), the RL-1 strain had a 57.1% increase in α-amylase activity. We conclude that ion implantation in B. amyloliquefaciens can produce strains with increased production of thermostable α-amylase.

  19. Bacillus stearothermophilus contains a plasmid-borne gene for alpha-amylase.

    PubMed Central

    Mielenz, J R

    1983-01-01

    The gene for thermostable alpha-amylase from the thermophilic bacterium Bacillus stearothermophilus has been cloned and expressed in Escherichia coli. Each alpha-amylase-producing colony contained at least a 9.7-kilobase-pair (kb) chimeric plasmid composed of the vector pBR322 and a common 5.4-kb HindIII fragment of DNA. B. stearothermophilus contains four plasmids with sizes from 12 kb to over 108 kb. Restriction endonuclease analysis of these naturally occurring plasmids showed they also contain a 5.4-kb HindIII fragment of DNA. Cloning experiments with the four plasmids yielded alpha-amylase-producing E. coli that contained the same 9.7-kb chimeric plasmid. Restriction endonuclease analysis and further recombinant DNA experiments identified a 26-kb plasmid that contains the gene for alpha-amylase. A spontaneous mutant of B. stearothermophilus unable to produce alpha-amylase was missing the 26-kb plasmid but contained a 20-kb plasmid. A 6-kb deletion within the region of the 5.4-kb HindIII fragment yielded the 20-kb plasmid unable to code for alpha-amylase. A nick-translated probe for the alpha-amylase coding region did not hybridize to either plasmid or total cellular DNA from this mutant strain of B. stearothermophilus. These results demonstrate the gene for alpha-amylase is located exclusively on a 26-kb plasmid in B. stearothermophilus with no genetic counterpart present on the chromosome. Images PMID:6193526

  20. Low Serum Amylase is Associated with Gestational Diabetes Mellitus in Chinese Pregnant Women.

    PubMed

    Zheng, Ruoheng; Zhang, Juanwen; Ying, Zhao; Zheng, Nengneng

    2015-01-01

    The association between low serum amylase levels and type 2 diabetes mellitus and metabolic syndrome has been clearly disclosed. However, the relationship between serum amylase levels and gestational diabetes mellitus (GDM) has not been extensively studied. This study aimed to assess the association of serum amylase with GDM. A cross-sectional study was performed among 878 Chinese pregnant women who underwent detailed prenatal visits in Hangzhou, China. A total of 108 (12.30%) subjects fulfilled the diagnostic criteria of GDM. Patients with GDM had significantly lower levels of serum amylase than those without GDM. The prevalence rate of GDM decreased across serum amylase increasing tertiles (p for trend < 0.001). Correlation analysis showed that serum amylase level was negatively correlated with fasting plasma glucose, 1hPG, 2hPG, HOMA-IR, triglyceride, free fatty acid, and thyroid stimulating hormone (all with p < 0.05). Multiple logistic regression showed that low serum amylase level predicted increased risk of GDM. Our findings suggest that low serum amylase level is significantly associated with increased risk of GDM.

  1. Further Experiments on Gibberellin-Stimulated Amylase Production in Cereal Grains

    ERIC Educational Resources Information Center

    Coppage, Jo; Hill, T. A.

    1973-01-01

    Experiments conducted on wheat and barley grains to analyze activities of alpha- and beta-amylase enzymes. Gibberellins were used exogenously. Techniques are described in detail. Results on different cultivars revealed that beta-amylase was not an invariable result of imbibition. Techniques employed can be used by school students. (PS)

  2. The evaluation of possible false positives with detergents when performing amylase serological testing on clothing.

    PubMed

    Feia, Andrea; Novroski, Nicole

    2013-01-01

    For almost 40 years, detergent companies have been adding enzymes such as amylases to their products as an effective method of breaking down tough stains created by polysaccharides and proteins. The possibility that α-amylases present in common household laundry detergents may contribute to the positive detection of α-amylase on evidentiary samples during forensic presumptive screening procedures is a potential problem that has not yet been investigated. To determine whether α-amylase detection is possible following routine laundering, five different fabrics were laundered in a variety of detergents, and presumptive testing using RSID(™)-Saliva and Phadebas(®) Amylase Test was conducted. Our results demonstrate that clothing laundered in detergents known to contain enzymes does not retain any detectable levels of α-amylase following a typical wash cycle. We also show that, unlike laundered clothing, undiluted detergents do contain detectable levels of α-amylase; however, these findings were only observed using the Phadebas(®) Amylase Test.

  3. Isolation of Mutants Defective in α-Amylase from Bacillus subtilis: Genetic Analyses

    PubMed Central

    Yamaguchi, Kazuo; Nagata, Yoshiho; Maruo, Bunji

    1974-01-01

    The rate of α-amylase (EC 3.2.1.1) synthesis in Bacillus subtilis is regulated by a gene, amyR, located near a structural gene, amyE, for the enzyme. To construct a fine map of the amyR-amyE region, we isolated 28 mutants defective in α-amylase activity. Eleven mutants out of 28 showed no α-amylase activity, whereas the other 17 showed less α-amylase activity than the parent. Out of 17 partially positive α-amylase mutants, 10 produced temperature-sensitive enzymes, and 4 produced immunologically altered enzymes, two of which are concurrently temperature-sensitive, and 5 produced smaller amounts of α-amylases which are indistinguishable from normal enzyme in their temperature sensitivity and immunological properties. Two out of 11 α-amylase-negative mutants produced material that cross-reacted with anti-amylase serum, and 3 mutants carried suppressible mutations by the suppressor described by Okubo. Mapping data indicate that all 28 mutation sites are located in the amyE region, and none of the groups of the mutants mentioned above contains lesions that are clustered in a single region of amyE. The amyR gene seems most likely to adjoin the terminal region of amyE. PMID:4212116

  4. Human Parotid Gland Alpha-Amylase Secretion as a Function of Chronic Hyperbaric Exposure

    DTIC Science & Technology

    1979-01-01

    parotid ...Pullman, WA 99163 Gilman, S. C, G. J. Fischer, R. J. Biersner, R. D. Thornton, and D. A. Miller. 1979. Human parotid gland alpha-amylase secretion...as a function of chronic hyperbaric exposure. Undersea Biomed. Res. 6(3):303-307.—Secretion of a-amylase by the human parotid gland increased

  5. N-terminal amino acid sequence of Bacillus licheniformis alpha-amylase: comparison with Bacillus amyloliquefaciens and Bacillus subtilis Enzymes.

    PubMed Central

    Kuhn, H; Fietzek, P P; Lampen, J O

    1982-01-01

    The thermostable, liquefying alpha-amylase from Bacillus licheniformis was immunologically cross-reactive with the thermolabile, liquefying alpha-amylase from Bacillus amyloliquefaciens. Their N-terminal amino acid sequences showed extensive homology with each other, but not with the saccharifying alpha-amylases of Bacillus subtilis. PMID:6172418

  6. Enzymatic detergent formulation containing amylase from Aspergillus niger: a comparative study with commercial detergent formulations.

    PubMed

    Mitidieri, Sydnei; Souza Martinelli, Anne Helene; Schrank, Augusto; Vainstein, Marilene Henning

    2006-07-01

    There is a wide range of biotechnological applications for amylases, including the textile, pharmaceutical, food and laundry industries. Hydrolytic enzymes are 100% biodegradable and enzymatic detergents can achieve effective cleaning with lukewarm water. Microorganisms and culture media were tested for amylase production and the best producer was Aspergillus niger L119 (3.9 U ml(-1) +/- 0.2) in submerged culture and its amylase demonstrated excellent activity at 50-55 degrees C and pH 4.0, remaining stable at 53 degrees C for up to 200 h. In order to establish the potential uses of this enzyme in detergents, different formulations were tested using the A. niger amylase extract. Enzyme activity was compared with three commercial formulations. The detergents are used in hospitals to clean surgical and endoscopy equipment. The presence of amylase in the formulation is because of its action within hospital drainage system, whether or not it has any function in cleaning the equipment.

  7. Amylase/creatinine clearance ratio in diabetic ketoacidosis: a case report.

    PubMed

    Boybeyi, Ozlem; Ergür, Ayça Törel; Dursun, Zarife Esra; Gülerman, Fulya

    2014-11-01

    Diabetic ketoacidosis (DKA) accompanies any other intra-abdominal pathology. Serum amylase/lipase levels are commonly used in order to rule out acute pancreatitis in patients having abdominal pain in DKA. A more specific and noninvasive diagnostic tool - amylase/creatinine clearance ratio (ACCR) - can be used to rule out pancreatitis in patients with DKA. A 14-year-old girl was admitted with abdominal pain and nausea. She had been followed up for type 1 diabetes mellitus for the last 5 years. The serum amylase levels were increased up to 687 U/L (normal: 28-120 U/L) on the third day of hospitalization. Simultaneous serum and urinary amylase concentrations were measured, and ACCR was calculated (1.2%). The diagnosis of pancreatitis was ruled out. The serum amylase levels decreased in the following days, and she was discharged. ACCR determination is a simple and specific test to diagnose pancreatitis, especially in patients with DKA.

  8. The use of the Rapignost strip for estimating urinary amylase levels.

    PubMed Central

    Touquet, V L; Wilcox, A H

    1985-01-01

    The Rapignost-Amylase urinary test strip (Behringwerke Laboratories) provides an estimation of urine amylase which takes a few minutes and is easy to perform. During a period of 9 months, 84 patients had their urine tested with this strip by casualty officers in the Accident and Emergency Department of St George's Hospital, London. In addition, urine amylase, and plasma amylase and creatinine were measured in the chemical pathology laboratory. In all but one instance, the result of the strip test agreed with the laboratory result. The Rapignost strip should prove useful in screening for acute pancreatitis in situations where there is likely to be a delay in obtaining a laboratory amylase result. PMID:2413872

  9. Classification of microbial α-amylases for food manufacturing using proteinase digestion.

    PubMed

    Akiyama, Takumi; Yamazaki, Takeshi; Tada, Atsuko; Ito, Yusai; Otsuki, Noriko; Akiyama, Hiroshi

    2014-09-01

    Enzymes produced by microorganisms and plants are used as food additives to aid the processing of foods. Identification of the origin of these enzyme products is important for their proper use. Proteinase digestion of α-amylase products, followed by high performance liquid chromatography (HPLC) analysis, was applied to α-amylase from the mold Aspergillus species, the bacteria Bacillus species, and the actinomycetes Saccharomonospora species. Eighteen commercial products of α-amylase were digested with trypsin and endoproteinase Lys-C and HPLC analyzed. For some proteinase/sample combinations, the area of the intact α-amylase peak decreased and new peaks were detected after digestion. The presence and retention times of the novel peaks were used to group the products. The results from this method, called the proteinase digestion-HPLC method, allowed the classification of the α-amylase products into 10 groups, whereas the results from sodium dodecyl sulfate polyacrylamide gel electrophoresis allowed their classification into seven groups.

  10. Structural basis for the inhibition of mammalian and insect alpha-amylases by plant protein inhibitors.

    PubMed

    Payan, Françoise

    2004-02-12

    Alpha-amylases are ubiquitous proteins which play an important role in the carbohydrate metabolism of microorganisms, animals and plants. Living organisms use protein inhibitors as a major tool to regulate the glycolytic activity of alpha-amylases. Most of the inhibitors for which three-dimensional (3-D) structures are available are directed against mammalian and insect alpha-amylases, interacting with the active sites in a substrate-like manner. In this review, we discuss the detailed inhibitory mechanism of these enzymes in light of the recent determination of the 3-D structures of pig pancreatic, human pancreatic, and yellow mealworm alpha-amylases in complex with plant protein inhibitors. In most cases, the mechanism of inhibition occurs through the direct blockage of the active center at several subsites of the enzyme. Inhibitors exhibiting "dual" activity against mammalian and insect alpha-amylases establish contacts of the same type in alternative ways.

  11. Improved detection of amylase activity by sodium dodecyl sulfate-polyacrylamide gel electrophoresis with copolymerized starch.

    PubMed

    Martínez, T F; Alarcón, F J; Díaz-López, M; Moyano, F J

    2000-08-01

    An improved method, based on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) for detection of amylase activity is described. This method will allow better characterization of certain amylases than that obtained by the Davis technique. The main features of the technique are: (i) identification of amylase bands and molecular mass determination are possible in the same gel; (ii) the hydrolysis of copolymerized substrate during electrophoretic separation is prevented using very low temperatures instead of inactivating agents such as chelating agents; and (iii) the technique is applicable to reveal amylase activity in a wide range of biological samples. The method is not useful for enzymes sensitive to SDS and for high molecular mass amylases.

  12. Structure activity relationships of flavonoids as potent alpha-amylase inhibitors.

    PubMed

    Yuan, Erdong; Liu, Benguo; Wei, Qingyi; Yang, Jiguo; Chen, Lei; Li, Qiong

    2014-08-01

    The effects of three flavonoids (quercetin, luteolin, diosmetin) on alpha-amylase were examined by enzymatic kinetics and fluorescence spectroscopy. The three test flavonoids were non-competitive inhibitors of the enzyme. Addition of flavonoids led to fluorescence quenching of alpha-amylase. The quenching was initiated from the formation of a complex between the flavonoids and the enzyme, corresponding to a static quenching process. An alpha-amylase molecule provides a binding site for the test flavonoid. The main binding force was hydrophobic. The decreasing order of inhibition of alpha-amylase by flavonoids and the binding force was luteolin, diosmetin, and quercetin. It is demonstrated that hydroxylation in ring C and methylation of the hydroxyl group in ring B of flavonoids may weaken the binding affinities to alpha-amylase.

  13. Sweet potato beta-amylase. Primary structure and identification of the active-site glutamyl residue.

    PubMed

    Toda, H; Nitta, Y; Asanami, S; Kim, J P; Sakiyama, F

    1993-08-15

    The complete amino acid sequence of a subunit of sweet potato beta-amylase, a homotetramer, was established by sequence analysis of peptides obtained by digestions with Achromobacter protease I and Staphylococcus aureus V8 protease and by cyanogen bromide cleavage of the S-carboxymethylated subunit. The subunit of the enzyme is a single polypeptide consisting of 498 amino acid residues. It showed 50-60% identity in the amino acid sequence with those of beta-amylases from soybean and barley, while it about 25% with those of three bacterial beta-amylases deduced from the cDNA sequences. Sweet potato beta-amylase was completely inactivated with 2,3-epoxypropyl alpha-D-[U-14C]glucopyranoside. Sequence analysis of the inactivated enzyme revealed that Glu187 was specifically esterified by the affinity labeling with the above reagent, proposing that Glu187 is a potent candidate involved directly in the catalysis with this plant beta-amylase.

  14. Isolation of Amylolytic Strains of Thermoactinomyces vulgaris and Production of Thermophilic Actinomycete Amylases1

    PubMed Central

    Kuo, M. J.; Hartman, P. A.

    1966-01-01

    Kuo, M. J. (Iowa State University, Ames), and P. A. Hartman. Isolation of amylolytic strains of Thermoactinomyces vulgaris and production of thermophilic actinomycete amylases. J. Bacteriol. 92:723–726. 1966.—Of 759 isolates obtained from dung, compost, and soil samples, a culture of Thermoactinomyces vulgaris (strain 5) was selected for further study on the basis of quantities of amylase produced in synthetic and nonsynthetic media, rapid growth and sporulation, culture stability upon prolonged storage at 5 C, and growth temperature range. Inoculum preparation, temperature optimum for amylase formation, and the effects of various kinds and levels of carbon and nitrogen sources on amylase production were studied with T. vulgaris strain 5. An optimal procedure for production of T. vulgaris amylases is proposed. PMID:5922543

  15. alpha-Amylase: an ideal representative of thermostable enzymes.

    PubMed

    Prakash, Om; Jaiswal, Nivedita

    2010-04-01

    The conditions prevailing in the industrial applications in which enzymes are used are rather extreme, especially with respect to temperature and pH. Therefore, there is a continuing demand to improve the stability of enzymes and to meet the requirements set by specific applications. In this respect, thermostable enzymes have been proposed to be industrially relevant. In this review, alpha-amylase, a well-established representative of thermostable enzymes, providing an attractive model for the investigation of the structural basis of thermostability of proteins, has been discussed.

  16. Raw starch conversion by Saccharomyces cerevisiae expressing Aspergillus tubingensis amylases

    PubMed Central

    2013-01-01

    Background Starch is one of the most abundant organic polysaccharides available for the production of bio-ethanol as an alternative transport fuel. Cost-effective utilisation of starch requires consolidated bioprocessing (CBP) where a single microorganism can produce the enzymes required for hydrolysis of starch, and also convert the glucose monomers to ethanol. Results The Aspergillus tubingensis T8.4 α-amylase (amyA) and glucoamylase (glaA) genes were cloned and expressed in the laboratory strain Saccharomyces cerevisiae Y294 and the semi-industrial strain, S. cerevisiae Mnuα1. The recombinant AmyA and GlaA displayed protein sizes of 110–150 kDa and 90 kDa, respectively, suggesting significant glycosylation in S. cerevisiae. The Mnuα1[AmyA-GlaA] and Y294[AmyA-GlaA] strains were able to utilise 20 g l-1 raw corn starch as sole carbohydrate source, with ethanol titers of 9.03 and 6.67 g l-1 (0.038 and 0.028 g l-1 h-1), respectively, after 10 days. With a substrate load of 200 g l-1 raw corn starch, Mnuα1[AmyA-GlaA] yielded 70.07 g l-1 ethanol (0.58 g l-1 h-1) after 120 h of fermentation, whereas Y294[AmyA-GlaA] was less efficient at 43.33 g l-1 ethanol (0.36 g l-1 h-1). Conclusions In a semi-industrial amylolytic S. cerevisiae strain expressing the A. tubingensis α-amylase and glucoamylase genes, 200 g l-1 raw starch was completely hydrolysed (saccharified) in 120 hours with 74% converted to released sugars plus fermentation products and the remainder presumably to biomass. The single-step conversion of raw starch represents significant progress towards the realisation of CBP without the need for any heat pretreatment. Furthermore, the amylases were produced and secreted by the host strain, thus circumventing the need for exogenous amylases. PMID:24286270

  17. Salt-dependent thermo-reversible α-amylase: cloning and characterization of halophilic α-amylase from moderately halophilic bacterium, Kocuria varians.

    PubMed

    Yamaguchi, Rui; Tokunaga, Hiroko; Ishibashi, Matsujiro; Arakawa, Tsutomu; Tokunaga, Masao

    2011-02-01

    A moderately halophilic bacterium, Kocuria varians, was found to produce active α-amylase (K. varians α-amylase (KVA)). We have observed at least six different forms of α-amylase secreted by this bacterium into the culture medium. Characterization of these KVA forms and cloning of the corresponding gene revealed that KVA comprises pre-pro-precursor form of α-amylase catalytic domain followed by the tandem repeats, which show high similarity to each other and to the starch binding domain (SBD) of other α-amylases. The observed six forms were most likely derived by various processing of the protein product. Recombinant KVA protein was successfully expressed in Escherichia coli as a fusion protein and was purified with affinity chromatography after cleavage from fusion partner. The highly acidic amino acid composition of KVA and the highly negative electrostatic potential surface map of the modeled structure strongly suggested its halophilic nature. Indeed, KVA showed distinct salt- and time-dependent thermal reversibility: when α-amylase was heat denatured at 85°C for 3 min in the presence of 2 M NaCl, the activity was recovered upon incubation on ice (50% recovery after 15 min incubation). Conversely, KVA denatured in 0.1 M NaCl was not refolded at all, even after prolonged incubation. KVA activity was inhibited by proteinaceous α-amylase inhibitor from Streptomyces nitrosporeus, which had been implicated to inhibit only animal α-amylases. KVA with putative SBD regions was found to digest raw starch.

  18. Low serum amylase and obesity, diabetes and metabolic syndrome: A novel interpretation

    PubMed Central

    Nakajima, Kei

    2016-01-01

    For the last decade, low serum amylase (hypoamylasemia) has been reported in certain common cardiometabolic conditions such as obesity, diabetes (regardless of type), and metabolic syndrome, all of which appear to have a common etiology of insufficient insulin action due to insulin resistance and/or diminished insulin secretion. Some clinical studies have shown that salivary amylase may be preferentially decreased in obese individuals, whereas others have revealed that pancreatic amylase may be preferentially decreased in diabetic subjects with insulin dependence. Despite this accumulated evidence, the clinical relevance of serum, salivary, and pancreatic amylase and the underlying mechanisms have not been fully elucidated. In recent years, copy number variations (CNVs) in the salivary amylase gene (AMY1), which range more broadly than the pancreatic amylase gene (AMY2A and AMY2B), have been shown to be well correlated with salivary and serum amylase levels. In addition, low CNV of AMY1, indicating low salivary amylase, was associated with insulin resistance, obesity, low taste perception/satiety, and postprandial hyperglycemia through impaired insulin secretion at early cephalic phase. In most populations, insulin-dependent diabetes is less prevalent (minor contribution) compared with insulin-independent diabetes, and obesity is highly prevalent compared with low body weight. Therefore, obesity as a condition that elicits cardiometabolic diseases relating to insulin resistance (major contribution) may be a common determinant for low serum amylase in a general population. In this review, the novel interpretation of low serum, salivary, and pancreas amylase is discussed in terms of major contributions of obesity, diabetes, and metabolic syndrome. PMID:27022442

  19. Partial characterization of a novel amylase activity isolated from Tunisian Ficus carica latex.

    PubMed

    Aref, Houda Lazreg; Mosbah, Habib; Louati, Hanen; Said, Khaled; Selmi, Boulbaba

    2011-11-01

    A large number of plants still need to be investigated through screening of amylases suitable for industry. In the present study, and for the first time, we describe the amylolytic activity of Saint Pedro Ficus carica L. (Moraceae) crude latex of Kahli and Bidhi varieties. Effects of temperature, pH, metal ions, and inhibitors and compatibility with some commercial detergents were investigated for amylase activity. Amylase activity was screened in crude latex using the DNS method and potato starch as a substrate. Analyses of amylolytic reaction products by thin-layer chromatography (TLC) and high-performance liquid chromatography (HPLC) were performed. Bidhi and Kahli amylases were active in optimal pH of 6.5 and 7 at 45°C, respectively, displaying a half life of 85 and 60 min, respectively, at 80°C, and they were very stable in a wide range of pH (4-12). Bidhi amylase activity increased to 260% by addition of 10(-3) mM Fe(2+) or 10(-2) mM Cu(2+), and was strongly inhibited by Mg(2+) and EDTA. In the presence of Ca(2+) and Mg(2+), Kahli amylase activity was dramatically enhanced by 220 and 260%, respectively. The compatibility of both amylases with certain commercial detergents was also shown to be good as enzymes retained up to 98% of their activities after 30 min of incubation at 80°C. Analysis of amylolytic reaction products by TLC and HPLC suggested that Kahli amylase was an amyloglucosidase and Bidhi amylase was β-fructose, α(1-4) glucose. Bidhi amylase is a good choice for application in starch, food, detergents and medical industries.

  20. Exposure-sensitization relationship for alpha-amylase allergens in the baking industry.

    PubMed

    Houba, R; Heederik, D J; Doekes, G; van Run, P E

    1996-07-01

    Fungal alpha-amylase is an important occupational allergen in the bakery industry. Epidemiologic studies focusing on the relationship between alpha-amylase allergen exposure and work-related respiratory allergy, however, have not been reported yet. In this cross-sectional study, sensitization to occupational allergens and work-related symptoms were studied in 178 bakery workers and related to allergen exposure. Alpha-amylase allergen concentrations were measured in personal dust samples, using a sandwich enzyme immunoassay. All workers were categorized into groups on the basis of their job histories and the alpha-amylase exposure levels of their job titles. Of all workers 25% had one or more work-related symptoms. As much as 9% of the bakery workers showed a positive skin prick test reaction to fungal amylase, and in 8% amylase-specific IgE was demonstrated. Alpha-amylase exposure and atopy appeared to be the most important determinants of skin sensitization, with prevalence ratios for atopy of 20.8 (95% CI, 2.74 to 158) and for medium and high alpha-amylase exposure groups of 8.6 (95% CI, 1.01 to 74) and 15.9 (95% CI, 1.95 to 129), respectively. Furthermore, a positive association was found between positive skin prick tests to alpha-amylase and work-related respiratory symptoms. In conclusion, this study has shown that there is a strong and positive relationship between alpha-amylase allergen exposure levels in bakeries and specific sensitization in bakery workers.

  1. α-Amylase: an enzyme specificity found in various families of glycoside hydrolases.

    PubMed

    Janeček, Štefan; Svensson, Birte; MacGregor, E Ann

    2014-04-01

    α-Amylase (EC 3.2.1.1) represents the best known amylolytic enzyme. It catalyzes the hydrolysis of α-1,4-glucosidic bonds in starch and related α-glucans. In general, the α-amylase is an enzyme with a broad substrate preference and product specificity. In the sequence-based classification system of all carbohydrate-active enzymes, it is one of the most frequently occurring glycoside hydrolases (GH). α-Amylase is the main representative of family GH13, but it is probably also present in the families GH57 and GH119, and possibly even in GH126. Family GH13, known generally as the main α-amylase family, forms clan GH-H together with families GH70 and GH77 that, however, contain no α-amylase. Within the family GH13, the α-amylase specificity is currently present in several subfamilies, such as GH13_1, 5, 6, 7, 15, 24, 27, 28, 36, 37, and, possibly in a few more that are not yet defined. The α-amylases classified in family GH13 employ a reaction mechanism giving retention of configuration, share 4-7 conserved sequence regions (CSRs) and catalytic machinery, and adopt the (β/α)8-barrel catalytic domain. Although the family GH57 α-amylases also employ the retaining reaction mechanism, they possess their own five CSRs and catalytic machinery, and adopt a (β/α)7-barrel fold. These family GH57 attributes are likely to be characteristic of α-amylases from the family GH119, too. With regard to family GH126, confirmation of the unambiguous presence of the α-amylase specificity may need more biochemical investigation because of an obvious, but unexpected, homology with inverting β-glucan-active hydrolases.

  2. Structural and enzymatic analysis of soybean beta-amylase mutants with increased pH optimum.

    PubMed

    Hirata, Akira; Adachi, Motoyasu; Sekine, Atsushi; Kang, You-Na; Utsumi, Shigeru; Mikami, Bunzo

    2004-02-20

    Comparison of the architecture around the active site of soybean beta-amylase and Bacillus cereus beta-amylase showed that the hydrogen bond networks (Glu380-(Lys295-Met51) and Glu380-Asn340-Glu178) in soybean beta-amylase around the base catalytic residue, Glu380, seem to contribute to the lower pH optimum of soybean beta-amylase. To convert the pH optimum of soybean beta-amylase (pH 5.4) to that of the bacterial type enzyme (pH 6.7), three mutants of soybean beta-amylase, M51T, E178Y, and N340T, were constructed such that the hydrogen bond networks were removed by site-directed mutagenesis. The kinetic analysis showed that the pH optimum of all mutants shifted dramatically to a neutral pH (range, from 5.4 to 6.0-6.6). The Km values of the mutants were almost the same as that of soybean beta-amylase except in the case of M51T, while the Vmax values of all mutants were low compared with that of soybean beta-amylase. The crystal structure analysis of the wild type-maltose and mutant-maltose complexes showed that the direct hydrogen bond between Glu380 and Asn340 was completely disrupted in the mutants M51T, E178Y, and N340T. In the case of M51T, the hydrogen bond between Glu380 and Lys295 was also disrupted. These results indicated that the reduced pKa value of Glu380 is stabilized by the hydrogen bond network and is responsible for the lower pH optimum of soybean beta-amylase compared with that of the bacterial beta-amylase.

  3. Study of conformation and thermodynamics of α-amylase interaction with ethylene in vitro.

    PubMed

    Hu, Yiwei; Zhang, Guangxian; Zhang, Fengxiu

    2016-10-01

    In this article, the conformation and thermodynamics of α-amylase interaction with ethylene in vitro were investigated. The ultraviolet (UV) absorption showed a strong peak of α-amylase treated with 6.04, 29.32 and 262.11μmolL(-1) ethylene appears at ~222nm and a weak peak at 278nm blue-shifted 1nm. Circular dichroism (CD) spectra indicated that the conformations of α-amylase treated with 29.32 and 262.11μmolL(-1) ethylene were obviously changed in which α-helix content were decreased by 20 and 31% respectively, and β-sheet, β-turn and random coil contents were increased by contrast. Fluorescence spectra suggested that the peak intensities of α-amylase at 342nm were obviously increased with the ethylene increase from 6.04 to 525.75μmolL(-1) and more than control group. The binding constants K between ethylene and α-amylase were 3.318×10(6), 4.407×10(6) and 5.125×10(6)Lmol(-1) at 288, 298 and 308K, respectively. And the calculated values of ΔH(0) and ΔS(0) are positive, which suggests that the interaction between ethylene and α-amylase is an endothermic reaction. The negative ΔG(0) values implied that the direct effect of ethylene on α-amylase conformation was spontaneous. The possible reason is that ethylene molecules were easily embedded into the interior of α-amylase in term of the hydrophobic force between α-amylase and ethylene, causing the conformation and thermodynamics changes of α-amylase. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Release and Activity of Bound beta-Amylase in a Germinating Barley Grain.

    PubMed

    Sopanen, T; Laurière, C

    1989-01-01

    In resting grains of Triumph barley (Hordeum vulgare L. cv Triumph) about 40% of the beta-amylase could be extracted with a saline solution, the remaining 60% being in a bound form. During seedling growth (20 degrees C), the bound form was released mainly between days 1 and 3. When a preparation containing bound beta-amylase was incubated with an extract made of endosperms separated from germinating grains, release of bound beta-amylase took place and could be studied in vitro. The release was almost completely prevented by leupeptin and antipain, specific inhibitors of a group of SH-proteinases, but it was not inhibited by pepstatin A or EDTA, which inhibit some other barley proteinases. It is thus very likely that in a whole grain, at least the bulk of the bound beta-amylase is released by the proteolytic action of one or several SH-proteinases. When the bound beta-amylase was released by papain, its molecular weight was about 5000 daltons smaller than that of beta-amylase released by dithiothreitol. This indicates that the release is due to removal of a sequence of beta-amylase itself. A similar decrease in size took place during seedling growth. Bound beta-amylase showed some activity against native starch and it hydrolyzed maltotetraose at a rate that was about 70% of the rate the same amount of bound beta-amylase gave after release. Bound beta-amylase is thus not inactive and it is likely that the slower rate of hydrolysis is due to steric hindrances which prevent substrates from reaching the active site.

  5. Liver alpha-amylase gene expression as an early obesity biomarker.

    PubMed

    Mojbafan, Marzieh; Afsartala, Zohreh; Amoli, Mahsa M; Mahmoudi, Mahdi; Yaghmaei, Parichehreh; Larijani, Bagher; Ebrahim-Habibi, Azadeh

    2017-04-01

    Obesity is a major health problem worldwide, for which preventive and therapeutic means are still needed. Alpha-amylase is a digestive enzyme whose inhibition has been targeted as a potential anti-obesity strategy. However, alpha-amylase gene expression has not been particularly attended to, and in contrast with pancreatic and salivary amylases, fewer studies have focused on liver alpha-amylase. The present study aimed at investigating the expression of alpha-amylase gene in obese and normal mice at RNA and protein level as well as acarbose effect on this gene expression in hepatocyte cell culture. Control and case groups were fed by normal mouse pellet and high-fat diet respectively, during 8 weeks. After this period, serum biochemical parameters including glucose, cholesterol, triglycerides, AST, ALT and alpha-amylase were assayed. Liver alpha-amylase gene was analyzed by real time PCR, and liver enzyme was assayed with Bernfeld and ELISA methods Hepatocyte cell culture derived from both group were also treated by acarbose and alpha-amylase activity and gene expression was analyzed by above mentioned methods. All biochemical factors showed an increase in obese mice, but the increase in ALT and AST were not statistically significant. Alpha-amylase levels were also increased in obese mice, both at RNA and protein level, while a decrease was seen in obese mice derived hepatocytes after acarbose treatment. Elevated liver alpha-amylase levels may be indicative of initial stages of obesity and the use of acarbose could be considered as a treatment of obesity which could be potentially effective at multiple levels. Copyright © 2016. Published by Elsevier Urban & Partner Sp. z o.o.

  6. A glycoprotein α-amylase inhibitor from Withania somnifera differentially inhibits various α-amylases and affects the growth and development of Tribolium castaneum.

    PubMed

    Kasar, Sainath S; Marathe, Kiran R; Bhide, Amey J; Herwade, Abhijeet P; Giri, Ashok P; Maheshwari, Vijay L; Pawar, Pankaj K

    2017-07-01

    Identification and characterisation of plant defensive molecules enrich our resources to design crop protection strategies. In particular, plant-derived proteinaceous inhibitor(s) of insect digestive enzymes appear to be a safe, sustainable and attractive option. A glycoprotein having non-competitive α-amylase inhibitory activity with a molecular weight of 8.3 kDa was isolated and purified from seeds of Withania somnifera α-amylase inhibitor (WSAI). Its mass spectrometry analysis revealed 59% sequence coverage with Wrightide II-type α-amylase inhibitor from Wrightia religiosa. A dose-dependent inhibition of α-amylases from Aspergillus oryzae, Bacillus subtilis, Helicoverpa armigera and Tribolium castaneum was recorded. Interestingly, WSAI did not inhibit human salivary α-amylase significantly. When adults of T. castaneum were fed with WSAI (1.6 mg g(-1) ), decrease in consumption, growth and efficiency of conversion of ingested food was evident, along with over fourfold increases in feeding deterrence index. A decline in larval residual α-amylase activity after feeding of WSAI resulted in a reduction in longevity of T. castaneum. The study reflects the significance of WSAI in affecting the overall growth and development of T. castaneum. Pre- and post-harvest pest resistive capability makes WSAI a potential candidate for insect pest management. Further, the effectiveness of this inhibitor could be explored either in formulations or through a transgenic approach. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  7. Biochemical characterisation of α-amylase inhibitors from Achyranthes aspera and their interactions with digestive amylases of coleopteran and lepidopteran insects.

    PubMed

    Hivrale, Vandana K; Chougule, Nanasaheb P; Giri, Ashok P; Chhabda, Pavan J; Kachole, Manvendra S

    2011-08-15

    Starchy seeds are an important food and a source of dietary ingredients in many countries. However, they suffer from extensive predation by bruchids (weevils) and other pests. α-Amylase inhibitors are attractive candidates for the control of seed weevils, as these insects are highly dependent on starch as an energy source. A proteinaceous α-amylase inhibitor from the seeds of Achyranthes aspera was identified, purified and characterised. In electrophoretic analysis, two prominent amylase inhibitor activity bands (AI1 and AI2) were detected. The inhibitor was purified 9.99-fold with 1206.95 total amylase inhibitor units mg⁻¹ protein. The molecular weight of the purified inhibitor was around 6 kDa. The isolated α-amylase inhibitor was found to be resistant to heat and proteolysis. Feeding analysis of Callosobruchus maculatus larvae on a diet containing seed powder of A. aspera revealed that survival of the larvae was severely affected, with the highest mortality rate occurring on the fifth day of feeding. The isolated inhibitor inhibited the majority of amylase isoforms of C. maculatus, Tribolium confusum and Helicoverpa armigera in electrophoretic analysis and solution assays. The information obtained in the present investigation could be useful for a genetic engineering approach that would make seeds resistant to storage pest infestations. Copyright © 2011 Society of Chemical Industry.

  8. Characterization of two coleopteran α-amylases and molecular insights into their differential inhibition by synthetic α-amylase inhibitor, acarbose.

    PubMed

    Channale, Sonal M; Bhide, Amey J; Yadav, Yashpal; Kashyap, Garima; Pawar, Pankaj K; Maheshwari, V L; Ramasamy, Sureshkumar; Giri, Ashok P

    2016-07-01

    Post-harvest insect infestation of stored grains makes them unfit for human consumption and leads to severe economic loss. Here, we report functional and structural characterization of two coleopteran α-amylases viz. Callosobruchus chinensis α-amylase (CcAmy) and Tribolium castaneum α-amylase (TcAmy) along with their interactions with proteinaceous and non-proteinaceous α-amylase inhibitors. Secondary structural alignment of CcAmy and TcAmy with other coleopteran α-amylases revealed conserved motifs, active sites, di-sulfide bonds and two point mutations at spatially conserved substrate or inhibitor-binding sites. Homology modeling and molecular docking showed structural differences between these two enzymes. Both the enzymes had similar optimum pH values but differed in their optimum temperature. Overall, pattern of enzyme stabilities were similar under various temperature and pH conditions. Further, CcAmy and TcAmy differed in their substrate affinity and catalytic efficiency towards starch and amylopectin. HPLC analysis detected common amylolytic products like maltose and malto-triose while glucose and malto-tetrose were unique in CcAmy and TcAmy catalyzed reactions respectively. At very low concentrations, wheat α-amylase inhibitor was found to be superior over the acarbose as far as complete inhibition of amylolytic activities of CcAmy and TcAmy was concerned. Mechanism underlying differential amylolytic reaction inhibition by acarbose was discussed.

  9. Induction of digestive alpha-amylases in larvae of Zabrotes subfasciatus (Coleoptera: Bruchidae) in response to ingestion of common bean alpha-amylase inhibitor 1.

    PubMed

    Silva, C P.; Terra, W R.; de Sá, M F.G.; Samuels, R I.; Isejima, E M.; Bifano, T D.; Almeida, J S.

    2001-11-01

    Zabrotes subfasciatus larvae possess three alpha-amylase isoforms determined by in gel assays following SDS-PAGE. Two minor isoforms present lower electrophoretic mobility than the major form. When developed inside Vigna unguiculata (cowpea) seeds, fourth instar larvae have minor quantities of the slow-migrating isoforms, but when reared on seeds of Phaseolus vulgaris (common bean), the two slow-migrating forms are expressed in higher amounts, whilst the quantity of the major constitutive form is independent of the host bean. Larvae at the beginning of the fourth instar were fed on flour or cotyledons of cowpea and common bean and it was observed that the larvae fed on the common bean expressed the two slow-migrating forms in higher amounts when compared to the control larvae fed on cowpea. In order to investigate the possible correlation between the induction of alpha-amylases and the ingestion of the common bean alpha-amylase inhibitor 1 (alphaAI-1), this inhibitor was incorporated into artificial diet. It was observed that larvae fed on diet containing chronic doses of alphaAI-1 during their development, produced the two slow-migrating forms in higher amounts than control larvae, however, fourth-instar larvae fed on the same diet presented less amylase activity than control larvae. The data suggested that alphaAI-1 is involved in amylase induction and that it has inhibitory activity against the constitutive amylase, when starch granules are used as substrate.

  10. α-Amylase-assisted extraction of polysaccharides from Panax ginseng.

    PubMed

    Sun, Lin; Wu, Di; Ning, Xin; Yang, Guang; Lin, Ziheng; Tian, Meihong; Zhou, Yifa

    2015-04-01

    In this paper, α-amylase-assisted extraction was used to isolate the polysaccharide that remained in hot water-extracted ginseng. The yield of the polysaccharide was 9.0%, almost equal to that of the hot water-extracted polysaccharide. Using anion exchange and gel permeation chromatography, the polysaccharide was fractionated into a neutral polysaccharide fraction and six pectic fractions. The neutral fraction accounted for 76% of the polysaccharide and contained both amylopectin and amylose. The pectic polysaccharide fractions were identified to be arabinogalactan, type-I rhamnogalacturonan and homogalacturonan-type pectin by high-performance liquid chromatography, Fourier transform-infrared and nuclear magnetic resonance analysis. Structural and lymphocyte proliferation activity results showed that these polysaccharides were different from those extracted by hot water, indicating that ginseng contains complex polysaccharides with diverse structures, which results in its diverse pharmacological activities. The α-amylase-assisted extraction is a novel method for preparing ginseng polysaccharides and could be applied toward the further study and exploration of ginseng. These findings provide technical and theoretical support for ginseng pharmacology.

  11. [Utility of amylase levels in malignant pleural effusions].

    PubMed

    Haro-Estarriol, Manuel; Casamitjá-Sot, María Teresa; Alvarez-Castillo, Luis Alberto; Calderón-López, Juan Carlos; Martínez-Somolinos, Sandra; Sebastián-Quetglas, Fernando

    2007-09-22

    To analyze the utility of the measurement of pleural amylase levels (AL) and pleural fluid/serum amylase ratio (AR) in malignant pleural effusions. Prospective and comparative study of AL and its AR in relation to the patient and pleural fluid characteristics in 295 malignant effusions and 673 nonmalignant. There were 103 patients with AL greater than 100 U/l (11%) and 268 with AR greater than 1 (28%): 53 (18%) and 109 (37%) in malignant effusions respectively. Patients with malignant effusions had higher AL and AR, especially when tumour origin was lung cancer, had positive pleural citology or biopsy and showed an adenocarcinoma. Multivariate regression analysis revealed a significant difference in the changes in AL associated with positive pleural citology or biopsy and massive pleural effusion. The malignant effusions had higher AL in lung cancer of stage IV. AL and AR should not be routinely measured to exclude a malignant effusion. A high AL or AR was related to positive pleural citology or biopsy, a massive pleural effusion and lung cancer with an advanced disease.

  12. Alpha-amylase activity from the halophilic archaeon Haloferax mediterranei.

    PubMed

    Pérez-Pomares, F; Bautista, V; Ferrer, J; Pire, C; Marhuenda-Egea, F C; Bonete, M J

    2003-08-01

    The halophilic archaeon Haloferax mediterranei is able to grow in a minimal medium containing ammonium acetate as a carbon and nitrogen source. When this medium is enriched with starch, alpha-amylase activity is excreted to the medium in low concentration. Here we report methods to concentrate and purify the enzyme. The relative molecular mass of the enzyme, determined by gel filtration, is 50 +/- 4 kDa, and on SDS-PAGE analysis a single band appeared at 58 kDa. These results indicated that the halophilic alpha-amylase is a monomeric enzyme. The enzyme showed a salt requirement for both stability and activity, being stable from 2 to 4 M NaCl, with maximal activity at 3 M NaCl. The enzyme displayed maximal activity at pHs from 7 to 8, and its optimal temperature was in a range from 50 degrees C to 60 degrees C. The results also implicated several prototropic groups in the catalytic reaction.

  13. Salivary Alpha-Amylase Reactivity in Breast Cancer Survivors

    PubMed Central

    Wan, Cynthia; Couture-Lalande, Marie-Ève; Narain, Tasha A.; Lebel, Sophie; Bielajew, Catherine

    2016-01-01

    The two main components of the stress system are the hypothalamic-pituitary-adrenal (HPA) and sympathetic-adrenal-medullary (SAM) axes. While cortisol has been commonly used as a biomarker of HPA functioning, much less attention has been paid to the role of the SAM in this context. Studies have shown that long-term breast cancer survivors display abnormal reactive cortisol patterns, suggesting a dysregulation of their HPA axis. To fully understand the integrity of the stress response in this population, this paper explored the diurnal and acute alpha-amylase profiles of 22 breast cancer survivors and 26 women with no history of cancer. Results revealed that breast cancer survivors displayed identical but elevated patterns of alpha-amylase concentrations in both diurnal and acute profiles relative to that of healthy women, F (1, 39) = 17.95, p < 0.001 and F (1, 37) = 7.29, p = 0.010, respectively. The average area under the curve for the diurnal and reactive profiles was 631.54 ± 66.94 SEM and 1238.78 ± 111.84 SEM, respectively. This is in sharp contrast to their cortisol results, which showed normal diurnal and blunted acute patterns. The complexity of the stress system necessitates further investigation to understand the synergistic relationship of the HPA and SAM axes. PMID:27023572

  14. Antidiabetic Indian Plants: A Good Source of Potent Amylase Inhibitors

    PubMed Central

    Bhat, Menakshi; Zinjarde, Smita S.; Bhargava, Shobha Y.; Kumar, Ameeta Ravi; Joshi, Bimba N.

    2011-01-01

    Diabetes is known as a multifactorial disease. The treatment of diabetes (Type II) is complicated due to the inherent patho-physiological factors related to this disease. One of the complications of diabetes is post-prandial hyperglycemia (PPHG). Glucosidase inhibitors, particularly α-amylase inhibitors are a class of compounds that helps in managing PPHG. Six ethno-botanically known plants having antidiabetic property namely, Azadirachta indica Adr. Juss.; Murraya koenigii (L.) Sprengel; Ocimum tenuflorum (L.) (syn: Sanctum); Syzygium cumini (L.) Skeels (syn: Eugenia jambolana); Linum usitatissimum (L.) and Bougainvillea spectabilis were tested for their ability to inhibit glucosidase activity. The chloroform, methanol and aqueous extracts were prepared sequentially from either leaves or seeds of these plants. It was observed that the chloroform extract of O. tenuflorum; B. spectabilis; M. koenigii and S. cumini have significant α-amylase inhibitory property. Plants extracts were further tested against murine pancreatic, liver and small intestinal crude enzyme preparations for glucosidase inhibitory activity. The three extracts of O. tenuflorum and chloroform extract of M. koenigi showed good inhibition of murine pancreatic and intestinal glucosidases as compared with acarbose, a known glucosidase inhibitor. PMID:18955350

  15. Antidiabetic Indian plants: a good source of potent amylase inhibitors.

    PubMed

    Bhat, Menakshi; Zinjarde, Smita S; Bhargava, Shobha Y; Kumar, Ameeta Ravi; Joshi, Bimba N

    2011-01-01

    Diabetes is known as a multifactorial disease. The treatment of diabetes (Type II) is complicated due to the inherent patho-physiological factors related to this disease. One of the complications of diabetes is post-prandial hyperglycemia (PPHG). Glucosidase inhibitors, particularly α-amylase inhibitors are a class of compounds that helps in managing PPHG. Six ethno-botanically known plants having antidiabetic property namely, Azadirachta indica Adr. Juss.; Murraya koenigii (L.) Sprengel; Ocimum tenuflorum (L.) (syn: Sanctum); Syzygium cumini (L.) Skeels (syn: Eugenia jambolana); Linum usitatissimum (L.) and Bougainvillea spectabilis were tested for their ability to inhibit glucosidase activity. The chloroform, methanol and aqueous extracts were prepared sequentially from either leaves or seeds of these plants. It was observed that the chloroform extract of O. tenuflorum; B. spectabilis; M. koenigii and S. cumini have significant α-amylase inhibitory property. Plants extracts were further tested against murine pancreatic, liver and small intestinal crude enzyme preparations for glucosidase inhibitory activity. The three extracts of O. tenuflorum and chloroform extract of M. koenigi showed good inhibition of murine pancreatic and intestinal glucosidases as compared with acarbose, a known glucosidase inhibitor.

  16. Amylase Variation in the Salt Marsh Amphipod, GAMMARUS PALUSTRIS

    PubMed Central

    Borowsky, Richard; Borowsky, Betty; Milani, Haleh; Greenberg, Pietra

    1985-01-01

    There are two common alleles at the Amylase-2 locus in populations of Gammarus palustris, the salt marsh amphipod. Intensive sampling of individuals from two localities at Jamaica Bay revealed a consistent pattern of heterozygote deficiency.—Five possible sources of heterozygote deficiency were examined in this study. Four of them—selection against heterozygotes, null alleles at the locus, assortative mating for amylase genotype and inbreeding—are inconsistent with the evidence and are rejected. The fifth possibility, Wahlund effects due to genetic differentiation of the population, is tentatively accepted. Although there is no direct evidence for differentiation within this population, separate populations along the Eastern seaboard are highly differentiated in a nonclinal pattern. Furthermore, the Wahlund hypothesis is consistent with observations on differences in degree of deficiency exhibited among collections at Jamaica Bay.—Animals from this population exhibit feeding preferences correlated with genotype. Given the choice of two green algae, Enteromorpha or Ulva, the frequency of the slow allele among individuals choosing Enteromorpha was higher than among those choosing Ulva. This suggests that the animals assort themselves in the field into subpopulations with different allelic frequencies. This assortment could contribute to the maintenance of the polymorphism and to the observed heterozygote deficiency. We hypothesize that genotype influences behavior in this system through the action of enzyme on substrate, which determines the nature of the oligosaccharide pool liberated early in amylolysis. PMID:17246300

  17. Effects of dietary amylase and sucrose on productivity of cows fed low-starch diets.

    PubMed

    Vargas-Rodriguez, C F; Engstrom, M; Azem, E; Bradford, B J

    2014-07-01

    Recent studies have observed positive effects of both sucrose and exogenous amylase on the productivity of dairy cattle. Our objective was to evaluate direct effects and interactions of amylase and sucrose on dry matter intake (DMI), milk production, and milk components. Forty-eight multiparous Holstein cows between 70 and 130 d in milk were randomly assigned to each of 4 pens (12 cows/pen). Pens were randomly assigned to treatment sequence in a 4 × 4 Latin square design, balanced for carryover effects. Treatment periods were 28 d, with 24 d for diet adaptation and 4d for sample and data collection. The treatments were a control diet (36% NDF and 21% starch), the control diet with amylase [0.5 g/kg of DM; Ronozyme RumiStar 600 (CT); DSM Nutritional Products Ltd., Basel, Switzerland], a diet with sucrose replacing corn grain at 2% of DM, and the sucrose diet with amylase (0.5 g/kg of DM). All data were analyzed with mixed models, including the fixed effects of sugar, amylase, and their interaction, and the random effects of period and pen. Milk data included the random effects of cow nested within pen and pen × period to provide the error term for the pen-level analysis. Dry matter intake was not affected by treatments. Milk yield and milk composition were not altered by the inclusion of sucrose or amylase; however, a tendency for an amylase × sucrose interaction was observed for milk protein content, reflecting slightly lower milk protein concentrations for amylase and sucrose treatments (3.00 and 2.99 ± 0.03%) compared with the control and amylase + sucrose treatments (3.02 and 3.03 ± 0.03%). Solids-corrected and fat-corrected milk yields were not significantly altered by treatment, although the direct effect of amylase approached significance for both variables, suggesting possible small increases with amylase supplementation (~0.5 kg/d). Feed efficiency (energy-corrected milk divided by dry matter intake) numerically increased with either amylase (1.57 ± 0

  18. OPTIMIZATION OF ALKALINE Α-AMYLASE PRODUCTION BY THERMOPHILIC BACILL US SUBTILIS.

    PubMed

    Al-Johani, Nuha Bakeet; Al-Seeni, Madeha N; Ahmed, Youssri Mohamed

    2017-01-01

    Starch-degrading amylase enzyme is important in biotechnological applications as food, fermentation, textile, paper and pharmaceutical purposes. The aim of current study to isolate alkaline thermostable α-amylase bacteria and then study the composition of medium and culture conditions to optimize cells growth and a-amylase production. Thermophilic amylase producing bacterium was isolated from local hot water-springs in Gazan city Saudi Arabia. Phylogenetic analysis of 16 S rRNA sequence for the strain revealed that the strain have the same sequence of Bacillus subtilis. Maximum amylase production was observed, when B. subtilis cultured in medium containing starch at concentration 0.5%, and 10 g/L peptones as nitrogen source at pH 8.5 in when it was incubated for 48 h at 45°C. An amylase-producing bacterium were isolated from hot-spring water and was identified as B. subtilis. Amylase produced from B.subtilis had optimum temperature 45°C and pH 8.5 in shaking media.

  19. An analytical method for measuring α-amylase activity in starch-containing foods.

    PubMed

    Koyama, Kazuo; Hirao, Takashi; Toriba, Akira; Hayakawa, Kazuichi

    2013-05-01

    The quality of starch-containing foods may be significantly impaired by contamination with very small amounts of α-amylase, which can enzymatically hydrolyze the starch and cause viscosity loss. Thus, for quality control, it is necessary to have an analytical method that can measure low amylase activity. We developed a sensitive analytical method for measuring the activity of α-amylase (from Bacillus subtilis) in starch-containing foods. The method consists of six steps: (1) crude extraction of α-amylase by centrifugation and filtration; (2) α-amylase purification by desalting and anion-exchange chromatography; (3) reaction of the purified amylase with boron-dipyrromethene (BODIPY)-labeled substrate, which releases a fluorescent fragment upon digestion of the substrate, thus avoiding interference from starch derivatives in the sample; (4) stopping the reaction with acetonitrile; (5) reversed-phase solid-phase extraction of the fluorescent substrate to remove contaminating dye and impurities; and (6) separation and measurement of BODIPY fluorescence by HPLC. The proposed method could quantify α-amylase activities as low as 10 mU/mL, which is enough to reduce the viscosity of starch-containing foods. Copyright © 2012 John Wiley & Sons, Ltd.

  20. Effects of Pulsed Electric Field (PEF) Treatment on Enhancing Activity and Conformation of α-Amylase.

    PubMed

    Tian, Mei-ling; Fang, Ting; Du, Mu-ying; Zhang, Fu-sheng

    2016-04-01

    To explore an efficient, safe, and speedy application of pulsed electric field (PEF) technology for enzymatic modification, effects of PEF treatment on the enzymatic activity, property and kinetic parameters of α-amylase were investigated. Conformational transitions were also studied with the aid of circular dichroism (CD) and fluorescence spectra. The maximum enzymatic activity of α-amylase was obtained under 15 kV/cm electric field intensity and 100 mL/min flow velocity PEF treatment, in which the enzymatic activity increased by 22.13 ± 1.14% compared with control. The activation effect could last for 18 h at 4 °C. PEF treatment could widen the range of optimum temperature for α-amylase, however, it barely exerted any effect on the optimum pH. On the other hand, α-amylase treated by PEF showed an increase of Vmax, t1/2 and ΔG, whereas a decrease of Km and k were observed. Furthermore, it can be observed from fluorescence and CD spectra that PEF treatment had increased the number of amino acid residues, especially that of tryptophan, on α-amylase surface with enhanced α-helices by 34.76% and decreased random coil by 12.04% on α-amylase when compared with that of untreated. These changes in structure had positive effect on enhancing α-amylase activity and property.

  1. A new group of glycoside hydrolase family 13 α-amylases with an aberrant catalytic triad

    PubMed Central

    Sarian, Fean D.; Janeček, Štefan; Pijning, Tjaard; Ihsanawati; Nurachman, Zeily; Radjasa, Ocky K.; Dijkhuizen, Lubbert; Natalia, Dessy; van der Maarel, Marc J. E. C.

    2017-01-01

    α-Amylases are glycoside hydrolase enzymes that act on the α(1→4) glycosidic linkages in glycogen, starch, and related α-glucans, and are ubiquitously present in Nature. Most α-amylases have been classified in glycoside hydrolase family 13 with a typical (β/α)8-barrel containing two aspartic acid and one glutamic acid residue that play an essential role in catalysis. An atypical α-amylase (BmaN1) with only two of the three invariant catalytic residues present was isolated from Bacillus megaterium strain NL3, a bacterial isolate from a sea anemone of Kakaban landlocked marine lake, Derawan Island, Indonesia. In BmaN1 the third residue, the aspartic acid that acts as the transition state stabilizer, was replaced by a histidine. Three-dimensional structure modeling of the BmaN1 amino acid sequence confirmed the aberrant catalytic triad. Glucose and maltose were found as products of the action of the novel α-amylase on soluble starch, demonstrating that it is active in spite of the peculiar catalytic triad. This novel BmaN1 α-amylase is part of a group of α-amylases that all have this atypical catalytic triad, consisting of aspartic acid, glutamic acid and histidine. Phylogenetic analysis showed that this group of α-amylases comprises a new subfamily of the glycoside hydrolase family 13. PMID:28287181

  2. A new group of glycoside hydrolase family 13 α-amylases with an aberrant catalytic triad.

    PubMed

    Sarian, Fean D; Janeček, Štefan; Pijning, Tjaard; Ihsanawati; Nurachman, Zeily; Radjasa, Ocky K; Dijkhuizen, Lubbert; Natalia, Dessy; van der Maarel, Marc J E C

    2017-03-13

    α-Amylases are glycoside hydrolase enzymes that act on the α(1→4) glycosidic linkages in glycogen, starch, and related α-glucans, and are ubiquitously present in Nature. Most α-amylases have been classified in glycoside hydrolase family 13 with a typical (β/α)8-barrel containing two aspartic acid and one glutamic acid residue that play an essential role in catalysis. An atypical α-amylase (BmaN1) with only two of the three invariant catalytic residues present was isolated from Bacillus megaterium strain NL3, a bacterial isolate from a sea anemone of Kakaban landlocked marine lake, Derawan Island, Indonesia. In BmaN1 the third residue, the aspartic acid that acts as the transition state stabilizer, was replaced by a histidine. Three-dimensional structure modeling of the BmaN1 amino acid sequence confirmed the aberrant catalytic triad. Glucose and maltose were found as products of the action of the novel α-amylase on soluble starch, demonstrating that it is active in spite of the peculiar catalytic triad. This novel BmaN1 α-amylase is part of a group of α-amylases that all have this atypical catalytic triad, consisting of aspartic acid, glutamic acid and histidine. Phylogenetic analysis showed that this group of α-amylases comprises a new subfamily of the glycoside hydrolase family 13.

  3. Where do animal alpha-amylases come from? An interkingdom trip.

    PubMed

    Da Lage, Jean-Luc; Danchin, Etienne G J; Casane, Didier

    2007-08-21

    Alpha-amylases are widely found in eukaryotes and prokaryotes. Few amino acids are conserved among these organisms, but at an intra-kingdom level, conserved protein domains exist. In animals, numerous conserved stretches are considered as typical of animal alpha-amylases. Searching databases, we found no animal-type alpha-amylases outside the Bilateria. Instead, we found in the sponge Reniera sp. and in the sea anemone Nematostella vectensis, alpha-amylases whose most similar cognate was that of the amoeba Dictyostelium discoideum. We found that this "Dictyo-type" alpha-amylase was shared not only by these non-Bilaterian animals, but also by other Amoebozoa, Choanoflagellates, and Fungi. This suggested that the Dictyo-type alpha-amylase was present in the last common ancestor of Unikonts. The additional presence of the Dictyo-type in some Ciliates and Excavates, suggests that horizontal gene transfers may have occurred among Eukaryotes. We have also detected putative interkingdom transfers of amylase genes, which obscured the historical reconstitution. Several alternative scenarii are discussed.

  4. Role of parotid amylase in starch digestion in the gastro-intestinal tracts of diabetic rats.

    PubMed

    Kurahashi, M; Inomata, K

    1989-09-01

    In order for the role of parotid amylase in starch digestion in the gastro-intestinal tracts of diabetic rats to be clarified, this study investigated the effect of parotid-duct ligation on both amylase secretion from the parotid glands and pancreas into the gastro-intestinal tract and on starch digestion in the gastro-intestinal contents during feedings. In both diabetic rats and control rats, parotid-duct ligation reduced amylase activity in both the parotid glands during fasting and in the gastric contents after feeding. The amylase activity in the intestinal contents after feeding was reduced by parotid-duct ligation in the diabetic rats. Starch digestion in the gastro-intestinal tract after feeding was reduced by parotid-duct ligation in the diabetic rats. The results suggest that most of the amylase activity in the gastric contents and a large part of the amylase activity in the intestinal contents are derived from the parotid glands, and that parotid amylase plays an important role in starch digestion in the gastro-intestinal tracts of diabetic rats.

  5. Salivary alpha-amylase: role in dental plaque and caries formation.

    PubMed

    Scannapieco, F A; Torres, G; Levine, M J

    1993-01-01

    Salivary alpha-amylase, one of the most plentiful components in human saliva, has at least three distinct biological functions. The enzymatic activity of alpha-amylase undoubtedly plays a role in carbohydrate digestion. Amylase in solution binds with high affinity to a selected group of oral streptococci, a function that may contribute to bacterial clearance and nutrition. The fact that alpha-amylase is also found in acquired enamel pellicle suggests a role in the adhesion of alpha-amylase-binding bacteria. All of these biological activities seem to depend on an intact enzyme conformation. Binding of alpha-amylase to bacteria and teeth may have important implications for dental plaque and caries formation. alpha-Amylase bound to bacteria in plaque may facilitate dietary starch hydrolysis to provide additional glucose for metabolism by plaque microorganisms in close proximity to the tooth surface. The resulting lactic acid produced may be added to the pool of acid in plaque to contribute to tooth demineralization.

  6. Experimental approach to optimize the use of alpha-Amylases in breadmaking.

    PubMed

    Rosell, C M; Haros, M; Escrivá, C; Benedito De Barber, C

    2001-06-01

    alpha-Amylases from different origins (wheat, malted barley, fungi, and bacteria) are used extensively to improve breadmaking. However, the enzyme activities, in addition to the differences associated with their origins, are strongly affected by the process conditions and the presence of other compounds in the medium. The activity of different alpha-amylases was tested under different conditions (pH and temperature), and in the presence of some bread ingredients (salt and sugar), some breadmaking additives (ascorbic acid and sodium propionate), and some metabolites (organic acids and saccharides) generated during the fermentation step, to envisage the behavior of these alpha-amylases during the breadmaking process. The alpha-amylase activities were affected to a different extent by the addition of these compounds depending on the enzyme origin. In general, the alpha-amylases from cereals (wheat and malted barley) were less sensitive to the presence of some ingredients, additives, and metabolites. These results show the great variation of the alpha-amylase activity with the process conditions and the importance of its knowledge in the selection of the appropriate alpha-amylase for a specific breadmaking process.

  7. Conjugation of α-amylase with dextran for enhanced stability: process details, kinetics and structural analysis.

    PubMed

    Jadhav, Swati B; Singhal, Rekha S

    2012-11-06

    The influence of enzyme polysaccharide interaction on enzyme stability and activity was elucidated by covalently binding dextran to a model enzyme, α-amylase. The conjugation process was optimized with respect to concentration of oxidizing agent, pH of enzyme solution, ratio of dextran to enzyme concentration, temperature and time of conjugate formation, and was found to affect the stability of α-amylase. α-Amylase conjugated under optimized conditions showed 5% loss of activity but with enhanced thermal and pH stability. Lower inactivation rate constant of conjugated α-amylase within the temperature range of 60-80 °C implied its better stability. Activation energy for denaturation of α-amylase increased by 8.81 kJ/mol on conjugation with dextran. Analysis of secondary structure of α-amylase after covalent binding with dextran showed helix to turn conversion without loss of functional properties of α-amylase. Covalent bonding was found to be mandatory for the formation of conjugate.

  8. Protein engineering in the alpha-amylase family: catalytic mechanism, substrate specificity, and stability.

    PubMed

    Svensson, B

    1994-05-01

    Most starch hydrolases and related enzymes belong to the alpha-amylase family which contains a characteristic catalytic (beta/alpha)8-barrel domain. Currently known primary structures that have sequence similarities represent 18 different specificities, including starch branching enzyme. Crystal structures have been reported in three of these enzyme classes: the alpha-amylases, the cyclodextrin glucanotransferases, and the oligo-1,6-glucosidases. Throughout the alpha-amylase family, only eight amino acid residues are invariant, seven at the active site and a glycine in a short turn. However, comparison of three-dimensional models with a multiple sequence alignment suggests that the diversity in specificity arises by variation in substrate binding at the beta-->alpha loops. Designed mutations thus have enhanced transferase activity and altered the oligosaccharide product patterns of alpha-amylases, changed the distribution of alpha-, beta- and gamma-cyclodextrin production by cyclodextrin glucanotransferases, and shifted the relative alpha-1,4:alpha-1,6 dual-bond specificity of neopullulanase. Barley alpha-amylase isozyme hybrids and Bacillus alpha-amylases demonstrate the impact of a small domain B protruding from the (beta/alpha)8-scaffold on the function and stability. Prospects for rational engineering in this family include important members of plant origin, such as alpha-amylase, starch branching and debranching enzymes, and amylomaltase.

  9. Fluid and amylase secretion by perfused parotid gland: physio-morphological approach.

    PubMed Central

    Murakami, M; Yoshimura, K; Sugiya, H; Segawa, A; Loffredo, F; Testa-Riva, F; Riva, A

    2000-01-01

    Whole gland perfusion technique was applied to rat parotid glands to assess whether amylase affects fluid secretion. Control perfusion without any secretagogue evoked no spontaneous secretion. Carbachol (CCh 1 microM) induced both amylase and fluid secretion with distinctive kinetics. Fluid secretion occurred constantly around 60 microL/g-min, whereas amylase secretion exhibited an initial peak, followed by a rapid decrease to reach a plateau. Isoproterenol (Isop 1 microM) alone did not induce fluid secretion although it evoked amylase secretion as measured in isolated perfused acini. Addition of Isop during CCh stimulation evoked a rapid and large rise in amylase secretion accompanied by small increase in oxygen consumption. Morphological observations carried out by HR SEM and TEM revealed exocytotic profiles following Isop stimulation. CCh stimulation alone seldom showed exocytotic profiles, suggesting a low incidence of amylase secretion during copious fluid secretion. Combined stimulation of CCh and Isop induced both vacuolation and exocytosis along intercellular canaliculi. These findings suggest that control of salivary fluid secretion is independent of the amylase secretion system induced by CCh and/or Isop. PMID:10981508

  10. Effects of alpha-amylase on in vitro growth of Legionella pneumophila.

    PubMed Central

    Bortner, C A; Miller, R D; Arnold, R R

    1983-01-01

    Sterile parotid saliva inhibited growth of Legionella pneumophila on solid media, and the salivary component involved in this inhibition has been shown to be amylase. Disk diffusion and well plate assays were used to study possible mechanisms for this effect. The amylolytic activity of saliva copurified with inhibitory activity, and both activities were sensitive to proteinase K digestion and heat treatment. In addition, purified alpha-amylase from several sources (bacteria, fungi, porcine pancreas, and human saliva) exhibited similar activity. Incorporation of charcoal or bovine serum albumin into media blocked inhibition by amylase. Replacement of Bacto-Agar with Noble agar (both from Difco Laboratories) prevented growth inhibition in the absence of starch. However, when corn starch was present with Noble agar, amylase-induced growth inhibition occurred. Purification of starch by washing with methanol eliminated some toxic component. The toxic component from starch could be recovered from the methanol wash and inhibited growth of L. pneumophila in the absence of amylase activity. The results suggest that toxic substances exist in media components which may be unmasked during salivary amylase digestion of starch. This effect may explain, in part, the difficulty in recovery of the organism from clinical specimens containing amylase. PMID:6190756

  11. Evaluation of amylase testing as a tool for saliva screening of crime scene trace swabs.

    PubMed

    Hedman, Johannes; Dalin, Erik; Rasmusson, Birgitta; Ansell, Ricky

    2011-06-01

    Amylase testing has been used as a presumptive test for crime scene saliva for over three decades, mainly to locate saliva stains on surfaces. We have developed a saliva screening application for crime scene trace swabs, utilising an amylase sensitive paper (Phadebas(®) Forensic Press test). Positive results were obtained for all tested dried saliva stains (0.5-32 μL) with high or intermediate amylase activity (840 and 290 kU/L). Results were typically obtained within 5 min, and all samples that produced DNA profiles were positive. However, salivary amylase activities, as well as DNA concentrations, vary significantly between individuals. We show that there is no correlation between amylase activity and amount of DNA in fresh saliva. Even so, a positive amylase result indicates presence of saliva, and thereby presence of DNA. Amylase testing may be useful for screening in investigations where the number of DNA analyses is limited due to cost, e.g., in volume crime. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  12. Isolation and characterization of a novel thermostable alpha-amylase from Korean pine seeds.

    PubMed

    Azad, Md Abul Kalam; Bae, Jae-Han; Kim, Jong-Sang; Lim, Jin-Kyu; Song, Kyung-Sik; Shin, Beom-Soo; Kim, Hak-Ryul

    2009-10-31

    Amylases have significant importance in broad industrial application including bio-ethanol production. Although amylases are widely distributed in microbes, plants and animals, it has been sought for new amylases from various sources with special industrial potential. In this study we firstly isolated and characterized a novel thermostable alpha-amylase from Korean pine seed. Enzyme was purified to homogeneity level with purification fold of 1286.1 using several techniques such as self-precipitation, (NH(4))(2)SO(4) fractionation, DEAE anion exchange and starch affinity chromatography. The purified alpha-amylase showed two bands in SDS-PAGE with molecular weight of 44 and 45 kDa. The apparent molecular weight of native enzyme was calculated to be 46.7 kDa. Internal peptide sequencing confirmed that the purified alpha-amylase was a novel enzyme. The optimum pH and temperature for enzyme activity were pH 4.5 and 65 degrees C, respectively. This enzyme was fully stable for 48h at 50 degrees C and retained 80% activity up to 96h. The K(m) and V(max) were 0.84 mg/ml and 3.71 micromol/min, respectively. On the basis of high thermal stability and a broad range of pH stability, the pine seed alpha-amylase showed a good prospect of industrial application.

  13. [Comparison between alpha-amylase from B. amyloliquefaciens and B. licheniformis].

    PubMed

    Maassen, A

    1991-01-01

    Two sequence-homologous alpha-amylases from B. amyloliquefaciens and B. licheniformis were studied with respect to their stability against heat denaturation and were compared with respect to common structure-stabilizing principles. The investigated alpha-amylases were isolated from culture broth of B. amyloliquefaciens and B. licheniformis. The molecular parameters (molecular weight and isoelectric point) are similar. The thermostability was determined by changes of the protein structure (changes of the fluorescence emission spectra). At pH 5.0 the thermostable alpha-amylase from B. licheniformis showed a rate of denaturation which was achieved by the thermolabile alpha-amylase from B. amyloliquefaciens at a temperature 15 degrees lower. The alpha-amylase from B. licheniformis exhibits a marked stability also at the alkaline pH-range in contrast to the alpha-amylase from B. amyloliquefaciens. From measurements in the presence of EDTA and Ca2+ follows that both enzymes are stabilized by binding of calcium ions. An analysis of preferred amino acid exchanges between the two sequence-homologous alpha-amylases showed correspondences and differences to the well-known diagram of ARGOS. Possibly an increased thermic stability can already be achieved by special amino acid exchanges without significant changes in the protein structure.

  14. Alpha-amylase kinetic test in bodily single and mixed stains.

    PubMed

    Barni, Filippo; Berti, Andrea; Rapone, Cesare; Lago, Giampietro

    2006-11-01

    Recently, in Italy, a murder and a putative sexual violence was accomplished on a child. A bodily fluids mixture on the child's underwear between the victim (female) and the suspect (male) was ascertained by short tandem repeat (STR) DNA typing and, due to the absence of seminal fluid, saliva from the suspect and urine from the child was hypothesized. In order to investigate the possibility of specifically and rapidly detecting saliva stains both alone and mixed with other bodily fluids, we used a quantitative spectrophotometric technique, named Amylase test, for the detection of alpha-amylases. We determined alpha-amylase activity and reaction kinetic curves in several samples collected from the child's underwear. In order to confirm our intuition, we first tested saliva, perspiration, and urine, singularly and in mixtures; second, several forensic stains including saliva, perspiration, urine stains, saliva/perspiration, and saliva/urine mixture stains were tested. Evaluating alpha-amylase activity values and time-course curves' behavior of alpha-amylase reactions we were able to recognize successfully, in all cases, the presence of saliva and to distinguish it specifically from other bodily fluids containing alpha-amylase. A further confirmation of our result was provided by STR DNA typing on several areas of the underwear: a clear correlation between alpha-amylases activity and male DNA was detected on all the samples evaluated.

  15. Variation in Amylase Haplotypes among Congenic Lines of the House Mouse

    PubMed Central

    Nielsen, J. Tonnes

    1982-01-01

    Pancreatic amylase in the mouse displays considerable quantitative genetic variation. Agar gel electrophoresis reveals that homozygous animals have either one form of the enzyme, type A, or two forms, type AB. Only few animals have been found that contradict this statement, namely among Mus musculus castaneus from Thailand, which has a single-banded B type. Double-banded homozygous specimens of various origins have different relative proportions of the two isoenzymes. By measuring the A:B ratios in such animals, a number of distinct haplotypes or amylase complexes, determining ratios ranging from 61% A:39% B to 12% A:88% B, have been recognized. These complexes differ also with respect to the total amount of amylase produced. If the reference stock C3H/As is given the value 1, then other haplotypes have values ranging from 1.0 to 0.27. Nineteen amylase haplotypes have been established in congenic lines on a C3H/As background. Some of these lines contain at least four active pancreatic amylase structural genes and breeding experiments have demonstrated that the genetic elements regulating total amylase production and relative proportions of the isoenzymes are located within the amylase complex, cis-acting, and very closely linked to the structural genes. PMID:6184261

  16. Hormonal Regulation of alpha-Amylase Gene Transcription in Wild Oat (Avena fatua L.) Aleurone Protoplasts.

    PubMed

    Zwar, J A; Hooley, R

    1986-02-01

    The time of appearance and relative amounts of alpha-amylase mRNA in wild oat (Avena fatua L.) aleurone protoplasts incubated with 1 micromolar gibberellin A(4) (GA(4)) were closely correlated with the amounts of alpha-amylase enzyme secreted by the protoplasts. In the absence of GA(4), or when protoplasts were incubated with 25 micromolar abscisic acid (ABA) together with 1 micromolar GA(4) no alpha-amylase mRNA was detected and only very low levels of alpha-amylase were secreted. Nuclei were isolated in high yields (65-71%) from aleurone protoplasts and in an in vitro transcription system displayed characteristics of a faithful DNA-dependent RNA synthesizing system. The time course of incorporation of [(3)H]-UTP suggested that the RNA synthesized was mainly ;run off' transcription and therefore that the transcripts produced in vitro were those being synthesized in the protoplasts at the times when the nuclei were isolated. By hybridizing in vitro synthesized [(32)P]RNA to barley alpha-amylase cDNA and control filters we have estimated that 90 +/- 10 ppm of the transcripts synthesized by nuclei isolated from GA(4) treated protoplasts can be attributed to alpha-amylase sequences and that statistically insignificant amounts of these transcripts are obtained from control and GA(4) plus ABA treatments. The results suggest that GA(4) and ABA influence the transcription of alpha-amylase genes in aleurone protoplasts of wild oat.

  17. Beta-AMYLASE4, a noncatalytic protein required for starch breakdown, acts upstream of three active beta-amylases in Arabidopsis chloroplasts.

    PubMed

    Fulton, Daniel C; Stettler, Michaela; Mettler, Tabea; Vaughan, Cara K; Li, Jing; Francisco, Perigio; Gil, Manuel; Reinhold, Heike; Eicke, Simona; Messerli, Gaëlle; Dorken, Gary; Halliday, Karen; Smith, Alison M; Smith, Steven M; Zeeman, Samuel C

    2008-04-01

    This work investigated the roles of beta-amylases in the breakdown of leaf starch. Of the nine beta-amylase (BAM)-like proteins encoded in the Arabidopsis thaliana genome, at least four (BAM1, -2, -3, and -4) are chloroplastic. When expressed as recombinant proteins in Escherichia coli, BAM1, BAM2, and BAM3 had measurable beta-amylase activity but BAM4 did not. BAM4 has multiple amino acid substitutions relative to characterized beta-amylases, including one of the two catalytic residues. Modeling predicts major differences between the glucan binding site of BAM4 and those of active beta-amylases. Thus, BAM4 probably lost its catalytic capacity during evolution. Total beta-amylase activity was reduced in leaves of bam1 and bam3 mutants but not in bam2 and bam4 mutants. The bam3 mutant had elevated starch levels and lower nighttime maltose levels than the wild type, whereas bam1 did not. However, the bam1 bam3 double mutant had a more severe phenotype than bam3, suggesting functional overlap between the two proteins. Surprisingly, bam4 mutants had elevated starch levels. Introduction of the bam4 mutation into the bam3 and bam1 bam3 backgrounds further elevated the starch levels in both cases. These data suggest that BAM4 facilitates or regulates starch breakdown and operates independently of BAM1 and BAM3. Together, our findings are consistent with the proposal that beta-amylase is a major enzyme of starch breakdown in leaves, but they reveal unexpected complexity in terms of the specialization of protein function.

  18. alpha. -Amylase of Clostridium thermosulfurogenes EM1: Nucleotide sequence of the gene, processing of the enzyme, and comparison to other. alpha. -amylases

    SciTech Connect

    Bahl, H.; Burchhardt, G.; Spreinat, A.; Haeckel, K.; Wienecke, A.; Antranikian, G.; Schmidt, B. )

    1991-05-01

    The nucleotide sequence of the {alpha}-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes Em1 suggested that the {alpha}-amylase is translated form mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature {alpha}-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 {alpha}-amylase with those from other bacterial and eukaryotic {alpha}-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca{sup 2+}-binding site (consensus region I) of this Ca{sub 2+}-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the {alpha}-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the {beta}-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains.

  19. alpha-Amylase of Clostridium thermosulfurogenes EM1: nucleotide sequence of the gene, processing of the enzyme, and comparison of other alpha-amylases.

    PubMed Central

    Bahl, H; Burchhardt, G; Spreinat, A; Haeckel, K; Wienecke, A; Schmidt, B; Antranikian, G

    1991-01-01

    The nucleotide sequence of the alpha-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes EM1 suggested that the alpha-amylase is translated from mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature alpha-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 alpha-amylase with those from other bacterial and eucaryotic alpha-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca(2+)-binding site (consensus region I) of this Ca(2+)-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the alpha-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the beta-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains. PMID:1854207

  20. A quantitative assessment of the importance of barley seed alpha-amylase, beta-amylase, debranching enzyme, and alpha-glucosidase in starch degradation.

    PubMed

    Sun, Z T; Henson, C A

    1991-02-01

    Extracts of germinated barley (Hordeum vulgare L.) seeds of 41 different genotypes were analyzed for their activities of alpha-amylase, beta-amylase, alpha-glucosidase, and debranching enzyme and for their abilities to hydrolyze boiled soluble starch, nonboiled soluble starch, and starch granules extracted from barley seeds with water. Linear correlation analysis, used to quantitate the interactions between the seven parameters, revealed that boiled soluble starch was not a good substrate for predicting activities of enzymes functioning in in vivo starch hydrolysis as the extracts' abilities to hydrolyze boiled soluble starch was not correlated with their abilities to hydrolyze native starch granules. Activities of alpha-amylase and alpha-glucosidase were positively and significantly correlated with the seed extracts' abilities to hydrolyze all three starches. beta-Amylase was only significantly correlated with hydrolysis of boiled soluble starch. No significant correlations existed between debranching enzyme activity and hydrolysis of any of the three starches. Interactions between the four enzymes as they functioned together to hydrolyze the three types of starch were evaluated by path coefficient analysis. alpha-Amylase contributed to hydrolyses of all three starches primarily by its direct effect (noninteractive component). This direct contribution increased as the substrate progressed from the completely artificial boiled soluble starch, to the most physiologically significant substrate, native starch granules. alpha-Glucosidase contributed to the hydrolysis of boiled soluble starch primarily by its direct effect (noninteractive) yet contributed to starch granule hydrolysis primarily via its interaction with alpha-amylase (indirect effect). The contribution of beta-amylase to hydrolysis of boiled soluble starch was direct and it did not contribute significantly to hydrolysis of native starch granules.

  1. Biochemical characterization of the alpha-amylase inhibitor in mungbeans and its application in inhibiting the growth of Callosobruchus maculatus.

    PubMed

    Wisessing, Anussorn; Engkagul, Arunee; Wongpiyasatid, Arunee; Choowongkomon, Kiattawee

    2010-02-24

    The insect Callosobruchus maculatus causes considerable damage to harvested mungbean seeds every year, which leads to commercial losses. However, recent studies have revealed that mungbean seeds contain alpha-amylase inhibitors that can inhibit the protein C. maculatus, preventing growth and development of the insect larvae in the seed, thus preventing further damage. For this reason, the use of alpha-amylase inhibitors to interfere with the pest's digestion process has become an interesting alternative biocontrolling agent. In this study, we have isolated and purified the alpha-amylase inhibitor from mungbean seeds (KPS1) using ammonium sulfate precipitation, gel filtration chromatography and reversed phase HPLC. We found that the alpha-amylase inhibitor, isolated as a monomer, had a molecular weight of 27 kDa. The alpha-amylase inhibitor was purified 750-fold with a final yield of 0.4 mg of protein per 30 g of mungbean seeds. Its specific activity was determined at 14.5 U (mg of protein)(-1). Interestingly, we found that the isolated alpha-amylase inhibitor inhibits C. maculatus alpha-amylase but not human salivary alpha-amylase. After preincubation of the enzyme with the inhibitor, the mungbean alpha-amylase inhibitor inhibited C. maculatus alpha-amylase activity by decreasing V(max) while increasing the K(m) constant, indicating that the mungbean alpha-amylase is a mix noncompetitive inhibitor. The in vivo effect of alpha-amylase inhibitor on the mortality of C. maculatus shows that the alpha-amylase inhibitor acts on C. maculatus during the development stage, by reducing carbohydrate digestion necessary for growth and development, rather than during the end laying/hatching stage. Our results suggest that mungbean alpha-amylase inhibitor could be a useful future biocontrolling agent.

  2. Properties and synthesis de novo of auxin-induced α-amylase in pea cotyledons.

    PubMed

    Hirasawa, E; Yamamoto, S

    1991-07-01

    Analysis of starch-degrading enzymes in a crude extract of detached cotyledons of Pisum sativum L. by polyacrylamide gel electrophoresis (PAGE) demonstrated the presence of one band of α-amylase (EC 3.2.1.1) activity. The activity of only this amylase was promoted in cotyledons incubated with 2,4-dichlorophenoxyacetic acid (2,4-D). The auxin-induced α-amylase from pea cotyledons was purified to homogeneity, as judged by the criterion of a single band after PAGE. The relative molecular mass (Mr), estimated by gel filtration, was approx. 42 000 and the enzyme contained no carbohydrate moiety. Sodium dodecylsulfate-PAGE yielded a single band that corresponded to an Mr of 41 000. The isoelectric point was 5.85 and the aminoacid composition was similar to that of α-amylase from other plants. When [(3)H]leucine was fed to detached dry cotyledons prior to incubation, the radioactivity in α-amylase from cotyledons incubated in the presence of 2,4-D was found to be approx. 10-fold higher than that from cotyledons incubated in distilled water. When α-amylase from cotyledons incubated with (2)H2O that contained 2,4-D and the tritiated amylase were centrifuged together in a CsCl density gradient, the peak of enzymatic activity of deuterated α-amylase was shifted to a denser fraction than the peak of radioactivity of the tritiated enzyme. These results show that auxin-induced α-amylase in pea cotyledons is synthesized de novo.

  3. Various emetogens increase the secretion of salivary amylase in rats: a potential model in emesis research.

    PubMed

    Fukui, Hideo; Miwa, Eri; Iwachido, Takako; Kitaura, Harumi; Furukawa, Hatsue

    2010-01-01

    We investigated the effects of various emetic agents: cisplatin, apomorphine, lithium chloride (LiCl), rolipram, sibutramine, and the beta(3)-adrenoceptor (AR) agonist CL316243 on salivary amylase secretion in rats. We also determined the inhibitory effect of granisetron, a 5-HT(3)-receptor antagonist, on cisplatin-induced increased salivary amylase activity and the inhibitory effect of bilateral abdominal vagotomy on increases in salivary amylase activity induced by cisplatin and LiCl. Granisetron was administered 15 min before and 1 h after cisplatin administration. Cisplatin (10 - 15 mg/kg, i.v.) increased salivary amylase activity dose-dependently and induced an acute increase from 1.5 h post-treatment with 15 mg/kg. Apomorphine (1 - 3 mg/kg, s.c.), LiCl (120 mg/kg, i.p.), rolipram (3 - 10 mg/kg, p.o.), and sibutramine (10 mg/kg, p.o.) induced significant increases in salivary amylase secretion. On the other hand, CL316243 did not stimulate salivary amylase secretion. The increased amylase activity induced by cisplatin (15 mg/kg, i.v.) was inhibited significantly by granisetron (1 or 3 mg/kg x 2, i.v.) or tended to be inhibited by bilateral abdominal vagotomy, whereas an increase in amylase activity produced by LiCl was not inhibited by abdominal visceral nerve section. These results suggest that salivary amylase activity is useful as a marker for emesis in rats, a species that does not exhibit vomiting.

  4. Serum amylase levels are decreased in Chinese non-alcoholic fatty liver disease patients.

    PubMed

    Yao, Jinmei; Zhao, Ying; Zhang, Juanwen; Hong, Yani; Lu, Huanle; Wu, Jianping

    2014-12-07

    Low serum amylase levels have been reported in patients with metabolic syndrome (MS), diabetes, and asymptomatic non-alcoholic fatty liver disease (NAFLD). However, no study has yet indicated the serum amylase levels in NAFLD with MS. The aim of the present study was to evaluate serum amylase levels in NAFLD patients with and without MS, and to explore a possible association between serum amylase levels with the components of MS and the degree of hepatic fibrosis in NAFLD patients. Our study included 713 NAFLD participants (180 females and 533 males) and 304 healthy control participants (110 females and 194 males). The diagnosis of NAFLD was based on ultrasonography, and advanced fibrosis was assessed by the FIB-4 index. Serum amylase levels were significantly lower in NAFLD patients with MS compared with NAFLD patients without MS and healthy controls (42, 45, and 53 IU/L, respectively). The serum amylase levels of patients with elevated glucose, elevated triglycerides, and low high density lipoprotein cholesterol patients were significantly lower than in case of normal parameters (both p < 0.05). Multivariate logistic regression analysis showed that a relative serum amylase level increase was an independent factor predicting advanced fibrosis (FIB-4 ≥1.3) in NAFLD participants (OR: 1.840, 95% CI: 1.117-3.030, p=0.017). Compared with NAFLD patients without MS and healthy controls, serum amylase levels were significantly lower in NAFLD patients with MS. Moreover, a relative serum amylase increase may be an independent factor of more advanced hepatic fibrosis.

  5. Tracheal amylase dosage as a marker for microaspiration: a pilot study.

    PubMed

    Filloux, B; Bedel, A; Nseir, S; Mathiaux, J; Amadéo, B; Clouzeau, B; Pillot, J; Saghi, T; Vargas, F; Hilbert, G; Gruson, D; Boyer, A

    2013-09-01

    Devices that limit microaspiration through the cuffs of endotracheal tubes could help prevent ventilator-associated pneumonia (VAP). The amount of tracheal microaspirations could be a relevant study endpoint. The aim of our study was to assess whether amylase measured in tracheal secretions constituted a relevant marker for microaspiration. Twenty-six patients, intubated for at least 48 h and supplied with a subglottic secretion-suctioning device, constituted a group with a high risk of microaspiration. Twelve non-ventilated patients that required a bronchoscopy procedure constituted a group with a low risk of microaspiration (the control group). Tracheal (T) amylase was compared between the groups. In the intubated group, a series of oral (O), subglottic (Sg) and tracheal (T) suction samples were collected and T/O, T/Sg, Sg/O amylase ratios were determined. Amylase was measured in 277 (89 Sg, 96 B, 92 T) samples from the intubated group and in 12 T samples from the control group. Tracheal amylase was lower in the control group than the intubated group (191 [10-917] vs. 6661 [2774-19,358] IU/L, P<0.001). Amylase gradually increased from tracheal (6661 [2774-19,358] IU/L), to subglottic (130,750 [55,257-157,717] IU/L), to oral samples (307,606 [200,725-461,300] IU/L), resulting in a median 5.5% T/O ratio. In a subset of intubated patients, T amylase samples were assessed in two different laboratories, and gave reproducible results. Tracheal amylase was easy to collect, transport, and measure. The T/O amylase ratio is a first step towards quantifying oropharyngeal to tracheal microaspiration in mechanically-ventilated patients.

  6. Seeking new mutation clues from Bacillus licheniformis amylase by molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Lu, Tao

    2009-07-01

    Amylase is one of the most important industrial enzymes in the world. Researchers have been searching for a highly thermal stable mutant for many years, but most focus on point mutations of one or few nitrogenous bases. According to this molecular dynamic simulation of amylase from Bacillus licheniformis (BLA), the deletion of some nitrogenous bases would be more efficacious than point mutations. The simulation reveals strong fluctuation of the BLA structure at optimum temperature. The fluctuation of the outer domains of BLA is stronger than that of the core domain. Molecular simulation provides a clue to design thermal stable amylases through deletion mutations in the outer domain.

  7. Alpha-amylase production is induced by sulfuric acid in rice aleurone cells.

    PubMed

    Mitsunaga, Shin-ichiro; Kobayashi, Midori; Fukui, Satoe; Fukuoka, Kayoko; Kawakami, Osamu; Yamaguchi, Junji; Ohshima, Masahiro; Mitsui, Toshiaki

    2007-12-01

    The hydrolytic enzyme alpha-amylase (EC 3.2.1.1) is produced mainly in aleurone cells of germinating cereals, and the phytohormone gibberellin (GA) is essential for its induction. However, in rice (Oryza sativa L.), sulfuric acid (H(2)SO(4)) induces alpha-amylase production in aleurone tissue even in the absence of GA. Here, the pre-treatment of rice aleurone cells with H(2)SO(4) and incubation in water induced alpha-amylase activity, as if the cells had been incubated in GA solution.

  8. Capillary electrophoresis as a screening tool for alpha amylase inhibitors in plant extracts

    PubMed Central

    Hamdan, Imad I.; Afifi, Fatima U.

    2010-01-01

    Capillary electrophoresis (CE) method was developed for screening plant extract for potential alpha amylase (AA) inhibitory activity. The method was validated against a well established UV method. Overall, the proposed method was shown able to detect plants with significant alpha amylase inhibitory activity but not those with rather clinically insignificant activities. Fifty plant species were screened using both the proposed CE method and the UV method and seven plant species were found to possess significant AA inhibitory activities. Two plant species were proved to have alpha amylase inhibitory activity for the first time. PMID:24115900

  9. Crystal and molecular structure of barley alpha-amylase.

    PubMed

    Kadziola, A; Abe, J; Svensson, B; Haser, R

    1994-05-27

    The three-dimensional structure of barley malt alpha-amylase (isoform AMY2-2) was determined by multiple isomorphous replacement using three heavy-atom derivatives and solvent flattening. The model was refined using a combination of simulated annealing and conventional restrained least-squares crystallographic refinement to an R-factor of 0.153 based on 18,303 independent reflections with F(o) > sigma(F(o)) between 10 and 2.8 A resolution, with root-mean-square deviations of 0.016 A and 3.3 degrees from ideal bond lengths and bond angles, respectively. The final model consists of 403 amino acid residues, three calcium ions and 153 water molecules. The polypeptide chain folds into three domains: a central domain forming a (beta alpha)8-barrel of 286 residues, with a protruding irregular structured loop domain of 64 residues (domain B) connecting strand beta 3 and helix alpha 3 of the barrel, and a C-terminal domain of 53 residues forming a five stranded anti-parallel beta-sheet. Unlike the previously known alpha-amylase structures, AMY2-2 contains three Ca2+ binding sites co-ordinated by seven or eight oxygen atoms from carboxylate groups, main-chain carbonyl atoms and water molecules, all calcium ions being bound to domain B and therefore essential for the structural integrity of that domain. Two of the Ca2+ sites are located only 7.0 A apart with one Asp residue serving as ligand for both. One Ca2+ site located at about 20 A from the other two was found to be exchangeable with Eu3+. By homology with other alpha-amylases, some important active site residues are identified as Asp179, Glu204 and Asp289, and are situated at the C-terminal end of the central beta-barrel. A starch granule binding site, previously identified as Trp276 and Trp277, is situated on alpha-helix 6 in the central (beta alpha)8-barrel, at the surface of the enzyme. This binding site region is associated with a considerable disruption of the (beta alpha)8-barrel 8-fold symmetry.

  10. Effect of different amylases on the utilization of cornstarch in broiler chickens.

    PubMed

    Yuan, Jianmin; Wang, Xingyu; Yin, Dafei; Wang, Maofei; Yin, Xiaonan; Lei, Zhao; Guo, Yuming

    2016-09-23

    This study compared the effect of different amylases on the utilization of cornstarch in broiler chickens fed a corn-based diet. Three-day-old Arbor Acres plus male chickens were randomly divided into 7 treatments and fed a diet supplemented with different sources and concentrations of amylase: 1,500 U/kg and 3,000 U/kg α-1,4 amylase from Aspergillus oryzae (α-amylase A); 480 U/kg and 960 U/kg α-1,4 amylase from Bacillus subtilis (α-amylase B); 200 U/kg and 400 U/kg α-1,6 isoamylase from B. subtilis; and the control. The experimental period comprised 11 d, during which performance, nutrient digestibility, digestive enzyme activity, intestinal morphology, and glucose transporter transcription of the chickens were evaluated. The results indicated that 1,500 U/kg α-amylase improved the digestibility of energy and decreased the feed conversion rate compared to α-1,6 isoamylase (P < 0.05). Supplemental 400 U/kg α-1,6 isoamylase decreased ileal digestibility of amylopectin and total starch (P < 0.05) compared to 200 U/kg α-1,6 isoamylase, α-amylase A, α-amylase B, and the control (P < 0.05). Supplemental α-1,6 isoamylase decreased (P < 0.05) insulin content. Supplemental 3,000 U/kg α-amylase A and α-1,6 isoamylase increased (P < 0.05) the relative weight of the liver. In addition, 3,000 U/kg α-amylase A, 480 U/kg α-amylase B, and α-1,6 isoamylase decreased the V:C in the duodenum and ileum. α-amylase A increased sucrase activity in the jejunum (P < 0.05), whereas 400 U/kg α-1,6 isoamylase reduced maltase activity in the duodenum (P < 0.05). Furthermore, 3,000 U/kg α-amylase A and α-amylase B decreased (P < 0.05) sodium/glucose cotransporter 1 (SGLT1) mRNA expression in the duodenum and jejunum. However, 200 U/kg α-1,6 isoamylase increased glucose transporter 2 (GLUCT2) in the duodenum (P < 0.05). These results suggest that exogenous amylase affects the digestibility of starch by affecting disaccharidase activity in the

  11. Analysis of α-amylase inhibitor from corni fructus by coupling magnetic cross-linked enzyme aggregates of α-amylase with HPLC-MS.

    PubMed

    Liu, Liangliang; Cen, Yin; Liu, Fang; Yu, Jingang; Jiang, Xinyu; Chen, Xiaoqing

    2015-07-15

    As a carrier-free immobilization strategy, magnetic cross-linked enzyme aggregates (MCLEAs) showed improved enzyme activity, stability and magnetic response. In this study, MCLEAs of α-amylase (MCLEAs-amylase) was prepared under optimized conditions and characterized with scanning electron microscope and vibrating sample magnetometer. The prepared MCLEAs-amylase showed an amorphous structure and the saturation magnetization was 33.5emu/g, which was sufficient for magnetic separation. Then MCLEAs-amylase coupled with high performance liquid chromatography-mass spectrometry (HPLC-MS) was utilized to screen and identify α-amylase inhibitors from ethyl acetate extract of corni fructus. The experiment conditions were optimized. At the optimum conditions (incubation time: 10min, pH: 7.0 and temperature: 20°C), querciturone was successfully screened and identified with weak non-specific binding. The screening result was verified by inhibition assays and the IC50 value of querciturone was 22.5μg/mL. This method provided a rapid way to screen active compounds from natural products.

  12. Ca-binding to Bacillus licheniformis alpha-amylase (BLA).

    PubMed

    Nazmi, Ali Reza; Reinisch, Timm; Hinz, Hans-Jürgen

    2006-09-01

    Ca-induced renaturation of Bacillus licheniformis alpha-amylase in the presence of urea has been employed to determine the binding constants of the ion. The native enzyme is folded at 3M urea while the Ca-depleted protein is largely unfolded at this denaturant concentration. Refolding of the protein has been monitored by circular dichroism and the titration curves have been analyzed assuming a model of three independent binding sites. The stoichiometry has been taken from X-ray studies. The refolded protein exhibits a secondary structure that is similar but not identical to that of the native protein. The binding constants have been used to construct a phase diagram that illustrates the contribution of Ca-binding to the resistance against urea unfolding.

  13. Structure and sequence based analysis of alpha-amylase evolution.

    PubMed

    Singh, Swati; Guruprasad, Lalitha

    2014-01-01

    α-Amylases hydrolyze α- 1,4-glycosidic bonds during assimilation of biological macromolecules. The amino acid sequences of these enzymes in thousands of diverse organisms are known and the 3D structures of several proteins have been solved. The 3D structure analysis of these universal enzymes from diverse organisms has been studied by the generation of phylogenetic trees and structure based sequence analysis to generate a metric for the degree of conservation that is responsible for individual speciation. Greater similarities are observed between reference NCBI tree and structure based phylogenetic tree compared to sequence based phylogenetic tree indicating that structures truly represent the functional aspects of proteins than from the sequence information alone. We report differences in the profile specific conserved and insertion/deletion regions, factors responsible for the Ca(2+) and Cl(-) ion binding and the disulfide connectivity pattern that discriminate the enzymes over evolution.

  14. Optimization of alpha-amylase immobilization in calcium alginate beads.

    PubMed

    Ertan, Figen; Yagar, Hulya; Balkan, Bilal

    2007-01-01

    alpha-Amylase enzyme was produced by Aspergillus sclerotiorum under SSF conditions, and immobilized in calcium alginate beads. Effects of immobilization conditions, such as alginate concentration, CaCl(2) concentration, amount of loading enzyme, bead size, and amount of beads, on enzymatic activity were investigated. Optimum alginate and CaCl(2) concentration were found to be 3% (w/v). Using a loading enzyme concentration of 140 U mL(-1), and bead (diameter 3 mm) amount of 0.5 g, maximum enzyme activity was observed. Beads prepared at optimum immobilization conditions were suitable for up to 7 repeated uses, losing only 35% of their initial activity. Among the various starches tested, the highest enzyme activity (96.2%) was determined in soluble potato starch hydrolysis for 120 min at 40 degrees C.

  15. Aleppo tannin: structural analysis and salivary amylase inhibition.

    PubMed

    Zajácz, Agnes; Gyémánt, Gyöngyi; Vittori, Natale; Kandra, Lili

    2007-04-09

    The effectiveness and specificity of a tannin inhibition on human salivary amylase (HSA) catalyzed hydrolysis was studied using 2-chloro-4-nitrophenyl 4-O-beta-D-galactopyranosyl-alpha-maltoside (GalG(2)-CNP) and amylose substrates. Aleppo tannin was isolated from the gall nut of Aleppo oak. This tannin is a gallotannin, in which glucose is esterified with gallic acids. This is the first kinetic report, which details the inhibitory effects of this compound on HSA. A mixed non-competitive type inhibition has been observed on both substrates. The extent of inhibition is markedly dependent on the substrate-type. Kinetic constants were calculated from Lineweaver-Burk secondary plots for GalG(2)-CNP (K(EI) 0.82 microg mL(-1), K(ESI) 3.3 microg mL(-1)). This indicates a 1:1 binding ratio of inhibitor-enzyme and/or inhibitor-enzyme-substrate complex. When amylose was the substrate the binding ratio of inhibitor to enzyme-substrate complex was found to be 2:1, with the binding constants of K(EI) 17.4 microg mL(-1), K(ESI) 14.9 microg mL(-1), K(ESI(2)) 9.6 microg mL(-1). Presumably, the tannin inhibitor can bind not only to HSA, but to the amylose substrate, as well. Kinetic data suggest that Aleppo tannin is a more efficient amylase inhibitor than the recently studied other tannin with quinic acid core (GalG(2)-CNP: K(EI) 9.0 microg mL(-1), K(ESI) 47.9 microg mL(-1)).

  16. Association among growth, food consumption-related traits and amylase gene polymorphism in the Pacific oyster Crassostrea gigas.

    PubMed

    Huvet, A; Jeffroy, F; Fabioux, C; Daniel, J Y; Quillien, V; Van Wormhoudt, A; Moal, J; Samain, J F; Boudry, P; Pouvreau, S

    2008-12-01

    To examine further a previously reported association between amylase gene polymorphism and growth in the Pacific oyster Crassostrea gigas, ecophysiological parameters and biochemical and molecular expression levels of alpha-amylase were studied in Pacific oysters of different amylase genotypes. Genotypes that previously displayed significantly different growth were found to be significantly different for ingestion and absorption efficiency. These estimated parameters, used in a dynamic energy budget model, showed that observed ingestion rates (unlike absorption efficiencies) allowed an accurate prediction of growth potential in these genotypes. The observed association between growth and amylase gene polymorphism is therefore more likely to be related to ingestion than to absorption efficiency. Additionally, relative mRNA levels of the two amylase cDNAs were also strongly associated with amylase gene polymorphism, possibly reflecting variation in an undefined regulatory region, although no corresponding variation was observed in specific amylase activity. Amylase gene sequences were determined for each genotype, showing the existence of only synonymous or functionally equivalent non-synonymous polymorphisms. The observed associations among growth, food consumption-related traits and amylase gene polymorphism are therefore more likely to be related to variation in the level of amylase gene expression than to functional enzymatic variants.

  17. Differential expression of salivary (Amy1) and pancreatic (Amy2) human amylase loci in prenatal and postnatal development.

    PubMed Central

    Tye, J G; Karn, R C; Merritt, A D

    1976-01-01

    The age-dependent development of alpha-amylase expression in utero and during the first two years of life is reported. Separation of salivary and pancreatic amylase isozymes in a discontinuous buffered sheet polyacrylamide electrophoretic system, with subsequent densitometry, provides a reliable semiquantitative method of estimating the proportions of salivary and pancreatic amylases in urine and amniotic fluid samples. In the newborn the predominant amylase isozymes seen in the urine are of salivary origin. As the child ages the level of amylase in the urine rises and an increase in the proportion of pancreatic amylase isozymes occurs. Amniotic fluids of late first and early second trimester pregnancies contain salivary isozymes. None of the amniotic fluid samples examined has pancreatic amylase isozymes. These data reflect a differential development of the expression of the two amylase approaches adult levels by 16 months of age. Conversely, the salivary (Amy1) locus is expressed as early as 18 weeks of gestation and remains relatively constant with but a small increase in salivary amylase (units/ml) activity during early development, as the total amylase activity approaches adult values. Images PMID:933119

  18. Characterization of a starch-hydrolyzing α-amylase produced by Aspergillus niger WLB42 mutated by ethyl methanesulfonate treatment

    PubMed Central

    Wang, Shihui; Lin, Chaoyang; Liu, Yun; Shen, Zhicheng; Jeyaseelan, Jenasia; Qin, Wensheng

    2016-01-01

    Aspergillus niger is the most commonly used fungus for commercial amylase production, the increase of amylase activity will be beneficial to the amylase industry. Herein we report a high α-amylase producing (HAP) A. niger WLB42 mutated from A. niger A4 by ethyl methanesulfonate treatment. The fermentation conditions for the amylase production were optimized. The results showed that both the amylase activity and total protein content reached highest after 48-h incubation in liquid medium using starch as the sole carbon source. The enzyme production reached maximum at temperature of 30°C, pH 7, with 40 g/L starch in the medium inoculated with 1.4% v/v spore. When 0.3% w/v urea was added to the liquid medium as a nitrogen source, the amylase activity was elevated by 20%. Nine monosaccharides and derivatives were tested for α-amylase induction, glucose was the best inducer. Furthermore, the enzymology characterization of amylase was conducted. The molecular weight of amylase was determined to be 50 kD by SDS-PAGE. The amylase had maximum activity at 45°C and pH 7. The activity could be dramatically triggered by adding 1 mM Co2+, increased to 250%. The activity was inhibited by detergents SDS and Triton X-100. Six different brands of starch were tested for amylase activity, the results demonstrated that the more soluble of the starch, the higher hydrolyzability of the substrate by amylase. PMID:27335681

  19. Synergistic action of. alpha. -amylase and glucoamylase on hydrolysis of starch

    SciTech Connect

    Fujii, M.; Kawamura, Y.

    1985-03-01

    Synergistic action of ..alpha..-amylase and glucoamylase on hydrolysis of starch is modeled by the kinetic equations presented in this paper. At the early stage of the reaction ..alpha..-amylase acts as a contributor of newly formed non-reducing ends of starch molecules to glucoamylase by splitting the original starch molecules. This is expressed by the simultaneous differential equations which consist of each rate equation for ..alpha.. amylase and glucoamylase. After the molecular weight of the substrate decreases to the value of about 5000, which is obtained experimentally in this work, the action of ..alpha.. amylase can be neglected and the rate of formation of glucose obeys only the rate equation for glucoamylase. 5 references.

  20. Design, synthesis and α-amylase inhibitory activity of novel chromone derivatives.

    PubMed

    Valentina, Parthiban; Ilango, Kaliappan; Chander, Subhash; Murugesan, Sankaranarayanan

    2017-10-01

    Quercetin is one of the naturally occurring polyphenol flavonoid predominantly known for antidiabetic activity. In the present study, by considering the structural requirements, twenty two novel chromone derivatives (5-26) as α-amylase inhibitor were designed and subsequently in silico evaluated for drug likeness behavior. Designed compounds were synthesized, characterized by spectral analysis and finally evaluated for the inhibition of α-amylase activity by in vitro assay. Tested compounds exhibited significant to weak activity with IC50 range of 12-125µM. Among the tested compounds, analogues 5, 8, 12, 13, 15, 17 and 22 exhibited significant human α-amylase inhibitory activity with IC50 values <25µM, which can be further explored as anti-hyperglycemic agents. Putative binding mode of the significant and least active α-amylase inhibitors with the target enzyme was also explored by the docking studies. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. From carbohydrates to drug-like fragments: Rational development of novel α-amylase inhibitors.

    PubMed

    Al-Asri, Jamil; Fazekas, Erika; Lehoczki, Gábor; Perdih, Andrej; Görick, Cornelia; Melzig, Matthias F; Gyémánt, Gyöngyi; Wolber, Gerhard; Mortier, Jérémie

    2015-10-15

    Starch catabolism leading to high glucose level in blood is highly problematic in chronic metabolic diseases, such as type II diabetes and obesity. α-Amylase catalyzes the hydrolysis of starch, increasing blood sugar concentration. Its inhibition represents a promising therapeutic approach to control hyperglycaemia. However, only few drug-like molecule inhibitors without sugar moieties have been discovered so far, and little information on the enzymatic mechanism is available. This work aims at the discovery of novel small α-amylase binders using a systematic in silico methodology. 3D-pharmacophore-based high throughput virtual screening of small compounds libraries was performed to identify compounds with high α-amylase affinity. Twenty-seven compounds were selected and biologically tested, revealing IC50 values in the micromolar range and ligand efficiency higher than the one of the bound form of acarbose, which is used as a reference for α-amylase inhibition.

  2. Purification of extrachloroplastic. beta. -amylase from leaves of starchless and wild type Arabidopsis

    SciTech Connect

    Somerville, C.; Monroe, J.; Preiss, J. )

    1989-04-01

    Amylase activity in crude leaf extracts from starchless mutants of Arabidopsis thaliana is 5 to 10 fold higher than in the wild type (WT) when plants are grown under a 12 h photoperiod. Visualized on native PAGE, the increased activity is attributed primarily to a previously characterized extrachloroplastic {beta}-(exo)amylase. The {beta}-amylases from phosoglucomutase deficient (starchless) and WT leaves were purified to homogeneity in two steps utilizing polyethylene glycol fractionation, and cyclohexaamylose affinity chromatography. The enzyme from both mutant and WT leaves had negligible activity toward either {beta}-limit dextrin or pullulan. The specific activities of both purified enzymes were similar indicating that the protein is over-expressed in the mutant. Preliminary antibody neutralization experiments suggest that the two {beta}-amylases are not different.

  3. Biochemical features and kinetic properties of α-amylases from marine organisms.

    PubMed

    Homaei, Ahmad; Ghanbarzadeh, Mehri; Monsef, Ferial

    2016-02-01

    Marine organisms have the ability of producing enzymes with unique properties compared to those of the same enzymes from terrestrial organisms. α-Amylases are among the most important extracellular enzymes found in various groups of organisms such as plants, animals and microorganisms. They play important roles in their carbohydrates metabolism of each organism. Microbial production of α-amylases is more effective than other sources of the enzyme. Many microorganisms are known to produce α-amylase including bacteria, yeasts, fungi and actinomycetes. However, enzymes from fungal and bacterial sources have dominated applications in industrial sectors. This review deals with what is known about the kinetics, biochemical properties and applications of these enzymes that have only been found in them and not in other α-amylases, and discussing their mechanistic and regulatory implications.

  4. Studies on the formation of alpha-amylase by Thermomonospora vulgaris.

    PubMed

    Allam, A M; Hussein, A M; Ragab, A M

    1977-01-01

    Conditions affecting the formation of alpha-amylase by static cultures of the thermophilic actinomycete Thermomonospora vulgaris were studied. The organism failed to grow under submerged culture conditions or when the culture medium was devoid of CaCO3-alpha-Amylase was produced during the logarithmic phase of growth and maximum yield was obtained after 3 to 9 days of incubation. Growth and amylase formation took place only in a range from 45 degrees to 55 degrees C; optimum temperature was 55 degrees C. Of the tested carbon sources only starch induced enzyme formation. Maximum enzyme yield was obtained when starch concentration of the medium was 2% and when ammonium citrate served as a nitrogen source. Crushed clay pots could substitute for CaCO3 of the medium, but growth and amylase yield were less.

  5. Structural and functional characterization of recombinant medaka fish alpha-amylase expressed in yeast Pichia pastoris.

    PubMed

    Mizutani, Kimihiko; Toyoda, Mayuko; Otake, Yuichiro; Yoshioka, Soshi; Takahashi, Nobuyuki; Mikami, Bunzo

    2012-08-01

    The medaka fish α-amylase was expressed and purified. The expression systems were constructed using methylotrophic yeast Pichia pastoris, and the recombinant proteins were secreted into the culture medium. Purified recombinant α-amylase exhibited starch hydrolysis activity. The optimal pH, denaturation temperature, and K(M) and V(max) values were determined; chloride ions were essential for enzyme activity. The purified protein was also crystallized and examined by X-ray crystallography. The structure has the (α/β)(8) barrel fold, as do other known α-amylases, and the overall structure is very similar to the structure of vertebrate (human and pig) α-amylases. A novel expression plasmid was developed. Using this plasmid, high-throughput construction of an expression system by homologous recombination in P. pastoris cells, previously reported for membrane proteins, was successfully applied to the secretory protein.

  6. [Study of the effect of Pb2+ on alpha-amylase activity by spectroscopy].

    PubMed

    Hong, Fa-shui

    2003-06-01

    The activity of alpha-amylase from porcine pancreas was enhanced under the treatment by Pb2+ at low concentration (0.5-4 mumol.L-1), but was inhibited by Pb2+ at high concentration (above 4 mumol.L-1). Pb2+ at high concentration could competitively displace Ca2+ from alpha-amylase. The EXAFS demonstrated that Pb2+ was bound to the active site of alpha-amylase, the coordination atom was oxygen, the coordination number was 2, and the Pb-O bond length was 0.234 nm. Circular dichroism spectra showed that the secondary structure of trypsin was greatly changed by Pb2+ at high concentration, as alpha-helix, beta-turn and random coil contents decreased, while beta-sheet, aromatic and disulfide bond contents increased. It was suggested that Pb2+ was bound to result in an alpha-amylase conformational change, and the enzyme activity decreased.

  7. Characterization of extracellular amylase produced by haloalkalophilic strain Kocuria sp. HJ014.

    PubMed

    Soto-Padilla, Marisela Y; Gortáres-Moroyoqui, Pablo; Cira-Chávez, Luis A; Levasseur, Anthony; Dendooven, Luc; Estrada-Alvarado, María Isabel

    2016-08-01

    The haloalkaliphilic bacterium Kocuria sp. (HJ014) has the ability to produce extracellular amylase. The aim of this study was to purify and characterize this protein. The amylase enzyme with a specific activity of 753,502 U/mg was purified 5.7- fold using Sepharose 4B and Sephacryl S-300 gel filtration columns. The molecular weight of the enzyme was 45,000 Da as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The amylase showed maximum activity at pH 9 and 50°C in the presence of 3.5 M NaCl. The Km was 3.0 mg/ml and Vmax 90.09 U/ml. It was found that extracellular amylase from Kocuria sp. has a high industrial potential.

  8. Molecular improvements in microbial α-amylases for enhanced stability and catalytic efficiency.

    PubMed

    Sindhu, Raveendran; Binod, Parameswaran; Madhavan, Aravind; Beevi, Ummalyma Sabeela; Mathew, Anil Kuruvilla; Abraham, Amith; Pandey, Ashok; Kumar, Vinod

    2017-04-27

    α-Amylases is one of the most important industrial enzyme which contributes to 25% of the industrial enzyme market. Though it is produced by plant, animals and microbial source, those from microbial source seems to have potential applications due to their stability and economic viability. However a large number of α-amylases from different sources have been detailed in the literature, only few numbers of them could withstand the harsh industrial conditions. Thermo-stability, pH tolerance, calcium independency and oxidant stability and starch hydrolyzing efficiency are the crucial qualities for α-amylase in starch based industries. Microbes can be genetically modified and fine tuning can be done for the production of enzymes with desired characteristics for specific applications. This review focuses on the native and recombinant α-amylases from microorganisms, their heterologous production and the recent molecular strategies which help to improve the properties of this industrial enzyme. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Selective inhibition of histidine-modified pancreatic alpha-amylase by proteinaceous inhibitor from Phaseolus vulgaris.

    PubMed

    Nakatani, H

    1988-06-01

    Chemical modification of two histidine residues of porcine pancreatic alpha-amylase (EC 3.2.1.1) by diethyl pyrocarbonate in the presence of a high concentration of maltotriose caused a decrease of amylase activity and an increase of maltosidase activity (hydrolysis of p-nitrophenyl-alpha-maltoside). By binding a proteinaceous inhibitor from Phaseolus vulgaris (white kidney bean) with the modified enzyme, the amylase activity was further decreased but the maltosidase activity was retained to about 100% that of the native enzyme. Both amylase and maltosidase activities of the native enzyme were almost completely inhibited by the proteinaceous inhibitor. The increase of maltosidase activity by histidine modification was due to an increase of kcat, whereas the Km value was not changed; but binding of the proteinous inhibitor affected mainly the Km value of the modified enzyme.

  10. Augmentation of cholinergic-mediated amylase release by forskolin in mouse parotid gland

    SciTech Connect

    Watson, E.L.; Singh, J.C.; Jacobson, K.L.

    1985-12-30

    Cholinergic-mediated amylase release in mouse parotid acini was augmented by forskolin; the potency but not the maximal response to carbachol was altered. Amylase released by carbachol plus forskolin was dependent on extracellular calcium and was mimicked by the calcium ionophore, A23187 plus forskolin. Forskolin was also shown to enhance carbachol-stimulated /sup 45/Ca/sup 2 +/ uptake into isolated acini. Hydroxylamine, nitroprusside, and 8-bromo-c-GMP each in combination with forskolin mimicked the effects of carbachol plus forskolin on amylase release. In the presence of carbachol (10/sup -8/M) forskolin did not augment c-AMP levels. However, in the presence of carbachol (5 x 10/sup -7/ M) or hydroxylamine (50 ..mu..M) forskolin did significantly augment c-AMP accumulation. These results suggest that calcium and c-GMP may mediate the augmentation of cholinergic-mediated amylase release by effects on c-AMP metabolism. 21 references, 1 figure, 3 tables.

  11. Elevated serum amylase in patients with chronic pancreatitis: acute attack or macroamylasemia?

    PubMed

    Gubergrits, Natalya; Golubova, Oksana; Lukashevich, Galina; Fomenko, Pavlo

    2014-01-01

    Asymptomatic patients with chronic pancreatitis not infrequently have elevated concentrations of amylase, even though detailed examination reveals no indication of an acute exacerbation. One hundred and eighty-six consecutive patients with chronic pancreatitis were examined clinically and, if indicated, by ultrasonography and computed tomography. In addition, all patients underwent determination of serum amylase and serum lipase as well as amylase/creatinine clearance, followed as required by a polyethylene glycol test and/or chromatography to demonstrate macroamylase. Twenty (11%) of the 186 patients had macroamylasemia, and 15 of these 20 had hyperamylasemia. In the remaining five cases the serum amylase levels were within the normal range. Patients with asymptomatic chronic pancreatitis and hyperamylasemia should first be investigated for macroamylasemia, before initiating any costly or complex procedures in the attempt to demonstrate a clinically silent or only mildly symptomatic attack of their disease. Copyright © 2014 IAP and EPC. Published by Elsevier B.V. All rights reserved.

  12. Relationship among physiological quality, heterosis, and amylase gene expression in maize seeds.

    PubMed

    Oliveira, G E; Von Pinho, E V R; Andrade, T; Souza, J C; Caixeta, F; Ferreira, R A D C

    2015-07-31

    In this study, we analyzed heterosis, amylase enzyme gene expression, and the physiological quality of maize seeds with different genotypes and sizes, which were subjected to aging and not subjected to aging. We used seeds from 2 maize lines that differed with regard to physiological quality, the hybrid, and the reciprocal hybrid; they were classified into 2 sizes and were subjected to aging and not subjected to aging. Physiological quality was assessed by performing tests for germination, emergence, emergence speed index, and artificial aging. Expressions of the genes alpha amylase B73, alpha amylase (LOC542522), isoamylase mRNA clone 353244, and the endogenous controls ubiquitin and alcohol dehydrogenase in the seeds were studied using quantitative real-time-polymerase chain reaction. We observed heterosis for seed quality and for expression of amylase genes in the genotypes studied. We found no difference in seed quality between large and small seeds.

  13. Inhibition of alpha-glucosidase and amylase by bartogenic acid isolated from Barringtonia racemosa Roxb. seeds.

    PubMed

    Gowri, P Mangala; Tiwari, Ashok K; Ali, A Zehra; Rao, J Madhusudana

    2007-08-01

    Barringtonia racemosa presents a wide range of therapeutic applications. In the course of identifying bioactives from Indian medicinal plants it was observed that the hexane, ethanol and methanol extracts of B. racemosa seeds displayed potent yeast and intestinal alpha-glucosidase inhibitory activities. The methanol extract was found to be superior among them. However, none of the extracts exhibited pancreatic alpha-amylase inhibitory activity, rather the ethanol and methanol extracts accelerated the alpha-amylase enzyme activity. Interestingly, however, bartogenic acid isolated from the methanol extract inhibited alpha-amylase also. This is the first report identifying alpha-glucosidase inhibitory activity in B. racemosa seed extracts and assigning to bartogenic acid an alpha-glucosidase and amylase inhibitory property. The presence of bartogenic acid in B. racemosa seeds as a major compound is also reported for the first time in this communication. (c) 2007 John Wiley & Sons, Ltd.

  14. In Vitro  α-Amylase Inhibitory Activity of the Leaves of Thespesia populnea

    PubMed Central

    Sangeetha, R.; Vedasree, N.

    2012-01-01

    Postprandial hyperglycemia is a prime characteristic of diabetes mellitus and has been a focus in the therapy for diabetes. One of the therapeutic approaches which involve decreasing hyperglycemia aims at inhibiting the enzyme α-amylase. The leaves of T. populnea were studied for the presence of amylase inhibitors. The fractions obtained by successive fractionation using solvents of varying polarity were studied for the presence of primary and secondary metabolites. The total phenolic content of the different fractions was determined by HPLC and was correlated with their amylase inhibitory potential. Similarly, the protein content of the extracts was also estimated to understand the nature of the inhibitor present. This study shows that the leaves of T. populnea were effective in inhibiting α-amylase, thereby proving to be potential hyperglycemic agents. PMID:22550597

  15. Alpha amylase is a major allergenic component in occupational asthma patients caused by porcine pancreatic extract.

    PubMed

    Park, Hae-Sim; Kim, Hee-Yeon; Suh, You-Jin; Lee, Soo-Jin; Lee, Soo-Keol; Kim, Sun-Sin; Nahm, Dong-Ho

    2002-09-01

    Porcine pancreatic extracts (PPE) are composed of alpha-amylase and lipase, which are common components of digestive enzymes. They have been known to cause occupational asthma in exposed workers in pharmaceutical and baking industries, as well as in a laboratory technician, but there has been no report of PPE-induced occupational asthma in medical personnel and their IgE binding components to each component. Four asthmatic subjects showing positive results on PPE-bronchoprovocation testing were enrolled. All of them were nurses working in a university hospital. Their job included grinding and mixing PPE powder for admitted patients. Serum-specific IgE antibodies to PPE, alpha-amylase, and lipase were measured by enzyme linked immunosorbent assay (ELISA). To confirm specificity of IgE binding and cross-allergenicity among the three extracts, ELISA inhibition tests were performed. In order to characterize allergenic components within these three extracts, SDS-PAGE and IgE immunoblot analysis were done. Specific IgE antibodies to PPE, alpha-amylase, and lipase were detectable by ELISA in all study subjects. An alpha-amylase ELISA inhibition test showed significant inhibitions by amylase and PPE, and minimal inhibition by lipase. However, a lipase ELISA inhibition test showed significant inhibitions by alpha-amylase and PPE with a lesser degree of inhibition by lipase. Furthermore, IgE immunoblot analysis showed one IgE binding component (55 kDa) within PPE, six components (55 kDa, 43 kDa, 41 kDa, 32 kDa, 31 kDa, 29 kDa) within alpha-amylase and two components (31 kDa, 29 kDa) within lipase extracts. Thesefindings suggest that inhalation of PPE powder can induce IgE-mediated bronchoconstriction in exposed nurses. Alpha-amylase is a major allergenic component within PPE.

  16. New Perspectives on the Role of α- and β-Amylases in Transient Starch Synthesis

    PubMed Central

    Wu, Alex Chi; Ral, Jean-Philippe; Morell, Matthew K.; Gilbert, Robert G.

    2014-01-01

    Transient starch in leaves is synthesized by various biosynthetic enzymes in the chloroplasts during the light period. This paper presents the first mathematical model for the (bio)synthesis of the chain-length distribution (CLD) of transient starch to aid the understanding of this synthesis. The model expresses the rate of change of the CLD in terms of the actions of the enzymes involved. Using this to simulate the experimental CLD with different enzyme combinations is a new means to test for enzymes that are significant to the rate of change of the CLD during synthesis. Comparison between the simulated CLD from different enzyme combinations and the experimental CLD in the leaves of the model plant Arabidopsis thaliana indicate α-amylase, in addition to the core starch biosynthetic enzymes, is also involved in the modification of glucans for the synthesis of insoluble starch granules. The simulations suggest involvement of β-amylase, in the absence of α-amylase in mutants, slows the rate of attaining a crystalline-competent CLD for crystallization of glucans to form insoluble starch. This suggests a minor role of β-amylase in shaping normal starch synthesis. The model simulation predicts that debranching of glucans is an efficient mechanism for the attainment of crystalline-competent CLD; however, attaining this is still possible, albeit slower, through combinations of α- and β-amylase in the absence of isoamylase-type debranching enzyme. In Arabidopsis defective in one of the isoamylase-type debranching enzymes, the impact of α-amylase in starch synthesis is reduced, while β-amylase becomes significantly involved, slowing the rate of synthesis in this mutant. Modeling of transient starch CLD brings to light previously unrecognized but significant effects of α- and β-amylase on the rate of transient starch synthesis. PMID:24971464

  17. Expression and Characterization of Geobacillus stearothermophilus SR74 Recombinant α-Amylase in Pichia pastoris

    PubMed Central

    Gandhi, Sivasangkary; Salleh, Abu Bakar; Rahman, Raja Noor Zaliha Raja Abd; Chor Leow, Thean; Oslan, Siti Nurbaya

    2015-01-01

    Geobacillus stearothermophilus SR74 is a locally isolated thermophilic bacteria producing thermostable and thermoactive α-amylase. Increased production and commercialization of thermostable α-amylase strongly warrant the need of a suitable expression system. In this study, the gene encoding the thermostable α-amylase in G. stearothermophilus SR74 was amplified, sequenced, and subcloned into P. pastoris GS115 strain under the control of a methanol inducible promoter, alcohol oxidase (AOX). Methanol induced recombinant expression and secretion of the protein resulted in high levels of extracellular amylase production. YPTM medium supplemented with methanol (1% v/v) was the best medium and once optimized, the maximum recombinant α-amylase SR74 achieved in shake flask was 28.6 U mL−1 at 120 h after induction. The recombinant 59 kDa α-amylase SR74 was purified 1.9-fold using affinity chromatography with a product yield of 52.6% and a specific activity of 151.8 U mg−1. The optimum pH of α-amylase SR74 was 7.0 and the enzyme was stable between pH 6.0–8.0. The purified enzyme was thermostable and thermoactive, exhibiting maximum activity at 65°C with a half-life (t 1/2) of 88 min at 60°C. In conclusion, thermostable α-amylase SR74 from G. stearothermophilus SR74 would be beneficial for industrial applications, especially in liquefying saccrification. PMID:26090417

  18. Expression and Characterization of Geobacillus stearothermophilus SR74 Recombinant α-Amylase in Pichia pastoris.

    PubMed

    Gandhi, Sivasangkary; Salleh, Abu Bakar; Rahman, Raja Noor Zaliha Raja Abd; Chor Leow, Thean; Oslan, Siti Nurbaya

    2015-01-01

    Geobacillus stearothermophilus SR74 is a locally isolated thermophilic bacteria producing thermostable and thermoactive α-amylase. Increased production and commercialization of thermostable α-amylase strongly warrant the need of a suitable expression system. In this study, the gene encoding the thermostable α-amylase in G. stearothermophilus SR74 was amplified, sequenced, and subcloned into P. pastoris GS115 strain under the control of a methanol inducible promoter, alcohol oxidase (AOX). Methanol induced recombinant expression and secretion of the protein resulted in high levels of extracellular amylase production. YPTM medium supplemented with methanol (1% v/v) was the best medium and once optimized, the maximum recombinant α-amylase SR74 achieved in shake flask was 28.6 U mL(-1) at 120 h after induction. The recombinant 59 kDa α-amylase SR74 was purified 1.9-fold using affinity chromatography with a product yield of 52.6% and a specific activity of 151.8 U mg(-1). The optimum pH of α-amylase SR74 was 7.0 and the enzyme was stable between pH 6.0-8.0. The purified enzyme was thermostable and thermoactive, exhibiting maximum activity at 65°C with a half-life (t₁/₂) of 88 min at 60°C. In conclusion, thermostable α-amylase SR74 from G. stearothermophilus SR74 would be beneficial for industrial applications, especially in liquefying saccrification.

  19. New perspectives on the role of α- and β-amylases in transient starch synthesis.

    PubMed

    Wu, Alex Chi; Ral, Jean-Philippe; Morell, Matthew K; Gilbert, Robert G

    2014-01-01

    Transient starch in leaves is synthesized by various biosynthetic enzymes in the chloroplasts during the light period. This paper presents the first mathematical model for the (bio)synthesis of the chain-length distribution (CLD) of transient starch to aid the understanding of this synthesis. The model expresses the rate of change of the CLD in terms of the actions of the enzymes involved. Using this to simulate the experimental CLD with different enzyme combinations is a new means to test for enzymes that are significant to the rate of change of the CLD during synthesis. Comparison between the simulated CLD from different enzyme combinations and the experimental CLD in the leaves of the model plant Arabidopsis thaliana indicate α-amylase, in addition to the core starch biosynthetic enzymes, is also involved in the modification of glucans for the synthesis of insoluble starch granules. The simulations suggest involvement of β-amylase, in the absence of α-amylase in mutants, slows the rate of attaining a crystalline-competent CLD for crystallization of glucans to form insoluble starch. This suggests a minor role of β-amylase in shaping normal starch synthesis. The model simulation predicts that debranching of glucans is an efficient mechanism for the attainment of crystalline-competent CLD; however, attaining this is still possible, albeit slower, through combinations of α- and β-amylase in the absence of isoamylase-type debranching enzyme. In Arabidopsis defective in one of the isoamylase-type debranching enzymes, the impact of α-amylase in starch synthesis is reduced, while β-amylase becomes significantly involved, slowing the rate of synthesis in this mutant. Modeling of transient starch CLD brings to light previously unrecognized but significant effects of α- and β-amylase on the rate of transient starch synthesis.

  20. The contribution of salivary amylase to glucose polymer hydrolysis in premature infants.

    PubMed

    Murray, R D; Kerzner, B; Sloan, H R; McClung, H J; Gilbert, M; Ailabouni, A

    1986-02-01

    To determine whether salivary amylase of premature infants can function as a surrogate for pancreatic amylase, we evaluated its production in the infant, acid resistance, and hydrolytic potency in a simulated oropharyngeal, gastric, and intestinal environment. The activity of salivary amylase in 11 prematures varied between 1 and 33 U/ml; the isozymic profile and acid resistance of the premature salivary amylase were identical to those of the enzyme of adults. A "modular" formula containing 7 g/dl of a 14C labeled long chain glucose polymer with degrees of polymerization ranging between 18 and 29 glucose units was prepared. Salivary amylase, 1.1 U/ml, was added to this formula. The progressive breakdown of the 14C polymers as the milk was subjected to oropharyngeal, gastric, and intestinal phase environments was evaluated by quantifying the liberation of short-chain oligomers from the 14C labeled substrates. The gastric pH was varied between 2 and 5 and the gastric incubation time was either 5 or 180 min. Substantial gastric phase breakdown only occurred after 3 h of exposure at the higher pHs of 4 (12%) and 5 (32%). During the intestinal phase, salivary amylase activity resumed. Prior gastric phase pH affected ultimate intestinal phase breakdown, p less than 0.001; after 5-min gastric phases at pHs ranging from 2 to 5, the intestinal phase breakdown ranged from 17 to 55%. We conclude that the limited salivary amylase in the saliva of premature infants can produce significant glucose polymer digestion in both the stomach and small intestine but the digestion falls substantially short of that accomplished by usual concentrations of pancreatic amylase.

  1. alpha-Amylase is not required for breakdown of transitory starch in Arabidopsis leaves.

    PubMed

    Yu, Tien-Shin; Zeeman, Samuel C; Thorneycroft, David; Fulton, Daniel C; Dunstan, Hannah; Lue, Wei-Ling; Hegemann, Björn; Tung, Shu-Yun; Umemoto, Takayuki; Chapple, Andrew; Tsai, Der-Long; Wang, Shue-Mei; Smith, Alison M; Chen, Jychian; Smith, Steven M

    2005-03-18

    The Arabidopsis thaliana genome encodes three alpha-amylase-like proteins (AtAMY1, AtAMY2, and AtAMY3). Only AtAMY3 has a predicted N-terminal transit peptide for plastidial localization. AtAMY3 is an unusually large alpha-amylase (93.5 kDa) with the C-terminal half showing similarity to other known alpha-amylases. When expressed in Escherichia coli, both the whole AtAMY3 protein and the C-terminal half alone show alpha-amylase activity. We show that AtAMY3 is localized in chloroplasts. The starch-excess mutant of Arabidopsis sex4, previously shown to have reduced plastidial alpha-amylase activity, is deficient in AtAMY3 protein. Unexpectedly, T-DNA knock-out mutants of AtAMY3 have the same diurnal pattern of transitory starch metabolism as the wild type. These results show that AtAMY3 is not required for transitory starch breakdown and that the starch-excess phenotype of the sex4 mutant is not caused simply by deficiency of AtAMY3 protein. Knock-out mutants in the predicted non-plastidial alpha-amylases AtAMY1 and AtAMY2 were also isolated, and these displayed normal starch breakdown in the dark as expected for extraplastidial amylases. Furthermore, all three AtAMY double knock-out mutant combinations and the triple knock-out degraded their leaf starch normally. We conclude that alpha-amylase is not necessary for transitory starch breakdown in Arabidopsis leaves.

  2. Expression and mutation of soybean beta-amylase in Escherichia coli.

    PubMed

    Totsuka, A; Fukazawa, C

    1993-06-15

    The cDNA clones corresponding to soybean beta-amylase mRNA were isolated and sequenced. The cDNA contained an open-reading frame composed of 496 amino acids. The comparison of the amino acid sequence deduced from the cDNA with the N-terminal peptide sequence from mature enzyme proved that beta-amylase had no leader sequence. Employing the cDNA, the beta-amylase was directly synthesized in Escherichia coli by the expression vector pKK233-2 controlled by the tac promoter. The enzyme activity detected in E. coli lysate drastically increased with a lower cultivation temperature, and the total activity and specific activity of the enzyme in E. coli lysate cultured at 13 degrees C was 130-fold and 280-fold, respectively, the value at 37 degrees C. The enzyme produced in E. coli was purified by the affinity column chromatography of cyclomaltohexaose-immobilized Sepharose 6B. Employing the established expression and purification system of the enzyme, the functional ionizable groups in the active site were searched. His93, involving an imidazole, and Asp348, involving a carboxylate, in the highly conserved regions within the beta-amylases were replaced by Arg (H93R) and Ash (D348N) by site-directed mutagenesis, respectively. All beta-amylases, including the non-mutant and mutant beta-amylases, produced in E. coli exhibited lower Vmax values than that of beta-amylase isolated conventionally from soybean seeds. Especially the Vmax value of [H93R]beta-amylase was reduced drastically compared to that of the non-mutant; however, none of them lost their enzyme activities completely. Therefore, neither His93 nor Asp348 may participate in the catalytic reaction directly.

  3. [Studies on determination of alpha-amylase with p-nitrophenyl-alpha-D-maltotetraoside].

    PubMed

    Kruse-Jarres, J D; Schott, F J; Klein, B; Rastetter, N; Wallenfels, K

    1982-11-01

    Nitrophenylmaltodextrins are alpha-amylase substrates which allow a continuous determination with a zero order kinetics over a period of at least 10 min, without deviations from linearity. Only one auxiliary enzyme is necessary. Practicability and clinical evidence of alpha-amylase determinations by means of p-nitrophenyl-alpha-D-maltotetraoside are demonstrated. The interserial precision of 0.84% cannot conceal an only moderate correlation with previous methods. This fact, however, does not negate the advantages.

  4. Characterization of alpha-Amylase from Shoots and Cotyledons of Pea (Pisum sativum L.) Seedlings.

    PubMed

    Beers, E P; Duke, S H

    1990-04-01

    The most abundant alpha-amylase (EC 3.2.1.1) in shoots and cotyledons from pea (Pisum sativum L.) seedlings was purified 6700-and 850-fold, respectively, utilizing affinity (amylose and cycloheptaamylose) and gel filtration chromatography and ultrafiltration. This alpha-amylase contributed at least 79 and 15% of the total amylolytic activity in seedling cotyledons and shoots, respectively. The enzyme was identified as an alpha-amylase by polarimetry, substrate specificity, and end product analyses. The purified alpha-amylases from shoots and cotyledons appear identical. Both are 43.5 kilodalton monomers with pls of 4.5, broad pH activity optima from 5.5 to 6.5, and nearly identical substrate specificities. They produce identical one-dimensional peptide fingerprints following partial proteolysis in the presence of SDS. Calcium is required for activity and thermal stability of this amylase. The enzyme cannot attack maltodextrins with degrees of polymerization below that of maltotetraose, and hydrolysis of intact starch granules was detected only after prolonged incubation. It best utilizes soluble starch as substrate. Glucose and maltose are the major end products of the enzyme with amylose as substrate. This alpha-amylase appears to be secreted, in that it is at least partially localized in the apoplast of shoots. The native enzyme exhibits a high degree of resistance to degradation by proteinase K, trypsin/chymostrypsin, thermolysin, and Staphylococcus aureus V8 protease. It does not appear to be a high-mannose-type glycoprotein. Common cell wall constituents (e.g. beta-glucan) are not substrates of the enzyme. A very low amount of this alpha-amylase appears to be associated with chloroplasts; however, it is unclear whether this activity is contamination or alpha-amylase which is integrally associated with the chloroplast.

  5. Extracellular production of beta-amylase by a halophilic isolate, Halobacillus sp. LY9.

    PubMed

    Li, Xin; Yu, Hui-Ying

    2011-11-01

    A moderately halophilic strain LY9 with high amylolytic activity was isolated from soil sample obtained from Yuncheng, China. Biochemical and physiological characterization along with 16S rRNA sequence analysis placed the isolate in the genus Halobacillus. Amylase production started from the post-exponential phase of bacterial growth and reached a maximum level during the early-stationary phase. The isolate LY9 was found to secrete the amylase, the production of which depended on the salinity of the growth medium. Maximum amylase production was observed in the presence of 10% KCl or 10% NaCl. Maltose was the main product of soluble starch hydrolysis, indicating a β-amylase activity. The enzyme showed optimal activity at 60°C, pH 8.0, and 10-12.5% of NaCl. It was highly active over broad temperature (50-70°C), NaCl concentration (5.0-20.0%), and pH (4.0-12.0) ranges, indicating its thermoactive and alkali-stable nature. However, activity dropped off dramatically at low NaCl concentrations, showing the amylase was halophilic. Ca(2+) was found to stimulate the β-amylase activity, whereas ethylenediaminetetraacetic acid (EDTA), phenylarsine oxide (PAO), and diethyl pyrocarbonate (DEPC) strongly inhibited the enzyme, indicating it probably was a metalloenzyme with cysteine and histidine residues located in its active site. Moreover, the enzyme exhibited remarkable stability towards sodium dodecyl sulfate (SDS) and Triton X-100. This is the first report of β-amylase production from moderate halophiles. The present study indicates that the extracellular β-amylase of Halobacillus sp. LY9 may have considerable potential for industrial application owing to its properties.

  6. High-resolution α-amylase assay combined with high-performance liquid chromatography-solid-phase extraction-nuclear magnetic resonance spectroscopy for expedited identification of α-amylase inhibitors: proof of concept and α-amylase inhibitor in cinnamon.

    PubMed

    Okutan, Leyla; Kongstad, Kenneth T; Jäger, Anna K; Staerk, Dan

    2014-11-26

    Type 2 diabetes affects millions of people worldwide, and new improved drugs or functional foods containing selective α-amylase inhibitors are needed for improved management of blood glucose. In this article the development of a microplate-based high-resolution α-amylase inhibition assay with direct photometric measurement of α-amylase activity is described. The inhibition assay is based on porcine pancreatic α-amylase with 2-chloro-4-nitrophenyl-α-D-maltotriose as substrate, which this gives a stable, sensitive, and cheap inhibition assay as requested for high-resolution purposes. In combination with HPLC-HRMS-SPE-NMR, this provides an analytical platform that allows simultaneous chemical and biological profiling of α-amylase inhibitors in plant extracts. Proof-of-concept with an artificial mixture of six compounds-of which three are known α-amylase inhibitors-showed that the high-resolution α-amylase inhibition profiles allowed detection of sub-microgram amounts of the α-amylase inhibitors. Furthermore, the high-resolution α-amylase inhibition assay/HPLC-HRMS-SPE-NMR platform allowed identification of cinnamaldehyde as the α-amylase inhibitor in cinnamon (Cinnamomum verum Presl.).

  7. Production of itaconic acid in Escherichia coli expressing recombinant α-amylase using starch as substrate.

    PubMed

    Okamoto, Shusuke; Chin, Taejun; Nagata, Keisuke; Takahashi, Tetsuya; Ohara, Hitomi; Aso, Yuji

    2015-05-01

    Several studies on fermentative production of a vinyl monomer itaconic acid from hydrolyzed starch using Aspergillus terreus have been reported. Herein, we report itaconic acid production by Escherichia coli expressing recombinant α-amylase, using soluble starch as its sole carbon source. To express α-amylase in E. coli, we first constructed recombinant plasmids expressing α-amylases by using cell surface display technology derived from two amylolytic bacteria, Bacillus amyloliquefaciens NBRC 15535(T) and Streptococcus bovis NRIC 1535. The recombinant α-amylase from S. bovis (SBA) showed activity at 28°C, which is the optimal temperature for production of itaconic acid, while α-amylase from B. amyloliquefaciens displayed no noticeable activity. E. coli cells expressing SBA produced 0.15 g/L itaconic acid after 69 h cultivation under pH-stat conditions, using 1% starch as the sole carbon source. In fact, E. coli cells expressing SBA had similar growth rates when grown in the presence of 1% glucose or starch, thereby highlighting the expression of an active α-amylase that enabled utilization of starch to produce itaconic acid in E. coli.

  8. Improved performance of α-amylase immobilized on poly(glycidyl methacrylate-co-ethylenedimethacrylate) beads.

    PubMed

    He, Tian; Tian, Yong-Le; Qi, Liang; Zhang, Jing; Zhang, Zhi-Qi

    2014-04-01

    α-Amylase was successfully immobilized onto poly(glycidyl methacrylate-co-ethylenedimethacrylate) (PGMA/EDMA) beads with high immobilization efficiency of 87.8%. PGMA/EDMA beads with a relatively uniform diameter of 2-3 μm were prepared by single-step swelling polymerization. After amination with ethanediamine and activation with glutaraldehyde, PGMA/EDMA beads showed commendable α-amylase immobilization capacity of 35.1 mg g(-1) carrier. Compared with free form, immobilized α-amylase had increasement of 12.94 mg mL(-1) for Km and 0.124 mmol mL(-1) min(-1) for Vmax, improved acid resistance (the optimal pH from 7 to 5), presented better thermal stability by retaining 61% activity than 40% at 90 °C, and displayed high operational reusability by retaining 58% of its initial activity after nine uses. Moreover, less than 10% of the free enzyme and more than 80% of the immobilized enzyme retained activity after 180 min pre-incubation at 50 °C. The easy modification, high immobilization efficiency and good properties of immobilized α-amylase in the present study indicate that PGMA/EDMA beads are suitable for α-amylase immobilization. The enhancement of acid resistance and thermo stability is doubtless of benefit for the industrial use of α-amylase.

  9. Immobilization of α-amylase onto a calix[4]arene derivative: Evaluation of its enzymatic activity.

    PubMed

    Veesar, Irshad Ali; Solangi, Imam Bakhsh; Memon, Shahabuddin

    2015-06-01

    In order to enhance the cost-effectiveness practicability of enzymes in many industries such as pharmaceutical, food, medical and some other technological processes, there is great need to immobilize them onto a solid supports. In this study, a new and efficient immobilization of α-amylase from Saccharomyces cerevisiae has been developed by using the surface functionalization of calix[4]arene as support. A glutaraldehyde-containing amino group functionalized calix[4]arene was used to immobilize α-amylase covalently. In this procedure, imide bonds are formed between amino groups on the protein and aldehyde groups on the calix[4]arene surface. The surface modified support was characterized using Fourier transform infrared spectroscopy (FT-IR), scanning electron microscopy (SEM). The effect of various preparation conditions on the immobilized α-amylase process such as immobilization time, enzyme concentration, temperature and pH were investigated. The influence of pH and temperature on the activity of free and immobilized α-amylase was also studied using starch as substrate. The optimum reaction temperature and pH value for the enzymatic conversion catalyzed by the immobilized α-amylase were 25°C and 7, respectively. Compared to the free enzyme, the immobilized α-amylase retained 85% of its original activity and exhibited significant thermal stability than the free one and excellent durability. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Lignin from bamboo shoot shells as an activator and novel immobilizing support for α-amylase.

    PubMed

    Gong, Weihua; Ran, Zhanxiang; Ye, Fayin; Zhao, Guohua

    2017-08-01

    This study examined the feasibility of α-amylase activation and immobilization, using lignin from bamboo shoot shells (BSS). Our results demonstrated that BSS lignin is an excellent α-amylase activator and it elevated α-amylase activity more than two-fold at a concentration of 5mg/ml. For immobilization of α-amylase via adsorption, BSS lignin was incubated in an α-amylase solution (5mg/ml) for 20min, and the maximum specific activity, amount of loaded protein and activity recovery were 92.4U/mg, 19.0mg/g and 111%, respectively. In contrast to its free counterpart, immobilized α-amylase improved the catalytic efficiency and storage stability, under comparable working conditions (temperature and pH). Regarding its convenient usage, immobilized enzyme can be suspended in advance, but a suspension incubated at 60°C should be used within 30min. The residual activity after 14 re-uses remained at a reasonable level (53.2%). In conclusion, this study reveals a novel support for enzyme immobilization. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. LEADER 3—Lipase and Amylase Activity in Subjects With Type 2 Diabetes

    PubMed Central

    Steinberg, William M.; Nauck, Michael A.; Zinman, Bernard; Daniels, Gilbert H.; Bergenstal, Richard M.; Mann, Johannes F.E.; Steen Ravn, Lasse; Moses, Alan C.; Stockner, Mette; Baeres, Florian M.M.; Marso, Steven P.; Buse, John B.

    2014-01-01

    Objectives This report from the LEADER (Liraglutide Effect and Action in Diabetes: Evaluation of Cardiovascular Outcome Results) trial describes baseline lipase and amylase activity in type 2 diabetic subjects without acute pancreatitis symptoms before randomization to the glucagonlike peptide analog liraglutide or placebo. Methods The LEADER is an international randomized placebo-controlled trial evaluating the cardiovascular safety of liraglutide in 9340 type 2 diabetic patients at high cardiovascular risk. Fasting lipase and amylase activity was assessed at baseline, before receiving liraglutide or placebo, using a commercial assay (Roche) with upper limit of normal values of 63 U/L for lipase and 100 U/L for amylase. Results Either or both enzymes were above the upper limit of normal in 22.7% of subjects; 16.6% (n = 1540) had an elevated lipase level (including 1.2% >3-fold elevated), and 11.8% (n = 1094) had an elevated amylase level (including 0.2% >3-fold elevated). In multivariable regression models, severely reduced kidney function was associated with the largest effect on increasing activity of both. However, even among subjects with normal kidney function, 12.2% and 7.7% had elevated lipase and amylase levels. Conclusions In this large study of type 2 diabetic patients, nearly 25% had elevated lipase or amylase levels without symptoms of acute pancreatitis. The clinician must take these data into account when evaluating abdominal symptoms in type 2 diabetic patients. PMID:25275271

  12. Amylase production potentials of bacterial isolates obtained from the gut of Oryctes rhinoceros larvae

    NASA Astrophysics Data System (ADS)

    Aryati, P. C.; Pangastuti, A.; Sari, S. L. A.

    2017-04-01

    Amylase is one of the main enzymes used in industry, such as food, detergent, textile, and pharmaceutical industry. Amylase can be produced by plants, animals, and microorganisms. However, bacterial and fungal amylases have dominated application in industries. This research was aimed to determine amylolytic activity of bacteria isolated from the gut of Oryctes rhinoceros larvae. Based on clear zone formation, 9 from 11 isolates showed amylolytic activity. Isolates with the widest clear zone, i.e Bacillus subtilis GOR1, Bacillus cereus GOR3, and Bacillus pumilus GOR2, were screened for amylolytic activity based on reduction sugar production. The result showed that Bacillus subtilis GOR1 was the most potential as amylase producer, showed by the widest clear zone 5.224 cm2 and highest reduction sugar production 0.0235 mg/ml. Highest amylase specific activity (0.1447 U/mg protein) was obtained at 60°C and pH 7. Amylase activity was stable for 3 hours at 60°C with residual activity respectively was 59.7%.

  13. [Microbial alpha-amylases: physicochemical properties, substrate specificity and domain structure].

    PubMed

    Avdiiuk, K V; Varbanets', L D

    2013-01-01

    The current literature data on producers, physico-chemical properties and substrate specificity of a-amylases produced by microbes from different taxonomic groups such as bacteria, fungi and yeasts are discussed in the survey. Synthesis of alpha-amylase majority is an inducible process which is stimulated in the presence of starch or products of its hydrolysis. It is possible to increase enzymes activity level by optimization of cultivation conditions of strains-producers. alpha-Amylases, isolated from different sources are distinguished in their physico-chemical properties, particularly in their molecular weights, pH- and thermooptimums, inhibitors and activators. The enzymes hydrolyse soluble starch, amylose, amylopectin, glycogen, maltodextrins, alpha- and beta3-cyclodextrins and other carbohydrate substrates. It is well known that alpha-amylases belong to GH-13 family of glycosyl-hydrolases, which contain the catalytic domain A as (beta/alpha)8-barrel. In addition to domain A, alpha-amylases contain two other domains: B and C, which are localized approximately on opposite sides of (beta/alpha)8-barrel. Most of the known alpha-amylases contain calcium ion, which is located on the surface between domains A and B and plays an important role in stability and activity of the enzyme.

  14. Purification and characterization of a novel thermostable beta-amylase from Clostridium thermosulphurogenes.

    PubMed Central

    Shen, G J; Saha, B C; Lee, Y E; Bhatnagar, L; Zeikus, J G

    1988-01-01

    An extracellular beta-amylase from Clostridium thermosulphurogenes was purified 811-fold to homogeneity, and its general molecular, physico-chemical and catalytic properties were determined. The native enzyme was a tetramer of 210 kDa composed of a single type subunit; its 20 amino acid N-terminus displayed 45% homology with Bacillus polymyxa beta-amylase. The beta-amylase was enriched in both acidic and hydrophobic amino acids. The pure enzyme displayed an isoelectric point of 5.1 and a pH activity optimum of 5.5. The optimum temperature for beta-amylase activity was 75 degrees C, and enzyme thermostability at 80 degrees C was enhanced by substrate and Ca2+ addition. The beta-amylase hydrolysed amylose to maltose and amylopectin and glycogen to maltose and limit dextrins, and it was inhibited by alpha- and beta-cyclodextrins. The enzyme displayed kcat. and Km values for boiled soluble starch of 400,000 min-1 per mol and 1.68 mg/ml, respectively. The enzyme was antigenically distinct from plant beta-amylases. PMID:2461701

  15. Bread eating induced oral angioedema due to alpha-amylase allergy.

    PubMed

    Moreno-Ancillo, A; Domínguez-Noche, C; Gil-Adrados, A C; Cosmes, P M

    2004-01-01

    Inhalation of dust from different enzymes can be the cause of occupational asthma in exposed workers. Enzymes from different sources are being increasingly used in food. Few cases of food allergy to alpha-amylase induced by eating bread have been reported. Those cases were reported in bakery-related patients and in a pharmaceutical-industry worker. A 25-year-old farmer suffered sneezing, rhinorrhea, oropharyngeal itching, hoarseness, cough, and non-wheezy dyspnea after eating white bread. Skin prick tests (SPT) with common aeroallergens and food allergens revealed only sensitization to Olea europaea pollen. SPT response was positive to Aspergillus oryzae alpha-amylase. Specific IgE against alpha-amylase was positive. A double-blind placebo-controlled challenge with 5 mg of uncooked -amylase induced sneezing, cough, oral angioedema within 10 minutes. The provocation test with 50 g of white bread gave similar findings. This case indicates that alpha-amylase contained in bread may provoke IgE-mediated food allergy. It is worth noting that in this case, the only source of alpha-amylases sensitization was bread.

  16. Cloning and Characterization of Cold-Adapted α-Amylase from Antarctic Arthrobacter agilis.

    PubMed

    Kim, Su-Mi; Park, Hyun; Choi, Jong-Il

    2017-03-01

    In this study, the gene encoding an α-amylase from a psychrophilic Arthrobacter agilis PAMC 27388 strain was cloned into a pET-28a(+) vector and heterologously expressed in Escherichia coli BL21(DE3). The recombinant α-amylase with a molecular mass of about 80 kDa was purified by using Ni(2+)-NTA affinity chromatography. This recombinant α-amylase exhibited optimal activity at pH 3.0 and 30 °C and was highly stable at varying temperatures (30-60 °C) and within the pH range of 4.0-8.0. Furthermore, α-amylase activity was enhanced in the presence of FeCl3 (1 mM) and β-mercaptoethanol (5 mM), while CoCl2 (1 mM), ammonium persulfate (5 mM), SDS (10 %), Triton X-100 (10 %), and urea (1 %) inhibited the enzymatic activity. Importantly, the presence of Ca(2+) ions and phenylmethylsulfonyl fluoride (PMSF) did not affect enzymatic activity. Thin layer chromatography (TLC) analysis showed that recombinant A. agilis α-amylase hydrolyzed starch, maltotetraose, and maltotriose, producing maltose as the major end product. These results make recombinant A. agilis α-amylase an attractive potential candidate for industrial applications in the textile, paper, detergent, and pharmaceutical industries.

  17. [Baking ingredients, especially alpha-amylase, as occupational inhalation allergens in the baking industry].

    PubMed

    Wüthrich, B; Baur, X

    1990-03-31

    Baker's asthma is the most frequent occupational lung disease in Switzerland and West Germany. Cereal flours, and more rarely flour parasites, are implicated as the responsible allergens. Based on an observation of a case of baker's asthma due to monovalent sensitization to alpha-amylase used as additive to flour, 31 bakers with occupational asthma and/or rhinitis were routinely tested by skin tests and serological RAST examinations for allergic sensitivity to flour, alpha-amylase and other bakery additives. 17/31 subjects (55%) reacted positively in scratch tests to a commercial powdered alpha-amylase and 13/20 (65%) to a lecithin preparation. 23/31 (74%) and 19/31 (61%) were RAST positive to wheat and to rye flour respectively. 32% had RAST specific IgE to alpha-amylase (from Aspergillus oryzae), 19.3% to soya bean flour and 16% to malt. 7/12 and 5/12 respectively reacted to trypsin inhibitor and lipoxidase, the main allergens in soya bean. In two patients monosensitization to alpha-amylase was present. In accordance with other reports we recommend that baking additives, especially alpha-amylase, should be tested in allergological diagnosis of occupational diseases in flour processing workers. Full declaration of all additives used in the bakery industry is needed.

  18. Screening, Gene Cloning, and Characterizations of an Acid-Stable α-Amylase.

    PubMed

    Liu, Xinyu; Jia, Wei; An, Yi; Cheng, Kun; Wang, Mingdao; Yang, Sen; Chen, Hongge

    2015-06-01

    Based on its α-amylase activity at pH 5.0 and optimal pH of the crude enzyme, a strain (named B-5) with acid α-amylase production was screened. The B-5 strain was identified as Bacillus amyloliquefaciens through morphological, physiological, and biochemical characteristics analysis, as well as 16S rDNA phylogenetic analysis. Its α-amylase gene of GenBank Accession No. GU318401 was cloned and expressed in Escherichia coli. The purified recombinant α-amylase AMY-Ba showed the optimal pH of 5.0, and was stable at a pH range of 4.0-6.0. When hydrolyzing soluble starch, amylose, and amylopectin, AMY-Ba released glucose and maltose as major end products. The α-amylase AMY-Ba in this work was a different type from the well-investigated J01542 (GenBank Accession No.)-type α-amylase from the same species. AMY-Ba exhibited notable adsorption and hydrolysis ability towards various raw starches. Structure analysis of AMY-Ba suggested the presence of a new starch-binding domain at its C-terminal region.

  19. Evaluation of alpha- amylase inhibition by Urtica dioica and Juglans regia extracts

    PubMed Central

    Rahimzadeh, Mahsa; Jahanshahi, Samaneh; Moein, Soheila; Moein, Mahmood Reza

    2014-01-01

    Objective(s): One strategy for the treatment of diabetes is inhibition of pancreatic α- amylase. Plants contains different chemical constituents with potential for inhibition of α-amylase and hence maybe used as therapeutic. Materials and Methods: Urtica dioica and Juglans regia Linn were tested for α-amylase inhibition. Different concentrations of leaf aqueous extracts were incubated with enzyme substrate solution and the activity of enzyme was measured. For determination of the type of inhibition, Dixon plot was depicted. Acarbose was used as the standard inhibitor. Results: Both plant extracts showed time and concentration dependent inhibition of α-amylase. 60% inhibition was seen with 2 mg/ml of U. dioica and 0.4 mg/ml of J. regia aqueous extract. Dixon plots revealed the type of α-amylase inhibition by these two extracts as competitive inhibition. Conclusion: Determination of the type of α-amylase inhibition by these plant extracts could provide by successful use of plant chemicals as drug targets. PMID:25140210

  20. Oral intercourse or secondary transfer? A Bayesian approach of salivary amylase and foreign DNA findings.

    PubMed

    Breathnach, Michelle; Moore, Elizabeth

    2013-06-10

    The Bayesian Approach allows forensic scientists to evaluate the significance of scientific evidence in light of two conflicting hypothesis. This aids the investigator to calculate a numerical value of the probability that the scientific findings support one hypothesis over conflicting opinions. In the case where oral intercourse is alleged, α-amylase, an indicator of saliva, is detected on penile swabs. The value of this finding is unknown as it may indicate the presence of saliva resulting from oral intercourse however it may also represent the presence of saliva due to innocent means such as background levels of salivary-α-amylase in the male population due to secondary transfer. Therefore, it is difficult to attach significance to this finding without background information and knowledge. A population study of the background levels of salivary-α-amylase was performed by analysing items of underwear worn under normal circumstances by 69 male volunteers. The Phadebas press test was used to screen the garments for amylase-containing stains and the positive areas were subjected to further confirmation of saliva by the RSID-Saliva kit. 44% of underwear screened had stains containing amylase. This study determined the background level of salivary-α-amylase and DNA on the inside front of male underwear which has potential implications on the interpretation of evidence in alleged oral intercourse. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  1. MS characterization of multiple forms of alpha-amylase in human saliva.

    PubMed

    Hirtz, Christophe; Chevalier, François; Centeno, Delphine; Rofidal, Valerie; Egea, Jean-Christophe; Rossignol, Michel; Sommerer, Nicolas; Deville de Périère, Dominique

    2005-11-01

    Alpha-amylase is a major and well-characterized component of human saliva. Recent proteomic studies suggested that this protein could be observed in more than twenty spots on 2-D gels of salivary proteins. The aim of this work was to investigate this unexpected redundancy. 2-D gel electrophoresis was combined with systematic MALDI-TOF MS analysis. More than 140 protein spots identifying the alpha-amylase were shown to constitute a stable but very complex pattern. Careful analysis of mass spectra and simultaneous hierarchical clustering of the observed peptides and of the electrophoretic features of spots allowed one to define three major groups. A main class grouping 90 spots was shown to correspond to full length alpha-amylases that can be assumed to include isoforms and post-translationally modified forms, a subset of this class being demonstrated to be N-glycosylated. A second group included short alpha-amylases that are differently truncated in a non-random manner, very likely in the oral cavity. The last class grouped alpha-amylase forms showing both the N- and C-terminal sequences of the enzyme but displaying a molecular weight that was up to 50% lower than that of the native protein. It is speculated that the last group of alpha-amylase spots could correspond to proteins submitted to internal deletions prior to the secretion.

  2. Physical and catalytic properties of alpha-amylase from Tenebrio molitor L. larvae.

    PubMed Central

    Buonocore, V; Poerio, E; Silano, V; Tomasi, M

    1976-01-01

    The amylase from Tenebrio molitor L. larvae (yellow mealworm) was characterized according to a number of its molecular and catalytic properties. The insect amylase is a single polypeptide chain with mol.wt. 68000, an isoelectric point of 4.0 and a very low content of sulphur-containing amino acids. The enzyme is a Ca2+-protein and behaves as an alpha-amylase. Removal of Ca2+ by exhaustive dialysis against water causes the irreversible inactivation of the enzyme. Moreover, the enzyme is activated by the presence in the assay mixture of Cl-, or some other inorganic anions that are less effective than Cl-, and is inhibited by F-. Optimal conditions of pH and temperature for the enzymic activity are 5.8 and 37 degrees C. The insect amylase exhibits an identical kinetic behaviour toward starch, amylose and amylopectin; the enzyme hydrolyses glycogen with a higher affinity constant. Compared with the non-insect alpha-amylases described in the literature, Tenebrio molitor amylase has a lower affinity for starch. PMID:942374

  3. Effect of an herb root extract, herbal dentifrice and synthetic dentifrice on human salivary amylase

    PubMed Central

    Sapra, Gaurav; Vyas, Yogesh Kumar; Agarwal, Rahul; Aggarwal, Ashish; Chandrashekar, K T; Sharma, Kanika

    2013-01-01

    Background: Salivary amylase is an enzyme, which plays a vital role in formation of dental plaque. It has the ability to bind on the bacterial surfaces and to hydrolyze starch, giving rise to products that are transformed into acids leading to dental caries. Suppression of salivary amylase activity can lead to decrease in risk of dental caries and plaque associated periodontal diseases. The aim of this study was to evaluate the effect of an herb, Spilanthes calva (in form of a test dentifrice) on human salivary amylase activity and to compare it with other dentifrices. Materials and Methods: A total of 80 subjects of age 18-35 years were randomly selected and divided equally into 4 groups. Group 1 subjects were assigned to use Test Dentifrice (with S. calva root extract), while Group 2, Group 3, and Group 4 subjects were assigned to use Herbal Dentifrice (Arodent™), Synthetic Dentifrice (Colgate®), and Control Dentifrice respectively. Salivary amylase activity was determined by Bernfeld method in each group, before and after using the given dentifrices. Results: Maximum inhibition of salivary amylase activity was found in the group using test dentifrice as compared to others. Conclusion: The present study indicates that, the root extract of S. calva possess significant inhibitory activity for salivary amylase. Use of S. calva root extract will provide a wider protection against different pathogenic oral microflora. Use of this extract singly or in combination is strongly recommended in the dentifrice formulations. PMID:24130585

  4. Effect of an herb root extract, herbal dentifrice and synthetic dentifrice on human salivary amylase.

    PubMed

    Sapra, Gaurav; Vyas, Yogesh Kumar; Agarwal, Rahul; Aggarwal, Ashish; Chandrashekar, K T; Sharma, Kanika

    2013-07-01

    Salivary amylase is an enzyme, which plays a vital role in formation of dental plaque. It has the ability to bind on the bacterial surfaces and to hydrolyze starch, giving rise to products that are transformed into acids leading to dental caries. Suppression of salivary amylase activity can lead to decrease in risk of dental caries and plaque associated periodontal diseases. The aim of this study was to evaluate the effect of an herb, Spilanthes calva (in form of a test dentifrice) on human salivary amylase activity and to compare it with other dentifrices. A total of 80 subjects of age 18-35 years were randomly selected and divided equally into 4 groups. Group 1 subjects were assigned to use Test Dentifrice (with S. calva root extract), while Group 2, Group 3, and Group 4 subjects were assigned to use Herbal Dentifrice (Arodent(™)), Synthetic Dentifrice (Colgate(®)), and Control Dentifrice respectively. Salivary amylase activity was determined by Bernfeld method in each group, before and after using the given dentifrices. Maximum inhibition of salivary amylase activity was found in the group using test dentifrice as compared to others. The present study indicates that, the root extract of S. calva possess significant inhibitory activity for salivary amylase. Use of S. calva root extract will provide a wider protection against different pathogenic oral microflora. Use of this extract singly or in combination is strongly recommended in the dentifrice formulations.

  5. Alpha-amylase serum levels in professional soccer players are not related with physical fitness.

    PubMed

    Sanchis-Gomar, Fabian; Alis, Rafael; Rampinini, Ermanno; Bosio, Andrea; Romagnoli, Marco; Lombardi, Giovanni; Lippi, Giuseppe

    2017-03-01

    Recent evidence has showed that serum or salivary values of α-amylase predict endurance running performance. In this study we investigate whether serum α-amylase concentration may be associated with training status during a competitive season and after a detraining period in professional soccer players. The study population consisted in 15 male professional soccer players from an Italian major league team (age [mean±SD] 27±5 years, weight 76.9±4.1 kg, height 1.82±0.05 m). Serum α-amylase levels were measured 3 times during the last part of a competitive season (January, March and May) and just before preseason training (July). Metabolic and cardiovascular fitness of soccer players was improved during the last part of the season. The levels of α-amylase did not change significantly throughout the study period (χ2=7.331, P=0.062), nor they were found to be associated with variation of physical fitness and training status. The α-amylase fluctuations throughout a competitive season and after vacation time were meaningless in professional soccer players. No significant associations with physical fitness variations could be observed. These results suggest that α-amylase concentration may be a useful parameter for identifying individual inclination to endurance exercise, but not for predicting actual training status.

  6. Pepsin and amylase in oral and tracheal secretions: a pilot study.

    PubMed

    Sole, Mary Lou; Conrad, Janet; Bennett, Melody; Middleton, Aurea; Hay, Katherine; Ash-worth, Suzanne; Mehta, Devendra Indulal

    2014-07-01

    Endotracheal intubation increases the risk for microaspiration of secretions around the tube cuff. Pepsin has been used as a biomarker for gastric aspiration. Amylase is a newer proposed biomarker for aspiration of oral contents. To assess the presence of pepsin and amylase in paired oral-tracheal secretions of adult patients treated with mechanical ventilation. In this descriptive study, paired samples of oral and tracheal secretions were obtained from adult patients at baseline and again within 4 hours when a need for endotracheal suctioning was assessed. Assays of pepsin and amylase were processed in a specialty diagnostic laboratory. The sample consisted of 10 men and 3 women with a median age of 56 years. The majority were intubated with a subglottic suction endotracheal tube (9 patients, 69%), receiving synchronized intermittent mandatory ventilation (10 patients; 77%), and receiving enteral feedings (11 patients; 85%) through a tube distally placed in the stomach (8 patients; 67%). Pepsin was present in oral secretions of 9 patients (69%), and in tracheal specimens of 7 patients (54%) at one or both sampling times. Amylase was detected in all patients' oral secretions and in tracheal secretions of 5 patients (38%) at one or both sampling times. Many patients had pepsin, amylase, or both in tracheal aspirates. Pepsin was more commonly detected than was amylase. Although the relationship of this finding to long-term outcomes was not assessed, findings indicate that microaspiration of oral and gastric secretions occurs frequently. ©2014 American Association of Critical-Care Nurses.

  7. Control of alpha-Amylase Development in Cotyledons during and following Germination of Mung Bean Seeds.

    PubMed

    Morohashi, Y; Katoh, H; Kaneko, Y; Matsushima, H

    1989-09-01

    Developmental patterns of alpha-amylase in Vigna radiata cotyledons during and following germination were quite different depending on the differences in the treatments of cotyledons during the imbibitional stage. When axis-detached cotyledons were imbibed in water with seed-coats attached, alpha-amylase activity did not increase and remained low. On the other hand, when the cotyledons were imbibed in water after seed-coat removal, the enzyme activity increased markedly. If the axis was attached to the cotyledons, alpha-amylase showed a marked development even under the former imbibition conditions. These changes in the enzyme activity were in parallel with those in the enzyme content, and the content, in turn, was dependent upon the availability of mRNA for alpha-amylase. We propose that the regulation of the development of alpha-amylase in cotyledons may involve some factor(s) inhibitory to accumulation of alpha-amylase mRNA, which is present in dry cotyledons and can be removed from cotyledons by leakage or by the presence of the axis.

  8. The small GTPase Rab33A participates in regulation of amylase release from parotid acinar cells.

    PubMed

    Imai, Akane; Tsujimura, Maiko; Yoshie, Sumio; Fukuda, Mitsunori

    2015-06-05

    Amylase is released from exocrine parotid acinar cells via typical exocytosis. Exocytosis of amylase-containing granules occurs through several steps, including formation, maturation, and transport of granules. These steps are thought to be regulated by members of the small GTPase Rab family. We previously demonstrated that Rab27 and its effectors mediate amylase release from parotid acinar cells, but the functional involvement of other Rab proteins in exocrine granule exocytosis remains largely unknown. Here, we studied isoproterenol (IPR)-induced amylase release from parotid acinar cells to investigate the possible involvement of Rab33A, which was recently suggested to regulate exocytosis in hippocampal neurons and PC12 cells. Rab33A was endogenously expressed in parotid acinar cells and present in secretory granules and the Golgi body. Functional ablation of Rab33A with anti-Rab33A antibody or a dominant-negative Rab33A-T50N mutant significantly reduced IPR-induced amylase release. Our results indicated that Rab33A is a novel component of IPR-stimulated amylase secretion from parotid acinar cells. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Recurrent Rearrangements of Human Amylase Genes Create Multiple Independent CNV Series.

    PubMed

    Shwan, Nzar A A; Louzada, Sandra; Yang, Fengtang; Armour, John A L

    2017-05-01

    The human amylase gene cluster includes the human salivary (AMY1) and pancreatic amylase genes (AMY2A and AMY2B), and is a highly variable and dynamic region of the genome. Copy number variation (CNV) of AMY1 has been implicated in human dietary adaptation, and in population association with obesity, but neither of these findings has been independently replicated. Despite these functional implications, the structural genomic basis of CNV has only been defined in detail very recently. In this work, we use high-resolution analysis of copy number, and analysis of segregation in trios, to define new, independent allelic series of amylase CNVs in sub-Saharan Africans, including a series of higher-order expansions of a unit consisting of one copy each of AMY1, AMY2A, and AMY2B. We use fiber-FISH (fluorescence in situ hybridization) to define unexpected complexity in the accompanying rearrangements. These findings demonstrate recurrent involvement of the amylase gene region in genomic instability, involving at least five independent rearrangements of the pancreatic amylase genes (AMY2A and AMY2B). Structural features shared by fundamentally distinct lineages strongly suggest that the common ancestral state for the human amylase cluster contained more than one, and probably three, copies of AMY1. © 2017 WILEY PERIODICALS, INC.

  10. Cholecystokinin receptors: disparity between phosphoinositide breakdown and amylase releasing activity of CCK analogues in pancreas

    SciTech Connect

    Lin, C.W.; Grant, D.; Bianchi, B.; Miller, T.; Witte, D.; Shue, Y.K.; Nadzan, A.

    1986-03-05

    Cholecystokinin (CCK) peptides are a family of hormones which also occur in brain. In pancreas CCK stimulates the release of amylase, a process that is dependent on the mobilization of intracellular Ca/sup 2 +/. Recent evidence suggests that inositol 1,4,5-trisphosphate, the breakdown product of phosphatidylinositol 4,5-bisphosphate, is responsible for the rise in intracellular Ca/sup 2 +/. Their laboratory has developed assays to study synthetic CCK analogues using radioligand binding, PI breakdown and amylase release. They have shown that there are good correlations among these three assay systems for the carboxy terminal fragments of CCK/sub 8/. Recently, they have discovered synthetic analogues of CCK/sub 4/ that are full agonists in amylase release but are ineffective in causing PI breakdown. In particular, A-61576, Boc-5-amino-2-indolemethylene-pent-2-ene-1-oyl-Leu-Asp-Phe-NH/sub 2/, is a full agonist in the amylase releasing assay, but is devoid of PI stimulating activity. A-61576 completely reverses the stimulation of PI response induced by CCK/sub 8/, indicative of an antagonist. Since a mechanism other than the PI breakdown is responsible for amylase release by A-61576, they suggest that separate receptors are responsible for PI breakdown and amylase release.

  11. Physical and catalytic properties of alpha-amylase from Tenebrio molitor L. larvae.

    PubMed

    Buonocore, V; Poerio, E; Silano, V; Tomasi, M

    1976-03-01

    The amylase from Tenebrio molitor L. larvae (yellow mealworm) was characterized according to a number of its molecular and catalytic properties. The insect amylase is a single polypeptide chain with mol.wt. 68000, an isoelectric point of 4.0 and a very low content of sulphur-containing amino acids. The enzyme is a Ca2+-protein and behaves as an alpha-amylase. Removal of Ca2+ by exhaustive dialysis against water causes the irreversible inactivation of the enzyme. Moreover, the enzyme is activated by the presence in the assay mixture of Cl-, or some other inorganic anions that are less effective than Cl-, and is inhibited by F-. Optimal conditions of pH and temperature for the enzymic activity are 5.8 and 37 degrees C. The insect amylase exhibits an identical kinetic behaviour toward starch, amylose and amylopectin; the enzyme hydrolyses glycogen with a higher affinity constant. Compared with the non-insect alpha-amylases described in the literature, Tenebrio molitor amylase has a lower affinity for starch.

  12. A thermoactive alpha-amylase from a Bacillus sp. isolated from CSMCRI salt farm.

    PubMed

    Pancha, Imran; Jain, Deepti; Shrivastav, Anupama; Mishra, Sanjiv K; Shethia, Bhumi; Mishra, Sandhya; V P, Mohandas; Jha, Bhavanath

    2010-08-01

    Amylases are the most important hydrolytic enzymes for starch-based industries. It is desirable that alpha-amylases should be active at high temperature of gelatinization (100-110 degrees C) and liquefaction (80-90 degrees C) to economize processes. Therefore, thermostable and thermoactive enzyme from natural bacterial strain would have wide industrial importance. In the present study a highly thermoactive and thermostable amylase producing Bacillus sp. was isolated from experimental salt farm of Central Salt and Marine Chemicals Research Institute, yielding 452Uml(-1) amylase in medium containing (%) NaCl 0.5, peptone 0.5, beef extract 0.3, starch 1.0 at 37 degrees C, pH 7.0 after 48h of incubation. Maximum activity of amylase was observed at pH 8.0 and 110 degrees C temperature. The crude enzyme was highly active between pH 6.0 and 11.0 and observed to be active and thermostable after 30min of incubation at 60 degrees C. These properties indicated that the isolated alpha-amylase enzyme is suitable for starch liquefaction and other food processing. Copyright 2010 Elsevier B.V. All rights reserved.

  13. Experimental periodontitis induces a cAMP-dependent increase in amylase activity in parotid glands from male rats.

    PubMed

    Miozza, Valeria; Borda, Enri; Sterin-Borda, Leonor; Busch, Lucila

    2009-12-01

    It is known that subjects with periodontitis show enhanced amylase concentration in saliva. Our purpose was to analyze the release of amylase in parotid glands from rats with experimental periodontitis and controls. We present evidence that periodontitis induces an increase in resting amylase activity and release without changes in isoproterenol-induced amylase secretion. Changes in amylase were reverted by the inhibition of the adenylyl cyclase by SQ 22536, the cyclooxygenase type 1 by FR 122047 and by blocking the vasoactive intestinal peptide (VIP) receptor with VIP 6-28. Parotid glands from rats with periodontitis showed an increase in cAMP levels that was also reverted in the presence of SQ 22536, FR 122047 and VIP 6-28. We concluded that both PGE(2) and VIP are produced in parotid glands from rats with periodontitis and, by activating their own receptors in acinar cells, induce cAMP accumulation leading to an increase in amylase basal secretion.

  14. Molecular, Biochemical, and Dietary Regulation Features of α-Amylase in a Carnivorous Crustacean, the Spiny Lobster Panulirus argus

    PubMed Central

    Martos-Sitcha, Juan Antonio; Perdomo-Morales, Rolando; Casuso, Antonio; Montero-Alejo, Vivian; García-Galano, Tsai; Martínez-Rodríguez, Gonzalo; Mancera, Juan Miguel

    2016-01-01

    Alpha-amylases are ubiquitously distributed throughout microbials, plants and animals. It is widely accepted that omnivorous crustaceans have higher α-amylase activity and number of isoforms than carnivorous, but contradictory results have been obtained in some species, and carnivorous crustaceans have been less studied. In addition, the physiological meaning of α-amylase polymorphism in crustaceans is not well understood. In this work we studied α-amylase in a carnivorous lobster at the gene, transcript, and protein levels. It was showed that α-amylase isoenzyme composition (i.e., phenotype) in lobster determines carbohydrate digestion efficiency. Most frequent α-amylase phenotype has the lowest digestion efficiency, suggesting this is a favoured trait. We revealed that gene and intron loss have occurred in lobster α-amylase, thus lobsters express a single 1830 bp cDNA encoding a highly conserved protein with 513 amino acids. This protein gives rise to two isoenzymes in some individuals by glycosylation but not by limited proteolysis. Only the glycosylated isoenzyme could be purified by chromatography, with biochemical features similar to other animal amylases. High carbohydrate content in diet down-regulates α-amylase gene expression in lobster. However, high α-amylase activity occurs in lobster gastric juice irrespective of diet and was proposed to function as an early sensor of the carbohydrate content of diet to regulate further gene expression. We concluded that gene/isoenzyme simplicity, post-translational modifications and low Km, coupled with a tight regulation of gene expression, have arose during evolution of α-amylase in the carnivorous lobster to control excessive carbohydrate digestion in the presence of an active α-amylase. PMID:27391425

  15. Molecular, Biochemical, and Dietary Regulation Features of α-Amylase in a Carnivorous Crustacean, the Spiny Lobster Panulirus argus.

    PubMed

    Rodríguez-Viera, Leandro; Perera, Erick; Martos-Sitcha, Juan Antonio; Perdomo-Morales, Rolando; Casuso, Antonio; Montero-Alejo, Vivian; García-Galano, Tsai; Martínez-Rodríguez, Gonzalo; Mancera, Juan Miguel

    2016-01-01

    Alpha-amylases are ubiquitously distributed throughout microbials, plants and animals. It is widely accepted that omnivorous crustaceans have higher α-amylase activity and number of isoforms than carnivorous, but contradictory results have been obtained in some species, and carnivorous crustaceans have been less studied. In addition, the physiological meaning of α-amylase polymorphism in crustaceans is not well understood. In this work we studied α-amylase in a carnivorous lobster at the gene, transcript, and protein levels. It was showed that α-amylase isoenzyme composition (i.e., phenotype) in lobster determines carbohydrate digestion efficiency. Most frequent α-amylase phenotype has the lowest digestion efficiency, suggesting this is a favoured trait. We revealed that gene and intron loss have occurred in lobster α-amylase, thus lobsters express a single 1830 bp cDNA encoding a highly conserved protein with 513 amino acids. This protein gives rise to two isoenzymes in some individuals by glycosylation but not by limited proteolysis. Only the glycosylated isoenzyme could be purified by chromatography, with biochemical features similar to other animal amylases. High carbohydrate content in diet down-regulates α-amylase gene expression in lobster. However, high α-amylase activity occurs in lobster gastric juice irrespective of diet and was proposed to function as an early sensor of the carbohydrate content of diet to regulate further gene expression. We concluded that gene/isoenzyme simplicity, post-translational modifications and low Km, coupled with a tight regulation of gene expression, have arose during evolution of α-amylase in the carnivorous lobster to control excessive carbohydrate digestion in the presence of an active α-amylase.

  16. Regulation of the synthesis of barley aleurone. cap alpha. -amylase by gibberellic acid and calcium ions

    SciTech Connect

    Jones, R.L.; Carbonell, J.

    1984-09-01

    The effects of gibberellic acid (GA/sub 3/) and calcium ions on the production of ..cap alpha..-amylase and acid phosphatase by isolated aleurone layers of barley (Hordeum vulgare L. cv Himalaya) were studied. Aleurone layers not previously exposed to GA/sub 3/ or CA/sup 2 +/ show qualitative and quantitative changes in hydrolase production following incubation in either GA/sub 3/ or CA/sup 2 +/ or both. In cubation in H/sub 2/O or CA/sup 2 +/ results in the production of low levels of ..cap alpha..-amylase or acid phosphatase. The addition of GA/sub 3/ to the incubation medium causes 10- to 20-fold increase in the amounts of these enzymes released from the tissue, and addition of CA/sup 2 +/ at 10 millimolar causes a further 8- to 9-fold increase in ..cap alpha..-amylase release and a 75% increase in phosphatase release. Production of ..cap alpha..-amylase isoenzymes is also modified by the levels of GA/sub 3/ and CA/sup 2 +/ in the incubation medium. ..cap alpha..-amylase 2 is produced under all conditions of incubation, while ..cap alpha..-amylase 1 appears only when layers are incubated in GA/sub 3/ or GA/sub 3/ plus CA/sup 2 +/. The synthesis of ..cap alpha..-amylases 3 and 4 requires the presence of both GA/sub 3/ and CA/sup 2 +/ in the incubation medium. Laurell rocket immunoelectrophoresis shows that two distinct groups of ..cap alpha..-amylase antigens are present in incubation media of aleurone layers incubated with both GA/sub 3/ and CA/sup 2 +/, while only one group of antigens is found in media of layers incubated in GA/sub 3/ alone. Strontium ions can be substituted for CA/sup 2 +/ in increasing hydrolase production, although higher concentrations of Sr/sup 2 +/ are requried for maximal response. We conclude that GA/sub 3/ is required for the production of ..cap alpha..-amylase 1 and that both GA/sub 3/ and either CA/sup 2 +/ or Sr/sup 2 +/ are required for the production of isoenzymes 3 and 4 of barley aleurone ..cap alpha..-amylase. 22 references, 8

  17. Alpha-Amylase Activity in Blood Increases after Pharmacological, But Not Psychological, Activation of the Adrenergic System

    PubMed Central

    Nater, Urs M.; La Marca, Roberto; Erni, Katja; Ehlert, Ulrike

    2015-01-01

    Background & Aim Alpha-amylase in both blood and saliva has been used as a diagnostic parameter. While studies examining alpha-amylase activity in saliva have shown that it is sensitive to physiological and psychological challenge of the adrenergic system, no challenge studies have attempted to elucidate the role of the adrenergic system in alpha-amylase activity in blood. We set out to examine the impact of psychological and pharmacological challenge on alpha-amylase in blood in two separate studies. Methods In study 1, healthy subjects were examined in a placebo-controlled, double-blind paradigm using yohimbine, an alpha2-adrenergic antagonist. In study 2, subjects were examined in a standardized rest-controlled psychosocial stress protocol. Alpha-amylase activity in blood was repeatedly measured in both studies. Results Results of study 1 showed that alpha-amylase in blood is subject to stronger increases after injection of yohimbine compared to placebo. In study 2, results showed that there was no significant effect of psychological stress compared to rest. Conclusions Alpha-amylase in blood increases after pharmacological activation of the adrenergic pathways suggesting that sympathetic receptors are responsible for these changes. Psychological stress, however, does not seem to have an impact on alpha-amylase in blood. Our findings provide insight into the mechanisms underlying activity changes in alpha-amylase in blood in healthy individuals. PMID:26110636

  18. Acteoside and Acyl-Migrated Acteoside, Compounds in Chinese Kudingcha Tea, Inhibit α-Amylase In Vitro.

    PubMed

    Lu, Yuqin; Zhou, Wenyu; Feng, Yue; Li, Yao; Liu, Ke; Liu, Lizhong; Lin, Dongxu; He, Zhendan; Wu, Xuli

    2017-06-01

    Acteoside, the predominant polyphenol of small-leaved kudingcha, the Chinese tea, has various biological activities. In this study, we examined the acyl migration of acteoside to isoacteoside with high-temperature treatment of acteoside. The inhibitory effects of acyl-migrated acteoside and acteoside on α-amylase were investigated, as were their binding interaction with α-amylase. The binding of acteoside and isoacteoside to α-amylase was investigated by using the fluorescence spectra assay, circular dichroism, and protein-ligand docking studies. Acteoside was more effective than preheated acteoside and isoacteoside in inhibiting α-amylase activity. Acteoside and isoacteoside binding to α-amylase may induce conformational changes to α-amylase, and the binding site of acteoside and isoacteoside being near the active site pocket of α-amylase may explain the decreased activity of α-amylase. The different affinities and binding sites of acteoside and isoacteoside for α-amylase resulted in different inhibition rates, which may be due to structural differences between acteoside and isoacteoside.

  19. Evidence that cleavage of the precursor enzyme by autocatalysis caused secretion of multiple amylases by Aspergillus niger.

    PubMed

    Ravi-Kumar, K; Venkatesh, K S; Umesh-Kumar, S

    2004-01-16

    The observation that a mutant strain of Aspergillus niger isolated for protease overproduction accumulated Taka-amylase supported an earlier report that processing of the precursor amylase by protease resulted in the secretion of multiple amylases. Studies using a mutant strain revealed that such processing was not due to aspergillopepsin but to autocatalysis by an inherent protease activity of the precursor and glucoamylase. Alignment of protease sequences with glucoamylase showed regions of consensus with serine carboxypeptidase of A. niger. Thus point mutations in this region due to ultraviolet radiation apparently caused the mutant to evolve with enhanced protease activity that degraded the precursor and accumulated Taka-amylase.

  20. Relationship between parotid amylase secretion and osmolality in the gastric contents of rats fed a pelleted or liquid diet.

    PubMed

    Kurahashi, M; Inomata, K

    1999-12-01

    The relationship between parotid amylase secretion and the osmolality in the gastric contents of rats fed a pelleted or liquid diet was investigated. In sham-operated rats fed a pelleted diet, amylase activity in the parotid glands decreased, amylase activity in the plasma increased, and there was strong amylase activity in the gastric contents. As a result, both reducing sugar concentration and osmolality in the gastric contents increased. In parotid duct-ligated rats, the feeding of a pelleted diet affected neither parotid nor plasma amylase activity and there was little amylase activity in the gastric contents; this resulted in decreased starch digestion. The amylase activity in the gastric contents of rats fed a liquid diet was lower than that of rats fed the pelleted diet. Both the reducing sugar concentration and osmolality in the gastric contents of rats fed the liquid diet were lower than those of rats fed the pelleted diet. However, both the reducing sugar concentration and osmolality in the gastric contents of rats fed the liquid diet were higher than those in the liquid diet itself. A small quantity of parotid amylase seems to effectively digest a large part of the starch in the stomaches of rats fed the liquid diet. These findings suggest that amylase secreted from parotid glands increases osmolality in the gastric contents via the production of reducing sugars from starch in rats when fed either pelleted or liquid diets.

  1. Alpha-Amylase Activity in Blood Increases after Pharmacological, But Not Psychological, Activation of the Adrenergic System.

    PubMed

    Nater, Urs M; La Marca, Roberto; Erni, Katja; Ehlert, Ulrike

    2015-01-01

    Alpha-amylase in both blood and saliva has been used as a diagnostic parameter. While studies examining alpha-amylase activity in saliva have shown that it is sensitive to physiological and psychological challenge of the adrenergic system, no challenge studies have attempted to elucidate the role of the adrenergic system in alpha-amylase activity in blood. We set out to examine the impact of psychological and pharmacological challenge on alpha-amylase in blood in two separate studies. In study 1, healthy subjects were examined in a placebo-controlled, double-blind paradigm using yohimbine, an alpha2-adrenergic antagonist. In study 2, subjects were examined in a standardized rest-controlled psychosocial stress protocol. Alpha-amylase activity in blood was repeatedly measured in both studies. Results of study 1 showed that alpha-amylase in blood is subject to stronger increases after injection of yohimbine compared to placebo. In study 2, results showed that there was no significant effect of psychological stress compared to rest. Alpha-amylase in blood increases after pharmacological activation of the adrenergic pathways suggesting that sympathetic receptors are responsible for these changes. Psychological stress, however, does not seem to have an impact on alpha-amylase in blood. Our findings provide insight into the mechanisms underlying activity changes in alpha-amylase in blood in healthy individuals.

  2. Pancreatic and salivary amylase/creatinine clearance ratios in normal subjects and in patients with chronic pancreatitis.

    PubMed Central

    Hegarty, J E; O'Donnell, M D; McGeeney, K F; Fitzgerald, O

    1978-01-01

    The clearance of pancreatic and salivary amylase relative to creatinine was measured in 26 control subjects and 22 patients with chronic pancreatitis. Control values for pancreatic amylase clearance (+/- SD) were 2.64 +/- 0.86% compared with 1.54 +/- 0.95% for salivary amylase. In chronic pancreatitis, pancreatic amylase clearance ratios were significantly higher than controls (P less than 0.0005, mean 4.09 +/- 1.63 SD). The difference in clearance rate of salivary amylase did not reach a level of significance when compared with the control group. Twelve of the 22 patients showed pancreatic amylase clearance values above the normal limit of 4.4, while only five were abnormal when the clearance of total amylase was measured. The patients also showed statistically higher (P less than 0.0005) levels of serum salivary amylase when compared with 69 control sera. No such difference was found for the pancreatic component of serum amylase. Comparison of beta2-microglobulin clearance values showed no statistical difference between patients and controls. PMID:350726

  3. Associations of eating a late-evening meal before bedtime with low serum amylase and unhealthy conditions.

    PubMed

    Oshida, Haruki; Kutsuma, Ayano; Nakajima, Kei

    2013-12-19

    Little is known about the associations of eating a late-evening meal (ELM), a putative unhealthy eating behavior, with low serum amylase, other eating behaviors, and cardiometabolic risk factors. Therefore, we investigated whether ELM before bedtime was associated with low serum amylase or other clinical factors in 2,426 asymptomatic adults aged 20-80 years. Multivariate logistic regression analysis showed that ELM was significantly associated with low serum amylase (<60 IU/l), overweight, smoking, daily alcohol consumption, skipping breakfast, and rapid eating, but not with abnormal glucose metabolism. In conclusion, ELM may be independently associated with low serum amylase and common unhealthy behaviors.

  4. Relationships Between Fasting Serum Amylase and Ghrelin or Peptide YY3-36 Levels in Healthy Men.

    PubMed

    Tak, Young Jin; Yi, Yu Hyeon; Lee, Sang Yeoup; Kim, Yun Jin; Lee, Jeong Gyu; Cho, Young Hye

    2016-03-01

    Appetite and carbohydrate metabolism are important contributors to the development of obesity. Recently, low serum amylase was shown to be associated with obesity and metabolic disorder. We investigated the relationship between amylase and ghrelin or peptide YY (PYY) levels in healthy men. Twenty-one men were enrolled in this cross-sectional study; all subjects were asymptomatic with no medical history. Fasting serum amylase, ghrelin, PYY3-36, anthropometry, and nutritional intake were measured. Linear regression analyses were performed to examine associations between amylase and ghrelin or PYY3-36. The mean (SD) age and waist circumference of the subjects were 51.5 (10.9) years and 87.0 (4.4) cm, respectively. Amylase was found to be correlated with waist circumference (r = -0.438, P = 0.054), ghrelin (r = 0.533, P = 0.015), and PYY3-36 (r = -0.511, P = 0.021). Multivariate linear regression analysis revealed a negative association between amylase and PYY3-36 (β = -0.428, P = 0.045) but a nonsignificantly positive association between amylase and ghrelin (β = 0.260, P = 0.146). Amylase levels were found to be associated with ghrelin and PYY3-36 in healthy men. Amylase, ghrelin, and PYY3-36 may play a role in obesity; further research is required to identify the underlying mechanism.

  5. Interaction of wheat monomeric and dimeric protein inhibitors with alpha-amylase from yellow mealworm (Tenebrio molitor L. larva).

    PubMed

    Buonocore, V; Gramenzi, F; Pace, W; Petrucci, T; Poerio, E; Silano, V

    1980-06-01

    The highly purified alpha-amylase from Tenebrio molitor L. larva (yellow mealworm) reversibly combines with two closely related homogeneous glycoprotein inhibitors, one dimeric (termed 'inhibitor 0.19') and one monomeric (termed 'inhibitor 0.28'), from wheat flour. As established by means of difference spectroscopy and kinetic studies, molar combining ratios for the amylase--inhibitor-0.19 and amylase-inhibitor-0.28 complexes were 1:1 and 1:2 respectively. Two amylase--inhibitor-0.19 complexes with slightly different retention volumes on Bio-Gel P-300 and only one amylase--inhibitor-0.28 complex were observed. Dissociation constants of the amylase--inhibitor-0.19 and amylase--inhibitor-0.28 complexes were 0.85 nM and 0.13 nM respectively. A strong tendency of both complexes to precipitate under an ultracentrifugal field was observed; the minimum molecular weight calculated for the two complexes under such conditions was approx. 95 000. The two complexes showed difference spectra indicating involvement of structurally related or identical tryptophyl side chains in the binding of inhibitors 0.28 and 0.19 to the amylase. A model summarizing the main features of the inhibition of the insect amylase by the two wheat protein inhibitors is proposed.

  6. Arabidopsis thaliana AMY3 Is a Unique Redox-regulated Chloroplastic α-Amylase*

    PubMed Central

    Seung, David; Thalmann, Matthias; Sparla, Francesca; Abou Hachem, Maher; Lee, Sang Kyu; Issakidis-Bourguet, Emmanuelle; Svensson, Birte; Zeeman, Samuel C.; Santelia, Diana

    2013-01-01

    α-Amylases are glucan hydrolases that cleave α-1,4-glucosidic bonds in starch. In vascular plants, α-amylases can be classified into three subfamilies. Arabidopsis has one member of each subfamily. Among them, only AtAMY3 is localized in the chloroplast. We expressed and purified AtAMY3 from Escherichia coli and carried out a biochemical characterization of the protein to find factors that regulate its activity. Recombinant AtAMY3 was active toward both insoluble starch granules and soluble substrates, with a strong preference for β-limit dextrin over amylopectin. Activity was shown to be dependent on a conserved aspartic acid residue (Asp666), identified as the catalytic nucleophile in other plant α-amylases such as the barley AMY1. AtAMY3 released small linear and branched glucans from Arabidopsis starch granules, and the proportion of branched glucans increased after the predigestion of starch with a β-amylase. Optimal rates of starch digestion in vitro was achieved when both AtAMY3 and β-amylase activities were present, suggesting that the two enzymes work synergistically at the granule surface. We also found that AtAMY3 has unique properties among other characterized plant α-amylases, with a pH optimum of 7.5–8, appropriate for activity in the chloroplast stroma. AtAMY3 is also redox-regulated, and the inactive oxidized form of AtAMY3 could be reactivated by reduced thioredoxins. Site-directed mutagenesis combined with mass spectrometry analysis showed that a disulfide bridge between Cys499 and Cys587 is central to this regulation. This work provides new insights into how α-amylase activity may be regulated in the chloroplast. PMID:24089528

  7. α-Amylase in Vaginal Fluid: Association With Conditions Favorable to Dominance of Lactobacillus.

    PubMed

    Nasioudis, Dimitrios; Beghini, Joziani; Bongiovanni, Ann Marie; Giraldo, Paulo C; Linhares, Iara M; Witkin, Steven S

    2015-11-01

    Vaginal glycogen is degraded by host α-amylase and then converted to lactic acid by Lactobacilli. This maintains the vaginal pH at ≤4.5 and prevents growth of other bacteria. Therefore, host α-amylase activity may promote dominance of Lactobacilli. We evaluated whether the α-amylase level in vaginal fluid is altered in women with bacterial vaginosis (BV) and vulvovaginal candidiasis (VVC) and whether its concentration was associated with levels of lactic acid isomers and host mediators. Vaginal fluid was obtained from 43 women with BV, 50 women with VVC, and 62 women with no vulvovaginal disorders. Vaginal fluid concentrations of α-amylase, secretory leukocyte protease inhibitor (SLPI), hyaluronan, hyaluronidase-1, β-defensin, and elafin were measured by enzyme-linked immunosorbent assay (ELISA). Vaginal concentrations of neutrophil gelatinase-associated lipocalin (NGAL), matrix metalloproteinase (MMP) 8, and d- and l-lactic acid levels in these patients were previously reported. The median vaginal fluid α-amylase level was 1.83 mU/mL in control women, 1.45 mU/mL in women with VVC, and 1.07 mU/mL in women with BV. Vaginal levels of α-amylase were correlated with d-lactic acid (P = .003) but not with l-lactic acid (P > .05) and with SLPI (P < .001), hyaluronidase-1 (P < .001), NGAL (P = .001), and MMP-8 (P = .005). The exfoliation of glycogen-rich epithelial cells into the vaginal lumen by hyaluronidase-1 and MMP-8 may increase glycogen availability and promote α-amylase activity. The subsequent enhanced availability of glycogen breakdown products would favor proliferation of Lactobacilli, the primary producers of d-lactic acid in the vagina. Concomitant production of NGAL and SLPI would retard growth of BV-related bacteria. © The Author(s) 2015.

  8. Arabidopsis thaliana AMY3 is a unique redox-regulated chloroplastic α-amylase.

    PubMed

    Seung, David; Thalmann, Matthias; Sparla, Francesca; Abou Hachem, Maher; Lee, Sang Kyu; Issakidis-Bourguet, Emmanuelle; Svensson, Birte; Zeeman, Samuel C; Santelia, Diana

    2013-11-22

    α-Amylases are glucan hydrolases that cleave α-1,4-glucosidic bonds in starch. In vascular plants, α-amylases can be classified into three subfamilies. Arabidopsis has one member of each subfamily. Among them, only AtAMY3 is localized in the chloroplast. We expressed and purified AtAMY3 from Escherichia coli and carried out a biochemical characterization of the protein to find factors that regulate its activity. Recombinant AtAMY3 was active toward both insoluble starch granules and soluble substrates, with a strong preference for β-limit dextrin over amylopectin. Activity was shown to be dependent on a conserved aspartic acid residue (Asp(666)), identified as the catalytic nucleophile in other plant α-amylases such as the barley AMY1. AtAMY3 released small linear and branched glucans from Arabidopsis starch granules, and the proportion of branched glucans increased after the predigestion of starch with a β-amylase. Optimal rates of starch digestion in vitro was achieved when both AtAMY3 and β-amylase activities were present, suggesting that the two enzymes work synergistically at the granule surface. We also found that AtAMY3 has unique properties among other characterized plant α-amylases, with a pH optimum of 7.5-8, appropriate for activity in the chloroplast stroma. AtAMY3 is also redox-regulated, and the inactive oxidized form of AtAMY3 could be reactivated by reduced thioredoxins. Site-directed mutagenesis combined with mass spectrometry analysis showed that a disulfide bridge between Cys(499) and Cys(587) is central to this regulation. This work provides new insights into how α-amylase activity may be regulated in the chloroplast.

  9. Phylogenetic and Comparative Sequence Analysis of Thermostable Alpha Amylases of kingdom Archea, Prokaryotes and Eukaryotes.

    PubMed

    Huma, Tayyaba; Maryam, Arooma; Rehman, Shahid Ur; Qamar, Muhammad Tahir Ul; Shaheen, Tayyaba; Haque, Asma; Shaheen, Bushra

    2014-01-01

    Alpha amylase family is generally defined as a group of enzymes that can hydrolyse and transglycosylase α-(1, 4) or α-(1, 6) glycosidic bonds along with the preservation of anomeric configuration. For the comparative analysis of alpha amylase family, nucleotide sequences of seven thermo stable organisms of Kingdom Archea i.e. Pyrococcus furiosus (100-105°C), Kingdom Prokaryotes i.e. Bacillus licheniformis (90-95°C), Geobacillus stearothermophilus (75°C), Bacillus amyloliquefaciens (72°C), Bacillus subtilis (70°C) and Bacillus KSM K38 (55°C) and Eukaryotes i.e. Aspergillus oryzae (60°C) were selected from NCBI. Primary structure composition analysis and Conserved sequence analysis were conducted through Bio Edit tools. Results from BioEdit shown only three conserved regions of base pairs and least similarity in MSA of the above mentioned alpha amylases. In Mega 5.1 Phylogeny of thermo stable alpha amylases of Kingdom Archea, Prokaryotes and Eukaryote was handled by Neighbor-Joining (NJ) algorithm. Mega 5.1 phylogenetic results suggested that alpha amylases of thermo stable organisms i.e. Pyrococcus furiosus (100-105°C), Bacillus licheniformis (90-95°C), Geobacillus stearothermophilus (75°C) and Bacillus amyloliquefaciens (72°C) are more distantly related as compared to less thermo stable organisms. By keeping in mind the characteristics of most thermo stable alpha amylases novel and improved features can be introduced in less thermo stable alpha amylases so that they become more thermo tolerant and productive for industry.

  10. Chemical constituents of Swertia longifolia Boiss. with α-amylase inhibitory activity

    PubMed Central

    Saeidnia, Soodabeh; Ara, Leila; Hajimehdipoor, Homa; Read, Roger W.; Arshadi, Sattar; Nikan, Marjan

    2016-01-01

    α-Amylase inhibitors play a critical role in the control of diabetes and many of medicinal plants have been found to act as α-amylase inhibitors. Swertia genus, belonging to the family Gentianaceae, comprises different species most of which have been used in traditional medicine of several cultures as antidiabetic, anti-pyretic, analgesic, liver and gastrointestinal tonic. Swertia longifolia Boiss. is the only species of Swertia growing in Iran. In the present investigation, phytochemical study of S. longifolia was performed and α-amylase inhibitory effects of the plant fractions and purified compounds were determined. Aerial parts of the plant were extracted with hexane, chloroform, methanol and water, respectively. The components of the hexane and chloroform fractions were isolated by different chromatographic methods and their structures were determined by 1H NMR and 13C NMR data. α-Amylase inhibitory activity was determined by a colorimetric assay using 3,5-dinitro salysilic acid. During phytochemical examination, α-amyrin, β-amyrin and β-sitosterol were purified from the hexane fraction, while ursolic acid, daucosterol and swertiamarin were isolated from chloroform fraction. The results of the biochemical assay revealed α-amylase inhibitory activity of hexane, chloroform, methanol and water fractions, of which the chloroform and methanol fractions were more potent (IC50 16.8 and 18.1 mg/ml, respectively). Among examined compounds, daucosterol was found to be the most potent α-amylase inhibitor (57.5% in concentration 10 mg/ml). With regard to α-amylase inhibitory effects of the plant extracts, purified constituents, and antidiabetic application of the species of Swertia genus in traditional medicine of different countries, S. longifolia seems more appropriate species for further mechanistic antidiabetic evaluations. PMID:27051429

  11. Gibberellic acid induces α-amylase expression in adipose-derived stem cells.

    PubMed

    Kasamatsu, Atsushi; Iyoda, Manabu; Usukura, Katsuya; Sakamoto, Yosuke; Ogawara, Katsunori; Shiiba, Masashi; Tanzawa, Hideki; Uzawa, Katsuhiro

    2012-08-01

    Salivary α-amylase is the most important enzyme for oral digestion of dietary starch. Therefore, regeneration of the salivary glands via a tissue engineering approach is clearly required for patients with salivary gland dysfunction. Early during seed germination, the embryo synthesizes gibberellic acid (GA3), a plant hormone that activates the synthesis and secretion of α-amylase. The purpose of this study was to explore an approach for differentiation of stem cells into salivary glands using GA3. We isolated adipose-derived stem cells (ASCs), which are positive for mesenchymal stem cell markers (CD73, CD90 and CD105) and possess pluripotency to osteoblasts, adipocytes and neural cells, from human buccal fat pads, which are a readily available source for dentists and oral surgeons. In addition, we investigated the cytotoxicity of GA3 for human ASCs. GA3 neither affects cell morphology nor cell viability in a dose- or time-dependent manner. ASCs were incubated with GA3 to assess mRNA and protein expression of α-amylase by reverse transcriptase-polymerase chain reaction and western blot analyses. α-amylase mRNA expression on 21 days after treatment with GA3 (1 mM) was seven times greater than that in resting condition (Day 0). While we did not detect α-amylase bands on Day 0, α-amylase protein was detectable 7 days after treatment with GA3, reaching a maximal level on Day 21. Our results indicated that GA3 can increase cellular α-amylase expression and that our induction method would be useful for therapeutic application for salivary gland regeneration.

  12. Purification and characterization of the extracellular. alpha. -amylase from Clostridium acetobutylicum ATCC 824

    SciTech Connect

    Paquet, V.; Croux, C.; Goma, G.; Soucaille, P. )

    1991-01-01

    The extracellular {alpha}-amylase (1,4-{alpha}-D-glucanglucanohydrolase; EC 3.2.1.1) from Clostridium acetobutylicum ATCC 824 was purified to homogeneity by anion-exchange chromatography (Mono Q) and gel filtration (Superose 12). The enzyme had an isoelectric point of 4.7 and a molecular weight of 84,000, as estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. It was a monomeric protein, the 19-amino-acid N terminus of which displayed 42% homology with the Bacillus subtilis saccharifying {alpha}-amylase. The amino acid composition of the enzyme showed a high number of acidic and hydrophobic residues and only one cysteine residue per mole. The activity of the {alpha}-amylase was not stimulated by calcium ions (or other metal ions) or inhibited by EDTA, although the enzyme contained seven calcium atoms per molecule. {alpha}-Amylase activity on soluble starch was optimal at pH 5.6 and 45{degree}C. The {alpha}-amylase was stable at an acidic pH but very sensitive to thermal inactivation. It hydrolyzed soluble starch, with a K{sub m} of 3.6 g {center dot} liter{sup {minus}1} and a K{sub cat} of 122 mol of reducing sugars {center dot} s{sup {minus}1} {center dot} mol{sup {minus}1}. The {alpha}-amylase showed greater activity with high-molecular-weight substrates than with low-molecular-weight maltooligosaccharides, hydrolyzed glycogen and pullulan slowly, but did not hydrolyze dextran or cyclodextrins. The major end products of maltohexaose degradation were glucose, maltose, and maltotriose; maltotetraose and maltopentaose were formed as intermediate products. Twenty seven percent of the glucoamylase activity generally detected in the culture supernatant of C. acetobutylicum can be attributed to the {alpha}-amylase.

  13. Structural elucidation and molecular characterization of Marinobacter sp. α-amylase.

    PubMed

    Kumar, Sumit; Khan, Rizwan Hasan; Khare, S K

    2016-01-01

    Halophiles have been perceived as potential source of novel enzymes in recent years. The interest emanates from their ability to catalyze efficiently under high salt and organic solvents. Marinobacter sp. EMB8 α-amylase was found to be active and stable in salt and organic solvents. A study was carried out using circular dichroism (CD), fluorescence spectroscopy, and bioinformatics analysis of similar protein sequence to ascertain molecular basis of salt and solvent adaptability of α-amylase. Structural changes recorded in the presence of varying amounts of NaCl exhibited an increase in negative ellipticity as a function of salt, confirming that salt stabilizes the protein and increases the secondary structure, making it catalytically functional. The data of intrinsic and extrinsic fluorescence (using 1-anilinonaphthalene 8-sulfonate [ANS] as probe) further confirmed the role of salt. The α-amylase was active in the presence of nonpolar solvents, namely, hexane and decane, but inactivated by ethanol. The decrease in the activity was correlated with the loss of tertiary structure in the presence of ethanol. Guanidine hydrochloride and pH denaturation indicated the molten globule state at pH 4.0. Partial N-terminal amino acid sequence of the purified α-amylase revealed the relatedness to Pseudoalteromonas sp. α-amylase. "FVHLFEW" was found as the N-terminal signature sequence. Bioinformatics analysis was done using M. algicola α-amylase protein having the same N-terminal signature sequence. The three-dimensional structure of Marinobacter α-amylase was deduced using the I-TASSER server, which reflected the enrichment of acidic amino acids on the surface, imparting the stability in the presence of salt. Our study clearly indicate that salt is necessary for maintaining the secondary and tertiary structure of halophilic protein, which is a necessary prerequisite for catalysis.

  14. Crystal structure of a maltogenic amylase provides insights into a catalytic versatility.

    PubMed

    Kim, J S; Cha, S S; Kim, H J; Kim, T J; Ha, N C; Oh, S T; Cho, H S; Cho, M J; Kim, M J; Lee, H S; Kim, J W; Choi, K Y; Park, K H; Oh, B H

    1999-09-10

    Amylases catalyze the hydrolysis of starch material and play central roles in carbohydrate metabolism. Compared with many different amylases that are able to hydrolyze only alpha-D-(1,4)-glycosidic bonds, maltogenic amylases exhibit catalytic versatility: hydrolysis of alpha-D-(1,4)- and alpha-D-(1,6)-glycosidic bonds and transglycosylation of oligosaccharides to C3-, C4-, or C6-hydroxyl groups of various acceptor mono- or disaccharides. It has been speculated that the catalytic property of the enzymes is linked to the additional approximately 130 residues at the N terminus that are absent in other typical alpha-amylases. The crystal structure of a maltogenic amylase from a Thermus strain was determined at 2.8 A. The structure, an analytical centrifugation, and a size exclusion column chromatography proved that the enzyme is a dimer in solution. The N-terminal segment of the enzyme folds into a distinct domain and comprises the enzyme active site together with the central (alpha/beta)(8) barrel of the adjacent subunit. The active site is a narrow and deep cleft suitable for binding cyclodextrins, which are the preferred substrates to other starch materials. At the bottom of the active site cleft, an extra space, absent in the other typical alpha-amylases, is present whose size is comparable with that of a disaccharide. The space is most likely to host an acceptor molecule for the transglycosylation and to allow binding of a branched oligosaccharide for hydrolysis of alpha-D-(1,4)-glycosidic or alpha-D-(1,6)-glycosidic bond. The (alpha/beta)(8) barrel of the enzyme is the preserved scaffold in all the known amylases. The structure represents a novel example of how an enzyme acquires a different substrate profile and a catalytic versatility from a common active site and represents a framework for explaining the catalytic activities of transglycosylation and hydrolysis of alpha-D-(1,6)-glycosidic bond.

  15. Bioassay-guided fractionation and identification of α-amylase inhibitors from Syzygium cumini leaves.

    PubMed

    Poongunran, Jeyakumaran; Perera, Handunge Kumudu Irani; Jayasinghe, Lalith; Fernando, Irushika Thushari; Sivakanesan, Ramaiah; Araya, Hiroshi; Fujimoto, Yoshinori

    2017-12-01

    Pancreatic α-amylase and α-glucosidase inhibitors serve as important strategies in the management of blood glucose. Even though Syzygium cumini (L.) Skeels (Myrtaceae) (SC) is used extensively to treat diabetes; scientific evidence on antidiabetic effects of SC leaves is scarce. SC leaf extract was investigated for α-amylase inhibitory effect and continued with isolation and identification of α-amylase inhibitors. Bioassay-guided fractionation was conducted using in vitro α-amylase inhibitory assay (with 20-1000 μg/mL test material) to isolate the inhibitory compounds from ethyl acetate extract of SC leaves. Structures of the isolated inhibitory compounds were elucidated using (1)H NMR and (13)C NMR spectroscopic analysis and direct TLC and HPLC comparison with authentic samples. Study period was from October 2013 to October 2015. An active fraction obtained with chromatographic separation of the extract inhibited porcine pancreatic α-amylase with an IC50 of 39.9 μg/mL. Furthermore, it showed a strong inhibition on α-glucosidase with an IC50 of 28.2 μg/mL. The active fraction was determined to be a 3:1 mixture of ursolic acid and oleanolic acid. Pure ursolic acid and oleanolic acid showed IC50 values of 6.7 and 57.4 μg/mL, respectively, against α-amylase and 3.1 and 44.1 μg/mL respectively, against α-glucosidase. The present study revealed strong α-amylase and α-glucosidase inhibitory effects of ursolic acid and oleanolic acid isolated from SC leaves for the first time validating the use of SC leaves in antidiabetic therapy.

  16. One-step production of immobilized alpha-amylase in recombinant Escherichia coli.

    PubMed

    Rasiah, Indira A; Rehm, Bernd H A

    2009-04-01

    Industrial enzymes are often immobilized via chemical cross-linking onto solid supports to enhance stability and facilitate repeated use in bioreactors. For starch-degrading enzymes, immobilization usually places constraints on enzymatic conversion due to the limited diffusion of the macromolecular substrate through available supports. This study describes the one-step immobilization of a highly thermostable alpha-amylase (BLA) from Bacillus licheniformis and its functional display on the surface of polyester beads inside engineered Escherichia coli. An optimized BLA variant (Termamyl) was N-terminally fused to the polyester granule-forming enzyme PhaC of Cupriavidus necator. The fusion protein lacking the signal sequence mediated formation of stable polyester beads exhibiting alpha-amylase activity. The alpha-amylase beads were assessed with respect to alpha-amylase activity, which was demonstrated qualitatively and quantitatively. The immobilized alpha-amylase showed Michaelis-Menten enzyme kinetics exerting a V(max) of about 506 mU/mg of bead protein with a K(m) of about 5 microM, consistent with that of free alpha-amylase. The stability of the enzyme at 85 degrees C and the capacity for repeated usage in a starch liquefaction process were also demonstrated. In addition, structural integrity and functionality of the beads at extremes of pH and temperature, demonstrating their suitability for industrial use, were confirmed by electron microscopy and protein/enzyme analysis. This study proposes a novel, cost-effective method for the production of immobilized alpha-amylase in a single step by using the polyester granules forming protein PhaC as a fusion partner in engineered E. coli.

  17. Variation in the Number of Genes Coding for Salivary Amylase in the Bank Vole, CLETHRIONOMYS GLAREOLA

    PubMed Central

    Nielsen, Jørn Tønnes

    1977-01-01

    A Danish population of bank voles is polymorphic for three electrophoretically different salivary amylases, A, H and S, of which A is the most common. Both single-, double- and triple banded phenotypes were observed, and in several crosses two electrophoretic forms cosegregated. In addition to the qualitative variation, some individuals show consistent quantitative variation in the relative activities of their amylase bands. This variation has been qualified by spectrophotometrical measurements of the relative amounts of amylase protein in the various bands.—Seventy wild chromosomes were analyzed by determining the amounts of amylase they produced when heterozygous with a laboratory stock chromosome known to carry two closely linked amylase genes, both coding for a fourth electrophoretic variant, B. The amount of A-protein divided by half the amount of B-protein was used as an estimate of the number of A-genes on the tested chromosomes. The wild chromosomes fell into three clearly distinguishable classes: 9 clustered around a gene number estimate of one, 45 chromosomes yielded estimates around two genes, and the gene number estimate of the remaining 16 was close to three. The integer values of the gene number estimates and the cosegregation of electrophoretically different salivary amylases are consistent with the model that the population is polymorphic for chromosomes with either one, two, or three closely linked amylase genes. It is suggested that such gene number variation may be more common than generally recognized, and some other reported cases of quantitative enzyme variation, for instance that of human red cell acid phosphatase, are interpreted in terms of variation in the number of genes involved. PMID:320091

  18. Comparative genomics and evolution of the amylase-binding proteins of oral streptococci.

    PubMed

    Haase, Elaine M; Kou, Yurong; Sabharwal, Amarpreet; Liao, Yu-Chieh; Lan, Tianying; Lindqvist, Charlotte; Scannapieco, Frank A

    2017-04-20

    Successful commensal bacteria have evolved to maintain colonization in challenging environments. The oral viridans streptococci are pioneer colonizers of dental plaque biofilm. Some of these bacteria have adapted to life in the oral cavity by binding salivary α-amylase, which hydrolyzes dietary starch, thus providing a source of nutrition. Oral streptococcal species bind α-amylase by expressing a variety of amylase-binding proteins (ABPs). Here we determine the genotypic basis of amylase binding where proteins of diverse size and function share a common phenotype. ABPs were detected in culture supernatants of 27 of 59 strains representing 13 oral Streptococcus species screened using the amylase-ligand binding assay. N-terminal sequences from ABPs of diverse size were obtained from 18 strains representing six oral streptococcal species. Genome sequencing and BLAST searches using N-terminal sequences, protein size, and key words identified the gene associated with each ABP. Among the sequenced ABPs, 14 matched amylase-binding protein A (AbpA), 6 matched amylase-binding protein B (AbpB), and 11 unique ABPs were identified as peptidoglycan-binding, glutamine ABC-type transporter, hypothetical, or choline-binding proteins. Alignment and phylogenetic analyses performed to ascertain evolutionary relationships revealed that ABPs cluster into at least six distinct, unrelated families (AbpA, AbpB, and four novel ABPs) with no phylogenetic evidence that one group evolved from another, and no single ancestral gene found within each group. AbpA-like sequences can be divided into five subgroups based on the N-terminal sequences. Comparative genomics focusing on the abpA gene locus provides evidence of horizontal gene transfer. The acquisition of an ABP by oral streptococci provides an interesting example of adaptive evolution.

  19. Salivary amylase and stress during stressful environment: three Mars analog mission crews study.

    PubMed

    Rai, Balwant; Kaur, Jasdeep; Foing, Bernard H

    2012-06-14

    After the establishment of the space age physicians, human factors engineers, neurologist and psychologists and their special attention to work on people's capability to meet up the physical, psychological, neuroscience and interpersonal strains of working in space, it has been regarded as an issue that seeks urgent consideration. Not study was conducted on effect of simulated Mars analog environment on stress and salivary amylase. So, this study aimed to confirm whether salivary amylase is act as stress biomarker in crew members who took part in Mars analog mission in an isolated and stressful environment. The 18 crew members were selected who took part in Mars Analog Research Station, Utah. Salivary amylase was measured using a biosensor of salivary amylase monitor and State-Trait Anxiety Inventory score at pre-extravehicular activity, post-extravehicular activity and on before mission. The state and trait anxiety scores at pre-extravehicular activity for each commander were elevated as compared to after extravehicular activity. There were significant differences in the state and trait anxiety scores between before extravehicular activity and after extravehicular activity of Commander and other members, also there were significant differences in values of before-extravehicular activity between commanders and other members. There were significant differences in values of salivary amylase at before extravehicular activity and after extravehicular activity between commander group and other members. There was significant correlation between salivary amylase and state and trait anxiety scores in all groups. Measuring salivary amylase level could be useful for stress assessment of crew members and population working in a stressful and isolated environment. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  20. Correlation between salivary alpha-amylase and stress-related anxiety.

    PubMed

    Rashkova, Maya R; Ribagin, Lora S; Toneva, Nina G

    2012-01-01

    Salivary alpha-amylase is a useful biomarker that can be used in assessing human psychobiological and social behavioural processes. Studying it opens up possibilities for the creation of novel concepts concerning the interaction of biological and social processes and their impact on health and behaviour. The levels of salivary alpha-amylase and situation anxiety self-assessment using Spielberger test were measured twice in 30 individuals aged 21.37 +/- 0.96 yrs (18 females and 12 males): once during stressful situation (prior to examination) and, again a month later, in stress-free environment (during a training session). Salivary alpha-amylase was measured using kinetic reaction kit Salimetrics LLC--USA. The mean level of salivary alpha-amylase measured during the first measurement 156.0 +/- 93.33 U/ml. During the second measurement in the absence of intense stress, the levels were two times lower - 74.03 +/- 58.06 U/ml and the differences were statistically significant (P < 0.001). We found a statistically significant correlation between the levels of salivary alpha-amylase in both measurements (P < 0.01). The correlation coefficient was r = 0.472 (P < 0.01). The adapted version of the State-Trait Anxiety Inventory score (STAI) created by Spielberger is appropriate for assessment of stress-related anxiety in young individuals. Salivary alpha-amylase may be used as a biomarker for objective evaluation of the psychosomatic state of individuals in a stressful environment. The combination of psychological test and objective indicator such as salivary alpha-amylase is an excellent tool for objective evaluation of individual's state in stressful environment. Similar tests may be used in assessment of patients' behaviours at dental treatment that may be considered a stressor in most patients.

  1. Dynamics of the Streptococcus gordonii Transcriptome in Response to Medium, Salivary α-Amylase, and Starch

    PubMed Central

    Haase, Elaine M.; Feng, Xianghui; Pan, Jiachuan; Miecznikowski, Jeffrey C.

    2015-01-01

    Streptococcus gordonii, a primary colonizer of the tooth surface, interacts with salivary α-amylase via amylase-binding protein A (AbpA). This enzyme hydrolyzes starch to glucose, maltose, and maltodextrins that can be utilized by various oral bacteria for nutrition. Microarray studies demonstrated that AbpA modulates gene expression in response to amylase, suggesting that the amylase-streptococcal interaction may function in ways other than nutrition. The goal of this study was to explore the role of AbpA in gene regulation through comparative transcriptional profiling of wild-type KS1 and AbpA− mutant KS1ΩabpA under various environmental conditions. A portion of the total RNA isolated from mid-log-phase cells grown in 5% CO2 in (i) complex medium with or without amylase, (ii) defined medium (DM) containing 0.8% glucose with/without amylase, and (iii) DM containing 0.2% glucose and amylase with or without starch was reverse transcribed to cDNA and the rest used for RNA sequencing. Changes in the expression of selected genes were validated by quantitative reverse transcription-PCR. Maltodextrin-associated genes, fatty acid synthesis genes and competence genes were differentially expressed in a medium-dependent manner. Genes in another cluster containing a putative histidine kinase/response regulator, peptide methionine sulfoxide reductase, thioredoxin protein, lipoprotein, and cytochrome c-type protein were downregulated in KS1ΩabpA under all of the environmental conditions tested. Thus, AbpA appears to modulate genes associated with maltodextrin utilization/transport and fatty acid synthesis. Importantly, in all growth conditions AbpA was associated with increased expression of a potential two-component signaling system associated with genes involved in reducing oxidative stress, suggesting a role in signal transduction and stress tolerance. PMID:26025889

  2. Phage display selects for amylases with improved low pH starch-binding.

    PubMed

    Verhaert, Raymond M D; Beekwilder, Jules; Olsthoorn, René; van Duin, Jan; Quax, Wim J

    2002-06-13

    Directed evolution of secreted industrial enzymes is hampered by the lack of powerful selection techniques. We have explored surface display to select for enzyme variants with improved binding performance on complex polymeric substrates. By a combination of saturation mutagenesis and phage display we selected alpha-amylase variants, which have the ability to bind starch substrate at industrially preferred low pH conditions. First we displayed active alpha-amylase on the surface of phage fd. Secondly we developed a selection system that is based on the ability of alpha-amylase displaying phages to bind to cross-linked starch. This system was used to probe the involvement of specific beta-strands in substrate interaction. Finally, a saturated library of alpha-amylase mutants with one or more amino acid residues changed in their Cbeta4 starch-binding domain was subjected to phage display selection. Mutant molecules with good starch-binding and hydrolytic capacity could be isolated from the phage library by repeated binding and elution of phage particles at lowered pH value. Apart from the wild type alpha-amylase a specific subset of variants, with only changes in three out of the seven possible positions, was selected. All selected variants could hydrolyse starch and heptamaltose at low pH. Interestingly, variants were found with a starch hydrolysis ratio at pH 4.5/7.5 that is improved relative to the wild type alpha-amylase. These data demonstrate that useful alpha-amylase mutants can be selected via surface display on the basis of their binding properties to starch at lowered pH values.

  3. Interactions between α-amylase and an acidic branched polysaccharide from green tea.

    PubMed

    Wu, Shuyun; Lai, Minghua; Luo, Jiahao; Pan, Jingwen; Zhang, Li-Ming; Yang, Liqun

    2017-01-01

    To understand the mechanism responsible for the α-amylase inhibitory activity of tea polysaccharides, the interaction between α-amylase and an acidic branched tea polysaccharide (TPSA) was investigated using fluorescence spectroscopy and resonance light scattering analysis. TPSA, exhibiting inhibitory activity towards α-amylase (the maximum inhibition percentage of 65%), was isolated from green tea (Camellia sinensis) and characterized by nuclear magnetic resonance spectroscopy, Fourier transform infrared spectroscopy, ultraviolet-visible spectroscopy, and gas chromatography. Synchronous fluorescence spectroscopy revealed that the binding interaction between the tryptophan residues of α-amylase and TPSA was predominant. Based on the fluorescence quenching effect of tryptophan residues induced by TPSA, the binding constants between α-amylase and TPSA were determined to be 18.6×10(6), 8.0×10(6) and 4.6×10(6) L·mol(-1) at 20, 30 and 37°C, respectively. The calculated Gibbs free-energy changes were negative, indicating that the bonding interaction was a spontaneous process. The enthalpy and the entropy changes were -62.13 KJ·mol(-1) and -0.0728 KJ·mol(-1)·K(-1), suggesting that hydrogen bonding interactions might play a major role in the binding process. The formation of an α-amylase/TPSA complex was evidenced by fluorescence quenching and resonance light scattering analysis, and this complex could be the main contributor to the α-amylase inhibitory activity of TPSA. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Postoperative drain amylase predicts pancreatic fistula in pancreatic surgery: A systematic review and meta-analysis.

    PubMed

    Yang, Ji; Huang, Qiang; Wang, Chao

    2015-10-01

    This study to evaluate the utility of drain fluid amylase as a predictor of PF in patients undergoing pancreatic surgery based on the International Study Group of Pancreatic Fistula definitions of pancreatic fistula. A comprehensive search was carried out using Pubmed (Medline), Embase, Web of science and Cochrane database for clinical trials, which studied DFA as a diagnostic marker for pancreatic fistula after pancreatic surgery. Sensitivity, specificity and the diagnostic odds ratios with 95% confidence interval were calculated for each study. Summary receiver-operating curves were conducted and the area under the curve was evaluated. A total of 10 studies were included. The pooled sensitivity and specificity of drain fluid amylase Day 1 for the diagnosis of postoperative pancreatic fistula were 81% and 87%, respectively (area under the curve was 0.897, diagnostic odds ratios was 16.83 and 95%CI was 12.66-22.36), the pooled sensitivity and specificity of drain fluid amylase Day 3 for the diagnosis of postoperative pancreatic fistula were 56% and 79%, respectively (area under the curve was 0.668, diagnostic odds ratios was 3.26 and 95%CI was 1.83-5.82) CONCLUSIONS: The drain fluid amylase Day 1, instead of drain fluid amylase Day 3, may be a useful criterion for the early identification of postoperative pancreatic fistula, and a value of drain fluid amylase Day 1 over than 1300 U/L was a risk factor of pancreatic fistula. And the diagnostic accuracy and the proposed cut-off levels of drain fluid amylase Day 1 in predicting the postoperative pancreatic fistula will have to be validated by multicenter prospective studies. Copyright © 2015. Published by Elsevier Ltd.

  5. Serum amylase on the night of surgery predicts clinically significant pancreatic fistula after pancreaticoduodenectomy.

    PubMed

    Palani Velu, Lavanniya K; Chandrabalan, Vishnu V; Jabbar, Salman; McMillan, Donald C; McKay, Colin J; Carter, C Ross; Jamieson, Nigel B; Dickson, Euan J

    2014-07-01

    Drainage after pancreaticoduodenectomy (PD) remains controversial because the risk for uncontrolled postoperative pancreatic fistula (POPF) must be balanced against the potential morbidity associated with prolonged and possibly unnecessary drainage. This study investigated the utility of the level of serum amylase on the night of surgery [postoperative day (PoD) 0 serum amylase] to predict POPF. A total of 185 patients who underwent PD were studied. Occurrences of POPF were graded using the International Study Group on Pancreatic Fistula (ISGPF) classification. Receiver operating characteristic (ROC) analysis identified a threshold value of PoD 0 serum amylase associated with clinically significant POPF (ISGPF Grades B and C) in a test cohort (n = 45). The accuracy of this threshold value was then tested in a validation cohort (n = 140). Overall, 43 (23.2%) patients developed clinically significant POPF. The threshold value of PoD 0 serum amylase for the identification of clinically significant POPF was ≥ 130 IU/l (P = 0.003). Serum amylase of <130 IU/l had a negative predictive value of 88.8% for clinically significant POPF (P < 0.001). Serum amylase of ≥ 130 IU/l on PoD 0 and a soft pancreatic parenchyma were independent risk factors for clinically significant POPF. Postoperative day 0 serum amylase of <130 IU/l allows for the early and accurate categorization of patients at least risk for clinically significant POPF and may identify patients suitable for early drain removal. © 2013 International Hepato-Pancreato-Biliary Association.

  6. Crystal structure of yellow meal worm alpha-amylase at 1.64 A resolution.

    PubMed

    Strobl, S; Maskos, K; Betz, M; Wiegand, G; Huber, R; Gomis-Rüth, F X; Glockshuber, R

    1998-05-08

    The three-dimensional structure of the alpha-amylase from Tenebrio molitor larvae (TMA) has been determined by molecular replacement techniques using diffraction data of a crystal of space group P212121 (a=51.24 A; b=93.46 A; c=96.95 A). The structure has been refined to a crystallographic R-factor of 17.7% for 58,219 independent reflections in the 7.0 to 1.64 A resolution range, with root-mean-square deviations of 0.008 A for bond lengths and 1.482 degrees for bond angles. The final model comprises all 471 residues of TMA, 261 water molecules, one calcium cation and one chloride anion. The electron density confirms that the N-terminal glutamine residue has undergone a post-transitional modification resulting in a stable 5-oxo-proline residue. The X-ray structure of TMA provides the first three-dimensional model of an insect alpha-amylase. The monomeric enzyme exhibits an elongated shape approximately 75 Ax46 Ax40 A and consists of three distinct domains, in line with models for alpha-amylases from microbial, plant and mammalian origin. However, the structure of TMA reflects in the substrate and inhibitor binding region a remarkable difference from mammalian alpha-amylases: the lack of a highly flexible, glycine-rich loop, which has been proposed to be involved in a "trap-release" mechanism of substrate hydrolysis by mammalian alpha-amylases. The structural differences between alpha-amylases of various origins might explain the specificity of inhibitors directed exclusively against insect alpha-amylases.

  7. Structure, specificity and function of cyclomaltodextrinase, a multispecific enzyme of the alpha-amylase family.

    PubMed

    Park, K H; Kim, T J; Cheong, T K; Kim, J W; Oh, B H; Svensson, B

    2000-05-23

    Cyclomaltodextrinase (CDase, EC 3.2.1.54), maltogenic amylase (EC 3. 2.1.133), and neopullulanase (EC 3.2.1.135) are reported to be capable of hydrolyzing all or two of the following three types of substrates: cyclomaltodextrins (CDs); pullulan; and starch. These enzymes hydrolyze CDs and starch to maltose and pullulan to panose by cleavage of alpha-1,4 glycosidic bonds whereas alpha-amylases essentially lack activity on CDs and pullulan. They also catalyze transglycosylation of oligosaccharides to the C3-, C4- or C6-hydroxyl groups of various acceptor sugar molecules. The present review surveys the biochemical, enzymatic, and structural properties of three types of such enzymes as defined based on the substrate specificity toward the CDs: type I, cyclomaltodextrinase and maltogenic amylase that hydrolyze CDs much faster than pullulan and starch; type II, Thermoactinomyces vulgaris amylase II (TVA II) that hydrolyzes CDs much less efficiently than pullulan; and type III, neopullulanase that hydrolyzes pullulan efficiently, but remains to be reported to hydrolyze CDs. These three types of enzymes exhibit 40-60% amino acid sequence identity. They occur in the cytoplasm of bacteria and have molecular masses from 62 to 90 kDa which are slightly larger than those of most alpha-amylases. Multiple amino acid sequence alignment and crystal structures of maltogenic amylase and TVA II reveal the presence of an N-terminal extension of approximately 130 residues not found in alpha-amylases. This unique N-terminal domain as seen in the crystal structures apparently contributes to the active site structure leading to the distinct substrate specificity through a dimer formation. In aqueous solution, most of these enzymes show a monomer-dimer equilibrium. The present review discusses the multiple specificity in the light of the oligomerization and the molecular structures arriving at a clarified enzyme classification. Finally, a physiological role of the enzymes is proposed.

  8. Wheat amylase trypsin inhibitors as nutritional activators of innate immunity.

    PubMed

    Schuppan, Detlef; Zevallos, Victor

    2015-01-01

    While the central role of an adaptive, T cell-mediated immune response to certain gluten peptides in celiac disease is well established, the innate immune response to wheat proteins remains less well defined. We identified wheat amylase trypsin inhibitors (ATIs), but not gluten, as major stimulators of innate immune cells (dendritic cells>macrophages>monocytes), while intestinal epithelial cells were nonresponsive. ATIs bind to and activate the CD14-MD2 toll-like receptor 4 (TLR4) complex. This activation occurs both in vitro and in vivo after oral ingestion of purified ATIs or gluten, which is usually enriched in ATIs. Wheat ATIs represent a family of up to 17 proteins with molecular weights of around 15 kDa and a variable primary but conserved secondary structure characterized by 5 intrachain disulfide bonds and alpha helices. They mostly form di- and tetramers that appear to equally activate TLR4. Relevant biological activity is confined to ATIs in gluten-containing cereals, while gluten-free cereals display no or minimal activities. ATIs represent up to 4% of total wheat protein and are highly resistant to intestinal proteases. In line with their dose-dependent function as co-stimulatory molecules in adaptive immunity of celiac disease, they appear to play a role in promoting other immune-mediated diseases within and outside the GI tract. Thus, ATIs may be prime candidates of severe forms of non-celiac gluten (wheat) sensitivity. © 2015 S. Karger AG, Basel.

  9. Inhibitory effects of tannin on human salivary alpha-amylase.

    PubMed

    Kandra, Lili; Gyémánt, Gyöngyi; Zajácz, Agnes; Batta, Gyula

    2004-07-09

    Here, we first report on the effectiveness and specificity of tannin inhibition of 2-chloro-4-nitrophenyl-4-O-beta-d-galactopyranosylmaltoside hydrolysis that is catalyzed by human salivary alpha-amylase (HSA). Tannin was gallotannin in which quinic acid was esterified with 2-7 units of gallic acid. A number of studies establish that polyphenols-like tannins-may prevent oral diseases, e.g., dental caries. Kinetic analyses confirmed that the inhibition of hydrolysis is a mixed non-competitive type and only one molecule of tannin binds to the active site or the secondary site of the enzyme. Since Dixon plots were linear, product formation could be excluded from the enzyme-substrate-inhibitor complex (ESI). Kinetic constants calculated from secondary plots and non-linear regression are almost identical, thereby confirming the suggested model. Kinetic constants (K(EI) = 9.03 microgmL(-1), K(ESI) = 47.84 microgmL(-1)) show that tannin is as an effective inhibitor of HSA as acarbose and indicate a higher stability for the enzyme-inhibitor complex than ESI.

  10. Increasing levels of saliva alpha amylase in electrohypersensitive (EHS) patients.

    PubMed

    Andrianome, Soafara; Hugueville, Laurent; de Seze, René; Selmaoui, Brahim

    2017-08-01

    To assess the level of various salivary and urinary markers of patients with electromagnetic hypersensitivity (EHS) and to compare them with those of a healthy control group. We analyzed samples from 30 EHS individuals and a matched control group of 25 individuals (non-EHS) aged between 22 and 66. We quantified cortisol both in saliva and urine, alpha amylase (sAA), immunoglobulin A and C Reactive Protein levels in saliva and neopterin in urine (uNeopterin). sAA was found to be significantly higher (p < 0.005) in the EHS group. uNeopterin and sAA analysis showed a significant difference based on the duration of EHS. Higher levels of sAA in EHS participants may suggest that the sympathetic adrenal medullar system is activated. However, most of the analyzed markers of the immune system, sympathetic activity and circadian rhythm did not vary significantly in the EHS group. There is a trend to the higher levels of some variables in subgroups according to the EHS duration.

  11. Salivary cortisol, salivary alpha amylase, and the dental anxiety scale.

    PubMed

    Sadi, Hana; Finkelman, Matthew; Rosenberg, Morton

    2013-01-01

    The aim of this study was to investigate the correlation between dental anxiety, salivary cortisol, and salivary alpha amylase (sAA) levels. Furthermore, the aim was to look into individual differences such as age, race, gender, any existing pain, or traumatic dental experience and their effect on dental anxiety. This study followed a cross-sectional design and included a convenience sample of 46. Every patient was asked to complete the Dental Anxiety Scale (DAS) and a basic demographic/dental history questionnaire. A saliva sample, utilizing the method of passive drooling, was then collected in 2-mL cryovials. Samples were analyzed for salivary cortisol and sAA levels by Salimetrics. Significant associations were observed between DAS scores and presence of pain and history of traumatic dental experience. However, no significant correlations were observed between DAS, cortisol, and sAA levels. Our study reconfirms that dental anxiety is associated with presence of pain and a history of traumatic dental experience. On the other hand, our study was the first to our knowledge to test the correlation between the DAS and sAA; nevertheless, our results failed to show any significant correlation between dental anxiety, cortisol, and sAA levels.

  12. Genetic control of α-Amylase production in wheat.

    PubMed

    Gale, M D; Law, C N; Chojecki, A J; Kempton, R A

    1983-03-01

    An analysis of the α-amylase isozymes in GA-treated endosperm of wheat nullisomic-tetrasomics shows that there is more variation at the α-Amy-1 and α-Amy-2 homoeoallelic loci than was previously thought. Among the 16 isozymes produced by genes on the group 7 chromosomes, most could be definitely established as products of a single homoeoallele.Inter-varietal allelic differences would be expected at such loci and clear variation was found in isozymes produced by chromosomes 6B and 7B. The latter allele, α-Amy-B2b carried by the variety 'Hope', was used to locate the enzyme structural gene within chromosome 7B relative to the centromere and five other gene markers.The nature of the α-Amy-B2b phenotype and the rare non-parental isozyme patterns found among the recombinant lines indicates that the locus is large and compound, probably involving some degree of intra-locus gene duplication.

  13. Interparental Aggression and Parent-Adolescent Salivary Alpha Amylase Symmetry

    PubMed Central

    Gordis, Elana B.; Margolin, Gayla; Spies, Lauren; Susman, Elizabeth J.; Granger, Douglas A.

    2010-01-01

    The present study examined salivary alpha-amylase (sAA), a putative marker of adrenergic activity, in family members engaging in family conflict discussions. We examined symmetry among family members' sAA levels at baseline and in response to a conflict discussion. The relation between a history of interparental aggression on parent-adolescent sAA symmetry also was examined. Participants were 62 families with a mother, father, and biological child age 13-18 (n = 29 girls). After engaging in a relaxation procedure, families participated in a 15-minute triadic family conflict discussion. Participants provided saliva samples at post-relaxation/pre-discussion, immediately post-discussion, and at 10 and 20 min post-discussion. Participants also reported on interparental physical aggression during the previous year. Across the sample we found evidence of symmetry between mothers' and adolescents' sAA levels at baseline and around the discussion. Interparental aggression was associated with lower sAA levels among fathers. Interparental aggression also affected patterns of parent-child sAA response symmetry such that families reporting interparental aggression exhibited greater father-adolescent sAA symmetry than did those with no reports of interparental aggression. Among families with no interparental aggression history, we found consistent mother-adolescent symmetry. These differences suggest different patterns of parent-adolescent physiological attunement among families with interparental aggression. PMID:20096715

  14. Immobilization of diastase α-amylase on nano zinc oxide.

    PubMed

    Antony, Navya; Balachandran, S; Mohanan, P V

    2016-11-15

    Diastase α-amylase extracted from malt, catalyses break down of starch into maltose. It is commonly used in food and fermentation industry. In the present study nano zinc oxide is used as support for this starch hydrolyzing enzyme. IR study revealed that the enzyme got adsorbed via electrostatic interaction with the functional groups on the support. The immobilized enzyme possessed a better heat-resistance than free enzyme. The kinetic parameters were determined using Lineweaver-Burk plot. The immobilized enzyme showed higher Km 2.08mg/ml than the free enzyme whose Km is 0.45±.05mg/ml. The Vmax of immobilized enzyme was about 2.92±.02mg/ml/min and that of free enzyme was 7.14±.02mg/ml/min, showing decrease in activity after immobilization. The immobilized enzyme showed 70% activity after 30days of storage while free enzyme lost its activity within 7days. About 80% of enzyme retained activity after 4 cycles of reuse.

  15. Obesity, starch digestion and amylase: association between copy number variants at human salivary (AMY1) and pancreatic (AMY2) amylase genes.

    PubMed

    Carpenter, Danielle; Dhar, Sugandha; Mitchell, Laura M; Fu, Beiyuan; Tyson, Jess; Shwan, Nzar A A; Yang, Fengtang; Thomas, Mark G; Armour, John A L

    2015-06-15

    The human salivary amylase genes display extensive copy number variation (CNV), and recent work has implicated this variation in adaptation to starch-rich diets, and in association with body mass index. In this work, we use paralogue ratio tests, microsatellite analysis, read depth and fibre-FISH to demonstrate that human amylase CNV is not a smooth continuum, but is instead partitioned into distinct haplotype classes. There is a fundamental structural distinction between haplotypes containing odd or even numbers of AMY1 gene units, in turn coupled to CNV in pancreatic amylase genes AMY2A and AMY2B. Most haplotypes have one copy each of AMY2A and AMY2B and contain an odd number of copies of AMY1; consequently, most individuals have an even total number of AMY1. In contrast, haplotypes carrying an even number of AMY1 genes have rearrangements leading to CNVs of AMY2A/AMY2B. Read-depth and experimental data show that different populations harbour different proportions of these basic haplotype classes. In Europeans, the copy numbers of AMY1 and AMY2A are correlated, so that phenotypic associations caused by variation in pancreatic amylase copy number could be detected indirectly as weak association with AMY1 copy number. We show that the quantitative polymerase chain reaction (qPCR) assay previously applied to the high-throughput measurement of AMY1 copy number is less accurate than the measures we use and that qPCR data in other studies have been further compromised by systematic miscalibration. Our results uncover new patterns in human amylase variation and imply a potential role for AMY2 CNV in functional associations.

  16. Obesity, starch digestion and amylase: association between copy number variants at human salivary (AMY1) and pancreatic (AMY2) amylase genes

    PubMed Central

    Carpenter, Danielle; Dhar, Sugandha; Mitchell, Laura M.; Fu, Beiyuan; Tyson, Jess; Shwan, Nzar A.A.; Yang, Fengtang; Thomas, Mark G.; Armour, John A.L.

    2015-01-01

    The human salivary amylase genes display extensive copy number variation (CNV), and recent work has implicated this variation in adaptation to starch-rich diets, and in association with body mass index. In this work, we use paralogue ratio tests, microsatellite analysis, read depth and fibre-FISH to demonstrate that human amylase CNV is not a smooth continuum, but is instead partitioned into distinct haplotype classes. There is a fundamental structural distinction between haplotypes containing odd or even numbers of AMY1 gene units, in turn coupled to CNV in pancreatic amylase genes AMY2A and AMY2B. Most haplotypes have one copy each of AMY2A and AMY2B and contain an odd number of copies of AMY1; consequently, most individuals have an even total number of AMY1. In contrast, haplotypes carrying an even number of AMY1 genes have rearrangements leading to CNVs of AMY2A/AMY2B. Read-depth and experimental data show that different populations harbour different proportions of these basic haplotype classes. In Europeans, the copy numbers of AMY1 and AMY2A are correlated, so that phenotypic associations caused by variation in pancreatic amylase copy number could be detected indirectly as weak association with AMY1 copy number. We show that the quantitative polymerase chain reaction (qPCR) assay previously applied to the high-throughput measurement of AMY1 copy number is less accurate than the measures we use and that qPCR data in other studies have been further compromised by systematic miscalibration. Our results uncover new patterns in human amylase variation and imply a potential role for AMY2 CNV in functional associations. PMID:25788522

  17. Individual differences in AMY1 gene copy number, salivary α-amylase levels, and the perception of oral starch.

    PubMed

    Mandel, Abigail L; Peyrot des Gachons, Catherine; Plank, Kimberly L; Alarcon, Suzanne; Breslin, Paul A S

    2010-10-13

    The digestion of dietary starch in humans is initiated by salivary α-amylase, an endo-enzyme that hydrolyzes starch into maltose, maltotriose and larger oligosaccharides. Salivary amylase accounts for 40 to 50% of protein in human saliva and rapidly alters the physical properties of starch. Importantly, the quantity and enzymatic activity of salivary amylase show significant individual variation. However, linking variation in salivary amylase levels with the oral perception of starch has proven difficult. Furthermore, the relationship between copy number variations (CNVs) in the AMY1 gene, which influence salivary amylase levels, and starch viscosity perception has not been explored. Here we demonstrate that saliva containing high levels of amylase has sufficient activity to rapidly hydrolyze a viscous starch solution in vitro. Furthermore, we show with time-intensity ratings, which track the digestion of starch during oral manipulation, that individuals with high amylase levels report faster and more significant decreases in perceived starch viscosity than people with low salivary amylase levels. Finally, we demonstrate that AMY1 CNVs predict an individual's amount and activity of salivary amylase and thereby, ultimately determine their perceived rate of oral starch viscosity thinning. By linking genetic variation and its consequent salivary enzymatic differences to the perceptual sequellae of these variations, we show that AMY1 copy number relates to salivary amylase concentration and enzymatic activity level, which, in turn, account for individual variation in the oral perception of starch viscosity. The profound individual differences in salivary amylase levels and salivary activity may contribute significantly to individual differences in dietary starch intake and, consequently, to overall nutritional status.

  18. Individual Differences in AMY1 Gene Copy Number, Salivary α-Amylase Levels, and the Perception of Oral Starch

    PubMed Central

    Mandel, Abigail L.; Peyrot des Gachons, Catherine; Plank, Kimberly L.; Alarcon, Suzanne; Breslin, Paul A. S.

    2010-01-01

    Background The digestion of dietary starch in humans is initiated by salivary α-amylase, an endo-enzyme that hydrolyzes starch into maltose, maltotriose and larger oligosaccharides. Salivary amylase accounts for 40 to 50% of protein in human saliva and rapidly alters the physical properties of starch. Importantly, the quantity and enzymatic activity of salivary amylase show significant individual variation. However, linking variation in salivary amylase levels with the oral perception of starch has proven difficult. Furthermore, the relationship between copy number variations (CNVs) in the AMY1 gene, which influence salivary amylase levels, and starch viscosity perception has not been explored. Principal Findings Here we demonstrate that saliva containing high levels of amylase has sufficient activity to rapidly hydrolyze a viscous starch solution in vitro. Furthermore, we show with time-intensity ratings, which track the digestion of starch during oral manipulation, that individuals with high amylase levels report faster and more significant decreases in perceived starch viscosity than people with low salivary amylase levels. Finally, we demonstrate that AMY1 CNVs predict an individual's amount and activity of salivary amylase and thereby, ultimately determine their perceived rate of oral starch viscosity thinning. Conclusions By linking genetic variation and its consequent salivary enzymatic differences to the perceptual sequellae of these variations, we show that AMY1 copy number relates to salivary amylase concentration and enzymatic activity level, which, in turn, account for individual variation in the oral perception of starch viscosity. The profound individual differences in salivary amylase levels and salivary activity may contribute significantly to individual differences in dietary starch intake and, consequently, to overall nutritional status. PMID:20967220

  19. Screening and characterization of amylase and cellulase activities in psychrotolerant yeasts.

    PubMed

    Carrasco, Mario; Villarreal, Pablo; Barahona, Salvador; Alcaíno, Jennifer; Cifuentes, Víctor; Baeza, Marcelo

    2016-02-19

    Amylases and cellulases have great potential for application in industries such as food, detergent, laundry, textile, baking and biofuels. A common requirement in these fields is to reduce the temperatures of the processes, leading to a continuous search for microorganisms that secrete cold-active amylases and cellulases. Psychrotolerant yeasts are good candidates because they inhabit cold-environments. In this work, we analyzed the ability of yeasts isolated from the Antarctic region to grow on starch or carboxymethylcellulose, and their potential extracellular amylases and cellulases. All tested yeasts were able to grow with soluble starch or carboxymethylcellulose as the sole carbon source; however, not all of them produced ethanol by fermentation of these carbon sources. For the majority of the yeast species, the extracellular amylase or cellulase activity was higher when cultured in medium supplemented with glucose rather than with soluble starch or carboxymethylcellulose. Additionally, higher amylase activities were observed when tested at pH 5.4 and 6.2, and at 30-37 °C, except for Rhodotorula glacialis that showed elevated activity at 10-22 °C. In general, cellulase activity was high until pH 6.2 and between 22-37 °C, while the sample from Mrakia blollopis showed high activity at 4-22 °C. Peptide mass fingerprinting analysis of a potential amylase from Tetracladium sp. of about 70 kDa, showed several peptides with positive matches with glucoamylases from other fungi. Almost all yeast species showed extracellular amylase or cellulase activity, and an inducing effect by the respective substrate was observed in a minor number of yeasts. These enzymatic activities were higher at 30 °C in most yeast, with highest amylase and cellulase activity in Tetracladium sp. and M. gelida, respectively. However, Rh. glacialis and M. blollopis displayed high amylase or cellulase activity, respectively, under 22 °C. In this sense, these yeasts are interesting

  20. Salivary cortisol and α-amylase: subclinical indicators of stress as cardiometabolic risk

    PubMed Central

    Cozma, S.; Dima-Cozma, L.C.; Ghiciuc, C.M.; Pasquali, V.; Saponaro, A.; Patacchioli, F.R.

    2017-01-01

    Currently, the potential for cardiovascular (CV) stress-induced risk is primarily based on the theoretical (obvious) side effects of stress on the CV system. Salivary cortisol and α-amylase, produced respectively by the hypothalamus-pituitary-adrenal (HPA) axis and the sympathetic-adrenomedullary (SAM) system during stress response, are still not included in the routine evaluation of CV risk and require additional and definitive validation. Therefore, this article overviews studies published between 2010 and 2015, in which salivary cortisol and α-amylase were measured as stress biomarkers to examine their associations with CV/CMR (cardiometabolic risk) clinical and subclinical indicators. A comprehensive search of PubMed, Web of Science and Scopus electronic databases was performed, and 54 key articles related to the use of salivary cortisol and α-amylase as subclinical indicators of stress and CV/CMR factors, including studies that emphasized methodological biases that could influence the accuracy of study outcomes, were ultimately identified. Overall, the biological impact of stress measured by salivary cortisol and α-amylase was associated with CV/CMR factors. Results supported the use of salivary cortisol and α-amylase as potential diagnostic tools for detecting stress-induced cardiac diseases and especially to describe the mechanisms by which stress potentially contributes to the pathogenesis and outcomes of CV diseases. PMID:28177057

  1. Inhibition of α-amylase activity by cellulose: Kinetic analysis and nutritional implications.

    PubMed

    Dhital, Sushil; Gidley, Michael J; Warren, Frederick J

    2015-06-05

    We report on inhibition of α-amylase activity by cellulose based on in vitro experiments. The presence of cellulose in the hydrolysing medium reduced the initial velocity of starch hydrolysis in a concentration dependent manner. α-Amylase adsorption to cellulose was reversible, attaining equilibrium within 30min of incubation, and showed a higher affinity at 37°C compared to 20 and 0°C. The adsorption was almost unchanged in the presence of maltose (2.5-20mM) but was hindered in the presence of excess protein, suggesting non-specific adsorption of α-amylase to cellulose. Kinetic analyses of α-amylase hydrolysis of maize starch in the presence of cellulose showed that the inhibition is of a mixed type. The dissociation constant (Kic) of the EI complex was found to be ca. 3mg/mL. The observed inhibition of α-amylase activity suggests that cellulose in the diet can potentially attenuate starch hydrolysis.

  2. Purification and characterization of thermostable α-amylase from thermophilic Anoxybacillus flavithermus.

    PubMed

    Agüloğlu Fincan, S; Enez, B; Özdemir, S; Matpan Bekler, F

    2014-02-15

    This study reports on the purification and characterization of thermostable α-amylase (α-1-4 D-glucan glucanohydrolase EC 3.2.1.1) from a newly isolated Anoxybacillus flavithermus. A. flavithermus was used, which was isolated from hot water springs of Ömer, Afyonkarahisar, Turkey. The gram-positive, spore-forming, motile, moderately thermophilic bacteria were found to be a strain of A. flavithermus analysed by 16S rRNA comparison. The optimal conditions for bacterial growth were determined to be at 20 thh, 55 °C and pH 6.0. Maximum α-amylase activity was obtained at 55 °C at pH 7.0 after 24h of incubation. Thermostable α-amylase from A. flavithermus was purified by 70% (NH4)2SO4 and ion-exchange chromatography (5.2-fold; 65.8% yield). The molecular weight of α-amylase was 60 kDa, as estimated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). The α-amylase hydrolyzed soluble starch at 55 °C with Km: 0.005 mM and Vmax: 3.5 μmol min(-1).

  3. HPLC method for measurement of human salivary α-amylase inhibition by aqueous plant extracts.

    PubMed

    Takács, István; Takács, Ákos; Pósa, Anikó; Gyémánt, Gyöngyi

    2017-06-01

    Control of hyperglycemia is an important treatment in metabolic disorders such as type II diabetes and obesity. α-Amylase, as the first enzyme of glucose release from dietary polysaccharides, is a potential target to identify new sources of novel anti-obesity and anti-diabetic drugs. In this work, different herbal extracts as α-amylase inhibitors were studied by measuring the rate of the cleavage of a maltooligomer substrate 2-chloro-4-nitrophenyl-β-D-maltoheptoside. Measurement of chromophore containing products after reversed phase HPLC separation was used for α-amylase activity measurement. Rates of hydrolysis catalysed by human salivary α-amylase were determined in the presence and absence of lyophilised water extracts of eleven herbs. Remarkable bioactivities were found for extracts of Cinnamomum zeylanicum Blume (bark), Camellia sinensis L. (leaf), Ribes nigrum L. (leaf), Laurus nobilis L. (leaf), Vaccinium macrocarpon Aiton (fruit) and Syzygium aromaticum L. (bud). Determined IC50 values were in 0.017-41 μg/ml range for these six selected plant extracts. Our results confirm the applicability of this HPLC-based method for the quick and reliable comparison of plants as α-amylase inhibitors.

  4. Macromolecular cross-linked enzyme aggregates (M-CLEAs) of α-amylase.

    PubMed

    Nadar, Shamraja S; Muley, Abhijeet B; Ladole, Mayur R; Joshi, Pranoti U

    2016-03-01

    Macromolecular cross-linked enzyme aggregates (M-CLEAs) of α-amylase were prepared by precipitation and subsequent cross-linking. The non-toxic, biodegradable, biocompatible, renewable polysaccharide based macromolecular cross-linkers viz. agar, chitosan, dextran, and gum arabic were used as a substitute for traditional glutaraldehyde to augment activity recovery toward macromolecular substrate. Macromolecular cross-linkers were prepared by periodate mediated controlled oxidation of polysaccharides. The effects of precipitating agent, concentration and different cross-linkers on activity recovery of α-amylase CLEAs were investigated. α-Amylase aggregated with ammonium sulphate and cross-linked by dextran showed 91% activity recovery, whereas glutaraldehyde CLEAs (G-CLEAs) exhibited 42% activity recovery. M-CLEAs exhibited higher thermal stability in correlation with α-amylase and G-CLEAs. Moreover, dextran and chitosan M-CLEAs showed same affinity for starch hydrolysis as of free α-amylase. The changes in secondary structures revealed the enhancements in structural and conformational rigidity attributed by cross-linkers. Finally, after five consecutive cycles dextran M-CLEAs retained 1.25 times higher initial activity than G-CLEAs. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Crystal structure of α-amylase from Oryza sativa: molecular insights into enzyme activity and thermostability.

    PubMed

    Ochiai, Akihito; Sugai, Hiroshi; Harada, Kazuki; Tanaka, Seiya; Ishiyama, Yohei; Ito, Kosuke; Tanaka, Takaaki; Uchiumi, Toshio; Taniguchi, Masayuki; Mitsui, Toshiaki

    2014-01-01

    AmyI-1 is an α-amylase from Oryza sativa (rice) and plays a crucial role in degrading starch in various tissues and at various growth stages. This enzyme is a glycoprotein with an N-glycosylated carbohydrate chain, a unique characteristic among plant α-amylases. In this study, we report the first crystal structure of AmyI-1 at 2.2-Å resolution. The structure consists of a typical (β/α)8-barrel, which is well-conserved among most α-amylases in the glycoside hydrolase family-13. Structural superimposition indicated small variations in the catalytic domain and carbohydrate-binding sites between AmyI-1 and barley α-amylases. By contrast, regions around the N-linked glycosylation sites displayed lower conservation of amino acid residues, including Asn-263, Asn-265, Thr-307, Asn-342, Pro-373, and Ala-374 in AmyI-1, which are not conserved in barley α-amylases, suggesting that these residues may contribute to the construction of the structure of glycosylated AmyI-1. These results increase the depths of our understanding of the biological functions of AmyI-1.

  6. Identification of active site residues of Fenugreek β-amylase: chemical modification and in silico approach.

    PubMed

    Srivastava, Garima; Singh, Vinay K; Kayastha, Arvind M

    2014-10-01

    The amino acid sequence of Fenugreek β-amylase is not available in protein data bank. Therefore, an attempt has been made to identify the catalytic amino acid residues of enzyme by employing studies of pH dependence of enzyme catalysis, chemical modification and bioinformatics. Treatment of purified Fenugreek β-amylase with EDAC in presence of glycine methyl ester and sulfhydryl group specific reagents (IAA, NEM and p-CMB), followed a pseudo first-order kinetics and resulted in effective inactivation of enzyme. The reaction with EDAC in presence of NTEE (3-nitro-l-tyrosine ethylester) resulted into modification of two carboxyl groups per molecule of enzyme and presence of one accessible sulfhydryl group at the active site, per molecule of enzyme was ascertained by titration with DTNB. The above results were supported by the prevention of inactivation of enzyme in presence of substrate. Based on MALDI-TOF analysis of purified Fenugreek β-amylase and MASCOT search, β-amylase of Medicago sativa was found to be the best match. To further confirm the amino acid involved in catalysis, homology modelling of β-amylase of M. sativa was performed. The sequence alignment, superimposition of template and target models, along with study of interactions involved in docking of sucrose and maltose at the active site, led to identification of Glu187, Glu381 and Cys344 as active site residues. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  7. Salivary Alpha-Amylase and Cortisol Among Pentecostals on a Worship and Nonworship Day

    PubMed Central

    LYNN, CHRISTOPHER DANA; PARIS, JASON; FRYE, CHERYL ANNE; SCHELL, LAWRENCE M.

    2013-01-01

    Objectives This investigation used a biomarker of sympathetic nervous system activity novel to biocultural research to test the hypothesis that engaging in religious worship activities would reduce baseline stress levels on a non-worship day among Pentecostals. Methods As detailed in Lynn et al. (submitted for publication), stress was measured via salivary cortisol and α-amylase among 52 Apostolic Pentecostals in New York’s mid-Hudson Valley. Saliva samples were collected at four predetermined times on consecutive Sundays and Mondays to establish diurnal profiles and compare days of worship and non-worship. These data were reanalyzed using separate analyses of covariance on α-amylase and cortisol to control for individual variation in Pentecostal behavior, effects of Sunday biomarkers on Monday, and other covariates. Results There was a significant decrease in cortisol and an increase in α-amylase on a non-worship day compared with a service day. Models including engagement in Pentecostal worship behavior explained 62% of the change in non-service day cortisol and 73% of the change in non-service day α-amylase. Conclusions Engagement in Pentecostal worship may be associated with reductions in circulatory cortisol and enhancements in α-amylase activity. Am. J. Hum. Biol. 22:819–822, 2010. PMID:20878966

  8. Characterizing Novel Thermophilic Amylase Producing Bacteria From Taptapani Hot Spring, Odisha, India

    PubMed Central

    Sen, Sudip Kumar; Raut, Sangeeta; Satpathy, Soumya; Rout, Prangya Ranjan; Bandyopadhyay, Bidyut; Das Mohapatra, Pradeep Kumar

    2014-01-01

    Background: Amylases play a vital role in biotechnological studies and rank an important position in the world enzyme market (25% to 33%). Bioprocess method of amylase production is more effective than the other sources, since the technique is easy, cost effective, fast, and the enzymes of required properties can be procured. Objectives: The current study aimed to report the characteristics of novel amylase producing bacterial strains isolated from Taptapani hot spring, Odisha, India. Materials and Methods: Bacterial strains were isolated by dilution plating method from the water samples collected from Taptapani Hot Spring, Odisha and screened for amylase production through starch hydrolysis. The bacterial isolates were identified morphologically, biochemically, and finally by 16S rDNA profiling. Results: Based on the morphological, physiological, biochemical characteristics and the molecular characterization, the isolates SS1, SS2, and SS3 were identified as Bacillus barbaricus, Aeromonas veroni, and Stenotrophomonas maltophilia, respectively. The approximate molecular weight of enzymes from SS1, SS2, and SS3 strains were 19 kDa, 56 kDa and 49 kDa, respectively. Conclusions: The current report isolates, characterizes, and demonstrates the novel heat-adapted amylase-producing bacteria SS1, SS2 and SS3 from Taptapani hot spring, indicating its potentiality and stability under acidic conditions. PMID:25741425

  9. Integrable alpha-amylase plasmid for generating random transcriptional fusions in Bacillus subtilis.

    PubMed Central

    O'Kane, C; Stephens, M A; McConnell, D

    1986-01-01

    An integrable plasmid, pOK4, which replicated independently in Escherichia coli was constructed for generating transcriptional fusions in vivo in Bacillus DNA. It did not replicate independently in Bacillus subtilis, but it could be made to integrate into the chromosome of B. subtilis if sequences homologous to chromosomal sequences were inserted into it. It had a selectable marker for chloramphenicol resistance and carried unique sites for EcoRI and SmaI just to the 5' side of a promoterless alpha-amylase gene from Bacillus licheniformis. When B. subtilis DNA fragments were ligated into one of these sites and the ligation mixture was used to transform an alpha-amylase-negative B. subtilis strain, chloramphenicol-resistant transformants could be isolated conveniently. Many of these were alpha-amylase positive, owing to the fusion of the plasmid amylase gene to chromosomal operons. In principle, because integration need not be mutagenic, it is possible to obtain fusions to any chromosomal operon. The site of each integration can be mapped, and the flanking sequences can be cloned into E. coli. The alpha-amylase gene can be used to detect regulated genes. We used it as an indicator to detect operons which are DNA-damage-inducible (din), and we identified insertions in both SP beta and PBSX prophages. Images PMID:3096966

  10. Purification and characterization of amylases from small abalone (Sulculus diversicolor aquatilis).

    PubMed

    Tsao, Ching-Yu; Pan, Yun-Zu; Jiang, Shann-Tzong

    2003-02-12

    Amylases II-1 and II-2 with molecular weights of 55.7 and 65 kDa, respectively, were purified to electrophoretical homogeneity from small abalone (Sulculus diversicolor aquatilis) by ammonium sulfate fractionation, Sepharose CL-6B, CM-Sepharose CL-6B, and Sephacryl S-100 chromatographs. They had optimal temperatures of 45 and 50 degrees C and an optimal pH of 6.0. The purified amylases were stable at pH 5.0-8.0 and 6.0-8.0, respectively. They were completely or partially inhibited by Hg(2+), Cu(2+), Cd(2+), Zn(2+), iodoacetamide, phenylmethanesulfonyl fluoride, and N-ethylmaleimide, suggesting the existence of cysteine at their active sites. Digestion tests against various polysaccharides suggested that the purified amylases II-1 and II-2 are neoamylases which can hydrolyze both alpha-1,4 and alpha-1,6 glucosidic bonds. Amylase II-2 might be an exo- and II-1 an endo-/exo-amylase.

  11. Existence of hydroxylated MWCNTs demotes the catalysis effect of amylases against starch degradation.

    PubMed

    Sekar, Gajalakshmi; Sivakumar, Amaravathy; Mukherjee, Amitava; Chandrasekaran, Natarajan

    2016-05-01

    Possible interaction between amylase and Multi Walled Carbon Nanotubes (MWCNTs) has been elucidated with spectroscopic methods. Hyperchromism of the UV-visible spectra of amylase-CNT conjugates suggested ground state complex formation between them. On contrary, the decreasing fluorescence emission spectra revealed the fate of quenching mechanism to be static. Stoke shift observed from the synchronous and 3D spectra suggested the possibilities of disturbances to the aromatic micro-environment of amylases by OH-MWCNTS. FTIR and FT-Raman spectra showed alteration in the amide I band, that corresponds to their effect on alpha-helical structures. Loss of alpha-helical structures and alteration in the dichroic band again revealed possible conformational change and effect towards the stability of polypeptide backbone structures. In addition, the shift observed in the SPR band and FTIR peaks of CNTs-amylase conjugates suggested possible alteration in their optical and structural properties. On the functional aspect, amylase activity on starch degradation and hydrolysis were found to be decreased in the presence of CNTs.

  12. Starch-binding domain affects catalysis in two Lactobacillus alpha-amylases.

    PubMed

    Rodríguez-Sanoja, R; Ruiz, B; Guyot, J P; Sanchez, S

    2005-01-01

    A new starch-binding domain (SBD) was recently described in alpha-amylases from three lactobacilli (Lactobacillus amylovorus, Lactobacillus plantarum, and Lactobacillus manihotivorans). Usually, the SBD is formed by 100 amino acids, but the SBD sequences of the mentioned lactobacillus alpha-amylases consist of almost 500 amino acids that are organized in tandem repeats. The three lactobacillus amylase genes share more than 98% sequence identity. In spite of this identity, the SBD structures seem to be quite different. To investigate whether the observed differences in the SBDs have an effect on the hydrolytic capability of the enzymes, a kinetic study of L. amylovorus and L. plantarum amylases was developed, with both enzymes acting on several starch sources in granular and gelatinized forms. Results showed that the amylolytic capacities of these enzymes are quite different; the L. amylovorus alpha-amylase is, on average, 10 times more efficient than the L. plantarum enzyme in hydrolyzing all the tested polymeric starches, with only a minor difference in the adsorption capacities.

  13. Rhizopus microsporus var. rhizopodiformis: a thermotolerant fungus with potential for production of thermostable amylases.

    PubMed

    Peixoto, Simone C; Jorge, João A; Terenzi, Héctor F; Polizeli, Maria de Lourdes T M

    2003-12-01

    The effect of several nutritional and environmental parameters on growth and amylase production from Rhizopus microsporus var. rhizopodiformis was analysed. This fungus was isolated from soil of the Brazilian "cerrado" and produced high levels of amylolytic activity at 45 degrees C in liquid medium supplemented with starch, sugar cane bagasse, oat meal or cassava flour. Glucose in the culture medium drastically repressed the amylolytic activity. The products of hydrolysis were analysed by thin layer chromatography, and glucose was detected as the main component. The amylolytic activity hydrolysed several substrates, such as amylopectin, amylase, glycogen, pullulan, starch, and maltose. Glucose was always the main end product detected by high-pressure liquid chromatography analysis. These results indicated that the amylolytic activity studied is a glucoamylase, but there were also low levels of alpha-amylase. As compared to other fungi, R. microsporus var. rhizopodiformis can be considered an efficient producer of thermostable amylases, using raw residues of low cost as substrates. This information is of technological value, considering the importance of amylases for industrial hydrolysis.

  14. Production and Characterization of α-Amylase from an Extremely Halophilic Archaeon, Haloferax sp. HA10

    PubMed Central

    Bajpai, Bhakti; Chaudhary, Monika

    2015-01-01

    Summary Haloarchaea are found at very high concentrations in salt-conditioned environments, hence produce enzymes which are able to catalyze reactions under harsh conditions, typical of many industrial processes. In the present study, culture conditions for extracellular amylase production from Haloarchaea isolated from a solar saltern were optimized and the purified enzyme was characterized. Haloferax sp. HA10 showed maximum amylase production at 3 M NaCl, 37 °C, pH=7 and 1% starch content. Purified α-amylase was a calcium-dependent enzyme with an estimated molecular mass of about 66 kDa and many industrially useful properties. It was found to be stable in a broad range of pH (from 5 to 9) and NaCl concentrations (from 0.5 to 3.0 M), retaining 48% activity even at 4 M. The optimal temperature for Haloferax sp. HA10 amylase activity was 55 °C (99% activity), and 57% activity was retained at 80 °C, which dropped to 44% with the increase of temperature to 90 or 100 °C. It was able to sustain various surfactants and detergents. To the best of our knowledge the detergent-stable α-amylases from halophilic archaeon have not been reported yet. PMID:27904327

  15. Characterisation and inhibition studies of Helicoverpa armigera (Hübner) gut α-amylase.

    PubMed

    Kaur, Rimaljeet; Gupta, Anil K; Taggar, Gaurav K

    2015-09-01

    The survival of a devastating pest, Helicoverpa armigera, is mainly dependent on the availability of α-amylase. Therefore, characterising H. armigera α-amylase and targeting it with effective inhibitors could aid in reducing its damaging effects. H. armigera gut possessed four isozymes of α-amylase. The molecular weight of the major purified isozyme ranged from 79 to 81 kDa. The purified enzyme was identified to be α-amylase on the basis of products formed from starch. The optimum pH and temperature were 10.0 and 50 °C respectively. The activation energy was 5.7 kcal mol(-1) . The enzyme showed high activity with starch and amylopectin, whereas dextrins were poor substrates. The Michaelis constant Km with starch, amylose and amylopectin was 0.45, 1.23 and 0.11 mg mL(-1) respectively. ZnSO4 , FeSO4 , CuSO4 , citric acid, oxalic acid and salicylic acid were potent inhibitors. ZnSO4 , salicylic acid and pigeonpea α-amylase inhibitor (∼21.0 kDa) acted primarily as competitive inhibitors, FeSO4 and citric acid displayed mainly anticompetitive behaviour, while CuSO4 and oxalic acid behaved mainly as non-competitive inhibitors. The identification of effective ecofriendly inhibitors could help in managing H. armigera infestation. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  16. Salivary alpha-amylase and cortisol among pentecostals on a worship and nonworship day.

    PubMed

    Lynn, Christopher Dana; Paris, Jason; Frye, Cheryl Anne; Schell, Lawrence M

    2010-01-01

    This investigation used a biomarker of sympathetic nervous system activity novel to biocultural research to test the hypothesis that engaging in religious worship activities would reduce baseline stress levels on a non-worship day among Pentecostals. As detailed in Lynn et al. (submitted for publication), stress was measured via salivary cortisol and α-amylase among 52 Apostolic Pentecostals in New York's mid-Hudson Valley. Saliva samples were collected at four predetermined times on consecutive Sundays and Mondays to establish diurnal profiles and compare days of worship and non-worship. These data were reanalyzed using separate analyses of covariance on α-amylase and cortisol to control for individual variation in Pentecostal behavior, effects of Sunday biomarkers on Monday, and other covariates. There was a significant decrease in cortisol and an increase in α-amylase on a non-worship day compared with a service day. Models including engagement in Pentecostal worship behavior explained 62% of the change in non-service day cortisol and 73% of the change in non-service day α-amylase. Engagement in Pentecostal worship may be associated with reductions in circulatory cortisol and enhancements in α-amylase activity. © 2010 Wiley-Liss, Inc.

  17. Castration decreases amylase release associated with muscarinic acetylcholine receptor downregulation in rat parotid gland.

    PubMed

    Busch, Lucila; Borda, Enri

    2003-05-01

    1 The mechanism and receptor subtypes involved in carbachol-stimulated amylase release and its changes after castration were studied in parotid slices from male rats. 2 Carbachol induced both amylase release and inositol phosphate (IP) accumulation in parotid slices from control and castrated rats, but castration induced a decrease of carbachol maximal effect. The effect of castration was reverted by testosterone replacement. 3 The selective M(1) and M(3) muscarinic receptor antagonists, pirenzepine and 4-diphenylacetoxy-N-methylpiperidine methiodide, respectively, inhibited carbachol-stimulated amylase release and IP accumulation in a dose-dependent manner in parotid slices from control and castrated rats. 4 A diminution of binding sites of muscarinic receptor in parotid membrane from castrated rats was observed. Competition binding assays showed that both, M(1) and M(3) muscarinic receptor subtypes are expressed in membranes of parotid glands from control and castrated rats, M(3) being the greater population. 5 These results suggest that amylase release induced by carbachol in parotid slices is mediated by phosphoinositide accumulation. This mechanism appears to be triggered by the activation of M(1) and M(3) muscarinic receptor subtypes. Castration induced a decrease of the maximal effect of carbachol evoked amylase release and IP accumulation followed by a diminution in the number of parotid gland muscarinic acetylcholine receptors.

  18. Effect of anthranilic acid on the catabolite repression of a Drosophila amylase gene in E. coli

    SciTech Connect

    Stevens, S.M.; Moehring, J.M.; Chernin, M.I.

    1987-05-01

    A Drosophila pseudoobscura amylase pseudogene cloned in Escherichia coli is expressed at high levels. The expression of this pseudogene is repressed when glucose (0.5% final conc) is added to a starch minimal medium culture of E. coli cells that contain the amylase plasmid pAMY17F. Addition of anthranilic acid (7 mM final conc.) to catabolite repressed cells acts like adenosine 3',5' cyclic monophosphate (cAMP) by derepressing the amylase pseudogene at the promoter. This is consistent with the Metabolite Gene Regulation (MGR) model proposed by Kline et al. which suggests that small molecules can circumvent the necessity for cAMP. Catabolite repression of the amylase structural gene of D. pseudoobscura has been previously shown. This would suggest that the amylase pseudogene expression in E. coli is either from a Drosophila structural gene promoter co-cloned with the pseudogene or a catabolite repressible E. coli promoter placed in the proper orientation and reading frame during the rearrangement of pAMY17F.

  19. Purification and Characterization of Midgut α-Amylase in a Predatory Bug, Andralus spinidens

    PubMed Central

    Sorkhabi-Abdolmaleki, Sahar; Zibaee, Arash; Hoda, Hassan; Fazeli-Dinan, Mahmoud

    2014-01-01

    α-Amylases are widespread enzymes that catalyze endohydrolysis of long α-1,4-glucan chains such as starch and glycogen. The highest amylolytic activity was found in 5th instar nymphs and midgut of the predatory bug, Andrallus spinidens F. (Hemiptera: Pentatomidae). The α-amylase was purified following a three-step procedure. The purified α-amylase had a specific activity of 13.46 U/mg protein, recovery of 4.21, purification fold of 13.87, and molecular weight of 21.3 kDa. The enzyme had optimal pH and temperature of 7 and 45°C, respectively. Na+, Mn+, Mg2+, and Zn2+ significantly decreased activity of the purified α-amylase, but some concentrations of K+, Ca2+, and Cu2+ had the opposite effect. EDTA, EGTA, and DTC significantly decreased enzymatic activity, showing the presence of metal ions in the catalytic site of the enzyme. Kinetic parameters of the purified α-amylase showed a Km of 3.71% in starch and 4.96% for glycogen, suggesting that the enzyme had a higher affinity for starch. PMID:25373212

  20. A novel alpha-amylase from the cyanobacterium Nostoc sp. PCC 7119.

    PubMed

    Reyes-Sosa, Francisco M; Molina-Heredia, Fernando P; De la Rosa, Miguel A

    2010-03-01

    Little information is yet available on the alpha-amylases of cyanobacteria. Here, the presence of an alpha-amylase in the cyanobacterium Nostoc sp. PCC 7119 is first demonstrated. A gene (amy1) encoding a cytoplasmic alpha-amylase (Amy1) protein has been identified, cloned, and overexpressed in Escherichia coli cells. The recombinant protein is a 56.7-kDa monomer, which has been purified to electrophoretic homogeneity by affinity chromatography. The substrate specificity and end product analyses confirm that it is a calcium-dependent alpha-amylase enzyme, which exhibits its maximum activity at 31 degrees C and at pH between 6.5 and 7.5. The Amy1 protein breaks down mainly starch, is also able to cleave glycogen and dextrin, and exhibits no activity against xylan or pullulan. So the enzyme cannot efficiently attack the maltodextrins with degrees of polymerization below that of maltooctaose. Maltotriose, maltose, and maltotetraose are the major products of the enzymatic reaction with starch as substrate. The enzyme shows a very high turnover number against soluble potato starch (3,420 +/- 270 s(-1)), as compared with other alpha-amylases reported in the literature. The high catalytic efficiency and relatively low optimum temperature of the Nostoc Amy1 protein make this previously unexplored group of cyanobacterial enzymes of great interest for further physiological studies and industrial applications.

  1. Production and Characterization of α-Amylase from an Extremely Halophilic Archaeon, Haloferax sp. HA10.

    PubMed

    Bajpai, Bhakti; Chaudhary, Monika; Saxena, Jyoti

    2015-03-01

    Haloarchaea are found at very high concentrations in salt-conditioned environments, hence produce enzymes which are able to catalyze reactions under harsh conditions, typical of many industrial processes. In the present study, culture conditions for extracellular amylase production from Haloarchaea isolated from a solar saltern were optimized and the purified enzyme was characterized. Haloferax sp. HA10 showed maximum amylase production at 3 M NaCl, 37 °C, pH=7 and 1% starch content. Purified α-amylase was a calcium-dependent enzyme with an estimated molecular mass of about 66 kDa and many industrially useful properties. It was found to be stable in a broad range of pH (from 5 to 9) and NaCl concentrations (from 0.5 to 3.0 M), retaining 48% activity even at 4 M. The optimal temperature for Haloferax sp. HA10 amylase activity was 55 °C (99% activity), and 57% activity was retained at 80 °C, which dropped to 44% with the increase of temperature to 90 or 100 °C. It was able to sustain various surfactants and detergents. To the best of our knowledge the detergent-stable α-amylases from halophilic archaeon have not been reported yet.

  2. Effects of dopamine on adenylyl cyclase activity and amylase secretion in rat parotid tissue.

    PubMed

    Hatta, S; Amemiya, N; Takemura, H; Ohshika, H

    1995-06-01

    Several previous studies have shown that dopamine causes amylase secretion from rat parotid tissue. However, the mechanism of this dopamine action is still unclear. The present study was designed to characterize dopamine action in rat parotid gland tissue by examining the effects of dopamine on cyclic AMP accumulation, adenylyl cyclase activity, and amylase release. Dopamine significantly enhanced accumulation of cyclic AMP in parotid slices and stimulated adenylyl cyclase activity in parotid membrane preparations. It also significantly stimulated amylase release from parotid slices. The stimulatory effects of dopamine on cyclic AMP accumulation, adenylyl cyclase activity, and amylase release were effectively blocked with propranolol, a beta-adrenergic antagonist, but not by either SCH 23390, a preferential D1 antagonist, or butaclamol, a preferential D2 antagonist. No substantial specific binding sites for D1 receptors were detectable by [3H]SCH 23390 binding in parotid membranes. These results suggest that the stimulatory effect of dopamine on amylase secretion in rat parotid tissue is not mediated through specific D1 dopamine receptors but rather through beta-adrenergic receptors.

  3. Phenotypic Variation for Diastatic power, ß-Amylase Activity, and ß-Amylase Thermostability vs. Allelic Variation at the Bmy1 Locus in a Sample of North American Barley Germplasm

    USDA-ARS?s Scientific Manuscript database

    Malting quality data including diastatic power, ß-amylase activity, and ß-amylase thermostability, were collected on malts from three barley (Hordeum vulgare L.) breeding program trials containing two growth habits and 165 lines grown in multiple environments. We attempted to identify causal polymor...

  4. Characterization, expression in Streptomyces lividans, and processing of the amylase of Streptomyces griseus IMRU 3570: two different amylases are derived from the same gene by an intracellular processing mechanism.

    PubMed Central

    Garcia-Gonzalez, M D; Martin, J F; Vigal, T; Liras, P

    1991-01-01

    Extracellular amylase in Streptomyces lividans was undetectable in starch-supplemented medium. However, S. lividans produced fivefold-higher levels of amylase than Streptomyces griseus IMRU 3570 when transformed with the S. griseus amy gene. Two major proteins of 57 and 50 kDa with amylase activity accumulated in the culture broths of the donor S. griseus and S. lividans transformed with the amy gene. Both proteins were also present in protoplast lysates in the same relative proportion; they gave a positive reaction with antibodies against the 57-kDa amylase. They did not differ in substrate specificity or enzyme kinetics. The two amylases were purified to homogeneity by a two-step procedure. Both proteins showed the same amino-terminal sequence of amino acids, suggesting that both proteins are derived from the same gene. The deduced signal peptide has 28 amino acids with two positively charged arginines near the amino-terminal end. When an internal NcoI fragment was removed from the amy gene, the resulting S. lividans transformants did not synthesize any of the two amylase proteins and showed no reaction in immunoblotting. Formation of the 50-kDa protein was observed when pure 57-kDa amylase was treated with supernatants of protoplast lysates but not when it was treated with membrane preparations, indicating that the native 57-kDa amylase could be processed intracellularly. Images PMID:1707411

  5. Mechanism of removal of undesirable residual amylase, insoluble starch, and select colorants from refinery streams by powdered activated carbons

    USDA-ARS?s Scientific Manuscript database

    There is a need in the world-wide sugar industry to find a practical and economical solution to remove or inactivate residual alpha-amylases that are high temperature stable from factory or refinery streams. A survey of refineries that used amylase and had activated carbon systems for decolorization...

  6. Recognition and binding of the PF2 lectin to α-amylase from Zabrotes subfasciatus (Coleoptera:Bruchidae) larval midgut.

    PubMed

    Lagarda-Diaz, I; Geiser, D; Guzman-Partida, A M; Winzerling, J; Vazquez-Moreno, L

    2014-01-01

    Amylases are an important family of enzymes involved in insect carbohydrate metabolism that are required for the survival of insect larvae. For this reason, enzymes from starch-dependent insects are targets for insecticidal control. PF2 (Olneya tesota) is a lectin that is toxic to Zabrotes subfasciatus (Coleoptera: Bruchidae) larvae. In this study, we evaluated recognition of the PF2 lectin to α-amylases from Z. subfasciatus midgut and the effect of PF2 on α-amylase activity. PF2 caused a decrease of total amylase activity in vitro. Subsequently, several α-amylase isoforms were isolated from insect midgut tissues using ion exchange chromatography. Three enzyme isoforms were verified by an in-gel assay for amylase activity; however, only one isoform was recognized by antiamylase serum and PF2. The identity of this Z. subfasciatus α-amylase was confirmed by liquid chromatography-tandem mass spectrometry. The findings strongly suggest that a glycosylated α-amylase isoform from larval Z. subfasciatus midgut interacts with PF2, which interferes with starch digestion.

  7. Mechanism of removal of undesirable residual amylase, insoluble starch, and select colorants from refinery streams by powdered activated carbons

    USDA-ARS?s Scientific Manuscript database

    There is a need in the world-wide sugar industry to find a practical and economical solution to remove or inactivate residual alpha-amylase that are high temperature stable from factory or refinery streams. A survey of refineries that used amylase and had activated carbon systems for decolorization,...

  8. General Subject 1. Report to ICUMSA on the determination of commercial alpha-amylase activity by a spectrophotometric method

    USDA-ARS?s Scientific Manuscript database

    A report is given on a new industrial method for the determination of the activity or strength of commercial alpha-amylase at a sugarcane factory or refinery, as well as a recommendation. At the present time, the activities or strengths of commercial alpha-amylases cannot be directly compared becau...

  9. The need for and development of a method to measure carry-over amylase activity in raw and refined sugars

    USDA-ARS?s Scientific Manuscript database

    In recent years, there has been increased world-wide concern over carry-over activity of mostly high temperature (HT) and very high temperature (VHT) stable amylases in refined sugars to various food and end-user industries. HT and VHT stable amylases were developed for much larger markets than the...

  10. Development of an industrial method to quantitatively measure carry-over amylase activity in raw and refined sugars

    USDA-ARS?s Scientific Manuscript database

    In recent years, there has been increased concern over carry-over activity of mostly high temperature (HT) and very high temperature (VHT) stable amylases in white, refined sugars from refineries to various food manufacturing industries and other end-users. HT and VHT stable amylases were developed...

  11. Identification of serum and urine proteins responsible for enhanced pigment production by group B streptococci as amylases.

    PubMed Central

    Rosa-Fraile, M; Sampedro, A; Ruiz-Bravo, A; Sanbonmatsu, S; Gimenez-Gallego, G

    1996-01-01

    The serum and urine proteins responsible for enhanced pigment production in Streptococcus agalactiae in culture media were purified by chromatography and were identified as amylases by comparison of their amino acid composition with that calculated for proteins with known sequences. Similar pigment-enhancing activity was displayed by other amylases of nonanimal origin and by maltooligosaccharides. PMID:8877142

  12. A comparison of currently used serum lipase and amylase procedures in the serial detection of enzyme elevations in acute pancreatitis.

    PubMed

    Hathaway, J A; Kitt, D; Wingate, B

    1983-10-14

    Twenty-eight patients having acute pancreatitis were followed during convalescence with serum amylase and lipase determinations. Starch and p-nitrophenyl-oligosaccharide substrates were used for amylase. Dimercaptotributyrate and triolein were employed for lipase. The extreme sensitivity of the lipase procedure using the tributyrate detected a persistent elevation of lipase when other parameters of measurement had returned to normal.

  13. Mechanism of removal of undesirable residual amylase, insoluble starch, and select colorants from refinery streams by powdered activated carbons

    USDA-ARS?s Scientific Manuscript database

    There is a need in the world-wide sugar industry to find a practical and economical solution to remove or inactivate residual '-amylases that are high temperature stable from factory or refinery streams. A survey of refineries that used amylase and had activated carbon systems for decolorization, re...

  14. Metabolism of glycosylated human salivary amylase: in vivo plasma clearance by rat hepatic endothelial cells and in vitro receptor mediated pinocytosis by rat macrophages

    SciTech Connect

    Niesen, T.E.; Alpers, D.H.; Stahl, P.D.; Rosenblum, J.L.

    1984-09-01

    Salivary-type amylase normally comprises about 60% of the amylase activity in human serum, but only a small fraction is a glycosylated isoenzyme (amylase A). In contrast, 1/3 of amylase in human saliva is glycosylated. Since glycosylation can affect circulatory clearance, we studied the clearance of amylase A in rats and its uptake by rat alveolar macrophages. Following intravenous injection, /sup 125/I-labeled amylase A disappeared rapidly from plasma (t 1/2 . 9 min) and accumulated in the liver. Simultaneous injection of mannose-albumin slowed its clearance to a rate comparable to that of /sup 125/I-labeled nonglycosylated salivary amylase (t 1/2 . 45 min). In contrast, galactose-albumin had no effect. Electron microscope autoradiography of the liver following injection of /sup 125/I-labeled amylase A revealed a localization of grains over the hepatic endothelial cells. In vitro studies indicated that amylase A is taken up by alveolar macrophages via receptor-mediated pinocytosis. Uptake was linear over time, saturable, and inhibited by mannan and mannose-albumin, but not by galactose-albumin. We conclude that amylase A, which is a naturally occurring human glycoprotein with at most three terminal L-fucose residues per molecule, is recognized in rats by a mannose receptor located on hepatic endothelial cells. We speculate that this receptor, by rapidly clearing circulating amylase A, may be responsible for the low level of amylase A in human serum.

  15. Interaction of europium and curium with alpha-amylase.

    PubMed

    Barkleit, Astrid; Heller, Anne; Ikeda-Ohno, Atsushi; Bernhard, Gert

    2016-06-07

    The complexation of Eu(iii) and Cm(iii) with the protein α-amylase (Amy), a major enzyme in saliva and pancreatic juice, was investigated over wide ranges of pH and concentration at both ambient and physiological temperatures. Macroscopic sorption experiments demonstrated a strong and fast binding of Eu(iii) to Amy between pH 5 and 8. The protein provides three independent, non-cooperative binding sites for Eu(iii). The overall association constant of these three binding sites on the protein was calculated to be log K = 6.4 ± 0.1 at ambient temperature. With potentiometric titration, the averaged deprotonation constant of the carboxyl groups (the aspartic and glutamic acid residues) of Amy was determined to be pKa = 5.23 ± 0.14 at 25 °C and 5.11 ± 0.24 at 37 °C. Time-resolved laser-induced fluorescence spectroscopy (TRLFS) revealed two different species for both Eu(iii) and Cm(iii) with Amy. In the case of the Eu(iii) species, the stability constants were determined to be log β11 = 4.7 ± 0.2 and log β13 = 12.0 ± 0.4 for Eu : Amy = 1 : 1 and 1 : 3 complexes, respectively, whereas the values for the respective Cm(iii) species were log β11 = 4.8 ± 0.1 and log β13 = 12.1 ± 0.1. Furthermore, the obtained stability constants were extrapolated to infinite dilution to make our data compatible with the existing thermodynamic database.

  16. Potent human α-amylase inhibition by the β-defensin-like protein helianthamide

    DOE PAGES

    Tysoe, Christina; Williams, Leslie K.; Keyzers, Robert; ...

    2016-02-26

    Here, selective inhibitors of human pancreatic α-amylase (HPA) are an effective means of controlling blood sugar levels in the management of diabetes. A high-throughput screen of marine natural product extracts led to the identification of a potent (Ki = 10 pM) peptidic HPA inhibitor, helianthamide, from the Caribbean sea anemone Stichodactyla helianthus. Active helianthamide was produced in Escherichia coli via secretion as a barnase fusion protein. X-ray crystallographic analysis of the complex of helianthamide with porcine pancreatic α-amylase revealed that helianthamide adopts a β-defensin fold and binds into and across the amylase active site, utilizing a contiguous YIYH inhibitory motif.more » Helianthamide represents the first of a novel class of glycosidase inhibitors and provides an unusual example of functional malleability of the β-defensin fold, which is rarely seen outside of its traditional role in antimicrobial peptides.« less

  17. Smart phone: a popular device supports amylase activity assay in fisheries research.

    PubMed

    Thongprajukaew, Karun; Choodum, Aree; Sa-E, Barunee; Hayee, Ummah

    2014-11-15

    Colourimetric determinations of amylase activity were developed based on a standard dinitrosalicylic acid (DNS) staining method, using maltose as the analyte. Intensities and absorbances of red, green and blue (RGB) were obtained with iPhone imaging and Adobe Photoshop image analysis. Correlation of green and analyte concentrations was highly significant, and the accuracy of the developed method was excellent in analytical performance. The common iPhone has sufficient imaging ability for accurate quantification of maltose concentrations. Detection limits, sensitivity and linearity were comparable to a spectrophotometric method, but provided better inter-day precision. In quantifying amylase specific activity from a commercial source (P>0.02) and fish samples (P>0.05), differences compared with spectrophotometric measurements were not significant. We have demonstrated that iPhone imaging with image analysis in Adobe Photoshop has potential for field and laboratory studies of amylase. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Inhibition of pancreatic lipase and amylase by extracts of different spices and plants.

    PubMed

    Sellami, Mohamed; Louati, Hanen; Kamoun, Jannet; Kchaou, Ali; Damak, Mohamed; Gargouri, Youssef

    2017-05-01

    The aim of this study is to search new anti-obesity and anti-diabetic agents from plant and spices crude extracts as alternative to synthetic drugs. The inhibitory effect of 72 extracts was evaluated, in vitro, on lipase and amylase activities. Aqueous extracts of cinnamon and black tea exhibited an appreciable inhibitory effect on pancreatic amylase with IC50 values of 18 and 87 μg, respectively. Aqueous extracts of cinnamon and mint showed strong inhibitory effects against pancreatic lipase with IC50 of 45 and 62 μg, respectively. The presence of bile salts and colipase or an excess of interface failed to restore the lipase activity. Therefore, the inhibition of pancreatic lipase, by extracts of spices and plants, belongs to an irreversible inhibition. Crude extract of cinnamon showed the strongest anti-lipase and anti-amylase activities which offer a prospective therapeutic approach for the management of diabetes and obesity.

  19. A highly efficient and thermostable α-amylase from soya bean seeds.

    PubMed

    Prakash, Om; Jaiswal, Nivedita

    2010-12-01

    The α-amylase from soya bean seeds was purified by affinity precipitation, resulting in approx. 20-fold purification with approx. 84% recovery. The purified α-amylase had an optimum pH of 5.5, optimum temperature of 75 °C, Arrhenius energy of activation of 6.03 kcal/mol (1 kcal≈4.184 kJ) and a Km of 2.427 mg/ml (starch substrate). The enzyme had maximum substrate specificity for starch. Among the various metal ions tested, Co2+ and Mn2+ were found to be strong activators. The effect of thiol group modifying agents showed that the thiols of soya bean α-amylase are not directly involved in catalysis. The thermostability of the enzyme makes it suitable for starch liquefaction and the detergent industry respectively.

  20. An In Vitro and In Vivo Study of the α-Amylase Activity of Phaseolamin

    PubMed Central

    de Gouveia, Neire Moura; Alves, Fernanda Vieira; Furtado, Fabiana Barcelos; Scherer, Danielli Luana; Mundim, Antonio Vicente

    2014-01-01

    Abstract We evaluated the polypeptide profiles, inhibition of human salivary α-amylase activity, and hemagglutination properties of a commercial phaseolamin sample. We also performed an in vivo assay to investigate the effects of a commercial phaseolamin treatment (100, 500, or 1500 mg/kg) over 20 days on the glycemia, body weight, and serum biochemical parameters (total cholesterol, triglycerides, alanine aminotransferase, and aspartate aminotransferase) of nondiabetic and streptozotocin-induced diabetic rats. The in vitro evaluation showed defined protein profiles, low hemagglutination activity, and high α-amylase inhibition. None of the experimental groups treated with phaseolamin or acarbose showed decreases in body weight. Our data demonstrate that phaseolamin inhibits amylase activity in vitro, reduces blood glucose levels, decreases or attenuates some of the renal and hepatic effects of diabetes in streptozotocin-induced rats, and could therefore have therapeutic potential in the treatment or prevention of the complications of diabetes. PMID:24650210

  1. Bacterial and Archaeal α-Amylases: Diversity and Amelioration of the Desirable Characteristics for Industrial Applications.

    PubMed

    Mehta, Deepika; Satyanarayana, Tulasi

    2016-01-01

    Industrial enzyme market has been projected to reach US$ 6.2 billion by 2020. Major reasons for continuous rise in the global sales of microbial enzymes are because of increase in the demand for consumer goods and biofuels. Among major industrial enzymes that find applications in baking, alcohol, detergent, and textile industries are α-amylases. These are produced by a variety of microbes, which randomly cleave α-1,4-glycosidic linkages in starch leading to the formation of limit dextrins. α-Amylases from different microbial sources vary in their properties, thus, suit specific applications. This review focuses on the native and recombinant α-amylases from bacteria and archaea, their production and the advancements in the molecular biology, protein engineering and structural studies, which aid in ameliorating their properties to suit the targeted industrial applications.

  2. Purification and crystallization of α-amylases from mucoid and non-mucoid B. amyloliquefaciens strains

    NASA Astrophysics Data System (ADS)

    Sarikaya, Elif; Mikami, Bunzo

    2001-11-01

    The purified α-amylases from mucoid and non-mucoid B. amyloliquefaciens strains were crystallized in forms suitable for X-ray diffraction analysis. Crystals were grown by the hanging-drop vapor diffusion method. Very thin crystals of α-amylase of non-mucoid strain were obtained in the presence 15% propanol, 12% PEG 6000 and 0.1 M PIPES (pH: 7.1) at the end of 3 months and these were not suitable for X-ray diffraction analysis. Crystals of the mucoid strain of B. amyloliquefaciens α-amylase were obtained with 30% PEG 6000, 0.2 M (NH 4) 2SO 4 and 0.1 M PIPES (pH: 6.5) at the end of 3 months and these were suitable for X-ray diffraction analysis.

  3. Bacterial and Archaeal α-Amylases: Diversity and Amelioration of the Desirable Characteristics for Industrial Applications

    PubMed Central

    Mehta, Deepika; Satyanarayana, Tulasi

    2016-01-01

    Industrial enzyme market has been projected to reach US$ 6.2 billion by 2020. Major reasons for continuous rise in the global sales of microbial enzymes are because of increase in the demand for consumer goods and biofuels. Among major industrial enzymes that find applications in baking, alcohol, detergent, and textile industries are α-amylases. These are produced by a variety of microbes, which randomly cleave α-1,4-glycosidic linkages in starch leading to the formation of limit dextrins. α-Amylases from different microbial sources vary in their properties, thus, suit specific applications. This review focuses on the native and recombinant α-amylases from bacteria and archaea, their production and the advancements in the molecular biology, protein engineering and structural studies, which aid in ameliorating their properties to suit the targeted industrial applications. PMID:27516755

  4. Selective sweep on human amylase genes postdates the split with Neanderthals

    PubMed Central

    Inchley, Charlotte E.; Larbey, Cynthia D. A.; Shwan, Nzar A. A.; Pagani, Luca; Saag, Lauri; Antão, Tiago; Jacobs, Guy; Hudjashov, Georgi; Metspalu, Ene; Mitt, Mario; Eichstaedt, Christina A.; Malyarchuk, Boris; Derenko, Miroslava; Wee, Joseph; Abdullah, Syafiq; Ricaut, François-Xavier; Mormina, Maru; Mägi, Reedik; Villems, Richard; Metspalu, Mait; Jones, Martin K.; Armour, John A. L.; Kivisild, Toomas

    2016-01-01

    Humans have more copies of amylase genes than other primates. It is still poorly understood, however, when the copy number expansion occurred and whether its spread was enhanced by selection. Here we assess amylase copy numbers in a global sample of 480 high coverage genomes and find that regions flanking the amylase locus show notable depression of genetic diversity both in African and non-African populations. Analysis of genetic variation in these regions supports the model of an early selective sweep in the human lineage after the split of humans from Neanderthals which led to the fixation of multiple copies of AMY1 in place of a single copy. We find evidence of multiple secondary losses of copy number with the highest frequency (52%) of a deletion of AMY2A and associated low copy number of AMY1 in Northeast Siberian populations whose diet has been low in starch content. PMID:27853181

  5. Action of Bacillus subtilis alpha-amylase on native wheat starch.

    PubMed

    Colonna, P; Buléon, A; Lemarié, F

    1988-06-05

    Native starch granules from wheat have been subjected to enzymatic depolymerization with an alpha-amylase from Bacillus subtilis. Crystallites made from short-chain amylose and residues from mild acid hydrolysis have been also tested. Electron microscopy, particle size analysis, DSC, and x-ray diffractometry reveal that enzymatic degradation occurs granule by granule. Gel permeation chromatography shows off the macromolecular nature of the remaining material. In contrast, acid erodes simultaneously all the granules, leading to a splitting into small particles. Crystalline fractions are completely degraded by alpha-amylase. These results support evidence for an active disentanglement of chains, carried out by the different subsites of alpha-amylase molecules. A simple mathematical treatment is proposed to explain the results of the kinetics.

  6. Potent Human α-Amylase Inhibition by the β-Defensin-like Protein Helianthamide.

    PubMed

    Tysoe, Christina; Williams, Leslie K; Keyzers, Robert; Nguyen, Nham T; Tarling, Chris; Wicki, Jacqueline; Goddard-Borger, Ethan D; Aguda, Adeleke H; Perry, Suzanne; Foster, Leonard J; Andersen, Raymond J; Brayer, Gary D; Withers, Stephen G

    2016-03-23

    Selective inhibitors of human pancreatic α-amylase (HPA) are an effective means of controlling blood sugar levels in the management of diabetes. A high-throughput screen of marine natural product extracts led to the identification of a potent (Ki = 10 pM) peptidic HPA inhibitor, helianthamide, from the Caribbean sea anemone Stichodactyla helianthus. Active helianthamide was produced in Escherichia coli via secretion as a barnase fusion protein. X-ray crystallographic analysis of the complex of helianthamide with porcine pancreatic α-amylase revealed that helianthamide adopts a β-defensin fold and binds into and across the amylase active site, utilizing a contiguous YIYH inhibitory motif. Helianthamide represents the first of a novel class of glycosidase inhibitors and provides an unusual example of functional malleability of the β-defensin fold, which is rarely seen outside of its traditional role in antimicrobial peptides.

  7. Potent Human α-Amylase Inhibition by the β-Defensin-like Protein Helianthamide

    PubMed Central

    2016-01-01

    Selective inhibitors of human pancreatic α-amylase (HPA) are an effective means of controlling blood sugar levels in the management of diabetes. A high-throughput screen of marine natural product extracts led to the identification of a potent (Ki = 10 pM) peptidic HPA inhibitor, helianthamide, from the Caribbean sea anemone Stichodactyla helianthus. Active helianthamide was produced in Escherichia coli via secretion as a barnase fusion protein. X-ray crystallographic analysis of the complex of helianthamide with porcine pancreatic α-amylase revealed that helianthamide adopts a β-defensin fold and binds into and across the amylase active site, utilizing a contiguous YIYH inhibitory motif. Helianthamide represents the first of a novel class of glycosidase inhibitors and provides an unusual example of functional malleability of the β-defensin fold, which is rarely seen outside of its traditional role in antimicrobial peptides. PMID:27066537

  8. A lectin from Spatholobus parviflorus inhibits Aspergillus flavus α-amylase: enzyme kinetics and thermodynamic studies.

    PubMed

    Tintu, Ignatius; Abhilash, Joseph; Dileep, Kalarickal V; Augustine, Anu; Haridas, Madathilkovilakath; Sadasivan, Chittalakkottu

    2014-07-01

    Aspergillus flavus is a commonly found fungal pathogen which produces structurally related and highly toxic secondary metabolites, aflatoxins. It has been proposed that α-amylase inhibitors may limit the ability of the fungus to produce aflatoxins. Hence, this enzyme is a potent target for the development of antifungal agents. In this study, it was found that Spatholobus parviflorus seed lectin (SPL) can inhibit the growth of A. flavus with a MIC value of 1.5 mg/mL. The enzyme kinetics, molecular modeling and isothermal titration calorimetric studies suggest that SPL can inhibit α-amylase with Ki value of 0.0042 mm. Hence, it is suggested that the antifungal activity of SPL might be partly due to its ability to inhibit the enzyme α-amylase. © 2014 John Wiley & Sons A/S.

  9. Preparation, characterization and biocatalytic activity of a nanoconjugate of alpha amylase and silver nanoparticles.

    PubMed

    Mishra, Abhijeet; Ahmad, Razi; Singh, Veena; Gupta, Munishwar Nath; Sardar, Meryam

    2013-07-01

    The primary challenge in developing nanoparticle based enzymatic devices is to be able to chemically immobilize an enzyme, which will retain its activity or improve its function while being attached to the nanoparticle. This would be of even greater significance if the whole process could be performed under benign conditions without having to resort to functionalization of key molecules at various steps. In the present study the conjugates of amylase and silver nanoparticles were synthesized using neem leaf extract as the reducing and stabilizing agent. The silver nanoparticles were characterized using Surface Plasmon Resonance Spectra, Dynamic Light Spectroscopy (DLS), Fourier Transform Infrared Spectroscopy (FTIR), Circular Dichroism (CD) and Surface Tunneling Microscopy (STM). The silver nanoparticles retained 85% amylase activity. The nanobiocatalyst was further characterized in terms of kinetic parameters and thermal stability. It was thermally more stable as compared to the free alpha amylase enzyme.

  10. An isoquinoline alkaloid, berberine, can inhibit fungal alpha amylase: enzyme kinetic and molecular modeling studies.

    PubMed

    Tintu, Ignatius; Dileep, Kalarickal V; Augustine, Anu; Sadasivan, Chittalakkottu

    2012-10-01

    Aspergillus flavus is a commonly found fungal pathogen, which produces aflatoxins, highly toxic and hepatocarcinogenic natural compounds. Inhibition of fungal alpha amylase activity has been found to limit the ability of the fungus to produce aflatoxins. Berberine, an isoquinoline alkaloid commonly found in many medicinal plants, was identified to inhibit the growth of A. flavus. The amount of berberine required to inhibit the fungal mycelial growth was determined. The compound was also found to inhibit the alpha amylase from the A. flavus. The binding affinity of the compound toward alpha amylase and the enzyme inhibitory activity have been determined by enzyme kinetic studies and Isothermal Titration Calorimetric analysis. Molecular modeling and docking studies were carried out to understand the enzyme-ligand interactions. © 2012 John Wiley & Sons A/S.

  11. Heterologous expression, biochemical characterization, and overproduction of alkaline α-amylase from Bacillus alcalophilus in Bacillus subtilis

    PubMed Central

    2011-01-01

    Background Alkaline α-amylases have potential applications for hydrolyzing starch under high pH conditions in the starch and textile industries and as ingredients in detergents for automatic dishwashers and laundries. While the alkaline α-amylase gains increased industrial interest, the yield of alkaline α-amylases from wild-type microbes is low, and the combination of genetic engineering and process optimization is necessary to achieve the overproduction of alkaline α-amylase. Results The alkaline α-amylase gene from Bacillus alcalophilus JN21 (CCTCC NO. M 2011229) was cloned and expressed in Bacillus subtilis strain WB600 with vector pMA5. The recombinant alkaline α-amylase was stable at pH from 7.0 to 11.0 and temperature below 40°C. The optimum pH and temperature of alkaline α-amylase was 9.0 and 50°C, respectively. Using soluble starch as the substrate, the Km and Vmax of alkaline α-amylase were 9.64 g/L and 0.80 g/(L·min), respectively. The effects of medium compositions (starch, peptone, and soybean meal) and temperature on the recombinant production of alkaline α-amylase in B. subtilis were investigated. Under the optimal conditions (starch concentration 0.6% (w/v), peptone concentration 1.45% (w/v), soybean meal concentration 1.3% (w/v), and temperature 37°C), the highest yield of alkaline α-amylase reached 415 U/mL. The yield of alkaline α-amylase in a 3-L fermentor reached 441 U/mL, which was 79 times that of native alkaline α-amylase from B. alcalophilus JN21. Conclusions This is the first report concerning the heterologous expression of alkaline α-amylase in B. subtilis, and the obtained results make it feasible to achieve the industrial production of alkaline α-amylase with the recombinant B. subtilis. PMID:21978209

  12. Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

    PubMed Central

    Yamazaki, H; Ohmura, K; Nakayama, A; Takeichi, Y; Otozai, K; Yamasaki, M; Tamura, G; Yamane, K

    1983-01-01

    amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems. Images PMID:6413492

  13. Regulation of amylase, cellulase and chitinase secretion in the digestive tract of the two-spotted field cricket, Gryllus bimaculatus.

    PubMed

    Weidlich, Sandy; Müller, Sonja; Hoffmann, Klaus H; Woodring, Joseph

    2013-06-01

    The secretion of amylase and cellulase in Gryllus bimaculatus is determined by increased food intake, whereby shortly after molting food consumption increases. About half of the standing amylase concentration (activity) in the endothelial cells can be secreted within 30 min. The peak of amylase and cellulase secretion that occurs in the photophase is related to the feeding peak in the previous scotophase. The secretion of chitinase on the other hand is primarily controlled by the molting cycle. Only amylase secretion was affected by calcium in the incubation medium, suggesting an apocrine release mechanism. Refeeding experiments (after 5 days without food) suggest that the release of amylase in response to a nutrient in the lumen (glucose) is not due to simple stimulation of exocytosis, but rather a stimulation of synthesis. © 2013 Wiley Periodicals, Inc.

  14. Genetic engineering of Lactococcus lactis to produce an amylase inhibitor for development of an anti-diabetes biodrug.

    PubMed

    D'Souza, Roshan; Pandeya, Dipendra Raj; Rahman, Mashiar; Seo Lee, Hyun; Jung, Jin-Kyoung; Hong, Seong-Tshool

    2012-01-01

    Diabetes is known as a multifactorial disease. The treatment of diabetes is complicated due to its inherent pathophysiological factors related to the disease. One of the complications of diabetes is postprandial hyperglycemia. Glucosidase inhibitors, particularly ?-amylase inhibitors can help manage postprandial hyperglycemia. The low molecular weight inhibitor of ? -amylases called PAMI (peptide amylase inhibitor) inhibits the ? -amylase. In this study we cloned this amylase blocker PAMI in Lactococcus lactis. Using this Lactococcus lactis expressing the PAMI, we prepared yogurt and fed it to diabetic mice models. There was decrease in the blood glucose level after 20 days of oral administration of the yogurt. This product be used as a biodrug in maintaining the blood glucose level in diabetic patients.

  15. Isolation and characterization of Taka-amylase A apoprotein deglycosylated by digestion with almond glycopeptidase immobilized on Sepharose.

    PubMed

    Takahashi, N; Toda, H; Nishibe, H; Yamamoto, K

    1982-10-05

    Taka-amylase A (1,4-alpha-D-glucan glucanohydrolase, EC 3.2.1.1), which contains a single asparagine-linked oligosaccharide unit, was digested with almond glycopeptidase immobilized on Sepharose 6B at 20 degrees C for 4 h. A maximum of 10% of the parent protein was isolated as apoprotein by column chromatography on Con-A Sepharose. The characteristics of the apoprotein were compared to those of the native Taka-amylase A. The removal of the sugar chain from Taka-amylase. A caused no change in the pH-activity profile or in kinetic parameters of the hydrolysis of soluble starch. The stability of the apoprotein toward changing pH and digestion by proteases did not show any appreciable difference from that of the native Taka-amylase. These results suggest that the carbohydrate moiety of Taka-amylase A is not an essential participant in the catalysis.

  16. Enzymic Mechanism of Starch Breakdown in Germinating Rice Seeds: 9. DE NOVO SYNTHESIS OF beta-AMYLASE.

    PubMed

    Okamoto, K; Akazawa, T

    1980-01-01

    Germinating rice seeds were fed with [(35)S]methionine and the incorporation of (35)S into beta-amylase demonstrated by quantitative immunoprecipitation using rabbit anti-beta-amylase immunoglobulin G fraction. Separation of the antigen-antibody complex by Na-dodecylsulfate gel electrophoresis and subsequent radioautography clearly showed the radioactive labeling of the beta-amylase molecule. The specific radioactivity of beta-amylase derived from scutellum by immunoprecipitation was significantly greater than that of the endosperm. The results strongly indicate that at the onset of germination of rice seeds beta-amylase is synthesized de novo in the scutellum and that in later stages there occurs activation of an inactive, latent form of the enzyme associated with starch granules in the endosperm. In later stages of germination this activated form of the enzyme becomes dominant.

  17. Identification of a new oat β-amylase by functional proteomics.

    PubMed

    Ben Halima, Nihed; Khemakhem, Bassem; Fendri, Imen; Ogata, Hiroyuki; Baril, Patrick; Pichon, Chantal; Abdelkafi, Slim

    2016-01-01

    Oat (Avena sativa L.) seed extracts exhibited a high degree of catalytic activity including amylase activities. Proteins in the oat seed extracts were optimized for their amylolytic activities. Oat extract with amylolytic activity was separated by SDS-PAGE and a major protein band with an apparent molecular mass of 53 kDa was subjected to tryptic digestion. The generated amino acid sequences were analyzed by liquid chromatography–tandem mass spectrometry (LC/ESI/MS/MS) and database searches. These sequences were used to identify a partial cDNA from expressed sequence tags (ESTs) of A. sativa L. Based upon EST sequences, a predicted full-length gene was identified, with an open reading frame of 1464 bp encoding a protein of 488 amino acid residues (AsBAMY), with a theoretical molecular mass of 55 kDa identified as a β-amylase belonging to the plant β-amylase family. Primary structure of oat β-amylase (AsBAMY) protein indicated high similarity with other β-amylase from other cereals such as wheat (Triticum aestivum), barley (Hordeum vulgare), and rye (Secale cereale) with two conserved Glu residues (E184 and E378) assigned as the “putative” catalytic residues which would act as an acid and base pair in the catalytic process. In addition, a 3D-model of AsBAMY was built from known X-ray structures and sequence alignments. A similar core (β/α)8-barrel architecture was found in AsBAMY like the other cereal β-amylases with a specific location of the active site in a pocket-like cavity structure made at one end of this core (β/α)8-barrel domain suggesting an accessibility of the non-reducing end of the substrate and thus confirming the results of AsBAMY exo-acting hydrolase.

  18. Cloning, Purification and Characterization of a Highly Thermostable Amylase Gene of Thermotoga petrophila into Escherichia coli.

    PubMed

    Zafar, Asma; Aftab, Muhammad Nauman; ud Din, Zia; Aftab, Saima; Iqbal, Irfana; ul Haq, Ikram

    2016-02-01

    A putative α-amylase gene of Thermotoga petrophila was cloned and expressed in Escherichia coli BL21 (DE3) using pET-21a (+), as an expression vector. The growth conditions were optimized for maximal expression of the α-amylase using various parameters, such as pH, temperature, time of induction and addition of an inducer. The optimum temperature and pH for the maximum expression of α-amylase were 22 °C and 7.0 pH units, respectively. Purification of the recombinant enzyme was carried out by heat treatment method, followed by ion exchange chromatography with 34.6-fold purification having specific activity of 126.31 U mg(-1) and a recovery of 56.25%. Molecular weight of the purified α-amylase, 70 kDa, was determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The enzyme was stable at 100 °C temperature and at pH of 7.0. The enzyme activity was increased in the presence of metal ions especially Ca(+2) and decreased in the presence of EDTA indicating that the α-amylase was a metalloenzyme. However, addition of 1% Tween 20, Tween 80 and β-mercaptoethanol constrained the enzyme activity to 87, 96 and 89%, respectively. No considerable effect of organic solvents (ethanol, methanol, isopropanol, acetone and n-butanol) was observed on enzyme activity. With soluble starch as a substrate, the enzyme activity under optimized conditions was 73.8 U mg(-1). The α-amylase enzyme was active to hydrolyse starch forming maltose.

  19. [Alpha-amylase as an occupational allergen in baking industry employees].

    PubMed

    De Zotti, R; Larese, F; Molinari, S

    1994-01-01

    In a group of 226 bakers and pastry makers and in 88 students of a training school for bakers, we evaluated skin sensitization to the common allergens, wheat and alpha amylase. Skin prick tests were positive to the enzyme in 17 exposed subjects (7.5%) and in one student with previous occupational exposure as a baker; 27 exposed subjects (11.9%) and 2 students were sensitized to wheat. Among the 42 exposed workers who complained of work-related symptoms, 12 (28.6%) cases were skin positive to amylase and 17 (42.9%) to wheat. Among the 17 workers who were positive to amylase, 16 were also sensitized to wheat and/or common allergens, 12 complained of symptoms at work but since in many cases there was a positive response to wheat, too, it is impossible to speculate on the role of each allergen in inducing symptoms. One case, with work-related rhinoconjunctivitis, had skin sensitization only to alpha amylase but no specific IgE in the serum. These findings confirm that bakers are at risk of sensitization not only to wheat allergen but also to amylase from Aspergillus oryzae. The enzyme should be included in the list of substances to be tested among bakers in whom an occupational allergy is suspected, but particular care should be taken in evaluating the cutaneous response, especially if compared to wheat wheals. Further investigations are also needed to identify the source of risk and to better define the characteristics of the enzyme and the relationship between skin reaction to amylase, sensitization to wheat and atopy.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. Redox regulation of a novel plastid-targeted beta-amylase of Arabidopsis.

    PubMed

    Sparla, Francesca; Costa, Alex; Lo Schiavo, Fiorella; Pupillo, Paolo; Trost, Paolo

    2006-07-01

    Nine genes of Arabidopsis (Arabidopsis thaliana) encode for beta-amylase isozymes. Six members of the family are predicted to be extrachloroplastic isozymes and three contain predicted plastid transit peptides. Among the latter, chloroplast-targeted beta-amylase (At4g17090) and thioredoxin-regulated beta-amylase (TR-BAMY; At3g23920; this work) are experimentally demonstrated to be targeted to plastids. Recombinant TR-BAMY was catalytically active only when expressed as a mature protein, i.e. with no transit peptide. Mature TR-BAMY was a monomer of 60 kD, hydrolyzing soluble starch with optimal activity between pH 6.0 and 8.0. The activity of recombinant TR-BAMY was strictly dependent on redox potential with an Em,7.0 of -302 +/- 14 mV. Thioredoxins f1, m1, and y1 of Arabidopsis were all able to mediate the reductive activation of oxidized TR-BAMY. Site-specific mutants showed that TR-BAMY oxidative inhibition depended on the formation of a disulfide bridge between Cys-32 and Cys-470. Consistent with TR-BAMY redox dependency, total beta-amylase activity in Arabidopsis chloroplasts was partially redox regulated and required reducing conditions for full activation. In Arabidopsis, TR-BAMY transcripts were detected in leaves, roots, flowers, pollen, and seeds. TR-BAMY may be the only beta-amylase of nonphotosynthetic plastids suggesting a redox regulation of starch metabolism in these organelles. In leaves, where chloroplast-targeted beta-amylase is involved in physiological degradation of starch in the dark, TR-BAMY is proposed to participate to a redox-regulated pathway of starch degradation under specific stress conditions.

  1. Performance Evaluation of a Salivary Amylase Biosensor for Stress Assessment in Military Field Research.

    PubMed

    Peng, Henry T; Savage, Erin; Vartanian, Oshin; Smith, Shane; Rhind, Shawn G; Tenn, Catherine; Bjamason, Stephen

    2016-05-01

    A convenient biosensor for real-time measurement of biomarkers for in-field psychophysiological stress research and military operations is desirable. We evaluated a hand-held device for measuring salivary amylase as a stress marker in medical technicians undergoing combat casualty care training using two different modalities in operating room and field settings. Salivary amylase activity was measured by two biosensor methods: directly sampling saliva with a test strip placed under the tongue or pipetting a fixed volume of precollected saliva onto the test strip, followed by analyzing the sample on the strip using a biosensor. The two methods were compared for their accuracy and sensitivity to detect the stress response using an enzyme assay method as a standard. The measurements from the under-the-tongue method were not as consistent with those from the standard assay method as the values obtained from the pipetting method. The under-the-tongue method did not detect any significant increase in the amylase activity due to stress in the operating room (P > 0.1), in contrast to the significant increases observed using the pipetting method and assay method with a significance level less than 0.05 and 0.1, respectively. Furthermore, the under-the-tongue method showed no increased amylase activity in the field testing, while both the pipetting method and assay method showed increased amylase activity in the same group (P < 0.1). The accuracy and consistency of the biosensors need to be improved when used to directly measure salivary amylase activity under the tongue for stress assessment in military medical training. © 2015 Her Majesty the Queen in Right of Canada. Journal of Clinical Laboratory Analysis published by Wiley Periodicals, Inc. Reproduced with the permission DRDC Editorial Board.

  2. Determination of salivary levels of mucin and amylase in chronic periodontitis patients.

    PubMed

    Sánchez, G A; Miozza, V; Delgado, A; Busch, L

    2011-04-01

    Patients with periodontal disease show differences in the profile of proteins in whole saliva. This profile reflects the nature and amplitude of the host response to a periodontal microbial challenge. Since periodontitis is a chronic inflammatory disease with different progression stages, the aim of the study was to evaluate the host response in these different clinical stages by assessing salivary flow rate, the concentrations of proteins and mucin and the amylase activity. Sixty adult subjects were clinically examined and distributed into four groups (n = 15) according to the periodontal status, namely, healthy, mild, moderate and severe periodontitis. Whole saliva was collected for 5 min, followed by a second 5 min sampling period with stimulation by chewing a paraffin block, and flow rate was determined. Salivary proteins, amylase and mucin were determined by colorimetric methods. The concentrations of proteins, amylase and mucin increased in subjects with moderate and severe periodontal disease in unstimulated saliva, while flow rate decreased. A positive correlation was found between proteins and amylase or mucin concentrations among the different groups, indicating that the concentrations changed in the same way, being the response of salivary glands to the disease, possibly to enhance the protective potential of saliva. Mucin concentration was lower in the mild periodontitis group. Mechanical stimulation induced an increase in flow rate and output of proteins, amylase and mucin. Periodontitis induces an increase in the output of proteins, including mucin and amylase, thereby enhancing the protective potential of saliva, but this is accompanied by a decrease in flow rate. © 2010 John Wiley & Sons A/S.

  3. Biochemical, structural and functional diversity between two digestive α-amylases from Helicoverpa armigera.

    PubMed

    Bhide, Amey J; Channale, Sonal M; Patil, Sucheta S; Gupta, Vidya S; Ramasamy, Sureshkumar; Giri, Ashok P

    2015-09-01

    Helicoverpa armigera (Lepidoptera) feeds on various plants using diverse digestive enzymes as one of the survival tool-kit. The aim of the present study was to understand biochemical properties of recombinant α-amylases of H. armigera viz., HaAmy1 and HaAmy2. The open reading frames of HaAmy1 and HaAmy2 were cloned in Pichia pastoris and expressed heterologously. Purified recombinant enzymes were characterized for their biochemical and biophysical attributes using established methods. Sequence alignment and homology modeling showed that HaAmy1 and HaAmy2 were conserved in their amino acid sequences and structures. HaAmy1 and HaAmy2 showed optimum activity at 60°C; however, they differed in their optimum pH. Furthermore, HaAmy2 showed higher affinity for starch and amylopectin whereas HaAmy1 had higher catalytic efficiency. HaAmy1 and HaAmy2 were inhibited to the same magnitude by a synthetic amylase inhibitor (acarbose) while wheat amylase inhibitor showed about 2-fold higher inhibition of HaAmy1 than HaAmy2 at pH7 while 6-fold difference at pH11. Interactions of HaAmy1 and HaAmy2 with wheat amylase inhibitor revealed 2:1 stoichiometric ratio and much more complex interaction with HaAmy1. The diversity of amylases in perspective of their biochemical and biophysical properties, and their differential interactions with amylase inhibitors signify the potential role of these enzymes in adaptation of H. armigera on diverse plant diets. Characterization of digestive enzymes of H. armigera provides the molecular basis for the polyphagous nature and thus could assist in designing future strategies for the insect control. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Serial Drain Amylase Can Accurately Detect Anastomotic Leak After Esophagectomy and May Facilitate Early Discharge.

    PubMed

    Perry, Yaron; Towe, Christopher W; Kwong, Jonathan; Ho, Vanessa P; Linden, Philip A

    2015-12-01

    Anastomotic leaks after esophagectomy are a significant cause of postoperative morbidity and death. Barium esophagram and esophagogastroduodenoscopy are commonly used to survey for leaks; however, each has inherent risks and limitations. We sought to evaluate the effectiveness of daily drain amylase levels in detecting anastomotic leaks after esophagectomy. We retrospectively reviewed 146 consecutive patients who underwent esophagectomy with cervical and intrathoracic anastomosis using gastric conduit. We collected daily drain amylase levels and obtained postoperative barium esophagrams routinely. Receiver operating characteristic analysis was performed to evaluate the ability of drain amylase to detect anastomotic leaks and to determine the sensitivity and specificity at various cutoff values. There were no in-hospital or outpatient deaths within 30 days of operation in this consecutive series of patients. A leak occurred in 22 of 146 esophagectomy patients (15%) that required postoperative intervention. An additional 13 patients (9%) had a leak requiring only alteration of diet or antibiotics. The sensitivity and specificity for barium esophagram was 36.9% and 95%, respectively. For drain amylase obtained on postoperative day 4, a cutoff of 38 IU/L yielded a sensitivity of 100% and a specificity of 52.0%, and a cutoff of 250 IU/L yielded a sensitivity of 66.7% and a specificity of 95.9% in detecting leaks eventually requiring intervention. Drain amylase levels recorded on day 4 after esophagectomy are more accurate for the detection of esophageal anastomotic leak than barium esophagram. Drain amylase levels represent a noninvasive test that may facilitate safe, early discharge after esophagectomy. Copyright © 2015 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

  5. Polymeric amylase nanoparticles as a new semi-synthetic enzyme system for hydrolysis of starch.

    PubMed

    Say, R; Şenay, R Hilal; Biçen, Özlem; Ersöz, Arzu; Şişman Yılmaz, Filiz; Akgöl, Sinan; Denizli, Adil

    2013-05-01

    α-Amylase (EC 3.2.1.1; α-D-1,4,glucan glucanohydrolase) catalyzes the hydrolysis of α-D-(1,4)-glucosidic linkages in starch, glycogen, and various malto-oligosaccharides, by releasing α-anomeric products. In this study, a novel method has been developed to prepare nanoprotein particles that carry α-amylase as a monomer by using a photosensitive microemulsion polymerization process. The nanostructured α-amylase with photosensitive features have been characterized by fluorescence spectroscopy, transmission electron microscopy (TEM) and Zeta Sizer. The fluorescence intensity of amylase nanoparticles was determined to be 658 a.u. at 610 nm and the average particle size of nanoamylase was found to be about 71.8 nm. Both free α-amylase and nanoparticles were used in the hydrolysis of starch under varying reaction conditions such as pH and temperature that affect enzyme activity and the results were compared to each other. Km values were 0.26 and 0.87 mM and Vmax values were 0.36 IU mg(-1) and 22.32 IU mg(-1) for nanoenzyme and free enzyme, respectively. Then, thermal stability, storage stability and reusability were investigated and according to the results, activity was preserved 60% at 60 °C; 20% at 70-80 °C temperature values and 80% after 105 days storage. Finally after 10 cycles, the activity was preserved 90% and this novel enzymatic polymeric amylase nanoparticle has showed considerable potential as reusable catalyst. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Prevalence of the Amylase-Binding Protein A Gene (abpA) in Oral Streptococci

    PubMed Central

    Brown, Alan E.; Rogers, Jeffrey D.; Haase, Elaine M.; Zelasko, Peter M.; Scannapieco, Frank A.

    1999-01-01

    Salivary amylase binds specifically to a number of oral streptococcal species. This interaction may play an important role in dental plaque formation. Recently, a 585-bp gene was cloned and sequenced from Streptococcus gordonii Challis encoding a 20.5-kDa amylase-binding protein (AbpA). The goal of this study was to determine if related genes are present in other species of oral streptococci. Biotinylated abpA was used in Southern blot analysis to screen genomic DNA from several strains representing eight species of oral streptococci. This probe hybridized with a 4.0-kb HindIII restriction fragment from all 13 strains of S. gordonii tested. The probe did not appear to bind to any restriction fragments from other species of amylase-binding oral streptococci including Streptococcus mitis (with the exception of 1 of 14 strains), Streptococcus crista (3 strains), Streptococcus anginosus (1 strain), and Streptococcus parasanguinis (1 strain), or to non-amylase-binding oral streptococci including Streptococcus sanguinis (3 strains), Streptococcus oralis (4 strains), and Streptococcus mutans (1 strain). Primers homologous to sequences within the 3′ and 5′ ends of abpA yielded products of 400 bp following PCR of genomic DNA from the Southern blot-positive strains. Several of these PCR products were cloned and sequenced. The levels of similarity of these cloned products to the abpA of S. gordonii Challis ranged from 91 to 96%. These studies reveal that the abpA gene appears to be specific to S. gordonii and differs from genes encoding amylase-binding proteins from other species of amylase-binding streptococci. PMID:10565935

  7. The baseline serum value of α-amylase is a significant predictor of distance running performance.

    PubMed

    Lippi, Giuseppe; Salvagno, Gian Luca; Danese, Elisa; Tarperi, Cantor; La Torre, Antonio; Guidi, Gian Cesare; Schena, Federico

    2015-02-01

    This study was planned to investigate whether serum α-amylase concentration may be associated with running performance, physiological characteristics and other clinical chemistry analytes in a large sample of recreational athletes undergoing distance running. Forty-three amateur runners successfully concluded a 21.1 km half-marathon at 75%-85% of their maximal oxygen uptake (VO2max). Blood was drawn during warm up and 15 min after conclusion of the run. After correction for body weight change, significant post-run increases were observed for serum values of alkaline phosphatase, alanine aminotransferase, aspartate aminotransferase, bilirubin, creatine kinase (CK), iron, lactate dehydrogenase (LDH), triglycerides, urea and uric acid, whereas the values of body weight, glomerular filtration rate, total and low density lipoprotein-cholesterol were significantly decreased. The concentration of serum α-amylase was unchanged. In univariate analysis, significant associations with running performance were found for gender, VO2max, training regimen and pre-run serum values of α-amylase, CK, glucose, high density lipoprotein-cholesterol, LDH, urea and uric acid. In multivariate analysis, only VO2max (p=0.042) and baseline α-amylase (p=0.021) remained significant predictors of running performance. The combination of these two variables predicted 71% of variance in running performance. The baseline concentration of serum α-amylase was positively correlated with variation of serum glucose during the trial (r=0.345; p=0.025) and negatively with capillary blood lactate at the end of the run (r=-0.352; p=0.021). We showed that the baseline serum α-amylase concentration significantly and independently predicts distance running performance in recreational runners.

  8. Retention of enzymatic activity of alpha-amylase in the reductive synthesis of gold nanoparticles.

    PubMed

    Rangnekar, Abhijit; Sarma, Tridib Kumar; Singh, Atul Kumar; Deka, Jashmini; Ramesh, Aiyagari; Chattopadhyay, Arun

    2007-05-08

    In this paper, we report the generation of Au nanoparticles (NPs), using a pure enzyme for the reduction of AuCl4(-), with the retention of enzymatic activity in the complex. As a model system, alpha-amylase was used to readily synthesize and stabilize Au NPs in aqueous solution. Although several other enzymes were also pursued for the synthesis, it was interesting to observe that only alpha-amylase and EcoRI could produce Au NPs. Following NP synthesis, the activity of the enzyme was retained in the Au NP-alpha-amylase complex. The presence of Au NPs and alpha-amylase in the complex was established by UV-visible and FT-IR spectroscopy, X-ray diffraction (XRD) and transmission electron microscopic (TEM) measurements. Our observations suggest that the presence of free and exposed S-H groups is essential in the reduction of AuCl4(-) to Au NPs. Structural analysis of the enzymes showed that both alpha-amylase and EcoRI enzymes have free and exposed S-H groups in their native form and thus are suitable for the generation of NPs, whereas the other ones used here do not have such groups. Fortuitously, the enzymatic functional group of alpha-amylase is positioned opposite to that of the free and exposed S-H group, which makes it ideal for the production of Au NPs; binding of the enzyme to Au NPs via Au-S bond and also retention of the biological activity of the enzyme.

  9. Componential profile and amylase inhibiting activity of phenolic compounds from Calendula officinalis L. leaves.

    PubMed

    Olennikov, Daniil N; Kashchenko, Nina I

    2014-01-01

    An ethanolic extract and its ethyl acetate-soluble fraction from leaves of Calendula officinalis L. (Asteraceae) were found to show an inhibitory effect on amylase. From the crude extract fractions, one new phenolic acid glucoside, 6'-O-vanilloyl-β-D-glucopyranose, was isolated, together with twenty-four known compounds including five phenolic acid glucosides, five phenylpropanoids, five coumarins, and nine flavonoids. Their structures were elucidated based on chemical and spectral data. The main components, isoquercitrin, isorhamnetin-3-O-β-D-glucopyranoside, 3,5-di-O-caffeoylquinic acid, and quercetin-3-O-(6''-acetyl)-β-D-glucopyranoside, exhibited potent inhibitory effects on amylase.

  10. [Flow rate, amylase and protein content of parotid saliva in sialadenosis (author's transl)].

    PubMed

    Chilla, R; Opaitz, M; Arglebe, C

    1978-03-01

    Flow rate, protein concentration and amylase activity of parotid saliva were investigated in 17 patients with sialadenosis. The results were compared with the data obtained from 90 healthy controls. Total protein and amylase concentrations of saliva did not change although, under the influence of sialadenosis, the parotid gland clearly shows ultrastructural signs of disturbed protein secretion. Also the flow rates of parotid saliva were the same in sialadenosis patients and the control group. This can be explained by the patho-physiology of parotid secretion from the sialadenotic gland.

  11. Biochemical approaches of increasing thermostability of beta-amylase from Bacillus megaterium B6.

    PubMed

    Ray, R R; Jana, S C; Nanda, G

    1994-12-12

    Studies on the irreversible thermoinactivation of beta-amylase from Bacillus megaterium B6 exposed to 60 degrees C revealed that the deactivation mechanism probably results from the oxidation of thiols present at the active site of the enzyme. Several attempts were made to increase its thermostability, which indicated that Mn2+ played a key role in determining thermostability and partially reactivating the inactivated enzyme. Immobilization of beta-amylase through gel-entrapment and covalent crosslinking brought about a remarkable increase in thermotolerance with about a 14-fold increase in catalytic half-life.

  12. Structure-based discovery of a new affinity ligand to pancreatic alpha-amylase.

    PubMed

    Westerfors, Maria; Tedebark, Ulf; Andersson, Hans O; Ohrman, Sara; Choudhury, Devapriya; Ersoy, Oguz; Shinohara, Yasuro; Axén, Andreas; Carredano, Enrique; Baumann, Herbert

    2003-01-01

    A ligand useful for affinity capture of porcine pancreatic alpha-amylase was found by virtual screening of the commercially available compound data base MDL Available Chemicals Directory. Hits from the virtual screening were investigated for binding by nuclear magnetic resonance (NMR) and surface plasmon resonance. Selected compounds were tested for inhibition of the enzyme using a NMR-based assay. One of the binders found was covalently coupled to a chromatographic resin and a column, packed with this resin, could retain alpha-amylase, which subsequently was eluted by introduction of the known inhibitor acarbose to the elution buffer. Copyright 2003 John Wiley & Sons, Ltd.

  13. Multiple Forms of Amylase Induced by Gibberellic Acid in Isolated Barley Aleurone Layers 1

    PubMed Central

    Jacobsen, John V.; Scandalios, J. G.; Varner, J. E.

    1970-01-01

    The addition of gibberellic acid to isolated aleurone layers of barley (Hordeum vulgare L.) causes the production and secretion of four α-amylases. Two of these are stable at pH 3.7 and are not inactivated by ethylenediaminetetraacetate. The other two represent the classical barley α-amylases; i.e., they are inactivated at pH 3.7 and by reagents which from complexes with divalent metal ions. All four forms are synthesized de novo in response to the addition of gibberellic acid. Images PMID:5427106

  14. High urine amylase level and the risk of enteric conversion in solitary pancreas transplant recipients.

    PubMed

    Kukla, A; Radosevich, D M; Finger, E B; Kandaswamy, R

    2014-01-01

    Compared with enteric drainage, bladder-drained solitary pancreas transplants can be monitored for rejection by measuring urine amylase levels. However, bladder drainage is associated with a higher risk of infection and metabolic complications, necessitating enteric conversion in about one third of patients. We hypothesized that hypersecreting pancreata with high urine amylase levels have a higher propensity for enteric conversion from an antecedent elevated enzymatic effect on the urinary tract and increased fluid losses. We analyzed the risk for enteric conversion in 312 bladder-drained solitary pancreas transplant recipients. Urine amylase levels at 30 days were used to identify those at risk for enteric conversion. Time-to-event analysis was used to evaluate the risk of enteric conversion at 10 years, adjusting for urine amylase level and other confounding factors. Confounding risk factors statistically related to enteric conversion were incorporated into the multivariable analysis by using Cox proportional hazards regression at 3 years' posttransplant. During the median follow-up of 184.6 months, 31% of recipients underwent duct conversion. A majority of recipients (84.5%) who required duct conversion were primary transplants. The 30-day median urine amylase level was 1749 IU/h (quartile 1, <777 IU/h; quartile 3, ≥3272 IU/h). Using receiver operating characteristic analysis, it was determined that urine amylase levels >3272 IU/h had the greatest specificity for predicting risk of enteric conversion. In the multivariate analysis, high urine amylase levels increased the risk of enteric conversion only in repeated pancreas transplants. Primary transplants are more likely to undergo enteric conversion than retransplants. High urine amylase levels increase the risk of enteric conversion in retransplants only, and therefore this enzyme alone cannot serve as the sole predictor for conversion in primary transplants. Other factors, such as fluid and bicarbonate

  15. Exposure to inhalable dust, wheat flour and alpha-amylase allergens in industrial and traditional bakeries.

    PubMed

    Bulat, Petar; Myny, Katrien; Braeckman, Lutgart; van Sprundel, Marc; Kusters, Edouard; Doekes, Gert; Pössel, Kerstin; Droste, Jos; Vanhoorne, Michel

    2004-01-01

    This study was designed to characterize exposure to inhalable dust, wheat flour and alpha-amylase allergens in industrial and traditional bakeries. The study included 70 bakeries from the northern part of Belgium. Based on the degree of automation and a clear division of individual job tasks, four bakeries were identified as industrial and the remaining 66 were identified as traditional ones. Personal, as well as stationary, samples of inhalable dust were collected during full shift periods, usually 5-7 h. The portable pumps aspirated 2 l/min through Teflon personal dust samplers (Millipore, pore size 1.0 microm) mounted in PAS-6 sampling heads. In the collected samples the inhalable dust, wheat flour and alpha-amylase allergens were determined. Wheat flour allergens were measured using enzyme-linked immunosorbent assay inhibition and an antiwheat IgG4 serum pool. The alpha-amylase allergens were measured using a sandwich enzyme immunoassay with affinity-purified polyclonal rabbit IgG antibodies. In total, 440 samples (300 personal and 140 stationary) were processed. The highest inhalable dust exposure was observed in traditional bakeries among bread [geometric mean (GM) 2.10 mg/m3] and bread and pastry workers (GM 1.80 mg/m3). In industrial bakeries the highest dust exposure was measured in bread-producing workers (GM 1.06 mg/m3). Similar relations were observed for wheat flour and alpha-amylase allergens. Bread baking workers in traditional bakeries had the highest exposure to both allergens (wheat flour GM 22.33 microg/m(3), alpha-amylase GM 0.61 ng/m3). The exposure to wheat flour and alpha-amylase allergens in industrial bakeries was higher in bread baking workers (wheat flour GM 6.15 microg/m3, alpha-amylase GM 0.47 ng/m3) than in bread packing workers (wheat flour GM 2.79 microg/m3, alpha-amylase GM 0.15 ng/m3). The data presented suggest that, on average, exposure in the Belgium bakeries studied-industrial as well as traditional-is lower than or similar to

  16. Partial Purification and Characterization of a Thermostable Actinomycete beta-Amylase.

    PubMed

    Obi, S K; Odibo, F J

    1984-03-01

    A thermostable amylase, possibly a beta-amylase from Thermoactinomyces sp. no. 2 isolated from soil, is reported. The enzyme was purified 36-fold by acetone precipitation, ion-exchange chromatography, and Sephadex G-200 gel filtration, and the molecular weight was estimated at 31,600. The enzyme was characterized by demonstration of optimum activity at 60 degrees C and pH 7 and by retention of 70% activity at 70 degrees C (30 min). It was stimulated by Mn and Fe but strongly inhibited by Hg. Maltose was the only detectable product of hydrolysis of starches and was quantitatively highest in plantain starch hydrolysate.

  17. Phenolic group on A-ring is key for dracoflavan B as a selective noncompetitive inhibitor of α-amylase.

    PubMed

    Toh, Zhi Siang; Wang, Hongyu; Yip, Yew Mun; Lu, Yuyun; Lim, Benedict Jeffrey Ang; Zhang, Daiwei; Huang, Dejian

    2015-12-15

    A high throughput assay was applied to guide the isolation of a new pancreatic α-amylase inhibitor, dracoflavan B, from the dragon's blood resin from Daemonorops draco. Applying C18 column, we successfully isolated both diastereomers and their structures verified by (1)H NMR spectra in comparison with the literature values. Their activity in inhibition of pancreatic α-amylase with comparable IC50 values of 23μM (A type) and 27μM (B type) that are similar to that of acarbose. Dracoflavan B shows much weaker activity in inhibiting bacterial α-amylase and no activity towards fungal α-amylase. Moreover, both isomers show no inhibitory activity towards mammalian α-glucosidase. Kinetic analysis revealed that using starch as the substrate, dracoflavan B was a non-competitive α-amylase inhibitor with a Ki value of 11.7μM. Lack of α-amylase inhibition for proanthocyanidin A2 dimer demonstrated that dracoflavan B hydrophobic nature of the B, A', C' and B' rings are important for its α-amylase inhibition. In addition, selective chemical modification studies revealed that the phenolic group is also vital to dracoflavan B for its pancreatic α-amylase inhibition activity. Without the A ring phenolic hydrogen bond donor, the derivatives of dracoflavan B showed detrimental α-amylase inhibition. On the contrary, galloylation on the A ring phenolic OH group enhanced the activity as shown by the low IC50 (12μM) against α-amylase which is 56% more potent as compared to dracoflavan B. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Dry-grind processing using amylase corn and superior yeast to reduce the exogenous enzyme requirements in bioethanol production.

    PubMed

    Kumar, Deepak; Singh, Vijay

    2016-01-01

    Conventional corn dry-grind ethanol production process requires exogenous alpha and glucoamylases enzymes to breakdown starch into glucose, which is fermented to ethanol by yeast. This study evaluates the potential use of new genetically engineered corn and yeast, which can eliminate or minimize the use of these external enzymes, improve the economics and process efficiencies, and simplify the process. An approach of in situ ethanol removal during fermentation was also investigated for its potential to improve the efficiency of high-solid fermentation, which can significantly reduce the downstream ethanol and co-product recovery cost. The fermentation of amylase corn (producing endogenous α-amylase) using conventional yeast and no addition of exogenous α-amylase resulted in ethanol concentration of 4.1 % higher compared to control treatment (conventional corn using exogenous α-amylase). Conventional corn processed with exogenous α-amylase and superior yeast (producing glucoamylase or GA) with no exogenous glucoamylase addition resulted in ethanol concentration similar to control treatment (conventional yeast with exogenous glucoamylase addition). Combination of amylase corn and superior yeast required only 25 % of recommended glucoamylase dose to complete fermentation and achieve ethanol concentration and yield similar to control treatment (conventional corn with exogenous α-amylase, conventional yeast with exogenous glucoamylase). Use of superior yeast with 50 % GA addition resulted in similar increases in yield for conventional or amylase corn of approximately 7 % compared to that of control treatment. Combination of amylase corn, superior yeast, and in situ ethanol removal resulted in a process that allowed complete fermentation of 40 % slurry solids with only 50 % of exogenous GA enzyme requirements and 64.6 % higher ethanol yield compared to that of conventional process. Use of amylase corn and superior yeast in the dry-grind processing industry

  19. Property of midgut α-amylase from Mythimna separata (Lepidoptera: Noctuidae) larvae and its responses to potential inhibitors in vitro.

    PubMed

    Xu, Wenping; Huang, Qingchun; Wu, Xiwei; Yu, Xiaoqin; Wang, Xuexiao; Tao, Liming

    2014-01-01

    Midgut α-amylase is an important digestive enzyme involved in larval energy metabolism and carbohydrate assimilation. In this article, the properties of midgut α-amylase from the Oriental armyworm, Mythimna separata (Lepidoptera: Noctuidae), larvae were characterized, and its in vitro responses to chemical inhibitors were also determined. The kinetic parameters Km and Vmax of midgut α-amylase were 0.064 M, 4.81 U mg pro(-1) in phosphate buffer, and 0.128 M, 1.96 U mg pro(-1) in barbiturate-acetate buffer; α-amylase activity linearly increased as starch concentration increased. α-Amylase activity was not influenced by amino acids such as Pro, Met, Try, His, Ala, and Phe but was strongly activated by antioxidants. Reduced glutathione, 1,4-dithiothreitol, β-mercaptoethanol, and ascorbic acid improved the activity of α-amylase about 2.06, 3.46, 3.37, and 6.38 times, respectively, relative to the control. Ethylenediaminetetraacetic acid, sodium dodecyl sulfonate, and N-bromosuccinimide (NBS) strongly inhibited α-amylase. α-, β-, and γ-cyclodextrin were not the preferred substrates for α-amylase. Kinetic analysis showed that IC50 value of NBS against α-amylase was 1.52 (±0.26) µM, and the mode of action of NBS with Ki as 2.53 (0.35) µM was a mixed-type inhibition that indicated a combination of partial competitive and pure noncompetitive inhibition. The midgut α-amylase of armyworm larvae may be a potential target for novel insecticide development and pest control. © The Author 2014. Published by Oxford University Press on behalf of the Entomological Society of America.

  20. Efficient synthesis and secretion of a thermophilic alpha-amylase by protein-producing Bacillus brevis 47 carrying the Bacillus stearothermophilus amylase gene.

    PubMed Central

    Tsukagoshi, N; Iritani, S; Sasaki, T; Takemura, T; Ihara, H; Idota, Y; Yamagata, H; Udaka, S

    1985-01-01

    Bacillus subtilis and Bacillus brevis 47-5, carrying the Bacillus stearothermophilus alpha-amylase gene on pUB110 (pBAM101), synthesized the same alpha-amylase as the donor strain as determined by the enzyme's thermal stability and NH2-terminal amino acid sequence. Regardless of the host, the 34-amino acid signal peptide of the enzyme was processed at exactly the same site between two alanine residues. B. brevis 47-5(pBAM101) secreted the enzyme most efficiently of the hosts examined, 100, 15, and 5 times more than B. stearothermophilus, Escherichia coli HB101(pH1301), and B. subtilis 1A289(pBAM101), respectively. The efficient secretion of the enzyme in B. brevis 47-5(pBAM101) was suggested to be due to the unique properties of the cell wall of this organism. Images PMID:2999073

  1. Isolation of a cDNA Clone for alpha-Amylase in Mung Bean Cotyledons : Analysis of alpha-Amylase mRNA Levels in Cotyledons during and following Germination of Mung Bean Seeds.

    PubMed

    Koizuka, N; Tanaka, Y; Morohashi, Y

    1990-11-01

    A cDNA was isolated that codes for alpha-amylase in mung bean (Vigna radiata) cotyledons, and the nucleotide sequence was determined. The deduced amino acid sequence (421 amino acid residues) is about 65% homologous with those of barley alpha-amylases. By comparing the deduced sequence with the sequence of the purified alpha-amylase, it was inferred that 23 N-terminal amino acids of a nascent polypeptide represent a signal peptide. Northern blot analysis showed that the levels of alpha-amylase mRNA are in parallel with the activities of alpha-amylase synthesis in cotyledons. Under the conditions where the solute leakage from cotyledons is accelerated during imbibition, a rapid increase in the amount of the alpha-amylase mRNA occurs. We postulate that a factor(s) which regulates in an inhibitory manner the alpha-amylase expression at the transcriptional level may be present in dry cotyledons and be removed by leakage.

  2. Dose- and tissue-specific interaction of monoterpenes with the gibberellin-mediated release of potato tuber bud dormancy, sprout growth and induction of α-amylases and β-amylases.

    PubMed

    Rentzsch, Sonja; Podzimska, Dagmara; Voegele, Antje; Imbeck, Madeleine; Müller, Kerstin; Linkies, Ada; Leubner-Metzger, Gerhard

    2012-01-01

    Gibberellins (GA) are involved in bud dormancy release in several species. We show here that GA-treatment released bud dormancy, initiated bud sprouting and promoted sprout growth of excised potato tuber bud discs ('eyes'). Monoterpenes from peppermint oil (PMO) and S-(+)-carvone (CAR) interact with the GA-mediated bud dormancy release in a hormesis-type response: low monoterpene concentrations enhance dormancy release and the initiation of bud sprouting, whereas high concentrations inhibit it. PMO and CAR did, however, not affect sprout growth rate after its onset. We further show that GA-induced dormancy release is associated with tissue-specific regulation of α- and β-amylases. Molecular phylogenetic analysis shows that potato α-amylases cluster into two distinct groups: α-AMY1 and α-AMY2. GA-treatment induced transcript accumulation of members of both α-amylase groups, as well as α- and β-amylase enzyme activity in sprout and 'sub-eye' tissues. In sprouts, CAR interacts with the GA-mediated accumulation of α-amylase transcripts in an α-AMY2-specific and dose-dependent manner. Low CAR concentrations enhance the accumulation of α-AMY2-type α-amylase transcripts, but do not affect the α-AMY1-type transcripts. Low CAR concentrations also enhance the accumulation of α- and β-amylase enzyme activity in sprouts, but not in 'sub-eye' tissues. In contrast, high CAR concentrations have no appreciable effect in sprouts on the enzyme activities and the α-amylase transcript abundances of either group. The dose-dependent effects on the enzyme activities and the α-AMY2-type α-amylase transcripts in sprouts are specific for CAR but not for PMO. Different monoterpenes therefore may have specific targets for their interaction with hormone signalling pathways.

  3. How Do Detergents Work? A Qualitative Assay to Measure Amylase Activity

    ERIC Educational Resources Information Center

    Novo, M. Teresa; Casanoves, Marina; Garcia-Vallvé, Santi; Pujadas, Gerard; Mulero, Miquel; Valls, Cristina

    2016-01-01

    We present a practical activity focusing on two main goals: to give learners the opportunity to experience how the scientific method works and to increase their knowledge about enzymes in everyday situations. The exercise consists of determining the amylase activity of commercial detergents. The methodology is based on a qualitative assay using a…

  4. Chromosomal integration of recombinant alpha-amylase and glucoamylase genes in saccharomyces cerevisiae for starch conversion

    USDA-ARS?s Scientific Manuscript database

    Recombinant constructs of barley '-amylase and Lentinula edodes glucoamylase genes were integrated into the chromosomes of Saccharomyces cerevisiae. The insertion was confirmed by PCR amplification of the gene sequence in the chromosomes. The expression was analyzed by SDS-PAGE of the enzymes puri...

  5. Biochemistry, Structure and Function of Non-Wheat Proteins: Case Study of Barley ß-Amylase

    USDA-ARS?s Scientific Manuscript database

    The importance of a protein is not always evident and may be due to its multifunctional nature. ß-Amylase in seeds of barley (Hordeum vulgare L.) constitutes approximately 2% of the total protein in mature seeds and is assumed to be important when storage proteins are mobilized to support protein s...

  6. Production of α-amylase for the biosynthesis of gold nanoparticles using Streptomyces sp. MBRC-82.

    PubMed

    Manivasagan, Panchanathan; Venkatesan, Jayachandran; Kang, Kyong-Hwa; Sivakumar, Kannan; Park, Sun-Joo; Kim, Se-Kwon

    2015-01-01

    Marine actinobacterial synthesis of gold nanoparticles has good potential to develop simple, cost-effective and eco-friendly methods for production of important biomaterials. In this context, gold nanoparticles have attracted considerable attention in recent years, owing to their various applications. In this paper, we report on the production of α-amylase for the extracellular synthesis of gold nanoparticles using Streptomyces sp. MBRC-82. Medium composition and culture conditions for α-amylase production were statistically optimized. Plackett-Burman design was employed to find out the optimal medium constituents and culture conditions to enhance α-amylase production. Box-Behnken design revealed that three independent variables namely soluble starch (5.8484 g), peptone (3.5191 g), and NaCl (0.3829) significantly influenced α-amylase production. The gold nanoparticles were characterized by ultraviolet-visible (UV-vis) spectrometer, X-ray diffractometer (XRD), Fourier transform infrared spectroscopy (FTIR), scanning electron microscopy (SEM), energy dispersive X-ray analysis (EDXA), and transmission electron microscopy (TEM). The particles synthesized using the optimized enzyme activity ranged from 20 to 80 nm with an average particle size of 40 nm and therefore can be extended to various medicinal applications.

  7. Increased production of alpha-amylase by Bacillus amyloliquefaciens in the presence of glycine

    SciTech Connect

    Zhang, Q.; Tsukagoshi, N.; Miyashiro, S.; Udaka, S.

    1983-07-01

    The production of alpha-amylase by Bacillus amyloliquefaciens increased by a factor of 300 when glycine was added to a chemically defined simple medium at the early-logarithmic phase of growth. Glycine was not metabolized to a significant extent under the conditions used, but it considerably prevented the lowering of the pH of the culture. (Refs. 10).

  8. Amy63, a novel type of marine bacterial multifunctional enzyme possessing amylase, agarase and carrageenase activities

    PubMed Central

    Liu, Ge; Wu, Shimei; Jin, Weihua; Sun, Chaomin

    2016-01-01

    A multifunctional enzyme is one that performs multiple physiological functions, thus benefiting the organism. Characterization of multifunctional enzymes is important for researchers to understand how organisms adapt to different environmental challenges. In the present study, we report the discovery of a novel multifunctional enzyme Amy63 produced by marine bacterium Vibrio alginolyticus 63. Remarkably, Amy63 possesses amylase, agarase and carrageenase activities. Amy63 is a substrate promiscuous α-amylase, with the substrate priority order of starch, carrageenan and agar. Amy63 maintains considerable amylase, carrageenase and agarase activities and stabilities at wide temperature and pH ranges, and optimum activities are detected at temperature of 60 °C and pH of 6.0, respectively. Moreover, the heteroexpression of Amy63 dramatically enhances the ability of E. coli to degrade starch, carrageenan and agar. Motif searching shows three continuous glycosyl hydrolase 70 (GH70) family homologs existed in Amy63 encoding sequence. Combining serial deletions and phylogenetic analysis of Amy63, the GH70 homologs are proposed as the determinants of enzyme promiscuity. Notably, such enzymes exist in all kingdoms of life, thus providing an expanded perspective on studies of multifunctional enzymes. To our knowledge, this is the first report of an amylase having additional agarase and carrageenase activities. PMID:26725302

  9. Homology modeling and molecular dynamics study on Schwanniomyces occidentalis alpha-amylase.

    PubMed

    Sefidbakht, Yahya; Ranaei Siadat, Omid; Taheri, Fatemeh

    2017-02-01

    With consumers growing increasingly aware of environmental issues, industries find enzymes as a reasonable alternative over physical conditions and chemical catalysts. Amylases are important hydrolase enzymes, which have been widely used in variety of industrial process such as pharmaceutical, food, and fermentation industries. Among amylases α-Amylase is in maximum demand due to its wide range of applications. The homology modeling study on Schwanniomyces occidentalis amylase (AMY1, UniProt identifier number: P19269) was performed by Modeller using Aspergillus oryzae (6TAA) as the template. The resulting structure was analyzed for validity and subjected to 14 ns of molecular dynamics (MD) simulation trough GROMACS. The validity of obtained model may represent that utilized OPLS force field is suitable for calcium-containing enzymes. DSSP secondary structure and contact map analysis represent the conservation of domain A TIM barrel feature together with calcium ion coordination sphere. Investigating the covariance matrix followed by principle component analyses for the first five eigenvectors of both trajectories indicate a little more flexibility for AMY1 structure. The electrostatic calculation for the final structures shows similar isoelectric point and superimposed buffering zone in the 5-8 pH range.

  10. Attenuation of Porphyromonas gingivalis oral infection by α-amylase and pentamidine.

    PubMed

    Li, Ying; Miao, Yu-Song; Fu, Yun; Li, Xi-Ting; Yu, Shao-Jie

    2015-08-01

    The Porphyromonas gingivalis bacterium is one of the most influential pathogens in oral infections. In the current study, the antimicrobial activity of α-amylase and pentamidine against Porphyromonas gingivalis was evaluated. Their in vitro inhibitory activity was investigated with the agar overlay technique, and the minimal inhibitory and bactericidal concentrations were determined. Using the bactericidal concentration, the antimicrobial actions of the inhibitors were investigated. In the present study, multiple techniques were utilized, including scanning electron microscopy (SEM), general structural analysis and differential gene expression analysis. The results obtained from SEM and bactericidal analysis indicated a notable observation; the pentamidine and α-amylase treatment destroyed the structure of the bacterial cell membranes, which led to cell death. These results were used to further explore these inhibitors and the mechanisms by which they act. Downregulated expression levels were observed for a number of genes coding for hemagglutinins and gingipains, and various genes involved in hemin uptake, chromosome replication and energy production. However, the expression levels of genes associated with iron storage and oxidative stress were upregulated by α-amylase and pentamidine. A greater effect was noted in response to pentamidine treatment. The results of the present study demonstrate promising therapeutic potential for α-amylases and pentamidine. These molecules have the potential to be used to develop novel drugs and broaden the availability of pharmacological tools for the attenuation of oral infections caused by Porphyromonas gingivalis.

  11. Improvement of Bacillus circulans beta-amylase activity attained using the ancestral mutation method.

    PubMed

    Yamashiro, Kan; Yokobori, Shin-ichi; Koikeda, Satoshi; Yamagishi, Akihiko

    2010-07-01

    Thermostabilization of enzymes is one of the greatest challenges of protein engineering. The ancestral mutation method, which introduces ancestral residues into a target enzyme, has previously been developed and used to improve the thermostabilities of thermophilic enzymes. Herein, we report a study that used the ancestral mutation method to improve the thermostability of Bacillus circulans beta-amylase, a mesophilic enzyme. A bacterial, common-ancestral beta-amylase sequence was inferred using a phylogenetic tree composed of higher plant and bacterial amylase sequences. Eighteen mutants containing ancestral residues were designed, expressed in Escherichia coli and purified. Several of these mutants were more thermostable than that of the wild-type amylase. Notably, one mutant had both greater activity and greater thermostability. The relationship between the extent to which the amino acid residues within 5 A of the mutation site were evolutionarily conserved and the extent to which thermostability was improved was examined. Apparently, it is necessary to conserve the residues surrounding an ancestral residue if thermostability is to be improved by the ancestral mutation method.

  12. Structural and biochemical features of acidic α-amylase of Bacillus acidicola.

    PubMed

    Sharma, Archana; Satyanarayana, T

    2013-10-01

    The investigation is aimed at understanding structure-function aspect of α-amylase of an acidophilic bacterium Bacillus acidicola (BAamy), which is Ca(2+)-independent and active at acidic pH of native starch, and thus, suits better in starch saccharification process. The CD spectroscopic data analysis revealed that the enzyme has 30% α-helices, 14.2% β-sheets, and 55.8% random coils at 60 °C and pH 4.0. Using Bacillus stearothermophilus α-amylase (BStA) as the template, 3-D structure of rBAamy has been proposed. A complete loss in α-amylase activity was recorded when the amino acid residues (D231, E261 and D328) were substituted that confirmed their role in catalysis. The CD studies indicated a decrease in the α-helices content below and beyond the optimum pH and temperature that suggests a critical role of α-helix in maintaining the structural conformation of the enzyme. Fluorescence-quenching by N-bromosuccinimide (NBS) suggested the role of tryptophan in maintaining structural integrity of α-amylase and that by acrylamide indicated interaction by simple collision process. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Extraction and purification of beta-amylase from stems of Abrus precatorius by three phase partitioning.

    PubMed

    Sagu, Sorel Tchewonpi; Nso, Emmanuel Jong; Homann, Thomas; Kapseu, César; Rawel, Harshadrai M

    2015-09-15

    The stems of Abrus precatorius were used to extract a beta-amylase enriched fraction. A three phase partitioning method and a Doehlert design with 3 variables (ratio of crude extract/t-butanol, the ammonium sulphate saturation and pH) were used. The data was fitted in a second-order polynomial model and the parameters were optimized to enrich beta-amylase. Experimental responses for the modulation were recovery of activity and the purification factor. The optimal conditions were: a ratio of crude extract/t-butanol of 0.87 (v/v), saturation in ammonium sulphate of 49.46% (w/v) and a pH of 5.2. An activity recovery of 156.2% and a purification factor of 10.17 were found. The enriched enzyme was identified as a beta-amylase and its molecular weight was 60.1kDa. Km and Vmax values were 79.37mg/ml and 5.13U/ml, respectively and the highest activity was registered at a temperature of 70°C and a pH between 6 and 6.5. A significant stabilization of the beta-amylase was observed up to 65°C. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. An Evaluation of the Amylase and Haemolytic Tests for the Diagnosis of Hog Cholera

    PubMed Central

    Gray, D. P.; Bannister, G. L.; Boulanger, Paul

    1962-01-01

    The amylase and haemolytic tests recommended for the diagnosis of hog cholera were used on normal swine, hog cholera-infected swine, hog cholera-immune swine and swine with some other virus diseases. The results obtained show that these tests do not appear to be sufficiently reliable for specific laboratory diagnosis. PMID:17649373

  15. Kinetic Analysis of Amylase Using Quantitative Benedict's and Iodine Starch Reagents

    ERIC Educational Resources Information Center

    Cochran, Beverly; Lunday, Deborah; Miskevich, Frank

    2008-01-01

    Quantitative analysis of carbohydrates is a fundamental analytical tool used in many aspects of biology and chemistry. We have adapted a technique developed by Mathews et al. using an inexpensive scanner and open-source image analysis software to quantify amylase activity using both the breakdown of starch and the appearance of glucose. Breakdown…

  16. Enhancing Maritime Education and Training: Measuring a Ship Navigator's Stress Based on Salivary Amylase Activity

    ERIC Educational Resources Information Center

    Murai, Koji; Wakida, Shin-Ichi; Miyado, Takashi; Fukushi, Keiichi; Hayashi, Yuji; Stone, Laurie C.

    2009-01-01

    Purpose: The purpose of this paper is to propose that the measurement of salivary amylase activity is an effective index to evaluate the stress of a ship navigator for safe navigation training and education. Design/methodology/approach: Evaluation comes from the simulator and actual on-board experiments. The subjects are real captains who have…

  17. The noncatalytic triad of alpha-amylases: a novel structural motif involved in conformational stability.

    PubMed

    Marx, Jean-Claude; Poncin, Johan; Simorre, Jean-Pierre; Ramteke, Pramod W; Feller, Georges

    2008-02-01

    Chloride-activated alpha-amylases contain a noncatalytic triad, independent of the glycosidic active site, perfectly mimicking the catalytic triad of serine-proteases and of other active serine hydrolytic enzymes. Mutagenesis of Glu, His, and Ser residues in various alpha-amylases shows that this pattern is a structural determinant of the enzyme conformation that cannot be altered without losing the intrinsic stability of the protein. (1)H-(15)N NMR spectra of a bacterial alpha-amylase reveal proton signals that are identical with the NMR signature of catalytic triads and especially a deshielded proton involving a protonated histidine and displaying properties similar to that of a low barrier hydrogen bond. It is proposed that the H-bond between His and Glu of the noncatalytic triad is an unusually strong interaction, responsible for the observed NMR signal and for the weak stability of the triad mutants. Furthermore, a stringent template-based search of the Protein Data Bank demonstrated that this motif is not restricted to alpha-amylases, but is also found in 80 structures from 33 different proteins, amongst which SH2 domain-containing proteins are the best representatives.

  18. Conquering the control of insoluble and soluble starch with novel applications of amylase

    USDA-ARS?s Scientific Manuscript database

    The new knowledge that there is markedly more insoluble starch than previously considered in products across both the sugarcane factory and refinery has processing implications. This includes the application of a-amylases in the factory to control not only soluble but insoluble starch. Studies wer...

  19. Optimization of Alpha-Amylase Application in U.S. Factories

    USDA-ARS?s Scientific Manuscript database

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentrations in raw sugar if starch control is not improved. Most commercial alpha-amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to...

  20. Optimization of Amylase Applications in Raw Sugar Manufacture that Directly Concern Refiners

    USDA-ARS?s Scientific Manuscript database

    In recent years there have been warnings by some US refineries that there may be a penalty for high starch concentrations in raw sugar if starch control is not improved. Most commercial alpha-amylases used by the US sugar industry to control starch have intermediate temperature stability (up to 85 ...

  1. Optimization of Amylase Applications in Raw Sugar Manufacture that Directly Concern Refiners

    USDA-ARS?s Scientific Manuscript database

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentrations in raw sugar if starch control is not improved. Most commercial alpha-amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to...

  2. Optimization of Amylase Application in Raw Sugar Manufacture. Part II: Factory Trials

    USDA-ARS?s Scientific Manuscript database

    In recent years there have been warnings by some U.S. refineries that there may be a penalty for high starch concentrations in raw sugar if starch control is not improved. Most commercial amylases used by the U.S. sugar industry to control starch have intermediate temperature stability (up to 85 de...

  3. How Do Detergents Work? A Qualitative Assay to Measure Amylase Activity

    ERIC Educational Resources Information Center

    Novo, M. Teresa; Casanoves, Marina; Garcia-Vallvé, Santi; Pujadas, Gerard; Mulero, Miquel; Valls, Cristina

    2016-01-01

    We present a practical activity focusing on two main goals: to give learners the opportunity to experience how the scientific method works and to increase their knowledge about enzymes in everyday situations. The exercise consists of determining the amylase activity of commercial detergents. The methodology is based on a qualitative assay using a…

  4. The bean. alpha. -amylase inhibitor is encoded by a lectin gene

    SciTech Connect

    Moreno, J.; Altabella, T.; Chrispeels, M.J. )

    1989-04-01

    The common bean, Phaseolus vulgaris, contains an inhibitor of insect and mammalian {alpha}-amylases that does not inhibit plant {alpha}-amylase. This inhibitor functions as an anti-feedant or seed-defense protein. We purified this inhibitor by affinity chromatography and found that it consists of a series of glycoforms of two polypeptides (Mr 14,000-19,000). Partial amino acid sequencing was carried out, and the sequences obtained are identical with portions of the derived amino acid sequence of a lectin-like gene. This lectin gene encodes a polypeptide of MW 28,000, and the primary in vitro translation product identified by antibodies to the {alpha}-amylase inhibitor has the same size. Co- and posttranslational processing of this polypeptide results in glycosylated polypeptides of 14-19 kDa. Our interpretation of these results is that the bean lectins constitute a gene family that encodes diverse plant defense proteins, including phytohemagglutinin, arcelin and {alpha}-amylase inhibitor.

  5. Enhancing Maritime Education and Training: Measuring a Ship Navigator's Stress Based on Salivary Amylase Activity

    ERIC Educational Resources Information Center

    Murai, Koji; Wakida, Shin-Ichi; Miyado, Takashi; Fukushi, Keiichi; Hayashi, Yuji; Stone, Laurie C.

    2009-01-01

    Purpose: The purpose of this paper is to propose that the measurement of salivary amylase activity is an effective index to evaluate the stress of a ship navigator for safe navigation training and education. Design/methodology/approach: Evaluation comes from the simulator and actual on-board experiments. The subjects are real captains who have…

  6. Investigating the Hydrolysis of Starch Using "a"-Amylase Contained in Dishwashing Detergent and Human Saliva

    ERIC Educational Resources Information Center

    Munegumi, Toratane; Inutsuka, Masato; Hayafuji, Yukitaka

    2016-01-01

    Although saliva has commonly been used to teach about digestion by organisms, the phenomenon of digestion is actually caused by enzymes as catalytic substances. This activity explores the hydrolysis of starch by "a"-amylase in cleaning materials as well as a comparison with the similar reaction using human saliva. The fact that the…

  7. Improvement of starch digestion using α-amylase entrapped in pectin-polyvinyl alcohol blend.

    PubMed

    Cruz, Maurício; Fernandes, Kátia; Cysneiros, Cristine; Nassar, Reginaldo; Caramori, Samantha

    2015-01-01

    Polyvinyl alcohol (PVA) and pectin blends were used to entrap α-amylase (Termamyl) using glutaraldehyde as a cross-linker. The effect of glutaraldehyde concentration (0.25, 0.5, 0.75, 1.0, and 1.25%) on the activity of the immobilized enzyme and rate of enzyme released was tested during a 24 h period. Characteristics of the material, such as scanning electron microscopy (SEM), tensile strength (TS), elongation, and rate of dissolution in water (pH 5.7), ruminal buffering solution (pH 7.0), and reactor containing 0.1 mol L(-1) sodium phosphate buffer (pH 6.5), were also analyzed. SEM results showed that the surfaces of the pectin/PVA/amylase films were highly irregular and rough. TS values increased as a function of glutaraldehyde concentration, whereas percentage of elongation (%E) decreased. Pectin/PVA/amylase films presented similar values of solubility in the tested solvents. The material obtained with 0.25% glutaraldehyde performed best with repeated use (active for 24 h), in a phosphate buffer reactor. By contrast, the material obtained with 1.25% glutaraldehyde presented higher performance during in vitro testing using an artificial rumen. The results suggest that pectin/PVA/amylase is a highly promising material for biotechnological applications.

  8. The effect of oral stimulation on human parotid salivary flow rate and alpha-amylase secretion.

    PubMed

    Froehlich, D A; Pangborn, R M; Whitaker, J R

    1987-01-01

    Unilateral parotid saliva was collected from ten subjects following oral stimulation with water as baseline, and aqueous solutions of starch (2.5, 5.0, and 10%), sucrose (0.1, 0.2, and 0.4 M) sodium chloride (0.075, 0.15, and 0.30 M), and citric acid (0.005, 0.01, and 0.02 M). Salivary flow rate increased with increasing levels of each taste stimulus. At concentrations of equal taste intensity, citric acid evoked the highest flow rate, followed by sodium chloride and sucrose, while starch, in solution, had a minimal effect. Secretion rate patterns for total protein and alpha-amylase mirrored those of flow rate. The total protein and alpha-amylase concentrations of the saliva, and specific activity of alpha-amylase, were influenced by the type but not the concentration of stimulus, with citric acid stimulation resulting in the lowest concentrations and highest specific activity. Sodium ion (Na+) concentration generally increased with increasing stimulated flow rate, while K+, Ca++, and Mg++ concentrations remained relatively constant. Subjects with lower flow rates had a more concentrated saliva than those with high flow, except for Na+ concentration. Oral stimulation resulted in similar changes in protein and alpha-amylase secretion rates for the two groups.

  9. Interaction mechanism between green tea extract and human α-amylase for reducing starch digestion.

    PubMed

    Miao, Ming; Jiang, Bo; Jiang, Huan; Zhang, Tao; Li, Xingfeng

    2015-11-01

    This study evaluated the inhibitory effects of the green tea extract on human pancreatic α-amylase activity and its molecular mechanism. The green tea extract was composed of epicatechin (59.2%), epigallocatechin gallate (14.6%) and epicatechin gallate (26.2%) as determined by HPLC analysis. Enzyme activity measurement showed that % inhibition and IC50 of the green tea extract (10%, based on starch) were 63.5% and 2.07 mg/ml, respectively. The Michaelis-Menten constant remained unchanged but the maximal velocity decreased from 0.43 (control) to 0.07 mg/(ml × min) (4 mg/ml of the green tea extract), indicating that the green tea extract was an effective inhibitor against α-amylase with a non-competitive mode. The fluorescence data revealed that the green tea extract bound with α-amylase to form a new complex with static quenching mechanism. Docking study showed the epicatechin gallate in the green tea extract presented stronger affinity than epigallocatechin gallate, with more number of amino acid residues involved in amylase binding with hydrogen bonds and Van der Waals forces. Thus, the green tea extract could be used to manipulate starch digestion for potential health benefits.

  10. Cell surface engineering of Bacillus subtilis improves production yields of heterologously expressed α-amylases.

    PubMed

    Cao, Haojie; van Heel, Auke J; Ahmed, Hifza; Mols, Maarten; Kuipers, Oscar P

    2017-04-04

    Bacillus subtilis is widely used as a cell factory for numerous heterologous proteins of commercial value and medical interest. To explore the possibility of further enhancing the secretion potential of this model bacterium, a library of engineered strains with modified cell surface components was constructed, and the corresponding influences on protein secretion were investigated by analyzing the secretion of α-amylase variants with either low-, neutral- or high- isoelectric points (pI). Relative to the wild-type strain, the presence of overall anionic membrane phospholipids (phosphatidylglycerol and cardiolipin) increased dramatically in the PssA-, ClsA- and double KO mutants, which resulted in an up to 47% higher secretion of α-amylase. Additionally, we demonstrated that the appropriate net charge of secreted targets (AmyTS-23, AmyBs and AmyBm) was beneficial for secretion efficiency as well. In B. subtilis, the characteristics of cell membrane phospholipid bilayer and the pIs of heterologous α-amylases appear to be important for their secretion efficiency. These two factors can be engineered to reduce the electrostatic interaction between each other during the secretion process, which finally leads to a better secretion yield of α-amylases.

  11. Isolation and characterisation of a novel alpha-amylase from the extreme haloarchaeon Haloterrigena turkmenica.

    PubMed

    Santorelli, Marco; Maurelli, Luisa; Pocsfalvi, Gabriella; Fiume, Immacolata; Squillaci, Giuseppe; La Cara, Francesco; Del Monaco, Giovanni; Morana, Alessandra

    2016-11-01

    An extracellular halophilic alpha-amylase (AmyA) was produced by the haloarchaeon Haloterrigena turkmenica grown in medium enriched with 0.2% (w/v) starch. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and size exclusion chromatography (SEC) analyses showed a major band at 66.0kDa and a peak of 54.0kDa, respectively. Analysis of tryptic fragments of the protein present in the major SDS-PAGE band by nano-LC-ESI-MS/MS led to identification of the alpha-amylase catalytic region, encoded by the htur2110 gene, as the protein possessing the described activity. Optimal values for activity were 55°C, pH 8.5 and 2M NaCl, and high thermostability was showed at 55°C and 3M NaCl. AmyA activity was enhanced by Triton X-100 and was not influenced by n-hexane and chloroform. Starch hydrolysis produced different oligomers with maltose as the smallest end-product. The efficiency of AmyA in degrading starch contained in agronomic residues was tested in grape cane chosen as model substrate. Preliminary results showed that starch was degraded making the enzyme a potential candidate for utilization of agro-industrial waste in fuel and chemicals production. AmyA is one of the few investigated amylases produced by haloarchaea, and the first alpha-amylase described among microorganisms belonging to the genus Haloterrigena.

  12. The gastric/pancreatic amylase ratio predicts postoperative pancreatic fistula with high sensitivity and specificity.

    PubMed

    Jin, Shuo; Shi, Xiao-Ju; Sun, Xiao-Dong; Zhang, Ping; Lv, Guo-Yue; Du, Xiao-Hong; Wang, Si-Yuan; Wang, Guang-Yi

    2015-01-01

    This article aims to identify risk factors for postoperative pancreatic fistula (POPF) and evaluate the gastric/pancreatic amylase ratio (GPAR) on postoperative day (POD) 3 as a POPF predictor in patients who undergo pancreaticoduodenectomy (PD).POPF significantly contributes to mortality and morbidity in patients who undergo PD. Previously identified predictors for POPF often have low predictive accuracy. Therefore, accurate POPF predictors are needed.In this prospective cohort study, we measured the clinical and biochemical factors of 61 patients who underwent PD and diagnosed POPF according to the definition of the International Study Group of Pancreatic Fistula. We analyzed the association between POPF and various factors, identified POPF risk factors, and evaluated the predictive power of the GPAR on POD3 and the levels of serum and ascites amylase.Of the 61 patients, 21 developed POPF. The color of the pancreatic drain fluid, POD1 serum, POD1 median output of pancreatic drain fluid volume, and GPAR were significantly associated with POPF. The color of the pancreatic drain fluid and high GPAR were independent risk factors. Although serum and ascites amylase did not predict POPF accurately, the cutoff value was 1.24, and GPAR predicted POPF with high sensitivity and specificity.This is the first report demonstrating that high GPAR on POD3 is a risk factor for POPF and showing that GPAR is a more accurate predictor of POPF than the previously reported amylase markers.

  13. Production of alpha-amylase from Aspergillus oryzae for several industrial applications in a single step.

    PubMed

    Porfirif, María C; Milatich, Esteban J; Farruggia, Beatriz M; Romanini, Diana

    2016-06-01

    A one-step method as a strategy of alpha-amylase concentration and purification was developed in this work. This methodology requires the use of a very low concentration of biodegradable polyelectrolyte (Eudragit(®) E-PO) and represents a low cost, fast, easy to scale up and non-polluting technology. Besides, this methodology allows recycling the polymer after precipitation. The formation of reversible soluble/insoluble complexes between alpha-amylase and the polymer Eudragit(®) E-PO was studied, and their precipitation in selected conditions was applied with bioseparation purposes. Turbidimetric assays allowed to determine the pH range where the complexes are insoluble (4.50-7.00); pH 5.50 yielded the highest turbidity of the system. The presence of NaCl (0.05M) in the medium totally dissociates the protein-polymer complexes. When the adequate concentration of polymer was added under these conditions to a liquid culture of Aspergillus oryzae, purification factors of alpha-amylase up to 7.43 and recoveries of 88% were obtained in a simple step without previous clarification. These results demonstrate that this methodology is suitable for the concentration and production of alpha-amylase from this source and could be applied at the beginning of downstream processing.

  14. Structure of Waxy Maize Starch Hydrolyzed by Maltogenic α-Amylase in Relation to Its Retrogradation.

    PubMed

    Grewal, Navneet; Faubion, Jon; Feng, Guohua; Kaufman, Rhett C; Wilson, Jeff D; Shi, Yong-Cheng

    2015-04-29

    Maltogenic α-amylase is widely used as an antistaling agent in bakery foods. The objective of this study was to determine the degree of hydrolysis (DH) and starch structure after maltogenic amylase treatments in relation to its retrogradation. Waxy maize starch was cooked and hydrolyzed to different degrees by a maltogenic amylase. High-performance anion-exchange chromatography and size exclusion chromatography were used to determine saccharides formed and the molecular weight (Mw) distributions of the residual starch structure, respectively. Chain length (CL) distributions of debranched starch samples were further related to amylopectin (AP) retrogradation. Differential scanning calorimetry (DSC) results showed the complete inhibition of retrogradation when starches were hydrolyzed to >20% DH. Mw and CL distributions of residual AP structure indicated that with an increase in %DH, a higher proportion of unit chains with degree of polymerization (DP) ≤9 and a lower proportion of unit chains with DP ≥17 were formed. A higher proportion of short outer AP chains that cannot participate in the formation of double helices supports the decrease in and eventual inhibition of retrogradation observed with the increase in %DH. These results suggest that the maltogenic amylase could play a powerful role in inhibiting the staling of baked products even at limited starch hydrolysis.

  15. A review on structure-activity relationship of dietary polyphenols inhibiting α-amylase.

    PubMed

    Xiao, Jianbo; Ni, Xiaoling; Kai, Guoyin; Chen, Xiaoqing

    2013-01-01

    The inhibitory effects of dietary polyphenols against α-amylase have attracted great interest among researchers. The aim of this review is to give an overview of the research reports on the structure-activity relationship of polyphenols inhibiting α-amylase. The molecular structures that influence the inhibition are the following: (1) The hydroxylation of flavonoids improved the inhibitory effect on α-amylase; (2) Presence of an unsaturated 2,3-bond in conjugation with a 4-carbonyl group has been associated with stronger inhibition; (3) The glycosylation of flavonoids decreased the inhibitory effect on α-amylase depending on the conjugation site and the class of sugar moiety; (4) The methylation and methoxylation of flavonoids obviously weakened the inhibitory effect; (5) The galloylated catechins have higher inhibition than nongalloylated catechins; the catechol-type catechins were stronger than the pyrogallol-type catechins; the inhibition activities of the catechins with 2,3-trans structure were higher than those of the catechins with 2,3-cis structure; (6) Cyanidin-3-glucoside showed higher inhibition against than cyanidin and cyanidin-3-galactoside and cyanidin-3,5-diglucoside had no inhibitory activity; (7) Ellagitannins with β-galloyl groups at glucose C-1 positions have higher inhibitory effect than the α-galloyl and nongalloyl compounds and the molecular weight of ellagitannins is not an important element.

  16. Allotides: Proline-Rich Cystine Knot α-Amylase Inhibitors from Allamanda cathartica.

    PubMed

    Nguyen, Phuong Q T; Luu, Thuy T; Bai, Yang; Nguyen, Giang K T; Pervushin, Konstantin; Tam, James P

    2015-04-24

    Cystine knot α-amylase inhibitors belong to a knottin family of peptidyl inhibitors of 30-32 residues and contain two to four prolines. Thus far, only four members of the group of cystine knot α-amylase inhibitors have been characterized. Herein, the discovery and characterization of five cystine knot α-amylase inhibitors, allotides C1-C5 (Ac1-Ac5) (1-5), from the medicinal plant Allamanda cathartica are reported using both proteomic and genomic methods. Proteomic analysis showed that 1-5 are 30 amino acids in length with three or four proline residues. NMR determination of 4 revealed that it has two cis- and one trans-proline residues and adopts two equally populated conformations in solution. Determination of disulfide connectivity of 2 by differential S-reduction and S-alkylation provided clues of its unfolding process. Genomic analysis showed that allotide precursors contain a three-domain arrangement commonly found in plant cystine knot peptides with conserved residues flanking the processing sites of the mature allotide domain. This work expands the number of known cystine knot α-amylase inhibitors and furthers the understanding of both the structural and biological diversity of this type of knottin family.

  17. Structure of Bacillus amyloliquefaciens alpha-amylase at high resolution: implications for thermal stability.

    PubMed

    Alikhajeh, Jahan; Khajeh, Khosro; Ranjbar, Bijan; Naderi-Manesh, Hossein; Lin, Yi Hung; Liu, Enhung; Guan, Hong Hsiang; Hsieh, Yin Cheng; Chuankhayan, Phimonphan; Huang, Yen Chieh; Jeyaraman, Jeyakanthan; Liu, Ming Yih; Chen, Chun Jung

    2010-02-01

    The crystal structure of Bacillus amyloliquefaciens alpha-amylase (BAA) at 1.4 A resolution revealed ambiguities in the thermal adaptation of homologous proteins in this family. The final model of BAA is composed of two molecules in a back-to-back orientation, which is likely to be a consequence of crystal packing. Despite a high degree of identity, comparison of the structure of BAA with those of other liquefying-type alpha-amylases indicated moderate discrepancies at the secondary-structural level. Moreover, a domain-displacement survey using anisotropic B-factor and domain-motion analyses implied a significant contribution of domain B to the total flexibility of BAA, while visual inspection of the structure superimposed with that of B. licheniformis alpha-amylase (BLA) indicated higher flexibility of the latter in the central domain A. Therefore, it is suggested that domain B may play an important role in liquefying alpha-amylases, as its rigidity offers a substantial improvement in thermostability in BLA compared with BAA.

  18. [Characteristics of alpha-amylase isozymes in cytologenetically different wheat cultivars].

    PubMed

    Netsvetaev, V P; Badaeva, E D

    2014-07-01

    The isoenzyme composition of alpha-amylase is studied by polyacrylamide gel electrophoresis in Tris-glycine (pH 8.3) system in wheat cultivars with different genome composition. We show that durum wheat (Triticum durum, 2n=4x=28, BBAA) lacks the isoenzymes encoded by 6D and 7D chromosomes that are present in common wheat zymograms (Triticum aestivum, 2n=6x=42, BBAADD). A similar pattern is observed in a synthetic allohexaploid carrying the BBAA genomes of wheat and the HchHch genome of barley (Hordeum chilense). Our method of electrophoresis fails to reveal additional variants of alpha-amylase encoded by the barley genome, although C-banding analysis confirms the genomic structure BBAAHChHCh of this allopolyploid. The electrophoretic spectrum of the spring common wheat cultivar Dobrynya with the wheat-Agropyron translocation 7DL-7AiL contains all of the alpha-amylase isoenzymes typical for common wheat (2n=6x=42, BBAADD) except for the zymotype encoded by the long arm of chromosome 7D. This observation confirms the results of cytogenetic analysis that identified a 7DL-7AiL translocation in this cultivar. No additional alpha-amylase isoenzymes encoded by Agropyron chromosome have been observed. Our data indicate that analysis of wheat-alien hybrids or introgressive forms should be carried out using a complex of different methods.

  19. Beta-thiomaltosides as active site probes for alpha-amylase.

    PubMed

    Stankiewicz, P J; Cascio, D; McPherson, A

    1983-12-01

    A series of substituted 1-thio-beta-D-maltopyranosides was synthesized and confirmed by elemental analysis, optical rotation, NMR, and liquid chromatography. These compounds were shown by several biochemical techniques to bind to the active site of alpha-amylase. Steady-state kinetic studies showed the compounds to be competitive inhibitors, with affinities lying within the range of the natural ligands, maltose and maltotriose. Affinity chromatography employing p-aminophenyl-1-thio-beta-D-maltopyranoside linked to Sepharose provides a relatively simple procedure for alpha-amylase purification. The binding of p-bromphenyl-1-thio-beta-D-maltoside was observed in crystals of alpha-amylase using X-ray crystallography, and through the use of difference Fourier analysis its interaction at 5.0-A resolution with the active site of the enzyme has been visualized. The inhibitor binds in a long, deep cleft that divides the two major domains of the enzyme. These studies are believed to provide a first step toward the rational design of ligands for the physiological regulation of starch breakdown and utilization through modulation of alpha-amylase activity.

  20. Two sulfhydryl groups near the active site of soybean beta-amylase.

    PubMed

    Mikami, B; Nomura, K; Morita, Y

    1994-01-01

    The less reactive SH groups of soybean beta-amylase, SH4, SH5, and SH6, were modified with p-chloromercuribenzoic acid or N-ethylmaleimide, after the reactive SH groups, SH1, SH2, and SH3, were blocked with 5,5'-dithiobis-(2-nitrobenzoic acid) and cyanide. The enzyme activity decreased, accompanied by the modification of SH4. alpha-Cyclodextrin protected SH4 from the modification more effectively than maltose. The SH4-modified enzyme still bound to glucose, maltose, and alpha-cyclodextrin. SH4 was concerned with neither the catalysis nor substrate binding but its large substituent affected the substrate binding site. The sequencing of the 5-(iodoacetoamidoethyl)-aminoaphthalene-1-sulfonate-labeled peptides showed that SH4, SH5, and SH6 are Cys343, Cys82, and Cys208, respectively. Comparison of the primary structure of beta-amylases also showed that the sequence around SH4 (Cys343), as well as SH2 (Cys95), is strongly conserved between higher plant and bacterial beta-amylases. These results agree with the structure model deduced from X-ray crystallography of soybean beta-amylase.