Wangsa-Wirawan, N D; O'Neill, B K; Middelberg, A P
2001-01-01
A knowledge of the physicochemical properties of inclusion bodies is important for the rational design of potential recovery processes such as flotation and precipitation. In this study, measurement of the size and electrophoretic mobility of protein inclusion bodies and cell debris was undertaken. SDS-PAGE analysis of protein inclusion bodies subjected to different cleaning regimes suggested that electrophoretic mobility provides a qualitative measure of protein inclusion body purity. Electrophoretic mobility as a function of electrolyte type and ionic strength was investigated. The presence of divalent ions produced a stronger effect on electrophoretic mobility compared with monovalent ions. The isoelectric point of cell debris was significantly lower than that for the inclusion bodies. Hence, the contaminating cell debris may be separated from inclusion bodies using flotation by exploiting this difference in isoelectric points. Separation by this method is simple, convenient, and a possible alternative to the conventional route of centrifugation.
NASA Technical Reports Server (NTRS)
Kunze, M. E.
1985-01-01
A systematic investigation was undertaken to characterize population shifts that occur in cultured human embryonic kidney cells as a function of passage number in vitro after original explantation. This approach to cell population shift analysis follows the suggestion of Mehreshi, Klein and Revesz that perturbed cell populations can be characterized by electrophoretic mobility distributions if they contain subpopulations with different electrophoretic mobilities. It was shown that this is the case with early passage cultured human embryo cells.
Oddy, M H; Santiago, J G
2004-01-01
We have developed a method for measuring the electrophoretic mobility of submicrometer, fluorescently labeled particles and the electroosmotic mobility of a microchannel. We derive explicit expressions for the unknown electrophoretic and the electroosmotic mobilities as a function of particle displacements resulting from alternating current (AC) and direct current (DC) applied electric fields. Images of particle displacements are captured using an epifluorescent microscope and a CCD camera. A custom image-processing code was developed to determine image streak lengths associated with AC measurements, and a custom particle tracking velocimetry (PTV) code was devised to determine DC particle displacements. Statistical analysis was applied to relate mobility estimates to measured particle displacement distributions.
Application of partition technology to particle electrophoresis
NASA Technical Reports Server (NTRS)
Van Alstine, James M.; Harris, J. Milton; Karr, Laurel J.; Bamberger, Stephan; Matsos, Helen C.; Snyder, Robert S.
1989-01-01
The effects of polymer-ligand concentration on particle electrophoretic mobility and partition in aqueous polymer two-phase systems are investigated. Polymer coating chemistry and affinity ligand synthesis, purification, and analysis are conducted. It is observed that poly (ethylene glycol)-ligands are effective for controlling particle electrophoretic mobility.
Solvent-mediated nonelectrostatic ion-ion interactions predicting anomalies in electrophoresis.
Goswami, Prakash; Dhar, Jayabrata; Ghosh, Uddipta; Chakraborty, Suman
2017-03-01
We study the effects of solvent-mediated nonelectrostatic ion-ion interactions on electrophoretic mobility of a charged spherical particle. To this end, we consider the case of low surface electrostatic potential resulting in the linearization of the governing equations, which enables us to deduce a closed-form analytical solution to the electrophoretic mobility. We subsequently compare our results to the standard model using Henry's approach and report the changes brought about by the nonelectrostatic potential. The classical approach to determine the electrophoretic mobility underpredicts the particle velocity when compared with experiments. We show that this issue can be resolved by taking into account nonelectrostatic interactions. Our analysis further reveals the phenomenon of electrophoretic mobility reversal that has been experimentally observed in numerous previous studies. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Principles of Micellar Electrokinetic Capillary Chromatography Applied in Pharmaceutical Analysis
Hancu, Gabriel; Simon, Brigitta; Rusu, Aura; Mircia, Eleonora; Gyéresi, Árpád
2013-01-01
Since its introduction capillary electrophoresis has shown great potential in areas where electrophoretic techniques have rarely been used before, including here the analysis of pharmaceutical substances. The large majority of pharmaceutical substances are neutral from electrophoretic point of view, consequently separations by the classic capillary zone electrophoresis; where separation is based on the differences between the own electrophoretic mobilities of the analytes; are hard to achieve. Micellar electrokinetic capillary chromatography, a hybrid method that combines chromatographic and electrophoretic separation principles, extends the applicability of capillary electrophoretic methods to neutral analytes. In micellar electrokinetic capillary chromatography, surfactants are added to the buffer solution in concentration above their critical micellar concentrations, consequently micelles are formed; micelles that undergo electrophoretic migration like any other charged particle. The separation is based on the differential partitioning of an analyte between the two-phase system: the mobile aqueous phase and micellar pseudostationary phase. The present paper aims to summarize the basic aspects regarding separation principles and practical applications of micellar electrokinetic capillary chromatography, with particular attention to those relevant in pharmaceutical analysis. PMID:24312804
Electrophoretic mobilities of erythrocytes in various buffers
NASA Technical Reports Server (NTRS)
Plank, L. D.; Kunze, M. E.; Todd, P. W.
1985-01-01
The calibration of space flight equipment depends on a source of standard test particles, this test particle of choice is the fixed erythrocyte. Erythrocytes from different species have different electrophoretic mobilities. Electrophoretic mobility depends upon zeta potential, which, in turn depends upon ionic strength. Zeta potential decreases with increasing ionic strength, so cells have high electrophoretic mobility in space electrophoresis buffers than in typical physiological buffers. The electrophoretic mobilities of fixed human, rat, and rabbit erythrocytes in 0.145 M salt and buffers of varying ionic strength, temperature, and composition, to assess the effects of some of the unique combinations used in space buffers were characterized. Several effects were assessed: glycerol or DMSO (dimethylsulfoxide) were considered for use as cryoprotectants. The effect of these substances on erythrocyte electrophoretic mobility was examined. The choice of buffer depended upon cell mobility. Primary experiments with kidney cells established the choice of buffer and cryoprotectant. A nonstandard temperature of EPM in the suitable buffer was determined. A loss of ionic strength control occurs in the course of preparing columns for flight, the effects of small increases in ionic strength over the expected low values need to be evaluated.
NASA Astrophysics Data System (ADS)
Shaparenko, N. O.; Beketova, D. I.; Demidova, M. G.; Bulavchenko, A. I.
2018-05-01
The hydrodynamic diameter and electrophoretic mobility of titania nanoparticles in AOT microemulsions are studied depending on their water content (from 0 to 1.5 vol %), chloroform content in n-decane-chloroform mixture (from 0 to 30 vol %) and temperature (from 0 to 60°C). Considerable changes in diameter (from 20 to 400 nm) are detected upon adding water to the microemulsion. The electrophoretic mobility grows by 2-3 times upon adding chloroform, or as the temperature falls. The observed features allow us to halve the time of electrophoretic concentration for 140 nm TiO2 nanoparticles, and to concentrate 14 nm nanoparticles that do not exhibit electrophoretic mobility in the absence of chloroform.
Electrophoretic cell separation by means of microspheres
NASA Technical Reports Server (NTRS)
Smolka, A. J. K.; Nerren, B. H.; Margel, S.; Rembaum, A.
1979-01-01
The electrophoretic mobility of fixed human erythrocytes immunologically labeled with poly(vinylpyridine) or poly(glutaraldehyde) microspheres was reduced by approximately 40%. This observation was utilized in preparative scale electrophoretic separations of fixed human and turkey erythrocytes, the mobilities of which under normal physiological conditions do not differ sufficiently to allow their separation by continuous flow electrophoresis. We suggest that resolution in the electrophoretic separation of cell subpopulations, currently limited by finite and often overlapping mobility distributions, may be significantly enhanced by immunospecific labeling of target populations using microspheres.
Affinity Electrophoresis Using Ligands Attached To Polymers
NASA Technical Reports Server (NTRS)
Van Alstine, James M.; Snyder, Robert S.; Harris, J. M.; Brooks, D. E.
1990-01-01
In new technique, reduction of electrophoretic mobilities by addition of polyethylene glycol to ligands increases electrophoretic separabilities. In immuno-affinity electrophoresis, modification of ligands extends specificity of electrophoretic separation to particles having surface electric-charge structures otherwise making them electrophoretically inseparable. Modification of antibodies by polyethylene glycol greatly reduces ability to aggregate while enhancing ability to affect electrophoretic mobilities of cells. In hydrophobic-affinity electrophoresis, addition of polyethylene glycol reduces tendency toward aggregation of cells or macromolecules.
Electrophoretic cell separation by means of immunomicrospheres
NASA Technical Reports Server (NTRS)
Rembaum, A.; Smolka, A. J. K.
1980-01-01
The electrophoretic mobility of fixed human red blood cells immunologically labeled with polymeric (4-vinyl)pyridine or polyglutaraldehyde microspheres was altered to a considerable extent. This observation was utilized in the preparative scale electrophoretic separation of human and turkey fixed red blood cells, whose mobilities under normal physiological conditions do not differ sufficiently to allow their separation by continuous flow electrophoresis. It is suggested that resolution in the electrophoretic separation of cell subpopulations, currently limited by finite and often overlapping mobility distributions, may be significantly enhanced by immuno-specific labeling of target populations using microspheres.
Density gradient electrophoresis of cultured human embryonic kidney cells
NASA Technical Reports Server (NTRS)
Plank, L. D.; Kunze, M. E.; Giranda, V.; Todd, P. W.
1985-01-01
Ground based confirmation of the electrophoretic heterogeneity of human embryonic kidney cell cultures, the general characterization of their electrophoretic migration, and observations on the general properties of cultures derived from electrophoretic subpopulations were studied. Cell migration in a density gradient electrophoresis column and cell electrophoretic mobility was determined. The mobility and heterogeneity of cultured human embryonic kidney cells with those of fixed rat erythrocytes as model test particle was compared. Electrophoretically separated cell subpopulations with respect to size, viability, and culture characteristics were examined.
Electrophoretic mobilities of cultured human embryonic kidney cells in various buffers
NASA Technical Reports Server (NTRS)
1985-01-01
Data on the electrophoretic mobility distributions of cells in the new D-1 buffer and the interlaboratory standardization of urokinase assay methods are presented. A table of cell strains and recent data on cell dispersal methods are also included. It was decided that glycerol in A-1 electrophoretic mobility data on cultured human embryonic kidney cells subjected to electrophoresis in this buffer. The buffer composition is presented.
NASA Astrophysics Data System (ADS)
Karam, Pascal; Pennathur, Sumita
2016-11-01
Characterization of the electrophoretic mobility and zeta potential of micro and nanoparticles is important for assessing properties such as stability, charge and size. In electrophoretic techniques for such characterization, the bulk fluid motion due to the interaction between the fluid and the charged surface must be accounted for. Unlike current industrial systems which rely on DLS and oscillating potentials to mitigate electroosmotic flow (EOF), we propose a simple alternative electrophoretic method for optically determining electrophoretic mobility using a DC electric fields. Specifically, we create a system where an adverse pressure gradient counters EOF, and design the geometry of the channel so that the flow profile of the pressure driven flow matches that of the EOF in large regions of the channel (ie. where we observe particle flow). Our specific COMSOL-optimized geometry is two large cross sectional areas adjacent to a central, high aspect ratio channel. We show that this effectively removes EOF from a large region of the channel and allows for the accurate optical characterization of electrophoretic particle mobility, no matter the wall charge or particle size.
Electrophoretic kinetics of concentrated TiO2 nanoparticle suspensions in aprotic solvent
NASA Astrophysics Data System (ADS)
Lee, So-Yeon; Yim, Jung-Ryoul; Lee, Se-Hee; Choi, In-Suk; Nam, Ki Tae; Joo, Young-Chang
2018-01-01
We studied the dependences of the concentration of additive and particle size on the electrophoretic mobility of TiO2 nanoparticles. A high concentration of TiO2 nanoparticles was dispersed in aprotic solvent, which is similar to the operating conditions of electrophoretic applications. Because spectroscopy has limits to measuring the electrophoretic mobility of concentrated suspensions in aprotic solvents, we developed a new measurement to determine the electrophoretic mobility of particles using the reflectance change according to the motion of the particles. TiO2 nanoparticles with sizes of 31 nm to 164 nm were synthesized by hydrolysis and were dispersed in cyclohexanone with a dye (Sudan Black B) for use in the new measurement method. In a concentrated suspension in aprotic solvent, the mobility of the particles was proportional to the dye concentration and was inversely proportional to the size of the particles. This infers that the particle size influences the drag force rather than the surface charge, and therefore, to increase the mobility by changing the surface charge, an additive is effective. [Figure not available: see fulltext.
Kidney cell electrophoresis, continuing task
NASA Technical Reports Server (NTRS)
Todd, P. W.
1985-01-01
Materials and procedures for microgravity electrophoresis of living human embryonic kidney cells were evaluated to provide ground support in the form of analytical cell electrophoresis and flow cytometry. Preflight culture media, electrophoresis buffer, fraction collection media, temperature profiles, and urokinase assay procedures were tested prior to flight. Electrophoretic mobility distributions of aliquots of the cell population to be fractionated in flight were obtained. Cells were prepared in suspension prior to flight in electrophoresis buffer and 10% calf serum. Electrophoretic separation proceeded in electrophoresis buffer without serum in the Continuous Flow Electrophoretic Separator, and fractions were collected into sample bags containing culture medium and concentrated serum. Fractions that yielded enough progeny cells were analyzed for morphology and electrophoretic mobility distributions. It is noted that the lowest mobility fraction studied produced higher mobility progeny while the other fractions produced progeny cells with mobilities related to the fractions from which they were collected.
Controlled method of reducing electrophoretic mobility of macromolecules, particles, or cells
NASA Technical Reports Server (NTRS)
Vanalstine, James M. (Inventor)
1992-01-01
A method of reducing electrophoretic mobility of macromolecules, particles, cells, and other substances is provided which comprises interacting in a conventional electrophoretic separating procedure, the substances with a polymer-linked affinity compound comprised of a hydrophilic neutral polymer such as polyethylene glycol bound to a second component such as a hydrophobic compound, an immunocompound such as an antibody or antibody active fragment, or a ligand such as a hormone, drug, antigen, or a hapten. The reduction of electrophoretic mobility achieved is directly proportional to the concentration of the polymer-linked affinity compound employed, and such reduction can comprise up to 100 percent for particular particles and cells. The present invention is advantageous in that electrophoretic separation can now be achieved for substances whose native surface charge structure had prevented them from being separated by normal electrophoretic means. Depending on the affinity component utilized, separation can be achieved on the basis of the specific/irreversible, specific/reversible, semi-specific/reversible, relatively nonspecific/reversible, or relatively nonspecific/irreversible ligand-substance interactions.
The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregati...
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Orlye, Fanny; Reiller, Pascal E.
2014-02-15
The physicochemical properties of three different humic substances (HS) are probed using capillary zone electrophoresis in alkaline carbonate buffers, pH 10. Special attention is drawn to the impact of the electrolyte ionic strength and counter-ion nature, chosen within the alkali-metal series, on HS electrophoretic mobility. Taylor-Aris dispersion analysis provides insights into the hydrodynamic radius (R-H) distributions of HS. The smallest characterized entities are of nano-metric dimensions, showing neither ionic strength- nor alkali-metal-induced aggregation. These results are compared with the entities evidenced in dynamic light scattering measurements, the size of which is two order of magnitude higher, ca. 100 nm. Themore » extended Onsager model provides a reasonable description of measured electrophoretic mobilities in the ionic strength range 1-50 mM, thus allowing the estimation of limiting mobilities and ionic charge numbers for the different HS samples. An unexpected HS electrophoretic mobility increase (in absolute value) is observed in the order Li{sup +} ≤ Na{sup +} ≤ K{sup +} ≤ Cs{sup +} and discussed either in terms of retarding forces or in terms of ion-ion interactions. (authors)« less
Mohamad, Saharuddin Bin; Nagasawa, Hideko; Sasaki, Hideyuki; Uto, Yoshihiro; Nakagawa, Yoshinori; Kawashima, Ken; Hori, Hitoshi
2003-01-01
Gc protein is the precursor for Gc protein-derived macrophage activating factor (GcMAF), with three phenotypes: Gc1f, Gc1s and Gc2, based on its electrophoretic mobility. The difference in electrophoretic mobility is because of the difference in its posttranslational sugar moiety composition. We compared the difference between Gc protein and GcMAF electrophoretic mobility using the isoelectric focusing (IEF) method. The tumoricidal activity of GcMAF-treated macrophage was evaluated after coculture with L-929 cell. The tumoricidal mechanism was investigated using TNF bioassay and nitric oxide (NO) release. The difference in Gc protein and GcMAF electrophoretic mobility was detected. The tumoricidal activity of GcMAF-treated macrophage was detected, but no release of TNF and NO was detected. The difference of isoelectric focusing mobility in Gc protein and GcMAF would be useful to develop a GcMAF detection method. GcMAF increased macrophage tumoricidal activity but TNF and NO release were not involved in the mechanism.
Controlled method of reducing electrophoretic mobility of various substances
NASA Technical Reports Server (NTRS)
Vanalstine, James M. (Inventor)
1989-01-01
A method of reducing electrophoretic mobility of macromolecules, particles, cells, and the like is provided. The method comprises interacting the particles or cells with a polymer-linked affinity compound composed of: a hydrophilic neutral polymer such as polyethylene glycol, and an affinity component consisting of a hydrophobic compound such as a fatty acid ester, an immunocompound such as an antibody or active fragment thereof or simular macromolecule, or other ligands. The reduction of electrophoretic mobility achieved is directly proportional to the concentration of the polymer-linked affinity compound employed, and the mobility reduction obtainable is up to 100 percent for particular particles and cells. The present invention is advantageous in that analytical electrophoretic separation can not be achieved for macromolecules, particles, and cells whose native surface charge structure had prevented them from being separated by normal electrophoretic means. Depending on the affinity component utilized, separation can be achieved on the basis of specific/irreversible, specific/reversible, semi-specific/reversible, relatively nonspecific/reversible, or relatively nonspecific/irreversible ligand-substance interactions. The present method is also advantageous in that it can be used in a variety of standard laboratory electrophoresis equipment.
NASA Technical Reports Server (NTRS)
Williams, K. B.; Kunze, M. E.; Todd, P. W.
1985-01-01
Four major cell types were identified by phase microscopy in early passage human embryonic kidney cell cultures. They are small and large epithelioid, domed, and fenestrated cells. Fibroblasts are also present in some explants. The percent of each cell type changes with passage number as any given culture grows. As a general rule, the fraction of small epithelioid cells increases, while the fraction of fenestrated cells, always small, decreases further. When fibroblasts are present, they always increase in percentage of the total cell population. Electrophoretic separation of early passage cells showed that the domed cells have the highest electrophoretic mobility, fibroblasts have an intermediate high mobility, small epithelioid cells have a low mobility, broadly distributed, and fenestrated cells have the lowest mobility. All cell types were broadly distributed among electrophoretic subfractions, which were never pure but only enriched with respect to a given cell type.
Peak capacity and peak capacity per unit time in capillary and microchip zone electrophoresis.
Foley, Joe P; Blackney, Donna M; Ennis, Erin J
2017-11-10
The origins of the peak capacity concept are described and the important contributions to the development of that concept in chromatography and electrophoresis are reviewed. Whereas numerous quantitative expressions have been reported for one- and two-dimensional separations, most are focused on chromatographic separations and few, if any, quantitative unbiased expressions have been developed for capillary or microchip zone electrophoresis. Making the common assumption that longitudinal diffusion is the predominant source of zone broadening in capillary electrophoresis, analytical expressions for the peak capacity are derived, first in terms of migration time, diffusion coefficient, migration distance, and desired resolution, and then in terms of the remaining underlying fundamental parameters (electric field, electroosmotic and electrophoretic mobilities) that determine the migration time. The latter expressions clearly illustrate the direct square root dependence of peak capacity on electric field and migration distance and the inverse square root dependence on solute diffusion coefficient. Conditions that result in a high peak capacity will result in a low peak capacity per unit time and vice-versa. For a given symmetrical range of relative electrophoretic mobilities for co- and counter-electroosmotic species (cations and anions), the peak capacity increases with the square root of the electric field even as the temporal window narrows considerably, resulting in a significant reduction in analysis time. Over a broad relative electrophoretic mobility interval [-0.9, 0.9], an approximately two-fold greater amount of peak capacity can be generated for counter-electroosmotic species although it takes about five-fold longer to do so, consistent with the well-known bias in migration time and resolving power for co- and counter-electroosmotic species. The optimum lower bound of the relative electrophoretic mobility interval [μ r,Z , μ r,A ] that provides the maximum peak capacity per unit time is a simple function of the upper bound, but its direct application is limited to samples with analytes whose electrophoretic mobilities can be varied independently of electroosmotic flow. For samples containing both co- and counter-electroosmotic ions whose electrophoretic mobilities cannot be easily manipulated, comparable levels of peak capacity and peak capacity per unit time for all ions can be obtained by adjusting the EOF to devote the same amount of time to the separation of each class of ions; this corresponds to μ r,Z =-0.5. Copyright © 2017 Elsevier B.V. All rights reserved.
Huhn, Carolin; Pyell, Ute
2008-07-11
It is investigated whether those relationships derived within an optimization scheme developed previously to optimize separations in micellar electrokinetic chromatography can be used to model effective electrophoretic mobilities of analytes strongly differing in their properties (polarity and type of interaction with the pseudostationary phase). The modeling is based on two parameter sets: (i) carbon number equivalents or octanol-water partition coefficients as analyte descriptors and (ii) four coefficients describing properties of the separation electrolyte (based on retention data for a homologous series of alkyl phenyl ketones used as reference analytes). The applicability of the proposed model is validated comparing experimental and calculated effective electrophoretic mobilities. The results demonstrate that the model can effectively be used to predict effective electrophoretic mobilities of neutral analytes from the determined carbon number equivalents or from octanol-water partition coefficients provided that the solvation parameters of the analytes of interest are similar to those of the reference analytes.
Analysis of NCAM helps identify unusual phenotypes of hereditary inclusion-body myopathy.
Broccolini, A; Gidaro, T; Tasca, G; Morosetti, R; Rodolico, C; Ricci, E; Mirabella, M
2010-07-20
Hereditary inclusion-body myopathy or distal myopathy with rimmed vacuoles (h-IBM/DMRV) is due to mutations of the UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE) gene, which codes for an enzyme of the sialic acid biosynthetic pathway. By Western blot (WB) analysis, we have previously shown that in h-IBM/DMRV muscle, the neural cell adhesion molecule (NCAM) has increased electrophoretic mobility that reflects reduced sialylation of the protein. To identify patients with h-IBM/DMRV with atypical clinical or pathologic phenotype using NCAM analysis and the possible cellular mechanism associated with the overall abnormal sialylation of NCAM observed in this disorder. WB analysis of NCAM was performed on muscle biopsies of 84 patients with an uncharacterized muscle disorder who were divided in the following 2 groups: 1) 46 patients with a proximal muscle weakness in whom the main limb-girdle muscular dystrophy syndromes had been ruled out; and 2) 38 patients with a distal distribution of weakness in whom a neurogenic affection had been excluded. Patients in whom a reduced sialylation of NCAM was suspected were studied for the presence of GNE mutations. In 3 patients, we found that NCAM had increased electrophoretic mobility, thus suggesting an abnormal sialylation of the protein. The genetic study demonstrated that they all carried pathogenic GNE mutations. Further studies demonstrated that hyposialylated NCAM, showing increased electrophoretic mobility on WB, is expressed by nonregenerating fibers in h-IBM/DMRV muscle. WB analysis of NCAM may be instrumental in the identification of h-IBM/DMRV with atypical clinical or pathologic features.
ELECTROPHORETIC MOBILITY OF MYCOBACTERIUM AVIUM COMPLEX ORGANISMS
The electrophoretic mobilities (EPMs) of thirty Mycobacterium avium Complex (MAC) organisms isolated from clinical and environmental sources were measured in 9.15 mM KH2PO4 buffered water. The EPMs of fifteen clinical isolates ranged from -1.9 to -5.0 µm cm V-1 ...
ELECTROPHORETIC MOBILITY OF MYCOBACTERIUM AVIUM COMPLEX ORGANISMS
The electrophoretic mobilities (EPMs) of thirty Mycobacterium avium Complex (MAC) organisms were measured. The EPMs of fifteen clinical isolates ranged from -1.9 to -5.0 µm cm V-1s-1, and the EPMs of fifteen environmental isolates ranged from -1...
ELECTROPHORETIC MOBILITIES OF ESCHERICHIA COLI 0157:H7 AND WILD-TYPE ESCHERICHIA COLI STRAINS
The electrophoretic mobility (EPM) of a number of human-virulent and "wild-type" Escherichia coli strains in phosphate buffered water was measured. The impact of pH, ionic strength, cation type (valence) and concentration, and bacterial strain on the EPM was investigated. Resul...
Pyell, Ute; Jalil, Alaa H; Pfeiffer, Christian; Pelaz, Beatriz; Parak, Wolfgang J
2015-07-15
Taking gold nanoparticles with different hydrophilic coatings as an example, it is investigated whether capillary electrophoresis in combination with Taylor dispersion analysis allows for the precise determination of mean electrophoretic mobilities, electrophoretic mobility distributions, and zeta potentials in a matrix of exactly known composition and the calibration-free determination of number-weighted mean hydrodynamic radii. Our experimental data confirm that the calculation of the zeta potential for colloidal nanoparticles with ζ>25 mV requires to take the relaxation effect into account. Because of the requirement to avoid particle-wall interactions, a solution of disodiumtetraborate decahydrate (borax) in deionized water had been selected as suitable electrolyte. Measurements of the electrophoretic mobility at different ionic strength and application of the analytic approximation developed by Ohshima show that in the present case of a buffered solution with a weak electrolyte co-ion and a strong electrolyte counterion, the effective ionic drag coefficient should be approximated with the ionic drag coefficient of the counterion. The obtained results are in good agreement with theoretical expectations regarding the dependence of the zeta potential and the electrokinetic surface charge density on the ionic strength. We also show that Taylor dispersion analysis (besides estimation of the number-weighted mean hydrodynamic radius) provides additional information on the type and width of the number-weighted particle distribution. Copyright © 2015 Elsevier Inc. All rights reserved.
Molecular-sieve chromatography and electrophoresis in polyacrylamide gels
Morris, C. J. O. R.; Morris, Peggy
1971-01-01
1. The absolute electrophoretic mobilities of eight proteins have been measured at pH8.76, I 0.05, in polyacrylamide gels of 20 different compositions at 10°C. 2. The partition coefficients of these proteins have been determined chromatographically under the same conditions by using columns of granulated polyacrylamide gel prepared simultaneously. 3. The electrophoretic mobilities are an exponential function of the gel concentrations when the latter are corrected for water uptake. The constants of this function have been determined by curvefitting methods. They have been shown to be related to the free solution mobility and to the mean molecular radius respectively. 4. The reduced mobilities have been shown to be a linear function of the partition coefficients by statistical analyses. 5. The physical significance of the relation between electrophoretic mobility and chromatographic phase distribution in gel media is discussed in the context of these results. PMID:5135238
Free-Flow Open-Chamber Electrophoresis
NASA Technical Reports Server (NTRS)
Sharnez, Rizwan; Sammons, David W.
1994-01-01
Free-flow open-chamber electrophoresis variant of free-flow electrophoresis performed in chamber with open ends and in which velocity of electro-osmotic flow adjusted equal to and opposite mean electrophoretic velocity of sample. Particles having electrophoretic mobilities greater than mean mobility of sample particles move toward cathode, those with mobilities less move toward anode. Technique applied to separation of components of mixtures of biologically important substances. Sensitivity enhanced by use of tapered chamber.
A review of light-scattering techniques for the study of colloids in natural waters
Rees, T.F.
1987-01-01
In order to understand the movement of colloidal materials in natural waters, we first need to have a means of quantifying their physical characteristics. This paper reviews three techniques which utilize light-scattering phenomena to measure the translational diffusion coefficient, the rotational diffusion coefficient, and the electrophoretic mobility of colloids suspended in water. Primary emphasis is to provide sufficient theoretical detail so that hydrologists can evaluate the utility of photon correlation spectrometry, electrophoretic light scattering, and electric birefringence analysis. ?? 1987.
Electrophoretic mobility (EPM) of endospores of Bacillus anthracis and surrogates were measured in aqueous solution across a broad pH range and several ionic strengths. EPM values trended around phylogenetic clustering based on the 16S rRNA gene. Measurements reported here prov...
Electrokinetic transport phenomena: Mobility measurement and electrokinetic instability
NASA Astrophysics Data System (ADS)
Oddy, Michael Huson
Miniaturization and integration of traditional bioassay procedures into microfabricated on-chip assay systems, commonly referred to as "Micro Total Analysis" (muTAS) systems, may have a significant impact on the fields of genomics, proteomics, and clinical analysis. These bioanalytical microsystems leverage electroosmosis and electrophoresis for sample transport, mixing, manipulation, and separation. This dissertation addresses the following three topics relevant to such systems: a new diagnostic for measuring the electrophoretic mobility of sub-micron, fluorescently-labeled particles and the electroosmotic mobility of a microchannel; a novel method and device for rapidly stirring micro- and nanoliter volume solutions for microfluidic bioanalytical applications; and a multiple-species electrokinetic instability model. Accurate measurement of the electrophoretic particle mobility and the electroosmotic mobility of microchannel surfaces is crucial to understanding the stability of colloidal suspensions, obtaining particle tracking-based velocimetry measurements of electroosmotic flow fields, and the quantification of electrokinetic bioanalytical device performance. A method for determining these mobilities from alternating and direct current electrokinetic particle tracking measurements is presented. The ability to rapidly mix fluids at low Reynolds numbers is important to the functionality of many bioanalytical, microfluidic devices. We present an electrokinetic process for rapidly stirring microflow streams by initiating an electrokinetic flow instability. The design, fabrication and performance analysis of two micromixing devices capable of rapidly stirring two low Reynolds number fluid streams are presented. Electroosmotic and electrophoretic transport in the presence of conductivity mismatches between reagent streams and the background electrolytes, can lead to an unstable flow field generating significant sample dispersion. In the multiple-species electrokinetic instability model, we consider a high aspect ratio microchannel geometry, a conductivity gradient orthogonal to the applied electric field, and a four-species chemistry model. A linear stability analysis of the depth-averaged governing equations shows unstable eigenmodes for conductivity ratios as close to unity as 1.01. Experiments and full nonlinear simulations of the governing equations were conducted for a conductivity ratio of 1.05. Images of the disturbance dye field from the nonlinear simulations show good qualitative and quantitative agreement with experiment. Species electromigration is shown to a have significant influence on the development of the conductivity field and instability dynamics in multi-ion configurations.
ERIC Educational Resources Information Center
Heffler, Michael A.; Walters, Ryan D.; Kugel, Jennifer F.
2012-01-01
An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K[subscript D]) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel;…
Palanisami, Akilan; Miller, John H.
2011-01-01
The size and surface chemistry of micron scale particles are of fundamental importance in studies of biology and air particulate pollution. However, typical electrophoretic measurements of these and other sub-micron scale particles (300 nm – 1 μm) cannot resolve size information within heterogeneous mixtures unambiguously. Using optical microscopy, we monitor electrophoretic motion together with the Brownian velocity fluctuations—using the latter to measure size by either the Green-Kubo relation or by calibration from known size standards. Particle diameters are resolved to ±12% with 95% confidence. Strikingly, the size resolution improves as particle size decreases due to the increased Brownian motion. The sizing ability of the Brownian assessed electrophoresis method described here complements the electrophoretic mobility resolution of traditional capillary electrophoresis. PMID:20882556
Wang, Nan-Hsuan; Lee, Wan-Li; Her, Guor-Rong
2011-08-15
A strategy based on postcolumn electrophoretic mobility control (EMC) was developed to alleviate the adverse effect of trifluoroacetic acid (TFA) on the liquid chromatography-mass spectrometry (LC-MS) analysis of peptides. The device created to achieve this goal consisted of a poly(dimethylsiloxane) (PDMS)-based junction reservoir, a short connecting capillary, and an electrospray ionization (ESI) sprayer connected to the outlet of the high-performance liquid chromatography (HPLC) column. By apply different voltages to the junction reservoir and the ESI emitter, an electric field was created across the connecting capillary. Due to the electric field, positively charged peptides migrated toward the ESI sprayer, whereas TFA anions remained in the junction reservoir and were removed from the ionization process. Because TFA did not enter the ESI source, ion suppression from TFA was alleviated. Operation of the postcolumn device was optimized using a peptide standard mixture. Under optimized conditions, signals for the peptides were enhanced 9-35-fold without a compromise in separation efficiency. The optimized conditions were also applied to the LC-MS analysis of a tryptic digest of bovine serum albumin.
Cobalt ferrite nanoparticles with improved aqueous colloidal stability and electrophoretic mobility
DOE Office of Scientific and Technical Information (OSTI.GOV)
Munjal, Sandeep, E-mail: drsandeepmunjal@gmail.com; Khare, Neeraj, E-mail: nkhare@physics.iitd.ernet.in
We have synthesized CoFe{sub 2}O{sub 4} (CFO) nanoparticles of size ∼ 12.2 nm by hydrothermal synthesis method. To control the size of these CFO nanoparticles, oleic acid was used as a surfactant. The inverse spinel phase of the synthesized nanoparticles was confirmed by X-ray diffraction method. As synthesized oleic acid coated CFO (OA@CFO) nanoparticles has very less electrophoretic mobility in the water and are not water dispersible. These OA@CFO nanoparticles were successfully turned into water soluble phase with a better colloidal aqueous stability, through a chemical treatment using citric acid. The modified citric acid coated CFO (CA@CFO) nanoparticles were dispersible inmore » water and form a stable aqueous solution with high electrophoretic mobility.« less
Buitenhuis, Johan
2012-09-18
The electrophoretic mobility of rodlike fd viruses is measured and compared to theory, with the theoretical calculations performed according to Stigter (Stigter, D. Charged Colloidal Cylinder with a Gouy Double-Layer. J. Colloid Interface Sci. 1975, 53, 296-306. Stigter, D. Electrophoresis of Highly Charged Colloidal Cylinders in Univalent Salt- Solutions. 1. Mobility in Transverse Field. J. Phys. Chem. 1978, 82, 1417-1423. Stigter, D. Electrophoresis of Highly Charged Colloidal Cylinders in Univalent Salt Solutions. 2. Random Orientation in External Field and Application to Polyelectrolytes. J. Phys. Chem. 1978, 82, 1424-1429. Stigter, D. Theory of Conductance of Colloidal Electrolytes in Univalent Salt Solutions. J. Phys. Chem. 1979, 83, 1663-1670), who describes the electrophoretic mobility of infinite cylinders including relaxation effects. Using the dissociation constants of the ionizable groups on the surfaces of the fd viruses, we can calculate the mobility without any adjustable parameter (apart from the possible Stern layer thickness). In addition, the approximation in the theoretical description of Stigter (and others) of using a model of infinitely long cylinders, which consequently is independent of the aspect ratio, is examined by performing more elaborate numerical calculations for finite cylinders. It is shown that, although the electrophoretic mobility of cylindrical particles in the limit of low ionic strength depends on the aspect ratio much more than "end effects", at moderate and high ionic strengths the finite and infinite cylinder models differ only to a degree that can be attributed to end effects. Furthermore, the range of validity of the Stokes regime is systematically calculated.
Potential of capillary zone electrophoresis for estimation of humate acid-base properties.
Vanifatova, Natalia G; Zavarzina, Anna G; Spivakov, Boris Ya
2008-03-07
Capillary zone electrophoresis (CZE) has been applied for fractionation and characterization of soil-derived humic acids (HAs). Humic acids from soddy-podzolic (HA(s)) and chernozem (HA(ch)) soils were studied as well as hydrophobic high-molecular-weight (HMW) and hydrophilic low-molecular-weight (LMW) HA(s) fractions obtained by salting-out with ammonium sulfate at a saturation of 0-40% and >70%, respectively. The possibility of CZE partial fractionation of HAs has been demonstrated. The shape of "humic hump" was shown to depend on the pH of running electrolyte. Almost the whole peak overlapping occurred if alkaline solutions were used for fractionation, but the peak resolution was improved at pH 5-7. Under appropriate fractionation conditions (pH 7), at least three humic acid subfractions with different electrophoretic mobilities were distinguished in the electropherograms of initial HA and HA(s) fractions. Such a high peak resolution has never been achieved for humic acids before. The presence of three subfractions in the HA is in agreement with gel-filtration analysis and was confirmed by comparison of the electrophoretic behavior of HA(s) with those of its HMW (hydrophobic) and the LMW (hydrophilic) fractions. The potentiometric titration of HA and its fractions was performed and the pK(a) of the functional groups were calculated. An attempt was made for the first time to relate the variation of electrophoretic mobility values with acid-base properties of humic acids. It was shown that changes in the humate charge resulting from the variation of the ionization degree of its functional groups as a function of pH can be estimated on the basis of electrophoretic mobility values. Potential of CZE in estimation of HA isoelectric point was demonstrated. The pH value corresponding to the lowest absolute electrophoretic mobility value of about 20 x 10(-5) cm(2) V(-1) s(-1) can be used for approximate estimation of HA isoelectric point. The data were discussed and agreement with the random coil structural model has been shown.
Piaggio, Maria V; Peirotti, Marta B; Deiber, Julio A
2007-10-01
Effective electrophoretic mobility data of 20 amino acids reported in the literature are analyzed and interpreted through simple physicochemical models, which are able to provide estimates of coupled quantities like hydrodynamic shape factor, equivalent hydrodynamic radius (size), net charge, actual pK values of ionizing groups, partial charges of ionizing groups, hydration number, and pH near molecule (microenvironment-pH of the BGE). It is concluded that the modeling of the electrophoretic mobility of these analytes requires a careful consideration of hydrodynamic shape coupled to hydration. In the low range of pH studied here, distinctive hydrodynamic behaviors of amino acids are found. For instance, amino acids with basic polar and ionizing side chain remain with prolate shape for pH values varying from 1.99 to 3.2. It is evident that as the pH increases from low values, amino acids get higher hydrations as a consequence each analyte total charge also increases. This result is consistent with the monotonic increase of the hydrodynamic radius, which accounts for both the analyte and the quite immobilized water molecules defining the electrophoretic kinematical unit. It is also found that the actual or effective pK value of the alpha-carboxylic ionizing group of amino acids increases when the pH is changed from 1.99 to 3.2. Several limitations concerning the simple modeling of the electrophoretic mobility of amino acids are presented for further research.
Electrophoretic manipulation of multiple-emulsion droplets
NASA Astrophysics Data System (ADS)
Schoeler, Andreas M.; Josephides, Dimitris N.; Chaurasia, Ankur S.; Sajjadi, Shahriar; Mesquida, Patrick
2014-02-01
Electrophoretic manipulation of multiple-emulsion oil-in-water-in-oil (O/W)/O and water-in-oil-in-water-in-oil (W/O/W)/O core-shell droplets is shown. It was found that the electrophoretic mobility of the droplets is determined solely by the outer water shell, regardless of size or composition of the inner droplets. It was observed that the surface charge of the outer water shell can be changed and the polarity can be reversed through contact with a biased electrode in a similar way as with simple W/O droplets. Furthermore, addition of the anionic surfactant, sodium dodecyl sulfate to the outer water shell reverses the initial polarity and hence, electrophoretic mobility of the core-shell droplets before contact with an electrode. The results have practical implications for the manipulation of oil droplets in a continuous oil phase.
Piaggio, Maria V; Peirotti, Marta B; Deiber, Julio A
2009-07-01
Electrophoretic mobility data of four proteins are analyzed and interpreted through a physicochemical CZE model, which provides estimates of quantities like equivalent hydrodynamic radius (size), effective charge number, shape orientation factor, hydration, actual pK values of ionizing groups, and pH near molecule, among others. Protein friction coefficients are simulated through the creeping flow theory of prolate spheroidal particles. The modeling of the effective electrophoretic mobility of proteins requires consideration of hydrodynamic size and shape coupled to hydration and effective charge. The model proposed predicts native protein hydration within the range of values obtained experimentally from other techniques. Therefore, this model provides consistently other physicochemical properties such as average friction and diffusion coefficients and packing fractal dimension. As the pH varies from native conditions to those that are denaturing the protein, hydration and packing fractal dimension change substantially. Needs for further research are also discussed and proposed.
Neu, T R; Verkerke, G J; Herrmann, I F; Schutte, H K; Van der Mei, H C; Busscher, H J
1994-05-01
Silicone rubber voice prostheses are implants which are inserted in a non-sterile environment and therefore become quickly colonized by micro-organisms. The micro-organisms exist on the medical grade silicone rubber as mixed biofilms of bacteria and yeasts. A total of 79 bacterial and 39 yeast strains were isolated from these biofilms by soft ultrasonic treatment. Gram-positive/catalase-negative and Gram-positive/catalase-positive cocci represented the dominant bacterial strains. The yeasts were mainly Candida species. Further characterization of cell surface properties such as hydrophobicity by microbial adhesion to hexadecane and electrophoretic mobility showed a distinct difference when the bacterial strains were compared with the yeasts. The bacterial hydrophobicities ranged from 0 to 100% adhesion to hexadecane, whereas the yeast strains, especially the Candida albicans strains, all had markedly hydrophilic cell surfaces. A comparison of the electrophoretic mobilities showed also differences between bacteria and yeast. The values for the bacteria were found to be between -2.5 to -0.5 (10(-8) m2 V-1 s-1), whereas for the yeasts electrophoretic mobilities were more positive. Based on the adhesive properties of the isolated micro-organisms, strategies can now be developed to modify the properties of the silicone rubber to reduce biofilm formation on such prostheses.
Vega, Juan F.; Vicente-Alique, Ernesto; Núñez-Ramírez, Rafael; Wang, Yang; Martínez-Salazar, Javier
2016-01-01
The stabilization of human papillomavirus type 16 virus-like particles has been examined by means of different techniques including dynamic and static light scattering, transmission electron microscopy and electrophoretic mobility. All these techniques provide different and often complementary perspectives about the aggregation process and generation of stabilized virus-like particles after a period of time of 48 hours at a temperature of 298 K. Interestingly, static light scattering results point towards a clear colloidal instability in the initial systems, as suggested by a negative value of the second virial coefficient. This is likely related to small repulsive electrostatic interactions among the particles, and in agreement with relatively small absolute values of the electrophoretic mobility and, hence, of the net surface charges. At this initial stage the small repulsive interactions are not able to compensate binding interactions, which tend to aggregate the particles. As time proceeds, an increase of the size of the particles is accompanied by strong increases, in absolute values, of the electrophoretic mobility and net surface charge, suggesting enhanced repulsive electrostatic interactions and, consequently, a stabilized colloidal system. These results show that electrophoretic mobility is a useful methodology that can be applied to screen the stabilization factors for virus-like particles during vaccine development. PMID:26885635
Sursyakova, Viktoria V; Burmakina, Galina V; Rubaylo, Anatoly I
2016-08-01
The influence of analyte concentration when compared with the concentration of a charged ligand in background electrolyte (BGE) on the measured values of electrophoretic mobilities and stability constants (association, binding or formation constants) is studied using capillary electrophoresis (CE) and a dynamic mathematical simulator of CE. The study is performed using labile complexes (with fast kinetics) of iron (III) and 5-sulfosalicylate ions (ISC) as an example. It is shown that because the ligand concentration in the analyte zone is not equal to that in BGE, considerable changes in the migration times and electrophoretic mobilities are observed, resulting in systematic errors in the stability constant values. Of crucial significance is the slope of the dependence of the electrophoretic mobility decrease on the ligand equilibrium concentration. Without prior information on this dependence to accurately evaluate the stability constants for similar systems, the total ligand concentration must be at least >50-100 times higher than the total concentration of analyte. Experimental ISC peak fronting and the difference between the direction of the experimental pH dependence of the electrophoretic mobility decrease and the mathematical simulation allow assuming the presence of capillary wall interaction. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
The influence of hydrodynamic slip on the electrophoretic mobility of a spherical colloidal particle
NASA Astrophysics Data System (ADS)
Khair, Aditya S.; Squires, Todd M.
2009-04-01
Recent theoretical studies have suggested a significant enhancement in electro-osmotic flows over hydrodynamically slipping surfaces, and experiments have indeed measured O(1) enhancements. In this paper, we investigate whether an equivalent effect occurs in the electrophoretic motion of a colloidal particle whose surface exhibits hydrodynamic slip. To this end, we compute the electrophoretic mobility of a uniformly charged spherical particle with slip length λ as a function of the zeta (or surface) potential of the particle ζ and diffuse-layer thickness κ-1. In the case of a thick diffuse layer, κa ≪1 (where a is the particle size), simple arguments show that slip does lead to an O(1) enhancement in the mobility, owing to the reduced viscous drag on the particle. On the other hand, for a thin-diffuse layer κa ≫1, the situation is more complicated. A detailed asymptotic analysis, following the method of O'Brien [J. Colloid Interface Sci. 92, 204 (1983)], reveals that an O(κλ) increase in the mobility occurs at low-to-moderate zeta potentials (with ζ measured on the scale of thermal voltage kBT /e≈25 mV). However, as ζ is further increased, the mobility decreases and ultimately becomes independent of the slip length—the enhancement is lost—which is due to the importance of nonuniform surface conduction within the thin-diffuse layer, at large ζ and large, but finite, κa. Our asymptotic calculations for thick and thin-diffuse layers are corroborated and bridged by computation of the mobility from the numerical solution of the full electrokinetic equations (using the method of O'Brien and White [J. Chem. Soc., Faraday Trans. 2 74, 1607 (1978)]). In summary, then, we demonstrate that hydrodynamic slip can indeed produce an enhancement in the electrophoretic mobility; however, such enhancements will not be as dramatic as the previously studied κa →∞ limit would suggest. Importantly, this conclusion applies not only to electrophoresis but also to electro-osmosis over highly charged surfaces, wherein any inhomogeneities (e.g., due to curvature, roughness, charge patterning, or a variation in slip length) will drive nonuniform surface conduction, which prevents the significant slip-driven flow enhancements predicted for a uniform highly charged surface.
Wooten, Dennis C; Starr, Clarise R; Lyon, Wanda J
2016-01-01
Different forms of heavy metals affect biochemical systems in characteristic ways that cannot be detected with typical metal analysis methods like atomic absorption spectrometry. Further, using living systems to analyze interaction of heavy metals with biochemical systems can be laborious and unreliable. To generate a reliable easy-to-use biologically-based biosensor system, the entire human metallothionein-II (MT-II) gene was incorporated into a plasmid (pUC57-MT) easily replicated in Escherichia coli. In this system, a commercial polyclonal antibody raised against human metal-responsive transcription factor-1 protein (MTF-1 protein) could modify the electrophoretic migration patterns (i.e. cause specific decreases in agarose gel electrophoretic mobility) of the plasmid in the presence or absence of heavy metals other than zinc (Zn). In the study here, heavy metals, MTF-1 protein, and polyclonal anti-MTF-1 antibody were used to assess pUC57-MT plasmid antibody-assisted electrophoretic mobility. Anti-MTF-1 antibody bound both MTF-1 protein and pUC57-MT plasmid in a non-competitive fashion such that it could be used to differentiate specific heavy metal binding. The results showed that antibody-inhibited plasmid migration was heavy metal level-dependent. Zinc caused a unique mobility shift pattern opposite to that of other metals tested, i.e. Zn blocked the antibody ability to inhibit plasmid migration, despite a greatly increased affinity for DNA by the antibody when Zn was present. The Zn effect was reversed/modified by adding MTF-1 protein. Additionally, antibody inhibition of plasmid mobility was resistant to heat pre-treatment and trypsinization, indicating absence of residual DNA extraction-resistant bacterial DNA binding proteins. DNA binding by anti-DNA antibodies may be commonly enhanced by xenobiotic heavy metals and elevated levels of Zn, thus making them potentially effective tools for assessment of heavy metal bioavailability in aqueous solutions and fluid obtained from metal implant sites.
Methods for separating particles and/or nucleic acids using isotachophoresis
Jung, Byoungsok; Ness, Kevin; Rose, Klint A.
2016-03-15
According to one embodiment, a method includes co-feeding fluids comprising a leading electrolyte, a trailing electrolyte, and at least one of DNA and RNA to a channel, and applying an electric field to the fluids in a direction perpendicular to an axis of the channel for inducing transverse isotachophoresis. In another embodiment, a method includes co-feeding fluids to a channel. The fluids include a leading electrolyte, a trailing electrolyte, biological objects, at least one of DNA and RNA, and a spacer electrolyte having an electrophoretic mobility that is between an electrophoretic mobility of at least some of the biological objects and an electrophoretic mobility of the at least one of the DNA and the RNA. The method also includes applying an electric field to the fluids in a direction perpendicular to an axis of the channel for inducing transverse isotachophoresis. Other methods of isotachophoresis are disclosed in addition to these.
Nano-colloid electrophoretic transport: Fully explicit modelling via dissipative particle dynamics
NASA Astrophysics Data System (ADS)
Hassanzadeh Afrouzi, Hamid; Farhadi, Mousa; Sedighi, Kurosh; Moshfegh, Abouzar
2018-02-01
In present study, a novel fully explicit approach using dissipative particle dynamics (DPD) method is introduced for modelling electrophoretic transport of nano-colloids in an electrolyte solution. Slater type charge smearing function included in 3D Ewald summation method is employed to treat electrostatic interaction. Moreover, capability of different thermostats are challenged to control the system temperature and study the dynamic response of colloidal electrophoretic mobility under practical ranges of external electric field in nano scale application (0.072 < E < 0.361 v / nm) covering non-linear response regime, and ionic salt concentration (0.049 < SC < 0.69 [M]) covering weak to strong Debye screening of the colloid. The effect of different colloidal repulsions are then studied on temperature, reduced mobility and zeta potential which is computed based on charge distribution within the spherical colloidal EDL. System temperature and electrophoretic mobility both show a direct and inverse relationship respectively with electric field and colloidal repulsion. Mobility declining with colloidal repulsion reaches a plateau which is a relatively constant value at each electrolyte salinity for Aii > 600 in DPD units regardless of electric field intensity. Nosé-Hoover-Lowe-Andersen and Lowe-Andersen thermostats are found to function more effectively under high electric fields (E > 0.145 [ v / nm ]) while thermal equilibrium is maintained. Reasonable agreements are achieved by benchmarking the radial distribution function with available electrolyte structure modellings, as well as comparing reduced mobility against conventional Smoluchowski and Hückel theories, and numerical solution of Poisson-Boltzmann equation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thornton, Michelle
Capillary electrophoresis (CE) is an effective method for separating ionic species according to differences in their electrophoretic mobilities. CE separations of amino acids by direct detection are difficult due to their similar electrophoretic mobilities and low absorbances. However, native amino acids can be separated by CE as cations at a low pH by adding an alkanesulfonic acid to the electrolyte carrier which imparts selectivity to the system. Derivatization is unnecessary when direct UV detection is used at 185 nm. Simultaneous speciation of metal cations such as vanadium (IV) and vanadium (V) can easily be performed without complexation prior to analysis.more » An indirect UV detection scheme for acidic conditions was also developed using guanidine as the background carrier electrolyte (BCE) for the indirect detection of metal cations. Three chapters have been removed for separate processing. This report contains introductory material, references, and general conclusions. 80 refs.« less
NASA Astrophysics Data System (ADS)
Pandey, Harsh; Underhill, Patrick T.
2015-11-01
The electrophoretic mobility of molecules such as λ -DNA depends on the conformation of the molecule. It has been shown that electrohydrodynamic interactions between parts of the molecule lead to a mobility that depends on conformation and can explain some experimental observations. We have developed a new coarse-grained model that incorporates these changes of mobility into a bead-spring chain model. Brownian dynamics simulations have been performed using this model. The model reproduces the cross-stream migration that occurs in capillary electrophoresis when pressure-driven flow is applied parallel or antiparallel to the electric field. The model also reproduces the change of mobility when the molecule is stretched significantly in an extensional field. We find that the conformation-dependent mobility can lead to a new type of unraveling of the molecule in strong fields. This occurs when different parts of the molecule have different mobilities and the electric field is large.
Wahl, Joachim; Furuishi, Takayuki; Yonemochi, Etsuo; Meinel, Lorenz; Holzgrabe, Ulrike
2017-04-01
To optimize chiral separation conditions and to improve the knowledge of enantioseparation, it is important to know the binding constants K between analytes and cyclodextrins and the electrophoretic mobilities of the temporarily formed analyte-cyclodextrin-complexes. K values for complexes between eight phenethylamine enantiomers, namely ephedrine, pseudoephedrine, methylephedrine and norephedrine, and four different β-cyclodextrin derivatives were determined by affinity capillary electrophoresis. The binding constants were calculated from the electrophoretic mobility values of the phenethylamine enantiomers at increasing concentrations of cyclodextrins in running buffer. Three different linear plotting methods (x-reciprocal, y-reciprocal, double reciprocal) and nonlinear regression were used for the determination of binding constants with β-cyclodextrin, (2-hydroxypropyl)-β-cyclodextrin, methyl-β-cyclodextrin and 6-O-α-maltosyl-β-cyclodextrin. The cyclodextrin concentration in a 50 mM phosphate buffer pH 3.0 was varied from 0 to 12 mM. To investigate the influence of the binding constant values on the enantioseparation the observed electrophoretic selectivities were compared with the obtained K values and the calculated enantiomer-cyclodextrin-complex mobilities. The different electrophoretic mobilities of the temporarily formed complexes were crucial factors for the migration order and enantioseparation of ephedrine derivatives. To verify the apparent binding constants determined by capillary electrophoresis, a titration process using ephedrine enantiomers and β-cyclodextrin was carried out. Furthermore, the isothermal titration calorimetry measurements gave information about the thermal properties of the complexes. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yousaf, Nasim; Gould, David
2017-01-01
Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.
Eichmann, Klaus; Braun, Dietmar G.; Feizi, Ten; Krause, Richard M.
1970-01-01
Electrophoretically monodisperse antibody components in rabbit antisera to the carbohydrates of the Groups A and C streptococci have been examined for their individual antigenic specificity. In these antibody components which were isolated by preparative electrophoresis, individual antigenic specificity was confined to the specific antibody and was absent in the nonantibody γ-globulin. Radioprecipitation experiments and the use of immune absorbent columns constructed from goat anti-antisera, which had been absorbed with fraction II, revealed that all the specific antibody in an electrophoretically monodisperse component was reactive with the homologous anti-antibody. Antibodies with either identical or distinct individual antigenic specificities may occur in the same rabbit with repeated immunizations. Antibodies with identical antigenic specificity had identical electrophoretic mobility, whereas antibodies with unrelated antigenic specificities had distinct electrophoretic mobilities. In the interval between immunizations, if antibody to the carbohydrate antigen was absent, there was no detectable antibody with individual antigenic specificity. PMID:4192569
Discrimination between closed and open forms of lipases using electrophoretic techniques.
Miled, N; Riviere, M; Cavalier, J F; Buono, G; Berti, L; Verger, R
2005-03-15
The enhanced catalytic activity of lipases is often associated with structural changes. The three-dimensional (3D) structures showed that the covalently inhibited lipases exist under their open conformations, in contrast to their native closed forms. We studied the inhibition of various lipases--human and dog gastric lipases, human pancreatic lipase, and Humicola lanuginosa lipase--by the octyl-undecyl phosphonate inhibitor, and we measured the subsequent modifications of their respective electrophoretic mobility. Furthermore, the experimental values of the isoelectric points found for the native (closed) and inhibited (open) lipases are in agreement with theoretical calculations based on the electrostatic potential. We concluded that there is a significant difference in the isoelectric points between the closed (native) and open (inhibited) conformations of the four lipases investigated. Thus, analysis of the electrophoretic pattern is proposed as an easy experimental tool to differentiate between a closed and an open form of a given lipase.
NASA Technical Reports Server (NTRS)
Todd, P.; Morrison, Dennis R.; Barlow, Grant H.; Lewis, Marian L.; Lanham, J. W.; Cleveland, C.; Williams, K.; Kunze, M. E.; Goolsby, C. L.
1988-01-01
Cultures of human embryonic kidney cells consistently contain an electrophoretically separable subpopulation of cells that produce high levels of urokinase and have an electrophoretic mobility about 85 percent as high as that of the most mobile human embryonic kidney cells. This subpopulation is rich in large epithelioid cells that have relatively little internal structure. When resolution and throughput are adequate, free fluid electrophoresis can be used to isolate a broad band of low mobility cells which also produces high levels of plasminogen activators (PAs). In the course of performing this, it was discovered that all electrophoretic subpopulations of cultured human embryonic kidney cells produce some PAs and that separate subpopulations produce high quantities of different types of PA's. This information and the development of sensitive assays for this project have provided new insights into cell secretion mechanisms related to fibrinolysis. These advances would probably not have been made without the NASA program to explore fundamental questions of free fluid electrophoresis in space.
The influence of tetrahydroxyborate ions on the electrophoretic mobility of humic acids was evaluated by capillary electrophoresis (CE). Depending on the molarity of borate ions in the separation buffer, the humic acids exhibit electropherograms with sharp peaks consistently exte...
Protein markers for discrimination of meat species in raw beef, pork and poultry and their mixtures.
Kim, Gap-Don; Seo, Jin-Kyu; Yum, Hyeon-Woong; Jeong, Jin-Yeon; Yang, Han-Sul
2017-02-15
The purpose of this study was to find discrimination markers for four major meat species such as beef, pork, chicken and duck. Myofibrillar and sarcoplasmic proteins isolated from each meat type were analyzed by one-dimensional gel electrophoresis and some proteins were identified through LC-MS/MS analysis. We confirmed that troponin I (TnI), enolase 3, l-lactate dehydrogenase (LDH) and triose-phosphate isomerase (TPI) could be useful markers for discrimination of mammals from poultry due to their different electrophoretic mobility. Tropomyosin 1 and carbonic anhydrase 3 were observed as muscle fiber type-related proteins and these could also be markers to distinguish mammals from poultry. Species-specific peptides identified by LC-MS/MS spectra allow the identification of each species regardless of the same protein. Therefore, it is easy to discriminate between mammals and poultry by comparing the electrophoretic mobility of TnI, enolase 3, LDH, TPI and CA3, and each species could be identified through LC-MS/MS analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Electrophoretic purification of cells in space - Evaluation of results from STS-3
NASA Technical Reports Server (NTRS)
Sarnoff, B. E.; Kunze, M. E.; Todd, P.
1983-01-01
The procedure and results of Electrophoresis Equipment Verification Test, designed to examine electrophoretic behavior of animal cells is suspension more concentrated than possible on earth and flown on the Shuttle flight STS-3, were discussed. Ground-based laboratory values of electrophoretic mobilities of a mixture of human and rabbit aldehyde-fixed red blood cells (RBC) were compared with those recorded at 11 minute intervals on the Shuttle STS-3. RBC migration and separation observed through photographic records were not as expected. However, cell mobilities and migrating band profiles were consistent with the results of laboratory simulation experiments. It was concluded that zero G electrophoresis of very high concentrations (1 x 10 to the 9th) is possible and similar to electrophoresis of normal cell concentrations on earth.
Time-dependent electrophoresis of a dielectric spherical particle embedded in Brinkman medium
NASA Astrophysics Data System (ADS)
Saad, E. I.; Faltas, M. S.
2018-04-01
An expression for electrophoretic apparent velocity slip in the time-dependent flow of an electrolyte solution saturated in a charged porous medium within an electric double layer adjacent to a dielectric plate under the influence of a tangential uniform electric field is derived. The velocity slip is used as a boundary condition to solve the electrophoretic motion of an impermeable dielectric spherical particle embedded in an electrolyte solution saturated in porous medium under the unsteady Darcy-Brinkman model. Throughout the system, a uniform electric field is applied and maintains with constant strength. Two cases are considered, when the electric double layer enclosing the particle is thin, but finite and when of a particle with a thick double layer. Expressions for the electrophoretic mobility of the particle as functions of the relevant parameters are found. Our results indicate that the time scale for the growth of mobility is significant and small for high permeability. Generally, the effect of the relaxation time for starting electrophoresis is negligible, irrespective of the thickness of the double layer and permeability of the medium. The effects of the elapsed time, permeability, mass density and Debye length parameters on the fluid velocity, the electrophoretic mobility and the acceleration are shown graphically.
DIGE Analysis of Human Tissues.
Gelfi, Cecilia; Capitanio, Daniele
2018-01-01
Two-dimensional difference gel electrophoresis (2-D DIGE) is an advanced and elegant gel electrophoretic analytical tool for comparative protein assessment. It is based on two-dimensional gel electrophoresis (2-DE) separation of fluorescently labeled protein extracts. The tagging procedures are designed to not interfere with the chemical properties of proteins with respect to their pI and electrophoretic mobility, once a proper labeling protocol is followed. The two-dye or three-dye systems can be adopted and their choice depends on specific applications. Furthermore, the use of an internal pooled standard makes 2-D DIGE a highly accurate quantitative method enabling multiple protein samples to be separated on the same two-dimensional gel. The image matching and cross-gel statistical analysis generates robust quantitative results making data validation by independent technologies successful.
Biochemical analysis with microfluidic systems.
Bilitewski, Ursula; Genrich, Meike; Kadow, Sabine; Mersal, Gaber
2003-10-01
Microfluidic systems are capillary networks of varying complexity fabricated originally in silicon, but nowadays in glass and polymeric substrates. Flow of liquid is mainly controlled by use of electroosmotic effects, i.e. application of electric fields, in addition to pressurized flow, i.e. application of pressure or vacuum. Because electroosmotic flow rates depend on the charge densities on the walls of capillaries, they are influenced by substrate material, fabrication processes, surface pretreatment procedures, and buffer additives. Microfluidic systems combine the properties of capillary electrophoretic systems and flow-through analytical systems, and thus biochemical analytical assays have been developed utilizing and integrating both aspects. Proteins, peptides, and nucleic acids can be separated because of their different electrophoretic mobility; detection is achieved with fluorescence detectors. For protein analysis, in particular, interfaces between microfluidic chips and mass spectrometers were developed. Further levels of integration of required sample-treatment steps were achieved by integration of protein digestion by immobilized trypsin and amplification of nucleic acids by the polymerase chain reaction. Kinetic constants of enzyme reactions were determined by adjusting different degrees of dilution of enzyme substrates or inhibitors within a single chip utilizing mainly the properties of controlled dosing and mixing liquids within a chip. For analysis of kinase reactions, however, a combination of a reaction step (enzyme with substrate and inhibitor) and a separation step (enzyme substrate and reaction product) was required. Microfluidic chips also enable separation of analytes from sample matrix constituents, which can interfere with quantitative determination, if they have different electrophoretic mobilities. In addition to analysis of nucleic acids and enzymes, immunoassays are the third group of analytical assays performed in microfluidic chips. They utilize either affinity capillary electrophoresis as a homogeneous assay format, or immobilized antigens or antibodies in heterogeneous assays with serial supply of reagents and washing solutions.
Rosner, A; Maslenin, L; Spiegel, S
1998-09-01
A method based on differences in electrophoretic mobility of RNA transcripts made from polymerase chain reaction (PCR) products was used for differentiation among virus isolates. A T7 RNA polymerase promoter was attached to amplified prunus necrotic ringspot virus (PNRSV) sequences by PCR. The PCR products then served as a template for transcription. Single-stranded transcripts originated from different PNRSV isolates varied in electrophoretic mobility in polyacrylamide gels, presumably because of transcript conformation polymorphism (TCP). This procedure was applied for the differentiation of PNRSV isolates.
Importance of pH-regulated charge density on the electrophoresis of soft particles
NASA Astrophysics Data System (ADS)
Gopmandal, Partha P.; Ohshima, H.
2017-02-01
The present study deals with the electrophoresis of spherical soft particles consisting of an ion and liquid-penetrable but liquid-flow-impenetrable inner core surrounded by an ion and fluid-penetrable polyelectrolyte layer. The inner core is considered to be dielectric and bearing basic functional group coated with polyelectrolyte layer containing acidic functional group. An approximate expression for the electrophoretic mobility of such a particle is obtained under a low potential limit. The electrophoretic behaviour of the undertaken particle is investigated for a wide range of bulk pH values and electrolyte concentrations. Our study also indicates some remarkable features of the electrophoresis e.g., occurrence of zero mobility, mobility reversal etc.
Apparent electric charge of protein molecules. Human thyroxine - binding proteins.
Hocman, G; Sadlon, J
1977-01-01
1. By comparison of electrophoretic mobilities of two different charged particles under the same conditions the net elementary electrostatic charge of one particle could be calculated when the charge of the other is known. 2. The electrophoretic mobility of human thyroxine - binding globulin does not depend upon the concentration of Tris - HCl buffer in the range 0.05 to 0.20 molar. The value of this mobility is 0.078 and 0.083 cm2 vol(-1) hour(-1) at pH 7.0 and 8.6, respectively. 3. The net elementary electrostatic charge of the human thyroxine - binding globulin appears to be approximately 22 negative elementary electrostatic units in mild alkaline solutions.
Duffy, Ciarán F; MacCraith, Brian; Diamond, Dermot; O'Kennedy, Richard; Arriaga, Edgar A
2006-08-01
The analysis of mitochondria by capillary electrophoresis usually takes longer than 20 min per replicate which may compromise the quality of the mitochondria due to degradation. In addition, low sample consumption may be beneficial in the analysis of rare or difficult samples. In this report, we demonstrate the ability to analyze individual mitochondrial events in picoliter-volume samples (approximately 80 pL) taken from a bovine liver preparation using microchip capillary electrophoresis with laser-induced fluorescence detection (micro-chip CE-LIF). Using a commercial "double-T" glass microchip, the sample was electrokinetically loaded in the "double-T" intersection and then subjected to electrophoretic separation along the main separation channel. In order to decrease interactions of mitochondria with channel walls during the analysis, poly(vinyl alcohol) was used as a dynamic coating. This procedure eliminates the need for complicated covalent surface modifications within the channels that were previously used in capillary electrophoresis methods. For analysis, mitochondria, isolated from bovine liver tissue, were selectively labelled using 10-nonyl acridine orange (NAO). The results consist of electropherograms where each mitochondrial event is a narrow spike (240 +/- 44 ms). While the spike intensity is representative of its NAO content, its migration time is used to calculate and describe its electrophoretic mobility, which is a property still largely unexplored for intracellular organelles. The five-fold decrease in separation time (4 min for microchip versus 20 min for capillary electrophoresis) makes microchip electrophoretic separations of organelles a faster, sensitive, low-sample volume alternative for the characterization of individual organelle properties and for investigations of subcellular heterogeneity.
Electrophoretic properties of BSA-coated quantum dots.
Bücking, Wendelin; Massadeh, Salam; Merkulov, Alexei; Xu, Shu; Nann, Thomas
2010-02-01
Low toxic InP/ZnS quantum dots (QDs), ZnS:Mn(2+)/ZnS nanocrystals and CdSe/ZnS nanoparticles were rendered water-dispersible by different ligand-exchange methods. Eventually, they were coated with bovine serum albumin (BSA) as a model protein. All particles were characterised by isotachophoresis (ITP), laser Doppler velocimetry (LDV) and agarose gel electrophoresis. It was found that the electrophoretic mobility and colloidal stability of ZnS:Mn(2+)/ZnS and CdSe/ZnS nanoparticles, which bore short-chain surface ligands, was primarily governed by charges on the nanoparticles, whereas InP/ZnS nanocrystals were not charged per se. BSA-coated nanoparticles showed lower electrophoretic mobility, which was attributed to their larger size and smaller overall charge. However, these particles were colloidally stable. This stability was probably caused by steric stabilisation of the BSA coating.
Electrokinetic Particle Aggregation and Flow Instabilities in Non-Dilute Colloidal Suspensions
NASA Astrophysics Data System (ADS)
Navaneetham, Guru; Posner, Jonathan
2007-11-01
An experimental investigation of electrokinetic particle aggregation and flow instabilities of non-dilute colloidal suspensions in microfabricated channels is presented. The addition of charged colloidal particles can alter the solution's conductivity, permittivity as well as the average particle electrophoretic mobility. In this work, a colloid volume fraction gradient is achieved at the intersection of a Y-shaped PDMS microchannel. The solution conductivity and the particle mobility as a function of the particle (500 nm polystyrene) volume fraction are presented. The critical conditions required for particle aggregation and flow instability are given along with a scaling analysis which shows that the flow becomes unstable at a critical electric Rayleigh number for a wide range of applied electric fields and colloid volume fractions. Electrokinetic particle aggregation and instabilities of non-dilute colloidal suspensions may be important for applications such as the electrophoretic deposition of particles to form micropatterned colloidal assemblies, electrorheological devices, and on-chip, electrokinetic manipulation of colloids.
Influence of phosphate on the transport properties of lead in sand.
Butkus, Michael A; Johnson, Marie C
2011-01-15
Temporal moment analysis was used to examine the transport of lead species in sand columns. The influence of sodium phosphate (PO(4(aq))) and hydroxyapatite (HA) on lead transport was also evaluated. Transport properties of lead microparticles (diameter>0.45 μm) were a function of electrophoretic mobility: those particles with electrophoretic mobility less than -1 × 10(-8)m(2)/Vs exhibited significantly lower dimensionless first temporal moment (θ) and second temporal moment (σ(θ)(2)). The forms of lead investigated in this work had a tendency to move in sand over a wide pH range. Although the PO(4(aq)) amendment substantially reduced lead mass recoveries in the sand column effluent, lead microparticles were formed that had a tendency to move rapidly and with minimal dispersion when compared with controls. Treatments with HA provided limited reduction in lead mass recovery and minimal changes in lead transport properties. A colloid stability model was used to predict attachment of lead particles in sand. Published by Elsevier B.V.
Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.
Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M
2001-11-01
Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.
Deiber, Julio A; Piaggio, Maria V; Peirotti, Marta B
2014-03-01
Several global chain properties of relatively long peptides composed of 20 amino acid residues are estimated through the modeling of their experimental effective electrophoretic mobilities determined by CZE for 2 < pH < 6. In this regard, an all l-α-eicosapeptide, including a secondary α-helix (Peptide 1) and its all retro d-inverso-α-eicosapeptide (Peptide 2), are considered. Despite Peptides 1 and 2 are isomeric chains, they do not present similar global conformations in the whole range of pH studied. These peptides may also differ in the quality of BGE components chain interactions depending on the pH value. Three Peptide 1 fragments (Peptides 3, 4, and 5) are also analyzed in this framework with the following purposes: (i) visualization of the effects of initial and final strands at each side of the α-helix on the global chain conformations of Peptide 1 at different pHs and (ii) analysis of global chain conformations of Peptides 1 and 2, and Peptide 1 fragments in relation to their pI values. Also, the peptide maximum and minimum hydrations predicted by the model, compatible with experimental effective electrophoretic mobilities at different pHs, are quantified and discussed, and needs for further research concerning chain hydration are proposed. It is shown that CZE is a useful analytical tool for peptidomimetic designs and purposes. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Pérez-Pérez, María Esther; Andrés-Garrido, Ascensión; Crespo, José L
2016-01-01
Identification of specific autophagy markers has been fundamental to investigate autophagy as catabolic process. Among them, the ATG8 protein turned out to be one of the most widely used and specific molecular markers of autophagy both in higher and lower eukaryotes. Here, we describe how ATG8 can be used to monitor autophagy in Chlamydomonas and Arabidopsis by western blot analysis.
2013-01-01
Background Sex presents evolutionary costs and benefits, leading to the expectation that the amount of genetic exchange should vary in conditions with contrasting cost-benefit equations. Like eukaryotes, viruses also engage in sex, but the rate of genetic exchange is often assumed to be a relatively invariant property of a particular virus. However, the rates of genetic exchange can vary within one type of virus according to geography, as highlighted by phylogeographic studies of cystoviruses. Here we merge environmental microbiology with experimental evolution to examine sex in a diverse set of cystoviruses, consisting of the bacteriophage ϕ6 and its relatives. To quantify reassortment we manipulated – by experimental evolution – electrophoretic mobility of intact virus particles for use as a phenotypic marker to estimate genetic exchange. Results We generated descendants of ϕ6 that exhibited fast and slow mobility during gel electrophoresis. We identified mutations associated with slow and fast phenotypes using whole genome sequencing and used crosses to establish the production of hybrids of intermediate mobility. We documented natural variation in electrophoretic mobility among environmental isolates of cystoviruses and used crosses against a common fast mobility ϕ6 strain to monitor the production of hybrids with intermediate mobility, thus estimating the amount of genetic exchange. Cystoviruses from different geographic locations have very different reassortment rates when measured against ϕ6, with viruses isolated from California showing higher reassortment rates than those from the Northeastern US. Conclusions The results confirm that cystoviruses from different geographic locations have remarkably different reassortment rates –despite similar genome structure and replication mechanisms– and that these differences are in large part due to sexual reproduction. This suggests that particular viruses may indeed exhibit diverse sexual behavior, but wide geographic sampling, across varying environmental conditions may be necessary to characterize the full repertoire. Variation in reassortment rates can assist in the delineation of viral populations and is likely to provide insight into important viral evolutionary dynamics including the rate of coinfection, virulence, and host range shifts. Electrophoretic mobility may be an indicator of important determinants of fitness and the techniques herein can be applied to the study of other viruses. PMID:24059872
Usrey, Monica L; Nair, Nitish; Agnew, Daniel E; Pina, Cesar F; Strano, Michael S
2007-07-03
The electrophoretic mobilities of single-walled carbon nanotubes (SWNTs) in agarose gels subjected to negatively charged covalent functionalization and noncovalent anionic surfactant adsorption are compared using a simplified hydrodynamic model. Net charges are calculated on the basis of estimated friction coefficients for cylindrical rodlike particles. The effects of functionalization with negatively charged 4-hydroxybenzene diazonium and anionic sodium cholate are quantified and compared with model predictions. The adsorption of Na+ counterions into the nonionic surfactant layer adsorbed on SWNTs (Triton-X-405) is shown to induce a positive charge and reverse the mobility under select conditions. This effect has not been identified or quantified for nanoparticle systems and may be important in the processing of these systems.
Hemoglobin Brigham (α2Aβ2100 Pro→Leu). HEMOGLOBIN VARIANT ASSOCIATED WITH FAMILIAL ERYTHROCYTOSIS
Lokich, Jacob J.; Moloney, William C.; Bunn, H. Franklin; Bruckheimer, Sally M.; Ranney, Helen M.
1973-01-01
Erythrocytosis associated with the presence of a hemoglobin with increased oxygen affinity has been reported for 10 hemoglobin variants, most of which demonstrate altered electrophoretic mobility. Several members of a family were found to have erythrocytosis, and both the whole blood and the hemoglobin exhibited increased oxygen affinity. Phosphate-free hemoglobin solutions had a normal Bohr effect and reactivity to 2,3-diphosphoglycerate. The electrophoretic properties of the hemoglobin were normal, but on peptide mapping of a tryptic digest of the isolated β-chains, a normal βT11 peptide and an abnormal βT11 with greater Rf were seen. Analysis of the abnormal peptide showed the substitution of leucine for the normal proline at β100 (helical residue G2). The hemoglobin variant, designated Hb Brigham, serves to emphasize the necessity for detailed evaluation of the structure and function of hemoglobin in familial erythrocytosis even with electrophoretically “normal” hemoglobin. PMID:4719677
A study of cell electrophoresis as a means of purifying growth hormone secreting cells
NASA Technical Reports Server (NTRS)
Plank, Lindsay D.; Hymer, W. C.; Kunze, M. Elaine; Marks, Gary M.; Lanham, J. Wayne
1983-01-01
Growth hormone secreting cells of the rat anterior pituitary are heavily laden with granules of growth hormone and can be partialy purified on the basis of their resulting high density. Two methods of preparative cell electrophoresis were investigated as methods of enhancing the purification of growth hormone producing cells: density gradient electrophoresis and continuous flow electrophoresis. Both methods provided a two- to four-fold enrichment in growth hormone production per cell relative to that achieved by previous methods. Measurements of electrophoretic mobilities by two analytical methods, microscopic electrophoresis and laser-tracking electrophoresis, revealed very little distinction between unpurified anterior pituitary cell suspensions and somatotroph-enriched cell suspensions. Predictions calculated on the basis of analytical electrophoretic data are consistent with the hypothesis that sedimentation plays a significant role in both types of preparative electrophoresis and the electrophoretic mobility of the growth hormone secreting subpopulation of cells remains unknown.
Investigation of the free flow electrophoretic process. Volume 2: Technical analysis
NASA Technical Reports Server (NTRS)
Weiss, R. A.; Lanham, J. W.; Richman, D. W.; Walker, C. D.
1979-01-01
The effect of gravity on the free flow electrophoretic process was investigated. The demonstrated effects were then compared with predictions made by mathematical models. Results show that the carrier buffer flow was affected by gravity induced thermal convection and that the movement of the separating particle streams was affected by gravity induced buoyant forces. It was determined that if gravity induced buoyant forces were included in the mathematical models, then effective predictions of electrophoresis chamber separation performance were possible. The results of tests performed using various methods of electrophoresis using supportive media show that the mobility and the ability to separate were essentially independent of concentration, providing promise of being able to perform electrophoresis with higher inlet concentrations in space.
Kim, Jong-Yeob; Kim, Hyung-Bae; Jang, Du-Jeon
2013-03-01
Gold nanospheres modified with bifunctional molecules have been separated and characterized by using agarose gel electrophoresis as well as optical spectroscopy and electron microscopy. The electrophoretic mobility of a gold nanosphere capped with 11-mercaptoundecanoic acid (MUA) has been found to depend on the number of MUA molecules per gold nanosphere, indicating that it increases with the surface charge of the nanoparticle. The extinction spectrum of gold nanospheres capped with MUA at an MUA molecules per gold nanosphere value of 1000 and connected via 1,6-hexanedithiol (HDT) decreases by 33% in magnitude and shifts to the red as largely as 22 nm with the increase of the molar ratio of HDT to MUA (R(HM)). Gold nanospheres capped with MUA and connected via HDT have been separated successfully using gel electrophoresis and characterized by measuring reflectance spectra of discrete electrophoretic bands directly in the gel and by monitoring transmission electron microscope images of gold nanoparticles collected from the discrete bands. Electrophoretic mobility has been found to decrease substantially with the increment of HDT to MUA, indicating that the size of aggregated gold nanoparticles increases with the concentration of HDT. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Electrophoretic mobilities of counterions and a polymer in cylindrical pores
Singh, Sunil P.; Muthukumar, M.
2014-01-01
We have simulated the transport properties of a uniformly charged flexible polymer chain and its counterions confined inside cylindrical nanopores under an external electric field. The hydrodynamic interaction is treated by describing the solvent molecules explicitly with the multiparticle collision dynamics method. The chain consisting of charged monomers and the counterions interact electrostatically with themselves and with the external electric field. We find rich behavior of the counterions around the polymer under confinement in the presence of the external electric field. The mobility of the counterions is heterogeneous depending on their location relative to the polymer. The adsorption isotherm of the counterions on the polymer depends nonlinearly on the electric field. As a result, the effective charge of the polymer exhibits a sigmoidal dependence on the electric field. This in turn leads to a nascent nonlinearity in the chain stretching and electrophoretic mobility of the polymer in terms of their dependence on the electric field. The product of the electric field and the effective polymer charge is found to be the key variable to unify our simulation data for various polymer lengths. Chain extension and the electrophoretic mobility show sigmoidal dependence on the electric field, with crossovers from the linear response regime to the nonlinear regime and then to the saturation regime. The mobility of adsorbed counterions is nonmonotonic with the electric field. For weaker and moderate fields, the adsorbed counterions move with the polymer and at higher fields they move opposite to the polymer's direction. We find that the effective charge and the mobility of the polymer decrease with a decrease in the pore radius. PMID:25240366
Jeon, Hyungkook; Kim, Youngkyu; Lim, Geunbae
2016-01-28
In this paper, we introduce pressure-driven flow-induced miniaturizing free-flow electrophoresis (PDF-induced μ-FFE), a novel continuous separation method. In our separation system, the external flow and electric field are applied to particles, such that particle movement is affected by pressure-driven flow, electroosmosis, and electrophoresis. We then analyzed the hydrodynamic drag force and electrophoretic force applied to the particles in opposite directions. Based on this analysis, micro- and nano-sized particles were separated according to their electrophoretic mobilities with high separation efficiency. Because the separation can be achieved in a simple T-shaped microchannel, without the use of internal electrodes, it offers the advantages of low-cost, simple device fabrication and bubble-free operation, compared with conventional μ-FFE methods. Therefore, we expect the proposed separation method to have a wide range of filtering/separation applications in biochemical analysis.
Jeon, Hyungkook; Kim, Youngkyu; Lim, Geunbae
2016-01-01
In this paper, we introduce pressure-driven flow-induced miniaturizing free-flow electrophoresis (PDF-induced μ-FFE), a novel continuous separation method. In our separation system, the external flow and electric field are applied to particles, such that particle movement is affected by pressure-driven flow, electroosmosis, and electrophoresis. We then analyzed the hydrodynamic drag force and electrophoretic force applied to the particles in opposite directions. Based on this analysis, micro- and nano-sized particles were separated according to their electrophoretic mobilities with high separation efficiency. Because the separation can be achieved in a simple T-shaped microchannel, without the use of internal electrodes, it offers the advantages of low-cost, simple device fabrication and bubble-free operation, compared with conventional μ-FFE methods. Therefore, we expect the proposed separation method to have a wide range of filtering/separation applications in biochemical analysis. PMID:26819221
Probing size-dependent electrokinetics of hematite aggregates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kedra-Królik, Karolina; Rosso, Kevin M.; Zarzycki, Piotr
Aqueous particle suspensions of many kinds are stabilized by the electrostatic potential developed at their surfaces from reaction with water and ions. An important and less well understood aspect of this stabilization is the dependence of the electrostatic surface potential on particle size. Surface electrostatics are typically probed by measuring particle electrophoretic mobilities and quantified in the electrokinetic potential (f), using commercially available Zeta Potential Analyzers (ZPA). Even though ZPAs provide frequency-spectra (histograms) of electrophoretic mobility and hydrodynamic diameter, typically only the maximal-intensity values are reported, despite the information in the remainder of the spectra. Here we propose a mappingmore » procedure that inter-correlates these histograms to extract additional insight, in this case to probe particle size-dependent electrokinetics. Our method is illustrated for a suspension of prototypical iron (III) oxide (hematite, a-Fe2O3). We found that the electrophoretic mobility and f-potential are a linear function of the aggregate size. By analyzing the distribution of surface site types as a function of aggregate size we show that site coordination increases with increasing aggregate diameter. This observation explains why the acidity of the iron oxide particles decreases with increasing particle size.« less
Siderosomal ferritin. The missing link between ferritin and haemosiderin?
Andrews, S C; Treffry, A; Harrison, P M
1987-01-01
A minor electrophoretically fast component was found in ferritin from iron-loaded rat liver in addition to a major electrophoretically slow ferritin similar to that observed in control rats. The electrophoretically fast ferritin showed immunological identity with the slow component, but on electrophoresis in SDS it gave a peptide of 17.3 kDa, in contrast with the electrophoretically slow ferritin, which gave a major band corresponding to the L-subunit (20.7 kDa). Thus the electrophoretically fast ferritin resembles that reported by Massover [(1985) Biochim. Biophys. Acta 829, 377-386] in livers of mice with short-term parenteral iron overload. The electrophoretically fast ferritin had a lower iron content (2000 Fe atoms/molecule) than the electrophoretically slow ferritin (3000 Fe atoms/molecule). Removal and re-incorporation of iron was possible without effect on the electrophoretic mobility of either ferritin species. On subcellular fractionation the electrophoretically fast ferritin was enriched in pellet fractions and was the sole soluble ferritin isolated from iron-laden secondary lysosomes (siderosomes). The amount and relative proportion of the electrophoretically fast species increased with iron loading. Haemosiderin isolated from siderosomes was found to contain a peptide reactive to anti-ferritin serum and corresponding to the 17.3 kDa peptide of the electrophoretically fast ferritin species. Unlike the electrophoretically slow ferritin, the electrophoretically fast ferritin did not become significantly radioactive in a 1 h biosynthetic labelling experiment. We conclude that the minor ferritin is not, as has been suggested for mouse liver ferritin, 'a completely new species of smaller holoferritin that represents a shift in the ferritin phenotype' in response to siderosis, but a precursor of haemosiderin, in agreement with the proposal by Richter [(1984) Lab. Invest. 50, 26-35] concerning siderosomal ferritin. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3663170
Makino, K
1997-01-01
The electrical surface properties of biological cells have been studied, which provided us with the fundamental knowledge about the cell surface. The change in shape or biological functions of cells may affect the surface properties and can be detected by electrokinetic measurements. Biological cell surfaces are covered with polysaccharide chains, some are charged and some are not. Some polysaccharides produce a hydrogel matrixes under a proper condition. We thus consider it reasonable that cell surface is approximated by a hydrogel surface. Electrophoretic mobility measurements are useful for studying the surface properties of biological cells suspended as colloidal particles in an electrolyte solution. The electro-osmotic velocity measurements on the other hand are advantageous to the study of the surface properties of slab-shaped biological systems such as membranes. This work was started with a hydrogel, as a model material. As a hydrogel, poly(N-isopropylacrylamide) poly(NIPAAm), abbreviated as hereafter, was chosen, because this hydrogel changes its volume depending on temperature. The dependence of the electrophoretic mobility of latex particles covered with poly(NIPAAm) hydrogel layer or of the electro-osmotic mobility on poly(NIPAAm) plate upon temperature and ionic strength of the dispersing medium was well explained with an electrophoretic mobility formula for "soft particles" developed by Ohshima. The electrokinetic measurements and the explanation of data with an electrophoretic mobility formula for "soft particles" give us information about the surface charge density and the "softness" of soft surfaces. On the basis of the findings with hydrogels, we have discussed the relationship between the changes in shape or function of the biological cells and the change in physicochemical surface properties using these measurements. To study the change in physicochemical properties of the cell surface caused by apoptosis, we have measured the electrophoretic mobilities of intact and apoptotic human promyelocytic leukemia cell lines, HL-60RG cells. We have also studied the differences observed in surface properties of malignant lymphosarcoma cell line, RAW117-P, and its variant, RAW117-H10, with a high metastatic property to the liver. In both cases, the cell surfaces became softer by the changes of biological functions. We have applied electrophoresis and electro-osmosis measurements to the study of the electrokinetic surface properties of rat basophilic leukemia cells, RBL cells. It was also found that the surface of Human umbilical vein endothelial cells, HUVEC, is considerably soft as compared with those of other biological cells we have studied before.
An agarose gel electrophoretic method for analysis of hyaluronan molecular weight distribution.
Lee, H G; Cowman, M K
1994-06-01
An electrophoretic method is described for determining the molecular weight distribution of hyaluronan (HA). The method involves separation of HA by electrophoresis on a 0.5% agarose gel, followed by detection of HA using the cationic dye Stains-All (3,3'-dimethyl-9-methyl-4,5,4'5'-dibenzothiacarbocyanine). The recommended sample load is 7 micrograms. Calibration of the method with HA standards of known molecular weight has established a linear relationship between electrophoretic mobility and the logarithm of the weight-average molecular weight over the range of approximately 0.2-6 x 10(6). The separated HA pattern may also be visualized after electrotransfer of HA from the agarose gel to a nylon membrane. The membrane may be stained with the dye alcian blue. Alternatively, specific detection of HA from impure samples can be achieved by probing the nylon membrane with biotin-labeled HA-binding protein and subsequent interaction with a streptavidin-linked gold reagent and silver staining for amplification. The electrophoretic method was used to analyze HA in two different liquid connective tissues. Normal human knee joint synovial fluid showed a narrow HA molecular weight distribution, with a peak at 6-7 x 10(6). Owl monkey vitreous HA also showed a narrow molecular weight distribution, with a peak at 5-6 x 10(6). These results agree well with available published data and indicate the applicability of the method to the analysis of impure HA samples which may be available in limited amounts.
Hsieh, Yi-Wen; Alqadah, Amel; Chuang, Chiou-Fen
2016-11-29
Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. Radioactivity has been the predominant method of DNA labeling in EMSAs. However, recent advances in fluorescent dyes and scanning methods have prompted the use of fluorescent tagging of DNA as an alternative to radioactivity for the advantages of easy handling, saving time, reducing cost, and improving safety. We have recently used fluorescent EMSA (fEMSA) to successfully address an important biological question. Our fEMSA analysis provides mechanistic insight into the effect of a missense mutation, G73E, in the highly conserved HMG transcription factor SOX-2 on olfactory neuron type diversification. We found that mutant SOX-2 G73E protein alters specific DNA binding activity, thereby causing olfactory neuron identity transformation. Here, we present an optimized and cost-effective step-by-step protocol for fEMSA using infrared fluorescent dye-labeled oligonucleotides containing the LIM-4/SOX-2 adjacent target sites and purified SOX-2 proteins (WT and mutant SOX-2 G73E proteins) as a biological example.
Sant, Himanshu J; Chakravarty, Siddharth; Merugu, Srinivas; Ferguson, Colin G; Gale, Bruce K
2012-10-02
Characterization of polymerized liposomes (PolyPIPosomes) was carried out using a combination of normal dc electrical field-flow fractionation and cyclical electrical field-flow fractionation (CyElFFF) as an analytical technique. The constant nature of the carrier fluid and channel configuration for this technique eliminates many variables associated with multidimensional analysis. CyElFFF uses an oscillating field to induce separation and is performed in the same channel as standard dc electrical field-flow fractionation separation. Theory and experimental methods to characterize nanoparticles in terms of their sizes and electrophoretic mobilities are discussed in this paper. Polystyrene nanoparticles are used for system calibration and characterization of the separation performance, whereas polymerized liposomes are used to demonstrate the applicability of the system to biomedical samples. This paper is also the first to report separation and a higher effective field when CyElFFF is operated at very low applied voltages. The technique is shown to have the ability to quantify both particle size and electrophoretic mobility distributions for colloidal polystyrene nanoparticles and PolyPIPosomes.
Optimal MEMS device for mobility and zeta potential measurements using DC electrophoresis.
Karam, Pascal R; Dukhin, Andrei; Pennathur, Sumita
2017-05-01
We have developed a novel microchannel geometry that allows us to perform simple DC electrophoresis to measure the electrophoretic mobility and zeta potential of analytes and particles. In standard capillary geometries, mobility measurements using DC fields are difficult to perform. Specifically, measurements in open capillaries require knowledge of the hard to measure and often dynamic wall surface potential. Although measurements in closed capillaries eliminate this requirement, the measurements must be performed at infinitesimally small regions of zero flow where the pressure driven-flow completely cancels the electroosmotic flow (Komagata Planes). Furthermore, applied DC fields lead to electrode polarization, further questioning the reliability and accuracy of the measurement. In contrast, our geometry expands and moves the Komagata planes to where velocity gradients are at a minimum, and thus knowledge of the precise location of a Komagata plane is not necessary. Additionally, our microfluidic device prevents electrode polarization because of fluid recirculation around the electrodes. We fabricated our device using standard MEMS fabrication techniques and performed electrophoretic mobility measurements on 500 nm fluorescently tagged polystyrene particles at various buffer concentrations. Results are comparable to two different commercial dynamic light scattering based particle sizing instruments. We conclude with guidelines to further develop this robust electrophoretic tool that allows for facile and efficient particle characterization. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Free-zone electrophoresis of animal cells. 1: Experiments on cell-cell interactions
NASA Technical Reports Server (NTRS)
Todd, P. W.; Hjerten, S.
1985-01-01
The electrophoretically migrating zones wasa monitored. The absence of fluid flows in the direction of migration permits direct measurement of electrophoretic velocities of any material. Sedimentation is orthogonal to electrokinetic motion and the effects of particle-particle interaction on electrophoretic mobility is studied by free zone electrophoresis. Fixed erythrocytes at high concentrations, mixtures of fixed erythrocytes from different animal species, and mixtures of cultured human cells were studied in low ionic strength buffers. The electrophoretic velocity of fixed erythrocytes was not altered by increasing cell concentration or by the mixing of erythrocytes from different species. When zones containing cultured human glial cells and neuroblastoma cells are permitted to interact during electrophoresis, altered migration patterns occur. It is found that cell-cell interactions depends upon cell type.
Kerékgyártó, Márta; Járvás, Gábor; Novák, Levente; Guttman, András
2016-02-01
The activation energy related to the electromigration of oligosaccharides can be determined from their measured electrophoretic mobilities at different temperatures. The effects of a viscosity modifier (ethylene glycol) and a polymeric additive (linear polyacrylamide) on the electrophoretic mobility of linear sugar oligomers with α1-4 linked glucose units (maltooligosaccharides) were studied in CE using the activation energy concept. The electrophoretic separations of 8-aminopyrene-1,3,6-trisulfonate-labeled maltooligosaccharides were monitored by LIF detection in the temperature range of 20-50°C, using either 0-60% ethylene glycol (viscosity modifier) or 0-3% linear polyacrylamide (polymeric additive) containing BGEs. Activation energy curves were constructed based on the slopes of the Arrhenius plots. With the use of linear polyacrylamide additive, solute size-dependent activation energy variations were found for the maltooligosaccharides with polymerization degrees below and above maltoheptaose (DP 7), probably due to molecular conformation changes and possible matrix interaction effects. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin...
21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin...
21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin...
21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin...
21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin...
Startup of electrophoresis in a suspension of colloidal spheres.
Chiang, Chia C; Keh, Huan J
2015-12-01
The transient electrophoretic response of a homogeneous suspension of spherical particles to the step application of an electric field is analyzed. The electric double layer encompassing each particle is assumed to be thin but finite, and the effect of dynamic electroosmosis within it is incorporated. The momentum equation for the fluid outside the double layers is solved through the use of a unit cell model. Closed-form formulas for the time-evolving electrophoretic and settling velocities of the particles in the Laplace transform are obtained in terms of the electrokinetic radius, relative mass density, and volume fraction of the particles. The time scale for the development of electrophoresis and sedimentation is significantly smaller for a suspension with a higher particle volume fraction or a smaller particle-to-fluid density ratio, and the electrophoretic mobility at any instant increases with an increase in the electrokinetic particle radius. The transient electrophoretic mobility is a decreasing function of the particle volume fraction if the particle-to-fluid density ratio is relatively small, but it may increase with an increase in the particle volume fraction if this density ratio is relatively large. The particle interaction effect in a suspension on the transient electrophoresis is much weaker than that on the transient sedimentation of the particles. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Nanolaminate microfluidic device for mobility selection of particles
Surh, Michael P [Livermore, CA; Wilson, William D [Pleasanton, CA; Barbee, Jr., Troy W.; Lane, Stephen M [Oakland, CA
2006-10-10
A microfluidic device made from nanolaminate materials that are capable of electrophoretic selection of particles on the basis of their mobility. Nanolaminate materials are generally alternating layers of two materials (one conducting, one insulating) that are made by sputter coating a flat substrate with a large number of layers. Specific subsets of the conducting layers are coupled together to form a single, extended electrode, interleaved with other similar electrodes. Thereby, the subsets of conducting layers may be dynamically charged to create time-dependent potential fields that can trap or transport charge colloidal particles. The addition of time-dependence is applicable to all geometries of nanolaminate electrophoretic and electrochemical designs from sinusoidal to nearly step-like.
High-concentration zeta potential measurements using light-scattering techniques
Kaszuba, Michael; Corbett, Jason; Watson, Fraser Mcneil; Jones, Andrew
2010-01-01
Zeta potential is the key parameter that controls electrostatic interactions in particle dispersions. Laser Doppler electrophoresis is an accepted method for the measurement of particle electrophoretic mobility and hence zeta potential of dispersions of colloidal size materials. Traditionally, samples measured by this technique have to be optically transparent. Therefore, depending upon the size and optical properties of the particles, many samples will be too concentrated and will require dilution. The ability to measure samples at or close to their neat concentration would be desirable as it would minimize any changes in the zeta potential of the sample owing to dilution. However, the ability to measure turbid samples using light-scattering techniques presents a number of challenges. This paper discusses electrophoretic mobility measurements made on turbid samples at high concentration using a novel cell with reduced path length. Results are presented on two different sample types, titanium dioxide and a polyurethane dispersion, as a function of sample concentration. For both of the sample types studied, the electrophoretic mobility results show a gradual decrease as the sample concentration increases and the possible reasons for these observations are discussed. Further, a comparison of the data against theoretical models is presented and discussed. Conclusions and recommendations are made from the zeta potential values obtained at high concentrations. PMID:20732896
Dissipative particle dynamics: Effects of thermostating schemes on nano-colloid electrophoresis
NASA Astrophysics Data System (ADS)
Hassanzadeh Afrouzi, Hamid; Moshfegh, Abouzar; Farhadi, Mousa; Sedighi, Kurosh
2018-05-01
A novel fully explicit approach using dissipative particle dynamics (DPD) method is introduced in the present study to model the electrophoretic transport of nano-colloids in an electrolyte solution. Slater type charge smearing function included in 3D Ewald summation method is employed to treat electrostatic interaction. Performance of various thermostats are challenged to control the system temperature and study the dynamic response of colloidal electrophoretic mobility under practical ranges of external electric field (0 . 072 < E < 0 . 361 v/nm) covering linear to non-linear response regime, and ionic salt concentration (0.049 < SC < 0 . 69 [M]) covering weak to strong Debye screening of the colloid. System temperature and electrophoretic mobility both show a direct and inverse relationships respectively with electric field and colloidal repulsion; although they each respectively behave direct and inverse trends with salt concentration under various thermostats. Nosé-Hoover-Lowe-Andersen and Lowe-Andersen thermostats are found to function more effectively under high electric fields (E > 0 . 145[v/nm ]) while thermal equilibrium is maintained. Reasonable agreements are achieved by benchmarking the system radial distribution function with available EW3D modellings, as well as comparing reduced mobility against conventional Smoluchowski and Hückel theories, and numerical solution of Poisson-Boltzmann equation.
Asensi-Bernardi, Lucía; Escuder-Gilabert, Laura; Martín-Biosca, Yolanda; Sagrado, Salvador; Medina-Hernández, María José
2014-01-01
The estimation of apparent binding constants and limit mobilities of the complexes of the enantiomers that characterize the interaction of enantiomers with chiral selectors, in this case highly sulfated β-cyclodextrin, was approached using a simple and economic electrophoretic modality, the complete filling technique (CFT) in counter-current mode. The enantiomers of eight psychoactive drugs, four antihistamines (dimethindene, promethazine, orphenadrine and terfenadine) and four antidepressants (bupropion, fluoxetine, nomifensine and viloxazine) were separated for the first time for this cyclodextrin (CD). Estimations of thermodynamic and electrophoretic enantioselectivies were also performed. Results indicate that, in general, thermodynamic enantioselectivity is the main component explaining the high resolution found, but also one case suggests that electrophoretic enantioselectivity itself is enough to obtain a satisfactory resolution. CFT results advantageous compared with conventional capillary electrophoresis (CE) and partial filling technique (PFT) for the study of the interaction between drugs and chiral selectors. It combines the use of a simple fitting model (as in CE), when the enantiomers do not exit the chiral selector plug during the separation (i.e. mobility of electroosmotic flow larger than mobility of CD), and drastic reduction of the consumption (and cost; ~99.7%) of the CD reagent (as in PFT) compared with the conventional CE. Copyright © 2013 John Wiley & Sons, Ltd.
Hisanaga, S; Yasugawa, S; Yamakawa, T; Miyamoto, E; Ikebe, M; Uchiyama, M; Kishimoto, T
1993-06-01
The dephosphorylation-induced interaction of neurofilaments (NFs) with microtubules (MTs) was investigated by using several phosphatases. Escherichia coli alkaline and wheat germ acid phosphatases increased the electrophoretic mobility of NF-H and NF-M by dephosphorylation, and induced the binding of NF-H to MTs. The binding of NFs to MTs was observed only after the electrophoretic mobility of NF-H approached the exhaustively dephosphorylated level when alkaline phosphatase was used. The number of phosphate remaining when NF-H began to bind to MTs was estimated by measuring phosphate bound to NF-H. NF-H did not bind to MTs even when about 40 phosphates from the total of 51 had been removed by alkaline phosphatase. The removal of 6 further phosphates finally resulted in the association of NF-H with MTs. A similar finding, that the restricted phosphorylation sites in the NF-H tail domain, but not the total amount of phosphates, were important for binding to MTs, was also obtained with acid phosphatases. In contrast to alkaline and acid phosphatases, four classes of protein phosphatases (protein phosphatases 1, 2A, 2B, and 2C) were ineffective for shifting the electrophoretic mobility of NF proteins and for inducing the association of NFs to MTs.
Electrophoretic Mobility Shift Assay (EMSA) for Detecting Protein-Nucleic Acid Interactions
Hellman, Lance M.; Fried, Michael G.
2009-01-01
The gel electrophoresis mobility shift assay (EMSA) is used to detect protein complexes with nucleic acids. It is the core technology underlying a wide range of qualitative and quantitative analyses for the characterization of interacting systems. In the classical assay, solutions of protein and nucleic acid are combined and the resulting mixtures are subjected to electrophoresis under native conditions through polyacrylamide or agarose gel. After electrophoresis, the distribution of species containing nucleic acid is determined, usually by autoradiography of 32P-labeled nucleic acid. In general, protein-nucleic acid complexes migrate more slowly than the corresponding free nucleic acid. In this article, we identify the most important factors that determine the stabilities and electrophoretic mobilities of complexes under assay conditions. A representative protocol is provided and commonly used variants are discussed. Expected outcomes are briefly described. References to extensions of the method and a troubleshooting guide are provided. PMID:17703195
NASA Technical Reports Server (NTRS)
Morrison, D. R.; Lewis, M. L.; Barlow, G. H.; Todd, P. W.; Kunze, M. E.; Sarnoff, B. E.; Li, Z. K.
1985-01-01
Suspensions of cultured primary human embryonic kidney cells were subjected to continuous flow electrophoresis on Space Shuttle flight STS-8. The objectives of the experiments were to obtain electrophoretically separated fractions of the original cell populations and to test these fractions for the amount and kind of urokinase (a kidney plasminogen activator that is used medically for digesting blood clots), the morphologies of cells in the individual fractions, and their cellular electrophoretic mobilities after separation and subsequent proliferation. Individual fractions were successfully cultured after return from orbit, and they were found to differ substantially from one another and from the starting sample with respect to all of these properties.
Electrokinetic properties of polymer colloids
NASA Technical Reports Server (NTRS)
Micale, F. J.; Fuenmayor, D. Y.
1986-01-01
The surface of polymer colloids, especially polystyrene latexes, were modified for the purpose of controlling the electrokinetic properties of the resulting colloids. Achievement required a knowledge of electrical double layer charging mechanism, as a function of the electrolyte conditions, at the polymer/water interface. The experimental approach is to control the recipe formulation in the emulsion polymerization process so as to systematically vary the strong acid group concentration on the surface of the polymer particles. The electrophoretic mobility of these model particles will then be measured as a function of surface group concentration and as a function of electrolyte concentration and type. An effort was also made to evaluate the electrophoretic mobility of polystyrene latexes made in space and to compare the results with latexes made on the ground.
Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj
2011-10-01
The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.
Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S
2011-01-01
The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373
NASA Astrophysics Data System (ADS)
Sun, Cui; Feng, Ya-Qing; Zhang, Bao; Li, Xiang-Gao; Shao, Ji-Zhou; Han, Jing-Jing; Chen, Xu
2013-05-01
The use of Isopar M as a liquid suspending fluid for electrophoretic display was studied. The dispersion stability and chargeability of pigments suspended in Isopar M were investigated. Polyisobutylene monosuccinimide (T-151) as the charge control additive in Isopar M electrophoretic fluid can provide a good electrophoretic mobility to the particles. The wall materials of a series of blue-white, red-white and yellow-white dual-particle microcapsules were prepared by in situ polymerization of urea and formaldehyde. The mass ratio of wall/core material was a key factor in influencing the yield of microcapsules. The concentration of resorcinol has an impact on the surface morphology and mechanical strength of microcapsule wall. Microcapsules' surface morphologies were characterized by optical microscopy and scanning electron microscopy. The performance of the microcapsules with different binder materials and adhesive layers were investigated. Contrast ratio of microcapsules display device were tested every 10 days for a period of 90 days. The compatibility of Isopar M with both the electrophoretic particles and bounding capsule was studied.
Quantification of Cysteinyl-S-Nitrosylation by Fluorescence in Unbiased Proteomic Studies*
Wiktorowicz, John E.; Stafford, Susan; Rea, Harriet; Urvil, Petri; Soman, Kizhake; Kurosky, Alexander; Perez-Polo, J. Regino; Savidge, Tor C.
2011-01-01
Cysteinyl-S-nitrosylation has emerged as an important post-translational modification affecting protein function in health and disease. Great emphasis has been placed on global, unbiased quantification of S-nitrosylated proteins due to physiologic and oxidative stimuli. However, current strategies have been hampered by sample loss and altered protein electrophoretic mobility. Here, we describe a novel quantitative approach that combines accurate, sensitive fluorescence modification of cysteine S-nitrosylation that leaves electrophoretic mobility unaffected (SNOFlo), and introduce unique concepts for measuring changes in S-nitrosylation status relative to protein abundance. Its efficacy in defining the functional S-nitrosoproteome is demonstrated in two diverse biological applications: an in vivo rat hypoxia-ischemia reperfusion model, and antimicrobial S-nitrosoglutathione-driven transnitrosylation of an enteric microbial pathogen. The suitability of this approach for investigating endogenous S-nitrosylation is further demonstrated using Ingenuity Pathways analysis that identified nervous system and cellular development networks as the top two networks. Functional analysis of differentially S-nitrosylated proteins indicated their involvement in apoptosis, branching morphogenesis of axons, cortical neurons, and sympathetic neurites, neurogenesis, and calcium signaling. Major abundance changes were also observed for fibrillar proteins known to be stress-responsive in neurons and glia. Thus, both examples demonstrate the technique’s power in confirming the widespread involvement of S-nitrosylation in hypoxia-ischemia/reperfusion injury and in antimicrobial host responses. PMID:21615140
NASA Astrophysics Data System (ADS)
Brans, Toon; Strubbe, Filip; Schreuer, Caspar; Neyts, Kristiaan; Beunis, Filip
2015-06-01
We present a novel approach for label-free concentration measurement of a specific protein in a solution. The technique combines optical tweezers and microelectrophoresis to establish the electrophoretic mobility of a single microparticle suspended in the solution. From this mobility measurement, the amount of adsorbed protein on the particle is derived. Using this method, we determine the concentration of avidin in a buffer solution. After calibration of the setup, which accounts for electro-osmotic flow in the measurement device, the mobilities of both bare and biotinylated microspheres are measured as a function of the avidin concentration in the mixture. Two types of surface adsorption are identified: the biotinylated particles show specific adsorption, resulting from the binding of avidin molecules with biotin, at low avidin concentrations (below 0.04 μg/ml) while at concentrations of several μg/ml non-specific on both types of particles is observed. These two adsorption mechanisms are incorporated in a theoretical model describing the relation between the measured mobility and the avidin concentration in the mixture. This model describes the electrophoretic mobility of these particles accurately over four orders of magnitude of the avidin concentration.
Bayoumi, R A; Nur-E-Kamal, M S; Tadayyon, M; Mohamed, K K; Mahboob, B H; Qureshi, M M; Lakhani, M S; Awaad, M O; Kaeda, J; Vulliamy, T J; Luzzatto, L
1996-01-01
In a cross-sectional study, the activity, electrophoretic mobility and genotypes of glucose-6-phosphate dehydrogenase (G6PD) were determined among healthy, UAE national school boys from Al-Ain District in the United Arab Emirates, The prevalence of G6PD deficiency in this population sample was 11%. The majority of G6PD-deficient subjects were descendants of Omani, Baluchi or Yemeni migrants. Of 18 deficient subjects, 16 had an enzyme activity of < 10% of normal while 2 had an activity of just above 10%. Electrophoresis was performed on 166 samples and showed that, apart from deficient samples, all had the normal mobility of G6PD type B. Of the 18 deficient subjects, 14 had the B type mobility of G6PD Mediterranean and 4 had the A type mobility of G6PD A-. Genotyping demonstrated that 10 had the Mediterranean mutation while 3 had the A- mutation, consistent with their electrophoretic mobility. Another 3 had the G6PD Aures mutation, recently described as polymorphic in Algeria and Spain. The mutations in the remaining 2 subjects have not yet been identified.
Viviano, Jeffrey; Krishnan, Anuradha; Wu, Hao; Venkataraman, Venkat
2016-02-01
In proteins of the neuronal calcium sensor (NCS) family, changes in structure as well as function are brought about by the binding of calcium. In this article, we demonstrate that these structural changes, solely due to calcium binding, can be assessed through electrophoresis in native gels. The results demonstrate that the NCS proteins undergo ligand-dependent conformational changes that are detectable in native gels as a gradual decrease in mobility with increasing calcium but not other tested divalent cations such as magnesium, strontium, and barium. Surprisingly, such a gradual change over the entire tested range is exhibited only by the NCS proteins but not by other tested calcium-binding proteins such as calmodulin and S100B, indicating that the change in mobility may be linked to a unique NCS family feature--the calcium-myristoyl switch. Even within the NCS family, the changes in mobility are characteristic of the protein, indicating that the technique is sensitive to the individual features of the protein. Thus, electrophoretic mobility on native gels provides a simple and elegant method to investigate calcium (small ligand)-induced structural changes at least in the superfamily of NCS proteins. Copyright © 2015 Elsevier Inc. All rights reserved.
Genetic and developmental variation of hemoglobin in the deermouse, Peromyscus maniculatus.
Maybank, K M; Dawson, W D
1976-04-01
A genetic investigation of electrophoretic hemoglobin variants of the deermouse, Peromyscus maniculatus, shows three alleles, Hblf, Hblr, and Hblo, at a duplicated site controlling the six adult phenotypes. The Hblf allele has not been described previously. The hemoglobin locus is not closely linked to the albino locus. Fetal hemoglobin is distinct from any of the adult components and has a slower electrophoretic mobility. The fetal phenotype changes to the adult type between the days 15 and 18 of prenatal life.
Silica-coated titania and zirconia colloids for subsurface transport field experiments
Ryan, Joseph N.; Elimelech, Menachem; Baeseman, Jenny L.; Magelky, Robin D.
2000-01-01
Silica-coated titania (TiO2) and zirconia (ZrO2) colloids were synthesized in two sizes to provide easily traced mineral colloids for subsurface transport experiments. Electrophoretic mobility measurements showed that coating with silica imparted surface properties similar to pure silica to the titania and zirconia colloids. Measurements of steady electrophoretic mobility and size (by dynamic light scattering) over a 90-day period showed that the silica-coated colloids were stable to aggregation and loss of coating. A natural gradient field experiment conducted in an iron oxide-coated sand and gravel aquifer also showed that the surface properties of the silica-coated colloids were similar. Colloid transport was traced at μg L-1 concentrations by inductively coupled plasma-atomic emission spectroscopy measurement of Ti and Zr in acidified samples.
Separability of electrostatic and hydrodynamic forces in particle electrophoresis
NASA Astrophysics Data System (ADS)
Todd, Brian A.; Cohen, Joel A.
2011-09-01
By use of optical tweezers we explicitly measure the electrostatic and hydrodynamic forces that determine the electrophoretic mobility of a charged colloidal particle. We test the ansatz of O'Brien and White [J. Chem. Soc. Faraday IIJCFTBS0300-923810.1039/f29787401607 74, 1607 (1978)] that the electrostatically and hydrodynamically coupled electrophoresis problem is separable into two simpler problems: (1) a particle held fixed in an applied electric field with no flow field and (2) a particle held fixed in a flow field with no applied electric field. For a system in the Helmholtz-Smoluchowski and Debye-Hückel regimes, we find that the electrostatic and hydrodynamic forces measured independently accurately predict the electrophoretic mobility within our measurement precision of 7%; the O'Brien and White ansatz holds under the conditions of our experiment.
Sadek, Samir H.; Pimenta, Francisco; Pinho, Fernando T.
2017-01-01
In this work, we explore two methods to simultaneously measure the electroosmotic mobility in microchannels and the electrophoretic mobility of micron‐sized tracer particles. The first method is based on imposing a pulsed electric field, which allows to isolate electrophoresis and electroosmosis at the startup and shutdown of the pulse, respectively. In the second method, a sinusoidal electric field is generated and the mobilities are found by minimizing the difference between the measured velocity of tracer particles and the velocity computed from an analytical expression. Both methods produced consistent results using polydimethylsiloxane microchannels and polystyrene micro‐particles, provided that the temporal resolution of the particle tracking velocimetry technique used to compute the velocity of the tracer particles is fast enough to resolve the diffusion time‐scale based on the characteristic channel length scale. Additionally, we present results with the pulse method for viscoelastic fluids, which show a more complex transient response with significant velocity overshoots and undershoots after the start and the end of the applied electric pulse, respectively. PMID:27990654
NASA Astrophysics Data System (ADS)
Noel, Amélie; Mirbel, Déborah; Cloutet, Eric; Fleury, Guillaume; Schatz, Christophe; Navarro, Christophe; Hadziioannou, Georges; CyrilBrochon
2018-01-01
In order to obtain efficient electrophoretic inks, Tridodecylamine (Dod3N), has been studied as charge control agent (CCA) in a non-polar paraffin solvent (Isopar G) for various inorganic pigments (TiO2 and Fe2O3). All hydrophobic mineral oxides, i.e. treated with octyltrimethoxysilane (C8) or dodecyltrimethoxysilane (C12), were found to be negatively charged in presence of Dod3N. The electrophoretic mobilities of inorganic pigments seemed to be strongly dependent of their isoelectric point (IEP) and also of the concentration of dod3N with an optimum range between 10 and 20 mM depending on the pigments. Finally, an electrophoretic ink constituted of hydrophobic mineral oxides in presence of Dod3N was tested in a device. Its efficiency as charge control agent to negatively charge hydrophobic particles was confirmed through good optical properties and fast response time (220 ms at 200 kV m-1).
NASA Technical Reports Server (NTRS)
Plank, L. D.; Kunze, M. E.; Todd, P. W.
1985-01-01
Cultured mouse leukemia cells line L5178Y were subjected to upward electrophoresis in a density gradient and the slower migrating cell populations were enriched in G2 cells. It is indicated that this cell line does not change electrophoretic mobility through the cell cycle. The possibility that increased sedimentation downward on the part of the larger G2 cells caused this separation was explored. Two different cell populations were investigated. The log phase population was found to migrate upward faster than the G2 population, and a similar difference between their velocities and calculated on the basis of a 1 um diameter difference between the two cell populations. The G2 and G1 enriched populations were isolated by Ficoll density gradient sedimentation. The bottom fraction was enriched in G2 cells and the top fraction was enriched with G1 cells, especially when compared with starting materials. The electrophoretic mobilities of these two cell populations did not differ significantly from one another. Cell diameter dependent migration curves were calculated and were found to be different. Families of migration curves that differ when cell size is considered as a parameter are predicted.
Qian, Cheng; Kovalchik, Kevin A; MacLennan, Matthew S; Huang, Xiaohua; Chen, David D Y
2017-06-01
Capillary electrophoresis frontal analysis (CE-FA) can be used to determine binding affinity of molecular interactions. However, its current data processing method mandate specific requirement on the mobilities of the binding pair in order to obtain accurate binding constants. This work shows that significant errors are resulted when the mobilities of the interacting species do not meet these requirements. Therefore, the applicability of CE-FA in many real word applications becomes questionable. An electrophoretic mobility-based correction method is developed in this work based on the flux of each species. A simulation program and a pair of model compounds are used to verify the new equations and evaluate the effectiveness of this method. Ibuprofen and hydroxypropyl-β-cyclodextrinare used to demonstrate the differences in the obtained binding constant by CE-FA when different calculation methods are used, and the results are compared with those obtained by affinity capillary electrophoresis (ACE). The results suggest that CE-FA, with the mobility-based correction method, can be a generally applicable method for a much wider range of applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Duval, Jérôme F L; Slaveykova, Vera I; Hosse, Monika; Buffle, Jacques; Wilkinson, Kevin J
2006-10-01
The electrostatic, hydrodynamic and conformational properties of aqueous solutions of succinoglycan have been analyzed by fluorescence correlation spectroscopy (FCS), proton titration, and capillary electrophoresis (CE) over a large range of pH values and electrolyte (NaCl) concentrations. Using the theoretical formalism developed previously for the electrokinetic properties of soft, permeable particles, a quantitative analysis for the electro-hydrodynamics of succinoglycan is performed by taking into account, in a self-consistent manner, the measured values of the diffusion coefficients, electric charge densities, and electrophoretic mobilities. For that purpose, two limiting conformations for the polysaccharide in solution are tested, i.e. succinoglycan behaves as (i) a spherical, random coil polymer or (ii) a rodlike particle with charged lateral chains. The results show that satisfactory modeling of the titration data for ionic strengths larger than 50 mM can be accomplished using both geometries over the entire range of pH values. Electrophoretic mobilities measured for sufficiently large pH values (pH > 5-6) are in line with predictions based on either model. The best manner to discriminate between these two conceptual models is briefly discussed. For low pH values (pH < 5), both models indicate aggregation, resulting in an increase of the hydrodynamic permeability and a decrease of the diffusion coefficient.
NASA Technical Reports Server (NTRS)
Pevzner, L. Z.; Venkov, L.; Cheresharov, L.
1980-01-01
Albino rats were kept for a year under conditions of daily motor load or constant hypokinesia. An increase in motor activity results in a rise in the acetylcholinesterase activity determined in the synaptosomal and purified mitochondrial fractions while hypokinesia induces a pronounced decrease in this enzyme activity. The butyrylcholinesterase activity somewhat decreases in the synaptosomal fraction after hypokinesia but does not change under the motor load pattern. Motor load causes an increase in the amount of synaptosomal water-soluble proteins possessing an intermediate electrophoretic mobility and seem to correspond to the brain-specific protein 14-3-2. In the synaptosomal fraction the amount of membrane proteins with a low electrophoretic mobility and with the cholinesterase activity rises. Hypokinesia, on the contrary, decreases the amount of these membrane proteins.
Ion size effects on the electrokinetics of spherical particles in salt-free concentrated suspensions
NASA Astrophysics Data System (ADS)
Roa, Rafael; Carrique, Felix; Ruiz-Reina, Emilio
2012-02-01
In this work we study the influence of the counterion size on the electrophoretic mobility and on the dynamic mobility of a suspended spherical particle in a salt-free concentrated colloidal suspension. Salt-free suspensions contain charged particles and the added counterions that counterbalance their surface charge. A spherical cell model approach is used to take into account particle-particle electro-hydrodynamic interactions in concentrated suspensions. The finite size of the counterions is considered including an entropic contribution, related with the excluded volume of the ions, in the free energy of the suspension, giving rise to a modified counterion concentration profile. We are interested in studying the linear response of the system to an electric field, thus we solve the different electrokinetic equations by using a linear perturbation scheme. We find that the ionic size effect is quite important for moderate to high particles charges at a given particle volume fraction. In addition for such particle surface charges, both the electrophoretic mobility and the dynamic mobility suffer more important changes the larger the particle volume fraction for each ion size. The latter effects are more relevant the larger the ionic size.
Population genetic analysis of oral treponemes by multilocus enzyme electrophoresis.
Dahle, U R; Olsen, I; Tronstad, L; Caugant, D A
1995-10-01
Seventeen treponemes recently isolated from necrotic pulps, periodontal and periapical infections and 17 previously well characterized oral treponemal strains were analyzed by multilocus enzyme electrophoresis. Ten genetic loci were characterized on the basis of the electrophoretic mobilities of their enzymatic products. All loci were polymorphic. The average number of alleles per locus was 7.8. The genetic diversity among the electrophoretic types at each locus ranged from 0.624 to 0.836 with a mean genetic diversity per locus of 0.751. The 34 strains represented 34 electrophoretic types, constituting 6 main divisions (I-VI) separated at genetic distances greater than 0.75. Several of the previously characterized treponemes revealed multiple bands of enzyme activity at several loci, indicating that they were not pure. The characterized strains usually clustered within established species, whereas fresh clinical isolates overlapped species borders. There was a large genetic difference between some reference and clinical strains, indicating that the latter may contain undescribed species. Treponema socranskii and Treponema denticola strains clustered in distinct divisions (IV and V, respectively), with the exception of T. denticola strain FDC 51B2 and T. socranskii subsp. paredis strain VPI D46CPE1, both previously well described. This indicated that the taxonomic assignment of these 2 strains should be reconsidered.
NASA Astrophysics Data System (ADS)
Engel, Nicole Y.; Weiss, Victor U.; Marchetti-Deschmann, Martina; Allmaier, Günter
2017-01-01
In order to better understand biological events, lectin-glycoprotein interactions are of interest. The possibility to gather more information than the mere positive or negative response for interactions brought mass spectrometry into the center of many research fields. The presented work shows the potential of a nano-electrospray gas-phase electrophoretic mobility molecular analyzer (nES GEMMA) to detect weak, noncovalent, biospecific interactions besides still unbound glycoproteins and unreacted lectins without prior liquid phase separation. First results for Sambucus nigra agglutinin, concanavalin A, and wheat germ agglutinin and their retained noncovalent interactions with glycoproteins in the gas phase are presented. Electrophoretic mobility diameters (EMDs) were obtained by nES GEMMA for all interaction partners correlating very well with molecular masses determined by matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) of the individual molecules. Moreover, EMDs measured for the lectin-glycoprotein complexes were in good accordance with theoretically calculated mass values. Special focus was laid on complex formation for different lectin concentrations and binding specificities to evaluate the method with respect to results obtained in the liquid phase. The latter was addressed by capillary electrophoresis on-a-chip (CE-on-a-chip). Of exceptional interest was the fact that the formed complexes could be sampled according to their size onto nitrocellulose membranes after gas-phase separation. Subsequent immunological investigation further proved that the collected complex actually retained its native structure throughout nES GEMMA analysis and sampling.
NASA Technical Reports Server (NTRS)
Todd, P.
1980-01-01
The following aspects of kidney cell electrophoresis are discussed: (1) the development and testing of electrophoresis solutions; (2) optimization of freezing and thawing; (3) procedures for evaluation of separated kidney cells; and (4) electrophoretic mobility characterization of kidney cells.
NASA Technical Reports Server (NTRS)
Todd, P.
1979-01-01
A kidney cell electrophoresis technique is described in four parts: (1) the development and testing of electrophoresis solutions; (2) optimization of freezing and thawing; (3) procedures for evaluation of separated kidney cells; and (4) electrophoretic mobility characteristics of kidney cells.
Analysis of the regulation of viral transcription.
Gloss, Bernd; Kalantari, Mina; Bernard, Hans-Ulrich
2005-01-01
Despite the small genomes and number of genes of papillomaviruses, regulation of their transcription is very complex and governed by numerous transcription factors, cis-responsive elements, and epigenetic phenomena. This chapter describes the strategies of how one can approach a systematic analysis of these factors, elements, and mechanisms. From the numerous different techniques useful for studying transcription, we describe in detail three selected protocols of approaches that have been relevant in shaping our knowledge of human papillomavirus transcription. These are DNAse I protection ("footprinting") for location of transcription-factor binding sites, electrophoretic mobility shifts ("gelshifts") for analysis of bound transcription factors, and bisulfite sequencing for analysis of DNA methylation as a prerequisite for epigenetic transcriptional regulation.
Deno, D C; McCafferty, M H; Saba, T M; Blumenstock, F A
1984-01-01
Plasma fibronectin was depleted within 15 min following sublethal burn, followed by partial recovery at 8 h and complete restoration by 24 h in anesthetized rats. Radiolabeled 75Se-plasma fibronectin, injected intravenously before burn, was rapidly sequestered in burn skin as well as the liver. Fibronectin levels at 2 h postburn as detected by immunoassay vs. 75Se-plasma fibronectin indicated that more fibronectin was in the plasma than detected by electroimmunoassay. Crossed immunoelectrophoretic analysis of fibronectin in early postburn plasma demonstrated a reduced electrophoretic mobility of the fibronectin antigen. Addition of heparin or fibrin, both of which have affinity for fibronectin, to normal plasma was unable to reproduce this altered fibronectin electrophoretic pattern. In contrast, addition of gelatin or native collagen to normal plasma reproduced the abnormal electrophoretic pattern of fibronectin seen in burn plasma. Extracts of burned skin, but not extracts of normal skin, when added to normal plasma, elicited a similar altered electrophoretic pattern for fibronectin. By gel filtration, fibronectin in burn plasma had an apparent molecular weight approximately 40% greater than that observed in normal plasma. These data suggest the release into the blood of a gelatinlike ligand from burned skin, which complexes with plasma fibronectin. Thus, fibronectin deficiency acutely postburn appears mediated by (a) its accumulation at the site of burn injury; (b) its removal from the circulation by the liver; and (c) its presence in the plasma in a form that is less detectable by immunoassay. Images PMID:6690478
Morphology of human embryonic kidney cells in culture after space flight
NASA Technical Reports Server (NTRS)
Todd, P.; Kunze, M. E.; Williams, K.; Morrison, D. R.; Lewis, M. L.; Barlow, G. H.
1985-01-01
The ability of human embyronic kidney cells to differentiate into small epithelioid, large epithelioid, domed, and fenestrated morphological cell types following space flight is examined. Kidney cells exposed to 1 day at 1 g, then 1 day in orbit, and a 12 minute passage through the electrophoretic separator are compared with control cultures. The data reveal that 70 percent of small epithelioid, 16 percent of large epithelioid, 9 percent of dome-forming, and 5 percent of fenestrated cells formed in the space exposed cells; the distributions correlate well with control data. The formation of domed cells from cells cultured from low electrophoretic mobility fractions and small epithelioid cells from high mobility fractions is unaffected by space flight conditions. It is concluded that storage under microgravity conditions does not influence the morphological differentiation of human embryonic kidney cells in low-passage culture.
Saha, N; Hong, S H; Wong, H A; Jeyaseelan, K; Tay, J S
1991-12-01
Biochemical characteristics of one non-deficient fast G6PD variant (GdSingapore) and six different deficient variants (three new, two Mahidol, one each of Indonesian and Mediterranean) were studied among the Malays of Singapore. The GdSingapore variant had normal enzyme activity (82%) and fast electrophoretic mobilities (140% in TEB buffer, 160% in phosphate and 140% in Tris-HCl buffer systems respectively). This variant is further characterized by normal Km for G6P; utilization of analogues (Gal6P, 2dG6P; dAmNADP), heat stability and pH optimum. The other six deficient G6PD variants had normal electrophoretic mobility in TEB buffer with enzyme activities ranging from 1 to 12% of GdB+. The biochemical characteristics identity them to be 2 Mahidol, 1 Indonesian and 1 Mediterranean variants and three new deficient variants.
Analysis of results of ASTP experiment in electrophoresis
NASA Technical Reports Server (NTRS)
Vanderhoff, J. W.; Micale, F. J.; Krumrine, P. H.
1977-01-01
The Apollo-Soyuz Test Project (ASTP) included an electrophoretic separation experiment of biological cells. The nature separation results of aldehyde-fixed rabbit, human and horse red blood cells, which were taken in the form of photographs taken at three-minute intervals, are the subject of this report. The electrophoretic separation was successful in that fractionation according to mobility did occur and was found in the sliced samples. Photographic evidence indicates that the low electroosmotic methylcellulose coating was successful in reducing the electroosmosis to a near zero value. Also, the flight film shows that the bands migrated down the column as theory would predict, producing two bands of high cell concentration separated and surrounded by regions of lower cell concentration. However, most likely some clumping of cells occurred to cause the trailing band to be larger than expected from theory. Overall, the experiment was a success in demonstrating a static electrophoresis separation under microgravity conditions with a resolution not possible on earth.
Erol, Özge Ö; Erdoğan, Behice Y; Onar, Atiye N
2017-03-01
Simultaneous determination of nitrate and nitrite in gunshot residue has been conducted by capillary electrophoresis using an acidic run buffer (pH 3.5). In previously developed capillary electrophoretic methods, alkaline pH separation buffers were used where nitrite and nitrate possess similar electrophoretic mobility. In this study, the electroosmotic flow has been reversed by using low pH running buffer without any additives. As a result of reversing the electroosmotic flow, very fast analysis has been actualized, well-defined and separated ion peaks emerge in less than 4 min. Besides, the limit of detection was improved by employing large volume sample stacking. Limit of detection values were 6.7 and 4.3 μM for nitrate and nitrite, respectively. In traditional procedure, mechanical agitation is employed for extraction, while in this work the extraction efficiency of ultrasound mixing for 30 min was found sufficient. The proposed method was successfully applied to authentic gunshot residue samples. © 2016 American Academy of Forensic Sciences.
Purification and protein composition of endogenous rat viruses.
Hlubinová, K; Prachar, J; Vrbenská, A; Matoska, J; Simkovic, D
1984-01-01
Endogenous retroviruses are not in the majority of cases the cause of any neoplasia, except for the laboratory conditions. As far as they might serve for the evolution of pathogenic retroviruses more attention should have been paid to them. In this paper we introduce some approaches to the purification of rat endogenous retroviruses to such a degree of purity that enabled satisfactory SDS-PAGE analysis of its structural proteins. Purities of samples obtained by usual purification methods, long-term isopycnic centrifugation at a high gravity force and velocity centrifugation are compared. Protein profile of rat endogenous virus in SDS-PAGE is compared with the ones of other retroviruses. For the first time the evidence was obtained for the striking similarity between electrophoretic protein profile of rat endogenous virus WERC and feline leukemia virus. The major structural proteins of rat endogenous retrovirus and feline leukemia virus cannot be distinguished even when resolution long gradient PAGE had been employed. The accordance of electrophoretic mobilities of major structural proteins in SDS-PAGE can indicate the relatedness of retroviruses.
Major immunoglobulin classes of the echidna (Tachyglossus aculeatus)
Atwell, J. L.; Marchalonis, J. J.; Ealey, E. H. M.
1973-01-01
The Australian echidna responds to the antigen Salmonella adelaide flagella by producing antibodies characterized by mol. wt of 900,000 and 150,000. After cleavage of interchain disulphide bonds, both the high and low mol. wt immunoglobulins can be resolved into light and heavy polypeptide chains. In both cases, the light chains resemble those of other vertebrate immunoglobulins in size (22,500 Daltons) and electrophoretic mobility. The 900,000 Dalton immunoglobulin contains heavy chains similar to human μ chains in size (70,000 Daltons) and electrophoretic mobility. The 150,000 Dalton immunoglobulin contains a different class of heavy chain, similar in size (50,000 Daltons) and electrophoretic mobility to human γ chains. Proportional mass contributions of the light and heavy chains to the intact molecule suggest the structure of the intact molecules could be represented by (L2, μ2)5 and (L2, γ2) for the high and low mol. wt immunoglobulins respectively. These configurations are similar to those described for human γM and γG immunoglobulins. The results are relevant to theories of the evolution of the different classes of immunoglobulins. While the echidna is distinctly more primitive than eutherian mammals and still retains structural features characteristic of reptiles, its major immunoglobulin classes are very similar to human IgM and IgG. The striking similarities between the γ-like heavy chain of the echnidna and human IgG heavy chains suggest that the echidna may be the first species in which a γ chain gene directly homologous to mammalian γ chain genes is expressed. ImagesFIG. 4 PMID:4761634
Lee, Myung W.; Song, C.K.
2012-01-01
In this study, solution processes were developed for backplane using an organic thin film transistor (OTFT) as a driving device for an electrophoretic display (EPD) panel. The processes covered not only the key device of OTFTs but also interlayer and pixel electrodes. The various materials and printing processes were adopted to achieve the requirements of devices and functioning layers. The performance of OTFT of the backplane was sufficient to drive EPD sheet by producing a mobility of 0.12 cm2/v x sec and on/off current ratio of 10(5).
ALTERATIONS OF PROPERTIES OF RED BLOOD CELLS MEMBRANES PROTEINS OF DIFFERENT AGE AND SEX VOLUNTEERS.
Pruidze, N; Khetsuriani, R; Sujashvili, R; Ioramashvili, I; Arabuli, M; Sanikidze, T
2015-01-01
Considering the age and sex-dependent trend in the manifestation of various diseases, as well as an important pathogenic role of circulatory disorders, we decided to study the age-dependent changes in the physical properties of RBCs membrane proteins (their electric charge and molecular weight) in healthy people of different sex (males and females) and age. Blood of 56 healthy volunteers (Tbilisi, Georgia) of different sex and gender was studied (the patients were divided in 8 groups (7 patients in each groups): 1 - 18-25 years old male, 2 - 18-25 years old female, 3 - 25-44 years old male, 4 - 25-44 years old female, 5 - 44-60 years old male, 6 - 44-60 years old female; 7 - 60-80 years old male, 8 - 70-80 years old female). In groups 6 and 8 were women in menopause was determined according 12 months of amenorrhea. Individuals often consume alcohol addicts, pregnant women and patients with chronic diseases were excluded from the study. The study protocol was approved by Ethical Committee of the Tbilisi State Medical University. RBCs membrane proteins have been extracted from human heparinized blood and their mobility was studied by electrophoretic method. The electrophoretic mobility of RBCs membrane proteins decreases with age of healthy volunteers, that indicates decrease of total charge of proteins, depending on the electrically charged amino acids content. In female patients the electrophoretic mobility of the RBCs membrane proteins especially intensively decreases in period of menopause. Increase of molecular weight of proteins (100-200 kDa) from RBCs' membranes of alder age group was manifested. Intensively decrease electrophoretic mobility of erythrocytes membrane proteins from female patients in period of menopause indicates on estrogen related mechanism of the regulation of membrane protein conformation and composition in females. Increased content of high molecular weight proteins in the RBCs membranes from patients of older age groups may be caused to disorders of protein-protein interaction mechanisms, their ubiquitinylation or oligomerisation and formation of high molecular weight complexes of inactivated proteins in aged RBCs. These processes play important role in regulation of the RBCs shape and stability. Identified sex- and age-related alterations in RBCs membranes proteins affect the rheological properties of blood and can be considered as the etiologic and pathogenic markers of various diseases.
Gwarda, Radosław Ł; Dzido, Tadeusz H
2018-07-13
In our previous papers we have investigated the influence of the mobile phase composition on mechanism of retention, selectivity and efficiency of peptide separation in various high-performance thin-layer chromatography (HPTLC) systems with commercially available silica-based adsorbents. We have also investigated the influence of pH of the mobile phase buffer on migration and separation of peptides in pressurized planar electrochromatography (PPEC). Here we investigate the influence of concentration of ion-pairing additive, and concentration and type of organic modifier of the mobile phase on migration of peptides in PPEC system with octadecyl silica-based adsorbent, and with the same set of the solutes as before. We compare our current results with the results obtained before for similar HPTLC and PPEC systems, and discuss the influence of particular variables on retention, electrophoretic mobility of solutes and electroosmotic flow of the mobile phase. We show, that the final selectivity of peptide separation results from co-influence of all the three factors mentioned. Concentration of organic modifier of the mobile phase, as well as concentration of ion-pairing additive, affect the retention, the electrophoretic mobility, and the electroosmotic flow simultaneously. This makes independent optimization of these factors rather difficult. Anyway PPEC offers much faster separation of peptides with quite different selectivity, in comparison to HPTLC, with similar adsorbents and similar mobile phase composition. However, we also present and discuss the issue of extensive tailing of peptide zones in the PPEC in comparison to similar HPTLC systems. Copyright © 2018 Elsevier B.V. All rights reserved.
United States Air Force Summer Faculty Research Program. Management Report. Volume 4
1988-12-01
Anderson, N.L. et al (1986). Effects of Aroclor 1254 on proteins of mouse liver: Aplication of two-dimensional electrophoretic protein mapping...transferability of job skill, has surfaced in the context of civilian occupational mobility (Byrne, 1975; Fine, 1957a, 1957b) transitions from military to...considerations from concept through deployment. Defense Management Journal, 16(2), 12-19. Byrne, J. J. (1975). Occupational mobility of workers. Monthly
Pedersen-Bjergaard, S; Rasmussen, K E; Sannes, E
1998-01-01
While the hallucinogenic mushrooms Psilocybe semilanceata have previously been analyzed for the indole alkaloids psilocybin and baeocystin by capillary zone electrophoresis (CZE) at pH 11.5, the present work focused on the development of an alternative and complementary capillary electrophoretic method for their identification. Owing to their structural similarity and zwitterionic nature, the compounds were difficult to resolve based on different interactions with cationic or anionic micelles. However, while the attempts with micellar electrokinetic chromatography (MEKC) were unsuccessful, rapid derivatization with propyl chloroformate and reanalysis by CZE at pH 11.5 was effective to support identification of the two indole alkaloids. Psilocin was difficult to analyze by CZE at pH 11.5 owing to comigration with the electroosmotic flow. For this compound, the pH of the running buffer was reduced to 7.2 to effectively enhance the electrophoretic mobility.
Gondikas, Andreas; von der Kammer, Frank; Hofmann, Thilo; Marchetti-Deschmann, Martina; Allmaier, Günter; Marko-Varga, György; Andersson, Roland
2017-01-01
For drug delivery, characterization of liposomes regarding size, particle number concentrations, occurrence of low-sized liposome artefacts and drug encapsulation are of importance to understand their pharmacodynamic properties. In our study, we aimed to demonstrate the applicability of nano Electrospray Gas-Phase Electrophoretic Mobility Molecular Analyser (nES GEMMA) as a suitable technique for analyzing these parameters. We measured number-based particle concentrations, identified differences in size between nominally identical liposomal samples, and detected the presence of low-diameter material which yielded bimodal particle size distributions. Subsequently, we compared these findings to dynamic light scattering (DLS) data and results from light scattering experiments coupled to Asymmetric Flow-Field Flow Fractionation (AF4), the latter improving the detectability of smaller particles in polydisperse samples due to a size separation step prior detection. However, the bimodal size distribution could not be detected due to method inherent limitations. In contrast, cryo transmission electron microscopy corroborated nES GEMMA results. Hence, gas-phase electrophoresis proved to be a versatile tool for liposome characterization as it could analyze both vesicle size and size distribution. Finally, a correlation of nES GEMMA results with cell viability experiments was carried out to demonstrate the importance of liposome batch-to-batch control as low-sized sample components possibly impact cell viability. PMID:27639623
On-chip Micro- and Nanofluidic Electrokinetic Injection and Separation for PEGylation Analysis
NASA Astrophysics Data System (ADS)
Shelton, Elijah; Baum, Mary; Morse, Dan; Pennathur, Sumita; Pennathur Nanofluidics Laboratory Collaboration; Morse Laboratory Collaboration
2012-11-01
We present an experimental study of micro- and nanofluidic electrokinetic injection and separation in borosilcate channels as a method for characterizing size and zeta potential of biomolecules-specifically polyethlylene glycol (PEG), keyhole limpet hemocyanine (KLH), and pegylated KLH. While pegylation (the conjugation of proteins with PEG) is an established technique for enhancing a protein's therapeutic properties, reliable characterization of these conjugations by traditional analysis techniques (i.e. gel-electrophoresis, zetasizer) remains a challenge. Using a three-step electrokinetic sequence (load, gate, and inject), FITC labeled species and a fluorescein tracer dye are injected into a channel where they separate according to differences in electrophoretic mobility. We find the average absolute mobility of pegylated subunit KLH in 1 micron channels to be 56% that of unpegylated subunit KLH. In a 250 nm channel, we measure a 33% shift in the average absolute mobility of PEG dendrimers as compared to measurements in a 1 micron channel. These results begin to demonstrate how a micro- and nanofluidic-based approach might address the demand for effective and accessible nanoparticle characterization platforms. Supported by the Institute for Collaborative Biotechnologies.
Endospore surface properties of commonly used Bacillus anthracis surrogates vary in aqueous solution
The hydrophobic character and electrophoretic mobility of microorganisms are vital aspects of understanding their interactions with the environment. These properties are fundamental in fate-and-transport, physiological, and virulence studies, and thus integral in surrogate select...
Determination of ionization constants by paper electrophoresis.
Tate, M E
1981-01-01
Dimensionless apparent ionization constants of charged low-molecular-weight species may be obtained from paper-electrophoretic data at 20-25 degrees C with buffers (I0.1-0.5) of measured pH (1.5-12.5) containing oxalate ions. Relative mobilities rather than absolute mobilities were measured by using glycerol and m-nitrobenzenesulphonate respectively as standards of zero and unit mobility. Application of the procedure to ionizations of adenine, adenosine, 2'-deoxyadenosine, 3'-deoxyadenosine, 3':5'-cyclic AMP, ADP, ADP-glucose-agrocin 84 and ATP is described. PMID:6976169
Verrier, C S; Roodi, N; Yee, C J; Bailey, L R; Jensen, R A; Bustin, M; Parl, F F
1997-07-01
The estrogen receptor (ER) belongs to a family of ligand-inducible nuclear receptors that exert their effects by binding to cis-acting DNA elements in the regulatory region of target genes. The detailed mechanisms by which ER interacts with the estrogen response element (ERE) and affects transcription still remain to be elucidated. To study the ER-ERE interaction and transcription initiation, we employed purified recombinant ER expressed in both the baculovirus-Sf9 and his-tagged bacterial systems. The effect of high-mobility group (HMG) protein HMG-1 and purified recombinant TATA-binding protein-associated factor TAF(II)30 on ER-ERE binding and transcription initiation were assessed by electrophoretic mobility shift assay and in vitro transcription from an ERE-containing template (pERE2LovTATA), respectively. We find that purified, recombinant ER fails to bind to ERE in spite of high ligand-binding activity and electrophoretic and immunological properties identical to ER in MCF-7 breast cancer cells. HMG-1 interacts with ER and promotes ER-ERE binding in a concentration- and time-dependent manner. The effectiveness of HMG-1 to stimulate ER-ERE binding in the electrophoretic mobility shift assay depends on the sequence flanking the ERE consensus as well as the position of the latter in the oligonucleotide. We find that TAF(II)30 has no effect on ER-ERE binding either alone or in combination with ER and HMG-1. Although HMG-1 promotes ER-ERE binding, it fails to stimulate transcription initiation either in the presence or absence of hormone. In contrast, TAF(II)30, while not affecting ER-ERE binding, stimulates transcription initiation 20-fold in the presence of HMG-1. These results indicate that HMG-1 and TAF(II)30 act in sequence, the former acting to promote ER-ERE binding followed by the latter to stimulate transcription initiation.
High temperature microelectrophoresis studies of the solid oxide/water interface
NASA Astrophysics Data System (ADS)
Fedkin, Mark Valentinovich
Metal oxides are abundant components of geo-environmental systems and are widely used materials in industry. Many practical applications of oxide materials require the knowledge of their surface properties at both ambient and elevated temperatures. Due to substantial technical challenges associated with experimental studies of solid/water interfaces at elevated temperatures, consistent data on adsorption, surface charge, and zeta potential for most oxide materials are limited to temperatures less than 100°C. A high temperature microelectrophoresis technique, developed in this study, made it possible to extend the zeta potential measurements at the solid oxide/water interface to 200°C. The design of the high temperature electrophoresis cell allowed for the visual microscopic observation of the electrophoretic movement of suspended particles through pressure-tight sapphire windows. The electrophoretic mobilities of metal oxide particles suspended in aqueous solutions were measured in a DC electric field as a function of pH, ionic strength, and temperature. The experimental procedure and methods for evaluation of the main experimental parameters (electrophoretic mobility, electric field strength, high temperature pH, and cell constant) have been developed. Zeta potentials were calculated from the experimental data using O'Brien and White's (1978) numerical solution for electrophoretic mobility equation. Zeta potentials and isoelectric points (IEP) of the metal oxide/aqueous solution interface were experimentally determined for ZrO2, TiO 2(rutile), and alphaAl2O3 at 25, 120, and 200°C. The background solutions used for the preparation of suspensions were pure H2O, NaCl(aq) (10-4--10-2 mol.kg-1), and SrCl2 (10-4 mol.kg, for TiO2). For all studied materials, the IEPs were found to regularly decrease with increasing temperature, which agrees with available theoretical predictions. Thermodynamic functions, including Gibbs energy, enthalpy, and heat capacity, were estimated for the H +/OH- adsorption from the experimental IEP data using the 1-pK model of the oxide/water interface. The experimental information obtained in this study combined with data from potentiometric titration and other experimental methods form the basis for future theoretical studies of the electrical double layer at the oxide/water interface.
The surface properties of microorganisms play an important role in their behavior within the environment. Electrophoretic mobility and cell surface hydrophobicity of bacterial cells influence their initial interaction with surfaces and mediate their stability within an aqueous su...
CONDUCTOMETRIC CHARACTERIZATION OF DISSOLVED HUMIC MATERIALS. (R828158)
Conductometric replacement titrations of humic and fulvic acids dissolved in a slight excess of hydroxide were carried out with standard acid. The slope of the titration curve corresponding to the protonation of humate/fulvate was related to the electrophoretic mobility of the...
Capillary Electrophoresis Sensitivity Enhancement Based on Adaptive Moving Average Method.
Drevinskas, Tomas; Telksnys, Laimutis; Maruška, Audrius; Gorbatsova, Jelena; Kaljurand, Mihkel
2018-06-05
In the present work, we demonstrate a novel approach to improve the sensitivity of the "out of lab" portable capillary electrophoretic measurements. Nowadays, many signal enhancement methods are (i) underused (nonoptimal), (ii) overused (distorts the data), or (iii) inapplicable in field-portable instrumentation because of a lack of computational power. The described innovative migration velocity-adaptive moving average method uses an optimal averaging window size and can be easily implemented with a microcontroller. The contactless conductivity detection was used as a model for the development of a signal processing method and the demonstration of its impact on the sensitivity. The frequency characteristics of the recorded electropherograms and peaks were clarified. Higher electrophoretic mobility analytes exhibit higher-frequency peaks, whereas lower electrophoretic mobility analytes exhibit lower-frequency peaks. On the basis of the obtained data, a migration velocity-adaptive moving average algorithm was created, adapted, and programmed into capillary electrophoresis data-processing software. Employing the developed algorithm, each data point is processed depending on a certain migration time of the analyte. Because of the implemented migration velocity-adaptive moving average method, the signal-to-noise ratio improved up to 11 times for sampling frequency of 4.6 Hz and up to 22 times for sampling frequency of 25 Hz. This paper could potentially be used as a methodological guideline for the development of new smoothing algorithms that require adaptive conditions in capillary electrophoresis and other separation methods.
Urokinase production by electrophoretically separated cultured human embryonic kidney cells
NASA Technical Reports Server (NTRS)
Kunze, M. E.; Plank, L. D.; Giranda, V.; Sedor, K.; Todd, P. W.
1985-01-01
Urokinase is a plasminogen activator found in urine. Relatively pure preparations have been tested in Europe, Japan and the United States for the treatment of deep vein thrombosis and other dangerous blood clots. Human embryonic kidney cell cultures have been found to produce urokinase at much higher concentrations, but less than 5% of the cells in typical cultures are producers. Since human diploid cells become senescent in culture the selection of clones derived from single cells will not provide enough material to be useful, so a bulk purification method is needed for the isolation of urokinase producing cell populations. Preparative cell electrophoresis was chosen as the method, since evidence exists that human embryonic cell cultures are richly heterogeneous with respect to electrophoretic mobility, and preliminary electrophoretic separations on the Apollo-Soyuz space flight produced cell populations that were rich in urokinase production. Similarly, erythropoietin is useful in the treatment of certain anemias and is a kidney cell duct, and electrophoretically enriched cell populations producing this product have been reported. Thus, there is a clear need for diploid human cells that produce these products, and there is evidence that such cells should be separable by free-flow cell electrophoresis.
Molecular evidence of stereo-specific lactoferrin dimers in solution.
Persson, Björn A; Lund, Mikael; Forsman, Jan; Chatterton, Dereck E W; Akesson, Torbjörn
2010-10-01
Gathering experimental evidence suggests that bovine as well as human lactoferrin self-associate in aqueous solution. Still, a molecular level explanation is unavailable. Using force field based molecular modeling of the protein-protein interaction free energy we demonstrate (1) that lactoferrin forms highly stereo-specific dimers at neutral pH and (2) that the self-association is driven by a high charge complementarity across the contact surface of the proteins. Our theoretical predictions of dimer formation are verified by electrophoretic mobility and N-terminal sequence analysis on bovine lactoferrin. 2010 Elsevier B.V. All rights reserved.
LABELING WITH 14C AMINO ACIDS OF ALBUMIN-LIKE PROTEIN BY RAT LIVER RIBONUCLEOPROTEIN PARTICLES
von der Decken, Alexandra
1963-01-01
Ribonucleoprotein particles were prepared by treatment of rat liver microsomes with detergents and high concentrations of KCl. They were active in incorporating 14C amino acids into protein when incubated with cell sap together with ATP, GTP, and a system to regenerate the triphosphates. The albumin of the incubation mixture, soluble at 105,000 g, and that of the fraction released by ultrasonication of the particles were studied by immunoelectrophoresis in agar gel. When the ribonucleoprotein particles were incubated with cell sap the immunological precipitation lines formed with antiserum to rat serum albumin were highly radioactive as tested by autoradiography. After zone electrophoresis on cellulose acetate, two immunologically reactive albumins were obtained which differed in their electrophoretic mobility from rat serum albumin. Labeled albumin, when purified on DEAE-cellulose columns, retained its radioactivity as tested by autoradiography following immunoelectrophoresis. On cellulose acetate this purified albumin showed an electrophoretic mobility higher than that of rat serum albumin. PMID:14026307
Le Cerf, Didier; Pepin, Anne Sophie; Niang, Pape Momar; Cristea, Mariana; Karakasyan-Dia, Carole; Picton, Luc
2014-11-26
The formation of polyelectrolyte complexes (PECs) between carboxymethyl pullulan and DEAE Dextran, was investigated, in dilute solution, with emphasis on the effect of charge density (molar ratio or pH) and molar masses. Electrophoretic mobility measurements have evidenced that insoluble PECs (neutral electrophoretic mobility) occurs for charge ratio between 0.6 (excess of polycation) and 1 (stoichiometry usual value) according to the pH. This atypical result is explained by the inaccessibility of some permanent cationic charge when screened by pH dependant cationic ones (due to the Hoffman alkylation). Isothermal titration calorimetry (ITC) indicates an endothermic formation of PEC with a binding constant around 10(5) L mol(-1). Finally asymmetrical flow field flow fractionation coupled on line with static multi angle light scattering (AF4/MALS) evidences soluble PECs with very large average molar masses and size around 100 nm, in agreement with scrambled eggs multi-association between various polyelectrolyte chains. Copyright © 2014 Elsevier Ltd. All rights reserved.
Wilson, Emma L; Garton, Mark; Fuller, Heidi R
2016-05-01
Phenytoin is an antiepileptic drug used in the management of partial and tonic-clonic seizures. In previous studies we have shown that valproate, another antiepileptic drug, reduced the amount of two key bone proteins, pro-collagen I and osteonectin (SPARC, BM-40), in both skin fibroblasts and cultured osteoblast-like cells. Here we show that phenytoin also reduces pro-collagen I production in osteoblast-like cells, but does not appear to cause a decrease in osteonectin message or protein production. Instead, a 24h exposure to a clinically relevant concentration of phenytoin resulted in a dose-dependent change in electrophoretic mobility of osteonectin, which was suggestive of a change in post-translational modification status. The perturbation of these important bone proteins could be one of the mechanisms to explain the bone loss that has been reported following long-term treatment with phenytoin. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Frants, E. A.; Ganchenko, G. S.; Shelistov, V. S.; Amiroudine, S.; Demekhin, E. A.
2018-02-01
Electrokinetics and the movement of charge-selective micro-granules in an electrolyte solution under the influence of an external electric field are investigated theoretically. Straightforward perturbation analysis is applied to a thin electric double layer and a weak external field, while a numerical solution is used for moderate electric fields. The asymptotic solution enables the determination of the salt concentration, electric charge distribution, and electro-osmotic velocity fields. It may also be used to obtain a simple analytical formula for the electrophoretic velocity in the case of quasi-equilibrium electrophoresis (electrophoresis of the first kind). This formula differs from the famous Helmholtz-Smoluchowski relation, which applies to dielectric microparticles, but not to ion-selective granules. Numerical calculations are used to validate the derived formula for weak external electric fields, but for moderate fields, nonlinear effects lead to a significant increase in electrophoretic mobility and to a transition from quasi-equilibrium electrophoresis of the first kind to nonequilibrium electrophoresis of the second kind. Theoretical results are successfully compared with experimental data.
USDA-ARS?s Scientific Manuscript database
Surface macromolecule cleavage experiments were conducted on enterohaemorrhagic Escherichia coli O157:H7 cells to investigate the influence of these macromolecules on cell surface properties. Electrophoretic mobility, hydrophobicity, and titration experiments were carried out on proteinase K treate...
Cathodic electrodeposition of ceramic and organoceramic materials. Fundamental aspects.
Zhitomirsky, I
2002-03-29
Electrodeposition of ceramic materials can be performed by electrophoretic (EPD) or electrolytic (ELD) deposition. Electrophoretic deposition is achieved via motion of charged particles towards an electrode under an applied electric field. Electrolytic deposition produces colloidal particles in cathodic reactions for subsequent deposition. Various electrochemical strategies and deposition mechanisms have been developed for electrodeposition of ceramic and organoceramic films, and are discussed in the present article. Electrode-position of ceramic and organoceramic materials includes mass transport, accumulation of particles near the electrode and their coagulation to form a cathodic deposit. Various types of interparticle forces that govern colloidal stability in the absence and presence of processing additives are discussed. Novel theoretical contributions towards an interpretation of particle coagulation near the electrode surface are reviewed. Background information is given on the methods of particle charging, stabilization of colloids in aqueous and non-aqueous media, electrophoretic mobility of ceramic particles and polyelectrolytes, and electrode reactions. This review also covers recent developments in the electrodeposition of ceramic and organoceramic materials.
Castro, Felipe D; Sedman, Jacqueline; Ismail, Ashraf A; Asadishad, Bahareh; Tufenkji, Nathalie
2010-06-01
The effects of dissolved oxygen tension during bacterial growth and acclimation on the cell surface properties and biochemical composition of the bacterial pathogens Escherichia coli O157:H7 and Yersinia enterocolitica are characterized. Three experimental techniques are used in an effort to understand the influence of bacterial growth and acclimation conditions on cell surface charge and the composition of the bacterial cell: (i) electrophoretic mobility measurements; (ii) potentiometric titration; and (iii) ATR-FTIR spectroscopy. Potentiometric titration data analyzed using chemical speciation software are related to measured electrophoretic mobilities at the pH of interest. Titration of bacterial cells is used to identify the major proton-active functional groups and the overall concentration of these cell surface ligands at the cell membrane. Analysis of titration data shows notable differences between strains and conditions, confirming the appropriateness of this tool for an overall charge characterization. ATR-FTIR spectroscopy of whole cells is used to further characterize the bacterial biochemical composition and macromolecular structures that might be involved in the development of the net surficial charge of the organisms examined. The evaluation of the integrated intensities of HPO(2)(-) and carbohydrate absorption bands in the IR spectra reveals clear differences between growth protocols. Taken together, the three techniques seem to indicate that the dissolved oxygen tension during cell growth or acclimation can noticeably influence the expression of cell surface molecules and the measurable cell surface charge, though in a strain-dependent fashion.
Ashikhmin, Aleksandr; Makhneva, Zoya; Bolshakov, Maksim; Moskalenko, Andrey
2017-05-01
Spheroidene and spheroidenone from the non-sulfur bacterium Rhodobacter (Rba.) sphaeroides were incorporated into diphenylamine (DPA) LH1-RC and LH2 complexes from sulfur bacteria Allochromatium (Alc.) minutissimum and Ectothiorhodospira (Ect.) haloalkaliphila in which carotenoid (Car) biosynthesis was inhibited by ~95%. A series of biochemical characteristics of the modified LH2 complexes was studied (electrophoretic mobility, absorption and CD spectra, Car composition, Car-to-BChl energy transfer and thermal stability). It was found that the electrophoretic mobility of the complexes with incorporated Cars did not change compared to that of the control and DPA-complexes, indicating the absence of any significant change in the structure of LH complexes upon DPA-treatment and subsequent incorporation of Cars. The analysis of fluorescence excitation spectra of the spheroidene-incorporated LH2 complex (LH2:sph) and the spheroidenone-incorporated LH2 complex (LH2:sph-ne) showed that spheroidene and spheroidenone exhibited relatively low efficiencies of energy transfer to BChl, when incorporated into the LH2 DPA-complexes from Alc. minutissimum and Ect. haloalkaliphila, although, they showed high efficiencies, being in their natural state in the LH2 complexes from Rba. sphaeroides. A significant increase in thermostability observed for the LH2:sph and LH2:sph-ne complexes with respect to the LH2 DPA-complexes indicated that the two incorporated Cars stabilized the structure of the LH2 complexes. Copyright © 2017 Elsevier B.V. All rights reserved.
Lazarus, Geraldine Genevive; Revaprasadu, Neerish; López-Viota, Julián; Singh, Moganavelli
2014-09-01
Gold nanoparticles have attracted strong biomedical interest for drug delivery due to their low toxic nature, surface plasmon resonance and capability of increasing the stability of the payload. However, gene transfection represents another important biological application. Considering that cellular barriers keep enclosed their secret to deliver genes using nanoparticles, an important step can be achieved by studying the functionalization of nanoparticles with DNA. In the present contribution the synthesis of nanoparticles consisting of a gold core coated with one or more layers of amino acid (l-lysine), and cationic polyelectrolytes (poly-ethyleneimine and poly-l-lysine) is reported. All nanoparticles were subjected to dynamic light scattering, electrophoretic mobility measurements, UV-vis optical spectrophotometry analysis and transmission electron microscopy imaging. In addition, the adsorption of DNA plasmid (pSGS) with linear and supercoiled configurations was studied for those gold nanoparticles under the most suitable surface modifications. Preliminary results showed that the gold nanoparticles functionalized with poly-ethyleneimine and poly-l-lysine, respectively, and bound to linear DNA configurations, present in absolute value a higher electrophoretic mobility irrespective of the pH of the media, compared to the supercoiled and nicked configuration. The findings from this study suggest that poly-ethyleneimine and poly-l-lysine functionalized gold nanoparticles are biocompatible and may be promising in the chemical design and future optimization of nanostructures for biomedical applications such as gene and drug delivery. Copyright © 2014 Elsevier B.V. All rights reserved.
Urey, Carlos; Weiss, Victor U; Gondikas, Andreas; von der Kammer, Frank; Hofmann, Thilo; Marchetti-Deschmann, Martina; Allmaier, Günter; Marko-Varga, György; Andersson, Roland
2016-11-20
For drug delivery, characterization of liposomes regarding size, particle number concentrations, occurrence of low-sized liposome artefacts and drug encapsulation are of importance to understand their pharmacodynamic properties. In our study, we aimed to demonstrate the applicability of nano Electrospray Gas-Phase Electrophoretic Mobility Molecular Analyser (nES GEMMA) as a suitable technique for analyzing these parameters. We measured number-based particle concentrations, identified differences in size between nominally identical liposomal samples, and detected the presence of low-diameter material which yielded bimodal particle size distributions. Subsequently, we compared these findings to dynamic light scattering (DLS) data and results from light scattering experiments coupled to Asymmetric Flow-Field Flow Fractionation (AF4), the latter improving the detectability of smaller particles in polydisperse samples due to a size separation step prior detection. However, the bimodal size distribution could not be detected due to method inherent limitations. In contrast, cryo transmission electron microscopy corroborated nES GEMMA results. Hence, gas-phase electrophoresis proved to be a versatile tool for liposome characterization as it could analyze both vesicle size and size distribution. Finally, a correlation of nES GEMMA results with cell viability experiments was carried out to demonstrate the importance of liposome batch-to-batch control as low-sized sample components possibly impact cell viability. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Malá, Zdena; Gebauer, Petr; Boček, Petr
2016-09-07
This article describes for the first time the combination of electrophoretic focusing on inverse electromigration dispersion (EMD) gradient, a new separation principle described in 2010, with electrospray-ionization (ESI) mass spectrometric detection. The separation of analytes along the electromigrating EMD profile proceeds so that each analyte is focused and concentrated within the profile at a particular position given by its pKa and ionic mobility. The proposed methodology combines this principle with the transport of the focused zones to the capillary end by superimposed electromigration, electroosmotic flow and ESI suction, and their detection by the MS detector. The designed electrolyte system based on maleic acid and 2,6-lutidine is suitable to create an inverse EMD gradient of required properties and its components are volatile enough to be compatible with the ESI interface. The characteristic properties of the proposed electrolyte system and of the formed inverse gradient are discussed in detail using calculated diagrams and computer simulations. It is shown that the system is surprisingly robust and allows sensitive analyses of trace amounts of weak acids in the pKa range between approx. 6 and 9. As a first practical application of electrophoretic focusing on inverse EMD gradient, the analysis of several sulfonamides in waters is reported. It demonstrates the potential of the developed methodology for fast and high-sensitivity analyses of ionic trace analytes, with reached LODs around 3 × 10(-9) M (0.8 ng mL(-1)) of sulfonamides in spiked drinking water without any sample pretreatment. Copyright © 2016 Elsevier B.V. All rights reserved.
Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V
2000-12-01
ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.
Electrophoretic separation of kidney and pituitary cells on STS-8
NASA Technical Reports Server (NTRS)
Morrison, D. R.; Nachtwey, D. S.; Barlow, G. H.; Cleveland, C.; Lanham, J. W.; Farrington, M. A.; Hatfield, J. M.; Hymer, W. C.; Grindeland, R.; Lewis, M. L.
1984-01-01
Specific secretory cells were separated from suspensions of cultured primary human embryonic cells and rat pituitary cells in microgravity conditions, with an objective of isolating the subfractions of kidney cells that produce the largest amount of urakinase, and the subfractions of rat pituitary cells that secrete growth hormones (GH), prolactin (PRL), and other hormones. It is inferred from the experimental observations that the surface charge distributions of the GH-containing cells differ from those of the PRL-containing cells, which is explained by the presence of secretory products on the surface of pituitary cells. For kidney cells, the electrophoretic mobility distributions in flight experiments were spread more than the ground controls.
Zugel, S A; Burke, B J; Regnier, F E; Lytle, F E
2000-11-15
Two-photon excited fluorescence detection was performed on a microfabricated electrophoresis chip. A calibration curve of the fluorescent tag beta-naphthylamine was performed, resulting in a sensitivity of 2.5 x 10(9) counts M(-1) corresponding to a detection limit of 60 nM. Additionally, leucine aminopeptidase was assayed on the chip using electrophoretically mediated microanalysis. The differential electroosmotic mobilities of the enzyme and substrate, L-leucine beta-naphthylamide, allowed for efficient mixing in an open channel, resulting in the detection of a 30 nM enzyme solution under constant potential. A zero potential incubation for 1 min yielded a calculated detection limit of 4 nM enzyme.
Biophysical studies of spermatozoa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pistenma, David Andrew
1970-12-01
The objectives of this thesis include characterization of spermatozoa according to several physical properties (morphology, size, electrophoretic mobility, sedimentation rate and specific gravity), correlation of these properties with several biological properties (viability, intrinsic motility, fertilizing capacity, antigenicity and genetic composition) and an evaluation of interrelationships among these properties and with selected experimental variables.
USDA-ARS?s Scientific Manuscript database
Selenite Se(IV) and selenate Se(VI) selenium adsorption behavior was investigated on gibbsite as a function of solution pH and solution ionic strength. Adsorption of both Se redox states decreased with increasing solution pH. Electrophoretic mobility measurements showed downward shifts in point of...
Isoelectric focusing of red blood cells in a density gradient stabilized column
NASA Technical Reports Server (NTRS)
Smolka, A. J. K.; Miller, T. Y.
1980-01-01
The effects of Ficoll and cell application pH on red blood cell electrophoretic mobility and focusing pH were investigated by focusing cells in a density gradient stabilized column. Sample loading, cell dispersion, column conductivity, resolution of separation, and the effect of Ampholines were examined.
Viviano, Jeffrey; Krishnan, Anuradha; Scully, Jenna; Wu, Hao; Venkataraman, Venkat
2016-06-01
In this data article we show the specificity of the Ca(2+)-induced mobility shift in three proteins that belong to the neuronal calcium sensor (NCS) protein family: Hippocalcin, GCAP1 and GCAP2. These proteins did not display a shift in mobility in native gels when incubated with divalent cations other than Ca(2+) - such as Mg(2+), Ba(2+), and Sr(2+), even at 10× concentrations. The data is similar to that obtained with another NCS protein, neurocalcin delta (Viviano et al., 2016, "Electrophoretic Mobility Shift in Native Gels Indicates Calcium-dependent Structural Changes of Neuronal Calcium Sensor Proteins", [1]).
Start-up of electrophoresis of an arbitrarily oriented dielectric cylinder.
Chen, Guan Y; Keh, Huan J
2014-09-01
An analytical study is presented for the transient electrophoretic response of a circular cylindrical particle to the step application of an electric field. The electric double layer adjacent to the particle surface is thin but finite compared with the radius of the particle. The time-evolving electroosmotic velocity at the outer boundary of the double layer is utilized as a slip condition so that the transient momentum conservation equation for the bulk fluid flow is solved. Explicit formulas for the unsteady electrophoretic velocity of the particle are obtained for both axially and transversely applied electric fields, and can be linearly superimposed for an arbitrarily-oriented applied field. If the cylindrical particle is neutrally buoyant in the suspending fluid, the transient electrophoretic velocity is independent of the orientation of the particle relative to the applied electric field and will be in the direction of the applied field. If the particle is different in density from the fluid, then the direction of electrophoresis will not coincide with that of the applied field until the steady state is attained. The growth of the electrophoretic mobility with the elapsed time for a cylindrical particle is substantially slower than for a spherical particle. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Piaggio, Maria V; Peirotti, Marta B; Deiber, Julio A
2010-08-01
Peptide electrophoretic mobility data are interpreted through a physicochemical CZE model, providing estimates of the equivalent hydrodynamic radius, hydration, effective and total charge numbers, actual ionizing pK, pH-near molecule and electrical permittivity of peptide domain, among other basic properties. In this study, they are used to estimate some peptide global structural properties proposed, providing thus a distinction among different peptides. Therefore, the solvent drag on the peptide is obtained through a characteristic friction power coefficient of the number of amino acid residues, defined from the global chain conformation in solution. As modeling of the effective electrophoretic mobility of peptides is carried out in terms of particle hydrodynamic size and shape coupled to hydration and effective charge, a packing dimension related to chain conformation within the peptide domain may be defined. In addition, the effective and total charge number fractions of peptides provide some clues on the interpretation of chain conformations within the framework of scaling laws. Furthermore, the model estimates transport properties, such as sedimentation, friction and diffusion coefficients. As the relative numbers of ionizing, polar and non-polar amino acid residues vary in peptides, their global structural properties defined here change appreciably. Needs for further research are also discussed.
Popovici, Jonathan; White, Colin P; Hoelle, Jill; Kinkle, Brian K; Lytle, Darren A
2014-06-01
The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregation, adhesion to surfaces, and stability of the cells within the aqueous environments. These cell characteristics are unique to the bacterial species and are a reflection of the large diversity of surface structures, proteins, and appendages of microorganisms. CSH and EPM of bacterial cells contribute substantially to the effectiveness of drinking water treatment to remove them, and therefore an investigation of these properties will be useful in predicting their removal through drinking water treatment processes and transport through drinking water distribution systems. EPM and CSH measurements of six microbiological pathogen or surrogate species suspended in phosphate-buffered water are reported in this work. Two strains of Vibrio cholerae were hydrophobic, while three strains of Escherichia coli were hydrophilic. Bacillus cereus was categorized as moderately hydrophobic. The strains of E. coli had the highest (most negative) EPM. Based on the measurements, E. coli species is predicted to be most difficult to remove from water while V. cholerae will be the easiest to remove. Copyright © 2014 Elsevier B.V. All rights reserved.
Column-coupling strategies for multidimensional electrophoretic separation techniques.
Kler, Pablo A; Sydes, Daniel; Huhn, Carolin
2015-01-01
Multidimensional electrophoretic separations represent one of the most common strategies for dealing with the analysis of complex samples. In recent years we have been witnessing the explosive growth of separation techniques for the analysis of complex samples in applications ranging from life sciences to industry. In this sense, electrophoretic separations offer several strategic advantages such as excellent separation efficiency, different methods with a broad range of separation mechanisms, and low liquid consumption generating less waste effluents and lower costs per analysis, among others. Despite their impressive separation efficiency, multidimensional electrophoretic separations present some drawbacks that have delayed their extensive use: the volumes of the columns, and consequently of the injected sample, are significantly smaller compared to other analytical techniques, thus the coupling interfaces between two separations components must be very efficient in terms of providing geometrical precision with low dead volume. Likewise, very sensitive detection systems are required. Additionally, in electrophoretic separation techniques, the surface properties of the columns play a fundamental role for electroosmosis as well as the unwanted adsorption of proteins or other complex biomolecules. In this sense the requirements for an efficient coupling for electrophoretic separation techniques involve several aspects related to microfluidics and physicochemical interactions of the electrolyte solutions and the solid capillary walls. It is interesting to see how these multidimensional electrophoretic separation techniques have been used jointly with different detection techniques, for intermediate detection as well as for final identification and quantification, particularly important in the case of mass spectrometry. In this work we present a critical review about the different strategies for coupling two or more electrophoretic separation techniques and the different intermediate and final detection methods implemented for such separations.
Su, Wei; Qian, Quanquan; Li, Peiyuan; Lei, Xiaolin; Xiao, Qi; Huang, Shan; Huang, Chusheng; Cui, Jianguo
2013-11-04
A series of ketone-N(4)-substituted thiosemicarbazone (TSC) compounds (L1-L9) and their corresponding [(η(6)-p-cymene)Ru(II)(TSC)Cl](+/0) complexes (1-9) were synthesized and characterized by NMR, IR, elemental analysis, and HR-ESI-mass spectrometry. The molecular structures of L4, L9, 1-6, and 9 were determined by single-crystal X-ray diffraction analysis. The compounds were further evaluated for their in vitro antiproliferative activities against the SGC-7901 human gastric cancer, BEL-7404 human liver cancer, and HEK-293T noncancerous cell lines. Furthermore, the interactions of the compounds with DNA were followed by electrophoretic mobility spectrometry studies.
Stability and transport of graphene oxide nanoparticles in groundwater and surface water
USDA-ARS?s Scientific Manuscript database
A transport study investigating the effects of natural organic matter (NOM) in the presence of monovalent (KCl) and divalent (CaCl2) salts was performed in a packed bed column. The electrophoretic mobility (EPM) and effective diameter of the graphene oxide nanoparticles (GONPs) were measured as a fu...
USDA-ARS?s Scientific Manuscript database
Selenite Se(IV) and selenate Se(VI) adsorption behavior was investigated on gibbsite as a function of solution pH and solution ionic strength. Adsorption of both Se redox states decreased with increasing solution pH. Electrophoretic mobility measurements showed downward shifts in point of zero cha...
Preparative electrophoresis of cultured human cells: Effect of cell cycle phase
NASA Technical Reports Server (NTRS)
Kunze, M. E.; Todd, P. W.; Goolsby, C. L.; Walker, J. T.
1985-01-01
Human epithelioid T-1E cells were cultured in suspension and subjected to density gradient electrophoresis upward in a vertical column. It is indicated that the most rapidly migrating cells were at the beginning of the cell cycle and the most slowly migrating cells were at the end of the cell cycle. The fastest migrating cells divided 24 hr later than the slowest migrating cells. Colonies developing from slowly migrating cells had twice as many cells during exponential growth as did the most rapidly migrating cells, and the numbers of cells per colony at any time was inversely related to the electrophoretic migration rate. The DNA measurements by fluorescence flow cytometry indicates that the slowest migrating cell populations are enriched in cells that have twice as much DNA as the fastest migrating cells. It is concluded that electrophoretic mobility of these cultured human cells declines steadily through the cell cycle and that the mobility is lowest at the end of G sub 2 phase and highest at the beginning of G sub 1 phase.
Shaw, C F; Schaeffer-Memmel, N; Krawczak, D
1986-03-01
The metabolites of gold in the urine of rats given the antiarthritic drug aurothiomalate were investigated by gel permeation chromatography, electrophoresis, and chemical studies. Following a single dose of aurtothiomalate, the excreted gold was protein-bound in the high-molecular-weight (greater than or equal to 150,000 dalton) and serum albumin fractions. Electrophoresis confirmed the presence of albumin, but showed that the other proteins present differ from those in normal or in vitro aurothiomalate-incubated rat sera. The pattern of the proteins establishes that the proteinuria was of the glomerular type. The alterations in the gold distribution produced by incubation of the urine with the low-molecular-weight thiol penicillamine and with exogenously added aurothiomalate indicated the existence of a labile equilibrium of gold among protein binding sites in the urine. Incubation of rat and human sera and commercially prepared serum albumins with aurothiomalate increased the electrophoretic mobility of the albumin. The significance of this change in electrophoretic mobility with respect to two models of gold binding by serum albumin is discussed.
Freire, Carmen S. R.; Coutinho, João A. P.; Silvestre, Armando J. D.; Freire, Mara G.
2016-01-01
Due to their unique properties, in recent years, ionic liquids (ILs) have been largely investigated in the field of analytical chemistry. Particularly during the last sixteen years, they have been successfully applied in the chromatographic and electrophoretic analysis of value-added compounds extracted from biomass. Considering the growing interest in the use of ILs in this field, this critical review provides a comprehensive overview on the improvements achieved using ILs as constituents of mobile or stationary phases in analytical techniques, namely in capillary electrophoresis and its different modes, in high performance liquid chromatography, and in gas chromatography, for the separation and analysis of natural compounds. The impact of the IL chemical structure and the influence of secondary parameters, such as the IL concentration, temperature, pH, voltage and analysis time (when applied), are also critically addressed regarding the achieved separation improvements. Major conclusions on the role of ILs in the separation mechanisms and the performance of these techniques in terms of efficiency, resolution and selectivity are provided. Based on a critical analysis of all published results, some target-oriented ILs are suggested. Finally, current drawbacks and future challenges in the field are highlighted. In particular, the design and use of more benign and effective ILs as well as the development of integrated (and thus more sustainable) extraction–separation processes using IL aqueous solutions are suggested within a green chemistry perspective. PMID:27667965
Fundamentals of capillary electrochromatography: migration behavior of ionized sample components.
Xiang, Rong; Horváth, Csaba
2002-02-15
The mechanism of separating charged species by capillary electrochromatography (CEC) was modeled with the conditions of ideal/linear chromatography by using a simple random walk. The most novel aspect of the work rests with the assumption that in sufficiently high electric field ionized sample components can also migrate in the adsorbed state on the ionized surface of the stationary phase. This feature of CEC leads to the introduction of three dimensionless parameters: alpha, reduced mobility of a sample component with the electrosmotic mobility as the reference; beta, the CEC retention factor; and gamma, the ratio of the electrophoretic migration velocity and the velocity of surface electrodiffusion. Since the interplay of retentive and electrophoretic forces determines the overall migration velocity, the separation mechanism in CEC is governed by the relative importance of the above parameters. The model predicts conditions under which the features of the CEC system engender migration behavior that manifests itself in a relatively narrow elution window and in a gradient like elution pattern in the separation of peptides and proteins by using pro forma isocratic CEC. It is believed that such elution patterns, which resemble those obtained by the use of external gradient of the eluent, are brought about by the formation of an internal gradient in the CEC system that gave rise to concomitant peak compression. The peculiarities of CEC are discussed in the three operational modalities of the technique: co-current, countercurrent, and co-counter CEC. The results suggest that CEC, which is often called "liquid chromatography on electrophoretic platform" is an analytical tool with great potential in the separation of peptides and proteins.
Candidate space processing techniques for biomaterials other than preparative electrophoresis
NASA Technical Reports Server (NTRS)
Brooks, D. E.
1976-01-01
The advantages of performing the partition and countercurrent distribution (CCD) of cells in phase separated aqueous polymer systems under reduced gravity were assessed. Other possible applications considered for the space processing program include the freezing front separation of cells, adsorption of cells at the air-water interface, and the macrophage electrophoretic mobility test for cancer.
Electrophoretic mobility patterns of collagen following laser welding
NASA Astrophysics Data System (ADS)
Bass, Lawrence S.; Moazami, Nader; Pocsidio, Joanne O.; Oz, Mehmet C.; LoGerfo, Paul; Treat, Michael R.
1991-06-01
Clinical application of laser vascular anastomosis in inhibited by a lack of understanding of its mechanism. Whether tissue fusion results from covalent or non-covalent bonding of collagen and other structural proteins is unknown. We compared electrophoretic mobility of collagen in laser treated and untreated specimens of rat tail tendon (>90% type I collagen) and rabbit aorta. Welding was performed, using tissue shrinkage as the clinical endpoint, using the 808 nm diode laser (power density 14 watts/cm2) and topical indocyanine green dye (max absorption 805 nm). Collagen was extracted with 8 M urea (denaturing), 0.5 M acetic acid (non-denaturing) and acetic acid/pepsin (cleaves non- helical protein). Mobility patterns on gel electrophoresis (SDS-PAGE) after urea or acetic acid extraction were identical in the lasered and control tendon and vessel (confirmed by optical densitometry), revealing no evidence of formation of novel covalent bonds. Alpha and beta band intensity was diminished in pepsin incubated lasered specimens compared with controls (optical density ratio 0.00 +/- 9 tendon, 0.65 +/- 0.12 aorta), indicating the presence of denatured collagen. With the laser parameters used, collagen is denatured without formation of covalent bonds, suggesting that non-covalent interaction between denatured collagen molecules may be responsible for the weld. Based on this mechanism, welding parameters can be chosen which produce collagen denaturation without cell death.
Kostal, Vratislav; Arriaga, Edgar A.
2011-01-01
Interactions between the cytoskeleton and mitochondria are essential for normal cellular function. An assessment of such interactions is commonly based on bulk analysis of mitochondrial and cytoskeletal markers present in a given sample, which assumes complete binding between these two organelle types. Such measurements are biased because they rarely account for non-bound ‘free’ subcellular species. Here we report on the use of capillary electrophoresis with dual laser induced fluorescence detection (CE-LIF) to identify, classify, count and quantify properties of individual binding events of mitochondria and cytoskeleton. Mitochondria were fluorescently labeled with DsRed2 while F-actin, a major cytoskeletal component, was fluorescently labeled with Alexa488-phalloidin. In a typical subcellular fraction of L6 myoblasts, 79% of mitochondrial events did not have detectable levels of F-actin, while the rest had on average ~2 zeptomole F-actin, which theoretically represents a ~ 2.5-μm long network of actin filaments per event. Trypsin treatment of L6 subcellular fractions prior to analysis decreased the fraction of mitochondrial events with detectable levels of F-actin, which is expected from digestion of cytoskeletal proteins on the surface of mitochondria. The electrophoretic mobility distributions of the individual events were also used to further distinguish between cytoskeleton-bound from cytoskeleton-free mitochondrial events. The CE-LIF approach described here could be further developed to explore cytoskeleton interactions with other subcellular structures, the effects of cytoskeleton destabilizing drugs, and the progression of viral infections. PMID:21309532
NASA Technical Reports Server (NTRS)
Tsai, Amos; Mosher, Richard A.; Bier, Milan
1986-01-01
Computer simulation is used to analyze a system of two electrophoretic columns coupled by mixing the anolyte of one with the catholyte of the other. A mathematical model is presented which is used to predict the pH gradients formed by monovalent buffers in this system, when the currents in the columns are unequal. In the column with the higher current a pH gradient is created which increases from anode to cathode and is potentially useful for isoelectric focusing. The breadth of this gradient is dependent upon the ratio of the currents. The function of the second column is the compensation of buffer migration which occurs in the first column, thereby maintaining constant electrolyte composition. The effects of buffer pKs and mobilities are evaluated.
Combined electrophoretic-separation and electrospray method and system
Smith, Richard D.; Olivares, Jose A.
1989-01-01
A system and method for analyzing molecular constituents of a composition sample includes: forming a solution of the sample, separating the solution by capillary zone electrophoresis into an eluent of constituents longitudinally separated according to their relative electrophoretic mobilities, electrospraying the eluent to form a charged spray in which the molecular constituents have a temporal distribution; and detecting or collecting the separated constituents in accordance with the temporal distribution in the spray. A first high-voltage (e.g., 5-100 KVDC) is applied to the solution. The spray is charged by applying a second high voltage (e.g., .+-.2-8 KVDC) between the eluent at the capillary exit and a cathode spaced in front of the exit. A complete electrical circuit is formed by a conductor which directly contacts the eluent at the capillary exit.
Lokajová, Jana; Railila, Annika; King, Alistair W T; Wiedmer, Susanne K
2013-09-20
The distribution constants of some analytes, closely connected to the petrochemical industry, between an aqueous phase and a phosphonium ionic liquid phase, were determined by ionic liquid micellar electrokinetic chromatography (MEKC). The phosphonium ionic liquids studied were the water-soluble tributyl(tetradecyl)phosphonium with chloride or acetate as the counter ion. The retention factors were calculated and used for determination of the distribution constants. For calculating the retention factors the electrophoretic mobilities of the ionic liquids were required, thus, we adopted the iterative process, based on a homologous series of alkyl benzoates. Calculation of the distribution constants required information on the phase-ratio of the systems. For this the critical micelle concentrations (CMC) of the ionic liquids were needed. The CMCs were calculated using a method based on PeakMaster simulations, using the electrophoretic mobilities of system peaks. The resulting distribution constants for the neutral analytes between the ionic liquid and the aqueous (buffer) phase were compared with octanol-water partitioning coefficients. The results indicate that there are other factors affecting the distribution of analytes between phases, than just simple hydrophobic interactions. Copyright © 2013 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Todd, P. W.; Sarnoff, B. E.; Li, Z. K.
1985-01-01
Studies of the physical properties of continuous-flow zero-G electrophoretic separator (CFES) buffer, the electrokinetic properties of human erythrocytes in the CFES buffer, the electrokinetic properties of human embryonic kidney cells in the CFES buffer, and the viability and yield of human embryonc kidney cells subjected to flight handling procedures are discussed. In general, the procedure for cell handling and electrophoresis of HEK-8514 cells in 1st or 2nd passage on STS-8 is acceptable if executed properly. The CFES buffer has ionic strength that is barely compatible with cell viability and membrane stability, as seen in experiments with human erythrocytes and trypan-blue staining of human kidney cells. Cells suspended in 10% dialysed horse serum for 3 days in the cold appear to be more stable than freshly trypsinized cells. 10% horse serum appears to be superior to 5% horse serum for this purpose. The mean absolute raw mobility of HEK-8514 cells in CFES buffer at 6 degrees, conductivity 0.055 mmho/cm, is 1.1 to 1.4 um-cm/V-sec, with a range of nearly a whole mobility unit.
NASA Technical Reports Server (NTRS)
Hymer, W. C.; Salada, T.; Cenci, R.; Krishnan, K.; Seaman, G. V. F.; Snyder, R.; Matsumiya, H.; Nagaoka, S.
1996-01-01
In this report we describe the results of a continuous flow electrophoresis (CFE) experiment done on STS-65 in which we tested the idea that intracellular growth hormone (GH) particles contained in a cell lysate prepared from cultured rat anterior pituitary cells in microgravity might have different electrophoretic mobilities from those in a synchronous ground control cell lysate. Collectively, the results suggested that CFE processing in microgravity was better than on earth; more samples could be processed at a time (6 x) and more variant forms of GH molecules could be resolved as well. We had also hoped to carry out a pituitary cell CFE experiment, but failure of the hardware required that the actual cell electrophoresis trials be done on earth shortly after Shuttle landing. Data from these experiments showed that space-flown cells possessed a higher electrophoretic mobility than ground control cells, thereby offering evidence for the idea that exposure of cultured cells to microgravity can change their net surface charge-density especially when the cells are fed. Collectively, the results from this pituitary cell experiment document the advantage of using coupled cell culture and CFE techniques in the microgravity environment.
Assessing the scalability of dynamic field gradient focusing by linear modeling
Tracy, Noah I.; Ivory, Cornelius F.
2010-01-01
Dynamic field gradient focusing (DFGF) separates and concentrates proteins in native buffers, where proteins are most soluble, using a computer-controlled electric field gradient which lets the operator adjust the pace and resolution of the separation in real-time. The work in this paper assessed whether DFGF could be scaled up from microgram analytical-scale protein loads to milligram preparative-scale loads. Linear modeling of the electric potential, protein transport, and heat transfer simulated the performance of a preparative-scale DFGF instrument. The electric potential model showed where the electrodes should be placed to optimize the shape and strength of the electric field gradient. Results from the protein transport model suggested that in 10 min the device should separate 10 mg each of two proteins whose electrophoretic mobilities differ by 5 ×. Proteins with electrophoretic mobilities differing by only 5% should separate in 3 h. The heat transfer model showed that the preparative DFGF design could dissipate 1 kW of Joule heat while keeping the separation chamber at 25°C. Model results pointed to DFGF successfully scaling up by 1000 × using the proposed instrument design. PMID:18196522
Cell and Particle Interactions and Aggregation During Electrophoretic Motion
NASA Technical Reports Server (NTRS)
Davis, Robert H.
2000-01-01
The objectives of this research were (i) to perform experiments for observing and quantifying electrophoretic aggregation, (ii) to develop a theoretical description to appropriately analyze and compare with the experimental results, (iii) to study the combined effects of electrophoretic and gravitational aggregation of large particles, and the combined effects of electrophoretic and Brownian aggregation of small particles, and (iv) to perform a preliminary design of a potential future flight experiment involving electrophoretic aggregation. Electrophoresis refers to the motion of charged particles, droplets or molecules in response to an applied electric field. Electrophoresis is commonly used for analysis and separation of biological particles or molecules. When particles have different surface charge densities or potentials, they will migrate at different velocities in an electric field. This differential migration leads to the possibility that they will collide and aggregate, thereby preventing separation.
EMSA Analysis of DNA Binding By Rgg Proteins
LaSarre, Breah; Federle, Michael J.
2016-01-01
In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function (e.g. interruption of DNA-binding in some cases). PMID:27430004
EMSA Analysis of DNA Binding By Rgg Proteins.
LaSarre, Breah; Federle, Michael J
2013-08-20
In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function ( e.g. interruption of DNA-binding in some cases).
Hibiscus anthocyanins-rich extract inhibited LDL oxidation and oxLDL-mediated macrophages apoptosis.
Chang, Yun-Ching; Huang, Kai-Xun; Huang, An-Chung; Ho, Yung-Chyuan; Wang, Chau-Jong
2006-07-01
The oxidative modification of low-density lipoprotein (LDL) plays a key role in the pathogenesis of atherosclerosis. Anti-oxidative reagents, which can effectively inhibit LDL oxidation, may prevent atherosclerosis via reducing early atherogenesis, and slowing down the progression to advance stages. As shown in previous studies Hibiscus sabdariffa L. is a natural plant containing a lot of pigments that was found to possess anti-oxidative of activity. Therefore, in this study, we evaluated the anti-oxidative activity of Hibiscus anthocyanins (HAs) by measuring their effects on LDL oxidation (in cell-free system) and anti-apoptotic abilities (in RAW264.7 cells). HAs have been tested in vitro examining their relative electrophoretic mobility (REM), Apo B fragmentation, thiobarbituric acid relative substances (TBARS) and radical 1,1-diphenyl-2-picrylhydrazyl (DPPH) scavenging activity assay. The anti-oxidative activity of HAs was defined by relative electrophoretic mobility of oxLDL (decrease of 50% at 2 mg/ml), fragmentation of Apo B (inhibition of 61% at 1mg/ml), and TBARS assay (IC(50): 0.46 mg/ml) in the Cu(2+)-mediated oxidize LDL. Furthermore, the addition of >0.1 mg/ml of HAs could scavenge over 95% of free DPPH radicals, HAs showed strong potential in inhibiting LDL oxidation induced by copper. In addition, to determine whether oxLDL-induced apoptosis in macrophages is inhibited by HAs, we studied the viability, morphology and caspase-3 expression of RAW 264.7 cells. MTT assay, Leukostate staining analysis and Western blotting reveals that HAs could inhibit oxLDL-induced apoptosis. According to these findings, we suggest that HAs may be used to inhibit LDL oxidation and oxLDL-mediated macrophage apoptosis, serving as a chemopreventive agent. However, further investigations into the specificity and mechanism(s) of HAs are needed.
Quirino, Joselito P; Aranas, Agnes T
2011-10-14
The on-line sample concentration technique, micelle to solvent stacking (MSS), was studied for small organic cations (quaternary ammonium herbicides, β-blocker drugs, and tricyclic antidepressant drugs) in reversed migration micellar electrokinetic chromatography. Electrokinetic chromatography was carried out in fused silica capillaries with a background solution of sodium dodecyl sulfate (SDS) in a low pH phosphate buffer. MSS was performed using anionic SDS micelles in the sample solution for analyte transport and methanol or acetonitrile as organic solvent in the background solution for analyte effective electrophoretic mobility reversal. The solvent also allowed for the separation of the analyte test mixtures. A model for focusing and separation was developed and the mobility reversal that involved micelle collapse was experimentally verified. The effect of analyte retention factor was observed by changing the % organic solvent in the background solution or the concentration of SDS in the sample matrix. With an injection length of 31.9 cm (77% of effective capillary length) for the 7 test drugs, the LODs (S/N=3) of 5-14 ng/mL were 101-346-fold better when compared to typical injection. The linearity (R(2), range=0.025-0.8 μg/mL), intraday and interday repeatability (%RSD, n=10) were ≥0.988, <6.0% and <8.5%, respectively. In addition, analysis of spiked urine samples after 10-fold dilution with the sample matrix yielded LODs=0.02-0.10 μg/mL. These LODs are comparable to published electrophoretic methods that required off-line sample concentration. However, the practicality of the technique for more complex samples will rely on dedicated sample preparation schemes. Copyright © 2011 Elsevier B.V. All rights reserved.
Caugant, D A; Zollinger, W D; Mocca, L F; Frasch, C E; Whittam, T S; Frøholm, L O; Selander, R K
1987-01-01
Two hundred and thirty-four strains of Neisseria meningitidis, including 94 serotype 2a, 111 serotype 2b, and 19 serotype 2c isolates, together with 10 isolates that were serotyped as 2 with polyvalent antiserum but did not react with monoclonal antibodies, were characterized by the electrophoretic mobilities of 15 metabolic enzymes. Of these enzymes, 14 were polymorphic, and 56 distinctive combinations of alleles at the enzyme loci (electrophoretic types) were identified, among which the mean genetic diversity per locus was 0.413, or about 75% of that recorded for the species N. meningitidis as a whole. Mean genetic diversity among electrophoretic types of the same serotype (2a, 2b, or 2c) was, however, on average, less than half the total species diversity, and no multilocus genotypes were shared between isolates of the different serotypes, which belong to distinctive clonal lineages. Recent temporal changes in the frequencies of recovery of pathogenic strains of serotypes 2a and 2b in South Africa and North America resulted from clone replacement in these populations rather than evolutionary modification of the serotype protein of the initially dominant clones. PMID:3106223
High Molecular Weight Forms of Mammalian Respiratory Chain Complex II
Nůsková, Hana; Holzerová, Eliška; Vrbacký, Marek; Pecina, Petr; Hejzlarová, Kateřina; Kľučková, Katarína; Rohlena, Jakub; Neuzil, Jiri; Houštěk, Josef
2013-01-01
Mitochondrial respiratory chain is organised into supramolecular structures that can be preserved in mild detergent solubilisates and resolved by native electrophoretic systems. Supercomplexes of respiratory complexes I, III and IV as well as multimeric forms of ATP synthase are well established. However, the involvement of complex II, linking respiratory chain with tricarboxylic acid cycle, in mitochondrial supercomplexes is questionable. Here we show that digitonin-solubilised complex II quantitatively forms high molecular weight structures (CIIhmw) that can be resolved by clear native electrophoresis. CIIhmw structures are enzymatically active and differ in electrophoretic mobility between tissues (500 – over 1000 kDa) and cultured cells (400–670 kDa). While their formation is unaffected by isolated defects in other respiratory chain complexes, they are destabilised in mtDNA-depleted, rho0 cells. Molecular interactions responsible for the assembly of CIIhmw are rather weak with the complexes being more stable in tissues than in cultured cells. While electrophoretic studies and immunoprecipitation experiments of CIIhmw do not indicate specific interactions with the respiratory chain complexes I, III or IV or enzymes of the tricarboxylic acid cycle, they point out to a specific interaction between CII and ATP synthase. PMID:23967256
Optical tweezers with 2.5 kHz bandwidth video detection for single-colloid electrophoresis
NASA Astrophysics Data System (ADS)
Otto, Oliver; Gutsche, Christof; Kremer, Friedrich; Keyser, Ulrich F.
2008-02-01
We developed an optical tweezers setup to study the electrophoretic motion of colloids in an external electric field. The setup is based on standard components for illumination and video detection. Our video based optical tracking of the colloid motion has a time resolution of 0.2ms, resulting in a bandwidth of 2.5kHz. This enables calibration of the optical tweezers by Brownian motion without applying a quadrant photodetector. We demonstrate that our system has a spatial resolution of 0.5nm and a force sensitivity of 20fN using a Fourier algorithm to detect periodic oscillations of the trapped colloid caused by an external ac field. The electrophoretic mobility and zeta potential of a single colloid can be extracted in aqueous solution avoiding screening effects common for usual bulk measurements.
Preparation of guinea pig macrophage for electrophoretic experiments in space
NASA Technical Reports Server (NTRS)
1979-01-01
Methods of storage and cultivation of macrophage cells in preparation for space experiments were investigated. Results show that freezing and thawing immediately after extraction did not cause any change in viability or electrophoretic mobility of the cells. A prolonged storage at -80 C did cause cell damage as indicated by a 95% reduction in variable cells. Cell damage was decreased when Glycerol or Dimethyl Sulfoxide (DMSO) was added as a cryogenic protective agent. A 100% viability was observed in cultivation experiments after two weeks due to the additional serum. Results from gamma-glutamyl transpeptidase study showed a zero activity rate. It is suggested that a flat stationary field be used for the collection and use of macrophage. It was found that a 24-hour delay in obtaining macrophage cells helps to maintain a pure culture.
Combined electrophoretic-separation and electrospray method and system
Smith, R.D.; Olivares, J.A.
1989-06-27
A system and method for analyzing molecular constituents of a composition sample includes: forming a solution of the sample, separating the solution by capillary zone electrophoresis into an eluent of constituents longitudinally separated according to their relative electrophoretic mobilities, electrospraying the eluent to form a charged spray in which the molecular constituents have a temporal distribution; and detecting or collecting the separated constituents in accordance with the temporal distribution in the spray. A first high-voltage (e.g., 5--100 kVDC) is applied to the solution. The spray is charged by applying a second high voltage (e.g., [+-]2--8 kVDC) between the eluent at the capillary exit and a cathode spaced in front of the exit. A complete electrical circuit is formed by a conductor which directly contacts the eluent at the capillary exit. 10 figs.
Boulton, A P; Pascall, J C; Craig, R K
1984-01-01
Golgi and endoplasmic-reticulum fractions were prepared from the lactating guinea-pig mammary gland. The endoplasmic-reticulum fraction was highly active in the processing and sequestration of milk-protein primary translation products. Explants from the lactating gland in organ culture were used to identify milk-protein intermediates present in the secretory pathway, and the timing of the events leading to their post-translational modification. With [35S]methionine, the milk proteins labelled after a short pulse (3 min) were represented by the partially processed (but not phosphorylated) caseins and alpha-lactalbumin sequestered within membrane-bound vesicles. After a 30 min labelling period, higher-Mr caseins with electrophoretic mobilities identical with those of the phosphorylated caseins isolated from milk were identified in the incubation medium, and sequestered within membrane-bound vesicles. Pulse-chase experiments established a precursor-product relationship between these forms. Secretion is apparent approx. 30 min after sequestration. Caseins are highly phosphorylated; removal of the phosphate residues with acid phosphatase results in proteins with increased electrophoretic mobility, similar to those of the partially processed early casein intermediates found sequestered in explants after a 3 min pulse with [35S]methionine, and those sequestered within microsomal membranes after mRNA-directed cell-free protein synthesis. A comparison of the proteins labelled during both short (5 min) and long (30 min) pulses with [35S]methionine and [32P]Pi shows that, in contrast with the 35S-labelled caseins, those labelled with [32P]Pi exhibit only electrophoretic mobilities identical with those of the mature caseins isolated from milk and those identified after long labelling periods with [35S]methionine. No phosphorylated early intermediate forms of caseins were identified. We conclude that the synthesis and post-translational modification of guinea-pig caseins occurs in two stages, (i) an early event involving synthesis and sequestration within the endoplasmic reticulum, an event that involves signal-peptide removal, followed (ii) 10-20 min later by phosphorylation at a different point in the secretory pathway, probably in the Golgi complex. Secretion of the phosphorylated caseins occurs 10-20 min later. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:6477529
Analysis of Toxic and Non-Toxic Alexandrium (Dinophyceae) Species Using Ribosomal RNA Gene Sequences
1993-02-01
Therriault, J.-C. (1988). Cladistic analysis of electrophoretic variants within the toxic dinoflagellate genus Protogonyaulax. Botanica Marina 31: 39- 51. 8... Botanica Marina 34: 575-587. Halegraeff, G. M., and Bolch, C.J. (1992). Transport of toxic dinoflagellate cysts via ship’s ballast water: implications...analysis of electrophoretic variants within the toxic dinoflagellate genus Protogonv-u.!a,. Botanica Marina 31: 39-51. Curran, J., Baillie, D.L
NASA Astrophysics Data System (ADS)
Carr, Bob; Knowles, John; Warren, Jeremy
2008-10-01
We describe the continuing development of a laser-based, light scattering detector system capable of detecting and analysing liquid-borne nanoparticles. Using a finely focussed and specially configured laser beam to illuminate a suspension of nanoparticles in a small (250ul) sample and videoing the Brownian motion of each and every particle in the detection zone should allow individual but simultaneous detection and measurement of particle size, scattered light intensity, electrophoretic mobility and, where applicable, shape asymmetry. This real-time, multi-parameter analysis capability offers the prospect of reagentlessly differentiating between different particle types within a complex sample of potentially high and variable background. Employing relatively low powered (50-100mW) laser diode modules and low resolution CCD arrays, each component could be run off battery power, allowing distributed/remote or personal deployment. Voltages needed for electrophoresis measurement s would be similarly low (e.g. 20V, low current) and 30second videos (exported at mobile/cell phone download speeds) analysed remotely. The potential of such low-cost technology as a field-deployable grid of remote, battery powered and reagentless, multi-parameter sensors for use as trigger devices is discussed.
Large-scale collision cross-section profiling on a travelling wave ion mobility mass spectrometer
Lietz, Christopher B.; Yu, Qing; Li, Lingjun
2014-01-01
Ion mobility (IM) is a gas-phase electrophoretic method that separates ions according to charge and ion-neutral collision cross-section (CCS). Herein, we attempt to apply a travelling wave (TW) IM polyalanine calibration method to shotgun proteomics and create a large peptide CCS database. Mass spectrometry methods that utilize IM, such as HDMSE, often use high transmission voltages for sensitive analysis. However, polyalanine calibration has only been demonstrated with low voltage transmission used to prevent gas-phase activation. If polyalanine ions change conformation under higher transmission voltages used for HDMSE, the calibration may no longer be valid. Thus, we aimed to characterize the accuracy of calibration and CCS measurement under high transmission voltages on a TW IM instrument using the polyalanine calibration method and found that the additional error was not significant. We also evaluated the potential error introduced by liquid chromatography (LC)-HDMSE analysis, and found it to be insignificant as well, validating the calibration method. Finally, we demonstrated the utility of building a large-population peptide CCS database by investigating the effects of terminal lysine position, via LysC or LysN digestion, on the formation of two structural sub-families formed by triply charged ions. PMID:24845359
Hickey, Owen A; Shendruk, Tyler N; Harden, James L; Slater, Gary W
2012-08-31
We introduce a mesoscale simulation method based on multiparticle collision dynamics (MPCD) for the electrohydrodynamics of polyelectrolytes with finite Debye lengths. By applying the Debye-Hückel approximation to assign an effective charge to MPCD particles near charged monomers, our simulations are able to reproduce the rapid rise in the electrophoretic mobility with respect to the degree of polymerization for the shortest polymer lengths followed by a small decrease for longer polymers due to charge condensation. Moreover, these simulations demonstrate the importance of a finite Debye length in accurately determining the mobility of uniformly charged polyelectrolytes and net neutral polyampholytes.
Electro-Optical Platform for the Manipulation of Live Cells
2002-10-02
system, other physical forces may play a significant role. In particular, electroosmotic forces that cause fluid movement relative to a surface can...occur due to the mobility of ions in solution. Electroosmotic forces are commonly utilized in capillary electrophoretic separa- tion, where the capillary...fluid motion that acts to entrain particles to be separated.46 Thus, in the chamber presented here, the patterned anode can induce electroosmotic flow
2009-08-01
tubular mode driven by electroosmotic flow and the inherent electrophoretic mobility of the analytes under the influence of an applied electric field...could be due to unlabeled beads. Figure 3 (C and D) also shows electropherogram of a neutral electroosmotic flow (EOF) marker dye BODIPY and...internal turbulent mixing . The current microfabricated electromagnets cannot produce sufficient fields to trap the NPs against a large flow forces
NASA Technical Reports Server (NTRS)
Rubin, A. L.; Stenzel, K. H.; Cheigh, J. S.; Seaman, G. V. F.; Novogrodsky, A.
1977-01-01
Electrophoretic mobilities (EPM) of peripheral lymphocytes were studied from normal subjects, chronic hemodialysis patients and kidney transplant recipients. A technique to separate B lymphocytes and null cells from non-T lymphocyte preparation was developed. The experiments were designed to determine which subpopulation of the non-T lymphocytes is primarily affected and shows a decreased EPM in chronic hemodialysis patients and kidney transplant recipients.
Electrophoresis experiment for space
NASA Technical Reports Server (NTRS)
Vanderhoff, J. W.; Micale, F. J.
1976-01-01
The Apollo 16 electrophoresis experiment was analyzed, demonstrating that the separation of the two different-size monodisperse latexes did indeed take place, but that the separation was obscured by the pronounced electroosmotic flow of the liquid medium. The results of this experiment, however, were dramatic since it is impossible to carry out a similar separation on earth. It can be stated unequivocally from this experiment that any electrophoretic separation will be enhanced under microgravity conditions. The only question is the degree of this enhancement, which can be expected to vary from one experimental technique to another. The low-electroosmotic-mobility coating (Z6040-MC) developed under this program was found to be suitable for a free-fluid electrophoretic separation such as the experiment designed for the ASTP flight. The problem with this coating, however, is that its permanency is limited because of the slow desorption of the methylcellulose from the coated surface.
Hormone purification by isoelectric focusing in space
NASA Technical Reports Server (NTRS)
Bier, M.
1988-01-01
The objective of the program was the definition and development of optimal methods for electrophoretic separations in microgravity. The approach is based on a triad consisting of ground based experiments, mathematical modeling and experiments in microgravity. Zone electrophoresis is a rate process, where separation is achieved in uniform buffers on the basis of differences in electrophoretic mobilities. Optimization and modeling of continuous flow electrophoresis mainly concern the hydrodynamics of the flow process, including gravity dependent fluid convection due to density gradients and gravity independent electroosmosis. Optimization of focusing requires a more complex model describing the molecular transport processes involved in electrophoresis of interacting systems. Three different focusing instruments were designed, embodying novel principles of fluid stabilization. Fluid stability was achieved by: (1) flow streamlining by means of membrane elements in combination with rapid fluid recycling; (2) apparatus rotation in combination with said membrane elements; and (3) shear stress induced by rapid recycling through a narrow gap channel.
He, Liping; Sato, Kae; Abo, Mitsuru; Okubo, Akira; Yamazaki, Sunao
2003-03-01
Saccharides including mono- and disaccharides were quantitatively derivatized with 2-aminobenzoic acid (2-AA). These derivatives were then separated by capillary zone electrophoresis with UV detection using 50mM sodium phosphate buffer as the running electrolyte solution. In particular, the saccharide derivatives with the same molecular weight as 2-AA aldohexoses (mannose and glucose) and 2-AA aldopentoses (ribose and xylose) were well separated. The underlying reasons for separation were explored by studying their structural data using 1H and 13C NMR. It was found that the configurational difference between their hydroxyl group at C2 or C3 could cause the difference in Stokes' radii between their molecules and thus lead to different electrophoretic mobilities. The correlation between the electrophoretic behavior of these carbohydrate derivatives and their structures was studied utilizing the calculated molecular models of the 2-AA-labeled mannose, glucose, ribose, and xylose.
Use of hydrophilic polymer coatings for control of electroosmosis and protein adsorption
NASA Technical Reports Server (NTRS)
Harris, J. Milton
1987-01-01
The purpose of this project was to examine the utility of polyethylene glycol (PEG) and dextran coatings for control of electroosmosis and protein adsorption; electroosmosis is an important, deleterious process affecting electrophoretic separations, and protein adsorption is a factor which needs to be controlled during protein crystal growth to avoid multiple nucleation sites. Performance of the project required use of X-ray photoelectron spectroscopy to refine previously developed synthetic methods. The results of this spectroscopic examination are reported. Measurements of electroosmotic mobility of charged particles in appropriately coated capillaries reveals that a new, one-step route to coating capillaries gives a surface in which electroosmosis is dramatically reduced. Similarly, both PEG and dextran coatings were shown by protein adsorption measurements to be highly effective at reducing protein adsorption on solid surfaces. These results should have impact on future low-g electrophoretic and protein crystal growth experiments.
Structure of allelic variants of subtype 5 of histone H1 in pea Pisum sativum L.
Bogdanova, V S; Lester, D R; Berdnikov, V A; Andersson, I
2005-06-01
The pea genome contains seven histone H1 genes encoding different subtypes. Previously, the DNA sequence of only one gene, His1, coding for the subtype H1-1, had been identified. We isolated a histone H1 allele from a pea genomic DNA library. Data from the electrophoretic mobility of the pea H1 subtypes and their N-bromosuccinimide cleavage products indicated that the newly isolated gene corresponded to the H1-5 subtype encoded by His5. We confirmed this result by sequencing the gene from three pea lines with H1-5 allelic variants of altered electrophoretic mobility. The allele of the slow H1-5 variant differed from the standard allele by a nucleotide substitution that caused the replacement of the positively charged lysine with asparagine in the DNA-interacting domain of the histone molecule. A temperature-related occurrence had previously been demonstrated for this H1-5 variant in a study on a worldwide collection of pea germplasm. The variant tended to occur at higher frequencies in geographic regions with a cold climate. The fast allelic variant of H1-5 displayed a deletion resulting in the loss of a duplicated pentapeptide in the C-terminal domain.
Mammalian transcription factor LSF is a target of ERK signaling
Pagon, Zrinka; Volker, Janet; Cooper, Geoffrey M.; Hansen, Ulla
2012-01-01
LSF is a mammalian transcription factor that is rapidly and quantitatively phosphorylated upon growth induction of resting, peripheral human T cells, as assayed by a reduction in its electrophoretic mobility. The DNA-binding activity of LSF in primary T cells is greatly increased after this phosphorylation event [Volker et al., 1997]. We demonstrate here that LSF is also rapidly and quantitatively phosphorylated upon growth induction in NIH 3T3 cells, although its DNA-binding activity is not significantly altered. Three lines of experimentation established that ERK is responsible for phosphorylating LSF upon growth induction in both cell types. First, phosphorylation of LSF by ERK is sufficient to cause the reduced electrophoretic mobility of LSF. Second, the amount of ERK activity correlates with the extent of LSF phosphorylation in both primary human T cells and NIH 3T3 cells. Finally, specific inhibitors of the Ras/Raf/MEK/ERK pathway inhibit LSF modification in vivo. This phosphorylation by ERK is not sufficient for activation of LSF DNA-binding activity, as evidenced both in vitro and in mouse fibroblasts. Nonetheless, activation of ERK is a prerequisite for the substantial increase in LSF DNA-binding activity upon activation of resting T cells, indicating that ERK phosphorylation is necessary but not sufficient for activation of LSF in this cell type. PMID:12858339
Biased Cyclical Electrical Field-Flow Fractionation for Separation of Submicron Particles
Ornthai, Mathuros; Siripinyanond, Atitaya; Gale, Bruce K.
2015-01-01
The potential of biased cyclical electrical field flow fractionation (BCyElFFF), which applies the positive cycle voltage longer than the negative cycle voltage, for characterization of submicron particles, was investigated. Parameters affecting separation and retention such as voltage, frequency, and duty cycle were examined. The results suggest that the separation mechanism in BCyElFFF in many cases is more related to the size of particles, as is the case with normal ElFFF, in the studied conditions, than the electrophoretic mobility, which is what the theory predicts for CyElFFF. However, better resolution was obtained when separating using BCyElFFF mode than when using normal CyElFFF. BCyElFFF was able to demonstrate simultaneous baseline separations of a mixture of 0.04, 0.1, and 0.2 μm particles and near separation of 0.5 μm particles. This study has shown the applicability of the BCyElFFF for separation and characterization of submicron particles greater than 0.1 μm in size, which had not been demonstrated previously. The separation and retention results suggest that for particles of this size, retention is based more on particle size than on electrophoretic mobility, which is contrary to existing theory for CyElFFF. PMID:26612733
Biased cyclical electrical field-flow fractionation for separation of submicron particles.
Ornthai, Mathuros; Siripinyanond, Atitaya; Gale, Bruce K
2016-01-01
The potential of biased cyclical electrical field-flow fractionation (BCyElFFF), which applies the positive cycle voltage longer than the negative cycle voltage, for characterization of submicron particles, was investigated. Parameters affecting separation and retention such as voltage, frequency, and duty cycle were examined. The results suggest that the separation mechanism in BCyElFFF in many cases is more related to the size of particles, as is the case with normal ElFFF, in the studied conditions, than the electrophoretic mobility, which is what the theory predicts for CyElFFF. However, better resolution was obtained when separating using BCyElFFF mode than when using normal CyElFFF. BCyElFFF was able to demonstrate simultaneous baseline separations of a mixture of 0.04-, 0.1-, and 0.2-μm particles and near separation of 0.5-μm particles. This study has shown the applicability of BCyElFFF for separation and characterization of submicron particles greater than 0.1-μm in size, which had not been demonstrated previously. The separation and retention results suggest that for particles of this size, retention is based more on particle size than on electrophoretic mobility, which is contrary to existing theory for CyElFFF.
Miwa, S; Ono, J; Nakashima, K; Abe, S; Kageoka, T
1976-01-01
Two new variants of glucose 6-phosphate dehydrogenase (G6PD) deficiency associated with chronic nonspherocytic hemolytic anemia were discovered in Japan. Gd(-) Tokushima was found in a 17-years-old male whose erythrocytes contained 4.4% of normal enzyme activity. Partially purified enzyme revealed a main band of normal electrophoretic mobility with additional two minor bands of different mobility; normal Km G6P, and Km NADP five-to sixfold higher than normal; normal utilization of 2-deoxy-G6P, galactose-6P, and deamino-NADP; marked thermal instability; a normal pH curve; and normal Ki NADPH. The hemolytic anemia was moderate to severe. Gd(-) Tokyo was characterized from a 15-year-old male who had chronic nonspherocytic hemolytic anemia of mild degree. The erythrocytes contained 3% of normal enzyme activity, and partially purified enzyme revealed slow electrophoretic mobility (90% of normal for both a tris-hydrochloride buffer system and a tris-EDTA-borate buffer system, and 70% of normal for a phosphate buffer system); normal Km G6P and Km NADP; normal utilization of 2-deoxy-G6P, galactose-6P, and deamino-NADP; greatly increased thermal instability; a normal pH curve; and normal Ki NADPH. These two variants are clearly different from hitherto described G6PD variants, including the Japanese variants Gd(-) Heian and Gd(-) Kyoto. The mothers of both Gd(-) Tokushima and Gd(-) Tokoyo were found to be heterozygote by an ascorbate-cyanide test.
Giera, Brian; Bukosky, Scott; Lee, Elaine; ...
2018-01-23
Here, quantitative color analysis is performed on videos of high contrast, low power reversible electrophoretic deposition (EPD)-based displays operated under different applied voltages. This analysis is coded in an open-source software, relies on a color differentiation metric, ΔE * 00, derived from digital video, and provides an intuitive relationship between the operating conditions of the devices and their performance. Time-dependent ΔE * 00 color analysis reveals color relaxation behavior, recoverability for different voltage sequences, and operating conditions that can lead to optimal performance.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giera, Brian; Bukosky, Scott; Lee, Elaine
Here, quantitative color analysis is performed on videos of high contrast, low power reversible electrophoretic deposition (EPD)-based displays operated under different applied voltages. This analysis is coded in an open-source software, relies on a color differentiation metric, ΔE * 00, derived from digital video, and provides an intuitive relationship between the operating conditions of the devices and their performance. Time-dependent ΔE * 00 color analysis reveals color relaxation behavior, recoverability for different voltage sequences, and operating conditions that can lead to optimal performance.
Analysis of E2F factors during epidermal differentiation.
Chang, Wing Y; Dagnino, Lina
2005-01-01
The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.
NASA Technical Reports Server (NTRS)
Todd, P.
1985-01-01
Materials and procedures for microgravity electrophoresis of living human embryonic kidney cells were evaluated, ground support in the form of analytical cell electrophoresis and flow cytometry was provided and cells returned from space flight were analyzed. Preflight culture media, electrophoresis buffer, fraction collection media, temperature profiles, and urokinase assay procedures were tested prior to flight. Electrophoretic mobility distributions of aliquots of the cell population to be fractionated in flight were obtained. The protocol established and utilized is given.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Neumann, H.; Moran, E.M.; Russell, R.M.
1974-10-11
A distinct alkaline phosphatase (phosphatase N) was demonstrated in the serum of patients with acute lymphatic leukemia, chronic lymphatic leukemia, and infectious mononucleosis. This enzyme closely resembles that extracted from the thymus of mice with lymphoma or lymphatic leukemia, both in its electrophoretic mobility and its substrate specificity. The phosphatase N activity was related to the clinical state of patients with lymphatic leukemia and disappeared with recovery from infectious mononucleosis.
Genomic Instability and Breast Cancer
2011-06-01
Survival Assay—Atotal of 1 103 cells were seeded onto a 60-mm dish in triplicate. Twenty-four hours after seeding, cells were irradiated by using a JL...ShepherdMark I-68A 137Cs- irradiator at indicated doses and incubated for 14 days. Result- ing colonies were fixed and stainedwithCoomassie Blue. Num...antibodies, cell culture, transfection and siRNAs, DNA substrates protein purification in insect cells, electrophoretic mobility shift assay and the ATPase
Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan
2008-01-01
Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.
Liquid and gel electrodes for transverse free flow electrophoresis
Jung, Byoungsok; Rose, Klint A; Shusteff, Maxim; Persat, Alexandre; Santiago, Juan
2015-04-07
The present invention provides a mechanism for separating or isolating charged particles under the influence of an electric field without metal electrodes being in direct contact with the sample solution. The metal electrodes normally in contact with the sample are replaced with high conductivity fluid electrodes situated parallel and adjacent to the sample. When the fluid electrodes transmit the electric field across the sample, particles within the sample migrate according to their electrophoretic mobility.
NASA Technical Reports Server (NTRS)
Todd, Paul; Plank, Lindsay D.; Kunze, M. Elaine; Lewis, Marian L.; Morrison, Dennis R.
1986-01-01
The use of free-fluid electrophoresis methods to separate tissue cells having a specific function is discussed. It is shown that cells suspended by trypsinization from cultures of human embryonic kidney are electrophoretically heterogeneous and tolerate a wide range of electrophoresis buffers and conditions without significant attenuation of function. Moreover, these cells do not separate electrophoretically on the basis of size or cell position alone and can be separated according to their ability to give rise to progeny that produce specific plasminogen activators.
Triazine herbicide imprinted monolithic column for capillary electrochromatography.
Aşır, Süleyman; Derazshamshir, Ali; Yılmaz, Fatma; Denizli, Adil
2015-12-01
Trietazine was selectively separated from aqueous solution containing the competitor molecule cyanazine, which is similar in size and shape to the template molecule. Structural features of the molecularly imprinted column were figured out by SEM. The influence of the mobile-phase composition, applied electrical field, and pH of the mobile phase on the recognition of trietazine by the imprinted monolithic polymer has been evaluated, and the imprint effect in the trietazine-imprinted monolithic polymer was demonstrated by an imprinting factor. The optimized monolithic column resulted in separation of trietazine from a structurally related competitor molecule, cyanazine. In addition, fast separation was obtained within 6 min by applying higher electrical field, with the electrophoretic mobility of 2.97 × 10(-8) m(2) V(-1) s(-1) at pH 11.0. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Kubo, K; Hattori, A
2001-10-01
The use of polyamines as electroosmotic modifiers has been shown to be effective in enhancing resolution of protein glycoforms in capillary zone electrophoresis (CZE) using a bare capillary tube. In this study, effectiveness was evaluated by using a polyacrylamide-coated capillary tube instead of a bare capillary tube. Electropherograms obtained in the presence of polyamines were inferior to those obtained in their absence with respect to resolution. Electrophoretic mobility of the proteins decreased and their peaks were broadened by polyamines bound to them. This unfavorable effect was dependent on both the species of polyamines and the pH values of the electrolyte buffer. The reduction of resolution caused by polyamines was in the following order: spermidine (SPD) approximately spermidine-tri-hydrochloride (SPD-HCI) > putrescine (PUT) > hexamethonium chloride (HMC). The observed effect can be ascribed to the formation of complexes between the proteins and the polyamines. In addition, for the bare capillary tube the complexes showed interaction with the inner surface, resulting in local suppression of electroosmosis and poor resolution. The high resolution obtained in the coated capillary tube was reduced in the presence of the polyamines. Thus, the use of the polyamines has a negative effect on the analysis of protein microheterogeneity as a result of protein-polyamine interaction.
Three-dimensional fluorescence analysis of chernozem humic acids and their electrophoretic fractions
NASA Astrophysics Data System (ADS)
Trubetskoi, O. A.; Trubetskaya, O. E.
2017-09-01
Polyacrylamide gel electrophoresis in combination with size-exclusion chromatography (SEC-PAGE) has been used to obtain stable electrophoretic fractions of different molecular size (MS) from chernozem humic acids (HAs). Three-dimensional fluorescence charts of chernozem HAs and their fractions have been obtained for the first time, and all fluorescence excitation-emission maxima have been identified in the excitation wavelength range of 250-500 nm. It has been found that fractionation by the SEC-PAGE method results in a nonuniform distribution of protein- and humin-like fluorescence of the original HA preparation among the electrophoretic fractions. The electrophoretic fractions of the highest and medium MSs have only the main protein-like fluorescence maximum and traces of humin-like fluorescence. In the electrophoretic fraction of the lowest MS, the intensity of protein-like fluorescence is low, but the major part of humin-like fluorescence is localized there. Relationships between the intensity of protein-like fluorescence and the weight distribution of amino acids have been revealed, as well as between the degree of aromaticity and the intensity of humin-like fluorescence in electrophoretic fractions of different MSs. The obtained relationships can be useful in the interpretation of the spatial structural organization and ecological functions of soil HAs.
Lakshmi, G. Girija; Ghosh, Sushmita; Jones, Gabriel P.; Parikh, Roshni; Rawlins, Bridgette A.; Vaughn, Jack C.
2014-01-01
Alternative splicing greatly enhances the diversity of proteins encoded by eukaryotic genomes, and is also important in gene expression control. In contrast to the great depth of knowledge as to molecular mechanisms in the splicing pathway itself, relatively little is known about the regulatory events behind this process. The 5′-UTR and 3′-UTR in pre-mRNAs play a variety of roles in controlling eukaryotic gene expression, including translational modulation, and nearly 4,000 of the roughly 14,000 protein coding genes in Drosophila contain introns of unknown functional significance in their 5′-UTR. Here we report the results of an RNA electrophoretic mobility shift analysis of Drosophila rnp-4f 5′-UTR intron 0 splicing regulatory proteins. The pre-mRNA potential regulatory element consists of an evolutionarily-conserved 177-nt stem-loop arising from pairing of intron 0 with part of adjacent exon 2. Incubation of in vitro transcribed probe with embryo protein extract is shown to result in two shifted RNA-protein bands, and protein extract from a dADAR null mutant fly line results in only one shifted band. A mutated stem-loop in which the conserved exon 2 primary sequence is changed but secondary structure maintained by introducing compensatory base changes results in diminished band shifts. To test the hypothesis that dADAR plays a role in intron splicing regulation in vivo, levels of unspliced rnp-4f mRNA in dADAR mutant were compared to wild-type via real-time qRT-PCR. The results show that during embryogenesis unspliced rnp-4f mRNA levels fall by up to 85% in the mutant, in support of the hypothesis. Taken together, these results demonstrate a novel role for dADAR protein in rnp-4f 5′-UTR alternative intron splicing regulation which is consistent with a previously proposed model. PMID:23026215
Vertical ascending electrophoresis of cells with a minimal stabilizing medium
NASA Technical Reports Server (NTRS)
Omenyi, S. N.; Snyder, R. S.
1983-01-01
Vertical fractionation of a mixture of fixed horse and human red blood cells layered over a stabilizing support medium was done to give a valid comparison with proposed space experiments. In particular, the effects of sample thickness and concentration on zone migration rate were investigated. Electrophoretic mobilities of horse and human cells calculated from zone migration rates were compatible with those obtained by microelectrophoresis. Complete cell separation was observed when low power and effective cooling were employed.
The surface charge of trypanosomatids.
Souto-Padrón, Thaïs
2002-12-01
The surface charge of trypanosomatids was evaluated by means of the binding of cationic particles, as visualized by electron microscopy and by direct measurements of the electrophoretic mobility of cells. The results obtained indicate that most of the trypanosomatids exhibit a negatively charged surface whose value is species specific and varies according to the developmental stages. Sialic acids associated with glycoproteins, glycolipids and phosphate groups are the major components responsible for the net negative surface charge of the trypanosomatids.
Recombinant albumin monolayers on latex particles.
Sofińska, Kamila; Adamczyk, Zbigniew; Kujda, Marta; Nattich-Rak, Małgorzata
2014-01-14
The adsorption of recombinant human serum albumin (rHSA) on negatively charged polystyrene latex micro-particles was studied at pH 3.5 and the NaCl concentration range of 10(-3) to 0.15 M. The electrophoretic mobility of latex monotonically increased with the albumin concentration in the suspension. The coverage of adsorbed albumin was quantitatively determined using the depletion method, where the residual protein concentration was determined by electrokinetic measurements and AFM imaging. It was shown that albumin adsorption was irreversible. Its maximum coverage on latex varied between 0.7 mg m(-2) for 10(-3) M NaCl to 1.3 mg m(-2) for 0.15 M NaCl. The latter value matches the maximum coverage previously determined for human serum albumin on mica using the streaming potential method. The increase in the maximum coverage was interpreted in terms of reduced electrostatic repulsion among adsorbed molecules. These facts confirm that albumin adsorption at pH 3.5 is governed by electrostatic interactions and proceeds analogously to colloid particle deposition. The stability of albumin monolayers was measured in additional experiments where changes in the latex electrophoretic mobility and the concentration of free albumin in solutions were monitored over prolonged time periods. Based on these experimental data, a robust procedure of preparing albumin monolayers on latex particles of well-controlled coverage and molecule distribution was proposed.
Batz, Nicholas G; Mellors, J Scott; Alarie, Jean Pierre; Ramsey, J Michael
2014-04-01
We describe a chemical vapor deposition (CVD) method for the surface modification of glass microfluidic devices designed to perform electrophoretic separations of cationic species. The microfluidic channel surfaces were modified using aminopropyl silane reagents. Coating homogeneity was inferred by precise measurement of the separation efficiency and electroosmotic mobility for multiple microfluidic devices. Devices coated with (3-aminopropyl)di-isopropylethoxysilane (APDIPES) yielded near diffusion-limited separations and exhibited little change in electroosmotic mobility between pH 2.8 and pH 7.5. We further evaluated the temporal stability of both APDIPES and (3-aminopropyl)triethoxysilane (APTES) coatings when stored for a total of 1 week under vacuum at 4 °C or filled with pH 2.8 background electrolyte at room temperature. Measurements of electroosmotic flow (EOF) and separation efficiency during this time confirmed that both coatings were stable under both conditions. Microfluidic devices with a 23 cm long, serpentine electrophoretic separation channel and integrated nanoelectrospray ionization emitter were CVD coated with APDIPES and used for capillary electrophoresis (CE)-electrospray ionization (ESI)-mass spectrometry (MS) of peptides and proteins. Peptide separations were fast and highly efficient, yielding theoretical plate counts over 600,000 and a peak capacity of 64 in less than 90 s. Intact protein separations using these devices yielded Gaussian peak profiles with separation efficiencies between 100,000 and 400,000 theoretical plates.
Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V
1996-01-19
Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.
Leach, S D; Modlin, I M; Scheele, G A; Gorelick, F S
1991-01-01
The mechanism by which digestive zymogens become activated during acute pancreatitis remains poorly understood. Given the ability for cholecystokinin (CCK) to induce pancreatitis in vivo, the effects of high dose CCK on preparations of isolated pancreatic acini were examined. Using an immunologic technique for the detection of zymogen activation, CCK was found to stimulate the conversion of procarboxypeptidase A1 to a 35-kD form having the same net charge and electrophoretic mobility as purified recombinant carboxypeptidase A1. This enhanced conversion was proportional to the dose of CCK (maximal at 100 nM), and time dependent. CCK also produced changes in the electrophoretic mobility of procarboxypeptidase B and chymotrypsinogen 2 immunoreactivity, consistent with activation of these zymogens. These events were detectable only within acinar cell pellets and not in the incubation medium, suggesting an intracellular site of conversion. The conversion of procarboxypeptidase A1 to its active form was inhibited by pretreatment with the weak base chloroquine (40 microM) and the protonophore monensin (10 microM). This conversion was also inhibited by pretreatment with the serine protease inhibitor benzamidine (10 mM) but not the cysteine protease inhibitor E64 (100 microM). The results suggest that high dose CCK stimulates the intracellular activation of digestive zymogens within isolated pancreatic acini. This event appears to require an acidic subcellular compartment and serine protease activity. Images PMID:1985109
Mathematical models of continuous flow electrophoresis: Electrophoresis technology
NASA Technical Reports Server (NTRS)
Saville, Dudley A.
1986-01-01
Two aspects of continuous flow electrophoresis were studied: (1) the structure of the flow field in continuous flow devices; and (2) the electrokinetic properties of suspended particles relevant to electrophoretic separations. Mathematical models were developed to describe flow structure and stability, with particular emphasis on effects due to buoyancy. To describe the fractionation of an arbitrary particulate sample by continuous flow electrophoresis, a general mathematical model was constructed. In this model, chamber dimensions, field strength, buffer composition, and other design variables can be altered at will to study their effects on resolution and throughput. All these mathematical models were implemented on a digital computer and the codes are available for general use. Experimental and theoretical work with particulate samples probed how particle mobility is related to buffer composition. It was found that ions on the surface of small particles are mobile, contrary to the widely accepted view. This influences particle mobility and suspension conductivity. A novel technique was used to measure the mobility of particles in concentrated suspensions.
Effects of high intensity exercise on isoelectric profiles and SDS-PAGE mobility of erythropoietin.
Voss, S; Lüdke, A; Romberg, S; Schänzer, E; Flenker, U; deMarees, M; Achtzehn, S; Mester, J; Schänzer, W
2010-06-01
Exercise induced proteinuria is a common phenomenon in high performance sports. Based on the appearance of so called "effort urines" in routine doping analysis the purpose of this study was to investigate the influence of exercise induced proteinuria on IEF profiles and SDS-PAGE relative mobility values (rMVs) of endogenous human erythropoietin (EPO). Twenty healthy subjects performed cycle-ergometer exercise until exhaustion. VO (2)max, blood lactate, urinary proteins and urinary creatinine were analysed to evaluate the exercise performance and proteinuria. IEF and SDS-PAGE analyses were performed to test for differences in electrophoretic behaviour of the endogenous EPO before and after exercise. All subjects showed increased levels of protein/creatinine ratio after performance (8.8+/-5.2-26.1+/-14.4). IEF analysis demonstrated an elevation of the relative amount of basic band areas (13.9+/-11.3-36.4+/-12.6). Using SDS-PAGE analysis we observed a decrease in rMVs after exercise and no shift in direction of the recombinant human EPO (rhEPO) region (0.543+/-0.013-0.535+/-0.012). Following identification criteria of the World Anti Doping Agency (WADA) all samples were negative. The implementation of the SDS-PAGE method represents a good solution to distinguish between results influenced by so called effort urines and results of rhEPO abuse. Thus this method can be used to confirm adverse analytical findings.
Peroxiredoxin 3 Is a Redox-Dependent Target of Thiostrepton in Malignant Mesothelioma Cells
Newick, Kheng; Cunniff, Brian; Preston, Kelsey; Held, Paul; Arbiser, Jack; Pass, Harvey; Mossman, Brooke; Shukla, Arti; Heintz, Nicholas
2012-01-01
Thiostrepton (TS) is a thiazole antibiotic that inhibits expression of FOXM1, an oncogenic transcription factor required for cell cycle progression and resistance to oncogene-induced oxidative stress. The mechanism of action of TS is unclear and strategies that enhance TS activity will improve its therapeutic potential. Analysis of human tumor specimens showed FOXM1 is broadly expressed in malignant mesothelioma (MM), an intractable tumor associated with asbestos exposure. The mechanism of action of TS was investigated in a cell culture model of human MM. As for other tumor cell types, TS inhibited expression of FOXM1 in MM cells in a dose-dependent manner. Suppression of FOXM1 expression and coincidental activation of ERK1/2 by TS were abrogated by pre-incubation of cells with the antioxidant N-acetyl-L-cysteine (NAC), indicating its mechanism of action in MM cells is redox-dependent. Examination of the mitochondrial thioredoxin reductase 2 (TR2)-thioredoxin 2 (TRX2)-peroxiredoxin 3 (PRX3) antioxidant network revealed that TS modifies the electrophoretic mobility of PRX3. Incubation of recombinant human PRX3 with TS in vitro also resulted in PRX3 with altered electrophoretic mobility. The cellular and recombinant species of modified PRX3 were resistant to dithiothreitol and SDS and suppressed by NAC, indicating that TS covalently adducts cysteine residues in PRX3. Reduction of endogenous mitochondrial TRX2 levels by the cationic triphenylmethane gentian violet (GV) promoted modification of PRX3 by TS and significantly enhanced its cytotoxic activity. Our results indicate TS covalently adducts PRX3, thereby disabling a major mitochondrial antioxidant network that counters chronic mitochondrial oxidative stress. Redox-active compounds like GV that modify the TR2/TRX2 network may significantly enhance the efficacy of TS, thereby providing a combinatorial approach for exploiting redox-dependent perturbations in mitochondrial function as a therapeutic approach in mesothelioma. PMID:22761781
Rochette, Christophe N; Crassous, Jérôme J; Drechsler, Markus; Gaboriaud, Fabien; Eloy, Marie; de Gaudemaris, Benoît; Duval, Jérôme F L
2013-11-26
The interfacial structure of natural rubber (NR) colloids is investigated by means of cryogenic transmission electron microscopy (cryo-TEM) and electrokinetics over a broad range of KNO3 electrolyte concentrations (4-300 mM) and pH values (1-8). The asymptotic plateau value reached by NR electrophoretic mobility (μ) in the thin double layer limit supports the presence of a soft (ion- and water-permeable) polyelectrolytic type of layer located at the periphery of the NR particles. This property is confirmed by the analysis of the electron density profile obtained from cryo-TEM that evidences a ∼2-4 nm thick corona surrounding the NR polyisoprene core. The dependence of μ on pH and salt concentration is further marked by a dramatic decrease of the point of zero electrophoretic mobility (PZM) from 3.6 to 0.8 with increasing electrolyte concentration in the range 4-300 mM. Using a recent theory for electrohydrodynamics of soft multilayered particles, this "anomalous" dependence of the PZM on electrolyte concentration is shown to be consistent with a radial organization of anionic and cationic groups across the peripheral NR structure. The NR electrokinetic response in the pH range 1-8 is indeed found to be equivalent to that of particles surrounded by a positively charged ∼3.5 nm thick layer (mean dissociation pK ∼ 4.2) supporting a thin and negatively charged outermost layer (0.6 nm in thickness, pK ∼ 0.7). Altogether, the strong dependence of the PZM on electrolyte concentration suggests that the electrostatic properties of the outer peripheral region of the NR shell are mediated by lipidic residues protruding from a shell containing a significant amount of protein-like charges. This proposed NR shell interfacial structure questions previously reported NR representations according to which the shell consists of either a fully mixed lipid-protein layer, or a layer of phospholipids residing exclusively beneath an outer proteic film.
Rim, Jong S; Kozak, Leslie P
2002-09-13
Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.
Heinrich, Hannah T M; Bremer, Phil J; Daughney, Christopher J; McQuillan, A James
2007-02-27
Acid-base functional groups at the surface of Anoxybacillus flavithermus (AF) were assigned from the modeling of batch titration data of bacterial suspensions and compared with those determined from in situ infrared spectroscopic titration analysis. The computer program FITMOD was used to generate a two-site Donnan model (site 1: pKa = 3.26, wet concn = 2.46 x 10(-4) mol g(-1); site 2: pKa = 6.12, wet concn = 6.55 x 10(-5) mol g(-1)), which was able to describe data for whole exponential phase cells from both batch acid-base titrations at 0.01 M ionic strength and electrophoretic mobility measurements over a range of different pH values and ionic strengths. In agreement with information on the composition of bacterial cell walls and a considerable body of modeling literature, site 1 of the model was assigned to carboxyl groups, and site 2 was assigned to amino groups. pH difference IR spectra acquired by in situ attenuated total reflection infrared (ATR-IR) spectroscopy confirmed the presence of carboxyl groups. The spectra appear to show a carboxyl pKa in the 3.3-4.0 range. Further peaks were assigned to phosphodiester groups, which deprotonated at slightly lower pH. The presence of amino groups could not be confirmed or discounted by IR spectroscopy, but a positively charged group corresponding to site 2 was implicated by electrophoretic mobility data. Carboxyl group speciation over a pH range of 2.3-10.3 at two different ionic strengths was further compared to modeling predictions. While model predictions were strongly influenced by the ionic strength change, pH difference IR data showed no significant change. This meant that modeling predictions agreed reasonably well with the IR data for 0.5 M ionic strength but not for 0.01 M ionic strength.
Nowak, Paweł Mateusz; Woźniakiewicz, Michał; Mitoraj, Mariusz; Sagan, Filip; Kościelniak, Paweł
2018-03-02
Capillary electrophoresis is often used to the determination of the acid-base dissociation/deprotonation constant (pK a ), and the more advanced thermodynamic quantities describing this process (ΔH°, -TΔS°). Remarkably, it is commonly overlooked that due to insufficient dissipation of Joule heating the accuracy of parameters determined using a standard approach may be questionable. In this work we show an effective method allowing to enhance reliability of these parameters, and to estimate the magnitude of errors. It relies on finding a relationship between electrophoretic mobility and actual temperature, and performing pK a determination with the corrected mobility values. It has been employed to accurately examine the thermodynamics of acid-base dissociation of several amine compounds - known for their strong dependency of pK a on temperature: six cathinones (2-methylmethcathinone, 3-methylmethcathinone, 4-methylmethcathinone, α-pyrrolidinovalerophenone, methylenedioxypyrovalerone, and ephedrone); and structurally similar 1-phenylethylamine. The average pK a error caused by Joule heating noted at 25 °C was relatively small - 0.04-0.05 pH unit, however, a more significant inaccuracy was observed in the enthalpic and, in particular, entropic terms. An alternative correction method has also been proposed, simpler and faster, but not such effective in correcting ΔH°/-TΔS° terms. The corrected thermodynamic data have been interpreted with the aid of theoretical calculations, on a ground of the enthalpy-entropy relationships and the most probable structural effects accounting for them. Finally, we have demonstrated that the thermal dependencies of electrophoretic mobility, modelled during the correction procedure, may be directly used to find optimal temperature providing a maximal separation efficiency. Copyright © 2018 Elsevier B.V. All rights reserved.
Chemical and immunochemical characterization of caseins and the major whey proteins of rabbit milk.
Dayal, R; Hurlimann, J; Suard, Y M; Kraehenbuhl, J P
1982-01-01
Caseins were separated from whey proteins by acid precipitation of skimmed rabbit milk. Whole casein was resolved by sodium dodecyl sulphate/polyacrylamide-gel electrophoresis into three major bands with apparent relative molecular masses (Mr of 31 000, 29 000 and 25 000. On agarose/urea-gel electrophoresis whole casein gave three bands with electrophoretic mobilities alpha, beta and gamma. The three components were purified by DEAE-cellulose chromatography under denaturing and reducing conditions. Each was shown to have a different amino acid, hexose and phosphorus content, as well as non-identical peptide fragments after proteinase digestion. The 31 000 Da (dalton) protein, of alpha-electrophoretic mobility, had a high phosphorus content (4.38%, w/w); the 29 000 Da peptide, of gamma-mobility, had the highest hexose content (2.2%, w/w), contained 0.8 cysteine residue per 100 amino acid residues and was susceptible to chymosin digestion corresponding thus to kappa-casein; the 25 000 Da protein migrated to the beta-position. The rabbit casein complex is composed of at least three caseins, two of which (alpha- and kappa-caseins) are analogous to the caseins from ruminants. Although caseins are poor immunogens, specific antibodies were raised against total and purified polypeptides. The antiserum directed against whole casein recognized each polypeptide, each casein corresponding to a distinct precipitation line. The antisera directed against each casein polypeptide reacted exclusively with the corresponding casein and no antiserum cross-reaction occurred between the three polypeptides. From whey, several proteins were isolated, characterized and used as antigens to raise specific antibodies. An iron-binding protein with an apparent Mr of 80 000 was shown to be immunologically and structurally identical with serum transferrin. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:6177316
Numerical study of the influence of solid polarization on electrophoresis at finite Debye thickness.
Bhattacharyya, Somnath; De, Simanta
2015-09-01
The influence of solid polarization on the electrophoresis of a uniformly charged dielectric particle for finite values of the particle-to-fluid dielectric permittivity ratio is analyzed quantitatively without imposing the thin Debye length or weak-field assumption. Present analysis is based on the computation of the coupled Poisson-Nernst-Planck and Stokes equations in the fluid domain along with the Laplace equation within the solid. The electrophoretic velocity is determined through the balance of forces acting on the particle. The solid polarization of the charged particle produces a reduction on its electrophoretic velocity compared to a nonpolarizable particle of the same surface charge density. In accordance with the existing thin-layer analysis, our computed results for thin Debye layer shows that the solid polarization is important only when the applied electric field is strong. When the Debye length is in the order of the particle size, the electrophoretic velocity decreases with the rise of the particle permittivity and attains a saturation limit at large values of the permittivity. Our computed solution for electrophoretic velocity is in agreement with the existing asymptotic analyses based on a thin Debye layer for limiting cases.
Shashoua, V E; Nolan, P M; Shea, T B; Milinazzo, B
1992-06-01
Northern blot, immunoprecipitation, and gel electrophoretic data demonstrate that the mouse neuroblastoma NB2a/d1 cells express ependymin mRNA and synthesize and release into the culture medium a protein with immunoreactivity and electrophoretic mobility properties identical to ependymin. This is a brain extracellular glycoprotein that has been implicated in the consolidation process of memory formation and neuronal regeneration. In labeling experiments with 35S-methionine, dibutyrylcyclic3',5'-adenosine-monophosphate (dbcAMP) was found to stimulate the expression of ependymin mRNA and the enhanced synthesis and release of ependymin into the culture medium at the same time that dbcAMP stimulation of neurite outgrowth takes place. These results are consistent with the proposed role of the protein in the mechanism of neuronal regeneration and synaptogenesis. The data indicate that the NB2a/d1 cell line is a good model system for studies of the functional properties of ependymin.
Loxdale, H D; Rhodes, J A; Fox, J S
1985-07-01
A study of variation in three peptidases (PEP-3 to -5) in a parthenogenetic S. avenae field population at Rothamsted using serial one-dimensional polyacrylamide gel electrophoresis (involving changes of gel concentration and electrophoretic run-time) increased the overall number of "allozymes" (mobility variants) detected from 10 under standard conditions (6% gels, 2 h run-time) to 22, as well as revealing putative heterozygous banding patterns under some test conditions. However, an examination of another enzyme, 6-phosphogluconate dehydrogenase (6-PGD) in a sample collected at Rothamsted the following year failed, using a combination of serial methods (changes of gel concentration) and isoelectric focusing, to increase the total number of 6-PGD bands separated (seven, none of which appeared to be allelic in origin). Nevertheless, some major bands were split into several bands, whilst other infrequent bands were either gained or lost. The findings are briefly discussed.
Womack, J E; Cramer, D V
1980-10-01
Starch gel electrophoresis and histochemical staining with L-leucyl-L-tyrosine have revealed genetic variation for dipeptidase in Rattus norvegicus. The tissue distribution, substrate specificity, and heterozygous expression as a monmeric protein suggest homology of the variant peptidase to human PEP-C and mouse Pep-3 (Dip-1). We propose Peptidase-3 (Pep-3) as a name for this autosomal locus in the rat. The allele responsible for slower (less anodal) electrophoretic migration is designated Pep-3a and is characteristic of strain ACI/Pit. A faster (more anodal) electrophoretic mobility is the product of the Pep-3b allele in strain F344/Pit. Twenty-five additional inbred strains carry Pep-3a and 16 others carry Pep-3b. Wild rats trapped in Pittsburgh were polymorphic for this locus. Alleles at Pep-3 segregated independently of c (linkage group I), a (linkage group IV), RT2 and Es-1 (linkage group V), h (linkage group VI), and RTI (linkage group VIII).
Separation of 1-23-kb complementary DNA strands by urea-agarose gel electrophoresis.
Hegedüs, Eva; Kókai, Endre; Kotlyar, Alexander; Dombrádi, Viktor; Szabó, Gábor
2009-09-01
Double-stranded (ds), as well as denatured, single-stranded (ss) DNA samples can be analyzed on urea-agarose gels. Here we report that after denaturation by heat in the presence of 8 M urea, the two strands of the same ds DNA fragment of approximately 1-20-kb size migrate differently in 1 M urea containing agarose gels. The two strands are readily distinguished on Southern blots by ss-specific probes. The different migration of the two strands could be attributed to their different, base composition-dependent conformation impinging on the electrophoretic mobility of the ss molecules. This phenomenon can be exploited for the efficient preparation of strand-specific probes and for the separation of the complementary DNA strands for subsequent analysis, offering a new tool for various cell biological research areas.
In vivo phosphorylation of a peptide tag for protein purification.
Goux, Marine; Fateh, Amina; Defontaine, Alain; Cinier, Mathieu; Tellier, Charles
2016-05-01
To design a new system for the in vivo phosphorylation of proteins in Escherichia coli using the co-expression of the α-subunit of casein kinase II (CKIIα) and a target protein, (Nanofitin) fused with a phosphorylatable tag. The level of the co-expressed CKIIα was controlled by the arabinose promoter and optimal phosphorylation was obtained with 2 % (w/v) arabinose as inductor. The effectiveness of the phosphorylation system was demonstrated by electrophoretic mobility shift assay (NUT-PAGE) and staining with a specific phosphoprotein-staining gel. The resulting phosphorylated tag was also used to purify the phosphoprotein by immobilized metal affinity chromatography, which relies on the specific interaction of phosphate moieties with Fe(III). The use of a single tag for both the purification and protein array anchoring provides a simple and straightforward system for protein analysis.
Murata, H; Hattori, T; Maeda, H; Takashiba, S; Takigawa, M; Kido, J; Nagata, T
2015-08-01
Tumor necrosis factor alpha (TNF-α) is a major cytokine implicated in various inflammatory diseases. The nature of the nuclear factors associated with human TNF-α gene regulation is not well elucidated. We previously identified a novel region located from -550 to -487 in human TNF-α promoter that did not contain the reported binding sites for nuclear factor kappa B (NF-κB) but showed lipopolysaccharide (LPS)-induced transcriptional activity. The purpose of this study is to identify novel factors that bind to the promoter region and regulate TNF-α expression. To identify DNA-binding proteins that bound to the target region of TNF-α promoter, a cDNA library from LPS-stimulated human monocytic cell line THP-1 was screened using a yeast one-hybrid system. Cellular localizations of the DNA-binding protein in the cells were examined by subcellular immunocytochemistry. Nuclear amounts of the protein in LPS-stimulated THP-1 cells were identified by western blot analysis. Expression of mRNA of the protein in the cells was quantified by real-time polymerase chain reaction. Electrophoretic mobility shift assays were performed to confirm the DNA-binding profile. Overexpression of the protein and knockdown of the gene were also performed to investigate the role for TNF-α expression. Several candidates were identified from the cDNA library and transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) was focused on. Western blot analysis revealed that nuclear TDP-43 protein was increased in the LPS-stimulated THP-1 cells. Expression of TDP-43 mRNA was already enhanced before TNF-α induction by LPS. Electrophoretic mobility shift assay analysis showed that nuclear extracts obtained by overexpressing FLAG-tagged TDP-43 bound to the -550 to -487 TNF-α promoter fragments. Overexpression of TDP-43 in THP-1 cells resulted in an increase of TNF-α expression. Knockdown of TDP-43 in THP-1 cells downregulated TNF-α expression. We identified TDP-43 as one of the novel TNF-α factors and found that it bound to the LPS-responsive element in the TNF-α promoter to increase TNF-α expression. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Hoffmann, W.; Kaufmann, R.; Steiner, R.; Werner, W.
1981-01-01
Determination of the electrophoretic mobility of test cells has been widely used in an attempt to detect so-called lymphokines in a laboratory test for cancer, but operational difficulties are inherent in conventional cytopherometers. This study therefore investigates the technical and operational aspects of cell electrophoresis, using the Zeiss cytopherometer; e.g. influence of electro-osmosis, focus uncertainty, movement due to convection and other sources of error. Implications and possible improvements in the test are discussed. PMID:7248145
1998-06-29
Curcumin DFX Desferrioxamine DNA Deoxyribonucleic Acid DPI Diphenyliodinium DPPD Diphenylphenylenediamine DTH Dithionite EMSA Electrophoretic mobility shift... neuroprotective effects (Fern et al., 1996, Morishita et al., 1 1997). The identification of a hypoxia inducible transcription factor known as HIF-1 (Semenza...derived EPO in the eNS neuroprotective response to hypoxia. Cloning of the human and murine EPO gene, the availability of a convenient EPa producing
Biochemical identification of the mallard, Anas platyrhynchos, and black duck, A. rubripes
Morgan, R.P.; Noe, L.A.; Henny, C.J.
1976-01-01
1. Eleven tissue systems from mallards and black ducks were examined for soluble proteins, lactate dehydrogenases and non-specific esterases through discontinuous polyacrylamide techniques.2. Biochemical relationships between the black duck and mallard are extremely similar.3. Hemoglobins and lactate dehydrogenase appear to be common in electrophoretic mobility between the two species.4. Approximately 89% of the soluble proteins and 58% of the non-specific esterases are common among the two species, indicating both biochemical similarity at the genus level and species-specificity.
Assignment of simian rotavirus SA11 temperature-sensitive mutant groups B and E to genome segments
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gombold, J.L.; Estes, M.K.; Ramig, R.F.
1985-05-01
Recombinant (reassortant) viruses were selected from crosses between temperature-sensitive (ts) mutants of simian rotavirus SA11 and wild-type human rotavirus Wa. The double-stranded genome RNAs of the reassortants were examined by electrophoresis in Tris-glycine-buffered polyacrylamide gels and by dot hybridization with a cloned DNA probe for genome segment 2. Analysis of replacements of genome segments in the reassortants allowed construction of a map correlating genome segments providing functions interchangeable between SA11 and Wa. The reassortants revealed a functional correspondence in order of increasing electrophoretic mobility of genome segments. Analysis of the parental origin of genome segments in ts+ SA11/Wa reassortants derivedmore » from the crosses SA11 tsB(339) X Wa and SA11 tsE(1400) X Wa revealed that the group B lesion of tsB(339) was located on genome segment 3 and the group E lesion of tsE(1400) was on segment 8.« less
Gritsun, T S; Frolova, T V; Zhankov, A I; Armesto, M; Turner, S L; Frolova, M P; Pogodina, V V; Lashkevich, V A; Gould, E A
2003-01-01
A strain of Tick-borne encephalitis virus designated Zausaev (Za) was isolated in Siberia from a patient who died of a progressive (2-year) form of tick-borne encephalitis 10 years after being bitten by a tick. The complete genomic sequence of this virus was determined, and an attempt was made to correlate the sequence with the biological characteristics of the virus. Phylogenetic analysis demonstrated that this virus belongs to the Siberian subtype of Tick-borne encephalitis virus. Comparison of Za virus with two related viruses, a Far Eastern isolate, Sofjin, and a Siberian isolate, Vasilchenko, revealed differences among the three viruses in pathogenicity for Syrian hamsters, cytopathogenicity for PS cells, plaque morphology, and the electrophoretic profiles of virus-specific nonstructural proteins. Comparative amino acid alignments revealed 10 individual amino acid substitutions in the Za virus polyprotein sequence that were different from those of other tick-borne flaviviruses. Notably, the dimeric form of the Za virus NS1 protein migrated in polyacrylamide gels as a heterogeneous group of molecules with a significantly higher electrophoretic mobility than those of the Sofjin and Vasilchenko viruses. Two amino acid substitutions, T(277)-->V and E(279)-->G, within the NS1 dimerization domain are probably responsible for the altered oligomerization of Za virus NS1. These studies suggest that the patient from whom Za virus was isolated died due to increased pathogenicity of the latent virus following spontaneous mutagenesis.
Gritsun, T. S.; Frolova, T. V.; Zhankov, A. I.; Armesto, M.; Turner, S. L.; Frolova, M. P.; Pogodina, V. V.; Lashkevich, V. A.; Gould, E. A.
2003-01-01
A strain of Tick-borne encephalitis virus designated Zausaev (Za) was isolated in Siberia from a patient who died of a progressive (2-year) form of tick-borne encephalitis 10 years after being bitten by a tick. The complete genomic sequence of this virus was determined, and an attempt was made to correlate the sequence with the biological characteristics of the virus. Phylogenetic analysis demonstrated that this virus belongs to the Siberian subtype of Tick-borne encephalitis virus. Comparison of Za virus with two related viruses, a Far Eastern isolate, Sofjin, and a Siberian isolate, Vasilchenko, revealed differences among the three viruses in pathogenicity for Syrian hamsters, cytopathogenicity for PS cells, plaque morphology, and the electrophoretic profiles of virus-specific nonstructural proteins. Comparative amino acid alignments revealed 10 individual amino acid substitutions in the Za virus polyprotein sequence that were different from those of other tick-borne flaviviruses. Notably, the dimeric form of the Za virus NS1 protein migrated in polyacrylamide gels as a heterogeneous group of molecules with a significantly higher electrophoretic mobility than those of the Sofjin and Vasilchenko viruses. Two amino acid substitutions, T277→V and E279→G, within the NS1 dimerization domain are probably responsible for the altered oligomerization of Za virus NS1. These studies suggest that the patient from whom Za virus was isolated died due to increased pathogenicity of the latent virus following spontaneous mutagenesis. PMID:12477807
Chloroplast membrane alterations in triazine-resistant Amaranthus retroflexus biotypes
Arntzen, Charles J.; Ditto, Cathy L.; Brewer, Philip E.
1979-01-01
The effectiveness of diuron, atrazine, procyazine, and cyanazine were compared in controlling growth of redroot pigweed (Amaranthus retroflexus L.) in hydroponic culture. A very marked differential inhibition response was observed for atrazine between resistant and susceptible biotypes. Procyazine and cyanazine exhibited less dramatic differential responses, whereas diuron was equally effective in controlling growth in both biotypes. Photosystem II activity of chloroplasts from both triazine-resistant and triazine-susceptible biotypes was inhibited by diuron but only the chloroplasts from triazine-susceptible biotypes were inhibited significantly by atrazine. The photochemical activity of chloroplasts from triazine-resistant biotypes was partially resistant to procyazine or cyanazine inhibition. The parallel lack of diuron differential effects, partial procyazine and cyanazine differential response, and very marked atrazine differential response in both whole plant and chloroplast assays indicates that the chloroplast is the site of selective herbicide tolerance in these triazine-resistant redroot pigweed biotypes. Photosystem II photochemical properties were characterized by analysis of chlorophyll fluorescence transients in the presence or absence of herbicides. Data with susceptible chloroplasts indicated that both diuron and atrazine inhibit electron flow very near the primary electron acceptor of photosystem II. Only diuron altered the fluorescence transient in resistant chloroplasts. In untreated preparations there were marked differences in the fast phases of the fluorescence increase in resistant vs. susceptible chloroplasts; these data are interpreted as showing that the resistant plastids have an alteration in the rate of reoxidation of the primary photosystem II electron acceptor. Electrophoretic analysis of chloroplast membrane proteins of the two biotypes showed small changes in the electrophoretic mobilities of two polypeptide species. The data provide evidence for the following herbicide resistance mechanism: genetically controlled modification of the herbicide target site. Images PMID:16592608
Interpretive Reporting of Protein Electrophoresis Data by Microcomputer
Talamo, Thomas S.; Losos, Frank J.; Kessler, G. Frederick
1982-01-01
A microcomputer based system for interpretive reporting of protein electrophoretic data has been developed. Data for serum, urine and cerebrospinal fluid protein electrophoreses as well as immunoelectrophoresis can be entered. Patient demographic information is entered through the keyboard followed by manual entry of total and fractionated protein levels obtained after densitometer scanning of the electrophoretic strip. The patterns are then coded, interpreted, and final reports generated. In most cases interpretation time is less than one second. Misinterpretation by computer is uncommon and can be corrected by edit functions within the system. These discrepancies between computer and pathologist interpretation are automatically stored in a data file for later review and possible program modification. Any or all previous tests on a patient may be reviewed with graphic display of the electrophoretic pattern. The system has been in use for several months and is presently well accepted by both laboratory and clinical staff. It also allows rapid storage, retrieval and analysis of protein electrophoretic datab.
Holtkamp, Hannah; Grabmann, Gerlinde; Hartinger, Christian G
2016-04-01
Electrophoretic methods have been widely applied in research on the roles of metal complexes in biological systems. In particular, CE, often hyphenated to a sensitive MS detector, has provided valuable information on the modes of action of metal-based pharmaceuticals, and more recently new methods have been added to the electrophoretic toolbox. The range of applications continues to expand as a result of enhanced CE-to-MS interfacing, with sensitivity often at picomolar level, and evolved separation modes allowing for innovative sample analysis. This article is a followup to previous reviews about CE methods in metallodrug research (Electrophoresis, 2003, 24, 2023-2037; Electrophoresis, 2007, 28, 3436-3446; Electrophoresis, 2012, 33, 622-634), also providing a comprehensive overview of metal species studied by electrophoretic methods hyphenated to MS. It highlights the latest CE developments, takes a sneak peek into gel electrophoresis, traces biomolecule labeling, and focuses on the importance of early-stage drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Abath, F. G.; Almeida, A. M.; Ferreira, L. C.
1989-01-01
The outer membrane proteins of 38 Yersinia pestis isolates from all known plague foci of north-east Brazil were analysed by SDS-PAGE. Approximately 20 bands were consistently found in all strains analysed and 11 were selected for comparative studies. Although qualitative differences among the electrophoretic profiles of outer membrane proteins of wild Y. pestis isolates were not observed, quantitative alterations were clearly noted for most of these proteins. No particular quantitative alteration of the electrophoretic profile of outer membrane proteins could be associated with the period of isolation and geographic origin of the isolates. The 64 kDa outer membrane protein was significantly expressed in higher amounts among Y. pestis strains isolated from a recent plague outbreak. The possible use of electrophoretic profiles of outer membrane proteins of wild Y. pestis isolates as a tool for epidemiological studies and for the analysis of virulence determinants is discussed. Images Fig. 2 PMID:2606164
A Semianalytical Analysis of Compressible Electrophoretic Cake Formation
NASA Astrophysics Data System (ADS)
Kambham, Kiran K. R.; Tuncay, Kagan; Corapcioglu, M. Yavuz
1995-05-01
Leaks in geomembrane liners of waste landfills and liquid impoundments cause chemical contaminants to leak into the subsurface environment. A mathematical model is presented to simulate electrophoretic sealing of impoundment leaks. The model describes the formation of a compressible clay cake because of electrical and gravitational forces. The model includes mass balance equations for the solid particles and liquid phase, modified Darcy's law in an electrical field, and Terzaghi's definition of effective stress. The formulation is presented in the Eulerian coordinates. The resulting second-order, nonlinear partial differential equation and the lower boundary condition are linearized to obtain an analytical solution for time-dependent settlement. After discretizing in time the analytical solution is applied to simulate compression of an accreting sediment. In the simulation of an accreting sediment, solid fluxes on either side of suspension/sediment interface are coupled using a no-jump condition. The velocity of a discrete particle in the suspension zone is assumed to be equal to the algebraic sum of electrophoretic and Stoke's settling velocities. An empirical relationship available in the literature is used to account for the effect of concentration on the velocity of solid particles in the suspension zone. The validity of the semianalytical approach is partially verified using an exact steady state solution for self-weight consolidation. The simulation results obtained for a set of material parameters are presented graphically. It is noted that the electrokinetic consolidation of sediment continues even after the completion of electrophoretic settling of all clay particles. An analysis reveals that the electrophoretic cake formation process is quite sensitive to voltage gradient and the coefficient of compressibility.
Comprehensive and Critical Literature Review on Insitu Micro-Sensors for Application in Tribology
1994-04-01
Electroosmotic flow provides a pumping method that is convenient for small capillaries. Electrophoretic separation is shown to be useful. On the left hand...analysis systems on glass chips (1 centimeter by 2 centimeters or larger) that utilize electroosmotic pumping to drive fluid flow and electrophoretic...elucidate the interaction mechanism. Additionally, using two types of sensors in a mixed array increases selectivity by providing different information
Yamazaki, Yuji; Kubota, Hiroshi; Nozaki, Masami; Nagata, Kazuhiro
2003-08-15
The chaperonin-containing t-complex polypeptide 1 (CCT) is a molecular chaperone that facilitates protein folding in eukaryotic cytosol, and the expression of CCT is highly dependent on cell growth. We show here that transcription of the gene encoding the theta subunit of mouse CCT, Cctq, is regulated by the ternary complex factors (TCFs), Elk-1, Sap-1a, and Net (Sap-2). Reporter gene assay using HeLa cells indicated that the Cctq gene promoter contains a cis-acting element of the CCGGAAGT sequence (CQE1) at -36 bp. The major CQE1-binding proteins in HeLa cell nuclear extract was recognized by anti-Elk-1 or anti-Sap-1a antibodies in electrophoretic mobility shift assay, and recombinant Elk-1, Sap-1a, or Net specifically recognized CQE1. The CQE1-dependent transcriptional activity in HeLa cells was virtually abolished by overexpression of the DNA binding domains of TCFs. Overexpression of full-length TCFs with Ras indicated that exogenous TCFs can regulate the CQE1-dependent transcription in a Ras-dependent manner. PD98059, an inhibitor of MAPK, significantly repressed the CQE1-dependent transcription. However, no serum response factor was detected by electrophoretic mobility shift assay using the CQE1 element. These results indicate that transcription of the Cctq gene is regulated by TCFs under the control of the Ras/MAPK pathway, probably independently of serum response factor.
d'Orlyé, Fanny; Varenne, Anne; Georgelin, Thomas; Siaugue, Jean-Michel; Teste, Bruno; Descroix, Stéphanie; Gareil, Pierre
2009-07-01
In view of employing functionalized nanoparticles (NPs) in the context of an immunodiagnostic, aminated maghemite/silica core/shell particles were synthesized so as to be further coated with an antibody or an antigen via the amino groups at their surface. Different functionalization rates were obtained by coating these maghemite/silica core/shell particles with 3-(aminopropyl)triethoxysilane and 2-[methoxy(polyethyleneoxy)propyl]-trimethoxysilane at different molar ratios. Adequate analytical performances with CE coupled with UV-visible detection were obtained through semi-permanent capillary coating with didodecyldimethyl-ammonium bromide, thus preventing particle adsorption. First, the influence of experimental conditions such as electric field strength, injected particle amount as well as electrolyte ionic strength and pH, was evaluated. A charge-dependent electrophoretic mobility was evidenced and the separation selectivity was tuned according to electrolyte ionic strength and pH. The best resolutions were obtained at pH 8.0, high ionic strength (ca. 100 mM), and low total particle volume fraction (ca. 0.055%), thus eliminating interference effects between different particle populations in mixtures. A protocol derived from Kaiser's original description was performed for quantitation of the primary amino groups attached onto the NP surface. Thereafter a correlation between particle electrophoretic mobility and the density of amino groups at their surface was established. Eventually, CE proved to be an easy, fast, and reliable method for the determination of NP effective surface charge density.
Yeh, Li-Hsien; Fang, Kuo-Ying; Hsu, Jyh-Ping; Tseng, Shiojenn
2011-12-01
The electrophoresis of a soft particle comprising a rigid core and a charged porous membrane layer in a narrow space is modeled. This simulates, for example, the capillary electrophoresis of biocolloids such as cells and microorganisms, and biosensor types of device. We show that, in addition to the boundary effect, the effects of double-layer polarization (DLP) and the electroosmotic retardation flow can be significant, yielding interesting electrophoretic behaviors. For example, if the friction coefficient of the membrane layer and/or the boundary is large, then the DLP effect can be offset by the electroosmotic retardation flow, making the particle mobility to decrease with increasing double layer thickness, which is qualitatively consistent with many experimental observations in the literature, but has not been explained clearly in previous analyses. In addition, depending upon the thickness of double layer, the friction of the membrane layer of a particle can either retard or accelerate its movement, an interesting result which has not been reported previously. This work is the first attempt to show solid evidence for the influence of a boundary on the effect of DLP and the electrophoretic behavior of soft particles. The model proposed is verified by the experimental data in the literature. The results of numerical simulation provide valuable information for the design of bio-analytical apparatus such as nanopore-based sensing applications and for the interpretation of relevant experimental data. Copyright © 2011 Elsevier B.V. All rights reserved.
Ohuchi, Shoji J; Sagawa, Fumihiko; Sakamoto, Taiichi; Inoue, Tan
2015-10-23
RNA-protein complexes (RNPs) are useful for constructing functional nano-objects because a variety of functional proteins can be displayed on a designed RNA scaffold. Here, we report circular permutations of an RNA-binding protein L7Ae based on the three-dimensional structure information to alter the orientation of the displayed proteins on the RNA scaffold. An electrophoretic mobility shift assay and atomic force microscopy (AFM) analysis revealed that most of the designed circular permutants formed an RNP nano-object. Moreover, the alteration of the enhanced green fluorescent protein (EGFP) orientation was confirmed with AFM by employing EGFP on the L7Ae permutant on the RNA. The results demonstrate that targeted fine-tuning of the stereo-specific fixation of a protein on a protein-binding RNA is feasible by using the circular permutation technique. Copyright © 2015 Elsevier Inc. All rights reserved.
GAS6 is an estrogen-inducible gene in mammary epithelial cells
Mo, Rigen; Zhu, Yiwei Tony; Zhang, Zhongyi; Rao, Sambasiva M.; Zhu, Yi-Jun
2007-01-01
To identify estrogen responsive genes in mammary glands, microarray assays were performed. Twenty genes were found to be up-regulated while 16 genes were repressed in the 9h estrogen treated glands. The induction of GAS6, one of the genes up-regulated by estrogen, was confirmed by RNase protection assay. Furthermore, GAS6 was also demonstrated to be induced by estrogen in ER positive breast cancer cells. Analysis of GAS6 promoter revealed that GAS6 promoter was regulated by estrogen. An estrogen response element (ERE) was identified in the GAS6 promoter. Electrophoretic mobility shift assay revealed that ERα interacted with the ERE in the GAS6 promoter. Chromatin immunoprecipitation demonstrated that ERα was recruited to the GAS6 promoter upon estrogen stimulation. These results suggested that GAS6 is an estrogen target gene in mammary epithelial cells. PMID:17174935
Zhao, Yan-Yan; Sun, Kai-Lai; Ashok, Kumar
1998-01-01
The work was aimed to identify the estrogen responsive element in the human angiotensinogen gene. The nucleotide sequence between the transcription initiation site and TATA box in angiotensinogen gene promoter was found to be strongly homologous with the consensus estrogen responsive element. This sequence was confirmed as the estrogen responsive element (HAG ERE) by electrophoretic mobility shift assay. The recombinant expression vectors were constructed in which chloramphenicol acetyltransferase (CAT) reporter gene was driven by angiotensinogen core promoter with HAG ERE of by TK core promoter with multiplied HAG ERE, and were used in cotransfection with the human estrogen receptor expression vector into HepG(2) cells; CAT assays showed an increase of the CAT activity on 17beta-estradiol treatment in those transfectants. These results suggest that the human angiotensinogen gene is transcriptionally up-regulated by estrogen through the estrogen responsive element near TATA box of the promoter.
Kumal, Raju R; Abu-Laban, Mohammad; Landry, Corey R; Kruger, Blake; Zhang, Zhenyu; Hayes, Daniel J; Haber, Louis H
2016-10-11
The photocleaving dynamics of colloidal microRNA-functionalized nanoparticles are studied using time-dependent second harmonic generation (SHG) measurements. Model drug-delivery systems composed of oligonucleotides attached to either silver nanoparticles or polystyrene nanoparticles using a nitrobenzyl photocleavable linker are prepared and characterized. The photoactivated controlled release is observed to be most efficient on resonance at 365 nm irradiation, with pseudo-first-order rate constants that are linearly proportional to irradiation powers. Additionally, silver nanoparticles show a 6-fold plasmon enhancement in photocleaving efficiency over corresponding polystyrene nanoparticle rates, while our previous measurements on gold nanoparticles show a 2-fold plasmon enhancement compared to polystyrene nanoparticles. Characterizations including extinction spectroscopy, electrophoretic mobility, and fluorimetry measurements confirm the analysis from the SHG results. The real-time SHG measurements are shown to be a highly sensitive method for investigating plasmon-enhanced photocleaving dynamics in model drug delivery systems.
Nowicki, L; Behnken, L; Martin, H
1975-11-01
In 588 bloodsamples of negride natives from Moçambique, preferably Chuabo and Macua, haemoglobin analyses were performed. In 21 cases an increase of Hb A2 was found, indicating the presence of heterozygous beta-thalassaemia, in one case the changes in Hb-analysis were typical for beta-delta-thalassaemia, 18 samples could be shown to contain Hb S, typical for the heterozygous sickle cell trait. Futhermore in 7 cases Hb A2' was found. In two bloodsamples haemoglobin variants were observed, which according to their electrophoretical mobility were assumed to represent Hb D in one case, and Hb G in the other. In the Chuabo population the frequency of the thalassaemia gene was found to be more than twice as high as in the Macua population. In non-lepers Hb S was observed with a remarkable higher incidence than in lepers.
Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components
NASA Astrophysics Data System (ADS)
Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik
2015-03-01
We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.
Micro-rheology on (polymer-grafted) colloids using optical tweezers.
Gutsche, C; Elmahdy, M M; Kegler, K; Semenov, I; Stangner, T; Otto, O; Ueberschär, O; Keyser, U F; Krueger, M; Rauscher, M; Weeber, R; Harting, J; Kim, Y W; Lobaskin, V; Netz, R R; Kremer, F
2011-05-11
Optical tweezers are experimental tools with extraordinary resolution in positioning (± 1 nm) a micron-sized colloid and in the measurement of forces (± 50 fN) acting on it-without any mechanical contact. This enables one to carry out a multitude of novel experiments in nano- and microfluidics, of which the following will be presented in this review: (i) forces within single pairs of colloids in media of varying concentration and valency of the surrounding ionic solution, (ii) measurements of the electrophoretic mobility of single colloids in different solvents (concentration, valency of the ionic solution and pH), (iii) similar experiments as in (i) with DNA-grafted colloids, (iv) the nonlinear response of single DNA-grafted colloids in shear flow and (v) the drag force on single colloids pulled through a polymer solution. The experiments will be described in detail and their analysis discussed.
AFFINITY OF ANIMAL CELL NUCLEOLI FOR NORMAL SERUM
Maisel, John C.; Lytle, Ralph I.
1966-01-01
Nucleoli of animal cells cultured in vitro are modified by a component of "nonimmune" animal serum. Modified nucleoli bind fluorescein-conjugated nonimmune serum proteins, as shown by calcium ion-dependent fluorescence. Analysis of serum indicates that the nucleolar-binding component is a globulin, with an electrophoretic mobility in the same region as the slow alpha-1 component in pH 8.6 Veronal buffer. The component has a low sedimentation constant (2.4S), and appears to contain glycoprotein with relatively high sialic acid content (8.5%); the latter moiety may be essential to reaction with nucleoli. The nucleolar component reacting with this alpha globulin fraction appears to be a histonelike basic protein. Primary cultures of animal cells have been supported for 1 wk through attachment, spreading, and outgrowth from colonies to confluent monolayers in medium containing a nucleolar-reactive serum fraction as the only protein supplement. PMID:4164214
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ohuchi, Shoji J.; Sagawa, Fumihiko; Sakamoto, Taiichi
RNA-protein complexes (RNPs) are useful for constructing functional nano-objects because a variety of functional proteins can be displayed on a designed RNA scaffold. Here, we report circular permutations of an RNA-binding protein L7Ae based on the three-dimensional structure information to alter the orientation of the displayed proteins on the RNA scaffold. An electrophoretic mobility shift assay and atomic force microscopy (AFM) analysis revealed that most of the designed circular permutants formed an RNP nano-object. Moreover, the alteration of the enhanced green fluorescent protein (EGFP) orientation was confirmed with AFM by employing EGFP on the L7Ae permutant on the RNA. Themore » results demonstrate that targeted fine-tuning of the stereo-specific fixation of a protein on a protein-binding RNA is feasible by using the circular permutation technique.« less
Viprakasit, Vip; Tachavanich, Kalaya; Suwantol, Lerlugsn; Pung-Amritt, Parichat; Chinchang, Worawut; Tanphaichitr, Voravarn S
2002-08-01
Hemoglobin New York (beta 113 (G15) Val-->Glu), a beta-globin variant, was first reported in a Chinese family living in New York. Subsequently, this abnormal hemoglobin was reported in many Chinese descendants from several groups and it was also known as Hb Kaohsiung. The subtle change in alpha1beta1 contact region apart from the heme group connecting area by Val-->Glu substitution has minor changes in both the electrophoretic mobility and stability making this hemoglobin variant difficult to distinguish from Hb A using routine hemoglobin analysis. The authors described a case of heterozygosity of Hb New York diagnosed by a molecular technique and revealed a mutation in beta(CD113 GTG-->GAG). A novel Allele Related Mutation Specific-Polymerase Chain Reaction (ARMS-PCR) for rapid diagnosis of this mutation has been proposed.
Beckenbach, Andrew T.; Prakash, Satya
1977-01-01
Recently a number of electrophoretic techniques have been applied to reveal the presence of additional genetic variation among the electrophoretic mobility classes of the highly polymorphic xanthine dehydrogenase (XDH ) and esterase-5 (est-5) loci. We examined the hexokinase loci of Drosophila pseudoobscura and D. persimilis using a variety of techniques to determine whether further allelic variation could be revealed for these much less polymorphic loci and to analyze the nature of the known variation at the hexokinase-1 (hex-1) locus. The following studies were conducted: 135 strains of the two species from six localities were examined with buffer pH ranging from 5.5 to 10.0; 40 strains of D. pseudoobscura and 9 strains of D. persimilis from Mather were studied using starch gel concentrations ranging from 8.5 to 15.5% and were examined for differences in heat stability and reactivity to the thiol reagent pCMSA; strains were also tested for susceptibility to urea denaturation and differences in relative activities. Major findings of the work are: (1) No additional allelic variation could be detected at any of the hexokinase loci by applying these techniques. The finding of abundant hidden genetic variation in XDH and est-5 does not extend to all enzyme loci. (2) Evidence from studies using pCMSA indicates that the hex-1 alleles 0.6, 0.8, 1.0 and 1.2 of the two species form a series of unit charge steps. Since the 0.94 allele of D. persimilis has mobility intermediate between 0.8 and 1.0, it is argued that routine electrophoretic techniques are sensitive to at least some conservative amino acid substitutions. (3) Strong correlations were found at the hex-1 locus between low allelic frequency, reduced relative activity and reduced stability to heat and urea denaturation. Since the three sibling species, D. pseudoobscura, D. persimilis and D. miranda, all appear to share a common high frequency allele (1.0) at that locus, these findings are taken as evidence that the observed allelic frequencies are a result of directional selection and mutation, rather than any form of balancing selection. PMID:17248785
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wirth, Mary J
Solar energy conversion through biology would provide a renewable and nonpolluting abundance of energy. The bacterium Halobacterium salinarum converts solar to electrical energy by virtue of a transmembrane protein, bacteriorhodopsin. This transmembrane protein pumps protons across a nonconducting bilayer upon irradiation with green light. The bacterium evolved to perform this function inefficiently. If we were able to understand this process to engineer this protein for efficiency, then inexpensive energy production could be achieved. There are tens of thousands of different types of halobacteria, giving the opportunity to study different efficiencies and relating these to the protein structures. Technology does notmore » yet exist to perform such screening. The goal of this research is to generate new separation technology that can ultimately enable such screening. This involves creating a method for separating oriented and functional transmembrane proteins that remain in an electrically insulating lipid bilayer, with aqueous solutions on either side of the bilayer. A pH change across the lipid bilayer upon irradiation of a known concentration of proteins would probe function. Differences in proton pumping efficiency for different proteins variants would provide structure-function information for engineering the proteins. A schematic diagram from the original proposal is shown here. The idea is that (a) a lipid bilayer supported on a hydrophilic polymer film will make the bilayer fluid, and (b) applying an electric field will cause electrophoretic migration of the transmembrane proteins. We demonstrated this concept experimentally in a paper that was published just after this new grant period started (Lipid Bilayers on Polyacrylamide Brushes for Inclusion of Membrane Proteins, Emily A. Smith, Jason W. Coym, Scott M. Cowell, Victor J. Hruby, Henry I. Yamamura, Mary J. Wirth, Langmuir, 21, 9644-9650, 2005). The electrophoretic mobility was slow (10{sup -8} cm{sup 2}/Vs), and we project that a two order of magnitude increase would make this a practical tool. We are investigating two ways of improving electrophoretic mobility: better polymer supports, and a novel nanoporous medium that suspends the bilayer over free solution.« less
An Investigation of Traveling-Wave Electrophoresis using a Trigonometric Potential
NASA Astrophysics Data System (ADS)
Vopal, James
Traveling-wave electrophoresis, a technique for microfluidic separations in lab-on-achip devices, is investigated using a trigonometric model that naturally incorporates the spatial periodicity of the device. Traveling-wave electrophoresis can be used to separate high-mobility ions from low-mobility ions in forensic and medical applications, with a separation threshold that can be tuned for specific applications by simply choosing the traveling wave frequency. Our simulations predict plateaus in the average ion velocity verses the mobility, plateaus that correspond to Farey fractions and yield Devil's staircases for non-zero discreteness values. The plateaus indicate that ions with different mobilities can travel with the same average velocity. To determine the conditions for chaos, Lyapunov exponents and contact maps are employed. Through the use of contact maps, the chaotic trajectories are determined to be either narrowband or broadband. Narrowband chaotic trajectories are exhibited in the plateaus of the average velocity, while broadband chaotic trajectories are exhibited where the average velocity varies nonmonotonically with the mobility. Narrowband chaos will be investigated in future work incorporating the role of diffusion. The results of this and future work can be used to develop new tools for electrophoretic separation.
de la Fuente-Gonzalo, Félix; Nieto, Jorge M; Velasco, Diego; Cela, Elena; Pérez, Germán; Fernández-Teijeiro, Ana; Escudero, Antonio; Villegas, Ana; González-Fernández, Fernando A; Ropero, Paloma
2016-04-01
Structural hemoglobinopathies do not usually have a clinical impact, but they can interfere with the analytical determination of some parameters, such as the glycated hemoglobin in diabetic patients. Thalassemias represent a serious health problem in areas where their incidence is high. The defects in the post-translational modifications produce hyper-unstable hemoglobin that is not detected by most of electrophoretic or chromatographic methods that are available so far. We studied seven patients who belong to six unrelated families. The first two families were studied because they had peak abnormal hemoglobin (Hb) during routine analytical assays. The other four families were studied because they had microcytosis and hypochromia with normal HbA2 and HbF without iron deficiency. HbA2 and F quantification and abnormal Hb separation were performed by chromatographic and electrophoretic methods. The molecular characterization was performed using specific sequencing. The Hb Puerta del Sol presents electrophoretic mobility and elution in HPLC that is different from HbA and similar to HbS. The electrophoretic and chromatographic profiles of the four other variants are normal and do not show any anomalies, and their identification was only possible with sequencing. Some variants, such as Hb Valdecilla, Hb Gran Vía, Hb Macarena and Hb El Retiro, have significant clinical impact when they are associated with other forms of α-thalassemia, which could lead to more serious forms of this group of pathologies as for HbH disease. Therefore, it is important to maintain an adequate program for screening these diseases in countries where the prevalence is high to prevent the occurrence of severe forms.
Burland, Timothy G.; Schedl, Tim; Gull, Keith; Dove, William F.
1984-01-01
Physarum displays two vegetative cell types, uninucleate myxamoebae and multinucleate plasmodia. Mutant myxamoebae of Physarum resistant to the antitubulin drug methylbenzimidazole-2-yl-carbamate (MBC) were isolated. All mutants tested were cross-resistant to other benzimidazoles but not to cycloheximide or emetine. Genetic analysis showed that mutation to MBC resistance can occur at any one of four unlinked loci, benA, benB, benC or benD. MBC resistance of benB and benD mutants was expressed in plasmodia, but benA and benC mutant plasmodia were MBC sensitive, suggesting that benA and benC encode myxamoeba-specific products. Myxamoebae carrying the recessive benD210 mutation express a β-tubulin with noval electrophoretic mobility, in addition to a β-tubulin with wild-type mobility. This and other evidence indicates that benD is a structural gene for β-tubulin, and that at least two β-tubulin genes are expressed in myxamoebae. Comparisons of the β-tubulins of wildtype and benD210 strains by gel electrophoresis revealed that, of the three (or more) β-tubulin genes expressed in Physarum, one, benD, is expressed in both myxamoebae and plasmodia, one is expressed specifically in myxamoebae and one is expressed specifically in plasmodia. However, mutation in only one gene, benD, is sufficient to confer MBC resistance on both myxamoebae and plasmodia. PMID:6479584
Bhilocha, Shardul; Amin, Ripal; Pandya, Monika; Yuan, Han; Tank, Mihir; LoBello, Jaclyn; Shytuhina, Anastasia; Wang, Wenlan; Wisniewski, Hans-Georg; de la Motte, Carol; Cowman, Mary K.
2011-01-01
Agarose and polyacrylamide gel electrophoresis systems for the molecular mass-dependent separation of hyaluronan (HA) in the size range of approximately 5–500 kDa have been investigated. For agarose-based systems, the suitability of different agarose types, agarose concentrations, and buffers systems were determined. Using chemoenzymatically synthesized HA standards of low polydispersity, the molecular mass range was determined for each gel composition, over which the relationship between HA mobility and logarithm of the molecular mass was linear. Excellent linear calibration was obtained for HA molecular mass as low as approximately 9 kDa in agarose gels. For higher resolution separation, and for extension to molecular masses as low as approximately 5 kDa, gradient polyacrylamide gels were superior. Densitometric scanning of stained gels allowed analysis of the range of molecular masses present in a sample, and calculation of weight-average and number-average values. The methods were validated for polydisperse HA samples with viscosity-average molecular masses of 112, 59, 37, and 22 kDa, at sample loads of 0.5 µg (for polyacrylamide) to 2.5 µg (for agarose). Use of the methods for electrophoretic mobility shift assays was demonstrated for binding of the HA-binding region of aggrecan (recombinant human aggrecan G1-IGD-G2 domains) to a 150 kDa HA standard. PMID:21684248
Method for Single-Cell Mass and Electrophoretic Mobility Measurement
2010-02-01
Staphylococcus Aureus . The species of the contaminant was determined by catalase test and visual comparison with cultured S. Epidermidis. In this experiment...mnicron’crtrVs)) Corrected EPM Hatogam for teratior 2 d) p 0.3 10 I EPM ((rii n*cmy(V**)) CO, ?rz A ) WO Buoyart Mass vs. EPM forSuspected S. Aureus . 583 V...2 -1 E PM ((n cror*crnYC*) Cxnected EPM His-ograrr for Suspected S. Aureus at - - 332 V/cm EPM ((rnicron*cmY(V’s)) Figure 5-3: Integrated measurements
Failure to Confirm the Macrophage Electrophoretic Mobility Test in Cancer
Forrester, J. A.; Dando, P. M.; Smith, W. J.; Turberville, C.
1977-01-01
A series of patients with a variety of histopathologically confirmed cancers have been examined using the MOD-MEM test as described by Pritchard et al. (1973). Despite the closest possible adherence to the experimental protocols recommended by these authors, no positive reactions to the test were observed in this series: neither were we able to demonstrate the release of a “macrophage-slowing factor” by a panel of normal donors when challenged with tubercle PPD. We conclude that the test has no present application to the diagnosis of cancer.
Barron, Annelise
2002-01-01
Polyamides comprising at least one hydrophilic C.sub.1 -C.sub.10 hydrocarbyl substituent on an amide nitrogen atom, and methods for producing and using the same is provided. In particular, polyamides of the formula: ##STR1## and methods for using the same for altering the ratio of charge/translational frictional drag of binding polymers to allow electrophoretic separation of polynucleotides or analogs thereof in a non-sieving liquid medium is provided, where a, q, L.sup.1, P.sup.1, Q.sup.1, R, R.sup.1, R.sup.10 and R.sup.11 are those described herein.
Barron, Annelise E.
2004-04-20
Polyamides comprising at least one hydrophilic C.sub.1 -C.sub.10 hydrocarbyl substituent on an amide nitrogen atom, and methods for producing and using the same is provided. In particular, polyamides of the formula: ##STR1## and methods for using the same for altering the ratio of charge/translational frictional drag of binding polymers to allow electrophoretic separation of polynucleotides or analogs thereof in a non-sieving liquid medium is provided, where a, q, L.sup.1, P.sup.1, Q.sup.1, R, R.sup.1, R.sup.10 and R.sup.11 are those described herein.
Volkova, P Yu; Geras'kin, S A; Horemans, N; Makarenko, E S; Saenen, E; Duarte, G T; Nauts, R; Bondarenko, V S; Jacobs, G; Voorspoels, S; Kudin, M
2018-01-01
Genetic and epigenetic changes were investigated in chronically irradiated Scots pine (Pinus sylvestris L.) populations from territories that were heavily contaminated by radionuclides as result of the Chernobyl Nuclear Power Plant accident. In comparison to the reference site, the genetic diversity revealed by electrophoretic mobility of AFLPs was found to be significantly higher at the radioactively contaminated areas. In addition, the genome of pine trees was significantly hypermethylated at 4 of the 7 affected sites. Copyright © 2017 Elsevier Ltd. All rights reserved.
Malina, Jaroslav; Hannon, Michael J; Brabec, Viktor
2016-07-12
The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat-TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rayas-Solis, P.
Great Northern bean (Phaseolus vulgaris L.) drum dried flours at native pH of 6.54, pH 6 and 7 showed reduced activities of trypsin inhibitor, ..cap alpha..-amylase inhibitor, hemagglutinating titer, and nitrogen solubility. Electrophoretic analyses showed a slight modification of the native bean proteins, and the presence of at least four trypsin inhibitors. The study of the effect of 2.5-20 kGy irradiation doses on Great Northern beans showed essentially no modification of the electrophoretic mobility of the storage proteins or the trypsin inhibitors. Nitrogen solubility and hemagglutinating activity were essentially unchanged. With the 20 kGy dose, decrease in ..cap alpha..-amylase inhibitormore » activity, decrease reactive/available lysine content, and decrease cooking time of the irradiated beans after 11 months of storage were observed. Taste panel results indicated that the control and 20 kGy irradiated bean were significantly different at 5% level. At 20 kGy dose, the beans developed a partially water soluble brown color.« less
Simulating Electrophoresis with Discrete Charge and Drag
NASA Astrophysics Data System (ADS)
Mowitz, Aaron J.; Witten, Thomas A.
A charged asymmetric rigid cluster of colloidal particles in saline solution can respond in exotic ways to an electric field: it may spin or move transversely. These distinctive motions arise from the drag force of the neutralizing countercharge surrounding the cluster. Because of this drag, calculating the motion of arbitrary asymmetric objects with nonuniform charge is impractical by conventional methods. Here we present a new method of simulating electrophoresis, in which we replace the continuous object and the surrounding countercharge with discrete point-draggers, called Stokeslets. The balance of forces imposes a linear, self-consistent relation among the drag and Coulomb forces on the Stokeslets, which allows us to easily determine the object's motion via matrix inversion. By explicitly enforcing charge+countercharge neutrality, the simulation recovers the distinctive features of electrophoretic motion to few-percent accuracy using as few as 1000 Stokeslets. In particular, for uniformly charged objects, we observe the characteristic Smoluchowski independence of mobility on object size and shape. We then discuss electrophoretic motion of asymmetric objects, where our simulation method is particularly advantageous. This work is supported by a Grant from the US-Israel Binational Science Foundation.
On-chip isothermal, chemical cycling polymerase chain reaction (ccPCR)
NASA Astrophysics Data System (ADS)
Persat, Alexandre; Santiago, Juan
2008-11-01
We demonstrate a novel ccPCR technique for microfluidic DNA amplification where temperature is held constant in space and time. The polymerase chain reaction is a platform of choice for biological assays and typically based on a three-step thermal cycling: DNA denaturation, primers annealing and extension by an enzyme. We here demonstrate a novel technique where high concentration chemical denaturants (solvents) denature DNA. We leverage the high electrophoretic mobility of DNA and the electrical neutrality of denaturants to achieve chemical cycling. We focus DNA with isotachophoresis (ITP); a robust electrophoretic preconcentration technique which generates strong electric field gradients and protects the sample from dispersion. We apply a pressure-driven flow to balance electromigration velocity and keep the DNA sample stationary in a microchannel. We drive the DNA through a series of high denaturant concentration zones. DNA denatures at high denaturant concentration. At low denaturant concentration, the enzyme creates complementary strands. DNA reaction kinetics are slower than buffer reactions involved in ITP. We demonstrate successful ccPCR amplification for detection of E. Coli. The ccPCR has the potential for simpler chemistry than traditional PCR.
Gel electrophoresis of linear and star-branched DNA
NASA Astrophysics Data System (ADS)
Lau, Henry W.; Archer, Lynden A.
2011-12-01
The electrophoretic mobility of double-stranded DNA in polyacrylamide gel is investigated using an activated hopping model for the transport of a charged object within a heterogeneous medium. The model is premised upon a representation of the DNA path through the gel matrix as a series of traps with alternating large and small cross sections. Calculations of the trap dimensions from gel data show that the path imposes varying degrees of confinement upon migrating analytes, which retard their forward motion in a size-dependent manner. An expression derived for DNA mobility is shown to provide accurate predictions for the dynamics of linear DNA (67-622 bp) in gels of multiple concentrations. For star-branched DNA, the incorporation within the model of a length scale previously proposed to account for analyte architecture [Yuan , Anal. Chem.ANCHAM0003-270010.1021/ac060414w 78, 6179 (2006)] leads to mobility predictions that compare well with experimental results for a wide range of DNA shapes and molecular weights.
Dopamine-imprinted monolithic column for capillary electrochromatography.
Aşır, Süleyman; Sarı, Duygu; Derazshamshir, Ali; Yılmaz, Fatma; Şarkaya, Koray; Denizli, Adil
2017-11-01
A dopamine-imprinted monolithic column was prepared and used in capillary electrochromatography as stationary phase for the first time. Dopamine was selectively separated from aqueous solution containing the competitor molecule norepinephrine, which is similar in size and shape to the template molecule. Morphology of the dopamine-imprinted column was observed by scanning electron microscopy. The influence of the organic solvent content of mobile phase, applied pressure and pH of the mobile phase on the recognition of dopamine by the imprinted monolithic column has been evaluated, and the imprinting effect in the dopamine-imprinted monolithic polymer was verified. Developed dopamine-imprinted monolithic column resulted in excellent separation of dopamine from structurally related competitor molecule, norepinephrine. Separation was achieved in a short period of 10 min, with the electrophoretic mobility of 5.81 × 10 -5 m 2 V -1 s -1 at pH 5.0 and 500 mbar pressure. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Cell Partition in Two Polymer Aqueous Phases
NASA Technical Reports Server (NTRS)
Brooks, D. E.
1985-01-01
In a reduced gravity environment the two polymer phases will not separate via density driven settling in an acceptably short length of time. It is to be expected that a certain amount of phase separation will take place, however, driven by the reduction in free energy gained when the interfacial area is reduced. This stage of separation process will therefore depend directly on the magnitude of the interfacial tension between the phases. In order to induce complete phase separation in a short time, electric field-induced separation which occurs because the droplets of one phase in the other have high electrophoretic mobilities which increase with droplet size was investigated. These mobilities are significant only in the presence of certain salts, particularly phosphates. The presence of such salts, in turn has a strong effect on the cell partition behavior in dextran-poly (ethylene glycol) (PEG) systems. The addition of the salts necessary to produce phase drop mobilities has a large effect on the interfacial tensions in the systems.
Cloning and functional analysis of 5'-upstream region of the Pokemon gene.
Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang
2008-04-01
Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.
Influence of ion sterics on diffusiophoresis and electrophoresis in concentrated electrolytes
NASA Astrophysics Data System (ADS)
Stout, Robert F.; Khair, Aditya S.
2017-01-01
We quantify the diffusiophoresis and electrophoresis of a uniformly charged, spherical colloid in a binary electrolyte using modified Poisson-Nernst-Planck equations that account for steric repulsion between finite sized ions. Specifically, we utilize the Bikerman (Bik) lattice gas model and the Carnahan-Starling (CS) and Boublik-Mansoori-Carnahan-Starling-Leland (BMCSL) equations of state for monodisperse and polydisperse, respectively, hard spheres. We compute the phoretic mobility for weak applied fields using an asymptotic approach for thin diffuse layers, where ion steric effects are expected to be most prevalent. The thin diffuse layer limit requires λD/R →0 , where λD is the Debye screening length and R is the particle radius; this limit is readily attained for micron-sized colloids in concentrated electrolytic solutions. It is well known that the classic Poisson-Boltzmann (PB) model for pointlike, noninteracting ions leads to a prediction of a maximum in both the diffusiophoretic and electrophoretic mobilities with increasing particle zeta potential (at fixed λD/R ). In contrast, we find that ion sterics essentially eliminate this maximum (for reasonably attainable zeta potentials) and increase the mobility relative to PB. Next, we consider the more experimentally relevant case of a particle with a constant surface charge density and vary the electrolyte concentration, neglecting charge regulation on surface active sites. Rather surprisingly, there is little difference between the predictions of the four models (PB, Bik, CS, and BMCSL) for electrophoretic mobility in concentrated solutions, at reasonable surface charge densities (˜1 -10 μ C /cm2 ). This is because as the concentration increases, the zeta potential is reduced (to below the thermal voltage for concentrations above about 1 M) and therefore the diffuse layer structure is largely unaffected by ion sterics. For gradients of symmetric electrolytes (equal diffusivities, charge, and size) diffusiophoresis is also essentially unaffected by ion sterics, with a mobility that approaches zero with increasing concentration, just as in electrophoresis. For gradients of asymmetric electrolytes, the difference in diffusivities of the cation and anions leads to an induced electric field that acts on the charged particle. Importantly, we show that ion sterics leads to an excess contribution to the induced electric field, which increases rapidly with concentration. This increase overwhelms the accompanying decrease in zeta potential. The result is the diffusiophoretic mobility increases with concentration, rather than approaching zero. Therefore, diffusiophoresis could be an appealing alternative transport mechanism to electrophoresis in concentrated electrolyte solutions.
Petosa, Adamo Riccardo; Ohl, Carolin; Rajput, Faraz; Tufenkji, Nathalie
2013-10-01
The environmental and health risks posed by emerging engineered nanoparticles (ENPs) released into aquatic environments are largely dependent on their aggregation, transport, and deposition behavior. Herein, laboratory-scale columns were used to examine the mobility of polyacrylic acid (PAA)-coated cerium dioxide nanoparticles (nCeO2) and an analogous nanosized polymeric capsule (nCAP) in water saturated quartz sand or loamy sand. The influence of solution ionic strength (IS) and cation type (Na(+), Ca(2+), or Mg(2+)) on the transport potential of these ENPs was examined in both granular matrices and results were also compared to measurements obtained using a natural groundwater. ENP suspensions were characterized using dynamic light scattering and nanoparticle tracking analysis to establish aggregate size, and laser Doppler electrophoresis to determine ENP electrophoretic mobility. Regardless of IS, virtually all nCeO2 particles suspended in NaNO3 eluted from the quartz sand-packed columns. In contrast, heightened nCeO2 and nCAP particle retention and dynamic (time-dependent) transport behavior was observed with increasing concentrations of the divalent salts and in the presence of natural groundwater. Enhanced particle retention was also observed in loamy sand in comparison to the quartz sand, emphasizing the need to consider the nature of the aqueous matrix and granular medium in evaluating contamination risks associated with the release of ENPs in natural and engineered aquatic environments. Copyright © 2013 Elsevier Ltd. All rights reserved.
Rodgers, K K; Villey, I J; Ptaszek, L; Corbett, E; Schatz, D G; Coleman, J E
1999-07-15
RAG1 and RAG2 are the two lymphoid-specific proteins required for the cleavage of DNA sequences known as the recombination signal sequences (RSSs) flanking V, D or J regions of the antigen-binding genes. Previous studies have shown that RAG1 alone is capable of binding to the RSS, whereas RAG2 only binds as a RAG1/RAG2 complex. We have expressed recombinant core RAG1 (amino acids 384-1008) in Escherichia coli and demonstrated catalytic activity when combined with RAG2. This protein was then used to determine its oligomeric forms and the dissociation constant of binding to the RSS. Electrophoretic mobility shift assays show that up to three oligomeric complexes of core RAG1 form with a single RSS. Core RAG1 was found to exist as a dimer both when free in solution and as the minimal species bound to the RSS. Competition assays show that RAG1 recognizes both the conserved nonamer and heptamer sequences of the RSS. Zinc analysis shows the core to contain two zinc ions. The purified RAG1 protein overexpressed in E.coli exhibited the expected cleavage activity when combined with RAG2 purified from transfected 293T cells. The high mobility group protein HMG2 is stably incorporated into the recombinant RAG1/RSS complex and can increase the affinity of RAG1 for the RSS in the absence of RAG2.
Li, Shunbo; Li, Ming; Bougot-Robin, Kristelle; Cao, Wenbin; Yeung Yeung Chau, Irene; Li, Weihua; Wen, Weijia
2013-01-01
Integrating different steps on a chip for cell manipulations and sample preparation is of foremost importance to fully take advantage of microfluidic possibilities, and therefore make tests faster, cheaper and more accurate. We demonstrated particle manipulation in an integrated microfluidic device by applying hydrodynamic, electroosmotic (EO), electrophoretic (EP), and dielectrophoretic (DEP) forces. The process involves generation of fluid flow by pressure difference, particle trapping by DEP force, and particle redirect by EO and EP forces. Both DC and AC signals were applied, taking advantages of DC EP, EO and AC DEP for on-chip particle manipulation. Since different types of particles respond differently to these signals, variations of DC and AC signals are capable to handle complex and highly variable colloidal and biological samples. The proposed technique can operate in a high-throughput manner with thirteen independent channels in radial directions for enrichment and separation in microfluidic chip. We evaluated our approach by collecting Polystyrene particles, yeast cells, and E. coli bacteria, which respond differently to electric field gradient. Live and dead yeast cells were separated successfully, validating the capability of our device to separate highly similar cells. Our results showed that this technique could achieve fast pre-concentration of colloidal particles and cells and separation of cells depending on their vitality. Hydrodynamic, DC electrophoretic and DC electroosmotic forces were used together instead of syringe pump to achieve sufficient fluid flow and particle mobility for particle trapping and sorting. By eliminating bulky mechanical pumps, this new technique has wide applications for in situ detection and analysis. PMID:24404011
Li, Shunbo; Li, Ming; Bougot-Robin, Kristelle; Cao, Wenbin; Yeung Yeung Chau, Irene; Li, Weihua; Wen, Weijia
2013-01-01
Integrating different steps on a chip for cell manipulations and sample preparation is of foremost importance to fully take advantage of microfluidic possibilities, and therefore make tests faster, cheaper and more accurate. We demonstrated particle manipulation in an integrated microfluidic device by applying hydrodynamic, electroosmotic (EO), electrophoretic (EP), and dielectrophoretic (DEP) forces. The process involves generation of fluid flow by pressure difference, particle trapping by DEP force, and particle redirect by EO and EP forces. Both DC and AC signals were applied, taking advantages of DC EP, EO and AC DEP for on-chip particle manipulation. Since different types of particles respond differently to these signals, variations of DC and AC signals are capable to handle complex and highly variable colloidal and biological samples. The proposed technique can operate in a high-throughput manner with thirteen independent channels in radial directions for enrichment and separation in microfluidic chip. We evaluated our approach by collecting Polystyrene particles, yeast cells, and E. coli bacteria, which respond differently to electric field gradient. Live and dead yeast cells were separated successfully, validating the capability of our device to separate highly similar cells. Our results showed that this technique could achieve fast pre-concentration of colloidal particles and cells and separation of cells depending on their vitality. Hydrodynamic, DC electrophoretic and DC electroosmotic forces were used together instead of syringe pump to achieve sufficient fluid flow and particle mobility for particle trapping and sorting. By eliminating bulky mechanical pumps, this new technique has wide applications for in situ detection and analysis.
HMGB1 in Cancer: Good, Bad, or Both?
Kang, Rui; Zhang, Qiuhong; Zeh, Herbert J.; Lotze, Michael T.; Tang, Daolin
2013-01-01
Forty years ago, high mobility group box 1 (HMGB1) was discovered in calf thymus and named according to its electrophoretic mobility in polyacrylamide gels. Now, we know that HMGB1 performs dual functions. Inside the cell, HMGB1 is a highly conserved chromosomal protein acting as a DNA chaperone. Outside of the cell, HMGB1 is a prototypical damage-associated molecular pattern, acting with cytokine, chemokine, and growth factor. During tumor development and in cancer therapy, HMGB1 has been reported to play paradoxical roles in promoting both cell survival and death by regulating multiple signaling pathways, including inflammation, immunity, genome stability, proliferation, metastasis, metabolism, apoptosis, and autophagy. Here, we review the current knowledge of both HMGB1’s oncogenic and tumor suppressive roles and the potential strategies that target HMGB1 for the prevention and treatment of cancer. PMID:23723299
Rojaee, Ramin; Fathi, Mohammadhossein; Raeissi, Keyvan
2014-12-01
Magnesium is one of the most critical elements in hard tissues regeneration and therefore causes speeding up the restoration of harmed bones, while high deterioration rate of magnesium in body fluid restricts it to be used as biodegradable implants. Alloying magnesium with some relatively nobler metals such as aluminium, zinc, rare earth elements, magnesium-bioceramics composites, and surface modification techniques are some of the routes to control magnesium corrosion rate. In this study AZ91 magnesium alloy had been coated by nanostructured hydroxyapatite via sol-gel dip coating and electrophoretical methods to survey the final barricade properties of the obtained coatings. In order to perform electrophoretic coating, powders were prepared by sol-gel method, and then the powders deposited on substrates utilizing direct current electricity. Zeta potentials of the electrophoresis suspensions were measured to determine a best mode for good quality coatings. Transmission Electron Microscopy (TEM), and Scanning Electron Microscopy (SEM) were used to confirm nanoscale dimension, and the uniformity of the nanostructured hydroxyapatite coating, respectively. Fourier Transform-Infrared and X-ray diffraction analysis were utilized for functional group and phase structure evaluation of the prepared coatings, correspondingly. Electrochemical corrosion tests were performed in SBF at 37±1 (°)C which revealed considerable increase in corrosion protection resistivity and corrosion current density for electrophoretic coated specimens versus sol-gel coated specimens. Results showed that both sol-gel and electrophoretical techniques seem to be suitable to coat magnesium alloys for biomedical applications but electrophoretic coating technique is a better choice due to the more homogeneity and more crystalline structure of the coating.
Burns, J W; Chen, D; Estes, M K; Ramig, R F
1989-04-01
We have studied a variant virus isolated from a stock of SA11 virus (H. G. Pereira, R. S. Azeredo, A. M. Fialho, and M. N. P. Vidal, 1984, J. Gen. Virol. 65, 815-818). This virus, designated 4F, was initially identified by its faster electrophoretic mobility for genome segment 4. The variant was analyzed to determine if the altered electrophoretic mobility of genome segment 4 could be correlated with phenotypic changes. Comparison of our standard laboratory SA11 virus (clone 3) with the 4F variant showed the following: (i) The 4F variant possesses a viral hemagglutinin (VP4) with a higher apparent molecular weight than clone 3. (ii) The 4F variant produces large plaques when assayed in vitro, as compared to clone 3. (iii) The 4F variant produces plaques in the absence of proteolytic enzymes, whereas clone 3 does not. (iv) The 4F variant reacts with serotype-specific neutralizing monoclonal antibodies to VP7, but fails to react with several neutralizing anti-VP4 monoclonal antibodies generated to SA11 clone 3. (v) The 4F variant grows to a higher titer and is more stable than clone 3. (vi) The 4F variant produces a VP4 that appears to be more susceptible to cleavage by trypsin than is the VP4 of clone 3. Further analyses with the 4F variant may lead to an understanding of the molecular basis for these altered phenotypes that appear to be related, at least in part, to the product of genome segment 4.
Riesová, Martina; Svobodová, Jana; Ušelová, Kateřina; Tošner, Zdeněk; Zusková, Iva; Gaš, Bohuslav
2014-10-17
In this paper we determine acid dissociation constants, limiting ionic mobilities, complexation constants with β-cyclodextrin or heptakis(2,3,6-tri-O-methyl)-β-cyclodextrin, and mobilities of resulting complexes of profens, using capillary zone electrophoresis and affinity capillary electrophoresis. Complexation parameters are determined for both neutral and fully charged forms of profens and further corrected for actual ionic strength and variable viscosity in order to obtain thermodynamic values of complexation constants. The accuracy of obtained complexation parameters is verified by multidimensional nonlinear regression of affinity capillary electrophoretic data, which provides the acid dissociation and complexation parameters within one set of measurements, and by NMR technique. A good agreement among all discussed methods was obtained. Determined complexation parameters were used as input parameters for simulations of electrophoretic separation of profens by Simul 5 Complex. An excellent agreement of experimental and simulated results was achieved in terms of positions, shapes, and amplitudes of analyte peaks, confirming the applicability of Simul 5 Complex to complex systems, and accuracy of obtained physical-chemical constants. Simultaneously, we were able to demonstrate the influence of electromigration dispersion on the separation efficiency, which is not possible using the common theoretical approaches, and predict the electromigration order reversals of profen peaks. We have shown that determined acid dissociation and complexation parameters in combination with tool Simul 5 Complex software can be used for optimization of separation conditions in capillary electrophoresis. Copyright © 2014 Elsevier B.V. All rights reserved.
Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.
Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T
2018-06-01
To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.
Further analyses of human kidney cell populations separated on the Space Shuttle
NASA Technical Reports Server (NTRS)
Stewart, Robin M.; Todd, Paul; Cole, Kenneth D.; Morrison, Dennis R.
1992-01-01
Cultured human embryonic kidney cells were separated into electrophoretic subpopulations in laboratory experiments and in two separation experiments on the STS-8 (Challenger) Space Shuttle flight using the mid-deck Continuous Flow Electrophoretic Separator (CFES). Populations of cells from each fraction were cultured for the lifetime of the cells, and supernatant medium was withdrawn and replaced at 4-day intervals. Withdrawn medium was frozen at -120 C for subsequent analysis. Enzyme assays, antibodies and gel electrophoresis were used as analytical tools for the detection and quantization of plasminogen activators in these samples. These assays of frozen-culture supernatant fluids confirmed the electrophoretic separation of plasminogen-activator-producing cells from nonproducing cells, the isolation of cells capable of sustained production, and the separation of cells that produce different plasminogen activators from one other.
Native and sodium dodecyl sulfate-capillary gel electrophoresis of proteins on a single microchip.
Tsai, Shuo-Wen; Loughran, Michael; Suzuki, Hiroaki; Karube, Isao
2004-02-01
Simultaneous electrophoresis of both native and Sodium dodecyl sulfate (SDS) proteins was observed on a single microchip within 20 min. The capillary array prevented lateral diffusion of SDS components and avoided cross contamination of native protein samples. The planar sputtered electrode format provided a more uniform distribution of separation voltage into each of the 36 parallel microchannel capillaries than platinum wire electrodes commonly used in conventional electrophoresis. The customized geometry of the stacking capillary machined into the cover plate of the microchip facilitated reproducible sample injection without the requirement for stacking gel. Polyimide served as a mask and facilitated insulation of the anode and cathode to prevent electrode lift off and deterioration during continuous electrophoresis, even at a constant current of 8 mA. Improved protein separation was observed during capillary electrophoresis at lower currents. Ferguson plot analysis confirmed the electrophoretic mobility of native globular proteins in accordance with their charge and size. Corresponding Ferguson plot analysis of SDS-associated proteins on the same chip confirmed separation of marker proteins according to their molecular weight.
Ho, Chun-Han; Wang, Hao-Ching; Ko, Tzu-Ping; Chang, Yuan-Chih; Wang, Andrew H.-J.
2014-01-01
The T4 phage protein Arn (Anti restriction nuclease) was identified as an inhibitor of the restriction enzyme McrBC. However, until now its molecular mechanism remained unclear. In the present study we used structural approaches to investigate biological properties of Arn. A structural analysis of Arn revealed that its shape and negative charge distribution are similar to dsDNA, suggesting that this protein could act as a DNA mimic. In a subsequent proteomic analysis, we found that the bacterial histone-like protein H-NS interacts with Arn, implying a new function. An electrophoretic mobility shift assay showed that Arn prevents H-NS from binding to the Escherichia coli hns and T4 p8.1 promoters. In vitro gene expression and electron microscopy analyses also indicated that Arn counteracts the gene-silencing effect of H-NS on a reporter gene. Because McrBC and H-NS both participate in the host defense system, our findings suggest that T4 Arn might knock down these mechanisms using its DNA mimicking properties. PMID:25118281
First report of linear megaplasmids in the genus Micrococcus.
Dib, Julian R; Wagenknecht, Martin; Hill, Russell T; Farías, María E; Meinhardt, Friedhelm
2010-01-01
High-altitude wetlands (above 4200m) in the northwest of Argentina are considered pristine and extreme environments. Micrococcus sp. A1, H5, and V7, isolated from such environments, were shown to contain linear megaplasmids, designated pLMA1, pLMH5, and pLMV7, respectively. As known from linear plasmids of other actinomycetes, all three plasmids were resistant to lambda exonuclease treatment, which is consistent with having terminal proteins covalently attached to their 5' DNA ends. Electrophoretic mobility, Southern analysis, and restriction endonuclease patterns revealed pLMA1 and pLMH5 being indistinguishable plasmids, even though they were found in different strains isolated from two distant wetlands - Laguna Azul and Laguna Huaca Huasi. Analysis of 16S rDNA sequences of Micrococcus sp. A1, H5, and V7 suggested a close relationship to Micrococcus luteus. Typing of isolates was performed using fingerprint patterns generated by BOX-PCR. Plasmid-deficient strains, generated from Micrococcus sp. A1, showed a significantly decreased resistance level for erythromycin. Copyright 2009 Elsevier Inc. All rights reserved.
Gel Electrophoresis of Gold-DNA Nanoconjugates
Pellegrino, T.; Sperling, R. A.; Alivisatos, A. P.; ...
2007-01-01
Gold-DNA conjugates were investigated in detail by a comprehensive gel electrophoresis study based on 1200 gels. A controlled number of single-stranded DNA of different length was attached specifically via thiol-Au bonds to phosphine-stabilized colloidal gold nanoparticles. Alternatively, the surface of the gold particles was saturated with single stranded DNA of different length either specifically via thiol-Au bonds or by nonspecific adsorption. From the experimentally determined electrophoretic mobilities, estimates for the effective diameters of the gold-DNA conjugates were derived by applying two different data treatment approaches. The first method is based on making a calibration curve for the relation between effectivemore » diameters and mobilities with gold nanoparticles of known diameter. The second method is based on Ferguson analysis which uses gold nanoparticles of known diameter as reference database. Our study shows that effective diameters derived from gel electrophoresis measurements are affected with a high error bar as the determined values strongly depend on the method of evaluation, though relative changes in size upon binding of molecules can be detected with high precision. Furthermore, in this study, the specific attachment of DNA via gold-thiol bonds to Au nanoparticles is compared to nonspecific adsorption of DNA. Also, the maximum number of DNA molecules that can be bound per particle was determined.« less
Ryu, Gi Seong; Lee, Myung Won; Jeong, Seung Hyeon; Song, Chung Kun
2012-01-01
In this study we developed a simple ink-jet process for 6,13-bis(triisopropylsilylethynyl)-pentacene (TIPS-pentacene), which is known as a high-mobility soluble organic semiconductor, to achieve relatively high-mobility and high-uniformity performance for large-area applications. We analyzed the behavior of fluorescent particles in droplets and applied the results to determining a method of controlling the behavior of TIPS-pentacene molecules. The grain morphology of TIPS-pentacene varied depending on the temperature applied to the droplets during drying. We were able to obtain large and uniform grains at 46 degrees C without any "coffee stain". The process was applied to a large-size organic thin-film transistor (OTFT) backplane for an electrophoretic display panel containing 192 x 150 pixels on a 6-in.-sized substrate. The average of mobilities of 36 OTFTs, which were taken from different locations of the backplane, was 0.44 +/- 0.08 cm2.V-1.s-1, with a small deviation of 20%, over a 6-in.-size area comprising 28,800 OTFTs. This process providing high mobility and high uniformity can be achieved by simply maintaining the whole area of the substrate at a specific temperature (46 degrees C in this case) during drying of the droplets.
Rill, Randolph L; Beheshti, Afshin; Van Winkle, David H
2002-08-01
Electrophoretic mobilities of DNA molecules ranging in length from 200 to 48 502 base pairs (bp) were measured in agarose gels with concentrations T = 0.5% to 1.3% at electric fields from E = 0.71 to 5.0 V/cm. This broad data set determines a range of conditions over which the new interpolation equation nu(L) = (beta+alpha(1+exp(-L/gamma))(-1) can be used to relate mobility to length with high accuracy. Mobility data were fit with chi(2) > 0.999 for all gel concentrations and fields ranging from 2.5 to 5 V/cm, and for lower fields at low gel concentrations. Analyses using so-called reptation plots (Rousseau, J., Drouin, G., Slater, G. W., Phys. Rev. Lett. 1997, 79, 1945-1948) indicate that this simple exponential relation is obeyed well when there is a smooth transition from the Ogston sieving regime to the reptation regime with increasing DNA length. Deviations from this equation occur when DNA migration is hindered, apparently by entropic-trapping, which is favored at low fields and high gel concentrations in the ranges examined.
Malá, Zdena; Gebauer, Petr
2017-10-06
Capillary isotachophoresis (ITP) is an electrophoretic technique offering high sensitivity due to permanent stacking of the migrating analytes. Its combination with electrospray-ionization mass-spectrometric (ESI-MS) detection is limited by the narrow spectrum of ESI-compatible components but can be compensated by experienced system architecture. This work describes a methodology for sensitive analysis of hydroxyderivatives of s-triazine herbicides, based on implementation of the concepts of moving-boundary isotachophoresis and of H + as essential terminating component into cationic ITP with ESI-MS detection. Theoretical description of such kind of system is given and equations for zone-related boundary mobilities are derived, resulting in a much more general definition of the effective mobility of the terminating H + zone than used so far. Explicit equations allowing direct calculation for selected simple systems are derived. The presented theory allows prediction of stacking properties of particular systems and easy selection of suitable electrolyte setups. A simple ESI-compatible system composed of acetic acid and ammonium with H + and ammonium as a mixed terminator was selected for the analysis of 2-hydroxyatrazine and 2-hydroxyterbutylazine, degradation products of s-triazine herbicides. The proposed method was tested with direct injection without any sample pretreatment and provided excellent linearity and high sensitivity with limits of detection below 100ng/L (0.5nM). Example analyses of unspiked and spiked drinking and river water are shown. Copyright © 2017 Elsevier B.V. All rights reserved.
Ludewig, Ronny; Nietzsche, Sandor; Scriba, Gerhard K E
2011-01-01
A CEC weak cation-exchange monolith has been prepared by in situ polymerization of acrylamide, methylenebisacrylamide and 4-acrylamidobutyric acid in a decanol-dimethylsulfoxide mixture as porogen. The columns were evaluated by SEM and characterized with regard to the separation of diastereomers and α/β-isomers of aspartyl peptides. Column preparation was reproducible as evidenced by comparison of the analyte retention times of several columns prepared simultaneously. Analyte separation was achieved using mobile phases consisting of acidic phosphate buffer and ACN. Under these conditions the peptides migrated due to their electrophoretic mobility but the EOF also contributed as driving force as a function of the pH of the mobile phase due to increasing dissociation of the carboxyl groups of the polymer. Raising the pH of the mobile phase also resulted in deprotonation of the peptides reducing analyte mobility. Due to these mechanisms each pair of diastereomeric peptides displayed the highest resolution at a different pH of the buffer component of the mobile phase. Comparing the weak-cation exchange monolith to an RP monolith and a strong cation-exchange monolith different elution order of some peptide diastereomers was observed, clearly illustrating that interactions with the stationary phase contribute to the CEC separations. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sample injection and electrophoretic separation on a simple laminated paper based analytical device.
Xu, Chunxiu; Zhong, Minghua; Cai, Longfei; Zheng, Qingyu; Zhang, Xiaojun
2016-02-01
We described a strategy to perform multistep operations on a simple laminated paper-based separation device by using electrokinetic flow to manipulate the fluids. A laminated crossed-channel paper-based separation device was fabricated by cutting a filter paper sheet followed by lamination. Multiple function units including sample loading, sample injection, and electrophoretic separation were integrated on a single paper based analytical device for the first time, by applying potential at different reservoirs for sample, sample waste, buffer, and buffer waste. As a proof-of-concept demonstration, mixed sample solution containing carmine and sunset yellow were loaded in the sampling channel, and then injected into separation channel followed by electrophoretic separation, by adjusting the potentials applied at the four terminals of sampling and separation channel. The effects of buffer pH, buffer concentration, channel width, and separation time on resolution of electrophoretic separation were studied. This strategy may be used to perform multistep operations such as reagent dilution, sample injection, mixing, reaction, and separation on a single microfluidic paper based analytical device, which is very attractive for building micro total analysis systems on microfluidic paper based analytical devices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sim, H H; Kim, Y J; Choi, H J
2012-12-01
Black inorganic pigment modified with poly(styrene-co-acrylonitrile) was fabricated via dispersion polymerization, and then the synthesized hybrid nanoparticles were examined by SEM to confirm their morphology, while their density and size were studied using a gas pycnometer and electrophoretic light scattering apparatus, respectively. We also confirmed their chemical structure and coated state via FT-IR and TGA. Electrophoretic characteristics including the zeta potential were examined via an electrophoretic light scattering apparatus, while the movement of particles was directly observed by an optical microscopy under an electric field applied. The hybrid nanoparticles were confirmed to possess an electrophoretic property as a potential candidate for the microcapsule-type electrophoretic display.
Kellenberger, Colleen A; Sales-Lee, Jade; Pan, Yuchen; Gassaway, Madalee M; Herr, Amy E; Hammond, Ming C
2015-01-01
Cyclic di-GMP (c-di-GMP) is a second messenger that is important in regulating bacterial physiology and behavior, including motility and virulence. Many questions remain about the role and regulation of this signaling molecule, but current methods of detection are limited by either modest sensitivity or requirements for extensive sample purification. We have taken advantage of a natural, high affinity receptor of c-di-GMP, the Vc2 riboswitch aptamer, to develop a sensitive and rapid electrophoretic mobility shift assay (EMSA) for c-di-GMP quantitation that required minimal engineering of the RNA.
NASA Technical Reports Server (NTRS)
Davis, Robert H.; Loewenberg, Michael
1997-01-01
The primary objective of this research was to develop a fundamental understanding of aggregation and coalescence processes during electrically-driven migration of cells, particles and droplets. The process by which charged cells, particles, molecules, or drops migrate in a weak electric field is known as electrophoresis. If the migrating species have different charges or surface potentials, they will migrate at different speeds and thus may collide and aggregate or coalesce. Aggregation and coalescence are undesirable, if the goal is to separate the different species on the basis of their different electrophoretic mobilities.
Binary Oscillatory Crossflow Electrophoresis
NASA Technical Reports Server (NTRS)
Molloy, Richard F.; Gallagher, Christopher T.; Leighton, David T., Jr.
1996-01-01
We present preliminary results of our implementation of a novel electrophoresis separation technique: Binary Oscillatory Cross flow Electrophoresis (BOCE). The technique utilizes the interaction of two driving forces, an oscillatory electric field and an oscillatory shear flow, to create an active binary filter for the separation of charged species. Analytical and numerical studies have indicated that this technique is capable of separating proteins with electrophoretic mobilities differing by less than 10%. With an experimental device containing a separation chamber 20 cm long, 5 cm wide, and 1 mm thick, an order of magnitude increase in throughput over commercially available electrophoresis devices is theoretically possible.
Malina, Jaroslav; Hannon, Michael J.; Brabec, Viktor
2016-01-01
The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat–TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates. PMID:27405089
Fabrication of (K0.5Na0.5)(Nb0.7Ta0.3)O3 thick films by electrophoretic deposition
NASA Astrophysics Data System (ADS)
Vineetha, P.; Saravanan, K. Venkata
2018-05-01
(K0.5Na0.5)(Nb0.7Ta0.3)O3 (KNNT) thick films were prepared by electrophoretic deposition method on copper plates (substrates). Prior to the deposition, stable suspensions of KNNT powder were prepared in isopropyl alcohol medium with and without adding triethanolamine (TEA) as dispersant. The optical transmittance spectra with time for both the suspensions were recorded and compared. Suspensions with dispersant has shown low transmittance, which indicate that the particles were dispersed very well in isopropyl alcohol. Fourier Transform Infrared (FTIR) spectroscopy was used to analyze the adsorption of TEA on KNNT particles. Suspension with dispersant was used for electrophoretic deposition. The depositions were carried out at various d.c voltages, keeping the deposition duration and inter electrode distance constant. X-Ray diffraction was used for the phase analysis of the films.
Thermoplastic microchannel fabrication using carbon dioxide laser ablation.
Wang, Shau-Chun; Lee, Chia-Yu; Chen, Hsiao-Ping
2006-04-14
We report the procedures of machining microchannels on Vivak co-polyester thermoplastic substrates using a simple industrial CO(2) laser marker. To avoid overheating the substrates, we develop low-power marking techniques in nearly anaerobic environment. These procedures are able to machine microchannels at various aspect ratios. Either straight or serpent channel can be easily marked. Like the wire-embossed channel walls, the ablated channel surfaces become charged after alkaline hydrolysis treatment. Stable electroosmotic flow in the charged conduit is observed to be of the same order of magnitude as that in fused silica capillary. Typical dynamic coating protocols to alter the conduit surface properties are transferable to the ablated channels. The effects of buffer acidity on electroosmotic mobility in both bare and coated channels are similar to those in fused silica capillaries. Using video microscopy we also demonstrate that this device is useful in distinguishing the electrophoretic mobility of bare and latex particles from that of functionalized ones.
Electric field-induced reversible trapping of microtubules along metallic glass microwire electrodes
NASA Astrophysics Data System (ADS)
Kim, Kyongwan; Sikora, Aurélien; Nakayama, Koji S.; Umetsu, Mitsuo; Hwang, Wonmuk; Teizer, Winfried
2015-04-01
Microtubules are among bio-polymers providing vital functions in dynamic cellular processes. Artificial organization of these bio-polymers is a requirement for transferring their native functions into device applications. Using electrophoresis, we achieve an accumulation of microtubules along a metallic glass (Pd42.5Cu30Ni7.5P20) microwire in solution. According to an estimate based on migration velocities of microtubules approaching the wire, the electrophoretic mobility of microtubules is around 10-12 m2/Vs. This value is four orders of magnitude smaller than the typical mobility reported previously. Fluorescence microscopy at the individual-microtubule level shows microtubules aligning along the wire axis during the electric field-induced migration. Casein-treated electrodes are effective to reversibly release trapped microtubules upon removal of the external field. An additional result is the condensation of secondary filamentous structures from oriented microtubules.
Divakar, K; Devi, G Nandhini; Gautam, Pennathur
2012-01-01
Protein identification in polyacrylamide gel electrophoresis (PAGE) requires post-electrophoretic steps like fixing, staining, and destaining of the gel, which are time-consuming and cumbersome. A new method for direct visualization of protein bands in PAGE has been developed using meso-tetrakis(4-sulfonatophenyl)porphyrin (TPPS) as a dye without the need for any post-electrophoretic steps; thus, separation and recovery of enzymes become much easier for further analysis. Activity staining was carried out to show that the biochemical activity of the enzymes was preserved after electrophoresis.
Enzyme markers in inbred rat strains: genetics of new markers and strain profiles.
Adams, M; Baverstock, P R; Watts, C H; Gutman, G A
1984-08-01
Twenty-six inbred strains of the laboratory rat (Rattus norvegicus) were examined for electrophoretic variation at an estimated 97 genetic loci. In addition to previously documented markers, variation was observed for the enzymes aconitase, aldehyde dehydrogenase, and alkaline phosphatase. The genetic basis of these markers (Acon-1, Ahd-2, and Akp-1) was confirmed. Linkage analysis between 35 pairwise comparisons revealed that the markers Fh-1 and Pep-3 are linked. The strain profiles of the 25 inbred strains at 11 electrophoretic markers are given.
Plant cell transformation with Agrobacterium tumefaciens under simulated microgravity
NASA Astrophysics Data System (ADS)
Sarnatska, Veresa; Gladun, Hanna; Padalko, Svetlana
To investigate simulated microgravity (clinorotation) effect on plant cell transformation with Agrobacterium tumefaciens and crown gall formation, the culture of primary explants of potato and Jerusalem artichoke tubers was used. It is found that the efficiency of tumor formation and development in clinorotated explants are considerably reduced. When using the explants isolated from potato tubers clinorotated for 3, 5 and 19 days, drastic reduction of formation and development of crown gall tumors was observed. Conversely, the tumor number and their development increased when potato tubers were clinorotated for one day. As was estimated by us previously, cells of Jerusalem artichoke explants are the most sensitive to agrobacteria on 4-5 h of in vitro culturing and this time corresponds to the certain period of G1-stage of the cell cycle. We have also estimated that this period is characterized by the increase of binding of acridine orange by nuclear chromatin and increase in activity of RNA-polymerase I and II. Inoculation of explants with agrobacteria in this period was the most optimal for transformation and crown gall induction. We estimated that at four - hour clinorotation of explants the intensity of acridine orange binding to nuclei was considerably lower than on 4h in the control. At one-day clinorotation of potato tubers, a considerable increase in template accessibility of chromatin and in activity of RNA-polymerase I and II occurred. These results may serve as an evidence for the ability of plant dormant tissues to respond to microgravity. Another demonstration of dormant tissue response to changed gravity we obtained when investigating pathogenesis-related proteins (PR-proteins). PR-proteins were subjected to nondenaturing PAGE.and we have not found any effect of microgravity on PR-proteins of potato explants with normal or tumorous growth. We may suggest that such response derives from the common effects of two stress factors - wounding and changed gravity. Investigation of the effect of microgravity on PR-proteins of dormant potato tubers showed that an intensity of several electrophoretic fractions of these proteins with middle electrophoretic mobility increased and appeared two new minor fractions with high electrophoretic mobility under clinorotation of tubers. We discuss the possibility to use short term clinorotation of plant organs, from which the explants for the transformation with A. tumefaciens will be isolated, for an increase in the transformation efficiency of recalcitrant plants.
Countercurrent distribution of biological cells
NASA Technical Reports Server (NTRS)
Brooks, D. E.
1982-01-01
Detailed physiochemical studies of dextran/poly(ethylene glycol) (PEG) two phase systems were carried out to characterize and provide understanding of the properties of the systems which determine cell partition and the electrophoretic behavior of phase drops responsible for electric field driven phase separation. A detailed study of the electrostatic and electrokinetic potentials developed in these systems was carried out. The salt partition was examined both in phase systems and with pure polymer solutions via equilibrium dialysis and mechanism of sulfate, chloride and phosphate partition shown to be exclusion by PEG rather than binding by dextran. Salt partition was shown to have a strong effect on the polymer compositions of the phases as well, an effect which produces large changes in the interfacial tension between them. These effects were characterized and the interfacial tension shown to obey a power law with respect to its dependence on the length of the tie line describing the system composition on a phase diagram. The electrostatic potential differences measured via salt bridges were shown to obey thermodynamic predictions. The electrophoretic mobilities measured were utilized to provide a partial test of Levine's incomplete theory of phase drop electrophoresis. The data were consistent with Levine's expression over a limited range of the variables tested.
Low density lipoprotein (LDL)-antioxidant flavonoids from roots of Sophora flavescens.
Jeong, Tae-Sook; Ryu, Young Bae; Kim, Hoi Young; Curtis-Long, Marcus John; An, Sojin; An, So Jin; Lee, Jin Hwan; Lee, Woo Song; Park, Ki Hun
2008-11-01
Oxidation of low density lipoprotein (LDL) is strongly implicated as a key process in the onset of atherosclerosis. In this study, nine alkylated (C10-C5) flavonoids from Sophora flavescens were examined for their inhibitory effects on copper-induced LDL oxidation. Of the flavonoids tested, sophoraflavanone G (1), kurarinone (2), kurarinol (3), norkurarinol (4), and kuraridin (9) inhibited the generation of thiobarbituric acid reactive substances (TBARS) with IC50s of 7.9, 14.5, 22.0, 26.9, and 17.5 microM, respectively. The most potent inhibitor, compound 1, also demonstrated significant activities in complementary in vitro investigations, such as lag time (130 min at 5 microM), relative electrophoretic mobility (REM) of ox-LDL (80% inhibition at 20 microM), and fragmentation of apoB-100 (inhibition of 71% at 20 microM). Analysis of the structures of these compounds reveals that a resorcinol moiety in the B-ring is strongly correlated with protection of LDL-oxidation.
Heider, Susanne; Muzard, Julien; Zaruba, Marianne; Metzner, Christoph
2017-07-01
Elements derived from lentiviral particles such as viral vectors or virus-like particles are commonly used for biotechnological and biomedical applications, for example in mammalian protein expression, gene delivery or therapy, and vaccine development. Preparations of high purity are necessary in most cases, especially for clinical applications. For purification, a wide range of methods are available, from density gradient centrifugation to affinity chromatography. In this study we have employed size exclusion columns specifically designed for the easy purification of extracellular vesicles including exosomes. In addition to viral marker protein and total protein analysis, a well-established single-particle characterization technology, termed tunable resistive pulse sensing, was employed to analyze fractions of highest particle load and purity and characterize the preparations by size and surface charge/electrophoretic mobility. With this study, we propose an integrated platform combining size exclusion chromatography and tunable resistive pulse sensing for monitoring production and purification of viral particles.
GATA-1 directly regulates Nanog in mouse embryonic stem cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Wen-Zhong; Ai, Zhi-Ying; Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A&F University, Yangling 712100
2015-09-25
Nanog safeguards pluripotency in mouse embryonic stem cells (mESCs). Insight into the regulation of Nanog is important for a better understanding of the molecular mechanisms that control pluripotency of mESCs. In a silico analysis, we identify four GATA-1 putative binding sites in Nanog proximal promoter. The Nanog promoter activity can be significantly repressed by ectopic expression of GATA-1 evidenced by a promoter reporter assay. Mutation studies reveal that one of the four putative binding sites counts for GATA-1 repressing Nanog promoter activity. Direct binding of GATA-1 on Nanog proximal promoter is confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation.more » Our data provide new insights into the expanded regulatory circuitry that coordinates Nanog expression. - Highlights: • The Nanog proximal promoter conceives functional element for GATA-1. • GATA-1 occupies the Nanog proximal promoter in vitro and in vivo. • GATA-1 transcriptionally suppresses Nanog.« less
Valenta, M; Stratil, A; Slechtová, V; Kálal, L; Slechta, V
1976-02-01
Seven transferrin variants (A,B,C,D,E,F, and G) have been found in carp sera (Cyprinus carpio L.). Genetic analysis involves five variants and agrees with the hypothesis of simple codominant autosomal inheritance at one transferrin (Tf) locus in spite of the fact that the carp is a tetraploid in relation to other species of the same family. Carp populations from three regions were studied which differed in gene frequencies. Individual populations were in Hardy-Weinberg equilibrium. The polymorphism of carp transferrins can be used for the identification of offspring of single parent pairs, stocked in one pond. Transferrins have been isolated and characterized. Homozygous phenotypes comprised four iron-binding components differing in electrophoretic mobility. This heterogeneity is not caused by sialic acid, which is absent. Amino acid composition, content of hexoses (1 mole/mole of protein) and hexosamines (1 mole/mole of protein), molecualr weight (70,000), and the isoelectric point (5.0) have been determined. No N-terminal amino acid could be detected.
Comprehensive Analysis of a Vibrio parahaemolyticus Strain Extracellular Serine Protease VpSP37
Bennici, Carmelo; Quatrini, Paola; Catania, Valentina; Mazzola, Salvatore; Ghersi, Giulio; Cuttitta, Angela
2015-01-01
Proteases play an important role in the field of tissue dissociation combined with regenerative medicine. During the years new sources of proteolytic enzymes have been studied including proteases from different marine organisms both eukaryotic and prokaryotic. Herein we have purified a secreted component of an isolate of Vibrio parahaemolyticus, with electrophoretic mobilities corresponding to 36 kDa, belonging to the serine proteases family. Sequencing of the N-terminus enabled the in silico identification of the whole primary structure consisting of 345 amino acid residues with a calculated molecular mass of 37.4 KDa. The purified enzyme, named VpSP37, contains a Serine protease domain between residues 35 and 276 and a canonical Trypsin/Chimotrypsin 3D structure. Functional assays were performed to evaluate protease activity of purified enzyme. Additionally the performance of VpSP37 was evaluated in tissue dissociations experiments and the use of such enzyme as a component of enzyme blend for tissue dissociation procedures is strongly recommended. PMID:26162075
Wen, Bi-Qing; Xing, Mei-Qing; Zhang, Hua; Dai, Cheng; Xue, Hong-Wei
2011-11-01
Homeobox transcription factors are involved in various aspects of plant development, including maintenance of the biosynthesis and signaling pathways of different hormones. However, few direct targets of homeobox proteins have been identified. We here show that overexpression of rice homeobox gene HOX1a resulted in enhanced gibberellin (GA) response, indicating a positive effect of HOX1a in GA signaling. HOX1a is induced by GA and encodes a homeobox transcription factor with transcription repression activity. In addition, HOX1a suppresses the transcription of early flowering1 (EL1), a negative regulator of GA signaling, and further electrophoretic mobility shift assay and chromatin immunoprecipitation analysis revealed that HOX1a directly bound to the promoter region of EL1 to suppress its expression and stimulate GA signaling. These results demonstrate that HOX1a functions as a positive regulator of GA signaling by suppressing EL1, providing informative hints on the study of GA signaling. © 2011 Institute of Botany, Chinese Academy of Sciences.
Gel electrophoresis of partially denatured DNA. Retardation effect: its analysis and application.
Lyamichev, V I; Panyutin, I G; Lyubchenko YuL
1982-01-01
The hypothesis about the role of partial denaturation in DNA retardation during its electrophoresis in denaturing gel /1,2/ was tested. We used partially melted DNA molecules in which the size of the melted regions and their location were known. They were obtained through glyoxal treatment of the melted regions by a procedure allowing the denatured state to be fixed at any point within the melting range. The approach and the availability of the melting maps of DNAs made it possible to investigate DNA molecules differing in length and in the size of the melted regions. The presence of a denatured region at the end of the molecule or inside of it was shown to decrease its electrophoretic mobility, the effect depending on the size of the melted region and on the DNA length. On the basis of the experimental results an explanation is proposed for the cause of retardation in the case of partially denatured DNA. Images PMID:7133999
Han, S H; Yea, S S; Jeon, Y J; Yang, K H; Kaminski, N E
1998-12-01
Transforming growth factor beta1 (TGF-beta1) has been previously shown to modulate interleukin 2 (IL-2) secretion by activated T-cells. In the present studies, we determined that TGF-beta1 induced IL-2 mRNA expression in the murine T-cell line EL4, in the absence of other stimuli. IL-2 mRNA expression was significantly induced by TGF-beta1 (0.1-1 ng/ml) over a relatively narrow concentration range, which led to the induction of IL-2 secretion. Under identical condition, we examined the effect of TGF-beta1 on the activity of nuclear factor AT (NF-AT), nuclear factor kappaB (NF-kappaB), activator protein-1 (AP-1) and octamer, all of which contribute to the regulation of IL-2 gene expression. Electrophoretic mobility shift assays showed that TGF-beta1 markedly increased NF-AT, NF-kappaB and AP-1 binding to their respective cognate DNA binding sites, whereas octamer binding remained constant, as compared with untreated cells. Employing a reporter gene expression system with p(NF-kappaB)3-CAT, p(NF-AT)3-CAT and p(AP-1)3-CAT, TGF-beta1 treatment of transfected EL4 cells induced a dose-related increase in chloramphenicol acetyltransferase activity that correlated well with the DNA binding profile found in the electrophoretic mobility shift assay studies. These results show that TGF-beta1, in the absence of any additional stimuli, up-regulates the activity of key transcription factors involved in IL-2 gene expression, including NF-AT, NF-kappaB and AP-1, to help promote IL-2 mRNA expression by EL4 cells.
Elimination of cdc2 phosphorylation sites in the cdc25 phosphatase blocks initiation of M-phase.
Izumi, T; Maller, J L
1993-01-01
The cdc25 phosphatase is a mitotic inducer that activates p34cdc2 at the G2/M transition by dephosphorylation of Tyr15 in p34cdc2. cdc25 itself is also regulated through periodic changes in its phosphorylation state. To elucidate the mechanism for induction of mitosis, phosphorylation of cdc25 has been investigated using recombinant proteins. cdc25 is phosphorylated by both cyclin A/p34cdc2 and cyclin B/p34cdc2 at similar sets of multiple sites in vitro. This phosphorylation retards its electrophoretical mobility and activates its ability to increase cyclin B/p34cdc2 kinase activity three- to fourfold in vitro, as found for endogenous Xenopus cdc25 in M-phase extracts. The threonine and serine residues followed by proline that are conserved between Xenopus and human cdc25 have been mutated. Both the triple mutation of Thr48, Thr67, and Thr138 and the quintuple mutation of these three threonine residues plus Ser205 and Ser285, almost completely abolish the shift in electrophoretic mobility of cdc25 after incubation with M-phase extracts or phosphorylation by p34cdc2. These mutations inhibit the activation of cdc25 by phosphorylation with p34cdc2 by 70 and 90%, respectively. At physiological concentrations these mutants cannot activate cyclin B/p34cdc2 in cdc25-immunodepleted oocyte extracts, suggesting that a positive feed-back loop between cdc2 and cdc25 is necessary for the full activation of cyclin B/p34cdc2 that induces abrupt entry into mitosis in vivo. Images PMID:7513216
Silva, Marcilene Rezende; Sendin, Shimene Mascarenhas; Araujo, Isabela Couto de Oliveira; Pimentel, Fernanda Silva; Viana, Marcos Borato
2013-01-01
To characterize alpha-chain variant hemoglobins with electric mobility similar to that of hemoglobin S in a newborn screening program. β(S) allele and alpha-thalassemia deletions were investigated in 14 children who had undefined hemoglobin at birth and an electrophoretic profile similar to that of hemoglobin S when they were six months old. Gene sequencing and restriction enzymes (DdeI, BsaJI, NlaIV, Bsu36I and TaqI) were used to identify hemoglobins. Clinical and hematological data were obtained from children who attended scheduled medical visits. THE FOLLOWING ALPHA CHAIN VARIANTS WERE FOUND: seven children with hemoglobin Hasharon [alpha2 47(CE5) Asp>His, HbA2:c.142G>C], all associated with alpha-thalassemia, five with hemoglobin Ottawa [alpha1 15(A13) Gly>Arg, HBA1:c.46G>C], one with hemoglobin St Luke's [alpha1 95(G2) Pro>Arg, HBA1:c.287C>G] and another one with hemoglobin Etobicoke [alpha212 84(F5) Ser>Arg, HBA212:c.255C>G]. Two associations with hemoglobin S were found: one with hemoglobin Ottawa and one with hemoglobin St Luke's. The mutation underlying hemoglobin Etobicoke was located in a hybrid α212 allele in one child. There was no evidence of clinically relevant hemoglobins detected in this study. Apparently these are the first cases of hemoglobin Ottawa, St Luke's, Etobicoke and the α212 gene described in Brazil. The hemoglobins detected in this study may lead to false diagnosis of sickle cell trait or sickle cell disease when only isoelectric focusing is used in neonatal screening. Additional tests are necessary for the correct identification of hemoglobin variants.
Xu, R; Birke, S; Carberry, S E; Geacintov, N E; Swenberg, C E; Harvey, R G
1992-01-01
The unwinding of supercoiled phi X174 RFI DNA induced by the tumorigenic (+) and non-tumorigenic (-) enantiomers of trans-7,8-dihydroxy-anti-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE) has been investigated by agarose slab-gel and ethidium titration tube gel electrophoresis. The differences in adduct conformations were verified by flow linear dichroism techniques. Both enantiomers cause a reversible unwinding by the formation of noncovalent intercalative complexes. The effects of covalently bound BPDE residues on the electrophoretic mobilities of the RF I DNA form in agarose gels were investigated in detail in the range of binding ratios rb approximately 0.0-0.06 (covalently bound BPDE residues/nucleotide). In this range of rb values, there is a striking difference in the mobilities of (+)-BPDE- and (-)-BPDE-adducted phi X174 DNA in agarose slab-gels, the covalently bound (+)-BPDE residues causing a significantly greater retardation than (-)-BPDE residues. Increasing the level of covalent adducts beyond rb approximately 0.06 in the case of the (+)-BPDE enantiomer, leads to further unwinding and a minimum in the mobilities (corresponding to comigration of the nicked form and the covalently closed relaxed modified form) at rb 0.10 +/- 0.01; at still higher rb values, rewinding of the modified DNA in the opposite sense is observed. From the minimum in the mobility, a mean unwinding angle (per BPDE residue) of theta = 12 +/- 1.5 degrees is determined, which is in good agreement the value of theta = 11 +/- 1.8 degrees obtained by the tube gel titration method. Using this latter method, values of theta = 6.8 +/- 1.7 degrees for (-)-BPDE-phi X174 adducts are observed. It is concluded that agarose slab gel techniques are not suitable for determining unwinding angles for (-)-BPDE-modified phi X174 DNA because the alterations in the tertiary structures for rb < 0.06 are too small to cause sufficiently large changes in the electrophoretic mobilities. The major trans (+)-BPDE-N2-guanosine covalent adduct is situated at external binding sites and the mechanisms of unwinding are therefore different from those relevant to noncovalent intercalative BPDE-DNA complexes or to classical intercalating drug molecules; a flexible hinge joint and a widening of the minor groove at the site of the lesion may account for the observed unwinding effects. The more heterogeneous (-)-BPDE-nucleoside adducts (involving cis and trans N2-guanosine, and adenosine adducts) are less effective in causing unwinding of supercoiled DNA for reasons which remain to be elucidated. Images PMID:1475180
Chromatographic and electrophoretic approaches in ink analysis.
Zlotnick, J A; Smith, F P
1999-10-15
Inks are manufactured from a wide variety of substances that exhibit very different chemical behaviors. Inks designed for use in different writing instruments or printing methods have quite dissimilar components. Since the 1950s chromatographic and electrophoretic methods have played important roles in the analysis of inks, where compositional information may have bearing on the investigation of counterfeiting, fraud, forgery, and other crimes. Techniques such as paper chromatography and electrophoresis, thin-layer chromatography, high-performance liquid chromatography, gas chromatography, gel electrophoresis, and the relatively new technique of capillary electrophoresis have all been explored as possible avenues for the separation of components of inks. This paper reviews the components of different types of inks and applications of the above separation methods are reviewed.
Electrophoretic variation in low molecular weight lens crystallins from inbred strains of rats.
Donner, M E; Skow, L C; Kunz, H W; Gill, T J
1985-10-01
Analysis of rat lens soluble proteins by analytical isoelectric focusing detected two inherited electrophoretic differences in low molecular weight (LM) crystallins from inbred strains of rats (Rattus norvegicus). The polymorphic lens crystallins were shown to be similar to a genetically variant LM crystallin, LEN-1, previously described in mice (Mus musculus) and encoded on chromosome 1, at a locus linked to Pep-3 (dipeptidase). Linkage analysis demonstrated that the rat crystallin locus was loosely linked to Pep-3 at a recombination distance of 38 +/- 4.5 U. These data suggest the conservation of a large chromosomal region during the evolution of Rodentia and support the hypothesis that the gamma-crystallins are evolving more rapidly than alpha- or beta-crystallins.
Mykhal's'kyĭ, L O; Furtat, I M; Dem'ianenko, F P; Kostiuchyk, A A
2001-01-01
Electrophoretic patterns of cell wall protein of three industrial strains, that were used for production of lysin, and eight collection strains from the genus Corynevacterium were studied to analyze their similarity as well as to estimate an opportunity of using this parameter as an additional criterion for identification and classification of corynebacteria. Similarity coefficient of cell wall overall and main protein electrophoretic patterns were determined by a specially created computer program. Electrophoretic analysis showed that every specie had an individual protein profile. There were determined biopolymers common for the specie, genus and individual among the overall majors and minors. The obtained results showed, that the patterns of main proteins were more conservative and informative in comparison with those ones of overall proteins. The definition of similarity coefficient by the main protein patterns has correlated with the protein profile characteristics of every analyzed strain, and it managed to distribute them into the separate groups. The similarity coefficient of preparations by the main protein patterns allows to separate one specie or a strain from another, and that gives us a chance to claim that this parameter could be used as an additional criterion for differentiation and referring the corynebacteria to a certain taxonomic group.
A stable and convenient protein electrophoresis titration device with bubble removing system.
Zhang, Qiang; Fan, Liu-Yin; Li, Wen-Lin; Cong, Feng-Song; Zhong, Ran; Chen, Jing-Jing; He, Yu-Chen; Xiao, Hua; Cao, Cheng-Xi
2017-07-01
Moving reaction boundary titration (MRBT) has a potential application to immunoassay and protein content analysis with high selectivity. However, air bubbles often impair the accuracy of MRBT, and the leakage of electrolyte greatly decreases the safety and convenience of electrophoretic titration. Addressing these two issues a reliable MRBT device with modified electrolyte chamber of protein titration was designed. Multiphysics computer simulation was conducted for optimization according to two-phase flow. The single chamber was made of two perpendicular cylinders with different diameters. After placing electrophoretic tube, the resident air in the junction next to the gel could be eliminated by a simple fast electrolyte flow. Removing the electrophoretic tube automatically prevented electrolyte leakage at the junction due to the gravity-induced negative pressure within the chamber. Moreover, the numerical simulation and experiments showed that the improved MRBT device has following advantages: (i) easy and rapid setup of electrophoretic tube within 20 s; (ii) simple and quick bubble dissipates from the chamber of titration within 2 s; (iii) no electrolyte leakage from the two chambers: and (iv) accurate protein titration and safe instrumental operation. The developed technique and apparatus greatly improves the performance of the previous MRBT device, and providing a new route toward practical application. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Vedantam, Gayatri; Knopf, Sarah; Hecht, David W
2006-01-01
Tn5520 is the smallest known bacterial mobilizable transposon and was isolated from an antibiotic resistant Bacteroides fragilis clinical isolate. When a conjugation apparatus is provided in trans, Tn5520 is mobilized (transferred) efficiently within, and from, both Bacteroides spp. and Escherichia coli. Only two genes are present on Tn5520; one encodes an integrase, and the other a multifunctional mobilization (Mob) protein BmpH. BmpH is essential for Tn5520 mobility. The focus of this study was to identify the Tn5520 origin of conjugative transfer (oriT) and to study BmpH-oriT binding. We delimited the functional Tn5520 oriT to a 71 bp sequence upstream of the bmpH gene. A plasmid vector harbouring this minimal 71 bp oriT was mobilized at the same frequency as that of intact Tn5520. The minimal oriT contains one 17 bp inverted repeat (IR) sequence. We constructed and tested multiple IR mutants and showed that the IR was essential in its entirety for mobilization. A nick site sequence (5'-GCTAC-3') was also identified within the minimal oriT; this sequence resembled nick sites found in plasmids of Gram positive origin. We further showed that mutation of a highly conserved GC dinucleotide in the nick site sequence completely abolished mobilization. We also purified BmpH and showed that it specifically bound a Tn5520 oriT fragment in electrophoretic mobility shift assays. We also identified non-nick site sequences within the minimal oriT that were essential for mobilization. We hypothesize that transposon-based single Mob protein systems may contribute to efficient gene dissemination from Bacteroides spp., because fewer DNA processing proteins are required for relaxosome formation.
NASA Astrophysics Data System (ADS)
Ryu, Gi Seong; Lee, Myung Won; Jeong, Seung Hyeon; Song, Chung Kun
2012-05-01
In this study we developed a simple ink-jet process for 6,13-bis(triisopropylsilylethynyl)-pentacene (TIPS-pentacene), which is known as a high-mobility soluble organic semiconductor, to achieve relatively high-mobility and high-uniformity performance for large-area applications. We analyzed the behavior of fluorescent particles in droplets and applied the results to determining a method of controlling the behavior of TIPS-pentacene molecules. The grain morphology of TIPS-pentacene varied depending on the temperature applied to the droplets during drying. We were able to obtain large and uniform grains at 46 °C without any “coffee stain”. The process was applied to a large-size organic thin-film transistor (OTFT) backplane for an electrophoretic display panel containing 192×150 pixels on a 6-in.-sized substrate. The average of mobilities of 36 OTFTs, which were taken from different locations of the backplane, was 0.44±0.08 cm2·V-1·s-1, with a small deviation of 20%, over a 6-in.-size area comprising 28,800 OTFTs. This process providing high mobility and high uniformity can be achieved by simply maintaining the whole area of the substrate at a specific temperature (46 °C in this case) during drying of the droplets.
DNA Extraction by Isotachophoresis in a Microfluidic Channel
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stephenson, S J
Biological assays have many applications. For example, forensics personnel and medical professionals use these tests to diagnose diseases and track their progression or identify pathogens and the host response to them. One limitation of these tests, however, is that most of them target only one piece of the sample - such as bacterial DNA - and other components (e.g. host genomic DNA) get in the way, even though they may be useful for different tests. To address this problem, it would be useful to extract several different substances from a complex biological sample - such as blood - in anmore » inexpensive and efficient manner. This summer, I worked with Maxim Shusteff at Lawrence Livermore National Lab on the Rapid Automated Sample Prep project. The goal of the project is to solve the aforementioned problem by creating a system that uses a series of different extraction methods to extract cells, bacteria, and DNA from a complex biological sample. Biological assays can then be run on purified output samples. In this device, an operator could input a complex sample such as blood or saliva, and would receive separate outputs of cells, bacteria, viruses, and DNA. I had the opportunity to work this summer with isotachophoresis (ITP), a technique that can be used to extract nucleic acids from a sample. This technique is intended to be the last stage of the purification device. Isotachophoresis separates particles based on different electrophoretic mobilities. This technique is convenient for out application because free solution DNA mobility is approximately equal for DNA longer than 300 base pairs in length. The sample of interest - in our case DNA - is fed into the chip with streams of leading electrolyte (LE) and trailing electrolyte (TE). When an electric field is applied, the species migrate based on their electrophoretic mobilities. Because the ions in the leading electrolyte have a high electrophoretic mobility, they race ahead of the slower sample and trailing electrolyte ions. Conversely, the trailing electrolyte ions have a slow electrophoretic mobility, so they lag behind the sample, thus trapping the species of interest between the LE and TE streams. In a typical isotachophoresis configuration, the electric field is applied in a direction parallel to the direction of flow. The species then form bands that stretch across the width of the channel. A major limitation of that approach is that only a finite amount of sample can be processed at once, and the sample must be processed in batches. For our purposes, a form of free-flow isotachophoresis is more convenient, where the DNA forms a band parallel to the edges of the channel. To achieve this, in our chip, the electric field is applied transversely. This creates a force perpendicular to the direction of flow, which causes the different ions to migrate across the flow direction. Because the mobility of the DNA is between the mobility of the leading and the trailing electrolyte, the DNA is focused in a tight band near the center of the channel. The stream of DNA can then be directed to a different output to produce a highly concentrated outlet stream without batch processing. One hurdle that must be overcome for successful ITP is isolating the electrochemical reactions that result from the application of high voltage for the actual process of isotachophoresis. The electrochemical reactions that occur around metal electrodes produce bubbles and pH changes that are detrimental to successful ITP. The design of the chips we use incorporates polyacrylamide gels to serve as electrodes along the central channel. For our design, the metal electrodes are located away from the chip, and high conductivity buffer streams carry the potential to the chip, functioning as a 'liquid electrode.' The stream then runs alongside a gel barrier. The gel electrode permits ion transfer while simultaneously isolating the separation chamber from any contaminants in the outer, 'liquid electrode' streams. The difference in potential from one side of the chip to the other creates an electric field. This field traverses the inner, separation channel, containing the leading electrolyte, the trailing electrolyte, and the sample of interest (DNA). To increase the ease of use of the chips, a newer chip design has been fabricated. This design has wire electrodes integrated on the chip, rather than elsewhere. To keep the pH changes and bubbling isolated from the separation channel, the chip contains deeper wells near the electrodes so that the flowing buffer can wash away any gases that form around the electrode. This design is significantly more compact because it eliminates the cumbersome electrode boxes. Eliminating the electrode boxes also decreases the required voltage, making the experiments safer. This happens because when the 'liquid electrode' streams travel through small diameter tubing, they lose much of their voltage due to the electrical resistance of the fluid in the tubing.« less
Foulon, C; Duhal, N; Lacroix-Callens, B; Vaccher, C; Bonte, J P; Goossens, J F
2007-07-01
Acidity constants of benzoxa-, benzothia- and benzoselena-zolinone derivatives were determined by capillary electrophoresis, potentiometry and spectrophotometry experiments. These three analytical techniques gave pK(a) results that were in good agreement. A convenient, accurate and precise method for the determination of pK(a) was developed to measure changes in acidity constants induced by heteroatom or 6-benzoyl substituted derivatives. pK(a) values were determined simultaneously for two compounds characterized by different electrophoretic mobility (micro(e)) and pK(a) value and in the presence of an analogous neutral marker.
Indirect photometric detection of boron cluster anions electrophoretically separated in methanol.
Vítová, Lada; Fojt, Lukáš; Vespalec, Radim
2014-04-18
3,5-Dinitrobenzoate and picrate are light absorbing anions pertinent to indirect photometric detection of boron cluster anions in buffered methanolic background electrolytes (BGEs). Tris(hydroxymethyl)aminomethane and morpholine have been used as buffering bases, which eliminated baseline steps, and minimized the baseline noise. In methanolic BGEs, mobilities of boron cluster anions depend on both ionic constituents of the BGE buffer. This dependence can be explained by ion pair interaction of detected anions with BGE cations, which are not bonded into ion pairs with the BGE anions. The former ion pair interaction decreases sensitivity of the indirect photometric detection. Copyright © 2014 Elsevier B.V. All rights reserved.
Diepoxybutane Interstrand Cross-Links Induce DNA Bending
Millard, Julie T.; McGowan, Erin E.; Bradley, Sharonda Q.
2011-01-01
The bifunctional alkylating agent 1,2,3,4-diepoxybutane (DEB) is thought to be a major contributor to the carcinogenicity of 1,3-butadiene, from which it is derived in vivo. DEB forms DNA interstrand cross-links primarily between distal deoxyguanosine residues at the duplex sequence 5’-GNC. In order for the short butanediol tether to span this distance, distortion of the DNA target has been postulated. We determined that the electrophoretic mobility of ligated DNA oligomers containing DEB cross-links was retarded in comparison with control, uncross-linked DNA. Our data are consistent with DNA bending of ~34° per lesion towards the major groove. PMID:21839139
Control of electroosmosis in coated quartz capillaries
NASA Technical Reports Server (NTRS)
Herren, Blair J.; Van Alstine, James; Snyder, Robert S.; Shafer, Steven G.; Harris, J. Milton
1987-01-01
The effectiveness of various coatings for controlling the electroosmotic fluid flow that hinders electrophoretic processes is studied using analytical particle microelectrophoresis. The mobilities of 2-micron diameter glass and polystyrene latex spheres (exhibiting both negative and zero effective surface charge) were measured in 2-mm diameter quartz capillaries filled with NaCl solutions within the 3.5-7.8 pH range. It is found that capillary inner surface coatings using 5000 molecular weight (or higher) poly(ethylene glycol): significantly reduced electroosmosis within the selected pH range, were stable for long time periods, and appeared to be more effective than dextran, methylcellulose, or silane coatings.
Dual-opposite injection capillary electrophoresis: Principles and misconceptions.
Blackney, Donna M; Foley, Joe P
2017-03-01
Dual-opposite injection capillary electrophoresis (DOI-CE) is a separation technique that utilizes both ends of the capillary for sample introduction. The electroosmotic flow (EOF) is suppressed to allow all ions to reach the detector quickly. Depending on the individual electrophoretic mobilities of the analytes of interest and the effective length that each analyte travels to the detection window, the elution order of analytes in a DOI-CE separation can vary widely. This review discusses the principles, applications, and limitations of dual-opposite injection capillary electrophoresis. Common misconceptions regarding DOI-CE are clarified. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Wang, Hanyang; Slater, Gary; Haan, Hendrick
We examine the electrophoresis of spherical particles in microfluidic devices made of alternating wells and narrow channels a type of system previously used to separate DNA molecules. Using computer simulations, we first show why it should be possible to separate particles having the same free-solution mobility using these systems in DC fields. Interestingly, in some of the systems we studied, the mobility shows an inversion as the field intensity is increased: while small particles have higher mobilities at low fields, the situation is reversed at high fields with the larger particles then moving faster. The resulting nonlinearity allows us to use asymmetric AC electric fields to build a ratchet in which particles have a net size-dependent velocity in the presence of an unbiased (zero-mean) AC field. Exploiting the inversion mentioned above, we show how to build pulsed field sequences that make particles move against the net field (an example of negative mobility). Finally, we demonstrate that it is possible to use these pulsed fields to make particles of different sizes move in opposite directions even though their charge have the same sign. Potential uses of these idea are discussed. Gary is my supervisor in my Master program.
Leung, Jacqueline M.; Tran, Fanny; Pathak, Ravindra B.; Poupart, Séverine; Heaslip, Aoife T.; Ballif, Bryan A.; Westwood, Nicholas J.; Ward, Gary E.
2014-01-01
Motility of the protozoan parasite Toxoplasma gondii plays an important role in the parasite’s life cycle and virulence within animal and human hosts. Motility is driven by a myosin motor complex that is highly conserved across the Phylum Apicomplexa. Two key components of this complex are the class XIV unconventional myosin, TgMyoA, and its associated light chain, TgMLC1. We previously showed that treatment of parasites with a small-molecule inhibitor of T. gondii invasion and motility, tachypleginA, induces an electrophoretic mobility shift of TgMLC1 that is associated with decreased myosin motor activity. However, the direct target(s) of tachypleginA and the molecular basis of the compound-induced TgMLC1 modification were unknown. We show here by “click” chemistry labelling that TgMLC1 is a direct and covalent target of an alkyne-derivatized analogue of tachypleginA. We also show that this analogue can covalently bind to model thiol substrates. The electrophoretic mobility shift induced by another structural analogue, tachypleginA-2, was associated with the formation of a 225.118 Da adduct on S57 and/or C58, and treatment with deuterated tachypleginA-2 confirmed that the adduct was derived from the compound itself. Recombinant TgMLC1 containing a C58S mutation (but not S57A) was refractory to click labelling and no longer exhibited a mobility shift in response to compound treatment, identifying C58 as the site of compound binding on TgMLC1. Finally, a knock-in parasite line expressing the C58S mutation showed decreased sensitivity to compound treatment in a quantitative 3D motility assay. These data strongly support a model in which tachypleginA and its analogues inhibit the motility of T. gondii by binding directly and covalently to C58 of TgMLC1, thereby causing a decrease in the activity of the parasite’s myosin motor. PMID:24892871
Galson, D L; Tsuchiya, T; Tendler, D S; Huang, L E; Ren, Y; Ogura, T; Bunn, H F
1995-04-01
The erythropoietin (Epo) gene is regulated by hypoxia-inducible cis-acting elements in the promoter and in a 3' enhancer, both of which contain consensus hexanucleotide hormone receptor response elements which are important for function. A group of 11 orphan nuclear receptors, transcribed and translated in vitro, were screened by the electrophoretic mobility shift assay. Of these, hepatic nuclear factor 4 (HNF-4), TR2-11, ROR alpha 1, and EAR3/COUP-TF1 bound specifically to the response elements in the Epo promoter and enhancer and, except for ROR alpha 1, formed DNA-protein complexes that had mobilities similar to those observed in nuclear extracts of the Epo-producing cell line Hep3B. Moreover, both anti-HNF-4 and anti-COUP antibodies were able to supershift complexes in Hep3B nuclear extracts. Like Epo, HNF-4 is expressed in kidney, liver, and Hep3B cells but not in HeLa cells. Transfection of a plasmid expressing HNF-4 into HeLa cells enabled an eightfold increase in the hypoxic induction of a luciferase reporter construct which contains the minimal Epo enhancer and Epo promoter, provided that the nuclear hormone receptor consensus DNA elements in both the promoter and the enhancer were intact. The augmentation by HNF-4 in HeLa cells could be abrogated by cotransfection with HNF-4 delta C, which retains the DNA binding domain of HNF-4 but lacks the C-terminal activation domain. Moreover, the hypoxia-induced expression of the endogenous Epo gene was significantly inhibited in Hep3B cells stably transfected with HNF-4 delta C. On the other hand, cotransfection of EAR3/COUP-TF1 and the Epo reporter either with HNF-4 into HeLa cells or alone into Hep3B cells suppressed the hypoxia induction of the Epo reporter. These electrophoretic mobility shift assay and functional experiments indicate that HNF-4 plays a critical positive role in the tissue-specific and hypoxia-inducible expression of the Epo gene, whereas the COUP family has a negative modulatory role.
Electrophoresis of a polarizable charged colloid with hydrophobic surface: A numerical study
NASA Astrophysics Data System (ADS)
Bhattacharyya, Somnath; Majee, Partha Sarathi
2017-04-01
We consider the electrophoresis of a charged colloid for a generalized situation in which the particle is considered to be polarizable and the surface exhibits hydrophobicity. The dielectric polarization of the particle creates a nonlinear dependence of the electrophoretic velocity on the applied electric field, and the core hydrophobicity amplifies the fluid convection in the Debye layer. Thus, a linear analysis is no longer applicable for this situation. The present analysis is based on the numerical solution of the nonlinear electrokinetic equations based on the Navier-Stokes-Nernst-Planck-Poisson equations coupled with the Laplace equation for the electric field within the dielectric particle. The hydrophobicity of the particle may influence its electric polarization by enhancing the convective transport of ions. The nonlinear effects, such as double-layer polarization and relaxation, are also influenced by the hydrophobicity of the particle surface. The present results compare well for a lower range of the applied electric field and surface charge density with the existing results for a perfectly dielectric particle with a hydrophobic surface based on the first-order perturbation analysis due to Khair and Squires [Phys. Fluids 21, 042001 (2009), 10.1063/1.3116664]. Dielectric polarization creates a reduction in particle electrophoretic velocity, and its impact is strong for a moderate range of Debye length. A quantitative measure of the nonlinear effects is demonstrated by comparing the electrophoretic velocity with an existing linear model.
Size and DNA distributions of electrophoretically separated cultured human kidney cells
NASA Technical Reports Server (NTRS)
Kunze, M. E.; Plank, L. D.; Todd, P. W.
1985-01-01
Electrophoretic purification of purifying cultured cells according to function presumes that the size of cycle phase of a cell is not an overriding determinant of its electrophoretic velocity in an electrophoretic separator. The size distributions and DNA distributions of fractions of cells purified by density gradient electrophoresis were determined. No systematic dependence of electrophoretic migration upward in a density gradient column upon either size or DNA content were found. It was found that human leukemia cell populations, which are more uniform function and found in all phases of the cell cycle during exponential growth, separated on a vertical sensity gradient electrophoresis column according to their size, which is shown to be strictly cell cycle dependent.
Świeca, Michał; Gawlik-Dziki, Urszula; Sęczyk, Łukasz; Dziki, Dariusz; Sikora, Małgorzata
2018-08-30
Interactions of phenolics from green coffee bean flour (GCS) with the matrix of wheat bread have been studied employing direct (electrophoretic and chromatographic techniques) and indirect tests (nutrient digestibility). According to the chromatograms of digests, the antiradical activity of enriched bread was exhibited by free phenolics. An increase the area of chromatograms and some additional peaks observed for enriched bread may confirm some interactions of proteins with phenolics. The electrophoretic profile of these extracts showed that the band corresponding to a protein with molecular mass of 38 kDA had much higher intensity in enriched bread. Electrophoretic analysis of pellets remaining after digestion revealed GCS dose-dependent differences in bands corresponding to proteins with molecular masses of 52 kDa and 23 kDa. The relative digestibility of both starch and proteins was slightly decreased by addition of GCS; however, these changes did not exceed 10%, which justifies the use of this functional material. Copyright © 2018 Elsevier Ltd. All rights reserved.
Electrophoretic fractional elution apparatus employing a rotational seal fraction collector
NASA Technical Reports Server (NTRS)
Bier, M. (Inventor)
1977-01-01
Electrophoretic fractional elution apparatus which has a column with a rotating seal joint is described. A thin jet of eluting buffer is directed across the lumen of the electrophoretic column in a direction perpendicular to that of electrophoretic migration. Either the content of the column is rotated with respect to the stationary jet, or the jet is rotated with respect to the column. The system may employ electrophoresis either in free solution or in packed columns.
González-Ruiz, Víctor; Gagnebin, Yoric; Drouin, Nicolas; Codesido, Santiago; Rudaz, Serge; Schappler, Julie
2018-05-01
The use of capillary electrophoresis coupled to mass spectrometry (CE-MS) in metabolomics remains an oddity compared to the widely adopted use of liquid chromatography. This technique is traditionally regarded as lacking the reproducibility to adequately identify metabolites by their migration times. The major reason is the variability of the velocity of the background electrolyte, mainly coming from shifts in the magnitude of the electroosmotic flow and from the suction caused by electrospray interfaces. The use of the effective electrophoretic mobility is one solution to overcome this issue as it is a characteristic feature of each compound. To date, such an approach has not been applied to metabolomics due to the complexity and size of CE-MS data obtained in such studies. In this paper, ROMANCE (RObust Metabolomic Analysis with Normalized CE) is introduced as a new software for CE-MS-based metabolomics. It allows the automated conversion of batches of CE-MS files with minimal user intervention. ROMANCE converts the x-axis of each MS file from the time into the effective mobility scale and the resulting files are already pseudo-aligned, present normalized peak areas and improved reproducibility, and can eventually follow existing metabolomic workflows. The software was developed in Scala, so it is multi-platform and computationally-efficient. It is available for download under a CC license. In this work, the versatility of ROMANCE was demonstrated by using data obtained in the same and in different laboratories, as well as its application to the analysis of human plasma samples. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Esaka, Yukihiro; Okumura, Noriko; Uno, Bunji; Goto, Masashi
2003-05-01
We have investigated analysis of anion radicals of phenanthrenequinone (PhQ) and anthraquinone (AQ) using acetonitrile-capillary electrophoresis (CE) under anaerobic conditions. PhQ and AQ have relatively high negative reduction potentials meaning that their anion radicals are re-oxidized quite readily by the surrounding O(2) to disappear during analysis and we failed to detect them with our previous system. In this work, we have developed an on-line system combining a unique electrolysis cell for generation of the radicals and a CE unit to keep the analysis system free from external O(2) molecules and to reduce analysis time remarkably. As a result, electrophoretic detection of the anion radicals of PhQ and AQ has been achieved. Furthermore, we have observed hydrogen-bonding interaction between the anion radicals and dimethylurea (DMU) using the present system and have indicated a characteristic interaction of the anion radical of PhQ as an ortho-quinone with DMU.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biery, B.J.; Stein, D.E.; Goodman, S.I.
The structure of the human glutaryl coenzyme A dehydrogenase (GCD) gene was determined to contain 11 exons and to span {approximately}7 kb. Fibroblast DNA from 64 unrelated glutaric academia type I (GA1) patients was screened for mutations by PCR amplification and analysis of SSCP. Fragments with altered electrophoretic mobility were subcloned and sequenced to detect mutations that caused GA1. This report describes the structure of the GCD gene, as well as point mutations and polymorphisms found in 7 of its 11 exons. Several mutations were found in more than one patient, but no one prevalent mutation was detected in themore » general population. As expected from pedigree analysis, a single mutant allele causes GA1 in the Old Order Amish of Lancaster County, Pennsylvania. Several mutations have been expressed in Escherichia coli, and all produce diminished enzyme activity. Reduced activity in GCD encoded by the A421V mutation in the Amish may be due to impaired association of enzyme subunits. 13 refs., 5 figs., 3 tabs.« less
Characterization of monomeric DNA-binding protein Histone H1 in Leishmania braziliensis.
Carmelo, Emma; González, Gloria; Cruz, Teresa; Osuna, Antonio; Hernández, Mariano; Valladares, Basilio
2011-08-01
Histone H1 in Leishmania presents relevant differences compared to higher eukaryote counterparts, such as the lack of a DNA-binding central globular domain. Despite that, it is apparently fully functional since its differential expression levels have been related to changes in chromatin condensation and infectivity, among other features. The localization and the aggregation state of L. braziliensis H1 has been determined by immunolocalization, mass spectrometry, cross-linking and electrophoretic mobility shift assays. Analysis of H1 sequences from the Leishmania Genome Database revealed that our protein is included in a very divergent group of histones H1 that is present only in L. braziliensis. An antibody raised against recombinant L. braziliensis H1 recognized specifically that protein by immunoblot in L. braziliensis extracts, but not in other Leishmania species, a consequence of the sequence divergences observed among Leishmania species. Mass spectrometry analysis and in vitro DNA-binding experiments have also proven that L. braziliensis H1 is monomeric in solution, but oligomerizes upon binding to DNA. Finally, despite the lack of a globular domain, L. braziliensis H1 is able to form complexes with DNA in vitro, with higher affinity for supercoiled compared to linear DNA.
Capillary electrophoretic determination of main components of natural dyes with MS detection.
Surowiec, Izabella; Pawelec, Katarzyna; Rezeli, Melinda; Kilar, Ferenc; Trojanowicz, Marek
2008-07-01
CE with UV-Vis and MS detections was investigated as a technique for detection of main components of selected natural dyes of plant and insect origin. The BGE giving the best separation of the investigated flavonoids and anthraquinoids, suitable for MS detection consisted of 40 mM ammonium acetate solution of pH 9.5 with 40% ACN. LODs obtained with MS detection were even one order of magnitude lower than the ones obtained with UV-Vis detection. Application of MS detection enabled determination of eleven dye compounds from three different chemical groups in 15 min. and proved to be more satisfactory than diode-array detection in the electrophoretic analysis of main classes of natural dyes both in terms of selectivity and sensitivity of analysis.
Problems with multiple use of transfer buffer in protein electrophoretic transfer.
Dorri, Yaser; Kurien, Biji T; Scofield, R Hal
2010-04-01
Two-dimensional gel electrophoresis (2DE) and SDS-PAGE are the two most useful methods in protein separation. Proteins separated by 2DE or SDS-PAGE are usually transferred to membranes using a variety of methods, such as electrophoretic transfer, heat-mediated transfer, or nonelectrophoretic transfer, for specific protein detection and/or analysis. In a recent study, Pettegrew et al. claim to reuse transfer buffer containing methanol for at least five times for transferring proteins from SDS-PAGE to polyvinylidene difluoride. They add 150-200 ml fresh transfer solution each time for extended use as a result of loss of transfer buffer. Finally, they test efficiency of each protein transfer by chemiluminescence detection. Here, we comment on this report, as we believe this method is not accurate and useful for protein analysis, and it can cause background binding as well as inaccurate protein analysis.
Kobrin, Eeva-Gerda; Lees, Heidi; Fomitšenko, Maria; Kubáň, Petr; Kaljurand, Mihkel
2014-04-01
A portable capillary electrophoretic system with contactless conductivity detection was used for fingerprint analysis of postblast explosive residues from commercial organic and improvised inorganic explosives on various surfaces (sand, concrete, metal witness plates). Simple extraction methods were developed for each of the surfaces for subsequent simultaneous capillary electrophoretic analysis of anions and cations. Dual-opposite end injection principle was used for fast (<4 min) separation of 10 common anions and cations from postblast residues using an optimized separation electrolyte composed of 20 mM MES, 20 mM l-histidine, 30 μM CTAB and 2 mM 18-crown-6. The concentrations of all ions obtained from the electropherograms were subjected to principal component analysis to classify the tested explosives on all tested surfaces, resulting in distinct cluster formations that could be used to verify (each) type of the explosive. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zhang, Qianqian; Chen, Xi; Zhu, Zhijia; Zhan, Xueqiang; Wu, Yanfang; Song, Lankun; Kang, Jingwu
2013-02-05
Although low molecular weight heparins (LMWHs) have been used as anticoagulant agents for over 2 decades, their structures have not been fully characterized. In this work, we propose a new strategy for the comprehensive structural analysis of LMWHs based on the combination of ultraperformance size exclusion chromatography/electrospray quadruple time-of-flight-mass spectrometry (UPSEC/Q-TOF-MS) and capillary zone electrophoresis (CZE). More than 70 components, including oligosaccharides with special structures such as 1,6-anhydro rings, saturated uronic acid at the nonreducing end and odd-numbered saccharides units were identified with UPSEC/Q-TOF-MS. Furthermore, a more detailed compositional analysis was accomplished by CZE analysis. PEG10000 and MgCl(2) were added to the background electrolyte to separate those saccharides with the nearly same charge-to-mass ratio. Baseline separation and quantification of all the building blocks of the most complex LMWH, namely, enoxaparin, which include 10 disaccharides, 1 trisaccharide, 2 tetrasaccharides, and, of particular importance, 4 1,6-anhyro derivatives, was achieved using CZE for the first time. Additionally, the peaks of oligosaccharides, in the absence of commercially available standards, were assigned on the basis of the linear correlation between the electrophoretic mobilities of oligosaccharides and their charge-to-mass ratios. These two approaches are simple and robust for structural analysis of LMWHs.
Influence of the LILRA3 Deletion on Multiple Sclerosis Risk: Original Data and Meta-Analysis
Ortiz, Miguel A.; Núñez, Concepción; Ordóñez, David; Alvarez-Cermeño, José C.; Martínez-Rodriguez, José E.; Sánchez, Antonio J.; Arroyo, Rafael; Izquierdo, Guillermo; Malhotra, Sunny; Montalban, Xavier; García-Merino, Antonio; Munteis, Elvira; Alcina, Antonio; Comabella, Manuel; Matesanz, Fuencisla
2015-01-01
Background Multiple sclerosis (MS) is a neurodegenerative, autoimmune disease of the central nervous system. Genome-wide association studies (GWAS) have identified over hundred polymorphisms with modest individual effects in MS susceptibility and they have confirmed the main individual effect of the Major Histocompatibility Complex. Additional risk loci with immunologically relevant genes were found significantly overrepresented. Nonetheless, it is accepted that most of the genetic architecture underlying susceptibility to the disease remains to be defined. Candidate association studies of the leukocyte immunoglobulin-like receptor LILRA3 gene in MS have been repeatedly reported with inconsistent results. Objectives In an attempt to shed some light on these controversial findings, a combined analysis was performed including the previously published datasets and three newly genotyped cohorts. Both wild-type and deleted LILRA3 alleles were discriminated in a single-tube PCR amplification and the resulting products were visualized by their different electrophoretic mobilities. Results and Conclusion Overall, this meta-analysis involved 3200 MS patients and 3069 matched healthy controls and it did not evidence significant association of the LILRA3 deletion [carriers of LILRA3 deletion: p = 0.25, OR (95% CI) = 1.07 (0.95–1.19)], even after stratification by gender and the HLA-DRB1*15:01 risk allele. PMID:26274821
The oculocerebrorenal syndrome gene product is a 105-kD protein localized to the Golgi complex.
Olivos-Glander, I M; Jänne, P A; Nussbaum, R L
1995-01-01
The oculocerebrorenal syndrome of Lowe (OCRL) is a multisystem disorder affecting the lens, kidney, and CNS. The predicted amino acid sequence of the OCRL gene, OCRL-1, was used to develop antibodies against the OCRL-1 protein. Western blot analysis using affinity-purified serum against the amino terminus of the OCRL-1 gene product (ocrl-1) demonstrates a single protein of 105 kD in fibroblasts of a normal individual that is absent in fibroblasts of an OCRL patient who lacks OCRL-1 transcript. A single protein with the same electrophoretic mobility is found by western analysis in various human cultured cell lines, and approximately the same size protein is also found in all mouse tissues tested. Northern analysis of various human and mouse tissues demonstrate that OCRL-1 transcript is expressed in nearly all tissues examined. By immunofluorescence, the ocrl-1 antibody stains a juxtanuclear region in normal fibroblast cells, while no specific staining is evident in the OCRL patient who produces no transcript. Colocalization of the ocrl-1 protein to the Golgi complex was demonstrated using a known monoclonal antibody against a Golgi-specific coat protein, beta-COP (beta coatomer protein). Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:7573041
Henriksson-Peltola, Petri; Sehlén, Wilhelmina; Haggård-Ljungquist, Elisabeth
2007-01-01
Bacteriophages P2, P2 Hy dis and WΦ are very similar but heteroimmune Escherichia coli phages. The structural genes show over 96% identity, but the repressors show between 43 and 63% identities. Furthermore, the operators, which contain two directly repeated sequences, vary in sequence, length, location relative to the promoter and spacing between the direct repeats. We have compared the in vivo effects of the wild type and mutated operators on gene expression with the complexes formed between the repressors and their wild type or mutated operators using electrophoretic mobility shift assay (EMSA), and real-time kinetics of the protein–DNA interactions using surface plasmon resonance (SPR) analysis. Using EMSA, the repressors formed different protein–DNA complexes, and only WΦ was significantly affected by point mutations. However, SPR analysis showed a reduced association rate constant and an increased dissociation rate constant for P2 and WΦ operator mutants. The association rate constants of P2 Hy dis was too fast to be determined. The P2 Hy dis dissociation response curves were shown to be triphasic, while both P2 and WΦ C were biphasic. Thus, the kinetics of complex formation and the nature of the complexes formed differ extensively between these very closely related phages. PMID:17412705
NASA Astrophysics Data System (ADS)
Sun, Yi; Chian Kwok, Yien; Nguyen, Nam-Trung
2006-08-01
A new method for thermally bonding poly(methyl methacrylate) (PMMA) substrates has been demonstrated. PMMA substrates are first engraved by CO2-laser micromachining to form microchannels. Both channel width and depth can be adjusted by varying the laser power and scanning speed. Channel depths from 50 µm to 1500 µm and widths from 150 µm to 400 µm are attained. CO2 laser is also used for drilling and dicing of the PMMA parts. Considering the thermal properties of PMMA, a novel thermal bonding process with high temperature and low bonding pressure has been developed for assembling PMMA sheets. A high bonding strength of 2.15 MPa is achieved. Subsequent inspection of the cross sections of several microdevices reveals that the dimensions of the channels are well preserved during the bonding process. Electroosmotic mobility of the ablated channel is measured to be 2.47 × 10-4 cm2 V-1 s-1. The functionality of these thermally bonded microfluidic substrates is demonstrated by performing rapid and high-resolution electrophoretic separations of mixture of fluorescein and carboxyfluorescein as well as double-stranded DNA ladders (ΦX174-Hae III dsDNA digest). The performance of the CO2 laser ablated and thermally bonded PMMA devices compares favorably with those fabricated by other professional means.
Marín-Yaseli, Margarita R; Cid, Cristina; Yagüe, Ana I; Ruiz-Bermejo, Marta
2017-02-01
Elucidating the origin of life involves synthetic as well as analytical challenges. Herein, for the first time, we describe the use of gel electrophoresis and ultrafiltration to fractionate HCN polymers. Since the first prebiotic synthesis of adenine by Oró, HCN polymers have gained much interest in studies on the origins of life due to the identification of biomonomers and related compounds within them. Here, we demonstrate that macromolecular fractions with electrophoretic mobility can also be detected within HCN polymers. The migration of polymers under the influence of an electric field depends not only on their sizes (one-dimensional electrophoresis) but also their different isoelectric points (two-dimensional electrophoresis, 2-DE). The same behaviour was observed for several macromolecular fractions detected in HCN polymers. Macromolecular fractions with apparent molecular weights as high as 250 kDa were detected by tricine-SDS gel electrophoresis. Cationic macromolecular fractions with apparent molecular weights as high as 140 kDa were also detected by 2-DE. The HCN polymers synthesized were fractionated by ultrafiltration. As a result, the molecular weight distributions of the macromolecular fractions detected in the HCN polymers directly depended on the synthetic conditions used to produce these polymers. The implications of these results for prebiotic chemistry will be discussed. © 2017 Wiley-VHCA AG, Zurich, Switzerland.
SDS-PAGE Electrophoretic Property of Human Chorionic Gonadotropin (hCG) and its β-subunit
2005-01-01
The microheterogeneity property of hCG with regards to its sialic acid contents resulted in variable mobility of the glycoprotein in SDS-PAGE. The intact hCG molecule is composed of two dissimilar subunits, namely α- and β-subunits. The identification of hCG bands in SDS-PAGE was accomplished by the immunoblotting experiment, whereby the antibody directed toward the specific region of β-subunit of hCG was used. The data shows that the different mobility of intact hCG was attributed to the different degree of desialylation of the glycoprotein. Nevertheless, unlike the intact hCG, the mobility of its β-subunit was not affected by its variety sialic acid content. This characteristic of β-hCG is beneficial when semi-quantification of total hCG is required. Quantification of hCG using the HPLC-reversed phase C18 analytical column is not possible as the glycoprotein was eluted in multiple fractions at different retention times. The identification of denatured hCG (HPLC eluted fractions) was carried out by immunoblotting experiment whilst immunoassay technique failed to detect its presence in any fraction. PMID:16094462
Seed protein variations of Salicornia L. and allied taxa in Turkey.
Yaprak, A E; Yurdakulol, E
2007-06-01
Electrophoretic seed protein patterns of a number of accessions of Salicornia europaea L. sl., S. prostrata Palas, S. fragilis P.W. Ball and Tutin, Sarcocornia fruticosa (L.) A. J. Scott, Sarcocornia perennis (Miller.) A. J. Scott, Arthrocnemum glaucum (Del.) Ung.-Sternb., Microcnemum coralloides (Loscos and Pardo) subsp. anatolicum Wagenitz and Halocnemum strobilaceum (Pall.) Bieb. were electrophoretically analysed on SDS-PAGE. In total 48 different bands were identified. The obtained data have been treated numerically using the cluster analysis method of unweighted pair group (UPGMA). Finally it was determined that all species separated according to seed protein profiles. And the cladogram obtained studied taxa have been given.
Parodi, Monica; Pedrazzi, Marco; Cantoni, Claudia; Averna, Monica; Patrone, Mauro; Cavaletto, Maria; Spertino, Stefano; Pende, Daniela; Balsamo, Mirna; Pietra, Gabriella; Sivori, Simona; Carlomagno, Simona; Mingari, Maria Cristina; Moretta, Lorenzo; Sparatore, Bianca; Vitale, Massimo
2015-01-01
In this study we characterize a new mechanism by which Natural Killer (NK) cells may amplify their recruitment to tumors. We show that NK cells, upon interaction with melanoma cells, can release a chemotactic form of High Mobility Group Box-1 (HMGB1) protein capable of attracting additional activated NK cells. We first demonstrate that the engagement of different activating NK cell receptors, including those mainly involved in tumor cell recognition can induce the active release of HMGB1. Then we show that during NK-mediated tumor cell killing two HMGB1 forms are released, each displaying a specific electrophoretic mobility possibly corresponding to a different redox status. By the comparison of normal and perforin-defective NK cells (which are unable to kill target cells) we demonstrate that, in NK/melanoma cell co-cultures, NK cells specifically release an HMGB1 form that acts as chemoattractant, while dying tumor cells passively release a non-chemotactic HMGB1. Finally, we show that Receptor for Advanced Glycation End products is expressed by NK cells and mediates HMGB1-induced NK cell chemotaxis. Proteomic analysis of NK cells exposed to recombinant HMGB1 revealed that this molecule, besides inducing immediate chemotaxis, also promotes changes in the expression of proteins involved in the regulation of the cytoskeletal network. Importantly, these modifications could be associated with an increased motility of NK cells. Thus, our findings allow the definition of a previously unidentified mechanism used by NK cells to amplify their response to tumors, and provide additional clues for the emerging role of HMGB1 in immunomodulation and tumor immunity. PMID:26587323
Arlian, L G; Vyszenski-Moher, D L; Merski, J A; Ritz, H L; Nusair, T L; Wilson, E R
1990-01-01
Alcalase and savinase, produced by Bacillus species, are proteolytic enzymes that are used in laundry products and are known to cause respiratory allergy. Antigenic and allergenic characteristics of alcalase and savinase and their potential cross-reactivity were evaluated using crossed immunoelectrophoresis and crossed radioimmunoelectrophoresis. Alcalase exhibited two distinct antigens; one electropositive and one electronegative. The electropositive antigen exhibited some retrograde anodic mobility when coupled with antiserum components. Savinase exhibited one electropositive and two electronegative antigens. The antigens of the two enzymes were clearly different from each other, the three savinase antigens exhibiting greater electrophoretic mobility than the two alcalase antigens. In crossed radioimmunoelectrophoresis studies, only the electropositive antigen of alcalase, its retrograde complex, and the electropositive antigen of savinase bound IgE from the sera of individuals who were skin test positive to one or both enzymes. No evidence of cross-reactivity was observed in heterologous and tandem crossed immunoelectrophoresis studies and heterologous microimmunodiffusion reactions.
A Sinusoidal Applied Electric Potential can Induce a Long-Range, Steady Electrophoretic Force
NASA Astrophysics Data System (ADS)
Amrei, Seyyed Hashemi; Ristenpart, William D.; Miller, Greg R.
2017-11-01
We use the standard electrokinetic model to numerically investigate the electric field in aqueous solutions between parallel electrodes under AC polarization. In contrast to prior work, we invoke no simplifying assumptions regarding the applied voltage, frequency, or mismatch in ionic mobilities. We find that the nonlinear electromigration terms significantly contribute to the overall shape of the electric potential vs. time, which at sufficiently high applied potentials develops multi-modal peaks. More surprisingly, we find that electrolytes with non-equal mobilities yield an electric field with non-zero time average at large distances from the electrodes. Our calculations indicate this long-range electric field suffices to levitate colloidal particles many microns away from the electrode against the gravitational field, in accord with experimental observations of such behavior (Woehl et al., PRX, 2015). Moreover, the results indicate that particles will aggregate laterally near electrodes in some electrolytes but separate in others, helping explain a longstanding but not well understood phenomenon.
Environmental Degradation of Materials: Surface Chemistry Related to Stress Corrosion Cracking
NASA Technical Reports Server (NTRS)
Schwarz, J. A.
1985-01-01
Parallel experiments have been performed in order to develop a comprehensive model for stress cracking (SCC) in structural materials. The central objective is to determine the relationship between the activity and selectivity of the microstructure of structural materials to their dissolution kinetics and experimentally measured SCC kinetics. Zinc was chosen as a prototype metal system. The SCC behavior of two oriented single-crystal disks of zinc in a chromic oxide/sodium sulfate solution (Palmerton solution) were determined. It was found that: (1) the dissolution rate is strongly (hkil)-dependent and proportional to the exposure time in the aggressive environment; and (2) a specific slip system is selectively active to dissolution under applied stress and this slip line controls crack initiation and propagation. As a precursor to potential microgrvity experiments, electrophoretic mobility measurements of zinc particles were obtained in solutions of sodium sulfate (0.0033 M) with concentrations of dissolved oxygen from 2 to 8 ppm. The equilibrium distribution of exposed oriented planes as well as their correlation will determine the particle mobility.
Effect of Coexisting Ions on Adsorption of Arsenic by Metal Oxides
NASA Astrophysics Data System (ADS)
Meng, Xiaoguang; Shi, Qiantao; Christodoulatos, Christos
2017-04-01
Iron hydroxides and nano TiO2 are commonly used adsorbents for removal of arsenic in water. Iron hydroxides also play an important role in controlling the fate and transport of arsenic in groundwater. Co-existing anions, such as phosphate, silicate, and bicarbonate could significantly affect the adsorption capacity of the adsorbents for arsenate and arsenite and increase their mobility in groundwater aquifers. Arsenate and arsenite interactions at the solid-water interface were investigated using electrophoretic mobility (EM) measurements, Fourier transform infrared (FTIR) spectroscopy, and extended X-ray absorption fine structure (EXAFS) spectroscopy. Electrochemical scanning tunneling microscopy (ECSTM) and in-situ flow cell ATR-FTIR were applied to investigate the interactions between As(III), As(V) and carbonate in water and at the solid-water interface. The experimental results suggested that arsenate and arsenite formed inner-sphere complexes with the hydroxide groups on the adsorbents. Arsenite and carbonate could form ternary surface complexes with the hydroxyl groups on iron hydroxide.
Fractionation of mineral species by electrophoresis
NASA Technical Reports Server (NTRS)
Dunning, J. D.; Herren, B. J.; Tipps, R. W.; Snyder, R. S.
1982-01-01
The fractionation of fine-grained aggregates into their major components is a problem in many scientific areas including earth and planetary science. Electrophoresis, the transport of electrically charged particles, immersed in a suspension medium, by a direct current field (Bier, 1959), was employed in this study as a means of separating simulated lunar soil into its constituent minerals. In these tests, conducted in a static analytical cylindrical microelectrophoresis apparatus, samples of simulated lunar soil and samples of pure mineral constituents were placed in the chamber; the electrophoretic mobilities of the lunar soil and the individual mineral constituents were measured. In most of the suspension buffers employed separability was indicated, on the basis of differences in mobility, for all the constituent mineral species except ilmenite and pyroxene, which were not efficiently separable in any of the buffers. Although only a few suspension media were employed, the success of this initial study suggests that electrophoresis may be an important mineral fractionation option in fine-grained aggregate processing.
Design and preparation of beta-sheet forming repetitive and block-copolymerized polypeptides.
Higashiya, Seiichiro; Topilina, Natalya I; Ngo, Silvana C; Zagorevskii, Dmitri; Welch, John T
2007-05-01
The design and rapid construction of libraries of genes coding beta-sheet forming repetitive and block-copolymerized polypeptides bearing various C- and N-terminal sequences are described. The design was based on the assembly of DNA cassettes coding for the (GA)3GX amino acid sequence where the (GAGAGA) sequences would constitute the beta-strand units of a larger beta-sheet assembly. The edges of this beta-sheet would be functionalized by the turn-inducing amino acids (GX). The polypeptides were expressed in Escherichia coli using conventional vectors and were purified by Ni-nitriloacetic acid (NTA) chromatography. The correlation of polymer structure with molecular weight was investigated by gel electrophoresis and mass spectrometry. The monomer sequences and post-translational chemical modifications were found to influence the mobility of the polypeptides over the full range of polypeptide molecular weights while the electrophoretic mobility of lower molecular weight polypeptides was more susceptible to C- and N-termini polypeptide modifications.
Electrophoretic Deposition of Hydroxyapatite Film Containing Re-Doped MoS₂ Nanoparticles.
Shalom, Hila; Feldman, Yishay; Rosentsveig, Rita; Pinkas, Iddo; Kaplan-Ashiri, Ifat; Moshkovich, Alexey; Perfilyev, Vladislav; Rapoport, Lev; Tenne, Reshef
2018-02-26
Films combining hydroxyapatite (HA) with minute amounts (ca. 1 weight %) of (rhenium doped) fullerene-like MoS₂ (IF) nanoparticles were deposited onto porous titanium substrate through electrophoretic process (EPD). The films were analyzed by scanning electron microscopy (SEM), X-ray diffraction and Raman spectroscopy. The SEM analysis showed relatively uniform coatings of the HA + IF on the titanium substrate. Chemical composition analysis using energy dispersive X-ray spectroscopy (EDS) of the coatings revealed the presence of calcium phosphate minerals like hydroxyapatite, as a majority phase. Tribological tests were undertaken showing that the IF nanoparticles endow the HA film very low friction and wear characteristics. Such films could be of interest for various medical technologies. Means for improving the adhesion of the film to the underlying substrate and its fracture toughness, without compromising its biocompatibility are discussed at the end.
NASA Astrophysics Data System (ADS)
Li, Ming; Liu, Qian; Jia, Zhaojun; Xu, Xuchen; Shi, Yuying; Cheng, Yan; Zheng, Yufeng; Xi, Tingfei; Wei, Shicheng
2013-11-01
Novel ternary graphene oxide-hyaluronic acid-hydroxyapatite (GO-HY-HA) nanocomposite coatings were prepared on Ti substrate using anodic electrophoretic deposition (EPD). Hyaluronic acid was employed as charging additive and dispersion agent during EPD. The kinetics and mechanism of the deposition, and the microstructure of the coated samples were investigated using scanning electron microscopy, X-ray diffraction, Raman spectrum, thermo-gravimetric analysis, and microscopic Fourier transform infrared analysis. The results showed that the addition of GO sheets into the HY-HA suspensions could increase the deposition rate and inhibit cracks creation and propagation in the coatings. The corrosion resistant of the resulting samples were evaluated using potentiodynamic polarization method in simulated body fluid, and the GO-HY-HA coatings could effectively improve the anti-corrosion property of the Ti substrate.
Modeling Electrokinetic Flows by the Smoothed Profile Method
Luo, Xian; Beskok, Ali; Karniadakis, George Em
2010-01-01
We propose an efficient modeling method for electrokinetic flows based on the Smoothed Profile Method (SPM) [1–4] and spectral element discretizations. The new method allows for arbitrary differences in the electrical conductivities between the charged surfaces and the the surrounding electrolyte solution. The electrokinetic forces are included into the flow equations so that the Poisson-Boltzmann and electric charge continuity equations are cast into forms suitable for SPM. The method is validated by benchmark problems of electroosmotic flow in straight channels and electrophoresis of charged cylinders. We also present simulation results of electrophoresis of charged microtubules, and show that the simulated electrophoretic mobility and anisotropy agree with the experimental values. PMID:20352076
Precursor–product relationship between intrahepatic albumin and plasma albumin
LeBouton, A. V.
1968-01-01
Rats were injected with [3H]leucine, and at various times thereafter labelled albumin was isolated by electrophoresis from their livers and blood plasma. The specific radioactivity of each protein was determined by spectrophotometry and liquid-scintillation spectrometry. Intrahepatic albumin was shown to be identical with plasma albumin by its electrophoretic mobility and antigenicity. It was found that intrahepatic albumin was the direct precursor of plasma albumin. Comparison of their specific radioactivities showed that intrahepatic albumin attained a higher specific radioactivity before plasma albumin. When plasma albumin reached its maximum specific radioactivity, that of intrahepatic albumin had decreased to a similar value. Thereafter, the specific radioactivity of intrahepatic albumin remained lower than that of plasma albumin. PMID:4966084
Microelectrophoretic study of calcium oxalate monohydrate in macromolecular solutions
NASA Technical Reports Server (NTRS)
Curreri, P. A.; Onoda, G. Y., Jr.; Finlayson, B.
1987-01-01
Electrophoretic mobilities were measured for calcium oxalate monohydrate (COM) in solutions containing macromolecules. Two mucopolysaccharides (sodium heparin and chondroitin sulfate) and two proteins (positively charged lysozyme and negatively charged bovine serum albumin) were studied as adsorbates. The effects of pH, calcium oxalate surface charge (varied by calcium or oxalate ion activity), and citrate concentration were investigated. All four macromolecules showed evidence for adsorption. The macromolecule concentrations needed for reversing the surface charge indicated that the mucopolysaccharides have greater affinity for the COM surface than the proteins. Citrate ions at high concentrations appear to compete effectively with the negative protein for surface sites but show no evidence for competing with the positively charged protein.
NASA Technical Reports Server (NTRS)
Todd, P. W.; Hjerten, S.
1985-01-01
Experiments were designed to replicate, as closely as possible in 1-G, the conditions of the STS-3 red blood cell (RBC) experiments. Free zone electrophoresis was the method of choice, since it minimizes the role of gravity in cell migration. The physical conditions of the STS-3 experiments were used, and human and rabbit RBC's fixed by the same method were the test particles. The effects of cell concentration, electroosmotic mobility, and sample composition were tested in order to seek explanations for the STS-3 results and to provide data on cell concentration effects for future zero-G separation on the continuous-flow zero-G electrophoretics separator.
NASA Astrophysics Data System (ADS)
Chiesl, T. N.; Benhabib, M.; Stockton, A. M.; Mathies, R. A.
2010-04-01
We present the Multichannel Mars Organic Analyzer (McMOA) for the analysis of Amino Acids, PAHs, and Oxidized Carbon. Microfluidic architecures integrating automated metering, mixing, on chip reactions, and serial dilutions are also discussed.
Electrophoretic separator for purifying biologicals, part 1
NASA Technical Reports Server (NTRS)
Mccreight, L. R.
1978-01-01
A program to develop an engineering model of an electrophoretic separator for purifying biologicals is summarized. An extensive mathematical modeling study and numerous ground based tests were included. Focus was placed on developing an actual electrophoretic separator of the continuous flow type, configured and suitable for flight testing as a space processing applications rocket payload.
Interactions between the nuclear matrix and an enhancer of the tryptophan oxygenase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kaneoka, Hidenori; Miyake, Katsuhide, E-mail: miyake@nubio.nagoya-u.ac.jp; Iijima, Shinji
2009-10-02
The gene for tryptophan oxygenase (TO) is expressed in adult hepatocytes in a tissue- and differentiation-specific manner. The TO promoter has two glucocorticoid-responsive elements (GREs), and its expression is regulated by glucocorticoid hormone in the liver. We found a novel GRE in close proximity to a scaffold/matrix attachment region (S/MAR) that was located around -8.5 kb from the transcriptional start site of the TO gene by electrophoretic mobility shift and chromatin immunoprecipitation (ChIP) assays. A combination of nuclear fractionation and quantitative PCR analysis showed that the S/MAR was tethered to the nuclear matrix in both fetal and adult hepatocytes. ChIPmore » assay showed that, in adult hepatocytes, the S/MAR-GRE and the promoter proximal regions interacted with lamin and heterogeneous nuclear ribonucleoprotein U in a dexamethasone dependent manner, but this was not the case in fetal cells, suggesting that developmental stage-specific expression of the TO gene might rely on the binding of the enhancer (the -8.5 kb S/MAR-GRE) and the promoter to the inner nuclear matrix.« less
Affinity Pulldown of Biotinylated RNA for Detection of Protein-RNA Complexes.
Panda, Amaresh C; Martindale, Jennifer L; Gorospe, Myriam
2016-12-20
RNA-binding proteins (RBPs) have recently emerged as crucial players in the regulation of gene expression. The interactions of RBPs with target mRNAs control the levels of gene products by altering different regulatory steps, including pre-mRNA splicing and maturation, nuclear mRNA export, and mRNA stability and translation (Glisovic et al. , 2008). There are several methodologies available today to identify RNAs bound to specific RBPs; some detect only recombinant molecules in vitro , others detect recombinant and endogenous molecules, while others detect only endogenous molecules. Examples include systematic evolution of ligands by exponential enrichment (SELEX), biotinylated RNA pulldown assay, RNA immunoprecipitation (RIP) assay, electrophoretic mobility shift assay (EMSA), RNA footprinting analysis, and various UV crosslinking and immunoprecipitation (CLIP) methods such as CLIP, PAR-CLIP, and iCLIP (Popova et al. , 2015). Here, we describe a simple and informative method to study and identify the RNA region of interaction between an RBP and its target transcript (Panda et al. , 2014 and 2016). Its reproducibility and ease of use make this protocol a fast and useful method to identify interactions between RBPs and specific RNAs.
NF-kappaB mediates FGF signal regulation of msx-1 expression.
Bushdid, P B; Chen, C L; Brantley, D M; Yull, F; Raghow, R; Kerr, L D; Barnett, J V
2001-09-01
The nuclear factor-kappaB (NF-kappaB) family of transcription factors is involved in proliferation, differentiation, and apoptosis in a stage- and cell-dependent manner. Recent evidence has shown that NF-kappaB activity is necessary for both chicken and mouse limb development. We report here that the NF-kappaB family member c-rel and the homeodomain gene msx-1 have partially overlapping expression patterns in the developing chick limb. In addition, inhibition of NF-kappaB activity resulted in a decrease in msx-1 mRNA expression. Sequence analysis of the msx-1 promoter revealed three potential kappaB-binding sites similar to the interferon-gamma (IFN-gamma) kappaB-binding site. These sites bound to c-Rel, as shown by electrophoretic mobility shift assay (EMSA). Furthermore, inhibition of NF-kappaB activity significantly reduced transactivation of the msx-1 promoter in response to FGF-2/-4, known stimulators of msx-1 expression. These results suggest that NF-kappaB mediates the FGF-2/-4 signal regulation of msx-1 gene expression. Copyright 2001 Academic Press.
Bisphenol A induces corticotropin-releasing hormone expression in the placental cells JEG-3.
Huang, Hui; Tan, Wenjuan; Wang, C C; Leung, Lai K
2012-11-01
Bisphenol A is utilized to make polycarbonate plastics and is an environmental pollutant. Recent research has indicated that it is an endocrine disruptor and may interfere with reproduction. Placental corticotrophin-releasing hormone (CRH) is a peptide hormone which is involved in fetal development. Increased plasma CRH is associated with elevated risk of premature delivery. In the present study, we demonstrated that bisphenol A increased CRH mRNA expression in the placental JEG-3 cells at or above 25μM. Reporter gene assay also demonstrated that bisphenol A could induce CRH gene transactivity. Since cyclic AMP response element (CRE) is a major regulatory element located in CRH promoter, the sequence-specific binding activity was investigated by using electrophoretic mobility shift assay. Our data indicated that bisphenol A increased the CRE binding activity. Western analysis further illustrated that PKA could be the signal triggering the CRE binding and CRH gene transactivation. In summary, the present study demonstrated that bisphenol A could induce CRH expression in placental cells and the underlying signal transduction pathway was also described. Copyright © 2012 Elsevier Inc. All rights reserved.
Crystal Structure of the GRAS Domain of SCARECROW-LIKE7 in Oryza sativa
Li, Shengping; Zhao, Yanhe; Zhao, Zheng; Wu, Xiuling; Sun, Lifang; Liu, Qingsong; Wu, Yunkun
2016-01-01
GRAS proteins belong to a plant-specific protein family with many members and play essential roles in plant growth and development, functioning primarily in transcriptional regulation. Proteins in the family are minimally defined as containing the conserved GRAS domain. Here, we determined the structure of the GRAS domain of Os-SCL7 from rice (Oryza sativa) to 1.82 Å. The structure includes cap and core subdomains and elucidates the features of the conserved GRAS LRI, VHIID, LRII, PFYRE, and SAW motifs. The structure is a dimer, with a clear groove to accommodate double-stranded DNA. Docking a DNA segment into the groove to generate an Os-SCL7/DNA complex provides insight into the DNA binding mechanism of GRAS proteins. Furthermore, the in vitro DNA binding property of Os-SCL7 and model-defined recognition residues are assessed by electrophoretic mobility shift analysis and mutagenesis assays. These studies reveal the structure and preliminary DNA interaction mechanisms of GRAS proteins and open the door to in-depth investigation and understanding of the individual pathways in which they play important roles. PMID:27081181
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Ho, Yu-Hsuan; Sung, Tzu-Cheng; Chen, Chien-Sheng
2012-01-01
Natural antimicrobial peptides provide fundamental protection for multicellular organisms from microbes, such as Lactoferricin B (Lfcin B). Many studies have shown that Lfcin B penetrates the cell membrane and has intracellular activities. To elucidate the intracellular behavior of Lfcin B, we first used Escherichia coli K12 proteome chips to identify the intracellular targets of Lfcin B. The results showed that Lfcin B binds to two response regulators, BasR and CreB, of the two-component system. For further analysis, we conducted several in vitro and in vivo experiments and utilized bioinformatics methods. The electrophoretic mobility shift assays and kinase assays indicate that Lfcin B inhibits the phosphorylation of the response regulators (BasR and CreB) and their cognate sensor kinases (BasS and CreC). Antibacterial assays showed that Lfcin B reduced E. coli's tolerance to environmental stimuli, such as excessive ferric ions and minimal medium conditions. This is the first study to show that an antimicrobial peptide inhibits the growth of bacteria by influencing the phosphorylation of a two-component system directly. PMID:22138548
Ho, Yu-Hsuan; Sung, Tzu-Cheng; Chen, Chien-Sheng
2012-04-01
Natural antimicrobial peptides provide fundamental protection for multicellular organisms from microbes, such as Lactoferricin B (Lfcin B). Many studies have shown that Lfcin B penetrates the cell membrane and has intracellular activities. To elucidate the intracellular behavior of Lfcin B, we first used Escherichia coli K12 proteome chips to identify the intracellular targets of Lfcin B. The results showed that Lfcin B binds to two response regulators, BasR and CreB, of the two-component system. For further analysis, we conducted several in vitro and in vivo experiments and utilized bioinformatics methods. The electrophoretic mobility shift assays and kinase assays indicate that Lfcin B inhibits the phosphorylation of the response regulators (BasR and CreB) and their cognate sensor kinases (BasS and CreC). Antibacterial assays showed that Lfcin B reduced E. coli's tolerance to environmental stimuli, such as excessive ferric ions and minimal medium conditions. This is the first study to show that an antimicrobial peptide inhibits the growth of bacteria by influencing the phosphorylation of a two-component system directly.
Tilted hexagonal post arrays: DNA electrophoresis in anisotropic media
Chen, Zhen; Dorfman, Kevin D.
2013-01-01
Using Brownian dynamics simulations, we show that DNA electrophoresis in a hexagonal array of micron-sized posts changes qualitatively when the applied electric field vector is not coincident with the lattice vectors of the array. DNA electrophoresis in such “tilted” post arrays is superior to the standard “un-tilted” approach; while the time required to achieve a resolution of unity in a tilted post array is similar to an un-tilted array at a low electric field strengths, this time (i) decreases exponentially with electric field strength in a tilted array and (ii) increases exponentially with electric field strength in an un-tilted array. Although the DNA dynamics in a post array are complicated, the electrophoretic mobility results indicate that the “free path”, i.e., the average distance of ballistic trajectories of point sized particles launched from random positions in the unit cell until they intersect the next post, is a useful proxy for the detailed DNA trajectories. The analysis of the free path reveals a fundamental connection between anisotropy of the medium and DNA transport therein that goes beyond simply improving the separation device. PMID:23868490
Matsukuma, Shoichi; Yoshihara, Mitsuyo; Kasai, Fumio; Kato, Akinori; Yoshida, Akira; Akaike, Makoto; Kobayashi, Osamu; Nakayama, Haruhiko; Sakuma, Yuji; Yoshida, Tsutomu; Kameda, Yoichi; Tsuchiya, Eiju; Miyagi, Yohei
2006-01-01
A simple and rapid method to detect the epidermal growth factor receptor hot spot mutation L858R in lung adenocarcinoma was developed based on principles similar to the universal heteroduplex generator technology. A single-stranded oligonucleotide with an internal deletion was used to generate heteroduplexes (loop-hybrids) bearing a loop in the complementary strand derived from the polymerase chain reaction product of the normal or mutant allele. By placing deletion in the oligonucleotide adjacent to the mutational site, difference in electrophoretic mobility between loop-hybrids with normal and mutated DNA was distinguishable in a native polyacrylamide gel. The method was also modified to detect in-frame deletion mutations of epidermal growth factor receptor in lung adenocarcinomas. In addition, the method was adapted to detect hot spot mutations in the B-type Raf kinase (BRAF) at V600 and in a Ras-oncogene (NRAS) at Q61, the mutations commonly found in thyroid carcinomas. Our mutation detection system, designated the loop-hybrid mobility shift assay was sensitive enough to detect mutant DNA comprising 7.5% of the total DNA. As a simple and straightforward mutation detection technique, loop-hybrid mobility shift assay may be useful for the molecular diagnosis of certain types of clinical cancers. Other applications are also discussed. PMID:16931592
NASA Astrophysics Data System (ADS)
Hong, S. H.; Kang, M. G.; Lim, J. H.; Hwang, S. W.
2008-07-01
An ensemble of electrophoretically captured gold nanoparticles is exploited to fingerprint their velocity distribution in solution. The electrophoretic capture is performed using a dc biased nanogap electrode, and panoramic scanning electron microscopic images are inspected to obtain the regional density of the captured gold nanoparticles. The regional density profile along the surface of the electrode is in a quantitative agreement with the calculated density of the captured nanoparticles. The calculated density is obtained by counting, in the Boltzmann distribution, the number of nanoparticles whose thermal velocity is smaller than the electrophoretic velocity.
Cell and Particle Interactions and Aggregation During Electrophoretic Motion
NASA Technical Reports Server (NTRS)
Wang, Hua; Zeng, Shulin; Loewenberg, Michael; Todd, Paul; Davis, Robert H.
1996-01-01
The stability and pairwise aggregation rates of small spherical particles under the collective effects of buoyancy-driven motion and electrophoretic migration are analyzed. The particles are assumed to be non-Brownian, with thin double-layers and different zeta potentials. The particle aggregation rates may be enhanced or reduced, respectively, by parallel and antiparallel alignments of the buoyancy-driven and electrophoretic velocities. For antiparallel alignments, with the buoyancy-driven relative velocity exceeding the electrophoretic relative velocity between two widely-separated particles, there is a 'collision-forbidden region' in parameter space due to hydrodynamic interactions; thus, the suspension becomes stable against aggregation.
Das, Maumita; Dhand, Chetna; Sumana, Gajjala; Srivastava, A K; Nagarajan, R; Nain, Lata; Iwamoto, M; Manaka, Takaaki; Malhotra, B D
2011-03-14
The present work describes electrophoretic fabrication of nanostructured chitosan-zirconium-oxide composite (CHIT-NanoZrO(2)) film (180 nm) onto indium-tin-oxide (ITO)-coated glass plate. This nanobiocomposite film has been explored as immobilization platform for probe DNA specific to M. Tuberculosis as model biomolecule to investigate its sensing characteristics. It is revealed that pH-responsive behavior of CHIT and its cationic skeleton is responsible for the movement of CHIT-NanoZrO(2) colloids toward cathode during electrophoretic deposition. The FT-IR, SEM, TEM, and EDX techniques have been employed for the structural, morphological, and composition analysis of the fabricated electrodes. The morphological studies clearly reveal uniform inter-linking and dispersion of hexagonal nanograins of ZrO(2) (30-50 nm) into the chitosan matrix, resulting in homogeneous nanobiocomposite formation. Electrochemical response measurements of DNA/CHIT-NanoZrO(2)/ITO bioelectrode, carried out using cyclic voltammetry and differential pulse voltammetry, reveal that this bioelectrode can specifically detect complementary target DNA up to 0.00078 μM with sensitivity of 6.38 × 10(-6) AμM(-1).
NASA Technical Reports Server (NTRS)
Knox, R. J.
1978-01-01
Embryonic kidney cells were studied as a follow-up to the MA-011 Electrophoresis Technology Experiment which was conducted during the Apollo Soyuz Test Project (ASTP). The postflight analysis of the performance of the ASTP zone electrophoresis experiment involving embryonic kidney cells is reported. The feasibility of producing standard particles for electrophoresis was also studied. This work was undertaken in response to a need for standardization of methods for producing, calibrating, and storing electrophoretic particle standards which could be employed in performance tests of various types of electrophoresis equipment. Promising procedures were tested for their suitability in the production of standard test particles from red blood cells.
Affinity capillary electrophoresis for studying interactions in life sciences.
Olabi, Mais; Stein, Matthias; Wätzig, Hermann
2018-05-10
Affinity capillary electrophoresis (ACE) analyzes noncovalent interactions between ligands and analytes based on changes in their electrophoretic mobility. This technique has been widely used to investigate various biomolecules, mainly proteins, polysaccharides and hormones. ACE is becoming a technique of choice to validate high throughput screening results, since it is very predictively working in realistic and relevant media, e.g. in body fluids. It is highly recommended to incorporate ACE as a powerful analytical tool to properly prepare animal testing and preclinical studies. The interacting molecules can be found free in solution or can be immobilized to a solid support. Thus, ACE is classified in two modes, free solution ACE and immobilized ACE. Every ACE mode has advantages and disadvantages. Each can be used for a variety of applications. This review covers literature of scopus and SciFinder data base in the period from 2016 until beginning 2018, including the keywords "affinity capillary electrophoresis", "immunoaffinity capillary electrophoresis", "immunoassay capillary electrophoresis" and "immunosorbent capillary electrophoresis". More than 200 articles have been found and 112 have been selected and thoroughly discussed. During this period, the data processing and the underlying calculations in mobility shift ACE (ms ACE), frontal analysis ACE (FA ACE) and plug-plug kinetic capillary electrophoresis (ppKCE) as mostly applied free solution techniques have substantially improved. The range of applications in diverse free solution and immobilized ACE techniques has been considerably broadened. Copyright © 2018. Published by Elsevier Inc.
Rigsby, C M; Showalter, D N; Herms, D A; Koch, J L; Bonello, P; Cipollini, D
2015-07-01
Emerald ash borer, Agrilus planipennis Fairmaire, an Asian wood-boring beetle, has devastated ash (Fraxinus spp.) trees in North American forests and landscapes since its discovery there in 2002. In this study, we collected living larvae from EAB-resistant Manchurian ash (Fraxinus mandschurica), and susceptible white (Fraxinus americana) and green (Fraxinus pennsylvanica) ash hosts, and quantified the activity and production of selected detoxification, digestive, and antioxidant enzymes. We hypothesized that differences in larval physiology could be used to infer resistance mechanisms of ash. We found no differences in cytochrome P450, glutathione-S-transferase, carboxylesterase, sulfotransferase, and tryptic BApNAase activities between larvae feeding on different hosts. Despite this, Manchurian ash-fed larvae produced a single isozyme of low electrophoretic mobility that was not produced in white or green ash-fed larvae. Additionally, larvae feeding on white and green ash produced two serine protease isozymes of high electrophoretic mobility that were not observed in Manchurian ash-fed larvae. We also found lower activity of β-glucosidase and higher activities of monoamine oxidase, ortho-quinone reductase, catalase, superoxide dismutase, and glutathione reductase in Manchurian ash-fed larvae compared to larvae that had fed on susceptible ash. A single isozyme was detected for both catalase and superoxide dismutase in all larval groups. The activities of the quinone-protective and antioxidant enzymes are consistent with the resistance phenotype of the host species, with the highest activities measured in larvae feeding on resistant Manchurian ash. We conclude that larvae feeding on Manchurian ash could be under quinone and oxidative stress, suggesting these may be potential mechanisms of resistance of Manchurian ash to EAB larvae, and that quinone-protective and antioxidant enzymes are important counter-adaptations of larvae for dealing with these resistance mechanisms. Copyright © 2015 Elsevier Ltd. All rights reserved.
Human fibrinogen adsorption on positively charged latex particles.
Zeliszewska, Paulina; Bratek-Skicki, Anna; Adamczyk, Zbigniew; Cieśla, Michał
2014-09-23
Fibrinogen (Fb) adsorption on positively charged latex particles (average diameter of 800 nm) was studied using the microelectrophoretic and the concentration depletion methods based on AFM imaging. Monolayers on latex were adsorbed from diluted bulk solutions at pH 7.4 and an ionic strength in the range of 10(-3) to 0.15 M where fibrinogen molecules exhibited an average negative charge. The electrophoretic mobility of the latex after controlled fibrinogen adsorption was systematically measured. A monotonic decrease in the electrophoretic mobility of fibrinogen-covered latex was observed for all ionic strengths. The results of these experiments were interpreted according to the three-dimensional electrokinetic model. It was also determined using the concentration depletion method that fibrinogen adsorption was irreversible and the maximum coverage was equal to 0.6 mg m(-2) for ionic strength 10(-3) M and 1.3 mg m(-2) for ionic strength 0.15 M. The increase of the maximum coverage was confirmed by theoretical modeling based on the random sequential adsorption approach. Paradoxically, the maximum coverage of fibrinogen on positively charged latex particles was more than two times lower than the maximum coverage obtained for negative latex particles (3.2 mg m(-2)) at pH 7.4 and ionic strength of 0.15 M. This was interpreted as a result of the side-on adsorption of fibrinogen molecules with their negatively charged core attached to the positively charged latex surface. The stability and acid base properties of fibrinogen monolayers on latex were also determined in pH cycling experiments where it was observed that there were no irreversible conformational changes in the fibrinogen monolayers. Additionally, the zeta potential of monolayers was more positive than the zeta potential of fibrinogen in the bulk, which proves a heterogeneous charge distribution. These experimental data reveal a new, side-on adsorption mechanism of fibrinogen on positively charged surfaces and confirmed the decisive role of electrostatic interactions in this process.
Aboobakar, Eanas F.; Wang, Xuying; Heitman, Joseph; Kozubowski, Lukasz
2011-01-01
Calcineurin is a conserved calcium/calmodulin-dependent serine/threonine-specific protein phosphatase that acts in cell stress responses. Calcineurin is essential for growth at 37°C and for virulence of the human fungal pathogen Cryptococcus neoformans, but its substrates remain unknown. The C2 domain-containing, phospholipid-binding protein Cts1 was previously identified as a multicopy suppressor of a calcineurin mutation in C. neoformans. Here we further characterize the function of Cts1 and the links between Cts1 and calcineurin. GFP-Cts1 localizes to cytoplasmic puncta and colocalizes with the endosomal marker FM4-64. The cts1Δ mutant shows a distinct FM4-64 staining pattern, suggesting involvement of Cts1 in endocytic trafficking. In large budded cells, GFP-Cts1 localizes transiently at the mother bud neck, as a single ring that undergoes contraction. mCherry-Cts1 colocalizes with the GFP-tagged calcineurin catalytic subunit Cna1 at sites of mRNA processing at 37°C, suggesting that Cts1 and calcineurin function coordinately during thermal stress. GFP-Cts1 exhibits slower electrophoretic mobility for cells grown at 37°C than for cells grown at 24°C, and the shift to a higher molecular weight is more pronounced in the presence of the calcineurin inhibitor FK506. In vitro treatment with calf intestinal alkaline phosphatase (CIP) restores faster electrophoretic mobility to GFP-Cts1, suggesting that Cts1 is phosphorylated at 37°C and may be dephosphorylated in a calcineurin-dependent manner. mCherry-Cts1 also coimmunoprecipitates with GFP-Cna1, with greater complex formation at 37°C than at 24°C. Taken together, these findings support potential roles for Cts1 in endocytic trafficking, mRNA processing, and cytokinesis and suggest that Cts1 is a substrate of calcineurin during high-temperature stress responses. PMID:22002655
Neel, J V; Satoh, C; Goriki, K; Asakawa, J; Fujita, M; Takahashi, N; Kageoka, T; Hazama, R
1988-01-01
A sample of (1) children whose parents had been proximally exposed (i.e., less than 2,000 m from the hypocenter) at the time of the atomic bombings of Hiroshima and Nagasaki and (2) a suitable comparison group have been examined for the occurrence of mutations altering the electrophoretic mobility or activity of a series of 30 proteins. The examination of the equivalent of 667,404 locus products in the children of proximally exposed persons yielded three mutations altering electrophoretic mobility; the corresponding figure for the comparison group was three mutations in 466,881 tests. The examination of a subset of 60,529 locus products for loss of enzyme activity in the children of proximally exposed persons yielded one mutation; no mutations were encountered in 61,741 determinations on the children of the comparison group. When these two series are compared, the mutation rate observed in the children of proximally exposed persons is thus 0.60 x 10(-5)/locus/generation, with 95% confidence intervals between 0.2 and 1.5 x 10(-5), and that in the comparison children is 0.64 x 10(-5)/locus/generation, with 95% intervals between 0.1 and 1.9 x 10(-5). The average conjoint gonad doses for the proximally exposed parents are estimated to be 0.437 Gy of gamma radiation and 0.002 Gy of neutron radiation. If a relative biological effectiveness of 20 is assigned to the neutron radiation, the combined total gonad dose for the parents becomes 0.477 Sv. (Organ absorbed doses are expressed in gray [1 Gy = 100 rad]; where dose is a mixture of gamma and neutron radiation, it is necessary because of the differing relative biological effectiveness of gamma and neutron radiation to express the combined gamma-neutron gonad exposures in sieverts [1 Sv = 100 rem]). PMID:3358419
ERIC Educational Resources Information Center
Xu, Chunxiu; Lin, Wanqi; Cai, Longfei
2016-01-01
A demonstration is described of electrophoretic separation of carmine and sunset yellow with a paper-based device. The channel in the paper device was fabricated by hand with a wax pen. Electrophoretic separation of carmine and sunset yellow was achieved within a few minutes by applying potential on the channel using a simple and inexpensive power…
Electrophoretic Deposition of Hydroxyapatite Film Containing Re-Doped MoS2 Nanoparticles
Shalom, Hila; Feldman, Yishay; Rosentsveig, Rita; Pinkas, Iddo; Kaplan-Ashiri, Ifat; Moshkovich, Alexey; Perfilyev, Vladislav; Rapoport, Lev
2018-01-01
Films combining hydroxyapatite (HA) with minute amounts (ca. 1 weight %) of (rhenium doped) fullerene-like MoS2 (IF) nanoparticles were deposited onto porous titanium substrate through electrophoretic process (EPD). The films were analyzed by scanning electron microscopy (SEM), X-ray diffraction and Raman spectroscopy. The SEM analysis showed relatively uniform coatings of the HA + IF on the titanium substrate. Chemical composition analysis using energy dispersive X-ray spectroscopy (EDS) of the coatings revealed the presence of calcium phosphate minerals like hydroxyapatite, as a majority phase. Tribological tests were undertaken showing that the IF nanoparticles endow the HA film very low friction and wear characteristics. Such films could be of interest for various medical technologies. Means for improving the adhesion of the film to the underlying substrate and its fracture toughness, without compromising its biocompatibility are discussed at the end. PMID:29495394
Dubey, S; Kalia, Y N
2014-06-10
The original aim of the study was to investigate the transdermal iontophoretic delivery of lysozyme and to gain further insight into the factors controlling protein electrotransport. Initial experiments were done using porcine skin. Lysozyme transport was quantified by using an activity assay based on the lysis of Micrococcus lysodeikticus and was corrected for the release of endogenous enzyme from the skin during current application. Cumulative iontophoretic permeation of lysozyme during 8h at 0.5mA/cm(2) (0.7mM; pH6) was surprisingly low (5.37±3.46μg/cm(2) in 8h) as compared to electrotransport of cytochrome c (Cyt c) and ribonuclease A (RNase A) under similar conditions (923.0±496.1 and 170.71±92.13μg/cm(2), respectively) - despite its having a higher electrophoretic mobility. The focus of the study then became to understand and explain the causes of its poor iontophoretic transport. Lowering formulation pH to 5 increased histidine protonation in the protein and decreased the ionisation of fixed negative charges in the skin (pI ~4.5) and resulted in a small but statistically significant increase in permeation. Co-iontophoresis of acetaminophen revealed a significant inhibition of electroosmosis; inhibition factors of 12-16 were indicative of strong lysozyme binding to skin. Intriguingly, lidocaine electrotransport, which is due almost exclusively to electromigration, was also decreased (approximately 2.7-fold) following skin pre-treatment by lysozyme iontophoresis (cf. iontophoresis of buffer solution) - suggesting that lysozyme was also able to influence subsequent cation electromigration. In order to elucidate the site of skin binding, different porcine skin models were tested (dermatomed skin with thicknesses of 250 and 750μm, tape-stripped skin and heat-separated dermis). Although no difference was seen between permeation across 250 and 750μm dermatomed skin (13.57±12.20 and 5.37±3.46μg/cm(2), respectively), there was a statistically significant increase across tape-stripped skin and heat-separated dermis (36.86±7.48 and 43.42±13.11μg/cm(2), respectively) - although transport was still much less than that seen across intact skin for Cyt c or RNase A. Furthermore, electroosmotic inhibition factors fell to 2.2 and 1.0 for tape-stripped skin and heat-separated dermis - indicating that lysozyme affected convective solvent flow through interactions with the epidermis and predominantly the stratum corneum. Finally, cation exchange and hydrophobic interaction chromatography confirmed that although lysozyme had greater positive charge than Cyt c or RNase A under the conditions used for iontophoresis, it also possessed the highest surface hydrophobicity, which may have facilitated the interactions with the transport pathways and encouraged aggregation in the skin microenvironment. Thus, high charge and electrophoretic mobility seem to be inadequate descriptors to predict the transdermal iontophoretic transport of proteins whose complex three dimensional structures can facilitate interactions with cutaneous transport pathways. Copyright © 2014 Elsevier B.V. All rights reserved.
The electrophoretically 'slow' and 'fast' forms of the alpha 2-macroglobulin molecule.
Barrett, A J; Brown, M A; Sayers, C A
1979-01-01
alpha 2-Macroglobulin (alpha 2M) was isolated from human plasma by a four-step procedure: poly(ethylene glyco) fractionation, gel chromatography, euglobulin precipitation and immunoadsorption. No contaminants were detected in the final preparations by electrophoresis or immunoprecipitation. The protein ran as a single slow band in gel electrophoresis, and was designated 'S-alpha 2M'. S-alpha 2M bound about 2 mol of trypsin/mol. Treatment of S-alpha 2M with a proteinase or ammonium salts produced a form of the molecule more mobile in electrophoresis, and lacking proteinase-binding activity (F-alpha 2M). The electrophoretic mobility of the F-alpha 2M resulting from reaction with NH4+ salts was identical with that of proteinase complexes. We attribute the change in electrophoretic mobility of the alpha 2M to a conformation change, but there was no evidence of a change in pI or Strokes radius. Electrophoresis of S-alpha 2M in the presence of sodium dodecylsulphate gave results consistent with the view that the alpha 2M molecule is a tetramer of identical subunits, assembled as a non-covalent pair of disulphide-linked dimers. Some of the subunits seemed to be 'nicked' into two-thires-length and one-third-length chains, however. This was not apparent with F-alpha 2M produced by ammonium salts. F-alpha 2M produced by trypsin showed two new bands attributable to cleavage of the subunit polypeptide chain near the middle. Immunoassays of F-alpha 2M gave 'rockets' 12-29% lower than those with S-alpha 2M. The nature of the interactions between subunits in S-alpha 2M and F-alpha 2M was investigated by treating each form with glutaraldehyde before electrophoresis in the presence of sodium dodecyl sulphate. A much greater degree of cross-linking was observed with the F-alpha 2M, indicating that the subunits interact most closely in this form of the molecule. Exposure of S-alpha 2M to 3 M-urea or pH3 resulted in dissociation to the disulphide-bonded half-molecules; these did not show the proteinase-binding activity characteristic of the intact alpha 2M. F-alpha 2M was less easily dissociated than was S-alpha 2M. S-alpha 2M was readily dissociated to the quarter-subunits by mild reduction, with the formation of 3-4 new thiol groups per subunit. Inact reactive alpha 2M could then be regenerated in high yield by reoxidation of the subunits. F-alpha 2M formed by reaction with a proteinase or ammonium salts was not dissociated under the same conditions, although the interchain disulphide bonds were reduced. If the thiol groups of the quarter-subunits of S-alpha 2M were blocked by carboxymethylation, oxidative reassociation did not occur. Nevertheless treatment of these subunits with methylammonium salts or a proteinase caused the reassembly of half-molecules and intact (F-) tetramers. It is emphasized that F-alpha 2M does not have the properties of a denatured form of the protein... Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:91367
Electrothermal flow effects in insulating (electrodeless) dielectrophoresis systems.
Hawkins, Benjamin G; Kirby, Brian J
2010-11-01
We simulate electrothermally induced flow in polymeric, insulator-based dielectrophoresis (iDEP) systems with DC-offset, AC electric fields at finite thermal Péclet number, and we identify key regimes where electrothermal (ET) effects enhance particle deflection and trapping. We study a single, two-dimensional constriction in channel depth with parametric variations in electric field, channel geometry, fluid conductivity, particle electrophoretic (EP) mobility, and channel electroosmotic (EO) mobility. We report the effects of increasing particle EP mobility, channel EO mobility, and AC and DC field magnitudes on the mean constriction temperature and particle behavior. Specifically, we quantify particle deflection and trapping, referring to the deviation of particles from their pathlines due to dielectrophoresis as they pass a constriction and the stagnation of particles due to negative dielectrophoresis near a constriction, respectively. This work includes the coupling between fluid, heat, and electromagnetic phenomena via temperature-dependent physical parameters. Results indicate that the temperature distribution depends strongly on the fluid conductivity and electric field magnitude, and particle deflection and trapping depend strongly on the channel geometry. Electrothermal (ET) effects perturb the EO flow field, creating vorticity near the channel constriction and enhancing the deflection and trapping effects. ET effects alter particle deflection and trapping responses in insulator-based dielectrophoresis devices, especially at intermediate device aspect ratios (2 ≤ r ≤ 7) in solutions of higher conductivity (σ m ≥ 1 × 10(-3)S/m). The impact of ET effects on particle deflection and trapping are diminished when particle EP mobility or channel EO mobility is high. In almost all cases, ET effects enhance negative dielectrophoretic particle deflection and trapping phenomena. Copyright © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores
Belkin, Maxim; Maffeo, Christopher; Wells, David B.
2013-01-01
Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013
Ciriello, Rosanna; Iallorenzi, Pina Teresa; Laurita, Alessandro; Guerrieri, Antonio
2017-03-01
A novel capillary zone electrophoresis (CZE) method was developed for an improved separation and size characterization of pristine gold nanoparticles (AuNP) using uncoated fused-silica capillaries with UV-Vis detection at 520 nm. To avoid colloid aggregation and/or adsorption during runs, poly(sodium 4-styrenesulfonate) (PSS) was added (1%, w/v) in the running buffer (CAPS 10 mM, pH 11). This polyelectrolyte conferred an enhanced stabilization to AuNP, both steric and electrostatic, exalting at the same time their differences in electrophoretic mobility. Resolution was further and successfully improved through a stepwise field strength gradient by the application of 25 kV for the first 5 min and then 10 kV. Migration times varied linearly with particles diameters showing relative standard deviations better than 1% for daily experiments and 3% for interday experiments. A comparison with the size distribution obtained by transmission electron microscopy (TEM) allowed assessing that the electrophoretic profile can reasonably be considered as representative of the effective size heterogeneity of each colloid. Finally, the practical utility of the proposed method was demonstrated by measuring the core diameter of a gold colloid sample produced by chemical synthesis which was in good agreement with the value obtained by TEM measurements. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Shameli, Seyed Mostafa; Glawdel, Tomasz; Ren, Carolyn L
2015-03-01
Counter-flow gradient electrofocusing allows the simultaneous concentration and separation of analytes by generating a gradient in the total velocity of each analyte that is the sum of its electrophoretic velocity and the bulk counter-flow velocity. In the scanning format, the bulk counter-flow velocity is varying with time so that a number of analytes with large differences in electrophoretic mobility can be sequentially focused and passed by a single detection point. Studies have shown that nonlinear (such as a bilinear) velocity gradients along the separation channel can improve both peak capacity and separation resolution simultaneously, which cannot be realized by using a single linear gradient. Developing an effective separation system based on the scanning counter-flow nonlinear gradient electrofocusing technique usually requires extensive experimental and numerical efforts, which can be reduced significantly with the help of analytical models for design optimization and guiding experimental studies. Therefore, this study focuses on developing an analytical model to evaluate the separation performance of scanning counter-flow bilinear gradient electrofocusing methods. In particular, this model allows a bilinear gradient and a scanning rate to be optimized for the desired separation performance. The results based on this model indicate that any bilinear gradient provides a higher separation resolution (up to 100%) compared to the linear case. This model is validated by numerical studies. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sherman, M Y; Goldberg, A L
1993-01-01
The "molecular chaperone", dnaK, is induced in Escherichia coli upon heat shock and promotes ATP-dependent refolding or degradation of damaged proteins. When cells were grown at 25 degrees C and disrupted, a small fraction of the dnaK bound to affinity columns containing unfolded polypeptides (e.g., a fusion protein named CRAG or casein) and could be dissociated by ATP-Mg2+. After shifting cells to 42 degrees C for 30 min, up to 5-fold more dnaK bound to these columns than after growth at 25 degrees C. This enhanced binding capacity was reversed after shifting cells back to 25 degrees C. It resulted from a covalent modification, which decreases dnaK's electrophoretic mobility and isoelectric point. This modification appears to be phosphorylation; after treatment with phosphatases, the ATP-eluted dnaK resembled the predominant form in electrophoretic and binding properties. In addition, after incubating cells with [32P]orthophosphate at 42 degrees C, the 32P-labeled dnaK bound quantitatively to the CRAG column, unlike the nonlabeled protein. Thus, the phosphorylated dnaK is a special form of the chaperone with enhanced affinity for unfolded proteins. Its accumulation at high temperatures may account for dnaK's function as the "cellular thermometer." Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 PMID:8378342
Latex samples for RAMSES electrophoresis experiment on IML 2
NASA Technical Reports Server (NTRS)
Seaman, Geoffrey V. F.; Knox, Robert J.
1994-01-01
The objectives of these reported studies were to provide ground based support services for the flight experiment team for the RAMSES experiment to be flown aboard IML-2. The specific areas of support included consultation on the performance of particle based electrophoresis studies, development of methods for the preparation of suitable samples for the flight hardware, the screening of particles to obtain suitable candidates for the flight experiment, and the electrophoretic characterization of sample particle preparations. The first phases of these studies were performed under this contract, while the follow on work was performed under grant number NAG8 1081, 'Preparation and Characterization of Latex Samples for RAMSES Experiment on IML 2.' During this first phase of the experiment the following benchmarks were achieved: Methods were tested for the concentration and resuspension of latex samples in the greater than 0.4 micron diameter range to provide moderately high solids content samples free of particle aggregation which interferred with the normal functioning of the RAMSES hardware. Various candidate latex preparations were screened and two candidate types of latex were identified for use in the flight experiments, carboxylate modified latex (CML) and acrylic acid-acrylamide modified latex (AAM). These latexes have relatively hydrophilic surfaces, are not prone to aggregate, and display sufficiently low electrophoretic mobilities in the flight buffer so that they can be used to make mixtures to test the resolving power of the flight hardware.
Structural and biophysical properties of h-FANCI ARM repeat protein.
Siddiqui, Mohd Quadir; Choudhary, Rajan Kumar; Thapa, Pankaj; Kulkarni, Neha; Rajpurohit, Yogendra S; Misra, Hari S; Gadewal, Nikhil; Kumar, Satish; Hasan, Syed K; Varma, Ashok K
2017-11-01
Fanconi anemia complementation groups - I (FANCI) protein facilitates DNA ICL (Inter-Cross-link) repair and plays a crucial role in genomic integrity. FANCI is a 1328 amino acids protein which contains armadillo (ARM) repeats and EDGE motif at the C-terminus. ARM repeats are functionally diverse and evolutionarily conserved domain that plays a pivotal role in protein-protein and protein-DNA interactions. Considering the importance of ARM repeats, we have explored comprehensive in silico and in vitro approach to examine folding pattern. Size exclusion chromatography, dynamic light scattering (DLS) and glutaraldehyde crosslinking studies suggest that FANCI ARM repeat exist as monomer as well as in oligomeric forms. Circular dichroism (CD) and fluorescence spectroscopy results demonstrate that protein has predominantly α- helices and well-folded tertiary structure. DNA binding was analysed using electrophoretic mobility shift assay by autoradiography. Temperature-dependent CD, Fluorescence spectroscopy and DLS studies concluded that protein unfolds and start forming oligomer from 30°C. The existence of stable portion within FANCI ARM repeat was examined using limited proteolysis and mass spectrometry. The normal mode analysis, molecular dynamics and principal component analysis demonstrated that helix-turn-helix (HTH) motif present in ARM repeat is highly dynamic and has anti-correlated motion. Furthermore, FANCI ARM repeat has HTH structural motif which binds to double-stranded DNA.
Kariminejad, Ariana; Bozorgmehr, Bita; Khatami, Alireza; Kariminejad, Mohamad-Hasan; Giunta, Cecilia; Steinmann, Beat
2010-01-01
Background The Ehlers-Danlos syndrome type VI (EDSVI) is an autosomal recessive connective tissue disease which is characterized by severe hypotonia at birth, progressive kyphoscoliosis, skin hyperelasticity and fragility, joint hypermobility and (sub-)luxations, microcornea, rupture of arteries and the eye globe, and osteopenia. The enzyme collagen lysyl hydroxylase (LH1) is deficient in these patients due to mutations in the PLOD1 gene. Case Presentation We report a 17-year-old boy, born to related parents, with severe kyphoscoliosis, scar formation, joint hypermobility and multiple dislocations, muscular weakness, rupture of an ocular globe, and a history of severe infantile hypotonia. EDS VI was suspected clinically and confirmed by an elevated ratio of urinary total lysyl pyridinoline to hydroxylysyl pyridinoline, abnormal electrophoretic mobility of the α-collagen chains, and mutation analysis. Conclusion Because of the high rate of consanguineous marriages in Iran and, as a consequence thereof, an increased rate of autosomal recessive disorders, we urge physicians to consider EDS VI in the differential diagnosis of severe infantile hypotonia and muscular weakness, a disorder which can easily be confirmed by the analysis of urinary pyridinolines that is highly specific, sensitive, robust, fast, non-invasive, and inexpensive. PMID:23056730
Gorkhali, Neena Amatya; Dong, Kunzhe; Yang, Min; Song, Shen; Kader, Adiljian; Shrestha, Bhola Shankar; He, Xiaohong; Zhao, Qianjun; Pu, Yabin; Li, Xiangchen; Kijas, James; Guan, Weijun; Han, Jianlin; Jiang, Lin; Ma, Yuehui
2016-07-22
Sheep has successfully adapted to the extreme high-altitude Himalayan region. To identify genes underlying such adaptation, we genotyped genome-wide single nucleotide polymorphisms (SNPs) of four major sheep breeds living at different altitudes in Nepal and downloaded SNP array data from additional Asian and Middle East breeds. Using a di value-based genomic comparison between four high-altitude and eight lowland Asian breeds, we discovered the most differentiated variants at the locus of FGF-7 (Keratinocyte growth factor-7), which was previously reported as a good protective candidate for pulmonary injuries. We further found a SNP upstream of FGF-7 that appears to contribute to the divergence signature. First, the SNP occurred at an extremely conserved site. Second, the SNP showed an increasing allele frequency with the elevated altitude in Nepalese sheep. Third, the electrophoretic mobility shift assays (EMSA) analysis using human lung cancer cells revealed the allele-specific DNA-protein interactions. We thus hypothesized that FGF-7 gene potentially enhances lung function by regulating its expression level in high-altitude sheep through altering its binding of specific transcription factors. Especially, FGF-7 gene was not implicated in previous studies of other high-altitude species, suggesting a potential novel adaptive mechanism to high altitude in sheep at the Himalayas.
Park, Bum-Chan; Park, Yun-Hee; Yi, Soohyun; Choi, Yu Kyung; Kang, Eun-Hye; Park, Hee-Moon
2014-11-01
The temporal and spatial regulation of β-1,3-glucan synthesis plays an important role in morphogenesis during fungal growth and development. Northern blot analysis showed that the transcription of fksA, the gene encoding β-1,3-glucan synthase in Aspergillus nidulans, was cell-cycle-dependent and increased steadily over the duration of the vegetative period, but its overall expression during the asexual and sexual stages was fairly constant up until the time of transcription cessation. In an A. nidulans strain mutated in the eukaryotic bHLH-like APSES transcription factor stuA1, the transcriptional level of fksA, and consequently the content of alkali-insoluble cell wall β-glucan, significantly increased at the conidial chain formation and maturation stage. Electrophoretic mobility shift assays revealed that StuA was bound to StREs (StuA Response Elements) on the fksA promoter region. Promoter analysis with sGFP-fusion constructs also indicated the negative regulation of fksA expression by StuA, especially during asexual development. Taken together, these data suggest that StuA plays an important role in cell wall biogenesis during the development of A. nidulans, by controlling the transcription level of fksA.
Mukherjee, Joy; Ow, Saw Yen; Noirel, Josselin; Biggs, Catherine A
2011-02-01
Cell surface physicochemical characterization techniques were combined with quantitative changes in protein expression, to investigate the biological and biophysical changes of Escherichia coli MG1655 cells when grown as a biofilm (BIO). The overall surface charge of BIO cells was found to be less negative, highlighting the need for a lower electrophoretic mobility for attachment to occur. Comparison of the chemical functional groups on the cell surface showed similar profiles, with the absorbance intensity higher for proteins and carbohydrates in the BIO cells. Quantitative proteomic analysis demonstrated that 3 proteins were significantly increased, and 9 proteins significantly decreased in abundance, in cells grown as a BIO compared to their planktonic counterparts, with 7 of these total 12 proteins unique to this study. Proteins showing significant increased or decreased abundance include proteins involved in acid resistance, DNA protection and binding and ABC transporters. Further predictive analysis of the metabolic pathways showed an increased abundance of the amino acid metabolism and tricarboxylic acid (TCA) cycle, with a decrease in expression within the pentose phosphate and glycolysis pathways. It is therefore hypothesized that cells grown as a BIO are still energetically viable potentially using amino acids as an indirect carbon backbone source into the TCA cycle. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Dalmont, Helene; Pinprayoon, Orawan; Saunders, Brian R
2008-03-18
pH-responsive microgel dispersions contain cross-linked polymer particles that swell when the pH approaches the pKa of the ionic monomer incorporated within the particles. In recent work from our group, it was demonstrated that the mechanical properties of degenerated intervertebral discs (IVDs) could be restored to normal values by injection of pH-responsive microgel dispersions (Saunders, J. M.; Tong, T.; LeMaitre, C.; Freemont, A. J.; Saunders, B. R. Soft Matter 2007, 3, 486). These dispersions change from a fluid to a gel with increasing pH. The present work investigates the pH-dependent properties of dispersions of microgel particles containing MAA (methacrylic acid) and also the effects of added Ca2+. Two microgels are discussed: microgel A is poly(EA/MAA/AM) (EA and AM are ethyl acrylate and allyl methacrylate), and microgel B is poly(EA/MAA/BDDA) (butanediol diacrylate). The pH-dependent particle properties investigated include hydrodynamic diameters and electrophoretic mobilities. The critical coagulation concentrations (CCC) of dilute dispersions and the elastic modulus (G') of concentrated, gelled microgel dispersions were also investigated. In the absence of added Ca2+, the particle swelling and G' were smallest and largest, respectively, for microgel A. The changes in hydrodynamic diameter and mobility with pH were explained in terms of a core-shell swelling mechanism. Added Ca2+ was found to significantly decrease the CCCs, extents of particle swelling, and magnitude of the electrophoretic mobility. This was attributed to the ionic cross-linking of neighboring RCOO- groups by Ca2+. It is suggested that the formation of ionic cross-links is inefficient within the microgel particles because of the presence of covalent cross-links that oppose the large-scale conformational rearrangement of neighboring RCOO- groups. The effect of Ca2+ on the properties of the gelled dispersions is important from the viewpoint of potential application in vivo. Rheological studies of the gelled microgel dispersions showed that added Ca2+ did not have a specific influence on G'. The differences observed in the presence of Ca2+ were attributed to ionic strength effects (screening). The key parameter that controls G' of the gelled microgel dispersions is pH. The results from this work suggest that the elasticity of the gels would be slightly reduced in vivo as a consequence of the high ionic strength present.
Walz, M; Kück, U
1995-12-01
The ascomycete Sordaria macrospora was transformed using different plasmid molecules containing the bacterial hygromycin B resistance gene (hph) under the control of different expression signals. The highest transformation frequency was obtained with vector pMW1. On this plasmid molecule, expression of the hph gene is directed by the upstream region of the isopenicillin N synthetase gene (pcbC) from the deuteromycete Acremonium chrysogenum. Southern analysis suggests that the vector copies are integrated as tandem repeats into the S. macrospora chromosomes and that duplicated sequences are most probably not inactivated by methylation during meiosis. Furthermore, the hygromycin B resistance (hygR) is not correlated with the number of integrated vector molecules. Electrophoretic karyotyping was used to further characterize S. macrospora transformants. Five chromosomal bands were separated by pulsed-field gel electrophoresis (PFGE) representing seven chromosomes with a total genome size of 39.5Mb. Hybridization analysis revealed ectopic integration of vector DNA into different chromosomes. In a few transformants, major rearrangements were detected. Transformants were sexually propagated to analyze the fate of the heterologous vector DNA. Although the hygR phenotype is stably maintained during mitosis, about a third of all lines tested showed loss of the resistance marker gene after meiosis. However, as was concluded from electrophoretic karyotyping, the resistant spores showed a Mendelian segregation of the integrated vector molecules in at least three consecutive generations. Our data indicate that heterologous marker genes can be used for transformation tagging, or the molecular mapping of chromosomal loci in S. macrospora.
A Laboratory Exercise Illustrating the Sensitivity and Specificity of Western Blot Analysis
ERIC Educational Resources Information Center
Chang, Ming-Mei; Lovett, Janice
2011-01-01
Western blot analysis, commonly known as "Western blotting," is a standard tool in every laboratory where proteins are analyzed. It involves the separation of polypeptides in polyacrylamide gels followed by the electrophoretic transfer of the separated polypeptides onto a nitrocellulose or polyvinylidene fluoride membrane. A replica of the…
Allison, Stuart A; Xin, Yao
2005-08-15
A boundary element (BE) procedure is developed to numerically calculate the electrophoretic mobility of highly charged, rigid model macroions in the thin double layer regime based on the continuum primitive model. The procedure is based on that of O'Brien (R.W. O'Brien, J. Colloid Interface Sci. 92 (1983) 204). The advantage of the present procedure over existing BE methodologies that are applicable to rigid model macroions in general (S. Allison, Macromolecules 29 (1996) 7391) is that computationally time consuming integrations over a large number of volume elements that surround the model particle are completely avoided. The procedure is tested by comparing the mobilities derived from it with independent theory of the mobility of spheres of radius a in a salt solution with Debye-Huckel screening parameter, kappa. The procedure is shown to yield accurate mobilities provided (kappa)a exceeds approximately 50. The methodology is most relevant to model macroions of mean linear dimension, L, with 1000>(kappa)L>100 and reduced absolute zeta potential (q|zeta|/k(B)T) greater than 1.0. The procedure is then applied to the compact form of high molecular weight, duplex DNA that is formed in the presence of the trivalent counterion, spermidine, under low salt conditions. For T4 DNA (166,000 base pairs), the compact form is modeled as a sphere (diameter=600 nm) and as a toroid (largest linear dimension=600 nm). In order to reconcile experimental and model mobilities, approximately 95% of the DNA phosphates must be neutralized by bound counterions. This interpretation, based on electrokinetics, is consistent with independent studies.
Tachibana, Hiroshi; Yanagi, Tetsuo; Pandey, Kishor; Cheng, Xun-Jia; Kobayashi, Seiki; Sherchand, Jeevan B; Kanbara, Hiroji
2007-06-01
An Entamoeba sp. strain, P19-061405, was isolated from a rhesus monkey in Nepal and characterized genetically. The strain was initially identified as Entamoeba histolytica using PCR amplification of peroxiredoxin genes. However, sequence analysis of the 18S rRNA gene showed a 0.8% difference when compared to the reference E. histolytica HM-1:IMSS human strain. Differences were also observed in the 5.8S rRNA gene and the internal transcribed spacer (ITS) regions 1 and 2, and analysis of the serine-rich protein gene from the monkey strain showed unique codon usages compared to E. histolytica isolated from humans. The amino acid sequences of two hexokinases and two glucose phosphate isomerases also differed from those of E. histolytica. Isoenzyme analyses of these enzymes in the monkey strain showed different electrophoretic mobility patterns compared with E. histolytica isolates. Analysis of peroxiredoxin genes indicated the presence of at least seven different types of protein, none of which were identical to proteins in E. histolytica. When the trophozoites from the monkey strain were inoculated into the livers of hamsters, formation of amebic abscesses was observed 7 days after the injection. These results demonstrate that the strain is genetically different from E. histolytica and is virulent. Revival of the name Entamoeba nuttalli is proposed for the organism.
Analysis of aromatic aldehydes in brandy and wine by high-performance capillary electrophoresis.
Panossian, A; Mamikonyan, G; Torosyan, M; Gabrielyan, E; Mkhitaryan, S
2001-09-01
A new method of analysis of vanillin, syringaldehyde, coniferaldehyde, and sinapaldehyde in brandy and wine by high-performance capillary electrophoresis is described. Electrophoretic mobility of these compounds is achieved by a borate buffer at pH 9.3. At this pH, the sensitivity of UV detection of these phenolic aldehydes also increases. UV absorptions at 348, 362, 404, and 422 nm were selected for monitoring vanillin, syringaldehyde, coniferaldehyde, and sinapaldehyde, respectively. This procedure was performed simultaneously during one run using a diode array detector. Samples of brandy or wine were analyzed directly without concentration, extraction, or any other preliminary treatment of the test sample. The limits of detection were found to be 0.275, 0.1425, 0.1475, and 0.1975 ppm for syringaldehyde, coniferaldehyde, sinapaldehyde, and vanillin, respectively, which is acceptable for analysis of both brandy and wine aged in oak barrels. The method has been shown to be linear in a range from 0.3 to 57 mg/L. Recoveries ranged between 99.9% and 107.7% for all of the compounds tested. Repeatability and reproducibility of the method were high. The relative standard deviation was consequently approximately 3% and also between 4.47% and 6.89% for all tested compounds. The method is useful for the identification of counterfeit brandy, which is easy to recognize by the absence of sinapaldehyde, syringaldehyde, and coniferaldehyde, which are not detectable in false brandy.
Surface chemical effects on colloid stability and transport through natural porous media
Puls, Robert W.; Paul, Cynthia J.; Clark, Donald A.
1993-01-01
Surface chemical effects on colloidal stability and transport through porous media were investigated using laboratory column techniques. Approximately 100 nm diameter, spherical, iron oxide particles were synthesized as the mobile colloidal phase. The column packing material was retrieved from a sand and gravel aquifer on Cape Cod, MA. Previous studies have indicated enhanced stability and transport of iron oxide particles due to specific adsorption of some inorganic anions on the iron oxide surface. This phenomenon was further evaluated with an anionic surfactant, sodium dodecyl sulfate. Surfactants constitute a significant mass of the contaminant loading at the Cape Cod site and their presence may contribute to colloidal transport as a significant transport mechanism at the site. Other studies at the site have previously demonstrated the occurrence of this transport mechanism for iron phosphate particles. Photon correlation spectroscopy, micro-electrophoretic mobility, and scanning electron microscopy were used to evaluate particle stability, mobility and size. Adsorption of negatively charged organic and inorganic species onto the surface of the iron oxide particles was shown to significantly enhance particle stability and transport through alterations of the electrokinetic properties of the particle surface. Particle breakthrough generally occurred simultaneously with tritiated water, a conservative tracer. The extent of particle breakthrough was primarily dependent upon colloidal stability and surface charge.
Kumar, Krishan; Singal, Ankita; Rizvi, M Moshahid A; Chauhan, Virander S
2008-06-01
High mobility group box chromosomal protein 1 (HMGB1), known as an abundant, non-histone architectural chromosomal protein, is highly conserved across different species. Homologues of HMGB1 were identified and cloned from malaria parasite, Plasmodium falciparum. Sequence analyses showed that the P. falciparum HMGB1 (PfHMGB1) exhibits 45, 23 and 18%, while PfHMGB2 shares 42, 21 and 17% homology with Saccharomyces cerevisiae, human and mouse HMG box proteins respectively. Parasite PfHMGB1and PfHMGB2 proteins contain one HMG Box domain similar to B-Box of mammalian HMGB1. Electrophoretic Mobility Shift Assay (EMSA) showed that recombinant PfHMGB1 and PfHMGB2 bind to DNA. Immunofluorescence Assay using specific antibodies revealed that these proteins are expressed abundantly in the ring stage nuclei. Significant levels of PfHMGB1 and PfHMGB2 were also present in the parasite cytosol at trophozoite and schizont stages. Both, PfHMGB1 and PfHMGB2 were found to be potent inducers of pro-inflammatory cytokines such as TNFalpha from mouse peritoneal macrophages as analyzed by both reverse transcription PCR and by ELISA. These results suggest that secreted PfHMGB1 and PfHMGB2 may be responsible for eliciting/ triggering host inflammatory immune responses associated with malaria infection.
An analytical model for enantioseparation process in capillary electrophoresis
NASA Astrophysics Data System (ADS)
Ranzuglia, G. A.; Manzi, S. J.; Gomez, M. R.; Belardinelli, R. E.; Pereyra, V. D.
2017-12-01
An analytical model to explain the mobilities of enantiomer binary mixture in capillary electrophoresis experiment is proposed. The model consists in a set of kinetic equations describing the evolution of the populations of molecules involved in the enantioseparation process in capillary electrophoresis (CE) is proposed. These equations take into account the asymmetric driven migration of enantiomer molecules, chiral selector and the temporary diastomeric complexes, which are the products of the reversible reaction between the enantiomers and the chiral selector. The solution of these equations gives the spatial and temporal distribution of each species in the capillary, reproducing a typical signal of the electropherogram. The mobility, μ, of each specie is obtained by the position of the maximum (main peak) of their respective distributions. Thereby, the apparent electrophoretic mobility difference, Δμ, as a function of chiral selector concentration, [ C ] , can be measured. The behaviour of Δμ versus [ C ] is compared with the phenomenological model introduced by Wren and Rowe in J. Chromatography 1992, 603, 235. To test the analytical model, a capillary electrophoresis experiment for the enantiomeric separation of the (±)-chlorpheniramine β-cyclodextrin (β-CD) system is used. These data, as well as, other obtained from literature are in closed agreement with those obtained by the model. All these results are also corroborate by kinetic Monte Carlo simulation.
Manquián-Cerda, Karen; Cruces, Edgardo; Angélica Rubio, María; Reyes, Camila; Arancibia-Miranda, Nicolás
2017-11-01
The application of iron nanoparticles (FeNPs) to the removal of various pollutants has received wide attention over the last few decades. A synthesis alternative to obtain these nanoparticles without using harmful chemical reagents, such as NaBH 4 , is the use of extracts from different natural sources that allow a lesser degree of agglomeration, in a process known as green synthesis. In this study, FeNPs were synthesized by 'green' (hereafter, BB-Fe NPs) and 'chemical' (hereafter, nZVI) methods. Extracts of leaves and blueberry shoots (Vaccinium corymbosum) were used as reducing agents for FeCl 3 ·6H 2 O solution in the green synthesis method. FeNPs were characterized using transmission electron microscopy (TEM), scanning electron microscopy (SEM), electrophoretic migration, Brunauer-Emmett-Teller (BET) surface area analysis and X-ray diffraction (XRD) and evaluated for the removal of As(V) from aqueous systems. In both synthesis methods, XRD analysis confirmed the presence of the different kinds of iron nanoparticles. SEM analysis showed that the average size of BB-Fe NPs was 52.4nm and that a variety of nanoparticles of different forms and associated structures, such as lepidocrocite, magnetite, and nZVI, were present, while the dimensions of nZVI were 80.2nm. Comparatively significant differences regarding the electrophoretic mobility were found between both materials pre- and post-sorption of As(V). The velocity of As(V) removal by BB-Fe NPs was slower than that by nZVI, reaching equilibrium at 120min compared to 60min for nZVI. The removal kinetics of As(V) were adequately described by the pseudo-second-order kinetic model, and the maximum adsorbed amounts of this analyte are in close accordance with the experimental results. The Langmuir-Freundlich model is in good agreement with our experimental data, where the sorption capacity of nZVI and BB-Fe NPs was found to be 52.23 ± 6.06 and 50.40 ± 5.90 (mg·g -1 ), respectively. The use of leaves of Vaccinium corymbosum affords an easy-to-synthesize, low-cost, and eco-friendly material with capabilities similar to nZVI. BB-Fe NPs are promising for arsenic remediation, which has emerged as a new alternative for water purification and sanitation. Copyright © 2017 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Tada, Kazuya; Onoda, Mitsuyoshi
2009-09-01
The material efficiency of electrophoretic deposition of a fluorene-based conjugated polymer, poly[(9,9-dioctyl-2,7-divinylenefluorenylene)-alt-{2-methoxy-5-(2-ethylhexyloxy)-1,4-phenylene}] (PDOF-MEHPV), from suspensions with a mixture of acetonitrile and toluene as dispersant is studied. It has been found that the recovery rate of the electrophoretic deposition from a suspension containing 90% of the poor solvent acetonitrile reaches 98%. Although the recovery rate decreases with decreasing acetonitrile content, almost 70% of the polymer can be deposited on the substrates from the suspension containing equivalent volumes of the good and poor solvents by electrophoretic deposition, from which smooth and transparent films suitable for electronic devices are obtained.
Electrophoretic interactions and aggregation of colloidal biological particles
NASA Technical Reports Server (NTRS)
Davis, Robert H.; Nichols, Scott C.; Loewenberg, Michael; Todd, Paul
1994-01-01
The separation of cells or particles from solution has traditionally been accomplished with centrifuges or by sedimentation; however, many particles have specific densities close to unity, making buoyancy-driven motion slow or negligible, but most cells and particles carry surface charges, making them ideal for electrophoretic separation. Both buoyancy-driven and electrophoretic separation may be influenced by hydrodynamic interactions and aggregation of neighboring particles. Aggregation by electrophoresis was analyzed for two non-Brownian particles with different zeta potentials and thin double layers migrating through a viscous fluid. The results indicate that the initial rate of electrophoretically-driven aggregation may exceed that of buoyancy-driven aggregation, even under conditions in which buoyancy-driven relative motion of noninteracting particles is dominant.
Chan, Daisy K L
2008-12-01
Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common genetic enzyme defect present in many people from African, Middle Eastern, Mediterranean and Asian countries. Individuals with the enzyme deficiency may remain asymptomatic, develop an acute haemolytic crises to infections or Fava beans, neonatal jaundice or chronic non-spherocytic haemolytic anaemia. Electrophoretic mobility may be fast, slow or normal. Over 160 mutations have been described, mostly due to single amino acid substitution. Although correlation of the genotype and biochemistry with the clinical phenotype of G6PD deficient individuals remains somewhat variable, there is better correlation among individuals presenting with chronic non-spherocytic haemolytic anaemia, which is related to the NADP structure of the enzyme.
NASA Astrophysics Data System (ADS)
Drillien, Robert; Spehner, Daniele; Kirn, Andre; Giraudon, Pascale; Buckland, Robin; Wild, Fabian; Lecocq, Jean-Pierre
1988-02-01
Vaccinia virus recombinants encoding the hemagglutinin or fusion protein of measles virus have been constructed. Infection of cell cultures with the recombinants led to the synthesis of authentic measles proteins as judged by their electrophoretic mobility, recognition by antibodies, glycosylation, proteolytic cleavage, and presentation on the cell surface. Mice vaccinated with a single dose of the recombinant encoding the hemagglutinin protein developed antibodies capable of both inhibiting hemagglutination activity and neutralizing measles virus, whereas animals vaccinated with the recombinant encoding the fusion protein developed measles neutralizing antibodies. Mice vaccinated with either of the recombinants resisted a normally lethal intracerebral inoculation of a cell-associated measles virus subacute sclerosing panencephalitis strain.
NASA Astrophysics Data System (ADS)
Cantin, Edouard M.; Eberle, Richard; Baldick, Joseph L.; Moss, Bernard; Willey, Dru E.; Notkins, Abner L.; Openshaw, Harry
1987-08-01
The herpes simplex virus 1 (HSV-1) strain F gene encoding glycoprotein gB was isolated and modified at the 5' end by in vitro oligonucleotide-directed mutagenesis. The modified gB gene was inserted into the vaccinia virus genome and expressed under the control of a vaccinia virus promoter. The mature gB glycoprotein produced by the vaccinia virus recombinant was glycosylated, was expressed at the cell surface, and was indistinguishable from authentic HSV-1 gB in terms of electrophoretic mobility. Mice immunized intradermally with the recombinant vaccinia virus produced gB-specific neutralizing antibodies and were resistant to a lethal HSV-1 challenge.
Bender, K; Bissbort, S; Kuhn, A; Nagel, M; Günther, E
1986-02-01
A genetic locus controlling the electrophoretic mobility of an acid phosphatase in the rat (Rattus norvegicus) is described. The locus, designed Acp-2, is not expressed in erythrocytes but is expressed in all other tissues studied. The product of Acp-2 hydrolyzes a wide variety of phosphate monoesters and is inhibited by L(+)-tartaric acid. Inbred rat strains have fixed either allele Acp-2a or allele Acp-2b. Codominant expression is observed in the respective F1 hybrids. Backcross progenies revealed the expected 1:1 segregation ratio. Possible loose linkage was found between the Acp-2 and the Pep-3 gene loci at a recombination frequency of 0.36 +/- 0.06.
The effect of small temperature gradients on flow in a continuous flow electrophoresis chamber
NASA Technical Reports Server (NTRS)
Rhodes, P. H.; Snyder, R. S.
1982-01-01
Continuous flow electrophoresis employs an electric field to separate biological cells suspended in a flowing liquid buffer solution. Good separations based on differences in electrophoretic mobility are obtained only when a unidirectional flow is maintained. The desired flow has a parabolic structure in the narrow dimension of the chamber and is uniform acros the width, except near the edges where the no-slip condition prevails. However, because of buoyancy, very small laterall or axial temperature gradients deform the flow significantly. The results of experiments conducted with a specially instrumented chamber show the origin and structure of the buoyancy-driven perturbations. It is found that very small temperature gradients can disturb the flow significantly, as was predicted by earlier theoretical work.
Electrophoresis of small particles and fluid globules in weak electrolytes
NASA Technical Reports Server (NTRS)
Baygents, J. C.; Saville, D. A.
1991-01-01
An examination is conducted of the influence of partial ionization on the electrophoresis of small particles and fluid globules, with a view to the nature of conditions under which dissociation-association (D-A) alters electrokinetics. It is found that, since D-A processes are important in cases where double-layer polarization and relaxation would otherwise prevail, the predicted effect on electrophoretic mobility is greatest for the drops and bubbles whose surfaces are fluid and convection within the interface is significant. While the computation scheme used applies only to situations where forcing-field magnitude is small, the results obtained indicate that D-A processes involving ionogenic solutes may be significant in apolar liquids where electrokinetic phenomena are driven by strong forcing fields.
Reddy, S G; Cochran, B J; Worth, L L; Knutson, V P; Haddox, M K
1994-04-01
A high-resolution isoelectric focusing vertical slab gel method which can resolve proteins which differ by a single charge was developed and this method was applied to the study of the multiple isoelectric forms of ornithine decarboxylase. Separation of proteins at this high level of resolution was achieved by increasing the ampholyte concentration in the gels to 6%. Various lots of ampholytes, from the same or different commercial sources, differed significantly in their protein binding capacity. Ampholytes bound to proteins interfered both with the electrophoretic transfer of proteins from the gel to immunoblotting membranes and with the ability of antibodies to interact with proteins on the immunoblotting membranes. Increasing the amount of protein loaded into a gel lane also decreased the efficiency of the electrophoretic transfer and immunodetection. To overcome these problems, both gel washing and gel electrophoretic transfer protocols for disrupting the ampholyte-protein binding and enabling a quantitative electrophoretic transfer of proteins were developed. Two gel washing procedures, with either thiocyanate or borate buffers, and a two-step electrophoretic transfer method are described. The choice of which method to use to optimally disrupt the ampholyte-protein binding was found to vary with each lot of ampholytes employed.
Arora, Dhara; Singh, Neha; Bhatla, Satish C
2018-01-01
Tyrosine nitrated proteins can be detected in plant cells electrophoretically and their distribution can be monitored by confocal laser scanning microscopy (CLSM) imaging. One-dimensional polyacrylamide gel electrophoresis (1D PAGE) followed by Western blotting using polyclonal antibody against 3-nitrotyrosine residues enables detection of tyrosine nitrated proteins in plant cells. Here we describe detection of tyrosine nitrated proteins in the homogenates derived from sunflower (Helianthus annuus L.) seedling cotyledons. Total soluble proteins obtained from tissue homogenates are resolved using vertical gel electrophoresis followed by their electrophoretic transfer on to a microporous membrane support for immunodetection. Spatial distribution of tyrosine nitrated proteins can be visualized using an antibody against 3-nitrotyrosine residues. Immunofluorescent localization is performed by cutting 7 μm thick wax sections of tissue followed by incubation in primary anti-nitrotyrosine antibody (dilution 1:200) and secondary Cy-3 labeled anti-rabbit IgG antibody (dilution 1:1500). Confocal laser scanning microscopy analysis is undertaken using argon lasers (ex: 530-550 nm and em: 570 nm) at pinhole 1. Modulation in the abundance and spatial localization of tyrosine nitrated proteins in plant tissues can be monitored using these techniques.
Sopina, V A
2000-01-01
Glucose-6-phosphate dehydrogenase (G6PD), acid phosphatase and esterases in free-living amoebae of 7 Amoeba species were investigated with the use of disc-electrophoresis in polyacrylamide gel. The evidence provided is suggestive that the electrophoretic isoenzyme patterns of acid phosphatase and esterases (and G6PD in some cases), in addition to a few morphological characters, can serve as a taxonomic criterion for species identification within this genus, as well as for revealing erroneously classified species and strains. It is suggested that A. indica is an independent species whose preliminary diagnosis has been given in this paper. It is concluded that A. discoides and A. lescherae are strains of A. proteus, rather than two independent species. A and As-102 amoebian strains, kept in the collection of protozoan strains and species of the Institute of Cytology RAS and referred to as strains of A. proteus, belong in reality to another Amoeba species and even to another genus within the family Amoebidae. This conclusion has been documented by results of our analysis of electrophoretic patterns of acid phosphatase and esterases in these strains.
Song, Tian-Shun; Peng-Xiao; Wu, Xia-Yuan; Zhou, Charles C
2013-07-01
Sediment microbial fuel cells (SMFCs) could be used as power sources and one type of new technology for the removal of organic matters in sediments. In order to improve electrode materials and enhance their effect on the performance, we deposited multi-walled carbon nanotube (MWNT) on stainless steel net (SSN). Electrophoretic deposition technique as a method with low cost, process simplicity, and thickness control was used for this electrode modification and produced this novel SSN-MWNT electrode. The performances of SMFCs with SSN-MWNT as electrode were investigated. The results showed that the maximum power density of SMFC with SSN-MWNT cathode was 31.6 mW m(-2), which was 3.2 times that of SMFC with an uncoated stainless steel cathode. However, no significant increase in the maximum power density of SMFC with SSN-MWNT anode was detected. Further electrochemical analysis showed that when SSN-MWNT was used as the cathode, the cathodic electrochemical activity and oxygen reduction rate were significantly improved. This study demonstrates that the electrophoretic deposition of carbon nanotubes on conductive substrate can be applied for improving the performance of SMFC.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nguyen, T.N.
1994-05-06
We have optimized the reaction conditions under which unactivated metabolite of the food borne carcinogen 2-amino-1-methyl-6-phenylimidazo [4,5-{beta}]pyridine (PhIP) is covalently bound to the oligodeoxynucleotide d(CCTACGCATCC). Capillary electrophoresis (CE) was used to separate and characterize this DNA oligomer bound by PhIP. We observed 2 major and several minor PhIP adduct species. The 2 major adducts had different absorbance maxima; the major adduct eluates with faster and slower mobilities had absorbance maxima of 360 and 340 nm, respectively. One of the two major PhIP adduct species was resolvable but the peak was broad. Using detection at 260 nm, the other major PhIPmore » adduct with fastest electrophoretic mobility was not resolvable, but coelute with the huge broad unmodified DNA oligomer peak. However, at higher wavelengths (>320 nm) where DNA does not absorb, electropherograms generated by detection at these higher wavelengths showed very heterogeneous binding by PhIP to the DNA oligomer with no interfering absorbance by the DNA.« less
Countercurrent distribution of biological cells
NASA Technical Reports Server (NTRS)
Brooks, D. E.
1979-01-01
A neutral polymer phase system consisting of 7.5 percent dextran 40/4.5 percent PEG 6, 0.11 M Na phosphate, 5 percent fetal bovine serum (FBS), pH 7.5, was developed which has a high phase droplet electrophoretic mobility and retains cell viability over many hours. In this and related systems, the drop mobility was a linear function of drop size, at least in the range 4-30 micron diameter. Applications of and electric field of 4.5 v/cm to a system containing 10 percent v/v bottom phase cleared the system more than two orders of magnitude faster than in the absence of the field. At higher bottom phase concentrations a secondary phenomenon intervened in the field driven separations which resulted in an increase in turbidity after clearing had commenced. The increase was associated with a dilution of the phase system in the chamber. The effect depended on the presence of the electric field. It may be due to electroosmotic flow of buffer through the Amicon membranes into the sample chamber and flow of phase system out into the rinse stream. Strategies to eliminate this problem are proposed.
NASA Astrophysics Data System (ADS)
Moraila-Martínez, Carmen Lucía; Guerrero-García, Guillermo Iván; Chávez-Páez, Martín; González-Tovar, Enrique
2018-04-01
The capacitive compactness has been introduced very recently [G. I. Guerrero-García et al., Phys. Chem. Chem. Phys. 20, 262-275 (2018)] as a robust and accurate measure to quantify the thickness, or spatial extension, of the electrical double layer next to either an infinite charged electrode or a spherical macroion. We propose here an experimental/theoretical scheme to determine the capacitive compactness of a spherical electrical double layer that relies on the calculation of the electrokinetic charge and the associated mean electrostatic potential at the macroparticle's surface. This is achieved by numerically solving the non-linear Poisson-Boltzmann equation of point ions around a colloidal sphere and matching the corresponding theoretical mobility, predicted by the O'Brien and White theory [J. Chem. Soc., Faraday Trans. 2 74, 1607-1626 (1978)], with experimental measurements of the electrophoretic mobility under the same conditions. This novel method is used to calculate the capacitive compactness of NaCl and CaCl2 electrolytes surrounding a negatively charged polystyrene particle as a function of the salt concentration.
Electrophoretic and Electrolytic Deposition of Ceramic Particles on Porous Substrates
1990-08-30
hydrodynamic drag force exerted on the particle due to the electroosmotic flow of the solvent inside the pore, the electrophoretic force exerted on the...8217 - electrophoretic velocity UN - electroosmotic velocity b - pore mean radius D - diffusion coefficient k - local deposition rate Large Peclet numbers and small...experimentally as the charge is acquired spontaneously on mixing the particles with the solvent and it may be reversed upon addition ot ionic compounds. The
Electrophoretic and Electrolytic Deposition of Ceramic Particles on Porous Substrates
1992-09-30
particle penetration is facilitated by the electrophoretic force exerted on it and the electroosmotic flow of the fluid into the pores. 1 2 The...skeleton showed that the whole cross--section of the graphite was impregnated. - The existence of an electroosmotic effect was demonstrated by the...Pe) and the Damkohler number (A): Pe ((U" + Us)b -kb where U" - electrophoretic velocity Um - electroosmotic velocity b - pore mean radius D
Co-expression analysis identifies CRC and AP1 the regulator of Arabidopsis fatty acid biosynthesis.
Han, Xinxin; Yin, Linlin; Xue, Hongwei
2012-07-01
Fatty acids (FAs) play crucial rules in signal transduction and plant development, however, the regulation of FA metabolism is still poorly understood. To study the relevant regulatory network, fifty-eight FA biosynthesis genes including de novo synthases, desaturases and elongases were selected as "guide genes" to construct the co-expression network. Calculation of the correlation between all Arabidopsis thaliana (L.) genes with each guide gene by Arabidopsis co-expression dating mining tools (ACT) identifies 797 candidate FA-correlated genes. Gene ontology (GO) analysis of these co-expressed genes showed they are tightly correlated to photosynthesis and carbohydrate metabolism, and function in many processes. Interestingly, 63 transcription factors (TFs) were identified as candidate FA biosynthesis regulators and 8 TF families are enriched. Two TF genes, CRC and AP1, both correlating with 8 FA guide genes, were further characterized. Analyses of the ap1 and crc mutant showed the altered total FA composition of mature seeds. The contents of palmitoleic acid, stearic acid, arachidic acid and eicosadienoic acid are decreased, whereas that of oleic acid is increased in ap1 and crc seeds, which is consistent with the qRT-PCR analysis revealing the suppressed expression of the corresponding guide genes. In addition, yeast one-hybrid analysis and electrophoretic mobility shift assay (EMSA) revealed that CRC can bind to the promoter regions of KCS7 and KCS15, indicating that CRC may directly regulate FA biosynthesis. © 2012 Institute of Botany, Chinese Academy of Sciences.
Composition and Molecular Weight Distribution of Carob Germ Proteins Fractions
USDA-ARS?s Scientific Manuscript database
Biochemical properties of carob germ proteins were analyzed using a combination of selective extraction, reversed-phase high performance liquid chromatography (RP-HPLC), size exclusion chromatography coupled with multi-angle laser light scattering (SEC-MALS) and electrophoretic analysis. Using a mo...
Electrophoretic Analysis of Diversity and Phylogeny of Pinus brutia and Closely Related Taxa
M. T. Conkle; G. Schiller; C. Grunwald
1988-01-01
Rangewide samples from mature natural stands of Pinus brutia Ten. subsp. brutia, subsp. stankewiczii (Sukaczew) Nahal, subsp. pithyusa (Stevenson) Nahal, and subsp. eldarica (Medw.) Nahal from throughout the eastern Mediterranean display a continuum of allozyme variation for...
Fabrication and kinetics study of nano-Al/NiO thermite film by electrophoretic deposition.
Zhang, Daixiong; Li, Xueming
2015-05-21
Nano-Al/NiO thermites were successfully prepared as film by electrophoretic deposition (EPD). For the key issue of this EPD, a mixture solvent of ethanol-acetylacetone (1:1 in volume) containing 0.00025 M nitric acid was proved to be a suitable dispersion system for EPD. The kinetics of electrophoretic deposition for both nano-Al and nano-NiO were investigated; the linear relation between deposition weight and deposition time in short time and parabolic relation in prolonged time were observed in both EPDs. The critical transition time between linear deposition kinetics and parabolic deposition kinetics for nano-Al and nano-NiO were 20 and 10 min, respectively. The theoretical calculation of the kinetics of electrophoretic deposition revealed that the equivalence ratio of nano-Al/NiO thermites film would be affected by the behavior of electrophoretic deposition for nano-Al and nano-NiO. The equivalence ratio remained steady when the linear deposition kinetics dominated for both nano-Al and nano-NiO. The equivalence ratio would change with deposition time when deposition kinetics for nano-NiO changed into parabolic kinetics dominated after 10 min. Therefore, the rule was suggested to be suitable for other EPD of bicomposites. We also studied thermodynamic properties of electrophoretic nano-Al/NiO thermites film as well as combustion performance.
Binary Oscillatory Crossflow Electrophoresis
NASA Technical Reports Server (NTRS)
Molloy, Richard F.; Gallagher, Christopher T.; Leighton, David T., Jr.
1997-01-01
Electrophoresis has long been recognized as an effective analytic technique for the separation of proteins and other charged species, however attempts at scaling up to accommodate commercial volumes have met with limited success. In this report we describe a novel electrophoretic separation technique - Binary Oscillatory Crossflow Electrophoresis (BOCE). Numerical simulations indicate that the technique has the potential for preparative scale throughputs with high resolution, while simultaneously avoiding many problems common to conventional electrophoresis. The technique utilizes the interaction of an oscillatory electric field and a transverse oscillatory shear flow to create an active binary filter for the separation of charged protein species. An oscillatory electric field is applied across the narrow gap of a rectangular channel inducing a periodic motion of charged protein species. The amplitude of this motion depends on the dimensionless electrophoretic mobility, alpha = E(sub o)mu/(omega)d, where E(sub o) is the amplitude of the electric field oscillations, mu is the dimensional mobility, omega is the angular frequency of oscillation and d is the channel gap width. An oscillatory shear flow is induced along the length of the channel resulting in the separation of species with different mobilities. We present a model that predicts the oscillatory behavior of charged species and allows estimation of both the magnitude of the induced convective velocity and the effective diffusivity as a function of a in infinitely long channels. Numerical results indicate that in addition to the mobility dependence, the steady state behavior of solute species may be strongly affected by oscillating fluid into and out of the active electric field region at the ends of the cell. The effect is most pronounced using time dependent shear flows of the same frequency (cos((omega)t)) flow mode) as the electric field oscillations. Under such conditions, experiments indicate that solute is drawn into the cell from reservoirs at both ends of the cell leading to a large mass build up. As a consequence, any initially induced mass flux will vanish after short times. This effect was not captured by the infinite channel model and hence numerical and experimental results deviated significantly. The revised model including finite cell lengths and reservoir volumes allowed quantitative predictions of the time history of the concentration profile throughout the system. This latter model accurately describes the fluxes observed for both oscillatory flow modes in experiments using single protein species. Based on the results obtained from research funded under NASA grant NAG-8-1080.S, we conclude that binary separations are not possible using purely oscillatory flow modes because of end effects associated with the cos((omega)t) mode. Our research shows, however, that a combination of cos(2(omega)t) and steady flow should lead to efficient separation free of end effects. This possibility is currently under investigation.
Rodríguez-Nogales, J M; Vivar-Quintana, A M; Revilla, I
2007-07-01
Bulk tank ewe milk from the Assaf, Castellana, and Churra breeds categorized into 3 somatic cell count (SCC) groups (<500,000; 1,000,000 to 1,500,000; and >2,500,000 cells/mL) was used to investigate changes in chemical composition and capillary electrophoresis protein profiles. The results obtained indicated that breed affected fat, protein, and total solids levels, and differences were also observed for the following milk proteins: beta-, beta1-, beta2-, and alpha(s1)-III-casein, alpha-lactalbumin, and beta-lactoglobulin. High SCC affected fat and protein contents and bacterial counts. The level of beta1-, beta2-, and alpha(s1)-I-casein, and alpha-lactalbumin were significantly lower in milk with SCC scores >2,500,000 cells/mL. A preliminary study of the chemical, microbiological, and electrophoretic data was performed by cluster analysis and principal components analysis. Applying discriminant analysis, it was possible to group the milk samples according to breed and level of SCC, obtaining a prediction of 100 and 97% of the samples, respectively.
Analysis of oligonucleotide photoproducts produced by UV-A light and a riboflavin photosensitizer
NASA Astrophysics Data System (ADS)
Gelhaus, Stacy L.; LaCourse, William R.
2004-12-01
DNA damage is caused by a variety of foreign and endogenous compounds. There are endogenous photosensitizers in cells, such as porphyrins and flavins, which may create damage in the presence of UV-A light. Typically, samples are analyzed by 32P-postlabelling and electrophoretic separation or by LC-MS separation and detection. Separation by HPLC is common; however, in all instances, the DNA sample is hydrolyzed down to nucleosides prior to analysis. It will be shown here that ion-pairing reversed phase high performance liquid chromatography (IP-RPLC) has the ability to provide biophysical information concerning the sites of UV-A induced photosensitizer damage on an intact oligonucleotide concurrent with the separation. IP-RPLC is less labor intensive and faster than electrophoretic methods and it is less costly than LC-MS. IP-RPLC can also be used to purify modified oligonucleotides for further use and analysis. This technique is sensitive to the charge, conformation, and sequence characteristics of the nucleic acid sample and may be used to determine the damage or modifications made to DNA by a variety of compounds.
Fan, Zhong-Qi; Tan, Xiao-Li; Shan, Wei; Kuang, Jian-Fei; Lu, Wang-Jin; Chen, Jian-Ye
2017-06-08
Plant-specific WRKY transcription factors (TFs) have been implicated to function as regulators of leaf senescence, but their association with postharvest leaf senescence of economically important leafy vegetables, is poorly understood. In this work, the characterization of a Group IIe WRKY TF, BrWRKY65, from Chinese flowering cabbage ( Brassica rapa var. parachinensis) is reported. The expression of BrWRKY65 was up-regulated following leaf chlorophyll degradation and yellowing during postharvest senescence. Subcellular localization and transcriptional activation assays showed that BrWRKY65 was localized in the nucleus and exhibited trans-activation ability. Further electrophoretic mobility shift assay (EMSA) and transient expression analysis clearly revealed that BrWRKY65 directly bound to the W-box motifs in the promoters of three senescence-associated genes ( SAGs ) such as BrNYC1 and BrSGR1 associated with chlorophyll degradation, and BrDIN1 , and subsequently activated their expressions. These findings demonstrate that BrWRKY65 may be positively associated with postharvest leaf senescence, at least partially, by the direct activation of SAGs . Taken together, these findings provide new insights into the transcriptional regulatory mechanism of postharvest leaf senescence in Chinese flowering cabbage.
Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A; Schroeder, Charles M
2012-09-19
Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays, and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry.
Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A.
2012-01-01
Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry. PMID:22871171
Goldman, Johnathan M; Zhang, Li Ang; Manna, Arunava; Armitage, Bruce A; Ly, Danith H; Schneider, James W
2013-07-08
Hybridization analysis of short DNA and RNA targets presents many challenges for detection. The commonly employed sandwich hybridization approach cannot be implemented for these short targets due to insufficient probe-target binding strengths for unmodified DNA probes. Here, we present a method capable of rapid and stable sandwich hybridization detection for 22 nucleotide DNA and RNA targets. Stable hybridization is achieved using an n-alkylated, polyethylene glycol γ-carbon modified peptide nucleic acid (γPNA) amphiphile. The γPNA's exceptionally high affinity enables stable hybridization of a second DNA-based probe to the remaining bases of the short target. Upon hybridization of both probes, an electrophoretic mobility shift is measured via interaction of the n-alkane modification on the γPNA with capillary electrophoresis running buffer containing nonionic surfactant micelles. We find that sandwich hybridization of both probes is stable under multiple binding configurations and demonstrate single base mismatch discrimination. The binding strength of both probes is also stabilized via coaxial stacking on adjacent hybridization to targets. We conclude with a discussion on the implementation of the proposed sandwich hybridization assay as a high-throughput microRNA detection method.
Hu, Zu-Quan; Xue, Hui; Long, Jin-Hua; Wang, Yun; Jia, Yi; Qiu, Wei; Zhou, Jing; Wen, Zong-Yao; Yao, Wei-Juan; Zeng, Zhu
2016-01-01
Dendritic cells (DCs), the most potent antigen-presenting cells, play a central role in the initiation, regulation, and maintenance of the immune responses. Vascular endothelial growth factor (VEGF) is one of the important cytokines in the tumor microenvironment (TME) and can inhibit the differentiation and functional maturation of DCs. To elucidate the potential mechanisms of DC dysfunction induced by VEGF, the effects of VEGF on the biophysical characteristics and motility of human mature DCs (mDCs) were investigated. The results showed that VEGF had a negative influence on the biophysical properties, including electrophoretic mobility, osmotic fragility, viscoelasticity, and transmigration. Further cytoskeleton structure analysis by confocal microscope and gene expression profile analyses by gene microarray and real-time PCR indicated that the abnormal remodeling of F-actin cytoskeleton may be the main reason for the deterioration of biophysical properties, motility, and stimulatory capability of VEGF-treated mDCs. This is significant for understanding the biological behavior of DCs and the immune escape mechanism of tumors. Simultaneously, the therapeutic efficacies may be improved by blocking the signaling pathway of VEGF in an appropriate manner before the deployment of DC-based vaccinations against tumors. PMID:27809226
The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.
Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D
2004-11-15
Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.
Alvarez-Martin, Pablo; O'Connell Motherway, Mary; Turroni, Francesca; Foroni, Elena; Ventura, Marco; van Sinderen, Douwe
2012-10-01
This work reports on the identification and molecular characterization of a two-component regulatory system (2CRS), encoded by serRK, which is believed to control the expression of the ser(2003) locus in Bifidobacterium breve UCC2003. The ser(2003) locus consists of two genes, Bbr_1319 (sagA) and Bbr_1320 (serU), which are predicted to encode a hypothetical membrane-associated protein and a serpin-like protein, respectively. The response regulator SerR was shown to bind to the promoter region of ser(2003), and the probable recognition sequence of SerR was determined by a combinatorial approach of in vitro site-directed mutagenesis coupled to transcriptional fusion and electrophoretic mobility shift assays (EMSAs). The importance of the serRK 2CRS in the response of B. breve to protease-mediated induction was confirmed by generating a B. breve serR insertion mutant, which was shown to exhibit altered ser(2003) transcriptional induction patterns compared to the parent strain, UCC2003. Interestingly, the analysis of a B. breve serU mutant revealed that the SerRK signaling pathway appears to include a SerU-dependent autoregulatory loop.
Alvarez-Martin, Pablo; O'Connell Motherway, Mary; Turroni, Francesca; Foroni, Elena; Ventura, Marco
2012-01-01
This work reports on the identification and molecular characterization of a two-component regulatory system (2CRS), encoded by serRK, which is believed to control the expression of the ser2003 locus in Bifidobacterium breve UCC2003. The ser2003 locus consists of two genes, Bbr_1319 (sagA) and Bbr_1320 (serU), which are predicted to encode a hypothetical membrane-associated protein and a serpin-like protein, respectively. The response regulator SerR was shown to bind to the promoter region of ser2003, and the probable recognition sequence of SerR was determined by a combinatorial approach of in vitro site-directed mutagenesis coupled to transcriptional fusion and electrophoretic mobility shift assays (EMSAs). The importance of the serRK 2CRS in the response of B. breve to protease-mediated induction was confirmed by generating a B. breve serR insertion mutant, which was shown to exhibit altered ser2003 transcriptional induction patterns compared to the parent strain, UCC2003. Interestingly, the analysis of a B. breve serU mutant revealed that the SerRK signaling pathway appears to include a SerU-dependent autoregulatory loop. PMID:22843530
Transcriptional regulation of the Borrelia burgdorferi antigenically variable VlsE surface protein.
Bykowski, Tomasz; Babb, Kelly; von Lackum, Kate; Riley, Sean P; Norris, Steven J; Stevenson, Brian
2006-07-01
The Lyme disease agent Borrelia burgdorferi can persistently infect humans and other animals despite host active immune responses. This is facilitated, in part, by the vls locus, a complex system consisting of the vlsE expression site and an adjacent set of 11 to 15 silent vls cassettes. Segments of nonexpressed cassettes recombine with the vlsE region during infection of mammalian hosts, resulting in combinatorial antigenic variation of the VlsE outer surface protein. We now demonstrate that synthesis of VlsE is regulated during the natural mammal-tick infectious cycle, being activated in mammals but repressed during tick colonization. Examination of cultured B. burgdorferi cells indicated that the spirochete controls vlsE transcription levels in response to environmental cues. Analysis of PvlsE::gfp fusions in B. burgdorferi indicated that VlsE production is controlled at the level of transcriptional initiation, and regions of 5' DNA involved in the regulation were identified. Electrophoretic mobility shift assays detected qualitative and quantitative changes in patterns of protein-DNA complexes formed between the vlsE promoter and cytoplasmic proteins, suggesting the involvement of DNA-binding proteins in the regulation of vlsE, with at least one protein acting as a transcriptional activator.
Herrera, M. Carmen; Daddaoua, Abdelali; Fernández-Escamilla, Ana
2012-01-01
The phhAB operon encodes a phenylalanine hydroxylase involved in the conversion of l-phenylalanine into l-tyrosine in Pseudomonas putida. The phhAB promoter is transcribed by RNA polymerase sigma-70 and is unusual in that the specific regulator PhhR acts as an enhancer protein that binds to two distant upstream sites (−75 to −92 and −132 to −149). There is an integration host factor (IHF) binding site that overlaps the proximal PhhR box, and, consequently, IHF acts as an inhibitor of transcription. Use of l-phenylalanine is compromised in a crp-deficient background due to reduced expression from the phhAB promoter. Electrophoretic mobility shift assays and DNase I footprinting assays reveal that Crp binds at a site centered at −109 only in the presence of cyclic AMP (cAMP). We show, using circular permutation analysis, that the simultaneous binding of Crp/cAMP and PhhR bends DNA to bring positive regulators and RNA polymerase into close proximity. This nucleoprotein complex promotes transcription from phhA only in response to l-phenylalanine. PMID:22081386
Physicochemical characterization of native and modified sodium caseinate- Vitamin A complexes.
Gupta, Chitra; Arora, Sumit; Syama, M A; Sharma, Apurva
2018-04-01
Native and modified sodium caseinate- Vitamin A complexes {Sodium caseinate- Vit A complex by stirring (NaCas-VA ST), succinylated sodium caseinate- Vit A complex by stirring (SNaCas-VA ST), reassembled sodium caseinate- Vit A complex (RNaCas-VA) and reassembled succinylated sodium caseinate- Vit A complex (RSNaCas-VA)} were prepared and characterized for their physicochemical characteristics e.g. particle size, zeta potential, turbidity analysis and tryptophan intensities which confirmed structural modification of both native (NaCas-VA ST) and modified (SNaCas-VA ST, RNaCas-VA and RSNaCas- VA) proteins upon complex formation with vitamin A. Binding of vitamin A to milk protein reduced the turbidity caused by vitamin A, however, the particle size and zeta potential of milk protein increased after complexation. Microstructure details of NaCas (spray dried) showed uniform spherical structure, however, other milk proteins and milk protein- Vit A complexes (freeze dried) showed broken glass and flaky structures. Tiny particles were observed on the surface of reassembled protein and reassembled protein- Vit A complexes. Binding of vitamin A to milk protein did not have an influence on the electrophoretic mobility and elution profile (RP-HPLC). Copyright © 2018 Elsevier Ltd. All rights reserved.
Yu, Xuefei; Zheng, Wei; Bhat, Somanath; Aquilina, J. Andrew
2015-01-01
Bacillus sp. CDB3 possesses a novel eight-gene ars cluster (ars1, arsRYCDATorf7orf8) with some unusual features in regard to expression regulation. This study demonstrated that the cluster is a single operon but can also produce a short three-gene arsRYC transcript. A hairpin structure formed by internal inverted repeats between arsC and arsD was shown to diminish the expression of the full operon, thereby probably acting as a transcription attenuator. A degradation product of the arsRYC transcript was also identified. Electrophoretic mobility shift analysis demonstrated that ArsR interacts with the ars1 promoter forming a protein-DNA complex that could be impaired by arsenite. However, no interaction was detected between ArsD and the ars1 promoter, suggesting that the CDB3 ArsD protein may not play a regulatory role. Compared to other ars gene clusters, regulation of the Bacillus sp. CDB3 ars1 operon is more complex. It represents another example of specific mRNA degradation in the transporter gene region and possibly the first case of attenuator-mediated regulation of ars operons. PMID:26355338
Tilted hexagonal post arrays: DNA electrophoresis in anisotropic media.
Chen, Zhen; Dorfman, Kevin D
2014-02-01
Using Brownian dynamics simulations, we show that DNA electrophoresis in a hexagonal array of micron-sized posts changes qualitatively when the applied electric field vector is not coincident with the lattice vectors of the array. DNA electrophoresis in such "tilted" post arrays is superior to the standard "un-tilted" approach; while the time required to achieve a resolution of unity in a tilted post array is similar to an un-tilted array at a low-electric field strengths, this time (i) decreases exponentially with electric field strength in a tilted array and (ii) increases exponentially with electric field strength in an un-tilted array. Although the DNA dynamics in a post array are complicated, the electrophoretic mobility results indicate that the "free path," i.e. the average distance of ballistic trajectories of point-sized particles launched from random positions in the unit cell until they intersect the next post, is a useful proxy for the detailed DNA trajectories. The analysis of the free path reveals a fundamental connection between anisotropy of the medium and DNA transport therein that goes beyond simply improving the separation device. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Balani, Valério Américo; de Lima Neto, Quirino Alves; Takeda, Karen Izumi; Gimenes, Fabrícia; Fiorini, Adriana; Debatisse, Michelle; Fernandez, Maria Aparecida
2010-11-01
The aim of this work was to determine whether intrinsically bent DNA sites are present at, or close to, the mammalian replication origins oriGNAI3 and oriB in the Chinese hamster AMPD2 locus. Using an electrophoretic mobility shift assay and in silico analysis, we located four intrinsically bent DNA sites (b1 to b4) in a fragment that contains the oriGNAI3 and one site (b5) proximal to oriB. The helical parameters show that each bent DNA site is curved in a left-handed superhelical writhe. A 2D projection of 3D fragment trajectories revealed that oriGNAI3 is located in a relatively straight segment flanked by bent sites b1 and b2, which map in previously identified Scaffold/Matrix Attachment Region. Sites b3 and b4 are located approximately 2 kb downstream and force the fragment into a strong closed loop structure. The b5 site is also located in an S/MAR that is found just downstream of oriB.
Shi, Y Y; Li, M; Liu, Q; Jia, Z J; Xu, X C; Cheng, Y; Zheng, Y F
2016-03-01
Electrophoretic deposition (EPD) is a facile and feasible technique to prepare functional nanocomposite coatings for application in orthopedic-related implants. In this work, a ternary graphene oxide-chitosan-hydroxyapatite (GO-CS-HA) composite coating on Ti substrate was successfully fabricated by EPD. Coating microstructure and morphologies were investigated by scanning electron microscopy, contact angle test, Raman spectroscopy, Fourier transform infrared spectroscopy and thermogravimetric analysis. It was found GO-CS surface were uniformly decorated by HA nanoparticles. The potentiodynamic polarization test in simulated body fluid indicated that the GO-CS-HA coatings could provide effective protection of Ti substrate from corrosion. This ternary composite coating also exhibited good biocompatibility during incubation with MG63 cells. In addition, the nanocomposite coatings could decrease the attachment of Staphylococcus aureus.
Cernohorsky, Ondrej; Grym, Jan; Yatskiv, Roman; ...
2016-08-13
We report on the formation of Pt nanoparticle monolayers by electrophoretic deposition from nonpolar solvents. First, the growth kinetics of Pt nanoparticles prepared by the reverse micelle technique are described in detail. Second, a model of nanoparticle charging in nonpolar media is discussed and methods to control the nanoparticle charging are proposed. Lastly, essential parameters of the electrophoretic deposition process to control the deposition of nanoparticle monolayers are discussed and mechanisms of their formation are analyzed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cernohorsky, Ondrej; Grym, Jan; Yatskiv, Roman
We report on the formation of Pt nanoparticle monolayers by electrophoretic deposition from nonpolar solvents. First, the growth kinetics of Pt nanoparticles prepared by the reverse micelle technique are described in detail. Second, a model of nanoparticle charging in nonpolar media is discussed and methods to control the nanoparticle charging are proposed. Lastly, essential parameters of the electrophoretic deposition process to control the deposition of nanoparticle monolayers are discussed and mechanisms of their formation are analyzed.
CAPILLARY ELECTROPHORETIC BEHAVIOR OF SEVEN SULFONYLUREAS
The electrophoretic behavior of bensulfuron Me, sulfometuron Me, nicosulfuron (Accent), chlorimuron Et, thifensulfuron Me (Harmony), metsulfuron Me, and chlorsulfuron was studied under capillary zone electrophoresis (CZE) and micellar electrokinetic chromatography (MEKC) conditio...
Transport, manipulation, and reaction of biological cells on-chip using electrokinetic effects.
Li, P C; Harrison, D J
1997-04-15
A microfluidic system was fabricated on a glass chip to study mobilization of biological cells on-chip. Electroosmotic and/or electrophoretic pumping were used to drive the cell transport within a network of capillary channels. Whole cells such as Saccharomyces cerevisiae, canine erythrocyte, and Escherichia coli were employed in this work. Photographs are presented to illustrate how cells are selected and transported from one location to another within the capillary network, with velocities up to about 0.5 mm/s in capillaries with a 15- x 55-microns cross section. The mixing of canine erythrocytes with the lysing agent sodium dodecyl sulfate, at an intersection within the chip, was performed to demonstrate that cell selection and subsequent reaction can be accomplished within the microchip.
PURIFICATION OF THE SOLUBLE HEMOLYSINS OF LISTERIA MONOCYTOGENES
Jenkins, E. M.; Njoku-Obi, A. N.; Adams, E. W.
1964-01-01
Jenkins, E. M. (Tuskegee Institute, Tuskegee, Ala.), A. N. Njoku-Obi, and E. W. Adams. Purification of the soluble hemolysins of Listeria monocytogenes. J. Bacteriol. 88:418–424. 1964.—A method is described for obtaining relatively purified hemolysin preparations from both virulent and avirulent strains of Listeria monocytogenes. These hemolysins are protein in nature as shown by heat lability, nondialyzable properties, precipitation with trichloroacetic acid, and electrophoretic mobility. The hemolysins are antigenic in rabbits as shown by serum neutralization tests. The potency of the purified hemolysin was markedly increased by cysteine, sodium hydrosulfite, and a number of reducing agents. Many of the actions of the purified hemolysin seemed to parallel that of streptolysin O, and certain of these activities could be explained by the “thioldisulfide hypothesis.” PMID:14203359
Hattori, Toshiaki; Anraku, Nobuhiro; Kato, Ryo
2010-02-01
Five chitosan oligosaccharides were separated in acidic aqueous solution by capillary electrophoresis (CE) with indirect photometric detection using a positively coated capillary. Electrophoretic mobility of the chitooligosaccharides (COSs) depended on the number of monomer units in acidic aqueous solution, similar to other polyelectrolyte oligomers. The separation was developed in nitric acid aqueous solution at pH 3.0 with 1 mM Crystal Violet, using a capillary positively coated with N-trimethoxypropyl-N,N,N-trimethylammonium chloride. The limit of the detection for chitooligosaccharides with two to six saccharide chains was less than 5 microM. CE determination of an enzymatically hydrolyzed COS agreed with results from HPLC. 2009 Elsevier B.V. All rights reserved.
Singh, Narendra P; Singh, Udai P; Nagarkatti, Prakash S; Nagarkatti, Mitzi
2012-11-01
Prenatal exposure to diethylstilbestrol (DES) is known to cause altered immune functions and increased susceptibility to autoimmune disease in humans. In the current study, we investigated the effect of prenatal exposure to DES on thymocyte differentiation involving apoptotic pathways. Prenatal DES exposure caused thymic atrophy, apoptosis, and up-regulation of Fas and Fas ligand (FasL) expression in thymocytes. To examine the mechanism underlying DES-mediated regulation of Fas and FasL, we performed luciferase assays using T cells transfected with luciferase reporter constructs containing full-length Fas or FasL promoters. There was significant luciferase induction in the presence of Fas or FasL promoters after DES exposure. Further analysis demonstrated the presence of several cis-regulatory motifs on both Fas and FasL promoters. When DES-induced transcription factors were analyzed, estrogen receptor element (ERE), nuclear factor κB (NF-κB), nuclear factor of activated T cells (NF-AT), and activator protein-1 motifs on the Fas promoter, as well as ERE, NF-κB, and NF-AT motifs on the FasL promoter, showed binding affinity with the transcription factors. Electrophoretic mobility-shift assays were performed to verify the binding affinity of cis-regulatory motifs of Fas or FasL promoters with transcription factors. There was shift in mobility of probes (ERE or NF-κB2) of both Fas and FasL in the presence of nuclear proteins from DES-treated cells, and the shift was specific to DES because these probes failed to shift their mobility in the presence of nuclear proteins from vehicle-treated cells. Together, the current study demonstrates that prenatal exposure to DES triggers significant alterations in apoptotic molecules expressed on thymocytes, which may affect T-cell differentiation and cause long-term effects on the immune functions.
Singh, Narendra P.; Singh, Udai P.; Nagarkatti, Prakash S.
2012-01-01
Prenatal exposure to diethylstilbestrol (DES) is known to cause altered immune functions and increased susceptibility to autoimmune disease in humans. In the current study, we investigated the effect of prenatal exposure to DES on thymocyte differentiation involving apoptotic pathways. Prenatal DES exposure caused thymic atrophy, apoptosis, and up-regulation of Fas and Fas ligand (FasL) expression in thymocytes. To examine the mechanism underlying DES-mediated regulation of Fas and FasL, we performed luciferase assays using T cells transfected with luciferase reporter constructs containing full-length Fas or FasL promoters. There was significant luciferase induction in the presence of Fas or FasL promoters after DES exposure. Further analysis demonstrated the presence of several cis-regulatory motifs on both Fas and FasL promoters. When DES-induced transcription factors were analyzed, estrogen receptor element (ERE), nuclear factor κB (NF-κB), nuclear factor of activated T cells (NF-AT), and activator protein-1 motifs on the Fas promoter, as well as ERE, NF-κB, and NF-AT motifs on the FasL promoter, showed binding affinity with the transcription factors. Electrophoretic mobility-shift assays were performed to verify the binding affinity of cis-regulatory motifs of Fas or FasL promoters with transcription factors. There was shift in mobility of probes (ERE or NF-κB2) of both Fas and FasL in the presence of nuclear proteins from DES-treated cells, and the shift was specific to DES because these probes failed to shift their mobility in the presence of nuclear proteins from vehicle-treated cells. Together, the current study demonstrates that prenatal exposure to DES triggers significant alterations in apoptotic molecules expressed on thymocytes, which may affect T-cell differentiation and cause long-term effects on the immune functions. PMID:22888145
Zeng, Nina; D'Souza, Randall F; Mitchell, Cameron J; Cameron-Smith, David
2018-05-08
A gradual loss of skeletal muscle mass is a common feature of aging, leading to impaired insulin sensitivity and mobility. Sestrin1, 2, 3 are multifunctional proteins that regulate the mammalian target of rapamycin complex (mTORC1), autophagy and redox homeostasis. It is unclear how aging affects Sestrins and their downstream targets in human, therefore this study examined the basal expression of Sestrins in three age groups, young, middle-aged and older men and explored the mTORC1 pathway, autophagy markers and antioxidant regulation. Older men had less Sestrin1 and 3 protein and a different pattern of Sestrin2 electrophoretic mobility. The mRNA expression of SESN1 was highly upregulated in older men, but the discrepancy was not by microRNA expression. Although protein expressions of Sestrins were downregulated with aging, phosphorylation of AMP-dependent protein kinase (AMPKα Thr172 ) and read-outs of mTORC1 activation, ribosomal protein S6 kinase 1 (p70S6K1 Thr421/Ser424 ) and 4E-binding protein 1 (4E-BP1) mobility shift were unaltered. However, total p70S6K1 and 4E-BP1 were reduced in middle-age and older men. The mRNA expressions of autophagic markers including microtubule-associated protein 1 light chain 3 (LC3) and BCL2 interacting protein 3 (BNIP3) were upregulated in middle-age and older men. Although nuclear factor (erythroid-derived 2)-like 2 (Nrf2) was upregulated in older men, the protein and mRNA expressions of its downstream antioxidants were either increased, decreased or unaltered. No clear relationship was observed between Sestrins and their downstream targets, yet it can be concluded that Sestrins proteins are clearly downregulated with aging. Copyright © 2017. Published by Elsevier Inc.
Analyte concentration at the tip of a nanopipette.
Calander, Nils
2009-10-15
Concentration of molecules within the tips of nanopipettes when applying a DC voltage is herein investigated using finite-element simulations. The ion concentrations and fluxes due to diffusion, electro-migration, and electro-osmotic flow, and the electric potential are determined by the simultaneous solution of the Nernst-Planck, Poisson, and Navier-Stokes equations within the water solution containing sodium and chloride ions and negatively charged molecules. The electric potential within the pipette glass wall is at the same time determined by the Poisson equation together with appropriate boundary conditions and accounts for a field effect through the wall. Fixed negative surface charge on both the internal and external glass surfaces of the nanopipette is included together with the field effect through the glass wall to account for the electric double layer and the electro-osmosis. The inclusion of the field effect through the pipette wall is new compared to previous modeling of similar structures and is shown to be crucial for the behavior at the tip. It is demonstrated that the concentration of molecules is a consequence of ionic charge accumulation at the tip screening the electric field, thereby slowing down the electrophoretic motion of the molecules, which is further slowed down or stopped by the oppositely directed electro-osmosis. It is also shown that the trapping is very sensitive to the properties of the molecule, that is, its electrophoretic mobility and diffusion coefficient, the properties of the pipette, the ionic strength of the solution, and the applied electric field.
Matussek, K; Moritz, P; Brunner, N; Eckerskorn, C; Hensel, R
1998-11-01
Cyclic 2,3-diphosphoglycerate synthetase (cDPGS) catalyzes the synthesis of cyclic 2,3-diphosphoglycerate (cDPG) by formation of an intramolecular phosphoanhydride bond in 2,3-diphosphoglycerate. cDPG is known to be accumulated to high intracellular concentrations (>300 mM) as a putative thermoadapter in some hyperthermophilic methanogens. For the first time, we have purified active cDPGS from a methanogen, the hyperthermophilic archaeon Methanothermus fervidus, sequenced the coding gene, and expressed it in Escherichia coli. cDPGS purification resulted in enzyme preparations containing two isoforms differing in their electrophoretic mobility under denaturing conditions. Since both polypeptides showed the same N-terminal amino acid sequence and Southern analyses indicate the presence of only one gene coding for cDPGS in M. fervidus, the two polypeptides originate from the same gene but differ by a not yet identified modification. The native cDPGS represents a dimer with an apparent molecular mass of 112 kDa and catalyzes the reversible formation of the intramolecular phosphoanhydride bond at the expense of ATP. The enzyme shows a clear preference for the synthetic reaction: the substrate affinity and the Vmax of the synthetic reaction are a factor of 8 to 10 higher than the corresponding values for the reverse reaction. Comparison with the kinetic properties of the electrophoretically homogeneous, apparently unmodified recombinant enzyme from E. coli revealed a twofold-higher Vmax of the enzyme from M. fervidus in the synthesizing direction.
Predicting tensorial electrophoretic effects in asymmetric colloids
NASA Astrophysics Data System (ADS)
Mowitz, Aaron J.; Witten, T. A.
2017-12-01
We formulate a numerical method for predicting the tensorial linear response of a rigid, asymmetrically charged body to an applied electric field. This prediction requires calculating the response of the fluid to the Stokes drag forces on the moving body and on the countercharges near its surface. To determine the fluid's motion, we represent both the body and the countercharges using many point sources of drag known as Stokeslets. Finding the correct flow field amounts to finding the set of drag forces on the Stokeslets that is consistent with the relative velocities experienced by each Stokeslet. The method rigorously satisfies the condition that the object moves with no transfer of momentum to the fluid. We demonstrate that a sphere represented by 1999 well-separated Stokeslets on its surface produces flow and drag force like a solid sphere to 1% accuracy. We show that a uniformly charged sphere with 3998 body and countercharge Stokeslets obeys the Smoluchowski prediction [F. Morrison, J. Colloid Interface Sci. 34, 210 (1970), 10.1016/0021-9797(70)90171-2] for electrophoretic mobility when the countercharges lie close to the sphere. Spheres with dipolar and quadrupolar charge distributions rotate and translate as predicted analytically to 4% accuracy or better. We describe how the method can treat general asymmetric shapes and charge distributions. This method offers promise as a way to characterize and manipulate asymmetrically charged colloid-scale objects from biology (e.g., viruses) and technology (e.g., self-assembled clusters).
Johnson, D E; Brookhart, G L; Kramer, K J; Barnett, B D; McGaughey, W H
1990-03-01
Midgut homogenates from susceptible and resistant strains of the Indian meal moth, Plodia interpunctella, were compared for their ability to activate the entomocidal parasporal crystal protein from Bacillus thuringiensis. The properties of midgut proteinases from both types of larvae were also examined. Electrophoretic patterns of crystal protein from B. thuringiensis subspecies kurstaki (HD-1) and aizawai (HD-133 and HD-144) were virtually unchanged following digestion by either type of midgut homogenate. Changes in pH (9.5 to 11.5) or midgut homogenate concentration during digestion failed to substantially alter protein electrophoretic patterns of B. thuringiensis HD-1 crystal toxin. In vitro toxicity of crystal protein activated by either type of midgut preparation was equal toward cultured insect cells from either Manduca sexta or Choristoneura fumiferana. Electrophoresis of midgut extracts in polyacrylamide gels containing gelatin as substrate also yielded matching mobility patterns of proteinases from both types of midguts. Quantitation of midgut proteolytic activity using tritiated casein as a substrate revealed variation between midgut preparations, but no statistically significant differences between proteolytic activities from susceptible and resistant Indian meal moth larvae. Inhibition studies indicated that a trypsin-like proteinase with maximal activity at pH 10 is a major constituent of Indian meal moth midguts. The results demonstrated that midguts from susceptible and resistant strains of P. interpunctella are similar both in their ability to activate B. thuringiensis protoxin and in their proteolytic activity.
Kuwae, T; Andoh, M; Fukasawa, S; Kurata, M
1983-01-01
In order to investigate the relationship between host and symbiosis in the luminous marine fish, Physiculus japonicus, the bacterial lipopolysaccharides (LPS) of symbiotic luminous bacteria were compared serologically and electrophoretically. Five symbiotic luminous bacteria (PJ strains) were separately isolated from five individuals of this fish species caught at three points, off the coasts of Chiba, Nakaminato, and Oharai. LPS preparations were made from these bacteria by Westphal's phenol-water method and highly purified by repeated ultracentrifugation. These LPSs contained little or no 2-keto-3-deoxyoctonate and had powerful mitogenic activity. In sodium dodecylsulfate polyacrylamide gel electrophoresis, these PJ-1 to -5 LPSs were separated by their electrophoretic patterns into three groups; the first group included PJ-1 and PJ-4, the second group PJ-2 and PJ-3, and the third group PJ-5 alone. The results agreed with those of the double immunodiffusion test; precipitin lines completely coalesced within each group but not with other groups. In immunoelectrophoresis, one precipitin line was observed between anti PJ-2 LPS serum and PJ-5 LPS but the electrophoretic mobility of PJ-5 LPS was clearly different from that of the PJ-2 LPS group. Furthermore, in a 50% inhibition test with PJ-2 LPS by the passive hemolysis system, the doses of PJ-2 LPS, PJ-3 LPS, and PJ-5 LPS required for 50% inhibition (ID50) in this system were 0.25, 0.25, and 21.6 micrograms/ml for each alkali-treated LPS, respectively, and the ID50's of both PJ-1 LPS and PJ-4 LPS were above 1,000 micrograms/ml. These results indicate that PJ-5 LPS has an antigenic determinant partially in common with LPS from the PJ-2 group but not with LPS from the PJ-1 group and that the symbiotic luminous bacterium PJ-5 is more closely related to the PJ-2 group than to the PJ-1 group. These results show that the species Physiculus japonicus is symbiotically associated with at least three immunologically different strains of luminous marine bacteria in its specialized light organ.
Liu, Rongfeng; Liu, Yu-Chih; Meng, Junwei; Zhu, Haiyan; Zhang, Xuehong
2017-11-01
The β-secretase (BACE1) initiates the generation of toxic amyloid-β peptide (Aβ) from amyloid-β precursor protein (APP), which was widely considered to play a key role in the pathogenesis of Alzheimer's disease (AD). Here, a novel microfluidics-based mobility shift assay (MMSA) was developed, validated, and applied for the screening of BACE1 inhibitors for AD. First, the BACE1 activity assay was established with a new fluorescent peptide substrate (FAM-EVNLDAEF) derived from the Swedish mutant APP, and high-quality ratiometric data were generated in both endpoint and kinetic modes by electrophoretic separation of peptide substrate from the BACE1 cleaved product (FAM-EVNL) before fluorescence quantification. To validate the assay, the inhibition and kinetic parameter values of two known inhibitors (AZD3839 and AZD3293) were evaluated, and the results were in good agreement with those reported by other methods. Finally, the assay was applied to screen for new inhibitors from a 900-compound library in a 384-well format, and one novel hit (IC 50 = 26.5 ± 1.5 μM) was identified. Compared with the common fluorescence-based assays, the primary advantage of the direct MMSA was to discover novel BACE1 inhibitors with lower auto-fluorescence interference, and its superb capability for kinetic study. Graphical abstract Microfluidics-based mobility shift assay for BACE1.
Recent advances in capillary electrophoretic migration techniques for pharmaceutical analysis.
Deeb, Sami El; Wätzig, Hermann; El-Hady, Deia Abd; Albishri, Hassan M; de Griend, Cari Sänger-van; Scriba, Gerhard K E
2014-01-01
Since the introduction about 30 years ago, CE techniques have gained a significant impact in pharmaceutical analysis. The present review covers recent advances and applications of CE for the analysis of pharmaceuticals. Both small molecules and biomolecules such as proteins are considered. The applications range from the determination of drug-related substances to the analysis of counterions and the determination of physicochemical parameters. Furthermore, general considerations of CE methods in pharmaceutical analysis are described. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Molecular cloning and characterization of the promoter region of the porcine apolipoprotein E gene.
Xia, Jihan; Hu, Bingjun; Mu, Yulian; Xin, Leilei; Yang, Shulin; Li, Kui
2014-05-01
Apolipoprotein E (APOE), a component of lipoproteins plays an important role in the transport and metabolism of cholesterol, and is associated with hyperlipoproteinemia and Alzheimer's disease. In order to further understand the characterization of APOE gene, the promoter of APOE gene of Landrace pigs was analyzed in the present study. The genomic structure and amino acid sequence in pigs were analyzed and found to share high similarity in those of human but low similarity in promoter region. Real-time PCR revealed the APOE gene expression pattern of pigs in diverse tissues. The highest expression level was observed in liver, relatively low expression in other tissues, especially in stomach and muscle. Furthermore, the promoter expressing in Hepa 1-6 was significantly better at driving luciferase expression compared with C2C12 cell. After analysis of porcine APOE gene promoter regions, potential transcription factor binding sites were predicted and two GC signals, a TATA box were indicated. Results of promoter activity analysis indicated that one of potential regulatory elements was located in the region -669 to -259, which was essential for a high expression of the APOE gene. Promoter mutation and deletion analysis further suggested that the C/EBPA binding site within the APOE promoter was responsible for the regulation of APOE transcription. Electrophoretic mobility shift assays also showed the binding site of the transcription factor C/EBPA. This study advances our knowledge of the promoter of the porcine APOE gene.
Nadai, Matteo; Palù, Giorgio; Palumbo, Manlio; Richter, Sara N.
2012-01-01
Non-canonical DNA structures have been postulated to mediate protein-nucleic acid interactions and to function as intermediates in the generation of frame-shift mutations when errors in DNA replication occur, which result in a variety of diseases and cancers. Compounds capable of binding to non-canonical DNA conformations may thus have significant diagnostic and therapeutic potential. Clerocidin is a natural diterpenoid which has been shown to selectively react with single-stranded bases without targeting the double helix. Here we performed a comprehensive analysis on several non-canonical DNA secondary structures, namely mismatches, nicks, bulges, hairpins, with sequence variations in both the single-stranded region and the double-stranded flanking segment. By analysis of clerocidin reactivity, we were able to identify the exposed reactive residues which provided information on both the secondary structure and the accessibility of the non-paired sites. Mismatches longer than 1 base were necessary to be reached by clerocidin reactive groups, while 1-base nicks were promptly targeted by clerocidin; in hairpins, clerocidin reactivity increased with the length of the hairpin loop, while, interestingly, reactivity towards bulges reached a maximum in 3-base-long bulges and declined in longer bulges. Electrophoretic mobility shift analysis demonstrated that bulges longer than 3 bases (i.e. 5- and 7-bases) folded or stacked on the duplex region therefore being less accessible by the compound. Clerocidin thus represents a new valuable diagnostic tool to dissect DNA secondary structures. PMID:23285245
Nadai, Matteo; Palù, Giorgio; Palumbo, Manlio; Richter, Sara N
2012-01-01
Non-canonical DNA structures have been postulated to mediate protein-nucleic acid interactions and to function as intermediates in the generation of frame-shift mutations when errors in DNA replication occur, which result in a variety of diseases and cancers. Compounds capable of binding to non-canonical DNA conformations may thus have significant diagnostic and therapeutic potential. Clerocidin is a natural diterpenoid which has been shown to selectively react with single-stranded bases without targeting the double helix. Here we performed a comprehensive analysis on several non-canonical DNA secondary structures, namely mismatches, nicks, bulges, hairpins, with sequence variations in both the single-stranded region and the double-stranded flanking segment. By analysis of clerocidin reactivity, we were able to identify the exposed reactive residues which provided information on both the secondary structure and the accessibility of the non-paired sites. Mismatches longer than 1 base were necessary to be reached by clerocidin reactive groups, while 1-base nicks were promptly targeted by clerocidin; in hairpins, clerocidin reactivity increased with the length of the hairpin loop, while, interestingly, reactivity towards bulges reached a maximum in 3-base-long bulges and declined in longer bulges. Electrophoretic mobility shift analysis demonstrated that bulges longer than 3 bases (i.e. 5- and 7-bases) folded or stacked on the duplex region therefore being less accessible by the compound. Clerocidin thus represents a new valuable diagnostic tool to dissect DNA secondary structures.
Poe, Bobby G; Navratil, Marian; Arriaga, Edgar A
2006-12-29
Flow cytometry (FCM) and more recently capillary electrophoresis with post-column laser-induced fluorescence detection (CE-LIF) have both been used for subcellular particle analysis but their analytical performance has not been compared. In this work, we compare a commercial FCM with an in-house built CE-LIF instrument using fluorescently labeled microspheres and isolated mitochondria. As evidenced by the relative standard deviation (RSD) of the individual fluorescence intensities, FCM is two-fold better than CE-LIF for microspheres with > or =1.5 x 10(6) molecules of equivalent soluble fluorescein (MESF). However, FCM has a comparatively low signal-to-noise ratio (S/N) and high RSD for microspheres with <1.5 x 10(6) MESF. CE-LIF, on the other hand, produces S/N ratios that are >25 times higher than FCM for all the microspheres tested and a lower RSD for microspheres with <1.5 x 10(6) MESF. When 10-N-nonyl acridine orange (NAO)-labeled mitochondria are analyzed, the S/N ratios of both techniques are similar. This appears to result from photobleaching of NAO-labeled mitochondria as they are detected by the LIF detector of the CE-LIF instrument. Both techniques have a niche in subcellular analysis; FCM has the advantage of collecting data for thousands of particles quickly, whereas CE-LIF consumes less than a nanoliter of sample and provides the electrophoretic mobility for individual particles.
De Clercq, Inge; Vermeirssen, Vanessa; Van Aken, Olivier; Vandepoele, Klaas; Murcha, Monika W.; Law, Simon R.; Inzé, Annelies; Ng, Sophia; Ivanova, Aneta; Rombaut, Debbie; van de Cotte, Brigitte; Jaspers, Pinja; Van de Peer, Yves; Kangasjärvi, Jaakko; Whelan, James; Van Breusegem, Frank
2013-01-01
Upon disturbance of their function by stress, mitochondria can signal to the nucleus to steer the expression of responsive genes. This mitochondria-to-nucleus communication is often referred to as mitochondrial retrograde regulation (MRR). Although reactive oxygen species and calcium are likely candidate signaling molecules for MRR, the protein signaling components in plants remain largely unknown. Through meta-analysis of transcriptome data, we detected a set of genes that are common and robust targets of MRR and used them as a bait to identify its transcriptional regulators. In the upstream regions of these mitochondrial dysfunction stimulon (MDS) genes, we found a cis-regulatory element, the mitochondrial dysfunction motif (MDM), which is necessary and sufficient for gene expression under various mitochondrial perturbation conditions. Yeast one-hybrid analysis and electrophoretic mobility shift assays revealed that the transmembrane domain–containing NO APICAL MERISTEM/ARABIDOPSIS TRANSCRIPTION ACTIVATION FACTOR/CUP-SHAPED COTYLEDON transcription factors (ANAC013, ANAC016, ANAC017, ANAC053, and ANAC078) bound to the MDM cis-regulatory element. We demonstrate that ANAC013 mediates MRR-induced expression of the MDS genes by direct interaction with the MDM cis-regulatory element and triggers increased oxidative stress tolerance. In conclusion, we characterized ANAC013 as a regulator of MRR upon stress in Arabidopsis thaliana. PMID:24045019
Nguyen, Tinh T.; Martí-Arbona, Ricardo; Hall, Richard S.; ...
2013-05-21
Transcriptional regulators (TRs) are an important and versatile group of proteins, yet very little progress has been achieved towards the discovery and annotation of their biological functions. We have characterized a previously unknown organic hydroperoxide resistance regulator from Burkholderia xenovoransLB400, Bxe_B2842, which is homologous to E. coli’s OhrR. Bxe_B2842 regulates the expression of an organic hydroperoxide resistance protein (OsmC). We utilized frontal affinity chromatography coupled with mass spectrometry (FAC-MS) and electrophoretic mobility gel shift assays (EMSA) to identify and characterize the possible effectors of the regulation by Bxe_B2842. Without an effector, Bxe_B2842 binds a DNA operator sequence (DOS) upstream ofmore » osmC. FAC-MS results suggest that 2-aminophenol binds to the protein and is potentially an effector molecule. EMSA analysis shows that 2-aminophenol also attenuates the Bxe_B2842’s affinity for its DOS. EMSA analysis also shows that organic peroxides attenuate Bxe_B2842/DOS affinity, suggesting that binding of the TR to its DOS is regulated by the two-cysteine mechanism, common to TRs in this family. Bxe_B2842 is the first OhrR TR to have both oxidative and effector-binding mechanisms of regulation. Our paper reveals further mechanistic diversity TR mediated gene regulation and provides insights into methods for function discovery of TRs.« less
Boulnois, G J; Roberts, I S; Hodge, R; Hardy, K R; Jann, K B; Timmis, K N
1987-06-01
Transposon and deletion analysis of the cloned K1 capsule biosynthesis genes of Escherichia coli revealed that approximately 17 kb of DNA, split into three functional regions, is required for capsule production. One block (region 1) is required for translocation of polysaccharide to the cell surface and mutations in this region result in the intracellular appearance of polymer indistinguishable on immunoelectrophoresis to that found on the surface of K1 encapsulated bacteria. This material was released from the cell by osmotic shock indicating that the polysaccharide was probably present in the periplasmic space. Insertions in a second block (region 2) completely abolished polymer production and this second region is believed to encode the enzymes for the biosynthesis and polymerisation of the K1 antigen. Addition of exogenous N-acetylneuraminic acid to one insertion mutant in this region restored its ability to express surface polymer as judged by K1 phage sensitivity. This insertion probably defines genes involved in biosynthesis of N-acetylneuraminic acid. Insertions in a third block (region 3) result in the intracellular appearance of polysaccharide with a very low electrophoretic mobility. The presence of the cloned K1 capsule biosynthesis genes on a multicopy plasmid in an E. coli K-12 strain did not increase the yields of capsular polysaccharide produced compared to the K1+ isolate from which the genes were cloned.
Nuclear factors that bind to the enhancer region of nondefective Friend murine leukemia virus.
Manley, N R; O'Connell, M A; Sharp, P A; Hopkins, N
1989-01-01
Nondefective Friend murine leukemia virus (MuLV) causes erythroleukemia when injected into newborn NFS mice, while Moloney MuLV causes T-cell lymphoma. Exchange of the Friend virus enhancer region, a sequence of about 180 nucleotides including the direct repeat and a short 3'-adjacent segment, for the corresponding region in Moloney MuLV confers the ability to cause erythroid disease on Moloney MuLV. We have used the electrophoretic mobility shift assay and methylation interference analysis to identify cellular factors which bind to the Friend virus enhancer region and compared these with factors, previously identified, that bind to the Moloney virus direct repeat (N. A. Speck and D. Baltimore, Mol. Cell. Biol. 7:1101-1110, 1987). We identified five binding sites for sequence-specific DNA-binding proteins in the Friend virus enhancer region. While some binding sites are present in both the Moloney and Friend virus enhancers, both viruses contain unique sites not present in the other. Although none of the factors identified in this report which bind to these unique sites are present exclusively in T cells or erythroid cells, they bind to three regions of the enhancer shown by genetic analysis to encode disease specificity and thus are candidates to mediate the tissue-specific expression and distinct disease specificities encoded by these virus enhancer elements. Images PMID:2778872
LmaPA2G4, a Homolog of Human Ebp1, Is an Essential Gene and Inhibits Cell Proliferation in L. major
Joyce, Michelle V.; Morales, Miguel A.
2014-01-01
We have identified LmaPA2G4, a homolog of the human proliferation-associated 2G4 protein (also termed Ebp1), in a phosphoproteomic screening. Multiple sequence alignment and cluster analysis revealed that LmaPA2G4 is a non-peptidase member of the M24 family of metallopeptidases. This pseudoenzyme is structurally related to methionine aminopeptidases. A null mutant system based on negative selection allowed us to demonstrate that LmaPA2G4 is an essential gene in Leishmania major. Over-expression of LmaPA2G4 did not alter cell morphology or the ability to differentiate into metacyclic and amastigote stages. Interestingly, the over-expression affected cell proliferation and virulence in mouse footpad analysis. LmaPA2G4 binds a synthetic double-stranded RNA polyriboinosinic polyribocytidylic acid [poly(I∶C)] as shown in an electrophoretic mobility shift assay (EMSA). Quantitative proteomics revealed that the over-expression of LmaPA2G4 led to accumulation of factors involved in translation initiation and elongation. Significantly, we found a strong reduction of de novo protein biosynthesis in transgenic parasites using a non-radioactive metabolic labeling assay. In conclusion, LmaPA2G4 is an essential gene and is potentially implicated in fundamental biological mechanisms, such as translation, making it an attractive target for therapeutic intervention. PMID:24421916
USDA-ARS?s Scientific Manuscript database
Verification of the bio-content in bio-based or green products identifies genuine products, exposes counterfeit copies, supports or refutes content claims and ensures consumer confidence. When the bio-content includes protein, elemental nitrogen analysis is insufficient for verification since non-pr...
Genetic structure of populations and differentiation in forest trees
Raymond P. Guries; F. Thomas Ledig
1981-01-01
Electrophoretic techniques permit population biologists to analyze genetic structure of natural populations by using large numbers of allozyme loci. Several methods of analysis have been applied to allozyme data, including chi-square contingency tests, F-statistics, and genetic distance. This paper compares such statistics for pitch pine (Pinus rigida...
An analysis of genetic architecture in populations of Ponderosa Pine
Yan B. Linhart; Jeffry B. Mitton; Kareen B. Sturgeon; Martha L. Davis
1981-01-01
Patterns of genetic variation were studied in three populations of ponderosa pine in Colorado by using electrophoretically variable protein loci. Significant genetic differences were found between separate clusters of trees and between age classes within populations. In addition, data indicate that differential cone production and differential animal damage have...
Leone, Laura; Ferri, Diego; Manfredi, Carla; Persson, Per; Shchukarev, Andrei; Sjöberg, Staffan; Loring, John
2007-09-15
In this study, macroscopic and spectroscopic data were combined to develop a surface complexation model that describes the acid-base properties of Bacillus subtilis. The bacteria were freeze-dried and then resuspended in 0.1 M NaCl ionic medium. Macroscopic measurements included potentiometric acid-base titrations and electrophoretic mobility measurements. In addition, ATR-FTIR spectra of wet pastes from suspensions of Bacillus subtilis at different pH values were collected. The least-squares program MAGPIE was used to generate a surface complexation model that takes into account the presence of three acid-base sites on the surface: tripple bond COOH, tripple bond NH+, and tripple bond PO-, which were identified previously by XPS measurements. Both potentiometric titration data and ATR-FTIR spectra were used quantitatively, and electrostatic effects at the charged bacterial surface were accounted for using the constant capacitance model. The model was calculated using two different approaches: in the first one XPS data were used to constrain the ratio of the total concentrations of all three surface sites. The capacitance of the double layer, the total buffer capacity, and the deprotonation constants of the tripple bond NH+, tripple bond POH, and tripple bond COOH species were determined in the fit. A second approach is presented in which the ratio determined by XPS of the total concentrations of tripple bond NH+ to tripple bond PO- sites is relaxed. The total concentration of tripple bond PO- sites was determined in the fit, while the deprotonation constant for tripple bond POH was manually varied until the minimization led to a model which predicted an isoelectric point that resulted in consistency with electrophoretic mobility data. The model explains well the buffering capacity of Bacillus subtilis suspensions in a wide pH range (between pH=3 and pH=9) which is of considerable environmental interest. In particular, a similar quantitative use of the IR data opens up possibilities to model other bacterial surfaces at the laboratory scale and help estimate the buffering capacity of carboxylate-containing compounds in natural samples.
Cranberry Proanthocyanidins - Protein complexes for macrophage activation.
Carballo, Sergio M; Haas, Linda; Krueger, Christian G; Reed, Jess D
2017-09-20
In this work we characterize the interaction of cranberry (Vaccinium macrocarpon) proanthocyanidins (PAC) with bovine serum albumin (BSA) and hen egg-white lysozyme (HEL) and determine the effects of these complexes on macrophage activation and antigen presentation. We isolated PAC from cranberry and complexed the isolated PAC with BSA and HEL. The properties of the PAC-protein complexes were studied by matrix assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF MS), gel electrophoresis and zeta-potential. The effects of PAC-BSA complexes on macrophage activation were studied in RAW 264.7 macrophage like cells after treatment with lipopolysaccharide (LPS). Fluorescence microscopy was used to study the endocytosis of PAC-BSA complexes. The effects of the PAC complexes on macrophage antigen presentation were studied in an in vitro model of HEL antigen presentation by mouse peritoneal mononuclear cells to a T-cell hybridoma. The mass spectra of the PAC complexes with BSA and HEL differed from the spectra of the proteins alone by the presence of broad shoulders on the singly and doubly charged protein peaks. Complexation with PAC altered the electrophoretic mobility shift assay in native agarose gel and the electrophoretic mobility (ζ-potential) values. These results indicate that the PAC-protein complexes are stable and alter the protein structure without precipitating the protein. Fluorescence microscopy showed that the RAW 264.7 macrophages endocytosed BSA and PAC-BSA complexes in discrete vesicles that surrounded the nucleus. Macrophages treated with increasing amounts of PAC-BSA complexes had significantly reduced COX-2 and iNOS expression in response to treatment with lipopolysaccharide (LPS) in comparison to the controls. The PAC-HEL complexes modulated antigen uptake, processing and presentation in murine peritoneal macrophages. After 4 h of pre-incubation, only trace amounts of IL-2 were detected in the co-cultures treated with HEL alone, whereas the PAC-HEL complex had already reached the maximum IL-2 expression. Cranberry PAC may increase the rate of endocytosis of HEL and subsequent expression of IL-2 by the T-cell hybridomas. These results suggest that PAC-protein complexes modulate aspects of innate and acquired immune responses in macrophages.
Cali, Ignazio; Miller, Cathleen J; Parisi, Joseph E; Geschwind, Michael D; Gambetti, Pierluigi; Schonberger, Lawrence B
2015-06-25
The present study compares the clinical, pathological and molecular features of a United States (US) case of growth hormone (GH)-associated Creutzfeldt-Jakob disease (GH-CJD) (index case) to those of two earlier referred US cases of GH-CJD and one case of dura mater (d)-associated CJD (dCJD). All iatrogenic CJD (iCJD) subjects were methionine (M) homozygous at codon 129 (129MM) of the prion protein (PrP) gene and had scrapie prion protein (PrP(Sc)) type 1 (iCJDMM1). The index subject presented with ataxia, weight loss and changes in the sleep pattern about 38 years after the midpoint of GH treatment. Autopsy examination revealed a neuropathological phenotype reminiscent of both sCJDMV2-K (a sporadic CJD subtype in subjects methionine/valine heterozygous at codon 129 with PrP(Sc) type 2 and the presence of kuru plaques) and variant CJD (vCJD). The two earlier cases of GH-CJDMM1 and the one of dCJDMM1 were associated with neuropathological phenotypes that differed from that of the index case mainly because they lacked PrP plaques. The phenotype of the earlier GH-CJDMM1 cases shared several, but not all, characteristics with sCJDMM1, whereas dCJDMM1 was phenotypically indistinguishable from sCJDMM1. Two distinct groups of dCJDMM1 have also been described in Japan based on clinical features, the presence or absence of PrP plaques and distinct PK-resistant PrP(Sc) (resPrP(Sc)) electrophoretic mobilities. The resPrP(Sc) electrophoretic mobility was, however, identical in our GH-CJDMM1 and dCJDMM1 cases, and matched that of sCJDMM1. Our study shows that receipt of prion-contaminated GH can lead to a prion disease with molecular features (129MM and PrP(Sc) type 2) and phenotypic characteristics that differ from those of sporadic prion disease (sCJDMM1), a difference that may reflect adaptation of "heterologous" prion strains to the 129MM background.
Electrophoretic study of the genome of human rotavirus from Maceió, Brazil.
Houly, C A; Uchoa, M M; Zaidan, A M; Gomes-Neto, A; de-Oliveira, F M; Athayde, M A; Almeida, M F; Pereira, H G
1986-01-01
Rotaviruses were detected by enzyme immunoassay (EIA) in 53 (13.3%) of 397 fecal samples from children with acute gastroenteritis in the city of Maceió, Alagoas, Brazil. Polyacrylamide gel electrophoretic (PAGE) patterns characteristic of rotavirus double-stranded RNA were detected in 51 (96.2%) of the 53 EIA-positive samples. Of the RNA-positive samples, 1 (2%) was classified as subgroup 1 (short profile), 49 (96%) as subgroup 2 (long profile) and 1 (2%) could not be classified because of the absence of bands 10 and 11. The strains of subgroup 2 showed a great degree of electrophoretic heterogeneity and could be divided into several subcategories. Two samples showed splitting of one of the genome segments. PAGE, a very sensitive method capable of identifying rotavirus RNA genomes, has demonstrated that human rotaviruses detected in Maceió present many differences in RNA electrophoretic patterns.