Intelligent subsystem interface for modular hardware system
NASA Technical Reports Server (NTRS)
Caffrey, Robert T. (Inventor); Krening, Douglas N. (Inventor); Lannan, Gregory B. (Inventor); Schneiderwind, Michael J. (Inventor); Schneiderwind, Robert A. (Inventor)
2000-01-01
A single chip application specific integrated circuit (ASIC) which provides a flexible, modular interface between a subsystem and a standard system bus. The ASIC includes a microcontroller/microprocessor, a serial interface for connection to the bus, and a variety of communications interface devices available for coupling to the subsystem. A three-bus architecture, utilizing arbitration, provides connectivity within the ASIC and between the ASIC and the subsystem. The communication interface devices include UART (serial), parallel, analog, and external device interface utilizing bus connections paired with device select signals. A low power (sleep) mode is provided as is a processor disable option.
Command Interface ASIC - Analog Interface ASIC Chip Set
NASA Technical Reports Server (NTRS)
Ruiz, Baldes; Jaffe, Burton; Burke, Gary; Lung, Gerald; Pixler, Gregory; Plummer, Joe; Katanyoutanant,, Sunant; Whitaker, William
2003-01-01
A command interface application-specific integrated circuit (ASIC) and an analog interface ASIC have been developed as a chip set for remote actuation and monitoring of a collection of switches, which can be used to control generic loads, pyrotechnic devices, and valves in a high-radiation environment. The command interface ASIC (CIA) can be used alone or in combination with the analog interface ASIC (AIA). Designed primarily for incorporation into spacecraft control systems, they are also suitable for use in high-radiation terrestrial environments (e.g., in nuclear power plants and facilities that process radioactive materials). The primary role of the CIA within a spacecraft or other power system is to provide a reconfigurable means of regulating the power bus, actuating all valves, firing all pyrotechnic devices, and controlling the switching of power to all switchable loads. The CIA is a mixed-signal (analog and digital) ASIC that includes an embedded microcontroller with supporting fault-tolerant switch control and monitoring circuitry that is capable of connecting to a redundant set of interintegrated circuit (I(sup 2)C) buses. Commands and telemetry requests are communicated to the CIA. Adherence to the I(sup 2)C bus standard helps to reduce development costs by facilitating the use of previously developed, commercially available components. The AIA is a mixed-signal ASIC that includes the analog circuitry needed to connect the CIA to a custom higher powered version of the I(sup 2)C bus. The higher-powered version is designed to enable operation with bus cables longer than those contemplated in the I(sup 2)C standard. If there are multiple higher-power I(sup 2)C-like buses, then there must an AIA between the CIA and each such bus. The AIA includes two identical interface blocks: one for the side-A I(sup 2)C clock and data buses and the other for the side B buses. All the AIAs on each side are powered from a common power converter module (PCM). Sides A and B of the I(sup 2)C buses are electrically isolated from each other (see figure). They are also isolated from the CIA by use of transformer coupling of signals between the AIA blocks and the CIA.
NASA Technical Reports Server (NTRS)
Ruiz, Ian B.; Burke, Gary R.; Lung, Gerald; Whitaker, William D.; Nowicki, Robert M.
2004-01-01
The Jet Propulsion Laboratory (JPL) has developed a command interface chip-set that primarily consists of two mixed-signal ASICs'; the Command Interface ASIC (CIA) and Analog Interface ASIC (AIA). The Open-systems architecture employed during the design of this chip-set enables its use as both an intelligent gateway between the system's flight computer and the control, actuation, and activation of the spacecraft's loads, valves, and pyrotechnics respectfully as well as the regulator of the spacecraft power bus. Furthermore, the architecture is highly adaptable and employed fault-tolerant design methods enabling a host of other mission uses including reliable remote data collection. The objective of this design is to both provide a needed flight component that meets the stringent environmental requirements of current deep space missions and to add a new element to a growing library that can be used as a standard building block for future missions to the outer planets.
A Low-Power ASIC Signal Processor for a Vestibular Prosthesis.
Töreyin, Hakan; Bhatti, Pamela T
2016-06-01
A low-power ASIC signal processor for a vestibular prosthesis (VP) is reported. Fabricated with TI 0.35 μm CMOS technology and designed to interface with implanted inertial sensors, the digitally assisted analog signal processor operates extensively in the CMOS subthreshold region. During its operation the ASIC encodes head motion signals captured by the inertial sensors as electrical pulses ultimately targeted for in-vivo stimulation of vestibular nerve fibers. To achieve this, the ASIC implements a coordinate system transformation to correct for misalignment between natural sensors and implanted inertial sensors. It also mimics the frequency response characteristics and frequency encoding mappings of angular and linear head motions observed at the peripheral sense organs, semicircular canals and otolith. Overall the design occupies an area of 6.22 mm (2) and consumes 1.24 mW when supplied with ± 1.6 V.
A Low-Power ASIC Signal Processor for a Vestibular Prosthesis
Töreyin, Hakan; Bhatti, Pamela T.
2017-01-01
A low-power ASIC signal processor for a vestibular prosthesis (VP) is reported. Fabricated with TI 0.35 μm CMOS technology and designed to interface with implanted inertial sensors, the digitally assisted analog signal processor operates extensively in the CMOS subthreshold region. During its operation the ASIC encodes head motion signals captured by the inertial sensors as electrical pulses ultimately targeted for in-vivo stimulation of vestibular nerve fibers. To achieve this, the ASIC implements a coordinate system transformation to correct for misalignment between natural sensors and implanted inertial sensors. It also mimics the frequency response characteristics and frequency encoding mappings of angular and linear head motions observed at the peripheral sense organs, semicircular canals and otolith. Overall the design occupies an area of 6.22 mm2 and consumes 1.24 mW when supplied with ± 1.6 V. PMID:26800546
NASA Technical Reports Server (NTRS)
Smith, Brian S.; Loose, Markus; Alkire, Greg; Joshi, Atul; Kelly, Daniel; Siskind, Eric; Rossetti, Dino; Mah, Jonathan; Cheng, Edward; Miko, Laddawan;
2016-01-01
The Wide-Field Infrared Survey Telescope (WFIRST) will have the largest near-IR focal plane ever flown by NASA, a total of 18 4K x 4K devices. The project has adopted a system-level approach to detector control and data acquisition where 1) control and processing intelligence is pushed into components closer to the detector to maximize signal integrity, 2) functions are performed at the highest allowable temperatures, and 3) the electronics are designed to ensure that the intrinsic detector noise is the limiting factor for system performance. For WFIRST, the detector arrays operate at 90 to 100 K, the detector control and data acquisition functions are performed by a custom ASIC at 150 to 180 K, and the main data processing electronics are at the ambient temperature of the spacecraft, notionally approx.300 K. The new ASIC is the main interface between the cryogenic detectors and the warm instrument electronics. Its single-chip design provides basic clocking for most types of hybrid detectors with CMOS ROICs. It includes a flexible but simple-to-program sequencer, with the option of microprocessor control for more elaborate readout schemes that may be data-dependent. All analog biases, digital clocks, and analog-to-digital conversion functions are incorporated and are connected to the nearby detectors with a short cable that can provide thermal isolation. The interface to the warm electronics is simple and robust through multiple LVDS channels. It also includes features that support parallel operation of multiple ASICs to control detectors that may have more capability or requirements than can be supported by a single chip.
A CMOS Neural Interface for a Multichannel Vestibular Prosthesis
Hageman, Kristin N.; Kalayjian, Zaven K.; Tejada, Francisco; Chiang, Bryce; Rahman, Mehdi A.; Fridman, Gene Y.; Dai, Chenkai; Pouliquen, Philippe O.; Georgiou, Julio; Della Santina, Charles C.; Andreou, Andreas G.
2015-01-01
We present a high-voltage CMOS neural-interface chip for a multichannel vestibular prosthesis (MVP) that measures head motion and modulates vestibular nerve activity to restore vision- and posture-stabilizing reflexes. This application specific integrated circuit neural interface (ASIC-NI) chip was designed to work with a commercially available microcontroller, which controls the ASIC-NI via a fast parallel interface to deliver biphasic stimulation pulses with 9-bit programmable current amplitude via 16 stimulation channels. The chip was fabricated in the ONSemi C5 0.5 micron, high-voltage CMOS process and can accommodate compliance voltages up to 12 V, stimulating vestibular nerve branches using biphasic current pulses up to 1.45 ± 0.06 mA with durations as short as 10 µs/phase. The ASIC-NI includes a dedicated digital-to-analog converter for each channel, enabling it to perform complex multipolar stimulation. The ASIC-NI replaces discrete components that cover nearly half of the 2nd generation MVP (MVP2) printed circuit board, reducing the MVP system size by 48% and power consumption by 17%. Physiological tests of the ASIC-based MVP system (MVP2A) in a rhesus monkey produced reflexive eye movement responses to prosthetic stimulation similar to those observed when using the MVP2. Sinusoidal modulation of stimulus pulse rate from 68–130 pulses per second at frequencies from 0.1 to 5 Hz elicited appropriately-directed slow phase eye velocities ranging in amplitude from 1.9–16.7°/s for the MVP2 and 2.0–14.2°/s for the MVP2A. The eye velocities evoked by MVP2 and MVP2A showed no significant difference (t-test, p = 0.034), suggesting that the MVP2A achieves performance at least as good as the larger MVP2. PMID:25974945
The SIRIUS mixed analog-digital ASIC developed for the LOFT LAD and WFM instruments
NASA Astrophysics Data System (ADS)
Cros, A.; Rambaud, D.; Moutaye, E.; Ravera, L.; Barret, D.; Caïs, P.; Clédassou, R.; Bodin, P.; Seyler, J. Y.; Bonzo, A.; Feroci, M.; Labanti, C.; Evangelista, Y.; Favre, Y.
2014-07-01
We report on the development and characterization of the low-noise, low power, mixed analog-digital SIRIUS ASICs for both the LAD and WFM X-ray instruments of LOFT. The ASICs we developed are reading out large area silicon drift detectors (SDD). Stringent requirements in terms of noise (ENC of 17 e- to achieve an energy resolution on the LAD of 200 eV FWHM at 6 keV) and power consumption (650 μW per channel) were basis for the ASICs design. These SIRIUS ASICs are developed to match SDD detectors characteristics: 16 channels ASICs adapted for the LAD (970 microns pitch) and 64 channels for the WFM (145 microns pitch) will be fabricated. The ASICs were developed with the 180nm mixed technology of TSMC.
ePix: a class of architectures for second generation LCLS cameras
Dragone, A.; Caragiulo, P.; Markovic, B.; ...
2014-03-31
ePix is a novel class of ASIC architectures, based on a common platform, optimized to build modular scalable detectors for LCLS. The platform architecture is composed of a random access analog matrix of pixel with global shutter, fast parallel column readout, and dedicated sigma-delta analog-to-digital converters per column. It also implements a dedicated control interface and all the required support electronics to perform configuration, calibration and readout of the matrix. Based on this platform a class of front-end ASICs and several camera modules, meeting different requirements, can be developed by designing specific pixel architectures. This approach reduces development time andmore » expands the possibility of integration of detector modules with different size, shape or functionality in the same camera. The ePix platform is currently under development together with the first two integrating pixel architectures: ePix100 dedicated to ultra low noise applications and ePix10k for high dynamic range applications.« less
Distributed Motor Controller (DMC) for Operation in Extreme Environments
NASA Technical Reports Server (NTRS)
McKinney, Colin M.; Yager, Jeremy A.; Mojarradi, Mohammad M.; Some, Rafi; Sirota, Allen; Kopf, Ted; Stern, Ryan; Hunter, Don
2012-01-01
This paper presents an extreme environment capable Distributed Motor Controller (DMC) module suitable for operation with a distributed architecture of future spacecraft systems. This motor controller is designed to be a bus-based electronics module capable of operating a single Brushless DC motor in extreme space environments: temperature (-120 C to +85 C required, -180 C to +100 C stretch goal); radiation (>;20K required, >;100KRad stretch goal); >;360 cycles of operation. Achieving this objective will result in a scalable modular configuration for motor control with enhanced reliability that will greatly lower cost during the design, fabrication and ATLO phases of future missions. Within the heart of the DMC lies a pair of cold-capable Application Specific Integrated Circuits (ASICs) and a Field Programmable Gate Array (FPGA) that enable its miniaturization and operation in extreme environments. The ASICs are fabricated in the IBM 0.5 micron Silicon Germanium (SiGe) BiCMOS process and are comprised of Analog circuitry to provide telemetry information, sensor interface, and health and status of DMC. The FPGA contains logic to provide motor control, status monitoring and spacecraft interface. The testing and characterization of these ASICs have yielded excellent functionality in cold temperatures (-135 C). The DMC module has demonstrated successful operation of a motor at temperature.
NASA Astrophysics Data System (ADS)
Ahangarianabhari, Mahdi; Macera, Daniele; Bertuccio, Giuseppe; Malcovati, Piero; Grassi, Marco
2015-01-01
We present the design and the first experimental characterization of VEGA, an Application Specific Integrated Circuit (ASIC) designed to read out large area monolithic linear Silicon Drift Detectors (SDD's). VEGA consists of an analog and a digital/mixed-signal section to accomplish all the functionalities and specifications required for high resolution X-ray spectroscopy in the energy range between 500 eV and 50 keV. The analog section includes a charge sensitive preamplifier, a shaper with 3-bit digitally selectable shaping times from 1.6 μs to 6.6 μs and a peak stretcher/sample-and-hold stage. The digital/mixed-signal section includes an amplitude discriminator with coarse and fine threshold level setting, a peak discriminator and a logic circuit to fulfill pile-up rejection, signal sampling, trigger generation, channel reset and the preamplifier and discriminators disabling functionalities. A Serial Peripherical Interface (SPI) is integrated in VEGA for loading and storing all configuration parameters in an internal register within few microseconds. The VEGA ASIC has been designed and manufactured in 0.35 μm CMOS mixed-signal technology in single and 32 channel versions with dimensions of 200 μm×500 μm per channel. A minimum intrinsic Equivalent Noise Charge (ENC) of 12 electrons r.m.s. at 3.6 μs peaking time and room temperature is measured and the linearity error is between -0.9% and +0.6% in the whole input energy range. The total power consumption is 481 μW and 420 μW per channel for the single and 32 channels version, respectively. A comparison with other ASICs for X-ray SDD's shows that VEGA has a suitable low noise and offers high functionality as ADC-ready signal processing but at a power consumption that is a factor of four lower than other similar existing ASICs.
A CMOS ASIC Design for SiPM Arrays
Dey, Samrat; Banks, Lushon; Chen, Shaw-Pin; Xu, Wenbin; Lewellen, Thomas K.; Miyaoka, Robert S.; Rudell, Jacques C.
2012-01-01
Our lab has previously reported on novel board-level readout electronics for an 8×8 silicon photomultiplier (SiPM) array featuring row/column summation technique to reduce the hardware requirements for signal processing. We are taking the next step by implementing a monolithic CMOS chip which is based on the row-column architecture. In addition, this paper explores the option of using diagonal summation as well as calibration to compensate for temperature and process variations. Further description of a timing pickoff signal which aligns all of the positioning (spatial channels) pulses in the array is described. The ASIC design is targeted to be scalable with the detector size and flexible to accommodate detectors from different vendors. This paper focuses on circuit implementation issues associated with the design of the ASIC to interface our Phase II MiCES FPGA board with a SiPM array. Moreover, a discussion is provided for strategies to eventually integrate all the analog and mixed-signal electronics with the SiPM, on either a single-silicon substrate or multi-chip module (MCM). PMID:24825923
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shinde, Subhash L.; Teifel, John; Flores, Richard S.
A 3D stacked sASIC is provided that includes a plurality of 2D reconfigurable structured structured ASIC (sASIC) levels interconnected through hard-wired arrays of 3D vias. The 2D sASIC levels may contain logic, memory, analog functions, and device input/output pad circuitry. During fabrication, these 2D sASIC levels are stacked on top of each other and fused together with 3D metal vias. Such 3D vias may be fabricated as through-silicon vias (TSVs). They may connect to the back-side of the 2D sASIC level, or they may be connected to top metal pads on the front-side of the 2D sASIC level.
A 160 μA biopotential acquisition IC with fully integrated IA and motion artifact suppression.
Van Helleputte, Nick; Kim, Sunyoung; Kim, Hyejung; Kim, Jong Pal; Van Hoof, Chris; Yazicioglu, Refet Firat
2012-12-01
This paper proposes a 3-channel biopotential monitoring ASIC with simultaneous electrode-tissue impedance measurements which allows real-time estimation of motion artifacts on each channel using an an external μC. The ASIC features a high performance instrumentation amplifier with fully integrated sub-Hz HPF rejecting rail-to-rail electrode-offset voltages. Each readout channel further has a programmable gain amplifier and programmable 4th order low-pass filter. Time-multiplexed 12 b SAR-ADCs are used to convert all the analog data to digital. The ASIC achieves >; 115 dB of CMRR (at 50/60 Hz), a high input impedance of >; 1 GΩ and low noise (1.3 μVrms in 100 Hz). Unlike traditional methods, the ASIC is capable of actual motion artifact suppression in the analog domain before final amplification. The complete ASIC core operates from 1.2 V with 2 V digital IOs and consumes 200 μW when all 3 channels are active.
SODR Memory Control Buffer Control ASIC
NASA Technical Reports Server (NTRS)
Hodson, Robert F.
1994-01-01
The Spacecraft Optical Disk Recorder (SODR) is a state of the art mass storage system for future NASA missions requiring high transmission rates and a large capacity storage system. This report covers the design and development of an SODR memory buffer control applications specific integrated circuit (ASIC). The memory buffer control ASIC has two primary functions: (1) buffering data to prevent loss of data during disk access times, (2) converting data formats from a high performance parallel interface format to a small computer systems interface format. Ten 144 p in, 50 MHz CMOS ASIC's were designed, fabricated and tested to implement the memory buffer control function.
High-performance electronics for time-of-flight PET systems
NASA Astrophysics Data System (ADS)
Choong, W.-S.; Peng, Q.; Vu, C. Q.; Turko, B. T.; Moses, W. W.
2013-01-01
We have designed and built a high-performance readout electronics system for time-of-flight positron emission tomography (TOF PET) cameras. The electronics architecture is based on the electronics for a commercial whole-body PET camera (Siemens/CPS Cardinal electronics), modified to improve the timing performance. The fundamental contributions in the electronics that can limit the timing resolution include the constant fraction discriminator (CFD), which converts the analog electrical signal from the photo-detector to a digital signal whose leading edge is time-correlated with the input signal, and the time-to-digital converter (TDC), which provides a time stamp for the CFD output. Coincident events are identified by digitally comparing the values of the time stamps. In the Cardinal electronics, the front-end processing electronics are performed by an Analog subsection board, which has two application-specific integrated circuits (ASICs), each servicing a PET block detector module. The ASIC has a built-in CFD and TDC. We found that a significant degradation in the timing resolution comes from the ASIC's CFD and TDC. Therefore, we have designed and built an improved Analog subsection board that replaces the ASIC's CFD and TDC with a high-performance CFD (made with discrete components) and TDC (using the CERN high-performance TDC ASIC). The improved Analog subsection board is used in a custom single-ring LSO-based TOF PET camera. The electronics system achieves a timing resolution of 60 ps FWHM. Prototype TOF detector modules are read out with the electronics system and give coincidence timing resolutions of 259 ps FWHM and 156 ps FWHM for detector modules coupled to LSO and LaBr3 crystals respectively.
High-performance electronics for time-of-flight PET systems.
Choong, W-S; Peng, Q; Vu, C Q; Turko, B T; Moses, W W
2013-01-01
We have designed and built a high-performance readout electronics system for time-of-flight positron emission tomography (TOF PET) cameras. The electronics architecture is based on the electronics for a commercial whole-body PET camera (Siemens/CPS Cardinal electronics), modified to improve the timing performance. The fundamental contributions in the electronics that can limit the timing resolution include the constant fraction discriminator (CFD), which converts the analog electrical signal from the photo-detector to a digital signal whose leading edge is time-correlated with the input signal, and the time-to-digital converter (TDC), which provides a time stamp for the CFD output. Coincident events are identified by digitally comparing the values of the time stamps. In the Cardinal electronics, the front-end processing electronics are performed by an Analog subsection board, which has two application-specific integrated circuits (ASICs), each servicing a PET block detector module. The ASIC has a built-in CFD and TDC. We found that a significant degradation in the timing resolution comes from the ASIC's CFD and TDC. Therefore, we have designed and built an improved Analog subsection board that replaces the ASIC's CFD and TDC with a high-performance CFD (made with discrete components) and TDC (using the CERN high-performance TDC ASIC). The improved Analog subsection board is used in a custom single-ring LSO-based TOF PET camera. The electronics system achieves a timing resolution of 60 ps FWHM. Prototype TOF detector modules are read out with the electronics system and give coincidence timing resolutions of 259 ps FWHM and 156 ps FWHM for detector modules coupled to LSO and LaBr 3 crystals respectively.
Cryogenic and radiation-hard asic for interfacing large format NIR/SWIR detector arrays
NASA Astrophysics Data System (ADS)
Gao, Peng; Dupont, Benoit; Dierickx, Bart; Müller, Eric; Verbruggen, Geert; Gielis, Stijn; Valvekens, Ramses
2017-11-01
For scientific and earth observation space missions, weight and power consumption is usually a critical factor. In order to obtain better vehicle integration, efficiency and controllability for large format NIR/SWIR detector arrays, a prototype ASIC is designed. It performs multiple detector array interfacing, power regulation and data acquisition operations inside the cryogenic chambers. Both operation commands and imaging data are communicated via the SpaceWire interface which will significantly reduce the number of wire goes in and out the cryogenic chamber. This "ASIC" prototype is realized in 0.18um CMOS technology and is designed for radiation hardness.
Spacecraft optical disk recorder memory buffer control
NASA Technical Reports Server (NTRS)
Hodson, Robert F.
1992-01-01
The goal of this project is to develop an Application Specific Integrated Circuit (ASIC) for use in the control electronics of the Spacecraft Optical Disk Recorder (SODR). Specifically, this project is to design an extendable memory buffer controller ASIC for rate matching between a system Input/Output port and the SODR's device interface. The aforementioned goal can be partitioned into the following sub-goals: (1) completion of ASIC design and simulation (on-going via ASEE fellowship); (2) ASIC Fabrication (at ASIC manufacturer); and (3) ASIC Testing (NASA/LaRC, Christopher Newport University).
Front-end ASICs for high-energy astrophysics in space
NASA Astrophysics Data System (ADS)
Gevin, O.; Limousin, O.; Meuris, A.
2016-07-01
In most of embedded imaging systems for space applications, high granularity and increasing size of focal planes justify an almost systematic use of integrated circuits. . To fulfill challenging requirements for excellent spatial and energy resolution, integrated circuits must fit the sensors perfectly and interface the system such a way to optimize simultaneously noise, geometry and architecture. Moreover, very low power consumption and radiation tolerance are mandatory to envision a use onboard a payload in space. Consequently, being part of an optimized detection system for space, the integrated circuit is specifically designed for each application and becomes an Application Specific Integrated Circuits (ASIC). The paper focuses on mixed analog and digital signal ASICs for spectro-imaging systems in the keVMeV energy band. The first part of the paper summarizes the main advantages conferred by the use of front-end ASICs for highenergy astrophysics instruments in space mission. Space qualification of ASICs requires the chip to be radiation hard. The paper will shortly describe some of the typical hardening techniques and give some guidelines that an ASIC designer should follow to choose the most efficient technology for his project. The first task of the front-end electronics is to convert the charge coming from the detector into a voltage. For most of the Silicon detectors (CCD, DEPFET, SDD) this is conversion happens in the detector itself. For other sensor materials, charge preamplifiers operate the conversion. The paper shortly describes the different key parameters of charge preamplifiers and the binding parameters for the design. Filtering is generally mandatory in order to increase the signal to noise ratio or to reduce the duration of the signal. After a brief review on the main noise sources, the paper reviews noise-filtering techniques that are commonly used in Integrated circuits designs. The way sensors and ASICs are interconnected together plays a major role in the noise performances of the detection systems. The geometry of a sensor is therefore critical and drives the ASIC design. The second part of the paper takes the geometry of the detector as a story line to explore different kinds of ASIC structures and architectures. From the simple single-channel ASIC for CCDs to the most advanced 3D ASIC prototypes used to build dead-zone free imaging systems, the paper reports on different families of circuits for spectro-imaging systems. It emphasizes a variety of designer choices, all around the word, in different space missions.
A Spacecraft Housekeeping System-on-Chip in a Radiation Hardened Structured ASIC
NASA Technical Reports Server (NTRS)
Suarez, George; DuMonthier, Jeffrey J.; Sheikh, Salman S.; Powell, Wesley A.; King, Robyn L.
2012-01-01
Housekeeping systems are essential to health monitoring of spacecraft and instruments. Typically, sensors are distributed across various sub-systems and data is collected using components such as analog-to-digital converters, analog multiplexers and amplifiers. In most cases programmable devices are used to implement the data acquisition control and storage, and the interface to higher level systems. Such discrete implementations require additional size, weight, power and interconnect complexity versus an integrated circuit solution, as well as the qualification of multiple parts. Although commercial devices are readily available, they are not suitable for space applications due the radiation tolerance and qualification requirements. The Housekeeping System-o n-A-Chip (HKSOC) is a low power, radiation hardened integrated solution suitable for spacecraft and instrument control and data collection. A prototype has been designed and includes a wide variety of functions including a 16-channel analog front-end for driving and reading sensors, analog-to-digital and digital-to-analog converters, on-chip temperature sensor, power supply current sense circuits, general purpose comparators and amplifiers, a 32-bit processor, digital I/O, pulse-width modulation (PWM) generators, timers and I2C master and slave serial interfaces. In addition, the device can operate in a bypass mode where the processor is disabled and external logic is used to control the analog and mixed signal functions. The device is suitable for stand-alone or distributed systems where multiple chips can be deployed across different sub-systems as intelligent nodes with computing and processing capabilities.
Highly-Integrated CMOS Interface Circuits for SiPM-Based PET Imaging Systems.
Dey, Samrat; Lewellen, Thomas K; Miyaoka, Robert S; Rudell, Jacques C
2012-01-01
Recent developments in the area of Positron Emission Tomography (PET) detectors using Silicon Photomultipliers (SiPMs) have demonstrated the feasibility of higher resolution PET scanners due to a significant reduction in the detector form factor. The increased detector density requires a proportionally larger number of channels to interface the SiPM array with the backend digital signal processing necessary for eventual image reconstruction. This work presents a CMOS ASIC design for signal reducing readout electronics in support of an 8×8 silicon photomultiplier array. The row/column/diagonal summation circuit significantly reduces the number of required channels, reducing the cost of subsequent digitizing electronics. Current amplifiers are used with a single input from each SiPM cathode. This approach helps to reduce the detector loading, while generating all the necessary row, column and diagonal addressing information. In addition, the single current amplifier used in our Pulse-Positioning architecture facilitates the extraction of pulse timing information. Other components under design at present include a current-mode comparator which enables threshold detection for dark noise current reduction, a transimpedance amplifier and a variable output impedance I/O driver which adapts to a wide range of loading conditions between the ASIC and lines with the off-chip Analog-to-Digital Converters (ADCs).
Highly-Integrated CMOS Interface Circuits for SiPM-Based PET Imaging Systems
Dey, Samrat; Lewellen, Thomas K.; Miyaoka, Robert S.; Rudell, Jacques C.
2013-01-01
Recent developments in the area of Positron Emission Tomography (PET) detectors using Silicon Photomultipliers (SiPMs) have demonstrated the feasibility of higher resolution PET scanners due to a significant reduction in the detector form factor. The increased detector density requires a proportionally larger number of channels to interface the SiPM array with the backend digital signal processing necessary for eventual image reconstruction. This work presents a CMOS ASIC design for signal reducing readout electronics in support of an 8×8 silicon photomultiplier array. The row/column/diagonal summation circuit significantly reduces the number of required channels, reducing the cost of subsequent digitizing electronics. Current amplifiers are used with a single input from each SiPM cathode. This approach helps to reduce the detector loading, while generating all the necessary row, column and diagonal addressing information. In addition, the single current amplifier used in our Pulse-Positioning architecture facilitates the extraction of pulse timing information. Other components under design at present include a current-mode comparator which enables threshold detection for dark noise current reduction, a transimpedance amplifier and a variable output impedance I/O driver which adapts to a wide range of loading conditions between the ASIC and lines with the off-chip Analog-to-Digital Converters (ADCs). PMID:24301987
NASA Tech Briefs, December 2003
NASA Technical Reports Server (NTRS)
2003-01-01
Topics covered include: Organic/Inorganic Hybrid Polymer/Clay Nanocomposites; Less-Toxic Coatings for Inhibiting Corrosion of Aluminum; Liquid Coatings for Reducing Corrosion of Steel in Concrete; Processable Polyimides Containing APB and Reactive End Caps; Rod/Coil Block Copolyimides for Ion-Conducting Membranes; Techniques for Characterizing Microwave Printed Antennas; Cylindrical Antenna With Partly Adaptive Phased-Array Feed; Command Interface ASIC - Analog Interface ASIC Chip Set; Predicting Accumulations of Ice on Aerodynamic Surfaces; Analyzing Aeroelasticity in Turbomachines; Software for Allocating Resources in the Deep Space Network; Expert Seeker; High-Speed Recording of Test Data on Hard Disks; Functionally Graded Nanophase Beryllium/Carbon Composites; Thin Thermal-Insulation Blankets for Very High Temperatures; Aerostructures Test Wing; Flight-Test Evaluation of Flutter-Prediction Methods; Piezoelectrically Actuated Microvalve for Liquid Effluents; Larger-Stroke Piezoelectrically Actuated Microvalve; Innovative, High-Pressure, Cryogenic Control Valve: Short Face-to-Face, Reduced Cost; Safer Roadside Crash Walls Would Limit Deceleration; Improved Interactive Medical-Imaging System; Scanning Microscopes Using X Rays and Microchannels; Slotting Fins of Heat Exchangers to Provide Thermal Breaks; Methane Clathrate Hydrate Prospecting; Automated Monitoring with a BSP Fault-Detection Test; Automated Monitoring with a BCP Fault-Decision Test; Vector-Ordering Filter Procedure for Data Reduction; Remote Sensing and Information Technology for Large Farms; Developments at the Advanced Design Technologies Testbed; Spore-Forming Bacteria that Resist Sterilization; and Acoustical Applications of the HHT Method.
Development of a dedicated readout ASIC for TPC based X-ray polarimeter
NASA Astrophysics Data System (ADS)
Zhang, Hongyan; Deng, Zhi; Li, Hong; Liu, Yinong; Feng, Hua
2016-07-01
X-ray polarimetry with time projection chambers was firstly proposed by JK Black in 2007 and has been greatly developed since then. It measured two dimensional photoelectron tracks with one dimensional strip and the other dimension was estimated by the drift time from the signal waveforms. A readout ASIC, APV25, originally developed for CMS silicon trackers was used and has shown some limitations such as waveform sampling depth. A dedicated ASIC was developed for TPC based X-ray polarimeters in this paper. It integrated 32 channel circuits and each channel consisted of an analog front-end and a waveform sampler based on switched capacitor array. The analog front-end has a charge sensitive preamplifier with a gain of 25 mV/fC, a CR-RC shaper with a peaking time of 25 ns, a baseline holder and a discriminator for self-triggering. The SCA has a buffer latency of 3.2 μs with 64 cells operating at 20 MSPS. The ASIC was fabricated in a 0.18 μm CMOS process. The equivalent noise charge (ENC) of the analog front-end was measured to be 274.8 e+34.6 e/pF. The effective resolution of the SCA was 8.8 bits at sampling rate up to 50 MSPS. The total power consumption was 2.8 mW per channel. The ASIC was also tested with real TPC detectors and two dimensional photoelectron tracks have been successfully acquired. More tests and analysis on the sensitivity to the polarimetry are undergoing and will be presented in this paper.
NASA Astrophysics Data System (ADS)
Caragiulo, P.; Dragone, A.; Markovic, B.; Herbst, R.; Nishimura, K.; Reese, B.; Herrmann, S.; Hart, P.; Blaj, G.; Segal, J.; Tomada, A.; Hasi, J.; Carini, G.; Kenney, C.; Haller, G.
2015-05-01
ePix10k is a variant of a novel class of integrating pixel ASICs architectures optimized for the processing of signals in second generation LINAC Coherent Light Source (LCLS) X-Ray cameras. The ASIC is optimized for high dynamic range application requiring high spatial resolution and fast frame rates. ePix ASICs are based on a common platform composed of a random access analog matrix of pixel with global shutter, fast parallel column readout, and dedicated sigma-delta analog to digital converters per column. The ePix10k variant has 100um×100um pixels arranged in a 176×192 matrix, a resolution of 140e- r.m.s. and a signal range of 3.5pC (10k photons at 8keV). In its final version it will be able to sustain a frame rate of 2kHz. A first prototype has been fabricated and characterized. Performance in terms of noise, linearity, uniformity, cross-talk, together with preliminary measurements with bump bonded sensors are reported here.
A 32-channel front-end ASIC for GEM detectors used in beam monitoring applications
NASA Astrophysics Data System (ADS)
Ciciriello, F.; Altieri, P. R.; Corsi, F.; De Robertis, G.; Felici, G.; Loddo, F.; Lorusso, L.; Marzocca, C.; Matarrese, G.; Ranieri, A.; Stamerra, A.
2017-11-01
A multichannel, mixed-signal, front-end ASIC for GEM detectors, intended for beam monitoring in hadron therapy applications, has been designed and prototyped in a standard 0.35 μm CMOS technology. The analog channels are based on the classic CSA + shaper processing chain, followed by a peak detector which can work as an analog memory, to simplifiy the analog-to-digital conversion of the peak voltage of the output pulse, proportional to the energy of the detected event. The available hardware resources include an 8-bit A/D converter and a standard-cell digital part, which manages the read-out procedure, in sparse or serial mode. The ASIC is self-triggered and transfers energy and address data to the external DAQ via a fast 100 MHz LVDS link. Preliminary characterization results show that the non-linearity error is limited to 5% for a maximum input charge of about 70 fC, the measured ENC is about 1400e- and the time jitter of the trigger signal generated in response to an injected charge of 60 fC is close to 200 ps.
An application specific integrated circuit based multi-anode microchannel array readout system
NASA Technical Reports Server (NTRS)
Smeins, Larry G.; Stechman, John M.; Cole, Edward H.
1991-01-01
Size reduction of two new multi-anode microchannel array (MAMA) readout systems is described. The systems are based on two analog and one digital application specific integrated circuits (ASICs). The new readout systems reduce volume over previous discrete designs by 80 percent while improving electrical performance on virtually every significant parameter. Emphasis is made on the packaging used to achieve the volume reduction. Surface mount technology (SMT) is combined with modular construction for the analog portion of the readout. SMT reliability concerns and the board area impact of MIL SPEC SMT components is addressed. Package selection for the analog ASIC is discussed. Future sytems will require even denser packaging and the volume reduction progression is shown.
Wessendorf, Kurt O.; Kemper, Dale A.
2003-06-03
A very low power analog pulse processing system implemented as an ASIC useful for processing signals from radiation detectors, among other things. The system incorporates the functions of a charge sensitive amplifier, a shaping amplifier, a peak sample and hold circuit, and, optionally, an analog to digital converter and associated drivers.
NASA Astrophysics Data System (ADS)
Ceresa, D.; Marchioro, A.; Kloukinas, K.; Kaplon, J.; Bialas, W.; Re, V.; Traversi, G.; Gaioni, L.; Ratti, L.
2014-11-01
The CMS tracker at HL-LHC is required to provide prompt information on particles with high transverse momentum to the central Level 1 trigger. For this purpose, the innermost part of the outer tracker is based on a combination of a pixelated sensor with a short strip sensor, the so-called Pixel-Strip module (PS). The readout of these sensors is carried out by distinct ASICs, the Strip Sensor ASIC (SSA), for the strip layer, and the Macro Pixel ASIC (MPA) for the pixel layer. The processing of the data directly on the front-end module represents a design challenge due to the large data volume (30720 pixels and 1920 strips per module) and the limited power budget. This is the reason why several studies have been carried out to find the best compromise between ASICs performance and power consumption. This paper describes the current status of the MPA ASIC development where the logic for generating prompt information on particles with high transverse momentum is implemented. An overview of the readout method is presented with particular attention on the cluster reduction, position encoding and momentum discrimination logic. Concerning the architectural studies, a software test bench capable of reading physics Monte-Carlo generated events has been developed and used to validate the MPA design and to evaluate the MPA performance. The MPA-Light is scheduled to be submitted for fabrication this year and will include the full analog functions and a part of the digital logic of the final version in order to qualify the chosen VLSI technology for the analog front-end, the module assembly and the low voltage digital supply.
Controller and data acquisition system for SIDECAR ASIC driven HAWAII detectors
NASA Astrophysics Data System (ADS)
Ramaprakash, Anamparambu; Burse, Mahesh; Chordia, Pravin; Chillal, Kalpesh; Kohok, Abhay; Mestry, Vilas; Punnadi, Sujit; Sinha, Sakya
2010-07-01
SIDECAR is an Application Specific Integrated Circuit (ASIC), which can be used for control and data acquisition from near-IR HAWAII detectors offered by Teledyne Imaging Sensors (TIS), USA. The standard interfaces provided by Teledyne are COM API and socket servers running under MS Windows platform. These interfaces communicate to the ASIC (and the detector) through an intermediate card called JWST ASIC Drive Electronics (JADE2). As part of an ongoing programme of several years, for developing astronomical focal plane array (CCDs, CMOS and Hybrid) controllers and data acquisition systems (CDAQs), IUCAA is currently developing the next generation controllers employing Virtex-5 family FPGA devices. We present here the capabilities which are built into these new CDAQs for handling HAWAII detectors. In our system, the computer which hosts the application programme, user interface and device drivers runs on a Linux platform. It communicates through a hot-pluggable USB interface (with an optional optical fibre extender) to the FPGA-based card which replaces the JADE2. The FPGA board in turn, controls the SIDECAR ASIC and through it a HAWAII-2RG detector, both of which are located in a cryogenic test Dewar set up which is liquid nitrogen cooled. The system can acquire data over 1, 4, or 32 readout channels, with or without binning, at different speeds, can define sub-regions for readout, offers various readout schemes like Fowler sampling, up-theramp etc. In this paper, we present the performance results obtained from a prototype system.
JPIC-Rad-Hard JPEG2000 Image Compression ASIC
NASA Astrophysics Data System (ADS)
Zervas, Nikos; Ginosar, Ran; Broyde, Amitai; Alon, Dov
2010-08-01
JPIC is a rad-hard high-performance image compression ASIC for the aerospace market. JPIC implements tier 1 of the ISO/IEC 15444-1 JPEG2000 (a.k.a. J2K) image compression standard [1] as well as the post compression rate-distortion algorithm, which is part of tier 2 coding. A modular architecture enables employing a single JPIC or multiple coordinated JPIC units. JPIC is designed to support wide data sources of imager in optical, panchromatic and multi-spectral space and airborne sensors. JPIC has been developed as a collaboration of Alma Technologies S.A. (Greece), MBT/IAI Ltd (Israel) and Ramon Chips Ltd (Israel). MBT IAI defined the system architecture requirements and interfaces, The JPEG2K-E IP core from Alma implements the compression algorithm [2]. Ramon Chips adds SERDES interfaces and host interfaces and integrates the ASIC. MBT has demonstrated the full chip on an FPGA board and created system boards employing multiple JPIC units. The ASIC implementation, based on Ramon Chips' 180nm CMOS RadSafe[TM] RH cell library enables superior radiation hardness.
Valente, Virgilio; Dai Jiang; Demosthenous, Andreas
2015-08-01
This paper presents the preliminary design and simulation of a flexible and programmable analog front-end (AFE) circuit with current and voltage readout capabilities for electric impedance spectroscopy (EIS). The AFE is part of a fully integrated multifrequency EIS platform. The current readout comprises of a transimpedance stage and an automatic gain control (AGC) unit designed to accommodate impedance changes larger than 3 order of magnitude. The AGC is based on a dynamic peak detector that tracks changes in the input current over time and regulates the gain of a programmable gain amplifier in order to optimise the signal-to-noise ratio. The system works up to 1 MHz. The voltage readout consists of a 2 stages of fully differential current-feedback instrumentation amplifier which provide 100 dB of CMRR and a programmable gain up to 20 V/V per stage with a bandwidth in excess of 10MHz.
Development of a 32-channel ASIC for an X-ray APD detector onboard the ISS
NASA Astrophysics Data System (ADS)
Arimoto, Makoto; Harita, Shohei; Sugita, Satoshi; Yatsu, Yoichi; Kawai, Nobuyuki; Ikeda, Hirokazu; Tomida, Hiroshi; Isobe, Naoki; Ueno, Shiro; Mihara, Tatehiro; Serino, Motoko; Kohmura, Takayoshi; Sakamoto, Takanori; Yoshida, Atsumasa; Tsunemi, Hiroshi; Hatori, Satoshi; Kume, Kyo; Hasegawa, Takashi
2018-02-01
We report on the design and performance of a mixed-signal application specific integrated circuit (ASIC) dedicated to avalanche photodiodes (APDs) in order to detect hard X-ray emissions in a wide energy band onboard the International Space Station. To realize wide-band detection from 20 keV to 1 MeV, we use Ce:GAGG scintillators, each coupled to an APD, with low-noise front-end electronics capable of achieving a minimum energy detection threshold of 20 keV. The developed ASIC has the ability to read out 32-channel APD signals using 0.35 μm CMOS technology, and an analog amplifier at the input stage is designed to suppress the capacitive noise primarily arising from the large detector capacitance of the APDs. The ASIC achieves a performance of 2099 e- + 1.5 e-/pF at root mean square (RMS) with a wide 300 fC dynamic range. Coupling a reverse-type APD with a Ce:GAGG scintillator, we obtain an energy resolution of 6.7% (FWHM) at 662 keV and a minimum detectable energy of 20 keV at room temperature (20 °C). Furthermore, we examine the radiation tolerance for space applications by using a 90 MeV proton beam, confirming that the ASIC is free of single-event effects and can operate properly without serious degradation in analog and digital processing.
A Radiation Hardened by Design CMOS ASIC for Thermopile Readouts
NASA Technical Reports Server (NTRS)
Quilligan, G.; Aslam, S.; DuMonthier, J.
2012-01-01
A radiation hardened by design (RHBD) mixed-signal application specific integrated circuit (ASIC) has been designed for a thermopile readout for operation in the harsh Jovian orbital environment. The multi-channel digitizer (MCD) ASIC includes 18 low noise amplifier channels which have tunable gain/filtering coefficients, a 16-bit sigma-delta analog-digital converter (SDADC) and an on-chip controller. The 18 channels, SDADC and controller were designed to operate with immunity to single event latchup (SEL) and to at least 10 Mrad total ionizing dose (TID). The ASIC also contains a radiation tolerant 16-bit 20 MHz Nyquist ADC for general purpose instrumentation digitizer needs. The ASIC is currently undergoing fabrication in a commercial 180 nm CMOS process. Although this ASIC was designed specifically for the harsh radiation environment of the NASA led JEO mission it is suitable for integration into instrumentation payloads 011 the ESA JUICE mission where the radiation hardness requirements are slightly less stringent.
2010-01-01
Background Acid-sensing ion channels (ASICs) have long been known to sense extracellular protons and contribute to sensory perception. Peripheral ASIC3 channels represent natural sensors of acidic and inflammatory pain. We recently reported the use of a synthetic compound, 2-guanidine-4-methylquinazoline (GMQ), to identify a novel nonproton sensing domain in the ASIC3 channel, and proposed that, based on its structural similarity with GMQ, the arginine metabolite agmatine (AGM) may be an endogenous nonproton ligand for ASIC3 channels. Results Here, we present further evidence for the physiological correlation between AGM and ASIC3. Among arginine metabolites, only AGM and its analog arcaine (ARC) activated ASIC3 channels at neutral pH in a sustained manner similar to GMQ. In addition to the homomeric ASIC3 channels, AGM also activated heteromeric ASIC3 plus ASIC1b channels, extending its potential physiological relevance. Importantly, the process of activation by AGM was highly sensitive to mild acidosis, hyperosmolarity, arachidonic acid (AA), lactic acid and reduced extracellular Ca2+. AGM-induced ASIC3 channel activation was not through the chelation of extracellular Ca2+ as occurs with increased lactate, but rather through a direct interaction with the newly identified nonproton ligand sensing domain. Finally, AGM cooperated with the multiple inflammatory signals to cause pain-related behaviors in an ASIC3-dependent manner. Conclusions Nonproton ligand sensing domain might represent a novel mechanism for activation or sensitization of ASIC3 channels underlying inflammatory pain-sensing under in vivo conditions. PMID:21143836
NASA Astrophysics Data System (ADS)
Caragiulo, P.; Dragone, A.; Markovic, B.; Herbst, R.; Nishimura, K.; Reese, B.; Herrmann, S.; Hart, P.; Blaj, G.; Segal, J.; Tomada, A.; Hasi, J.; Carini, G.; Kenney, C.; Haller, G.
2014-09-01
ePix100 is the first variant of a novel class of integrating pixel ASICs architectures optimized for the processing of signals in second generation LINAC Coherent Light Source (LCLS) X-Ray cameras. ePix100 is optimized for ultra-low noise application requiring high spatial resolution. ePix ASICs are based on a common platform composed of a random access analog matrix of pixel with global shutter, fast parallel column readout, and dedicated sigma-delta analog to digital converters per column. The ePix100 variant has 50μmx50μm pixels arranged in a 352x384 matrix, a resolution of 50e- r.m.s. and a signal range of 35fC (100 photons at 8keV). In its final version it will be able to sustain a frame rate of 1kHz. A first prototype has been fabricated and characterized and the measurement results are reported here.
Analog front-end design of the STS/MUCH-XYTER2—full size prototype ASIC for the CBM experiment
NASA Astrophysics Data System (ADS)
Kleczek, Rafal
2017-01-01
The design of the analog front-end of the STS/MUCH-XYTER2 ASIC, a full-size prototype chip for the Silicon Tracking System (STS, based on double-sided silicon strip sensors) and Muon Chamber (MUCH, based on gas sensors) detectors is presented. The ASIC contains 128 charge processing channels, each built of a charge sensitive amplifier, a polarity selection circuit and two pulse shaping amplifiers forming two parallel signal paths. The first path is used for timing measurement with a fast discriminator. The second path allows low-noise amplitude measurement with a 5-bit continuous-time flash ADC. Different operating conditions and constraints posed by two target detectors' applications require front-end electronics flexibility to meet extended system-wise requirements. The presented circuit implements switchable shaper peaking time, gain switching and trimming, input amplifier pulsed reset circuit, fail-safe measures. The power consumption is scalable (for the STS and the MUCH modes), but limited to 10 mW/channel.
SPIDR, a general-purpose readout system for pixel ASICs
NASA Astrophysics Data System (ADS)
van der Heijden, B.; Visser, J.; van Beuzekom, M.; Boterenbrood, H.; Kulis, S.; Munneke, B.; Schreuder, F.
2017-02-01
The SPIDR (Speedy PIxel Detector Readout) system is a flexible general-purpose readout platform that can be easily adapted to test and characterize new and existing detector readout ASICs. It is originally designed for the readout of pixel ASICs from the Medipix/Timepix family, but other types of ASICs or front-end circuits can be read out as well. The SPIDR system consists of an FPGA board with memory and various communication interfaces, FPGA firmware, CPU subsystem and an API library on the PC . The FPGA firmware can be adapted to read out other ASICs by re-using IP blocks. The available IP blocks include a UDP packet builder, 1 and 10 Gigabit Ethernet MAC's and a "soft core" CPU . Currently the firmware is targeted at the Xilinx VC707 development board and at a custom board called Compact-SPIDR . The firmware can easily be ported to other Xilinx 7 series and ultra scale FPGAs. The gap between an ASIC and the data acquisition back-end is bridged by the SPIDR system. Using the high pin count VITA 57 FPGA Mezzanine Card (FMC) connector only a simple chip carrier PCB is required. A 1 and a 10 Gigabit Ethernet interface handle the connection to the back-end. These can be used simultaneously for high-speed data and configuration over separate channels. In addition to the FMC connector, configurable inputs and outputs are available for synchronization with other detectors. A high resolution (≈ 27 ps bin size) Time to Digital converter is provided for time stamping events in the detector. The SPIDR system is frequently used as readout for the Medipix3 and Timepix3 ASICs. Using the 10 Gigabit Ethernet interface it is possible to read out a single chip at full bandwidth or up to 12 chips at a reduced rate. Another recent application is the test-bed for the VeloPix ASIC, which is developed for the Vertex Detector of the LHCb experiment. In this case the SPIDR system processes the 20 Gbps scrambled data stream from the VeloPix and distributes it over four 10 Gigabit Ethernet links, and in addition provides the slow and fast control for the chip.
Zeng, Wei-Zheng; Liu, Di-Shi; Liu, Lu; She, Liang; Wu, Long-Jun; Xu, Tian-Le
2015-09-15
Extracellular transients of pH alterations likely mediate signal transduction in the nervous system. Neuronal acid-sensing ion channels (ASICs) act as sensors for extracellular protons, but the mechanism underlying ASIC activation remains largely unknown. Here, we show that, following activation of a light-activated proton pump, Archaerhodopsin-3 (Arch), proton transients induced ASIC currents in both neurons and HEK293T cells co-expressing ASIC1a channels. Using chimera proteins that bridge Arch and ASIC1a by a glycine/serine linker, we found that successful coupling occurred within 15 nm distance. Furthermore, two-cell sniffer patch recording revealed that regulated release of protons through either Arch or voltage-gated proton channel Hv1 activated neighbouring cells expressing ASIC1a channels. Finally, computational modelling predicted the peak proton concentration at the intercellular interface to be at pH 6.7, which is acidic enough to activate ASICs in vivo. Our results highlight the pathophysiological role of proton signalling in the nervous system.
Stability of the Baseline Holder in Readout Circuits For Radiation Detectors
Chen, Y.; Cui, Y.; O’Connor, P.; Seo, Y.; Camarda, G. S.; Hossain, A.; Roy, U.; Yang, G.; James, R. B.
2016-01-01
Baseline holder (BLH) circuits are used widely to stabilize the analog output of application-specific integrated circuits (ASICs) for high-count-rate applications. The careful design of BLH circuits is vital to the overall stability of the analog-signal-processing chain in ASICs. Recently, we observed self-triggered fluctuations in an ASIC in which the shaping circuits have a BLH circuit in the feedback loop. In fact, further investigations showed that methods of enhancing small-signal stabilities cause an even worse situation. To resolve this problem, we used large-signal analyses to study the circuit’s stability. We found that a relatively small gain for the error amplifier and a small current in the non-linear stage of the BLH are required to enhance stability in large-signal analysis, which will compromise the properties of the BLH. These findings were verified by SPICE simulations. In this paper, we present our detailed analysis of the BLH circuits, and propose an improved version of them that have only minimal self-triggered fluctuations. We summarize the design considerations both for the stability and the properties of the BLH circuits. PMID:27182081
LSST camera readout chip ASPIC: test tools
NASA Astrophysics Data System (ADS)
Antilogus, P.; Bailly, Ph; Jeglot, J.; Juramy, C.; Lebbolo, H.; Martin, D.; Moniez, M.; Tocut, V.; Wicek, F.
2012-02-01
The LSST camera will have more than 3000 video-processing channels. The readout of this large focal plane requires a very compact readout chain. The correlated ''Double Sampling technique'', which is generally used for the signal readout of CCDs, is also adopted for this application and implemented with the so called ''Dual Slope integrator'' method. We have designed and implemented an ASIC for LSST: the Analog Signal Processing asIC (ASPIC). The goal is to amplify the signal close to the output, in order to maximize signal to noise ratio, and to send differential outputs to the digitization. Others requirements are that each chip should process the output of half a CCD, that is 8 channels and should operate at 173 K. A specific Back End board has been designed especially for lab test purposes. It manages the clock signals, digitizes the analog differentials outputs of ASPIC and stores data into a memory. It contains 8 ADCs (18 bits), 512 kwords memory and an USB interface. An FPGA manages all signals from/to all components on board and generates the timing sequence for ASPIC. Its firmware is written in Verilog and VHDL languages. Internals registers permit to define various tests parameters of the ASPIC. A Labview GUI allows to load or update these registers and to check a proper operation. Several series of tests, including linearity, noise and crosstalk, have been performed over the past year to characterize the ASPIC at room and cold temperature. At present, the ASPIC, Back-End board and CCD detectors are being integrated to perform a characterization of the whole readout chain.
CWICOM: A Highly Integrated & Innovative CCSDS Image Compression ASIC
NASA Astrophysics Data System (ADS)
Poupat, Jean-Luc; Vitulli, Raffaele
2013-08-01
The space market is more and more demanding in terms of on image compression performances. The earth observation satellites instrument resolution, the agility and the swath are continuously increasing. It multiplies by 10 the volume of picture acquired on one orbit. In parallel, the satellites size and mass are decreasing, requiring innovative electronic technologies reducing size, mass and power consumption. Astrium, leader on the market of the combined solutions for compression and memory for space application, has developed a new image compression ASIC which is presented in this paper. CWICOM is a high performance and innovative image compression ASIC developed by Astrium in the frame of the ESA contract n°22011/08/NLL/LvH. The objective of this ESA contract is to develop a radiation hardened ASIC that implements the CCSDS 122.0-B-1 Standard for Image Data Compression, that has a SpaceWire interface for configuring and controlling the device, and that is compatible with Sentinel-2 interface and with similar Earth Observation missions. CWICOM stands for CCSDS Wavelet Image COMpression ASIC. It is a large dynamic, large image and very high speed image compression ASIC potentially relevant for compression of any 2D image with bi-dimensional data correlation such as Earth observation, scientific data compression… The paper presents some of the main aspects of the CWICOM development, such as the algorithm and specification, the innovative memory organization, the validation approach and the status of the project.
NASA Technical Reports Server (NTRS)
1997-01-01
The NASA Lewis Research Center is sponsoring the Advanced Communication Technology Insertion (ACTION) for Commercial Space Applications program. The goal of the program is to expedite the development of new technology with a clear path towards productization and enhancing the competitiveness of U.S. manufacturers. The industry has made significant investment in developing ASIC-based modem technology for continuous-mode applications and has made investigations into East, reliable acquisition of burst-mode digital communication signals. With rapid advances in analog and digital communications ICs, it is expected that more functions will be integrated onto these parts in the near future. In addition custom ASIC's can also be developed to address the areas not covered by the other IC's. Using the commercial chips and custom ASIC's, lower-cost, compact, reliable, and high-performance modems can be built for demanding satellite communication application. This report outlines a frequency-hop burst modem design based on commercially available chips.
NASA Astrophysics Data System (ADS)
Caratelli, A.; Bonacini, S.; Kloukinas, K.; Marchioro, A.; Moreira, P.; De Oliveira, R.; Paillard, C.
2015-03-01
The future upgrades of the LHC experiments will increase the beam luminosity leading to a corresponding growth of the amounts of data to be treated by the data acquisition systems. To address these needs, the GBT (Giga-Bit Transceiver optical link [1,2]) architecture was developed to provide the simultaneous transfer of readout data, timing and trigger signals as well as slow control and monitoring data. The GBT-SCA ASIC, part of the GBT chip-set, has the purpose to distribute control and monitoring signals to the on-detector front-end electronics and perform monitoring operations of detector environmental parameters. In order to meet the requirements of different front-end ASICs used in the experiments, it provides various user-configurable interfaces capable to perform simultaneous operations. It is designed employing radiation tolerant design techniques to ensure robustness against SEUs and TID radiation effects and is implemented in a commercial 130 nm CMOS technology. This work presents the GBT-SCA architecture, the ASIC interfaces, the data transfer protocol, and its integration with the GBT optical link.
Zeng, Wei-Zheng; Liu, Di-Shi; Liu, Lu; She, Liang; Wu, Long-Jun; Xu, Tian-Le
2015-01-01
Extracellular transients of pH alterations likely mediate signal transduction in the nervous system. Neuronal acid-sensing ion channels (ASICs) act as sensors for extracellular protons, but the mechanism underlying ASIC activation remains largely unknown. Here, we show that, following activation of a light-activated proton pump, Archaerhodopsin-3 (Arch), proton transients induced ASIC currents in both neurons and HEK293T cells co-expressing ASIC1a channels. Using chimera proteins that bridge Arch and ASIC1a by a glycine/serine linker, we found that successful coupling occurred within 15 nm distance. Furthermore, two-cell sniffer patch recording revealed that regulated release of protons through either Arch or voltage-gated proton channel Hv1 activated neighbouring cells expressing ASIC1a channels. Finally, computational modelling predicted the peak proton concentration at the intercellular interface to be at pH 6.7, which is acidic enough to activate ASICs in vivo. Our results highlight the pathophysiological role of proton signalling in the nervous system. PMID:26370138
DOE Office of Scientific and Technical Information (OSTI.GOV)
De Geronimo, G.; Fried, J.; Rehak, P.
We present an application-specific integrated circuit (ASIC) for high-resolution x-ray spectrometers (XRS). The ASIC reads out signals from pixelated silicon drift detectors (SDDs). The pixel does not have an integrated field effect transistor (FET); rather, readout is accomplished by wire-bonding the anodes to the inputs of the ASIC. The ASIC dissipates 32 mW, and offers 16 channels of low-noise charge amplification, high-order shaping with baseline stabilization, discrimination, a novel pile-up rejector, and peak detection with an analog memory. The readout is sparse and based on custom low-power tristatable low-voltage differential signaling (LPT-LVDS). A unit of 64 SDD pixels, read outmore » by four ASICs, covers an area of 12.8 cm{sup 2} and dissipates with the sensor biased about 15 mW/cm{sup 2}. As a tile-based system, the 64-pixel units cover a large detection area. Our preliminary measurements at -44 C show a FWHM of 145 eV at the 5.9 keV peak of a {sup 55}Fe source, and less than 80 eV on a test-pulse line at 200 eV.« less
A Radiation Dosimeter Concept for the Lunar Surface Environment
NASA Technical Reports Server (NTRS)
Adams, James H.; Christl, Mark J.; Watts, John; Kuznetsov, Eugeny N.; Parnell, Thomas A.; Pendleton, Geoff N.
2007-01-01
A novel silicon detector configuration for radiation dose measurements in an environment where solar energetic particles are of most concern is described. The dosimeter would also measure the dose from galactic cosmic rays. In the lunar environment a large range in particle flux and ionization density must be measured and converted to dose equivalent. This could be accomplished with a thick (e.g. 2mm) silicon detector segmented into cubic volume elements "voxels" followed by a second, thin monolithic silicon detector. The electronics needed to implement this detector concept include analog signal processors (ASIC) and a field programmable gate array (FPGA) for data accumulation and conversion to linear energy transfer (LET) spectra and to dose-equivalent (Sievert). Currently available commercial ASIC's and FPGA's are suitable for implementing the analog and digital systems.
NASA Technical Reports Server (NTRS)
Quilligan, Gerard T.; Aslam, Shahid; Lakew, Brook; DuMonthier, Jeffery J.; Katz, Richard B.; Kleyner, Igor
2014-01-01
Radiation hardened by design (RHBD) techniques allow commercial CMOS circuits to operate in high total ionizing dose and particle fluence environments. Our radiation hard multi-channel digitizer (MCD) ASIC (Figure 1) is a versatile analog system on a chip (SoC) fabricated in 180nm CMOS. It provides 18 chopper stabilized amplifier channels, a 16- bit sigma-delta analog-digital converter (SDADC) and an on-chip controller. The MCD was evaluated at Goddard Space Flight Center and Texas A&M University's radiation effects facilities and found to be immune to single event latchup (SEL) and total ionizing dose (TID) at 174 MeV-cm(exp 2)/mg and 50 Mrad (Si) respectively.
NASA Astrophysics Data System (ADS)
Di Pietro, V.; Brinkmann, K.-Th.; Riccardi, A.; Ritman, J.; Rivetti, A.; Rolo, M. D.; Stockmanns, T.; Zambanini, A.
2016-03-01
The bar PANDA (Antiproton Annihilation at Darmstadt) experiment foresees many detectors for tracking, particle identification and calorimetry. Among them, the innermost is the MVD (Micro Vertex Detector) responsible for a precise tracking and the reconstruction of secondary vertices. This detector will be built from both hybrid pixel (two inner barrels and six forward disks) and double-sided micro strip (two outer barrels and outer rim of the last two disks) silicon sensors. A time-based approach has been chosen for the readout ASIC of the strip sensors. The PASTA (bar PANDA Strip ASIC) chip aims at high resolution time-stamping and charge information through the Time over Threshold (ToT) technique. It benefits from a Time to Digital Converter (TDC) allowing a time bin width down to 50 ps. The analog front-end was designed to serve both n-type and p-type strips and the performed simulations show remarkable performances in terms of linearity and electronic noise. The TDC consists of an analog interpolator, a digital local controller, and a digital global controller as the common back-end for all of the 64 channels.
VMM - An ASIC for Micropattern Detectors
NASA Astrophysics Data System (ADS)
Iakovidis, George
2018-02-01
The VMM is a custom Application Specific Integrated Circuit (ASIC) that can be used in a variety of charge interpolating tracking detectors. It is designed to be used with the resistive strip micromegas and sTGC detectors in the New Small Wheel upgrade of the ATLAS Muon spectrometer. The ASIC is designed at Brookhaven National Laboratory and fabricated in the 130 nm Global Foundries 8RF-DM process. It is packaged in a Ball Grid Array with outline dimensions of 21×21 mm2. It integrates 64 channels, each providing charge amplification, discrimination, neighbour logic, amplitude and timing measurements, analog-to-digital conversions, and either direct output for trigger or multiplexed readout. The front-end amplifier can operate with a wide range of input capacitances, has adjustable polarity, gain and peaking time. The VMM1 and VMM2 are the first two versions of the VMM ASIC family fabricated in 2012 and 2014 respectively. The design, tests and qualification of the VMM1, VMM2 and roadmap to VMM3 are described.
Design of a Multi-Channel Low-Noise Readout ASIC for CdZnTe-Based X-Ray and γ-Ray Spectrum Analyzer
NASA Astrophysics Data System (ADS)
Gan, B.; Wei, T.; Gao, W.; Zheng, R.; Hu, Y.
2015-10-01
In this paper, we report on the recent development of a 32-channel low-noise front-end readout ASIC for cadmium zinc telluride (CdZnTe) X-ray and γ-ray detectors. Each readout channel includes a charge sensitive amplifier, a CR-RC shaping amplifier and an analog output buffer. The readout ASIC is implemented using TSMC 0.35 - μm mixed-signal CMOS technology, the die size of the prototype chip is 2.2 mm ×4.8 mm. At room temperature, the equivalent noise level of a typical channel reaches 133 e- (rms) with the input parasitic capacitance of 0 pF for the average power consumption of 2.8 mW per channel. The linearity error is less than ±2% and the input energy dynamic range of the readout ASIC is from 10 keV to 1 MeV. The crosstalk between the channels is less than 0.4%. By connecting the readout ASIC to a CdZnTe detector, we obtained a γ-ray spectrum, the energy resolution is 1.8% at the 662-keV line of 137Cs source.
Epithelial Sodium and Acid-Sensing Ion Channels
NASA Astrophysics Data System (ADS)
Kellenberger, Stephan
The epithelial Na+ channel (ENaC) and acid-sensing ion channels (ASICs) are non-voltage-gated Na+ channels that form their own subfamilies within the ENaC/degenerin ion channel family. ASICs are sensors of extracellular pH, and ENaC, whose main function is trans-epithelial Na+ transport, can sense extra- and intra-cellular Na+. In aldosterone-responsive epithelial cells of the kidney, ENaC plays a critical role in the control of sodium balance, blood volume and blood pressure. In airway epithelia, ENaC has a distinct role in controlling fluid reabsorption at the air-liquid interface, thereby determining the rate of mucociliary transport. In taste receptor cells of the tongue, ENaC is involved in salt taste sensation. ASICs have emerged as key sensors for extracellular protons in central and peripheral neurons. Although not all of their physiological and pathological functions are firmly established yet, there is good evidence for a role of ASICs in the brain in learning, expression of fear, and in neurodegeneration after ischaemic stroke. In sensory neurons, ASICs are involved in nociception and mechanosensation. ENaC and ASIC subunits share substantial sequence homology and the conservation of several functional domains. This chapter summarises our current understanding of the physiological functions and of the mechanisms of ion permeation, gating and regulation of ENaC and ASICs.
Cryogenic and radiation hard ASIC design for large format NIR/SWIR detector
NASA Astrophysics Data System (ADS)
Gao, Peng; Dupont, Benoit; Dierickx, Bart; Müller, Eric; Verbruggen, Geert; Gielis, Stijn; Valvekens, Ramses
2014-10-01
An ASIC is developed to control and data quantization for large format NIR/SWIR detector arrays. Both cryogenic and space radiation environment issue are considered during the design. Therefore it can be integrated in the cryogenic chamber, which reduces significantly the vast amount of long wires going in and out the cryogenic chamber, i.e. benefits EMI and noise concerns, as well as the power consumption of cooling system and interfacing circuits. In this paper, we will describe the development of this prototype ASIC for image sensor driving and signal processing as well as the testing in both room and cryogenic temperature.
Wang, J Y; Wang, Z M; Jeurgens, L P H; Mittemeijer, E J
2009-06-01
Aluminium-induced crystallization (ALIC) of amorphous Si and subsequent layer exchange (ALILE) occur in amorphous-Si/polycrystalline-Al bilayers (a-Si/c-Al) upon annealing at temperatures as low as 165 degrees C and were studied by X-ray diffraction and Auger electron spectroscopic depth profiling. It follows that: (i) nucleation of Si crystallization is initiated at Al grain boundaries and not at the a-Si/c-Al interface; (ii) low-temperature annealing results in a large Si grain size in the continuous c-Si layer produced by ALILE. Thermodynamic model calculations show that: (i) Si can "wet" the Al grain boundaries due to the favourable a-Si/c-Al interface energy (as compared to the Al grain-boundary energy); (ii) the wetting-induced a-Si layer at the Al grain boundary can maintain its amorphous state only up to a critical thickness, beyond which nucleation of Si crystallization takes place; and (iii) a tiny driving force controls the kinetics of the layer exchange.
IMOTEPAD: A mixed-signal 64-channel front-end ASIC for small-animal PET imaging
NASA Astrophysics Data System (ADS)
Fang, Xiaochao; Ollivier-Henry, Nicolas; Gao, Wu; Hu-Guo, Christine; Colledani, Claude; Humbert, Bernard; Brasse, David; Hu, Yann
2011-04-01
This paper presents the design and characteristics of a mixed-signal 64-channel front-end readout ASIC called IMOTEPAD dedicated to multi-channel plate (MCP) photodetector coupled to LYSO scintillating crystals for small-animal PET imaging. In our configuration, the crystals are oriented in the axial direction readout on both sides by individual photodetector channels allowing the spatial resolution and the detection efficiency to be independent of each other. As a result, both energy signals and timing triggers from the photodetectors are required to be read out by the front-end ASIC. This dedicated ASIC IMOTEPAD comprises two parts: the analog part IMOTEPA and the digital part IMOTEPD. The IMOTEPA is dedicated to energy measurement. And the timing information is digitized by the IMOTEPD in which the key principal element is a time-to-digital converter (TDC) based on a delay-locked loop (DLL) with 32 delay cells. The chip is designed and fabricated in 0.35 μm CMOS process. The measurements show that for the analog part IMOTEPA, the energy gain is 13.1 mV/pC while the peak time of a CR-RC pulse shaper is 280 ns. The SNR is 39 dB and the RMS noise is 300 μV. The nonlinearity is less than 3%. The crosstalk is less than 0.2%. For the IMOTEPD, the bin size of the TDC is 625 ps with a reference clock of 50 MHz. The RMS jitter of the DLL is less than 42 ps. The DNL of the TDC is equal to about 0.17 LSB and the INL is equal to 0.31 LSB. The power dissipation of each channel is less than 16.8 mW. The design of the ASIC, especially for TDC and the measurement results of the IMOTEPAD will be presented and discussed in this paper.
DOE Office of Scientific and Technical Information (OSTI.GOV)
DE GERONIMO,G.; CHEN, W.; FRIED, J.
We present an application specific integrated circuit (ASIC) for high-resolution x-ray spectrometers. The ASIC is designed to read out signals from a pixelated silicon drift detector (SDD). Each hexagonal pixel has an area of 15 mmz and an anode capacitance of less than 100 fF. There is no integrated Field Effect transistor (FET) in the pixel, rather, the readout is done by wirebonding the anodes to the inputs of the ASIC. The ASIC provides 14 channels of low-noise charge amplification, high-order shaping with baseline stabilization, and peak detection with analog memory. The readout is sparse and based on low voltagemore » differential signaling. An interposer provides all the interconnections required to bias and operate the system. The channel dissipates 1.6 mW. The complete 14-pixel unit covers an area of 210 mm{sup 2}, dissipates 12 mW cm{sup -2}, and can be tiled to cover an arbitrarily large detection area. We measured a preliminary resolution of 172 eV at -35 C on the 6 keV peak of a {sup 55}Fe source.« less
A High Performance LIA-Based Interface for Battery Powered Sensing Devices
García-Romeo, Daniel; Valero, María R.; Medrano, Nicolás; Calvo, Belén; Celma, Santiago
2015-01-01
This paper proposes a battery-compatible electronic interface based on a general purpose lock-in amplifier (LIA) capable of recovering input signals up to the MHz range. The core is a novel ASIC fabricated in 1.8 V 0.18 µm CMOS technology, which contains a dual-phase analog lock-in amplifier consisting of carefully designed building blocks to allow configurability over a wide frequency range while maintaining low power consumption. It operates using square input signals. Hence, for battery-operated microcontrolled systems, where square reference and exciting signals can be generated by the embedded microcontroller, the system benefits from intrinsic advantages such as simplicity, versatility and reduction in power and size. Experimental results confirm the signal recovery capability with signal-to-noise power ratios down to −39 dB with relative errors below 0.07% up to 1 MHz. Furthermore, the system has been successfully tested measuring the response of a microcantilever-based resonant sensor, achieving similar results with better power-bandwidth trade-off compared to other LIAs based on commercial off-the-shelf (COTS) components and commercial LIA equipment. PMID:26437408
A High Performance LIA-Based Interface for Battery Powered Sensing Devices.
García-Romeo, Daniel; Valero, María R; Medrano, Nicolás; Calvo, Belén; Celma, Santiago
2015-09-30
This paper proposes a battery-compatible electronic interface based on a general purpose lock-in amplifier (LIA) capable of recovering input signals up to the MHz range. The core is a novel ASIC fabricated in 1.8 V 0.18 µm CMOS technology, which contains a dual-phase analog lock-in amplifier consisting of carefully designed building blocks to allow configurability over a wide frequency range while maintaining low power consumption. It operates using square input signals. Hence, for battery-operated microcontrolled systems, where square reference and exciting signals can be generated by the embedded microcontroller, the system benefits from intrinsic advantages such as simplicity, versatility and reduction in power and size. Experimental results confirm the signal recovery capability with signal-to-noise power ratios down to -39 dB with relative errors below 0.07% up to 1 MHz. Furthermore, the system has been successfully tested measuring the response of a microcantilever-based resonant sensor, achieving similar results with better power-bandwidth trade-off compared to other LIAs based on commercial off-the-shelf (COTS) components and commercial LIA equipment.
NASA Astrophysics Data System (ADS)
Cho, M.; Lim, K.-t.; Kim, H.; Yeom, J.-y.; Kim, J.; Lee, C.; Choi, H.; Cho, G.
2017-01-01
In most cases, a PET system has numerous electrical components and channel circuits and thus it would rather be a bulky product. Also, most existing systems receive analog signals from detectors which make them vulnerable to signal distortions. For these reasons, channel reduction techniques are important. In this work, an ASIC for PET module is being proposed. An ASIC chip for 16 PET detector channels, VSSPDC, has been designed and simulated. The main function of the chip is 16-to-1 channel reduction, i.e., finding the position of only the valid signals, signal timing, and magnitudes in all 16 channels at every recorded event. The ASIC comprises four of 4-channel modules and a 2nd 4-to-1 router. A single channel module comprises a transimpedance amplifier for the silicon photomultipliers, dual comparators with high and low level references, and a logic circuitry. While the high level reference was used to test the validity of the signal, the low level reference was used for the timing. The 1-channel module of the ASIC produced an energy pulse by time-over-threshold method and it also produced a time pulse with a fixed delayed time. Since the ASIC chip outputs only a few digital pulses and does not require an external clock, it has an advantage over noise properties. The cadence simulation showed the good performance of the chip as designed.
An Energy-Efficient ASIC for Wireless Body Sensor Networks in Medical Applications.
Xiaoyu Zhang; Hanjun Jiang; Lingwei Zhang; Chun Zhang; Zhihua Wang; Xinkai Chen
2010-02-01
An energy-efficient application-specific integrated circuit (ASIC) featured with a work-on-demand protocol is designed for wireless body sensor networks (WBSNs) in medical applications. Dedicated for ultra-low-power wireless sensor nodes, the ASIC consists of a low-power microcontroller unit (MCU), a power-management unit (PMU), reconfigurable sensor interfaces, communication ports controlling a wireless transceiver, and an integrated passive radio-frequency (RF) receiver with energy harvesting ability. The MCU, together with the PMU, provides quite flexible communication and power-control modes for energy-efficient operations. The always-on passive RF receiver with an RF energy harvesting block offers the sensor nodes the capability of work-on-demand with zero standby power. Fabricated in standard 0.18-¿m complementary metal-oxide semiconductor technology, the ASIC occupies a die area of 2 mm × 2.5 mm. A wireless body sensor network sensor-node prototype using this ASIC only consumes < 10-nA current under the passive standby mode, and < 10 ¿A under the active standby mode, when supplied by a 3-V battery.
NASA Astrophysics Data System (ADS)
Seljak, A.; Cumming, H. S.; Varner, G.; Vallerga, J.; Raffanti, R.; Virta, V.
2018-02-01
Our collaboration works on the development of a large aperture, high resolution, UV single-photon imaging detector, funded through NASA's Strategic Astrophysics Technology (SAT) program. The detector uses a microchannel plate for charge multiplication, and orthogonal cross strip (XS) anodes for charge readout. Our target is to make an advancement in the technology readiness level (TRL), which enables real scale prototypes to be tested for future NASA missions. The baseline detector has an aperture of 50×50 mm and requires 160 low-noise charge-sensitive channels, in order to extrapolate the incoming photon position with a spatial resolution of about 20 μm FWHM. Technologies involving space flight require highly integrated electronic systems operating at very low power. We have designed two ASICs which enable the construction of such readout system. First, a charge sensitive amplifier (CSAv3) ASIC provides an equivalent noise charge (ENC) of around 600 e-, and a baseline gain of 10 mV/fC. The second, a Giga Sample per Second (GSPS) ASIC, called HalfGRAPH, is a 12-bit analog to digital converter. Its architecture is based on waveform sampling capacitor arrays and has about 8 μs of analog storage memory per channel. Both chips encapsulate 16 measurement channels. Using these chips, a small scale prototype readout system has been constructed on a FPGA Mezzanine Board (FMC), equipped with 32 measurement channels for system evaluation. We describe the construction of HalfGRAPH ASIC, detector's readout system concept and obtained results from the prototype system. As part of the space flight qualification, these chips were irradiated with a Cobalt gamma-ray source, to verify functional operation under ionizing radiation exposure.
Design methodology: edgeless 3D ASICs with complex in-pixel processing for pixel detectors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fahim Farah, Fahim Farah; Deptuch, Grzegorz W.; Hoff, James R.
The design methodology for the development of 3D integrated edgeless pixel detectors with in-pixel processing using Electronic Design Automation (EDA) tools is presented. A large area 3 tier 3D detector with one sensor layer and two ASIC layers containing one analog and one digital tier, is built for x-ray photon time of arrival measurement and imaging. A full custom analog pixel is 65μm x 65μm. It is connected to a sensor pixel of the same size on one side, and on the other side it has approximately 40 connections to the digital pixel. A 32 x 32 edgeless array withoutmore » any peripheral functional blocks constitutes a sub-chip. The sub-chip is an indivisible unit, which is further arranged in a 6 x 6 array to create the entire 1.248cm x 1.248cm ASIC. Each chip has 720 bump-bond I/O connections, on the back of the digital tier to the ceramic PCB. All the analog tier power and biasing is conveyed through the digital tier from the PCB. The assembly has no peripheral functional blocks, and hence the active area extends to the edge of the detector. This was achieved by using a few flavors of almost identical analog pixels (minimal variation in layout) to allow for peripheral biasing blocks to be placed within pixels. The 1024 pixels within a digital sub-chip array have a variety of full custom, semi-custom and automated timing driven functional blocks placed together. The methodology uses a modified mixed-mode on-top digital implementation flow to not only harness the tool efficiency for timing and floor-planning but also to maintain designer control over compact parasitically aware layout. The methodology uses the Cadence design platform, however it is not limited to this tool.« less
Design methodology: edgeless 3D ASICs with complex in-pixel processing for pixel detectors
NASA Astrophysics Data System (ADS)
Fahim, Farah; Deptuch, Grzegorz W.; Hoff, James R.; Mohseni, Hooman
2015-08-01
The design methodology for the development of 3D integrated edgeless pixel detectors with in-pixel processing using Electronic Design Automation (EDA) tools is presented. A large area 3 tier 3D detector with one sensor layer and two ASIC layers containing one analog and one digital tier, is built for x-ray photon time of arrival measurement and imaging. A full custom analog pixel is 65μm x 65μm. It is connected to a sensor pixel of the same size on one side, and on the other side it has approximately 40 connections to the digital pixel. A 32 x 32 edgeless array without any peripheral functional blocks constitutes a sub-chip. The sub-chip is an indivisible unit, which is further arranged in a 6 x 6 array to create the entire 1.248cm x 1.248cm ASIC. Each chip has 720 bump-bond I/O connections, on the back of the digital tier to the ceramic PCB. All the analog tier power and biasing is conveyed through the digital tier from the PCB. The assembly has no peripheral functional blocks, and hence the active area extends to the edge of the detector. This was achieved by using a few flavors of almost identical analog pixels (minimal variation in layout) to allow for peripheral biasing blocks to be placed within pixels. The 1024 pixels within a digital sub-chip array have a variety of full custom, semi-custom and automated timing driven functional blocks placed together. The methodology uses a modified mixed-mode on-top digital implementation flow to not only harness the tool efficiency for timing and floor-planning but also to maintain designer control over compact parasitically aware layout. The methodology uses the Cadence design platform, however it is not limited to this tool.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dragone, A; /SLAC; Pratte, J.F.
An ASIC for the readout of signals from X-ray Active Matrix Pixel Sensor (XAMPS) detectors to be used at the Linac Coherent Light Source (LCLS) is presented. The X-ray Pump Probe (XPP) instrument, for which the ASIC has been designed, requires a large input dynamic range on the order of 104 photons at 8 keV with a resolution of half a photon FWHM. Due to the size of the pixel and the length of the readout line, large input capacitance is expected, leading to stringent requirement on the noise optimization. Furthermore, the large number of pixels needed for a goodmore » position resolution and the fixed LCLS beam period impose limitations on the time available for the single pixel readout. Considering the periodic nature of the LCLS beam, the ASIC developed for this application is a time-variant system providing low-noise charge integration, filtering and correlated double sampling. In order to cope with the large input dynamic range a charge pump scheme implementing a zero-balance measurement method has been introduced. It provides an on chip 3-bit coarse digital conversion of the integrated charge. The residual charge is sampled using correlated double sampling into analog memory and measured with the required resolution. The first 64 channel prototype of the ASIC has been fabricated in TSMC CMOS 0.25 {micro}m technology. In this paper, the ASIC architecture and performances are presented.« less
NASA Astrophysics Data System (ADS)
Briggl, K.; Dorn, M.; Hagdorn, R.; Harion, T.; Schultz-Coulon, H. C.; Shen, W.
2014-02-01
KLauS is an ASIC produced in the AMS 0.35 μm SiGe process to read out the charge signals from silicon photomultipliers. Developed as an analog front-end for future calorimeters with high granularity as pursued by the AHCAL concept in the CALICE collaboration, the ASIC is designed to measure the charge signal of the sensors in a large dynamic range and with low electronic noise contributions. In order to tune the operation voltage of each sensor individually, an 8-bit DAC to tune the voltage at the input terminal within a range of 2V is implemented. Using an integrated fast comparator with low jitter, the time information can be measured with sub-nanosecond resolution. The low power consumption of the ASIC can be further decreased using power gating techniques. Future versions of KLauS are under development and will incorporate an ADC with a resolution of up to 12-bits and blocks for digital data transmission. The chip is used in a setup for mass testing and characterization of scintillator tiles for the AHCAL test beam program.
In vivo Characterization of Amorphous Silicon Carbide As a Biomaterial for Chronic Neural Interfaces
Knaack, Gretchen L.; McHail, Daniel G.; Borda, German; Koo, Beomseo; Peixoto, Nathalia; Cogan, Stuart F.; Dumas, Theodore C.; Pancrazio, Joseph J.
2016-01-01
Implantable microelectrode arrays (MEAs) offer clinical promise for prosthetic devices by enabling restoration of communication and control of artificial limbs. While proof-of-concept recordings from MEAs have been promising, work in animal models demonstrates that the obtained signals degrade over time. Both material robustness and tissue response are acknowledged to have a role in device lifetime. Amorphous Silicon carbide (a-SiC), a robust material that is corrosion resistant, has emerged as an alternative encapsulation layer for implantable devices. We systematically examined the impact of a-SiC coating on Si probes by immunohistochemical characterization of key markers implicated in tissue-device response. After implantation, we performed device capture immunohistochemical labeling of neurons, astrocytes, and activated microglia/macrophages after 4 and 8 weeks of implantation. Neuron loss and microglia activation were similar between Si and a-SiC coated probes, while tissue implanted with a-SiC displayed a reduction in astrocytes adjacent to the probe. These results suggest that a-SiC has a similar biocompatibility profile as Si, and may be suitable for implantable MEA applications as a hermetic coating to prevent material degradation. PMID:27445672
Knaack, Gretchen L; McHail, Daniel G; Borda, German; Koo, Beomseo; Peixoto, Nathalia; Cogan, Stuart F; Dumas, Theodore C; Pancrazio, Joseph J
2016-01-01
Implantable microelectrode arrays (MEAs) offer clinical promise for prosthetic devices by enabling restoration of communication and control of artificial limbs. While proof-of-concept recordings from MEAs have been promising, work in animal models demonstrates that the obtained signals degrade over time. Both material robustness and tissue response are acknowledged to have a role in device lifetime. Amorphous Silicon carbide (a-SiC), a robust material that is corrosion resistant, has emerged as an alternative encapsulation layer for implantable devices. We systematically examined the impact of a-SiC coating on Si probes by immunohistochemical characterization of key markers implicated in tissue-device response. After implantation, we performed device capture immunohistochemical labeling of neurons, astrocytes, and activated microglia/macrophages after 4 and 8 weeks of implantation. Neuron loss and microglia activation were similar between Si and a-SiC coated probes, while tissue implanted with a-SiC displayed a reduction in astrocytes adjacent to the probe. These results suggest that a-SiC has a similar biocompatibility profile as Si, and may be suitable for implantable MEA applications as a hermetic coating to prevent material degradation.
Front End Spectroscopy ASIC for Germanium Detectors
NASA Astrophysics Data System (ADS)
Wulf, Eric
Large-area, tracking, semiconductor detectors with excellent spatial and spectral resolution enable exciting new access to soft (0.2-5 MeV) gamma-ray astrophysics. The improvements from semiconductor tracking detectors come with the burden of high density of strips and/or pixels that require high-density, low-power, spectroscopy quality readout electronics. CMOS ASIC technologies are a natural fit to this requirement and have led to high-quality readout systems for all current semiconducting tracking detectors except for germanium detectors. The Compton Spectrometer and Imager (COSI), formerly NCT, at University of California Berkeley and the Gamma-Ray Imager/Polarimeter for Solar flares (GRIPS) at Goddard Space Flight Center utilize germanium cross-strip detectors and are on the forefront of NASA's Compton telescope research with funded missions of long duration balloon flights. The development of a readout ASIC for germanium detectors would allow COSI to replace their discrete electronics readout and would enable the proposed Gamma-Ray Explorer (GRX) mission utilizing germanium strip-detectors. We propose a 3-year program to develop and test a germanium readout ASIC to TRL 5 and to integrate the ASIC readout onto a COSI detector allowing a TRL 6 demonstration for the following COSI balloon flight. Our group at NRL led a program, sponsored by another government agency, to produce and integrate a cross-strip silicon detector ASIC, designed and fabricated by Dr. De Geronimo at Brookhaven National Laboratory. The ASIC was designed to handle the large (>30 pF) capacitance of three 10 cm^2 detectors daisy-chained together. The front-end preamplifier, selectable inverter, shaping times, and gains make this ASIC compatible with a germanium cross-strip detector as well. We therefore have the opportunity and expertise to leverage the previous investment in the silicon ASIC for a new mission. A germanium strip detector ASIC will also require precise timing of the signals at the anode and cathode of the device to allow the depth of the interaction within the crystal to be determined. Dr. De Geronimo has developed similar timing circuits for CZT detector ASICs. Furthermore, the timing circuitry of the ASIC is at the very end of the analog section, simplifying and mitigating risks in the redesign. In the first year, we propose to tweak the gain settings and to add timing to the silicon ASIC to match the requirements of a germanium detector. The design specifications of the ASIC will include advice from our collaborators Dr. Boggs from COSI and Dr. Shih from GRIPS. By using a master ASIC designer to integrate his proven front-end and back-end with only minor modifications, we are maximizing the probability of success. NRL has a commercial cross-strip germanium detector with 30 pF of capacitance per strip, including the flex circuit from the detector to the outside of the cryostat. The COSI and GRIPS detectors have a similar capacitance per strip on the outside of their mechanically cooled cryostat. The second year of the program will be devoted to testing the newly fabricated germanium cross-strip ASIC with the NRL germanium detector. At the end of the second year, NASA will have a TRL 5 ASIC for germanium detectors, allowing future missions, including COSI, GRX, and GRIPS, to operate within their thermal and electrical envelopes. At the end of the third year, a detector on COSI will be instrumented with the new ASIC allowing for a TRL 6 demonstration during the following COSI balloon flight.
NASA Astrophysics Data System (ADS)
Klein, Christopher R.; Kubánek, Petr; Butler, Nathaniel R.; Fox, Ori D.; Kutyrev, Alexander S.; Rapchun, David A.; Bloom, Joshua S.; Farah, Alejandro; Gehrels, Neil; Georgiev, Leonid; González, J. Jesús; Lee, William H.; Lotkin, Gennadiy N.; Moseley, Samuel H.; Prochaska, J. Xavier; Ramirez-Ruiz, Enrico; Richer, Michael G.; Robinson, Frederick D.; Román-Zúñiga, Carlos; Samuel, Mathew V.; Sparr, Leroy M.; Tucker, Corey; Watson, Alan M.
2012-07-01
The Reionization And Transients InfraRed (RATIR) camera has been built for rapid Gamma-Ray Burst (GRB) followup and will provide quasi-simultaneous imaging in ugriZY JH. The optical component uses two 2048 × 2048 pixel Finger Lakes Imaging ProLine detectors, one optimized for the SDSS u, g, and r bands and one optimized for the SDSS i band. The infrared portion incorporates two 2048 × 2048 pixel Teledyne HgCdTe HAWAII-2RG detectors, one with a 1.7-micron cutoff and one with a 2.5-micron cutoff. The infrared detectors are controlled by Teledyne's SIDECAR (System for Image Digitization Enhancement Control And Retrieval) ASICs (Application Specific Integrated Circuits). While other ground-based systems have used the SIDECAR before, this system also utilizes Teledyne's JADE2 (JWST ASIC Drive Electronics) interface card and IDE (Integrated Development Environment). Here we present a summary of the software developed to interface the RATIR detectors with Remote Telescope System, 2nd Version (RTS2) software. RTS2 is an integrated open source package for remote observatory control under the Linux operating system and will autonomously coordinate observatory dome, telescope pointing, detector, filter wheel, focus stage, and dewar vacuum compressor operations. Where necessary we have developed custom interfaces between RTS2 and RATIR hardware, most notably for cryogenic focus stage motor drivers and temperature controllers. All detector and hardware interface software developed for RATIR is freely available and open source as part of the RTS2 distribution.
Performance of CATIROC: ASIC for smart readout of large photomultiplier arrays
NASA Astrophysics Data System (ADS)
Blin, S.; Callier, S.; Conforti Di Lorenzo, S.; Dulucq, F.; De La Taille, C.; Martin-Chassard, G.; Seguin-Moreau, N.
2017-03-01
CATIROC (Charge And Time Integrated Read Out Chip) is a complete read-out chip manufactured in AustriaMicroSystem (AMS) SiGe 0.35 μm technology, designed to read arrays of 16 photomultipliers (PMTs). It is an upgraded version of PARISROC2 [1] designed in 2010 in the context of the PMm2 (square meter PhotoMultiplier) project [2]. CATIROC is a SoC (System on Chip) that processes analog signals up to the digitization and sparsification to reduce the cost and cable number. The ASIC is composed of 16 independent channels that work in triggerless mode, auto-triggering on the single photo-electron. It provides a charge measurement up to 400 photoelectrons (70 pC) on two scales of 10 bits and a timing information with an accuracy of 200 ps rms. The ASIC was sent for fabrication in February 2015 and then received in September 2015. It is a good candidate for two Chinese projects (LHAASO and JUNO). The architecture and the measurements will be detailed in the paper.
Inspecting Engineering Samples
2017-12-08
Goddard's Ritsko Wins 2011 SAVE Award The winner of the 2011 SAVE Award is Matthew Ritsko, a Goddard financial manager. His tool lending library would track and enable sharing of expensive space-flight tools and hardware after projects no longer need them. This set of images represents the types of tools used at NASA. To read more go to: www.nasa.gov/topics/people/features/ritsko-save.html Dr. Doug Rabin (Code 671) and PI La Vida Cooper (Code 564) inspect engineering samples of the HAS-2 imager which will be tested and readout using a custom ASIC with a 16-bit ADC (analog to digital converter) and CDS (correlated double sampling) circuit designed by the Code 564 ASIC group as a part of an FY10 IRAD. The purpose of the IRAD was to develop and high resolution digitizer for Heliophysics applications such as imaging. Future goals for the collaboration include characterization testing and eventually a sounding rocket flight of the integrated system. *ASIC= Application Specific Integrated Circuit NASA/GSFC/Chris Gunn
A 1280×1024-15μm CTIA ROIC for SWIR FPAs
NASA Astrophysics Data System (ADS)
Eminoglu, Selim; Isikhan, Murat; Bayhan, Nusret; Gulden, M. A.; Incedere, O. S.; Soyer, S. T.; Kocak, Serhat; Yalcin, Cem; Ustundag, M. Cem B.; Turan, Ozge; Eksi, Umut; Akin, Tayfun
2015-06-01
This paper reports the development of a new SXGA format low-noise CTIA ROIC (MT12815CA-3G) suitable for mega-pixel SWIR InGaAs detector arrays for low-light imaging applications. MT12815CA-3G is the first mega-pixel standard ROIC product from Mikro-Tasarim, which is a fabless semiconductor company specialized in the development of ROICs and ASICs for visible and infrared hybrid imaging sensors. MT12815CA-3G is a low-noise snapshot mega-pixel CTIA ROIC, has a format of 1280 × 1024 (SXGA) and pixel pitch of 15 μm. MT12815CA-3G has been developed with the system-on-chip architecture in mind, where all the timing and biasing for this ROIC are generated on-chip without requiring any special external inputs. MT12815CA-3G is a highly configurable ROIC, where many of its features can be programmed through a 3-wire serial interface allowing on-the-fly configuration of many ROIC features. It performs snapshot operation both using Integrate-Then-Read (ITR) and Integrate-While-Read (IWR) modes. The CTIA type pixel input circuitry has 3 gain modes with programmable full-well-capacity (FWC) values of 10K e-, 20K e-, and 350K e- in the very high gain (VHG), high-gain (HG), and low-gain (LG) modes, respectively. MT12815CA-3G has an input referred noise level of less than 5 e- in the very high gain (VHG) mode, suitable for very low-noise SWIR imaging applications. MT12815CA-3G has 8 analog video outputs that can be programmed in 8, 4, or 2-output modes with a selectable analog reference for pseudo-differential operation. The ROIC runs at 10 MHz and supports frame rate values up to 55 fps in the 8-output mode. The integration time of the ROIC can be programmed up to 1s in steps of 0.1 μs. The ROIC uses 3.3 V and 1.8V supply voltages and dissipates less than 350 mW in the 4-output mode. MT12815CA-3G is fabricated using a modern mixed-signal CMOS process on 200 mm CMOS wafers, and there are 44 ROIC parts per wafer. The probe tests show that the die yield is higher than 70%, which corresponds to more than 30 working ROIC parts per wafer typically. MT12815CA-3G ROIC is available as tested wafers or dies, where a detailed test report and wafer map are provided for each wafer. A compact USB 3.0 based test camera and imaging software are also available for the customers to test and evaluate the imaging performance of SWIR sensors built using MT12815CA-3G ROICs. Mikro-Tasarim has also recently developed a programmable mixed-signal application specific integrated circuit (ASIC), called MTAS1410X8, which is designed to perform ROIC driving and digitization functions for ROICs with analog outputs, such as MT12815CA-3G and MT6415CA ROIC products of Mikro-Tasarim. MTAS1410X8 has 8 simultaneously working 14-bit analog-to-digital converters (ADCs) with integrated programmable gain amplifiers (PGAs), video input buffers, programmable controller, and high-speed digital video interface supporting various formats including Camera-Link. MT12815CA-3G ROIC together with MTAS1410X8 ASIC can be used to develop low-noise high-resolution SWIR imaging sensors with low power dissipation and reduced board area for the camera electronics.
Development of double-sided silicon strip detectors for solar hard x-ray observation
NASA Astrophysics Data System (ADS)
Saito, Shinya; Ishikawa, Shin-Nosuke; Watanabe, Shin; Odaka, Hirokazu; Sugimoto, Soichiro; Fukuyama, Taro; Kokubun, Motohide; Takahashi, Tadayuki; Terada, Yukikatsu; Tajima, Hiroyasu; Tanaka, Takaaki; Krucker, Säm; Christe, Steven; McBride, Steve; Glesener, Lindsay
2010-07-01
The Focusing Optics X-ray Solar Imager (FOXSI) is a rocket experiment scheduled for January 2011 launch. FOXSI observes 5 - 15 keV hard X-ray emission from quiet-region solar flares in order to study the acceleration process of electrons and the mechanism of coronal heating. For observing faint hard X-ray emission, FOXSI uses focusing optics for the first time in solar hard X-ray observation, and attains 100 times higher sensitivity than RHESSI, which is the present solar hard X-ray observing satellite. Now our group is working on developments of both Double-sided Silicon Strip Detector (DSSD) and read-out analog ASIC "VATA451" used for FOXSI. Our DSSD has a very fine strip pitch of 75 μm, which has sufficient position resolution for FOXSI mirrors with angular resolution (FWHM) of 12 arcseconds. DSSD also has high spectral resolution and efficiency in the FOXSI's energy range of 5 - 15 keV, when it is read out by our 64-channel analog ASIC. In advance of the FOXSI launch, we have established and tested a setup of 75 μm pitch DSSD bonded with "VATA451" ASICs. We successfully read out from almost all the channels of the detector, and proved ability to make a shadow image of tungsten plate. We also confirmed that our DSSD has energy resolution (FWHM) of 0.5 keV, lower threshold of 5 keV, and position resolution less than 63 μm. These performance satisfy FOXSI's requirements.
SpaceWire Driver Software for Special DSPs
NASA Technical Reports Server (NTRS)
Clark, Douglas; Lux, James; Nishimoto, Kouji; Lang, Minh
2003-01-01
A computer program provides a high-level C-language interface to electronics circuitry that controls a SpaceWire interface in a system based on a space qualified version of the ADSP-21020 digital signal processor (DSP). SpaceWire is a spacecraft-oriented standard for packet-switching data-communication networks that comprise nodes connected through bidirectional digital serial links that utilize low-voltage differential signaling (LVDS). The software is tailored to the SMCS-332 application-specific integrated circuit (ASIC) (also available as the TSS901E), which provides three highspeed (150 Mbps) serial point-to-point links compliant with the proposed Institute of Electrical and Electronics Engineers (IEEE) Standard 1355.2 and equivalent European Space Agency (ESA) Standard ECSS-E-50-12. In the specific application of this software, the SpaceWire ASIC was combined with the DSP processor, memory, and control logic in a Multi-Chip Module DSP (MCM-DSP). The software is a collection of low-level driver routines that provide a simple message-passing application programming interface (API) for software running on the DSP. Routines are provided for interrupt-driven access to the two styles of interface provided by the SMCS: (1) the "word at a time" conventional host interface (HOCI); and (2) a higher performance "dual port memory" style interface (COMI).
Neuro-Prosthetic Implants With Adjustable Electrode Arrays
NASA Technical Reports Server (NTRS)
Whitacre, Jay; DelCastillo, Linda Y.; Mojarradi, Mohammad; Johnson, Travis; West, William; Andersen, Richard
2006-01-01
Brushlike arrays of electrodes packaged with application-specific integrated circuits (ASICs) are undergoing development for use as electronic implants especially as neuro-prosthetic devices that might be implanted in brains to detect weak electrical signals generated by neurons. These implants partly resemble the ones reported in Integrated Electrode Arrays for Neuro-Prosthetic Implants (NPO-21198), NASA Tech Briefs, Vol. 27, No. 2 (February 2003), page 48. The basic idea underlying both the present and previously reported implants is that the electrodes would pick up signals from neurons and the ASICs would amplify and otherwise preprocess the signals for monitoring by external equipment. The figure presents a simplified and partly schematic view of an implant according to the present concept. Whereas the electrodes in an implant according to the previously reported concept would be microscopic wires, the electrodes according to the present concept are in the form of microscopic needles. An even more important difference would be that, unlike the previously reported concept, the present concept calls for the inclusion of microelectromechanical actuators for adjusting the depth of penetration of the electrodes into brain tissue. The prototype implant now under construction includes an array of 100 electrodes and corresponding array of electrode contact pads formed on opposite faces of a plate fabricated by techniques that are established in the art of microelectromechanical systems (MEMS). A mixed-signal ASIC under construction at the time of reporting the information for this article will include 100 analog amplifier channels (one amplifier per electrode). On one face of the mixed-signal ASIC there will be a solder-bump/micro-pad array that will have the same pitch as that of the electrode array, and that will be used to make the electrical and mechanical connections between the electrode array and the ASIC. Once the electrode array and the ASIC are soldered together, the remaining empty space between them will be filled with a biocompatible epoxy, the remaining exposed portions of the ASIC will be covered with micromachined plates for protection against corrosive bodily fluids, and then the ASIC and its covering micromachined plates will be coated with parylene
Development of 4-Sides Buttable CdTe-ASIC Hybrid Module for X-ray Flat Panel Detector
NASA Astrophysics Data System (ADS)
Tamaki, Mitsuru; Mito, Yoshio; Shuto, Yasuhiro; Kiyuna, Tatsuya; Yamamoto, Masaya; Sagae, Kenichi; Kina, Tooru; Koizumi, Tatsuhiro; Ohno, Ryoichi
2009-08-01
A 4-sides buttable CdTe-ASIC hybrid module suitable for use in an X-ray flat panel detector (FPD) has been developed by applying through silicon via (TSV) technology to the readout ASIC. The ASIC has 128 times 256 channels of charge integration type readout circuitry and an area of 12.9 mm times 25.7 mm. The CdTe sensor of 1 mm thickness, having the same area and pixel of 100 mum pitch, was fabricated from the Cl-doped CdTe single crystal grown by traveling heater method (THM). Then the CdTe pixel sensor was hybridized with the ASIC using the bump-bonding technology. The basic performance of this 4-sides buttable module was evaluated by taking X-ray images, and it was compared with that of a commercially available indirect type CsI(Tl) FPD. A prototype CdTe FPD was made by assembling 9 pieces of the 4-sides buttable modules into 3 times 3 arrays in which the neighboring modules were mounted on the interface board. The FPD covers an active area of 77 mm times 39 mm. The results showed the great potential of this 4-sides buttable module for the new real time X-ray FPD with high spatial resolution.
Design of an FPGA-based electronic flow regulator (EFR) for spacecraft propulsion system
NASA Astrophysics Data System (ADS)
Manikandan, J.; Jayaraman, M.; Jayachandran, M.
2011-02-01
This paper describes a scheme for electronically regulating the flow of propellant to the thruster from a high-pressure storage tank used in spacecraft application. Precise flow delivery of propellant to thrusters ensures propulsion system operation at best efficiency by maximizing the propellant and power utilization for the mission. The proposed field programmable gate array (FPGA) based electronic flow regulator (EFR) is used to ensure precise flow of propellant to the thrusters from a high-pressure storage tank used in spacecraft application. This paper presents hardware and software design of electronic flow regulator and implementation of the regulation logic onto an FPGA.Motivation for proposed FPGA-based electronic flow regulation is on the disadvantages of conventional approach of using analog circuits. Digital flow regulation overcomes the analog equivalent as digital circuits are highly flexible, are not much affected due to noise, accurate performance is repeatable, interface is easier to computers, storing facilities are possible and finally failure rate of digital circuits is less. FPGA has certain advantages over ASIC and microprocessor/micro-controller that motivated us to opt for FPGA-based electronic flow regulator. Also the control algorithm being software, it is well modifiable without changing the hardware. This scheme is simple enough to adopt for a wide range of applications, where the flow is to be regulated for efficient operation.The proposed scheme is based on a space-qualified re-configurable field programmable gate arrays (FPGA) and hybrid micro circuit (HMC). A graphical user interface (GUI) based application software is also developed for debugging, monitoring and controlling the electronic flow regulator from PC COM port.
Design and performance of a custom ASIC digitizer for wire chamber readout in 65 nm CMOS technology
NASA Astrophysics Data System (ADS)
Lee, M. J.; Brown, D. N.; Chang, J. K.; Ding, D.; Gnani, D.; Grace, C. R.; Jones, J. A.; Kolomensky, Y. G.; von der Lippe, H.; Mcvittie, P. J.; Stettler, M. W.; Walder, J.-P.
2015-06-01
We present the design and performance of a prototype ASIC digitizer for integrated wire chamber readout, implemented in 65 nm commercial CMOS technology. Each channel of the 4-channel prototype is composed of two 16-bit Time-to-Digital Converters (TDCs), one 8-bit Analog-to-Digital Converter (ADC), a front-end preamplifier and shaper, plus digital and analog buffers that support a variety of digitization chains. The prototype has a multiplexed digital backend that executes a state machine, distributes control and timing signals, and buffers data for serial output. Laboratory bench tests measure the absolute TDC resolution between 74 ps and 480 ps, growing with the absolute delay, and a relative time resolution of 19 ps. Resolution outliers due to cross-talk between clock signals and supply or reference voltages are seen. After calibration, the ADC displays good linearity and noise performance, with an effective number of bits of 6.9. Under normal operating conditions the circuit consumes 32 mW per channel. Potential design improvements to address the resolution drift and tails are discussed.
First results of the front-end ASIC for the strip detector of the PANDA MVD
NASA Astrophysics Data System (ADS)
Quagli, T.; Brinkmann, K.-T.; Calvo, D.; Di Pietro, V.; Lai, A.; Riccardi, A.; Ritman, J.; Rivetti, A.; Rolo, M. D.; Stockmanns, T.; Wheadon, R.; Zambanini, A.
2017-03-01
PANDA is a key experiment of the future FAIR facility and the Micro Vertex Detector (MVD) is the innermost part of its tracking system. PASTA (PAnda STrip ASIC) is the readout chip for the strip part of the MVD. The chip is designed to provide high resolution timestamp and charge information with the Time over Threshold (ToT) technique. Its architecture is based on Time to Digital Converters with analog interpolators, with a time bin width of 50 ps. The chip implements Single Event Upset (SEU) protection techniques for its digital parts. A first full-size prototype with 64 channels was produced in a commercial 110 nm CMOS technology and the first characterizations of the prototype were performed.
High Rate Digital Demodulator ASIC
NASA Technical Reports Server (NTRS)
Ghuman, Parminder; Sheikh, Salman; Koubek, Steve; Hoy, Scott; Gray, Andrew
1998-01-01
The architecture of High Rate (600 Mega-bits per second) Digital Demodulator (HRDD) ASIC capable of demodulating BPSK and QPSK modulated data is presented in this paper. The advantages of all-digital processing include increased flexibility and reliability with reduced reproduction costs. Conventional serial digital processing would require high processing rates necessitating a hardware implementation in other than CMOS technology such as Gallium Arsenide (GaAs) which has high cost and power requirements. It is more desirable to use CMOS technology with its lower power requirements and higher gate density. However, digital demodulation of high data rates in CMOS requires parallel algorithms to process the sampled data at a rate lower than the data rate. The parallel processing algorithms described here were developed jointly by NASA's Goddard Space Flight Center (GSFC) and the Jet Propulsion Laboratory (JPL). The resulting all-digital receiver has the capability to demodulate BPSK, QPSK, OQPSK, and DQPSK at data rates in excess of 300 Mega-bits per second (Mbps) per channel. This paper will provide an overview of the parallel architecture and features of the HRDR ASIC. In addition, this paper will provide an over-view of the implementation of the hardware architectures used to create flexibility over conventional high rate analog or hybrid receivers. This flexibility includes a wide range of data rates, modulation schemes, and operating environments. In conclusion it will be shown how this high rate digital demodulator can be used with an off-the-shelf A/D and a flexible analog front end, both of which are numerically computer controlled, to produce a very flexible, low cost high rate digital receiver.
Xu, Fei; Yan, Guozheng; Zhao, Kai; Lu, Li; Gao, Jinyang; Liu, Gang
2014-12-01
This paper presents the design of a wireless capsule system for monitoring the physiological signals of the human gastrointestinal (GI) tract. The primary components of the system include a wireless capsule, a portable data recorder, and a workstation. Temperature, pH, and pressure sensors; an RF transceiver; a controlling and processing application specific integrated circuit (ASIC); and batteries were applied in a wireless capsule. Decreasing capsule size, improving sensor precision, and reducing power needs were the primary challenges; these were resolved by employing micro sensors, optimized architecture, and an ASIC design that include power management, clock management, a programmable gain amplifier (PGA), an A/D converter (ADC), and a serial peripheral interface (SPI) communication unit. The ASIC has been fabricated in 0.18- μm CMOS technology with a die area of 5.0 mm × 5.0 mm. The wireless capsule integrating the ASIC controller measures Φ 11 mm × 26 mm. A data recorder and a workstation were developed, and 20 cases of human experiments were conducted in hospitals. Preprocessing in the workstation can significantly improve the quality of the data, and 76 original features were determined by mathematical statistics. Based on the 13 optimal features achieved in the evaluation of the features, the clustering algorithm can identify the patients who lack GI motility with a recognition rate reaching 83.3%.
NASA Astrophysics Data System (ADS)
Maj, P.; Kasiński, K.; Gryboś, P.; Szczygieł, R.; Kozioł, A.
2015-12-01
Integrated circuits designed for specific applications generally use non-standard communication methods. Hybrid pixel detector readout electronics produces a huge amount of data as a result of number of frames per seconds. The data needs to be transmitted to a higher level system without limiting the ASIC's capabilities. Nowadays, the Camera Link interface is still one of the fastest communication methods, allowing transmission speeds up to 800 MB/s. In order to communicate between a higher level system and the ASIC with a dedicated protocol, an FPGA with dedicated code is required. The configuration data is received from the PC and written to the ASIC. At the same time, the same FPGA should be able to transmit the data from the ASIC to the PC at the very high speed. The camera should be an embedded system enabling autonomous operation and self-monitoring. In the presented solution, at least three different hardware platforms are used—FPGA, microprocessor with real-time operating system and the PC with end-user software. We present the use of a single software platform for high speed data transfer from 65k pixel camera to the personal computer.
Design and performances of a low-noise and radiation-hardened readout ASIC for CdZnTe detectors
NASA Astrophysics Data System (ADS)
Bo, Gan; Tingcun, Wei; Wu, Gao; Yongcai, Hu
2016-06-01
In this paper, we present the design and performances of a low-noise and radiation-hardened front-end readout application specific integrated circuit (ASIC) dedicated to CdZnTe detectors for a hard X-ray imager in space applications. The readout channel is comprised of a charge sensitive amplifier, a CR-RC shaping amplifier, an analog output buffer, a fast shaper, and a discriminator. An 8-channel prototype ASIC is designed and fabricated in TSMC 0.35-μm mixed-signal CMOS technology, the die size of the prototype chip is 2.2 × 2.2 mm2. The input energy range is from 5 to 350 keV. For this 8-channel prototype ASIC, the measured electrical characteristics are as follows: the overall gain of the readout channel is 210 V/pC, the linearity error is less than 2%, the crosstalk is less than 0.36%, The equivalent noise charge of a typical channel is 52.9 e- at zero farad plus 8.2 e- per picofarad, and the power consumption is less than 2.4 mW/channel. Through the measurement together with a CdZnTe detector, the energy resolution is 5.9% at the 59.5-keV line under the irradiation of the radioactive source 241Am. The radiation effect experiments show that the proposed ASIC can resist the total ionization dose (TID) irradiation of higher than 200 krad(Si). Project supported by the National Key Scientific Instrument and Equipment Development Project (No. 2011YQ040082), the National Natural Science Foundation of China (Nos. 11475136, 11575144, 61176094), and the Shaanxi Natural Science Foundation of China (No. 2015JM1016).
Development of the hard x-ray monitor onboard WF-MAXI
NASA Astrophysics Data System (ADS)
Arimoto, Makoto; Yatsu, Yoichi; Kawai, Nobuyuki; Ikeda, Hirokazu; Harayama, Atsushi; Takeda, Shin'ichiro; Takahashi, Tadayuki; Tomida, Hiroshi; Ueno, Shiro; Kimura, Masashi; Mihara, Tatehiro; Serino, Motoko; Tsunemi, Hiroshi; Yoshida, Atsumasa; Sakamoto, Takanori; Kohmura, Tadayoshi; Negoro, Hitoshi; Ueda, Yoshihiro
2014-07-01
WF-MAXI is a mission to detect and localize X-ray transients with short-term variability as gravitational-wave (GW) candidates including gamma-ray bursts, supernovae etc. We are planning on starting observations by WF-MAXI to be ready for the initial operation of the next generation GW telescopes (e.g., KAGRA, Advanced LIGO etc.). WF-MAXI consists of two main instruments, Soft X-ray Large Solid Angle Camera (SLC) and Hard X-ray Monitor (HXM) which totally cover 0.7 keV to 1 MeV band. HXM is a multi-channel array of crystal scintillators coupled with APDs observing photons in the hard X-ray band with an effective area of above 100 cm2. We have developed an analog application specific integrated circuit (ASIC) dedicated for the readout of 32-channel APDs' signals using 0.35 μm CMOS technology based on Open IP project and an analog amplifier was designed to achieve a low-noise readout. The developed ASIC showed a low-noise performance of 2080 e- + 2.3 e-/pF at root mean square and with a reverse-type APD coupled to a Ce:GAGG crystal a good FWHM energy resolution of 6.9% for 662 keV -rays.
A One Chip Hardened Solution for High Speed SpaceWire System Implementations. Session: Components
NASA Technical Reports Server (NTRS)
Marshall, Joseph R.; Berger, Richard W.; Rakow, Glenn P.
2007-01-01
An Application Specific Integrated Circuit (ASIC) that implements the SpaceWire protocol has been developed in a radiation hardened 0.25 micron CMOS technology. This effort began in March 2003 as a joint development between the NASA Goddard Space Flight Center (GSFC) and BAE Systems. The BAE Systems SpaceWire ASIC is comprised entirely of reusable core elements, many of which are already flight-proven. It incorporates a router with 4 SpaceWire ports and two local ports, dual PC1 bus interfaces, a microcontroller, 32KB of internal memory, and a memory controller for additional external memory use. The SpaceWire cores are also reused in other ASICs under development. The SpaceWire ASIC is planned for use on the Geostationary Operational Environmental Satellites (GOES)-R, the Lunar Reconnaissance Orbiter (LRO) and other missions. Engineering and flight parts have been delivered to programs and users. This paper reviews the SpaceWire protocol and those elements of it that have been built into the current and next SpaceWire reusable cores and features within the core that go beyond the current standard and can be enabled or disabled by the user. The adaptation of SpaceWire to BAE Systems' On Chip Bus (OCB) for compatibility with the other reusable cores will be reviewed and highlighted. Optional configurations within user systems and test boards will be shown. The physical implementation of the design will be described and test results from the hardware will be discussed. Application of this ASIC and other ASICs containing the SpaceWire cores and embedded microcontroller to Plug and Play and reconfigurable implementations will be described. Finally, the BAE Systems roadmap for SpaceWire developments will be updated, including some products already in design as well as longer term plans.
A novel CMOS transducer for giant magnetoresistance sensors.
Luong, Van Su; Lu, Chih-Cheng; Yang, Jing-Wen; Jeng, Jen-Tzong
2017-02-01
In this work, an ASIC (application specific integrated circuits) transducer circuit for field modulated giant magnetoresistance (GMR) sensors was designed and fabricated using a 0.18-μm CMOS process. The transducer circuits consist of a frequency divider, a digital phase shifter, an instrument amplifier, and an analog mixer. These comprise a mix of analog and digital circuit techniques. The compact chip size of 1.5 mm × 1.5 mm for both analog and digital parts was achieved using the TSMC18 1P6M (1-polysilicon 6-metal) process design kit, and the characteristics of the system were simulated using an HSpice simulator. The output of the transducer circuit is the result of the first harmonic detection, which resolves the modulated field using a phase sensitive detection (PSD) technique and is proportional to the measured magnetic field. When the dual-bridge GMR sensor is driven by the transducer circuit with a current of 10 mA at 10 kHz, the observed sensitivity of the field sensor is 10.2 mV/V/Oe and the nonlinearity error was 3% in the linear range of ±1 Oe. The performance of the system was also verified by rotating the sensor system horizontally in earth's magnetic field and recording the sinusoidal output with respect to the azimuth angle, which exhibits an error of less than ±0.04 Oe. These results prove that the ASIC transducer is suitable for driving the AC field modulated GMR sensors applied to geomagnetic measurement.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zimmerman, T.
1997-12-01
This paper is distilled from a talk given at the 3rd International Meeting on Front End Electronics in Taos, N.M. on Nov. 7,1997. It is based on experience gained by designing and testing the SVX3 128 channel silicon strip detector readout chip. The SVX3 chip organization is shown in Fig. 1. The Front End section consists of an integrator and analog pipeline designed at Fermilab, and the Back End section is an ADC plus sparsification and readout logic designed at LBL. SVX3 is a deadtimeless readout chip, which means that the front end is acquiring low level analog signals whilemore » the back end is digitizing and reading out digital signals. It is thus a true mixed signal chip, and demands close attention to avoid disastrous coupling from the digital to the analog sections. SVX3 is designed in a bulk CMOS process (i.e., the circuits sit in a silicon substrate). In such a process, the substrate becomes a potential coupling path. This paper discusses the effect of the substrate resistivity on coupling, and also goes into a more general discussion of grounding and referencing in mixed signal designs and how low resistivity substrates can be used to advantage. Finally, an alternative power supply current conduction method for ASICs is presented as an additional advantage which can be obtained with low resistivity substrates. 1 ref., 13 figs., 1 tab.« less
Radiation hard programmable delay line for LHCb calorimeter upgrade
NASA Astrophysics Data System (ADS)
Mauricio, J.; Gascón, D.; Vilasís, X.; Picatoste, E.; Machefert, F.; Lefrancois, J.; Duarte, O.; Beigbeder, C.
2014-01-01
This paper describes the implementation of a SPI-programmable clock delay chip based on a Delay Locked Loop (DLL) in order to shift the phase of the LHC clock (25 ns) in steps of 1ns, with less than 5 ps jitter and 23 ps of DNL. The delay lines will be integrated into ICECAL, the LHCb calorimeter front-end analog signal processing ASIC in the near future. The stringent noise requirements on the ASIC imply minimizing the noise contribution of digital components. This is accomplished by implementing the DLL in differential mode. To achieve the required radiation tolerance several techniques are applied: double guard rings between PMOS and NMOS transistors as well as glitch suppressors and TMR Registers. This 5.7 mm2 chip has been implemented in CMOS 0.35 μm technology.
Back-end and interface implementation of the STS-XYTER2 prototype ASIC for the CBM experiment
NASA Astrophysics Data System (ADS)
Kasinski, K.; Szczygiel, R.; Zabolotny, W.
2016-11-01
Each front-end readout ASIC for the High-Energy Physics experiments requires robust and effective hit data streaming and control mechanism. A new STS-XYTER2 full-size prototype chip for the Silicon Tracking System and Muon Chamber detectors in the Compressed Baryonic Matter experiment at Facility for Antiproton and Ion Research (FAIR, Germany) is a 128-channel time and amplitude measuring solution for silicon microstrip and gas detectors. It operates at 250 kHit/s/channel hit rate, each hit producing 27 bits of information (5-bit amplitude, 14-bit timestamp, position and diagnostics data). The chip back-end implements fast front-end channel read-out, timestamp-wise hit sorting, and data streaming via a scalable interface implementing the dedicated protocol (STS-HCTSP) for chip control and hit transfer with data bandwidth from 9.7 MHit/s up to 47 MHit/s. It also includes multiple options for link diagnostics, failure detection, and throttling features. The back-end is designed to operate with the data acquisition architecture based on the CERN GBTx transceivers. This paper presents the details of the back-end and interface design and its implementation in the UMC 180 nm CMOS process.
Performance and Calibration of H2RG Detectors and SIDECAR ASICs for the RATIR Camera
NASA Technical Reports Server (NTRS)
Fox, Ori D.; Kutyrev, Alexander S.; Rapchun, David A.; Klein, Christopher R.; Butler, Nathaniel R.; Bloom, Josh; de Diego, Jos A.; Simn Farah, Alejandro D.; Gehrels, Neil A.; Georgiev, Leonid;
2012-01-01
The Reionization And Transient Infra,.Red (RATIR) camera has been built for rapid Gamma,.Ray Burst (GRE) followup and will provide simultaneous optical and infrared photometric capabilities. The infrared portion of this camera incorporates two Teledyne HgCdTe HAWAII-2RG detectors, controlled by Teledyne's SIDECAR ASICs. While other ground-based systems have used the SIDECAR before, this system also utilizes Teledyne's JADE2 interface card and IDE development environment. Together, this setup comprises Teledyne's Development Kit, which is a bundled solution that can be efficiently integrated into future ground-based systems. In this presentation, we characterize the system's read noise, dark current, and conversion gain.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bolotnikov, A. E., E-mail: bolotnik@bnl.gov; Ackley, K.; Camarda, G. S.
We developed a robust and low-cost array of virtual Frisch-grid CdZnTe detectors coupled to a front-end readout application-specific integrated circuit (ASIC) for spectroscopy and imaging of gamma rays. The array operates as a self-reliant detector module. It is comprised of 36 close-packed 6 × 6 × 15 mm{sup 3} detectors grouped into 3 × 3 sub-arrays of 2 × 2 detectors with the common cathodes. The front-end analog ASIC accommodates up to 36 anode and 9 cathode inputs. Several detector modules can be integrated into a single- or multi-layer unit operating as a Compton or a coded-aperture camera. We presentmore » the results from testing two fully assembled modules and readout electronics. The further enhancement of the arrays’ performance and reduction of their cost are possible by using position-sensitive virtual Frisch-grid detectors, which allow for accurate corrections of the response of material non-uniformities caused by crystal defects.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bolotnikov, A. E.; Ackley, K.; Camarda, G. S.
We developed a robust and low-cost array of virtual Frisch-grid CdZnTe (CZT) detectors coupled to a front-end readout ASIC for spectroscopy and imaging of gamma rays. The array operates as a self-reliant detector module. It is comprised of 36 close-packed 6x6x15 mm 3 detectors grouped into 3x3 sub-arrays of 2x2 detectors with the common cathodes. The front-end analog ASIC accommodates up to 36 anode and 9 cathode inputs. Several detector modules can be integrated into a single- or multi-layer unit operating as a Compton or a coded-aperture camera. We present the results from testing two fully assembled modules and readoutmore » electronics. The further enhancement of the arrays’ performance and reduction of their cost are made possible by using position-sensitive virtual Frisch-grid detectors, which allow for accurate corrections of the response of material non-uniformities caused by crystal defects.« less
NASA Astrophysics Data System (ADS)
Bugiel, Sz.; Dasgupta, R.; Firlej, M.; Fiutowski, T.; Idzik, M.; Kuczynska, M.; Moron, J.; Swientek, K.; Szumlak, T.
2016-02-01
The Upstream Tracker (UT) silicon strip detector, one of the central parts of the tracker system of the modernised LHCb experiment, will use a new 128-channel readout ASIC called SALT. It will extract and digitise analogue signals from the UT sensors, perform digital signal processing and transmit a serial output data. The SALT is being designed in CMOS 130 nm process and uses a novel architecture comprising of analog front-end and fast (40 MSps) ultra-low power (<0.5 mW) 6-bit ADC in each channel. The prototype ASICs of important functional blocks, like analogue front-end, 6-bit SAR ADC, PLL, and DLL, were designed, fabricated and tested. A prototype of an 8-channel version of the SALT chip, comprising all important functionalities was also designed and fabricated. The architecture and design of the SALT, together with the selected preliminary tests results, are presented.
NASA Astrophysics Data System (ADS)
Chen, H.; Briggl, K.; Eckert, P.; Harion, T.; Munwes, Y.; Shen, W.; Stankova, V.; Schultz-Coulon, H. C.
2017-01-01
MuTRiG is a mixed signal Silicon Photomultiplier readout ASIC designed in UMC 180 nm CMOS technology for precise timing and high event rate applications in high energy physics experiments and medical imaging. It is dedicated to the readout of the scintillating fiber detector and the scintillating tile detector of the Mu3e experiment. The MuTRiG chip extends the excellent timing performance of the STiCv3 chip with a fast digital readout for high rate applications. The high timing performance of the fully differential SiPM readout channels and 50 ps time binning TDCs are complemented by an upgraded digital readout logic and a 1.28 Gbps LVDS serial data link. The design of the chip and the characterization results of the analog front-end, TDC and the LVDS data link are presented.
Development of a Position Decoding ASIC for SPECT using Silicon Photomultiplier
NASA Astrophysics Data System (ADS)
Cho, M.; Kim, H.; Lim, K. T.; Cho, G.
2016-01-01
Single Photon Emission Computed Tomography(SPECT) is a widely used diagnosis modality for detecting metabolic diseases. In general, SPECT system is consisted of a sensor, a pre-amplifier, position decoding circuits(PDC) and a data acquisition(DAQ) system. Due to such complexity, it is quite costly to assemble SPECT system by putting discrete components together. Moreover, using discrete components would make the system rather bulky. In this work, we designed a channel module ASIC for SPECT system. This system was composed of a transimpedance amplifier(TIA), comparators and digital logics. In this particular module, a TIA was selected as a preamplifier because the decay time and the rise time are shorter than that of other preamplifier topologies. In the proposed module, the amplified pulse from the TIA was split into two separate signals and each signal was then fed into two comparators with different reference levels, e.g., a low and high level. Then an XOR gate combined the comparator outputs and the output of XOR gate was sent to the suceeding digital logic. Furthermore, the output of each component in the module is composed of a signal packet. The packet includes the information on the energy, the time and the position of the incident photon. The energy and position information of a detected radiation can be derived from the output of the D-flipflop(DFF) in the module via time-over-threshold(TOT). The timing information was measured using a delayed rising edge from the low-level referenced comparator. There are several advantages in developing the channel module ASIC. First of all, the ASIC has only digital outputs and thus a correction circuit for analog signal distortion can be neglected. In addition, it is possible to cut down the system production cost because the volume of the system can be reduced due to the compactness of ASIC. The benefits of channel module is not only limited to SPECT but also beneficial to many other radiation detecting systems.
NASA Astrophysics Data System (ADS)
Burse, Mahesh; Chattopadhyay, Sabyasachi; Ramaprakash, A. N.; Sinha, Sakya; Prabhudesai, Swapnil; Punnadi, Sujit; Chordia, Pravin; Kohok, Abhay
2016-07-01
As a part of a design study for the On-Instrument Low Order Wave-front Sensor (OIWFS) for the TMT Infra-Red Imaging Spectrograph (IRIS), we recently evaluated the noise performance of a detector control system consisting of IUCAA SIDECAR DRIVE ELECRONICS CONTROLLER (ISDEC), SIDECAR ASIC and HAWAII-2RG (H2RG) MUX. To understand and improve the performance of this system to serve as a near infrared wavefront sensor, we implemented new read out modes like multiple regions of interest with differential multi-accumulate readout schemes for the HAWAII-2RG (H2RG) detector. In this system, the firmware running in SIDECAR ASIC programs the detector for ROI readout, reads the detector, processes the detector output and writes the digitized data into its internal memory. ISDEC reads the digitized data from ASIC, performs the differential multi-accumulate operations and then sends the processed data to a PC over a USB interface. A special loopback board was designed and used to measure and reduce the noise from SIDECAR ASIC DC biases2. We were able to reduce the mean r.m.s read noise of this system down to 1-2 e. for any arbitrary window frame of 4x4 size at frame rates below about 200 Hz.
Price, Margaret P.; Gong, Huiyu; Parsons, Meredith G.; Kundert, Jacob R.; Reznikov, Leah R.; Bernardinelli, Luisa; Chaloner, Kathryn; Buchanan, Gordon F.; Wemmie, John A.; Richerson, George B.; Cassell, Martin D.; Welsh, Michael J.
2014-01-01
Acid sensing ion channels (ASICs) generate H+-gated Na+ currents that contribute to neuronal function and animal behavior. Like ASIC1, ASIC2 subunits are expressed in the brain and multimerize with ASIC1 to influence acid-evoked currents and facilitate ASIC1 localization to dendritic spines. To better understand how ASIC2 contributes to brain function, we localized the protein and tested the behavioral consequences of ASIC2 gene disruption. For comparison, we also localized ASIC1 and studied ASIC1−/− mice. ASIC2 was prominently expressed in areas of high synaptic density, and with a few exceptions, ASIC1 and ASIC2 localization exhibited substantial overlap. Loss of ASIC1 or ASIC2 decreased freezing behavior in contextual and auditory cue fear conditioning assays, in response to predator odor, and in response to CO2 inhalation. In addition, loss of ASIC1 or ASIC2 increased activity in a forced swim assay. These data suggest that ASIC2, like ASIC1, plays a key role in determining the defensive response to aversive stimuli. They also raise the question of whether gene variations in both ASIC1 and ASIC2 might affect fear and panic in humans. PMID:24256442
Acid-sensing ion channels (ASICs) in the taste buds of adult zebrafish.
Viña, E; Parisi, V; Cabo, R; Laurà, R; López-Velasco, S; López-Muñiz, A; García-Suárez, O; Germanà, A; Vega, J A
2013-03-01
In detecting chemical properties of food, different molecules and ion channels are involved including members of the acid-sensing ion channels (ASICs) family. Consistently ASICs are present in sensory cells of taste buds of mammals. In the present study the presence of ASICs (ASIC1, ASIC2, ASIC3 and ASIC4) was investigated in the taste buds of adult zebrafish (zASICs) using Western blot and immunohistochemistry. zASIC1 and zASIC3 were regularly absent from taste buds, whereas faint zASIC2 and robust zASIC4 immunoreactivities were detected in sensory cells. Moreover, zASIC2 also immunolabelled nerves supplying taste buds. The present results demonstrate for the first time the presence of zASICs in taste buds of teleosts, with different patterns to that occurring in mammals, probably due to the function of taste buds in aquatic environment and feeding. Nevertheless, the role of zASICs in taste remains to be demonstrated. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Seljak, A.; Cumming, H. S.; Varner, G.; Vallerga, J.; Raffanti, R.; Virta, V.
2017-04-01
NASA has funded, through their Strategic Astrophysics Technology (SAT) program, the development of a cross strip (XS) microchannel plate (MCP) detector with the intention to increase its technology readiness level (TRL), enabling prototyping for future NASA missions. One aspect of the development is to convert the large and high powered laboratory Parallel Cross Strip (PXS) readout electronics into application specific integrated circuits (ASICs) to decrease their mass, volume, and power consumption (all limited resources in space) and to make them more robust to the environments of rocket launch and space. The redesign also foresees to increase the overall readout event rate, and decrease the noise contribution of the readout system. This work presents the design and verification of the first stage for the new readout system, the 16 channel charge sensitive amplifier ASIC, called the CSAv3. The single channel amplifier is composed of a charge sensitive amplifier (pre-amplifier), a pole zero cancellation circuit and a shaping amplifier. An additional output stage buffer allows polarity selection of the output analog signal. The operation of the amplifier is programmable via serial bus. It provides an equivalent noise charge (ENC) of around 600 e^- and a baseline gain of 10 mV/fC. The full scale pulse shaped output signal is confined within 100 ns, without long recovery tails, enabling up to 10 MHz periodic event rates without signal pile up. This ASIC was designed and fabricated in 130 nm, TSMC CMOS 1.2 V technology. In addition, we briefly discuss the construction of the readout system and plans for the future work.
Preliminary evaluation of a novel energy-resolved photon-counting gamma ray detector.
Meng, L-J; Tan, J W; Spartiotis, K; Schulman, T
2009-06-11
In this paper, we present the design and preliminary performance evaluation of a novel energy-resolved photon-counting (ERPC) detector for gamma ray imaging applications. The prototype ERPC detector has an active area of 4.4 cm × 4.4 cm, which is pixelated into 128 × 128 square pixels with a pitch size of 350 µm × 350µm. The current detector consists of multiple detector hybrids, each with a CdTe crystal of 1.1 cm × 2.2 cm × 1 mm, bump-bonded onto a custom-designed application-specific integrated circuit (ASIC). The ERPC ASIC has 2048 readout channels arranged in a 32 × 64 array. Each channel is equipped with pre- and shaping-amplifiers, a discriminator, peak/hold circuitry and an analog-to-digital converter (ADC) for digitizing the signal amplitude. In order to compensate for the pixel-to-pixel variation, two 8-bit digital-to-analog converters (DACs) are implemented into each channel for tuning the gain and offset. The ERPC detector is designed to offer a high spatial resolution, a wide dynamic range of 12-200 keV and a good energy resolution of 3-4 keV. The hybrid detector configuration provides a flexible detection area that can be easily tailored for different imaging applications. The intrinsic performance of a prototype ERPC detector was evaluated with various gamma ray sources, and the results are presented.
Radiation-Hardened Solid-State Drive
NASA Technical Reports Server (NTRS)
Sheldon, Douglas J.
2010-01-01
A method is provided for a radiationhardened (rad-hard) solid-state drive for space mission memory applications by combining rad-hard and commercial off-the-shelf (COTS) non-volatile memories (NVMs) into a hybrid architecture. The architecture is controlled by a rad-hard ASIC (application specific integrated circuit) or a FPGA (field programmable gate array). Specific error handling and data management protocols are developed for use in a rad-hard environment. The rad-hard memories are smaller in overall memory density, but are used to control and manage radiation-induced errors in the main, and much larger density, non-rad-hard COTS memory devices. Small amounts of rad-hard memory are used as error buffers and temporary caches for radiation-induced errors in the large COTS memories. The rad-hard ASIC/FPGA implements a variety of error-handling protocols to manage these radiation-induced errors. The large COTS memory is triplicated for protection, and CRC-based counters are calculated for sub-areas in each COTS NVM array. These counters are stored in the rad-hard non-volatile memory. Through monitoring, rewriting, regeneration, triplication, and long-term storage, radiation-induced errors in the large NV memory are managed. The rad-hard ASIC/FPGA also interfaces with the external computer buses.
Replication of Space-Shuttle Computers in FPGAs and ASICs
NASA Technical Reports Server (NTRS)
Ferguson, Roscoe C.
2008-01-01
A document discusses the replication of the functionality of the onboard space-shuttle general-purpose computers (GPCs) in field-programmable gate arrays (FPGAs) and application-specific integrated circuits (ASICs). The purpose of the replication effort is to enable utilization of proven space-shuttle flight software and software-development facilities to the extent possible during development of software for flight computers for a new generation of launch vehicles derived from the space shuttles. The replication involves specifying the instruction set of the central processing unit and the input/output processor (IOP) of the space-shuttle GPC in a hardware description language (HDL). The HDL is synthesized to form a "core" processor in an FPGA or, less preferably, in an ASIC. The core processor can be used to create a flight-control card to be inserted into a new avionics computer. The IOP of the GPC as implemented in the core processor could be designed to support data-bus protocols other than that of a multiplexer interface adapter (MIA) used in the space shuttle. Hence, a computer containing the core processor could be tailored to communicate via the space-shuttle GPC bus and/or one or more other buses.
Low-Power, 8-Channel EEG Recorder and Seizure Detector ASIC for a Subdermal Implantable System.
Do Valle, Bruno G; Cash, Sydney S; Sodini, Charles G
2016-12-01
EEG remains the mainstay test for the diagnosis and treatment of patients with epilepsy. Unfortunately, ambulatory EEG systems are far from ideal for patients who have infrequent seizures. These systems only last up to 3 days and if a seizure is not captured during the recordings, a definite diagnosis of the patient's condition cannot be given. This work aims to address this need by proposing a subdermal implantable, eight-channel EEG recorder and seizure detector that has two modes of operation: diagnosis and seizure counting. In the diagnosis mode, EEG is continuously recorded until a number of seizures are recorded. In the seizure counting mode, the system uses a low-power algorithm to track the number of seizures a patient has, providing doctors with a reliable count to help determine medication efficacy or other clinical endpoint. An ASIC that implements the EEG recording and seizure detection algorithm was designed and fabricated in a 0.18 μm CMOS process. The ASIC includes eight EEG channels and is designed to minimize the system's power and size. The result is a power-efficient analog front end that requires 2.75 μW per channel in diagnosis mode and 0.84 μW per channel in seizure counting mode. Both modes have an input referred noise of approximately 1.1 μVrms.
Network device interface for digitally interfacing data channels to a controller via a network
NASA Technical Reports Server (NTRS)
Ellerbrock, Philip J. (Inventor); Winkelmann, Joseph P. (Inventor); Grant, Robert L. (Inventor); Konz, Daniel W. (Inventor)
2006-01-01
The present invention provides a network device interface and method for digitally connecting a plurality of data channels, such as sensors, actuators, and subsystems, to a controller using a network bus. The network device interface interprets commands and data received from the controller and polls the data channels in accordance with these commands. Specifically, the network device interface receives digital commands and data from the controller, and based on these commands and data, communicates with the data channels to either retrieve data in the case of a sensor or send data to activate an actuator. Data retrieved from the sensor is then converted by the network device interface into digital signals and transmitted back to the controller. In one advantageous embodiment, the network device interface is a state machine, such as an ASIC, that operates independent of a processor in communicating with the bus controller and data channels.
DOE Office of Scientific and Technical Information (OSTI.GOV)
De Geronimo, G.; Li, S.; D'Andragora, A.
We present a front-end application-specific integrated circuit (ASIC) for a wire based time-projection-chamber (TPC) operating in liquid Argon (LAr). The LAr TPC will be used for long baseline neutrino oscillation experiments. The ASIC must provide a low-noise readout of the signals induced on the TPC wires, digitization of those signals at 2 MSamples/s, compression, buffering and multiplexing. A resolution of better than 1000 rms electrons at 200 pF input capacitance for an input range of 300 fC is required, along with low power and operation in LAr (at 87 K). We include the characterization of a commercial technology for operationmore » in the cryogenic environment and the first experimental results on the analog front end. The results demonstrate that complementary metal-oxide semiconductor transistors have lower noise and much improved dc characteristics at LAr temperature. Finally, we introduce the concept of '1/f equivalent' to model the low-frequency component of the noise spectral density, for use in the input metal-oxide semiconductor field-effect transistor optimization.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Breton, D.; /Orsay, LAL; Delagnes, E.
There is a considerable interest to develop new time-of-flight detectors using, for example, micro-channel-plate photodetectors (MCP-PMTs). The question we pose in this paper is if new waveform digitizer ASICs, such as the WaveCatcher and TARGET, operating with a sampling rate of 2-3 GSa/s can compete with 1GHz BW CFD/TDC/ADC electronics. We have performed a series of measurements with these waveform digitizers coupled to MCP-PMTs operating at low gain and with a signal equivalent to {approx}40 photoelectrons. The tests were done with a laser diode on detectors operating under the same condition used previously in SLAC and Fermilab beam tests. Ourmore » test results indicate that one can achieve similar resolution with both methods. Although the commercial CFD-based electronics does exist and performs very well, it is difficult to implement on a very large scale, and therefore the custom electronics is needed. In addition, the analog delay line requirement makes it very difficult to incorporate CFD discriminators in ASIC designs.« less
Integrated circuit for SAW and MEMS sensors
NASA Astrophysics Data System (ADS)
Fischer, Wolf-Joachim; Koenig, Peter; Ploetner, Matthias; Hermann, Rudiger; Stab, Helmut
2001-11-01
The sensor processor circuit has been developed for hand-held devices used in industrial and environmental applications, such as on-line process monitoring. Thereby devices with SAW sensors or MEMS resonators will benefit from this processor especially. Up to 8 sensors can be connected to the circuit as multisensors or sensor arrays. Two sensor processors SP1 and SP2 for different applications are presented in this paper. The SP-1 chip has a PCMCIA interface which can be used for the program and data transfer. SAW sensors which are working in the frequency range from 80 MHz to 160 MHz can be connected to the processor directly. It is possible to use the new SP-2 chip fabricated in a 0.5(mu) CMOS process for SAW devices with a maximum frequency of 600 MHz. An on-chip analog-digital-converter (ADC) and 6 PWM modules support the development of high-miniaturized intelligent sensor systems We have developed a multi-SAW sensor system with this ASIC that manages the requirements on control as well as signal generation and storage and provides an interface to the PC and electronic devices on the board. Its low power consumption and its PCMCIA plug fulfil the requirements of small size and mobility. For this application sensors have been developed to detect hazardous gases in ambient air. Sensors with differently modified copper-phthalocyanine films are capable of detecting NO2 and O3, whereas those with a hyperbranched polyester film respond to NH3.
Towards a Reduced-Wire Interface for CMUT-Based Intravascular Ultrasound Imaging Systems
Lim, Jaemyung; Tekes, Coskun; Degertekin, F. Levent; Ghovanloo, Maysam
2016-01-01
Having intravascular ultrasound (IVUS) imaging capability on guide wires used in cardiovascular interventions may eliminate the need for separate IVUS catheters and expand the use of IVUS in a larger portion of the vasculature. High frequency capacitive micro machined ultrasonic transducer (CMUT) arrays should be integrated with interface electronics and placed on the guide wire for this purpose. Besides small size, this system-on-a-chip (SoC) front-end should connect to the back-end imaging system with a minimum number of wires to preserve the critical mechanical properties of the guide wire. We present a 40 MHz CMUT array interface SoC, which will eventually use only two wires for power delivery and transmits image data using a combination of analog-to-time conversion (ATC) and an impulse radio ultra-wideband (IR-UWB) wireless link. The proof-of-concept prototype ASIC consumes only 52.8 mW and occupies 4.07 mm2 in a 0.35-μm standard CMOS process. A rectifier and regulator power the rest of the SoC at 3.3 V from a 10 MHz power carrier that is supplied through a 2.4 m micro-coax cable with an overall efficiency of 49.1%. Echo signals from an 8-element CMUT array are amplified by a transimpedance amplifier (TIA) array and down-converted to baseband by quadrature sampling using a 40 MHz clock, derived from the power carrier. The ATC generates pulse-width-modulated (PWM) samples at 2 × 10 MS/s with 6 bit resolution, while the entire system achieved 5.1 ENOB. Preliminary images from the prototype system are presented, and alternative data transmission and possible future directions towards practical implementation are discussed. PMID:27662686
Towards a Reduced-Wire Interface for CMUT-Based Intravascular Ultrasound Imaging Systems.
Lim, Jaemyung; Tekes, Coskun; Degertekin, F Levent; Ghovanloo, Maysam
2017-04-01
Having intravascular ultrasound (IVUS) imaging capability on guide wires used in cardiovascular interventions may eliminate the need for separate IVUS catheters and expand the use of IVUS in a larger portion of the vasculature. High frequency capacitive micro machined ultrasonic transducer (CMUT) arrays should be integrated with interface electronics and placed on the guide wire for this purpose. Besides small size, this system-on-a-chip (SoC) front-end should connect to the back-end imaging system with a minimum number of wires to preserve the critical mechanical properties of the guide wire. We present a 40 MHz CMUT array interface SoC, which will eventually use only two wires for power delivery and transmits image data using a combination of analog-to-time conversion (ATC) and an impulse radio ultra-wideband (IR-UWB) wireless link. The proof-of-concept prototype ASIC consumes only 52.8 mW and occupies 4.07 [Formula: see text] in a 0.35- [Formula: see text] standard CMOS process. A rectifier and regulator power the rest of the SoC at 3.3 V from a 10 MHz power carrier that is supplied through a 2.4 m micro-coax cable with an overall efficiency of 49.1%. Echo signals from an 8-element CMUT array are amplified by a transimpedance amplifier (TIA) array and down-converted to baseband by quadrature sampling using a 40 MHz clock, derived from the power carrier. The ATC generates pulse-width-modulated (PWM) samples at 2 × 10 MS/s with 6 bit resolution, while the entire system achieved 5.1 ENOB. Preliminary images from the prototype system are presented, and alternative data transmission and possible future directions towards practical implementation are discussed.
González-Garrido, Antonia; Vega, Rosario; Mercado, Francisco; López, Iván A.; Soto, Enrique
2015-01-01
Acid-sensing ion channels (ASICs) are activated by an increase in the extracellular proton concentration. There are four genes (ASIC1-4) that encode six subunits, and they are involved in diverse neuronal functions, such as mechanosensation, learning and memory, nociception, and modulation of retinal function. In this study, we characterize the ASIC currents of spiral ganglion neurons (SGNs). These ASIC currents are primarily carried by Na+, exhibit fast activation and desensitization, display a pH50 of 6.2 and are blocked by amiloride, indicating that these are ASIC currents. The ASIC currents were further characterized using several pharmacological tools. Gadolinium and acetylsalicylic acid reduced these currents, and FMRFamide, zinc (at high concentrations) and N,N,N’,N’–tetrakis-(2-piridilmetil)-ethylenediamine increased them, indicating that functional ASICs are composed of the subunits ASIC1, ASIC2, and ASIC3. Neomycin and streptomycin reduced the desensitization rate of the ASIC current in SGNs, indicating that ASICs may contribute to the ototoxic action of aminoglycosides. RT-PCR of the spiral ganglion revealed significant expression of all ASIC subunits. By immunohistochemistry the expression of the ASIC1a, ASIC2a, ASIC2b, and ASIC3 subunits was detected in SGNs. Although only a few SGNs exhibited action potential firing in response to an acidic stimulus, protons in the extracellular solution modulated SGN activity during sinusoidal stimulation. Our results show that protons modulate the excitability of SGNs via ASICs. PMID:26733809
Ultra-Reliable Digital Avionics (URDA) processor
NASA Astrophysics Data System (ADS)
Branstetter, Reagan; Ruszczyk, William; Miville, Frank
1994-10-01
Texas Instruments Incorporated (TI) developed the URDA processor design under contract with the U.S. Air Force Wright Laboratory and the U.S. Army Night Vision and Electro-Sensors Directorate. TI's approach couples advanced packaging solutions with advanced integrated circuit (IC) technology to provide a high-performance (200 MIPS/800 MFLOPS) modular avionics processor module for a wide range of avionics applications. TI's processor design integrates two Ada-programmable, URDA basic processor modules (BPM's) with a JIAWG-compatible PiBus and TMBus on a single F-22 common integrated processor-compatible form-factor SEM-E avionics card. A separate, high-speed (25-MWord/second 32-bit word) input/output bus is provided for sensor data. Each BPM provides a peak throughput of 100 MIPS scalar concurrent with 400-MFLOPS vector processing in a removable multichip module (MCM) mounted to a liquid-flowthrough (LFT) core and interfacing to a processor interface module printed wiring board (PWB). Commercial RISC technology coupled with TI's advanced bipolar complementary metal oxide semiconductor (BiCMOS) application specific integrated circuit (ASIC) and silicon-on-silicon packaging technologies are used to achieve the high performance in a miniaturized package. A Mips R4000-family reduced instruction set computer (RISC) processor and a TI 100-MHz BiCMOS vector coprocessor (VCP) ASIC provide, respectively, the 100 MIPS of a scalar processor throughput and 400 MFLOPS of vector processing throughput for each BPM. The TI Aladdim ASIC chipset was developed on the TI Aladdin Program under contract with the U.S. Army Communications and Electronics Command and was sponsored by the Advanced Research Projects Agency with technical direction from the U.S. Army Night Vision and Electro-Sensors Directorate.
Interface and protocol development for STS read-out ASIC in the CBM experiment at FAIR
NASA Astrophysics Data System (ADS)
Kasinski, Krzysztof; Zabolotny, Wojciech; Szczygiel, Robert
2014-11-01
This paper presents a proposal of a protocol for communication between the read-out integrated circuit for the STS (Silicon Tracking System) and the Data Processing Board (DPB) at CBM (Compressed Baryonic Matter) experiment at FAIR, GSI (Helmholtzzentrum fuer Schwerionenforschung GmbH) in Germany. The application background, objectives and proposed solution is presented.
Fu, Hui; Fang, Peng; Zhou, Hai-Yun; Zhou, Jun; Yu, Xiao-Wei; Ni, Ming; Zheng, Jie-Yan; Jin, You; Chen, Jian-Guo; Wang, Fang; Hu, Zhuang-Li
2016-02-01
Orofacial pain is a common clinical symptom that is accompanied by tooth pain, migraine and gingivitis. Accumulating evidence suggests that acid-sensing ion channels (ASICs), especially ASIC3, can profoundly affect the physiological properties of nociception in peripheral sensory neurons. The aim of this study is to examine the contribution of ASICs in trigeminal ganglion (TG) neurons to orofacial inflammatory pain. A Western blot (WB), immunofluorescence assay of labelled trigeminal ganglion neurons, orofacial formalin test, cell preparation and electrophysiological experiments are performed. This study demonstrated that ASIC1, ASIC2a and ASIC3 are highly expressed in TG neurons innervating the orofacial region of rats. The amplitude of ASIC currents in these neurons increased 119.72% (for ASIC1-like current) and 230.59% (for ASIC3-like current) in the formalin-induced orofacial inflammatory pain model. In addition, WB and immunofluorescence assay demonstrated a significantly augmented expression of ASICs in orofacial TG neurons during orofacial inflammation compared with the control group. The relative protein density of ASIC1, ASIC2a and ASIC3 also increased 58.82 ± 8.92%, 45.30 ± 11.42% and 55.32 ± 14.71%, respectively, compared with the control group. Furthermore, pharmacological blockade of ASICs and genetic deletion of ASIC1 attenuated the inflammation response. These findings indicate that peripheral inflammation can induce the upregulation of ASICs in TG neurons, causing orofacial inflammatory pain. Additionally, the specific inhibitor of ASICs may have a significant analgesic effect on orofacial inflammatory pain. © 2016 John Wiley & Sons Australia, Ltd.
The AGILE silicon tracker: an innovative /γ-ray instrument for space
NASA Astrophysics Data System (ADS)
Prest, M.; Barbiellini, G.; Bordignon, G.; Fedel, G.; Liello, F.; Longo, F.; Pontoni, C.; Vallazza, E.
2003-03-01
AGILE (Light Imager for Gamma-ray Astrophysics) is the first small scientific mission of ASI, the Italian Space Agency. It is a light (100kg for the scientific instrument) satellite for the detection of /γ-ray sources in the energy range 30MeV-50GeV within a large field of view (1/4 of the sky). It is planned to be operational in the years 2003-2006, a period in which no other gamma-ray mission in the same energy range is foreseen. AGILE is made of a silicon tungsten tracker, a CsI(Tl) minicalorimeter (1.5X0), an anticoincidence system of segmented plastic scintillators and a X-ray imaging detector sensitive in the 10-40keV range. The tracker consists of 14 planes, each of them made of two layers of 16 single-sided, AC coupled, 410μm thick, 9.5×9.5cm2 silicon detectors with a readout pitch of 242μm and a floating strip. The readout ASIC is the TAA1, an analog-digital, low noise, self-triggering ASIC used in a very low power configuration (<400μW/channel) with full analog readout. The trigger of the satellite is given by the tracker. The total number of readout channels is around 43000. We present a detailed description of the tracker, its trigger and readout logic, its assembly procedures and the prototype performance in several testbeam periods at the CERN PS.
ASIC1A in neurons is critical for fear-related behaviors.
Taugher, R J; Lu, Y; Fan, R; Ghobbeh, A; Kreple, C J; Faraci, F M; Wemmie, J A
2017-11-01
Acid-sensing ion channels (ASICs) have been implicated in fear-, addiction- and depression-related behaviors in mice. While these effects have been attributed to ASIC1A in neurons, it has been reported that ASICs may also function in nonneuronal cells. To determine if ASIC1A in neurons is indeed required, we generated neuron-specific knockout (KO) mice with floxed Asic1a alleles disrupted by Cre recombinase driven by the neuron-specific synapsin I promoter (SynAsic1a KO mice). We confirmed that Cre expression occurred in neurons, but not all neurons, and not in nonneuronal cells including astrocytes. Consequent loss of ASIC1A in some but not all neurons was verified by western blotting, immunohistochemistry and electrophysiology. We found ASIC1A was disrupted in fear circuit neurons, and SynAsic1a KO mice exhibited prominent deficits in multiple fear-related behaviors including Pavlovian fear conditioning to cue and context, predator odor-evoked freezing and freezing responses to carbon dioxide inhalation. In contrast, in the nucleus accumbens ASIC1A expression was relatively normal in SynAsic1a KO mice, and consistent with this observation, cocaine conditioned place preference (CPP) was normal. Interestingly, depression-related behavior in the forced swim test, which has been previously linked to ASIC1A in the amygdala, was also normal. Together, these data suggest neurons are an important site of ASIC1A action in fear-related behaviors, whereas other behaviors likely depend on ASIC1A in other neurons or cell types not targeted in SynAsic1a KO mice. These findings highlight the need for further work to discern the roles of ASICs in specific cell types and brain sites. © 2017 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.
Low-noise analog readout channel for SDD in X-ray spectrometry
NASA Astrophysics Data System (ADS)
Atkin, E.; Gusev, A.; Krivchenko, A.; Levin, V.; Malankin, E.; Normanov, D.; Rotin, A.; Sagdiev, I.; Samsonov, V.
2016-01-01
A low-noise analog readout channel optimized for operation with the Silicon Drift Detectors (SDDs) with built-in JFET is presented. The Charge Sensitive Amplifier (CSA) operates in a pulse reset mode using the reset diode built-in the SDD detector. The shaper is a 6th order semi-Gaussian filter with switchable discrete shaping times. The readout channel provides the Equivalent Noise Charge (ENC) of 12e- (simulation) and input dynamic range of 30 keV . The measured energy resolution at the 5,89 keV line of a 55Fe X-ray source is 336 eV (FWHM). The channel was prototyped via Europractice in the AMS 350 nm process as miniASIC. The simulation and first measurement results are presented in the paper.
Evidence for the involvement of ASIC3 in sensory mechanotransduction in proprioceptors
Lin, Shing-Hong; Cheng, Yuan-Ren; Banks, Robert W.; Min, Ming-Yuan; Bewick, Guy S.; Chen, Chih-Cheng
2016-01-01
Acid-sensing ion channel 3 (ASIC3) is involved in acid nociception, but its possible role in neurosensory mechanotransduction is disputed. We report here the generation of Asic3-knockout/eGFPf-knockin mice and subsequent characterization of heterogeneous expression of ASIC3 in the dorsal root ganglion (DRG). ASIC3 is expressed in parvalbumin (Pv+) proprioceptor axons innervating muscle spindles. We further generate a floxed allele of Asic3 (Asic3f/f) and probe the role of ASIC3 in mechanotransduction in neurite-bearing Pv+ DRG neurons through localized elastic matrix movements and electrophysiology. Targeted knockout of Asic3 disrupts spindle afferent sensitivity to dynamic stimuli and impairs mechanotransduction in Pv+ DRG neurons because of substrate deformation-induced neurite stretching, but not to direct neurite indentation. In behavioural tasks, global knockout (Asic3−/−) and Pv-Cre::Asic3f/f mice produce similar deficits in grid and balance beam walking tasks. We conclude that, at least in mouse, ASIC3 is a molecular determinant contributing to dynamic mechanosensitivity in proprioceptors. PMID:27161260
Proton and non-proton activation of ASIC channels
Gautschi, Ivan; van Bemmelen, Miguel Xavier; Schild, Laurent
2017-01-01
The Acid-Sensing Ion Channels (ASIC) exhibit a fast desensitizing current when activated by pH values below 7.0. By contrast, non-proton ligands are able to trigger sustained ASIC currents at physiological pHs. To analyze the functional basis of the ASIC desensitizing and sustained currents, we have used ASIC1a and ASIC2a mutants with a cysteine in the pore vestibule for covalent binding of different sulfhydryl reagents. We found that ASIC1a and ASIC2a exhibit two distinct currents, a proton-induced desensitizing current and a sustained current triggered by sulfhydryl reagents. These currents differ in their pH dependency, their sensitivity to the sulfhydryl reagents, their ionic selectivity and their relative magnitude. We propose a model for ASIC1 and ASIC2 activity where the channels can function in two distinct modes, a desensitizing mode and a sustained mode depending on the activating ligands. The pore vestibule of the channel represents a functional site for binding non-proton ligands to activate ASIC1 and ASIC2 at neutral pH and to prevent channel desensitization. PMID:28384246
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rahman, Taufiq, E-mail: mtur2@cam.ac.uk; Smith, Ewan St. John
Highlights: • We have made a reasonable model of rat ASIC3 using published structure of chicken ASIC1. • We have docked sea anemone toxin APETx2 on the model. • We have identified two putative sites for toxin binding. • We have argued for plausibility one site over the other. • We have identified the residues that are likely to be critical for APETx2–ASIC3 interaction. - Abstract: Acid sensing ion channels (ASICs) are proton-gated cation channels that are expressed throughout the nervous system and have been implicated in mediating sensory perception of noxious stimuli. Amongst the six ASIC isoforms, ASIC1a, 1b,more » 2a and 3 form proton-gated homomers, which differ in their activation and inactivation kinetics, expression profiles and pharmacological modulation; protons do not gate ASIC2b and ASIC4. As with many other ion channels, structure-function studies of ASICs have been greatly aided by the discovery of some toxins that act in isoform-specific ways. ASIC3 is predominantly expressed by sensory neurons of the peripheral nervous system where it acts to detect acid as a noxious stimulus and thus plays an important role in nociception. ASIC3 is the only ASIC subunit that is inhibited by the sea anemone (Anthopleura elegantissima)-derived toxin APETx2. However, the molecular mechanism by which APETx2 interacts with ASIC3 remains largely unknown. In this study, we made a homology model of ASIC3 and used extensive protein–protein docking to predict for the first time, the probable sites of APETx2 interaction on ASIC3. Additionally, using computational alanine scanning, we also suggest the ‘hot-spots’ that are likely to be critical for ASIC3–APETx2 interaction.« less
NASA Astrophysics Data System (ADS)
Dotsenko, V. V.; Sahu, A.; Chonigman, B.; Tang, J.; Lehmann, A. E.; Gupta, V.; Talalevskii, A.; Ruotolo, S.; Sarwana, S.; Webber, R. J.; Gupta, D.
2017-02-01
Research and development of cryogenic application-specific integrated circuits (ASICs), such as high-frequency (tens of GHz) semiconductor and superconductor mixed-signal circuits and large-scale (>10,000 Josephson Junctions) superconductor digital circuits, have long been hindered by the absence of specialized cryogenic test apparatus. During their iterative development phase, most ASICs require many additional input-output lines for applying independent bias controls, injecting test signals, and monitoring outputs of different sub-circuits. We are developing a full suite of modular test apparatus based on cryocoolers that do not consume liquid helium, and support extensive electrical interfaces to standard and custom test equipment. Our design separates the cryogenics from electrical connections, allowing even inexperienced users to conduct testing by simply mounting their ASIC on a removable electrical insert. Thermal connections between the cold stages and the inserts are made with robust thermal links. ICE-T accommodates two independent electrical inserts at the same time. We have designed various inserts, such as universal ones with all 40 or 80 coaxial cables and those with customized wiring and temperature-controlled stages. ICE-T features fast thermal cycling for rapid testing, enables detailed testing over long periods (days to months, if necessary), and even supports automated testing of digital ICs with modular additions.
Multigigabit optical transceivers for high-data rate military applications
NASA Astrophysics Data System (ADS)
Catanzaro, Brian E.; Kuznia, Charlie
2012-01-01
Avionics has experienced an ever increasing demand for processing power and communication bandwidth. Currently deployed avionics systems require gigabit communication using opto-electronic transceivers connected with parallel optical fiber. Ultra Communications has developed a series of transceiver solutions combining ASIC technology with flip-chip bonding and advanced opto-mechanical molded optics. Ultra Communications custom high speed ASIC chips are developed using an SoS (silicon on sapphire) process. These circuits are flip chip bonded with sources (VCSEL arrays) and detectors (PIN diodes) to create an Opto-Electronic Integrated Circuit (OEIC). These have been combined with micro-optics assemblies to create transceivers with interfaces to standard fiber array (MT) cabling technology. We present an overview of the demands for transceivers in military applications and how new generation transceivers leverage both previous generation military optical transceivers as well as commercial high performance computing optical transceivers.
Double-differential recording and AGC using microcontrolled variable gain ASIC.
Rieger, Robert; Deng, Shin-Liang
2013-01-01
Low-power wearable recording of biopotentials requires acquisition front-ends with high common-mode rejection for interference suppression and adjustable gain to provide an optimum signal range to a cascading analogue-to-digital stage. A microcontroller operated double-differential (DD) recording setup and automatic gain control circuit (AGC) are discussed which reject common-mode interference and provide tunable gain, thus compensating for imbalance and variation in electrode interface impedance. Custom-designed variable gain amplifiers (ASIC) are used as part of the recording setup. The circuit gain and balance is set by the timing of microcontroller generated clock signals. Measured results are presented which confirm that improved common-mode rejection is achieved compared to a single differential amplifier in the presence of input network imbalance. Practical measured examples further validate gain control suitable for biopotential recording and power-line rejection for wearable ECG and EMG recording. The prototype front-end consumes 318 μW including amplifiers and microcontroller.
Rad-Hard Structured ASIC Body of Knowledge
NASA Technical Reports Server (NTRS)
Heidecker, Jason
2013-01-01
Structured Application-Specific Integrated Circuit (ASIC) technology is a platform between traditional ASICs and Field-Programmable Gate Arrays (FPGA). The motivation behind structured ASICs is to combine the low nonrecurring engineering costs (NRE) costs of FPGAs with the high performance of ASICs. This report provides an overview of the structured ASIC platforms that are radiation-hardened and intended for space application
Delaunay, Anne; Gasull, Xavier; Salinas, Miguel; Noël, Jacques; Friend, Valérie; Lingueglia, Eric; Deval, Emmanuel
2012-08-07
In rodent sensory neurons, acid-sensing ion channel 3 (ASIC3) has recently emerged as a particularly important sensor of nonadaptive pain associated with tissue acidosis. However, little is known about the human ASIC3 channel, which includes three splice variants differing in their C-terminal domain (hASIC3a, hASIC3b, and hASIC3c). hASIC3a transcripts represent the main mRNAs expressed in both peripheral and central neuronal tissues (dorsal root ganglia [DRG], spinal cord, and brain), where a small proportion of hASIC3c transcripts is also detected. We show that hASIC3 channels (hASIC3a, hASIC3b, or hASIC3c) are able to directly sense extracellular pH changes not only during acidification (up to pH 5.0), but also during alkalization (up to pH 8.0), an original and inducible property yet unknown. When the external pH decreases, hASIC3 display a transient acid mode with brief activation that is relevant to the classical ASIC currents, as previously described. On the other hand, an external pH increase activates a sustained alkaline mode leading to a constitutive activity at resting pH. Both modes are inhibited by the APETx2 toxin, an ASIC3-type channel inhibitor. The alkaline sensitivity of hASIC3 is an intrinsic property of the channel, which is supported by the extracellular loop and involves two arginines (R68 and R83) only present in the human clone. hASIC3 is thus able to sense the extracellular pH in both directions and therefore to dynamically adapt its activity between pH 5.0 and 8.0, a property likely to participate in the fine tuning of neuronal membrane potential and to neuron sensitization in various pH environments.
Ugawa, Shinya; Ueda, Takashi; Yamamura, Hisao; Shimada, Shoichi
2005-05-20
The activation of nociceptors by protons plays a crucial role in the initiation and maintenance of acidosis-linked pain. Acid-sensing ion channel (ASIC) and transient receptor potential/vanilloid receptor subtype-1 (TRPV1) encode proton-activated cation channels expressed by nociceptors and the opening of these channels results in nociceptor excitation. Histological relations among ASIC clones and the colocalization of each ASIC subunit and TRPV1 within single sensory neurons were examined on serial sections of rat dorsal root ganglia (DRG) using in situ hybridization histochemistry. ASIC1a transcripts were expressed in 20-25% of the DRG neurons, and most of the neurons had small (<30 microm)-diameter cell bodies. ASIC1b transcripts and ASIC3 transcripts were expressed in approximately 10% and 30-35% of the DRG neurons, respectively, and the greater part of each population was located in small-to-medium (30-50 microm)-diameter cells. The ASIC1a transcripts and ASIC1b transcripts were basically localized in the distinct populations of the DRG neurons, while approximately 20% of the ASIC1a-positive neurons and approximately 10% of the ASIC1b-positive neurons expressed ASIC3 transcripts. TRPV1 transcripts were expressed in 35-40% of the DRG neurons, and most of the TRPV1-positive neurons had small-diameter cell bodies. Intense expression signals for ASIC1a transcripts were detected in 40-45% of the TRPV1-positive neurons. Neurons expressing both ASIC1b and TRPV1 transcripts were barely detected in the DRG. Approximately 30% of the TRPV1-positive neurons expressed ASIC3 transcripts, and the double-labeled neurons were comprised of both small-diameter and medium-diameter cells. Approximately 13% of the TRPV1-positive neurons expressed both ASIC1a and ASIC3 transcripts.
Springauf, Andreas; Gründer, Stefan
2010-03-01
Acid-sensing ion channels (ASICs) are proton-gated Na(+) channels. They are implicated in synaptic transmission, detection of painful acidosis, and possibly sour taste. The typical ASIC current is a transient, completely desensitizing current that can be blocked by the diuretic amiloride. ASICs are present in chordates but are absent in other animals. They have been cloned from urochordates, jawless vertebrates, cartilaginous shark and bony fish, from chicken and different mammals. Strikingly, all ASICs that have so far been characterized from urochordates, jawless vertebrates and shark are not gated by protons, suggesting that proton gating evolved relatively late in bony fish and that primitive ASICs had a different and unknown gating mechanism. Recently, amino acids that are crucial for the proton gating of rat ASIC1a have been identified. These residues are completely conserved in shark ASIC1b (sASIC1b), prompting us to re-evaluate the proton sensitivity of sASIC1b. Here we show that, contrary to previous findings, sASIC1b is indeed gated by protons with half-maximal activation at pH 6.0. sASIC1b desensitizes quickly but incompletely, efficiently encoding transient as well as sustained proton signals. Our results show that the conservation of the amino acids crucial for proton gating can predict proton sensitivity of an ASIC and increase our understanding of the evolution of ASICs.
Modulation of Acid-sensing Ion Channel 1a by Intracellular pH and Its Role in Ischemic Stroke.
Li, Ming-Hua; Leng, Tian-Dong; Feng, Xue-Chao; Yang, Tao; Simon, Roger P; Xiong, Zhi-Gang
2016-08-26
An important contributor to brain ischemia is known to be extracellular acidosis, which activates acid-sensing ion channels (ASICs), a family of proton-gated sodium channels. Lines of evidence suggest that targeting ASICs may lead to novel therapeutic strategies for stroke. Investigations of the role of ASICs in ischemic brain injury have naturally focused on the role of extracellular pH in ASIC activation. By contrast, intracellular pH (pHi) has received little attention. This is a significant gap in our understanding because the ASIC response to extracellular pH is modulated by pHi, and activation of ASICs by extracellular protons is paradoxically enhanced by intracellular alkalosis. Our previous studies show that acidosis-induced cell injury in in vitro models is attenuated by intracellular acidification. However, whether pHi affects ischemic brain injury in vivo is completely unknown. Furthermore, whereas ASICs in native neurons are composed of different subunits characterized by distinct electrophysiological/pharmacological properties, the subunit-dependent modulation of ASIC activity by pHi has not been investigated. Using a combination of in vitro and in vivo ischemic brain injury models, electrophysiological, biochemical, and molecular biological approaches, we show that the intracellular alkalizing agent quinine potentiates, whereas the intracellular acidifying agent propionate inhibits, oxygen-glucose deprivation-induced cell injury in vitro and brain ischemia-induced infarct volume in vivo Moreover, we find that the potentiation of ASICs by quinine depends on the presence of the ASIC1a, ASIC2a subunits, but not ASIC1b, ASIC3 subunits. Furthermore, we have determined the amino acids in ASIC1a that are involved in the modulation of ASICs by pHi. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Bolotnikov, A E; Ackley, K; Camarda, G S; Cherches, C; Cui, Y; De Geronimo, G; Fried, J; Hodges, D; Hossain, A; Lee, W; Mahler, G; Maritato, M; Petryk, M; Roy, U; Salwen, C; Vernon, E; Yang, G; James, R B
2015-07-01
We developed a robust and low-cost array of virtual Frisch-grid CdZnTe detectors coupled to a front-end readout application-specific integrated circuit (ASIC) for spectroscopy and imaging of gamma rays. The array operates as a self-reliant detector module. It is comprised of 36 close-packed 6 × 6 × 15 mm(3) detectors grouped into 3 × 3 sub-arrays of 2 × 2 detectors with the common cathodes. The front-end analog ASIC accommodates up to 36 anode and 9 cathode inputs. Several detector modules can be integrated into a single- or multi-layer unit operating as a Compton or a coded-aperture camera. We present the results from testing two fully assembled modules and readout electronics. The further enhancement of the arrays' performance and reduction of their cost are possible by using position-sensitive virtual Frisch-grid detectors, which allow for accurate corrections of the response of material non-uniformities caused by crystal defects.
Bolotnikov, A. E.; Ackley, K.; Camarda, G. S.; ...
2015-07-28
We developed a robust and low-cost array of virtual Frisch-grid CdZnTe (CZT) detectors coupled to a front-end readout ASIC for spectroscopy and imaging of gamma rays. The array operates as a self-reliant detector module. It is comprised of 36 close-packed 6x6x15 mm 3 detectors grouped into 3x3 sub-arrays of 2x2 detectors with the common cathodes. The front-end analog ASIC accommodates up to 36 anode and 9 cathode inputs. Several detector modules can be integrated into a single- or multi-layer unit operating as a Compton or a coded-aperture camera. We present the results from testing two fully assembled modules and readoutmore » electronics. The further enhancement of the arrays’ performance and reduction of their cost are made possible by using position-sensitive virtual Frisch-grid detectors, which allow for accurate corrections of the response of material non-uniformities caused by crystal defects.« less
Fast front-end electronics for semiconductor tracking detectors: Trends and perspectives
NASA Astrophysics Data System (ADS)
Rivetti, Angelo
2014-11-01
In the past few years, extensive research efforts pursued by both the industry and the academia have lead to major improvements in the performance of Analog to Digital Converters (ADCs) and Time to Digital Converters (TDCs). ADCs achieving 8-10 bit resolution, 50-100 MHz conversion frequency and less than 1 mW power consumption are the today's standard, while TDCs have reached sub-picosecond time resolution. These results have been made possible by architectural upgrades combined with the use of ultra deep submicron CMOS technologies with minimum feature size of 130 nm or smaller. Front-end ASICs in which a prompt digitization is followed by signal conditioning in the digital domain can now be envisaged also within the tight power budget typically available in high density tracking systems. Furthermore, tracking detectors embedding high resolution timing capabilities are gaining interest. In the paper, ADC's and TDC's developments which are of particular relevance for the design front-end electronics for semiconductor trackers are discussed along with the benefits and challenges of exploiting such high performance building blocks in implementing the next generation of ASICs for high granularity particle detectors.
Smart Power: New power integrated circuit technologies and their applications
NASA Astrophysics Data System (ADS)
Kuivalainen, Pekka; Pohjonen, Helena; Yli-Pietilae, Timo; Lenkkeri, Jaakko
1992-05-01
Power Integrated Circuits (PIC) is one of the most rapidly growing branches of the semiconductor technology. The PIC markets has been forecast to grow from 660 million dollars in 1990 to 1658 million dollars in 1994. It has even been forecast that at the end of the 1990's the PIC markets would correspond to the value of the whole semiconductor production in 1990. Automotive electronics will play the leading role in the development of the standard PIC's. Integrated motor drivers (36 V/4 A), smart integrated switches (60 V/30 A), solenoid drivers, integrated switch-mode power supplies and regulators are the latest standard devices of the PIC manufactures. ASIC (Application Specific Integrated Circuits) PIC solutions are needed for the same reasons as other ASIC devices: there are no proper standard devices, a company has a lot of application knowhow, which should be kept inside the company, the size of the product must be reduced, and assembly costs are wished to be reduced by decreasing the number of discrete devices. During the next few years the most probable ASIC PIC applications in Finland will be integrated solenoid and motor drivers, an integrated electronic lamp ballast circuit and various sensor interface circuits. Application of the PIC technologies to machines and actuators will strongly be increased all over the world. This means that various PIC's, either standard PIC's or full custom ASIC circuits, will appear in many products which compete with the corresponding Finnish products. Therefore the development of the PIC technologies must be followed carefully in order to immediately be able to apply the latest development in the smart power technologies and their design methods.
Springauf, Andreas; Gründer, Stefan
2010-01-01
Acid-sensing ion channels (ASICs) are proton-gated Na+ channels. They are implicated in synaptic transmission, detection of painful acidosis, and possibly sour taste. The typical ASIC current is a transient, completely desensitizing current that can be blocked by the diuretic amiloride. ASICs are present in chordates but are absent in other animals. They have been cloned from urochordates, jawless vertebrates, cartilaginous shark and bony fish, from chicken and different mammals. Strikingly, all ASICs that have so far been characterized from urochordates, jawless vertebrates and shark are not gated by protons, suggesting that proton gating evolved relatively late in bony fish and that primitive ASICs had a different and unknown gating mechanism. Recently, amino acids that are crucial for the proton gating of rat ASIC1a have been identified. These residues are completely conserved in shark ASIC1b (sASIC1b), prompting us to re-evaluate the proton sensitivity of sASIC1b. Here we show that, contrary to previous findings, sASIC1b is indeed gated by protons with half-maximal activation at pH 6.0. sASIC1b desensitizes quickly but incompletely, efficiently encoding transient as well as sustained proton signals. Our results show that the conservation of the amino acids crucial for proton gating can predict proton sensitivity of an ASIC and increase our understanding of the evolution of ASICs. PMID:20064854
Inhibition of Acid Sensing Ion Channel Currents by Lidocaine in Cultured Mouse Cortical Neurons
Lin, Jun; Chu, Xiangping; Maysami, Samaneh; Li, Minghua; Si, Hongfang; Cottrell, James E.; Simon, Roger P.; Xiong, Zhigang
2012-01-01
BACKGROUND Lidocaine is a local anesthetic that has multiple pharmacological effects including antiarrhythmia, antinociception, and neuroprotection. Acid sensing ion channels (ASICs) are proton-gated cation channels that belong to the epithelial sodium channel/degenerin superfamily. Activation of ASICs by protons results in sodium and calcium influx. ASICs have been implicated in various physiological processes including learning/memory, nociception, and in acidosis-mediated neuron injury. In this study, we examined the effect of lidocaine on ASICs in cultured mouse cortical neurons. METHODS ASIC currents were activated and recorded using a whole-cell patch-clamp technique in cultured mouse cortical neurons. The effects of lidocaine at different concentrations were examined. To determine whether the inhibition of lidocaine on ASIC currents is subunit specific, we examined the effect of lidocaine on homomeric ASIC1a and ASIC2a currents expressed in Chinese hamster ovary cells. RESULTS Lidocaine significantly inhibits the ASIC currents in mouse cortical neurons. The inhibition was reversible and dose dependent. A detectable effect was noticed at a concentration of 0.3 mM lidocaine. At 30 mM, ASIC current was inhibited by approximately 90%. Analysis of the complete dose-response relationship yielded a half-maximal inhibitory concentration of 11.79 ± 1.74 mM and a Hill coefficient of 2.7 ± 0.5 (n = 10). The effect is rapid and does not depend on pH. In Chinese hamster ovary cells expressing different ASIC subunits, lidocaine inhibits the ASIC1a current without affecting the ASIC2a current. CONCLUSION ASIC currents are significantly inhibited by lidocaine. Our finding reveals a new pharmacological effect of lidocaine in neurons. PMID:21385979
ASIC3 channels in multimodal sensory perception.
Li, Wei-Guang; Xu, Tian-Le
2011-01-19
Acid-sensing ion channels (ASICs), which are members of the sodium-selective cation channels belonging to the epithelial sodium channel/degenerin (ENaC/DEG) family, act as membrane-bound receptors for extracellular protons as well as nonproton ligands. At least five ASIC subunits have been identified in mammalian neurons, which form both homotrimeric and heterotrimeric channels. The highly proton sensitive ASIC3 channels are predominantly distributed in peripheral sensory neurons, correlating with their roles in multimodal sensory perception, including nociception, mechanosensation, and chemosensation. Different from other ASIC subunit composing ion channels, ASIC3 channels can mediate a sustained window current in response to mild extracellular acidosis (pH 7.3-6.7), which often occurs accompanied by many sensory stimuli. Furthermore, recent evidence indicates that the sustained component of ASIC3 currents can be enhanced by nonproton ligands including the endogenous metabolite agmatine. In this review, we first summarize the growing body of evidence for the involvement of ASIC3 channels in multimodal sensory perception and then discuss the potential mechanisms underlying ASIC3 activation and mediation of sensory perception, with a special emphasis on its role in nociception. We conclude that ASIC3 activation and modulation by diverse sensory stimuli represent a new avenue for understanding the role of ASIC3 channels in sensory perception. Furthermore, the emerging implications of ASIC3 channels in multiple sensory dysfunctions including nociception allow the development of new pharmacotherapy.
Seizure Termination by Acidosis Depends on ASIC1a
Ziemann, Adam E.; Schnizler, Mikael K.; Albert, Gregory W.; Severson, Meryl A.; Howard, Matthew A.; Welsh, Michael J.; Wemmie, John A.
2008-01-01
SUMMARY Most seizures stop spontaneously. However, the molecular mechanisms remain unknown. Earlier observations that seizures reduce brain pH and that acidosis inhibits seizures indicated that acidosis halts epileptic activity. Because acid–sensing ion channel–1a (ASIC1a) shows exquisite sensitivity to extracellular pH and regulates neuron excitability, we hypothesized that acidosis might activate ASIC1a to terminate seizures. Disrupting mouse ASIC1a increased the severity of chemoconvulsant–induced seizures, whereas overexpressing ASIC1a had the opposite effect. ASIC1a did not affect seizure threshold or onset, but shortened seizure duration and prevented progression. CO2 inhalation, long known to lower brain pH and inhibit seizures, also required ASIC1a to interrupt tonic–clonic seizures. Acidosis activated inhibitory interneurons through ASIC1a, suggesting that ASIC1a might limit seizures by increasing inhibitory tone. These findings identify ASIC1a as a key element in seizure termination when brain pH falls. The results suggest a molecular mechanism for how the brain stops seizures and suggest new therapeutic strategies. PMID:18536711
Abnormal cardiac autonomic regulation in mice lacking ASIC3.
Cheng, Ching-Feng; Kuo, Terry B J; Chen, Wei-Nan; Lin, Chao-Chieh; Chen, Chih-Cheng
2014-01-01
Integration of sympathetic and parasympathetic outflow is essential in maintaining normal cardiac autonomic function. Recent studies demonstrate that acid-sensing ion channel 3 (ASIC3) is a sensitive acid sensor for cardiac ischemia and prolonged mild acidification can open ASIC3 and evoke a sustained inward current that fires action potentials in cardiac sensory neurons. However, the physiological role of ASIC3 in cardiac autonomic regulation is not known. In this study, we elucidate the role of ASIC3 in cardiac autonomic function using Asic3(-/-) mice. Asic3(-/-) mice showed normal baseline heart rate and lower blood pressure as compared with their wild-type littermates. Heart rate variability analyses revealed imbalanced autonomic regulation, with decreased sympathetic function. Furthermore, Asic3(-/-) mice demonstrated a blunted response to isoproterenol-induced cardiac tachycardia and prolonged duration to recover to baseline heart rate. Moreover, quantitative RT-PCR analysis of gene expression in sensory ganglia and heart revealed that no gene compensation for muscarinic acetylcholines receptors and beta-adrenalin receptors were found in Asic3(-/-) mice. In summary, we unraveled an important role of ASIC3 in regulating cardiac autonomic function, whereby loss of ASIC3 alters the normal physiological response to ischemic stimuli, which reveals new implications for therapy in autonomic nervous system-related cardiovascular diseases.
Chiang, Po-Han; Chien, Ta-Chun; Chen, Chih-Cheng; Yanagawa, Yuchio; Lien, Cheng-Chang
2015-01-01
Genetic variants in the human ortholog of acid-sensing ion channel-1a subunit (ASIC1a) gene are associated with panic disorder and amygdala dysfunction. Both fear learning and activity-induced long-term potentiation (LTP) of cortico-basolateral amygdala (BLA) synapses are impaired in ASIC1a-null mice, suggesting a critical role of ASICs in fear memory formation. In this study, we found that ASICs were differentially expressed within the amygdala neuronal population, and the extent of LTP at various glutamatergic synapses correlated with the level of ASIC expression in postsynaptic neurons. Importantly, selective deletion of ASIC1a in GABAergic cells, including amygdala output neurons, eliminated LTP in these cells and reduced fear learning to the same extent as that found when ASIC1a was selectively abolished in BLA glutamatergic neurons. Thus, fear learning requires ASIC-dependent LTP at multiple amygdala synapses, including both cortico-BLA input synapses and intra-amygdala synapses on output neurons. PMID:25988357
A fast embedded readout system for large-area Medipix and Timepix systems
NASA Astrophysics Data System (ADS)
Brogna, A. S.; Balzer, M.; Smale, S.; Hartmann, J.; Bormann, D.; Hamann, E.; Cecilia, A.; Zuber, M.; Koenig, T.; Zwerger, A.; Weber, M.; Fiederle, M.; Baumbach, T.
2014-05-01
In this work we present a novel readout electronics for an X-ray sensor based on a Si crystal bump-bonded to an array of 3 × 2 Medipix ASICs. The pixel size is 55 μm × 55 μm with a total number of ~ 400k pixels and a sensitive area of 42 mm × 28 mm. The readout electronics operate Medipix-2 MXR or Timepix ASICs with a clock speed of 125 MHz. The data acquisition system is centered around an FPGA and each of the six ASICs has a dedicated I/O port for simultaneous data acquisition. The settings of the auxiliary devices (ADCs and DACs) are also processed in the FPGA. Moreover, a high-resolution timer operates the electronic shutter to select the exposure time from 8 ns to several milliseconds. A sophisticated trigger is available in hardware and software to synchronize the acquisition with external electro-mechanical motors. The system includes a diagnostic subsystem to check the sensor temperature and to control the cooling Peltier cells and a programmable high-voltage generator to bias the crystal. A network cable transfers the data, encapsulated into the UDP protocol and streamed at 1 Gb/s. Therefore most notebooks or personal computers are able to process the data and to program the system without a dedicated interface. The data readout software is compatible with the well-known Pixelman 2.x running both on Windows and GNU/Linux. Furthermore the open architecture encourages users to write their own applications. With a low-level interface library which implements all the basic features, a MATLAB or Python script can be implemented for special manipulations of the raw data. In this paper we present selected images taken with a microfocus X-ray tube to demonstrate the capability to collect the data at rates up to 120 fps corresponding to 0.76 Gb/s.
Memory-Based Structured Application Specific Integrated Circuit (ASIC) Study
2008-10-01
memory interface, arbiter/ schedulers for rescheduling the memory requests according to some schedule policy, and memory channels for communicating...between the power-savings and the wakeup overhead with respect to both wakeup power and wakeup delay. For example, dream mode can save 50% more static...power than sleep mode, but at the expense of twice the wake delay and three times the wakeup energy. The user can specify power-gating modes for various components.
The nuMOIRCS project: detector upgrade overview and early commissioning results
NASA Astrophysics Data System (ADS)
Walawender, Josh; Wung, Matthew; Fabricius, Maximilian; Tanaka, Ichi; Arimoto, Nobuo; Cook, David; Elms, Brian; Hashiba, Yasuhito; Hu, Yen-Sang; Iwata, Ikuru; Nishimura, Tetsuo; Omata, Koji; Takato, Naruhisa; Wang, Shiang-Yu; Weber, Mark
2016-08-01
In 2014 and 2015 the Multi-Object InfraRed Camera and Spectrograph (MOIRCS) instrument at the Subaru Telescope on Maunakea is underwent a significant modernization and upgrade project. We upgraded the two Hawaii2 detectors to Hawaii2-RG models, modernized the cryogenic temperature control system, and rewrote much of the instrument control software. The detector upgrade replaced the Hawaii2 detectors which use the Tohoku University Focal Plane Array Controller (TUFPAC) electronics with Hawaii2-RG detectors using SIDECAR ASIC (a fully integrated FPA controller system-on-a-chip) and a SAM interface card. We achieved an improvement in read noise by a factor of about 2 with this detector and electronics upgrade. The cryogenic temperature control upgrade focused on modernizing the components and making the procedures for warm up and cool down of the instrument safer. We have moved PID control loops out of the instrument control software and into Lakeshore model 336 cryogenic temperature controllers and have added interlocks on the warming systems to prevent overheating of the instrument. Much of the instrument control software has also been re-written. This was necessitated by the different interface to the detector electronics (ASIC and SAM vs. TUFPAC) and by the desire to modernize the interface to the telescope control software which has been updated to Subaru's "Gen2" system since the time of MOIRCS construction and first light. The new software is also designed to increase reliability of operation of the instrument, decrease overheads, and be easier for night time operators and support astronomers to use.
Rodent wearable ultrasound system for wireless neural recording.
Piech, David K; Kay, Joshua E; Boser, Bernhard E; Maharbiz, Michel M
2017-07-01
Advances in minimally-invasive, distributed biological interface nodes enable possibilities for networks of sensors and actuators to connect the brain with external devices. The recent development of the neural dust sensor mote has shown that utilizing ultrasound backscatter communication enables untethered sub-mm neural recording devices. These implanted sensor motes require a wearable external ultrasound interrogation device to enable in-vivo, freely-behaving neural interface experiments. However, minimizing the complexity and size of the implanted sensors shifts the power and processing burden to the external interrogator. In this paper, we present an ultrasound backscatter interrogator that supports real-time backscatter processing in a rodent-wearable, completely wireless device. We demonstrate a generic digital encoding scheme which is intended for transmitting neural information. The system integrates a front-end ultrasonic interface ASIC with off-the-shelf components to enable a highly compact ultrasound interrogation device intended for rodent neural interface experiments but applicable to other model systems.
Knockdown of acid-sensing ion channel 1a (ASIC1a) suppresses disease phenotype in SCA1 mouse model.
Vig, Parminder J S; Hearst, Scoty M; Shao, Qingmei; Lopez, Maripar E
2014-08-01
The mutated ataxin-1 protein in spinocerebellar ataxia 1 (SCA1) targets Purkinje cells (PCs) of the cerebellum and causes progressive ataxia due to loss of PCs and neurons of the brainstem. The exact mechanism of this cellular loss is still not clear. Currently, there are no treatments for SCA1; however, understanding of the mechanisms that regulate SCA1 pathology is essential for devising new therapies for SCA1 patients. We previously established a connection between the loss of intracellular calcium-buffering and calcium-signalling proteins with initiation of neurodegeneration in SCA1 transgenic (Tg) mice. Recently, acid-sensing ion channel 1a (ASIC1a) have been implicated in calcium-mediated toxicity in many brain disorders. Here, we report generating SCA1 Tg mice in the ASIC1a knockout (KO) background and demonstrate that the deletion of ASIC1a gene expression causes suppression of the SCA1 disease phenotype. Loss of the ASIC1a channel in SCA1/ASIC1a KO mice resulted in the improvement of motor deficit and decreased PC degeneration. Interestingly, the expression of the ASIC1 variant, ASIC1b, was upregulated in the cerebellum of both SCA1/ASIC1a KO and ASIC1a KO animals as compared to the wild-type (WT) and SCA1 Tg mice. Further, these SCA1/ASIC1a KO mice exhibited translocation of PC calcium-binding protein calbindin-D28k from the nucleus to the cytosol in young animals, which otherwise have both cytosolic and nuclear localization. Furthermore, in addition to higher expression of calcium-buffering protein parvalbumin, PCs of the older SCA1/ASIC1a KO mice showed a decrease in morphologic abnormalities as compared to the age-matched SCA1 animals. Our data suggest that ASIC1a may be a mediator of SCA1 pathogenesis and targeting ASIC1a could be a novel approach to treat SCA1.
Beam test of CSES silicon strip detector module
NASA Astrophysics Data System (ADS)
Zhang, Da-Li; Lu, Hong; Wang, Huan-Yu; Li, Xin-Qiao; Xu, Yan-Bing; An, Zheng-Hua; Yu, Xiao-xia; Wang, Hui; Shi, Feng; Wang, Ping; Zhao, Xiao-Yun
2017-05-01
The silicon-strip tracker of the China Seismo-Electromagnetic Satellite (CSES) consists of two double-sided silicon strip detectors (DSSDs) which provide incident particle tracking information. A low-noise analog ASIC VA140 was used in this study for DSSD signal readout. A beam test on the DSSD module was performed at the Beijing Test Beam Facility of the Beijing Electron Positron Collider (BEPC) using a 400-800 MeV/c proton beam. The pedestal analysis results, RMSE noise, gain correction, and intensity distribution of incident particles of the DSSD module are presented. Supported by the XXX Civil Space Programme
González-Inchauspe, Carlota; Urbano, Francisco J; Di Guilmi, Mariano N; Uchitel, Osvaldo D
2017-03-08
Acid-sensing ion channels (ASICs) regulate synaptic activities and play important roles in neurodegenerative diseases. We found that these channels can be activated in neurons of the medial nucleus of the trapezoid body (MNTB) of the auditory system in the CNS. A drop in extracellular pH induces transient inward ASIC currents (I ASIC s) in postsynaptic MNTB neurons from wild-type mice. The inhibition of I ASIC s by psalmotoxin-1 (PcTx1) and the absence of these currents in knock-out mice for ASIC-1a subunit (ASIC1a -/- ) suggest that homomeric ASIC-1as are mediating these currents in MNTB neurons. Furthermore, we detect ASIC1a-dependent currents during synaptic transmission, suggesting an acidification of the synaptic cleft due to the corelease of neurotransmitter and H + from synaptic vesicles. These currents are capable of eliciting action potentials in the absence of glutamatergic currents. A significant characteristic of these homomeric ASIC-1as is their permeability to Ca 2+ Activation of ASIC-1a in MNTB neurons by exogenous H + induces an increase in intracellular Ca 2+ Furthermore, the activation of postsynaptic ASIC-1as during high-frequency stimulation (HFS) of the presynaptic nerve terminal leads to a PcTx1-sensitive increase in intracellular Ca 2+ in MNTB neurons, which is independent of glutamate receptors and is absent in neurons from ASIC1a -/- mice. During HFS, the lack of functional ASICs in synaptic transmission results in an enhanced short-term depression of glutamatergic EPSCs. These results strongly support the hypothesis of protons as neurotransmitters and demonstrate that presynaptic released protons modulate synaptic transmission by activating ASIC-1as at the calyx of Held-MNTB synapse. SIGNIFICANCE STATEMENT The manuscript demonstrates that postsynaptic neurons of the medial nucleus of the trapezoid body at the mouse calyx of Held synapse express functional homomeric Acid-sensing ion channel-1a (ASIC-1as) that can be activated by protons (coreleased with neurotransmitter from acidified synaptic vesicles). These ASIC-1as contribute to the generation of postsynaptic currents and, more relevant, to calcium influx, which could be involved in the modulation of presynaptic transmitter release. Inhibition or deletion of ASIC-1a leads to enhanced short-term depression, demonstrating that they are concerned with short-term plasticity of the synapse. ASICs represent a widespread communication system with unique properties. We expect that our experiments will have an impact in the neurobiology field and will spread in areas related to neuronal plasticity. Copyright © 2017 the authors 0270-6474/17/372589-11$15.00/0.
A low power low noise analog front end for portable healthcare system
NASA Astrophysics Data System (ADS)
Yanchao, Wang; Keren, Ke; Wenhui, Qin; Yajie, Qin; Ting, Yi; Zhiliang, Hong
2015-10-01
The presented analog front end (AFE) used to process human bio-signals consists of chopping instrument amplifier (IA), chopping spikes filter and programmable gain and bandwidth amplifier. The capacitor-coupling input of AFE can reject the DC electrode offset. The power consumption of current-feedback based IA is reduced by adopting capacitor divider in the input and feedback network. Besides, IA's input thermal noise is decreased by utilizing complementary CMOS input pairs which can offer higher transconductance. Fabricated in Global Foundry 0.35 μm CMOS technology, the chip consumes 3.96 μA from 3.3 V supply. The measured input noise is 0.85 μVrms (0.5-100 Hz) and the achieved noise efficient factor is 6.48. Project supported by the Science and Technology Commission of Shanghai Municipality (No. 13511501100), the State Key Laboratory Project of China (No. 11MS002), and the State Key Laboratory of ASIC & System, Fudan University.
NASA Astrophysics Data System (ADS)
Gabrielli, Alessandro; Loddo, Flavio; Ranieri, Antonio; De Robertis, Giuseppe
2008-10-01
This work is aimed at defining the architecture of a new digital ASIC, namely Slow-Control Adapter (SCA), which will be designed in a commercial 130-nm CMOS technology. This chip will be embedded within a high-speed data acquisition optical link (GBT) to control and monitor the front-end electronics in future high-energy physics experiments. The GBT link provides a transparent transport layer between the SCA and control electronics in the counting room. The proposed SCA supports a variety of common bus protocols to interface with end-user general-purpose electronics. Between the GBT and the SCA a standard 100 Mb/s IEEE-802.3 compatible protocol will be implemented. This standard protocol allows off-line tests of the prototypes using commercial components that support the same standard. The project is justified because embedded applications in modern large HEP experiments require particular care to assure the lowest possible power consumption, still offering the highest reliability demanded by very large particle detectors.
Duan, Bo; Wang, Yi-Zhi; Yang, Tao; Chu, Xiang-Ping; Yu, Ye; Huang, Yu; Cao, Hui; Hansen, Jillian; Simon, Roger P.; Zhu, Michael X.; Xiong, Zhi-Gang; Xu, Tian-Le
2011-01-01
Ischemic brain injury is a major problem associated with stroke. It has been increasingly recognized that acid-sensing ion channels (ASICs) contribute significantly to ischemic neuronal damage, but the underlying mechanism has remained elusive. Here, we show that extracellular spermine, one of the endogenous polyamines, exacerbates ischemic neuronal injury through sensitization of ASIC1a channels to extracellular acidosis. Pharmacological blockade of ASIC1a or deletion of the ASIC1 gene greatly reduces the enhancing effect of spermine in ischemic neuronal damage both in cultures of dissociated neurons and in a mouse model of focal ischemia. Mechanistically, spermine profoundly reduces desensitization of ASIC1a by slowing down desensitization in the open state, shifting steady-state desensitization to more acidic pH, and accelerating recovery between repeated periods of acid stimulation. Spermine-mediated potentiation of ASIC1a activity is occluded by PcTX1 (psalmotoxin 1), a specific ASIC1a inhibitor binding to its extracellular domain. Functionally, the enhanced channel activity is accompanied by increased acid-induced neuronal membrane depolarization and cytoplasmic Ca2+ overload, which may partially explain the exacerbated neuronal damage caused by spermine. More importantly, blocking endogenous spermine synthesis significantly attenuates ischemic brain injury mediated by ASIC1a but not that by NMDA receptors. Thus, extracellular spermine contributes significantly to ischemic neuronal injury through enhancing ASIC1a activity. Our data suggest new neuroprotective strategies for stroke patients via inhibition of polyamine synthesis and subsequent spermine–ASIC interaction. PMID:21307247
Schuhmacher, Laura-Nadine; Smith, Ewan St John
2016-12-13
Acid-sensing ion channels (ASICs) are a family of ion channels comprised of six subunits encoded by four genes and they are expressed throughout the peripheral and central nervous systems. ASICs have been implicated in a wide range of physiological and pathophysiological processes: pain, breathing, synaptic plasticity and excitotoxicity. Unlike mice and humans, naked mole-rats do not perceive acid as a noxious stimulus, even though their sensory neurons express functional ASICs, likely an adaptation to living in a hypercapnic subterranean environment. Previous studies of ASIC expression in the mammalian nervous system have often not examined all subunits, or have failed to adequately quantify expression between tissues; to date there has been no attempt to determine ASIC expression in the central nervous system of the naked mole-rat. Here we perform a geNorm study to identify reliable housekeeping genes in both mouse and naked mole-rat and then use quantitative real-time PCR to estimate the relative amounts of ASIC transcripts in different tissues of both species. We identify RPL13A (ribosomal protein L13A) and CANX (calnexin), and β-ACTIN and EIF4A (eukaryotic initiation factor 4a) as being the most stably expressed housekeeping genes in mouse and naked mole-rat, respectively. In both species, ASIC3 was most highly expressed in dorsal root ganglia (DRG), and ASIC1a, ASIC2b and ASIC3 were more highly expressed across all brain regions compared to the other subunits. We also show that ASIC4, a proton-insensitive subunit of relatively unknown function, was highly expressed in all mouse tissues apart from DRG and hippocampus, but was by contrast the lowliest expressed ASIC in all naked mole-rat tissues.
Mora Lopez, Carolina; Prodanov, Dimiter; Braeken, Dries; Gligorijevic, Ivan; Eberle, Wolfgang; Bartic, Carmen; Puers, Robert; Gielen, Georges
2012-04-01
Since a few decades, micro-fabricated neural probes are being used, together with microelectronic interfaces, to get more insight in the activity of neuronal networks. The need for higher temporal and spatial recording resolutions imposes new challenges on the design of integrated neural interfaces with respect to power consumption, data handling and versatility. In this paper, we present an integrated acquisition system for in vitro and in vivo recording of neural activity. The ASIC consists of 16 low-noise, fully-differential input channels with independent programmability of its amplification (from 100 to 6000 V/V) and filtering (1-6000 Hz range) capabilities. Each channel is AC-coupled and implements a fourth-order band-pass filter in order to steeply attenuate out-of-band noise and DC input offsets. The system achieves an input-referred noise density of 37 nV/√Hz, a NEF of 5.1, a CMRR > 60 dB, a THD < 1% and a sampling rate of 30 kS/s per channel, while consuming a maximum of 70 μA per channel from a single 3.3 V. The ASIC was implemented in a 0.35 μm CMOS technology and has a total area of 5.6 × 4.5 mm². The recording system was successfully validated in in vitro and in vivo experiments, achieving simultaneous multichannel recordings of cell activity with satisfactory signal-to-noise ratios.
NASA Technical Reports Server (NTRS)
Ruiz, B. Ian; Burke, Gary R.; Lung, Gerald; Whitaker, William D.; Nowicki, Robert M.
2004-01-01
This viewgraph presentation reviews the architecture of the The CIA-AlA chip-set is a set of mixed-signal ASICs that provide a flexible high level interface between the spacecraft's command and data handling (C&DH) electronics and lower level functions in other spacecraft subsystems. Due to the open-systems architecture of the chip-set including an embedded micro-controller a variety of applications are possible. The chip-set was developed for the missions to the outer planets. The chips were developed to provide a single solution for both the switching and regulation of a spacecraft power bus. The Open-Systems Architecture allows for other powerful applications.
Identification of a unique Ca2+-binding site in rat acid-sensing ion channel 3.
Zuo, Zhicheng; Smith, Rachel N; Chen, Zhenglan; Agharkar, Amruta S; Snell, Heather D; Huang, Renqi; Liu, Jin; Gonzales, Eric B
2018-05-25
Acid-sensing ion channels (ASICs) evolved to sense changes in extracellular acidity with the divalent cation calcium (Ca 2+ ) as an allosteric modulator and channel blocker. The channel-blocking activity is most apparent in ASIC3, as removing Ca 2+ results in channel opening, with the site's location remaining unresolved. Here we show that a ring of rat ASIC3 (rASIC3) glutamates (Glu435), located above the channel gate, modulates proton sensitivity and contributes to the formation of the elusive Ca 2+ block site. Mutation of this residue to glycine, the equivalent residue in chicken ASIC1, diminished the rASIC3 Ca 2+ block effect. Atomistic molecular dynamic simulations corroborate the involvement of this acidic residue in forming a high-affinity Ca 2+ site atop the channel pore. Furthermore, the reported observations provide clarity for past controversies regarding ASIC channel gating. Our findings enhance understanding of ASIC gating mechanisms and provide structural and energetic insights into this unique calcium-binding site.
Acid-Sensing Ion Channel 1a Contributes to Airway Hyperreactivity in Mice
Reznikov, Leah R.; Meyerholz, David K.; Adam, Ryan J.; Abou Alaiwa, Mahmoud; Jaffer, Omar; Michalski, Andrew S.; Powers, Linda S.; Price, Margaret P.; Stoltz, David A.; Welsh, Michael J.
2016-01-01
Neurons innervating the airways contribute to airway hyperreactivity (AHR), a hallmark feature of asthma. Several observations suggested that acid-sensing ion channels (ASICs), neuronal cation channels activated by protons, might contribute to AHR. For example, ASICs are found in vagal sensory neurons that innervate airways, and asthmatic airways can become acidic. Moreover, airway acidification activates ASIC currents and depolarizes neurons innervating airways. We found ASIC1a protein in vagal ganglia neurons, but not airway epithelium or smooth muscle. We induced AHR by sensitizing mice to ovalbumin and found that ASIC1a-/- mice failed to exhibit AHR despite a robust inflammatory response. Loss of ASIC1a also decreased bronchoalveolar lavage fluid levels of substance P, a sensory neuropeptide secreted from vagal sensory neurons that contributes to AHR. These findings suggest that ASIC1a is an important mediator of AHR and raise the possibility that inhibiting ASIC channels might be beneficial in asthma. PMID:27820848
Onboard calibration circuit for the DAMPE BGO calorimeter front-end electronics
NASA Astrophysics Data System (ADS)
Zhang, De-Liang; Feng, Chang-Qing; Zhang, Jun-Bin; Wang, Qi; Ma, Si-Yuan; Shen, Zhong-Tao; Jiang, Di; Gao, Shan-Shan; Zhang, Yun-Long; Guo, Jian-Hua; Liu, Shu-Bin; An, Qi
2016-05-01
DAMPE (DArk Matter Particle Explorer) is a scientific satellite which is mainly aimed at indirectly searching for dark matter in space. One critical sub-detector of the DAMPE payload is the BGO (bismuth germanium oxide) calorimeter, which contains 1848 PMT (photomultiplier tube) dynodes and 16 FEE (Front-End Electronics) boards. VA160 and VATA160, two 32-channel low power ASICs (Application Specific Integrated Circuits), are adopted as the key components on the FEEs to perform charge measurement for the PMT signals. In order to monitor the parameter drift which may be caused by temperature variation, aging, or other environmental factors, an onboard calibration circuit is designed for the VA160 and VATA160 ASICs. It is mainly composed of a 12-bit DAC (Digital to Analog Converter), an operational amplifier and an analog switch. Test results showed that a dynamic range of 0-30 pC with a precision of 5 fC (Root Meam Square, RMS) was achieved, which covers the VA160’s input range. It can be used to compensate for the temperature drift and test the trigger function of the FEEs. The calibration circuit has been implemented for the front-end electronics of the BGO Calorimeter and verified by all the environmental tests for both Qualification Model and Flight Model of DAMPE. The DAMPE satellite was launched at the end of 2015 and the calibration circuit will operate periodically in space. Supported by Strategic Priority Research Program on Space Science of Chinese Academy of Sciences (XDA04040202-4), and National Basic Research Program (973 Program) of China (2010CB833002) and National Natural Science Foundation of China (11273070)
Acid-sensing ion channels in mouse olfactory bulb M/T neurons
Li, Ming-Hua; Liu, Selina Qiuying; Inoue, Koichi; Lan, Jinquan; Simon, Roger P.
2014-01-01
The olfactory bulb contains the first synaptic relay in the olfactory pathway, the sensory system in which odorants are detected enabling these chemical stimuli to be transformed into electrical signals and, ultimately, the perception of odor. Acid-sensing ion channels (ASICs), a family of proton-gated cation channels, are widely expressed in neurons of the central nervous system. However, no direct electrophysiological and pharmacological characterizations of ASICs in olfactory bulb neurons have been described. Using a combination of whole-cell patch-clamp recordings and biochemical and molecular biological analyses, we demonstrated that functional ASICs exist in mouse olfactory bulb mitral/tufted (M/T) neurons and mainly consist of homomeric ASIC1a and heteromeric ASIC1a/2a channels. ASIC activation depolarized cultured M/T neurons and increased their intracellular calcium concentration. Thus, ASIC activation may play an important role in normal olfactory function. PMID:24821964
Acid-sensing ion channels: trafficking and synaptic function.
Zha, Xiang-ming
2013-01-02
Extracellular acidification occurs in the brain with elevated neural activity, increased metabolism, and neuronal injury. This reduction in pH can have profound effects on brain function because pH regulates essentially every single biochemical reaction. Therefore, it is not surprising to see that Nature evolves a family of proteins, the acid-sensing ion channels (ASICs), to sense extracellular pH reduction. ASICs are proton-gated cation channels that are mainly expressed in the nervous system. In recent years, a growing body of literature has shown that acidosis, through activating ASICs, contributes to multiple diseases, including ischemia, multiple sclerosis, and seizures. In addition, ASICs play a key role in fear and anxiety related psychiatric disorders. Several recent reviews have summarized the importance and therapeutic potential of ASICs in neurological diseases, as well as the structure-function relationship of ASICs. However, there is little focused coverage on either the basic biology of ASICs or their contribution to neural plasticity. This review will center on these topics, with an emphasis on the synaptic role of ASICs and molecular mechanisms regulating the spatial distribution and function of these ion channels.
First results of the silicon telescope using an 'artificial retina' for fast track finding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Neri, N.; Abba, A.; Caponio, F.
We present the first results of the prototype of a silicon tracker with trigger capabilities based on a novel approach for fast track finding. The working principle of the 'artificial retina' is inspired by the processing of visual images by the brain and it is based on extensive parallelization of data distribution and pattern recognition. The algorithm has been implemented in commercial FPGAs in three main logic modules: a switch for the routing of the detector hits, a pool of engines for the digital processing of the hits, and a block for the calculation of the track parameters. The architecturemore » is fully pipelined and allows the reconstruction of real-time tracks with a latency less then 100 clock cycles, corresponding to 0.25 microsecond at 400 MHz clock. The silicon telescope consists of 8 layers of single-sided silicon strip detectors with 512 strips each. The detector size is about 10 cm x 10 cm and the strip pitch is 183 μm. The detectors are read out by the Beetle chip, a custom ASICs developed for LHCb, which provides the measurement of the hit position and pulse height of 128 channels. The 'artificial retina' algorithm has been implemented on custom data acquisition boards based on FPGAs Xilinx Kintex 7 lx160. The parameters of the tracks detected are finally transferred to host PC via USB 3.0. The boards manage the read-out ASICs and the sampling of the analog channels. The read-out is performed at 40 MHz on 4 channels for each ASIC that corresponds to a decoding of the telescope information at 1.1 MHz. We report on the first results of the fast tracking device and compare with simulations. (authors)« less
Role of ASIC1a in Aβ-induced synaptic alterations in the hippocampus.
Mango, D; Nisticò, R
2018-05-01
Acid-sensing ion channels (ASICs) are widely expressed in the mammalian central nervous system where they play a key role in synaptic transmission and in specific forms of memory. On the other hand, ASICs can be persistently active under pathological conditions contributing to neuronal damage in ischemic stroke, brain trauma, epilepsy and Parkinson's disease. However, to date no experimental evidence has linked ASICs to Alzheimer's disease (AD). Aim of the present work was to investigate, in CA1 pyramidal neurons, the possible involvement of ASIC1a in the Aβ-mediated effect on metabotropic glutamate (mGlu) receptor dependent transmission. We found that, in slices pretreated with Aβ, the pharmacological blockade of ASIC1a restored the increased intrinsic excitability following group I mGlu receptor activation. This suggests that, under certain conditions, ASIC1a might further contribute to the Aβ-related depolarizing response. We have recently demonstrated that ASIC1a is also involved long-term depression (LTD) induced either by low-frequency stimulation or by application of the group I mGlu receptor agonist DHPG. Here, we have shown that psalmotoxin-1, a selective blocker of ASIC1a, rescued the DHPG-LTD facilitation associated with genetic and non-genetic models of AD. Overall, these results suggest that a functional coupling between ASIC1a and mGlu receptors occurs and might contribute to the synaptic alterations associated with AD. Copyright © 2018 Elsevier Ltd. All rights reserved.
The role of periodontal ASIC3 in orofacial pain induced by experimental tooth movement in rats.
Gao, Meiya; Long, Hu; Ma, Wenqiang; Liao, Lina; Yang, Xin; Zhou, Yang; Shan, Di; Huang, Renhuan; Jian, Fan; Wang, Yan; Lai, Wenli
2016-12-01
This study aimed to clarify the roles of Acid-sensing ion channel 3 (ASIC3) in orofacial pain following experimental tooth movement. Sixty male Sprague-Dawley rats were divided into the experimental group (40g, n = 30) and the sham group (0g, n = 30). Closed coil springs were ligated between maxillary incisor and molars to achieve experimental tooth movement. Rat grimace scale (RGS) scores were assessed at 0, 1, 3, 5, 7, and 14 days after the placement of the springs. ASIC3 immunostaining was performed and the expression levels of ASIC3 were measured through integrated optical density/area in Image-Pro Plus 6.0. Moreover, 18 rats were divided into APETx2 group (n = 6), amiloride group (n = 6), and vehicle group (n = 6), and RGS scores were obtained compared among them to verify the roles of ASIC3 in orofacial pain following tooth movement. ASIC3 expression levels became significantly higher in the experimental group than in sham group on 1, 3, and 5 days and became similar on 7 and 14 days. Pain levels (RGS scores) increased in both groups and were significantly higher in the experimental group on 1, 3, 5, and 7 days and were similar on 14 days. Periodontal ASIC3 expression levels were correlated with orofacial pain levels following experimental tooth movement. Periodontal administrations of ASIC3 antagonists (APETx2 and amiloride) could alleviate pain. This study needs to be better evidenced by RNA interference of ASIC3 in periodontal tissues in rats following experimental tooth movement. Moreover, we hope further studies would concentrate on the pain perception of ASIC3 knockout (ASIC3 -/- ) mice. Our results suggest that periodontal ASIC3 plays an important role in orofacial pain induced by experimental tooth movement. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.
ANALOG I/O MODULE TEST SYSTEM BASED ON EPICS CA PROTOCOL AND ACTIVEX CA INTERFACE
DOE Office of Scientific and Technical Information (OSTI.GOV)
YENG,YHOFF,L.
2003-10-13
Analog input (ADC) and output (DAC) modules play a substantial role in device level control of accelerator and large experiment physics control system. In order to get the best performance some features of analog modules including linearity, accuracy, crosstalk, thermal drift and so on have to be evaluated during the preliminary design phase. Gain and offset error calibration and thermal drift compensation (if needed) may have to be done in the implementation phase as well. A natural technique for performing these tasks is to interface the analog VO modules and GPIB interface programmable test instruments with a computer, which canmore » complete measurements or calibration automatically. A difficulty is that drivers of analog modules and test instruments usually work on totally different platforms (vxworks VS Windows). Developing new test routines and drivers for testing instruments under VxWorks (or any other RTOS) platform is not a good solution because such systems have relatively poor user interface and developing such software requires substantial effort. EPICS CA protocol and ActiveX CA interface provide another choice, a PC and LabVIEW based test system. Analog 110 module can be interfaced from LabVIEW test routines via ActiveX CA interface. Test instruments can be controlled via LabVIEW drivers, most of which are provided by instrument vendors or by National Instruments. Labview also provides extensive data analysis and process functions. Using these functions, users can generate powerful test routines very easily. Several applications built for Spallation Neutron Source (SNS) Beam Loss Monitor (BLM) system are described in this paper.« less
Wideband pulse amplifiers for the NECTAr chip
NASA Astrophysics Data System (ADS)
Sanuy, A.; Delagnes, E.; Gascon, D.; Sieiro, X.; Bolmont, J.; Corona, P.; Feinstein, F.; Glicenstein, J.-F.; Naumann, C. L.; Nayman, P.; Ribó, M.; Tavernet, J.-P.; Toussenel, F.; Vincent, P.; Vorobiov, S.
2012-12-01
The NECTAr collaboration's FE option for the camera of the CTA is a 16 bits and 1-3 GS/s sampling chip based on analog memories including most of the readout functions. This works describes the input amplifiers of the NECTAr ASIC. A fully differential wideband amplifier, with voltage gain up to 20 V/V and a BW of 400 MHz. As it is impossible to design a fully differential OpAmp with an 8 GHz GBW product in a 0.35 CMOS technology, an alternative implementation based on HF linearized transconductors is explored. The output buffer is a class AB miller operational amplifier, with special non-linear current boost.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jeggle, Pia; Smith, Ewan St. J.; Stewart, Andrew P.
ASIC and ENaC are co-expressed in various cell types, and there is evidence for a close association between them. Here, we used atomic force microscopy (AFM) to determine whether ASIC1a and ENaC subunits are able to form cross-clade hybrid ion channels. ASIC1a and ENaC could be co-isolated from detergent extracts of tsA 201 cells co-expressing the two subunits. Isolated proteins were incubated with antibodies against ENaC and Fab fragments against ASIC1a. AFM imaging revealed proteins that were decorated by both an antibody and a Fab fragment with an angle of ∼120° between them, indicating the formation of ASIC1a/ENaC heterotrimers. -more » Highlights: • There is evidence for a close association between ASIC and ENaC. • We used AFM to test whether ASIC1a and ENaC subunits form cross-clade ion channels. • Isolated proteins were incubated with subunit-specific antibodies and Fab fragments. • Some proteins were doubly decorated at ∼120° by an antibody and a Fab fragment. • Our results indicate the formation of ASIC1a/ENaC heterotrimers.« less
A comparative study of the time performance between NINO and FlexToT ASICs
NASA Astrophysics Data System (ADS)
Sarasola, I.; Nemallapudi, M. V.; Gundacker, S.; Sánchez, D.; Gascón, D.; Rato, P.; Marín, J.; Auffray, E.
2017-04-01
Universitat de Barcelona (UB) and CIEMAT have designed the FlexToT ASIC for the front-end readout of SiPM-based scintillator detectors. This ASIC is aimed at time of flight (ToF) positron emission tomography (PET) applications. In this work we have evaluated the time performance of the FlexToT v2 ASIC compared to the NINO ASIC, a fast ASIC developped at CERN. NINO electronics give 64 ps sigma for single-photon time resolution (SPTR) and 93 ps FWHM for coincidence time resolution (CTR) with 2 × 2 × 5 mm3 LSO:Ce,Ca crystals and S13360-3050CS SiPMs. Using the same SiPMs and crystals, the FlexToT v2 ASIC yields 91 ps sigma for SPTR and 123 ps FWHM for CTR. Despite worse time performace than NINO, FlexToT v2 features lower power consumption (11 vs. 27 mW/ch) and linear ToT energy measurement.
Li, X; Ye, J-X; Xu, M-H; Zhao, M-D; Yuan, F-L
2017-07-01
Activated acid-sensing ion channel 1a (ASIC1a) is involved in acid-induced osteoclastogenesis by regulating activation of the transcription factor NFATc1. These results indicated that ASIC1a activation by extracellular acid may cause osteoclast migration and adhesion through Ca 2+ -dependent integrin/Pyk2/Src signaling pathway. Osteoclast adhesion and migration are responsible for osteoporotic bone loss. Acidic conditions promote osteoclastogenesis. ASIC1a in osteoclasts is associated with acid-induced osteoclastogenesis through modulating transcription factor NFATc1 activation. However, the influence and the detailed mechanism of ASIC1a in regulating osteoclast adhesion and migration, in response to extracellular acid, are not well characterized. In this study, knockdown of ASIC1a was achieved in bone marrow macrophage cells using small interfering RNA (siRNA). The adhesion and migration abilities of osteoclast precursors and osteoclasts were determined by adhesion and migration assays, in vitro. Bone resorption was performed to measure osteoclast function. Cytoskeletal changes were assessed by F-actin ring formation. αvβ3 integrin expression in osteoclasts was measured by flow cytometry. Western blotting and co-immunoprecipitation were performed to measure alterations in integrin/Pyk2/Src signaling pathway. Our results showed that blockade of ASIC1a using ASIC1a-siRNA inhibited acid-induced osteoclast precursor migration and adhesion, as well as osteoclast adhesion and bone resorption; we also demonstrated that inhibition of ASIC1a decreased the cell surface αvβ3 integrin and β3 protein expression. Moreover, blocking of ASIC1a inhibited acidosis-induced actin ring formation and reduced Pyk2 and Src phosphorylation in osteoclasts and also inhibited the acid-induced association of the αvβ3 integrin/Src/Pyk2. Together, these results highlight a key functional role of ASIC1a/αvβ3 integrin/Pyk2/Src signaling pathway in migration and adhesion of osteoclasts.
GSFC Cutting Edge Avionics Technologies for Spacecraft
NASA Technical Reports Server (NTRS)
Luers, Philip J.; Culver, Harry L.; Plante, Jeannette
1998-01-01
With the launch of NASA's first fiber optic bus on SAMPEX in 1992, GSFC has ushered in an era of new technology development and insertion into flight programs. Predating such programs the Lewis and Clark missions and the New Millenium Program, GSFC has spearheaded the drive to use cutting edge technologies on spacecraft for three reasons: to enable next generation Space and Earth Science, to shorten spacecraft development schedules, and to reduce the cost of NASA missions. The technologies developed have addressed three focus areas: standard interface components, high performance processing, and high-density packaging techniques enabling lower cost systems. To realize the benefits of standard interface components GSFC has developed and utilized radiation hardened/tolerant devices such as PCI target ASICs, Parallel Fiber Optic Data Bus terminals, MIL-STD-1773 and AS1773 transceivers, and Essential Services Node. High performance processing has been the focus of the Mongoose I and Mongoose V rad-hard 32-bit processor programs as well as the SMEX-Lite Computation Hub. High-density packaging techniques have resulted in 3-D stack DRAM packages and Chip-On-Board processes. Lower cost systems have been demonstrated by judiciously using all of our technology developments to enable "plug and play" scalable architectures. The paper will present a survey of development and insertion experiences for the above technologies, as well as future plans to enable more "better, faster, cheaper" spacecraft. Details of ongoing GSFC programs such as Ultra-Low Power electronics, Rad-Hard FPGAs, PCI master ASICs, and Next Generation Mongoose processors.
Xie, Zhi-Yang; Chen, Lu; Zhang, Cong; Liu, Lei; Wang, Feng; Cai, Feng; Wang, Xiao-Hu; Shi, Rui; Sinkemani, Arjun; Yu, Hao-Min; Hong, Xin; Wu, Xiao-Tao
2018-01-01
Acid-sensing ion channel 1a (ASIC1a) participates in human intervertebral disc degeneration (IVDD) and regulates the destiny of nucleus pulposus cells (NPCs) in acid stimulus. However, the mechanism of ASIC1a activation and its downstream pathway remain unclear. Endoplasmic reticulum (ER) stress also participates in the acid-induced apoptosis of NPCs. The main purpose of this study was to investigate whether there is any connection between ASIC1a and ER stress in an acid-induced nucleus pulposus degeneration model. The IVDs of Sprague-Dawley rats were stained by immunohistochemical staining to evaluate the expression of ASIC1a in normal and degenerated rat nucleus pulposus. ASIC1a expression was also quantified by quantitative real-time-polymerase chain reaction and Western blotting analysis. NPCs were exposed to the culture media with acidity at pH 7.2 and 6.5 for 24 h, with or without 4-phenylbutyrate (4-PBA, a blocker of the ER stress pathway). Cell apoptosis was examined by Annexin V/Propidium Iodide (PI) staining and was quantified using flow cytometry analysis. ASIC1a-mediated intracellular calcium was determined by Ca 2+ imaging using Fura-2-AM. Acidity-induced changes in ER stress markers were studied using Western blotting analysis. In vivo , ASIC1a expression was upregulated in natural degeneration. In vitro , acid stimulus increased intracellular calcium levels, but this effect was blocked by knockdown of ASIC1a, and this reversal was partly inhibited by 4-PBA. In addition, blockade of ASIC1a reduced expression of ER stress markers, especially the proapoptotic markers. ASIC1a partly regulates ER stress and promotes apoptosis of NPCs under acid stimulus and may be a novel therapeutic target in IVDD.
Acute stress enhances learning and memory by activating acid-sensing ion channels in rats.
Ye, Shunjie; Yang, Rong; Xiong, Qiuju; Yang, Youhua; Zhou, Lianying; Gong, Yeli; Li, Changlei; Ding, Zhenhan; Ye, Guohai; Xiong, Zhe
2018-04-15
Acute stress has been shown to enhance learning and memory ability, predominantly through the action of corticosteroid stress hormones. However, the valuable targets for promoting learning and memory induced by acute stress and the underlying molecular mechanisms remain unclear. Acid-sensing ion channels (ASICs) play an important role in central neuronal systems and involves in depression, synaptic plasticity and learning and memory. In the current study, we used a combination of electrophysiological and behavioral approaches in an effort to explore the effects of acute stress on ASICs. We found that corticosterone (CORT) induced by acute stress caused a potentiation of ASICs current via glucocorticoid receptors (GRs) not mineralocorticoid receptors (MRs). Meanwhile, CORT did not produce an increase of ASICs current by pretreated with GF109203X, an antagonist of protein kinase C (PKC), whereas CORT did result in a markedly enhancement of ASICs current by bryostatin 1, an agonist of PKC, suggesting that potentiation of ASICs function may be depended on PKC activating. More importantly, an antagonist of ASICs, amiloride (10 μM) reduced the performance of learning and memory induced by acute stress, which is further suggesting that ASICs as the key components involves in cognitive processes induced by acute stress. These results indicate that acute stress causes the enhancement of ASICs function by activating PKC signaling pathway, which leads to potentiated learning and memory. Copyright © 2018 Elsevier Inc. All rights reserved.
Correlations between properties and applications of the CVD amorphous silicon carbide films
NASA Astrophysics Data System (ADS)
Kleps, Irina; Angelescu, Anca
2001-12-01
The aim of this paper is to emphasise the correlation between film preparation conditions, film properties and their applications. Low pressure chemical vapour deposition amorphous silicon carbide (a-SiC) and silicon carbonitride (SiCN) films obtained from liquid precursors have different structure and composition depending on deposition conditions. Thus, the films deposited under kinetic working conditions reveal a stable structure and composition. Deposition at moderate temperature leads to stoichiometric SiC, while the films deposited at high temperatures have a composition closer to Si 1- xC x, with x=0.75. These films form a very reactive interface with metallic layers. The films realised under kinetic working regime can be used in Si membrane fabrication process or as coating films for field emission applications. SiC layers field emission properties were investigated; the field emission current density of the a-SiC/Si structures was 2.4 mA/cm 2 at 25 V/μm. An Si membrane technology based on moderate temperatures (770-850 °C) a-SiC etching mask is presented.
SCOC3: A Brand New Heart for Space Mission
NASA Astrophysics Data System (ADS)
Poupat, Jean-Luc; Lefevre, Aurelien
2012-08-01
Satellites are controlled via a platform On Board Computer (OBC) that manages different parameters (attitude, orbit, modes, temperatures ...) with respect to its payload mission (telecommunication, earth observation, scientific mission). The platform OBC is connected to the satellite and the ground control via digital links, and executes on board software.The main functions of a platform OBC are to provide the satellite flight segment with the following features: o Processing resources for the flight mission softwareo TM/TC services and interfaces with the RF communication chaino General communication services with the Avionics and payload equipments through on- board communication buso Time synchronization and distributiono Failure tolerant architecture based on the use of redounded reconfiguration units and redundancy implementationIn order to reach an ultimate level of integration, Astrium has designed an ASIC gathering on a single chip all these required digital functions: the SCOC3 ASIC.This paper presents in a first part the major innovations introduced by Astrium for SCOC3, in a second part the development tools associated to SCOC3, and in a third part the status concerning its commercialization.
Bhaumik, Basabi
2016-01-01
A novel algorithm based on forward search is developed for real-time electrocardiogram (ECG) signal processing and implemented in application specific integrated circuit (ASIC) for QRS complex related cardiovascular disease diagnosis. The authors have evaluated their algorithm using MIT-BIH database and achieve sensitivity of 99.86% and specificity of 99.93% for QRS complex peak detection. In this Letter, Physionet PTB diagnostic ECG database is used for QRS complex related disease detection. An ASIC for cardiovascular disease detection is fabricated using 130-nm CMOS high-speed process technology. The area of the ASIC is 0.5 mm2. The power dissipation is 1.73 μW at the operating frequency of 1 kHz with a supply voltage of 0.6 V. The output from the ASIC is fed to their Android application that generates diagnostic report and can be sent to a cardiologist through email. Their ASIC result shows average failed detection rate of 0.16% for six leads data of 290 patients in PTB diagnostic ECG database. They also have implemented a low-leakage version of their ASIC. The ASIC dissipates only 45 pJ with a supply voltage of 0.9 V. Their proposed ASIC is most suitable for energy efficient telemetry cardiovascular disease detection system. PMID:27284458
Jain, Sanjeev Kumar; Bhaumik, Basabi
2016-03-01
A novel algorithm based on forward search is developed for real-time electrocardiogram (ECG) signal processing and implemented in application specific integrated circuit (ASIC) for QRS complex related cardiovascular disease diagnosis. The authors have evaluated their algorithm using MIT-BIH database and achieve sensitivity of 99.86% and specificity of 99.93% for QRS complex peak detection. In this Letter, Physionet PTB diagnostic ECG database is used for QRS complex related disease detection. An ASIC for cardiovascular disease detection is fabricated using 130-nm CMOS high-speed process technology. The area of the ASIC is 0.5 mm(2). The power dissipation is 1.73 μW at the operating frequency of 1 kHz with a supply voltage of 0.6 V. The output from the ASIC is fed to their Android application that generates diagnostic report and can be sent to a cardiologist through email. Their ASIC result shows average failed detection rate of 0.16% for six leads data of 290 patients in PTB diagnostic ECG database. They also have implemented a low-leakage version of their ASIC. The ASIC dissipates only 45 pJ with a supply voltage of 0.9 V. Their proposed ASIC is most suitable for energy efficient telemetry cardiovascular disease detection system.
NASA Astrophysics Data System (ADS)
Deng, B.; Xiao, L.; Zhao, X.; Baker, E.; Gong, D.; Guo, D.; He, H.; Hou, S.; Liu, C.; Liu, T.; Sun, Q.; Thomas, J.; Wang, J.; Xiang, A. C.; Yang, D.; Ye, J.; Zhou, W.
2018-05-01
Two optical data link data transmission Application Specific Integrated Circuits (ASICs), the baseline and its backup, have been designed for the ATLAS Liquid Argon (LAr) Calorimeter Phase-I trigger upgrade. The latency of each ASIC and that of its corresponding receiver implemented in a back-end Field-Programmable Gate Array (FPGA) are critical specifications. In this paper, we present the latency measurements and simulation of two ASICs. The measurement results indicate that both ASICs achieve their design goals and meet the latency specifications. The consistency between the simulation and measurements validates the ASIC latency characterization.
BacNet and Analog/Digital Interfaces of the Building Controls Virtual Testbed
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nouidui, Thierry Stephane; Wetter, Michael; Li, Zhengwei
2011-11-01
This paper gives an overview of recent developments in the Building Controls Virtual Test Bed (BCVTB), a framework for co-simulation and hardware-in-the-loop. First, a general overview of the BCVTB is presented. Second, we describe the BACnet interface, a link which has been implemented to couple BACnet devices to the BCVTB. We present a case study where the interface was used to couple a whole building simulation program to a building control system to assess in real-time the performance of a real building. Third, we present the ADInterfaceMCC, an analog/digital interface that allows a USB-based analog/digital converter to be linked tomore » the BCVTB. In a case study, we show how the link was used to couple the analog/digital converter to a building simulation model for local loop control.« less
Blaettler, M; Bruegger, A; Forster, I C; Lehareinger, Y
1988-03-01
The design of an analog interface to a digital audio signal processor (DASP)-video cassette recorder (VCR) system is described. The complete system represents a low-cost alternative to both FM instrumentation tape recorders and multi-channel chart recorders. The interface or DASP input-output unit described in this paper enables the recording and playback of up to 12 analog channels with a maximum of 12 bit resolution and a bandwidth of 2 kHz per channel. Internal control and timing in the recording component of the interface is performed using ROMs which can be reprogrammed to suit different analog-to-digital converter hardware. Improvement in the bandwidth specifications is possible by connecting channels in parallel. A parallel 16 bit data output port is provided for direct transfer of the digitized data to a computer.
An Energy Efficient ECG Signal Processor Detecting Cardiovascular Diseases on Smartphone.
Jain, Sanjeev Kumar; Bhaumik, Basabi
2017-04-01
A novel disease diagnostic algorithm for ECG signal processing based on forward search is implemented in Application Specific Integrated Circuit (ASIC) for cardiovascular disease diagnosis on smartphone. An ASIC is fabricated using 130-nm CMOS low leakage process technology. The area of our PQRST ASIC is 1.21 mm 2 . The energy dissipation of PQRST ASIC is 96 pJ with a supply voltage of 0.9 V. The outputs from the ASIC are fed to an Android application that generates diagnostic report and can be sent to a cardiologist via email. The ASIC and Android application are verified for the detection of bundle branch block, hypertrophy, arrhythmia and myocardial infarction using Physionet PTB diagnostic ECG database. The failed detection rate is 0.69%, 0.69%, 0.34% and 1.72% for bundle branch block, hypertrophy, arrhythmia and myocardial infarction respectively. The AV block is detected in all the three patients in the Physionet St. Petersburg arrhythmia database. Our proposed ASIC together with our Android application is the most suitable for an energy efficient wearable cardiovascular disease detection system.
Tao Tang; Wang Ling Goh; Lei Yao; Jia Hao Cheong; Yuan Gao
2017-07-01
This paper describes an integrated multichannel neural recording analog front end (AFE) with a novel area-efficient driven right leg (DRL) circuit to improve the system common mode rejection ratio (CMRR). The proposed AFE consists of an AC-coupled low-noise programmable-gain amplifier, an area-efficient DRL block and a 10-bit SAR ADC. Compared to conventional DRL circuit, the proposed capacitor-less DRL design achieves 90% chip area reduction with enhanced CMRR performance, making it ideal for multichannel biomedical recording applications. The AFE circuit has been designed in a standard 0.18-μm CMOS process. Post-layout simulation results show that the AFE provides two gain settings of 54dB/60dB while consuming 1 μA per channel under a supply voltage of 1 V. The input-referred noise of the AFE integrated from 1 Hz to 10k Hz is only 4 μVrms and the CMRR is 110 dB.
NASA Astrophysics Data System (ADS)
Deng, Zhi; He, Li; Liu, Feng; Liu, Yinong; Xue, Tao; Li, Yulan; Yue, Qian
2017-05-01
The paper presents the developments of two cryogenic readout ASICs for the point-contact HPGe detectors for dark matter search and neutrino experiments. Extremely low noise readout electronics were demanded and the capability of working at cryogenic temperatures may bring great advantages. The first ASIC was a monolithic CMOS charge sensitive preamplifier with its noise optimized for ∼1 pF input capacitance. The second ASIC was a waveform recorder based on switched capacitor array. These two ASICs were fabricated in CMOS 350 nm and 180 nm processes respectively. The prototype chips were tested and showed promising results. Both ASICs worked well at low temperature. The preamplifier had achieved ENC of 10.3 electrons with 0.7 pF input capacitance and the SCA chip could run at 9 bit effective resolution and 25 MSPS sampling rate.
A Differential Monolithically Integrated Inductive Linear Displacement Measurement Microsystem
Podhraški, Matija; Trontelj, Janez
2016-01-01
An inductive linear displacement measurement microsystem realized as a monolithic Application-Specific Integrated Circuit (ASIC) is presented. The system comprises integrated microtransformers as sensing elements, and analog front-end electronics for signal processing and demodulation, both jointly fabricated in a conventional commercially available four-metal 350-nm CMOS process. The key novelty of the presented system is its full integration, straightforward fabrication, and ease of application, requiring no external light or magnetic field source. Such systems therefore have the possibility of substituting certain conventional position encoder types. The microtransformers are excited by an AC signal in MHz range. The displacement information is modulated into the AC signal by a metal grating scale placed over the microsystem, employing a differential measurement principle. Homodyne mixing is used for the demodulation of the scale displacement information, returned by the ASIC as a DC signal in two quadrature channels allowing the determination of linear position of the target scale. The microsystem design, simulations, and characterization are presented. Various system operating conditions such as frequency, phase, target scale material and distance have been experimentally evaluated. The best results have been achieved at 4 MHz, demonstrating a linear resolution of 20 µm with steel and copper scale, having respective sensitivities of 0.71 V/mm and 0.99 V/mm. PMID:26999146
A Differential Monolithically Integrated Inductive Linear Displacement Measurement Microsystem.
Podhraški, Matija; Trontelj, Janez
2016-03-17
An inductive linear displacement measurement microsystem realized as a monolithic Application-Specific Integrated Circuit (ASIC) is presented. The system comprises integrated microtransformers as sensing elements, and analog front-end electronics for signal processing and demodulation, both jointly fabricated in a conventional commercially available four-metal 350-nm CMOS process. The key novelty of the presented system is its full integration, straightforward fabrication, and ease of application, requiring no external light or magnetic field source. Such systems therefore have the possibility of substituting certain conventional position encoder types. The microtransformers are excited by an AC signal in MHz range. The displacement information is modulated into the AC signal by a metal grating scale placed over the microsystem, employing a differential measurement principle. Homodyne mixing is used for the demodulation of the scale displacement information, returned by the ASIC as a DC signal in two quadrature channels allowing the determination of linear position of the target scale. The microsystem design, simulations, and characterization are presented. Various system operating conditions such as frequency, phase, target scale material and distance have been experimentally evaluated. The best results have been achieved at 4 MHz, demonstrating a linear resolution of 20 µm with steel and copper scale, having respective sensitivities of 0.71 V/mm and 0.99 V/mm.
PFM2: a 32 × 32 processor for X-ray diffraction imaging at FELs
NASA Astrophysics Data System (ADS)
Manghisoni, M.; Fabris, L.; Re, V.; Traversi, G.; Ratti, L.; Grassi, M.; Lodola, L.; Malcovati, P.; Vacchi, C.; Pancheri, L.; Benkechcache, M. E. A.; Dalla Betta, G.-F.; Xu, H.; Verzellesi, G.; Ronchin, S.; Boscardin, M.; Batignani, G.; Bettarini, S.; Casarosa, G.; Forti, F.; Giorgi, M.; Paladino, A.; Paoloni, E.; Rizzo, G.; Morsani, F.
2016-11-01
This work is concerned with the design of a readout chip for application to experiments at the next generation X-ray Free Electron Lasers (FEL). The ASIC, named PixFEL Matrix (PFM2), has been designed in a 65 nm CMOS technology and consists of 32 × 32 pixels. Each cell covers an area of 110 × 110 μm2 and includes a low-noise charge sensitive amplifier (CSA) with dynamic signal compression, a time-variant shaper used to process the preamplifier output signal, a 10-bit successive approximation register (SAR) analog-to-digital converter (ADC) and digital circuitry for channel control and data readout. Two different solutions for the readout channel, based on different versions of the time-variant filter, have been integrated in the chip. Both solutions can be operated in such a way to cope with the high frame rate (exceeding 1 MHz) foreseen for future X-ray FEL machines. The ASIC will be bump bonded to a slim/active edge pixel sensor to form the first demonstrator for the PixFEL X-ray imager. This work has been carried out in the frame of the PixFEL project funded by Istituto Nazionale di Fisica Nucleare (INFN), Italy.
OSCAR: A Compact, Powerful and Versatile On Board Computer Based on LEON3 Core
NASA Astrophysics Data System (ADS)
Poupat, Jean-Luc; Lefevre, Aurelien; Koebel, Franck
2011-08-01
Satellites are controlled via a platform On Board Computer (OBC) that manages different parameters (attitude, orbit, modes, temperatures ...) with respect to its payload mission (telecommunication, earth observation, scientific mission). The platform OBC is connected to the satellite and the ground control via digital links, and executes on board software.The main functions of a platform OBC are to provide the satellite flight segment with the following features: o Processing resources for the flight mission software o TM/TC services and interfaces with the RF communication chaino General communication services with the Avionicsand payload equipments through an on-board communication bus based on the MIL-1553B standard or CANo Time synchronization and distributiono Failure tolerant architecture based on the use of redounded reconfiguration units and redundancyimplementationFrom a hardware point of view, it groups a lot of digital functions usually dispatched on numerous chips (processor, co-processor, digital links IP ...) together. In order to reach an ultimate level of integration, Astrium has designed an ASIC gathering on a single chip all the required digital functions: the SCOC3 ASIC.Astrium has developed an OBC based on this SCOC3 ASIC: the OSCAR (Optimized Spacecraft Computer Architecture with Reconfiguration). It is now available off-the-shelf as the new OBC product family of Astrium.This paper presents the major innovations introduced by Astrium for SCOC3 and OSCAR with the objective to save cost and mass through a solution compatible with any class quality project, using a unique software development environment for user.
Boscardin, Emilie; Alijevic, Omar; Hummler, Edith
2016-01-01
Acid‐sensing ion channels (ASICs) and the epithelial Na+ channel (ENaC) are both members of the ENaC/degenerin family of amiloride‐sensitive Na+ channels. ASICs act as proton sensors in the nervous system where they contribute, besides other roles, to fear behaviour, learning and pain sensation. ENaC mediates Na+ reabsorption across epithelia of the distal kidney and colon and of the airways. ENaC is a clinically used drug target in the context of hypertension and cystic fibrosis, while ASIC is an interesting potential target. Following a brief introduction, here we will review selected aspects of ASIC and ENaC function. We discuss the origin and nature of pH changes in the brain and the involvement of ASICs in synaptic signalling. We expose how in the peripheral nervous system, ASICs cover together with other ion channels a wide pH range as proton sensors. We introduce the mechanisms of aldosterone‐dependent ENaC regulation and the evidence for an aldosterone‐independent control of ENaC activity, such as regulation by dietary K+. We then provide an overview of the regulation of ENaC by proteases, a topic of increasing interest over the past few years. In spite of the profound differences in the physiological and pathological roles of ASICs and ENaC, these channels share many basic functional and structural properties. It is likely that further research will identify physiological contexts in which ASICs and ENaC have similar or overlapping roles. PMID:27278329
Protons are a neurotransmitter that regulates synaptic plasticity in the lateral amygdala.
Du, Jianyang; Reznikov, Leah R; Price, Margaret P; Zha, Xiang-ming; Lu, Yuan; Moninger, Thomas O; Wemmie, John A; Welsh, Michael J
2014-06-17
Stimulating presynaptic terminals can increase the proton concentration in synapses. Potential receptors for protons are acid-sensing ion channels (ASICs), Na(+)- and Ca(2+)-permeable channels that are activated by extracellular acidosis. Those observations suggest that protons might be a neurotransmitter. We found that presynaptic stimulation transiently reduced extracellular pH in the amygdala. The protons activated ASICs in lateral amygdala pyramidal neurons, generating excitatory postsynaptic currents. Moreover, both protons and ASICs were required for synaptic plasticity in lateral amygdala neurons. The results identify protons as a neurotransmitter, and they establish ASICs as the postsynaptic receptor. They also indicate that protons and ASICs are a neurotransmitter/receptor pair critical for amygdala-dependent learning and memory.
The University of Florida's next-generation cryogenic infrared focal plane array controller system
NASA Astrophysics Data System (ADS)
Raines, Steven N.; Boreman, Glenn D.; Eikenberry, Stephen S.; Bandyopadhyay, Reba M.; Quijano, Ismael
2008-07-01
The Infrared Instrumentation Group at the University of Florida has substantial experience building IR focal plane array (FPA) controllers and seamlessly integrating them into the instruments that it builds for 8-meter class observatories, including writing device drivers for UNIX-based computer systems. We report on a design study to investigate implementing an ASIC from Teledyne Imaging Systems (TIS) into our IR FPA controller while simultaneously replacing TIS's interface card with one that eliminates the requirement for a Windows-OS computer within the instrument's control system.
Chen, Chao; Raghunathan, Shreyas B; Yu, Zili; Shabanimotlagh, Maysam; Chen, Zhao; Chang, Zu-yao; Blaak, Sandra; Prins, Christian; Ponte, Jacco; Noothout, Emile; Vos, Hendrik J; Bosch, Johan G; Verweij, Martin D; de Jong, Nico; Pertijs, Michiel A P
2016-01-01
This paper presents the design, fabrication, and experimental evaluation of a prototype lead zirconium titanate (PZT) matrix transducer with an integrated receive ASIC, as a proof of concept for a miniature three-dimensional (3-D) transesophageal echocardiography (TEE) probe. It consists of an array of 9 ×12 piezoelectric elements mounted on the ASIC via an integration scheme that involves direct electrical connections between a bond-pad array on the ASIC and the transducer elements. The ASIC addresses the critical challenge of reducing cable count, and includes front-end amplifiers with adjustable gains and micro-beamformer circuits that locally process and combine echo signals received by the elements of each 3 ×3 subarray. Thus, an order-of-magnitude reduction in the number of receive channels is achieved. Dedicated circuit techniques are employed to meet the strict space and power constraints of TEE probes. The ASIC has been fabricated in a standard 0.18-μm CMOS process and consumes only 0.44 mW/channel. The prototype has been acoustically characterized in a water tank. The ASIC allows the array to be presteered across ±37° while achieving an overall dynamic range of 77 dB. Both the measured characteristics of the individual transducer elements and the performance of the ASIC are in good agreement with expectations, demonstrating the effectiveness of the proposed techniques.
He, Qiu-Lan; Chen, Yuling; Qin, Jian; Mo, Sui-Lin; Wei, Ming; Zhang, Jin-Jun; Li, Mei-Na; Zou, Xue-Nong; Zhou, Shu-Feng; Chen, Xiao-Wu; Sun, Lai-Bao
2012-01-01
Summary Background Osthole (Ost), a natural coumarin derivative, has been shown to inhibit many pro-inflammatory mediators and block voltage-gated Na+ channels. During inflammation, acidosis is an important pain inducer which activates nociceptors by gating depolarizing cationic channels, such as acid-sensing ion channel 3 (ASIC3). The aim of this study was to examine the effects of Ost on nucleus pulposus-evoked nociceptive responses and ASIC3 over-expression in the rat dorsal root ganglion, and to investigate the possible mechanism. Material/Methods Radicular pain was generated with application of nucleus pulposus (NP) to nerve root. Mechanical allodynia was evaluated using von Frey filaments with logarithmically incremental rigidity to calculate the 50% probability thresholds for mechanical paw withdrawal. ASIC3 protein expression in dorsal root ganglions (DRGs) was assessed with Western blot and immunohistochemistry. Membrane potential (MP) shift of DRG neurons induced by ASIC3-sensitive acid (pH6.5) was determined by DiBAC4 (3) fluorescence intensity (F.I.). Results The NP-evoked mechanical hyperalgesia model showed allodynia for 3 weeks, and ASIC3 expression was up-regulated in DRG neurons, reaching peak on Day 7. Epidural administration of Ost induced a remarkable and prolonged antinociceptive effect, accompanied by an inhibition of over-expressed ASIC3 protein and of abnormal shift of MP. Amiloride (Ami), an antagonist of ASIC3, strengthened the antinociceptive effect of Ost. Conclusions Up-regulation of ASIC3 expression may be associated with NP-evoked mechanical hyperalgesia. A single epidural injection of Ost decreased ASIC3 expression in DGR neurons and the pain in the NP-evoked mechanical hyperalgesia model. Osthole may be of great benefit for preventing chronic pain status often seen in lumbar disc herniation (LDH). PMID:22648244
Komnig, Daniel; Imgrund, Silke; Reich, Arno; Gründer, Stefan; Falkenburger, Björn H
2016-01-01
Inflammation contributes to the death of dopaminergic neurons in Parkinson disease and can be accompanied by acidification of extracellular pH, which may activate acid-sensing ion channels (ASIC). Accordingly, amiloride, a non-selective inhibitor of ASIC, was protective in an acute 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mouse model of Parkinson disease. To complement these findings we determined MPTP toxicity in mice deficient for ASIC1a, the most common ASIC isoform in neurons. MPTP was applied i.p. in doses of 30 mg per kg on five consecutive days. We determined the number of dopaminergic neurons in the substantia nigra, assayed by stereological counting 14 days after the last MPTP injection, the number of Nissl positive neurons in the substantia nigra, and the concentration of catecholamines in the striatum. There was no difference between ASIC1a-deficient mice and wildtype controls. We are therefore not able to confirm that ASIC1a are involved in MPTP toxicity. The difference might relate to the subacute MPTP model we used, which more closely resembles the pathogenesis of Parkinson disease, or to further targets of amiloride.
Protons are a neurotransmitter that regulates synaptic plasticity in the lateral amygdala
Du, Jianyang; Reznikov, Leah R.; Price, Margaret P.; Zha, Xiang-ming; Lu, Yuan; Moninger, Thomas O.; Wemmie, John A.; Welsh, Michael J.
2014-01-01
Stimulating presynaptic terminals can increase the proton concentration in synapses. Potential receptors for protons are acid-sensing ion channels (ASICs), Na+- and Ca2+-permeable channels that are activated by extracellular acidosis. Those observations suggest that protons might be a neurotransmitter. We found that presynaptic stimulation transiently reduced extracellular pH in the amygdala. The protons activated ASICs in lateral amygdala pyramidal neurons, generating excitatory postsynaptic currents. Moreover, both protons and ASICs were required for synaptic plasticity in lateral amygdala neurons. The results identify protons as a neurotransmitter, and they establish ASICs as the postsynaptic receptor. They also indicate that protons and ASICs are a neurotransmitter/receptor pair critical for amygdala-dependent learning and memory. PMID:24889629
Method and apparatus for data decoding and processing
Hunter, Timothy M.; Levy, Arthur J.
1992-01-01
A system and technique is disclosed for automatically controlling the decoding and digitizaiton of an analog tape. The system includes the use of a tape data format which includes a plurality of digital codes recorded on the analog tape in a predetermined proximity to a period of recorded analog data. The codes associated with each period of analog data include digital identification codes prior to the analog data, a start of data code coincident with the analog data recording, and an end of data code subsequent to the associated period of recorded analog data. The formatted tape is decoded in a processing and digitization system which includes an analog tape player coupled to a digitizer to transmit analog information from the recorded tape over at least one channel to the digitizer. At the same time, the tape player is coupled to a decoder and interface system which detects and decodes the digital codes on the tape corresponding to each period of recorded analog data and controls tape movement and digitizer initiation in response to preprogramed modes. A host computer is also coupled to the decoder and interface system and the digitizer and programmed to initiate specific modes of data decoding through the decoder and interface system including the automatic compilation and storage of digital identification information and digitized data for the period of recorded analog data corresponding to the digital identification data, compilation and storage of selected digitized data representing periods of recorded analog data, and compilation of digital identification information related to each of the periods of recorded analog data.
A High-Performance Deformable Mirror with Integrated Driver ASIC for Space Based Active Optics
NASA Astrophysics Data System (ADS)
Shelton, Chris
Direct imaging of exoplanets is key to fully understanding these systems through spectroscopy and astrometry. The primary impediment to direct imaging of exoplanets is the extremely high brightness ratio between the planet and its parent star. Direct imaging requires a technique for contrast suppression, which include coronagraphs, and nulling interferometers. Deformable mirrors (DMs) are essential to both of these techniques. With space missions in mind, Microscale is developing a novel DM with direct integration of DM and its electronic control functions in a single small envelope. The Application Specific Integrated Circuit (ASIC) is key to the shrinking of the electronic control functions to a size compatible with direct integration with the DM. Through a NASA SBIR project, Microscale, with JPL oversight, has successfully demonstrated a unique deformable mirror (DM) driver ASIC prototype based on an ultra-low power switch architecture. Microscale calls this the Switch-Mode ASIC, or SM-ASIC, and has characterized it for a key set of performance parameters, and has tested its operation with a variety of actuator loads, such as piezo stack and unimorph, and over a wide temperature range. These tests show the SM-ASIC's capability of supporting active optics in correcting aberrations of a telescope in space. Microscale has also developed DMs to go with the SM-ASIC driver. The latest DM version produced uses small piezo stack elements in an 8x8 array, bonded to a novel silicon facesheet structure fabricated monolithically into a polished mirror on one side and mechanical linkage posts that connect to the piezoelectric stack actuators on the other. In this Supporting Technology proposal we propose to further develop the ASIC-DM and have assembled a very capable team to do so. It will be led by JPL, which has considerable expertise with DMs used in Adaptive Optics systems, with high-contrast imaging systems for exoplanet missions, and with designing DM driver electronics. On its part Microscale will continue its design and fabrication of the ASIC-DM combination. Both the SM-ASIC and the DM are currently at a Technology Readiness Level (TRL) of 3; the major goal of the proposed effort is to raise the TRL of the combined system to 4 by scaling up the array formats and by testing, characterizing, and operating multiple generations of the integrated DM-ASIC systems in a laboratory environment. We propose a three year effort, with these tasks: Year 1: Optimize the influence function of an 8x8 DM for active / adaptive optics, by modeling and fabricating different geometric parameters of the facesheet, with its mechanical linkage posts. Fabricate an SM-ASIC and an 8x8 piezo stack DM, and evaluate their performance. Characterize and optimize the integration processes to achieve a driver/DM combination that can support high contrast imaging of exoplanets. Test the control resolution of the ASIC in driving actuators using a commercial interferometer, to ensure the ASIC can command the piezo stack actuator to nanometer levels. The goal, by year three, is control to a small number of picometers; 10-20 pm (surface) may be a practical goal, while 5 pm is the ultimate goal. Year 2: Fabricate 16x16 piezo stack DMs and matching driver ASICS, and repeat Year 1 tasks with the larger format devices. Year 3: Fabricate 32x32 DMs and SM-ASICs, and repeat Year 1 tasks with the larger format devices. Fabricate versions of the 32x32 devices that can be formed into a 2x2 array, to make a composite 64x64 DM/driver. Fabricate such a composite 64x64 DM/ASIC and evaluate its performance.
Drummond, Heather A; Xiang, Lusha; Chade, Alejandro R; Hester, Robert
2017-08-01
Acid-sensing ion channel (ASIC) proteins form extracellular proton-gated, cation-selective channels in neurons and vascular smooth muscle cells and are proposed to act as extracellular proton sensors. However, their importance to vascular responses under conditions associated with extracellular acidosis, such as strenuous exercise, is unclear. Therefore, the purpose of this study was to determine if one ASIC protein, ASIC1a, contributes to extracellular proton-gated vascular responses and exercise tolerance. To determine if ASIC1a contributes to exercise tolerance, we determined peak oxygen (O 2 ) uptake in conscious ASIC1a -/- mice during exhaustive treadmill running. Loss of ASIC1a was associated with a greater peak running speed (60 ± 2 vs. 53 ± 3 m·min -1 , P = 0.049) and peak oxygen (O 2 ) uptake during exhaustive treadmill running (9563 ± 120 vs. 8836 ± 276 mL·kg -1 ·h -1 , n = 6-7, P = 0.0082). There were no differences in absolute or relative lean body mass, as determined by EchoMRI. To determine if ASIC1a contributes to vascular responses during muscle contraction, we measured femoral vascular conductance (FVC) during a stepwise electrical stimulation (0.5-5.0 Hz at 3 V for 60 sec) of the left major hind limb muscles. FVC increased to a greater extent in ASIC1a -/- versus ASIC1a +/+ mice (0.44 ± 0.03 vs. 0.30 ± 0.04 mL·min -1 ·100 g hind limb mass -1 · mmHg -1 , n = 5 each, P = 0.0009). Vasodilation following local application of external protons in the spinotrapezius muscle increased the duration, but not the magnitude, of the vasodilatory response in ASIC1a -/- mice. Finally, we examined hind limb vascular density using micro-CT and found increased density of 0-80 μ m vessels ( P < 0.05). Our findings suggest an increased vascular density and an enhanced vasodilatory response to local protons, to a lesser degree, may contribute to the enhanced vascular conductance and increased peak exercise capacity in ASIC1a -/- mice. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.
Yin, Ming; Li, Hao; Bull, Christopher; Borton, David A; Aceros, Juan; Larson, Lawrence; Nurmikko, Arto V
2013-01-01
In this paper we present a new type of head-mounted wireless neural recording device in a highly compact package, dedicated for untethered laboratory animal research and designed for future mobile human clinical use. The device, which takes its input from an array of intracortical microelectrode arrays (MEA) has ninety-seven broadband parallel neural recording channels and was integrated on to two custom designed printed circuit boards. These house several low power, custom integrated circuits, including a preamplifier ASIC, a controller ASIC, plus two SAR ADCs, a 3-axis accelerometer, a 48MHz clock source, and a Manchester encoder. Another ultralow power RF chip supports an OOK transmitter with the center frequency tunable from 3GHz to 4GHz, mounted on a separate low loss dielectric board together with a 3V LDO, with output fed to a UWB chip antenna. The IC boards were interconnected and packaged in a polyether ether ketone (PEEK) enclosure which is compatible with both animal and human use (e.g. sterilizable). The entire system consumes 17mA from a 1.2Ahr 3.6V Li-SOCl2 1/2AA battery, which operates the device for more than 2 days. The overall system includes a custom RF receiver electronics which are designed to directly interface with any number of commercial (or custom) neural signal processors for multi-channel broadband neural recording. Bench-top measurements and in vivo testing of the device in rhesus macaques are presented to demonstrate the performance of the wireless neural interface.
Integrated circuit cell library
NASA Technical Reports Server (NTRS)
Whitaker, Sterling R. (Inventor); Miles, Lowell H. (Inventor)
2005-01-01
According to the invention, an ASIC cell library for use in creation of custom integrated circuits is disclosed. The ASIC cell library includes some first cells and some second cells. Each of the second cells includes two or more kernel cells. The ASIC cell library is at least 5% comprised of second cells. In various embodiments, the ASIC cell library could be 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more comprised of second cells.
Bérard, P; Bergeron, M; Pepin, C M; Cadorette, J; Tétrault, M-A; Viscogliosi, N; Fontaine, R; Dautet, H; Davies, M; Lecomte, R
2008-07-01
Visualization and quantification of biological processes in mice, the preferred animal model in most preclinical studies, require the best possible spatial resolution in positron emission tomography (PET). A new 64-channel avalanche photodiode (APD) detector module was developed to achieve submillimeter spatial resolution for this purpose. The module consists of dual 4 × 8 APD arrays mounted in a custom ceramic holder. Individual APD pixels having an active area of 1.1 × 1.1 mm2 at a 1.2 mm pitch can be fitted to an 8 × 8 LYSO scintillator block designed to accommodate one-to-one coupling. An analog test board with four 16-channel preamplifier ASICs was designed to be interfaced with the existing LabPET digital processing electronics. At a standard APD operating bias, a mean energy resolution of 27.5 ± 0.6% was typically obtained at 511 keV with a relative standard deviation of 13.8% in signal amplitude for the 64 individual pixels. Crosstalk between pixels was found to be well below the typical lower energy threshold used for PET imaging applications. With two modules in coincidence, a global timing resolution of 5.0 ns FWHM was measured. Finally, an intrinsic spatial resolution of 0.8 mm FWHM was measured by sweeping a 22Na point source between two detector arrays. The proposed detector module demonstrates promising characteristics for dedicated mouse PET imaging at submillimiter resolution. © 2008 American Association of Physicists in Medicine.
Broad-Bandwidth FPGA-Based Digital Polyphase Spectrometer
NASA Technical Reports Server (NTRS)
Jamot, Robert F.; Monroe, Ryan M.
2012-01-01
With present concern for ecological sustainability ever increasing, it is desirable to model the composition of Earth s upper atmosphere accurately with regards to certain helpful and harmful chemicals, such as greenhouse gases and ozone. The microwave limb sounder (MLS) is an instrument designed to map the global day-to-day concentrations of key atmospheric constituents continuously. One important component in MLS is the spectrometer, which processes the raw data provided by the receivers into frequency-domain information that cannot only be transmitted more efficiently, but also processed directly once received. The present-generation spectrometer is fully analog. The goal is to include a fully digital spectrometer in the next-generation sensor. In a digital spectrometer, incoming analog data must be converted into a digital format, processed through a Fourier transform, and finally accumulated to reduce the impact of input noise. While the final design will be placed on an application specific integrated circuit (ASIC), the building of these chips is prohibitively expensive. To that end, this design was constructed on a field-programmable gate array (FPGA). A family of state-of-the-art digital Fourier transform spectrometers has been developed, with a combination of high bandwidth and fine resolution. Analog signals consisting of radiation emitted by constituents in planetary atmospheres or galactic sources are downconverted and subsequently digitized by a pair of interleaved analog-to-digital converters (ADCs). This 6-Gsps (gigasample per second) digital representation of the analog signal is then processed through an FPGA-based streaming fast Fourier transform (FFT). Digital spectrometers have many advantages over previously used analog spectrometers, especially in terms of accuracy and resolution, both of which are particularly important for the type of scientific questions to be addressed with next-generation radiometers.
NASA Astrophysics Data System (ADS)
Dalola, Simone; Ferrari, Vittorio; Marioli, Daniele
2012-03-01
In this paper a dual-chip system for inclination measurement is presented. It consists of a MEMS (microelectromechanical system) piezoresistive accelerometer manufactured in silicon bulk micromachining and a CMOS (complementary metal oxide semiconductor) ASIC (application specific integrated circuit) interface designed for resistive-bridge sensors. The sensor is composed of a seismic mass symmetrically suspended by means of four flexure beams that integrate two piezoresistors each to detect the applied static acceleration, which is related to inclination with respect to the gravity vector. The ASIC interface is based on a relaxation oscillator where the frequency and the duty cycle of a rectangular-wave output signal are related to the fractional bridge imbalance and the overall bridge resistance of the sensor, respectively. The latter is a function of temperature; therefore the sensing element itself can be advantageously used to derive information for its own thermal compensation. DC current excitation of the sensor makes the configuration unaffected by wire resistances and parasitic capacitances. Therefore, a modular system results where the sensor can be placed remotely from the electronics without suffering accuracy degradation. The inclination measurement system has been characterized as a function of the applied inclination angle at different temperatures. At room temperature, the experimental sensitivity of the system results in about 148 Hz/g, which corresponds to an angular sensitivity around zero inclination angle of about 2.58 Hz deg-1. This is in agreement with finite element method simulations. The measured output fluctuations at constant temperature determine an equivalent resolution of about 0.1° at midrange. In the temperature range of 25-65 °C the system sensitivity decreases by about 10%, which is less than the variation due to the microsensor alone thanks to thermal compensation provided by the current excitation of the bridge and the positive temperature coefficient of resistance of the piezoresistors.
MUSIC: An 8 channel readout ASIC for SiPM arrays
NASA Astrophysics Data System (ADS)
Gómez, Sergio; Gascón, David; Fernández, Gerard; Sanuy, Andreu; Mauricio, Joan; Graciani, Ricardo; Sanchez, David
2016-04-01
This paper presents an 8 channel ASIC for SiPM anode readout based on a novel low input impedance current conveyor (under patent1). This Multiple Use SiPM Integrated Circuit (MUSIC) has been designed to serve several purposes, including, for instance, the readout of SiPM arrays for some of the Cherenkov Telescope Array (CTA) cameras. The current division scheme at the very front end part of the circuit splits the input current into differently scaled copies which are connected to independent current mirrors. The circuit contains a tunable pole zero cancellation of the SiPM recovery time constant to deal with sensors from different manufacturers. Decay times up to 100 ns are supported covering most of the available SiPM devices in the market. MUSIC offers three main features: (1) differential output of the sum of the individual input channels; (2) 8 individual single ended analog outputs and; (3) 8 individual binary outputs. The digital outputs encode the amount of collected charge in the duration of the digital signal using a time over threshold technique. For each individual channel, the user must select the analog or digital output. Each functionality, the signal sum and the 8 A/D outputs, include a selectable dual-gain configuration. Moreover, the signal sum implements dual-gain output providing a 15 bit dynamic range. Full die simulation results of the MUSIC designed using AMS 0.35 µm SiGe technology are presented: total die size of 9 mm2, 500 MHz bandwidth for channel sum and 150 MHz bandwidth for A/D channels, low input impedance (≍32 Ω), single photon output pulse width at half maximum (FWHM) between 5 and 10 ns and with a power consumption of ≍ 30 mW/ch plus ≍ 200 mW for the 8 ch sum. Encapsulated prototype samples of the MUSIC are expected by March 2016.
Architecture of a mixed-mode electrophysiological signal acquisition interface.
Shen, Ding-Lan; Chen, Jyun-Min
2012-01-01
This paper proposes mixed-mode architecture for the acquisition interface of electrophysiological signals. The architecture advances the analog-to-digital converter (ADC) from the second chopper signal in the conventional approach and performs the second chopper operation in the digital domain. The demanded low-pass filter (LPF) is realized with a digital type. The analog LPF in feedback path is substituted with a digital one accompanying with a digital-to-analog converter (DAC). The analog variation is decreased due to the digitization of these operations. The entire architecture is simulated with the ECG input in a behavior model of Simulink.
Differential regulation of ASICs and TRPV1 by zinc in rat bronchopulmonary sensory neurons.
Vysotskaya, Zhanna V; Moss, Charles R; Gu, Qihai
2014-12-01
Zinc has been known to act as a signaling molecule that regulates a variety of neuronal functions. In this study, we aimed to study the effect of zinc on two populations of acid-sensitive ion channels, acid-sensing ion channels (ASICs), and transient receptor potential vanilloid receptor-1 (TRPV1), in vagal bronchopulmonary sensory neurons. Rat vagal sensory neurons innervating lungs and airways were retrogradely labeled with a fluorescent tracer. Whole-cell perforated patch-clamp recordings were carried out in primarily cultured bronchopulmonary sensory neurons. The acid-evoked ASIC and TRPV1 currents were measured and compared between before and after the zinc pretreatment. ASIC currents were induced by a pH drop from 7.4 to 6.8 or 6.5 in the presence of capsazepine (10 µM), a specific TRPV1 antagonist. Pretreatment with zinc (50 or 300 µM, 2 min) displayed different effects on the two distinct phenotypes of ASIC currents: a marked potentiation on ASIC channels with fast kinetics of activation and inactivation or no significant effect on ASIC currents with slow activation and inactivation. On the other hand, pretreatment with zinc significantly inhibited the acid (pH 5.5 or 5.3)-induced TRPV1 currents. The inhibition was abolished by intracellular chelation of zinc by TPEN (25 µM), indicating that intracellular accumulation of zinc was likely required for its inhibitory effect on TRPV1 channels. Our study showed that zinc differentially regulates the activities of ASICs and TRPV1 channels in rat vagal bronchopulmonary sensory neurons.
Excoffon, Katherine J D A; Kolawole, Abimbola O; Kusama, Nobuyoshi; Gansemer, Nicholas D; Sharma, Priyanka; Hruska-Hageman, Alesia M; Petroff, Elena; Benson, Christopher J
2012-08-17
We have previously shown that the Coxsackievirus and adenovirus receptor (CAR) can interact with post-synaptic density 95 (PSD-95) and localize PSD-95 to cell-cell junctions. We have also shown that activity of the acid sensing ion channel (ASIC3), a H(+)-gated cation channel that plays a role in mechanosensation and pain signaling, is negatively modulated by PSD-95 through a PDZ-based interaction. We asked whether CAR and ASIC3 simultaneously interact with PSD-95, and if so, whether co-expression of these proteins alters their cellular distribution and localization. Results indicate that CAR and ASIC3 co-immunoprecipitate only when co-expressed with PSD-95. CAR also brings both PSD-95 and ASIC3 to the junctions of heterologous cells. Moreover, CAR rescues PSD-95-mediated inhibition of ASIC3 currents. These data suggest that, in addition to activity as a viral receptor and adhesion molecule, CAR can play a role in trafficking proteins, including ion channels, in a PDZ-based scaffolding complex. Copyright © 2012 Elsevier Inc. All rights reserved.
Silvestri, Cinzia; Riccio, Michele; Poelma, René H; Jovic, Aleksandar; Morana, Bruno; Vollebregt, Sten; Irace, Andrea; Zhang, Guo Qi; Sarro, Pasqualina M
2018-04-17
The high aspect ratio and the porous nature of spatially oriented forest-like carbon nanotube (CNT) structures represent a unique opportunity to engineer a novel class of nanoscale assemblies. By combining CNTs and conformal coatings, a 3D lightweight scaffold with tailored behavior can be achieved. The effect of nanoscale coatings, aluminum oxide (Al 2 O 3 ) and nonstoichiometric amorphous silicon carbide (a-SiC), on the thermal transport efficiency of high aspect ratio vertically aligned CNTs, is reported herein. The thermal performance of the CNT-based nanostructure strongly depends on the achieved porosity, the coating material and its infiltration within the nanotube network. An unprecedented enhancement in terms of effective thermal conductivity in a-SiC coated CNTs has been obtained: 181% compared to the as-grown CNTs and Al 2 O 3 coated CNTs. Furthermore, the integration of coated high aspect ratio CNTs in an epoxy molding compound demonstrates that, next to the required thermal conductivity, the mechanical compliance for thermal interface applications can also be achieved through coating infiltration into foam-like CNT forests. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
An ultra low power ECG signal processor design for cardiovascular disease detection.
Jain, Sanjeev Kumar; Bhaumik, Basabi
2015-08-01
This paper presents an ultra low power ASIC design based on a new cardiovascular disease diagnostic algorithm. This new algorithm based on forward search is designed for real time ECG signal processing. The algorithm is evaluated for Physionet PTB database from the point of view of cardiovascular disease diagnosis. The failed detection rate of QRS complex peak detection of our algorithm ranges from 0.07% to 0.26% for multi lead ECG signal. The ASIC is designed using 130-nm CMOS low leakage process technology. The area of ASIC is 1.21 mm(2). This ASIC consumes only 96 nW at an operating frequency of 1 kHz with a supply voltage of 0.9 V. Due to ultra low power consumption, our proposed ASIC design is most suitable for energy efficient wearable ECG monitoring devices.
Zhu, Haili; Ding, Jieqiong; Wu, Ji; Liu, Tingting; Liang, Jing; Tang, Qiong; Jiao, Ming
2017-11-01
Bone cancer pain (BCP) is one of the most common pains in patients with malignant cancers. The mechanism underlying BCP is largely unknown. Our previous studies and the increasing evidence both have shown that acid-sensing ion channels 3 (ASIC3) is an important protein in the pathological pain state in some pain models. We hypothesized that the expression change of ASIC3 might be one of the factors related to BCP. In this study, we established the BCP model through intrathecally injecting rat mammary gland carcinoma cells (MRMT-1) into the left tibia of Sprague-Dawley female rats, and found that the BCP rats showed bone destruction, increased mechanical pain sensitivities and up-regulated ASIC3 protein expression levels in L4-L6 dorsal root ganglion. Then, resveratrol, which was intraperitoneally injected into the BCP rats on post-operative Day 21, dose-dependently increased the paw withdrawal threshold of BCP rats, reversed the pain behavior, and had an antinociceptive effect on BCP rats. In ASIC3-transfected SH-SY5Y cells, the ASIC3 protein expression levels were regulated by resveratrol in a dose- and time-dependent manner. Meanwhile, resveratrol also had an antinociceptive effect in ASIC3-mediated pain rat model. Furthermore, resveratrol also enhanced the phosphorylation of AMPK, SIRT1, and LC3-II levels in ASIC3-transfected SH-SY5Y cells, indicating that resveratrol could activate the AMPK-SIRT1-autophagy signal pathway in ASIC3-transfected SH-SY5Y cells. In BCP rats, SIRT1 and LC3-II were also down-regulated. These findings provide new evidence for the use of resveratrol as a therapeutic treatment during BCP states. © The Author 2017. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Integrated low power digital gyro control electronics
NASA Technical Reports Server (NTRS)
M'Closkey, Robert (Inventor); Grayver, Eugene (Inventor); Challoner, A. Dorian (Inventor); Hayworth, Ken J. (Inventor)
2005-01-01
Embodiments of the invention generally encompass a digital, application specific integrated circuit (ASIC) has been designed to perform excitation of a selected mode within a vibratory rate gyroscope, damping, or force-rebalance, of other modes within the sensor, and signal demodulation of the in-phase and quadrature components of the signal containing the angular rate information. The ASIC filters dedicated to each channel may be individually programmed to accommodate different rate sensor designs/technology or variations within the same class of sensors. The ASIC architecture employs a low-power design, making the ASIC, particularly suitable for use in power-sensitive applications.
Flexible Peripheral Component Interconnect Input/Output Card
NASA Technical Reports Server (NTRS)
Bigelow, Kirk K.; Jerry, Albert L.; Baricio, Alisha G.; Cummings, Jon K.
2010-01-01
The Flexible Peripheral Component Interconnect (PCI) Input/Output (I/O) Card is an innovative circuit board that provides functionality to interface between a variety of devices. It supports user-defined interrupts for interface synchronization, tracks system faults and failures, and includes checksum and parity evaluation of interface data. The card supports up to 16 channels of high-speed, half-duplex, low-voltage digital signaling (LVDS) serial data, and can interface combinations of serial and parallel devices. Placement of a processor within the field programmable gate array (FPGA) controls an embedded application with links to host memory over its PCI bus. The FPGA also provides protocol stacking and quick digital signal processor (DSP) functions to improve host performance. Hardware timers, counters, state machines, and other glue logic support interface communications. The Flexible PCI I/O Card provides an interface for a variety of dissimilar computer systems, featuring direct memory access functionality. The card has the following attributes: 8/16/32-bit, 33-MHz PCI r2.2 compliance, Configurable for universal 3.3V/5V interface slots, PCI interface based on PLX Technology's PCI9056 ASIC, General-use 512K 16 SDRAM memory, General-use 1M 16 Flash memory, FPGA with 3K to 56K logical cells with embedded 27K to 198K bits RAM, I/O interface: 32-channel LVDS differential transceivers configured in eight, 4-bit banks; signaling rates to 200 MHz per channel, Common SCSI-3, 68-pin interface connector.
An Offload NIC for NASA, NLR, and Grid Computing
NASA Technical Reports Server (NTRS)
Awrach, James
2013-01-01
This work addresses distributed data management and access dynamically configurable high-speed access to data distributed and shared over wide-area high-speed network environments. An offload engine NIC (network interface card) is proposed that scales at nX10-Gbps increments through 100-Gbps full duplex. The Globus de facto standard was used in projects requiring secure, robust, high-speed bulk data transport. Novel extension mechanisms were derived that will combine these technologies for use by GridFTP, bandwidth management resources, and host CPU (central processing unit) acceleration. The result will be wire-rate encrypted Globus grid data transactions through offload for splintering, encryption, and compression. As the need for greater network bandwidth increases, there is an inherent need for faster CPUs. The best way to accelerate CPUs is through a network acceleration engine. Grid computing data transfers for the Globus tool set did not have wire-rate encryption or compression. Existing technology cannot keep pace with the greater bandwidths of backplane and network connections. Present offload engines with ports to Ethernet are 32 to 40 Gbps f-d at best. The best of ultra-high-speed offload engines use expensive ASICs (application specific integrated circuits) or NPUs (network processing units). The present state of the art also includes bonding and the use of multiple NICs that are also in the planning stages for future portability to ASICs and software to accommodate data rates at 100 Gbps. The remaining industry solutions are for carrier-grade equipment manufacturers, with costly line cards having multiples of 10-Gbps ports, or 100-Gbps ports such as CFP modules that interface to costly ASICs and related circuitry. All of the existing solutions vary in configuration based on requirements of the host, motherboard, or carriergrade equipment. The purpose of the innovation is to eliminate data bottlenecks within cluster, grid, and cloud computing systems, and to add several more capabilities while reducing space consumption and cost. Provisions were designed for interoperability with systems used in the NASA HEC (High-End Computing) program. The new acceleration engine consists of state-ofthe- art FPGA (field-programmable gate array) core IP, C, and Verilog code; novel communication protocol; and extensions to the Globus structure. The engine provides the functions of network acceleration, encryption, compression, packet-ordering, and security added to Globus grid or for cloud data transfer. This system is scalable in nX10-Gbps increments through 100-Gbps f-d. It can be interfaced to industry-standard system-side or network-side devices or core IP in increments of 10 GigE, scaling to provide IEEE 40/100 GigE compliance.
STIC3 - Silicon Photomultiplier Timing Chip with picosecond resolution
NASA Astrophysics Data System (ADS)
Stankova, Vera; Shen, Wei; Briggl, Konrad; Chen, Huangshan; Fischer, Peter; Gil, Alejandro; Harion, Tobias; Kiworra, Volker; Munwes, Yonathan; Ritzert, Michael; Schultz-Coulon, Hans-Christian
2015-07-01
The diagnostic of pancreas and prostate cancer is a challenging task due to the background noise coming from the closer organs. The EndoToFPET-US project aims to combine the synergy between metabolic and anatomical (ultrasound) image in order to improve the precision in the tumor localization. The goal of the project is to develop a Positron Emission Tomography (PET) system that provides a time-of-flight resolution of 200 ps FWHM for improving the signal to noise ratio and further to improve the medical image quality. In order to achieve this purpose an ASIC has been designed for very high timing resolution in time-of-flight (ToF) applications. In this paper we present the ASIC performance and the first characterization measurements with the 64-channels prototype version (STiC3). Measurements are performed with LYSO scintillator crystal and a Multi Pixel Photon Counter (MPPC). Measurements with the chip show an analog-front-end stage jitter of 35 ps for the first photo-electron equivalent charge and reach 18 ps for the third photo-electron. Coincidence time resolution (CTR) of 240 ps FWHM is measured with 3.1×3.1×15 mm3 LYSO crystal and 50 μm pixel pitch MPPC. Further optimization including the Time-to-Digital Converter (TDC) non-linearity corrections and setup fine tuning are ongoing for achieving the desired CTR of 200 ps FWHM.
Wu, Liping; Oshima, Tadayuki; Shan, Jing; Sei, Hiroo; Tomita, Toshihiko; Ohda, Yoshio; Fukui, Hirokazu; Watari, Jiro; Miwa, Hiroto
2015-10-15
Esophageal visceral hypersensitivity has been proposed to be the pathogenesis of heartburn sensation in nonerosive reflux disease. Protease-activated receptor-2 (PAR-2) is expressed in human esophageal epithelial cells and is believed to play a role in inflammation and sensation. PAR-2 activation may modulate these responses through adenosine triphosphate (ATP) release, which is involved in transduction of sensation and pain. The transient receptor potential vanilloid receptor 1 (TRPV1) and acid-sensing ion channels (ASICs) are both acid-sensitive nociceptors. However, the interaction among these molecules and the mechanisms of heartburn sensation are still not clear. We therefore examined whether ATP release in human esophageal epithelial cells in response to acid is modulated by TRPV1 and ASICs and whether PAR-2 activation influences the sensitivity of TRPV1 and ASICs. Weak acid (pH 5) stimulated the release of ATP from primary human esophageal epithelial cells (HEECs). This effect was significantly reduced after pretreatment with 5-iodoresiniferatoxin (IRTX), a TRPV1-specific antagonist, or with amiloride, a nonselective ASIC blocker. TRPV1 and ASIC3 small interfering RNA (siRNA) transfection also decreased weak acid-induced ATP release. Pretreatment of HEECs with trypsin, tryptase, or a PAR-2 agonist enhanced weak acid-induced ATP release. Trypsin treatment led to the phosphorylation of TRPV1. Acid-induced ATP release enhancement by trypsin was partially blocked by IRTX, amiloride, or a PAR-2 antagonist. Conversely, acid-induced ATP release was augmented by PAR-2 activation through TRPV1 and ASICs. These findings suggested that the pathophysiology of heartburn sensation or esophageal hypersensitivity may be associated with the activation of PAR-2, TRPV1, and ASICs. Copyright © 2015 the American Physiological Society.
Huda, Rafiq; Pollema-Mays, Sarah L; Chang, Zheng; Alheid, George F; McCrimmon, Donald R; Martina, Marco
2012-10-01
Cellular mechanisms of central pH chemosensitivity remain largely unknown. The nucleus of the solitary tract (NTS) integrates peripheral afferents with central pathways controlling breathing; NTS neurons function as central chemosensors, but only limited information exists concerning the ionic mechanisms involved. Acid-sensing ion channels (ASICs) mediate chemosensitivity in nociceptive terminals, where pH values ∼6.5 are not uncommon in inflammation, but are also abundantly expressed throughout the brain where pHi s tightly regulated and their role is less clear. Here we test the hypothesis that ASICs are expressed in NTS neurons and contribute to intrinsic chemosensitivity and control of breathing. In electrophysiological recordings from acute rat NTS slices, ∼40% of NTS neurons responded to physiological acidification (pH 7.0) with a transient depolarization. This response was also present in dissociated neurons suggesting an intrinsic mechanism. In voltage clamp recordings in slices, a pH drop from 7.4 to 7.0 induced ASIC-like inward currents (blocked by 100 μM amiloride) in ∼40% of NTS neurons, while at pH ≤ 6.5 these currents were detected in all neurons tested; RT-PCR revealed expression of ASIC1 and, less abundantly, ASIC2 in the NTS. Anatomical analysis of dye-filled neurons showed that ASIC-dependent chemosensitive cells (cells responding to pH 7.0) cluster dorsally in the NTS. Using in vivo retrograde labelling from the ventral respiratory column, 90% (9/10) of the labelled neurons showed an ASIC-like response to pH 7.0, suggesting that ASIC currents contribute to control of breathing. Accordingly, amiloride injection into the NTS reduced phrenic nerve activity of anaesthetized rats with an elevated arterial P(CO(2)) .
Human/Computer Interfacing in Educational Environments.
ERIC Educational Resources Information Center
Sarti, Luigi
1992-01-01
This discussion of educational applications of user interfaces covers the benefits of adopting database techniques in organizing multimedia materials; the evolution of user interface technology, including teletype interfaces, analogic overlay graphics, window interfaces, and adaptive systems; application design problems, including the…
Chip Design Process Optimization Based on Design Quality Assessment
NASA Astrophysics Data System (ADS)
Häusler, Stefan; Blaschke, Jana; Sebeke, Christian; Rosenstiel, Wolfgang; Hahn, Axel
2010-06-01
Nowadays, the managing of product development projects is increasingly challenging. Especially the IC design of ASICs with both analog and digital components (mixed-signal design) is becoming more and more complex, while the time-to-market window narrows at the same time. Still, high quality standards must be fulfilled. Projects and their status are becoming less transparent due to this complexity. This makes the planning and execution of projects rather difficult. Therefore, there is a need for efficient project control. A main challenge is the objective evaluation of the current development status. Are all requirements successfully verified? Are all intermediate goals achieved? Companies often develop special solutions that are not reusable in other projects. This makes the quality measurement process itself less efficient and produces too much overhead. The method proposed in this paper is a contribution to solve these issues. It is applied at a German design house for analog mixed-signal IC design. This paper presents the results of a case study and introduces an optimized project scheduling on the basis of quality assessment results.
Characterization of low-mass deformable mirrors and ASIC drivers for high-contrast imaging
NASA Astrophysics Data System (ADS)
Mejia Prada, Camilo; Yao, Li; Wu, Yuqian; Roberts, Lewis C.; Shelton, Chris; Wu, Xingtao
2017-09-01
The development of compact, high performance Deformable Mirrors (DMs) is one of the most important technological challenges for high-contrast imaging on space missions. Microscale Inc. has fabricated and characterized piezoelectric stack actuator deformable mirrors (PZT-DMs) and Application-Specific Integrated Circuit (ASIC) drivers for direct integration. The DM-ASIC system is designed to eliminate almost all cables, enabling a very compact optical system with low mass and low power consumption. We report on the optical tests used to evaluate the performance of the DM and ASIC units. We also compare the results to the requirements for space-based high-contrast imaging of exoplanets.
Development of n+-in-p planar pixel quadsensor flip-chipped with FE-I4 readout ASICs
NASA Astrophysics Data System (ADS)
Unno, Y.; Kamada, S.; Yamamura, K.; Yamamoto, H.; Hanagaki, K.; Hori, R.; Ikegami, Y.; Nakamura, K.; Takubo, Y.; Takashima, R.; Tojo, J.; Kono, T.; Nagai, R.; Saito, S.; Sugibayashi, K.; Hirose, M.; Jinnouchi, O.; Sato, S.; Sawai, H.; Hara, K.; Sato, Kz.; Sato, Kj.; Iwabuchi, S.; Suzuki, J.
2017-01-01
We have developed flip-chip modules applicable to the pixel detector for the HL-LHC. New radiation-tolerant n+-in-p planar pixel sensors of a size of four FE-I4 application-specific integrated circuits (ASICs) are laid out in a 6-in wafer. Variation in readout connection for the pixels at the boundary of ASICs is implemented in the design of quadsensors. Bump bonding technology is developed for four ASICs onto one quadsensor. Both sensors and ASICs are thinned to 150 μm before bump bonding, and are held flat with vacuum chucks. Using lead-free SnAg solder bumps, we encounter deficiency with large areas of disconnected bumps after thermal stress treatment, including irradiation. Surface oxidation of the solder bumps is identified as a critical source of this deficiency after bump bonding trials, using SnAg bumps with solder flux, indium bumps, and SnAg bumps with a newly-introduced hydrogen-reflow process. With hydrogen-reflow, we establish flux-less bump bonding technology with SnAg bumps, appropriate for mass production of the flip-chip modules with thin sensors and thin ASICs.
Evaluation of the Next-Gen Exercise Software Interface in the NEEMO Analog
NASA Technical Reports Server (NTRS)
Hanson, Andrea; Kalogera, Kent; Sandor, Aniko; Hardy, Marc; Frank, Andrew; English, Kirk; Williams, Thomas; Perera, Jeevan; Amonette, William
2017-01-01
NSBRI (National Space Biomedical Research Institute) funded research grant to develop the 'NextGen' exercise software for the NEEMO (NASA Extreme Environment Mission Operations) analog. Develop a software architecture to integrate instructional, motivational and socialization techniques into a common portal to enhance exercise countermeasures in remote environments. Increase user efficiency and satisfaction, and institute commonality across multiple exercise systems. Utilized GUI (Graphical User Interface) design principals focused on intuitive ease of use to minimize training time and realize early user efficiency. Project requirement to test the software in an analog environment. Top Level Project Aims: 1) Improve the usability of crew interface software to exercise CMS (Crew Management System) through common app-like interfaces. 2) Introduce virtual instructional motion training. 3) Use virtual environment to provide remote socialization with family and friends, improve exercise technique, adherence, motivation and ultimately performance outcomes.
NASA Astrophysics Data System (ADS)
Ishii, H.; Kojima, H.; Fukuhara, H.; Okada, S.; Yamakawa, H.
2012-04-01
Plasma wave is one of the most essential physical quantities in the solar terrestrial physics. The role of plasma wave receiver onboard satellites is to detect plasma waves in space with a good signal to noise ratio. There are two types of plasma wave receivers, the sweep frequency analyzer and the waveform capture. While the sweep frequency analyzer provides plasma wave spectra, the waveform capture obtains waveforms with phase information that is significant in studying nonlinear phenomena. Antenna sensors to observe electric fields of the plasma waves show different features in plasmas from in vacuum. The antenna impedances have specific characteristics in the frequency domain because of the dispersion of plasmas. These antenna impedances are expressed with complex number. We need to know not only the antenna impedances but also the transfer functions of plasma wave receiver's circuits in order to calibrate observed waveforms precisely. The impedances of the electric field antennas are affected by a state of surrounding plasmas. Since satellites run through various regions with different plasma parameters, we precisely should measure the antenna impedances onboard spacecraft. On the contrary, we can obtain the plasma density and by measuring the antenna impedances. Several formulas of the antenna impedance measurement system were proposed. A synchronous detection method is used on the BepiColombo Mercury Magnetospheric Orbiter (MMO), which will be launched in 2014. The digital data are stored in the onboard memory. They are read out and converted to the analog waveforms by D/A converter. They are fed into the input of the preamplifiers of antenna sensors through a resistor. We can calculate a transfer function of the circuit by applying the synchronous detection method to the output waveform from waveform receivers and digital data as a signal source. The size of this system is same as an A5 board. In recent years, Application Specific Integrated Circuit (ASIC) is in attention which is a technique to integrate large scale and complicated circuits. Lots of ASICs have been applied to high energy astrophysics. In this paper, we show our attempt to miniaturize the antennas impedances measurement system and Waveform Capture using the analogue ASIC. We design 8bits segment D/A converter that is implemented inside the waveform receiver ASIC chip. We improve input logic of the D/A converter to generate very weak signals accurately. The designed chip realizes the measurement of the antenna impedance as well as the waveform observation in the board size of business cards.
NASA Astrophysics Data System (ADS)
Vallerga, John; McPhate, Jason; Tremsin, Anton; Siegmund, Oswald; Raffanti, Rick; Cumming, Harley; Seljak, Andrej; Virta, Vihtori; Varner, Gary
2016-07-01
Photon counting microchannel plate (MCP) imagers have been the detector of choice for most UV astronomical missions over the last three decades (e.g. EUVE, FUSE, COS on Hubble etc.) and been mentioned for instruments on future large telescopes in space such as LUVOIR14. Using cross strip anodes, improvements in the MCP laboratory readout technology have resulted in better spatial resolution (x10), temporal resolution (x 1000) and output event rate (x100), all the while operating at lower gain (x10) resulting in lower high voltage requirements and longer MCP lifetimes. A crossed strip anode MCP readout starts with a set of orthogonal conducting strips (e.g. 80 x 80), typically spaced at a 635 micron pitch onto which charge clouds from MCP amplified events land. Each strip has its own charge sensitive amplifier that is sampled continuously by a dedicated analog to digital converter (ADC). All of the ADC digital output lines are fed into a field programmable gate array (FGPA) which can detect charge events landing on the strips, measure the peak amplitudes of those charge events and calculate their spatial centroid along with their time of arrival (X,Y,T) and pass this information to a downstream computer. Laboratory versions of these electronics have demonstrated < 20 microns FWHM spatial resolution, count rates on the order of 2 MHz, and temporal resolution of 1ns. In 2012 our group at U.C. Berkeley, along with our partners at the U. Hawaii, received a NASA Strategic Astrophysics Technology (SAT) grant to raise the TRL of a cross strip detector from 4 to 6 by replacing most of the 19" rack mounted, high powered electronics with application specific integrated circuits (ASICs) which will lower the power, mass, and volume requirements of the detector electronics. We were also tasked to design and fabricate a "standard" 50mm square active area MCP detector incorporating these electronics that can be environmentally qualified for flight (temperature, vacuum, vibration). ASICs designed for this program have been successfully fabricated and are undergoing extensive testing. We will present the latest progress on these ASIC designs and their performance. We will also show our preliminary work on scaling these designs (detector and electronics) to a flight qualified 100 x 100 mm cross strip detector, which has recently been funded through a follow on SAT grant.
Hardware Architecture Study for NASA's Space Software Defined Radios
NASA Technical Reports Server (NTRS)
Reinhart, Richard C.; Scardelletti, Maximilian C.; Mortensen, Dale J.; Kacpura, Thomas J.; Andro, Monty; Smith, Carl; Liebetreu, John
2008-01-01
This study defines a hardware architecture approach for software defined radios to enable commonality among NASA space missions. The architecture accommodates a range of reconfigurable processing technologies including general purpose processors, digital signal processors, field programmable gate arrays (FPGAs), and application-specific integrated circuits (ASICs) in addition to flexible and tunable radio frequency (RF) front-ends to satisfy varying mission requirements. The hardware architecture consists of modules, radio functions, and and interfaces. The modules are a logical division of common radio functions that comprise a typical communication radio. This paper describes the architecture details, module definitions, and the typical functions on each module as well as the module interfaces. Trade-offs between component-based, custom architecture and a functional-based, open architecture are described. The architecture does not specify the internal physical implementation within each module, nor does the architecture mandate the standards or ratings of the hardware used to construct the radios.
NASA Technical Reports Server (NTRS)
Reinhart, Richard C.; Kacpura, Thomas J.; Smith, Carl R.; Liebetreu, John; Hill, Gary; Mortensen, Dale J.; Andro, Monty; Scardelletti, Maximilian C.; Farrington, Allen
2008-01-01
This report defines a hardware architecture approach for software-defined radios to enable commonality among NASA space missions. The architecture accommodates a range of reconfigurable processing technologies including general-purpose processors, digital signal processors, field programmable gate arrays, and application-specific integrated circuits (ASICs) in addition to flexible and tunable radiofrequency front ends to satisfy varying mission requirements. The hardware architecture consists of modules, radio functions, and interfaces. The modules are a logical division of common radio functions that compose a typical communication radio. This report describes the architecture details, the module definitions, the typical functions on each module, and the module interfaces. Tradeoffs between component-based, custom architecture and a functional-based, open architecture are described. The architecture does not specify a physical implementation internally on each module, nor does the architecture mandate the standards or ratings of the hardware used to construct the radios.
Roza, Carolina; Puel, Jean-Luc; Kress, Michaela; Baron, Anne; Diochot, Sylvie; Lazdunski, Michel; Waldmann, Rainer
2004-01-01
Mechanosensitive cation channels are thought to be crucial for different aspects of mechanoperception, such as hearing and touch sensation. In the nematode C. elegans, the degenerins MEC-4 and MEC-10 are involved in mechanosensation and were proposed to form mechanosensitive cation channels. Mammalian degenerin homologues, the H+-gated ASIC channels, are expressed in sensory neurones and are therefore interesting candidates for mammalian mechanosensors. We investigated the effect of an ASIC2 gene knockout in mice on hearing and on cutaneous mechanosensation and visceral mechanonociception. However, our data do not support a role of ASIC2 in those facets of mechanoperception. PMID:15169849
Characterization of the VEGA ASIC coupled to large area position-sensitive Silicon Drift Detectors
NASA Astrophysics Data System (ADS)
Campana, R.; Evangelista, Y.; Fuschino, F.; Ahangarianabhari, M.; Macera, D.; Bertuccio, G.; Grassi, M.; Labanti, C.; Marisaldi, M.; Malcovati, P.; Rachevski, A.; Zampa, G.; Zampa, N.; Andreani, L.; Baldazzi, G.; Del Monte, E.; Favre, Y.; Feroci, M.; Muleri, F.; Rashevskaya, I.; Vacchi, A.; Ficorella, F.; Giacomini, G.; Picciotto, A.; Zuffa, M.
2014-08-01
Low-noise, position-sensitive Silicon Drift Detectors (SDDs) are particularly useful for experiments in which a good energy resolution combined with a large sensitive area is required, as in the case of X-ray astronomy space missions and medical applications. This paper presents the experimental characterization of VEGA, a custom Application Specific Integrated Circuit (ASIC) used as the front-end electronics for XDXL-2, a large-area (30.5 cm2) SDD prototype. The ASICs were integrated on a specifically developed PCB hosting also the detector. Results on the ASIC noise performances, both stand-alone and bonded to the large area SDD, are presented and discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carlson, Thomas J.; Myjak, Mitchell J.
At the request of the U.S. Army Corps of Engineers, Portland District, researchers from Pacific Northwest National Laboratory investigated the use of an application-specific integrated circuit (ASIC) to reduce the weight and volume of Juvenile Salmon Acoustic Telemetry System (JSATS) transmitters while retaining current functionality. Review of the design of current JSATS transmitters identified components that could be replaced by an ASIC while retaining the function of the current transmitter and offering opportunities to extend function if desired. ASIC design alternatives were identified that could meet transmitter weight and volume targets of 200 mg and 100 mm3. If alternatives tomore » the cylindrical batteries used in current JSATS transmitters can be identified, it could be possible to implant ASIC-based JSATS transmitters by injection rather than surgery. Using criteria for the size of fish suitable for surgical implantation of current JSATS transmitters, it was concluded that fish as small as 70 mm in length could be implanted with an ASIC-based transmitter, particularly if implantation by injection became feasible.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Huan, E-mail: wanghuan7@126.com; Institute for Liver Diseases of Anhui Medical University; Wang, Ying-hong
Metabolic syndrome characterized by hyperglycemia contributes to nonalcoholic steatohepatitis-associated liver fibrosis. This study was to investigate the effects of Acid-sensing ion Channel 1a (ASIC1a) on the process of liver fibrosis under hyperglycemia. Results showed that high glucose significantly worsen the pathology of liver fibrosis in vivo. In vitro, high glucose stimulated proliferation, activation and extracellular matrix (ECM) production in HSCs, and enhanced the effect of PDGF-BB on the activation and proliferation of HSCs. These effects could be attenuated by ASIC1a specific inhibitor Psalmotoxin-1(PcTx1) or specific ShRNA for ASIC1a through Notch1/Hes-1 pathways. These data indicate that ASIC1a plays an important role in diabetesmore » complication liver fibrosis. - Highlights: • Hyperglycemia is a risk factor for the process of liver fibrosis. • ASIC1a may be a key factor linking between high glucose and liver fibrosis. • Notch1/Hes-1 may involve to the process of liver fibrosis under hyperglycemia.« less
A Wireless Capsule Endoscope System With Low-Power Controlling and Processing ASIC.
Xinkai Chen; Xiaoyu Zhang; Linwei Zhang; Xiaowen Li; Nan Qi; Hanjun Jiang; Zhihua Wang
2009-02-01
This paper presents the design of a wireless capsule endoscope system. The proposed system is mainly composed of a CMOS image sensor, a RF transceiver and a low-power controlling and processing application specific integrated circuit (ASIC). Several design challenges involving system power reduction, system miniaturization and wireless wake-up method are resolved by employing optimized system architecture, integration of an area and power efficient image compression module, a power management unit (PMU) and a novel wireless wake-up subsystem with zero standby current in the ASIC design. The ASIC has been fabricated in 0.18-mum CMOS technology with a die area of 3.4 mm * 3.3 mm. The digital baseband can work under a power supply down to 0.95 V with a power dissipation of 1.3 mW. The prototype capsule based on the ASIC and a data recorder has been developed. Test result shows that proposed system architecture with local image compression lead to an average of 45% energy reduction for transmitting an image frame.
Fabrication Security and Trust of Domain-Specific ASIC Processors
2016-10-30
embedded in the design. For example , an ASIC processor potentially has a 10-1,000X performance advantage over its FPGA and GPP counterparts, but...paper by summarizing our lessons learned from this project and suggests a few research directions. II. DOMAIN-SPECIFIC ASIC PROCESSORS As Figure 1 has...sponsored by the Assistant Secretary of Defense for Research & Engineering under Air Force Contract #FA8721-05-C-0002. Opinions, interpretations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Khalid, Farah F.; Deptuch, Grzegorz; Shenai, Alpana
Monolithic Active Matrix with Binary Counters (MAMBO) is a counting ASIC designed for detecting and measuring low energy X-rays from 6-12 keV. Each pixel contains analogue functionality implemented with a charge preamplifier, CR-RC{sup 2} shaper and a baseline restorer. It also contains a window comparator which can be trimmed by 4 bit DACs to remove systematic offsets. The hits are registered by a 12 bit ripple counter which is reconfigured as a shift register to serially output the data from the entire ASIC. Each pixel can be tested individually. Two diverse approaches have been used to prevent coupling between themore » detector and electronics in MAMBO III and MAMBO IV. MAMBO III is a 3D ASIC, the bottom ASIC consists of diodes which are connected to the top ASIC using {mu}-bump bonds. The detector is decoupled from the electronics by physically separating them on two tiers and using several metal layers as a shield. MAMBO IV is a monolithic structure which uses a nested well approach to isolate the detector from the electronics. The ASICs are being fabricated using the SOI 0.2 {micro}m OKI process, MAMBO III is 3D bonded at T-Micro and MAMBO IV nested well structure was developed in collaboration between OKI and Fermilab.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Khalid, Farah; Deptuch, Grzegorz; Shenai, Alpana
Monolithic Active Matrix with Binary Counters (MAMBO) is a counting ASIC designed for detecting and measuring low energy X-rays from 6-12keV. Each pixel contains analogue functionality implemented with a charge preamplifier, CR-RC{sup 2} shaper and a baseline restorer. It also contains a window comparator which can be trimmed by 4 bit DACs to remove systematic offsets. The hits are registered by a 12 bit ripple counter which is reconfigured as a shift register to serially output the data from the entire ASIC. Each pixel can be tested individually. Two diverse approaches have been used to prevent coupling between the detectormore » and electronics in MAMBO III and MAMBO IV. MAMBO III is a 3D ASIC, the bottom ASIC consists of diodes which are connected to the top ASIC using {mu}-bump bonds. The detector is decoupled from the electronics by physically separating them on two tiers and using several metal layers as a shield. MAMBO IV is a monolithic structure which uses a nested well approach to isolate the detector from the electronics. The ASICs are being fabricated using the SOI 0.2 {micro}m OKI process, MAMBO III is 3D bonded at T-Micro and MAMBO IV nested well structure was developed in collaboration between OKI and Fermilab.« less
Deactivation kinetics of acid-sensing ion channel 1a are strongly pH-sensitive.
MacLean, David M; Jayaraman, Vasanthi
2017-03-21
Acid-sensing ion channels (ASICs) are trimeric cation-selective ion channels activated by protons in the physiological range. Recent reports have revealed that postsynaptically localized ASICs contribute to the excitatory postsynaptic current by responding to the transient acidification of the synaptic cleft that accompanies neurotransmission. In response to such brief acidic transients, both recombinant and native ASICs show extremely rapid deactivation in outside-out patches when jumping from a pH 5 stimulus to a single resting pH of 8. Given that the resting pH of the synaptic cleft is highly dynamic and depends on recent synaptic activity, we explored the kinetics of ASIC1a and 1a/2a heteromers to such brief pH transients over a wider [H + ] range to approximate neuronal conditions better. Surprisingly, the deactivation of ASICs was steeply dependent on the pH, spanning nearly three orders of magnitude from extremely fast (<1 ms) at pH 8 to very slow (>300 ms) at pH 7. This study provides an example of a ligand-gated ion channel whose deactivation is sensitive to agonist concentrations that do not directly activate the receptor. Kinetic simulations and further mutagenesis provide evidence that ASICs show such steeply agonist-dependent deactivation because of strong cooperativity in proton binding. This capacity to signal across such a large synaptically relevant bandwidth enhances the response to small-amplitude acidifications likely to occur at the cleft and may provide ASICs with the ability to shape activity in response to the recent history of the synapse.
Arefin, Md Shamsul; Redoute, Jean-Michel; Yuce, Mehmet Rasit
2018-01-01
This paper presents a wireless capsule microsystem to detect and monitor the pH, pressure, and temperature of the gastrointestinal tract in real time. This research contributes to the integration of sensors (microfabricated capacitive pH, capacitive pressure, and resistive temperature sensors), frequency modulation and pulse width modulation based interface IC circuits, microcontroller, and transceiver with meandered conformal antenna for the development of a capsule system. The challenges associated with the system miniaturization, higher sensitivity and resolution of sensors, and lower power consumption of interface circuits are addressed. The layout, PCB design, and packaging of a miniaturized wireless capsule, having diameter of 13 mm and length of 28 mm, have successfully been implemented. A data receiver and recorder system is also designed to receive physiological data from the wireless capsule and to send it to a computer for real-time display and recording. Experiments are performed in vitro using a stomach model and minced pork as tissue simulating material. The real-time measurements also validate the suitability of sensors, interface circuits, and meandered antenna for wireless capsule applications.
VLSI technology for smaller, cheaper, faster return link systems
NASA Technical Reports Server (NTRS)
Nanzetta, Kathy; Ghuman, Parminder; Bennett, Toby; Solomon, Jeff; Dowling, Jason; Welling, John
1994-01-01
Very Large Scale Integration (VLSI) Application-specific Integrated Circuit (ASIC) technology has enabled substantially smaller, cheaper, and more capable telemetry data systems. However, the rapid growth in available ASIC fabrication densities has far outpaced the application of this technology to telemetry systems. Available densities have grown by well over an order magnitude since NASA's Goddard Space Flight Center (GSFC) first began developing ASIC's for ground telemetry systems in 1985. To take advantage of these higher integration levels, a new generation of ASIC's for return link telemetry processing is under development. These new submicron devices are designed to further reduce the cost and size of NASA return link processing systems while improving performance. This paper describes these highly integrated processing components.
New APETx-like peptides from sea anemone Heteractis crispa modulate ASIC1a channels.
Kalina, Rimma; Gladkikh, Irina; Dmitrenok, Pavel; Chernikov, Oleg; Koshelev, Sergey; Kvetkina, Aleksandra; Kozlov, Sergey; Kozlovskaya, Emma; Monastyrnaya, Margarita
2018-06-01
Sea anemones are an abundant source of various biologically active peptides. The hydrophobic 20% ethanol fraction of tropical sea anemone Heteractis crispa was shown to contain at least 159 peptide compounds including neurotoxins, proteinase and α-amylase inhibitors, as well as modulators of acid-sensing ion channels (ASICs). The three new peptides, π-AnmTX Hcr 1b-2, -3, and -4 (41 aa) (short names Hcr 1b-2, -3, -4), identified by a combination of reversed-phase liquid chromatography and mass spectrometry were found to belong to the class 1b sea anemone neurotoxins. The amino acid sequences of these peptides were determined by Edman degradation and tandem mass spectrometry. The percent of identity of Hcr 1b-2, -3, and -4 with well-known ASIC3 inhibitors Hcr 1b-1 from H. crispa and APETx2 from Anthopleura elegantissima is 95-78% and 46-49%, respectively. Electrophysiological experiments on homomeric ASIC channels expressed in Xenopus laevis oocytes establish that these peptides are the first inhibitors of ASIC1a derived from sea anemone venom. The major peptide, Hcr 1b-2, inhibited both rASIC1a (IC 50 4.8 ± 0.3 μM; nH 0.92 ± 0.05) and rASIC3 (IC 50 15.9 ± 1.1 μM; nH 1.0 ± 0.05). The maximum inhibition at saturating peptide concentrations reached 64% and 81%, respectively. In the model of acid-induced muscle pain Hcr 1b-2 was also shown to exhibit an antihyperalgesic effect, significantly reducing of the pain threshold of experimental animals. Copyright © 2018 Elsevier Inc. All rights reserved.
Rooj, Arun K.; Liu, Zhiyong; McNicholas, Carmel M.
2015-01-01
Major plasma membrane components of the tumor cell, ion channels, and integrins play crucial roles in metastasis. Glioma cells express an amiloride-sensitive nonselective cation channel composed of acid-sensing ion channel (ASIC)-1 and epithelial Na+ channel (ENaC) α- and γ-subunits. Inhibition of this channel is associated with reduced cell migration and proliferation. Using the ASIC-1 subunit as a reporter for the channel complex, we found a physical and functional interaction between this channel and integrin-β1. Short hairpin RNA knockdown of integrin-β1 attenuated the amiloride-sensitive current, which was due to loss of surface expression of ASIC-1. In contrast, upregulation of membrane expression of integrin-β1 increased the surface expression of ASIC-1. The link between the amiloride-sensitive channel and integrin-β1 was mediated by α-actinin. Downregulation of α-actinin-1 or -4 attenuated the amiloride-sensitive current. Mutation of the putative binding site for α-actinin on the COOH terminus of ASIC-1 reduced the membrane localization of ASIC-1 and also resulted in attenuation of the amiloride-sensitive current. Our data suggest a novel interaction between the amiloride-sensitive glioma cation channel and integrin-β1, mediated by α-actinin. This interaction may form a mechanism by which channel activity can regulate glioma cell proliferation and migration. PMID:26108662
Structural plasticity and dynamic selectivity of acid-sensing ion channel-spider toxin complexes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baconguis, Isabelle; Gouaux, Eric
2012-07-29
Acid-sensing ion channels (ASICs) are voltage-independent, amiloride-sensitive channels involved in diverse physiological processes ranging from nociception to taste. Despite the importance of ASICs in physiology, we know little about the mechanism of channel activation. Here we show that psalmotoxin activates non-selective and Na +-selective currents in chicken ASIC1a at pH7.25 and 5.5, respectively. Crystal structures of ASIC1a–psalmotoxin complexes map the toxin binding site to the extracellular domain and show how toxin binding triggers an expansion of the extracellular vestibule and stabilization of the open channel pore. At pH7.25 the pore is approximately 10Å in diameter, whereas at pH5.5 the poremore » is largely hydrophobic and elliptical in cross-section with dimensions of approximately 5 by 7Å, consistent with a barrier mechanism for ion selectivity. These studies define mechanisms for activation of ASICs, illuminate the basis for dynamic ion selectivity and provide the blueprints for new therapeutic agents.« less
Chen, Wei-Nan; Chen, Chih-Cheng
2014-05-21
Substance P is an important neuropeptide released from nociceptors to mediate pain signals. We recently revealed antinociceptive signaling by substance P in acid-sensing ion channel 3 (ASIC3)-expressing muscle nociceptors in a mouse model of acid-induced chronic widespread pain. However, methods to specifically trigger the substance P antinociception were still lacking. Here we show that acid could induce antinociceptive signaling via substance P release in muscle. We prevented the intramuscular acid-induced hyperalgesia by pharmacological inhibition of ASIC3 and transient receptor potential V1 (TRPV1). The antinociceptive effect of non-ASIC3, non-TRPV1 acid signaling lasted for 2 days. The non-ASIC3, non-TRPV1 acid antinociception was largely abolished in mice lacking substance P. Moreover, pretreatment with substance P in muscle mimicked the acid antinociceptive effect and prevented the hyperalgesia induced by next-day acid injection. Acid could mediate a prolonged antinociceptive signaling via the release of substance P from muscle afferent neurons in a non-ASIC3, non-TRPV1 manner.
The Amygdala is a Chemosensor that Detects Carbon Dioxide and Acidosis to Elicit Fear Behavior
Ziemann, Adam E.; Allen, Jason E.; Dahdaleh, Nader S.; Drebot, Iuliia I.; Coryell, Matt; Wunsch, Amanda M.; Lynch, Cynthia M.; Faraci, Frank M.; Howard, Matthew A.; Welsh, Michael J.; Wemmie, John A.
2009-01-01
SUMMARY The amygdala processes and directs inputs and outputs that are key to fear behavior. However, whether it directly senses fear-evoking stimuli is unknown. Because the amygdala expresses acid sensing ion channel-1a (ASIC1a), and ASIC1a is required for normal fear responses, we hypothesized that the amygdala might detect a reduced pH. We found that inhaled CO2 reduced brain pH and evoked fear behavior in mice. Eliminating or inhibiting ASIC1a markedly impaired this activity, and localized ASIC1a expression in the amygdala rescued the CO2- induced fear deficit of ASIC1a-null animals. Buffering pH attenuated fear behavior, whereas directly reducing pH with amygdala microinjections reproduced the effect of CO2. These data identify the amygdala as an important chemosensor that detects hypercarbia and acidosis and initiates behavioral responses. They also give a molecular explanation for how rising CO2 concentrations elicit intense fear and provide a foundation for dissecting the bases of anxiety and panic disorders. PMID:19945383
Receptor for protons: First observations on Acid Sensing Ion Channels.
Krishtal, Oleg
2015-07-01
The history of ASICs began in 1980 with unexpected observation. The concept of highly selective Na(+) current gated by specific receptors for protons was not easily accepted. It took 16 years to get these receptor/channels cloned and start a new stage in their investigation. "The receptor for protons" became ASIC comprising under this name a family of receptor/channels ubiquitous for mammalian nervous system, both peripheral and central. The role of ASICs as putative nociceptors was suggested almost immediately after their discovery. This role subsequently was proven in many forms of pain-related phenomena. Many other functions of ASICs have been also found or primed for speculations both in physiology and in disease. Despite the width of field and strength of efforts, numerous basic questions are to be answered before we understand how the local changes in pH in the nervous tissue transform into electric and messenger signaling via ASICs as transducers. This article is part of the Special Issue entitled 'Acid-Sensing Ion Channels in the Nervous System'. Copyright © 2015. Published by Elsevier Ltd.
Driver ASIC Environmental Testing and Performance Optimization for SpaceBased Active Mirrors
NASA Astrophysics Data System (ADS)
Mejia Prada, Camilo
Direct imaging of Earth-like planets requires techniques for light suppression, such as coronagraphs or nulling interferometers, in which deformable mirrors (DM) are a principal component. On ground-based systems, DMs are used to correct for turbulence in the Earth’s atmosphere in addition to static aberrations in the optics. For space-based observations, DMs are used to correct for static and quasi- static aberrations in the optical train. State-of-the-art, high-actuator count deformable mirrors suffer from external heavy and bulky electronics in which electrical connections are made through thousands of wires. We are instead developing Application Specific Integrated Circuits (ASICs) capable of direct integration with the DM in a single small package. This integrated ASIC-DM is ideal for space missions, where it offers significant reduction in mass, power and complexity, and performance compatible with high-contrast observations of exoplanets. We have successfully prototyped and tested a 32x32 format Switch-Mode (SM) ASIC which consumes only 2mW static power (total, not per-actuator). A number of constraints were imposed on key parameters of this ASIC design, including sub-picoamp levels of leakage across turned-off switches and from switch-to-substrate, control resolution of 0.04 mV, satisfactory rise/fall times, and a near-zero on-chip crosstalk over a useful range of operating temperatures. This driver ASIC technology is currently at TRL 4. This Supporting Technology proposal will further develop the ASIC technology to TRL 5 by carrying on environmental tests and further optimizing performance, with the end goal of making ASICs suitable for space-based deployment. The effort will be led by JPL, which has considerable expertise with DMs used in highcontrast imaging systems for exoplanet missions and in adaptive optic systems, and in design of DM driver electronics. Microscale, which developed the prototype of the ASICDM, will continue its development. We propose a three-part program to advance the device maturity. The effort will cover (1) radiation hardness, (2) thermal-vacuum environment tests, and (3) parameter performance optimization. We expect to implement the results in an optimized ASIC design for NASA's space applications, expanding the current state-of-the-art into radiation-hardened electronics robust enough for a space environment. This effort will fill technology gaps listed in the Exoplanet Exploration Program Technology Plan 2017 : “The challenge is believed to not be the mosaicking of 48×48 devices or 32×32 devices (to reach 128×128) but rather dealing with the enormous number of interconnects and their electronics.”. After the close of this effort, continued ASIC development is of course planned, leading to further improvement in parameters.
Farrag, Mohamed; Drobish, Julie K; Puhl, Henry L; Kim, Joyce S; Herold, Paul B; Kaufman, Marc P; Ruiz-Velasco, Victor
2017-12-01
Chronic limb ischaemia, characterized by inflammatory mediator release and a low extracellular pH, leads to acid-sensing ion channel (ASIC) activation and reflexively increases mean arterial pressure; endomorphin release is also increased under inflammatory conditions. We examined the modulation of ASIC currents by endomorphins in sensory neurons from rats with freely perfused and ligated femoral arteries: peripheral artery disease (PAD) model. Endomorphins potentiated sustained ASIC currents in both groups of dorsal root ganglion neurons, independent of mu opioid receptor stimulation or G protein activation. Intra-arterial administration of lactic acid (to simulate exercising muscle and evoke a pressor reflex), endomorphin-2 and naloxone resulted in a significantly greater pressor response than lactic acid alone, while administration of APETx2 inhibited endomorphin's enhancing effect in both groups. These results suggest a novel role for endomorphins in modulating ASIC function to effect lactic acid-mediated reflex increase in arterial pressure in patients with PAD. Chronic muscle ischaemia leads to accumulation of lactic acid and other inflammatory mediators with a subsequent drop in interstitial pH. Acid-sensing ion channels (ASICs), expressed in thin muscle afferents, sense the decrease in pH and evoke a pressor reflex known to increase mean arterial pressure. The naturally occurring endomorphins are also released by primary afferents under ischaemic conditions. We examined whether high affinity mu opioid receptor (MOR) agonists, endomorphin-1 (E-1) and -2 (E-2), modulate ASIC currents and the lactic acid-mediated pressor reflex. In rat dorsal root ganglion (DRG) neurons, exposure to E-2 in acidic solutions significantly potentiated ASIC currents when compared to acidic solutions alone. The potentiation was significantly greater in DRG neurons isolated from rats whose femoral arteries were ligated for 72 h. Sustained ASIC current potentiation was also observed in neurons pretreated with pertussis toxin, an uncoupler of G proteins and MOR. The endomorphin-mediated potentiation was a result of a leftward shift of the activation curve to higher pH values and a slight shift of the inactivation curve to lower pH values. Intra-arterial co-administration of lactic acid and E-2 led to a significantly greater pressor reflex than lactic acid alone in the presence of naloxone. Finally, E-2 effects were inhibited by pretreatment with the ASIC3 blocker APETx2 and enhanced by pretreatment with the ASIC1a blocker psalmotoxin-1. These findings have uncovered a novel role of endomorphins by which the opioids can enhance the lactic acid-mediated reflex increase in arterial pressure that is MOR stimulation-independent and APETx2-sensitive. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Britton, C.L.; Jagadish, U.; Bryan, W.L.
An Integrated Circuit (IC) readout chip with four channels arranged so as to receive input charge from the corners of the chip was designed for use with 5- to 7-mm pixel detectors. This Application Specific IC (ASIC) can be used for cold neutron imaging, for study of structural order in materials using cold neutron scattering or for particle physics experiments. The ASIC is fabricated in a 0.5-{micro}m n-well AMI process. The design of the ASIC and the test measurements made is reported. Noise measurements are also reported.
NASA Astrophysics Data System (ADS)
Chow, Eric Y.
Glaucoma affects about 65 million people and is the second leading cause of blindness in the world. Although the condition is irreversible and incurable, early detection is vital to slowing and even stopping the progression of the disease. Our work focuses on the design, fabrication, and assembly of a continuous active glaucoma intraocular pressure (IOP) monitor that provides clinicians with the necessary data to more accurately diagnose and treat patients. Major benefits of an active monitoring device include the potential to develop a closed-loop treatment system and to operate independently for extended periods of time. The fully wireless operation uses gigahertzfrequency electromagnetic wave propagation, which allows for an orientation independent transfer of power and data over reasonable distances. Our system is comprised of a MEMS capacitive sensor, capacitive power storage array, ASIC, and monopole antenna assembled into a biocompatible liquid crystal polymer (LCP) package. We have performed in vivo trials on rabbits, both chronic and acute, to validate system functionality, fully wireless feasibility, and biocompatibility. Heart failure (HF) affects approximately 2% of the adult population in developed countries and 6-10% of people over the age of 65. Continuous monitoring of blood pressure, flow, and chemistry from a minimally invasive device can serve as a diagnostic and early-warning system for cardiac health. We developed a miniaturized system attached to the outer surface of an FDA approved stent, used as both the antenna for wireless telemetry/powering and structural support. The system comprises of a MEMS pressure sensor, ASIC for the sensor interface and wireless capabilities, LCP substrate, and FDA approved stent. In vivo studies on pigs validated functionality and fully wireless operation and demonstrate the feasibility of a stent-based wireless implant for continuous monitoring of blood pressure as well as other parameters including oxygen, flow and turbulence, chemistry, and glucose.
Design and implementation of the ATLAS TRT front end electronics
NASA Astrophysics Data System (ADS)
Newcomer, Mitch; Atlas TRT Collaboration
2006-07-01
The ATLAS TRT subsystem is comprised of 380,000 4 mm straw tube sensors ranging in length from 30 to 80 cm. Polypropelene plastic layers between straws and a xenon-based gas mixture in the straws allow the straws to be used for both tracking and transition radiation detection. Detector-mounted electronics with data sparsification was chosen to minimize the cable plant inside the super-conducting solenoid of the ATLAS inner tracker. The "on detector" environment required a small footprint, low noise, low power and radiation-tolerant readout capable of triggering at rates up to 20 MHz with an analog signal dynamic range of >300 times the discriminator setting. For tracking, a position resolution better than 150 μm requires leading edge trigger timing with ˜1 ns precision and for transition radiation detection, a charge collection time long enough to integrate the direct and reflected signal from the unterminated straw tube is needed for position-independent energy measurement. These goals have been achieved employing two custom Application-specific integrated circuits (ASICS) and board design techniques that successfully separate analog and digital functionality while providing an integral part of the straw tube shielding.
Characterization of Sphinx1 ASIC X-ray detector using photon counting and charge integration
NASA Astrophysics Data System (ADS)
Habib, A.; Arques, M.; Moro, J.-L.; Accensi, M.; Stanchina, S.; Dupont, B.; Rohr, P.; Sicard, G.; Tchagaspanian, M.; Verger, L.
2018-01-01
Sphinx1 is a novel pixel architecture adapted for X-ray imaging, it detects radiation by photon counting and charge integration. In photon counting mode, each photon is compensated by one or more counter-charges typically consisting of 100 electrons (e-) each. The number of counter-charges required gives a measure of the incoming photon energy, thus allowing spectrometric detection. Pixels can also detect radiation by integrating the charges deposited by all incoming photons during one image frame and converting this analog value into a digital response with a 100 electrons least significant bit (LSB), based on the counter-charge concept. A proof of concept test chip measuring 5 mm × 5 mm, with 200 μm × 200 μm pixels has been produced and characterized. This paper provides details on the architecture and the counter-charge design; it also describes the two modes of operation: photon counting and charge integration. The first performance measurements for this test chip are presented. Noise was found to be ~80 e-rms in photon counting mode with a power consumption of only 0.9 μW/pixel for the static analog part and 0.3 μW/pixel for the static digital part.
Mongoose ASIC microcontroller programming guide
NASA Astrophysics Data System (ADS)
Smith, Brian S.
1993-09-01
The 'Mongoose' ASIC microcontroller is a radiation-hard implementation of the R3000 microprocessor. This document describes the internals of the microcontroller in a level of detail necessary for someone implementing a software design.
Mongoose ASIC microcontroller programming guide
NASA Technical Reports Server (NTRS)
Smith, Brian S.
1993-01-01
The 'Mongoose' ASIC microcontroller is a radiation-hard implementation of the R3000 microprocessor. This document describes the internals of the microcontroller in a level of detail necessary for someone implementing a software design.
The future of automation for high-volume wafer fabrication and ASIC manufacturing
NASA Astrophysics Data System (ADS)
Hughes, Randall A.; Shott, John D.
1986-12-01
A framework is given to analyze the future trends in semiconductor manufacturing automation systems, focusing specifically on the needs of ASIC (application-specific integrated circuit) or custom integrated circuit manufacturing. Advances in technologies such as gate arrays and standard cells now make it significantly easier to obtain system cost and performance advantages by integrating nonstandard functions on silicon. ASICs are attractive to U.S. manufacturers because they place a premium on sophisticated design tools, familiarity with customer needs and applications, and fast turn-around fabrication. These are areas where U.S. manufacturers believe they have an advantage and, consequently, will not suffer from the severe price/manufacturing competition encountered in conventional high-volume semiconductor products. Previously, automation was often considered viable only for high-volume manufacturing, but automation becomes a necessity in the new ASIC environment.
Naked mole-rat cortical neurons are resistant to acid-induced cell death.
Husson, Zoé; Smith, Ewan St John
2018-05-09
Regulation of brain pH is a critical homeostatic process and changes in brain pH modulate various ion channels and receptors and thus neuronal excitability. Tissue acidosis, resulting from hypoxia or hypercapnia, can activate various proteins and ion channels, among which acid-sensing ion channels (ASICs) a family of primarily Na + permeable ion channels, which alongside classical excitotoxicity causes neuronal death. Naked mole-rats (NMRs, Heterocephalus glaber) are long-lived, fossorial, eusocial rodents that display remarkable behavioral/cellular hypoxia and hypercapnia resistance. In the central nervous system, ASIC subunit expression is similar between mouse and NMR with the exception of much lower expression of ASIC4 throughout the NMR brain. However, ASIC function and neuronal sensitivity to sustained acidosis has not been examined in the NMR brain. Here, we show with whole-cell patch-clamp electrophysiology of cultured NMR and mouse cortical and hippocampal neurons that NMR neurons have smaller voltage-gated Na + channel currents and more hyperpolarized resting membrane potentials. We further demonstrate that acid-mediated currents in NMR neurons are of smaller magnitude than in mouse, and that all currents in both species are reversibly blocked by the ASIC antagonist benzamil. We further demonstrate that NMR neurons show greater resistance to acid-induced cell death than mouse neurons. In summary, NMR neurons show significant cellular resistance to acidotoxicity compared to mouse neurons, contributing factors likely to be smaller ASIC-mediated currents and reduced NaV activity.
Baconguis, Isabelle; Bohlen, Christopher J; Goehring, April; Julius, David; Gouaux, Eric
2014-02-13
Acid-sensing ion channels (ASICs) detect extracellular protons produced during inflammation or ischemic injury and belong to the superfamily of degenerin/epithelial sodium channels. Here, we determine the cocrystal structure of chicken ASIC1a with MitTx, a pain-inducing toxin from the Texas coral snake, to define the structure of the open state of ASIC1a. In the MitTx-bound open state and in the previously determined low-pH desensitized state, TM2 is a discontinuous α helix in which the Gly-Ala-Ser selectivity filter adopts an extended, belt-like conformation, swapping the cytoplasmic one-third of TM2 with an adjacent subunit. Gly 443 residues of the selectivity filter provide a ring of three carbonyl oxygen atoms with a radius of ∼3.6 Å, presenting an energetic barrier for hydrated ions. The ASIC1a-MitTx complex illuminates the mechanism of MitTx action, defines the structure of the selectivity filter of voltage-independent, sodium-selective ion channels, and captures the open state of an ASIC. Copyright © 2014 Elsevier Inc. All rights reserved.
MAROC, a generic photomultiplier readout chip
NASA Astrophysics Data System (ADS)
Blin, S.; Barrillon, P.; de La Taille, C.
2010-12-01
The MAROC ASICs family is dedicated to the readout of 64-channel Multi Anode PMT and similar detectors. Its main roles are to correct the gain spread of MAPMT channels thanks to an individual variable gain preamplifier and to discriminate the input signals (from 50fC i.e 1/3 photo-electron) in order to produce 64 trigger outputs. A multiplexed analog charge output is also available with a dynamic range around 10 pe ( ~ 1.6 pC) and a 12 bit Wilkinson ADC is embedded. Three versions of this chip have been submitted. MAROC 2 is the production version for the ATLAS luminometer and MAROC3 is a version with lower dissipation and significant improvements concerning the charge (30 pe: ~ 5 pC) and trigger (discrimination from 10fC). This third version showed very good characteristics that are presented here.
Amorphous silicon carbide ultramicroelectrode arrays for neural stimulation and recording
NASA Astrophysics Data System (ADS)
Deku, Felix; Cohen, Yarden; Joshi-Imre, Alexandra; Kanneganti, Aswini; Gardner, Timothy J.; Cogan, Stuart F.
2018-02-01
Objective. Foreign body response to indwelling cortical microelectrodes limits the reliability of neural stimulation and recording, particularly for extended chronic applications in behaving animals. The extent to which this response compromises the chronic stability of neural devices depends on many factors including the materials used in the electrode construction, the size, and geometry of the indwelling structure. Here, we report on the development of microelectrode arrays (MEAs) based on amorphous silicon carbide (a-SiC). Approach. This technology utilizes a-SiC for its chronic stability and employs semiconductor manufacturing processes to create MEAs with small shank dimensions. The a-SiC films were deposited by plasma enhanced chemical vapor deposition and patterned by thin-film photolithographic techniques. To improve stimulation and recording capabilities with small contact areas, we investigated low impedance coatings on the electrode sites. The assembled devices were characterized in phosphate buffered saline for their electrochemical properties. Main results. MEAs utilizing a-SiC as both the primary structural element and encapsulation were fabricated successfully. These a-SiC MEAs had 16 penetrating shanks. Each shank has a cross-sectional area less than 60 µm2 and electrode sites with a geometric surface area varying from 20 to 200 µm2. Electrode coatings of TiN and SIROF reduced 1 kHz electrode impedance to less than 100 kΩ from ~2.8 MΩ for 100 µm2 Au electrode sites and increased the charge injection capacities to values greater than 3 mC cm‑2. Finally, we demonstrated functionality by recording neural activity from basal ganglia nucleus of Zebra Finches and motor cortex of rat. Significance. The a-SiC MEAs provide a significant advancement in the development of microelectrodes that over the years has relied on silicon platforms for device manufacture. These flexible a-SiC MEAs have the potential for decreased tissue damage and reduced foreign body response. The technique is promising and has potential for clinical translation and large scale manufacturing.
[Real-time detection and processing of medical signals under windows using Lcard analog interfaces].
Kuz'min, A A; Belozerov, A E; Pronin, T V
2008-01-01
Multipurpose modular software for an analog interface based on Lcard 761 is considered. Algorithms for pipeline processing of medical signals under Windows with dynamic control of computational resources are suggested. The software consists of user-friendly completable modifiable modules. The module hierarchy is based on object-oriented heritage principles, which make it possible to construct various real-time systems for long-term detection, processing, and imaging of multichannel medical signals.
Readout ASICs and Electronics for the 144-channel HAPDs for the Aerogel RICH at Belle II
NASA Astrophysics Data System (ADS)
Nishida, S.; Adachi, I.; Ikeda, H.; Hara, K.; Iijima, T.; Iwata, S.; Korpar, S.; Križan, P.; Kuroda, E.; Pestotnik, R.; Seljak, A.; Sumiyoshi, T.; Takagaki, H.
The particle identification (PID) device in the endcap of the Belle detector will be upgraded to a ring imaging Cherenkov counter (RICH) using aerogel as a radiator at the Belle II experiment. We develop the electronics to read out the 70,000 channels of hit information from the 144-channel hybrid avalanche photodetectors (HAPD), of the aerogel RICH detector. A readout ASIC is developed to digitize the HAPD signals, and was used in a beam test with the prototype detector. The performance and plan of the ASIC is reported in this study. We have also designed the readout electronics for the aerogel RICH, which consist of front-end boards with the ASICs merger boards to collect data from the front-end boards. A front-end board that fits in the actual available space for the aerogel RICH electronics was produced.
Identification of acid-sensing ion channels in adenoid cystic carcinomas
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ye Jinhai; Department of Oral and Maxillofacial Surgery, School of Stomatology, Nanjing Medical University, Research Institute of Stomatology, Nanjing 210029; Gao Jun
2007-04-20
Tissue acidosis is an important feature of tumor. The response of adenoid cystic carcinoma (ACC) cells to acidic solution was studied using whole-cell patch-clamp recording in the current study. An inward, amiloride-sensitive Na{sup +} current was identified in cultured ACC-2 cells while not in normal human salivary gland epithelial cells. Electrophysiological and pharmacological properties of the currents suggest that heteromeric acid-sensing ion channels (ASICs) containing 2a and 3 may be responsible for the proton-induced currents in the majority of ACC-2 cells. Consistent with it, analyses of RT-PCR and Western blotting demonstrated the presences of ASIC2a and 3 in ACC-2 cells.more » Furthermore, we observed the enhanced expression of ASIC2a and 3 in the sample of ACC tissues. These results indicate that the functional expression of ASICs is characteristic feature of ACC cells.« less
Wang, Dong; Pan, Hao; Zhu, Hang; Zhu, Li; He, Yong-Jiang; Wang, Jian; Jia, Gao-Yong
2017-10-01
The nucleus pulposus (NP) is an avascular, hydrated tissue that permits the intervertebral disc to resist compressive loads to the spine. To determine the mechanisms by which intervertebral disc degeneration is caused by the nucleus pulposus, the expression and regulation of nuclear factor (NF)‑κB and acid sensing ion channel 3 (ASIC3) were examined. For the intervertebral disc degeneration model, NP was harvested from the tail of rats and applied to the L5 dorsal root ganglion (DRG). The mechanical pain withdrawal threshold (PWT) in NP model rats was assessed. Reverse transcription‑quantitative polymerase chain reaction and western blotting were used to examine NF‑κB and ASIC3 expression levels in DRG. Finally, the effect of the NF‑κB inhibitor pyrrolidine dithiocarbamate (PDTC) and the ASIC3 signaling pathway blocker amiloride were examined. Rats exposed to NP exhibited decreased PWT for 12 days, and NF‑κB and ASIC3 was upregulated in DRG induced by NP 14 days after surgery. After administration of amiloride and PDTC to DRG affected by NP, the levels of nitric oxide (NO), tumor necrosis factor‑α (TNF‑α), interleukin‑6 (IL‑6), NF‑κB and ASIC3 were downregulated, and the levels of aquaporin (AQP) 1 and AQP3 were significantly increased for 14 days. In conclusion, these results suggested that NF‑κB and ASIC3 may serve an important role in intervertebral disc degeneration caused by NP.
Liu, Gang; Yan, Guozheng; Zhu, Bingquan; Lu, Li
2016-11-01
In recent years, wireless capsule endoscopy (WCE) has been a state-of-the-art tool to examine disorders of the human gastrointestinal tract painlessly. However, system miniaturization, enhancement of the image-data transfer rate and power consumption reduction for the capsule are still key challenges. In this paper, a video capsule endoscopy system with a low-power controlling and processing application-specific integrated circuit (ASIC) is designed and fabricated. In the design, these challenges are resolved by employing a microimage sensor, a novel radio frequency transmitter with an on-off keying modulation rate of 20 Mbps, and an ASIC structure that includes a clock management module, a power-efficient image compression module and a power management unit. An ASIC-based prototype capsule, which measures Φ11 mm × 25 mm, has been developed here. Test results show that the designed ASIC consumes much less power than most of the other WCE systems and that its total power consumption per frame is the least. The image compression module can realize high near-lossless compression rate (3.69) and high image quality (46.2 dB). The proposed system supports multi-spectral imaging, including white light imaging and autofluorescence imaging, at a maximum frame rate of 24 fps and with a resolution of 400 × 400. Tests and in vivo trials in pigs have proved the feasibility of the entire system, but further improvements in capsule control and compression performance inside the ASIC are needed in the future.
Digital Intermediate Frequency Receiver Module For Use In Airborne Sar Applications
Tise, Bertice L.; Dubbert, Dale F.
2005-03-08
A digital IF receiver (DRX) module directly compatible with advanced radar systems such as synthetic aperture radar (SAR) systems. The DRX can combine a 1 G-Sample/sec 8-bit ADC with high-speed digital signal processor, such as high gate-count FPGA technology or ASICs to realize a wideband IF receiver. DSP operations implemented in the DRX can include quadrature demodulation and multi-rate, variable-bandwidth IF filtering. Pulse-to-pulse (Doppler domain) filtering can also be implemented in the form of a presummer (accumulator) and an azimuth prefilter. An out of band noise source can be employed to provide a dither signal to the ADC, and later be removed by digital signal processing. Both the range and Doppler domain filtering operations can be implemented using a unique pane architecture which allows on-the-fly selection of the filter decimation factor, and hence, the filter bandwidth. The DRX module can include a standard VME-64 interface for control, status, and programming. An interface can provide phase history data to the real-time image formation processors. A third front-panel data port (FPDP) interface can send wide bandwidth, raw phase histories to a real-time phase history recorder for ground processing.
Readout electronics for LGAD sensors
NASA Astrophysics Data System (ADS)
Alonso, O.; Franch, N.; Canals, J.; Palacio, F.; López, M.; Vilà, A.; Diéguez, A.; Carulla, M.; Flores, D.; Hidalgo, S.; Merlos, A.; Pellegrini, G.; Quirion, D.
2017-02-01
In this paper, an ASIC fabricated in 180 nm CMOS technology from AMS with the very front-end electronics used to readout LGAD sensors is presented as well as its experimental results. The front-end has the typical architecture for Si-strip readout, i.e., preamplification stage with a Charge Sensitive Amplifier (CSA) followed by a CR-RC shaper. Both amplifiers are based on a folded cascode structure with a PMOS input transistor and the shaper only uses passive elements for the feedback stage. The CSA has programmable gain and a configurable input stage in order to adapt to the different input capacitance of the LGAD sensors (pixelated, short and long strips) and to the different input signal (depending on the gain of the LGAD). The fabricated prototype has an area of 0.865 mm × 0.965 mm and includes the biasing circuit for the CSA and the shaper, 4 analog channels (CSA+shaper) and programmable charge injection circuits included for testing purposes. Noise and power analysis performed during simulation fixed the size of the input transistor to W/L = 860 μm/0.2 μm. The shaping time is fixed by design at 1 us and, in this ASIC version, the feedback elements of the shaper are passive, which means that the area of the shaper can be reduced using active elements in future versions. Finally, the different gains of the CSA have been selected to maintain an ENC below 400 electrons for a detector capacitor of 20 pF, with a power consumption of 150 μ W per channel.
High density, multi-range analog output Versa Module Europa board for control system applications
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singh, Kundan, E-mail: kundan@iuac.res.in; Das, Ajit Lal
2014-01-15
A new VMEDAC64, 12-bit 64 channel digital-to-analog converter, a Versa Module Europa (VME) module, features 64 analog voltage outputs with user selectable multiple ranges, has been developed for control system applications at Inter University Accelerator Centre. The FPGA (Field Programmable Gate Array) is the module's core, i.e., it implements the DAC control logic and complexity of VMEbus slave interface logic. The VMEbus slave interface and DAC control logic are completely designed and implemented on a single FPGA chip to achieve high density of 64 channels in a single width VME module and will reduce the module count in the controlmore » system applications, and hence will reduce the power consumption and cost of overall system. One of our early design goals was to develop the VME interface such that it can be easily integrated with the peripheral devices and satisfy the timing specifications of VME standard. The modular design of this module reduces the amount of time required to develop other custom modules for control system. The VME slave interface is written as a single component inside FPGA which will be used as a basic building block for any VMEbus interface project. The module offers multiple output voltage ranges depending upon the requirement. The output voltage range can be reduced or expanded by writing range selection bits in the control register. The module has programmable refresh rate and by default hold capacitors in the sample and hold circuit for each channel are charged periodically every 7.040 ms (i.e., update frequency 284 Hz). Each channel has software controlled output switch which disconnects analog output from the field. The modularity in the firmware design on FPGA makes the debugging very easy. On-board DC/DC converters are incorporated for isolated power supply for the analog section of the board.« less
Scaling single-wavelength optical interconnects to 180 Gb/s with PAM-M and pulse shaping
NASA Astrophysics Data System (ADS)
Dris, Stefanos; Bakopoulos, Paraskevas; Argyris, Nikolaos; Spatharakis, Christos; Avramopoulos, Hercules
2016-03-01
Faced with surging datacenter traffic demand, system designers are turning to multi-level optical modulation with direct detection as the means of reaching 100 Gb/s in a single optical lane; a further upgrade to 400 Gb/s is envisaged through wavelength-multiplexing of multiple 100 Gb/s strands. In terms of modulation formats, PAM-4 and PAM-8 are considered the front-runners, striking a good balance between bandwidth-efficiency and implementation complexity. In addition, the emergence of energy-efficient, high-speed CMOS digital-to-analog converters (DACs) opens up new possibilities: Spectral shaping through digital filtering will allow squeezing even more data through low-cost, low-bandwidth electro-optic components. In this work we demonstrate an optical interconnect based on an EAM that is driven directly with sub-volt electrical swing by a 65 GSa/s arbitrary waveform generator (AWG). Low-voltage drive is particularly attractive since it allows direct interfacing with the switch/server ASIC, eliminating the need for dedicated, power-hungry and expensive electrical drivers. Single-wavelength throughputs of 180 and 120 Gb/s are experimentally demonstrated with 60 Gbaud optical PAM-8 and PAM-4 respectively. Successful transmission over 1250 m SMF is achieved with direct-detection, using linear equalization via offline digital signal processing in order to overcome the strong bandwidth limitation of the overall link (~20 GHz). The suitability of Nyquist pulse shaping for optical interconnects is also investigated experimentally with PAM-4 and PAM-8, at a lower symbol rate of 40 Gbaud (limited by the sampling rate of the AWG). To the best of our knowledge, the rates achieved are the highest ever using optical PAM-M formats.
Faulkner, Jonathan; Hu, Bill X; Kish, Stephen; Hua, Fei
2009-11-03
New mathematical and laboratory methods have been developed for simulating groundwater flow and solute transport in karst aquifers having conduits imbedded in a porous medium, such as limestone. The Stokes equations are used to model the flow in the conduits and the Darcy equation is used for the flow in the matrix. The Beavers-Joseph interface boundary conditions are adopted to describe the flow exchange at the interface boundary between the two domains. A laboratory analog is used to simulate the conduit and matrix domains of a karst aquifer. The conduit domain is located at the bottom of the transparent plexiglas laboratory analog and glass beads occupy the remaining space to represent the matrix domain. Water flows into and out of the two domains separately and each has its own supply and outflow reservoirs. Water and solute are exchanged through an interface between the two domains. Pressure transducers located within the matrix and conduit domains of the analog provide data that is processed and stored in digital format. Dye tracing experiments are recorded using time-lapse imaging. The data and images produced are analyzed by a spatial analysis program. The experiments provide not only hydraulic head distribution but also capture solute front images and mass exchange measurements between the conduit and matrix domains. In the experiment, we measure and record pressures, and quantify flow rates and solute transport. The results present a plausible argument that laboratory analogs can characterize groundwater water flow, solute transport, and mass exchange between the conduit and matrix domains in a karst aquifer. The analog validates the predictions of a numerical model and demonstrates the need of laboratory analogs to provide verification of proposed theories and the calibration of mathematical models.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lemley, James; Furey, Michael
The BNL Microelectronics group has designed a series of custom ASICs in CMOS technology for use with Cadmium-Zink-Telluride (CdZnTe) radiation detectors, primarily in the field of nuclear spectroscopy. An increased demand for CdZnTe based detection systems that can operate in high flux X-ray inspection equipment makes it necessary to develop a new type of signal processing ASIC, one which can achieve moderate energy resolution at very high count rate. This work covers the development of a high-rate, low power ASIC that classifies events into one of five energy windows at rates up to 2 MHz/channel.
Performance study of SKIROC2/A ASIC for ILD Si-W ECAL
NASA Astrophysics Data System (ADS)
Suehara, T.; Sekiya, I.; Callier, S.; Balagura, V.; Boudry, V.; Brient, J.-C.; de la Taille, C.; Kawagoe, K.; Irles, A.; Magniette, F.; Nanni, J.; Pöschl, R.; Yoshioka, T.
2018-03-01
The ILD Si-W ECAL is a sampling calorimeter with tungsten absorber and highly segmented silicon layers for the International Large Detector (ILD), one of the two detector concepts for the International Linear Collider. SKIROC2 is an ASIC for the ILD Si-W ECAL. To investigate the issues found in prototype detectors, we prepared dedicated ASIC evaluation boards with either BGA sockets or directly soldered SKIROC2. We report a performance study with the evaluation boards, including signal-to-noise ratio and TDC performance with comparing SKIROC2 and an updated version, SKIROC2A.
Acid-sensing ion channels in pain and disease
Wemmie, John A.; Taugher, Rebecca J.; Kreple, Collin J.
2015-01-01
Why do neurons sense extracellular acid? In large part, this question has driven increasing investigation on acid-sensing ion channels (ASICs) in the CNS and the peripheral nervous system for the past two decades. Significant progress has been made in understanding the structure and function of ASICs at the molecular level. Studies aimed at clarifying their physiological importance have suggested roles for ASICs in pain, neurological and psychiatric disease. This Review highlights recent findings linking these channels to physiology and disease. In addition, it discusses some of the implications for therapy and points out questions that remain unanswered. PMID:23783197
A miniature on-chip multi-functional ECG signal processor with 30 µW ultra-low power consumption.
Liu, Xin; Zheng, Yuan Jin; Phyu, Myint Wai; Zhao, Bin; Je, Minkyu; Yuan, Xiao Jun
2010-01-01
In this paper, a miniature low-power Electrocardiogram (ECG) signal processing application specific integrated circuit (ASIC) chip is proposed. This chip provides multiple critical functions for ECG analysis using a systematic wavelet transform algorithm and a novel SRAM-based ASIC architecture, while achieves low cost and high performance. Using 0.18 µm CMOS technology and 1 V power supply, this ASIC chip consumes only 29 µW and occupies an area of 3 mm(2). This on-chip ECG processor is highly suitable for reliable real-time cardiac status monitoring applications.
Acid-sensing ion channels in pain and disease.
Wemmie, John A; Taugher, Rebecca J; Kreple, Collin J
2013-07-01
Why do neurons sense extracellular acid? In large part, this question has driven increasing investigation on acid-sensing ion channels (ASICs) in the CNS and the peripheral nervous system for the past two decades. Significant progress has been made in understanding the structure and function of ASICs at the molecular level. Studies aimed at clarifying their physiological importance have suggested roles for ASICs in pain, neurological and psychiatric disease. This Review highlights recent findings linking these channels to physiology and disease. In addition, it discusses some of the implications for therapy and points out questions that remain unanswered.
NASA Astrophysics Data System (ADS)
Gao, W.; Gan, B.; Li, X.; Wei, T.; Gao, D.; Hu, Y.
2015-04-01
In this paper, we present the development and performances of a radiation-hardened front-end readout application-specific integrated circuit (ASIC) dedicated to CZT detectors for a hard X-ray imager in space applications. The readout channel consists of a charge sensitive amplifier (CSA), a CR-RC shaper, a fast shaper, a discriminator and a driving buffer. With the additional digital filtering, the readout channel can achieve very low noise performances and low power dissipation. An eight-channel prototype ASIC is designed and fabricated in 0.35 μm CMOS process. The energy range of the detected X-rays is evaluated as 1.45 keV to 281 keV. The gain is larger than 100 mV/fC. The equivalent noise charge (ENC) of the ASIC is 53 e- at zero farad plus 10 e- per picofarad. The power dissipation is less than 4.4 mW/channel. Through the measurement with a CZT detector, the energy resolution is less than 3.45 keV (FWHM) under the irradiation of the radioactive source 241Am. The radiation effect experiments indicate that the proposed ASIC can resist the total ionization dose (TID) irradiation of higher than 200 krad (Si).
Asic developments for radiation imaging applications: The medipix and timepix family
NASA Astrophysics Data System (ADS)
Ballabriga, Rafael; Campbell, Michael; Llopart, Xavier
2018-01-01
Hybrid pixel detectors were developed to meet the requirements for tracking in the inner layers at the LHC experiments. With low input capacitance per channel (10-100 fF) it is relatively straightforward to design pulse processing readout electronics with input referred noise of ∼ 100 e-rms and pulse shaping times consistent with tagging of events to a single LHC bunch crossing providing clean 'images' of the ionising tracks generated. In the Medipix Collaborations the same concept has been adapted to provide practically noise hit free imaging in a wide range of applications. This paper reports on the development of three generations of readout ASICs. Two distinctive streams of development can be identified: the Medipix ASICs which integrate data from multiple hits on a pixel and provide the images in the form of frames and the Timepix ASICs who aim to send as much information about individual interactions as possible off-chip for further processing. One outstanding circumstance in the use of these devices has been their numerous successful applications, thanks to a large and active community of developers and users. That process has even permitted new developments for detectors for High Energy Physics. This paper reviews the ASICs themselves and details some of the many applications.
Development of Formulations for a-SiC and Manganese CMP and Post-CMP Cleaning of Cobalt
NASA Astrophysics Data System (ADS)
Lagudu, Uma Rames Krishna
We have investigated the chemical mechanical polishing (CMP) of amorphous SiC (a-SiC) and Mn and Post CMP cleaning of cobalt for various device applications. During the manufacture of copper interconnects using the damascene process the polishing of copper is followed by the polishing of the barrier material (Co, Mn, Ru and their alloys) and its post CMP cleaning. This is followed by the a-SiC hard mask CMP. Silicon carbide thin films, though of widespread use in microelectronic engineering, are difficult to process by CMP because of their hardness and chemical inertness. The earlier part of the SiC work discusses the development of slurries based on silica abrasives that resulted in high a-SiC removal rates (RRs). The ionic strength of the silica dispersion was found to play a significant role in enhancing material removal rate, while also providing very good post-polish surface-smoothness. For example, the addition of 50 mM potassium nitrate to a pH 8 aqueous slurry consisting of 10 wt % of silica abrasives and 1.47 M hydrogen peroxide increased the RR from about 150 nm/h to about 2100 nm/h. The role of ionic strength in obtaining such high RRs was investigated using surface zeta-potentials measurements and X-ray photoelectron spectroscopy (XPS). Evidently, hydrogen peroxide promoted the oxidation of Si and C to form weakly adhered species that were subsequently removed by the abrasive action of the silica particles. The effect of potassium nitrate in increasing material removal is attributed to the reduction in the electrostatic repulsion between the abrasive particles and the SiC surface because of screening of surface charges by the added electrolyte. We also show that transition metal compounds when used as additives to silica dispersions enhance a-SiC removal rates (RRs). Silica slurries containing potassium permanganate gave RRs as high as 2000 nm/h at pH 4. Addition of copper sulfate to this slurry further enhanced the RRs to ˜3500 nm/h at pH 6. Furthermore, addition of a low concentration of 250 ppm Brij-35 to this slurry suppressed the RRs of silicon dioxide to zero, while retaining the RRs of a-SiC at ˜2700 nm/h , a combination of RRs that is appropriate for hard mask polishing. The second part of this thesis focuses on the polishing of manganese which was proposed as a "self-forming" barrier material to prevent copper diffusion in advanced generation (22 nm and smaller) Si devices. A major challenge associated with such a self-forming Mn barrier for Cu interconnects in sub-22nm devices is galvanic corrosion that can occur at the Cu-Mn interface during chemical mechanical planarization. In the present work, it was shown that an aqueous solution of sucrose, BTA and potassium periodate reduces the corrosion potential gap between Cu and Mn to ˜ 0.01 V at pH 10 while also lowering the galvanic currents significantly and hence can be an excellent candidate for a polishing slurry. We discuss the role of these reagents and the inhibiting film that can be formed at the interface of the bimetallic system in this solution. Preliminary polishing results for Cu and Mn using a silica-based slurry formulated with this solution are also presented. The third part involves the development of compositions for Post CMP cleaning of cobalt barriers in advanced generation (22 nm and smaller). The thickness of the cobalt films was found to impact the corrosion behavior of the films. Thinner films of cobalt were found be more prone to galvanic corrosion in the presence of copper. The corrosion currents were low for both Cu and Co in all the solutions tested but the galvanic currents varied significantly. It was found that while BTA was not able to suppress the galvanic corrosion between Cu and Co (2000 A) at pH 8, either 60 mM of 3 Amino 1,2,4 triazole or 30 mM of 3 Amino 5 methyl thio 1,2,4 triazole were able to suppress the galvanic corrosion between Cu and Co (2000 A) to < 0.3 micro amperes per square cm at pH 8. These compositions however were not able to suppress the galvanic corrosion of Co (20 A) films. Changing the pH to 10 did not improve the results. Furthermore, addition of several complexing agents and other corrosion inhibitors also did not lower the Ecorr of Co (20 A) and Cu. Further experiments are being conducted to identify compositions to protect Co and Cu from corrosion. (Abstract shortened by UMI.).
Genetic variation in the ASIC3 gene influences blood pressure levels in Taiwanese.
Ko, Yu-Lin; Hsu, Lung-An; Wu, Semon; Teng, Ming-Sheng; Chang, Hsien-Hsun; Chen, Chih-Cheng; Cheng, Ching-Feng
2008-11-01
The acid-sensing ion channel 3 (ASIC3) is a ligand-gated cation channel activated by extracellular protons, and is associated with an exercise-induced pressor reflex and possibly autonomic imbalance. To test the statistical association between genetic polymorphisms of the ASIC3 gene and blood pressure (BP) variations in Taiwanese, 551 unrelated individuals (286 men and 265 women) were recruited from a routine health examination. The participants had no prior history of cardiovascular disease or medication use for hypertension. Six ASIC3 gene polymorphisms were genotyped; three were polymorphic, and only the rs2288646 polymorphism was associated with variations in BP among participants. Significantly higher systolic, diastolic, and mean BP were observed in participants carrying the rs2288646-A allele (P=0.034, 0.023, and 0.010, respectively). Significantly higher frequencies of the rs2288646-A-containing genotype were observed in normotensive, prehypertensive, and hypertensive subgroups (P for trend=0.026); and in those with higher systolic and diastolic BPs (P for trend=0.005 and P for trend=0.002, respectively). The association between the rs2288646-A allele and BP persisted even after adjustment for age, sex, BMI, and other metabolic factors. When a second independent group of 403 individuals was combined with the first group of 551 (n=954), a significantly higher frequency of the rs2288646-A-containing genotype was observed in participants with hypertension (9.7 vs. 4.0%, P=0.003). Our data showed an independent association between an ASIC3 genetic polymorphism and BP variations in Taiwanese. These results suggest that the ASIC3 may be involved in BP regulation.
A heteromeric Texas coral snake toxin targets acid-sensing ion channels to produce pain.
Bohlen, Christopher J; Chesler, Alexander T; Sharif-Naeini, Reza; Medzihradszky, Katalin F; Zhou, Sharleen; King, David; Sánchez, Elda E; Burlingame, Alma L; Basbaum, Allan I; Julius, David
2011-11-16
Natural products that elicit discomfort or pain represent invaluable tools for probing molecular mechanisms underlying pain sensation. Plant-derived irritants have predominated in this regard, but animal venoms have also evolved to avert predators by targeting neurons and receptors whose activation produces noxious sensations. As such, venoms provide a rich and varied source of small molecule and protein pharmacophores that can be exploited to characterize and manipulate key components of the pain-signalling pathway. With this in mind, here we perform an unbiased in vitro screen to identify snake venoms capable of activating somatosensory neurons. Venom from the Texas coral snake (Micrurus tener tener), whose bite produces intense and unremitting pain, excites a large cohort of sensory neurons. The purified active species (MitTx) consists of a heteromeric complex between Kunitz- and phospholipase-A2-like proteins that together function as a potent, persistent and selective agonist for acid-sensing ion channels (ASICs), showing equal or greater efficacy compared with acidic pH. MitTx is highly selective for the ASIC1 subtype at neutral pH; under more acidic conditions (pH < 6.5), MitTx massively potentiates (>100-fold) proton-evoked activation of ASIC2a channels. These observations raise the possibility that ASIC channels function as coincidence detectors for extracellular protons and other, as yet unidentified, endogenous factors. Purified MitTx elicits robust pain-related behaviour in mice by activation of ASIC1 channels on capsaicin-sensitive nerve fibres. These findings reveal a mechanism whereby snake venoms produce pain, and highlight an unexpected contribution of ASIC1 channels to nociception. © 2011 Macmillan Publishers Limited. All rights reserved
Spinal afferent neurons projecting to the rat lung and pleura express acid sensitive channels
Groth, Michael; Helbig, Tanja; Grau, Veronika; Kummer, Wolfgang; Haberberger, Rainer V
2006-01-01
Background The acid sensitive ion channels TRPV1 (transient receptor potential vanilloid receptor-1) and ASIC3 (acid sensing ion channel-3) respond to tissue acidification in the range that occurs during painful conditions such as inflammation and ischemia. Here, we investigated to which extent they are expressed by rat dorsal root ganglion neurons projecting to lung and pleura, respectively. Methods The tracer DiI was either injected into the left lung or applied to the costal pleura. Retrogradely labelled dorsal root ganglion neurons were subjected to triple-labelling immunohistochemistry using antisera against TRPV1, ASIC3 and neurofilament 68 (marker for myelinated neurons), and their soma diameter was measured. Results Whereas 22% of pulmonary spinal afferents contained neither channel-immunoreactivity, at least one is expressed by 97% of pleural afferents. TRPV1+/ASIC3- neurons with probably slow conduction velocity (small soma, neurofilament 68-negative) were significantly more frequent among pleural (35%) than pulmonary afferents (20%). TRPV1+/ASIC3+ neurons amounted to 14 and 10% respectively. TRPV1-/ASIC3+ neurons made up between 44% (lung) and 48% (pleura) of neurons, and half of them presumably conducted in the A-fibre range (larger soma, neurofilament 68-positive). Conclusion Rat pleural and pulmonary spinal afferents express at least two different acid-sensitive channels that make them suitable to monitor tissue acidification. Patterns of co-expression and structural markers define neuronal subgroups that can be inferred to subserve different functions and may initiate specific reflex responses. The higher prevalence of TRPV1+/ASIC3- neurons among pleural afferents probably reflects the high sensitivity of the parietal pleura to painful stimuli. PMID:16813657
NASA Technical Reports Server (NTRS)
Wernlund, James V.
1993-01-01
HARRIS, under contract with NASA Lewis, has developed a hard decision BCH (Bose-Chaudhuri-Hocquenghem) triple error correcting block CODEC ASIC, that can be used in either a bursted or continuous mode. the ASIC contains both encoder and decoder functions, programmable lock thresholds, and PSK related functions. The CODEC provides up to 4 dB of coding gain for data rates up to 300 Mbps. The overhead is selectable from 7/8 to 15/16 resulting in minimal band spreading, for a given BER. Many of the internal calculations are brought out enabling the CODEC to be incorporated in more complex designs. The ASIC has been tested in BPSK, QPSK and 16-ary PSK link simulators and found to perform to within 0.1 dB of theory for BER's of 10(exp -2) to 10(exp -9). The ASIC itself, being a hard decision CODEC, is not limited to PSK modulation formats. Unlike most hard decision CODEC's, the HARRIS CODEC doesn't upgrade BER performance significantly at high BER's but rather becomes transparent.
A Muscle Fibre Conduction Velocity Tracking ASIC for Local Fatigue Monitoring.
Koutsos, Ermis; Cretu, Vlad; Georgiou, Pantelis
2016-12-01
Electromyography analysis can provide information about a muscle's fatigue state by estimating Muscle Fibre Conduction Velocity (MFCV), a measure of the travelling speed of Motor Unit Action Potentials (MUAPs) in muscle tissue. MFCV better represents the physical manifestations of muscle fatigue, compared to the progressive compression of the myoelectic Power Spectral Density, hence it is more suitable for a muscle fatigue tracking system. This paper presents a novel algorithm for the estimation of MFCV using single threshold bit-stream conversion and a dedicated application-specified integrated circuit (ASIC) for its implementation, suitable for a compact, wearable and easy to use muscle fatigue monitor. The presented ASIC is implemented in a commercially available AMS 0.35 [Formula: see text] CMOS technology and utilizes a bit-stream cross-correlator that estimates the conduction velocity of the myoelectric signal in real time. A test group of 20 subjects was used to evaluate the performance of the developed ASIC, achieving good accuracy with an error of only 3.2% compared to Matlab.
Test systems of the STS-XYTER2 ASIC: from wafer-level to in-system verification
NASA Astrophysics Data System (ADS)
Kasinski, Krzysztof; Zubrzycka, Weronika
2016-09-01
The STS/MUCH-XYTER2 ASIC is a full-size prototype chip for the Silicon Tracking System (STS) and Muon Chamber (MUCH) detectors in the new fixed-target experiment Compressed Baryonic Matter (CBM) at FAIR-center, Darmstadt, Germany. The STS assembly includes more than 14000 ASICs. The complicated, time-consuming, multi-step assembly process of the detector building blocks and tight quality assurance requirements impose several intermediate testing to be performed for verifying crucial assembly steps (e.g. custom microcable tab-bonding before wire-bonding to the PCB) and - if necessary - identifying channels or modules for rework. The chip supports the multi-level testing with different probing / contact methods (wafer probe-card, pogo-probes, in-system tests). A huge number of ASICs to be tested restricts the number and kind of tests possible to be performed within a reasonable time. The proposed architectures of test stand equipment and a brief summary of methodologies are presented in this paper.
A Gigabit-per-Second Ka-Band Demonstration Using a Reconfigurable FPGA Modulator
NASA Technical Reports Server (NTRS)
Lee, Dennis; Gray, Andrew A.; Kang, Edward C.; Tsou, Haiping; Lay, Norman E.; Fong, Wai; Fisher, Dave; Hoy, Scott
2005-01-01
Gigabit-per-second communications have been a desired target for future NASA Earth science missions, and for potential manned lunar missions. Frequency bandwidth at S-band and X-band is typically insufficient to support missions at these high data rates. In this paper, we present the results of a 1 Gbps 32-QAM end-to-end experiment at Ka-band using a reconfigurable Field Programmable Gate Array (FPGA) baseband modulator board. Bit error rate measurements of the received signal using a software receiver demonstrate the feasibility of using ultra-high data rates at Ka-band, although results indicate that error correcting coding and/or modulator predistortion must be implemented in addition. Also, results of the demonstration validate the low-cost, MOS-based reconfigurable modulator approach taken to development of a high rate modulator, as opposed to more expensive ASIC or pure analog approaches.
Angular Positioning Sensor for Space Mechanisms
NASA Astrophysics Data System (ADS)
Steiner, Nicolas; Chapuis, Dominique
2013-09-01
Angular position sensors are used on various rotating mechanisms such as solar array drive mechanisms, antenna pointing mechanisms, scientific instruments, motors or actuators.Now a days, potentiometers and encoders are mainly used for angular measurement purposes. Both of them have their own pros and cons.As alternative, Ruag Space Switzerland Nyon (RSSN) is developing and qualifying two innovative technologies of angular position sensors which offer easy implementation, medium to very high lifetime and high flexibility with regards to the output signal shape/type.The Brushed angular position sensor uses space qualified processes which are already flying on RSSN's sliprings for many years. A large variety of output signal shape can be implemented to fulfill customer requirements (digital, analog, customized, etc.).The contactless angular position sensor consists in a new radiation hard Application Specific Integrated Circuit (ASIC) based on the Hall effect and providing the angular position without complex processing algorithm.
2011-01-01
Background Acid-sensing ion channels (ASICs) have a significant role in the sensation of pain and constitute an important target for the search of new antinociceptive drugs. In this work we studied the antinociceptive properties of the BM-21 extract, obtained from the sea grass Thalassia testudinum, in chemical and thermal models of nociception in mice. The action of the BM-21 extract and the major phenolic component isolated from this extract, a sulphated flavone glycoside named thalassiolin B, was studied in the chemical nociception test and in the ASIC currents of the dorsal root ganglion (DRG) neurons obtained from Wistar rats. Results Behavioral antinociceptive experiments were made on male OF-1 mice. Single oral administration of BM-21 produced a significant inhibition of chemical nociception caused by acetic acid and formalin (specifically during its second phase), and increased the reaction time in the hot plate test. Thalassiolin B reduced the licking behavior during both the phasic and tonic phases in the formalin test. It was also found that BM-21 and thalassiolin B selectively inhibited the fast desensitizing (τ < 400 ms) ASIC currents in DRG neurons obtained from Wistar rats, with a nonsignificant action on ASIC currents with a slow desensitizing time-course. The action of thalassiolin B shows no pH or voltage dependence nor is it modified by steady-state ASIC desensitization or voltage. The high concentration of thalassiolin B in the extract may account for the antinociceptive action of BM-21. Conclusions To our knowledge, this is the first report of an ASIC-current inhibitor derived of a marine-plant extract, and in a phenolic compound. The antinociceptive effects of BM-21 and thalassiolin B may be partially because of this action on the ASICs. That the active components of the extract are able to cross the blood-brain barrier gives them an additional advantage for future uses as tools to study pain mechanisms with a potential therapeutic application. PMID:21261973
Garateix, Anoland; Salceda, Emilio; Menéndez, Roberto; Regalado, Erik L; López, Omar; García, Teidy; Morales, Ruth A; Laguna, Abilio; Thomas, Olivier P; Soto, Enrique
2011-01-24
Acid-sensing ion channels (ASICs) have a significant role in the sensation of pain and constitute an important target for the search of new antinociceptive drugs. In this work we studied the antinociceptive properties of the BM-21 extract, obtained from the sea grass Thalassia testudinum, in chemical and thermal models of nociception in mice. The action of the BM-21 extract and the major phenolic component isolated from this extract, a sulphated flavone glycoside named thalassiolin B, was studied in the chemical nociception test and in the ASIC currents of the dorsal root ganglion (DRG) neurons obtained from Wistar rats. Behavioral antinociceptive experiments were made on male OF-1 mice. Single oral administration of BM-21 produced a significant inhibition of chemical nociception caused by acetic acid and formalin (specifically during its second phase), and increased the reaction time in the hot plate test. Thalassiolin B reduced the licking behavior during both the phasic and tonic phases in the formalin test. It was also found that BM-21 and thalassiolin B selectively inhibited the fast desensitizing (τ < 400 ms) ASIC currents in DRG neurons obtained from Wistar rats, with a nonsignificant action on ASIC currents with a slow desensitizing time-course. The action of thalassiolin B shows no pH or voltage dependence nor is it modified by steady-state ASIC desensitization or voltage. The high concentration of thalassiolin B in the extract may account for the antinociceptive action of BM-21. To our knowledge, this is the first report of an ASIC-current inhibitor derived of a marine-plant extract, and in a phenolic compound. The antinociceptive effects of BM-21 and thalassiolin B may be partially because of this action on the ASICs. That the active components of the extract are able to cross the blood-brain barrier gives them an additional advantage for future uses as tools to study pain mechanisms with a potential therapeutic application.
Monolithic integration of GMR sensors for standard CMOS-IC current sensing
NASA Astrophysics Data System (ADS)
De Marcellis, A.; Reig, C.; Cubells-Beltrán, M.-D.; Madrenas, J.; Santos, J. D.; Cardoso, S.; Freitas, P. P.
2017-09-01
In this work we report on the development of Giant Magnetoresistive (GMR) sensors for off-line current measurements in standard integrated circuits. An ASIC has been specifically designed and fabricated in the well-known AMS-0.35 μm CMOS technology, including the electronic circuitry for sensor interfacing. It implements an oscillating circuit performing a voltage-to-frequency conversion. Subsequently, a fully CMOS-compatible low temperature post-process has been applied for depositing the GMR sensing devices in a full-bridge configuration onto the buried current straps. Sensitivity and resolution of these sensors have been investigated achieving experimental results that show a detection sensitivity of about 100 Hz/mA, with a resolution of about 5 μA.
Integrated input protection against discharges for Micro Pattern Gas Detectors readout ASICs
NASA Astrophysics Data System (ADS)
Fiutowski, T.; Dąbrowski, W.; Koperny, S.; Wiącek, P.
2017-02-01
Immunity against possible random discharges inside active detector volume of MPGDs is one of the key aspects that should be addressed in the design of the front-end electronics. This issue becomes particularly critical for systems with high channel counts and high density readout employing the front-end electronics built as multichannel ASICs implemented in modern CMOS technologies, for which the breakdown voltages are in the range of a few Volts. The paper presents the design of various input protection structures integrated in the ASIC manufactured in a 350 nm CMOS process and test results using an electrical circuit to mimic discharges in the detectors.
A Low Noise CMOS Readout Based on a Polymer-Coated SAW Array for Miniature Electronic Nose
Wu, Cheng-Chun; Liu, Szu-Chieh; Chiu, Shih-Wen; Tang, Kea-Tiong
2016-01-01
An electronic nose (E-Nose) is one of the applications for surface acoustic wave (SAW) sensors. In this paper, we present a low-noise complementary metal–oxide–semiconductor (CMOS) readout application-specific integrated circuit (ASIC) based on an SAW sensor array for achieving a miniature E-Nose. The center frequency of the SAW sensors was measured to be approximately 114 MHz. Because of interference between the sensors, we designed a low-noise CMOS frequency readout circuit to enable the SAW sensor to obtain frequency variation. The proposed circuit was fabricated in Taiwan Semiconductor Manufacturing Company (TSMC) 0.18 μm 1P6M CMOS process technology. The total chip size was nearly 1203 × 1203 μm2. The chip was operated at a supply voltage of 1 V for a digital circuit and 1.8 V for an analog circuit. The least measurable difference between frequencies was 4 Hz. The detection limit of the system, when estimated using methanol and ethanol, was 0.1 ppm. Their linearity was in the range of 0.1 to 26,000 ppm. The power consumption levels of the analog and digital circuits were 1.742 mW and 761 μW, respectively. PMID:27792131
A Low Noise CMOS Readout Based on a Polymer-Coated SAW Array for Miniature Electronic Nose.
Wu, Cheng-Chun; Liu, Szu-Chieh; Chiu, Shih-Wen; Tang, Kea-Tiong
2016-10-25
An electronic nose (E-Nose) is one of the applications for surface acoustic wave (SAW) sensors. In this paper, we present a low-noise complementary metal-oxide-semiconductor (CMOS) readout application-specific integrated circuit (ASIC) based on an SAW sensor array for achieving a miniature E-Nose. The center frequency of the SAW sensors was measured to be approximately 114 MHz. Because of interference between the sensors, we designed a low-noise CMOS frequency readout circuit to enable the SAW sensor to obtain frequency variation. The proposed circuit was fabricated in Taiwan Semiconductor Manufacturing Company (TSMC) 0.18 μm 1P6M CMOS process technology. The total chip size was nearly 1203 × 1203 μm². The chip was operated at a supply voltage of 1 V for a digital circuit and 1.8 V for an analog circuit. The least measurable difference between frequencies was 4 Hz. The detection limit of the system, when estimated using methanol and ethanol, was 0.1 ppm. Their linearity was in the range of 0.1 to 26,000 ppm. The power consumption levels of the analog and digital circuits were 1.742 mW and 761 μW, respectively.
NASA Astrophysics Data System (ADS)
Fang, X. C.; Hu-Guo, Ch.; Ollivier-Henry, N.; Brasse, D.; Hu, Y.
2010-06-01
This paper represents the design of a low-noise, wide band multi-channel readout integrated circuit (IC) used as front end readout electronics of avalanche photo diodes (APD) dedicated to a small animal positron emission tomography (PET) system. The first ten-channel prototype chip (APD-Chip) of the analog parts has been designed and fabricated in a 0.35 μm CMOS process. Every channel of the APD_Chip includes a charge-sensitive preamplifier (CSA), a CR-(RC)2 shaper, and an analog buffer. In a channel, the CSA reads charge signals (10 bits dynamic range) from an APD array having 10 pF of capacitance per pixel. A linearized degenerated differential pair which ensures high linearity in all dynamical range is used as the high feedback resistor for preventing pile up of signals. The designed CSA has the capability of compensating automatically up to 200 nA leakage current from the detector. The CR-(RC)2 shaper filters and shapes the output signal of the CSA. An equivalent input noise charge obtained from test is 275 e -+ 10 e-/pF. In this paper the prototype is presented for both its theoretical analysis and its test results.
The design and development of low- and high-voltage ASICs for space-borne CCD cameras
NASA Astrophysics Data System (ADS)
Waltham, N.; Morrissey, Q.; Clapp, M.; Bell, S.; Jones, L.; Torbet, M.
2017-12-01
The CCD remains the pre-eminent visible and UV wavelength image sensor in space science, Earth and planetary remote sensing. However, the design of space-qualified CCD readout electronics is a significant challenge with requirements for low-volume, low-mass, low-power, high-reliability and tolerance to space radiation. Space-qualified components are frequently unavailable and up-screened commercial components seldom meet project or international space agency requirements. In this paper, we describe an alternative approach of designing and space-qualifying a series of low- and high-voltage mixed-signal application-specific integrated circuits (ASICs), the ongoing development of two low-voltage ASICs with successful flight heritage, and two new high-voltage designs. A challenging sub-system of any CCD camera is the video processing and digitisation electronics. We describe recent developments to improve performance and tolerance to radiation-induced single event latchup of a CCD video processing ASIC originally developed for NASA's Solar Terrestrial Relations Observatory and Solar Dynamics Observatory. We also describe a programme to develop two high-voltage ASICs to address the challenges presented with generating a CCD's bias voltages and drive clocks. A 0.35 μm, 50 V tolerant, CMOS process has been used to combine standard low-voltage 3.3 V transistors with high-voltage 50 V diffused MOSFET transistors that enable output buffers to drive CCD bias drains, gates and clock electrodes directly. We describe a CCD bias voltage generator ASIC that provides 24 independent and programmable 0-32 V outputs. Each channel incorporates a 10-bit digital-to-analogue converter, provides current drive of up to 20 mA into loads of 10 μF, and includes current-limiting and short-circuit protection. An on-chip telemetry system with a 12-bit analogue-to-digital converter enables the outputs and multiple off-chip camera voltages to be monitored. The ASIC can drive one or more CCDs and replaces the many discrete components required in current cameras. We also describe a CCD clock driver ASIC that provides six independent and programmable drivers with high-current capacity. The device enables various CCD clock parameters to be programmed independently, for example the clock-low and clock-high voltage levels, and the clock-rise and clock-fall times, allowing configuration for serial clock frequencies in the range 0.1-2 MHz and image clock frequencies in the range 10-100 kHz. Finally, we demonstrate the impact and importance of this technology for the development of compact, high-performance and low-power integrated focal plane electronics.
Joch, Monica; Ase, Ariel R.; Chen, Carol X.-Q.; MacDonald, Penny A.; Kontogiannea, Maria; Corera, Amadou T.; Brice, Alexis
2007-01-01
Mutations in the parkin gene result in an autosomal recessive juvenile-onset form of Parkinson's disease. As an E3 ubiquitin-ligase, parkin promotes the attachment of ubiquitin onto specific substrate proteins. Defects in the ubiquitination of parkin substrates are therefore believed to lead to neurodegeneration in Parkinson's disease. Here, we identify the PSD-95/Discs-large/Zona Occludens-1 (PDZ) protein PICK1 as a novel parkin substrate. We find that parkin binds PICK1 via a PDZ-mediated interaction, which predominantly promotes PICK1 monoubiquitination rather than polyubiquitination. Consistent with monoubiquitination and recent work implicating parkin in proteasome-independent pathways, parkin does not promote PICK1 degradation. However, parkin regulates the effects of PICK1 on one of its other PDZ partners, the acid-sensing ion channel (ASIC). Overexpression of wild-type, but not PDZ binding– or E3 ubiquitin-ligase–defective parkin abolishes the previously described, protein kinase C-induced, PICK1-dependent potentiation of ASIC2a currents in non-neuronal cells. Conversely, the loss of parkin in hippocampal neurons from parkin knockout mice unmasks prominent potentiation of native ASIC currents, which is normally suppressed by endogenous parkin in wild-type neurons. Given that ASIC channels contribute to excitotoxicity, our work provides a mechanism explaining how defects in parkin-mediated PICK1 monoubiquitination could enhance ASIC activity and thereby promote neurodegeneration in Parkinson's disease. PMID:17553932
Acid-Sensing Ion Channel Pharmacology, Past, Present, and Future ….
Rash, Lachlan D
2017-01-01
pH is one of the most strictly controlled parameters in mammalian physiology. An extracellular pH of ~7.4 is crucial for normal physiological processes, and perturbations to this have profound effects on cell function. Acidic microenvironments occur in many physiological and pathological conditions, including inflammation, bone remodeling, ischemia, trauma, and intense synaptic activity. Cells exposed to these conditions respond in different ways, from tumor cells that thrive to neurons that are either suppressed or hyperactivated, often fatally. Acid-sensing ion channels (ASICs) are primary pH sensors in mammals and are expressed widely in neuronal and nonneuronal cells. There are six main subtypes of ASICs in rodents that can form homo- or heteromeric channels resulting in many potential combinations. ASICs are present and activated under all of the conditions mentioned earlier, suggesting that they play an important role in how cells respond to acidosis. Compared to many other ion channel families, ASICs were relatively recently discovered-1997-and there is a substantial lack of potent, subtype-selective ligands that can be used to elucidate their structural and functional properties. In this chapter I cover the history of ASIC channel pharmacology, which began before the proteins were even identified, and describe the current arsenal of tools available, their limitations, and take a glance into the future to predict from where new tools are likely to emerge. © 2017 Elsevier Inc. All rights reserved.
Low-power low-noise mixed-mode VLSI ASIC for infinite dynamic range imaging applications
NASA Astrophysics Data System (ADS)
Turchetta, Renato; Hu, Y.; Zinzius, Y.; Colledani, C.; Loge, A.
1998-11-01
Solid state solutions for imaging are mainly represented by CCDs and, more recently, by CMOS imagers. Both devices are based on the integration of the total charge generated by the impinging radiation, with no processing of the single photon information. The dynamic range of these devices is intrinsically limited by the finite value of noise. Here we present the design of an architecture which allows efficient, in-pixel, noise reduction to a practically zero level, thus allowing infinite dynamic range imaging. A detailed calculation of the dynamic range is worked out, showing that noise is efficiently suppressed. This architecture is based on the concept of single-photon counting. In each pixel, we integrate both the front-end, low-noise, low-power analog part and the digital part. The former consists of a charge preamplifier, an active filter for optimal noise bandwidth reduction, a buffer and a threshold comparator, and the latter is simply a counter, which can be programmed to act as a normal shift register for the readout of the counters' contents. Two different ASIC's based on this concept have been designed for different applications. The first one has been optimized for silicon edge-on microstrips detectors, used in a digital mammography R and D project. It is a 32-channel circuit, with a 16-bit binary static counter.It has been optimized for a relatively large detector capacitance of 5 pF. Noise has been measured to be equal to 100 + 7*Cd (pF) electron rms with the digital part, showing no degradation of the noise performances with respect to the design values. The power consumption is 3.8mW/channel for a peaking time of about 1 microsecond(s) . The second circuit is a prototype for pixel imaging. The total active area is about (250 micrometers )**2. The main differences of the electronic architecture with respect to the first prototype are: i) different optimization of the analog front-end part for low-capacitance detectors, ii) in- pixel 4-bit comparator-offset compensation, iii) 15-bit pseudo-random counter. The power consumption is 255 (mu) W/channel for a peaking time of 300 ns and an equivalent noise charge of 185 + 97*Cd electrons rms. Simulation and experimental result as well as imaging results will be presented.
Sauro, Salvatore; Osorio, Raquel; Watson, Timothy F; Toledano, Manuel
2015-07-01
The study aimed at evaluating the remineralization of acid-etched dentin pre-treated with primers containing biomimetic analogs and bonded using an ion-releasing light-curable resin-based material. An experimental etch-and-rinse adhesive system filled with Ca(2+), PO4(3-)-releasing Ca-Silicate micro-fillers was created along with two experimental primers containing biomimetic analogs such as sodium trimetaphosphate (TMP) and/or polyaspartic acid (PLA). Dentin specimens etched with 37% H3PO4 were pre-treated with two different aqueous primers containing the polyanionic biomimetic analogs or deionized water and subsequently bonded using the experimental resin-based materials. The specimens were sectioned and analyzed by AFM/nanoindentation to evaluate changes in the modulus of elasticity (Ei) across the resin-dentin interface at different AS storage periods (up to 90 days). Raman cluster analysis was also performed to evaluate the chemical changes along the interface. The phosphate uptake by the acid-etched dentin was evaluated using the ATR-FTIR. Additional resin-dentin specimens were tested for microtensile bond strength. SEM examination was performed after de-bonding, while confocal laser microscopy was used to evaluate the interfaces ultramorphology and micropermeability. Both biomimetic primers induced phosphate uptake by acid-etched dentin. Specimens created with the ion-releasing resin in combination with the pre-treatment primers containing either PLA and TMA showed the greatest recovery of the Ei of the hybrid layer, with no decrease in μTBS (p>0.05) after 3-month AS storage. The ion-releasing resin applied after use of the biomimetic primers showed the greatest reduction in micropermeability due to mineral precipitation; these results were confirmed using SEM. The use of the ion-releasing resin-based system applied to acid-etched dentin pre-treated with biomimetic primers containing analogs of phosphoproteins such as poly-l-aspartic acid and/or sodium trimetaphosphate provides a suitable bonding approach for biomimetic remineralization of resin-dentin interfaces. Copyright © 2015 Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.
BAE Systems Radiation Hardened SpaceWire ASIC and Roadmap
NASA Technical Reports Server (NTRS)
Berger, Richard; Milliser, Myrna; Kapcio, Paul; Stanley, Dan; Moser, David; Koehler, Jennifer; Rakow, Glenn; Schnurr, Richard
2006-01-01
An Application Specific Integrated Circuit (ASIC) that implements the SpaceWire protocol has been developed in a radiation hardened 0.25 micron CMOS, technology. This effort began in March 2003 as a joint development between the NASA Goddard Space Flight Center (GSFC) and BAE Systems. The BAE Systems SpaceWire ASlC is comprised entirely of reusable core elements, many of which are already flight-proven. It incorporates a 4-port SpaceWire router with two local ports, dual PC1 bus interfaces, a microcontroller, 32KB of internal memory, -and a memory controller for additional external memory use. The SpaceWire ASlC is planned for use on both the Geostationary Operational Environmental Satellites (GOES)-R and the Lunar Reconnaissance Orbiter (LRO). Engineering parts have already been delivered to both programs. This paper discusses the SpaceWire protocol and those elements of it that have been built into the current SpaceWire reusable core. There are features within the core that go beyond the current standard that can be enabled or disabled by the user and these will be described. The adaptation of SpaceWire to BAE Systems' On Chip Bus (OCB) for compatibility with the other reusable cores will be discussed. Optional configurations within user systems will be shown. The physical imp!ementation of the design will be described and test results from the hardware will be discussed. Finally, the BAE Systems roadmap for SpaceWire developments will be discussed, including some products already in design as well as longer term plans.
Hardware and software status of QCDOC
NASA Astrophysics Data System (ADS)
Boyle, P. A.; Chen, D.; Christ, N. H.; Clark, M.; Cohen, S. D.; Cristian, C.; Dong, Z.; Gara, A.; Joó, B.; Jung, C.; Kim, C.; Levkova, L.; Liao, X.; Liu, G.; Mawhinney, R. D.; Ohta, S.; Petrov, K.; Wettig, T.; Yamaguchi, A.
2004-03-01
QCDOC is a massively parallel supercomputer whose processing nodes are based on an application-specific integrated circuit (ASIC). This ASIC was custom-designed so that crucial lattice QCD kernels achieve an overall sustained performance of 50% on machines with several 10,000 nodes. This strong scalability, together with low power consumption and a price/performance ratio of $1 per sustained MFlops, enable QCDOC to attack the most demanding lattice QCD problems. The first ASICs became available in June of 2003, and the testing performed so far has shown all systems functioning according to specification. We review the hardware and software status of QCDOC and present performance figures obtained in real hardware as well as in simulation.
GET: A generic electronics system for TPCs and nuclear physics instrumentation
NASA Astrophysics Data System (ADS)
Pollacco, E. C.; Grinyer, G. F.; Abu-Nimeh, F.; Ahn, T.; Anvar, S.; Arokiaraj, A.; Ayyad, Y.; Baba, H.; Babo, M.; Baron, P.; Bazin, D.; Beceiro-Novo, S.; Belkhiria, C.; Blaizot, M.; Blank, B.; Bradt, J.; Cardella, G.; Carpenter, L.; Ceruti, S.; De Filippo, E.; Delagnes, E.; De Luca, S.; De Witte, H.; Druillole, F.; Duclos, B.; Favela, F.; Fritsch, A.; Giovinazzo, J.; Gueye, C.; Isobe, T.; Hellmuth, P.; Huss, C.; Lachacinski, B.; Laffoley, A. T.; Lebertre, G.; Legeard, L.; Lynch, W. G.; Marchi, T.; Martina, L.; Maugeais, C.; Mittig, W.; Nalpas, L.; Pagano, E. V.; Pancin, J.; Poleshchuk, O.; Pedroza, J. L.; Pibernat, J.; Primault, S.; Raabe, R.; Raine, B.; Rebii, A.; Renaud, M.; Roger, T.; Roussel-Chomaz, P.; Russotto, P.; Saccà, G.; Saillant, F.; Sizun, P.; Suzuki, D.; Swartz, J. A.; Tizon, A.; Usher, N.; Wittwer, G.; Yang, J. C.
2018-04-01
General Electronics for TPCs (GET) is a generic, reconfigurable and comprehensive electronics and data-acquisition system for nuclear physics instrumentation of up to 33792 channels. The system consists of a custom-designed ASIC for signal processing, front-end cards that each house 4 ASIC chips and digitize the data in parallel through 12-bit ADCs, concentration boards to read and process the digital data from up to 16 ASICs, a 3-level trigger and master clock module to trigger the system and synchronize the data, as well as all of the associated firmware, communication and data-acquisition software. An overview of the system including its specifications and measured performances are presented.
Silicon pixel-detector R&D for CLIC
NASA Astrophysics Data System (ADS)
Nürnberg, A.
2016-11-01
The physics aims at the future CLIC high-energy linear e+e- collider set very high precision requirements on the performance of the vertex and tracking detectors. Moreover, these detectors have to be well adapted to the experimental conditions, such as the time structure of the collisions and the presence of beam-induced backgrounds. The principal challenges are: a point resolution of a few μm, ultra-low mass (~ 0.2%X0 per layer for the vertex region and ~ 1%X0 per layer for the outer tracker), very low power dissipation (compatible with air-flow cooling in the inner vertex region) and pulsed power operation, complemented with ~ 10 ns time stamping capabilities. A highly granular all-silicon vertex and tracking detector system is under development, following an integrated approach addressing simultaneously the physics requirements and engineering constraints. For the vertex-detector region, hybrid pixel detectors with small pitch (25 μm) and analog readout are explored. For the outer tracking region, both hybrid concepts and fully integrated CMOS sensors are under consideration. The feasibility of ultra-thin sensor layers is validated with Timepix3 readout ASICs bump bonded to active edge planar sensors with 50 μm to 150 μm thickness. Prototypes of CLICpix readout ASICs implemented in 6525 nm CMOS technology with 25 μm pixel pitch have been produced. Hybridisation concepts have been developed for interconnecting these chips either through capacitive coupling to active HV-CMOS sensors or through bump-bonding to planar sensors. Recent R&D achievements include results from beam tests with all types of hybrid assemblies. Simulations based on Geant4 and TCAD are used to validate the experimental results and to assess and optimise the performance of various detector designs.
An infrastructure for accurate characterization of single-event transients in digital circuits.
Savulimedu Veeravalli, Varadan; Polzer, Thomas; Schmid, Ulrich; Steininger, Andreas; Hofbauer, Michael; Schweiger, Kurt; Dietrich, Horst; Schneider-Hornstein, Kerstin; Zimmermann, Horst; Voss, Kay-Obbe; Merk, Bruno; Hajek, Michael
2013-11-01
We present the architecture and a detailed pre-fabrication analysis of a digital measurement ASIC facilitating long-term irradiation experiments of basic asynchronous circuits, which also demonstrates the suitability of the general approach for obtaining accurate radiation failure models developed in our FATAL project. Our ASIC design combines radiation targets like Muller C-elements and elastic pipelines as well as standard combinational gates and flip-flops with an elaborate on-chip measurement infrastructure. Major architectural challenges result from the fact that the latter must operate reliably under the same radiation conditions the target circuits are exposed to, without wasting precious die area for a rad-hard design. A measurement architecture based on multiple non-rad-hard counters is used, which we show to be resilient against double faults, as well as many triple and even higher-multiplicity faults. The design evaluation is done by means of comprehensive fault injection experiments, which are based on detailed Spice models of the target circuits in conjunction with a standard double-exponential current injection model for single-event transients (SET). To be as accurate as possible, the parameters of this current model have been aligned with results obtained from 3D device simulation models, which have in turn been validated and calibrated using micro-beam radiation experiments at the GSI in Darmstadt, Germany. For the latter, target circuits instrumented with high-speed sense amplifiers have been used for analog SET recording. Together with a probabilistic analysis of the sustainable particle flow rates, based on a detailed area analysis and experimental cross-section data, we can conclude that the proposed architecture will indeed sustain significant target hit rates, without exceeding the resilience bound of the measurement infrastructure.
An infrastructure for accurate characterization of single-event transients in digital circuits☆
Savulimedu Veeravalli, Varadan; Polzer, Thomas; Schmid, Ulrich; Steininger, Andreas; Hofbauer, Michael; Schweiger, Kurt; Dietrich, Horst; Schneider-Hornstein, Kerstin; Zimmermann, Horst; Voss, Kay-Obbe; Merk, Bruno; Hajek, Michael
2013-01-01
We present the architecture and a detailed pre-fabrication analysis of a digital measurement ASIC facilitating long-term irradiation experiments of basic asynchronous circuits, which also demonstrates the suitability of the general approach for obtaining accurate radiation failure models developed in our FATAL project. Our ASIC design combines radiation targets like Muller C-elements and elastic pipelines as well as standard combinational gates and flip-flops with an elaborate on-chip measurement infrastructure. Major architectural challenges result from the fact that the latter must operate reliably under the same radiation conditions the target circuits are exposed to, without wasting precious die area for a rad-hard design. A measurement architecture based on multiple non-rad-hard counters is used, which we show to be resilient against double faults, as well as many triple and even higher-multiplicity faults. The design evaluation is done by means of comprehensive fault injection experiments, which are based on detailed Spice models of the target circuits in conjunction with a standard double-exponential current injection model for single-event transients (SET). To be as accurate as possible, the parameters of this current model have been aligned with results obtained from 3D device simulation models, which have in turn been validated and calibrated using micro-beam radiation experiments at the GSI in Darmstadt, Germany. For the latter, target circuits instrumented with high-speed sense amplifiers have been used for analog SET recording. Together with a probabilistic analysis of the sustainable particle flow rates, based on a detailed area analysis and experimental cross-section data, we can conclude that the proposed architecture will indeed sustain significant target hit rates, without exceeding the resilience bound of the measurement infrastructure. PMID:24748694
Contribution of TyrB26 to the Function and Stability of Insulin
Pandyarajan, Vijay; Phillips, Nelson B.; Rege, Nischay; Lawrence, Michael C.; Whittaker, Jonathan; Weiss, Michael A.
2016-01-01
Crystallographic studies of insulin bound to receptor domains have defined the primary hormone-receptor interface. We investigated the role of TyrB26, a conserved aromatic residue at this interface. To probe the evolutionary basis for such conservation, we constructed 18 variants at B26. Surprisingly, non-aromatic polar or charged side chains (such as Glu, Ser, or ornithine (Orn)) conferred high activity, whereas the weakest-binding analogs contained Val, Ile, and Leu substitutions. Modeling of variant complexes suggested that the B26 side chains pack within a shallow depression at the solvent-exposed periphery of the interface. This interface would disfavor large aliphatic side chains. The analogs with highest activity exhibited reduced thermodynamic stability and heightened susceptibility to fibrillation. Perturbed self-assembly was also demonstrated in studies of the charged variants (Orn and Glu); indeed, the GluB26 analog exhibited aberrant aggregation in either the presence or absence of zinc ions. Thus, although TyrB26 is part of insulin's receptor-binding surface, our results suggest that its conservation has been enjoined by the aromatic ring's contributions to native stability and self-assembly. We envisage that such classical structural relationships reflect the implicit threat of toxic misfolding (rather than hormonal function at the receptor level) as a general evolutionary determinant of extant protein sequences. PMID:27129279
Code of Federal Regulations, 2011 CFR
2011-10-01
... 47 Telecommunication 4 2011-10-01 2011-10-01 false Interfaces. 76.1903 Section 76.1903 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES MULTICHANNEL VIDEO AND... through any analog or digital output authorized or permitted under license, law or regulation governing...
Hardware Acceleration of Sparse Cognitive Algorithms
2016-05-01
Processor in Memory (PiM) extensions and a 65 nm ASIC version. They were compared against a 28 nm GPU baseline using the KTH video action recognition...30 Table 17. Memory Requirement of Proposed ASIC...for improvement of performance per unit of power for customized implementations of the Sparsey and Numenta Hierarchical Temporal Memory (HTM
ASIC For Complex Fixed-Point Arithmetic
NASA Technical Reports Server (NTRS)
Petilli, Stephen G.; Grimm, Michael J.; Olson, Erlend M.
1995-01-01
Application-specific integrated circuit (ASIC) performs 24-bit, fixed-point arithmetic operations on arrays of complex-valued input data. High-performance, wide-band arithmetic logic unit (ALU) designed for use in computing fast Fourier transforms (FFTs) and for performing ditigal filtering functions. Other applications include general computations involved in analysis of spectra and digital signal processing.
NASA Technical Reports Server (NTRS)
Ardalan, Sasan (Inventor)
2018-01-01
The invention relates to devices and methods of maintaining the current starved delay at a constant value across variations in voltage and temperature to increase the speed of operation of the sequential logic in the radiation hardened ASIC design.
α-Dendrotoxin inhibits the ASIC current in dorsal root ganglion neurons from rat.
Báez, Adriana; Salceda, Emilio; Fló, Martín; Graña, Martín; Fernández, Cecilia; Vega, Rosario; Soto, Enrique
2015-10-08
Dendrotoxins are a group of peptide toxins purified from the venom of several mamba snakes. α-Dendrotoxin (α-DTx, from the Eastern green mamba Dendroaspis angusticeps) is a well-known blocker of voltage-gated K(+) channels and specifically of K(v)1.1, K(v)1.2 and K(v)1.6. In this work we show that α-DTx inhibited the ASIC currents in DRG neurons (IC50=0.8 μM) when continuously perfused during 25 s (including a 5 s pulse to pH 6.1), but not when co-applied with the pH drop. Additionally, we show that α-DTx abolished a transient component of the outward current that, in some experiments, appeared immediately after the end of the acid pulse. Our data indicate that α-DTx inhibits ASICs in the high nM range while some Kv are inhibited in the low nM range. The α-DTx selectivity and its potential interaction with ASICs should be taken in consideration when DTx is used in the high nM range. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
CLARO: an ASIC for high rate single photon counting with multi-anode photomultipliers
NASA Astrophysics Data System (ADS)
Baszczyk, M.; Carniti, P.; Cassina, L.; Cotta Ramusino, A.; Dorosz, P.; Fiorini, M.; Gotti, C.; Kucewicz, W.; Malaguti, R.; Pessina, G.
2017-08-01
The CLARO is a radiation-hard 8-channel ASIC designed for single photon counting with multi-anode photomultiplier tubes. Each channel outputs a digital pulse when the input signal from the photomultiplier crosses a configurable threshold. The fast return to baseline, typically within 25 ns, and below 50 ns in all conditions, allows to count up to 107 hits/s on each channel, with a power consumption of about 1 mW per channel. The ASIC presented here is a much improved version of the first 4-channel prototype. The threshold can be precisely set in a wide range, between 30 ke- (5 fC) and 16 Me- (2.6 pC). The noise of the amplifier with a 10 pF input capacitance is 3.5 ke- (0.6 fC) RMS. All settings are stored in a 128-bit configuration and status register, protected against soft errors with triple modular redundancy. The paper describes the design of the ASIC at transistor-level, and demonstrates its performance on the test bench.
NASA Astrophysics Data System (ADS)
Uenomachi, M.; Orita, T.; Shimazoe, K.; Takahashi, H.; Ikeda, H.; Tsujita, K.; Sekiba, D.
2018-01-01
High-resolution Elastic Recoil Detection Analysis (HERDA), which consists of a 90o sector magnetic spectrometer and a position-sensitive detector (PSD), is a method of quantitative hydrogen analysis. In order to increase sensitivity, a HERDA system using a multi-channel silicon-based ion detector has been developed. Here, as a parallel and fast readout circuit from a multi-channel silicon-based ion detector, a slew-rate-limited time-over-threshold (ToT) application-specific integrated circuit (ASIC) was designed, and a new slew-rate-limited ToT method is proposed. The designed ASIC has 48 channels and each channel consists of a preamplifier, a slew-rate-limited shaping amplifier, which makes ToT response linear, and a comparator. The measured equivalent noise charges (ENCs) of the preamplifier, the shaper, and the ToT on no detector capacitance were 253±21, 343±46, and 560±56 electrons RMS, respectively. The spectra from a 241Am source measured using a slew-rate-limited ToT ASIC are also reported.
Triroc: A Multi-Channel SiPM Read-Out ASIC for PET/PET-ToF Application
NASA Astrophysics Data System (ADS)
Ahmad, Salleh; Fleury, Julien; de la Taille, Christophe; Seguin-Moreau, Nathalie; Dulucq, Frederic; Martin-Chassard, Gisele; Callier, Stephane; Thienpont, Damien; Raux, Ludovic
2015-06-01
Triroc is the latest addition to SiPM readout ASICs family developed at Weeroc, a start-up company from the Omega microelectronics group of IN2P3/CNRS. This chip is developed under the framework TRIMAGE European project which is aimed for building a cost effective tri-modal PET/MR/EEG brain scan. To ensure the flexibility and compatibility with any SiPM in the market, the ASIC is designed to be capable of accepting negative and positive polarity input signals. This 64-channel ASIC, is suitable for SiPM readout which requires high accuracy timing and charge measurements. Targeted applications would be PET prototyping with time-of-flight capability. Main features of Triroc includes high dynamic range ADC up to 2500 photoelectrons and TDC fine time binning of 40 ps. Triroc requires very minimal external components which means it is a good contender for compact multichannel PET prototyping. Triroc is designed by using AMS 0.35 μm SiGe technology and it was submitted in March 2014. The detail design of this chip will be presented.
Yin, Terry; Lindley, Timothy E.; Albert, Gregory W.; Ahmed, Raheel; Schmeiser, Peter B.; Grady, M. Sean; Howard, Matthew A.; Welsh, Michael J.
2013-01-01
Traumatic brain injury (TBI) is a common cause of morbidity and mortality in people of all ages. Following the acute mechanical insult, TBI evolves over the ensuing minutes and days. Understanding the secondary factors that contribute to TBI might suggest therapeutic strategies to reduce the long-term consequences of brain trauma. To assess secondary factors that contribute to TBI, we studied a lateral fluid percussion injury (FPI) model in mice. Following FPI, the brain cortex became acidic, consistent with data from humans following brain trauma. Administering HCO3 − after FPI prevented the acidosis and reduced the extent of neurodegeneration. Because acidosis can activate acid sensing ion channels (ASICs), we also studied ASIC1a−/− mice and found reduced neurodegeneration after FPI. Both HCO3 − administration and loss of ASIC1a also reduced functional deficits caused by FPI. These results suggest that FPI induces cerebral acidosis that activates ASIC channels and contributes to secondary injury in TBI. They also suggest a therapeutic strategy to attenuate the adverse consequences of TBI. PMID:23991103
Chemical synthesis, 3D structure, and ASIC binding site of the toxin mambalgin-2.
Schroeder, Christina I; Rash, Lachlan D; Vila-Farrés, Xavier; Rosengren, K Johan; Mobli, Mehdi; King, Glenn F; Alewood, Paul F; Craik, David J; Durek, Thomas
2014-01-20
Mambalgins are a novel class of snake venom components that exert potent analgesic effects mediated through the inhibition of acid-sensing ion channels (ASICs). The 57-residue polypeptide mambalgin-2 (Ma-2) was synthesized by using a combination of solid-phase peptide synthesis and native chemical ligation. The structure of the synthetic toxin, determined using homonuclear NMR, revealed an unusual three-finger toxin fold reminiscent of functionally unrelated snake toxins. Electrophysiological analysis of Ma-2 on wild-type and mutant ASIC1a receptors allowed us to identify α-helix 5, which borders on the functionally critical acidic pocket of the channel, as a major part of the Ma-2 binding site. This region is also crucial for the interaction of ASIC1a with the spider toxin PcTx1, thus suggesting that the binding sites for these toxins substantially overlap. This work lays the foundation for structure-activity relationship (SAR) studies and further development of this promising analgesic peptide. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lignan from Thyme Possesses Inhibitory Effect on ASIC3 Channel Current*
Dubinnyi, Maxim A.; Osmakov, Dmitry I.; Koshelev, Sergey G.; Kozlov, Sergey A.; Andreev, Yaroslav A.; Zakaryan, Naira A.; Dyachenko, Igor A.; Bondarenko, Dmitry A.; Arseniev, Alexander S.; Grishin, Eugene V.
2012-01-01
A novel compound was identified in the acidic extract of Thymus armeniacus collected in the Lake Sevan region of Armenia. This compound, named “sevanol,” to our knowledge is the first low molecular weight natural molecule that has a reversible inhibition effect on both the transient and the sustained current of human ASIC3 channels expressed in Xenopus laevis oocytes. Sevanol completely blocked the transient component (IC50 353 ± 23 μm) and partially (∼45%) inhibited the amplitude of the sustained component (IC50 of 234 ± 53 μm). Other types of acid-sensing ion channel (ASIC) channels were intact to sevanol application, except ASIC1a, which showed more than six times less affinity to it as compared with the inhibitory action on the ASIC3 channel. To elucidate the structure of sevanol, the set of NMR spectra in two solvents (d6-DMSO and D2O) was collected, and the complete chemical structure was confirmed by liquid chromatography-mass spectrometry with electrospray ionization (LC-ESI+-MS) fragmentation. This compound is a new lignan built up of epiphyllic acid and two isocitryl esters in positions 9 and 10. In vivo administration of sevanol (1–10 mg/kg) significantly reversed thermal hyperalgesia induced by complete Freund's adjuvant injection and reduced response to acid in a writhing test. Thus, we assume the probable considerable role of sevanol in known analgesic and anti-inflammatory properties of thyme. PMID:22854960
Analog Spectrophotometers in the Digital Age: Data Acquisition on a Budget
ERIC Educational Resources Information Center
Nazarenko, Alexander Y.; Nazarenko, Natalie A.
2005-01-01
The interfacing of various spectrometers with analog output to a personal computer running Microsoft Excel in the Windows environment is described. This low cost data acquisition solution is a useful replacement of a chart recorder for various UV-visible and infrared scanning spectrophotometers.
Hanaka, Megumi; Iba, Kousuke; Dohke, Takayuki; Kanaya, Kumiko; Okazaki, Shunichiro; Yamashita, Toshihiko
2018-05-01
Our recent studies demonstrated that regional bone loss in the unloaded hind limbs of tail-suspended mice triggered pain-like behaviors due to the acidic environment in the bone induced by osteoclast activation. The aims of the present study were to examine whether TRPV1, ASIC and P2X (known as nociceptors) are expressed in bone, and whether the antagonists to those receptors affect the expression of osteoblast and osteoclast regulators, and prevent the triggering of not only pain-like behaviors but also high bone turnover conditions in tail-suspension model mice. The hind limb-unloaded mice were subjected to tail suspension with the hind limbs elevated for 14days. The effects of the TRPV1, ASIC3, P2X2/3 antagonists on pain-like behaviors as assessed by the von Frey test, paw flick test and spontaneous pain scale; the expressions of TRPV1, ASICs, and P2X2 in the bone; and the effects of those antagonists on osteoblast and osteoclast regulators were examined. In addition, we evaluated the preventive effect of continuous treatment with a TRPV1 antagonist on the trigger for pain-like behavior and bone loss in tail-suspended mice. Pain-like behaviors were significantly improved by the treatment with TRPV1, ASIC, P2X antagonists; TRPV1, ASICs and P2X were expressed in the bone tissues; and the antagonists to these receptors down-regulated the expression of osteoblast and osteoclast regulators in tail-suspended mice. In addition, continuous treatment with a TRPV1 antagonist during tail-suspension prevented the induction of pain-like behaviors and regional bone loss in the unloaded hind limbs. We, therefore, believe that those receptor antagonists have a potential role in preventing the triggering of skeletal pain with associated regional bone metabolic disorder. Copyright © 2018 Elsevier Inc. All rights reserved.
Software/hardware distributed processing network supporting the Ada environment
NASA Astrophysics Data System (ADS)
Wood, Richard J.; Pryk, Zen
1993-09-01
A high-performance, fault-tolerant, distributed network has been developed, tested, and demonstrated. The network is based on the MIPS Computer Systems, Inc. R3000 Risc for processing, VHSIC ASICs for high speed, reliable, inter-node communications and compatible commercial memory and I/O boards. The network is an evolution of the Advanced Onboard Signal Processor (AOSP) architecture. It supports Ada application software with an Ada- implemented operating system. A six-node implementation (capable of expansion up to 256 nodes) of the RISC multiprocessor architecture provides 120 MIPS of scalar throughput, 96 Mbytes of RAM and 24 Mbytes of non-volatile memory. The network provides for all ground processing applications, has merit for space-qualified RISC-based network, and interfaces to advanced Computer Aided Software Engineering (CASE) tools for application software development.
2012-10-01
ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1
A New Statistics-Based Online Baseline Restorer for a High Count-Rate Fully Digital System.
Li, Hongdi; Wang, Chao; Baghaei, Hossain; Zhang, Yuxuan; Ramirez, Rocio; Liu, Shitao; An, Shaohui; Wong, Wai-Hoi
2010-04-01
The goal of this work is to develop a novel, accurate, real-time digital baseline restorer using online statistical processing for a high count-rate digital system such as positron emission tomography (PET). In high count-rate nuclear instrumentation applications, analog signals are DC-coupled for better performance. However, the detectors, pre-amplifiers and other front-end electronics would cause a signal baseline drift in a DC-coupling system, which will degrade the performance of energy resolution and positioning accuracy. Event pileups normally exist in a high-count rate system and the baseline drift will create errors in the event pileup-correction. Hence, a baseline restorer (BLR) is required in a high count-rate system to remove the DC drift ahead of the pileup correction. Many methods have been reported for BLR from classic analog methods to digital filter solutions. However a single channel BLR with analog method can only work under 500 kcps count-rate, and normally an analog front-end application-specific integrated circuits (ASIC) is required for the application involved hundreds BLR such as a PET camera. We have developed a simple statistics-based online baseline restorer (SOBLR) for a high count-rate fully digital system. In this method, we acquire additional samples, excluding the real gamma pulses, from the existing free-running ADC in the digital system, and perform online statistical processing to generate a baseline value. This baseline value will be subtracted from the digitized waveform to retrieve its original pulse with zero-baseline drift. This method can self-track the baseline without a micro-controller involved. The circuit consists of two digital counter/timers, one comparator, one register and one subtraction unit. Simulation shows a single channel works at 30 Mcps count-rate with pileup condition. 336 baseline restorer circuits have been implemented into 12 field-programmable-gate-arrays (FPGA) for our new fully digital PET system.
Flexible Architecture for FPGAs in Embedded Systems
NASA Technical Reports Server (NTRS)
Clark, Duane I.; Lim, Chester N.
2012-01-01
Commonly, field-programmable gate arrays (FPGAs) being developed in cPCI embedded systems include the bus interface in the FPGA. This complicates the development because the interface is complicated and requires a lot of development time and FPGA resources. In addition, flight qualification requires a substantial amount of time be devoted to just this interface. Another complication of putting the cPCI interface into the FPGA being developed is that configuration information loaded into the device by the cPCI microprocessor is lost when a new bit file is loaded, requiring cumbersome operations to return the system to an operational state. Finally, SRAM-based FPGAs are typically programmed via specialized cables and software, with programming files being loaded either directly into the FPGA, or into PROM devices. This can be cumbersome when doing FPGA development in an embedded environment, and does not have an easy path to flight. Currently, FPGAs used in space applications are usually programmed via multiple space-qualified PROM devices that are physically large and require extra circuitry (typically including a separate one-time programmable FPGA) to enable them to be used for this application. This technology adds a cPCI interface device with a simple, flexible, high-performance backend interface supporting multiple backend FPGAs. It includes a mechanism for programming the FPGAs directly via the microprocessor in the embedded system, eliminating specialized hardware, software, and PROM devices and their associated circuitry. It has a direct path to flight, and no extra hardware and minimal software are required to support reprogramming in flight. The device added is currently a small FPGA, but an advantage of this technology is that the design of the device does not change, regardless of the application in which it is being used. This means that it needs to be qualified for flight only once, and is suitable for one-time programmable devices or an application specific integrated circuit (ASIC). An application programming interface (API) further reduces the development time needed to use the interface device in a system.
NASA Astrophysics Data System (ADS)
El Khakani, My A.; Gat, E.; Beaudoin, Yves; Chaker, Mohamed; Monteil, C.; Guay, Daniel; Letourneau, G.; Pepin, Henri
1995-04-01
Laser ablation deposition technique was used to deposit silicon carbide thin films on both Si(100) and quartz substrates. The deposition was accomplished by ablating SiC sintered ceramic targets, using a KrF (248 nm) excimer laser. At a laser intensity of about 1 X 109 W/cm2, substrate temperatures in the (25-700) degree(s)C range were investigated. When the deposition temperature is varied from 27 to 650 degree(s)C, (i) the density of a-SiC films increases from 2.6 to 3.0 g cm-3, while their mean roughness value (for a film thickness of about 1 micrometers ) slightly changes from 0.44 to 0.5 nm; (ii) the optical transmission of a-SiC films is significantly improved (the absorption coefficient at 632.8 nm wavelength was reduced by a factor of about 5); and (iii) their Si-C bond density, as determined by FTIR spectroscopy, increases from (13.1 +/- 1.3) to (23.4 +/- 2.4) 1022 bond cm-3. The increased number of Si-C bonds is correlated to the increase of the optical transmission. Over all the investigated deposition temperature range, the a-SiC films were found to be under high compressive stress around a mean value of about 1.26 GPa. The control of the stress of a-SiC films was achieved by means of post- thermal annealings and the annealed a-SiC films were successfully used to fabricate x-ray membranes.
Traini, Chiara; Del Popolo, Giulio; Lazzeri, Massimo; Mazzaferro, Katia; Nelli, Federico; Calosi, Laura; Vannucchi, Maria Giuliana
2015-11-01
To investigate the expression of two types of cation channels, γEpithelial Na(+) Channel (γENaC) and the Acid-Sensing Ion Channel 1 (ASIC1), in the urothelium of controls and in patients affected by neurogenic detrusor overactivity (NDO). In parallel, urodynamic parameters were collected and correlated to the immunohistochemical results. Four controls and 12 patients with a clinical diagnosis of NDO and suprasacral spinal cord lesion underwent urodynamic measurements and cystoscopy. Cold-cup biopsies were frozen and processed for immunohistochemistry and Western Blot. Spearman's correlation coefficient between morphological and urodynamic data was applied. One-way anova followed by Newman-Keuls multiple comparison post hoc test was applied for Western Blot results. In the controls, γENaC and ASIC1 were expressed in the urothelium with differences in their cell distribution and intensity. In patients with NDO, both markers showed consistent changes either in cell distribution and labelling intensity compared with the controls. A significant correlation between a higher intensity of γENaC expression in the urothelium of patients with NDO and lower values of bladder compliance was detected. The present findings show important changes in the expression of γENaC and ASIC1 in NDO human urothelium. Notably, while the changes in γENaC might impair the mechanosensory function of the urothelium, the increase of ASIC1 might represent an attempt to compensate for the excess in local sensitivity. © 2014 The Authors BJU International © 2014 BJU International Published by John Wiley & Sons Ltd.
Subseasonal Reversal of East Asian Surface Temperature Variability in Winter 2014/15
NASA Astrophysics Data System (ADS)
Xu, Xinping; Li, Fei; He, Shengping; Wang, Huijun
2018-06-01
Although there has been a considerable amount of research conducted on the East Asian winter-mean climate, subseasonal surface air temperature (SAT) variability reversals in the early and late winter remain poorly understood. In this study, we focused on the recent winter of 2014/15, in which warmer anomalies dominated in January and February but colder conditions prevailed in December. Moreover, Arctic sea-ice cover (ASIC) in September-October 2014 was lower than normal, and warmer sea surface temperature (SST) anomalies occurred in the Niño4 region in winter, together with a positive Pacific Decadal Oscillation (PDO|+) phase. Using observational data and CMIP5 historical simulations, we investigated the PDO|+ phase modulation upon the winter warm Niño4 phase (autumn ASIC reduction) influence on the subseasonal SAT variability of East Asian winter. The results show that, under a PDO|+ phase modulation, warm Niño4 SST anomalies are associated with a subseasonal delay of tropical surface heating and subsequent Hadley cell and Ferrel cell intensification in January-February, linking the tropical and midlatitude regions. Consistently, the East Asian jet stream (EAJS) is significantly decelerated in January-February and hence promotes the warm anomalies over East Asia. Under the PDO|+ phase, the decrease in ASIC is related to cold SST anomalies in the western North Pacific, which increase the meridional temperature gradient and generate an accelerated and westward-shifted EAJS in December. The westward extension of the EAJS is responsible for the eastward-propagating Rossby waves triggered by declining ASIC and thereby favors the connection between ASIC and cold conditions over East Asia.
pMUT+ASIC integrated platform for wide range ultrasonic imaging
NASA Astrophysics Data System (ADS)
Tillak, J.; Saeed, N.; Khazaaleh, S.; Viegas, J.; Yoo, J.
2017-03-01
We propose an integrated platform of Aluminum Nitrate (AlN) based Piezoelectric Micromachined Ultrasonic Transducer (pMUT) phased array with Application Specific Integrated Circuit (ASIC) for medical imaging and industrial diagnosis. The ASIC provides wide driving range for frequencies between 100 kHz and 5 MHz and channelscalable, programmable application adaptive transmitting beamformer. The system supports operation in various media, including gasses, liquids and biological tissue. The scan resolution for 5 MHz operation is 68 μm in air. The beamformer covers a test volume from -30° to +30° with a step of 3° and scan depth of 10 cm. The ASIC system features low noise receiver electronics, power saving transmission circuitry, and high-voltage drive of large capacitance transducer (up to 500 pF). Integrated pMUT phased array consists of 4 channels of single-membrane ultrasonic transducer of 400 nm deflection and 20 pF feed-thru capacitance, which produce 15 Pa pressure at 500 μm distance from the surface of the transducers. The active area of the ASIC is (700×1490) μm2, which includes channel scalable TX, 8-channale low noise RX, digital back end with autonomous beamformer and power management unit. The system is battery powered with 3.3V-5V standard supply, representing a truly portable solution for ultrasonic applications. Given the CMOS-compatible fabrication process for the AlN pMUTs, dense, miniaturized arrays are possible. Furthermore the smooth surface of dielectric AlN renders optical quality MEMS surfaces for integration in miniaturized photonic + ultrasound microsystems.
Linearity enhancement design of a 16-channel low-noise front-end readout ASIC for CdZnTe detectors
NASA Astrophysics Data System (ADS)
Zeng, Huiming; Wei, Tingcun; Wang, Jia
2017-03-01
A 16-channel front-end readout application-specific integrated circuit (ASIC) with linearity enhancement design for cadmium zinc telluride (CdZnTe) detectors is presented in this paper. The resistors in the slow shaper are realized using a high-Z circuit to obtain constant resistance value instead of using only a metal-oxide-semiconductor (MOS) transistor, thus the shaping time of the slow shaper can be kept constant for different amounts of input energies. As a result, the linearity of conversion gain is improved significantly. The ASIC was designed and fabricated in a 0.35 μm CMOS process with a die size of 2.60 mm×3.53 mm. The tested results show that a typical channel provides an equivalent noise charge (ENC) of 109.7e-+16.3e-/pF with a power consumption of 4 mW and achieves a conversion gain of 87 mV/fC with a nonlinearity of <0.4%. The linearity of conversion gain is improved by at least 86.6% as compared with the traditional approaches using the same front-end readout architecture and manufacture process. Moreover, the inconsistency among channels is <0.3%. An energy resolution of 2.975 keV (FWHM) for gamma rays of 59.5 keV was measured by connecting the ASIC to a 5 mm×5 mm ×2 mm CdZnTe detector at room temperature. The front-end readout ASIC presented in this paper achieves an outstanding linearity performance without compromising the noise, power consumption, and chip size performances.
ERIC Educational Resources Information Center
Batt, Russell H., Ed.
1989-01-01
Discussed are some uses of computers in chemistry classrooms. Described are: (1) interactive chromatographic analysis software; (2) computer interface for a digital frequency-period-counter-ratio meter and analog interface based on a voltage-to-frequency converter; and (3) use of spectrometer/microcomputer arrangement for teaching atomic theory.…
Automated Design of Board and MCM Level Digital Systems.
1997-10-01
Partitioning for Multicomponent Synthesis 159 Appendix K: Resource Constrained RTL Partitioning for Synthesis of Multi- FPGA Designs 169 Appendix L...digital signal processing) ar- chitectures. These target architectures, illustrated in Figure 1, can contain application-specific ASICS, FPGAs ...synthesis tools for ASIC, FPGA and MCM synthesis (Figure 8). Multicomponent Partitioning Engine The par- titioning engine is a hierarchical partitioning
Electro-optic architecture (EOA) for sensors and actuators in aircraft propulsion systems
NASA Technical Reports Server (NTRS)
Glomb, W. L., Jr.
1989-01-01
Results of a study to design an optimal architecture for electro-optical sensing and control in advanced aircraft and space systems are described. The propulsion full authority digital Electronic Engine Control (EEC) was the focus for the study. The recommended architecture is an on-engine EEC which contains electro-optic interface circuits for fiber-optic sensors on the engine. Size and weight are reduced by multiplexing arrays of functionally similar sensors on a pair of optical fibers to common electro-optical interfaces. The architecture contains common, multiplex interfaces to seven sensor groups: (1) self luminous sensors; (2) high temperatures; (3) low temperatures; (4) speeds and flows; (5) vibration; (6) pressures; and (7) mechanical positions. Nine distinct fiber-optic sensor types were found to provide these sensing functions: (1) continuous wave (CW) intensity modulators; (2) time division multiplexing (TDM) digital optic codeplates; (3) time division multiplexing (TDM) analog self-referenced sensors; (4) wavelength division multiplexing (WDM) digital optic code plates; (5) wavelength division multiplexing (WDM) analog self-referenced intensity modulators; (6) analog optical spectral shifters; (7) self-luminous bodies; (8) coherent optical interferometers; and (9) remote electrical sensors. The report includes the results of a trade study including engine sensor requirements, environment, the basic sensor types, and relevant evaluation criteria. These figures of merit for the candidate interface types were calculated from the data supplied by leading manufacturers of fiber-optic sensors.
NASA Astrophysics Data System (ADS)
De Matteis, M.; De Blasi, M.; Vallicelli, E. A.; Zannoni, M.; Gervasi, M.; Bau, A.; Passerini, A.; Baschirotto, A.
2017-02-01
This paper presents the design and the experimental results of a CMOS Automatic Control System (ACS) for the biasing of High-Electron-Mobility-Transistors (HEMT). The ACS is the first low-power mixed-signal Application-Specified-Integrated-Circuit (ASIC) able to automatically set and regulate the operating point of an off-chip 6 HEMT Low-Noise-Amplifiers (LNAs), hence it composes a two-chip system (the ACS+LNAs) to be used in the Large Scale Polarization Explorer (LSPE) stratospheric balloon for Cosmic Microwave Background (CMB) signal observation. The hereby presented ACS ASIC provides a reliable instrumentation for gradual and very stable LNAs characterization, switching-on, and operating point (<4 mV accuracy). Moreover, it simplifies the electronic instrumentation needed for biasing the LNAs, since it replaces several off-the-shelf and digital programmable device components. The ASIC prototype has been implemented in a CMOS 0.35 μ m technology (12 mm2 area occupancy). It operates at 4 kHz clock frequency. The power consumption of one-channel ASIC (biasing one LNA) is 3.6 mW, whereas 30 mW are consumed by a single LNA device.
De Matteis, M; De Blasi, M; Vallicelli, E A; Zannoni, M; Gervasi, M; Bau, A; Passerini, A; Baschirotto, A
2017-02-01
This paper presents the design and the experimental results of a CMOS Automatic Control System (ACS) for the biasing of High-Electron-Mobility-Transistors (HEMT). The ACS is the first low-power mixed-signal Application-Specified-Integrated-Circuit (ASIC) able to automatically set and regulate the operating point of an off-chip 6 HEMT Low-Noise-Amplifiers (LNAs), hence it composes a two-chip system (the ACS+LNAs) to be used in the Large Scale Polarization Explorer (LSPE) stratospheric balloon for Cosmic Microwave Background (CMB) signal observation. The hereby presented ACS ASIC provides a reliable instrumentation for gradual and very stable LNAs characterization, switching-on, and operating point (<4 mV accuracy). Moreover, it simplifies the electronic instrumentation needed for biasing the LNAs, since it replaces several off-the-shelf and digital programmable device components. The ASIC prototype has been implemented in a CMOS 0.35 μm technology (12 mm 2 area occupancy). It operates at 4 kHz clock frequency. The power consumption of one-channel ASIC (biasing one LNA) is 3.6 mW, whereas 30 mW are consumed by a single LNA device.
Modeling and Measuring Charge-Sharing in Hard X-ray Imagers Using HEXITEC CdTe Detectors
NASA Technical Reports Server (NTRS)
Ryan, Daniel F.; Christe, Steven D.; Shih, Albert Y.; Baumgartner, Wayne H.; Wilson, Matthew D.; Seller, Paul; Gaskin, Jessica A.; Inglis, Andrew
2017-01-01
The Rutherford Appleton Laboratory's HEXITEC ASIC has been designed to provide fine pixelated X-ray spectroscopic imaging in combination with a CdTe or CZT detector layer. Although HEXITEC's small pixels enable higher spatial resolution as well as higher spectral resolution via the small-pixel effect, they also increase the probability of charge sharing, a process which degrades spectral performance by dividing the charge induced by a single photon among multiple pixels. In this paper, we investigate the effect of this process on a continuum X-ray spectrum below the Cd and Te fluorescence energies (23 keV). This is done by comparing laboratory measurements with simulations performed with a custom designed model of the HEXITEC ASIC. We find that the simulations closely match the observations implying that we have an adequate understanding of both charge sharing and the HEXITEC ASIC itself. These results can be used to predict the distortion of a spectrum measured with HEXITEC and will help determine to what extent it can be corrected. They also show that models like this one are important tools in developing and interpreting observations from ASICs like HEXITEC.
Active counter electrode in a-SiC electrochemical metallization memory
NASA Astrophysics Data System (ADS)
Morgan, K. A.; Fan, J.; Huang, R.; Zhong, L.; Gowers, R.; Ou, J. Y.; Jiang, L.; De Groot, C. H.
2017-08-01
Cu/amorphous-SiC (a-SiC) electrochemical metallization memory cells have been fabricated with two different counter electrode (CE) materials, W and Au, in order to investigate the role of CEs in a non-oxide semiconductor switching matrix. In a positive bipolar regime with Cu filaments forming and rupturing, the CE influences the OFF state resistance and minimum current compliance. Nevertheless, a similarity in SET kinetics is seen for both CEs, which differs from previously published SiO2 memories, confirming that CE effects are dependent on the switching layer material or type. Both a-SiC memories are able to switch in the negative bipolar regime, indicating Au and W filaments. This confirms that CEs can play an active role in a non-oxide semiconducting switching matrix, such as a-SiC. By comparing both Au and W CEs, this work shows that W is superior in terms of a higher R OFF/R ON ratio, along with the ability to switch at lower current compliances making it a favourable material for future low energy applications. With its CMOS compatibility, a-SiC/W is an excellent choice for future resistive memory applications.
Centering a DDR Strobe in the Middle of a Data Packet
NASA Technical Reports Server (NTRS)
Johnson, Michael; Nelson, Dave; Seefeldt, James; Roper, Weston; Passow, Craig
2014-01-01
The Orion CEV Northstar ASIC (application- specific integrated circuit) project required a DDR (double data rate) memory bus driver/receiver (DDR PHY block) to interface with external DDR memory. The DDR interface (JESD79C) is based on a source synchronous strobe (DQS\\) that is sent along with each packet of data (DQ). New data is provided concurrently with each edge of strobe and is sent irregularly. In order to capture this data, the strobe needs to be delayed and used to latch the data into a register. A circuit solves the need for training a DDR PRY block by incorporating a PVT-compensated delay element in the strobe path. This circuit takes an external reference clock signal and uses the regular clock to calibrate a known delay through a data path. The compensated delay DQS signal is then used to capture the DQ data in a normal register. This register structure can be configured as a FIFO (first in first out), in order to transfer data from the DDR domain to the system clock domain. This design is different in that it does not rely upon the need for training the system response, nor does it use a PLL (phase locked loop) or a DLL (delay locked loop) to provide an offset of the strobe signal. The circuit is created using standard ASIC building blocks, plus the PVT (process, voltage, and temperature) compensated delay line. The design uses a globally available system clock as a reference, alleviating the need to operate synchronously with the remote memory. The reference clock conditions the PVT compensated delay line to provide a pre-determined amount of delay to any data signal that passes through this delay line. The delay line is programmed in degrees of offset, so that one could think of the clock period representing 360deg of delay. In an ideal environment, delaying the strobe 1/4 of a clock cycle (90deg) would place the strobe in the middle of the data packet. This delayed strobe can then be used to clock the data into a register, satisfying setup and hold requirements of the system.
Data encryption standard ASIC design and development report.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Robertson, Perry J.; Pierson, Lyndon George; Witzke, Edward L.
2003-10-01
This document describes the design, fabrication, and testing of the SNL Data Encryption Standard (DES) ASIC. This device was fabricated in Sandia's Microelectronics Development Laboratory using 0.6 {micro}m CMOS technology. The SNL DES ASIC was modeled using VHDL, then simulated, and synthesized using Synopsys, Inc. software and finally IC layout was performed using Compass Design Automation's CAE tools. IC testing was performed by Sandia's Microelectronic Validation Department using a HP 82000 computer aided test system. The device is a single integrated circuit, pipelined realization of DES encryption and decryption capable of throughputs greater than 6.5 Gb/s. Several enhancements accommodate ATMmore » or IP network operation and performance scaling. This design is the latest step in the evolution of DES modules.« less
Spacecraft optical disk recorder memory buffer control
NASA Technical Reports Server (NTRS)
Hodson, Robert F.
1993-01-01
This paper discusses the research completed under the NASA-ASEE summer faculty fellowship program. The project involves development of an Application Specific Integrated Circuit (ASIC) to be used as a Memory Buffer Controller (MBC) in the Spacecraft Optical Disk System (SODR). The SODR system has demanding capacity and data rate specifications requiring specialized electronics to meet processing demands. The system is being designed to support Gigabit transfer rates with Terabit storage capability. The complete SODR system is designed to exceed the capability of all existing mass storage systems today. The ASIC development for SODR consist of developing a 144 pin CMOS device to perform format conversion and data buffering. The final simulations of the MBC were completed during this summer's NASA-ASEE fellowship along with design preparations for fabrication to be performed by an ASIC manufacturer.
Reilly, T.E.; Frimpter, M.H.; LeBlanc, D.R.; Goodman, A.S.
1987-01-01
Sharp interface methods have been used successfully to describe the physics of upconing. A finite-element model is developed to simulate a sharp interface for determination of the steady-state position of the interface and maximum permissible well discharges. The model developed is compared to previous published electric-analog model results of Bennett and others (1968). -from Authors
Automating analog design: Taming the shrew
NASA Technical Reports Server (NTRS)
Barlow, A.
1990-01-01
The pace of progress in the design of integrated circuits continues to amaze observers inside and outside of the industry. Three decades ago, a 50 transistor chip was a technological wonder. Fifteen year later, a 5000 transistor device would 'wow' the crowds. Today, 50,000 transistor chips will earn a 'not too bad' assessment, but it takes 500,000 to really leave an impression. In 1975 a typical ASIC device had 1000 transistors, took one year to first samples (and two years to production) and sold for about 5 cents per transistor. Today's 50,000 transistor gate array takes about 4 months from spec to silicon, works the first time, and sells for about 0.02 cents per transistor. Fifteen years ago, the single most laborious and error prone step in IC design was the physical layout. Today, most IC's never see the hand of a layout designer: and automatic place and route tool converts the engineer's computer captured schematic to a complete physical design using a gate array or a library of standard cells also created by software rather than by designers. CAD has also been a generous benefactor to the digital design process. The architect of today's digital systems creates the design using an RTL or other high level simulator. Then the designer pushes a button to invoke the logic synthesizer-optimizer tool. A fault analyzer checks the result for testability and suggests where scan based cells will improve test coverage. One obstinate holdout amidst this parade of progress is the automation of analog design and its reduction to semi-custom techniques. This paper investigates the application of CAD techniques to analog design.
MIRAGE: The data acquisition, analysis, and display system
NASA Technical Reports Server (NTRS)
Rosser, Robert S.; Rahman, Hasan H.
1993-01-01
Developed for the NASA Johnson Space Center and Life Sciences Directorate by GE Government Services, the Microcomputer Integrated Real-time Acquisition Ground Equipment (MIRAGE) system is a portable ground support system for Spacelab life sciences experiments. The MIRAGE system can acquire digital or analog data. Digital data may be NRZ-formatted telemetry packets of packets from a network interface. Analog signal are digitized and stored in experimental packet format. Data packets from any acquisition source are archived to a disk as they are received. Meta-parameters are generated from the data packet parameters by applying mathematical and logical operators. Parameters are displayed in text and graphical form or output to analog devices. Experiment data packets may be retransmitted through the network interface. Data stream definition, experiment parameter format, parameter displays, and other variables are configured using spreadsheet database. A database can be developed to support virtually any data packet format. The user interface provides menu- and icon-driven program control. The MIRAGE system can be integrated with other workstations to perform a variety of functions. The generic capabilities, adaptability and ease of use make the MIRAGE a cost-effective solution to many experimental data processing requirements.
Summary of Research 1998, Department of Electrical and Computer Engineering.
1999-08-01
Channel Interference," Master’s Thesis, Naval Postgraduate School, December 1998. Erdogan , V, "Time Domain Simulation of MPSK Communications System...1998, several new user interface screens have been designed. Software for reading data from analog tape has been completed and interfaced to the
An ADC Interface for the Apple II.
ERIC Educational Resources Information Center
Leiker, P. Steven
1990-01-01
Described is the construction of a simple analog-to-digital convertor circuit to interface an Apple II+ microcomputer to a light sensor used in conjunction with a holographic gear inspector. A list of parts, circuit diagram, and a simple BASIC program for the convertor are provided. (CW)
2011-10-01
GCGGTTGTCCC/CATGGTAACAGCATTGCAGGTGC (30 cycles); mouse ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 ...follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1 FIGURE 8A 8 324bp, and GAPDH 233bp as seen in Figure 8A. Reference: Malin S, et al. (2007
A memory-mapped output interface: Omega navigation output data from the JOLT (TM) microcomputer
NASA Technical Reports Server (NTRS)
Lilley, R. W.
1976-01-01
A hardware interface which allows both digital and analog data output from the JOLT microcomputer is described in the context of a software-based Omega Navigation receiver. The interface hardware described is designed for output of six (or eight with simple extensions) bits of binary output in response to a memory store command from the microcomputer. The interface was produced in breadboard form and is operational as an evaluation aid for the software Omega receiver.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fahim, Farah; Deptuch, Grzegorz; Shenai, Alpana
The Vertically Integrated Photon Imaging Chip - Large, (VIPIC-L), is a large area, small pixel (65μm), 3D integrated, photon counting ASIC with zero-suppressed or full frame dead-time-less data readout. It features data throughput of 14.4 Gbps per chip with a full frame readout speed of 56kframes/s in the imaging mode. VIPIC-L contain 192 x 192 pixel array and the total size of the chip is 1.248cm x 1.248cm with only a 5μm periphery. It contains about 120M transistors. A 1.3M pixel camera module will be developed by arranging a 6 x 6 array of 3D VIPIC-L’s bonded to a largemore » area silicon sensor on the analog side and to a readout board on the digital side. The readout board hosts a bank of FPGA’s, one per VIPIC-L to allow processing of up to 0.7 Tbps of raw data produced by the camera.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
DE GERONIMO,G.; FRIED, J.; FROST, E.
We describe a front-end application specific integrated circuit (ASIC) developed for a silicon Compton telescope. Composed of 32 channels, it reads out signals in both polarities from each side of a Silicon strip sensor, 2 mm thick 27 cm long, characterized by a strip capacitance of 30 pF. Each front-end channel provides low-noise charge amplification, shaping with a stabilized baseline, discrimination, and peak detection with an analog memory. The channels can process events simultaneously, and the read out is sparsified. The charge amplifier makes uses a dual-cascode configuration and dual-polarity adaptive reset, The low-hysteresis discriminator and the multi-phase peak detectormore » process signals with a dynamic range in excess of four hundred. An equivalent noise charge (ENC) below 200 electrons was measured at 30 pF, with a slope of about 4.5 electrons/pF at a peaking time of 4 {micro}s. With a total dissipated power of 5 mW the channel covers an energy range up to 3.2 MeV.« less
Design and Implementation of a New Real-Time Frequency Sensor Used as Hardware Countermeasure
Jiménez-Naharro, Raúl; Gómez-Galán, Juan Antonio; Sánchez-Raya, Manuel; Gómez-Bravo, Fernando; Pedro-Carrasco, Manuel
2013-01-01
A new digital countermeasure against attacks related to the clock frequency is –presented. This countermeasure, known as frequency sensor, consists of a local oscillator, a transition detector, a measurement element and an output block. The countermeasure has been designed using a full-custom technique implemented in an Application-Specific Integrated Circuit (ASIC), and the implementation has been verified and characterized with an integrated design using a 0.35 μm standard Complementary Metal Oxide Semiconductor (CMOS) technology (Very Large Scale Implementation—VLSI implementation). The proposed solution is configurable in resolution time and allowed range of period, achieving a minimum resolution time of only 1.91 ns and an initialization time of 5.84 ns. The proposed VLSI implementation shows better results than other solutions, such as digital ones based on semi-custom techniques and analog ones based on band pass filters, all design parameters considered. Finally, a counter has been used to verify the good performance of the countermeasure in avoiding the success of an attack. PMID:24008285
Configurable test bed design for nanosats to qualify commercial and customized integrated circuits
NASA Astrophysics Data System (ADS)
Guareschi, W.; Azambuja, J.; Kastensmidt, F.; Reis, R.; Durao, O.; Schuch, N.; Dessbesel, G.
The use of small satellites has increased substantially in recent years due to the reduced cost of their development and launch, as well to the flexibility offered by commercial components. The test bed is a platform that allows components to be evaluated and tested in space. It is a flexible platform, which can be adjusted to a wide quantity of components and interfaces. This work proposes the design and implementation of a test bed suitable for test and evaluation of commercial circuits used in nanosatellites. The development of such a platform allows developers to reduce the efforts in the integration of components and therefore speed up the overall system development time. The proposed test bed is a configurable platform implemented using a Field Programmable Gate Array (FPGA) that controls the communication protocols and connections to the devices under test. The Flash-based ProASIC3E FPGA from Microsemi is used as a control system. This adaptive system enables the control of new payloads and softcores for test and validation in space. Thus, the integration can be easily performed through configuration parameters. It is intended for modularity. Each component connected to the test bed can have a specific interface programmed using a hardware description language (HDL). The data of each component is stored in embedded memories. Each component has its own memory space. The size of the allocated memory can be also configured. The data transfer priority can be set and packaging can be added to the logic, when needed. Communication with peripheral devices and with the Onboard Computer (OBC) is done through the pre-implemented protocols, such as I2C (Inter-Integrated Circuit), SPI (Serial Peripheral Interface) and external memory control. In loco primary tests demonstrated the control system's functionality. The commercial ProASIC3E FPGA family is not space-flight qualified, but tests have been made under Total Ionizing Dose (TID) showing its robustness up to 25 kr- ds (Si). When considering proton and heavy ions, flash-based FPGAs provide immunity to configuration loss and low bit-flips susceptibility in flash memory. In this first version of the test bed two components are connected to the controller FPGA: a commercial magnetometer and a hardened test chip. The embedded FPGA implements a Single Event Effects (SEE) hardened microprocessor and few other soft-cores to be used in space. This test bed will be used in the NanoSatC-BR1, the first Brazilian Cubesat scheduled to be launched in mid-2013.
MEMS analog light processing: an enabling technology for adaptive optical phase control
NASA Astrophysics Data System (ADS)
Gehner, Andreas; Wildenhain, Michael; Neumann, Hannes; Knobbe, Jens; Komenda, Ondrej
2006-01-01
Various applications in modern optics are demanding for Spatial Light Modulators (SLM) with a true analog light processing capability, e.g. the generation of arbitrary analog phase patterns for an adaptive optical phase control. For that purpose the Fraunhofer IPMS has developed a high-resolution MEMS Micro Mirror Array (MMA) with an integrated active-matrix CMOS address circuitry. The device provides 240 x 200 piston-type mirror elements with 40 μm pixel size, where each of them can be addressed and deflected independently at an 8bit height resolution with a vertical analog deflection range of up to 400 nm suitable for a 2pi phase modulation in the visible. Full user programmability and control is provided by a newly developed comfortable driver software for Windows XP based PCs supporting both a Graphical User Interface (GUI) for stand-alone operation with pre-defined data patterns as well as an open ActiveX programming interface for a direct data feed-through within a closed-loop environment. High-speed data communication is established by an IEEE1394a FireWire interface together with an electronic driving board performing the actual MMA programming and control at a maximum frame rate of up to 500 Hz. Successful application demonstrations have been given in eye aberration correction, coupling efficiency optimization into a monomode fiber, ultra-short laser pulse modulation and diffractive beam shaping. Besides a presentation of the basic device concept the paper will give an overview of the obtained results from these applications.
A Laboratory Application of Microcomputer Graphics.
ERIC Educational Resources Information Center
Gehring, Kalle B.; Moore, John W.
1983-01-01
A PASCAL graphics and instrument interface program for a Z80/S-100 based microcomputer was developed. The computer interfaces to a stopped-flow spectrophotometer replacing a storage oscilloscope and polaroid camera. Applications of this system are discussed, indicating that graphics and analog-to-digital boards have transformed the computer into…
NASA Astrophysics Data System (ADS)
Lacombe, K.; Dezalay, J.-P.; Houret, B.; Amoros, C.; Atteia, J.-L.; Aubaret, K.; Billot, M.; Bordon, S.; Cordier, B.; Delaigue, S.; Galliano, M.; Gevin, O.; Godet, O.; Gonzalez, F.; Guillemot, Ph.; Limousin, O.; Mercier, K.; Nasser, G.; Pons, R.; Rambaud, D.; Ramon, P.; Waegebaert, V.
2016-07-01
ECLAIRs, a 2-D coded-mask imaging camera on-board the Sino-French SVOM space mission, will detect and locate gamma-ray bursts in near real time in the 4 - 150 keV energy band in a large field of view. The design of ECLAIRs has been driven by the objective to reach an unprecedented low-energy threshold of 4 keV. The detection plane is an assembly of 6400 Schottky CdTe detectors of size 4x4x1 mm3, biased from -200V to -500V and operated at -20°C. The low-energy threshold is achieved thanks to an innovative hybrid module composed of a thick film ceramic holding 32 CdTe detectors ("Detectors Ceramics"), associated to an HTCC ceramic housing a low-noise 32-channel ASIC ("ASIC Ceramics"). We manage the coupling between Detectors Ceramics and ASIC Ceramics in order to achieve the best performance and ensure the uniformity of the detection plane. In this paper, we describe the complete hybrid XRDPIX, of which 50 flight models have been manufactured by the SAGEM company. Afterwards, we show test results obtained on Detectors Ceramics, on ASIC Ceramics and on the modules once assembled. Then, we compare and confront detectors leakage currents and ASIC ENC with the energy threshold values and FWHM measured on XRDPIX modules at the temperature of -20°C by using a calibrated radioactive source of 241Am. Finally, we study the homogeneity of the spectral properties of the 32-detector hybrid matrices and we conclude on general performance of more than 1000 detection channels which may reach the lowenergy threshold of 4 keV required for the future ECLAIRs space camera.
Chassagnon, Irène R.; McCarthy, Claudia A.; Chin, Yanni K.-Y.; Pineda, Sandy S.; Mobli, Mehdi; Pham, Vi; De Silva, T. Michael; Lynch, Joseph W.; Widdop, Robert E.; Rash, Lachlan D.
2017-01-01
Stroke is the second-leading cause of death worldwide, yet there are no drugs available to protect the brain from stroke-induced neuronal injury. Acid-sensing ion channel 1a (ASIC1a) is the primary acid sensor in mammalian brain and a key mediator of acidosis-induced neuronal damage following cerebral ischemia. Genetic ablation and selective pharmacologic inhibition of ASIC1a reduces neuronal death following ischemic stroke in rodents. Here, we demonstrate that Hi1a, a disulfide-rich spider venom peptide, is highly neuroprotective in a focal model of ischemic stroke. Nuclear magnetic resonance structural studies reveal that Hi1a comprises two homologous inhibitor cystine knot domains separated by a short, structurally well-defined linker. In contrast with known ASIC1a inhibitors, Hi1a incompletely inhibits ASIC1a activation in a pH-independent and slowly reversible manner. Whole-cell, macropatch, and single-channel electrophysiological recordings indicate that Hi1a binds to and stabilizes the closed state of the channel, thereby impeding the transition into a conducting state. Intracerebroventricular administration to rats of a single small dose of Hi1a (2 ng/kg) up to 8 h after stroke induction by occlusion of the middle cerebral artery markedly reduced infarct size, and this correlated with improved neurological and motor function, as well as with preservation of neuronal architecture. Thus, Hi1a is a powerful pharmacological tool for probing the role of ASIC1a in acid-mediated neuronal injury and various neurological disorders, and a promising lead for the development of therapeutics to protect the brain from ischemic injury. PMID:28320941
Huque, Taufiqul; Cowart, Beverly J.; Dankulich-Nagrudny, Luba; Pribitkin, Edmund A.; Bayley, Douglas L.; Spielman, Andrew I.; Feldman, Roy S.; Mackler, Scott A.; Brand, Joseph G.
2009-01-01
Background The perception of sour taste in humans is incompletely understood at the receptor cell level. We report here on two patients with an acquired sour ageusia. Each patient was unresponsive to sour stimuli, but both showed normal responses to bitter, sweet, and salty stimuli. Methods and Findings Lingual fungiform papillae, containing taste cells, were obtained by biopsy from the two patients, and from three sour-normal individuals, and analyzed by RT-PCR. The following transcripts were undetectable in the patients, even after 50 cycles of amplification, but readily detectable in the sour-normal subjects: acid sensing ion channels (ASICs) 1a, 1β, 2a, 2b, and 3; and polycystic kidney disease (PKD) channels PKD1L3 and PKD2L1. Patients and sour-normals expressed the taste-related phospholipase C-β2, the δ-subunit of epithelial sodium channel (ENaC) and the bitter receptor T2R14, as well as β-actin. Genomic analysis of one patient, using buccal tissue, did not show absence of the genes for ASIC1a and PKD2L1. Immunohistochemistry of fungiform papillae from sour-normal subjects revealed labeling of taste bud cells by antibodies to ASICs 1a and 1β, PKD2L1, phospholipase C-β2, and δ-ENaC. An antibody to PKD1L3 labeled tissue outside taste bud cells. Conclusions These data suggest a role for ASICs and PKDs in human sour perception. This is the first report of sour ageusia in humans, and the very existence of such individuals (“natural knockouts”) suggests a cell lineage for sour that is independent of the other taste modalities. PMID:19812697
DockoMatic: automated peptide analog creation for high throughput virtual screening.
Jacob, Reed B; Bullock, Casey W; Andersen, Tim; McDougal, Owen M
2011-10-01
The purpose of this manuscript is threefold: (1) to describe an update to DockoMatic that allows the user to generate cyclic peptide analog structure files based on protein database (pdb) files, (2) to test the accuracy of the peptide analog structure generation utility, and (3) to evaluate the high throughput capacity of DockoMatic. The DockoMatic graphical user interface interfaces with the software program Treepack to create user defined peptide analogs. To validate this approach, DockoMatic produced cyclic peptide analogs were tested for three-dimensional structure consistency and binding affinity against four experimentally determined peptide structure files available in the Research Collaboratory for Structural Bioinformatics database. The peptides used to evaluate this new functionality were alpha-conotoxins ImI, PnIA, and their published analogs. Peptide analogs were generated by DockoMatic and tested for their ability to bind to X-ray crystal structure models of the acetylcholine binding protein originating from Aplysia californica. The results, consisting of more than 300 simulations, demonstrate that DockoMatic predicts the binding energy of peptide structures to within 3.5 kcal mol(-1), and the orientation of bound ligand compares to within 1.8 Å root mean square deviation for ligand structures as compared to experimental data. Evaluation of high throughput virtual screening capacity demonstrated that Dockomatic can collect, evaluate, and summarize the output of 10,000 AutoDock jobs in less than 2 hours of computational time, while 100,000 jobs requires approximately 15 hours and 1,000,000 jobs is estimated to take up to a week. Copyright © 2011 Wiley Periodicals, Inc.
Silicon photomultipliers for scintillating trackers
NASA Astrophysics Data System (ADS)
Rabaioli, S.; Berra, A.; Bolognini, D.; Bonvicini, V.; Bosisio, L.; Ciano, S.; Iugovaz, D.; Lietti, D.; Penzo, A.; Prest, M.; Rashevskaya, I.; Reia, S.; Stoppani, L.; Vallazza, E.
2012-12-01
In recent years, silicon photomultipliers (SiPMs) have been proposed as a new kind of readout device for scintillating detectors in many experiments. A SiPM consists of a matrix of parallel-connected pixels, which are independent photon counters working in Geiger mode with very high gain (∼106). This contribution presents the use of an array of eight SiPMs (manufactured by FBK-irst) for the readout of a scintillating bar tracker (a small size prototype of the Electron Muon Ranger detector for the MICE experiment). The performances of the SiPMs in terms of signal to noise ratio, efficiency and time resolution will be compared to the ones of a multi-anode photomultiplier tube (MAPMT) connected to the same bars. Both the SiPMs and the MAPMT are interfaced to a VME system through a 64 channel MAROC ASIC.
An update on the development of IO:I: a NIR imager for the Liverpool Telescope
NASA Astrophysics Data System (ADS)
Barnsley, R. M.; Steele, I. A.; Bates, S. D.; Mottram, C. J.
2014-07-01
IO:I is a new instrument in development for the Liverpool Telescope, extending current imaging capabilities beyond the optical and into the near infrared. Cost has been minimised by use of a previously decommissioned instrument's dewar as the base for a prototype, and retrofitting it with a 1.7μm cutoff Hawaii-2RG HgCdTe detector, SIDECAR ASIC controller and JADE2 interface card. Development of this prototype is nearing completion and will be operational mid 2014. In this paper, the mechanical, electronic and cryogenic facets of the dewar retrofitting process will be discussed together with a description of the instrument control system software/hardware setup. Finally, a brief overview of some initial testing undertaken on the engineering grade array will be given, along with future commissioning plans for the instrument.
NASA Astrophysics Data System (ADS)
Hou, Ligang; Luo, Rengui; Wu, Wuchen
2006-11-01
This paper forwards a low power grating detection chip (EYAS) on length and angle precision measurement. Traditional grating detection method, such as resister chain divide or phase locked divide circuit are difficult to design and tune. The need of an additional CPU for control and display makes these methods' implementation more complex and costly. Traditional methods also suffer low sampling speed for the complex divide circuit scheme and CPU software compensation. EYAS is an application specific integrated circuit (ASIC). It integrates micro controller unit (MCU), power management unit (PMU), LCD controller, Keyboard interface, grating detection unit and other peripherals. Working at 10MHz, EYAS can afford 5MHz internal sampling rate and can handle 1.25MHz orthogonal signal from grating sensor. With a simple control interface by keyboard, sensor parameter, data processing and system working mode can be configured. Two LCD controllers can adapt to dot array LCD or segment bit LCD, which comprised output interface. PMU alters system between working and standby mode by clock gating technique to save power. EYAS in test mode (system action are more frequently than real world use) consumes 0.9mw, while 0.2mw in real world use. EYAS achieved the whole grating detection system function, high-speed orthogonal signal handling in a single chip with very low power consumption.
Packet based serial link realized in FPGA dedicated for high resolution infrared image transmission
NASA Astrophysics Data System (ADS)
Bieszczad, Grzegorz
2015-05-01
In article the external digital interface specially designed for thermographic camera built in Military University of Technology is described. The aim of article is to illustrate challenges encountered during design process of thermal vision camera especially related to infrared data processing and transmission. Article explains main requirements for interface to transfer Infra-Red or Video digital data and describes the solution which we elaborated based on Low Voltage Differential Signaling (LVDS) physical layer and signaling scheme. Elaborated link for image transmission is built using FPGA integrated circuit with built-in high speed serial transceivers achieving up to 2500Gbps throughput. Image transmission is realized using proprietary packet protocol. Transmission protocol engine was described in VHDL language and tested in FPGA hardware. The link is able to transmit 1280x1024@60Hz 24bit video data using one signal pair. Link was tested to transmit thermal-vision camera picture to remote monitor. Construction of dedicated video link allows to reduce power consumption compared to solutions with ASIC based encoders and decoders realizing video links like DVI or packed based Display Port, with simultaneous reduction of wires needed to establish link to one pair. Article describes functions of modules integrated in FPGA design realizing several functions like: synchronization to video source, video stream packeting, interfacing transceiver module and dynamic clock generation for video standard conversion.
NASA Astrophysics Data System (ADS)
Zanni, Martin
2012-02-01
Sum-frequency generation spectroscopy provides an infrared spectrum of interfaces and thus has widespread use in the materials and chemical sciences. In this presentation, I will present our recent work in developing a 2D pulse sequence to generate 2D SFG spectra of interfaces, in analogy to 2D infrared spectra used to measure bulk species. To develop this spectroscopy, we have utilized many of the tricks-of-the-trade developed in the 2D IR and 2D Vis communities in the last decade, including mid-IR pulse shaping. With mid-IR pulse shaping, the 2D pulse sequence is manipulated by computer programming in the desired frequency resolution, rotating frame, and signal pathway. We believe that 2D SFG will become an important tool in the interfacial sciences in an analogous way that 2D IR is now being used in many disciplines.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Heffner, M.; Riot, V.; Fabris, L.
Medium to large channel count detectors are usually faced with a few unattractive options for data acquisition (DAQ). Small to medium sized TPC experiments, for example, can be too small to justify the high expense and long development time of application specific integrated circuit (ASIC) development. In some cases an experiment can piggy-back on a larger experiment and the associated ASIC development, but this puts the time line of development out of the hands of the smaller experiment. Another option is to run perhaps thousands of cables to rack mounted equipment, which is clearly undesirable. The development of commercial high-speedmore » high-density FPGAs and ADCs combined with the small discrete components and robotic assembly open a new option that scales to tens of thousands of channels and is only slightly larger than ASICs using off-the-shelf components.« less
An ASIC memory buffer controller for a high speed disk system
NASA Technical Reports Server (NTRS)
Hodson, Robert F.; Campbell, Steve
1993-01-01
The need for large capacity, high speed mass memory storage devices has become increasingly evident at NASA during the past decade. High performance mass storage systems are crucial to present and future NASA systems. Spaceborne data storage system requirements have grown in response to the increasing amounts of data generated and processed by orbiting scientific experiments. Predictions indicate increases in the volume of data by orders of magnitude during the next decade. Current predictions are for storage capacities on the order of terabits (Tb), with data rates exceeding one gigabit per second (Gbps). As part of the design effort for a state of the art mass storage system, NASA Langley has designed a 144 CMOS ASIC to support high speed data transfers. This paper discusses the system architecture, ASIC design and some of the lessons learned in the development process.
Latest generation of ASICs for photodetector readout
NASA Astrophysics Data System (ADS)
Seguin-Moreau, N.
2013-08-01
The OMEGA microelectronics group has designed a new generation of multichannel integrated circuits, the "ROC" family, in AustrianMicroSystem (AMS) SiGe 0.35 μm technology to read out signals from various families of photodetectors. The chip named MAROC (standing for Multi Anode ReadOut Chip) has been designed to read out MultiAnode Photomultipliers (MAPMT), Photomultiplier ARray In SiGe ReadOut Chip (PARISROC) to read out Photomultipliers (PMTs) and SiPM Integrated ReadOut Chip (SPIROC) to readout Silicon PhotoMultiplier (SiPM) detectors and which was the first ASIC to do so. The three of them fulfill the stringent requirements of the future photodetectors, in particular in terms of low noise, radiation hardness, large dynamic range, high density and high speed while keeping low power thanks to the SiGe technology. These multi-channel ASICs are real System on Chip (SoC) as they provide charge, time and photon-counting information which are digitized internally. Their complexity and versatility enable innovative frontier detectors and also cover spin off of these detectors in adjacent fields such as medical or material imaging as well as smart detectors. In this presentation, the three ASIC architectures and test results will be described to give a general panorama of the "ROC" chips.
Ultra-high-speed optical transmission using digital-preprocessed analog-multiplexed DAC
NASA Astrophysics Data System (ADS)
Yamazaki, Hiroshi; Nagatani, Munehiko; Hamaoka, Fukutaro; Horikoshi, Kengo; Nakamura, Masanori; Matsushita, Asuka; Kanazawa, Shigeru; Hashimoto, Toshikazu; Nosaka, Hideyuki; Miyamoto, Yutaka
2018-02-01
In advanced fiber transmission systems with digital signal processors (DSPs), analog bandwidths of digital-to-analog converters (DACs), which interface the DSPs and optics, are the major factors limiting the data rates. We have developed a technology to extend the DACs' bandwidth using a digital preprocessor, two sub-DACs, and an analog multiplexer. This technology enables us to generate baseband signals with bandwidths of up to around 60 GHz, which is almost twice that of signals generated by typical CMOS DACs. In this paper, we describe the principle of the bandwidth extension and review high-speed transmission experiments enabled by this technology.
Design Study of a Multi-channel Array Particle Spectrometer for Space Missions
NASA Astrophysics Data System (ADS)
Trindade, Andreia; Assis, P.; Brogueira, P.; Gonçalves, P.; Keating, A.; Pimenta, M.; Rodrigues, P.; Trindade, A.
In this work, a novel particle spectrometer is proposed to fulfil the need to map the space radiation environment for future space missions and to provide more accurate scientific data. The concept of the instrument brings together new radiation-hard technologies, for the photo-sensors and scintillating materials that will improve the quality of the data, while taking into account the limited resources such as mass, power and accommodation, allocated for space radiation monitors. The Multi-channel Array Particle Spectrometer (MAPS), can measure fluxes and energy dis-tributions of protons, ions, electrons and gammas in a wide energy range based on the 3D reconstruction of the particle track through the detector and its deposited energy in the active volume. It consists on a 8 x 8 segmented scintillator block built from 3.2 x 3.2 x 20 mm3 indi-vidual LYSO:Ce rods that are readout at both ends by two 64 pixel Silicon Photo-Multipliers (SiPMs) matrices, a new generation of high gain (105-106) avalanche photodiodes working in controlled Geiger mode, that collect the scintillating light produced by the interactions of the charged particles in the crystals. Each SiPM matrix is readout by a 64 channel mixed sig-nal analog-digital ASIC, offering both particle identification and particle counting capabilities. Power cycling design of the ASIC allows to activate the particle identification block only during a pre-determined time slice, keeping the total power budget of less than 1 mW/channel. An on-board FPGA sorts the serialized data from the two ASICs and computes the trigger primitives in real-time and in an event-by-event basis. Whenever a charged particle crosses the segmented volume of the detector, the XY coordinates, given by the pixelized crystal positions, and the deposited energy in each crystal is recorded. The double readout scheme allows to compute the light collection asymmetry between both ends of the crystal and to use that information to record the longitudinal interaction coordinate along the crystal with a resolution between 2-3 mm FWHM. As a result of determining the interaction coordinates and the topology of the energy depositions in the different layers of crystals, the type, incident energy and direction of the incoming particles can be reconstructed. A direct outcome of this concept is the up-down discrimination and lateral veto for radiation background rejection while keeping a simple read-out arrangement. Using this segmented, independent channel approach, a maximum count-rate of 1.3 MHz/cm2 and 6.3 MHz/cm2 for a 1% and 5% event pileup probability, respectively, can be achieved. In this work, the Geant4 Monte Carlo simulation toolkit was used to demonstrate the MAPS design feasibility and to assess its performance in different radiation scenarios. First results have shown the capability to measure protons from 1 to 350 MeV and alphas from 5 to 800 MeV, representing a significant increase in the energy range of traditional scintillator-based radiation monitors and with almost no ambiguity in particle discrimination. As a result of the proposed concept based on compact photo-sensors and electronics architecture, the current design of MAPS points to a power budget of 1Watt, a mass of 0.5 kg and a total dimen-sion of 10 x 10 x 10 cm3 matching the requirements for space applications. In a subsequent phase, space qualification of the new designed detector has to be addressed. A detailed assess-ment of MAPS performance, using the instrument Geant4 simulation interfaced with typical observation scenarios and including the first experimental results, will be presented and dis-cussed at COSPAR2010.
Microcontroller interface for diode array spectrometry
NASA Astrophysics Data System (ADS)
Aguo, L.; Williams, R. R.
An alternative to bus-based computer interfacing is presented using diode array spectrometry as a typical application. The new interface consists of an embedded single-chip microcomputer, known as a microcontroller, which provides all necessary digital I/O and analog-to-digital conversion (ADC) along with an unprecedented amount of intelligence. Communication with a host computer system is accomplished by a standard serial interface so this type of interfacing is applicable to a wide range of personal and minicomputers and can be easily networked. Data are acquired asynchronousty and sent to the host on command. New operating modes which have no traditional counterparts are presented.
NASA Astrophysics Data System (ADS)
Gigan, Olivier; Chen, Hua; Robert, Olivier; Renard, Stephane; Marty, Frederic
2002-11-01
This paper is dedicated to the fabrication and technological aspect of a silicon microresonator sensor. The entire project includes the fabrication processes, the system modelling/simulation, and the electronic interface. The mechanical model of such resonator is presented including description of frequency stability and Hysterises behaviour of the electrostatically driven resonator. Numeric model and FEM simulations are used to simulate the system dynamic behaviour. The complete fabrication process is based on standard microelectronics technology with specific MEMS technological steps. The key steps are described: micromachining on SOI by Deep Reactive Ion Etching (DRIE), specific release processes to prevent sticking (resist and HF-vapour release process) and collective vacuum encapsulation by Silicon Direct Bonding (SDB). The complete process has been validated and prototypes have been fabricated. The ASIC was designed to interface the sensor and to control the vibration amplitude. This electronic was simulated and designed to work up to 200°C and implemented in a standard 0.6μ CMOS technology. Characterizations of sensor prototypes are done both mechanically and electrostatically. These measurements showed good agreements with theory and FEM simulations.
Fló, Martín; Margenat, Mariana; Pellizza, Leonardo; Durán, Rosario; Salceda, Emilio; Alvarez, Beatriz
2017-01-01
We previously reported a multigene family of monodomain Kunitz proteins from Echinococcus granulosus (EgKU-1-EgKU-8), and provided evidence that some EgKUs are secreted by larval worms to the host interface. In addition, functional studies and homology modeling suggested that, similar to monodomain Kunitz families present in animal venoms, the E. granulosus family could include peptidase inhibitors as well as channel blockers. Using enzyme kinetics and whole-cell patch-clamp, we now demonstrate that the EgKUs are indeed functionally diverse. In fact, most of them behaved as high affinity inhibitors of either chymotrypsin (EgKU-2-EgKU-3) or trypsin (EgKU-5-EgKU-8). In contrast, the close paralogs EgKU-1 and EgKU-4 blocked voltage-dependent potassium channels (Kv); and also pH-dependent sodium channels (ASICs), while showing null (EgKU-1) or marginal (EgKU-4) peptidase inhibitory activity. We also confirmed the presence of EgKUs in secretions from other parasite stages, notably from adult worms and metacestodes. Interestingly, data from genome projects reveal that at least eight additional monodomain Kunitz proteins are encoded in the genome; that particular EgKUs are up-regulated in various stages; and that analogous Kunitz families exist in other medically important cestodes, but not in trematodes. Members of this expanded family of secreted cestode proteins thus have the potential to block, through high affinity interactions, the function of host counterparts (either peptidases or cation channels) and contribute to the establishment and persistence of infection. From a more general perspective, our results confirm that multigene families of Kunitz inhibitors from parasite secretions and animal venoms display a similar functional diversity and thus, that host-parasite co-evolution may also drive the emergence of a new function associated with the Kunitz scaffold. PMID:28192542
Feasibility study of a ``4H'' X-ray camera based on GaAs:Cr sensor
NASA Astrophysics Data System (ADS)
Dragone, A.; Kenney, C.; Lozinskaya, A.; Tolbanov, O.; Tyazhev, A.; Zarubin, A.; Wang, Zhehui
2016-11-01
A multilayer stacked X-ray camera concept is described. This type of technology is called `4H' X-ray cameras, where 4H stands for high-Z (Z>30) sensor, high-resolution (less than 300 micron pixel pitch), high-speed (above 100 MHz), and high-energy (above 30 keV in photon energy). The components of the technology, similar to the popular two-dimensional (2D) hybrid pixelated array detectors, consists of GaAs:Cr sensors bonded to high-speed ASICs. 4H cameras based on GaAs also use integration mode of X-ray detection. The number of layers, on the order of ten, is smaller than an earlier configuration for single-photon-counting (SPC) mode of detection [1]. High-speed ASIC based on modification to the ePix family of ASIC is discussed. Applications in X-ray free electron lasers (XFELs), synchrotrons, medicine and non-destructive testing are possible.
A Compact, Flexible, High Channel Count DAQ Built From Off-the-Shelf Components
Heffner, M.; Riot, V.; Fabris, L.
2013-06-01
Medium to large channel count detectors are usually faced with a few unattractive options for data acquisition (DAQ). Small to medium sized TPC experiments, for example, can be too small to justify the high expense and long development time of application specific integrated circuit (ASIC) development. In some cases an experiment can piggy-back on a larger experiment and the associated ASIC development, but this puts the time line of development out of the hands of the smaller experiment. Another option is to run perhaps thousands of cables to rack mounted equipment, which is clearly undesirable. The development of commercial high-speedmore » high-density FPGAs and ADCs combined with the small discrete components and robotic assembly open a new option that scales to tens of thousands of channels and is only slightly larger than ASICs using off-the-shelf components.« less
Potential Roles of Amiloride-Sensitive Sodium Channels in Cancer Development.
Xu, Siguang; Liu, Cui; Ma, Yana; Ji, Hong-Long; Li, Xiumin
2016-01-01
The ENaC/degenerin ion channel superfamily includes the amiloride-sensitive epithelial sodium channel (ENaC) and acid sensitive ionic channel (ASIC). ENaC is a multimeric ion channel formed by heteromultimeric membrane glycoproteins, which participate in a multitude of biological processes by mediating the transport of sodium (Na(+)) across epithelial tissues such as the kidney, lungs, bladder, and gut. Aberrant ENaC functions contribute to several human disease states including pseudohypoaldosteronism, Liddle syndrome, cystic fibrosis, and salt-sensitive hypertension. Increasing evidence suggests that ion channels not only regulate ion homeostasis and electric signaling in excitable cells but also play important roles in cancer cell behaviors such as proliferation, apoptosis, invasion, and migration. Indeed, ENaCs/ASICs had been reported to be associated with cancer characteristics. Given their cell surface localization and pharmacology, pharmacological strategies to target ENaC/ASIC family members may be promising cancer therapeutics.
Implementation of the Timepix ASIC in the Scalable Readout System
NASA Astrophysics Data System (ADS)
Lupberger, M.; Desch, K.; Kaminski, J.
2016-09-01
We report on the development of electronics hardware, FPGA firmware and software to provide a flexible multi-chip readout of the Timepix ASIC within the framework of the Scalable Readout System (SRS). The system features FPGA-based zero-suppression and the possibility to read out up to 4×8 chips with a single Front End Concentrator (FEC). By operating several FECs in parallel, in principle an arbitrary number of chips can be read out, exploiting the scaling features of SRS. Specifically, we tested the system with a setup consisting of 160 Timepix ASICs, operated as GridPix devices in a large TPC field cage in a 1 T magnetic field at a DESY test beam facility providing an electron beam of up to 6 GeV. We discuss the design choices, the dedicated hardware components, the FPGA firmware as well as the performance of the system in the test beam.
NASA Astrophysics Data System (ADS)
Wang, Jia; Su, Lin; Wei, Xiaomin; Zheng, Ran; Hu, Yann
2016-09-01
This paper presents an ASIC readout circuit development, which aims to achieve low noise. In order to compensate the leakage current and improve gain, a dual-stage CSA has been utilized. A 4th-order high-linearity shaper is proposed to obtain a Semi-Gaussian wave and further decrease the noise induced by the leakage current. The ASIC has been designed and fabricated in a standard commercial 2P4M 0.35 μm CMOS process. Die area of one channel is about 1190 μm×147 μm. The input charge range is 1.8 fC. The peaking time can be adjusted from 1 μs to 3 μs. Measured ENC is about 55e- (rms) at input capacitor of 0 F. The gain is 271 mV/fC at the peaking time of 1 μs.
Holt, Jerred; Bennett, Kevin B; Flach, John M
2015-01-01
Two sets of design principles for analogical visual displays, based on the concepts of emergent features and perceptual objects, are described. An interpretation of previous empirical findings for three displays (bar graph, polar graphic, alphanumeric) is provided from both perspectives. A fourth display (configural coordinate) was designed using principles of ecological interface design (i.e. direct perception). An experiment was conducted to evaluate performance (accuracy and latency of state identification) with these four displays. Numerous significant effects were obtained and a clear rank ordering of performance emerged (from best to worst): configural coordinate, bar graph, alphanumeric and polar graphic. These findings are consistent with principles of design based on emergent features; they are inconsistent with principles based on perceptual objects. Some limitations of the configural coordinate display are discussed and a redesign is provided. Practitioner Summary: Principles of ecological interface design, which emphasise the quality of very specific mappings between domain, display and observer constraints, are described; these principles are applicable to the design of all analogical graphical displays.
Coarse Grain Reconfigurable ASIC through Multiplexer Based Switches
2015-09-15
chip area (0.5 mm2), and from simulation their power consumption is negligible (0.002% from simulation, too small to measure in physical system...performing implementation that is also flexible. REFERENCES [1] I. Kuon and J. Rose, “ Measuring the gap between FPGAs and ASICs,” IEEE Trans...A 3GPP- LTE Example," Solid-State Circuits, IEEE Journal of , vol.47, no.3, pp.757,768, March 2012. [5] Agarwal, A.; Hassanieh, H.; Abari, O
DOE Office of Scientific and Technical Information (OSTI.GOV)
Braga, D.; Coleman-Smith, P. J.; Davinson, T.
We have designed a read-out ASIC for nuclear decay spectroscopy as part of the AIDA project - the Advanced Implantation Detector Array. AIDA will be installed in experiments at the Facility for Antiproton and Ion Research in GSI, Darmstadt. The AIDA ASIC will measure the signals when unstable nuclei are implanted into the detector, followed by the much smaller signals when the nuclei subsequently decay. Implant energies can be as high as 20 GeV; decay products need to be measured down to 25 keV within just a few microseconds of the initial implants. The ASIC uses two amplifiers per detectormore » channel, one covering the 20 GeV dynamic range, the other selectable over a 20 MeV or 1 GeV range. The amplifiers are linked together by bypass transistors which are normally switched off. The arrival of a large signal causes saturation of the low-energy amplifier and a fluctuation of the input voltage, which activates the link to the high-energy amplifier. The bypass transistors switch on and the input charge is integrated by the high-energy amplifier. The signal is shaped and stored by a peak-hold, then read out on a multiplexed output. Control logic resets the amplifiers and bypass circuit, allowing the low-energy amplifier to measure the subsequent decay signal. We present simulations and test results, demonstrating the AIDA ASIC operation over a wide range of input signals. (authors)« less
Gilbert, Hamish T J; Hodson, Nathan; Baird, Pauline; Richardson, Stephen M; Hoyland, Judith A
2016-11-17
The aetiology of intervertebral disc (IVD) degeneration remains poorly understood. Painful IVD degeneration is associated with an acidic intradiscal pH but the response of NP cells to this aberrant microenvironmental factor remains to be fully characterised. The aim here was to address the hypothesis that acidic pH, similar to that found in degenerate IVDs, leads to the altered cell/functional phenotype observed during IVD degeneration, and to investigate the involvement of acid-sensing ion channel (ASIC) -3 in the response. Human NP cells were treated with a range of pH, from that of a non-degenerate (pH 7.4 and 7.1) through to mildly degenerate (pH 6.8) and severely degenerate IVD (pH 6.5 and 6.2). Increasing acidity of pH caused a decrease in cell proliferation and viability, a shift towards matrix catabolism and increased expression of proinflammatory cytokines and pain-related factors. Acidic pH resulted in an increase in ASIC-3 expression. Importantly, inhibition of ASIC-3 prevented the acidic pH induced proinflammatory and pain-related phenotype in NP cells. Acidic pH causes a catabolic and degenerate phenotype in NP cells which is inhibited by blocking ASIC-3 activity, suggesting that this may be a useful therapeutic target for treatment of IVD degeneration.
An integrated signal conditioner for high-frequency inductive position sensors
NASA Astrophysics Data System (ADS)
Rahal, Mohamad; Demosthenous, Andreas
2010-01-01
This paper describes the design, implementation and evaluation of a signal conditioner application-specific integrated circuit (ASIC) for high-frequency inductive non-contact position sensors. These sensors employ a radio frequency technology based on an antenna planar arrangement and a resonant target, have a high inherent resolution (0.1% of antenna length) and can measure target position over a wide distance range (<0.1 mm to >10 m). However, due to the relatively high-frequency excitation (1 MHz typically) and to the specific layouts of these sensors, there is unwanted capacitive coupling between the transmitter and receiver coils; this type of distortion reduces linearity and resolution. The ASIC, which is the first generation of its kind for this type of sensor, employs a differential mixer topology which suppresses the capacitive coupling offsets. The system architecture and circuit details are presented. The ASIC was fabricated in a 0.6 µm high-voltage CMOS technology occupying an area of 8 mm2. It dissipates about 30 mA from a 24 V power supply. The ASIC was tested with a high-frequency inductive position sensor (with an antenna length of 10.8 cm). The measured input-referred offset due to transmitter crosstalk is on average about 22 µV over a wide phase difference variation (-99° to +117°) between the transmitter and demodulating signals.
Ultrasound phase rotation beamforming on multi-core DSP.
Ma, Jieming; Karadayi, Kerem; Ali, Murtaza; Kim, Yongmin
2014-01-01
Phase rotation beamforming (PRBF) is a commonly-used digital receive beamforming technique. However, due to its high computational requirement, it has traditionally been supported by hardwired architectures, e.g., application-specific integrated circuits (ASICs) or more recently field-programmable gate arrays (FPGAs). In this study, we investigated the feasibility of supporting software-based PRBF on a multi-core DSP. To alleviate the high computing requirement, the analog front-end (AFE) chips integrating quadrature demodulation in addition to analog-to-digital conversion were defined and used. With these new AFE chips, only delay alignment and phase rotation need to be performed by DSP, substantially reducing the computational load. We implemented the delay alignment and phase rotation modules on a Texas Instruments C6678 DSP with 8 cores. We found it takes 200 μs to beamform 2048 samples from 64 channels using 2 cores. With 4 cores, 20 million samples can be beamformed in one second. Therefore, ADC frequencies up to 40 MHz with 2:1 decimation in AFE chips or up to 20 MHz with no decimation can be supported as long as the ADC-to-DSP I/O requirement can be met. The remaining 4 cores can work on back-end processing tasks and applications, e.g., color Doppler or ultrasound elastography. One DSP being able to handle both beamforming and back-end processing could lead to low-power and low-cost ultrasound machines, benefiting ultrasound imaging in general, particularly portable ultrasound machines. Copyright © 2013 Elsevier B.V. All rights reserved.
Tests with beam setup of the TileCal phase-II upgrade electronics
NASA Astrophysics Data System (ADS)
Reward Hlaluku, Dingane
2017-09-01
The LHC has planned a series of upgrades culminating in the High Luminosity LHC which will have an average luminosity 5-7 times larger than the nominal Run-2 value. The ATLAS Tile calorimeter plans to introduce a new readout architecture by completely replacing the back-end and front-end electronics for the High Luminosity LHC. The photomultiplier signals will be fully digitized and transferred for every bunch crossing to the off-detector Tile PreProcessor. The Tile PreProcessor will further provide preprocessed digital data to the first level of trigger with improved spatial granularity and energy resolution in contrast to the current analog trigger signals. A single super-drawer module commissioned with the phase-II upgrade electronics is to be inserted into the real detector to evaluate and qualify the new readout and trigger concepts in the overall ATLAS data acquisition system. This new super-drawer, so-called hybrid Demonstrator, must provide analog trigger signals for backward compatibility with the current system. This Demonstrator drawer has been inserted into a Tile calorimeter module prototype to evaluate the performance in the lab. In parallel, one more module has been instrumented with two other front-end electronics options based on custom ASICs (QIE and FATALIC) which are under evaluation. These two modules together with three other modules composed of the current system electronics were exposed to different particles and energies in three test-beam campaigns during 2015 and 2016.
Advanced technology satellite demodulator development
NASA Technical Reports Server (NTRS)
Ames, Stephen A.
1989-01-01
Ford Aerospace has developed a proof-of-concept satellite 8 phase shift keying (PSK) modulation and coding system operating in the Time Division Multiple Access (TDMA) mode at a data range of 200 Mbps using rate 5/6 forward error correction coding. The 80 Msps 8 PSK modem was developed in a mostly digital form and is amenable to an ASIC realization in the next phase of development. The codec was developed as a paper design only. The power efficiency goal was to be within 2 dB of theoretical at a bit error rate (BER) of 5x10(exp 7) while the measured implementation loss was 4.5 dB. The bandwidth efficiency goal was 2 bits/sec/Hz while the realized bandwidth efficiency was 1.8 bits/sec/Hz. The burst format used a preamble of only 40 8 PSK symbol times including 32 symbols of all zeros and an eight symbol unique word. The modem and associated special test equipment (STE) were fabricated mostly on a specially designed stitch-weld board although a few of the highest rate circuits were built on printed circuit cards. All the digital circuits were ECL to support the clock rates of from 80 MHz to 360 MHz. The transmitter and receiver matched filters were square-root Nyquist bandpass filters realized at the 3.37 GHz i.f. The modem operated as a coherent system although no analog phase locked (PLL) loop was employed. Within the budgetary constraints of the program, the approach to the demodulator has been proven and is eligible to proceed to the next phase of development of a satellite demodulator engineering model. This would entail the development of an ASIC version of the digital portion of the demodulator, and MMIC version of the quadrature detector, and SAW Nyquist filters to realize the bandwidth efficiency.
A closed-loop compressive-sensing-based neural recording system.
Zhang, Jie; Mitra, Srinjoy; Suo, Yuanming; Cheng, Andrew; Xiong, Tao; Michon, Frederic; Welkenhuysen, Marleen; Kloosterman, Fabian; Chin, Peter S; Hsiao, Steven; Tran, Trac D; Yazicioglu, Firat; Etienne-Cummings, Ralph
2015-06-01
This paper describes a low power closed-loop compressive sensing (CS) based neural recording system. This system provides an efficient method to reduce data transmission bandwidth for implantable neural recording devices. By doing so, this technique reduces a majority of system power consumption which is dissipated at data readout interface. The design of the system is scalable and is a viable option for large scale integration of electrodes or recording sites onto a single device. The entire system consists of an application-specific integrated circuit (ASIC) with 4 recording readout channels with CS circuits, a real time off-chip CS recovery block and a recovery quality evaluation block that provides a closed feedback to adaptively adjust compression rate. Since CS performance is strongly signal dependent, the ASIC has been tested in vivo and with standard public neural databases. Implemented using efficient digital circuit, this system is able to achieve >10 times data compression on the entire neural spike band (500-6KHz) while consuming only 0.83uW (0.53 V voltage supply) additional digital power per electrode. When only the spikes are desired, the system is able to further compress the detected spikes by around 16 times. Unlike other similar systems, the characteristic spikes and inter-spike data can both be recovered which guarantes a >95% spike classification success rate. The compression circuit occupied 0.11mm(2)/electrode in a 180nm CMOS process. The complete signal processing circuit consumes <16uW/electrode. Power and area efficiency demonstrated by the system make it an ideal candidate for integration into large recording arrays containing thousands of electrode. Closed-loop recording and reconstruction performance evaluation further improves the robustness of the compression method, thus making the system more practical for long term recording.
NASA Astrophysics Data System (ADS)
Mourgias-Alexandris, G.; Moralis-Pegios, M.; Terzenidis, N.; Cherchi, M.; Harjanne, M.; Aalto, T.; Vyrsokinos, K.; Pleros, N.
2018-02-01
The urgent need for high-bandwidth and high-port connectivity in Data Centers has boosted the deployment of optoelectronic packet switches towards bringing high data-rate optics closer to the ASIC, realizing optical transceiver functions directly at the ASIC package for high-rate, low-energy and low-latency interconnects. Even though optics can offer a broad range of low-energy integrated switch fabrics for replacing electronic switches and seamlessly interface with the optical I/Os, the use of energy- and latency-consuming electronic SerDes continues to be a necessity, mainly dictated by the absence of integrated and reliable optical buffering solutions. SerDes undertakes the role of optimally synergizing the lower-speed electronic buffers with the incoming and outgoing optical streams, suggesting that a SerDes-released chip-scale optical switch fabric can be only realized in case all necessary functions including contention resolution and switching can be implemented on a common photonic integration platform. In this paper, we demonstrate experimentally a hybrid Broadcast-and-Select (BS) / wavelength routed optical switch that performs both the optical buffering and switching functions with μm-scale Silicon-integrated building blocks. Optical buffering is carried out in a silicon-integrated variable delay line bank with a record-high on-chip delay/footprint efficiency of 2.6ns/mm2 and up to 17.2 nsec delay capability, while switching is executed via a BS design and a silicon-integrated echelle grating, assisted by SOA-MZI wavelength conversion stages and controlled by a FPGA header processing module. The switch has been experimentally validated in a 3x3 arrangement with 10Gb/s NRZ optical data packets, demonstrating error-free switching operation with a power penalty of <5dB.
NASA Technical Reports Server (NTRS)
1975-01-01
Signal processing equipment specifications, operating and test procedures, and systems design and engineering are described. Five subdivisions of the overall circuitry are treated: (1) the spectrum analyzer; (2) the spectrum integrator; (3) the velocity discriminator; (4) the display interface; and (5) the formatter. They function in series: (1) first in analog form to provide frequency resolution, (2) then in digital form to achieve signal to noise improvement (video integration) and frequency discrimination, and (3) finally in analog form again for the purpose of real-time display of the significant velocity data. The formatter collects binary data from various points in the processor and provides a serial output for bi-phase recording. Block diagrams are used to illustrate the system.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Averyanov, A. V.; Bajajin, A. G.; Chepurnov, V. F.
The time-projection chamber (TPC) is the main tracking detector in the MPD/NICA. The information on charge-particle tracks in the TPC is registered by the MWPG with cathode pad readout. The frontend electronics (FEE) are developed with use of modern technologies such as application specific integrated circuits (ASIC), field-programmable gate arrays (FPGA), and data transfer to a concentrator via a fast optical interface. The main parameters of the FEE are as follows: total number of channels, ∼95 000; data stream from the whole TPC, 5 GB/s; low power consumption, less than 100 mW/ch; signal to noise ratio (S/N), 30; equivalent noisemore » charge (ENC), <1000e{sup –} (C{sub in} = 10–20 pF); and zero suppression (pad signal rejection ∼90%). The article presents the status of the readout chamber construction and the data acquisition system. The results of testing FEE prototypes are presented.« less
IO:I, a near-infrared camera for the Liverpool Telescope
NASA Astrophysics Data System (ADS)
Barnsley, Robert M.; Jermak, Helen E.; Steele, Iain A.; Smith, Robert J.; Bates, Stuart D.; Mottram, Chris J.
2016-01-01
IO:I is a new instrument that has recently been commissioned for the Liverpool Telescope, extending current imaging capabilities beyond the optical and into the near-infrared. Cost has been minimized by the use of a previously decommissioned instrument's cryostat as the base for a prototype and retrofitting it with Teledyne's 1.7-μm cutoff Hawaii-2RG HgCdTe detector, SIDECAR ASIC controller, and JADE2 interface card. The mechanical, electronic, and cryogenic aspects of the cryostat retrofitting process will be reviewed together with a description of the software/hardware setup. This is followed by a discussion of the results derived from characterization tests, including measurements of read noise, conversion gain, full well depth, and linearity. The paper closes with a brief overview of the autonomous data reduction process and the presentation of results from photometric testing conducted on on-sky, pipeline processed data.
Characterization and optimization for detector systems of IGRINS
NASA Astrophysics Data System (ADS)
Jeong, Ueejeong; Chun, Moo-Young; Oh, Jae Sok; Park, Chan; Yuk, In-Soo; Oh, Heeyoung; Kim, Kang-Min; Ko, Kyeong Yeon; Pavel, Michael D.; Yu, Young Sam; Jaffe, Daniel T.
2014-07-01
IGRINS (Immersion GRating INfrared Spectrometer) is a high resolution wide-band infrared spectrograph developed by the Korea Astronomy and Space Science Institute (KASI) and the University of Texas at Austin (UT). This spectrograph has H-band and K-band science cameras and a slit viewing camera, all three of which use Teledyne's λc~2.5μm 2k×2k HgCdTe HAWAII-2RG CMOS detectors. The two spectrograph cameras employ science grade detectors, while the slit viewing camera includes an engineering grade detector. Teledyne's cryogenic SIDECAR ASIC boards and JADE2 USB interface cards were installed to control those detectors. We performed experiments to characterize and optimize the detector systems in the IGRINS cryostat. We present measurements and optimization of noise, dark current, and referencelevel stability obtained under dark conditions. We also discuss well depth, linearity and conversion gain measurements obtained using an external light source.
A second generation 50 Mbps VLSI level zero processing system prototype
NASA Technical Reports Server (NTRS)
Harris, Jonathan C.; Shi, Jeff; Speciale, Nick; Bennett, Toby
1994-01-01
Level Zero Processing (LZP) generally refers to telemetry data processing functions performed at ground facilities to remove all communication artifacts from instrument data. These functions typically include frame synchronization, error detection and correction, packet reassembly and sorting, playback reversal, merging, time-ordering, overlap deletion, and production of annotated data sets. The Data Systems Technologies Division (DSTD) at Goddard Space Flight Center (GSFC) has been developing high-performance Very Large Scale Integration Level Zero Processing Systems (VLSI LZPS) since 1989. The first VLSI LZPS prototype demonstrated 20 Megabits per second (Mbp's) capability in 1992. With a new generation of high-density Application-specific Integrated Circuits (ASIC) and a Mass Storage System (MSS) based on the High-performance Parallel Peripheral Interface (HiPPI), a second prototype has been built that achieves full 50 Mbp's performance. This paper describes the second generation LZPS prototype based upon VLSI technologies.
NASA Astrophysics Data System (ADS)
Toyama, Toshihiko; Ichihara, Tokuyuki; Yamaguchi, Daisuke; Okamoto, Hiroaki
2007-10-01
Thin-film light emitting devices based on organic materials have been gathering attentions for applying a flat-panel display and a solid-state lighting. Alternatively, inorganic technologies such as Si-based thin-film technology have been growing almost independently. It is then expected that combining the Si-based thin-film technology with the organic light emitting diode (OLED) technology will develop innovative devices. Here, we report syntheses of the hybrid light emitting diode (LED) with a heterostructure consisting of p-type SiC x and tris-(8-hydroxyquinoline) aluminum films and characterization for the hybrid LEDs. We present the energy diagram of the heterostructure, and describe that the use of high dark conductivities of the p-type SiC x as well as inserting wide-gap intrinsic a-SiC x at the p-type SiC x/Alq interface are effective for improving device performance.
Upgrading the ATLAS Tile Calorimeter Electronics
NASA Astrophysics Data System (ADS)
Carrió, Fernando
2013-11-01
This work summarizes the status of the on-detector and off-detector electronics developments for the Phase 2 Upgrade of the ATLAS Tile Calorimeter at the LHC scheduled around 2022. A demonstrator prototype for a slice of the calorimeter including most of the new electronics is planned to be installed in ATLAS in the middle of 2014 during the first Long Shutdown. For the on-detector readout, three different front-end boards (FEB) alternatives are being studied: a new version of the 3-in-1 card, the QIE chip and a dedicated ASIC called FATALIC. The Main Board will provide communication and control to the FEBs and the Daughter Board will transmit the digitized data to the off-detector electronics in the counting room, where the super Read-Out Driver (sROD) will perform processing tasks on them and will be the interface to the trigger levels 0, 1 and 2.
The service telemetry and control device for space experiment “GRIS”
NASA Astrophysics Data System (ADS)
Glyanenko, A. S.
2016-02-01
Problems of scientific devices control (for example, fine control of measuring paths), collecting auxiliary (service information about working capacity, conditions of experiment carrying out, etc.) and preliminary data processing are actual for any space device. Modern devices for space research it is impossible to imagine without devices that didn't use digital data processing methods and specialized or standard interfaces and computing facilities. For realization of these functions in “GRIS” experiment onboard ISS for purposes minimization of dimensions, power consumption, the concept “system-on-chip” was chosen and realized. In the programmable logical integrated scheme by Microsemi from ProASIC3 family with maximum capacity up to 3M system gates, the computing kernel and all necessary peripherals are created. In this paper we discuss structure, possibilities and resources the service telemetry and control device for “GRIS” space experiment.
NASA Astrophysics Data System (ADS)
Steadman, Roger; Herrmann, Christoph; Livne, Amir
2017-08-01
Spectral CT based on energy-resolving photon counting detectors is expected to deliver additional diagnostic value at a lower dose than current state-of-the-art CT [1]. The capability of simultaneously providing a number of spectrally distinct measurements not only allows distinguishing between photo-electric and Compton interactions but also discriminating contrast agents that exhibit a K-edge discontinuity in the absorption spectrum, referred to as K-edge Imaging [2]. Such detectors are based on direct converting sensors (e.g. CdTe or CdZnTe) and high-rate photon counting electronics. To support the development of Spectral CT and show the feasibility of obtaining rates exceeding 10 Mcps/pixel (Poissonian observed count-rate), the ChromAIX ASIC has been previously reported showing 13.5 Mcps/pixel (150 Mcps/mm2 incident) [3]. The ChromAIX has been improved to offer the possibility of a large area coverage detector, and increased overall performance. The new ASIC is called ChromAIX2, and delivers count-rates exceeding 15 Mcps/pixel with an rms-noise performance of approximately 260 e-. It has an isotropic pixel pitch of 500 μm in an array of 22×32 pixels and is tile-able on three of its sides. The pixel topology consists of a two stage amplifier (CSA and Shaper) and a number of test features allowing to thoroughly characterize the ASIC without a sensor. A total of 5 independent thresholds are also available within each pixel, allowing to acquire 5 spectrally distinct measurements simultaneously. The ASIC also incorporates a baseline restorer to eliminate excess currents induced by the sensor (e.g. dark current and low frequency drifts) which would otherwise cause an energy estimation error. In this paper we report on the inherent electrical performance of the ChromAXI2 as well as measurements obtained with CZT (CdZnTe)/CdTe sensors and X-rays and radioactive sources.
Kwon, S G; Roh, D H; Yoon, S Y; Choi, S R; Choi, H S; Moon, J Y; Kang, S Y; Kim, H W; Han, H J; Beitz, A J; Oh, S B; Lee, J H
2016-04-01
The role of peripheral sigma-1 receptors (Sig-1Rs) in normal nociception and in pathologically induced pain conditions has not been thoroughly investigated. Since there is mounting evidence that Sig-1Rs modulate ischaemia-induced pathological conditions, we investigated the role of Sig-1Rs in ischaemia-induced mechanical allodynia (MA) and addressed their possible interaction with acid-sensing ion channels (ASICs) and P2X receptors at the ischaemic site. We used a rodent model of hindlimb thrombus-induced ischaemic pain (TIIP) to investigate their role. Western blot was performed to observe changes in Sig-1R expression in peripheral nervous tissues. MA was measured after intraplantar (i.pl.) injections of antagonists for the Sig-1, ASIC and P2X receptors in TIIP rats or agonists of each receptor in naïve rats. Sig-1R expression significantly increased in skin, sciatic nerve and dorsal root ganglia at 3 days post-TIIP surgery. I.pl. injections of the Sig-1R antagonist, BD-1047 on post-operative days 0-3 significantly attenuated the development of MA during the induction phase, but had no effect on MA when given during the maintenance phase (days 3-6 post-surgery). BD-1047 synergistically increased amiloride (an ASICs blocker)- and TNP-ATP (a P2X antagonist)-induced analgesic effects in TIIP rats. In naïve rats, i.pl. injection of Sig-1R agonist PRE-084 alone did not produce MA; but it did induce MA when co-administered with either an acidic pH solution or a sub-effective dose of αβmeATP. Peripheral Sig-1Rs contribute to the induction of ischaemia-induced MA via facilitation of ASICs and P2X receptors. Thus, peripheral Sig-1Rs represent a novel therapeutic target for the treatment of ischaemic pain. © 2015 European Pain Federation - EFIC®
Silicon technologies for the CLIC vertex detector
NASA Astrophysics Data System (ADS)
Spannagel, S.
2017-06-01
CLIC is a proposed linear e+e- collider designed to provide particle collisions at center-of-mass energies of up to 3 TeV. Precise measurements of the properties of the top quark and the Higgs boson, as well as searches for Beyond the Standard Model physics require a highly performant CLIC detector. In particular the vertex detector must provide a single point resolution of only a few micrometers while not exceeding the envisaged material budget of around 0.2% X0 per layer. Beam-beam interactions and beamstrahlung processes impose an additional requirement on the timestamping capabilities of the vertex detector of about 10 ns. These goals can only be met by using novel techniques in the sensor and ASIC design as well as in the detector construction. The R&D program for the CLIC vertex detector explores various technologies in order to meet these demands. The feasibility of planar sensors with a thickness of 50-150 μm, including different active edge designs, are evaluated using Timepix3 ASICs. First prototypes of the CLICpix readout ASIC, implemented in 65 nm CMOS technology and with a pixel size of 25×25μm 2, have been produced and tested in particle beams. An updated version of the ASIC with a larger pixel matrix and improved precision of the time-over-threshold and time-of-arrival measurements has been submitted. Different hybridization concepts have been developed for the interconnection between the sensor and readout ASIC, ranging from small-pitch bump bonding of planar sensors to capacitive coupling of active HV-CMOS sensors. Detector simulations based on Geant 4 and TCAD are compared with experimental results to assess and optimize the performance of the various designs. This contribution gives an overview of the R&D program undertaken for the CLIC vertex detector and presents performance measurements of the prototype detectors currently under investigation.
Interface For Fault-Tolerant Control System
NASA Technical Reports Server (NTRS)
Shaver, Charles; Williamson, Michael
1989-01-01
Interface unit and controller emulator developed for research on electronic helicopter-flight-control systems equipped with artificial intelligence. Interface unit interrupt-driven system designed to link microprocessor-based, quadruply-redundant, asynchronous, ultra-reliable, fault-tolerant control system (controller) with electronic servocontrol unit that controls set of hydraulic actuators. Receives digital feedforward messages from, and transmits digital feedback messages to, controller through differential signal lines or fiber-optic cables (thus far only differential signal lines have been used). Analog signals transmitted to and from servocontrol unit via coaxial cables.
Spacewire Routers Implemented with FPGA Technology
NASA Astrophysics Data System (ADS)
Habinc, Sandi; Isomaki, Marko
2011-08-01
Routers are an integral part of SpaceWire networks. Aeroflex Gaisler has developed a highly configurable SpaceWire router VHDL IP core to meet the needs for technology independent router designs. The main design goals have been configurability, technology independence, support of the standard and expandability. The IP core being technologically independent allows it to be used in both ASIC and FPGA technology. The latter is now being used to produce versatile standard products that can reach the market faster than for example an ASIC based product.
NASA Astrophysics Data System (ADS)
Koubaa, Zied
The communication network and the detection mechanisms are two critical systems in a plane. Their performance has a direct impact on aircrafts. This is of particular interest for avionics designers, who have increasingly invested more and more in the development of these elements. As a part of a project in this domain, we introduce the design and the development of a smart interface for position sensors dedicated to flights (Smart Sensor Interface - SSI). This interface will serve to connect sensors of different technologies (electromagnetic, optical and MEMS) to the new communication network, AFDX. The role of this interface is to generate an appropriate excitation signal for certain types of sensors (R/LVDT), and to treat, demodulate, and digitize their output signals. The proposed interface is thus composed of a Signal Acquisition Path (SAP) and an Excitation Signal Generation (ESG). By adopting the Integrated Modular Avionics architecture (IMA), we can minimize the size of the classic interface, reduce its energy consumption and improve its reliability and its performance. The focus of our design is particularly on the Data Acquisition Path (DAP). An Architecture characterized by a high resolution (14 bits) and a low latency (1.2 ms) of this module is introduced and developed in this prestigious work. This architecture was developed after a wellconducted study of existing solutions found in literature work and a detailed analysis of the problems arise in the design and implementation of this system (DAP). The conversion of the sensor signal into a digital signal is the most important step in acquiring data, as it sets the resolution of the acquired information and generates the majority of its latency. This module can also affect the reliability and stability of the system. Among different models and architectures, the Delta-Sigma analog-to-digital converter (ADC) is preferred for this application (for better resolution). This converter is formed by an analog circuit (modulator) followed by digital filters. The complexity of the implementation, the processing delay and the output resolution are all susceptible to change depending on the architecture of these filters. Thus, the main problem while designing such a system arises in the opposing evolution of the resolution and latency parameters; the improvement or evolution of one, results in the destruction of the other. Therefore, our work aims to provide one or more method to optimize the latency caused by the CAN while maintaining the same resolution of the desired data (14 bits). This optimization takes into account the objective of integrating the DAP in modules of small size and low power consumption. This proposed solution was implemented in order to validate the design of the conception of the interface. We are also interested to achieve the proposed solution and validate our design. The obtained results will be evaluated after following the manufacturing strategy. The data acquisition unit is made up of two electronic components. The first component is an integrated circuit, which uses CMOS 0.13mum IBM technology and contains the analog part of CAN (SigmaDelta modulator). The second component is a Virtex-6 FPGA, which allows one to acquire the necessary digital processing required for the acquisition and conversion of the sensor signal. In the final version of the interface, our analog portion will be integrated with the analog portion of GSE in the same chip. The integrated digital logic in the (FPGA) role will thus provide digital data to the ESG module in order to generate the excitation signal.
Wide-bandwidth high-resolution search for extraterrestrial intelligence
NASA Technical Reports Server (NTRS)
Horowitz, Paul
1993-01-01
A third antenna was added to the system. It is a terrestrial low-gain feed, to act as a veto for local interference. The 3-chip design for a 4 megapoint complex FFT was reduced to finished working hardware. The 4-Megachannel circuit board contains 36 MByte of DRAM, 5 CPLDs, the three large FFT ASICs, and 74 ICs in all. The Austek FDP-based Spectrometer/Power Accumulator (SPA) has now been implemented as a 4-layer printed circuit. A PC interface board has been designed and together with its associated user interface and control software allows an IBM compatible computer to control the SPA board, and facilitates the transfer of spectra to the PC for display, processing, and storage. The Feature Recognizer Array cards receive the stream of modulus words from the 4M FFT cards, and forward a greatly thinned set of reports to the PC's in whose backplane they reside. In particular, a powerful ROM-based state-machine architecture has been adopted, and DRAM has been added to permit integration modes when tracking or reobserving source candidates. The general purpose (GP) array consists of twenty '486 PC class computers, each of which receives and processes the data from a feature extractor/correlator board set. The array performs a first analysis on the provided 'features' and then passes this information on to the workstation. The core workstation software is now written. That is, the communication channels between the user interface, the backend monitor program and the PC's have working software.
Radar Imaging of Europa's Subsurface Properties and Processes: The View from Earth
NASA Astrophysics Data System (ADS)
Blankenship, D. D.; Moore, W. B.; Young, D. A.; Peters, M. E.
2007-12-01
A primary objective of future Europa studies will be to characterize the distribution of shallow subsurface water as well as to identify any ice-ocean interface. Another objective will be to understand the formation of surface and subsurface features associated with interchange processes between any ocean and the surface. Achieving these objectives will require either direct or inferred knowledge of the position of any ice/water interfaces as well as any brine or layer pockets. We will review the hypothesized processes that control the thermal, compositional and structural (TCS) properties, and therefore the dielectric character, of the subsurface of Europa's icy shell. Our approach will be to extract the TCS properties for various subsurface processes thought to control the formation of major surface (e.g., ridges/bands, lenticulae, chaos, cratering...) and subsurface (e.g., rigid shell eutectics, diapirs, accretionary lenses ...) features on Europa. We will then assess the spectrum of analog processes and TCS properties represented by Earth's cryosphere including both Arctic and Antarctic ice sheets, ice shelves and valley glaciers. There are few complete analogs over the full TCS space but, because of the wide range of ice thickness, impurities and strain rates for Earth's cryosphere, there are many more analogs than many Earth and planetary researchers might imagine for significant portions of this space (e.g., bottom crevasses, marine ice shelf/subglacial lake accretion, surging polythermal glaciers...).Our ultimate objective is to use these Earth analog studies to define the radar imaging approach for Europa's subsurface that will be most useful for supporting/refuting the hypotheses for the formation of major surface/subsurface features as well as for "pure" exploration of Europa's icy shell and its interface with the underlying ocean.
SEDHI: development status of the Pléiades detection electronics
NASA Astrophysics Data System (ADS)
Dantes, Didier; Biffi, Jean-Marc; Neveu, Claude; Renard, Christophe
2017-11-01
In the framework of the Pléiades program, Alcatel Space is developping with CNES a new concept of Highly Integrated Detection Electronic Subsystem (SEDHI) which lead to very high gains in term of camera mass, volume and power consumption. This paper presents the design of this new concept and summarizes its main performances. The electrical, mechanical and thermal aspects of the SEDHI concept are described, including the basic technologies: panchromatic detector, multispectral detector, butting technology, ASIC for phase shift of detector clocks, ASIC for video processing, ASIC for phase trimming, hybrids, video modules... This concept and these technologies can be adapted to a large scale of missions and instruments. Design, performance and budgets of the subsystem are given for the Pléiades mission for which the SEDHI concept has been selected. The detailed performances of each critical component are provided, focusing on the most critical performances which have been obtained at this level of the Pléiades development.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Guo, Di; Liu, Chonghan; Chen, Jinghong
This paper describes the design, fabrication and experiment results of a 4×8-Gbps Vertical-Cavity Surface-Emitting Laser (VCSEL) array driver ASIC with the adjustable active-shunt peaking technique and the novel balanced output structure under the Silicon-on-Sapphire (SOS) process, and a custom array optical transmitter module, featuring a compact size of 10 mm×15 mm×5.3 mm. Both the array driver ASIC and the module have been fully tested after integration as a complete parallel transmitter. Optical eye diagram of each channel passes the eye mask at 8 Gbps/ch with adjacent channel working simultaneously with a power consumption of 150 mW/ch. As a result, themore » optical transmission of Bit-Error Rate (BER) less than 10E-12 is achieved at an aggregated data rate of 4×8-Gbps.« less
Guo, Di; Liu, Chonghan; Chen, Jinghong; ...
2016-03-21
This paper describes the design, fabrication and experiment results of a 4×8-Gbps Vertical-Cavity Surface-Emitting Laser (VCSEL) array driver ASIC with the adjustable active-shunt peaking technique and the novel balanced output structure under the Silicon-on-Sapphire (SOS) process, and a custom array optical transmitter module, featuring a compact size of 10 mm×15 mm×5.3 mm. Both the array driver ASIC and the module have been fully tested after integration as a complete parallel transmitter. Optical eye diagram of each channel passes the eye mask at 8 Gbps/ch with adjacent channel working simultaneously with a power consumption of 150 mW/ch. As a result, themore » optical transmission of Bit-Error Rate (BER) less than 10E-12 is achieved at an aggregated data rate of 4×8-Gbps.« less
An Integrated Thermal Compensation System for MEMS Inertial Sensors
Chiu, Sheng-Ren; Teng, Li-Tao; Chao, Jen-Wei; Sue, Chung-Yang; Lin, Chih-Hsiou; Chen, Hong-Ren; Su, Yan-Kuin
2014-01-01
An active thermal compensation system for a low temperature-bias-drift (TBD) MEMS-based gyroscope is proposed in this study. First, a micro-gyroscope is fabricated by a high-aspect-ratio silicon-on-glass (SOG) process and vacuum packaged by glass frit bonding. Moreover, a drive/readout ASIC, implemented by the 0.25 μm 1P5M standard CMOS process, is designed and integrated with the gyroscope by directly wire bonding. Then, since the temperature effect is one of the critical issues in the high performance gyroscope applications, the temperature-dependent characteristics of the micro-gyroscope are discussed. Furthermore, to compensate the TBD of the micro-gyroscope, a thermal compensation system is proposed and integrated in the aforementioned ASIC to actively tune the parameters in the digital trimming mechanism, which is designed in the readout ASIC. Finally, some experimental results demonstrate that the TBD of the micro-gyroscope can be compensated effectively by the proposed compensation system. PMID:24599191
Feasibility study of a ``4H'' X-ray camera based on GaAs:Cr sensor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dragone, Angelo; Kenney, Chris; Lozinskaya, Anastassiya
Here, we describe a multilayer stacked X-ray camera concept. This type of technology is called `4H' X-ray cameras, where 4H stands for high-Z (Z>30) sensor, high-resolution (less than 300 micron pixel pitch), high-speed (above 100 MHz), and high-energy (above 30 keV in photon energy). The components of the technology, similar to the popular two-dimensional (2D) hybrid pixelated array detectors, consists of GaAs:Cr sensors bonded to high-speed ASICs. 4H cameras based on GaAs also use integration mode of X-ray detection. The number of layers, on the order of ten, is smaller than an earlier configuration for single-photon-counting (SPC) mode of detectionmore » [1]. High-speed ASIC based on modification to the ePix family of ASIC is discussed. Applications in X-ray free electron lasers (XFELs), synchrotrons, medicine and non-destructive testing are possible.« less
NASA Astrophysics Data System (ADS)
Adloff, C.; Francis, K.; Repond, J.; Smith, J.; Trojand, D.; Xia, L.; Baldolemar, E.; Li, J.; Park, S. T.; Sosebee, M.; White, A. P.; Yu, J.; Mikami, Y.; Watson, N. K.; Mavromanolakis, G.; Thomson, M. A.; Ward, D. R.; Yan, W.; Benchekroun, D.; Hoummada, A.; Khoulaki, Y.; Benyamna, M.; Cârloganu, C.; Fehr, F.; Gay, P.; Manen, S.; Royer, L.; Blazey, G. C.; Dyshkant, A.; Zutshi, V.; Hostachy, J.-Y.; Morin, L.; Cornett, U.; David, D.; Fabbri, R.; Falley, G.; Gadow, K.; Garutti, E.; Göttlicher, P.; Günter, C.; Karstensen, S.; Krivan, F.; Lucaci-Timoce, A.-I.; Lu, S.; Lutz, B.; Marchesini, I.; Meyer, N.; Morozov, S.; Morgunov, V.; Reinecke, M.; Sefkow, F.; Smirnov, P.; Terwort, M.; Vargas-Trevino, A.; Wattimena, N.; Wendt, O.; Feege, N.; Haller, J.; Richter, S.; Samson, J.; Eckert, P.; Kaplan, A.; Schultz-Coulon, H.-Ch.; Shen, W.; Stamen, R.; Tadday, A.; Bilki, B.; Norbeck, E.; Onel, Y.; Kawagoe, K.; Uozumi, S.; Dauncey, P. D.; Magnan, A.-M.; Bartsch, V.; Salvatore, F.; Laktineh, I.; Calvo Alamillo, E.; Fouz, M.-C.; Puerta-Pelayo, J.; Frey, A.; Kiesling, C.; Simon, F.; Bonis, J.; Bouquet, B.; Callier, S.; Cornebise, P.; Doublet, Ph.; Dulucq, F.; Faucci Giannelli, M.; Fleury, J.; Li, H.; Martin-Chassard, G.; Richard, F.; de La Taille, Ch.; Pöschl, R.; Raux, L.; Seguin-Moreau, N.; Wicek, F.; Anduze, M.; Boudry, V.; Brient, J.-C.; Jeans, D.; Mora de Freitas, P.; Musat, G.; Reinhard, M.; Ruan, M.; Videau, H.; Marcisovsky, M.; Sicho, P.; Vrba, V.; Zalesak, J.; Belhorma, B.; Ghazlane, H.; Calice Collaboration
2011-10-01
Application Specific Integrated Circuits, ASICs, similar to those envisaged for the readout electronics of the central calorimeters of detectors for a future lepton collider have been exposed to high-energy electromagnetic showers. A salient feature of these calorimeters is that the readout electronics will be embedded into the calorimeter layers. In this article it is shown that interactions of shower particles in the volume of the readout electronics do not alter the noise pattern of the ASICs. No signal at or above the MIP level has been observed during the exposure. The upper limit at the 95% confidence level on the frequency of fake signals is smaller than 1×10-5 for a noise threshold of about 60% of a MIP. For ASICs with similar design to those which were tested, it can thus be largely excluded that the embedding of the electronics into the calorimeter layers compromises the performance of the calorimeters.
NASA Technical Reports Server (NTRS)
Allen, Gregory R.; Swift, Gary M.
2006-01-01
This work describes radiation testing of Actel's ProASIC Plus and Altera's Stratix-II FPGAs. The Actel Device Under Test (DUT) was a ProASIC Plus APA300-PQ208 nonvolatile, field reprogrammable device which is based on a 0.22micron flash-based LVCMOS technology. Limited investigation has taken place into flash based FPGA technologies, therefore this test served as a preliminary reference point for various SEE behaviors. The Altera DUT was a Stratix-II EP2S60F1020C4. Single Event Upset (SEU) and Single Event Latchup (SEL) were the focus of these studies. For the Actel, a latchup test was done at an effective LET of 75.0 MeV-sq cm/mg at room temperature, and no latchup was detected when irradiated to a total fluence of 1 x 10(exp 7) particles/sq cm. The Altera part was shown to latchup at room temperature.
Multi-petascale highly efficient parallel supercomputer
Asaad, Sameh; Bellofatto, Ralph E.; Blocksome, Michael A.; Blumrich, Matthias A.; Boyle, Peter; Brunheroto, Jose R.; Chen, Dong; Cher, Chen -Yong; Chiu, George L.; Christ, Norman; Coteus, Paul W.; Davis, Kristan D.; Dozsa, Gabor J.; Eichenberger, Alexandre E.; Eisley, Noel A.; Ellavsky, Matthew R.; Evans, Kahn C.; Fleischer, Bruce M.; Fox, Thomas W.; Gara, Alan; Giampapa, Mark E.; Gooding, Thomas M.; Gschwind, Michael K.; Gunnels, John A.; Hall, Shawn A.; Haring, Rudolf A.; Heidelberger, Philip; Inglett, Todd A.; Knudson, Brant L.; Kopcsay, Gerard V.; Kumar, Sameer; Mamidala, Amith R.; Marcella, James A.; Megerian, Mark G.; Miller, Douglas R.; Miller, Samuel J.; Muff, Adam J.; Mundy, Michael B.; O'Brien, John K.; O'Brien, Kathryn M.; Ohmacht, Martin; Parker, Jeffrey J.; Poole, Ruth J.; Ratterman, Joseph D.; Salapura, Valentina; Satterfield, David L.; Senger, Robert M.; Smith, Brian; Steinmacher-Burow, Burkhard; Stockdell, William M.; Stunkel, Craig B.; Sugavanam, Krishnan; Sugawara, Yutaka; Takken, Todd E.; Trager, Barry M.; Van Oosten, James L.; Wait, Charles D.; Walkup, Robert E.; Watson, Alfred T.; Wisniewski, Robert W.; Wu, Peng
2015-07-14
A Multi-Petascale Highly Efficient Parallel Supercomputer of 100 petaOPS-scale computing, at decreased cost, power and footprint, and that allows for a maximum packaging density of processing nodes from an interconnect point of view. The Supercomputer exploits technological advances in VLSI that enables a computing model where many processors can be integrated into a single Application Specific Integrated Circuit (ASIC). Each ASIC computing node comprises a system-on-chip ASIC utilizing four or more processors integrated into one die, with each having full access to all system resources and enabling adaptive partitioning of the processors to functions such as compute or messaging I/O on an application by application basis, and preferably, enable adaptive partitioning of functions in accordance with various algorithmic phases within an application, or if I/O or other processors are underutilized, then can participate in computation or communication nodes are interconnected by a five dimensional torus network with DMA that optimally maximize the throughput of packet communications between nodes and minimize latency.
Physiological and pathological functions of acid-sensing ion channels in the central nervous system
Chu, Xiang-Ping; Xiong, Zhi-Gang
2012-01-01
Protons are important signals for neuronal function. In the central nervous system (CNS), proton concentrations change locally when synaptic vesicles release their acidic contents into the synaptic cleft, and globally in ischemia, seizures, traumatic brain injury, and other neurological disorders due to lactic acid accumulation. The finding that protons gate a distinct family of ion channels, the acid-sensing ion channels (ASICs), has shed new light on the mechanism of acid signaling and acidosis-associated neuronal injury. Accumulating evidence has suggested that ASICs play important roles in physiological processes such as synaptic plasticity, learning/memory, fear conditioning, and retinal integrity, and in pathological conditions such as brain ischemia, multiple sclerosis, epileptic seizures, and malignant glioma. Thus, targeting these channels may lead to novel therapeutic interventions for neurological disorders. The goal of this review is to provide an update on recent advances in our understanding of the functions of ASICs in the CNS. PMID:22204324
Possibilities for mixed mode chip manufacturing in EUROPRACTICE
NASA Astrophysics Data System (ADS)
Das, C.
1997-02-01
EUROPRACTICE is an EC initiative under the ESPRIT programme which aims to stimulate the wider exploitation of state-of-the-art microelectronics technologies by European industry and to enhance European industrial competitiveness in the global market-place. Through EUROPRACTICE, the EC has created a range of Basic Services that offer users a cost-effective and flexible means of accessing three main microelectronics-based technologies: Application Specific Integrated Circuit (ASICs), Multi-Chip Modules (MCMs) and Microsystems. EUROPRACTICE Basic Services reduce the cost and risk for companies wishing to begin using these technologies. EUROPRACTICE offers a fully supported, low cost route for companies to design and fabricate ASICs for their individual applications. Low cost is achieved by consolidating designs from many users onto a single semiconductor wafer (MPW: Multi Project Wafer). The EUROPRACTICE IC Manufacturing Service (ICMS) offers a broad range of fabrication technologies including CMOS, BiCMOS and GaAs. The Service extends from enabling users to produce prototype ASICs for testing and evaluation, through to low-volume production runs.
Feasibility study of a ``4H'' X-ray camera based on GaAs:Cr sensor
Dragone, Angelo; Kenney, Chris; Lozinskaya, Anastassiya; ...
2016-11-29
Here, we describe a multilayer stacked X-ray camera concept. This type of technology is called `4H' X-ray cameras, where 4H stands for high-Z (Z>30) sensor, high-resolution (less than 300 micron pixel pitch), high-speed (above 100 MHz), and high-energy (above 30 keV in photon energy). The components of the technology, similar to the popular two-dimensional (2D) hybrid pixelated array detectors, consists of GaAs:Cr sensors bonded to high-speed ASICs. 4H cameras based on GaAs also use integration mode of X-ray detection. The number of layers, on the order of ten, is smaller than an earlier configuration for single-photon-counting (SPC) mode of detectionmore » [1]. High-speed ASIC based on modification to the ePix family of ASIC is discussed. Applications in X-ray free electron lasers (XFELs), synchrotrons, medicine and non-destructive testing are possible.« less
MICROROC: MICRO-mesh gaseous structure Read-Out Chip
NASA Astrophysics Data System (ADS)
Adloff, C.; Blaha, J.; Chefdeville, M.; Dalmaz, A.; Drancourt, C.; Dulucq, F.; Espargilière, A.; Gaglione, R.; Geffroy, N.; Jacquemier, J.; Karyotakis, Y.; Martin-Chassard, G.; Prast, J.; Seguin-Moreau, N.; de La Taille, Ch; Vouters, G.
2012-01-01
MICRO MEsh GAseous Structure (MICROMEGAS) and Gas Electron Multipliers (GEM) detectors are two candidates for the active medium of a Digital Hadronic CALorimeter (DHCAL) as part of a high energy physics experiment at a future linear collider (ILC/CLIC). Physics requirements lead to a highly granular hadronic calorimeter with up to thirty million channels with probably only hit information (digital readout calorimeter). To validate the concept of digital hadronic calorimetry with such small cell size, the construction and test of a cubic meter technological prototype, made of 40 planes of one square meter each, is necessary. This technological prototype would contain about 400 000 electronic channels, thus requiring the development of front-end ASIC. Based on the experience gained with previous ASIC that were mounted on detectors and tested in particle beams, a new ASIC called MICROROC has been developped. This paper summarizes the caracterisation campaign that was conducted on this new chip as well as its integration into a large area Micromegas chamber of one square meter.
ASIC-based architecture for the real-time computation of 2D convolution with large kernel size
NASA Astrophysics Data System (ADS)
Shao, Rui; Zhong, Sheng; Yan, Luxin
2015-12-01
Bidimensional convolution is a low-level processing algorithm of interest in many areas, but its high computational cost constrains the size of the kernels, especially in real-time embedded systems. This paper presents a hardware architecture for the ASIC-based implementation of 2-D convolution with medium-large kernels. Aiming to improve the efficiency of storage resources on-chip, reducing off-chip bandwidth of these two issues, proposed construction of a data cache reuse. Multi-block SPRAM to cross cached images and the on-chip ping-pong operation takes full advantage of the data convolution calculation reuse, design a new ASIC data scheduling scheme and overall architecture. Experimental results show that the structure can achieve 40× 32 size of template real-time convolution operations, and improve the utilization of on-chip memory bandwidth and on-chip memory resources, the experimental results show that the structure satisfies the conditions to maximize data throughput output , reducing the need for off-chip memory bandwidth.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gao, W.; Yin, J.; Li, C.
This paper presents a novel front-end electronics based on a front-end ASIC with post digital filtering and calibration dedicated to CZT detectors for PET imaging. A cascade amplifier based on split-leg topology is selected to realize the charge-sensitive amplifier (CSA) for the sake of low noise performances and the simple scheme of the power supplies. The output of the CSA is connected to a variable-gain amplifier to generate the compatible signals for the A/D conversion. A multi-channel single-slope ADC is designed to sample multiple points for the digital filtering and shaping. The digital signal processing algorithms are implemented by amore » FPGA. To verify the proposed scheme, a front-end readout prototype ASIC is designed and implemented in 0.35 μm CMOS process. In a single readout channel, a CSA, a VGA, a 10-bit ADC and registers are integrated. Two dummy channels, bias circuits, and time controller are also integrated. The die size is 2.0 mm x 2.1 mm. The input range of the ASIC is from 2000 e{sup -} to 100000 e{sup -}, which is suitable for the detection of the X-and gamma ray from 11.2 keV to 550 keV. The linearity of the output voltage is less than 1 %. The gain of the readout channel is 40.2 V/pC. The static power dissipation is about 10 mW/channel. The above tested results show that the electrical performances of the ASIC can well satisfy PET imaging applications. (authors)« less
NASA Technical Reports Server (NTRS)
Willett, Mike
2015-01-01
Orbital Research, Inc., developed, built, and tested three high-temperature components for use in the design of a data concentrator module in distributed turbine engine control. The concentrator receives analog and digital signals related to turbine engine control and communicates with a full authority digital engine control (FADEC) or high-level command processor. This data concentrator follows the Distributed Engine Controls Working Group (DECWG) roadmap for turbine engine distributed controls communication development that operates at temperatures at least up to 225 C. In Phase I, Orbital Research developed detailed specifications for each component needed for the system and defined the total system specifications. This entailed a combination of system design, compiling existing component specifications, laboratory testing, and simulation. The results showed the feasibility of the data concentrator. Phase II of this project focused on three key objectives. The first objective was to update the data concentrator design modifications from DECWG and prime contractors. Secondly, the project defined requirements for the three new high-temperature, application-specific integrated circuits (ASICs): one-time programmable (OTP), transient voltage suppression (TVS), and 3.3V. Finally, the project validated each design by testing over temperature and under load.
Digital control of magnetic bearings in a cryogenic cooler
NASA Technical Reports Server (NTRS)
Feeley, J.; Law, A.; Lind, F.
1990-01-01
This paper describes the design of a digital control system for control of magnetic bearings used in a spaceborne cryogenic cooler. The cooler was developed by Philips Laboratories for the NASA Goddard Space Flight Center. Six magnetic bearing assemblies are used to levitate the piston, displacer, and counter-balance of the cooler. The piston and displacer are driven by linear motors in accordance with Stirling cycle thermodynamic principles to produce the desired cooling effect. The counter-balance is driven by a third linear motor to cancel motion induced forces that would otherwise be transmitted to the spacecraft. An analog control system is currently used for bearing control. The purpose of this project is to investigate the possibilities for improved performance using digital control. Areas for potential improvement include transient and steady state control characteristics, robustness, reliability, adaptability, alternate control modes, size, weight, and cost. The present control system is targeted for the Intel 80196 microcontroller family. The eventual introduction of application specific integrated circuit (ASIC) technology to this problem may produce a unique and elegant solution both here and in related industrial problems.
A fast event preprocessor for the Simbol-X Low-Energy Detector
NASA Astrophysics Data System (ADS)
Schanz, T.; Tenzer, C.; Kendziorra, E.; Santangelo, A.
2008-07-01
The Simbol-X1 Low Energy Detector (LED), a 128 × 128 pixel DEPFET array, will be read out very fast (8000 frames/second). This requires a very fast onboard data preprocessing of the raw data. We present an FPGA based Event Preprocessor (EPP) which can fulfill this requirements. The design is developed in the hardware description language VHDL and can be later ported on an ASIC technology. The EPP performs a pixel related offset correction and can apply different energy thresholds to each pixel of the frame. It also provides a line related common-mode correction to reduce noise that is unavoidably caused by the analog readout chip of the DEPFET. An integrated pattern detector can block all invalid pixel patterns. The EPP has an internal pipeline structure and can perform all operation in realtime (< 2 μs per line of 64 pixel) with a base clock frequency of 100 MHz. It is utilizing a fast median-value detection algorithm for common-mode correction and a new pattern scanning algorithm to select only valid events. Both new algorithms were developed during the last year at our institute.
Al-Ashmouny, Khaled M; Chang, Sun-Il; Yoon, Euisik
2012-10-01
We report an analog front-end prototype designed in 0.25 μm CMOS process for hybrid integration into 3-D neural recording microsystems. For scaling towards massive parallel neural recording, the prototype has investigated some critical circuit challenges in power, area, interface, and modularity. We achieved extremely low power consumption of 4 μW/channel, optimized energy efficiency using moderate inversion in low-noise amplifiers (K of 5.98 × 10⁸ or NEF of 2.9), and minimized asynchronous interface (only 2 per 16 channels) for command and data capturing. We also implemented adaptable operations including programmable-gain amplification, power-scalable sampling (up to 50 kS/s/channel), wide configuration range (9-bit) for programmable gain and bandwidth, and 5-bit site selection capability (selecting 16 out of 128 sites). The implemented front-end module has achieved a reduction in noise-energy-area product by a factor of 5-25 times as compared to the state-of-the-art analog front-end approaches reported to date.
Virtual Sensor Test Instrumentation
NASA Technical Reports Server (NTRS)
Wang, Roy
2011-01-01
Virtual Sensor Test Instrumentation is based on the concept of smart sensor technology for testing with intelligence needed to perform sell-diagnosis of health, and to participate in a hierarchy of health determination at sensor, process, and system levels. A virtual sensor test instrumentation consists of five elements: (1) a common sensor interface, (2) microprocessor, (3) wireless interface, (4) signal conditioning and ADC/DAC (analog-to-digital conversion/ digital-to-analog conversion), and (5) onboard EEPROM (electrically erasable programmable read-only memory) for metadata storage and executable software to create powerful, scalable, reconfigurable, and reliable embedded and distributed test instruments. In order to maximize the efficient data conversion through the smart sensor node, plug-and-play functionality is required to interface with traditional sensors to enhance their identity and capabilities for data processing and communications. Virtual sensor test instrumentation can be accessible wirelessly via a Network Capable Application Processor (NCAP) or a Smart Transducer Interlace Module (STIM) that may be managed under real-time rule engines for mission-critical applications. The transducer senses the physical quantity being measured and converts it into an electrical signal. The signal is fed to an A/D converter, and is ready for use by the processor to execute functional transformation based on the sensor characteristics stored in a Transducer Electronic Data Sheet (TEDS). Virtual sensor test instrumentation is built upon an open-system architecture with standardized protocol modules/stacks to interface with industry standards and commonly used software. One major benefit for deploying the virtual sensor test instrumentation is the ability, through a plug-and-play common interface, to convert raw sensor data in either analog or digital form, to an IEEE 1451 standard-based smart sensor, which has instructions to program sensors for a wide variety of functions. The sensor data is processed in a distributed fashion across the network, providing a large pool of resources in real time to meet stringent latency requirements.
Design and Measurement of a Low-Noise 64-Channels Front-End Readout ASIC for CdZnTe Detectors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gan, Bo; Wei, Tingcun; Gao, Wu
Cadmium zinc telluride (CdZnTe) detectors, as one of the principal detectors for the next-generation X-ray and γ-ray imagers, have high energy resolution and supporting electrode patterning in the radiation environment at room-temperature. In the present, a number of internationally renowned research institutions and universities are actively using these detector systems to carry out researches of energy spectrum analysis, medical imaging, materials characterization, high-energy physics, nuclear plant monitoring, and astrophysics. As the most important part of the readout system for the CdZnTe detector, the front-end readout application specific integrated circuit (ASIC) would have an important impact on the performances of themore » whole detector system. In order to ensure the small signal to noise ratio (SNR) and sufficient range of the output signal, it is necessary to design a front-end readout ASIC with very low noise and very high dynamic range. In addition, radiation hardness should be considered when the detectors are utilized in the space applications and high energy physics experiments. In this paper, we present measurements and performances of a novel multi-channel radiation-hardness low-noise front-end readout ASIC for CdZnTe detectors. The readout circuits in each channel consist of charge sensitive amplifier, leakage current compensation circuit (LCC), CR-RC shaper, S-K filter, inverse proportional amplifier, peak detect and hold circuit (PDH), discriminator and trigger logic, time sequence control circuit and driving buffer. All of 64 readout channels' outputs enter corresponding inputs of a 64 channel multiplexer. The output of the mux goes directly out of the chip via the output buffer. The 64-channel readout ASIC is implemented using the TSMC 0.35 μm mixed-signal CMOS technology. The die size of the prototype chip is 2.7 mm x 8 mm. At room temperature, the equivalent noise level of a typical channel reaches 66 e{sup -} (rms) at zero farad for a power consumption of 8 mW per channel. The linearity error is lower than 1% and the overall gain of the readout channel is 165 V/pC. The crosstalk between the channels is less than 3%. By connecting the readout ASIC to a CdZnTe detector, we obtained a γ-ray spectrum, the energy resolution is 5.1% at the 59.5-keV line of {sup 241}Am source. (authors)« less
Low power signal processing electronics for wearable medical devices.
Casson, Alexander J; Rodriguez-Villegas, Esther
2010-01-01
Custom designed microchips, known as Application Specific Integrated Circuits (ASICs), offer the lowest possible power consumption electronics. However, this comes at the cost of a longer, more complex and more costly design process compared to one using generic, off-the-shelf components. Nevertheless, their use is essential in future truly wearable medical devices that must operate for long periods of time from physically small, energy limited batteries. This presentation will demonstrate the state-of-the-art in ASIC technology for providing online signal processing for use in these wearable medical devices.
Improved On-Chip Measurement of Delay in an FPGA or ASIC
NASA Technical Reports Server (NTRS)
Chen, Yuan; Burke, Gary; Sheldon, Douglas
2007-01-01
An improved design has been devised for on-chip-circuitry for measuring the delay through a chain of combinational logic elements in a field-programmable gate array (FPGA) or application-specific integrated circuit (ASIC). In the improved design, the delay chain does not include input and output buffers and is not configured as an oscillator. Instead, the delay chain is made part of the signal chain of an on-chip pulse generator. The duration of the pulse is measured on-chip and taken to equal the delay.
Insulator photocurrents: Application to dose rate hardening of CMOS/SOI integrated circuits
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dupont-Nivet, E.; Coiec, Y.M.; Flament, O.
1998-06-01
Irradiation of insulators with a pulse of high energy x-rays can induce photocurrents in the interconnections of integrated circuits. The authors present, here, a new method to measure and analyze this effect together with a simple model. They also demonstrate that these insulator photocurrents have to be taken into account to obtain high levels of dose-rate hardness with CMOS on SOI integrated circuits, especially flip-flops or memory blocks of ASICs. They show that it explains some of the upsets observed in a SRAM embedded in an ASIC.
Modeling Auditory-Haptic Interface Cues from an Analog Multi-line Telephone
NASA Technical Reports Server (NTRS)
Begault, Durand R.; Anderson, Mark R.; Bittner, Rachael M.
2012-01-01
The Western Electric Company produced a multi-line telephone during the 1940s-1970s using a six-button interface design that provided robust tactile, haptic and auditory cues regarding the "state" of the communication system. This multi-line telephone was used as a model for a trade study comparison of two interfaces: a touchscreen interface (iPad)) versus a pressure-sensitive strain gauge button interface (Phidget USB interface controllers). The experiment and its results are detailed in the authors' AES 133rd convention paper " Multimodal Information Management: Evaluation of Auditory and Haptic Cues for NextGen Communication Dispays". This Engineering Brief describes how the interface logic, visual indications, and auditory cues of the original telephone were synthesized using MAX/MSP, including the logic for line selection, line hold, and priority line activation.
NASA Technical Reports Server (NTRS)
Jackson, Deborah J. (Inventor)
1998-01-01
An analog optical encryption system based on phase scrambling of two-dimensional optical images and holographic transformation for achieving large encryption keys and high encryption speed. An enciphering interface uses a spatial light modulator for converting a digital data stream into a two dimensional optical image. The optical image is further transformed into a hologram with a random phase distribution. The hologram is converted into digital form for transmission over a shared information channel. A respective deciphering interface at a receiver reverses the encrypting process by using a phase conjugate reconstruction of the phase scrambled hologram.
Ramin, Séverin; Hermida, Margaux; Millet, Ingrid; Murez, Thibault; Monnin, Valérie; Hamoui, Mazen; Capdevila, Xavier; Charbit, Jonathan
2018-06-12
The objective was to assess the predictive performance of different intravascular contrast extravasation (ICE) characteristics for need for pelvic transarterial embolization (TAE) to determine the risk factors of false-positives. A retrospective study was performed in our trauma center between 2010 and 2015. All severe trauma patients with pelvic fracture were included. Pelvic ICE characteristics on computed tomography (CT) scan were studied: arterial (aSICE), portal surface (pSICE), and extension (exSICE) anatomic relationships. The overall predictive performance of ICE surfaces for pelvic TAE was analyzed using receiver operating characteristic curves. The analysis focused on risk factors for false-positives. Among 311 severe trauma patients with pelvic ring fracture (mean age, 42 ± 19 years, mean Injury Severity Score, 27 ± 19), 94 (30%) had at least one pelvic ICE on the initial CT scan. Patients requiring pelvic TAE had significantly larger aSICE and pSICE than others (P=0.001 and P=0.035, respectively). The overall ability of ICE surfaces to predict pelvic TAE was modest (aSICE AUC, 0.76 [95% CI, 0.64-0.90]; P=0.011) or non-significant (pSICE and exSICE). The high-sensitivity threshold was defined as aSICE ≥20 mm. Using this threshold, 76% of patients were false-positives. Risk factors for false-positives were: admission systolic blood pressure ≥90 mmHg (63% versus 20%; P=0.03) and low transfusion needs (63% versus 10%; P=0.009), extravasation in contact with complex bone fracture (78% versus 30%; P=0.008) or the absence of a direct relationship between extravasation and a large retroperitoneal hematoma (100% versus 38%; P<0.001). A significant pelvic ICE during the arterial phase does not guarantee the need for pelvic TAE. Three-quarter of patients with aSICE ≥20 mm did not need pelvic TAE. Several complementary CT scan criteria will help to identify this risk of false-positives to determine adequate hemostatic pelvic procedures.This work is an original article, retrospective study Level II of evidence, Therapeutic/Critical Care management.
NASA Technical Reports Server (NTRS)
2013-01-01
Topics covered include: Remote Data Access with IDL Data Compression Algorithm Architecture for Large Depth-of-Field Particle Image Velocimeters Vectorized Rebinning Algorithm for Fast Data Down-Sampling Display Provides Pilots with Real-Time Sonic-Boom Information Onboard Algorithms for Data Prioritization and Summarization of Aerial Imagery Monitoring and Acquisition Real-time System (MARS) Analog Signal Correlating Using an Analog-Based Signal Conditioning Front End Micro-Textured Black Silicon Wick for Silicon Heat Pipe Array Robust Multivariable Optimization and Performance Simulation for ASIC Design; Castable Amorphous Metal Mirrors and Mirror Assemblies; Sandwich Core Heat-Pipe Radiator for Power and Propulsion Systems; Apparatus for Pumping a Fluid; Cobra Fiber-Optic Positioner Upgrade; Improved Wide Operating Temperature Range of Li-Ion Cells; Non-Toxic, Non-Flammable, -80 C Phase Change Materials; Soft-Bake Purification of SWCNTs Produced by Pulsed Laser Vaporization; Improved Cell Culture Method for Growing Contracting Skeletal Muscle Models; Hand-Based Biometric Analysis; The Next Generation of Cold Immersion Dry Suit Design Evolution for Hypothermia Prevention; Integrated Lunar Information Architecture for Decision Support Version 3.0 (ILIADS 3.0); Relay Forward-Link File Management Services (MaROS Phase 2); Two Mechanisms to Avoid Control Conflicts Resulting from Uncoordinated Intent; XTCE GOVSAT Tool Suite 1.0; Determining Temperature Differential to Prevent Hardware Cross-Contamination in a Vacuum Chamber; SequenceL: Automated Parallel Algorithms Derived from CSP-NT Computational Laws; Remote Data Exploration with the Interactive Data Language (IDL); Mixture-Tuned, Clutter Matched Filter for Remote Detection of Subpixel Spectral Signals; Partitioned-Interval Quantum Optical Communications Receiver; and Practical UAV Optical Sensor Bench with Minimal Adjustability.
Automobile Crash Sensor Signal Processor
DOT National Transportation Integrated Search
1973-11-01
The crash sensor signal processor described interfaces between an automobile-installed doppler radar and an air bag activating solenoid or equivalent electromechanical device. The processor utilizes both digital and analog techniques to produce an ou...
Spin Andreev-like Reflection in Metal-Mott Insulator Heterostructures
Al-Hassanieh, K. A.; Rincón, Julián; Alvarez, G.; ...
2015-02-09
Here we used the time-dependent density-matrix renormalization group (tDMRG) to study the time evolution of electron wave packets in one-dimensional (1D) metal-superconductor heterostructures. The results show Andreev reflection at the interface, as expected. By combining these results with the well-known single- spin-species electron-hole transformation in the Hubbard model, we predict an analogous spin Andreev reflection in metal-Mott insulator heterostructures. This effect is numerically confirmed using 1D tDMRG, but it is expected to also be present in higher dimensions, as well as in more general Hamiltonians. We present an intuitive picture of the spin reflection, analogous to that of Andreev reflectionmore » at metal- superconductor interfaces. This allows us to discuss a novel antiferromagnetic proximity effect. Possible experimental realizations are discussed.« less
Use of small stand-alone Internet nodes as a distributed control system
NASA Astrophysics Data System (ADS)
Goodwin, Robert W.; Kucera, Michael J.; Shea, Michael F.
1994-12-01
For several years, the standard model for accelerator control systems has been workstation consoles connected to VME local stations by a Local Area Network with analog and digital data being accessed via a field bus to custom I/O interface electronics. Commercially available hardware has now made it possible to implement a small stand-alone data acquisition station that combines the LAN connection, the computer, and the analog and digital I/O interface on a single board. This eliminates the complexity of a field bus and the associated proprietary I/O hardware. A minimum control system is one data acquisition station and a Macintosh or workstation console, both connected to the network; larger systems have more consoles and nodes. An implementation of this architecture is described along with performance and operational experience.
Brender, Jeffrey R.; Zhang, Yang
2015-01-01
The formation of protein-protein complexes is essential for proteins to perform their physiological functions in the cell. Mutations that prevent the proper formation of the correct complexes can have serious consequences for the associated cellular processes. Since experimental determination of protein-protein binding affinity remains difficult when performed on a large scale, computational methods for predicting the consequences of mutations on binding affinity are highly desirable. We show that a scoring function based on interface structure profiles collected from analogous protein-protein interactions in the PDB is a powerful predictor of protein binding affinity changes upon mutation. As a standalone feature, the differences between the interface profile score of the mutant and wild-type proteins has an accuracy equivalent to the best all-atom potentials, despite being two orders of magnitude faster once the profile has been constructed. Due to its unique sensitivity in collecting the evolutionary profiles of analogous binding interactions and the high speed of calculation, the interface profile score has additional advantages as a complementary feature to combine with physics-based potentials for improving the accuracy of composite scoring approaches. By incorporating the sequence-derived and residue-level coarse-grained potentials with the interface structure profile score, a composite model was constructed through the random forest training, which generates a Pearson correlation coefficient >0.8 between the predicted and observed binding free-energy changes upon mutation. This accuracy is comparable to, or outperforms in most cases, the current best methods, but does not require high-resolution full-atomic models of the mutant structures. The binding interface profiling approach should find useful application in human-disease mutation recognition and protein interface design studies. PMID:26506533
Greenwald, Elliot; So, Ernest; Wang, Qihong; Mollazadeh, Mohsen; Maier, Christoph; Etienne-Cummings, Ralph; Cauwenberghs, Gert; Thakor, Nitish
2016-01-01
We present a bidirectional neural interface with a 4-channel biopotential analog-to-digital converter (bioADC) and a 4-channel current-mode stimulator in 180nm CMOS. The bioADC directly transduces microvolt biopotentials into a digital representation without a voltage-amplification stage. Each bioADC channel comprises a continuous-time first-order ΔΣ modulator with a chopper-stabilized OTA input and current feedback, followed by a second-order comb-filter decimator with programmable oversampling ratio. Each stimulator channel contains two independent digital-to-analog converters for anodic and cathodic current generation. A shared calibration circuit matches the amplitude of the anodic and cathodic currents for charge balancing. Powered from a 1.5V supply, the analog and digital circuits in each recording channel draw on average 1.54 μA and 2.13 μA of supply current, respectively. The bioADCs achieve an SNR of 58 dB and a SFDR of >70 dB, for better than 9-b ENOB. Intracranial EEG recordings from an anesthetized rat are shown and compared to simultaneous recordings from a commercial reference system to validate performance in-vivo. Additionally, we demonstrate bidirectional operation by recording cardiac modulation induced through vagus nerve stimulation, and closed-loop control of cardiac rhythm. The micropower operation, direct digital readout, and integration of electrical stimulation circuits make this interface ideally suited for closed-loop neuromodulation applications. PMID:27845676
Data management system DIU test system
NASA Technical Reports Server (NTRS)
1976-01-01
An operational and functional description is given of the data management system. Descriptions are included for the test control unit, analog stimulus panel, discrete stimulus panel, and the precision source. The mechanical configuration is defined and illustrated to provide card and component location for modification or repair. The unit level interfaces are mirror images of the DIU interfaces and are described in the Final Technical Report for NASA-MSFC contract NAS8-29155.
New Generation Power System for Space Applications
NASA Technical Reports Server (NTRS)
Jones, Loren; Carr, Greg; Deligiannis, Frank; Lam, Barbara; Nelson, Ron; Pantaleon, Jose; Ruiz, Ian; Treicler, John; Wester, Gene; Sauers, Jim;
2004-01-01
The Deep Space Avionics (DSA) Project is developing a new generation of power system building blocks. Using application specific integrated circuits (ASICs) and power switching modules a scalable power system can be constructed for use on multiple deep space missions including future missions to Mars, comets, Jupiter and its moons. The key developments of the DSA power system effort are five power ASICs and a mod ule for power switching. These components enable a modular and scalab le design approach, which can result in a wide variety of power syste m architectures to meet diverse mission requirements and environments . Each component is radiation hardened to one megarad) total dose. The power switching module can be used for power distribution to regular spacecraft loads, to propulsion valves and actuation of pyrotechnic devices. The number of switching elements per load, pyrotechnic firin gs and valve drivers can be scaled depending on mission needs. Teleme try data is available from the switch module via an I2C data bus. The DSA power system components enable power management and distribution for a variety of power buses and power system architectures employing different types of energy storage and power sources. This paper will describe each power ASIC#s key performance characteristics as well a s recent prototype test results. The power switching module test results will be discussed and will demonstrate its versatility as a multip urpose switch. Finally, the combination of these components will illu strate some of the possible power system architectures achievable fro m small single string systems to large fully redundant systems.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vernon, E.; De Geronimo, G.; Ackley, K.
We report on the development of an application specific integrated circuit (ASIC) for 3D position sensitive detectors (3D PSD). The ASIC is designed to operate with pixelated wide bandgap sensors like Cadmium-Zinc-Telluride (CZT), Mercuric Iodide (Hgl2) and Thallium Bromide (TIBr). It measures the amplitudes and timings associated with an ionizing event on 128 anodes, the anode grid, and the cathode. Each channel provides low-noise charge amplification, high-order shaping with peaking time adjustable from 250 ns to 12 {micro}s, gain adjustable to 20 mV/fC or 120 mV/fC (for a dynamic range of 3.2 MeV and 530 keV in CZT), amplitude discriminationmore » with 5-bit trimming, and positive and negative peak and timing detections. The readout can be full or sparse, based on a flag and single- or multi-cycle token passing. All channels, triggered channels only, or triggered with neighbors can be read out thus increasing the rate capability of the system to more than 10 kcps. The ASIC dissipates 330 mW which corresponds to about 2.5 mW per channel.« less
Single Event Effects Test Results for Advanced Field Programmable Gate Arrays
NASA Technical Reports Server (NTRS)
Allen, Gregory R.; Swift, Gary M.
2006-01-01
Reconfigurable Field Programmable Gate Arrays (FPGAs) from Altera and Actel and an FPGA-based quick-turnApplication Specific Integrated Circuit (ASIC) from Altera were subjected to single-event testing using heavy ions. Both Altera devices (Stratix II and HardCopy II) exhibited a low latchup threshold (below an LET of 3 MeV-cm2/mg) and thus are not recommended for applications in the space radiation environment. The flash-based Actel ProASIC Plus device did not exhibit latchup to an effective LET of 75 MeV-cm2/mg at room temperature. In addition, these tests did not show flash cell charge loss (upset) or retention damage. Upset characterization of the design-level flip-flops yielded an LET threshold below 10 MeV-cm2/mg and a high LET cross section of about lxlO-6 cm2/bit for storing ones and about lxl0-7 cm2/bit for storing zeros . Thus, the ProASIC device may be suitable for critical flight applications with appropriate triple modular redundancy mitigation techniques.
A low power biomedical signal processor ASIC based on hardware software codesign.
Nie, Z D; Wang, L; Chen, W G; Zhang, T; Zhang, Y T
2009-01-01
A low power biomedical digital signal processor ASIC based on hardware and software codesign methodology was presented in this paper. The codesign methodology was used to achieve higher system performance and design flexibility. The hardware implementation included a low power 32bit RISC CPU ARM7TDMI, a low power AHB-compatible bus, and a scalable digital co-processor that was optimized for low power Fast Fourier Transform (FFT) calculations. The co-processor could be scaled for 8-point, 16-point and 32-point FFTs, taking approximate 50, 100 and 150 clock circles, respectively. The complete design was intensively simulated using ARM DSM model and was emulated by ARM Versatile platform, before conducted to silicon. The multi-million-gate ASIC was fabricated using SMIC 0.18 microm mixed-signal CMOS 1P6M technology. The die area measures 5,000 microm x 2,350 microm. The power consumption was approximately 3.6 mW at 1.8 V power supply and 1 MHz clock rate. The power consumption for FFT calculations was less than 1.5 % comparing with the conventional embedded software-based solution.
Small Microprocessor for ASIC or FPGA Implementation
NASA Technical Reports Server (NTRS)
Kleyner, Igor; Katz, Richard; Blair-Smith, Hugh
2011-01-01
A small microprocessor, suitable for use in applications in which high reliability is required, was designed to be implemented in either an application-specific integrated circuit (ASIC) or a field-programmable gate array (FPGA). The design is based on commercial microprocessor architecture, making it possible to use available software development tools and thereby to implement the microprocessor at relatively low cost. The design features enhancements, including trapping during execution of illegal instructions. The internal structure of the design yields relatively high performance, with a significant decrease, relative to other microprocessors that perform the same functions, in the number of microcycles needed to execute macroinstructions. The problem meant to be solved in designing this microprocessor was to provide a modest level of computational capability in a general-purpose processor while adding as little as possible to the power demand, size, and weight of a system into which the microprocessor would be incorporated. As designed, this microprocessor consumes very little power and occupies only a small portion of a typical modern ASIC or FPGA. The microprocessor operates at a rate of about 4 million instructions per second with clock frequency of 20 MHz.
A tripolar current-steering stimulator ASIC for field shaping in deep brain stimulation.
Valente, Virgilio; Demosthenous, Andreas; Bayford, Richard
2012-06-01
A significant problem with clinical deep brain stimulation (DBS) is the high variability of its efficacy and the frequency of side effects, related to the spreading of current beyond the anatomical target area. This is the result of the lack of control that current DBS systems offer on the shaping of the electric potential distribution around the electrode. This paper presents a stimulator ASIC with a tripolar current-steering output stage, aiming at achieving more selectivity and field shaping than current DBS systems. The ASIC was fabricated in a 0.35-μ m CMOS technology occupying a core area of 0.71 mm(2). It consists of three current sourcing/sinking channels. It is capable of generating square and exponential-decay biphasic current pulses with five different time constants up to 28 ms and delivering up to 1.85 mA of cathodic current, in steps of 4 μA, from a 12 V power supply. Field shaping was validated by mapping the potential distribution when injecting current pulses through a multicontact DBS electrode in saline.
Fang, Wai-Chi; Huang, Kuan-Ju; Chou, Chia-Ching; Chang, Jui-Chung; Cauwenberghs, Gert; Jung, Tzyy-Ping
2014-01-01
This is a proposal for an efficient very-large-scale integration (VLSI) design, 16-channel on-line recursive independent component analysis (ORICA) processor ASIC for real-time EEG system, implemented with TSMC 40 nm CMOS technology. ORICA is appropriate to be used in real-time EEG system to separate artifacts because of its highly efficient and real-time process features. The proposed ORICA processor is composed of an ORICA processing unit and a singular value decomposition (SVD) processing unit. Compared with previous work [1], this proposed ORICA processor has enhanced effectiveness and reduced hardware complexity by utilizing a deeper pipeline architecture, shared arithmetic processing unit, and shared registers. The 16-channel random signals which contain 8-channel super-Gaussian and 8-channel sub-Gaussian components are used to analyze the dependence of the source components, and the average correlation coefficient is 0.95452 between the original source signals and extracted ORICA signals. Finally, the proposed ORICA processor ASIC is implemented with TSMC 40 nm CMOS technology, and it consumes 15.72 mW at 100 MHz operating frequency.
NASA Astrophysics Data System (ADS)
Magazzù, G.; Borgese, G.; Costantino, N.; Fanucci, L.; Incandela, J.; Saponara, S.
2013-02-01
In many research fields as high energy physics (HEP), astrophysics, nuclear medicine or space engineering with harsh operating conditions, the use of fast and flexible digital communication protocols is becoming more and more important. The possibility to have a smart and tested top-down design flow for the design of a new protocol for control/readout of front-end electronics is very useful. To this aim, and to reduce development time, costs and risks, this paper describes an innovative design/verification flow applied as example case study to a new communication protocol called FF-LYNX. After the description of the main FF-LYNX features, the paper presents: the definition of a parametric SystemC-based Integrated Simulation Environment (ISE) for high-level protocol definition and validation; the set up of figure of merits to drive the design space exploration; the use of ISE for early analysis of the achievable performances when adopting the new communication protocol and its interfaces for a new (or upgraded) physics experiment; the design of VHDL IP cores for the TX and RX protocol interfaces; their implementation on a FPGA-based emulator for functional verification and finally the modification of the FPGA-based emulator for testing the ASIC chipset which implements the rad-tolerant protocol interfaces. For every step, significant results will be shown to underline the usefulness of this design and verification approach that can be applied to any new digital protocol development for smart detectors in physics experiments.
NetList(+): A simple interface language for chip design
NASA Astrophysics Data System (ADS)
Wuu, Tzyh-Yung
1991-04-01
NetList (+) is a design specification language developed at MOSIS for rapid turn-around cell-based ASIC prototyping. By using NetList (+), a uniform representation is achieved for the specification, simulation, and physical description of a design. The goal is to establish an interfacing methodology between design specification and independent computer aided design tools. Designers need only to specify a system by writing a corresponding netlist. This netlist is used for both functional simulation and timing simulation. The same netlist is also used to derive the low level physical tools to generate layout. Another goal of using NetList (+) is to generate parts of a design by running it through different kinds of placement and routing (P and R) tools. For example some parts of a design will be generated by standard cell P and R tools. Other parts may be generated by a layout tiler; i.e., datapath compiler, RAM/ROM generator, or PLA generator. Finally all different parts of a design can be integrated by general block P and R tools as a single chip. The NetList (+) language can actually act as an interface among tools. Section 2 shows a flowchart to illustrate the NetList (+) system and its relation with other related design tools. Section 3 shows how to write a NetList (+) description from the block diagram of a circuit. In section 4 discusses how to prepare a cell library or several cell libraries for a design system. Section 5 gives a few designs by NetList (+) and shows their simulation and layout results.
Embeddable Reconfigurable Neuroprocessors
NASA Technical Reports Server (NTRS)
Daud, Taher; Duong, Tuan; Langenbacher, Harry; Tran, Mua; Thakoor, Anil
1993-01-01
Reconfigurable and cascadable building block neural network chips, fabricated using analog VLSI design tools, are interfaced to a PC. The building block chip designs, the cascadability and the hardware-in-the-loop supervised learning aspects of these chips are described.
Two new constructions of approximately SIC-POVMs from multiplicative characters
NASA Astrophysics Data System (ADS)
Luo, Gaojun; Cao, Xiwang
2017-12-01
In quantum information theory, symmetric informationally complete positive operator-valued measures (SIC-POVMs) are relevant to quantum state tomography [8], quantum cryptography [15], and foundational studies [16]. In general, it is hard to construct SIC-POVMs and only a few classes of them existed, as we know. Moreover, we do not know whether there exists an infinite class of them. Many researchers tried to construct approximately symmetric informationally complete positive operator-valued measures (ASIC-POVMs). In this paper, we propose two new constructions of ASIC-POVMs for prime power dimensions only by using multiplicative characters over finite fields.
NASA Technical Reports Server (NTRS)
Quilligan, G.; DuMonthier, J.; Aslam, S.; Lakew, B.; Kleyner, I.; Katz, R.
2015-01-01
Thermal radiometers such as proposed for the Europa Clipper flyby mission require low noise signal processing for thermal imaging with immunity to Total Ionizing Dose (TID) and Single Event Latchup (SEL). Described is a second generation Multi- Channel Digitizer (MCD2G) Application Specific Integrated Circuit (ASIC) that accurately digitizes up to 40 thermopile pixels with greater than 50 Mrad (Si) immunity TID and 174 MeV-sq cm/mg SEL. The MCD2G ASIC uses Radiation Hardened By Design (RHBD) techniques with a 180 nm CMOS process node.
Vehicle-based vision sensors for intelligent highway systems
NASA Astrophysics Data System (ADS)
Masaki, Ichiro
1989-09-01
This paper describes a vision system, based on ASIC (Application Specific Integrated Circuit) approach, for vehicle guidance on highways. After reviewing related work in the fields of intelligent vehicles, stereo vision, and ASIC-based approaches, the paper focuses on a stereo vision system for intelligent cruise control. The system measures the distance to the vehicle in front using trinocular triangulation. An application specific processor architecture was developed to offer low mass-production cost, real-time operation, low power consumption, and small physical size. The system was installed in the trunk of a car and evaluated successfully on highways.
NASA Astrophysics Data System (ADS)
Quilligan, G.; DuMonthier, J.; Aslam, S.; Lakew, B.; Kleyner, I.; Katz, R.
2015-10-01
Thermal radiometers such as proposed for the Europa Clipper flyby mission [1] require low noise signal processing for thermal imaging with immunity to Total Ionizing Dose (TID) and Single Event Latchup (SEL). Described is a second generation Multi- Channel Digitizer (MCD2G) Application Specific Integrated Circuit (ASIC) that accurately digitizes up to 40 thermopile pixels with greater than 50 Mrad (Si) immunity TID and 174 MeV-cm2/mg SEL. The MCD2G ASIC uses Radiation Hardened By Design (RHBD) techniques with a 180 nm CMOS process node.
A 64ch readout module for PPD/MPPC/SiPM using EASIROC ASIC
NASA Astrophysics Data System (ADS)
Nakamura, Isamu; Ishijima, N.; Hanagaki, K.; Yoshimura, K.; Nakai, Y.; Ueno, K.
2015-07-01
A readout module for PPD/MPPC/GAPD/SiPM is developed using EASIROC ASIC. The module can handle 64 PPDs and has on-board bias power supply, ADC for energy measurement, 1 ns TDC on FPGA as well as 64ch Logic output for external trigger. Controls and data transfer are through SiTCP technology implemented in FPGA. The module has NIM format for convenience, but can be operated without crate with 5 V AC/DC converter. Basic performance of production module was tested and the results are presented in the poster.
Downsampling Photodetector Array with Windowing
NASA Technical Reports Server (NTRS)
Patawaran, Ferze D.; Farr, William H.; Nguyen, Danh H.; Quirk, Kevin J.; Sahasrabudhe, Adit
2012-01-01
In a photon counting detector array, each pixel in the array produces an electrical pulse when an incident photon on that pixel is detected. Detection and demodulation of an optical communication signal that modulated the intensity of the optical signal requires counting the number of photon arrivals over a given interval. As the size of photon counting photodetector arrays increases, parallel processing of all the pixels exceeds the resources available in current application-specific integrated circuit (ASIC) and gate array (GA) technology; the desire for a high fill factor in avalanche photodiode (APD) detector arrays also precludes this. Through the use of downsampling and windowing portions of the detector array, the processing is distributed between the ASIC and GA. This allows demodulation of the optical communication signal incident on a large photon counting detector array, as well as providing architecture amenable to algorithmic changes. The detector array readout ASIC functions as a parallel-to-serial converter, serializing the photodetector array output for subsequent processing. Additional downsampling functionality for each pixel is added to this ASIC. Due to the large number of pixels in the array, the readout time of the entire photodetector is greater than the time between photon arrivals; therefore, a downsampling pre-processing step is done in order to increase the time allowed for the readout to occur. Each pixel drives a small counter that is incremented at every detected photon arrival or, equivalently, the charge in a storage capacitor is incremented. At the end of a user-configurable counting period (calculated independently from the ASIC), the counters are sampled and cleared. This downsampled photon count information is then sent one counter word at a time to the GA. For a large array, processing even the downsampled pixel counts exceeds the capabilities of the GA. Windowing of the array, whereby several subsets of pixels are designated for processing, is used to further reduce the computational requirements. The grouping of the designated pixel frame as the photon count information is sent one word at a time to the GA, the aggregation of the pixels in a window can be achieved by selecting only the designated pixel counts from the serial stream of photon counts, thereby obviating the need to store the entire frame of pixel count in the gate array. The pixel count se quence from each window can then be processed, forming lower-rate pixel statistics for each window. By having this processing occur in the GA rather than in the ASIC, future changes to the processing algorithm can be readily implemented. The high-bandwidth requirements of a photon counting array combined with the properties of the optical modulation being detected by the array present a unique problem that has not been addressed by current CCD or CMOS sensor array solutions.
Theoretical Limits of Lunar Vision Aided Navigation with Inertial Navigation System
2015-03-26
camera model. Light reflected or projected from objects in the scene of the outside world is taken in by the aperture (or opening) shaped as a double...model’s analog aspects with an analog-to-digital interface converting raw images of the outside world scene into digital information a computer can use to...Figure 2.7. Digital Image Coordinate System. Used with permission [30]. Angular Field of View. The angular field of view is the angle of the world scene
Programmable Digital Controller
NASA Technical Reports Server (NTRS)
Wassick, Gregory J.
2012-01-01
An existing three-channel analog servo loop controller has been redesigned for piezoelectric-transducer-based (PZT-based) etalon control applications to a digital servo loop controller. This change offers several improvements over the previous analog controller, including software control over proportional-integral-derivative (PID) parameters, inclusion of other data of interest such as temperature and pressure in the control laws, improved ability to compensate for PZT hysteresis and mechanical mount fluctuations, ability to provide pre-programmed scanning and stepping routines, improved user interface, expanded data acquisition, and reduced size, weight, and power.
Digital optical conversion module
Kotter, D.K.; Rankin, R.A.
1988-07-19
A digital optical conversion module used to convert an analog signal to a computer compatible digital signal including a voltage-to-frequency converter, frequency offset response circuitry, and an electrical-to-optical converter. Also used in conjunction with the digital optical conversion module is an optical link and an interface at the computer for converting the optical signal back to an electrical signal. Suitable for use in hostile environments having high levels of electromagnetic interference, the conversion module retains high resolution of the analog signal while eliminating the potential for errors due to noise and interference. The module can be used to link analog output scientific equipment such as an electrometer used with a mass spectrometer to a computer. 2 figs.
Digital optical conversion module
Kotter, Dale K.; Rankin, Richard A.
1991-02-26
A digital optical conversion module used to convert an analog signal to a computer compatible digital signal including a voltage-to-frequency converter, frequency offset response circuitry, and an electrical-to-optical converter. Also used in conjunction with the digital optical conversion module is an optical link and an interface at the computer for converting the optical signal back to an electrical signal. Suitable for use in hostile environments having high levels of electromagnetic interference, the conversion module retains high resolution of the analog signal while eliminating the potential for errors due to noise and interference. The module can be used to link analog output scientific equipment such as an electrometer used with a mass spectrometer to a computer.
Plasmonic computing of spatial differentiation
NASA Astrophysics Data System (ADS)
Zhu, Tengfeng; Zhou, Yihan; Lou, Yijie; Ye, Hui; Qiu, Min; Ruan, Zhichao; Fan, Shanhui
2017-05-01
Optical analog computing offers high-throughput low-power-consumption operation for specialized computational tasks. Traditionally, optical analog computing in the spatial domain uses a bulky system of lenses and filters. Recent developments in metamaterials enable the miniaturization of such computing elements down to a subwavelength scale. However, the required metamaterial consists of a complex array of meta-atoms, and direct demonstration of image processing is challenging. Here, we show that the interference effects associated with surface plasmon excitations at a single metal-dielectric interface can perform spatial differentiation. And we experimentally demonstrate edge detection of an image without any Fourier lens. This work points to a simple yet powerful mechanism for optical analog computing at the nanoscale.
Layer-by-Layer Evolution of a Two-Dimensional Electron Gas Near an Oxide Interface
NASA Astrophysics Data System (ADS)
Chang, Young Jun; Moreschini, Luca; Bostwick, Aaron; Gaines, Geoffrey A.; Kim, Yong Su; Walter, Andrew L.; Freelon, Byron; Tebano, Antonello; Horn, Karsten; Rotenberg, Eli
2013-09-01
We report the momentum-resolved measurement of a two-dimensional electron gas at the LaTiO3/SrTiO3 interface by angle-resolved photoemission spectroscopy (ARPES). Thanks to an advanced sample preparation technique, the orbital character of the conduction electrons and the electronic correlations can be accessed quantitatively as each unit cell layer is added. We find that all of these quantities change dramatically with distance from the interface. These findings open the way to analogous studies on other heterostructures, which are traditionally a forbidden field for ARPES.
Faraday wave lattice as an elastic metamaterial.
Domino, L; Tarpin, M; Patinet, S; Eddi, A
2016-05-01
Metamaterials enable the emergence of novel physical properties due to the existence of an underlying subwavelength structure. Here, we use the Faraday instability to shape the fluid-air interface with a regular pattern. This pattern undergoes an oscillating secondary instability and exhibits spontaneous vibrations that are analogous to transverse elastic waves. By locally forcing these waves, we fully characterize their dispersion relation and show that a Faraday pattern presents an effective shear elasticity. We propose a physical mechanism combining surface tension with the Faraday structured interface that quantitatively predicts the elastic wave phase speed, revealing that the liquid interface behaves as an elastic metamaterial.
Applications of Emerging Parallel Optical Link Technology to High Energy Physics Experiments
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chramowicz, J.; Kwan, S.; Prosser, A.
2011-09-01
Modern particle detectors depend upon optical fiber links to deliver event data to upstream trigger and data processing systems. Future detector systems can benefit from the development of dense arrangements of high speed optical links emerging from the telecommunications and storage area network market segments. These links support data transfers in each direction at rates up to 120 Gbps in packages that minimize or even eliminate edge connector requirements. Emerging products include a class of devices known as optical engines which permit assembly of the optical transceivers in close proximity to the electrical interfaces of ASICs and FPGAs which handlemore » the data in parallel electrical format. Such assemblies will reduce required printed circuit board area and minimize electromagnetic interference and susceptibility. We will present test results of some of these parallel components and report on the development of pluggable FPGA Mezzanine Cards equipped with optical engines to provide to collaborators on the Versatile Link Common Project for the HI-LHC at CERN.« less
ERIC Educational Resources Information Center
Deininger, Rolf A.; Berger, Carl F., Jr.
1983-01-01
Provides instructions for interfacing a pH meter directly to an Apple II microcomputer without an analog-to-digital converter. Includes program listing (with enough remark statements to make it self-documenting) in Integer Basic to display the pH readings. (Author/JN)
Active Microelectronic Neurosensor Arrays for Implantable Brain Communication Interfaces
Song, Y.-K.; Borton, D. A.; Park, S.; Patterson, W. R.; Bull, C. W.; Laiwalla, F.; Mislow, J.; Simeral, J. D.; Donoghue, J. P.; Nurmikko, A. V.
2010-01-01
We have built a wireless implantable microelectronic device for transmitting cortical signals transcutaneously. The device is aimed at interfacing a microelectrode array cortical to an external computer for neural control applications. Our implantable microsystem enables presently 16-channel broadband neural recording in a non-human primate brain by converting these signals to a digital stream of infrared light pulses for transmission through the skin. The implantable unit employs a flexible polymer substrate onto which we have integrated ultra-low power amplification with analog multiplexing, an analog-to-digital converter, a low power digital controller chip, and infrared telemetry. The scalable 16-channel microsystem can employ any of several modalities of power supply, including via radio frequency by induction, or infrared light via a photovoltaic converter. As of today, the implant has been tested as a sub-chronic unit in non-human primates (~ 1 month), yielding robust spike and broadband neural data on all available channels. PMID:19502132
Development of a front end controller/heap manager for PHENIX
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ericson, M.N.; Allen, M.D.; Musrock, M.S.
1996-12-31
A controller/heap manager has been designed for applicability to all detector subsystem types of PHENIX. the heap manager performs all functions associated with front end electronics control including ADC and analog memory control, data collection, command interpretation and execution, and data packet forming and communication. Interfaces to the unit consist of a timing and control bus, a serial bus, a parallel data bus, and a trigger interface. The topology developed is modular so that many functional blocks are identical for a number of subsystem types. Programmability is maximized through the use of flexible modular functions and implementation using field programmablemore » gate arrays (FPGAs). Details of unit design and functionality will be discussed with particular detail given to subsystems having analog memory-based front end electronics. In addition, mode control, serial functions, and FPGA implementation details will be presented.« less
Abuna, Gabriel; Feitosa, Victor P; Correr, Americo Bortolazzo; Cama, Giuseppe; Giannini, Marcelo; Sinhoreti, Mario A; Pashley, David H; Sauro, Salvatore
2016-09-01
This study examined the bonding performance and dentin remineralization potential of an experimental adhesive containing calcium-phosphate (Ca/P) micro-fillers, and self-etching primers doped with phosphoprotein biomimetic analogs (polyacrylic acid-(PAA) and/or sodium trimetaphosphate-(TMP)). Experimental self-etching primers doped with biomimetic analogs (PAA and/or TMP), and an adhesive containing Ca(2+), PO4(-3)-releasing micro-fillers (Ca/P) were formulated. Sound human dentin specimens were bonded and cut into sticks after aging (24h or 6 months) under simulated pulpal pressure (20cm H2O), and tested for microtensile bond strength (μTBS). Results were analyzed using two-way ANOVA and Tukey's test (p<0.05). Interfacial silver nanoleakage was assessed using SEM. Remineralization of EDTA-demineralized dentin was assessed through FTIR and TEM ultrastructural analysis. Application of the Ca/P-doped adhesive with or without dentin pre-treatments with the primer containing both biomimetic analogs (PAA and TMP) promoted stable μTBS over 6 months. Conversely, μTBS of the control primer and filler-free adhesive significantly decreased after 6 months. Nanoleakage decreased within the resin-dentin interfaces created using the Ca/P-doped adhesives. EDTA-demineralized dentin specimens treated the Ca/P-doped adhesive and the primer containing PAA and TMP showed phosphate uptake (FTIR analysis), as well as deposition of needle-like crystallites at intrafibrillar level (TEM analysis). The use of Ca/P-doped self-etching adhesives applied in combination with analogs of phosphoproteins provides durable resin-dentin bonds. This approach may represent a suitable bonding strategy for remineralization of intrafibrillar dentin collagen within the resin-dentin interface. Copyright © 2016 Elsevier Ltd. All rights reserved.
Lu, Yongjun; Whiteis, Carol A; Sluka, Kathleen A; Chapleau, Mark W; Abboud, François M
2013-01-01
Carotid body glomus cells are the primary sites of chemotransduction of hypoxaemia and acidosis in peripheral arterial chemoreceptors. They exhibit pronounced morphological heterogeneity. A quantitative assessment of their functional capacity to differentiate between these two major chemical signals has remained undefined. We tested the hypothesis that there is a differential sensory transduction of hypoxia and acidosis at the level of glomus cells. We measured cytoplasmic Ca2+ concentration in individual glomus cells, isolated in clusters from rat carotid bodies, in response to hypoxia ( mmHg) and to acidosis at pH 6.8. More than two-thirds (68%) were sensitive to both hypoxia and acidosis, 19% were exclusively sensitive to hypoxia and 13% exclusively sensitive to acidosis. Those sensitive to both revealed significant preferential sensitivity to either hypoxia or to acidosis. This uncoupling and reciprocity was recapitulated in a mouse model by altering the expression of the acid-sensing ion channel 3 (ASIC3) which we had identified earlier in glomus cells. Increased expression of ASIC3 in transgenic mice increased pH sensitivity while reducing cyanide sensitivity. Conversely, deletion of ASIC3 in the knockout mouse reduced pH sensitivity while the relative sensitivity to cyanide or to hypoxia was increased. In this work, we quantify functional differences among glomus cells and show reciprocal sensitivity to acidosis and hypoxia in most glomus cells. We speculate that this selective chemotransduction of glomus cells by either stimulus may result in the activation of different afferents that are preferentially more sensitive to either hypoxia or acidosis, and thus may evoke different and more specific autonomic adjustments to either stimulus. PMID:23165770
NASA Astrophysics Data System (ADS)
Paschalidis, Nicholas; McNutt, Ralph
One of the most critical challenges of the Pluto Energetic Particle Spectrometer Science Inves-tigation (PEPSSI) was to meet the science requirements with a total mass and power of ¡1.5 kg and ¡2.5 W, respectively. A key, enabling technology to achieve these goals was the exten-sive use of high-performance, low-power, application-specific integrated circuits (ASICs) for the miniaturization of the 12-channel solid state detector (SSD) readout system, the time-of-flight (TOF) system, and the power supply and housekeeping systems. The PEPSSI instrument is a TOF-versus-energy, compact particle spectrometer that provides measurements of ions and electrons from 20keV to 1MeV in a 160 x 12 solid angle field of view divided into six dual-channel sectors. TOF, constant fraction discriminator (CFD), energy, peak detector, and temperature, remote input/output (TRIO, housekeeping) ASICs were all used synergistically in the instrument enabling the high science performance within the resource constraints. The ASICs were space qualified in accord with military specifications (Class S) for total radiation dose and single-event effects (SEEs), and, most importantly, for a 2000-hour life test to increase the reliability for the long duration of the mission. PEPSSI flies on-board the New Horizons NASA spacecraft to measure pick-up ions from the Pluto's outgassing atmosphere. The space-craft was launched 19 Jan 2006 and presently is en route to Pluto, having passed Jupiter in early 2007. Closest approach to Pluto will occur in mid-July 2015. The instrument has already produced excellent measurements in interplanetary space and during the traversal of Jupiter's magnetotail in 2007.
Rodrigues de Carvalho, Alyne Mara; Vasconcelos, Leonardo Freire; Moura Rocha, Nayrton Flávio; Vasconcelos Rios, Emiliano Ricardo; Dias, Marília Leite; Maria de França Fonteles, Marta; Gaspar, Danielle Macêdo; Barbosa Filho, José Maria; Chavez Gutierrez, Stanley Juan; Florenço de Sousa, Francisca Cléa
2018-05-01
Riparin II (RipII) has an anti-inflammatory activity potentially due its ability to decrease TNF-α and IL-1β production and its histamine antagonism. The objective of this study was to evaluate the role of RipII in the pain process and the possible antinociceptive mechanisms involved, using classic models of nociception. Male Swiss mice were used in the assays. Determinate the acute toxicity according to the OECD 425 test guideline. The models used were the acetic acid-, formalin-, hot plate and glutamate-induced nociception. For evaluation of antinociceptive effect, the involvement of TRPV1, TRPA1, TRPM8, ASICS, Bradykinin, PKC and PKA were performed using the paw licking using agonists. The acute toxicity study did not detect any clinical signs or changes in behavior or mortality. RipII, administered orally (25 and 50 mg/kg) caused a reduction of nociception induced by acetic acid, formalin (on the second phase) and glutamate. In the investigation of antinociceptive mechanism, we used capsaicin (2.2 μg/paw), cinnamaldehyde (10 nmol/paw), menthol (1.2 μmol/paw), ASICS (2% acetic acid, pH 1.98) and bradykinin (10 μg/paw). The results showed that TRPV1, TRPA1, TRPM8, ASICS and bradykinin play a role in the antinociceptive effect of RipII. The results also showed that PKA is involved too. These data demonstrate that RipII has a low or not toxicity and produced an important antinociceptive effect through mechanisms that probably involve an interaction, at least in part, TRPV1, TRPA1, TRPM8, ASICS, bradykinin and PKA participate in the RipII's antinociceptive effect. Copyright © 2018 Elsevier B.V. All rights reserved.
Parallel heterogeneous architectures for efficient OMP compressive sensing reconstruction
NASA Astrophysics Data System (ADS)
Kulkarni, Amey; Stanislaus, Jerome L.; Mohsenin, Tinoosh
2014-05-01
Compressive Sensing (CS) is a novel scheme, in which a signal that is sparse in a known transform domain can be reconstructed using fewer samples. The signal reconstruction techniques are computationally intensive and have sluggish performance, which make them impractical for real-time processing applications . The paper presents novel architectures for Orthogonal Matching Pursuit algorithm, one of the popular CS reconstruction algorithms. We show the implementation results of proposed architectures on FPGA, ASIC and on a custom many-core platform. For FPGA and ASIC implementation, a novel thresholding method is used to reduce the processing time for the optimization problem by at least 25%. Whereas, for the custom many-core platform, efficient parallelization techniques are applied, to reconstruct signals with variant signal lengths of N and sparsity of m. The algorithm is divided into three kernels. Each kernel is parallelized to reduce execution time, whereas efficient reuse of the matrix operators allows us to reduce area. Matrix operations are efficiently paralellized by taking advantage of blocked algorithms. For demonstration purpose, all architectures reconstruct a 256-length signal with maximum sparsity of 8 using 64 measurements. Implementation on Xilinx Virtex-5 FPGA, requires 27.14 μs to reconstruct the signal using basic OMP. Whereas, with thresholding method it requires 18 μs. ASIC implementation reconstructs the signal in 13 μs. However, our custom many-core, operating at 1.18 GHz, takes 18.28 μs to complete. Our results show that compared to the previous published work of the same algorithm and matrix size, proposed architectures for FPGA and ASIC implementations perform 1.3x and 1.8x respectively faster. Also, the proposed many-core implementation performs 3000x faster than the CPU and 2000x faster than the GPU.
Wang, Jie; Wen, Chun-Yan; Cui, Cui-Cui; Xing, Ying
2015-01-01
We investigated the role of acid-sensing ion channel Ia (ASIC1a) expression and changes in intracellular Ca(2+) concentration ([Ca(2+)]) in focal cerebral ischemia after middle cerebral artery occlusion (MCAO) in a rat model of diabetes mellitus (DM). Male Wistar rats (n = 108) were divided into three groups: the MCAO, DM + MCAO, and DM + MCAO + fasudil groups (n = 36 each). Samples were obtained 1, 3, 6, and 24 h after ischemia induction (n = 9). Rats in the DM + MCAO + fasudil group were treated with 1 mg/kg fasudil, a Rho-kinase inhibitor, by caudal vein injection 30 min after MCAO was performed. ASIC1a expression gradually increased with time in the MCAO and DM + MCAO groups (0.71 ± 0.10 nM, 0.80 ± 0.11 nM, 0.86 ± 0.08 nM, 0.93 ± 0.09 nM; 0.86 ± 0.11 nM, 1.05 ± 0.51 nM, 2.42 ± 0.08 nM, 2.78 ± 0.04 nM; pairwise comparisons at each time point, P < 0.05), and was higher in the DM + MCAO than the MCAO group (P < 0.05). [Ca(2+)] gradually increased in the DM + MCAO group (106.32 ± 18.6 nM, 137.84 ± 14.32 nM, 151.94 ± 18.38 nM, 183.61 ± 7.96 nM, P < 0.05). ASIC1a expression and calcium currents were reduced in the DM + MCAO + fasudil group. The overload of intracellular [Ca(2+)] caused by ASIC1a activation could be one mechanism for the aggravation of focal cerebral ischemia in diabetes.
Wang, Jie; Wen, Chun-Yan; Cui, Cui-Cui; Xing, Ying
2015-01-01
We investigated the role of acid-sensing ion channel Ia (ASIC1a) expression and changes in intracellular Ca2+ concentration ([Ca2+]) in focal cerebral ischemia after middle cerebral artery occlusion (MCAO) in a rat model of diabetes mellitus (DM). Male Wistar rats (n = 108) were divided into three groups: the MCAO, DM + MCAO, and DM + MCAO + fasudil groups (n = 36 each). Samples were obtained 1, 3, 6, and 24 h after ischemia induction (n = 9). Rats in the DM + MCAO + fasudil group were treated with 1 mg/kg fasudil, a Rho-kinase inhibitor, by caudal vein injection 30 min after MCAO was performed. ASIC1a expression gradually increased with time in the MCAO and DM + MCAO groups (0.71 ± 0.10 nM, 0.80 ± 0.11 nM, 0.86 ± 0.08 nM, 0.93 ± 0.09 nM; 0.86 ± 0.11 nM, 1.05 ± 0.51 nM, 2.42 ± 0.08 nM, 2.78 ± 0.04 nM; pairwise comparisons at each time point, P < 0.05), and was higher in the DM + MCAO than the MCAO group (P < 0.05). [Ca2+] gradually increased in the DM + MCAO group (106.32 ± 18.6 nM, 137.84 ± 14.32 nM, 151.94 ± 18.38 nM, 183.61 ± 7.96 nM, P < 0.05). ASIC1a expression and calcium currents were reduced in the DM + MCAO + fasudil group. The overload of intracellular [Ca2+] caused by ASIC1a activation could be one mechanism for the aggravation of focal cerebral ischemia in diabetes. PMID:26722526
NASA Astrophysics Data System (ADS)
Tao, Ashley T.; Noseworthy, Michael D.; Farncombe, Troy H.
2016-10-01
A cadmium zinc telluride (CZT) based detector system has been developed with the goal of combining molecular breast imaging (MBI) and magnetic resonance imaging (MRI) to address shortcomings of each modality. The CZT detector system is comprised of four CZT modules tiled in a 2×2 array. Each module consists of 256 pixels (16×16, 2.4 mm pixels) and features a built-in ASIC and FPGA. A custom digital readout circuit board was designed to interface the four modules with a microcontroller to a data acquisition PC. The system was placed within the bore of a 3 T GE Discovery MR750 and imaging performance of each modality evaluated using both sequential and simultaneous imaging protocols. The mean energy resolution of the gamma camera both inside and outside the MRI is 7.3% at 140 keV. The maximum increase in the integral uniformity was 3% when using a gradient echo MRI sequence while the mean differential uniformity when inside the MRI increased by 1%. Spatial resolution varied in a predictable manner from 2.4 mm FWHM at the collimator face to 6.9 mm at 10 cm from the collimator. Performance of the 3 T GE Discovery MR750 using a 16-channel breast RF coil array was measured with and without the gamma camera present using a gradient echo and spoiled gradient echo imaging sequence. A realistic 99mTc-filled breast-like phantom containing two lesions (30:1 lesion to background ratio) was used to assess the feasibility of both serial and simultaneous hybrid imaging. Sequential imaging resulted in a reduction in MRI SNR of 70-80% and a further decrease of 93-98% was observed when performing simultaneous MR/scintigraphy imaging, likely a result of RF interference originating from the CZT detector modules and associated analog electronics. Co-registered scintigraphic and MRI images display negligible geometric distortion when imaged with both simultaneous and serial imaging modes, thus indicating the feasibility of combining MBI with breast MRI.
Cross strip anode readouts for microchannel plate detectors: developing flight qualified prototypes
NASA Astrophysics Data System (ADS)
Vallerga, John; Cooney, M.; Raffanti, R.; Varner, G.; Siegmund, O.; McPhate, J. B.; Tremsin, A.
2014-01-01
Photon counting microchannel plate (MCP) imagers have been the detector of choice for most UV astronomical missions over the last two decades (eg. EUVE, FUSE, COS on Hubble etc.). Over this duration, improvements in the MCP laboratory readout technology have resulted in better spatial resolution (x10), temporal resolution (x 1000) and output event rate (x100), all the while operating at lower gain (x 10) resulting in lower high voltage requirements and longer MCP lifetimes. One such technology is the parallel cross strip (PXS) readout. The PXS anode is a set of orthogonal conducting strips (80 x 80), typically spaced at a 635 micron pitch onto which charge clouds from MCP amplified events land. Each strip has its own charge sensitive amplifier that is sampled continuously by a dedicated analog to digital (ADC) converter at 50MHz. All of the 160 ADC digital output lines are fed into a field programmable gate array (FGPA) which can detect charge events landing on the strips, measure the peak amplitudes of those charge events and calculate their spatial centroid along with their time of arrival (X,Y,T). Laboratory versions of these electronics have demonstrated < 20 microns FWHM spatial resolution, count rates on the order of 2 MHz, and temporal resolution of ~ 1ns. In 2012 the our group at U.C. Berkeley, along with our partners at the U. Hawaii, received a Strategic Astrophysics Technology grant to raise the TRL of the PXS detector from 4 to 6 by replacing most of the 19" rack mounted, high powered electronics with application specific integrated circuits (ASICs) which will lower the power, mass and volume requirements of the PXS detector. We were also tasked to design and fabricate a "standard" 50mm square active area MCP detector incorporating these electronics that can be environmentally qualified for flight (temperature, vacuum, vibration). This detector design could then be modified for individual flight opportunities with a higher level of confidence than starting from scratch. We will present the latest progress on the ASIC designs, fabrication and performance and show imaging results from the 50mm XS detector using our current laboratory PXS electronics.
MO-F-CAMPUS-J-03: Development of a Human Brain PET for On-Line Proton Beam-Range Verification
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shao, Yiping
Purpose: To develop a prototype PET for verifying proton beam-range before each fractionated therapy that will enable on-line re-planning proton therapy. Methods: Latest “edge-less” silicon photomultiplier arrays and customized ASIC readout electronics were used to develop PET detectors with depth-of-interaction (DOI) measurement capability. Each detector consists of one LYSO array with each end coupled to a SiPM array. Multiple detectors can be seamlessly tiled together to form a large detector panel. Detectors with 1.5×1.5 and 2.0×2.0 mm crystals at 20 or 30 mm lengths were studied. Readout of individual SiPM or signal multiplexing was used to transfer 3D interaction position-codedmore » analog signals through flexible-print-circuit cables or PCB board to dedicated ASIC front-end electronics to output digital timing pulses that encode interaction information. These digital pulses can be transferred to, through standard LVDS cables, and decoded by a FPGA-based data acquisition of coincidence events and data transfer. The modular detector and scalable electronics/data acquisition will enable flexible PET system configuration for different imaging geometry. Results: Initial detector performance measurement shows excellent crystal identification even with 30 mm long crystals, ∼18% and 2.8 ns energy and timing resolutions, and around 2–3 mm DOI resolution. A small prototype PET scanner with one detector ring has been built and evaluated, validating the technology and design. A large size detector panel has been fabricated by scaling up from modular detectors. Different designs of resistor and capacitor based signal multiplexing boards were tested and selected based on optimal crystal identification and timing performance. Stackable readout electronics boards and FPGA-based data acquisition boards were developed and tested. A brain PET is under construction. Conclusion: Technology of large-size DOI detector based on SiPM array and advanced readout has been developed. PET imaging performance and initial phantom studies of on-line proton beam-range measurement will be conducted and reported. NIH grant R21CA187717; Cancer Prevention and Research Institute of Texas grant RP120326.« less
A Framework for Robust Multivariable Optimization of Integrated Circuits in Space Applications
NASA Technical Reports Server (NTRS)
DuMonthier, Jeffrey; Suarez, George
2013-01-01
Application Specific Integrated Circuit (ASIC) design for space applications involves multiple challenges of maximizing performance, minimizing power and ensuring reliable operation in extreme environments. This is a complex multidimensional optimization problem which must be solved early in the development cycle of a system due to the time required for testing and qualification severely limiting opportunities to modify and iterate. Manual design techniques which generally involve simulation at one or a small number of corners with a very limited set of simultaneously variable parameters in order to make the problem tractable are inefficient and not guaranteed to achieve the best possible results within the performance envelope defined by the process and environmental requirements. What is required is a means to automate design parameter variation, allow the designer to specify operational constraints and performance goals, and to analyze the results in a way which facilitates identifying the tradeoffs defining the performance envelope over the full set of process and environmental corner cases. The system developed by the Mixed Signal ASIC Group (MSAG) at the Goddard Space Flight Center is implemented as framework of software modules, templates and function libraries. It integrates CAD tools and a mathematical computing environment, and can be customized for new circuit designs with only a modest amount of effort as most common tasks are already encapsulated. Customization is required for simulation test benches to determine performance metrics and for cost function computation. Templates provide a starting point for both while toolbox functions minimize the code required. Once a test bench has been coded to optimize a particular circuit, it is also used to verify the final design. The combination of test bench and cost function can then serve as a template for similar circuits or be re-used to migrate the design to different processes by re-running it with the new process specific device models. The system has been used in the design of time to digital converters for laser ranging and time-of-flight mass spectrometry to optimize analog, mixed signal and digital circuits such as charge sensitive amplifiers, comparators, delay elements, radiation tolerant dual interlocked (DICE) flip-flops and two of three voter gates.
MicroChemLab, A Novel Approach for Handheld Chemical Sensing
NASA Astrophysics Data System (ADS)
Lewis, Patrick
2003-03-01
In 1996, Sandia National Laboratories began development of a chemical sensing platform based on microfabricated components. The goal of the project was to develop a handheld system for the detection of chemical warfare (CW) agent vapors in air. The components developed for this project are analogous to devices used in analytical laboratories. The benefit of microfabrication is that the resulting components are small and require little power to operate. The key elements of MicroChemLab are a sample collector - preconcentrator, a GC column and a surface acoustic wave (SAW) array detector. The preconcentrator is a thermally isolated silicon nitride membrane with a resistive heater patterned on one side and a sorptive sol gel film deposited on the other. Since the membrane has a very small mass, the resistive heater can ballistically elevate the temperature of the sorptive film to 200° C in approximately 10 ms. The sol gel film collects target compounds efficiently, but rejects volatile industrial solvents like alcohols, ketones, etc. The GC column is a one-meter high aspect ratio spiral channel etched in silicon with an anodically bonded pyrex lid completing the channel. A heater patterned on the silicon allows the column to be temperature ramped. Analytes injected from the preconcentrator are separated in this stage. The SAW array detector contains 3 delay lines used for sensing and 1 reference delay line. Each delay line is driven by an application specific integrated circuit (ASIC) at 500 MHz. Instead of counting frequency, additional ASICs incorporate a phase comparator that delivers a DC signal proportional to the amount of phase change. The three sensing elements of the detector provide a pattern that is indicative of the class of compound detected i.e. nerve agents or blister agents. Combined, these components provide a selective and sensitive handheld solution for the detection of chemical warfare agents. We will present lab data showing the performance of individual components and field data demonstrating the performance of this system. Sandia is a multiprogram laboratory operated by Sandia Corporation, a Lockheed Martin Company, for the United States Department of Energy under Contract DE-AC04-94AL85000.
An Open Hardware seismic data recorder - a solid basis for citizen science
NASA Astrophysics Data System (ADS)
Mertl, Stefan
2015-04-01
"Ruwai" is a 24-Bit Open Hardware seismic data recorder. It is built up of four stackable printed circuit boards fitting the Arduino Mega 2560 microcontroller prototyping platform. An interface to the BeagleBone Black single-board computer enables extensive data storage, -processing and networking capabilities. The four printed circuit boards provide a uBlox Lea-6T GPS module and real-time clock (GPS Timing shield), an Texas Instruments ADS1274 24-Bit analog to digital converter (ADC main shield), an analog input section with a Texas Instruments PGA281 programmable gain amplifier and an analog anti-aliasing filter (ADC analog interface pga) and the power conditioning based on 9-36V DC input (power supply shield). The Arduino Mega 2560 is used for controlling the hardware components, timestamping sampled data using the GPS timing information and transmitting the data to the BeagleBone Black single-board computer. The BeagleBone Black provides local data storage, wireless mesh networking using the optimized link state routing daemon and differential GNSS positioning using the RTKLIB software. The complete hardware and software is published under free software - or open hardware licenses and only free software (e.g. KiCad) was used for the development to facilitate the reusability of the design and increases the sustainability of the project. "Ruwai" was developed within the framework of the "Community Environmental Observation Network (CEON)" (http://www.mertl-research.at/ceon/) which was supported by the Internet Foundation Austria (IPA) within the NetIdee 2013 call.
Hastrup, Hanne; Sen, Namita; Javitch, Jonathan A
2003-11-14
Using cysteine cross-linking, we demonstrated previously that the dopamine transporter (DAT) is at least a homodimer, with the extracellular end of transmembrane segment (TM) 6 at a symmetrical dimer interface. We have now explored the possibility that DAT exists as a higher order oligomer in the plasma membrane. Cysteine cross-linking of wild type DAT resulted in bands on SDS-PAGE consistent with dimer, trimer, and tetramer, suggesting that DAT forms a tetramer in the plasma membrane. A cysteine-depleted DAT (CD-DAT) into which only Cys243 or Cys306 was reintroduced was cross-linked to dimer, suggesting that these endogenous cysteines in TM4 and TM6, respectively, were cross-linked at a symmetrical dimer interface. Reintroduction of both Cys243 and Cys306 into CD-DAT led to a pattern of cross-linking indistinguishable from that of wild type, with dimer, trimer, and tetramer bands. This indicated that the TM4 interface and the TM6 interface are distinct and further suggested that DAT may exist in the plasma membrane as a dimer of dimers, with two symmetrical homodimer interfaces. The cocaine analog MFZ 2-12 and other DAT inhibitors, including benztropine and mazindol, protected Cys243 against cross-linking. In contrast, two substrates of DAT, dopamine and tyramine, did not significantly impact cross-linking. We propose that the impairment of cross-linking produced by the inhibitors results from a conformational change at the TM4 interface, further demonstrating that these compounds are not neutral blockers but by themselves have effects on the structure of the transporter.
NASA Technical Reports Server (NTRS)
Smith, Edwyn D.
1991-01-01
Two silicon CMOS application specific integrated circuits (ASICs), a data generation chip, and a data checker chip were designed. The conversion of the data generator circuitry into a pair of CMOS ASIC chips using the 1.2 micron standard cell library is documented. The logic design of the data checker is discussed. The functions of the control circuitry is described. An accurate estimate of timing relationships is essential to make sure that the logic design performs correctly under practical conditions. Timing and delay information are examined.
NASA Astrophysics Data System (ADS)
Ryan, D. F.; Baumgartner, W. H.; Wilson, M.; Benmoussa, A.; Campola, M.; Christe, S. D.; Gissot, S.; Jones, L.; Newport, J.; Prydderch, M.; Richards, S.; Seller, P.; Shih, A. Y.; Thomas, S.
2018-02-01
The High Energy X-ray Imaging Technology (HEXITEC) ASIC is designed on a 0.35 μm CMOS process to read out CdTe or CZT detectors and hence provide fine-pixellated spectroscopic imaging in the range 2-200 keV. In this paper, we examine the tolerance of HEXITEC to both potentially destructive cumulative and single event radiation effects. Bare ASICs are irradiated with X-rays up to a total ionising dose (TID) of 1 Mrad (SiO2) and bombarded with heavy ions with linear energy transfer (LET) up to 88.3 MeV mg-1 cm-2. HEXITEC is shown to operate reliably below a TID of 150 krad, have immunity to fatal single event latchup (SEL) and have high tolerance to non-fatal SEL up to LETs of at least 88.3 MeV mg-1 cm-2. The results are compared to predictions of TID and SELs for various Earth-orbits and aluminium shielding thicknesses. It is found that HEXITEC's radiation tolerance to both potentially destructive cumulative and single event effects is sufficient to reliably operate in these environments with moderate shielding.
Handheld ultrasound array imaging device
NASA Astrophysics Data System (ADS)
Hwang, Juin-Jet; Quistgaard, Jens
1999-06-01
A handheld ultrasound imaging device, one that weighs less than five pounds, has been developed for diagnosing trauma in the combat battlefield as well as a variety of commercial mobile diagnostic applications. This handheld device consists of four component ASICs, each is designed using the state of the art microelectronics technologies. These ASICs are integrated with a convex array transducer to allow high quality imaging of soft tissues and blood flow in real time. The device is designed to be battery driven or ac powered with built-in image storage and cineloop playback capability. Design methodologies of a handheld device are fundamentally different to those of a cart-based system. As system architecture, signal and image processing algorithm as well as image control circuit and software in this device is deigned suitably for large-scale integration, the image performance of this device is designed to be adequate to the intent applications. To elongate the battery life, low power design rules and power management circuits are incorporated in the design of each component ASIC. The performance of the prototype device is currently being evaluated for various applications such as a primary image screening tool, fetal imaging in Obstetrics, foreign object detection and wound assessment for emergency care, etc.
Simulation environment based on the Universal Verification Methodology
NASA Astrophysics Data System (ADS)
Fiergolski, A.
2017-01-01
Universal Verification Methodology (UVM) is a standardized approach of verifying integrated circuit designs, targeting a Coverage-Driven Verification (CDV). It combines automatic test generation, self-checking testbenches, and coverage metrics to indicate progress in the design verification. The flow of the CDV differs from the traditional directed-testing approach. With the CDV, a testbench developer, by setting the verification goals, starts with an structured plan. Those goals are targeted further by a developed testbench, which generates legal stimuli and sends them to a device under test (DUT). The progress is measured by coverage monitors added to the simulation environment. In this way, the non-exercised functionality can be identified. Moreover, the additional scoreboards indicate undesired DUT behaviour. Such verification environments were developed for three recent ASIC and FPGA projects which have successfully implemented the new work-flow: (1) the CLICpix2 65 nm CMOS hybrid pixel readout ASIC design; (2) the C3PD 180 nm HV-CMOS active sensor ASIC design; (3) the FPGA-based DAQ system of the CLICpix chip. This paper, based on the experience from the above projects, introduces briefly UVM and presents a set of tips and advices applicable at different stages of the verification process-cycle.
Two Mechanisms Involved in Trigeminal CGRP Release: Implications for Migraine Treatment
Durham, Paul L.; Masterson, Caleb G.
2012-01-01
Objective The goal of this study was to better understand the cellular mechanisms involved in proton stimulation of calcitonin gene-related peptide (CGRP) secretion from cultured trigeminal neurons by investigating the effects of two anti-migraine therapies, onabotulinumtoxin A and rizatriptan. Background Stimulated CGRP release from peripheral and central terminating processes of trigeminal ganglia neurons is implicated in migraine pathology by promoting inflammation and nociception. Based on models of migraine pathology, several inflammatory molecules including protons are thought to facilitate sensitization and activation of trigeminal nociceptive neurons and stimulate CGRP secretion. Despite the reported efficacy of triptans and onabotulinumtoxinA to treat acute and chronic migraine, respectively, a substantial number of migraneurs do not get adequate relief with these therapies. A possible explanation is that triptans and onabutulinumtoxinA are not able to block proton mediated CGRP secretion. Methods CGRP secretion from cultured primary trigeminal ganglia neurons was quantitated by radioimmunoassay while intracellular calcium and sodium levels were measured in neurons via live cell imaging using Fura2-AM and SBFI-AM, respectively. The expression of ASIC3 was determined by immunocytochemistry and western blot analysis. In addition, the involvement of ASICs in mediating proton stimulation of CGRP was investigated using the potent and selective ASIC3 inhibitor APETx2. Results While KCl caused a significant increase in CGRP secretion that was significantly repressed by treatment with EGTA, onabotulinumtoxinA, and rizatriptan, the stimulatory effect of protons (pH 5.5) was not suppressed by EGTA, onabotulinumtoxinA, or rizatriptan. In addition, while KCl caused a transient increase in intracellular calcium levels that was blocked by EGTA, no appreciable change in calcium levels was observed with proton treatment. However, protons did significantly increase the intracellular level of sodium ions. Under our culture conditions, ASIC3 was shown to be expressed in most trigeminal ganglion neurons. Importantly, proton stimulation of CGRP secretion was repressed by pretreatment with the ASIC3 inhibitor APETx2, but not the TRPV1 antagonist capsazepine. Conclusions Our findings provide evidence that proton regulated release of CGRP from trigeminal neurons utilizes a different mechanism than the calcium and SNAP-25 dependent pathways that are inhibited by the anti-migraine therapies rizatriptan and onabotulinumtoxinA. PMID:23095108
A wideband-PCM recorder for the Space Shuttle orbiter
NASA Technical Reports Server (NTRS)
Petit, R. D.
1976-01-01
The Shuttle wideband-PCM recorder accomplishes recording on up to 14 data tracks with analog or digital data inputs. FM multiplexed analog frequencies of up to 2 MHz and digital rates of 1 Mb/s are accommodated at a tape speed of 120 in/s. Recording time in analog mode varies between 4 min for 2 MHz data to 80 min for 100 kHz data. The total digital data storage is 3.44 x 10 to the 9th bits with recording times from 1 hour for 1 Mb/s to 19 hours for 50 Kb/s data in the serial track switching mode. A versatile command decoder and control interface are used for eight primary modes of operation.
Multi-DSP and FPGA based Multi-channel Direct IF/RF Digital receiver for atmospheric radar
NASA Astrophysics Data System (ADS)
Yasodha, Polisetti; Jayaraman, Achuthan; Kamaraj, Pandian; Durga rao, Meka; Thriveni, A.
2016-07-01
Modern phased array radars depend highly on digital signal processing (DSP) to extract the echo signal information and to accomplish reliability along with programmability and flexibility. The advent of ASIC technology has made various digital signal processing steps to be realized in one DSP chip, which can be programmed as per the application and can handle high data rates, to be used in the radar receiver to process the received signal. Further, recent days field programmable gate array (FPGA) chips, which can be re-programmed, also present an opportunity to utilize them to process the radar signal. A multi-channel direct IF/RF digital receiver (MCDRx) is developed at NARL, taking the advantage of high speed ADCs and high performance DSP chips/FPGAs, to be used for atmospheric radars working in HF/VHF bands. Multiple channels facilitate the radar t be operated in multi-receiver modes and also to obtain the wind vector with improved time resolution, without switching the antenna beam. MCDRx has six channels, implemented on a custom built digital board, which is realized using six numbers of ADCs for simultaneous processing of the six input signals, Xilinx vertex5 FPGA and Spartan6 FPGA, and two ADSPTS201 DSP chips, each of which performs one phase of processing. MCDRx unit interfaces with the data storage/display computer via two gigabit ethernet (GbE) links. One of the six channels is used for Doppler beam swinging (DBS) mode and the other five channels are used for multi-receiver mode operations, dedicatedly. Each channel has (i) ADC block, to digitize RF/IF signal, (ii) DDC block for digital down conversion of the digitized signal, (iii) decoding block to decode the phase coded signal, and (iv) coherent integration block for integrating the data preserving phase intact. ADC block consists of Analog devices make AD9467 16-bit ADCs, to digitize the input signal at 80 MSPS. The output of ADC is centered around (80 MHz - input frequency). The digitized data is fed to DDC block, which down converts the data to base-band. The DDC block has NCO, mixer and two chains of Bessel filters (fifth order cascaded integration comb filter, two FIR filters, two half band filters and programmable FIR filters) for in-phase (I) and Quadrature phase (Q) channels. The NCO has 32 bits and is set to match the output frequency of ADC. Further, DDC down samples (decimation) the data and reduces the data rate to 16 MSPS. This data is further decimated and the data rate is reduced down to 4/2/1/0.5/0.25/0.125/0.0625 MSPS for baud lengths 0.25/0.5/1/2/4/8/16 μs respectively. The down sampled data is then fed to decoding block, which performs cross correlation to achieve pulse compression of the binary-phase coded data to obtain better range resolution with maximum possible height coverage. This step improves the signal power by a factor equal to the length of the code. Coherent integration block integrates the decoded data coherently for successive pulses, which improves the signal to noise ratio and reduces the data volume. DDC, decoding and coherent integration blocks are implemented in Xilinx vertex5 FPGA. Till this point, function of all six channels is same for DBS mode and multi-receiver modes. Data from vertex5 FPGA is transferred to PC via GbE-1 interface for multi-modes or to two Analog devices make ADSP-TS201 DSP chips (A and B), via link port for DBS mode. ADSP-TS201 chips perform the normalization, DC removal, windowing, FFT computation and spectral averaging on the data, which is transferred to storage/display PC via GbE-2 interface for real-time data display and data storing. Physical layer of GbE interface is implemented in an external chip (Marvel 88E1111) and MAC layer is implemented internal to vertex5 FPGA. The MCDRx has total 4 GB of DDR2 memory for data storage. Spartan6 FPGA is used for generating timing signals, required for basic operation of the radar and testing of the MCDRx.
Tests of the MICE Electron Muon Ranger frontend electronics with a small scale prototype
NASA Astrophysics Data System (ADS)
Bolognini, D.; Bene, P.; Blondel, A.; Cadoux, F.; Debieux, S.; Giannini, G.; Graulich, J. S.; Lietti, D.; Masciocchi, F.; Prest, M.; Rothenfusser, K.; Vallazza, E.; Wisting, H.
2011-08-01
The MICE experiment is being commissioned at RAL to demonstrate the feasibility of the muon ionization cooling technique for future applications such as the Neutrino Factory and the Muon Collider. The cooling will be evaluated by measuring the emittance before and after the cooling channel with two 4 T spectrometers; to distinguish muons from the background, a multi-detector particle identification system is foreseen: three Time of Flight stations, two Cherenkov counters and a calorimetric system consisting of a pre-shower layer and a fully active scintillator detector (EMR) are used to discriminate muons from pions and electrons. EMR consists of 48 planes of triangular scintillating bars coupled to WLS fibers readout by single PMTs on one side and MAPMTs on the other; each plane sensible area is 1 m 2. This article deals with a small scale prototype of the EMR detector which has been used to test the MAPMT frontend electronics based on the MAROC ASIC; the tests with cosmic rays using both an analog mode and a digital readout mode are presented. A very preliminary study on the cross talk problem is also shown.
An 8-PSK TDMA uplink modulation and coding system
NASA Technical Reports Server (NTRS)
Ames, S. A.
1992-01-01
The combination of 8-phase shift keying (8PSK) modulation and greater than 2 bits/sec/Hz drove the design of the Nyquist filter to one specified to have a rolloff factor of 0.2. This filter when built and tested was found to produce too much intersymbol interference and was abandoned for a design with a rolloff factor of 0.4. The preamble is limited to 100 bit periods of the uncoded bit period of 5 ns for a maximum preamble length of 500 ns or 40 8PSK symbol times at 12.5 ns per symbol. For 8PSK modulation, the required maximum degradation of 1 dB in -20 dB cochannel interference (CCI) drove the requirement for forward error correction coding. In this contract, the funding was not sufficient to develop the proposed codec so the codec was limited to a paper design during the preliminary design phase. The mechanization of the demodulator is digital, starting from the output of the analog to digital converters which quantize the outputs of the quadrature phase detectors. This approach is amenable to an application specific integrated circuit (ASIC) replacement in the next phase of development.
NECTAr: New electronics for the Cherenkov Telescope Array
NASA Astrophysics Data System (ADS)
Vorobiov, S.; Bolmont, J.; Corona, P.; Delagnes, E.; Feinstein, F.; Gascón, D.; Glicenstein, J.-F.; Naumann, C. L.; Nayman, P.; Sanuy, A.; Toussenel, F.; Vincent, P.
2011-05-01
The European astroparticle physics community aims to design and build the next generation array of Imaging Atmospheric Cherenkov Telescopes (IACTs), that will benefit from the experience of the existing H.E.S.S. and MAGIC detectors, and further expand the very-high energy astronomy domain. In order to gain an order of magnitude in sensitivity in the 10 GeV to >100TeV range, the Cherenkov Telescope Array (CTA) will employ 50-100 mirrors of various sizes equipped with 1000-4000 channels per camera, to be compared with the 6000 channels of the final H.E.S.S. array. A 3-year program, started in 2009, aims to build and test a demonstrator module of a generic CTA camera. We present here the NECTAr design of front-end electronics for the CTA, adapted to the trigger and data acquisition of a large IACTs array, with simple production and maintenance. Cost and camera performances are optimized by maximizing integration of the front-end electronics (amplifiers, fast analog samplers, ADCs) in an ASIC, achieving several GS/s and a few μs readout dead-time. We present preliminary results and extrapolated performances from Monte Carlo simulations.
Micro-miniature radio frequency transmitter for communication and tracking applications
DOE Office of Scientific and Technical Information (OSTI.GOV)
Crutcher, R.I.; Emery, M.S.; Falter, K.G.
1996-12-31
A micro-miniature radio frequency (rf) transmitter has been developed and demonstrated by the Oak Ridge National Laboratory. The objective of the rf transmitter development was to maximize the transmission distance while drastically shrinking the overall transmitter size, including antenna. Based on analysis and testing, an application-specific integrated circuit (ASIC) with a 16-GHz gallium arsenide (GaAs) oscillator and integrated on-chip antenna was designed and fabricated using microwave monolithic integrated circuit (MMIC) technology. Details of the development and the results of various field tests will be discussed. The rf transmitter is applicable to covert surveillance and tracking scenarios due to its smallmore » size of 2.2 x 2.2 mm, including the antenna. Additionally, the 16-GHz frequency is well above the operational range of consumer-grade radio scanners, providing a degree of protection from unauthorized interception. Variations of the transmitter design have been demonstrated for tracking and tagging beacons, transmission of digital data, and transmission of real-time analog video from a surveillance camera. Preliminary laboratory measurements indicate adaptability to direct-sequence spread-spectrum transmission, providing a low probability of intercept and/or detection. Concepts related to law enforcement applications will be presented.« less
Smart image sensors: an emerging key technology for advanced optical measurement and microsystems
NASA Astrophysics Data System (ADS)
Seitz, Peter
1996-08-01
Optical microsystems typically include photosensitive devices, analog preprocessing circuitry and digital signal processing electronics. The advances in semiconductor technology have made it possible today to integrate all photosensitive and electronical devices on one 'smart image sensor' or photo-ASIC (application-specific integrated circuits containing photosensitive elements). It is even possible to provide each 'smart pixel' with additional photoelectronic functionality, without compromising the fill factor substantially. This technological capability is the basis for advanced cameras and optical microsystems showing novel on-chip functionality: Single-chip cameras with on- chip analog-to-digital converters for less than $10 are advertised; image sensors have been developed including novel functionality such as real-time selectable pixel size and shape, the capability of performing arbitrary convolutions simultaneously with the exposure, as well as variable, programmable offset and sensitivity of the pixels leading to image sensors with a dynamic range exceeding 150 dB. Smart image sensors have been demonstrated offering synchronous detection and demodulation capabilities in each pixel (lock-in CCD), and conventional image sensors are combined with an on-chip digital processor for complete, single-chip image acquisition and processing systems. Technological problems of the monolithic integration of smart image sensors include offset non-uniformities, temperature variations of electronic properties, imperfect matching of circuit parameters, etc. These problems can often be overcome either by designing additional compensation circuitry or by providing digital correction routines. Where necessary for technological or economic reasons, smart image sensors can also be combined with or realized as hybrids, making use of commercially available electronic components. It is concluded that the possibilities offered by custom smart image sensors will influence the design and the performance of future electronic imaging systems in many disciplines, reaching from optical metrology to machine vision on the factory floor and in robotics applications.
Contour Detector and Data Acquisition System for the Left Ventricular Outline
NASA Technical Reports Server (NTRS)
Reiber, J. H. C. (Inventor)
1978-01-01
A real-time contour detector and data acquisition system is described for an angiographic apparatus having a video scanner for converting an X-ray image of a structure characterized by a change in brightness level compared with its surrounding into video format and displaying the X-ray image in recurring video fields. The real-time contour detector and data acqusition system includes track and hold circuits; a reference level analog computer circuit; an analog compartor; a digital processor; a field memory; and a computer interface.
Designing artificial enzymes from scratch: Experimental study and mesoscale simulation
NASA Astrophysics Data System (ADS)
Komarov, Pavel V.; Zaborina, Olga E.; Klimova, Tamara P.; Lozinsky, Vladimir I.; Khalatur, Pavel G.; Khokhlov, Alexey R.
2016-09-01
We present a new concept for designing biomimetic analogs of enzymatic proteins; these analogs are based on the synthetic protein-like copolymers. α-Chymotrypsin is used as a prototype of the artificial catalyst. Our experimental study shows that in the course of free radical copolymerization of hydrophobic and hydrophilic monomers the target globular nanostructures of a "core-shell" morphology appear in a selective solvent. Using a mesoscale computer simulation, we show that the protein-like globules can have a large number of catalytic centers located at the hydrophobic core/hydrophilic shell interface.
Graphic Design Is Not a Medium.
ERIC Educational Resources Information Center
Gruber, John Edward, Jr.
2001-01-01
Discusses graphic design and reviews its development from analog processes to a digital tool with the use of computers. Topics include graphical user interfaces; the need for visual communication concepts; transmedia as opposed to repurposing; and graphic design instruction in higher education. (LRW)
Computers in the General Physics Laboratory.
ERIC Educational Resources Information Center
Preston, Daryl W.; Good, R. H.
1996-01-01
Provides ideas and outcomes for nine computer laboratory experiments using a commercial eight-bit analog to digital (ADC) interface. Experiments cover statistics; rotation; harmonic motion; voltage, current, and resistance; ADC conversions; temperature measurement; single slit diffraction; and radioactive decay. Includes necessary schematics. (MVL)
Processing-optimised imaging of analog geological models by electrical capacitance tomography
NASA Astrophysics Data System (ADS)
Ortiz Alemán, C.; Espíndola-Carmona, A.; Hernández-Gómez, J. J.; Orozco Del Castillo, MG
2017-06-01
In this work, the electrical capacitance tomography (ECT) technique is applied in monitoring internal deformation of geological analog models, which are used to study structural deformation mechanisms, in particular for simulating migration and emplacement of allochtonous salt bodies. A rectangular ECT sensor was used for internal visualization of analog geologic deformation. The monitoring of analog models consists in the reconstruction of permittivity images from the capacitance measurements obtained by introducing the model inside the ECT sensor. A simulated annealing (SA) algorithm is used as a reconstruction method, and is optimized by taking full advantage of some special features in a linearized version of this inverse approach. As a second part of this work our SA image reconstruction algorithm is applied to synthetic models, where its performance is evaluated in comparison to other commonly used algorithms such as linear back-projection and iterative Landweber methods. Finally, the SA method is applied to visualise two simple geological analog models. Encouraging results were obtained in terms of the quality of the reconstructed images, as interfaces corresponding to main geological units in the analog model were clearly distinguishable in them. We found reliable results quite useful for real time non-invasive monitoring of internal deformation of analog geological models.
SURFACE INACTIVATION OF BACTERIAL VIRUSES AND OF PROTEINS
Adams, Mark H.
1948-01-01
1. The seven bacterial viruses of the T group active against E. coli, are rapidly inactivated at gas-liquid interfaces. 2. The kinetics of this inactivation whether brought about by shaking or by bubbling with nitrogen are those of a first order reaction. 3. This inactivation may be prevented by the addition of enough protein to maintain the gas-liquid interface in a saturated condition. 4. The analogy between this phenomenon and the surface denaturation of proteins is pointed out and discussed. PMID:18917025
High-performance dual-speed CCD camera system for scientific imaging
NASA Astrophysics Data System (ADS)
Simpson, Raymond W.
1996-03-01
Traditionally, scientific camera systems were partitioned with a `camera head' containing the CCD and its support circuitry and a camera controller, which provided analog to digital conversion, timing, control, computer interfacing, and power. A new, unitized high performance scientific CCD camera with dual speed readout at 1 X 106 or 5 X 106 pixels per second, 12 bit digital gray scale, high performance thermoelectric cooling, and built in composite video output is described. This camera provides all digital, analog, and cooling functions in a single compact unit. The new system incorporates the A/C converter, timing, control and computer interfacing in the camera, with the power supply remaining a separate remote unit. A 100 Mbyte/second serial link transfers data over copper or fiber media to a variety of host computers, including Sun, SGI, SCSI, PCI, EISA, and Apple Macintosh. Having all the digital and analog functions in the camera made it possible to modify this system for the Woods Hole Oceanographic Institution for use on a remote controlled submersible vehicle. The oceanographic version achieves 16 bit dynamic range at 1.5 X 105 pixels/second, can be operated at depths of 3 kilometers, and transfers data to the surface via a real time fiber optic link.
Transitioning from analog to digital communications: An information security perspective
NASA Technical Reports Server (NTRS)
Dean, Richard A.
1990-01-01
A summary is given of the government's perspective on evolving digital communications as they affect secure voice users and approaches for operating during a transition period to an all digital world. An integrated architecture and a mobile satellite interface are discussed.
Programmable Remapper with Single Flow Architecture
NASA Technical Reports Server (NTRS)
Fisher, Timothy E. (Inventor)
1993-01-01
An apparatus for image processing comprising a camera for receiving an original visual image and transforming the original visual image into an analog image, a first converter for transforming the analog image of the camera to a digital image, a processor having a single flow architecture for receiving the digital image and producing, with a single algorithm, an output image, a second converter for transforming the digital image of the processor to an analog image, and a viewer for receiving the analog image, transforming the analog image into a transformed visual image for observing the transformations applied to the original visual image. The processor comprises one or more subprocessors for the parallel reception of a digital image for producing an output matrix of the transformed visual image. More particularly, the processor comprises a plurality of subprocessors for receiving in parallel and transforming the digital image for producing a matrix of the transformed visual image, and an output interface means for receiving the respective portions of the transformed visual image from the respective subprocessor for producing an output matrix of the transformed visual image.
Andreev reflections and the quantum physics of black holes
NASA Astrophysics Data System (ADS)
Manikandan, Sreenath K.; Jordan, Andrew N.
2017-12-01
We establish an analogy between superconductor-metal interfaces and the quantum physics of a black hole, using the proximity effect. We show that the metal-superconductor interface can be thought of as an event horizon and Andreev reflection from the interface is analogous to the Hawking radiation in black holes. We describe quantum information transfer in Andreev reflection with a final state projection model similar to the Horowitz-Maldacena model for black hole evaporation. We also propose the Andreev reflection analogue of Hayden and Preskill's description of a black hole final state, where the black hole is described as an information mirror. The analogy between crossed Andreev reflections and Einstein-Rosen bridges is discussed: our proposal gives a precise mechanism for the apparent loss of quantum information in a black hole by the process of nonlocal Andreev reflection, transferring the quantum information through a wormhole and into another universe. Given these established connections, we conjecture that the final quantum state of a black hole is exactly the same as the ground state wave function of the superconductor/superfluid in the Bardeen-Cooper-Schrieffer (BCS) theory of superconductivity; in particular, the infalling matter and the infalling Hawking quanta, described in the Horowitz-Maldacena model, forms a Cooper pairlike singlet state inside the black hole. A black hole evaporating and shrinking in size can be thought of as the analogue of Andreev reflection by a hole where the superconductor loses a Cooper pair. Our model does not suffer from the black hole information problem since Andreev reflection is unitary. We also relate the thermodynamic properties of a black hole to that of a superconductor, and propose an experiment which can demonstrate the negative specific heat feature of black holes in a growing/evaporating condensate.
NASA Astrophysics Data System (ADS)
Mazza, G.; Aglieri Rinella, G.; Benotto, F.; Corrales Morales, Y.; Kugathasan, T.; Lattuca, A.; Lupi, M.; Ravasenga, I.
2017-02-01
The upgrade of the ALICE Inner Tracking System is based on a Monolithic Active Pixel Sensor and ASIC designed in a CMOS 0.18 μ m process. In order to provide the required output bandwidth (1.2 Gb/s for the inner layers and 400 Mb/s for the outer ones) on a single high speed serial link, a custom Data Transmission Unit (DTU) has been developed in the same process. The DTU includes a clock multiplier PLL, a double data rate serializer and a pseudo-LVDS driver with pre-emphasis and is designed to be SEU tolerant.
Multi-petascale highly efficient parallel supercomputer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Asaad, Sameh; Bellofatto, Ralph E.; Blocksome, Michael A.
A Multi-Petascale Highly Efficient Parallel Supercomputer of 100 petaflop-scale includes node architectures based upon System-On-a-Chip technology, where each processing node comprises a single Application Specific Integrated Circuit (ASIC). The ASIC nodes are interconnected by a five dimensional torus network that optimally maximize the throughput of packet communications between nodes and minimize latency. The network implements collective network and a global asynchronous network that provides global barrier and notification functions. Integrated in the node design include a list-based prefetcher. The memory system implements transaction memory, thread level speculation, and multiversioning cache that improves soft error rate at the same time andmore » supports DMA functionality allowing for parallel processing message-passing.« less
ENaC/DEG in Tumor Development and Progression
Liu, Cui; Zhu, Li-Li; Xu, Si-Guang; Ji, Hong-Long; Li, Xiu-Min
2016-01-01
The epithelial Na+ channel/degenerin (ENaC/DEG) superfamily, including the acid-sensing ion channels (ASICs), is characterized by a high degree of similarity in structure but highly diverse in physiological functions. These ion channels have been shown to be important in several physiological functions of normal epithelial cells, including salt homeostasis, fluid transportation and cell mobility. There is increasing evidence suggesting that ENaC/DEG channels are critically engaged in cancer cell biology, such as proliferation, migration, invasion and apoptosis, playing a role in tumor development and progression. In this review, we will discuss recent studies showing the role of ENaC and ASIC channels in epithelial cells and its relationship to the oncogenesis. PMID:27698929
The 40 Gbps cascaded bit-interleaving PON
NASA Astrophysics Data System (ADS)
Vyncke, A.; Torfs, G.; Van Praet, C.; Verbeke, M.; Duque, A.; Suvakovic, D.; Chow, H. K.; Yin, X.
2015-12-01
In this paper, a 40 Gbps cascaded bit-interleaving passive optical network (CBI-PON) is proposed to achieve power reduction in the network. The massive number of devices in the access network makes that power consumption reduction in this part of the network has a major impact on the total network power consumption. Starting from the proven BiPON technology, an extension to this concept is proposed to introduce multiple levels of bit-interleaving. The paper discusses the CBI protocol in detail, as well as an ASIC implementation of the required custom CBI Repeater and End-ONT. From the measurements of this first 40 Gbps ASIC prototype, power consumption reduction estimates are presented.
Lunar Reconnaissance Orbiter (LRO) Command and Data Handling Flight Electronics Subsystem
NASA Technical Reports Server (NTRS)
Nguyen, Quang; Yuknis, William; Haghani, Noosha; Pursley, Scott; Haddad, Omar
2012-01-01
A document describes a high-performance, modular, and state-of-the-art Command and Data Handling (C&DH) system developed for use on the Lunar Reconnaissance Orbiter (LRO) mission. This system implements a complete hardware C&DH subsystem in a single chassis enclosure that includes a processor card, 48 Gbytes of solid-state recorder memory, data buses including MIL-STD-1553B, custom RS-422, SpaceWire, analog collection, switched power services, and interfaces to the Ka-Band and S-Band RF communications systems. The C&DH team capitalized on extensive experience with hardware and software with PCI bus design, SpaceWire networking, Actel FPGA design, digital flight design techniques, and the use of VxWorks for the real-time operating system. The resulting hardware architecture was implemented to meet the LRO mission requirements. The C&DH comprises an enclosure, a backplane, a low-voltage power converter, a single-board computer, a communications interface board, four data storage boards, a housekeeping and digital input/output board, and an analog data acquisition board. The interfaces between the C&DH and the instruments and avionics are connected through a SpaceWire network, a MIL-STD-1553 bus, and a combination of synchronous and asynchronous serial data transfers over RS-422 and LVDS (low-voltage differential-signaling) electrical interfaces. The C&DH acts as the spacecraft data system with an instrument data manager providing all software and internal bus scheduling, ingestion of science data, distribution of commands, and performing science operations in real time.
Minimally-Invasive Neural Interface for Distributed Wireless Electrocorticogram Recording Systems
Chang, Sun-Il
2018-01-01
This paper presents a minimally-invasive neural interface for distributed wireless electrocorticogram (ECoG) recording systems. The proposed interface equips all necessary components for ECoG recording, such as the high performance front-end integrated circuits, a fabricated flexible microelectrode array, and wireless communication inside a miniaturized custom-made platform. The multiple units of the interface systems can be deployed to cover a broad range of the target brain region and transmit signals via a built-in intra-skin communication (ISCOM) module. The core integrated circuit (IC) consists of 16-channel, low-power push-pull double-gated preamplifiers, in-channel successive approximation register analog-to-digital converters (SAR ADC) with a single-clocked bootstrapping switch and a time-delayed control unit, an ISCOM module for wireless data transfer through the skin instead of a power-hungry RF wireless transmitter, and a monolithic voltage/current reference generator to support the aforementioned analog and mixed-signal circuit blocks. The IC was fabricated using 250 nm CMOS processes in an area of 3.2 × 0.9 mm2 and achieved the low-power operation of 2.5 µW per channel. Input-referred noise was measured as 5.62 µVrms for 10 Hz to 10 kHz and ENOB of 7.21 at 31.25 kS/s. The implemented system successfully recorded multi-channel neural activities in vivo from a primate and demonstrated modular expandability using the ISCOM with power consumption of 160 µW. PMID:29342103
Minimally-Invasive Neural Interface for Distributed Wireless Electrocorticogram Recording Systems.
Chang, Sun-Il; Park, Sung-Yun; Yoon, Euisik
2018-01-17
This paper presents a minimally-invasive neural interface for distributed wireless electrocorticogram (ECoG) recording systems. The proposed interface equips all necessary components for ECoG recording, such as the high performance front-end integrated circuits, a fabricated flexible microelectrode array, and wireless communication inside a miniaturized custom-made platform. The multiple units of the interface systems can be deployed to cover a broad range of the target brain region and transmit signals via a built-in intra-skin communication (ISCOM) module. The core integrated circuit (IC) consists of 16-channel, low-power push-pull double-gated preamplifiers, in-channel successive approximation register analog-to-digital converters (SAR ADC) with a single-clocked bootstrapping switch and a time-delayed control unit, an ISCOM module for wireless data transfer through the skin instead of a power-hungry RF wireless transmitter, and a monolithic voltage/current reference generator to support the aforementioned analog and mixed-signal circuit blocks. The IC was fabricated using 250 nm CMOS processes in an area of 3.2 × 0.9 mm² and achieved the low-power operation of 2.5 µW per channel. Input-referred noise was measured as 5.62 µV rms for 10 Hz to 10 kHz and ENOB of 7.21 at 31.25 kS/s. The implemented system successfully recorded multi-channel neural activities in vivo from a primate and demonstrated modular expandability using the ISCOM with power consumption of 160 µW.
ERIC Educational Resources Information Center
Schuyler, Michael
1994-01-01
Compares Frame Relay with digital and analog alternatives for connecting sites on a Wide Area Network. Cost considerations, the concepts on which the technology is based, its carrying capacity, the use of CD-ROM and Graphical User Interface (GUI) on Frame Relay, and engineering bandwidth limitations are covered. (KRN)
Low cost open data acquisition system for biomedical applications
NASA Astrophysics Data System (ADS)
Zabolotny, Wojciech M.; Laniewski-Wollk, Przemyslaw; Zaworski, Wojciech
2005-09-01
In the biomedical applications it is often necessary to collect measurement data from different devices. It is relatively easy, if the devices are equipped with a MIB or Ethernet interface, however often they feature only the asynchronous serial link, and sometimes the measured values are available only as the analog signals. The system presented in the paper is a low cost alternative to commercially available data acquisition systems. The hardware and software architecture of the system is fully open, so it is possible to customize it for particular needs. The presented system offers various possibilities to connect it to the computer based data processing unit - e.g. using the USB or Ethernet ports. Both interfaces allow also to use many such systems in parallel to increase amount of serial and analog inputs. The open source software used in the system makes possible to process the acquired data with standard tools like MATLAB, Scilab or Octave, or with a dedicated, user supplied application.
S-Band POSIX Device Drivers for RTEMS
NASA Technical Reports Server (NTRS)
Lux, James P.; Lang, Minh; Peters, Kenneth J.; Taylor, Gregory H.
2011-01-01
This is a set of POSIX device driver level abstractions in the RTEMS RTOS (Real-Time Executive for Multiprocessor Systems real-time operating system) to SBand radio hardware devices that have been instantiated in an FPGA (field-programmable gate array). These include A/D (analog-to-digital) sample capture, D/A (digital-to-analog) sample playback, PLL (phase-locked-loop) tuning, and PWM (pulse-width-modulation)-controlled gain. This software interfaces to Sband radio hardware in an attached Xilinx Virtex-2 FPGA. It uses plug-and-play device discovery to map memory to device IDs. Instead of interacting with hardware devices directly, using direct-memory mapped access at the application level, this driver provides an application programming interface (API) offering that easily uses standard POSIX function calls. This simplifies application programming, enables portability, and offers an additional level of protection to the hardware. There are three separate device drivers included in this package: sband_device (ADC capture and DAC playback), pll_device (RF front end PLL tuning), and pwm_device (RF front end AGC control).
Pagkalos, Ilias; Rogers, Michelle L; Boutelle, Martyn G; Drakakis, Emmanuel M
2018-05-22
This paper presents the first application specific integrated chip (ASIC) for the monitoring of patients who have suffered a Traumatic Brain Injury (TBI). By monitoring the neurophysiological (ECoG) and neurochemical (glucose, lactate and potassium) signals of the injured human brain tissue, it is possible to detect spreading depolarisations, which have been shown to be associated with poor TBI patient outcome. This paper describes the testing of a new 7.5 mm 2 ASIC fabricated in the commercially available AMS 0.35 μm CMOS technology. The ASIC has been designed to meet the demands of processing the injured brain tissue's ECoG signals, recorded by means of depth or brain surface electrodes, and neurochemical signals, recorded using microdialysis coupled to microfluidics-based electrochemical biosensors. The potentiostats use switchedcapacitor charge integration to record currents with 100 fA resolution, and allow automatic gain changing to track the falling sensitivity of a biosensor. This work supports the idea of a "behind the ear" wireless microplatform modality, which could enable the monitoring of currently non-monitored mobile TBI patients for the onset of secondary brain injury. ©2018 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
Geysermans, P; Elyeznasni, N; Russier, V
2005-11-22
We present a study of the structure in the interface between two immiscible liquids by density-functional theory and molecular-dynamics calculations. The liquids are modeled by Lennard-Jones potentials, which achieve immiscibility by suppressing the attractive interaction between unlike particles. The density profiles of the liquids display oscillations only in a limited part of the simple liquid-phase diagram (rho,T). When approaching the liquid-vapor coexistence, a significant depletion appears while the layering behavior of the density profile vanishes. By analogy with the liquid-vapor interface and the analysis of the adsorption this behavior is suggested to be strongly related to the drying transition.
TUKAN—An 8K Pulse Height Analyzer and Multi-Channel Scaler With a PCI or a USB Interface
NASA Astrophysics Data System (ADS)
Guzik, Z.; Borsuk, S.; Traczyk, K.; Plominski, M.
2006-02-01
In this paper we present two types of 8K-channel analyzers designed for spectroscopy and intensity versus time measurements. The first type (Tukan-8K-PCI) incorporates a PCI interface and is designed to be plugged into a PCI slot of a normal PC. The second type (Tukan-8K-USB) incorporates a USB interface. It is mounted in a separate screened box and can be powered either directly from the USB port or from an external dc source (wall adapter or battery). Each type of device may operate in either of two independent operational modes: Multi Channel Analysis (MCA) and Multi-Channel Scaling (MCS). The most crucial component for the MCA mode-the Peak Detect and Hold circuit-is featuring a novel architecture based on a diamond transistor. Its analog stage can accept analog pulses with rise times as short as 100 ns and has a differential linearity below 1% with sliding scale averaging over the full scale. The functionality includes automatic stop on a programmable count in the Region-Of-Interest (ROI) and on preset live- or real time. The MCS mode works at medium counting rates of up to 8 MHz. The dwell time, the number of channels and single or multi-sweep mode may be preset. Each of these parameters can also be controlled externally via four user configurable logical I/O lines. A single Altera FLEX 10KE30 FPGA provides all control functions and incorporates PCI interface. The USB interface is based on FTDI FIFO controller. Advanced and user-friendly software has been developed for the analyzer
Xiong, Wei; Laaser, Jennifer E.; Mehlenbacher, Randy D.; Zanni, Martin T.
2011-01-01
In the last ten years, two-dimensional infrared spectroscopy has become an important technique for studying molecular structures and dynamics. We report the implementation of heterodyne detected two-dimensional sum-frequency generation (HD 2D SFG) spectroscopy, which is the analog of 2D infrared (2D IR) spectroscopy, but is selective to noncentrosymmetric systems such as interfaces. We implement the technique using mid-IR pulse shaping, which enables rapid scanning, phase cycling, and automatic phasing. Absorptive spectra are obtained, that have the highest frequency resolution possible, from which we extract the rephasing and nonrephasing signals that are sometimes preferred. Using this technique, we measure the vibrational mode of CO adsorbed on a polycrystalline Pt surface. The 2D spectrum reveals a significant inhomogenous contribution to the spectral line shape, which is quantified by simulations. This observation indicates that the surface conformation and environment of CO molecules is more complicated than the simple “atop” configuration assumed in previous work. Our method can be straightforwardly incorporated into many existing SFG spectrometers. The technique enables one to quantify inhomogeneity, vibrational couplings, spectral diffusion, chemical exchange, and many other properties analogous to 2D IR spectroscopy, but specifically for interfaces. PMID:22143772
Xiong, Wei; Laaser, Jennifer E; Mehlenbacher, Randy D; Zanni, Martin T
2011-12-27
In the last ten years, two-dimensional infrared spectroscopy has become an important technique for studying molecular structures and dynamics. We report the implementation of heterodyne detected two-dimensional sum-frequency generation (HD 2D SFG) spectroscopy, which is the analog of 2D infrared (2D IR) spectroscopy, but is selective to noncentrosymmetric systems such as interfaces. We implement the technique using mid-IR pulse shaping, which enables rapid scanning, phase cycling, and automatic phasing. Absorptive spectra are obtained, that have the highest frequency resolution possible, from which we extract the rephasing and nonrephasing signals that are sometimes preferred. Using this technique, we measure the vibrational mode of CO adsorbed on a polycrystalline Pt surface. The 2D spectrum reveals a significant inhomogenous contribution to the spectral line shape, which is quantified by simulations. This observation indicates that the surface conformation and environment of CO molecules is more complicated than the simple "atop" configuration assumed in previous work. Our method can be straightforwardly incorporated into many existing SFG spectrometers. The technique enables one to quantify inhomogeneity, vibrational couplings, spectral diffusion, chemical exchange, and many other properties analogous to 2D IR spectroscopy, but specifically for interfaces.
Boukabache, Hamza; Escriba, Christophe; Fourniols, Jean-Yves
2014-10-31
Structural health monitoring using noninvasive methods is one of the major challenges that aerospace manufacturers face in this decade. Our work in this field focuses on the development and the system integration of millimetric piezoelectric sensors/ actuators to generate and measure specific guided waves. The aim of the application is to detect mechanical flaws on complex composite and alloy structures to quantify efficiently the global structures' reliability. The study begins by a physical and analytical analysis of a piezoelectric patch. To preserve the structure's integrity, the transducers are directly pasted onto the surface which leads to a critical issue concerning the interfacing layer. In order to improve the reliability and mitigate the influence of the interfacing layer, the global equations of piezoelectricity are coupled with a load transfer model. Thus we can determine precisely the shear strain developed on the surface of the structure. To exploit the generated signal, a high precision analog charge amplifier coupled to a double T notch filter were designed and scaled. Finally, a novel joined time-frequency analysis based on a wavelet decomposition algorithm is used to extract relevant structures signatures. Finally, this paper provides examples of application on aircraft structure specimens and the feasibility of the system is thus demonstrated.
Boukabache, Hamza; Escriba, Christophe; Fourniols, Jean-Yves
2014-01-01
Structural health monitoring using noninvasive methods is one of the major challenges that aerospace manufacturers face in this decade. Our work in this field focuses on the development and the system integration of millimetric piezoelectric sensors/ actuators to generate and measure specific guided waves. The aim of the application is to detect mechanical flaws on complex composite and alloy structures to quantify efficiently the global structures' reliability. The study begins by a physical and analytical analysis of a piezoelectric patch. To preserve the structure's integrity, the transducers are directly pasted onto the surface which leads to a critical issue concerning the interfacing layer. In order to improve the reliability and mitigate the influence of the interfacing layer, the global equations of piezoelectricity are coupled with a load transfer model. Thus we can determine precisely the shear strain developed on the surface of the structure. To exploit the generated signal, a high precision analog charge amplifier coupled to a double T notch filter were designed and scaled. Finally, a novel joined time-frequency analysis based on a wavelet decomposition algorithm is used to extract relevant structures signatures. Finally, this paper provides examples of application on aircraft structure specimens and the feasibility of the system is thus demonstrated. PMID:25365457
Yan, Jin; Edelmayer, Rebecca M; Wei, Xiaomei; De Felice, Milena; Porreca, Frank; Dussor, Gregory
2011-01-01
Migraine headache is one of the most common neurological disorders. The pathological conditions that directly initiate afferent pain signaling are poorly understood. In trigeminal neurons retrogradely labeled from the cranial meninges, we have recorded pH-evoked currents using whole-cell patch-clamp electrophysiology. Approximately 80% of dural-afferent neurons responded to a pH 6.0 application with a rapidly activating and rapidly desensitizing ASIC-like current that often exceeded 20nA in amplitude. Inward currents were observed in response to a wide range of pH values and 30% of the neurons exhibited inward currents at pH 7.1. These currents led to action potentials in 53%, 30% and 7% of the dural afferents at pH 6.8, 6.9 and 7.0, respectively. Small decreases in extracellular pH were also able to generate sustained window currents and sustained membrane depolarizations. Amiloride, a non-specific blocker of ASIC channels, inhibited the peak currents evoked upon application of decreased pH while no inhibition was observed upon application of TRPV1 antagonists. The desensitization time constant of pH 6.0-evoked currents in the majority of dural afferents was less than 500ms which is consistent with that reported for ASIC3 homomeric or heteromeric channels. Finally, application of pH 5.0 synthetic-interstitial fluid to the dura produced significant decreases in facial and hind-paw withdrawal threshold, an effect blocked by amiloride but not TRPV1 antagonists, suggesting that ASIC activation produces migraine-related behavior in vivo. These data provide a cellular mechanism by which decreased pH in the meninges following ischemic or inflammatory events directly excites afferent pain-sensing neurons potentially contributing to migraine headache. Copyright © 2010 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.