Science.gov

Sample records for anchored dna molecules

  1. High Electronic Conductance through Double-Helix DNA Molecules with Fullerene Anchoring Groups

    PubMed Central

    2017-01-01

    Determining the mechanism of charge transport through native DNA remains a challenge as different factors such as measuring conditions, molecule conformations, and choice of technique can significantly affect the final results. In this contribution, we have used a new approach to measure current flowing through isolated double-stranded DNA molecules, using fullerene groups to anchor the DNA to a gold substrate. Measurements were performed at room temperature in an inert environment using a conductive AFM technique. It is shown that the π-stacked B-DNA structure is conserved on depositing the DNA. As a result, currents in the nanoampere range were obtained for voltages ranging between ±1 V. These experimental results are supported by a theoretical model that suggests that a multistep hopping mechanism between delocalized domains is responsible for the long-range current flow through this specific type of DNA. PMID:28094940

  2. High Electronic Conductance through Double-Helix DNA Molecules with Fullerene Anchoring Groups.

    PubMed

    Jiménez-Monroy, Kathia L; Renaud, Nicolas; Drijkoningen, Jeroen; Cortens, David; Schouteden, Koen; van Haesendonck, Christian; Guedens, Wanda J; Manca, Jean V; Siebbeles, Laurens D A; Grozema, Ferdinand C; Wagner, Patrick H

    2017-02-16

    Determining the mechanism of charge transport through native DNA remains a challenge as different factors such as measuring conditions, molecule conformations, and choice of technique can significantly affect the final results. In this contribution, we have used a new approach to measure current flowing through isolated double-stranded DNA molecules, using fullerene groups to anchor the DNA to a gold substrate. Measurements were performed at room temperature in an inert environment using a conductive AFM technique. It is shown that the π-stacked B-DNA structure is conserved on depositing the DNA. As a result, currents in the nanoampere range were obtained for voltages ranging between ±1 V. These experimental results are supported by a theoretical model that suggests that a multistep hopping mechanism between delocalized domains is responsible for the long-range current flow through this specific type of DNA.

  3. Enzymatic Digestion of Single DNA Molecules Anchored on Nanogold-Modified Surfaces

    NASA Astrophysics Data System (ADS)

    Lü, Junhong; Ye, Ming; Duan, Na; Li, Bin

    2009-09-01

    To study enzyme-DNA interactions at single molecular level, both the attachment points and the immediate surroundings of surfaces must be carefully considered such that they do not compromise the structural information and biological properties of the sample under investigation. The present work demonstrates the feasibility of enzymatic digestion of single DNA molecules attached to nanoparticle-modified surfaces. With Nanogold linking DNA to the mica surface by electrostatic interactions, advantageous conditions with fewer effects on the length and topography of DNA are obtained, and an appropriate environment for the activities of DNA is created. We demonstrate that by using Dip-Pen Nanolithography, individual DNA molecules attached to modified mica surfaces can be efficiently digested by DNase I.

  4. RNAP-II molecules participate in the anchoring of the ORC to rDNA replication origins.

    PubMed

    Mayan, Maria D

    2013-01-01

    The replication of genomic DNA is limited to a single round per cell cycle. The first component, which recognises and remains bound to origins from recognition until activation and replication elongation, is the origin recognition complex. How origin recognition complex (ORC) proteins remain associated with chromatin throughout the cell cycle is not yet completely understood. Several genome-wide studies have undoubtedly demonstrated that RNA polymerase II (RNAP-II) binding sites overlap with replication origins and with the binding sites of the replication components. RNAP-II is no longer merely associated with transcription elongation. Several reports have demonstrated that RNAP-II molecules affect chromatin structure, transcription, mRNA processing, recombination and DNA repair, among others. Most of these activities have been reported to directly depend on the interaction of proteins with the C-terminal domain (CTD) of RNAP-II. Two-dimensional gels results and ChIP analysis presented herein suggest that stalled RNAP-II molecules bound to the rDNA chromatin participate in the anchoring of ORC proteins to origins during the G1 and S-phases. The results show that in the absence of RNAP-II, Orc1p, Orc2p and Cdc6p do not bind to origins. Moreover, co-immunoprecipitation experiments suggest that Ser2P-CTD and hypophosphorylated RNAP-II interact with Orc1p. In the context of rDNA, cryptic transcription by RNAP-II did not negatively interfere with DNA replication. However, the results indicate that RNAP-II is not necessary to maintain the binding of ORCs to the origins during metaphase. These findings highlight for the first time the potential importance of stalled RNAP-II in the regulation of DNA replication.

  5. Intranuclear Anchoring of Repetitive DNA Sequences

    PubMed Central

    Weipoltshammer, Klara; Schöfer, Christian; Almeder, Marlene; Philimonenko, Vlada V.; Frei, Klemens; Wachtler, Franz; Hozák, Pavel

    1999-01-01

    Centromeres, telomeres, and ribosomal gene clusters consist of repetitive DNA sequences. To assess their contributions to the spatial organization of the interphase genome, their interactions with the nucleoskeleton were examined in quiescent and activated human lymphocytes. The nucleoskeletons were prepared using “physiological” conditions. The resulting structures were probed for specific DNA sequences of centromeres, telomeres, and ribosomal genes by in situ hybridization; the electroeluted DNA fractions were examined by blot hybridization. In both nonstimulated and stimulated lymphocytes, centromeric alpha-satellite repeats were almost exclusively found in the eluted fraction, while telomeric sequences remained attached to the nucleoskeleton. Ribosomal genes showed a transcription-dependent attachment pattern: in unstimulated lymphocytes, transcriptionally inactive ribosomal genes located outside the nucleolus were eluted completely. When comparing transcription unit and intergenic spacer, significantly more of the intergenic spacer was removed. In activated lymphocytes, considerable but similar amounts of both rDNA fragments were eluted. The results demonstrate that: (a) the various repetitive DNA sequences differ significantly in their intranuclear anchoring, (b) telomeric rather than centromeric DNA sequences form stable attachments to the nucleoskeleton, and (c) different attachment mechanisms might be responsible for the interaction of ribosomal genes with the nucleoskeleton. PMID:10613900

  6. DNA: An Extensible Molecule

    NASA Astrophysics Data System (ADS)

    Cluzel, Philippe; Lebrun, Anne; Heller, Christoph; Lavery, Richard; Viovy, Jean-Louis; Chatenay, Didier; Caron, Francois

    1996-02-01

    The force-displacement response of a single duplex DNA molecule was measured. The force saturates at a plateau around 70 piconewtons, which ends when the DNA has been stretched about 1.7 times its contour length. This behavior reveals a highly cooperative transition to a state here termed S-DNA. Addition of an intercalator suppresses this transition. Molecular modeling of the process also yields a force plateau and suggests a structure for the extended form. These results may shed light on biological processes involving DNA extension and open the route for mechanical studies on individual molecules in a previously unexplored range.

  7. Disentangling DNA molecules

    NASA Astrophysics Data System (ADS)

    Vologodskii, Alexander

    2016-09-01

    The widespread circular form of DNA molecules inside cells creates very serious topological problems during replication. Due to the helical structure of the double helix the parental strands of circular DNA form a link of very high order, and yet they have to be unlinked before the cell division. DNA topoisomerases, the enzymes that catalyze passing of one DNA segment through another, solve this problem in principle. However, it is very difficult to remove all entanglements between the replicated DNA molecules due to huge length of DNA comparing to the cell size. One strategy that nature uses to overcome this problem is to create the topoisomerases that can dramatically reduce the fraction of linked circular DNA molecules relative to the corresponding fraction at thermodynamic equilibrium. This striking property of the enzymes means that the enzymes that interact with DNA only locally can access their topology, a global property of circular DNA molecules. This review considers the experimental studies of the phenomenon and analyzes the theoretical models that have been suggested in attempts to explain it. We describe here how various models of enzyme action can be investigated computationally. There is no doubt at the moment that we understand basic principles governing enzyme action. Still, there are essential quantitative discrepancies between the experimental data and the theoretical predictions. We consider how these discrepancies can be overcome.

  8. Disentangling DNA molecules.

    PubMed

    Vologodskii, Alexander

    2016-09-01

    The widespread circular form of DNA molecules inside cells creates very serious topological problems during replication. Due to the helical structure of the double helix the parental strands of circular DNA form a link of very high order, and yet they have to be unlinked before the cell division. DNA topoisomerases, the enzymes that catalyze passing of one DNA segment through another, solve this problem in principle. However, it is very difficult to remove all entanglements between the replicated DNA molecules due to huge length of DNA comparing to the cell size. One strategy that nature uses to overcome this problem is to create the topoisomerases that can dramatically reduce the fraction of linked circular DNA molecules relative to the corresponding fraction at thermodynamic equilibrium. This striking property of the enzymes means that the enzymes that interact with DNA only locally can access their topology, a global property of circular DNA molecules. This review considers the experimental studies of the phenomenon and analyzes the theoretical models that have been suggested in attempts to explain it. We describe here how various models of enzyme action can be investigated computationally. There is no doubt at the moment that we understand basic principles governing enzyme action. Still, there are essential quantitative discrepancies between the experimental data and the theoretical predictions. We consider how these discrepancies can be overcome. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Enzymatic DNA molecules

    NASA Technical Reports Server (NTRS)

    Joyce, Gerald F. (Inventor); Breaker, Ronald R. (Inventor)

    1998-01-01

    The present invention discloses deoxyribonucleic acid enzymes--catalytic or enzymatic DNA molecules--capable of cleaving nucleic acid sequences or molecules, particularly RNA, in a site-specific manner, as well as compositions including same. Methods of making and using the disclosed enzymes and compositions are also disclosed.

  10. Promising anchoring groups for single-molecule conductance measurements.

    PubMed

    Kaliginedi, Veerabhadrarao; Rudnev, Alexander V; Moreno-García, Pavel; Baghernejad, Masoud; Huang, Cancan; Hong, Wenjing; Wandlowski, Thomas

    2014-11-21

    The understanding of the charge transport through single molecule junctions is a prerequisite for the design and building of electronic circuits based on single molecule junctions. However, reliable and robust formation of such junctions is a challenging task to achieve. In this topical review, we present a systematic investigation of the anchoring group effect on single molecule junction conductance by employing two complementary techniques, namely scanning tunneling microscopy break junction (STM-BJ) and mechanically controllable break junction (MCBJ) techniques, based on the studies published in the literature and important results from our own work. We compared conductance studies for conventional anchoring groups described earlier with the molecular junctions formed through π-interactions with the electrode surface (Au, Pt, Ag) and we also summarized recent developments in the formation of highly conducting covalent Au-C σ-bonds using oligophenyleneethynylene (OPE) and an alkane molecular backbone. Specifically, we focus on the electron transport properties of diaryloligoyne, oligophenyleneethynylene (OPE) and/or alkane molecular junctions composed of several traditional anchoring groups, (dihydrobenzo[b]thiophene (BT), 5-benzothienyl analogue (BTh), thiol (SH), pyridyl (PY), amine (NH2), cyano (CN), methyl sulphide (SMe), nitro (NO2)) and other anchoring groups at the solid/liquid interface. The qualitative and quantitative comparison of the results obtained with different anchoring groups reveals structural and mechanistic details of the different types of single molecular junctions. The results reported in this prospective may serve as a guideline for the design and synthesis of molecular systems to be used in molecule-based electronic devices.

  11. Molecular cloning of a glycosylphosphatidylinositol-anchored molecule CDw108.

    PubMed

    Yamada, A; Kubo, K; Takeshita, T; Harashima, N; Kawano, K; Mine, T; Sagawa, K; Sugamura, K; Itoh, K

    1999-04-01

    CDw108, also known as the John-Milton-Hagen human blood group Ag, is an 80-kDa glycosylphosphatidylinositol (GPI)-anchored membrane glycoprotein that is preferentially expressed on activated lymphocytes and E. The molecular characteristics and biological function of the CDw108 were not clarified previously. In this manuscript, we identify the cDNA clone containing the entire coding sequence of the CDw108 gene and report its molecular characteristics. The 1998-base pairs of the open reading frame of the cloned cDNA encoded a protein of 666 amino acids (aa), including the 46 aa of the signal peptide and the 19 aa of the GPI-anchor motif. Thus, the membrane-anchoring form of CDw108 was the 602 aa, and the estimated molecular mass of the unglycosylated form was 68 kDa. The RGD (Arg-Gly-Asp) cell attachment sequence and the five potential N-linked glycosylation sites were located on the membrane-anchoring form. Flow cytometric and immunoprecipitation analyses of the CDw108 cDNA transfectants confirmed that the cloned cDNA encoded the native form of CDw108. The CDw108 mRNA was expressed in activated PBMCs as well as in the spleen, thymus, testis, placenta, and brain, but was not expressed in any other tissues tested. Radiation hybrid mapping indicated that the CDw108 gene was located in the middle of the long arm of chromosome 15 (15q23-24). This molecular information will be critical for understanding the biological function of the CDw108 Ag.

  12. Invincible DNA tethers: covalent DNA anchoring for enhanced temporal and force stability in magnetic tweezers experiments

    PubMed Central

    Janissen, Richard; Berghuis, Bojk A.; Dulin, David; Wink, Max; van Laar, Theo; Dekker, Nynke H.

    2014-01-01

    Magnetic tweezers are a powerful single-molecule technique that allows real-time quantitative investigation of biomolecular processes under applied force. High pulling forces exceeding tens of picoNewtons may be required, e.g. to probe the force range of proteins that actively transcribe or package the genome. Frequently, however, the application of such forces decreases the sample lifetime, hindering data acquisition. To provide experimentally viable sample lifetimes in the face of high pulling forces, we have designed a novel anchoring strategy for DNA in magnetic tweezers. Our approach, which exploits covalent functionalization based on heterobifunctional poly(ethylene glycol) crosslinkers, allows us to strongly tether DNA while simultaneously suppressing undesirable non-specific adhesion. A complete force and lifetime characterization of these covalently anchored DNA-tethers demonstrates that, compared to more commonly employed anchoring strategies, they withstand 3-fold higher pulling forces (up to 150 pN) and exhibit up to 200-fold higher lifetimes (exceeding 24 h at a constant force of 150 pN). This advance makes it possible to apply the full range of biologically relevant force scales to biomolecular processes, and its straightforward implementation should extend its reach to a multitude of applications in the field of single-molecule force spectroscopy. PMID:25140010

  13. Towards single molecule DNA sequencing

    NASA Astrophysics Data System (ADS)

    Liu, Hao

    Single molecule DNA Sequencing technology has been a hot research topic in the recent decades because it holds the promise to sequence a human genome in a fast and affordable way, which will eventually make personalized medicine possible. Single molecule differentiation and DNA translocation control are the two main challenges in all single molecule DNA sequencing methods. In this thesis, I will first introduce DNA sequencing technology development and its application, and then explain the performance and limitation of prior art in detail. Following that, I will show a single molecule DNA base differentiation result obtained in recognition tunneling experiments. Furthermore, I will explain the assembly of a nanofluidic platform for single strand DNA translocation, which holds the promised to be integrated into a single molecule DNA sequencing instrument for DNA translocation control. Taken together, my dissertation research demonstrated the potential of using recognition tunneling techniques to serve as a general readout system for single molecule DNA sequencing application.

  14. Electrical conduction measurement of thiol modified DNA molecules

    NASA Astrophysics Data System (ADS)

    Hwang, J. S.; Hwang, S. W.; Ahn, D.

    2003-09-01

    We present a novel transport measurement of 60 base pairs of poly(dG)-poly(dC) DNA molecules. Thiol-terminated DNA molecules are chemically anchored at the surface of a Au nanoparticle and this DNA attached Au nanoparticle is self-trapped in between Au nanoelectrodes to make an electrical conduction channel. It provides an automatic electrical conduction channel consisting of electrode-DNA-nanoparticle-DNA-electrode. Due to robust bonding of thiol and Au, this transport channel is stable and reliable. The current-voltage characteristics measured from our device show a nonlinear behavior with voltage gaps comparable to previous experiment using the same molecules.

  15. Short read DNA fragment anchoring algorithm.

    PubMed

    Wang, Wendi; Zhang, Peiheng; Liu, Xinchun

    2009-01-30

    The emerging next-generation sequencing method based on PCR technology boosts genome sequencing speed considerably, the expense is also get decreased. It has been utilized to address a broad range of bioinformatics problems. Limited by reliable output sequence length of next-generation sequencing technologies, we are confined to study gene fragments with 30 - 50 bps in general and it is relatively shorter than traditional gene fragment length. Anchoring gene fragments in long reference sequence is an essential and prerequisite step for further assembly and analysis works. Due to the sheer number of fragments produced by next-generation sequencing technologies and the huge size of reference sequences, anchoring would rapidly becoming a computational bottleneck. We compared algorithm efficiency on BLAT, SOAP and EMBF. The efficiency is defined as the count of total output results divided by time consumed to retrieve them. The data show that our algorithm EMBF have 3 - 4 times efficiency advantage over SOAP, and at least 150 times over BLAT. Moreover, when the reference sequence size is increased, the efficiency of SOAP will get degraded as far as 30%, while EMBF have preferable increasing tendency. In conclusion, we deem that EMBF is more suitable for short fragment anchoring problem where result completeness and accuracy is predominant and the reference sequences are relatively large.

  16. Piezoresistivity in single DNA molecules

    PubMed Central

    Bruot, Christopher; Palma, Julio L.; Xiang, Limin; Mujica, Vladimiro; Ratner, Mark A.; Tao, Nongjian

    2015-01-01

    Piezoresistivity is a fundamental property of materials that has found many device applications. Here we report piezoresistivity in double helical DNA molecules. By studying the dependence of molecular conductance and piezoresistivity of single DNA molecules with different sequences and lengths, and performing molecular orbital calculations, we show that the piezoresistivity of DNA is caused by force-induced changes in the π–π electronic coupling between neighbouring bases, and in the activation energy of hole hopping. We describe the results in terms of thermal activated hopping model together with the ladder-based mechanical model for DNA proposed by de Gennes. PMID:26337293

  17. Incorporating single molecules into electrical circuits. The role of the chemical anchoring group.

    PubMed

    Leary, Edmund; La Rosa, Andrea; González, M Teresa; Rubio-Bollinger, Gabino; Agraït, Nicolás; Martín, Nazario

    2015-02-21

    Constructing electronic circuits containing singly wired molecules is at the frontier of electrical device miniaturisation. When a molecule is wired between a pair of electrodes, the two points of contact are determined by the chemical anchoring groups, located at the ends of the molecule. At this point, when a bias is applied, electrons are channelled from a metallic environment through an extremely narrow constriction, essentially a single atom, into the molecule. The fact that this is such an abrupt change in the electron pathway makes the nature of the chemical anchoring groups critically important regarding the propagation of electrons from the electrode across the molecule. A delicate interplay of phenomena can occur when a molecule binds to the electrodes, which can produce profound differences in conductance properties depending on the anchoring group. This makes answering the question "what is the best anchoring group for single molecule studies" far from straight forward. In this review, we firstly take a look at techniques developed to 'wire-up' single molecules, as understanding their limitations is key when assessing a molecular wire's performance. We then analyse the various chemical anchoring groups, and discuss their merits and disadvantages. Finally we discuss some theoretical concepts of molecular junctions to understand how transport is affected by the nature of the chemical anchor group.

  18. Autonomous DNA-Molecule Computing

    NASA Astrophysics Data System (ADS)

    Komiya, Ken; Rose, John A.; Yamamura, Masayuki

    DNA molecules autonomously change their forms from the single strand to the double helix by specific binding between complementary sequences according to the Watson-Crick base pairing rule. This paring rule allows us to control connections among molecules and to construct various structures by sequence design. Further, the motion of constructed structures can also be designed by considering sequential bindings. Recently, the feasibility to utilize the programmed DNA structural change for information processing was studied. In the present paper, we report an efficient synthetic chain reaction based on autonomous binding of DNA to realize a computing system, which enable us to implement computational intelligence in vitro.

  19. Electrical conduction through DNA molecule.

    PubMed

    Abdalla, S

    2011-09-01

    Several disorder parameters, inside the DNA molecule, lead to localization of charge carriers inside potential wells in the lowest unoccupied and highest occupied molecular orbits (LUMO and HOMO) which affects drastically the electrical conduction through the molecule, and demonstrates that the band carriers play an essential role in the conduction mechanism. So, a model is presented to shed light on the role of electrons of the LUMO in the electrical conduction through the DNA molecule. DC-, AC-conductivity and dielectric permittivity experimental data are well fitted with the presented model giving evidence that the free carriers in the LUMO and HOMO are responsible to make the DNA molecule conductor, insulator or semiconductor. The obtained results show that the localized charge carriers in the DNA molecule are characterized by four different types of relaxation phenomena which are thermally activated by corresponding four activation energies at 0.56 eV, 0.33 eV, 0.24 eV, and 0.05 eV respectively. Moreover, the calculations after the model, at room temperature, show that the time of the relaxation times of the current carriers are in the order of 5 × 10(-2)s, 1.74 × 10(-4)s, 5 × 10(-7)s, and 1.6 × 10(-10)s, respectively.

  20. Visualization of large elongated DNA molecules.

    PubMed

    Lee, Jinyong; Kim, Yongkyun; Lee, Seonghyun; Jo, Kyubong

    2015-09-01

    Long and linear DNA molecules are the mainstream single-molecule analytes for a variety of biochemical analysis within microfluidic devices, including functionalized surfaces and nanostructures. However, for biochemical analysis, large DNA molecules have to be unraveled, elongated, and visualized to obtain biochemical and genomic information. To date, elongated DNA molecules have been exploited in the development of a number of genome analysis systems as well as for the study of polymer physics due to the advantage of direct visualization of single DNA molecule. Moreover, each single DNA molecule provides individual information, which makes it useful for stochastic event analysis. Therefore, numerous studies of enzymatic random motions have been performed on a large elongated DNA molecule. In this review, we introduce mechanisms to elongate DNA molecules using microfluidics and nanostructures in the beginning. Secondly, we discuss how elongated DNA molecules have been utilized to obtain biochemical and genomic information by direct visualization of DNA molecules. Finally, we reviewed the approaches used to study the interaction of proteins and large DNA molecules. Although DNA-protein interactions have been investigated for many decades, it is noticeable that there have been significant achievements for the last five years. Therefore, we focus mainly on recent developments for monitoring enzymatic activity on large elongated DNA molecules.

  1. Single-Molecule Imaging of Signal Transduction via GPI-Anchored Receptors.

    PubMed

    Suzuki, Kenichi G N

    2016-01-01

    Lipid rafts have been drawing extensive attention as a signaling platform. To investigate molecular interactions in lipid rafts, we often need to observe molecules in the plasma membranes of living cells because chemical fixation and subsequent immunostaining with divalent or multivalent antibodies may change the location of the target molecules. In this chapter, we describe how to examine dynamics of raft-associated glycosylphosphatidylinositol (GPI)-anchored receptors and interactions of the receptors with downstream signaling molecules by single-particle tracking or single-molecule imaging techniques.

  2. Aligned deposition and electrical measurements on single DNA molecules

    NASA Astrophysics Data System (ADS)

    Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid

    2015-11-01

    A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)-poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin-DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin-DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity.

  3. Deformation of DNA molecules by hydrodynamic focusing

    NASA Astrophysics Data System (ADS)

    Wong, Pak Kin; Lee, Yi-Kuen; Ho, Chih-Ming

    2003-12-01

    The motion of a DNA molecule in a solvent flow reflects the deformation of a nano/microscale flexible mass spring structure by the forces exerted by the fluid molecules. The dynamics of individual molecules can reveal both fundamental properties of the DNA and basic understanding of the complex rheological properties of long-chain molecules. In this study, we report the dynamics of isolated DNA molecules under homogeneous extensional flow. Hydrodynamic focusing generates homogeneous extensional flow with uniform velocity in the transverse direction. The deformation of individual DNA molecules in the flow was visualized with video fluorescence microscopy. A coil stretch transition was observed when the Deborah number (De) is larger than 0.8. With a sudden stopping of the flow, the DNA molecule relaxes and recoils. The longest relaxation time of T2 DNA was determined to be 0.63 s when scaling viscosity to 0.9 cP.

  4. The role of anchor residues in the binding of peptides to HLA-A*1101 molecules.

    PubMed

    Chujoh, Y; Sobao, Y; Miwa, K; Kaneko, Y; Takiguchi, M

    1998-12-01

    The binding of 136 8- to 12-mer peptides carrying anchor residues at position 2 (P2) and the C-terminus to HLA-A*1101 molecules was analyzed by a stabilization assay using RMA-S transfectants expressing HLA-A*1101 and human beta2-microglobulin. 72.1% of these peptides bound to HLA-A*1101 molecules. Two known HLA-All-restricted cytotoxic T-lymphocyte epitope peptides showed high affinity to HLA-A*1101. The results confirmed a previous pool sequencing study of HLA-A*1101 binding self-peptides, which showed that Lys at the C-terminus and Val, Ile, Phe, Tyr, and Thr at P2 are anchor residues for HLA-A*1101. Thr and aliphatic hydrophobic residues Val, Ile, and Leu at P2 are stronger anchor residues than the aromatic hydrophobic residues Phe and Tyr. In addition, hydrophobic residues Leu, Phe, Tyr, Ile, and Ala at position 3 (P3) are secondary anchors but are weaker than those at P2. The affinities of the 8- and 12-mer peptides were significantly lower than those of 9- to 11-mer peptides. There was however no difference in affinity between 9-, 10- and 11-mer peptides. Furthermore, the analysis using peptides mutated at the C-terminus showed that HLA-A*1101 molecules can bind peptides carrying another positively charged residue, Arg. The present study clarified the role of the anchor residues at P2, P3 and the C-terminus in the binding of HLA-A*1101 molecules.

  5. Single-molecule studies of DNA mechanics.

    PubMed

    Bustamante, C; Smith, S B; Liphardt, J; Smith, D

    2000-06-01

    During the past decade, physical techniques such as optical tweezers and atomic force microscopy were used to study the mechanical properties of DNA at the single-molecule level. Knowledge of DNA's stretching and twisting properties now permits these single-molecule techniques to be used in the study of biological processes such as DNA replication and transcription.

  6. One-end immobilization of individual DNA molecules on a functional hydrophobic glass surface.

    PubMed

    Matsuura, Shun-ichi; Kurita, Hirofumi; Nakano, Michihiko; Komatsu, Jun; Takashima, Kazunori; Katsura, Shinji; Mizuno, Akira

    2002-12-01

    We demonstrate an effective method for DNA immobilization on a hydrophobic glass surface. The new DNA immobilizing technique is extremely simple compared with conventional techniques that require heterobifunctional crosslinking reagent between DNA and substrate surface that are both modified chemically. In the first process, a coverslip was treated with dichlorodimethylsilane resulting in hydrophobic surface. lambda DNA molecules were ligated with 3'-terminus disulfide-modified 14 mer oligonucleotides at one cohesive end. After reduction of the disulfide to sulfhydryl (thiol) groups the resulting thiol-modified lambda DNA molecules were reacted on silanized coverslip. Fluorescent observation showed that the thiol-modified lambda DNA molecules were anchored specifically to the hydrophobic surface at one terminus, although non-specific binding of the DNA molecules was suppressed. It was observed that the one-end-attached DNA molecule was bound firmly to the surface and stretched reversibly in one direction when a d.c. electric field was applied.

  7. Expressed Glycosylphosphatidylinositol-Anchored Horseradish Peroxidase Identifies Co-Clustering Molecules in Individual Lipid Raft Domains

    PubMed Central

    Miyagawa-Yamaguchi, Arisa; Kotani, Norihiro; Honke, Koichi

    2014-01-01

    Lipid rafts that are enriched in glycosylphosphatidylinositol (GPI)-anchored proteins serve as a platform for important biological events. To elucidate the molecular mechanisms of these events, identification of co-clustering molecules in individual raft domains is required. Here we describe an approach to this issue using the recently developed method termed enzyme-mediated activation of radical source (EMARS), by which molecules in the vicinity within 300 nm from horseradish peroxidase (HRP) set on the probed molecule are labeled. GPI-anchored HRP fusion proteins (HRP-GPIs), in which the GPI attachment signals derived from human decay accelerating factor and Thy-1 were separately connected to the C-terminus of HRP, were expressed in HeLa S3 cells, and the EMARS reaction was catalyzed by these expressed HRP-GPIs under a living condition. As a result, these different HRP-GPIs had differences in glycosylation and localization and formed distinct clusters. This novel approach distinguished molecular clusters associated with individual GPI-anchored proteins, suggesting that it can identify co-clustering molecules in individual raft domains. PMID:24671047

  8. An anchor-dependent molecular docking process for docking small flexible molecules into rigid protein receptors.

    PubMed

    Lin, Thy-Hou; Lin, Guan-Liang

    2008-08-01

    A molecular docking method designated as ADDock, anchor-dependent molecular docking process for docking small flexible molecules into rigid protein receptors, is presented in this article. ADDock makes the bond connection lists for atoms based on anchors chosen for building molecular structures for docking small flexible molecules or ligands into rigid active sites of protein receptors. ADDock employs an extended version of piecewise linear potential for scoring the docked structures. Since no translational motion for small molecules is implemented during the docking process, ADDock searches the best docking result by systematically changing the anchors chosen, which are usually the single-edge connected nodes or terminal hydrogen atoms of ligands. ADDock takes intact ligand structures generated during the docking process for computing the docked scores; therefore, no energy minimization is required in the evaluation phase of docking. The docking accuracy by ADDock for 92 receptor-ligand complexes docked is 91.3%. All these complexes have been docked by other groups using other docking methods. The receptor-ligand steric interaction energies computed by ADDock for some sets of active and inactive compounds selected and docked into the same receptor active sites are apparently separated. These results show that based on the steric interaction energies computed between the docked structures and receptor active sites, ADDock is able to separate active from inactive compounds for both being docked into the same receptor.

  9. Trapping and manipulating single molecules of DNA

    NASA Astrophysics Data System (ADS)

    Shon, Min Ju

    This thesis presents the development and application of nanoscale techniques to trap and manipulate biomolecules, with a focus on DNA. These methods combine single-molecule microscopy and nano- and micro-fabrication to study biophysical properties of DNA and proteins. The Dimple Machine is a lab-on-a-chip device that can isolate and confine a small number of molecules from a bulk solution. It traps molecules in nanofabricated chambers, or "dimples", and the trapped molecules are then studied on a fluorescence microscope at the single-molecule level. The sampling of bulk solution by dimples is representative, reproducible, and automated, enabling highthroughput single-molecule experiments. The device was applied to study hybridization of oligonucleotides, particularly in the context of reaction thermodynamics and kinetics in nanoconfinement. The DNA Pulley is a system to study protein binding and the local mechanical properties of DNA. A molecule of DNA is tethered to a surface on one end, and a superparamagnetic bead is attached to the other. A magnet pulls the DNA taut, and a silicon nitride knife with a nanoscale blade scans the DNA along its contour. Information on the local properties of the DNA is extracted by tracking the bead with nanometer precision in a white-light microscope. The system can detect proteins bound to DNA and localize their recognition sites, as shown with a model protein, EcoRI restriction enzyme. Progress on the measurements of nano-mechanical properties of DNA is included.

  10. Molecular insights into DNA binding and anchoring by the Bacillus subtilis sporulation kinetochore-like RacA protein

    PubMed Central

    Schumacher, Maria A.; Lee, Jeehyun; Zeng, Wenjie

    2016-01-01

    During Bacillus subtilis sporulation, segregating sister chromosomes are anchored to cell poles and the chromosome is remodeled into an elongated structure called the axial filament. Data indicate that a developmentally regulated protein called RacA is involved in these functions. To gain insight into how RacA performs these diverse processes we performed a battery of structural and biochemical analyses. These studies show that RacA contains an N-terminal winged-helix-turn-helix module connected by a disordered region to a predicted coiled-coil domain. Structures capture RacA binding the DNA using distinct protein–protein interfaces and employing adjustable DNA docking modes. This unique DNA binding mechanism indicates how RacA can both specifically recognize its GC-rich centromere and also non-specifically bind the DNA. Adjacent RacA molecules within the protein–DNA structure interact leading to DNA compaction, suggesting a mechanism for axial filament formation. We also show that the RacA C-domain coiled coil directly contacts the coiled coil region of the polar protein DivIVA, which anchors RacA and hence the chromosome to the pole. Thus, our combined data reveal unique DNA binding properties by RacA and provide insight into the DNA remodeling and polar anchorage functions of the protein. PMID:27085804

  11. The Arrangement of Information in DNA Molecules

    PubMed Central

    Thomas, Charles A.

    1966-01-01

    The anatomy of DNA molecules isolated from mature bacteriophage is reviewed. These molecules are linear, duplex DNA consisting mainly of uninterrupted polynucleotide chains. Certain phage (T5 and PB) contain four specifically located interruptions. While the nucleotide sequence of most of these molecules is unique (T5, T3, T7, λ), some are circular permutations of each other (T2, T4, P22). Partial degradation of these DNA molecules by exonuclease III predisposes some of them to form circles upon annealing, but indicating they are terminally redundant. PMID:5967428

  12. Mechanics and imaging of single DNA molecules.

    PubMed

    Hegner, M; Grange, W

    2002-01-01

    We review recent experiments that have revealed mechanical properties of single DNA molecules using advanced manipulation and force sensing techniques(scanning force microscopy (SFM), optical or magnetic tweezers, microneedles). From such measurements, intrinsic relevant parameters (persistence length, stretch modulus) as well as their dependence on external parameters (non-physiological conditions, coating with binding agents or proteins) are obtained on a single-molecule level. In addition, imaging of DNA molecules using SFM is presented.

  13. Relaxation dynamics of a single DNA molecule

    NASA Astrophysics Data System (ADS)

    Goshen, E.; Zhao, W. Z.; Carmon, G.; Rosen, S.; Granek, R.; Feingold, M.

    2005-06-01

    The relaxation of a single DNA molecule is studied. The experimental system consists of optical tweezers and a micron-sized bead that is tethered to the bottom of the sample by a single double-stranded DNA molecule. The bead slows down the DNA relaxation from a strongly stretched configuration such that it is passing through stretched equilibrium states. This allows for a theoretical description of the relaxation trajectory, which is in good agreement with experiment.

  14. Mechanobiology of Short DNA Molecules: A Single Molecule Perspective

    NASA Astrophysics Data System (ADS)

    Raghunathan, Krishnan

    Mechanical properties of DNA are known to play a significant role in several biological processes like wrapping of DNA around histones and looping. Most of these cellular events occur on a DNA length scale of a few hundred basepairs. Single molecule methods have been highly successful in directly investigating heterogeneity in different biomolecular systems and serve as ideal tools to study the mechanical properties of DNA. However, their use in studying DNA of contour lengths less than a kilobase are fraught with experimental difficulties. The research presented in this thesis explores the behavior of short stretches of DNA (≤ 500bp) using existing and novel single molecule methods. We have quantified the variation in persistence lengths between sequences having different elasticity using a constant force axial optical tweezers. Our experiments have also revealed that this difference in persistence lengths manifests itself as a difference in looping lifetimes of lac repressor, in sequences having the aforementioned constructs as the intervening sequence between the operator sites. We have also developed a system to probe DNA dynamics in vivo. We have found that the active processes in the cell have distinct effects on dynamics of DNA and eliminating the active processes causes a 'phase transition' like behavior in the inside the cell. We are currently extending this technique to understand DNA dynamics inside bacterial systems. Our results provide vital insights into mechanical properties of DNA and the effect of athermal fluctuations on DNA dynamics.

  15. Difference Raman spectroscopy of DNA molecules

    NASA Astrophysics Data System (ADS)

    Anokhin, Andrey S.; Gorelik, Vladimir S.; Dovbeshko, Galina I.; Pyatyshev, Alexander Yu; Yuzyuk, Yury I.

    2015-01-01

    In this paper the micro-Raman spectra of calf DNA for different points of DNA sample have been recorded. The Raman spectra were made with help of difference Raman spectroscopy technique. Raman spectra were recorded with high spatial resolution from different points of the wet and dry samples in different spectral range (100÷4000cm-1) using two lasers: argon (514.5 nm) and helium -neon (632.8 nm). The significant differences in the Raman spectra for dry and wet DNA and for different points of DNA molecules were observed. The obtained data on difference Raman scattering spectra of DNA molecules may be used for identification of DNA types and for analysis of genetic information associated with the molecular structure of this molecule.

  16. Stable anchoring chemistry for room temperature charge transport through graphite-molecule contacts

    PubMed Central

    Rudnev, Alexander V.; Kaliginedi, Veerabhadrarao; Droghetti, Andrea; Ozawa, Hiroaki; Kuzume, Akiyoshi; Haga, Masa-aki; Broekmann, Peter; Rungger, Ivan

    2017-01-01

    An open challenge for single-molecule electronics is to find stable contacts at room temperature with a well-defined conductance. Common coinage metal electrodes pose fabrication and operational problems due to the high mobility of the surface atoms. We demonstrate how molecules covalently grafted onto mechanically robust graphite/graphene substrates overcome these limitations. To this aim, we explore the effect of the anchoring group chemistry on the charge transport properties of graphite-molecule contacts by means of the scanning tunneling microscopy break-junction technique and ab initio simulations. Molecules adsorbed on graphite only via van der Waals interactions have a conductance that decreases exponentially upon stretching the junctions, whereas the molecules bonded covalently to graphite have a single well-defined conductance and yield contacts of unprecedented stability at room temperature. Our results demonstrate a strong bias dependence of the single-molecule conductance, which varies over more than one order of magnitude even at low bias voltages, and show an opposite rectification behavior for covalent and noncovalent contacts. We demonstrate that this bias-dependent conductance and opposite rectification behavior is due to a novel effect caused by the nonconstant, highly dispersive density of states of graphite around the Fermi energy and that the direction of rectification is governed by the detailed nature of the molecule/graphite contact. Combined with the prospect of new functionalities due to a strongly bias-dependent conductance, these covalent contacts are ideal candidates for next-generation molecular electronic devices. PMID:28630901

  17. Stable anchoring chemistry for room temperature charge transport through graphite-molecule contacts.

    PubMed

    Rudnev, Alexander V; Kaliginedi, Veerabhadrarao; Droghetti, Andrea; Ozawa, Hiroaki; Kuzume, Akiyoshi; Haga, Masa-Aki; Broekmann, Peter; Rungger, Ivan

    2017-06-01

    An open challenge for single-molecule electronics is to find stable contacts at room temperature with a well-defined conductance. Common coinage metal electrodes pose fabrication and operational problems due to the high mobility of the surface atoms. We demonstrate how molecules covalently grafted onto mechanically robust graphite/graphene substrates overcome these limitations. To this aim, we explore the effect of the anchoring group chemistry on the charge transport properties of graphite-molecule contacts by means of the scanning tunneling microscopy break-junction technique and ab initio simulations. Molecules adsorbed on graphite only via van der Waals interactions have a conductance that decreases exponentially upon stretching the junctions, whereas the molecules bonded covalently to graphite have a single well-defined conductance and yield contacts of unprecedented stability at room temperature. Our results demonstrate a strong bias dependence of the single-molecule conductance, which varies over more than one order of magnitude even at low bias voltages, and show an opposite rectification behavior for covalent and noncovalent contacts. We demonstrate that this bias-dependent conductance and opposite rectification behavior is due to a novel effect caused by the nonconstant, highly dispersive density of states of graphite around the Fermi energy and that the direction of rectification is governed by the detailed nature of the molecule/graphite contact. Combined with the prospect of new functionalities due to a strongly bias-dependent conductance, these covalent contacts are ideal candidates for next-generation molecular electronic devices.

  18. Impact of Anchoring Groups on Ballistic Transport: Single Molecule vs Monolayer Junctions

    PubMed Central

    2015-01-01

    Tuning the transport properties of molecular junctions by chemically modifying the molecular structure is one of the key challenges for advancing the field of molecular electronics. In the present contribution, we investigate current–voltage characteristics of differently linked metal–molecule–metal systems that comprise either a single molecule or a molecular assembly. This is achieved by employing density functional theory in conjunction with a Green’s function approach. We show that the conductance of a molecular system with a specific anchoring group is fundamentally different depending on whether a single molecule or a continuous monolayer forms the junction. This is a consequence of collective electrostatic effects that arise from dipolar elements contained in the monolayer and from interfacial charge rearrangements. As a consequence of these collective effects, the “ideal” choice for an anchoring group is clearly different for monolayer and single molecule devices. A particularly striking effect is observed for pyridine-docked systems. These are subject to Fermi-level pinning at high molecular packing densities, causing an abrupt increase of the junction current already at small voltages. PMID:26401191

  19. Comparative Study on Single-Molecule Junctions of Alkane- and Benzene-Based Molecules with Carboxylic Acid/Aldehyde as the Anchoring Groups

    NASA Astrophysics Data System (ADS)

    Chen, Fang; Peng, Lin-Lu; Hong, Ze-Wen; Mao, Jin-Chuan; Zheng, Ju-Fang; Shao, Yong; Niu, Zhen-Jiang; Zhou, Xiao-Shun

    2016-08-01

    We have measured the alkane and benzene-based molecules with aldehyde and carboxylic acid as anchoring groups by using the electrochemical jump-to-contact scanning tunneling microscopy break junction (ECSTM-BJ) approach. The results show that molecule with benzene backbone has better peak shape and intensity than those with alkane backbone. Typically, high junction formation probability for same anchoring group (aldehyde and carboxylic acid) with benzene backbone is found, which contributes to the stronger attractive interaction between Cu and molecules with benzene backbone. The present work shows the import role of backbone in junction, which can guide the design molecule to form effective junction for studying molecular electronics.

  20. Thiophene-based Tripodal Anchor Units for Hole Transport in Single-Molecule Junctions with Gold Electrodes.

    PubMed

    Ie, Yutaka; Tanaka, Kazunari; Tashiro, Aya; Lee, See Kei; Testai, Henrique Rosa; Yamada, Ryo; Tada, Hirokazu; Aso, Yoshio

    2015-09-17

    Molecule-metal junctions are inevitable for the realization of single-molecule electronics. In this study, we developed new tripodal anchors with electron-rich aromatic rings to achieve robust contact with gold electrodes, an effective hybridization of the π orbital with gold electrodes (π channel), and hole transport through π-channel hybridization. Cyclic voltammetry and X-ray photoelectron spectroscopy measurements of the monolayers indicated that the thiophene-based tripodal molecule exhibits anchoring characteristics as expected. The electrical conductance of thiophene-anchored bistripodal molecules using the scanning tunneling microscope (STM)-based break junction technique confirmed the formation of molecular junctions. The Seebeck coefficient of this compound estimated from thermoelectric voltage measurements using a STM was determined to be a positive value, which indicates that the charge carriers are holes. On the contrary, the corresponding pyridine-anchored molecules showed electron transport. These results reveal the versatility of π-channel tripodal anchors for the control of charge-carrier type in single-molecule electronics.

  1. Dielectrophoresis of surface-bound DNA molecules

    NASA Astrophysics Data System (ADS)

    Walti, Christoph; Germishuizen, W. Andre; Tosch, Paul; Cohen, Adam E.; Wirtz, Rene; Pepper, Michael; Middelberg, Anton P. J.; Davies, A. Giles

    2003-03-01

    Dielectrophoretic manipulation enables the positioning and orientation of DNA molecules in nanotechnological devices. However, a detailed understanding of the dielectrophoresis force and DNA orientation as a function of the electric field is required to fully exploit the technique. We present a study of the influence of the electric field on the length of the DNA molecules which are stretched out by the dielectrophoretic force and torque. DNA fragments (48 and 25 kb) were attached to an array of electrodes and the orientation and stretching characterised as a function of frequency (0.03 Â- 1.2 MHz) and electric field (0.2 Â- 1.5 MV/m). A distinct change in behaviour was observed for both fragments at about 100 kHz. Below 100 kHz, a change in polarisation of the DNA causes the fragments to collapse onto the electrodes. For frequencies above 100 kHz, the dielectrophoretic force and torque decrease and lead to a decrease in stretching length with increasing frequency. A maximum length of 20 μm for the 48 kb and 10 μm for the 25kb fragment was observed around 300 kHz for the DNA molecules. Our findings are in good agreement with the calculated length of DNA with a high intercalator density.

  2. A molecular anchor for stabilizing triple-helical DNA.

    PubMed Central

    Fox, K R; Polucci, P; Jenkins, T C; Neidle, S

    1995-01-01

    Molecular modeling has been used to predict that 2,6-disubstituted amidoanthraquinones, and not the 1,4 series, should preferentially interact with and stabilize triple-stranded DNA structures over duplex DNA. This is due to marked differences in the nature of chromophore-base stacking and groove accessibility for the two series. A DNA foot-printing method that monitors the extent of protection from DNase I cleavage on triplex formation has been used to examine the effects of a number of synthetic isomer compounds in the 1,4 and 2,6 series. The experimental results are in accord with the predicted behavior and confirm that the 1,4 series bind preferentially to double- rather than triple-stranded DNA, whereas the isomeric 2,6 derivatives markedly favor binding to triplex DNA. Images Fig. 3 Fig. 4 Fig. 5 PMID:7644509

  3. Individual Vesicle Fusion Events Mediated by Lipid-Anchored DNA

    PubMed Central

    van Lengerich, Bettina; Rawle, Robert J.; Bendix, Poul Martin; Boxer, Steven G.

    2013-01-01

    Membrane fusion consists of a complex rearrangement of lipids and proteins that results in the merger of two lipid bilayers. We have developed a model system that employs synthetic DNA-lipid conjugates as a surrogate for the membrane proteins involved in the biological fusion reaction. We previously showed that complementary DNA-lipids, inserted into small unilamellar vesicles, can mediate membrane fusion in bulk. Here, we use a model membrane architecture developed in our lab to directly observe single-vesicle fusion events using fluorescence microscopy. In this system, a planar tethered membrane patch serves as the target membrane for incoming vesicles. This allows us to quantify the kinetics and characteristics of individual fusion events from the perspective of the lipids or the DNA-lipids involved in the process. We find that the fusion pathways are heterogeneous, with an arrested hemi-fusion state predominating, and we quantitate the outcome and rate of fusion events to construct a mechanistic model of DNA-mediated vesicle fusion. The waiting times between docking and fusion are distributed exponentially, suggesting that fusion occurs in a single step. Our analysis indicates that when two lipid bilayers are brought into close proximity, fusion occurs spontaneously, with little or no dependence on the number of DNA hybrids formed. PMID:23870262

  4. Torsionally constrained DNA for single-molecule assays: an efficient, ligation-free method

    PubMed Central

    Paik, D. Hern; Roskens, Violet A.; Perkins, Thomas T.

    2013-01-01

    Controlled twisting of individual, double-stranded DNA molecules provides a unique method to investigate the enzymes that alter DNA topology. Such twisting requires a single DNA molecule to be torsionally constrained. This constraint is achieved by anchoring the opposite ends of the DNA to two separate surfaces via multiple bonds. The traditional protocol for making such DNA involves a three-way ligation followed by gel purification, a laborious process that often leads to low yield both in the amount of DNA and the fraction of molecules that is torsionally constrained. We developed a simple ligation-free procedure for making torsionally constrained DNA via polymerase chain reaction (PCR). This PCR protocol used two ‘megaprimers’, 400-base-pair long double-stranded DNA that were labelled with either biotin or digoxigenin. We obtained a relatively high yield of gel-purified DNA (∼500 ng/100 µl of PCR reaction). The final construct in this PCR-based method contains only one labelled strand in contrast to the traditional construct in which both strands of the DNA are labelled. Nonetheless, we achieved a high yield (84%) of torsionally constrained DNA when measured using an optical-trap-based DNA-overstretching assay. This protocol significantly simplifies the application and adoption of torsionally constrained assays to a wide range of single-molecule systems. PMID:23935118

  5. Torsionally constrained DNA for single-molecule assays: an efficient, ligation-free method.

    PubMed

    Paik, D Hern; Roskens, Violet A; Perkins, Thomas T

    2013-10-01

    Controlled twisting of individual, double-stranded DNA molecules provides a unique method to investigate the enzymes that alter DNA topology. Such twisting requires a single DNA molecule to be torsionally constrained. This constraint is achieved by anchoring the opposite ends of the DNA to two separate surfaces via multiple bonds. The traditional protocol for making such DNA involves a three-way ligation followed by gel purification, a laborious process that often leads to low yield both in the amount of DNA and the fraction of molecules that is torsionally constrained. We developed a simple ligation-free procedure for making torsionally constrained DNA via polymerase chain reaction (PCR). This PCR protocol used two 'megaprimers', 400-base-pair long double-stranded DNA that were labelled with either biotin or digoxigenin. We obtained a relatively high yield of gel-purified DNA (∼500 ng/100 µl of PCR reaction). The final construct in this PCR-based method contains only one labelled strand in contrast to the traditional construct in which both strands of the DNA are labelled. Nonetheless, we achieved a high yield (84%) of torsionally constrained DNA when measured using an optical-trap-based DNA-overstretching assay. This protocol significantly simplifies the application and adoption of torsionally constrained assays to a wide range of single-molecule systems.

  6. Fluorescently labeled circular DNA molecules for DNA topology and topoisomerases

    PubMed Central

    Gu, Maxwell; Berrido, Andrea; Gonzalez, Walter G.; Miksovska, Jaroslava; Chambers, Jeremy W.; Leng, Fenfei

    2016-01-01

    DNA topology plays essential roles in several fundamental biological processes, such as DNA replication, recombination, and transcription. Typically agarose gel electrophoresis is employed to study DNA topology. Since gel electrophoresis is time-consuming and labor intensive, it is desirable to develop other methods, such as fluorescence-based methods, for such studies. In this paper we report the synthesis of a type of unique fluorescence-labeled DNA molecules that can be used to study DNA topology and topoisomerases by fluorescence resonance energy transfer (FRET). Specifically, we inserted an 82 nt. synthetic DNA oligomer FL905 carrying a 42 nt. AT sequence with fluorescein and dabcyl labels into a gapped DNA molecule to generate relaxed and supercoiled pAB1_FL905. Since the fluorescence intensity of pAB1_FL905 is dependent on its supercoiling status, pAB1_FL905 is a powerful tool to study DNA topology and topoisomerases by FRET. pAB1_FL905 can also be developed into rapid and efficient high-throughput screening assays to identify inhibitors that target various DNA topoisomerases. PMID:27796331

  7. Polymer physics experiments with single DNA molecules

    NASA Astrophysics Data System (ADS)

    Smith, Douglas E.

    1999-11-01

    Bacteriophage DNA molecules were taken as a model flexible polymer chain for the experimental study of polymer dynamics at the single molecule level. Video fluorescence microscopy was used to directly observe the conformational dynamics of fluorescently labeled molecules, optical tweezers were used to manipulate individual molecules, and micro-fabricated flow cells were used to apply controlled hydrodynamic strain to molecules. These techniques constitute a powerful new experimental approach in the study of basic polymer physics questions. I have used these techniques to study the diffusion and relaxation of isolated and entangled polymer molecules and the hydrodynamic deformation of polymers in elongational and shear flows. These studies revealed a rich, and previously unobserved, ``molecular individualism'' in the dynamical behavior of single molecules. Individual measurements on ensembles of identical molecules allowed the average conformation to be determined as well as the underlying probability distributions for molecular conformation. Scaling laws, that predict the dependence of properties on chain length and concentration, were also tested. The basic assumptions of the reptation model were directly confirmed by visualizing the dynamics of entangled chains.

  8. A study of planar anchor groups for graphene-based single-molecule electronics

    SciTech Connect

    Bailey, Steven; Visontai, David; Lambert, Colin J.; Bryce, Martin R.; Frampton, Harry; Chappell, David

    2014-02-07

    To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for –OH and –CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains.

  9. A study of planar anchor groups for graphene-based single-molecule electronics.

    PubMed

    Bailey, Steven; Visontai, David; Lambert, Colin J; Bryce, Martin R; Frampton, Harry; Chappell, David

    2014-02-07

    To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for -OH and -CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains.

  10. Internal Dynamics of Supercoiled DNA Molecules

    PubMed Central

    Kalkbrenner, Thomas; Arnold, Axel; Tans, Sander J.

    2009-01-01

    Abstract The intramolecular diffusive motion within supercoiled DNA molecules is of central importance for a wide array of gene regulation processes. It has recently been shown, using fluorescence correlation spectroscopy, that plasmid DNA exhibits unexpected acceleration of its internal diffusive motion upon supercoiling to intermediate density. Here, we present an independent study that shows a similar acceleration for fully supercoiled plasmid DNA. We have developed a method that allows fluorescent labeling of a 200-bp region, as well as efficient supercoiling by Escherichia coli gyrase. Compared to plain circular or linear DNA, the submicrosecond motion within the supercoiled molecules appears faster by up to an order of magnitude. The mean-square displacement as a function of time reveals an additional intermediate regime with a lowered scaling exponent compared to that of circular DNA. Although this unexpected behavior is not fully understood, it could be explained by conformational constraints of the DNA strand within the supercoiled topology in combination with an increased apparent persistence length. PMID:19527654

  11. Single-molecule visualization of ROS-induced DNA damage in large DNA molecules.

    PubMed

    Lee, Jinyong; Kim, Yongkyun; Lim, Sangyong; Jo, Kyubong

    2016-02-07

    We present a single molecule visualization approach for the quantitative analysis of reactive oxygen species (ROS) induced DNA damage, such as base oxidation and single stranded breaks in large DNA molecules. We utilized the Fenton reaction to generate DNA damage with subsequent enzymatic treatment using a mixture of three types of glycosylases to remove oxidized bases, and then fluorescent labeling on damaged lesions via nick translation. This single molecule analytical platform provided the capability to count one or two damaged sites per λ DNA molecule (48.5 kb), which were reliably dependent on the concentrations of hydrogen peroxide and ferrous ion at the micromolar level. More importantly, the labeled damaged sites that were visualized under a microscope provided positional information, which offered the capability of comparing DNA damaged sites with the in silico genomic map to reveal sequence specificity that GTGR is more sensitive to oxidative damage. Consequently, single DNA molecule analysis provides a sensitive analytical platform for ROS-induced DNA damage and suggests an interesting biochemical insight that the genome primarily active during the lysogenic cycle may have less probability for oxidative DNA damage.

  12. Quantitative detection of single DNA molecules on DNA tetrahedron decorated substrates.

    PubMed

    Wang, Zhenguang; Xue, Qingwang; Tian, Wenzhi; Wang, Lei; Jiang, Wei

    2012-10-07

    A single DNA molecule detection method on DNA tetrahedron decorated substrates has been developed. DNA tetrahedra were introduced onto substrates for both preventing nonspecific adsorption and sensitive recognition of single DNA molecules.

  13. DNA, the central molecule of aging.

    PubMed

    Lenart, Peter; Krejci, Lumir

    2016-04-01

    Understanding the molecular mechanism of aging could have enormous medical implications. Despite a century of research, however, there is no universally accepted theory regarding the molecular basis of aging. On the other hand, there is plentiful evidence suggesting that DNA constitutes the central molecule in this process. Here, we review the roles of chromatin structure, DNA damage, and shortening of telomeres in aging and propose a hypothesis for how their interplay leads to aging phenotypes. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Construction of DNA Hemicatenanes from Two Small Circular DNA Molecules

    PubMed Central

    Gaillard, Claire; Strauss, François

    2015-01-01

    DNA hemicatenanes, one of the simplest possible junctions between two double stranded DNA molecules, have frequently been mentioned in the literature for their possible function in DNA replication, recombination, repair, and organization in chromosomes. They have been little studied experimentally, however, due to the lack of an appropriate method for their preparation. Here we have designed a method to build hemicatenanes from two small circular DNA molecules. The method involves, first, the assembly of two linear single strands and their circularization to form a catenane of two single stranded circles, and, second, the addition and base-pairing of the two single stranded circles complementary to the first ones, followed by their annealing using DNA topoisomerase I. The product was purified by gel electrophoresis and characterized. The arrangement of strands was as expected for a hemicatenane and clearly distinct from a full catenane. In addition, each circle was unwound by an average of half a double helical turn, also in excellent agreement with the structure of a hemicatenane. It was also observed that hemicatenanes are quickly destabilized by a single cut on either of the two strands passing inside the junction, strongly suggesting that DNA strands are able to slide easily inside the hemicatenane. This method should make it possible to study the biochemical properties of hemicatenanes and to test some of the hypotheses that have been proposed about their function, including a possible role for this structure in the organization of complex genomes in loops and chromosomal domains. PMID:25799010

  15. Combination probes with intercalating anchors and proximal fluorophores for DNA and RNA detection

    PubMed Central

    Qiu, Jieqiong; Wilson, Adam; El-Sagheer, Afaf H.; Brown, Tom

    2016-01-01

    A new class of modified oligonucleotides (combination probes) has been designed and synthesised for use in genetic analysis and RNA detection. Their chemical structure combines an intercalating anchor with a reporter fluorophore on the same thymine nucleobase. The intercalator (thiazole orange or benzothiazole orange) provides an anchor, which upon hybridisation of the probe to its target becomes fluorescent and simultaneously stabilizes the duplex. The anchor is able to communicate via FRET to a proximal reporter dye (e.g. ROX, HEX, ATTO647N, FAM) whose fluorescence signal can be monitored on a range of analytical devices. Direct excitation of the reporter dye provides an alternative signalling mechanism. In both signalling modes, fluorescence in the unhybridised probe is switched off by collisional quenching between adjacent intercalator and reporter dyes. Single nucleotide polymorphisms in DNA and RNA targets are identified by differences in the duplex melting temperature, and the use of short hybridization probes, made possible by the stabilisation provided by the intercalator, enhances mismatch discrimination. Unlike other fluorogenic probe systems, placing the fluorophore and quencher on the same nucleobase facilitates the design of short probes containing multiple modifications. The ability to detect both DNA and RNA sequences suggests applications in cellular imaging and diagnostics. PMID:27369379

  16. Combination probes with intercalating anchors and proximal fluorophores for DNA and RNA detection.

    PubMed

    Qiu, Jieqiong; Wilson, Adam; El-Sagheer, Afaf H; Brown, Tom

    2016-09-30

    A new class of modified oligonucleotides (combination probes) has been designed and synthesised for use in genetic analysis and RNA detection. Their chemical structure combines an intercalating anchor with a reporter fluorophore on the same thymine nucleobase. The intercalator (thiazole orange or benzothiazole orange) provides an anchor, which upon hybridisation of the probe to its target becomes fluorescent and simultaneously stabilizes the duplex. The anchor is able to communicate via FRET to a proximal reporter dye (e.g. ROX, HEX, ATTO647N, FAM) whose fluorescence signal can be monitored on a range of analytical devices. Direct excitation of the reporter dye provides an alternative signalling mechanism. In both signalling modes, fluorescence in the unhybridised probe is switched off by collisional quenching between adjacent intercalator and reporter dyes. Single nucleotide polymorphisms in DNA and RNA targets are identified by differences in the duplex melting temperature, and the use of short hybridization probes, made possible by the stabilisation provided by the intercalator, enhances mismatch discrimination. Unlike other fluorogenic probe systems, placing the fluorophore and quencher on the same nucleobase facilitates the design of short probes containing multiple modifications. The ability to detect both DNA and RNA sequences suggests applications in cellular imaging and diagnostics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Statistical I-V measurements of single-molecule junctions with an asymmetric anchoring group 1,4-aminobenzenethiol

    NASA Astrophysics Data System (ADS)

    Komoto, Yuki; Fujii, Shintaro; Kiguchi, Manabu

    2017-06-01

    Molecular diodes are an interesting topic in the field of single-molecule electronics. Rectification of molecules such as 1,4-aminobenzenethiol (ABT) having different contact areas was reported. However, a more statistical approach is necessary to clarify the rectification of the ABT single-molecule junctions. In this research, we statistically measured the single molecular conductance and I-V characteristics of ABT single-molecule junctions using the scanning tunneling microscope break junction (STM-BJ) method. Two single molecular conductances caused to difference of bridging geometries were observed in the conductance measurements. Statistically significant rectification was not observed for ABT junctions. We concluded rectification does not appear only due to the difference of two anchoring groups in case of a small conjugate molecule such as ABT. Invited talk at 8th International Workshop on Advanced Materials Science and Nanotechnology (IWAMSN2016), 8-12 November 2016, Ha Long City, Vietnam.

  18. Dynamics of DNA molecules under gel electrophoresis

    SciTech Connect

    Kotaka, Tadao, Adachi, Shiro; Shikata, Toshiyuki

    1993-12-31

    Electrophoretic mobilities {mu} of double stranded linear DNAs were examined in agarose gels subjected to a biased sinusoidal field (BSF) that utilizes a sinusoidal field of strength E{sub s} and frequency f superposed on a steady bias field of strength E{sub b}. Under BSF with E{sub s} {much_gt} E{sub b}. DNA fragments with the size M > 20 kbp exhibited peculiar behavior which the authors called a pin down phenomenon in that the {mu} shows a minimum {mu}{sub p} at a particular f{sub p} (pin down frequency) specific to M, C{sub gel} and the field strengths. The dynamics of DNA molecules under such pin-down conditions were examined by direct observation via fluorescence microscopy as well as dynamic electric birefringence.

  19. Biophysical characterization of DNA binding from single molecule force measurements

    PubMed Central

    Chaurasiya, Kathy R.; Paramanathan, Thayaparan; McCauley, Micah J.; Williams, Mark C.

    2010-01-01

    Single molecule force spectroscopy is a powerful method that uses the mechanical properties of DNA to explore DNA interactions. Here we describe how DNA stretching experiments quantitatively characterize the DNA binding of small molecules and proteins. Small molecules exhibit diverse DNA binding modes, including binding into the major and minor grooves and intercalation between base pairs of double-stranded DNA (dsDNA). Histones bind and package dsDNA, while other nuclear proteins such as high mobility group proteins bind to the backbone and bend dsDNA. Single-stranded DNA (ssDNA) binding proteins slide along dsDNA to locate and stabilize ssDNA during replication. Other proteins exhibit binding to both dsDNA and ssDNA. Nucleic acid chaperone proteins can switch rapidly between dsDNA and ssDNA binding modes, while DNA polymerases bind both forms of DNA with high affinity at distinct binding sites at the replication fork. Single molecule force measurements quantitatively characterize these DNA binding mechanisms, elucidating small molecule interactions and protein function. PMID:20576476

  20. Biophysical characterization of DNA binding from single molecule force measurements

    NASA Astrophysics Data System (ADS)

    Chaurasiya, Kathy R.; Paramanathan, Thayaparan; McCauley, Micah J.; Williams, Mark C.

    2010-09-01

    Single molecule force spectroscopy is a powerful method that uses the mechanical properties of DNA to explore DNA interactions. Here we describe how DNA stretching experiments quantitatively characterize the DNA binding of small molecules and proteins. Small molecules exhibit diverse DNA binding modes, including binding into the major and minor grooves and intercalation between base pairs of double-stranded DNA (dsDNA). Histones bind and package dsDNA, while other nuclear proteins such as high mobility group proteins bind to the backbone and bend dsDNA. Single-stranded DNA (ssDNA) binding proteins slide along dsDNA to locate and stabilize ssDNA during replication. Other proteins exhibit binding to both dsDNA and ssDNA. Nucleic acid chaperone proteins can switch rapidly between dsDNA and ssDNA binding modes, while DNA polymerases bind both forms of DNA with high affinity at distinct binding sites at the replication fork. Single molecule force measurements quantitatively characterize these DNA binding mechanisms, elucidating small molecule interactions and protein function.

  1. Unfolding Dynamics of Single Collapsed DNA Molecules

    NASA Astrophysics Data System (ADS)

    Murayama, Y.; Wada, H.; Ishida, R.; Sano, M.

    We observed elastic responses of single DNA molecules and visualized them during the collapsing transition induced by trivalent cation, spermidine (SPD). The force-extension curves show worm-like behavior, force plateau, and stick-release responses depending on SPD concentration. The periodic stick-release responses may reflect the unraveling of toroidal condensates. At much higher SPD concentration, we observed re-elongation of a single collapsed DNA. For the visualization, a fluorescent dye, YOYO, was used. We observed bright spots in the fluorescence intensity profile of a collapsed DNA during stretching, which may correspond to the collapsed parts within the single DNA. The decrease of the intensity of the spots in stretching implies the mechanical unfolding of collapsed parts. Towards achieving a microscopic understanding of these experimental results, we also investigate the elastic properties of a highly charged polyelectrolyte (PE) chain by Brownian dynamics simulation method. In our dynamic simulation, a PE has a small intrinsic stiffness (i.e., the PE is semiflexible) to model the stiffness of DNA chain, and added multivalent counterions are explicitly taken into account. As the electrostatic coupling parameter (proportional to counterion valency) is increased, counterion condensation is observed, leading finally to the PE collapse through the discontinuous transition for a sufficiently large coupling parameter. Mechanical unfolding of a PE globule reveals its molecular elasticities including force plateau, in agreement with the experimental observations. A numerically deduced electrostatic condensation energy is compared to the experimental value. Charge ordering in the PE-counterion complex and its deformation by the external forcing are elucidated in conjunction with the PE elastic responses. Other dynamic effects such as the effect of a pulling speed are also discussed.

  2. DNA-psoralen interaction: A single molecule experiment

    NASA Astrophysics Data System (ADS)

    Rocha, M. S.; Viana, N. B.; Mesquita, O. N.

    2004-11-01

    By attaching one end of a single λ-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the λ-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particulary interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.

  3. [Cu(phen)2](2+) acts as electrochemical indicator and anchor to immobilize probe DNA in electrochemical DNA biosensor.

    PubMed

    Yang, Linlin; Li, Xiaoyu; Li, Xi; Yan, Songling; Ren, Yinna; Wang, Mengmeng; Liu, Peng; Dong, Yulin; Zhang, Chaocan

    2016-01-01

    We demonstrate a novel protocol for sensitive in situ label-free electrochemical detection of DNA hybridization based on copper complex ([Cu(phen)2](2+), where phen = 1,10-phenanthroline) and graphene (GR) modified glassy carbon electrode. Here, [Cu(phen)2](2+) acted advantageously as both the electrochemical indicator and the anchor for probe DNA immobilization via intercalative interactions between the partial double helix structure of probe DNA and the vertical aromatic groups of phen. GR provided large density of docking site for probe DNA immobilization and increased the electrical conductivity ability of the electrode. The modification procedure was monitored by electrochemical impedance spectroscopy (EIS). Square-wave voltammetry (SWV) was used to explore the hybridization events. Under the optimal conditions, the designed electrochemical DNA biosensor could effectively distinguish different mismatch degrees of complementary DNA from one-base mismatch to noncomplementary, indicating that the biosensor had high selectivity. It also exhibited a reasonable linear relationship. The oxidation peak currents of [Cu(phen)2](2+) were linear with the logarithm of the concentrations of complementary target DNA ranging from 1 × 10(-12) to 1 × 10(-6) M with a detection limit of 1.99 × 10(-13) M (signal/noise = 3). Moreover, the stability of the electrochemical DNA biosensor was also studied.

  4. Increased throughput single molecule detection of DNA

    NASA Astrophysics Data System (ADS)

    Gurjar, Rajan; Seetamraju, Madhavi; Kolodziejski, Noah; Myers, Richard; Staples, Christopher; Christian, James; Squillante, Michael R.; Entine, Gerald

    2007-09-01

    In this work, we present research in using confocal optical techniques with femtolitre focal volumes and obtain very high signal-to-noise and signal-to-background ratios for single molecule detection (SMD). We were able to achieve improved signal strength by using highly fluorescent quantum dots and nanopatterned substrates to obtain plasmon induced resonant fluorescence enhancement. A method to simultaneously using multiple excitation spots without the use of confocal apertures and an array of single photon sensitive Geiger mode avalanche photodiodes was used to increase the throughput of the detection system. Using this highly sensitive SMD system, we detect small quantities of synthetic DNA through hybridization eliminating the need of polymerase chain reaction.

  5. Organization of 'nanocrystal molecules' using DNA

    NASA Astrophysics Data System (ADS)

    Alivisatos, A. Paul; Johnsson, Kai P.; Peng, Xiaogang; Wilson, Troy E.; Loweth, Colin J.; Bruchez, Marcel P.; Schultz, Peter G.

    1996-08-01

    PATTERNING matter on the nanometre scale is an important objective of current materials chemistry and physics. It is driven by both the need to further miniaturize electronic components and the fact that at the nanometre scale, materials properties are strongly size-dependent and thus can be tuned sensitively1. In nanoscale crystals, quantum size effects and the large number of surface atoms influence the, chemical, electronic, magnetic and optical behaviour2-4. 'Top-down' (for example, lithographic) methods for nanoscale manipulation reach only to the upper end of the nanometre regime5; but whereas 'bottom-up' wet chemical techniques allow for the preparation of mono-disperse, defect-free crystallites just 1-10 nm in size6-10, ways to control the structure of nanocrystal assemblies are scarce. Here we describe a strategy for the synthesis of'nanocrystal molecules', in which discrete numbers of gold nanocrystals are organized into spatially defined structures based on Watson-Crick base-pairing interactions. We attach single-stranded DNA oligonucleotides of defined length and sequence to individual nanocrystals, and these assemble into dimers and trimers on addition of a complementary single-stranded DNA template. We anticipate that this approach should allow the construction of more complex two-and three-dimensional assemblies.

  6. Extraction of ultrashort DNA molecules from herbarium specimens.

    PubMed

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

    2017-02-01

    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  7. Plasmonic imaging and detection of single DNA molecules.

    PubMed

    Yu, Hui; Shan, Xiaonan; Wang, Shaopeng; Chen, Hongyuan; Tao, Nongjian

    2014-04-22

    The capability of imaging and detecting single DNA molecules is critical in the study, analysis, and applications of DNA. Fluorescence imaging is a widely used method, but it suffers from blinking and photobleaching, and fluorescence tags may block or affect binding sites on DNA. We report on label-free imaging of single DNA molecules with a differential plasmonic imaging technique. The technique produces high contrast images due to the scattering of surface plasmonic waves by the molecules and the removal of background noises and interference patterns, allowing for quantitative analysis of individual DNA molecules. Simulation of the images based on a scattering model shows good agreement with the experiment. We further demonstrate optical mapping of single DNA molecules.

  8. Role of DNA Methylation in Type 2 Diabetes Etiology: Using Genotype as a Causal Anchor.

    PubMed

    Elliott, Hannah R; Shihab, Hashem A; Lockett, Gabrielle A; Holloway, John W; McRae, Allan F; Smith, George Davey; Ring, Susan M; Gaunt, Tom R; Relton, Caroline L

    2017-06-01

    Several studies have investigated the relationship between genetic variation and DNA methylation with respect to type 2 diabetes, but it is unknown if DNA methylation is a mediator in the disease pathway or if it is altered in response to disease state. This study uses genotypic information as a causal anchor to help decipher the likely role of DNA methylation measured in peripheral blood in the etiology of type 2 diabetes. Illumina HumanMethylation450 BeadChip data were generated on 1,018 young individuals from the Avon Longitudinal Study of Parents and Children (ALSPAC) cohort. In stage 1, 118 unique associations between published type 2 diabetes single nucleotide polymorphisms (SNPs) and genome-wide methylation (methylation quantitative trait loci [mQTLs]) were identified. In stage 2, a further 226 mQTLs were identified between 202 additional independent non-type 2 diabetes SNPs and CpGs identified in stage 1. Where possible, associations were replicated in independent cohorts of similar age. We discovered that around half of known type 2 diabetes SNPs are associated with variation in DNA methylation and postulated that methylation could either be on a causal pathway to future disease or could be a noncausal biomarker. For one locus (KCNQ1), we were able to provide further evidence that methylation is likely to be on the causal pathway to disease in later life. © 2017 by the American Diabetes Association.

  9. Visualization of Surface-tethered Large DNA Molecules with a Fluorescent Protein DNA Binding Peptide.

    PubMed

    Lee, Seonghyun; Jo, Kyubong

    2016-06-23

    Large DNA molecules tethered on the functionalized glass surface have been utilized in polymer physics and biochemistry particularly for investigating interactions between DNA and its binding proteins. Here, we report a method that uses fluorescent microscopy for visualizing large DNA molecules tethered on the surface. First, glass coverslips are biotinylated and passivated by coating with biotinylated polyethylene glycol, which specifically binds biotinylated DNA via avidin protein linkers and significantly reduces undesirable binding from non-specific interactions of proteins or DNA molecules on the surface. Second, the DNA molecules are biotinylated by two different methods depending on their terminals. The blunt ended DNA is tagged with biotinylated dUTP at its 3' hydroxyl terminus, by terminal transferase, while the sticky ended DNA is hybridized with biotinylated complimentary oligonucleotides by DNA ligase. Finally, a microfluidic shear flow makes single DNA molecules stretch to their full contour lengths after being stained with fluorescent protein-DNA binding peptide (FP-DBP).

  10. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

    ERIC Educational Resources Information Center

    Dimitrov, Valentin V.

    2009-01-01

    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  11. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

    ERIC Educational Resources Information Center

    Dimitrov, Valentin V.

    2009-01-01

    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  12. Assembly of G Protein-Coupled Receptors onto Nanosized Bacterial Magnetic Particles Using Mms16 as an Anchor Molecule

    PubMed Central

    Yoshino, Tomoko; Takahashi, Masayoshi; Takeyama, Haruko; Okamura, Yoshiko; Kato, Fukuichi; Matsunaga, Tadashi

    2004-01-01

    G protein-coupled receptors (GPCRs) play a central role in a wide range of biological processes and are prime targets for drug discovery. GPCRs have large hydrophobic domains, and therefore purification of GPCRs from cells is frequently time-consuming and typically results in loss of native conformation. In this work, GPCRs have been successfully assembled into the lipid membrane of nanosized bacterial magnetic particles (BMPs) produced by the magnetic bacterium Magnetospirillum magneticum AMB-1. A BMP-specific protein, Mms16, was used as an anchor molecule, and localization of heterologous Mms16 on BMPs was confirmed by luciferase fusion studies. Stable luminescence was obtained from BMPs bearing Mms16 fused with luciferase at the C-terminal region. D1 dopamine receptor (D1R), a GPCR, was also efficiently assembled onto BMPs by using Mms16 as an anchor molecule. D1R-BMP complexes were simply extracted by magnetic separation from ruptured AMB-1 transformants. After washing, the complexes were ready to use for analysis. This system conveniently refines the native conformation of GPCRs without the need for detergent solubilization, purification, and reconstitution after cell disruption. PMID:15128546

  13. Assembly of G protein-coupled receptors onto nanosized bacterial magnetic particles using Mms16 as an anchor molecule.

    PubMed

    Yoshino, Tomoko; Takahashi, Masayoshi; Takeyama, Haruko; Okamura, Yoshiko; Kato, Fukuichi; Matsunaga, Tadashi

    2004-05-01

    G protein-coupled receptors (GPCRs) play a central role in a wide range of biological processes and are prime targets for drug discovery. GPCRs have large hydrophobic domains, and therefore purification of GPCRs from cells is frequently time-consuming and typically results in loss of native conformation. In this work, GPCRs have been successfully assembled into the lipid membrane of nanosized bacterial magnetic particles (BMPs) produced by the magnetic bacterium Magnetospirillum magneticum AMB-1. A BMP-specific protein, Mms16, was used as an anchor molecule, and localization of heterologous Mms16 on BMPs was confirmed by luciferase fusion studies. Stable luminescence was obtained from BMPs bearing Mms16 fused with luciferase at the C-terminal region. D1 dopamine receptor (D1R), a GPCR, was also efficiently assembled onto BMPs by using Mms16 as an anchor molecule. D1R-BMP complexes were simply extracted by magnetic separation from ruptured AMB-1 transformants. After washing, the complexes were ready to use for analysis. This system conveniently refines the native conformation of GPCRs without the need for detergent solubilization, purification, and reconstitution after cell disruption.

  14. Electric-field-induced unwinding of ferroelectric helix in thin smectic C* layers with soft and rigid anchoring of molecules

    SciTech Connect

    Dolganov, P. V.; Zhilin, V. M. Dolganov, V. K.; Kats, E. I.

    2008-09-15

    The unwinding of a helical structure in thin films of a ferroelectric smectic liquid crystal (LC) by an external electric field has been theoretically studied using a discrete model in which every LC layer is characterized by a two-dimensional vector {xi}{sub i} (describing the orientation of molecules) and by the polarization P{sub i}. It is established that the unwinding of the LC helix in thin films significantly differs from the well-known behavior of thick samples. In particular, discrete intermediate states (differing by an integer or half-integer number of turns) are formed in thin films for both weak and strong anchoring of molecules to a substrate surface. The physical factor responsible for this behavior is the presence of near-surface regions with thicknesses below the helix pitch and the corresponding uncompensated polarization.

  15. Structural changes of linear DNA molecules induced by cisplatin

    SciTech Connect

    Liu, Zhiguo; Liu, Ruisi; Zhou, Zhen; Zu, Yuangang; Xu, Fengjie

    2015-02-20

    Interaction between long DNA molecules and activated cisplatin is believed to be crucial to anticancer activity. However, the exact structural changes of long DNA molecules induced by cisplatin are still not very clear. In this study, structural changes of long linear double-stranded DNA (dsDNA) and short single-stranded DNA (ssDNA) induced by activated cisplatin have been investigated by atomic force microscopy (AFM). The results indicated that long DNA molecules gradually formed network structures, beads-on-string structures and their large aggregates. Electrostatic and coordination interactions were considered as the main driving forces producing these novel structures. An interesting finding in this study is the beads-on-string structures. Moreover, it is worth noting that the beads-on-string structures were linked into the networks, which can be ascribed to the strong DNA–DNA interactions. This study expands our knowledge of the interactions between DNA molecules and cisplatin. - Highlights: • We investigate structural changes of dsDNA and ssDNA induced by cisplatin. • AFM results indicated long dsDNA formed network, beads-on-string and aggregates. • ssDNA can form very similar structures as those of long linear dsDNA. • A possible formation process of theses novel structure is proposed.

  16. Freezing shortens the lifetime of DNA molecules under tension.

    PubMed

    Chung, Wei-Ju; Cui, Yujia; Chen, Chi-Shuo; Wei, Wesley H; Chang, Rong-Shing; Shu, Wun-Yi; Hsu, Ian C

    2017-09-08

    DNA samples are commonly frozen for storage. However, freezing can compromise the integrity of DNA molecules. Considering the wide applications of DNA molecules in nanotechnology, changes to DNA integrity at the molecular level may cause undesirable outcomes. However, the effects of freezing on DNA integrity have not been fully explored. To investigate the impact of freezing on DNA integrity, samples of frozen and non-frozen bacteriophage lambda DNA were studied using optical tweezers. Tension (5-35 pN) was applied to DNA molecules to mimic mechanical interactions between DNA and other biomolecules. The integrity of the DNA molecules was evaluated by measuring the time taken for single DNA molecules to break under tension. Mean lifetimes were determined by maximum likelihood estimates and variances were obtained through bootstrapping simulations. Under 5 pN of force, the mean lifetime of frozen samples is 44.3 min with 95% confidence interval (CI) between 36.7 min and 53.6 min while the mean lifetime of non-frozen samples is 133.2 min (95% CI: 97.8-190.1 min). Under 15 pN of force, the mean lifetimes are 10.8 min (95% CI: 7.6-12.6 min) and 78.5 min (95% CI: 58.1-108.9 min). The lifetimes of frozen DNA molecules are significantly reduced, implying that freezing compromises DNA integrity. Moreover, we found that the reduced DNA structural integrity cannot be restored using regular ligation process. These results indicate that freezing can alter the structural integrity of the DNA molecules.

  17. Nanopore detection of DNA molecules in magnesium chloride solutions

    PubMed Central

    2013-01-01

    High translocation speed of a DNA strand through a nanopore is a major bottleneck for nanopore detection of DNA molecules. Here, we choose MgCl2 electrolyte as salt solution to control DNA mobility. Experimental results demonstrate that the duration time for straight state translocation events in 1 M MgCl2 solution is about 1.3 ms which is about three times longer than that for the same DNA in 1 M KCl solution. This is because Mg2+ ions can effectively reduce the surface charge density of the negative DNA strands and then lead to the decrease of the DNA electrophoretic speed. It is also found that the Mg2+ ions can induce the DNA molecules binding together and reduce the probability of straight DNA translocation events. The nanopore with small diameter can break off the bound DNA strands and increase the occurrence probability of straight DNA translocation events. PMID:23688283

  18. Adsorption behavior of Co anchored on graphene sheets toward NO, SO2, NH3, CO and HCN molecules

    NASA Astrophysics Data System (ADS)

    Tang, Yanan; Chen, Weiguang; Li, Chenggang; Pan, Lijun; Dai, Xianqi; Ma, Dongwei

    2015-07-01

    Based on the first-principles of density-functional theory (DFT), the effects of gas adsorption on the change in geometric stability, electronic structure and magnetic properties of graphene with anchored Co (Co-graphene) systems were investigated. A single Co adatom interacts much weaker with pristine graphene (Co/pri-graphene) than with the graphene containing a single vacancy (Co/SV-graphene). The Co dopant provides more electrons to the dangling bonds of carbon atom at defective site and exhibits more positive charges, which makes Co/SV-graphene less prone to be adsorbed by gas molecules in comparison to Co/pri-graphene. It is found that the electronic structure and magnetic properties of Co-graphene systems can be modulated by adsorbing gas molecules. Except the NH3 molecule, the adsorbed NO, SO2, CO or HCN as electron acceptors on the Co/pri-graphene can exhibit semiconducting properties. Among the gas molecules, the strong adsorption of NO molecule can effectively regulate the magnetic properties of Co-graphene systems. Moreover, the stable configuration of Co/SV-graphene is more likely to be the gas sensor for detecting NO and SO2. The results validate that the reactivity of atomic-scale catalyst is supported on graphene sheets, which is expected to be potentially efficient in the gas sensors and electronic device.

  19. Enzymatic assembly of DNA molecules up to several hundred kilobases.

    PubMed

    Gibson, Daniel G; Young, Lei; Chuang, Ray-Yuan; Venter, J Craig; Hutchison, Clyde A; Smith, Hamilton O

    2009-05-01

    We describe an isothermal, single-reaction method for assembling multiple overlapping DNA molecules by the concerted action of a 5' exonuclease, a DNA polymerase and a DNA ligase. First we recessed DNA fragments, yielding single-stranded DNA overhangs that specifically annealed, and then covalently joined them. This assembly method can be used to seamlessly construct synthetic and natural genes, genetic pathways and entire genomes, and could be a useful molecular engineering tool.

  20. Visualization of Single Molecules of RNA Polymerase Sliding along DNA

    NASA Astrophysics Data System (ADS)

    Kabata, Hiroyuki; Kurosawa, Osamu; Arai, Ichiro; Washizu, Masao; Margarson, Stefanie A.; Glass, Robert E.; Shimamoto, Nobuo

    1993-12-01

    Transcription requires that RNA polymerase binds to promoters buried in nonspecific sites on DNA. The search for promoters may be facilitated if the polymerase slides along the molecule of DNA. Single molecules of Escherichia coli RNA polymerase were visualized, and their movements on immobilized bacteriophage λ and T7 DNAs were examined. Deviating from drifts by bulk flow, about 40 percent of the enzyme molecules moved along the extended DNA. The results provide direct evidence for sliding as a mechanism for relocation of the enzyme on DNA.

  1. The Elasticity of a Single Supercoiled DNA Molecule

    NASA Astrophysics Data System (ADS)

    Strick, T. R.; Allemand, J.-F.; Bensimon, D.; Bensimon, A.; Croquette, V.

    1996-03-01

    Single linear DNA molecules were bound at multiple sites at one extremity to a treated glass cover slip and at the other to a magnetic bead. The DNA was therefore torsionally constrained. A magnetic field was used to rotate the beads and thus to coil and pull the DNA. The stretching force was determined by analysis of the Brownian fluctuations of the bead. Here, the elastic behavior of individual λ DNA molecules over-and underwound by up to 500 turns was studied. A sharp transition was discovered from a low to a high extension state at a force of ~0.45 piconewtons for underwound molecules and at a force of ~3 piconewtons for overwound ones. These transitions, probably reflecting the formation of alternative structure in stretched coiled DNA molecules, might be relevant for DNA transcription and replication.

  2. Recent developments in single-molecule DNA mechanics

    PubMed Central

    Bryant, Zev; Oberstrass, Florian C.; Basu, Aakash

    2013-01-01

    Over the past two decades, measurements on individual stretched and twisted DNA molecules have helped define the basic elastic properties of the double helix and enabled real-time functional assays of DNA-associated molecular machines. Recently, new magnetic tweezers approaches for simultaneously measuring freely fluctuating twist and extension have begun to shed light on the structural dynamics of large nucleoprotein complexes. Related technical advances have facilitated direct measurements of DNA torque, contributing to a better understanding of abrupt structural transitions in mechanically stressed DNA. The new measurements have also been exploited in studies that hint at a developing synergistic relationship between single-molecule manipulation and structural DNA nanotechnology. PMID:22658779

  3. Oriented and vectorial immobilization of linear M13 dsDNA between interdigitated electrodes--towards single molecule DNA nanostructures.

    PubMed

    Hölzel, Ralph; Gajovic-Eichelmann, Nenad; Bier, Frank F

    2003-05-01

    The ability to control molecules at a resolution well below that offered by photolithography has gained much interest recently. DNA is a promising candidate for this task since it offers excellent specificity in base-pairing combined with addressability at the nanometer scale. New applications in biosensing, e.g. interaction analysis at the single molecule level, or nanobiotechnology, e.g. ultradense DNA microarrays, have been devised that rely on stretched DNA bridges. The basic technology required is the ability to deposit spatially defined, stretched DNA-bridges between anchoring structures on surfaces. In this paper we present two techniques for spanning 2 microm long dsDNA bridges between neighboring interdigitated electrodes (IDEs). The extended DNA used was linearized M13 dsDNA (M13mp18 7231 bp, ca. 2.5 microm length), either unmodified, or with chemical modifications at both ends. The first approach is based on the dielectrophoretic (DEP) concentration and alignment of linearized wild-type dsDNA. IDEs with 1.7 microm spacing are driven with an AC voltage around 1 MHz leading to field strengths in the order of 1 MV m(-1). The dsDNA is polarized and linearized by the force field and accumulates in the gap between two neighboring electrodes. This process is reversible and was visualized by fluorescence staining of M13 DNA using PicoGreen, as intercalating dye. The resulting dsDNA bridges and their orientation are discernible under the fluorescence microscope using fluorescent particles of different color. The particles are tagged with sequence specific peptide nucleic acid (PNA) probes that bind to the DNA double strand at specific sites. The second approach is based on asymmetric electrochemical modification of a gold IDE with 2.0 microm spacings followed by spontaneous or stimulated deposition of a chemically modified M13-DNA. One side of the IDE was selectively coated with streptavidin by electropolymerization of a novel hydrophilic conductive polymer in

  4. Effect of anchor positioning on binding and diffusion of elongated 3D DNA nanostructures on lipid membranes

    NASA Astrophysics Data System (ADS)

    Khmelinskaia, Alena; Franquelim, Henri G.; Petrov, Eugene P.; Schwille, Petra

    2016-05-01

    DNA origami is a state-of-the-art technology that enables the fabrication of nano-objects with defined shapes, to which functional moieties, such as lipophilic anchors, can be attached with a nanometre scale precision. Although binding of DNA origami to lipid membranes has been extensively demonstrated, the specific requirements necessary for membrane attachment are greatly overlooked. Here, we designed a set of amphipathic rectangular-shaped DNA origami structures with varying placement and number of chol-TEG anchors used for membrane attachment. Single- and multiple-cholesteryl-modified origami nanostructures were produced and studied in terms of their membrane localization, density and dynamics. We show that the positioning of at least two chol-TEG moieties near the corners is essential to ensure efficient membrane binding of large DNA nanostructures. Quantitative fluorescence correlation spectroscopy data further confirm that increasing the number of corner-positioned chol-TEG anchors lowers the dynamics of flat DNA origami structures on freestanding membranes. Taken together, our approach provides the first evidence of the importance of the location in addition to the number of hydrophobic moieties when rationally designing minimal DNA nanostructures with controlled membrane binding.

  5. Visualization of DNA molecules in time during electrophoresis

    NASA Technical Reports Server (NTRS)

    Lubega, Seth

    1991-01-01

    For several years individual DNA molecules have been observed and photographed during agarose gel electrophoresis. The DNA molecule is clearly the largest molecule known. Nevertheless, the largest molecule is still too small to be seen using a microscope. A technique developed by Morikawa and Yanagida has made it possible to visualize individual DNA molecules. When these long molecules are labeled with appropriate fluorescence dyes and observed under a fluorescence microscope, although it is not possible to directly visualize the local ultrastructure of the molecules, yet because they are long light emitting chains, their microscopic dynamical behavior can be observed. This visualization works in the same principle that enables one to observe a star through a telescope because it emits light against a dark background. The dynamics of individual DNA molecules migrating through agarose matrix during electrophoresis have been described by Smith et al. (1989), Schwartz and Koval (1989), and Bustamante et al. (1990). DNA molecules during agarose gel electrophoresis advance lengthwise thorough the gel in an extended configuration. They display an extension-contraction motion and tend to bunch up in their leading ends as the 'heads' find new pores through the gel. From time to time they get hooked on obstacles in the gel to form U-shaped configurations before they resume their linear configuration.

  6. Controlling Electrical Conductance through a π-Conjugated Cruciform Molecule by Selective Anchoring to Gold Electrodes.

    PubMed

    Huang, Cancan; Chen, Songjie; Baruël Ørnsø, Kristian; Reber, David; Baghernejad, Masoud; Fu, Yongchun; Wandlowski, Thomas; Decurtins, Silvio; Hong, Wenjing; Thygesen, Kristian Sommer; Liu, Shi-Xia

    2015-11-23

    Tuning charge transport at the single-molecule level plays a crucial role in the construction of molecular electronic devices. Introduced herein is a promising and operationally simple approach to tune two distinct charge-transport pathways through a cruciform molecule. Upon in situ cleavage of triisopropylsilyl groups, complete conversion from one junction type to another is achieved with a conductance increase by more than one order of magnitude, and it is consistent with predictions from ab initio transport calculations. Although molecules are well known to conduct through different orbitals (either HOMO or LUMO), the present study represents the first experimental realization of switching between HOMO- and LUMO-dominated transport within the same molecule. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Ten years of tension: single-molecule DNA mechanics.

    PubMed

    Bustamante, Carlos; Bryant, Zev; Smith, Steven B

    2003-01-23

    The basic features of DNA were elucidated during the half-century following the discovery of the double helix. But it is only during the past decade that researchers have been able to manipulate single molecules of DNA to make direct measurements of its mechanical properties. These studies have illuminated the nature of interactions between DNA and proteins, the constraints within which the cellular machinery operates, and the forces created by DNA-dependent motors.

  8. DNA-binding small molecules as inhibitors of transcription factors.

    PubMed

    Leung, Chung-Hang; Chan, Daniel Shiu-Hin; Ma, Victor Pui-Yan; Ma, Dik-Lung

    2013-07-01

    Accumulating evidence implicating the role of aberrant transcription factor signaling in the pathogenesis of various human diseases such as cancer and inflammation has stimulated the development of small molecule ligands capable of targeting transcription factor activity and modulating gene expression. The use of DNA-binding small molecules to selectively inhibit transcription factor-DNA interactions represents one possible approach toward this goal. In this review, we summarize the development of DNA-binding small molecule inhibitors of transcription factors from 2004 to 2011, and their binding mode and therapeutic potential will be discussed. © 2012 Wiley Periodicals, Inc.

  9. Structural Transitions of a Twisted and Stretched DNA Molecule

    NASA Astrophysics Data System (ADS)

    Léger, J. F.; Romano, G.; Sarkar, A.; Robert, J.; Bourdieu, L.; Chatenay, D.; Marko, J. F.

    1999-08-01

    We report results of a micromanipulation study of single double-helical DNA molecules at forces up to 150 pN. Depending on whether the DNA winding is allowed to relax, or held fixed, qualitatively different structural transitions are observed. By studying the transitions as a function of winding the different DNA structures underlying them are characterized; this allows us to report the first estimate of S-DNA helicity. A model is introduced to describe these transitions; in addition to B-DNA, we find that four DNA states are needed to describe the experiments.

  10. Nanofluidic channel fabrication and manipulation of DNA molecules.

    PubMed

    Wang, Kai-Ge; Niu, Hanben

    2009-01-01

    Confining DNA molecules in a nanofluidic channel, particularly in channels with cross sections comparable to the persistence length of the DNA molecule (about 50 nm), allows the discovery of new biophysical phenomena. This sub-100 nm nanofluidic channel can be used as a novel platform to study and analyze the static as well as the dynamic properties of single DNA molecules, and can be integrated into a biochip to investigate the interactions between protein and DNA molecules. For instance, nanofluidic channel arrays that have widths of approximately 40 nm, depths of 60 nm, and lengths of 50 mum are created rapidly and exactly by a focused-ion beam milling instrument on a silicon nitride film; and the open channels are sealed with anodic bonding technology. Subsequently, lambda phage DNA (lambda-DNA; stained with the fluorescent dye, YOYO-1) molecules are introduced into these nanoconduits by capillary force. The movements of the DNA molecules, e.g. stretching, recoiling, and transporting along channels, are studied with fluorescence microscopy.

  11. Single Molecule Electrical Sequencing of DNA and RNA

    NASA Astrophysics Data System (ADS)

    Taniguchi, Masateru

    2013-03-01

    Gating nanopore devices are composed of nanopores with embedded nanoelectrodes, and they are expected to be one of the core devices used to realize label-free, low-cost DNA sequencing, subsequently leading to 1000-genome sequencing technologies. The operating principle of these nanodevices is based on identifying single base molecules of single DNA passing through a nanopore using a tunneling current between nanoelectrodes. We successfully identified single base molecules of DNA and RNA using tunneling currents. To make gating nanopore devices fit for practical use, core technologies should be integrated on one device chip. One core technology is the identification of single DNA and RNA composed of many base molecules using tunneling currents. We have succeeded in the single-molecule electrical sequencing of DNA and RNA formed by 3 and 7 base molecules, respectively, using a hybrid method of identifying single base molecules via a tunnelling current and random sequencing. A method that controls the speed of a single DNA passing through a nanopore is one core technology that determines the speed and accuracy of sequencing. We successfully developed a method that controls the translocation speed of a single DNA by three orders of magnitude using a voltage between nanoelectrodes.

  12. Localized single molecule isotherms of DNA molecules at confined liquid-solid interfaces.

    PubMed

    Liang, Heng; Cheng, Xiaoliang; Ma, Yinfa

    2009-03-15

    The study of dynamics and thermodynamics of single biological molecules at confined liquid-solid interfaces is crucially important, especially in the case of low-copy number molecules in a single cell. Using a high-throughput single molecule imaging system and Lagrangian coordinates of single molecule images, we discovered that the local equilibrium isotherms of single lambdaDNA molecules at a confined liquid-solid interface varied from a stair type for the regions of single or double molecular DNA to a mild "S" type for the regions of triple molecular DNA spots, which does not agree with the conventional equilibrium isotherms in the literature. Single molecule images in time sequence for different lambdaDNA concentrations were statistically analyzed by measuring preferential partitioning from shearing effects, which were used to measure the local velocity of DNA molecules by directly observing the migration of DNA fluorescence spots for the 12 continuous images. The local linear velocity of hydrodynamic flow was calculated by the Hagen-Poiseuille equation in different microregions with a local Lagrangian approach. The local single molecule isotherms for the tracked molecules in the regions of single, double, or triple molecular DNA layers within the laminar flows were obtained according to the average local velocities of both the stochastic molecule events and the corresponding local Poiseuille flows. A millisecond and microvolume approach to directly determine local single molecule isotherms at confined liquid-solid interfaces was established, and the microspace scale effects on the types of isotherms were discovered. This study may have significant impact on preparations of low-copy number proteins in a single cell, membrane separations, and other bioseparation studies.

  13. Small-molecule discovery from DNA-encoded chemical libraries.

    PubMed

    Kleiner, Ralph E; Dumelin, Christoph E; Liu, David R

    2011-12-01

    Researchers seeking to improve the efficiency and cost effectiveness of the bioactive small-molecule discovery process have recently embraced selection-based approaches, which in principle offer much higher throughput and simpler infrastructure requirements compared with traditional small-molecule screening methods. Since selection methods benefit greatly from an information-encoding molecule that can be readily amplified and decoded, several academic and industrial groups have turned to DNA as the basis for library encoding and, in some cases, library synthesis. The resulting DNA-encoded synthetic small-molecule libraries, integrated with the high sensitivity of PCR and the recent development of ultra high-throughput DNA sequencing technology, can be evaluated very rapidly for binding or bond formation with a target of interest while consuming minimal quantities of material and requiring only modest investments of time and equipment. In this tutorial review we describe the development of two classes of approaches for encoding chemical structures and reactivity with DNA: DNA-recorded library synthesis, in which encoding and library synthesis take place separately, and DNA-directed library synthesis, in which DNA both encodes and templates library synthesis. We also describe in vitro selection methods used to evaluate DNA-encoded libraries and summarize successful applications of these approaches to the discovery of bioactive small molecules and novel chemical reactivity.

  14. Small-Molecule Discovery from DNA-Encoded Chemical Libraries†

    PubMed Central

    Kleiner, Ralph E.; Dumelin, Christoph E.; Liu, David R.

    2015-01-01

    Researchers seeking to improve the efficiency and cost effectiveness of the bioactive small-molecule discovery process have recently embraced selection-based approaches, which in principle offer much higher throughput and simpler infrastructure requirements compared with traditional small-molecule screening methods. Since selection methods benefit greatly from an information-encoding molecule that can be readily amplified and decoded, several academic and industrial groups have turned to DNA as the basis for library encoding and, in some cases, library synthesis. The resulting DNA-encoded synthetic small-molecule libraries, integrated with the high sensitivity of PCR and the recent development of ultra high-throughput DNA sequencing technology, can be evaluated very rapidly for binding or bond formation with a target of interest while consuming minimal quantities of material and requiring only modest investments of time and equipment. In this review we describe the development of two classes of approaches for encoding chemical structures and reactivity with DNA: DNA-recorded library synthesis, in which encoding and library synthesis take place separately, and DNA-directed library synthesis, in which DNA both encodes and templates library synthesis. We also describe in vitro selection methods used to evaluate DNA-encoded libraries and summarize successful applications of these approaches to the discovery of bioactive small molecules and novel chemical reactivity. PMID:21674077

  15. Visualizing helicases unwinding DNA at the single molecule level.

    PubMed

    Fili, Natali; Mashanov, Gregory I; Toseland, Christopher P; Batters, Christopher; Wallace, Mark I; Yeeles, Joseph T P; Dillingham, Mark S; Webb, Martin R; Molloy, Justin E

    2010-07-01

    DNA helicases are motor proteins that catalyze the unwinding of double-stranded DNA into single-stranded DNA using the free energy from ATP hydrolysis. Single molecule approaches enable us to address detailed mechanistic questions about how such enzymes move processively along DNA. Here, an optical method has been developed to follow the unwinding of multiple DNA molecules simultaneously in real time. This was achieved by measuring the accumulation of fluorescent single-stranded DNA-binding protein on the single-stranded DNA product of the helicase, using total internal reflection fluorescence microscopy. By immobilizing either the DNA or helicase, localized increase in fluorescence provides information about the rate of unwinding and the processivity of individual enzymes. In addition, it reveals details of the unwinding process, such as pauses and bursts of activity. The generic and versatile nature of the assay makes it applicable to a variety of DNA helicases and DNA templates. The method is an important addition to the single-molecule toolbox available for studying DNA processing enzymes.

  16. Single-molecule mechanochemical sensing using DNA origami nanostructures.

    PubMed

    Koirala, Deepak; Shrestha, Prakash; Emura, Tomoko; Hidaka, Kumi; Mandal, Shankar; Endo, Masayuki; Sugiyama, Hiroshi; Mao, Hanbin

    2014-07-28

    While single-molecule sensing offers the ultimate detection limit, its throughput is often restricted as sensing events are carried out one at a time in most cases. 2D and 3D DNA origami nanostructures are used as expanded single-molecule platforms in a new mechanochemical sensing strategy. As a proof of concept, six sensing probes are incorporated in a 7-tile DNA origami nanoassembly, wherein binding of a target molecule to any of these probes leads to mechanochemical rearrangement of the origami nanostructure, which is monitored in real time by optical tweezers. Using these platforms, 10 pM platelet-derived growth factor (PDGF) are detected within 10 minutes, while demonstrating multiplex sensing of the PDGF and a target DNA in the same solution. By tapping into the rapid development of versatile DNA origami nanostructures, this mechanochemical platform is anticipated to offer a long sought solution for single-molecule sensing with improved throughput.

  17. Structural heterogeneity of mitochondrial DNA molecules within the genus Drosophila.

    PubMed Central

    Fauron, C M; Wolstenholme, D R

    1976-01-01

    We have determined by electron microscopy the molecular weight of circular mitochondrial DNA (mtDNA) molecules from 39 species representing 13 groups of five subgenera of the genus Drosophila. mtDNA molecules of all species examined, other than members of the melanogaster group, had, with one exception, molecular weights in the rather narrow range 9.90 X 10(6). The one exception was D. robusta, which had a molecular weight of 10.61 X 10(6). In contrast, mtDNA molecules from species within the melanogaster group had molecular weights covering the considerably greater range 9.92 X 10(6) to 12.35 X 10(6). Applying the electron microscope denaturation mapping technique of Inman to mtDNA molecules of eight species of the melanogaster group, we found each of them to contain a region [presumably rich in adenine and thymine (A+T)] which denatured at a specific temperature (40 degrees) at which most of the remainder of the molecule remained undenatured. The size of the A+T-rich region was constant for mtDNA molecules of a species, but varied from 0.62 X 10(6) to 3.41 X 10(6) for mtDNA molecules of different species. It was demonstrated that the differences in molecular weights of the A+T-rich regions can almost completely account for the differences in total molecular weights of the mtDNA molecules from species of the melanogaster group. Images PMID:1068475

  18. Entropic boundary effects on the elasticity of short DNA molecules

    NASA Astrophysics Data System (ADS)

    Chen, Yih-Fan; Wilson, David P.; Raghunathan, Krishnan; Meiners, Jens-Christian

    2009-08-01

    We have measured the entropic elasticity of double-stranded-DNA molecules ranging from 247 to 1298 bp in length using axial force-clamp optical tweezers. We show that entropic end effects and excluded-volume forces from surface attachments become significant for such short molecules. The effective persistence length of the shortest molecules decreases by a factor of 2 compared to the established value for long molecules, and excluded-volume forces extend the molecules to about one third of their nominal contour length. We interpret these results in the framework of an inextensible semiflexible rod model.

  19. Sequence-Specific Molecular Lithography on Single DNA Molecules

    NASA Astrophysics Data System (ADS)

    Keren, Kinneret; Krueger, Michael; Gilad, Rachel; Ben-Yoseph, Gdalyahu; Sivan, Uri; Braun, Erez

    2002-07-01

    Recent advances in the realization of individual molecular-scale electronic devices emphasize the need for novel tools and concepts capable of assembling such devices into large-scale functional circuits. We demonstrated sequence-specific molecular lithography on substrate DNA molecules by harnessing homologous recombination by RecA protein. In a sequence-specific manner, we patterned the coating of DNA with metal, localized labeled molecular objects and grew metal islands on specific sites along the DNA substrate, and generated molecularly accurate stable DNA junctions for patterning the DNA substrate connectivity. In our molecular lithography, the information encoded in the DNA molecules replaces the masks used in conventional microelectronics, and the RecA protein serves as the resist. The molecular lithography works with high resolution over a broad range of length scales from nanometers to many micrometers.

  20. Direct visualization of supercoiled DNA molecules in solution.

    PubMed Central

    Adrian, M; ten Heggeler-Bordier, B; Wahli, W; Stasiak, A Z; Stasiak, A; Dubochet, J

    1990-01-01

    The shape of supercoiled DNA molecules in solution is directly visualized by cryo-electron microscopy of vitrified samples. We observe that: (i) supercoiled DNA molecules in solution adopt an interwound rather than a toroidal form, (ii) the diameter of the interwound superhelix changes from about 12 nm to 4 nm upon addition of magnesium salt to the solution and (iii) the partition of the linking deficit between twist and writhe can be quantitatively determined for individual molecules. Images Fig. 1. Fig. 2. Fig. 3. PMID:2265618

  1. Arrays of Individual DNA Molecules on Nanopatterned Substrates

    NASA Astrophysics Data System (ADS)

    Hager, Roland; Halilovic, Alma; Burns, Jonathan R.; Schäffler, Friedrich; Howorka, Stefan

    2017-02-01

    Arrays of individual molecules can combine the advantages of microarrays and single-molecule studies. They miniaturize assays to reduce sample and reagent consumption and increase throughput, and additionally uncover static and dynamic heterogeneity usually masked in molecular ensembles. However, realizing single-DNA arrays must tackle the challenge of capturing structurally highly dynamic strands onto defined substrate positions. Here, we create single-molecule arrays by electrostatically adhering single-stranded DNA of gene-like length onto positively charged carbon nanoislands. The nanosites are so small that only one molecule can bind per island. Undesired adsorption of DNA to the surrounding non-target areas is prevented via a surface-passivating film. Of further relevance, the DNA arrays are of tunable dimensions, and fabricated on optically transparent substrates that enable singe-molecule detection with fluorescence microscopy. The arrays are hence compatible with a wide range of bioanalytical, biophysical, and cell biological studies where individual DNA strands are either examined in isolation, or interact with other molecules or cells.

  2. Arrays of Individual DNA Molecules on Nanopatterned Substrates

    PubMed Central

    Hager, Roland; Halilovic, Alma; Burns, Jonathan R.; Schäffler, Friedrich; Howorka, Stefan

    2017-01-01

    Arrays of individual molecules can combine the advantages of microarrays and single-molecule studies. They miniaturize assays to reduce sample and reagent consumption and increase throughput, and additionally uncover static and dynamic heterogeneity usually masked in molecular ensembles. However, realizing single-DNA arrays must tackle the challenge of capturing structurally highly dynamic strands onto defined substrate positions. Here, we create single-molecule arrays by electrostatically adhering single-stranded DNA of gene-like length onto positively charged carbon nanoislands. The nanosites are so small that only one molecule can bind per island. Undesired adsorption of DNA to the surrounding non-target areas is prevented via a surface-passivating film. Of further relevance, the DNA arrays are of tunable dimensions, and fabricated on optically transparent substrates that enable singe-molecule detection with fluorescence microscopy. The arrays are hence compatible with a wide range of bioanalytical, biophysical, and cell biological studies where individual DNA strands are either examined in isolation, or interact with other molecules or cells. PMID:28198806

  3. Recursive construction of perfect DNA molecules from imperfect oligonucleotides.

    PubMed

    Linshiz, Gregory; Yehezkel, Tuval Ben; Kaplan, Shai; Gronau, Ilan; Ravid, Sivan; Adar, Rivka; Shapiro, Ehud

    2008-01-01

    Making faultless complex objects from potentially faulty building blocks is a fundamental challenge in computer engineering, nanotechnology and synthetic biology. Here, we show for the first time how recursion can be used to address this challenge and demonstrate a recursive procedure that constructs error-free DNA molecules and their libraries from error-prone oligonucleotides. Divide and Conquer (D&C), the quintessential recursive problem-solving technique, is applied in silico to divide the target DNA sequence into overlapping oligonucleotides short enough to be synthesized directly, albeit with errors; error-prone oligonucleotides are recursively combined in vitro, forming error-prone DNA molecules; error-free fragments of these molecules are then identified, extracted and used as new, typically longer and more accurate, inputs to another iteration of the recursive construction procedure; the entire process repeats until an error-free target molecule is formed. Our recursive construction procedure surpasses existing methods for de novo DNA synthesis in speed, precision, amenability to automation, ease of combining synthetic and natural DNA fragments, and ability to construct designer DNA libraries. It thus provides a novel and robust foundation for the design and construction of synthetic biological molecules and organisms.

  4. Single-Molecule Denaturation Mapping of DNA in Nanofluidic Channels

    NASA Astrophysics Data System (ADS)

    Reisner, Walter; Larsen, Niels; Silahtaroglu, Asli; Kristensen, Anders; Tommerup, Niels; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

    2010-03-01

    Nanochannel based DNA stretching can serve as a platform for a new optical mapping technique based on measuring the pattern of partial melting along the extended molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions along the molecule and can be explained by calculations of sequence-dependent melting probability. Specifically, we obtain experimental melting profiles for T4, T7, lambda-phage and bacterial artificial chromosome DNA (from human chromosome 12) and compare these profiles to theory. In addition, we demonstrate that the BAC melting profile can be used to align the BAC to its correct position on chromosome 12.

  5. Correctly sorted molecules of a GPI-anchored protein are clustered and immobile when they arrive at the apical surface of MDCK cells

    PubMed Central

    1993-01-01

    Glycosyl-phosphatidylinositol (GPI)-anchored proteins are sorted to the apical surface of many epithelial cell types. To better understand the mechanism for apical segregation of these proteins, we analyzed the lateral mobility and molecular associations of a model GPI-anchored protein, herpes simplex virus gD1 fused to human decay accelerating factor (gD1-DAF) (Lisanti, M. P., I. W. Caras, M. A. Davitz, and E. Rodriguez-Boulan. 1989. J. Cell Biol. 109:2145-2156) shortly after arrival and after long-term residence at the surface of confluent, polarized MDCK cells. FRAP measurements of lateral diffusion showed that the mobile fraction of newly arrived gD1-DAF molecules was much less than the mobile fraction of long-term resident molecules (40 vs. 80-90%). Fluorescence resonance energy transfer measurements showed that the newly arrived molecules were clustered, while resident molecules were not. Newly delivered gD1-DAF molecules were clustered but not immobilized in mutant, Concanavalin A-resistant MDCK cells that failed to sort gD1-DAF. Our results indicate that GPI-anchored proteins in MDCK cells are clustered before delivery to the surface. However, clustering alone does not target molecules for apical delivery. The immobilization observed when gD1-DAF is correctly sorted suggests that the clusters must associate some component of the cell's cytoplasm. PMID:8380601

  6. Light-Triggered Release of Bioactive Molecules from DNA Nanostructures.

    PubMed

    Kohman, Richie E; Cha, Susie S; Man, Heng-Ye; Han, Xue

    2016-04-13

    Recent innovations in DNA nanofabrication allow the creation of intricately shaped nanostructures ideally suited for many biological applications. To advance the use of DNA nanotechnology for the controlled release of bioactive molecules, we report a general strategy that uses light to liberate encapsulated cargoes from DNA nanostructures with high spatiotemporal precision. Through the incorporation of a custom, photolabile cross-linker, we encapsulated cargoes ranging in size from small molecules to full-sized proteins within DNA nanocages and then released such cargoes upon brief exposure to light. This novel molecular uncaging technique offers a general approach for precisely releasing a large variety of bioactive molecules, allowing investigation into their mechanism of action, or finely tuned delivery with high temporal precision for broad biomedical and materials applications.

  7. Real-time DNA sequencing from single polymerase molecules.

    PubMed

    Korlach, Jonas; Bjornson, Keith P; Chaudhuri, Bidhan P; Cicero, Ronald L; Flusberg, Benjamin A; Gray, Jeremy J; Holden, David; Saxena, Ravi; Wegener, Jeffrey; Turner, Stephen W

    2010-01-01

    Pacific Biosciences has developed a method for real-time sequencing of single DNA molecules (Eid et al., 2009), with intrinsic sequencing rates of several bases per second and read lengths into the kilobase range. Conceptually, this sequencing approach is based on eavesdropping on the activity of DNA polymerase carrying out template-directed DNA polymerization. Performed in a highly parallel operational mode, sequential base additions catalyzed by each polymerase are detected with terminal phosphate-linked, fluorescence-labeled nucleotides. This chapter will first outline the principle of this single-molecule, real-time (SMRT) DNA sequencing method, followed by descriptions of its underlying components and typical sequencing run conditions. Two examples are provided which illustrate that, in addition to the DNA sequence, the dynamics of DNA polymerization from each enzyme molecules is directly accessible: the determination of base-specific kinetic parameters from single-molecule sequencing reads, and the characterization of DNA synthesis rate heterogeneities. Copyright 2010 Elsevier Inc. All rights reserved.

  8. Highly Parallel Translation of DNA Sequences into Small Molecules

    PubMed Central

    Weisinger, Rebecca M.; Wrenn, S. Jarrett; Harbury, Pehr B.

    2012-01-01

    A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 1010 to 1015 distinct molecules for the discovery of nanomolar-affinity ligands to proteins.[1], [2], [3], [4], [5] Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands.[6], [7] Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons.[8] Creating a collection of 1010 to 1015 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments. PMID:22479303

  9. Streching of (DNA/functional molecules) complex between electrodes towards DNA molecular wire

    NASA Astrophysics Data System (ADS)

    Kobayashi, Norihisa; Nishizawa, Makoto; Inoue, Shintarou; Nakamura, Kazuki

    2009-08-01

    DNA/functional molecules such as (Ru(bpy)32+ complex, conducting polymer etc.) complex was prepared to study molecular structure and I-V characteristics towards DNA molecular wire. For example, Ru(bpy)32+ was associated with duplex of DNA by not only electrostatic interaction but also intercalation in the aqueous solution. Singlemolecular structure of DNA/Ru(bpy)32+ complex was analyzed with AFM. We found a network structure of DNA/Ru(bpy)32+ complex on the mica substrate, which is similar to native DNA. The height of DNA/Ru(bpy)32+ complex on the mica substrate was ranging from 0.8 to 1.6 nm, which was higher than the naked DNA (0.5-1.0 nm). This indicates that single-molecular DNA/Ru(bpy)32+ complex also connects to each other to form network structure on a mica substrate. In order to stretch DNA complex between electrodes, we employed high frequency and high electric field stretching method proposed by Washizu et al. We stretched and immobilized DNA single molecules between a pair of electrodes and its structures were analyzed with AFM technique. The I-V characteristics of DNA single molecules between electrodes were improved by the association of functional molecules with DNA. The molecular structure and I-V characteristics of DNA complex were discussed.

  10. Studying DNA Looping by Single-Molecule FRET

    PubMed Central

    Le, Tung T.; Kim, Harold D.

    2014-01-01

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA. PMID:24998459

  11. Single molecule study of a processivity clamp sliding on DNA

    SciTech Connect

    Laurence, T A; Kwon, Y; Johnson, A; Hollars, C; O?Donnell, M; Camarero, J A; Barsky, D

    2007-07-05

    Using solution based single molecule spectroscopy, we study the motion of the polIII {beta}-subunit DNA sliding clamp ('{beta}-clamp') on DNA. Present in all cellular (and some viral) forms of life, DNA sliding clamps attach to polymerases and allow rapid, processive replication of DNA. In the absence of other proteins, the DNA sliding clamps are thought to 'freely slide' along the DNA; however, the abundance of positively charged residues along the inner surface may create favorable electrostatic contact with the highly negatively charged DNA. We have performed single-molecule measurements on a fluorescently labeled {beta}-clamp loaded onto freely diffusing plasmids annealed with fluorescently labeled primers of up to 90 bases. We find that the diffusion constant for 1D diffusion of the {beta}-clamp on DNA satisfies D {le} 10{sup -14} cm{sup 2}/s, much slower than the frictionless limit of D = 10{sup -10} cm{sup 2}/s. We find that the {beta} clamp remains at the 3-foot end in the presence of E. coli single-stranded binding protein (SSB), which would allow for a sliding clamp to wait for binding of the DNA polymerase. Replacement of SSB with Human RP-A eliminates this interaction; free movement of sliding clamp and poor binding of clamp loader to the junction allows sliding clamp to accumulate on DNA. This result implies that the clamp not only acts as a tether, but also a placeholder.

  12. Kinetic mechanism for DNA unwinding by multiple molecules of Dda helicase aligned on DNA.

    PubMed

    Eoff, Robert L; Raney, Kevin D

    2010-06-01

    Helicases catalyze the separation of double-stranded nucleic acids to form single-stranded intermediates. Using transient state kinetic methods, we have determined the kinetic properties of DNA unwinding under conditions that favor a monomeric form of the Dda helicase as well as conditions that allow multiple molecules to function on the same substrate. Multiple helicase molecules can align like a train on the DNA track. The number of base pairs unwound in a single binding event for Dda is increased from approximately 19 bp for the monomeric form to approximately 64 bp when as many as four Dda molecules are aligned on the same substrate, while the kinetic step size (3.2 +/- 0.7 bp) and unwinding rate (242 +/- 25 bp/s) appear to be independent of the number of Dda molecules present on a given substrate. The data support a model in which the helicase molecules bound to the same substrate move along the DNA track independently during DNA unwinding. The observed increase in processivity arises from the increased probability that at least one of the helicases will completely unwind the DNA prior to dissociation. These results are in contrast to previous reports in which multiple Dda molecules on the same track greatly enhanced the rate and amplitude for displacement of protein blocks on the track. Therefore, only when the progress of the lead molecule in the train is impeded by some type of block, such as a protein bound to DNA, do the trailing molecules interact with the lead molecule to overcome the block. The fact that trailing helicase molecules have little impact on the lead molecule in the train during routine DNA unwinding suggests that the trailing molecules are moving at rates similar to that of the lead molecule. This result implicates a step in the translocation mechanism as contributing greatly to the overall rate-limiting step for unwinding of duplex DNA.

  13. Developing DNA nanotechnology using single-molecule fluorescence.

    PubMed

    Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal

    2014-06-17

    CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and

  14. Single molecule techniques in DNA repair: A primer

    PubMed Central

    Hughes, Craig D.; Simons, Michelle; Mackenzie, Cassidy E.; Van Houten, Bennett; Kad, Neil M.

    2016-01-01

    A powerful new approach has become much more widespread and offers insights into aspects of DNA repair unattainable with billions of molecules. Single molecule techniques can be used to image, manipulate or characterize the action of a single repair protein on a single strand of DNA. This allows search mechanisms to be probed, and the effects of force to be understood. These physical aspects can dominate a biochemical reaction, where at the ensemble level their nuances are obscured. In this paper we discuss some of the many technical advances that permit study at the single molecule level. We focus on DNA repair to which these techniques are actively being applied. DNA repair is also a process that encompasses so much of what single molecule studies benefit – searching for targets, complex formation, sequential biochemical reactions and substrate hand-off to name just a few. We discuss how single molecule biophysics is poised to transform our understanding of biological systems, in particular DNA repair. PMID:24819596

  15. Single-Molecule Electrical Random Resequencing of DNA and RNA

    NASA Astrophysics Data System (ADS)

    Ohshiro, Takahito; Matsubara, Kazuki; Tsutsui, Makusu; Furuhashi, Masayuki; Taniguchi, Masateru; Kawai, Tomoji

    2012-07-01

    Two paradigm shifts in DNA sequencing technologies--from bulk to single molecules and from optical to electrical detection--are expected to realize label-free, low-cost DNA sequencing that does not require PCR amplification. It will lead to development of high-throughput third-generation sequencing technologies for personalized medicine. Although nanopore devices have been proposed as third-generation DNA-sequencing devices, a significant milestone in these technologies has been attained by demonstrating a novel technique for resequencing DNA using electrical signals. Here we report single-molecule electrical resequencing of DNA and RNA using a hybrid method of identifying single-base molecules via tunneling currents and random sequencing. Our method reads sequences of nine types of DNA oligomers. The complete sequence of 5'-UGAGGUA-3' from the let-7 microRNA family was also identified by creating a composite of overlapping fragment sequences, which was randomly determined using tunneling current conducted by single-base molecules as they passed between a pair of nanoelectrodes.

  16. DNA Binding Peptide Directed Synthesis of Continuous DNA Nanowires for Analysis of Large DNA Molecules by Scanning Electron Microscope.

    PubMed

    Kim, Kyung-Il; Lee, Seonghyun; Jin, Xuelin; Kim, Su Ji; Jo, Kyubong; Lee, Jung Heon

    2017-01-01

    Synthesis of smooth and continuous DNA nanowires, preserving the original structure of native DNA, and allowing its analysis by scanning electron microscope (SEM), is demonstrated. Gold nanoparticles densely assembled on the DNA backbone via thiol-tagged DNA binding peptides work as seeds for metallization of DNA. This method allows whole analysis of DNA molecules with entangled 3D features. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Nanofluidics and Single Molecule Detection for DNA analysis

    NASA Astrophysics Data System (ADS)

    Tegenfeldt, Jonas; Cao, Han; Austin, Robert H.; Cox, Edward C.; Tilghman, Shirley M.

    2002-03-01

    We present a device for high-resolution detection of fluorescent tags bound to DNA molecules. Submicron slits are defined in an aluminum film on a quartz wafer. Microfluidic channels are defined perpendicular to the slits. Fluorescently labeled DNA is passed through the microfluidic channels and is illuminated through the submicron slits. The resulting fluorescence is detected in using an APD. We are particularly interested in studying the pattern of transcription factors along single DNA molecules. We use the lac operon as a model system. Fusion proteins of lac-repressor and GFP have been made and imaged individually. To achieve reliable measurements of the positions of the transcription factors along the DNA, the DNA must be uniformly stretched. Previous devices relied on posts for stretching, resulting in poorly stretched DNA with highly disordered head and tail. Here we show that by forcing the DNA into channels that have a diameter close to or below the persistence length of the DNA (Lp=50nm), the DNA is forced into a stretched conformation along its entire length.

  18. Electrostatic Interaction of Long DNA Molecules with Solid State Surfaces

    NASA Astrophysics Data System (ADS)

    Li, Bingquan; Samuilov, Vladimir; Sokolov, Jonathan; Rafailovich, Miriam; Chu, Ben

    2004-03-01

    At low buffer concentration the electric charge of DNA molecules creates a strong electrostatic interaction and, as a result, a number of phenomena, such as the electro-hydrodynamic instability, partial adsorption at the buffer-semiconductor interface and stretching of DNA with the electric field. Long DNA molecules at the silicon substrate?buffer solution interface are very interesting objects for the electrical transport [1,2] and the mechanical properties, like entropic elasticity, studies. The system (DNA-substrate-electric field in the buffer solution) is very complicated. Due to the strong electrostatic interaction of DNA with the substrate, the image charge is generated, and the physical adsorption takes place. We have studied the S. Pombe genomic DNA of the order of 5 Mbp. Within a surface DNA is entropically partially recoiled due to electrostatic adsorption at a few points. While varying the direction of the low electric field the direction of the electroosmotic flow is changing and stretching the parts of DNA between the adsorption points. If the electric field is high enough, DNA is de-trapped and forms a compact coil. This behavior could be considered as an inverse mechanism of entropy trapping due to confined constrictions. In the case of the surface, DNA is recoiled and trapped in the stretched configuration in the deep energetic barrier by Si surface due to the strong electrostatic interaction. If the energy of the field is enough to overcome the barrier, DNA is detached. The Si surface could be considered as an analog of the entropic recoiling nanostructure. [1]. N. Pernodet, V. Samuilov, K. Shin, J. Sokolov, M.H. Rafailovich, D. Gersappe, B. Chu. DNA Electrophoresis on a Flat Surface, Physical Review Letters, 85 (2000) 5651-5654. [2] Y.-S. Seo, V.A. Samuilov, J. Sokolov, M. Rafailovich, B. Tinland, J. Kim, B. Chu. DNA separation at a liquid-solid interface, Electrophoresis, 23 (2002) 2618-2625.

  19. Automation of a single-DNA molecule stretching device.

    PubMed

    Sørensen, Kristian Tølbøl; Lopacinska, Joanna M; Tommerup, Niels; Silahtaroglu, Asli; Kristensen, Anders; Marie, Rodolphe

    2015-06-01

    We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free flowing in micro- and nanofluidics emit low fluorescence and change shape, thus challenging the image analysis for machine vision. We demonstrate a set of image processing steps that increase the intrinsically low signal-to-noise ratio associated with single-molecule fluorescence microscopy. Furthermore, we demonstrate how to estimate the length of molecules by continuous real-time image stitching and how to increase the effective resolution of a pressure controller by pulse width modulation. The sequence of image-processing steps addresses the challenges of genomic-length DNA visualization; however, they should also be general to other applications of fluorescence-based microfluidics.

  20. Microwave-Field Driven Acoustic Modes in Selected DNA Molecules

    NASA Astrophysics Data System (ADS)

    Edwards, Glenn Steven

    The direct coupling of a microwave field to selected DNA molecules is demonstrated using standard dielectrometry. The absorption is resonant with a typical lifetime of 300 picoseconds. Such a long lifetime is unexpected for DNA in aqueous solution at room temperature and has interesting implications for microscopic considerations in future models of solvent damping. Resonant absorption at fundamental and harmonic frequencies for both supercoiled circular and linear DNA agrees with an acoustic mode model. Our associated acoustic velocities for linear DNA are very close to the acoustic velocity of the longitudinal acoustic mode independently observed on DNA fibers using Brillouin Spectroscopy. The difference in acoustic velocities for supercoiled circular and linear DNA is discussed in terms of a conformation dependent model. *This research has been funded by the Office of Naval Research, the Center for Devices and Radiological Health, and the National Science Foundation.

  1. Single molecule conformational analysis of DNA G-quadruplexes

    PubMed Central

    Shirude, Pravin S.; Balasubramanian, Shankar

    2008-01-01

    Single molecule fluorescence resonance energy transfer (FRET) can be employed to study conformational heterogeneity and real-time dynamics of biological macromolecules. Here we present single molecule studies on human genomic DNA G-quadruplex sequences that occur in the telomeres and in the promoter of a proto-oncogene. The findings are discussed with respect to the proposed biological function(s) of such motifs in living cells. PMID:18295608

  2. Single-molecule mechanics of protein-labelled DNA handles.

    PubMed

    Jadhav, Vivek S; Brüggemann, Dorothea; Wruck, Florian; Hegner, Martin

    2016-01-01

    DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA-protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG)-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp) were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG) beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD) imaging control experiments revealed that quantum dot-streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein-DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular recognition in time

  3. Long DNA Molecules at Liuid-Solid Interfaces

    NASA Astrophysics Data System (ADS)

    Seo, Young-Soo; Samuilov, Vladimir; Sokolov, John; Rafailovich, Miriam; Chu, Ben

    2003-03-01

    The electrical transport of long DNA molecules was studied using a newly developed method of electrophoresis on flat surfaces [1]. We have shown that a flat silicon substrate, without any surface features, can be used to fractionate DNA on a liquid-solid interface. We determine that the ability of a flat surface to separate DNA molecules results from the local friction between the surface and the adsorbed DNA segments. The mobility of lambda- DNA molecules on this surface was found to scale as the persistent length with the ionic strength of the buffer. This experimental result indicates that at high buffer concentration the separation mechanism of solid-liquid interface electrophoresis is expected to be due to surface friction rather than biased reptation [2]. At low buffer concentrations the adsorbed DNA move in the electrical field parallel to the surface, and also due the electroosmotic convection that drags the DNA chains and they are stretched . The electric double layer is responsible for a velocity profile of the electroosmotic flow. The net electrophoretic mobility of longer DNA, being trapped closer to the surface, is higher than of the shorter ones in the electric field, oriented along the surface. [1]. N. Pernodet, V. Samuilov, K. Shin, J. Sokolov, M.H. Rafailovich, D. Gersappe, B. Chu. DNA Electrophoresis on a Flat Surface, Physical Review Letters, 85 (2000) 5651-5654. [2] Y.-S. Seo, V.A. Samuilov, J. Sokolov, M. Rafailovich, B. Tinland, J. Kim, B. Chu. DNA separation at a liquid-solid interface, Electrophoresis, 23 (2002) 2618-2625.

  4. De novo DNA synthesis using single-molecule PCR.

    PubMed

    Yehezkel, Tuval Ben; Linshiz, Gregory; Shapiro, Ehud

    2012-01-01

    The throughput of DNA reading (i.e., sequencing) has dramatically increased recently owing to the incorporation of in vitro clonal amplification. The throughput of DNA writing (i.e., synthesis) is trailing behind, with cloning and sequencing constituting the main bottleneck. To overcome this bottleneck, an in vitro alternative for in vivo DNA cloning needs to be integrated into DNA synthesis methods. Here, we show how a new single-molecule PCR (smPCR)-based procedure can be employed as a general substitute for in vivo cloning, thereby allowing for the first time in vitro DNA synthesis. We integrated this rapid and high fidelity in vitro procedure into our previously described recursive DNA synthesis and error correction procedure and used it to efficiently construct and error-correct a 1.8-kb DNA molecule from synthetic unpurified oligonucleotides, entirely in vitro. Although we demonstrate incorporating smPCR in a particular method, the approach is general and can be used, in principle, in conjunction with other DNA synthesis methods as well.

  5. Mechanics and Single-Molecule Interrogation of DNA Recombination.

    PubMed

    Bell, Jason C; Kowalczykowski, Stephen C

    2016-06-02

    The repair of DNA by homologous recombination is an essential, efficient, and high-fidelity process that mends DNA lesions formed during cellular metabolism; these lesions include double-stranded DNA breaks, daughter-strand gaps, and DNA cross-links. Genetic defects in the homologous recombination pathway undermine genomic integrity and cause the accumulation of gross chromosomal abnormalities-including rearrangements, deletions, and aneuploidy-that contribute to cancer formation. Recombination proceeds through the formation of joint DNA molecules-homologously paired but metastable DNA intermediates that are processed by several alternative subpathways-making recombination a versatile and robust mechanism to repair damaged chromosomes. Modern biophysical methods make it possible to visualize, probe, and manipulate the individual molecules participating in the intermediate steps of recombination, revealing new details about the mechanics of genetic recombination. We review and discuss the individual stages of homologous recombination, focusing on common pathways in bacteria, yeast, and humans, and place particular emphasis on the molecular mechanisms illuminated by single-molecule methods.

  6. Single-molecule mechanics of protein-labelled DNA handles

    PubMed Central

    Wruck, Florian

    2016-01-01

    Summary DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG)-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp) were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG) beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD) imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular recognition

  7. Specific heat spectra of long-range correlated DNA molecules

    NASA Astrophysics Data System (ADS)

    Moreira, D. A.; Albuquerque, E. L.; Mauriz, P. W.; Vasconcelos, M. S.

    2006-11-01

    The specific heat spectra of long-range correlated DNA molecules is theoretically analyzed for a stacked array of single-stranded DNA made up from the nucleotides guanine G, adenine A, cytosine C and thymine T arranged in the Fibonacci and Rudin-Shapiro quasiperiodic sequences, with the aim to compare them with those related with a genomic DNA sequence. The energy spectra are calculated using the one-dimensional Schrödinger equation in a tight-binding approximation with the on-site energy exhibiting long-range disorder and nonrandom hopping amplitudes.

  8. Single Molecule Screening of Disease DNA Without Amplification

    SciTech Connect

    Lee, Ji-Young

    2006-01-01

    The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA

  9. Microfluidic-assisted analysis of replicating DNA molecules

    PubMed Central

    Sidorova, Julia M.; Li, Nianzhen; Schwartz, David C.; Folch, Albert; Monnat, Raymond J.

    2009-01-01

    Single molecule-based protocols have been gaining popularity as a way to visualize DNA replication at the global genomic and locus-specific levels. These protocols take advantage of the ability of many organisms to incorporate nucleoside analogs during DNA replication, together with a method for displaying stretched DNA on glass for immunostaining and microscopy. We describe here a microfluidic platform that can be used to stretch and capture labeled DNA molecules for replication analyses. This platform consists of parallel arrays of 3-sided, 3 or 4 μm high, variable width capillary channels fabricated from polymethyl siloxane (PDMS) by conventional soft lithography, and silane-modified glass coverslips to reversibly seal the open side of the channels. Capillary tension in these microchannels facilitates DNA loading, stretching and glass coverslip deposition from μL-scale DNA samples. The simplicity and extensibility of this platform should facilitate DNA replication analyses using small samples from a variety of biological and clinical sources. PMID:19444242

  10. The properties and applications of single-molecule DNA sequencing

    PubMed Central

    2011-01-01

    Single-molecule sequencing enables DNA or RNA to be sequenced directly from biological samples, making it well-suited for diagnostic and clinical applications. Here we review the properties and applications of this rapidly evolving and promising technology. PMID:21349208

  11. Confining individual DNA molecules in an axisymmetric entropy gradient

    NASA Astrophysics Data System (ADS)

    Peters, Robert D.; Dalnoki-Veress, Kari

    2010-03-01

    Many asymmetric and discontinuous confining environments have been used to study the properties of confined DNA. We have developed a unique method for studying DNA in micropipettes, resulting in a confining environment that is axisymmetric with a continuously changing entropy gradient. An applied electric field forces the chain into sub-micron confinement and fluorescence microscopy is used to track the effect of confinement on the entropy of individual DNA chains. Releasing the electric field, we probe the dynamics of the DNA chain in a continuously changing confinement, yielding a comprehensive study of the entropic force. This technique provides a novel method for studying the effect of polymer chain architecture on entropy. These architectures include knots in polymer chains, cyclic chains, or the presence of histones amongst DNA molecules.

  12. Analysis of DNA interactions using single-molecule force spectroscopy.

    PubMed

    Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert

    2013-06-01

    Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

  13. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  14. Conductance of DNA molecules: Effects of decoherence and bonding

    NASA Astrophysics Data System (ADS)

    Zilly, Matías; Ujsághy, Orsolya; Wolf, Dietrich E.

    2010-09-01

    The influence of decoherence and bonding on the linear conductance of single double-stranded DNA molecules is examined by fitting a phenomenological statistical model developed recently [M. Zilly, O. Ujsághy, and D. E. Wolf, Eur. Phys. J. B 68, 237 (2009)10.1140/epjb/e2009-00101-0] to experimental results. The DNA molecule itself is described by a tight-binding ladder model with parameters obtained from published ab initio calculations [K. Senthilkumar, F. C. Grozema, C. F. Guerra, F. M. Bickelhaupt, F. D. Lewis, Y. A. Berlin, M. A. Ratner, and L. D. A. Siebbeles, J. Am. Chem. Soc. 127, 14894 (2005)10.1021/ja054257e]. The good agreement with the experiments on sequence and length dependence gives a hint on the nature of conduction in DNA and at the same time provides a crucial test of the model.

  15. Recursive construction and error correction of DNA molecules and libraries from synthetic and natural DNA.

    PubMed

    Yehezkel, Tuval Ben; Linshiz, Gregory; Kaplan, Shai; Gronau, Ilan; Ravid, Sivan; Adar, Rivka; Shapiro, Ehud

    2011-01-01

    Making error-free, custom DNA assemblies from potentially faulty building blocks is a fundamental challenge in synthetic biology. Here, we show how recursion can be used to address this challenge using a recursive procedure that constructs error-free DNA molecules and their libraries from error-prone synthetic oligonucleotides and naturally existing DNA. Specifically, we describe how divide and conquer (D&C), the quintessential recursive problem-solving technique, is applied in silico to divide target DNA sequences into overlapping, albeit error prone, oligonucleotides, and how recursive construction is applied in vitro to combine them to form error-prone DNA molecules. To correct DNA sequence errors, error-free fragments of these molecules are then identified, extracted, and used as new, typically longer and more accurate, inputs to another iteration of the recursive construction procedure; the entire process repeats until an error-free target molecule is formed. The method allows combining synthetic and natural DNA fragments into error-free designer DNA libraries, thus providing a foundation for the design and construction of complex synthetic DNA assemblies.

  16. Construction and expression of bivalent membrane-anchored DNA vaccine encoding Sjl4FABP and Sj26GST genes.

    PubMed

    Guo, Ping; Dai, Wuxing; Liu, Shuojie; Yang, Ping; Cheng, Jizhong; Liang, Liang; Chen, Zhihao; Gao, Hong

    2006-01-01

    In order to construct a eukaryotic co-expression plasmid containing membrane-anchored Sjcl4FABP and Sjc26GST genes and identify their expression in vitro, Sj14 and Sj26 genes were obtained by RT-PCR with total RNA of Schistosoma japonicum adult worms as the template and cloned into eukaryotic expression plasmid pVAC to construct recombinant plasmids pVAC-Sj14 and pVAC-Sj26. Then a 23 amino-acid signal peptide of human interleukin-2 (IL-2) upstream Sj14 or Sj26 gene and a membrane-anchored sequence containing 32 amino-acids of carboxyl-terminal of human placental alkaline phosphatase (PLAP) downstream were amplified by PCR as the template of plasmid pVAC-Sj14 or pVAC-Sj26 only to get two gene fragments including Sj14 gene and Sj26 gene. The two modified genes were altogether cloned into a eukaryotic co-expression plasmid pIRES, resulting in another new recombinant plasmid pIRES-Sj26-Sj14. The expression of Sj14 and Sj26 genes was detected by RT-PCR and indirect immunofluorescent assays (IFA) when the plasmid pIRES-Sj26-Sj14 was transfected into eukaryotic Hela cells. Restriction enzyme analysis, PCR and sequencing results revealed that the recombinant plasmids pVAC-Sj14, pVAC-Sj26 and plRES-Sj26-Sj14 were successfully constructed and the expression of modified Sj14 and Sj26 genes could be detected by RT-PCR and IFA. A bivalent membrane-anchored DNA vaccine encoding Sj14 and Sj26 genes was acquired and expressed proteins were proved to be mostly anchored in cellular membranes.

  17. Single Molecule Study of DNA Organization and Recombination

    NASA Astrophysics Data System (ADS)

    Xiao, Botao

    We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

  18. Selective binding of single-stranded DNA-binding proteins onto DNA molecules adsorbed on single-walled carbon nanotubes.

    PubMed

    Nii, Daisuke; Hayashida, Takuya; Yamaguchi, Yuuki; Ikawa, Shukuko; Shibata, Takehiko; Umemura, Kazuo

    2014-09-01

    Single-stranded DNA-binding (SSB) proteins were treated with hybrids of DNA and single-walled carbon nanotubes (SWNTs) to examine the biological function of the DNA molecules adsorbed on the SWNT surface. When single-stranded DNA (ssDNA) was used for the hybridization, significant binding of the SSB molecules to the ssDNA-SWNT hybrids was observed by using atomic force microscopy (AFM) and agarose gel electrophoresis. When double-stranded DNA (dsDNA) was used, the SSB molecules did not bind to the dsDNA-SWNT hybrids in most of the conditions that we evaluated. A specifically modified electrophoresis procedure was used to monitor the locations of the DNA, SSB, and SWNT molecules. Our results clearly showed that ssDNA/dsDNA molecules on the SWNT surfaces retained their single-stranded/double-stranded structures.

  19. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    SciTech Connect

    Wiliyanti, Vandan Yudiarsah, Efta

    2016-04-19

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from a base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.

  20. Ku stimulation of DNA ligase IV-dependent ligation requires inward movement along the DNA molecule.

    PubMed

    Kysela, Boris; Doherty, Aidan J; Chovanec, Miroslav; Stiff, Thomas; Ameer-Beg, Simon M; Vojnovic, Borivoj; Girard, Pierre-Marie; Jeggo, Penny A

    2003-06-20

    The DNA ligase IV.XRCC4 complex (LX) functions in DNA non-homologous-end joining, the main pathway for double-strand break repair in mammalian cells. We show that, in contrast to ligation by T4 ligase, the efficiency of LX ligation of double-stranded (ds) ends is critically dependent upon the length of the DNA substrate. The effect is specific for ds ligation, and LX/DNA binding is not influenced by the substrate length. Ku stimulates LX ligation at concentrations resulting in 1-2 Ku molecules bound per substrate, whereas multiply Ku-bound DNA molecules inhibit ds ligation. The combined footprint of DNA with Ku and LX bound is the sum of each individual footprint suggesting that the two complexes are located in tandem at the DNA end. Inhibition of Ku translocation by the presence of cis-platinum adducts on the DNA substrate severely inhibits ligation by LX. Fluorescence resonance energy transfer analysis using fluorophore-labeled Ku and DNA molecules showed that, as expected, Ku makes close contact with the DNA end and that addition of LX can disrupt this close contact. Finally, we show that recruitment of LX by Ku is impaired in an adenylation-defective mutant providing further evidence that LX interacts directly with the DNA end, possibly via the 5'-phosphate as shown for prokaryotic ligases. Taken together, our results suggest that, when LX binds to a Ku-bound DNA molecule, it causes inward translocation of Ku and that freedom to move inward on the DNA is essential to Ku stimulation of LX activity.

  1. Real-time DNA sequencing from single polymerase molecules.

    PubMed

    Eid, John; Fehr, Adrian; Gray, Jeremy; Luong, Khai; Lyle, John; Otto, Geoff; Peluso, Paul; Rank, David; Baybayan, Primo; Bettman, Brad; Bibillo, Arkadiusz; Bjornson, Keith; Chaudhuri, Bidhan; Christians, Frederick; Cicero, Ronald; Clark, Sonya; Dalal, Ravindra; Dewinter, Alex; Dixon, John; Foquet, Mathieu; Gaertner, Alfred; Hardenbol, Paul; Heiner, Cheryl; Hester, Kevin; Holden, David; Kearns, Gregory; Kong, Xiangxu; Kuse, Ronald; Lacroix, Yves; Lin, Steven; Lundquist, Paul; Ma, Congcong; Marks, Patrick; Maxham, Mark; Murphy, Devon; Park, Insil; Pham, Thang; Phillips, Michael; Roy, Joy; Sebra, Robert; Shen, Gene; Sorenson, Jon; Tomaney, Austin; Travers, Kevin; Trulson, Mark; Vieceli, John; Wegener, Jeffrey; Wu, Dawn; Yang, Alicia; Zaccarin, Denis; Zhao, Peter; Zhong, Frank; Korlach, Jonas; Turner, Stephen

    2009-01-02

    We present single-molecule, real-time sequencing data obtained from a DNA polymerase performing uninterrupted template-directed synthesis using four distinguishable fluorescently labeled deoxyribonucleoside triphosphates (dNTPs). We detected the temporal order of their enzymatic incorporation into a growing DNA strand with zero-mode waveguide nanostructure arrays, which provide optical observation volume confinement and enable parallel, simultaneous detection of thousands of single-molecule sequencing reactions. Conjugation of fluorophores to the terminal phosphate moiety of the dNTPs allows continuous observation of DNA synthesis over thousands of bases without steric hindrance. The data report directly on polymerase dynamics, revealing distinct polymerization states and pause sites corresponding to DNA secondary structure. Sequence data were aligned with the known reference sequence to assay biophysical parameters of polymerization for each template position. Consensus sequences were generated from the single-molecule reads at 15-fold coverage, showing a median accuracy of 99.3%, with no systematic error beyond fluorophore-dependent error rates.

  2. Mapping DNA polymerase errors by single-molecule sequencing

    SciTech Connect

    Lee, David F.; Lu, Jenny; Chang, Seungwoo; Loparo, Joseph J.; Xie, Xiaoliang S.

    2016-05-16

    Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replication product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.

  3. Small Molecules, Inhibitors of DNA-PK, Targeting DNA Repair, and Beyond

    PubMed Central

    Davidson, David; Amrein, Lilian; Panasci, Lawrence; Aloyz, Raquel

    2012-01-01

    Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining a major mechanism for the repair of double-strand breaks (DSB) in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK). The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA-PK. Computer based drug

  4. Detection of pathogenic DNA at the single-molecule level

    NASA Astrophysics Data System (ADS)

    Yahiatène, Idir; Klamp, Tobias; Schüttpelz, Mark; Sauer, Markus

    2011-03-01

    We demonstrate ultrasensitive detection of pathogenic DNA in a homogeneous assay at the single-molecule level applying two-color coincidence analysis. The target molecule we quantify is a 100 nucleotide long synthetic single-stranded oligonucleotide adapted from Streptococcus pneumoniae, a bacterium causing lower respiratory tract infections. Using spontaneous hybridization of two differently fluorescing Molecular Beacons we demonstrate a detection sensitivity of 100 fM (10-13M) in 30 seconds applying a simple microfluidic device with a 100 μm channel and confocal two-color fluorescence microscopy.

  5. Hydrodynamics of a DNA molecule in a flow field

    NASA Astrophysics Data System (ADS)

    Larson, R. G.; Perkins, T. T.; Smith, D. E.; Chu, S.

    1997-02-01

    The hydrodynamics of a single, fluorescing, DNA molecule held at one end by 'optical tweezers' and subjected to a uniform flow are compared with Monte Carlo simulations that account for the molecule's entropic elasticity, Brownian motion, and hydrodynamic drag. Using self-diffusion data and analytic expressions to obtain the drag in the limits of the undeformed coil and of the fully stretched thread, the predicted chain stretching and mass distribution are in quantitative agreement with measurements. The results explain the success of the nonlinear elastic 'dumbbell' model in predicting the rheological properties of dilute polymer solutions.

  6. Long DNA Molecules at Liquid-Solid Interfaces

    NASA Astrophysics Data System (ADS)

    Samuilov, Vladimir; Li, B.; Sokolov, J.; Rafailovich, M.; Chu, B.

    2006-03-01

    The electrophoresis of long DNA molecules was studied using a newly developed method of electrophoresis on flat surfaces [1] in the regime of strong electrostatic interaction. The mobility of lambda- DNA molecules on this surface was found to scale as the square root of the persistent length with the ionic strength at high buffer. This experimental result indicates that at high buffer concentration the separation mechanism of solid-liquid interface electrophoresis is expected to be due to surface friction rather than biased reptation [2-4]. At low buffer concentrations the DNA chains are stretched .The electric double layer is responsible for a velocity profile of the electroosmotic flow. The net electrophoretic mobility of longer DNA, being trapped closer to the surface as found to be higher then for the shorter ones in the electric field. [1]. N. Pernodet, V. Samuilov, K. Shin, et al. Physical Review Letters, 85 (2000) 5651-5654. [2] Y.-S. Seo, V.A. Samuilov, J. Sokolov, et al. Electrophoresis, 23 (2002) 2618-2625. [3] Y.-S. Seo, H.. Luo, V. A. Samuilov, et al. DNA Electrophoresis on nanopatterned surfaces, Nano Letters, 4, 2004, 659-664.

  7. Zwitterionic peptide anchored to conducting polymer PEDOT for the development of antifouling and ultrasensitive electrochemical DNA sensor.

    PubMed

    Wang, Guixiang; Han, Rui; Su, Xiaoli; Li, Yinan; Xu, Guiyun; Luo, Xiliang

    2017-06-15

    Zwitterionic peptides were anchored to a conducting polymer of citrate doped poly(3,4-ethylenedioxythiophene) (PEDOT) via the nickel cation coordination, and the obtained peptide modified PEDOT, with excellent antifouling ability and good conductivity, was further used for the immobilization of a DNA probe to construct an electrochemical biosensor for the breast cancer marker BRCA1. The DNA biosensor was highly sensitive (with detection limit of 0.03fM) and selective, and it was able to detect BRCA1 in 5% (v/v) human plasma with satisfying accuracy and low fouling. The marriage of antifouling and biocompatible peptides with conducting polymers opened a new avenue to construct electrochemical biosensors capable of assaying targets in complex biological media with high sensitivity and without biofouling. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Visualizing Protein Movement on DNA at the Single-molecule Level using DNA Curtains

    PubMed Central

    Silverstein, Timothy D.; Gibb, Bryan; Greene, Eric C.

    2014-01-01

    A fundamental feature of many nucleic-acid binding proteins is their ability to move along DNA either by diffusion-based mechanisms or by ATP-hydrolysis driven translocation. For example, most site-specific DNA-binding proteins must diffuse to some extent along DNA to either find their target sites, or to otherwise fulfill their biological roles. Similarly, nucleic-acid translocases such as helicases and polymerases must move along DNA to fulfill their functions. In both instances, the proteins must also be capable of moving in crowded environments while navigating through DNA-bound obstacles. These types of behaviors can be challenging to analyze by bulk biochemical methods because of the transient nature of the interactions, and/or heterogeneity of the reaction intermediates. The advent of single-molecule methodologies has overcome some of these problems, and has led to many new insights into the mechanisms that contribute to protein motion along DNA. We have developed DNA curtains as a tool to facilitate single molecule observations of protein-nucleic acid interactions, and we have applied these new research tools to systems involving both diffusive-based motion as well as ATP directed translocation. Here we highlight these studies by first discussing how diffusion contributes to target searches by proteins involved in post-replicative mismatch repair. We then discuss DNA curtain assays of two different DNA translocases, RecBCD and FtsK, which participate in homologous DNA recombination and site-specific DNA recombination, respectively. PMID:24598576

  9. Applications of optical trapping to single molecule DNA

    SciTech Connect

    Sonek, G.J.; Berns, M.W.; Keller, R.A.

    1997-12-01

    This is the final report of a three-year, Laboratory Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). The project focused on the methodologies required to integrate optical trapping with single molecule detection (SMD) so as to demonstrate high speed sequencing through optical micromanipulation of host substrates, nucleotide cleavage, and single molecule detection. As part of this effort, the new technology of optical tweezers was applied to the confinement and manipulation of microsphere handles containing attached DNA fragments. The authors demonstrated substrate optical trapping in rapid flow streams, the fluorescence excitation and detection of fluorescently labeled nucleotides in an optical trapping system, and the epifluorescent imaging of DNA fragments in flow streams. They successfully demonstrated optical trapping in laminar flow streams and completely characterized the trapping process as functions of fluid flow velocity, chamber dimension, trapping depth, incident laser power, and fluorescence measurement geometry.

  10. Simple horizontal magnetic tweezers for micromanipulation of single DNA molecules and DNA-protein complexes.

    PubMed

    McAndrew, Christopher P; Tyson, Christopher; Zischkau, Joseph; Mehl, Patrick; Tuma, Pamela L; Pegg, Ian L; Sarkar, Abhijit

    2016-01-01

    We report the development of a simple-to-implement magnetic force transducer that can apply a wide range of piconewton (pN) scale forces on single DNA molecules and DNA-protein complexes in the horizontal plane. The resulting low-noise force-extension data enable very high-resolution detection of changes in the DNA tether's extension: ~0.05 pN in force and <10 nm change in extension. We have also verified that we can manipulate DNA in near equilibrium conditions through the wide range of forces by ramping the force from low to high and back again, and observing minimal hysteresis in the molecule's force response. Using a calibration technique based on Stokes' drag law, we have confirmed our force measurements from DNA force-extension experiments obtained using the fluctuation-dissipation theorem applied to transverse fluctuations of the magnetic microsphere. We present data on the force-distance characteristics of a DNA molecule complexed with histones. The results illustrate how the tweezers can be used to study DNA binding proteins at the single molecule level.

  11. Visualizing Chemical Interaction Dynamics of Confined DNA Molecules

    NASA Astrophysics Data System (ADS)

    Henkin, Gilead; Berard, Daniel; Stabile, Frank; Leslie, Sabrina

    We present a novel nanofluidic approach to controllably introducing reagent molecules to interact with confined biopolymers and visualizing the reaction dynamics in real time. By dynamically deforming a flow cell using CLiC (Convex Lens-induced Confinement) microscopy, we are able to tune reaction chamber dimensions from micrometer to nanometer scales. We apply this gentle deformation to load and extend DNA polymers within embedded nanotopographies and visualize their interactions with other molecules in solution. Quantifying the change in configuration of polymers within embedded nanotopographies in response to binding/unbinding of reagent molecules provides new insights into their consequent change in physical properties. CLiC technology enables an ultra sensitive, massively parallel biochemical analysis platform which can acces a broader range of interaction parameters than existing devices.

  12. Single-Molecule Electronic Monitoring of DNA Polymerase Activity

    NASA Astrophysics Data System (ADS)

    Marushchak, Denys O.; Pugliese, Kaitlin M.; Turvey, Mackenzie W.; Choi, Yongki; Gul, O. Tolga; Olsen, Tivoli J.; Rajapakse, Arith J.; Weiss, Gregory A.; Collins, Philip G.

    Single-molecule techniques can reveal new spatial and kinetic details of the conformational changes occurring during enzymatic catalysis. Here, we investigate the activity of DNA polymerases using an electronic single-molecule technique based on carbon nanotube transistors. Single molecules of the Klenow fragment (KF) of polymerase I were conjugated to the transistors and then monitored via fluctuations in electrical conductance. Continuous, long-term monitoring recorded single KF molecules incorporating up to 10,000 new bases into single-stranded DNA templates. The duration of individual incorporation events was invariant across all analog and native nucleotides, indicating that the precise structure of different base pairs has no impact on the timing of incorporation. Despite similar timings, however, the signal magnitudes generated by certain analogs reveal alternate conformational states that do not occur with native nucleotides. The differences induced by these analogs suggest that the electronic technique is sensing KF's O-helix as it tests the stability of nascent base pairs.

  13. Single-molecule study of DNA polymerization activity of HIV-1 reverse transcriptase on DNA templates.

    PubMed

    Kim, Sangjin; Schroeder, Charles M; Xie, X Sunney

    2010-02-05

    HIV-1 RT (human immunodeficiency virus-1 reverse transcriptase) is a multifunctional polymerase responsible for reverse transcription of the HIV genome, including DNA replication on both RNA and DNA templates. During reverse transcription in vivo, HIV-1 RT replicates through various secondary structures on RNA and single-stranded DNA (ssDNA) templates without the need for a nucleic acid unwinding protein, such as a helicase. In order to understand the mechanism of polymerization through secondary structures, we investigated the DNA polymerization activity of HIV-1 RT on long ssDNA templates using a multiplexed single-molecule DNA flow-stretching assay. We observed that HIV-1 RT performs fast primer extension DNA synthesis on single-stranded regions of DNA (18.7 nt/s) and switches its activity to slow strand displacement synthesis at DNA hairpin locations (2.3 nt/s). Furthermore, we found that the rate of strand displacement synthesis is dependent on the GC content in hairpin stems and template stretching force. This indicates that the strand displacement synthesis occurs through a mechanism that is neither completely active nor passive: that is, the opening of the DNA hairpin is driven by a combination of free energy released during dNTP (deoxyribonucleotide triphosphate) hydrolysis and thermal fraying of base pairs. Our experimental observations provide new insight into the interchanging modes of DNA replication by HIV-1 RT on long ssDNA templates.

  14. Dual-Colored DNA Comb Polymers for Single Molecule Rheology

    NASA Astrophysics Data System (ADS)

    Mai, Danielle; Marciel, Amanda; Schroeder, Charles

    2014-03-01

    We report the synthesis and characterization of branched biopolymers for single molecule rheology. In our work, we utilize a hybrid enzymatic-synthetic approach to graft ``short'' DNA branches to ``long'' DNA backbones, thereby producing macromolecular DNA comb polymers. The branches and backbones are synthesized via polymerase chain reaction with chemically modified deoxyribonucleotides (dNTPs): ``short'' branches consist of Cy5-labeled dNTPs and a terminal azide group, and ``long'' backbones contain dibenzylcyclooctyne-modified (DBCO) dNTPs. In this way, we utilize strain-promoted, copper-free cycloaddition ``click'' reactions for facile grafting of azide-terminated branches at DBCO sites along backbones. Copper-free click reactions are bio-orthogonal and nearly quantitative when carried out under mild conditions. Moreover, comb polymers can be labeled with an intercalating dye (e.g., YOYO) for dual-color fluorescence imaging. We characterized these materials using gel electrophoresis, HPLC, and optical microscopy, with atomic force microscopy in progress. Overall, DNA combs are suitable for single molecule dynamics, and in this way, our work holds the potential to improve our understanding of topologically complex polymer melts and solutions.

  15. Exploring DNA-protein interactions on the single DNA molecule level using nanofluidic tools.

    PubMed

    Frykholm, Karolin; Nyberg, Lena K; Westerlund, Fredrik

    2017-08-14

    DNA-protein interactions are at the core of the cellular machinery and single molecule methods have revolutionized the possibilities to study, and our understanding of these interactions on the molecular level. Nanofluidic channels have been extensively used for studying single DNA molecules during the last twelve years and in this review, we discuss how this experimental platform has been extended to studies of DNA-protein interactions. We first present how the design of the device can be tailored for the specific DNA-protein system studied and how the channels can be passivated to avoid non-specific binding of proteins. We then focus on describing the different kinds of DNA-interacting proteins that have been studied in nanofluidic devices, including proteins that compact DNA and proteins that form filaments on DNA. Our main objective is to highlight the diverse functionalities of DNA-protein systems that have been characterized using nanofluidic structures and hence demonstrate the versatility of these experimental tools. We finally discuss potential future directions studies of DNA-protein complexes in nanochannels might take, including specific DNA-protein systems that are difficult to analyze with traditional techniques, devices with increased complexity, and fully integrated lab-on-a-chip devices for analysis of material extracted from (single) cells.

  16. Isolation of Circular DNA Molecules from Whole Cellular DNA by Use of ATP-Dependent Deoxyribonuclease

    PubMed Central

    Mukai, Tsunehiro; Matsubara, Kenichi; Takagi, Yasuyuki

    1973-01-01

    A technique is described for isolation of plasmid DNA in closed and open circular double-stranded forms from bacterial cells, by use of ATP-dependent deoxyribonuclease purified from Micrococcus luteus. This DNase, acting only upon linear DNA molecules, degrades all bacterial chromosomal DNA extracted in the linear form. Circular plasmid DNAs are left intact, and are then separated by sedimentation through a sucrose gradient. Unlike previous techniques for analysis of plasmid DNA, this technique can be used to isolate not only closed circular DNA but also open circular DNA. Several plasmids, such as those from phage (λdv1 and λdv21), a colicinogenic factor (Col E2), a sex factor (F8′ gal), and “minicircles” in Escherichia coli 15, in both the open and closed circular forms, were well separated from chromosomal DNA by this technique. PMID:4355370

  17. Unraveling the complexity of the interactions of DNA nucleotides with gold by single molecule force spectroscopy

    NASA Astrophysics Data System (ADS)

    Bano, Fouzia; Sluysmans, Damien; Wislez, Arnaud; Duwez, Anne-Sophie

    2015-11-01

    Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct adsorption behavior of the deoxyribonucleotides (i.e., a nitrogenous base, a deoxyribose sugar, and a phosphate group) and on the factors that govern the DNA-gold bond strength. Here, using single molecule force spectroscopy, we investigated the interaction of the four individual nucleotides, adenine, guanine, cytosine, and thymine, with gold. Experiments were performed in three salinity conditions and two surface dwell times to reveal the factors that influence nucleotide-Au bond strength. Force data show that, at physiological ionic strength, adenine-Au interactions are stronger, asymmetrical and independent of surface dwell time as compared to cytosine-Au and guanine-Au interactions. We suggest that in these conditions only adenine is able to chemisorb on gold. A decrease of the ionic strength significantly increases the bond strength for all nucleotides. We show that moderate ionic strength along with longer surface dwell period suggest weak chemisorption also for cytosine and guanine.Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct

  18. Mutual inhibition of RecQ molecules in DNA unwinding.

    PubMed

    Pan, Bing-Yi; Dou, Shuo-Xing; Yang, Ye; Xu, Ya-Nan; Bugnard, Elisabeth; Ding, Xiu-Yan; Zhang, Lingyun; Wang, Peng-Ye; Li, Ming; Xi, Xu Guang

    2010-05-21

    Helicases make conformational changes and mechanical movements through hydrolysis of NTP to unwind duplex DNA (or RNA). Most helicases require a single-stranded overhang for loading onto the duplex DNA substrates. Some helicases have been observed to exhibit an enhanced unwinding efficiency with increasing length of the single-stranded DNA tail both by preventing reannealing of the unwound DNA and by compensating for premature dissociation of the leading monomers. Here we report a previously unknown mutual inhibition of neighboring monomers in DNA unwinding by the monomeric Escherichia coli RecQ helicase. With single molecule fluorescence resonance energy transfer microscopy, we observed that the unwinding initiation of RecQ at saturating concentrations was more delayed for a long rather than a short tailed DNA. In stopped-flow kinetic studies under both single and multiple turnover conditions, the unwinding efficiency decreased with increasing enzyme concentration for long tailed substrates. In addition, preincubation of RecQ and DNA in the presence of 5'-adenylyl-beta,gamma-imidodiphosphate was observed to alleviate the inhibition. We propose that the mutual inhibition effect results from a forced closure of cleft between the two RecA-like domains of a leading monomer by a trailing one, hence the forward movements of both monomers are stalled by prohibition of ATP binding to the leading one. This effect represents direct evidence for the relative movements of the two RecA-like domains of RecQ in DNA unwinding. It may occur for all superfamily I and II helicases possessing two RecA-like domains.

  19. Detecting single DNA molecule interactions with optical microcavities (Presentation Recording)

    NASA Astrophysics Data System (ADS)

    Vollmer, Frank

    2015-09-01

    Detecting molecules and their interactions lies at the heart of all biosensor devices, which have important applications in health, environmental monitoring and biomedicine. Achieving biosensing capability at the single molecule level is, moreover, a particularly important goal since single molecule biosensors would not only operate at the ultimate detection limit by resolving individual molecular interactions, but they could also monitor biomolecular properties which are otherwise obscured in ensemble measurements. For example, a single molecule biosensor could resolve the fleeting interaction kinetics between a molecule and its receptor, with immediate applications in clinical diagnostics. We have now developed a label-free biosensing platform that is capable of monitoring single DNA molecules and their interaction kinetics[1], hence achieving an unprecedented sensitivity in the optical domain, Figure 1. We resolve the specific contacts between complementary oligonucleotides, thereby detecting DNA strands with less than 2.4 kDa molecular weight. Furthermore we can discern strands with single nucleotide mismatches by monitoring their interaction kinetics. Our device utilizes small glass microspheres as optical transducers[1,2, 3], which are capable of increasing the number of interactions between a light beam and analyte molecules. A prism is used to couple the light beam into the microsphere. Ourr biosensing approach resolves the specific interaction kinetics between single DNA fragments. The optical transducer is assembled in a simple three-step protocol, and consists of a gold nanorod attached to a glass microsphere, where the surface of the nanorod is further modified with oligonucleotide receptors. The interaction kinetics of an oligonucleotide receptor with DNA fragments in the surrounding aqueous solution is monitored at the single molecule level[1]. The light remains confined inside the sphere where it is guided by total internal reflections along a

  20. Single molecule studies of DNA packaging by bacteriophages

    NASA Astrophysics Data System (ADS)

    Fuller, Derek Nathan

    The DNA packaging dynamics of bacteriophages φ29, gamma, and T4 were studied at the single molecule level using a dual trap optical tweezers. Also, a method for producing long DNA molecules by PCR for optical tweezers studies of protein DNA interactions is presented and thoroughly characterized. This DNA preparation technique provided DNA samples for the φ29 and T4 studies. In the studies of φ29, the role of charge was investigated by varying the ionic conditions of the packaging buffer. Ionic conditions in which the DNA charge was highly screened due to divalent and trivalent cations showed the lowest resistance to packaging of the DNA to high density. This confirmed the importance of counterions in shielding the DNA interstrand repulsion when packaged to high density. While the ionic nature of the packaging buffer had a strong effect on packaging velocities, there was no clear trend between the counterion-screened charge of the DNA and the maximum packaging velocity. The packaging studies of lambda and T4 served as systems for comparative studies with φ29. Each system showed similarities to the φ29 system and unique differences. Both the lambda and T4 packaging motors were capable of generating forces in excess of 50 pN and showed remarkably high processivity, similar to φ29. However, dynamic structural transitions were observed with lambda that are not observed with φ29. The packaging of the lambda genome showed capsid expansion at approximately 30 percent of the genome packaged and capsid rupture at 90 percent of the genome packaged in the absence of capsid stabilizing protein gpD. Unique to the T4 packaging motor, packaging dynamics showed a remarkable amount of variability in velocities. This variability was seen both within individual packaging phages and from one phage to the next. This is possibly due to different conformational states of the packaging machinery. Additionally, lambda and T4 had average packaging velocities under minimal load of 600

  1. SINGLE-MOLECULE STUDY OF DNA POLYMERIZATION ACTIVITY OF HIV-1 REVERSE TRANSCRIPTASE ON DNA TEMPLATES

    PubMed Central

    Kim, Sangjin; Schroeder, Charles M.; Xie, X. Sunney

    2009-01-01

    Human Immunodeficiency Virus-1 reverse transcriptase (HIV-1 RT) is a multifunctional polymerase responsible for reverse transcription of the HIV genome, including DNA replication on both RNA and DNA templates. During reverse transcription in vivo, HIV-1 RT replicates through various secondary structures on RNA and single-stranded DNA templates without the need for a nucleic acid unwinding protein, such as a helicase. In order to understand the mechanism of polymerization through secondary structures, we investigated the DNA polymerization activity of HIV-1 RT on long single-stranded DNA templates using a multiplexed single-molecule DNA flow-stretching assay. We observed that HIV-1 RT performs fast primer extension DNA synthesis on single-stranded regions of DNA (18.7 nt/s) and switches its activity to slow strand displacement synthesis at DNA hairpin locations (2.3 nt/s). Furthermore, we found that the rate of strand displacement synthesis is dependent on the GC content in hairpin stems and template stretching force. This indicates that the strand displacement synthesis occurs through a mechanism that is neither completely active nor passive, i.e. the opening of the DNA hairpin is driven by a combination of free energy released during dNTP hydrolysis and thermal fraying of base pairs. Our experimental observations provide new insight into the interchanging modes of DNA replication by HIV-1 RT on long single-stranded DNA templates. PMID:19968999

  2. Molding single DNA molecules in metals and sample preparation for electronic sequencing.

    PubMed

    Lund, John A; Parviz, Babak A

    2009-01-01

    We demonstrate the molding of single DNA molecules in 8 nm thin platinum molds. The molded structures have an apparent depth of 1 nm under STM imaging, and closely follow the contours of the DNA molecules. We have confirmed the presence of the embedded molecules and have verified the ability of this technique to scale down to single molecules. Additionally, we have utilized this method to perform electron tunneling analysis on embedded DNA molecules.

  3. Single-molecule dissection of stacking forces in DNA.

    PubMed

    Kilchherr, Fabian; Wachauf, Christian; Pelz, Benjamin; Rief, Matthias; Zacharias, Martin; Dietz, Hendrik

    2016-09-09

    We directly measured at the single-molecule level the forces and lifetimes of DNA base-pair stacking interactions for all stack sequence combinations. Our experimental approach combined dual-beam optical tweezers with DNA origami components to allow positioning of blunt-end DNA helices so that the weak stacking force could be isolated. Base-pair stack arrays that lacked a covalent backbone connection spontaneously dissociated at average rates ranging from 0.02 to 500 per second, depending on the sequence combination and stack array size. Forces in the range from 2 to 8 piconewtons that act along the helical direction only mildly accelerated the stochastic unstacking process. The free-energy increments per stack that we estimate from the measured forward and backward kinetic rates ranged from -0.8 to -3.4 kilocalories per mole, depending on the sequence combination. Our data contributes to understanding the mechanics of DNA processing in biology, and it is helpful for designing the kinetics of DNA-based nanoscale devices according to user specifications.

  4. Reprogramming the assembly of unmodified DNA with a small molecule

    NASA Astrophysics Data System (ADS)

    Avakyan, Nicole; Greschner, Andrea A.; Aldaye, Faisal; Serpell, Christopher J.; Toader, Violeta; Petitjean, Anne; Sleiman, Hanadi F.

    2016-04-01

    The ability of DNA to store and encode information arises from base pairing of the four-letter nucleobase code to form a double helix. Expanding this DNA ‘alphabet’ by synthetic incorporation of new bases can introduce new functionalities and enable the formation of novel nucleic acid structures. However, reprogramming the self-assembly of existing nucleobases presents an alternative route to expand the structural space and functionality of nucleic acids. Here we report the discovery that a small molecule, cyanuric acid, with three thymine-like faces, reprogrammes the assembly of unmodified poly(adenine) (poly(A)) into stable, long and abundant fibres with a unique internal structure. Poly(A) DNA, RNA and peptide nucleic acid (PNA) all form these assemblies. Our studies are consistent with the association of adenine and cyanuric acid units into a hexameric rosette, which brings together poly(A) triplexes with a subsequent cooperative polymerization. Fundamentally, this study shows that small hydrogen-bonding molecules can be used to induce the assembly of nucleic acids in water, which leads to new structures from inexpensive and readily available materials.

  5. Regulation of DNA Metabolism by DNA-Binding Proteins Probed by Single Molecule Spectroscopy

    DTIC Science & Technology

    2006-12-05

    denaturation The Watson - Crick double- helix is the thermodynamically stable configuration of a DNA molecule under physiological conditions (normal salt and...room/body temperature). This stability is effected (a) by Watson - Crick H-bonding, that is essential for the specificity of base pairing, i.e., for...guarantees the high level of fidelity during replication and transcription. (b) The second contribution to DNA helix stability comes from base-stacking

  6. Sequence-selective single-molecule alkylation with a pyrrole-imidazole polyamide visualized in a DNA nanoscaffold.

    PubMed

    Yoshidome, Tomofumi; Endo, Masayuki; Kashiwazaki, Gengo; Hidaka, Kumi; Bando, Toshikazu; Sugiyama, Hiroshi

    2012-03-14

    We demonstrate a novel strategy for visualizing sequence-selective alkylation of target double-stranded DNA (dsDNA) using a synthetic pyrrole-imidazole (PI) polyamide in a designed DNA origami scaffold. Doubly functionalized PI polyamide was designed by introduction of an alkylating agent 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) and biotin for sequence-selective alkylation at the target sequence and subsequent streptavidin labeling, respectively. Selective alkylation of the target site in the substrate DNA was observed by analysis using sequencing gel electrophoresis. For the single-molecule observation of the alkylation by functionalized PI polyamide using atomic force microscopy (AFM), the target position in the dsDNA (∼200 base pairs) was alkylated and then visualized by labeling with streptavidin. Newly designed DNA origami scaffold named "five-well DNA frame" carrying five different dsDNA sequences in its cavities was used for the detailed analysis of the sequence-selectivity and alkylation. The 64-mer dsDNAs were introduced to five individual wells, in which target sequence AGTXCCA/TGGYACT (XY = AT, TA, GC, CG) was employed as fully matched (X = G) and one-base mismatched (X = A, T, C) sequences. The fully matched sequence was alkylated with 88% selectivity over other mismatched sequences. In addition, the PI polyamide failed to attach to the target sequence lacking the alkylation site after washing and streptavidin treatment. Therefore, the PI polyamide discriminated the one mismatched nucleotide at the single-molecule level, and alkylation anchored the PI polyamide to the target dsDNA.

  7. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    NASA Astrophysics Data System (ADS)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  8. Relaxation of a single DNA molecule observed by optical microscopy.

    PubMed

    Perkins, T T; Quake, S R; Smith, D E; Chu, S

    1994-05-06

    Single molecules of DNA, visualized in video fluorescence microscopy, were stretched to full extension in a flow, and their relaxation was measured when the flow stopped. The molecules, attached by one end to a 1-micrometer bead, were manipulated in an aqueous solution with optical tweezers. Inverse Laplace transformations of the relaxation data yielded spectra of decaying exponentials with distinct peaks, and the longest time component (tau) increased with length (L) as tau approximately L 1.68 +/- 0.10. A rescaling analysis showed that most of the relaxation curves had a universal shape and their characteristic times (lambda t) increased as lambda t approximately L 1.65 +/- 0.13. These results are in qualitative agreement with the theoretical prediction of dynamical scaling.

  9. Relaxation of a Single DNA Molecule Observed by Optical Microscopy

    NASA Astrophysics Data System (ADS)

    Perkins, Thomas T.; Quake, Stephen R.; Smith, Douglas E.; Chu, Steven

    1994-05-01

    Single molecules of DNA, visualized in video fluorescence microscopy, were stretched to full extension in a flow, and their relaxation was measured when the flow stopped. The molecules, attached by one end to a 1-micrometer bead, were manipulated in an aqueous solution with optical tweezers. Inverse Laplace transformations of the relaxation data yielded spectra of decaying exponentials with distinct peaks, and the longest time component (τ) increased with length (L) as τ~ L1.66± 0.10. A rescaling analysis showed that most of the relaxation curves had a universal shape and their characteristic times (λ_t) increased as λ_t~ L1.65± 0.13. These results are in qualitative agreement with the theoretical prediction of dynamical scaling.

  10. The dynamics of partially extended single molecules of DNA

    NASA Astrophysics Data System (ADS)

    Quake, Stephen R.; Babcock, Hazen; Chu, Steven

    1997-07-01

    The behaviour of an isolated polymer floating in a solvent forms the basis of our understanding of polymer dynamics,. Classical theories describe the motion of a polymer with linear equations of motion, which yield a set of `normal modes', analogous to the fundamental frequency and the harmonics of a vibrating violin string. But hydrodynamic interactions make polymer dynamics inherently nonlinear, and the linearizing approximations required for the normal-mode picture have therefore been questioned. Here we test the normal-mode theory by measuring the fluctuations of single molecules of DNA held in a partially extended state with optical tweezers. We find that the motion of the DNA can be described by linearly independent normal modes, and we have experimentally determined the eigenstates of the system. Furthermore, we show that the spectrum of relaxation times obeys a power law.

  11. The dynamics of partially extended single molecules of DNA.

    PubMed

    Quake, S R; Babcock, H; Chu, S

    1997-07-10

    The behaviour of an isolated polymer floating in a solvent forms the basis of our understanding of polymer dynamics. Classical theories describe the motion of a polymer with linear equations of motion, which yield a set of 'normal modes', analogous to the fundamental frequency and the harmonics of a vibrating violin string. But hydrodynamic interactions make polymer dynamics inherently nonlinear, and the linearizing approximations required for the normal-mode picture have therefore been questioned. Here we test the normal-mode theory by measuring the fluctuations of single molecules of DNA held in a partially extended state with optical tweezers. We find that the motion of the DNA can be described by linearly independent normal modes, and we have experimentally determined the eigenstates of the system. Furthermore, we show that the spectrum of relaxation times obeys a power law.

  12. Effect of Aperiodicity on the Charge Transfer Through DNA Molecules

    NASA Astrophysics Data System (ADS)

    Ghosh, Angsula; Chaudhuri, Puspitapallab

    The effect of aperiodicity on the charge transfer process through DNA molecules is investigated using a tight-binding model. Single-stranded aperiodic Fibonacci polyGC and polyAT sequences along with aperiodic Rudin-Shapiro poly(GCAT) sequences are used in the study. Based on the tight-binding model, molecular orbital calculations of the DNA chains are performed and ionization potentials compared, as this might be relevant to understanding the charge transfer process. Charges migrate through the sequences in a multistep hopping process. Results for current conduction through aperiodic sequences are compared with those for the corresponding periodic sequences. We find that dinucleotide aperiodic Fibonacci sequences decrease the current while tetranucleotide aperiodic Rudin-Shapiro sequences increase the current when compared with the corresponding periodic sequences. The conductance in all cases decays exponentially as the sequence length increases.

  13. Diffusion of isolated DNA molecules: dependence on length and topology.

    PubMed

    Robertson, Rae M; Laib, Stephan; Smith, Douglas E

    2006-05-09

    The conformation and dynamics of circular polymers is a subject of considerable theoretical and experimental interest. DNA is an important example because it occurs naturally in different topological states, including linear, relaxed circular, and supercoiled circular forms. A fundamental question is how the diffusion coefficients of isolated polymers scale with molecular length and how they vary for different topologies. Here, diffusion coefficients D for relaxed circular, supercoiled, and linear DNA molecules of length L ranging from approximately 6 to 290 kbp were measured by tracking the Brownian motion of single molecules. A topology-independent scaling law D approximately L(-nu) was observed with nu(L) = 0.571 +/- 0.014, nu(C) = 0.589 +/- 0.018, and nu(S) = 0.571 +/- 0.057 for linear, relaxed circular, and supercoiled DNA, respectively, in good agreement with the scaling exponent of nu congruent with 0.588 predicted by renormalization group theory for polymers with significant excluded volume interactions. Our findings thus provide evidence in support of several theories that predict an effective diameter of DNA much greater than the Debye screening length. In addition, the measured ratio D(Circular)/D(Linear) = 1.32 +/- 0.014 was closer to the value of 1.45 predicted by using renormalization group theory than the value of 1.18 predicted by classical Kirkwood hydrodynamic theory and agreed well with a value of 1.31 predicted when incorporating a recently proposed expression for the radius of gyration of circular polymers into the Zimm model.

  14. Mapping DNA polymerase errors by single-molecule sequencing

    PubMed Central

    Lee, David F.; Lu, Jenny; Chang, Seungwoo; Loparo, Joseph J.; Xie, Xiaoliang S.

    2016-01-01

    Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replication product is tagged with a unique nucleotide sequence before amplification. This allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases. PMID:27185891

  15. Mapping DNA polymerase errors by single-molecule sequencing

    DOE PAGES

    Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...

    2016-05-16

    Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

  16. Hyperactivation of DNA-PK by double-strand break mimicking molecules disorganizes DNA damage response.

    PubMed

    Quanz, Maria; Chassoux, Danielle; Berthault, Nathalie; Agrario, Céline; Sun, Jian-Sheng; Dutreix, Marie

    2009-07-21

    Cellular response to DNA damage involves the coordinated activation of cell cycle checkpoints and DNA repair. The early steps of DNA damage recognition and signaling in mammalian cells are not yet fully understood. To investigate the regulation of the DNA damage response (DDR), we designed short and stabilized double stranded DNA molecules (Dbait) mimicking double-strand breaks. We compared the response induced by these molecules to the response induced by ionizing radiation. We show that stable 32-bp long Dbait, induce pan-nuclear phosphorylation of DDR components such as H2AX, Rpa32, Chk1, Chk2, Nbs1 and p53 in various cell lines. However, individual cell analyses reveal that differences exist in the cellular responses to Dbait compared to irradiation. Responses to Dbait: (i) are dependent only on DNA-PK kinase activity and not on ATM, (ii) result in a phosphorylation signal lasting several days and (iii) are distributed in the treated population in an "all-or-none" pattern, in a Dbait-concentration threshold dependant manner. Moreover, despite extensive phosphorylation of the DNA-PK downstream targets, Dbait treated cells continue to proliferate without showing cell cycle delay or apoptosis. Dbait treatment prior to irradiation impaired foci formation of Nbs1, 53BP1 and Rad51 at DNA damage sites and inhibited non-homologous end joining as well as homologous recombination. Together, our results suggest that the hyperactivation of DNA-PK is insufficient for complete execution of the DDR but induces a "false" DNA damage signaling that disorganizes the DNA repair system.

  17. Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy.

    PubMed

    Chao, J; Zhang, P; Wang, Q; Wu, N; Zhang, F; Hu, J; Fan, C H; Li, B

    2016-03-21

    We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.

  18. Electrochemical detection of nucleic acids, proteins, small molecules and cells using a DNA-nanostructure-based universal biosensing platform.

    PubMed

    Lin, Meihua; Song, Ping; Zhou, Guobao; Zuo, Xiaolei; Aldalbahi, Ali; Lou, Xiaoding; Shi, Jiye; Fan, Chunhai

    2016-07-01

    The occurrence and prognosis of many complex diseases, such as cancers, is associated with the variation of various molecules, including DNA at the genetic level, RNA at the regulatory level, proteins at the functional level and small molecules at the metabolic level (defined collectively as multilevel molecules). Thus it is highly desirable to develop a single platform for detecting multilevel biomarkers for early-stage diagnosis. Here we report a protocol on DNA-nanostructure-based programmable engineering of the biomolecular recognition interface, which provides a universal electrochemical biosensing platform for the ultrasensitive detection of nucleic acids (DNA/RNA), proteins, small molecules and whole cells. The protocol starts with the synthesis of a series of differentially sized, self-assembled tetrahedral DNA nanostructures (TDNs) with site-specifically modified thiol groups that can be readily anchored on the surface of a gold electrode with high reproducibility. By exploiting the rigid structure, nanoscale addressability and versatile functionality of TDNs, one can tailor the type of biomolecular probes appended on individual TDNs for the detection of specific molecules of interest. Target binding occurring on the gold surface patterned with TDNs is quantitatively translated into electrochemical signals via a coupled enzyme-based catalytic process. This uses a sandwich assay strategy in which biotinylated reporter probes recognize TDN-bound target biomolecules, which then allow binding of horseradish-peroxidase-conjugated avidin (avidin-HRP). Hydrogen peroxide (H2O2) is then reduced by avidin-HRP in the presence of TMB (3,3',5,5'-tetramethylbenzidine) to generate a quantitative electrochemical signal. The time range for the entire protocol is ∼1 d, whereas the detection process takes ∼30 min to 3 h.

  19. DNA Physical Mapping via the Controlled Translocation of Single Molecules through a 5-10nm Silicon Nitride Nanopore

    NASA Astrophysics Data System (ADS)

    Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason

    2009-03-01

    The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.

  20. Did the Pre-RNA World Rest Upon DNA Molecules?

    NASA Technical Reports Server (NTRS)

    Lazcano, Antonio; Dworkin, Jason P.; Miller, Stanley L.

    2004-01-01

    The isolation of a DNA sequence that catalyzes the ligation of oligodeoxynucleotides via the formation of 3' - 5' phosphodiester linkage significance in selection experiments has been reported. Ball recently used this to discuss the possibility that natural DNA molecules may have formed in the primitive Earth leading to the origin of life. As noted by Ferris and Usher, if metabolic pathways evolved backwards, it could be argued that the biosynthesis of 2-deoxyribose from ribose suggests that RNA came from DNA. As summarized elsewhere, there are several properties of deoxyribose which could be interpreted to support the possibility that DNA-like molecules arose prior to the RNA world. For example, 2-deoxyribose is slightly more soluble than ribose (which may have been an advantage in a drying pool scenario), may have been more reactive under possible prebiotic conditions (it forms a nucleoside approx. 150 times faster than ribose with the alternative base urazole at 25 C), while it decomposes in solution (approximately 2.6 times more slowly than ribose at 100 C). Other advantages of DNA over RNA are that it has one fewer chiral center, has a greater stability at the 8.2 pH value of the current oceans, and does not has the 2'5' and 3'5' ambiguity in polymerizations. Yet, there is strong molecular biological and biochemical evidence that RNA was featured in the biology well before the last common ancestor. The presence of sugar acids, including both ribo- and deoxysugar acids, in the 4.6 Ga old Murchison meteorite suggest that both may have been available in the primitive Earth, derived from the accretion of extraterrestrial sources and/or from endogenous processes involving formaldehyde and its derivatives. However, the abiotic synthesis of deoxyribose, ribose, and other sugars from glyceraldehyde and acetaldehyde under alkaline conditions is inefficient and unespecific. Although sugars are labile compounds, the role of cyanamide or borate minerals in the

  1. Initiation of bacteriophage Φ29 DNA packaging studied by optical tweezers manipulation of single DNA molecules

    NASA Astrophysics Data System (ADS)

    Rickgauer, John Peter; Fuller, Derek N.; Hu, Bo; Grimes, Shelley; Jardine, Paul J.; Anderson, Dwight L.; Smith, Douglas E.

    2006-08-01

    A key step in the life cycle of many viruses, including bacteriophages, adenoviruses, and herpesviruses, is the packaging of replicated viral genomes into pre-assembled proheads by the action of ATP-dependent portal motor complexes. Here we present a method that allows the initiation of packaging by single complexes to be studied using optical tweezers. A procedure is developed for assembling phage Φ29 prohead-motor complexes, which are demonstrated to bind and begin translocation of a target DNA molecule within only a few seconds. We show that the Φ29 DNA terminal protein (gene product 3), which functions to prime DNA replication, also has a dramatic effect on packaging. The DNA tether length measured immediately after binding varied from ~30-100% of the full length, yet shortened monotonically, indicating that packaging does not strictly begin at the terminal end of the DNA. Removal of the terminal protein eliminated this variability, causing packaging to initiate at or very near the end of the DNA. These findings, taken together with electron microscopy data, suggest that rather than simply threading into the portal, the motor captures and dynamically tensions a DNA loop, and that the function of the terminal protein is to load DNA segments on both sides of the loop junction onto separate DNA translocating units.

  2. Structure and DNA-binding properties of the Bacillus subtilis SpoIIIE DNA translocase revealed by single-molecule and electron microscopies

    PubMed Central

    Cattoni, Diego I.; Thakur, Shreyasi; Godefroy, Cedric; Le Gall, Antoine; Lai-Kee-Him, Josephine; Milhiet, Pierre-Emmanuel; Bron, Patrick; Nöllmann, Marcelo

    2014-01-01

    SpoIIIE/FtsK are a family of ring-shaped, membrane-anchored, ATP-fuelled motors required to segregate DNA across bacterial membranes. This process is directional and requires that SpoIIIE/FtsK recognize highly skewed octameric sequences (SRS/KOPS for SpoIIIE/FtsK) distributed along the chromosome. Two models have been proposed to explain the mechanism by which SpoIIIE/FtsK interact with DNA. The loading model proposes that SpoIIIE/FtsK oligomerize exclusively on SpoIIIE recognition sequence/orienting polar sequences (SRS/KOPS) to accomplish directional DNA translocation, whereas the target search and activation mechanism proposes that pre-assembled SpoIIIE/FtsK hexamers bind to non-specific DNA, reach SRS/KOPS by diffusion/3d hopping and activate at SRS/KOPS. Here, we employ single-molecule total internal reflection imaging, atomic force and electron microscopies and ensemble biochemical methods to test these predictions and obtain further insight into the SpoIIIE–DNA mechanism of interaction. First, we find that SpoIIIE binds DNA as a homo-hexamer with neither ATP binding nor hydrolysis affecting the binding mechanism or affinity. Second, we show that hexameric SpoIIIE directly binds to double-stranded DNA without requiring the presence of SRS or free DNA ends. Finally, we find that SpoIIIE hexamers can show open and closed conformations in solution, with open-ring conformations most likely resembling a state poised to load to non-specific, double-stranded DNA. These results suggest how SpoIIIE and related ring-shaped motors may be split open to bind topologically closed DNA. PMID:24297254

  3. Single molecule analysis of Trypanosoma brucei DNA replication dynamics.

    PubMed

    Calderano, Simone Guedes; Drosopoulos, William C; Quaresma, Marina Mônaco; Marques, Catarina A; Kosiyatrakul, Settapong; McCulloch, Richard; Schildkraut, Carl L; Elias, Maria Carolina

    2015-03-11

    Eukaryotic genome duplication relies on origins of replication, distributed over multiple chromosomes, to initiate DNA replication. A recent genome-wide analysis of Trypanosoma brucei, the etiological agent of sleeping sickness, localized its replication origins to the boundaries of multigenic transcription units. To better understand genomic replication in this organism, we examined replication by single molecule analysis of replicated DNA. We determined the average speed of replication forks of procyclic and bloodstream form cells and we found that T. brucei DNA replication rate is similar to rates seen in other eukaryotes. We also analyzed the replication dynamics of a central region of chromosome 1 in procyclic forms. We present evidence for replication terminating within the central part of the chromosome and thus emanating from both sides, suggesting a previously unmapped origin toward the 5' extremity of chromosome 1. Also, termination is not at a fixed location in chromosome 1, but is rather variable. Importantly, we found a replication origin located near an ORC1/CDC6 binding site that is detected after replicative stress induced by hydroxyurea treatment, suggesting it may be a dormant origin activated in response to replicative stress. Collectively, our findings support the existence of more replication origins in T. brucei than previously appreciated. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Single molecule analysis of Trypanosoma brucei DNA replication dynamics

    PubMed Central

    Calderano, Simone Guedes; Drosopoulos, William C.; Quaresma, Marina Mônaco; Marques, Catarina A.; Kosiyatrakul, Settapong; McCulloch, Richard; Schildkraut, Carl L.; Elias, Maria Carolina

    2015-01-01

    Eukaryotic genome duplication relies on origins of replication, distributed over multiple chromosomes, to initiate DNA replication. A recent genome-wide analysis of Trypanosoma brucei, the etiological agent of sleeping sickness, localized its replication origins to the boundaries of multigenic transcription units. To better understand genomic replication in this organism, we examined replication by single molecule analysis of replicated DNA. We determined the average speed of replication forks of procyclic and bloodstream form cells and we found that T. brucei DNA replication rate is similar to rates seen in other eukaryotes. We also analyzed the replication dynamics of a central region of chromosome 1 in procyclic forms. We present evidence for replication terminating within the central part of the chromosome and thus emanating from both sides, suggesting a previously unmapped origin toward the 5′ extremity of chromosome 1. Also, termination is not at a fixed location in chromosome 1, but is rather variable. Importantly, we found a replication origin located near an ORC1/CDC6 binding site that is detected after replicative stress induced by hydroxyurea treatment, suggesting it may be a dormant origin activated in response to replicative stress. Collectively, our findings support the existence of more replication origins in T. brucei than previously appreciated. PMID:25690894

  5. Multiplex single-molecule interaction profiling of DNA barcoded proteins

    PubMed Central

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

    2014-01-01

    In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

  6. Mechanisms of DNA disentangling by type II topoisomerases. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

    NASA Astrophysics Data System (ADS)

    Yan, Jie

    2016-09-01

    In this article [1] Dr. Vologodskii presents a comprehensive discussion on the mechanisms by which the type II topoisomerases unknot/disentangle DNA molecules. It is motivated by a mysterious capability of the nanometer-size enzymes to keep the steady-state probability of DNA entanglement/knot almost two orders of magnitude below that expected from thermal equilibrium [2-5]. In spite of obvious functional advantages of the enzymes, it raises a question regarding how such high efficiency could be achieved. The off-equilibrium steady state distribution of DNA topology is powered by ATP consumption. However, it remains unclear how this energy is utilized to bias the distribution toward disentangled/unknotted topological states of DNA.

  7. Small circular DNA molecules act as rigid motifs to build DNA nanotubes.

    PubMed

    Zheng, Hongning; Xiao, Minyu; Yan, Qin; Ma, Yinzhou; Xiao, Shou-Jun

    2014-07-23

    Small circular DNA molecules with designed lengths, for example 64 and 96 nucleotides (nt), after hybridization with a few 32-nt staple strands respectively, can act as rigid motifs for the construction of DNA nanotubes with excellent uniformity in ring diameter. Unlike most native DNA nanotubes, which consist of longitudinal double helices, nanotubes assembled from circular DNAs are constructed from lateral double helices. Of the five types of DNA nanotubes designed here, four are built by alternating two different rings of the same ring size, while one is composed of all the same 96-nt rings. Nanotubes constructed from the same 96-nt rings are 10-100 times shorter than those constructed from two different 96-nt rings, because there are fewer hinge joints on the rings.

  8. Improving sensor response using reduced graphene oxide film transistor biosensor by controlling the adsorption of pyrene as an anchor molecule

    NASA Astrophysics Data System (ADS)

    Negishi, Ryota; Matsui, Yuji; Kobayashi, Yoshihiro

    2017-06-01

    Reduced graphene oxide (rGO) films functionalized with linker molecules that bind specific antibodies to the surface of their films are useful for biosensors based on field-effect transistors. Controlling the density of linker molecules on the rGO channel surface is a crucial issue for improving the sensor structure with the desired sensitivity and stability. In this study, ultraviolet-visible (UV-vis) absorption spectroscopy was utilized for the evaluation of the density of linker molecules adsorbed on the rGO and GO surfaces. We revealed that the density of adsorbed linker molecules on the rGO surface is dominated by oxygen-containing groups slightly remaining on the surfaces, rather than the restoration of the π-conjugated system in the graphitic structure of rGO films. We demonstrate that the difference in the density of adsorbed linker molecules on the rGO films significantly affects the sensitivity of sensor responses.

  9. Observation of DNA Molecules Using Fluorescence Microscopy and Atomic Force Microscopy

    ERIC Educational Resources Information Center

    Ito, Takashi

    2008-01-01

    This article describes experiments for an undergraduate instrumental analysis laboratory that aim to observe individual double-stranded DNA (dsDNA) molecules using fluorescence microscopy and atomic force microscopy (AFM). dsDNA molecules are observed under several different conditions to discuss their chemical and physical properties. In…

  10. Observation of DNA Molecules Using Fluorescence Microscopy and Atomic Force Microscopy

    ERIC Educational Resources Information Center

    Ito, Takashi

    2008-01-01

    This article describes experiments for an undergraduate instrumental analysis laboratory that aim to observe individual double-stranded DNA (dsDNA) molecules using fluorescence microscopy and atomic force microscopy (AFM). dsDNA molecules are observed under several different conditions to discuss their chemical and physical properties. In…

  11. Metal Ion Sensors Based on DNAzymes and Related DNA Molecules

    PubMed Central

    Kong, Rong-Mei

    2011-01-01

    Metal ion sensors are an important yet challenging field in analytical chemistry. Despite much effort, only a limited number of metal ion sensors are available for practical use because sensor design is often a trial-and-error-dependent process. DNAzyme-based sensors, in contrast, can be developed through a systematic selection that is generalizable for a wide range of metal ions. Here, we summarize recent progress in the design of DNAzyme-based fluorescent, colorimetric, and electrochemical sensors for metal ions, such as Pb2+, Cu2+, Hg2+, and UO22+ In addition, we also describe metal ion sensors based on related DNA molecules, including T-T or C-C mismatches and G-quadruplexes. PMID:21370984

  12. Direct comparison of the electronic coupling efficiency of sulfur and selenium anchoring groups for molecules adsorbed onto gold electrodes

    NASA Astrophysics Data System (ADS)

    Patrone, L.; Palacin, S.; Bourgoin, J. P.; Lagoute, J.; Zambelli, T.; Gauthier, S.

    2002-08-01

    We performed air and ultra-high vacuum scanning tunneling microscopy experiments in order to compare the electronic coupling provided by S and by Se used as alligator clips for bisthiol- and biselenol-terthiophene molecules adsorbed onto gold. The molecules were inserted in a dodecanethiol self-assembled monolayer. Their apparent height above the dodecanethiol matrix was used as a measure of the electronic coupling strength corresponding to S and Se, respectively. We show that the insertion behaviors of the two molecules are qualitatively the same, and that Se provides systematically a better coupling link than S whatever the tunneling conditions.

  13. Novel mechanism of gene regulation: the protein Rv1222 of Mycobacterium tuberculosis inhibits transcription by anchoring the RNA polymerase onto DNA

    PubMed Central

    Rudra, Paulami; Prajapati, Ranjit Kumar; Banerjee, Rajdeep; Sengupta, Shreya; Mukhopadhyay, Jayanta

    2015-01-01

    We propose a novel mechanism of gene regulation in Mycobacterium tuberculosis where the protein Rv1222 inhibits transcription by anchoring RNA polymerase (RNAP) onto DNA. In contrast to our existing knowledge that transcriptional repressors function either by binding to DNA at specific sequences or by binding to RNAP, we show that Rv1222-mediated transcription inhibition requires simultaneous binding of the protein to both RNAP and DNA. We demonstrate that the positively charged C-terminus tail of Rv1222 is responsible for anchoring RNAP on DNA, hence the protein slows down the movement of RNAP along the DNA during transcription elongation. The interaction between Rv1222 and DNA is electrostatic, thus the protein could inhibit transcription from any gene. As Rv1222 slows down the RNA synthesis, upon expression of the protein in Mycobacterium smegmatis or Escherichia coli, the growth rate of the bacteria is severely impaired. The protein does not possess any significant affinity for DNA polymerase, thus, is unable to inhibit DNA synthesis. The proposed mechanism by which Rv1222 inhibits transcription reveals a new repertoire of prokaryotic gene regulation. PMID:25999340

  14. Novel mechanism of gene regulation: the protein Rv1222 of Mycobacterium tuberculosis inhibits transcription by anchoring the RNA polymerase onto DNA.

    PubMed

    Rudra, Paulami; Prajapati, Ranjit Kumar; Banerjee, Rajdeep; Sengupta, Shreya; Mukhopadhyay, Jayanta

    2015-07-13

    We propose a novel mechanism of gene regulation in Mycobacterium tuberculosis where the protein Rv1222 inhibits transcription by anchoring RNA polymerase (RNAP) onto DNA. In contrast to our existing knowledge that transcriptional repressors function either by binding to DNA at specific sequences or by binding to RNAP, we show that Rv1222-mediated transcription inhibition requires simultaneous binding of the protein to both RNAP and DNA. We demonstrate that the positively charged C-terminus tail of Rv1222 is responsible for anchoring RNAP on DNA, hence the protein slows down the movement of RNAP along the DNA during transcription elongation. The interaction between Rv1222 and DNA is electrostatic, thus the protein could inhibit transcription from any gene. As Rv1222 slows down the RNA synthesis, upon expression of the protein in Mycobacterium smegmatis or Escherichia coli, the growth rate of the bacteria is severely impaired. The protein does not possess any significant affinity for DNA polymerase, thus, is unable to inhibit DNA synthesis. The proposed mechanism by which Rv1222 inhibits transcription reveals a new repertoire of prokaryotic gene regulation. © Crown copyright 2015.

  15. Placing molecules with Bohr radius resolution using DNA origami

    NASA Astrophysics Data System (ADS)

    Funke, Jonas J.; Dietz, Hendrik

    2016-01-01

    Molecular self-assembly with nucleic acids can be used to fabricate discrete objects with defined sizes and arbitrary shapes. It relies on building blocks that are commensurate to those of biological macromolecular machines and should therefore be capable of delivering the atomic-scale placement accuracy known today only from natural and designed proteins. However, research in the field has predominantly focused on producing increasingly large and complex, but more coarsely defined, objects and placing them in an orderly manner on solid substrates. So far, few objects afford a design accuracy better than 5 nm, and the subnanometre scale has been reached only within the unit cells of designed DNA crystals. Here, we report a molecular positioning device made from a hinged DNA origami object in which the angle between the two structural units can be controlled with adjuster helices. To test the positioning capabilities of the device, we used photophysical and crosslinking assays that report the coordinate of interest directly with atomic resolution. Using this combination of placement and analysis, we rationally adjusted the average distance between fluorescent molecules and reactive groups from 1.5 to 9 nm in 123 discrete displacement steps. The smallest displacement step possible was 0.04 nm, which is slightly less than the Bohr radius. The fluctuation amplitudes in the distance coordinate were also small (±0.5 nm), and within a factor of two to three of the amplitudes found in protein structures.

  16. Physisorption of DNA molecules on chemically modified single-walled carbon nanotubes with and without sonication.

    PubMed

    Umemura, Kazuo; Ishibashi, Yu; Oura, Shusuke

    2016-09-01

    We investigated the physisorption phenomenon of single-stranded DNA (ssDNA) molecules onto two types of commercially available chemically functionalized single-walled carbon nanotubes (SWNTs) by atomic force microscopy (AFM) and agarose gel electrophoresis. We found that DNA molecules can adsorb on the water-soluble SWNT surfaces without sonication, although sonication treatment has been used for hybridization of DNA and SWNTs in many previous studies. Using our method, damage of DNA molecules by sonication can be avoided. On the other hand, the amount of DNA molecules adsorbed on SWNT surfaces increased when the samples were sonicated. This fact suggests that the sonication is effective not only at debundling of SWNTs, but also at assisting DNA adsorption. Furthermore, DNA adsorption was affected by the types of functionalized SWNTs. In the case of SWNTs functionalized with polyethylene glycol (PEG-SWNT), physisorption of ssDNA molecules was confirmed only by agarose-gel electrophoresis. In contrast, amino-terminated SWNTs (NH2-SWNTs) showed a change in the height distribution profile based on AFM observations. These results suggest that DNA molecules tended to adsorb to NH2-SWNT surfaces, although DNA molecules can also adsorb on PEG-SWNT surfaces. Our results revealed fundamental information for developing nanobiodevices using hybrids of DNA and SWNTs.

  17. Direct observation of λ-DNA molecule reversal movement within microfluidic channels under electric field with single molecule imaging technique

    NASA Astrophysics Data System (ADS)

    Fengyun, Yang; Kaige, Wang; Dan, Sun; Wei, Zhao; Hai-qing, Wang; Xin, He; Gui-ren, Wang; Jin-tao, Bai

    2016-07-01

    The electrodynamic characteristics of single DNA molecules moving within micro-/nano-fluidic channels are important in the design of biomedical chips and bimolecular sensors. In this study, the dynamic properties of λ-DNA molecules transferring along the microchannels driven by the external electrickinetic force were systemically investigated with the single molecule fluorescence imaging technique. The experimental results indicated that the velocity of DNA molecules was strictly dependent on the value of the applied electric field and the diameter of the channel. The larger the external electric field, the larger the velocity, and the more significant deformation of DNA molecules. More meaningfully, it was found that the moving directions of DNA molecules had two completely different directions: (i) along the direction of the external electric field, when the electric field intensity was smaller than a certain threshold value; (ii) opposite to the direction of the external electric field, when the electric field intensity was greater than the threshold electric field intensity. The reversal movement of DNA molecules was mainly determined by the competition between the electrophoresis force and the influence of electro-osmosis flow. These new findings will theoretically guide the practical application of fluidic channel sensors and lab-on-chips for precisely manipulating single DNA molecules. Project supported by the National Natural Science Foundation of China (Grant No. 61378083), the International Cooperation Foundation of the National Science and Technology Major Project of the Ministry of Science and Technology of China (Grant No. 2011DFA12220), the Major Research Plan of National Natural Science Foundation of China (Grant No. 91123030), and the Natural Science Foundation of Shaanxi Province of China (Grant Nos. 2010JS110 and 2013SZS03-Z01).

  18. Titantium Dioxide Nanoparticles Assembled by DNA Molecules Hybridization and Loading of DNA Interacting Proteins.

    PubMed

    Wu, Aiguo; Paunesku, Tatjana; Brown, Eric M B; Babbo, Angela; Cruz, Cecille; Aslam, Mohamed; Dravid, Vinayak; Woloschak, Gayle E

    2008-02-01

    This work demonstrates the assembly of TiO(2) nanoparticles with attached DNA oligonucleotides into a 3D mesh structure by allowing base pairing between oligonucleotides. A change of the ratio of DNA oligonucleotide molecules and TiO(2) nanoparticles regulates the size of the mesh as characterized by UV-visible light spectra, transmission electron microscopy and atomic force microscopy images. This type of 3D mesh, based on TiO(2)-DNA oligonucleotide nanoconjugates, can be used for studies of nanoparticle assemblies in material science, energy science related to dye-sensitized solar cells, environmental science as well as characterization of DNA interacting proteins in the field of molecular biology. As an example of one such assembly, proliferating cell nuclear antigen protein (PCNA) was cloned, its activity verified, and the protein was purified, loaded onto double strand DNA oligonucleotide-TiO(2) nanoconjugates, and imaged by atomic force microscopy. This type of approach may be used to sample and perhaps quantify and/or extract specific cellular proteins from complex cellular protein mixtures affinity based on their affinity for chosen DNA segments assembled into the 3D matrix.

  19. Mode of action of DNA-competitive small molecule inhibitors of tyrosyl DNA phosphodiesterase 2

    PubMed Central

    Hornyak, Peter; Askwith, Trevor; Walker, Sarah; Komulainen, Emilia; Paradowski, Michael; Pennicott, Lewis E.; Bartlett, Edward J.; Brissett, Nigel C.; Raoof, Ali; Watson, Mandy; Jordan, Allan M.; Ogilvie, Donald J.; Ward, Simon E.; Atack, John R.; Pearl, Laurence H.; Caldecott, Keith W.; Oliver, Antony W.

    2016-01-01

    Tyrosyl-DNA phosphodiesterase 2 (TDP2) is a 5′-tyrosyl DNA phosphodiesterase important for the repair of DNA adducts generated by non-productive (abortive) activity of topoisomerase II (TOP2). TDP2 facilitates therapeutic resistance to topoisomerase poisons, which are widely used in the treatment of a range of cancer types. Consequently, TDP2 is an interesting target for the development of small molecule inhibitors that could restore sensitivity to topoisomerase-directed therapies. Previous studies identified a class of deazaflavin-based molecules that showed inhibitory activity against TDP2 at therapeutically useful concentrations, but their mode of action was uncertain. We have confirmed that the deazaflavin series inhibits TDP2 enzyme activity in a fluorescence-based assay, suitable for high-throughput screen (HTS)-screening. We have gone on to determine crystal structures of these compounds bound to a ‘humanized’ form of murine TDP2. The structures reveal their novel mode of action as competitive ligands for the binding site of an incoming DNA substrate, and point the way to generating novel and potent inhibitors of TDP2. PMID:27099339

  20. Processive translocation and DNA unwinding by individual RecBCD enzyme molecules

    NASA Astrophysics Data System (ADS)

    Bianco, Piero R.; Brewer, Laurence R.; Corzett, Michele; Balhorn, Rod; Yeh, Yin; Kowalczykowski, Stephen C.; Baskin, Ronald J.

    2001-01-01

    RecBCD enzyme is a processive DNA helicase and nuclease that participates in the repair of chromosomal DNA through homologous recombination. We have visualized directly the movement of individual RecBCD enzymes on single molecules of double-stranded DNA (dsDNA). Detection involves the optical trapping of solitary, fluorescently tagged dsDNA molecules that are attached to polystyrene beads, and their visualization by fluorescence microscopy. Both helicase translocation and DNA unwinding are monitored by the displacement of fluorescent dye from the DNA by the enzyme. Here we show that unwinding is both continuous and processive, occurring at a maximum rate of 972 +/- 172 base pairs per second (0.30µms-1), with as many as 42,300base pairs of dsDNA unwound by a single RecBCD enzyme molecule. The mean behaviour of the individual RecBCD enzyme molecules corresponds to that observed in bulk solution.

  1. Number and accuracy of T-DNA insertions in transgenic banana (Musa spp.) plants characterized by an improved anchored PCR technique.

    PubMed

    Pérez-Hernández, Juan Bernardo; Swennen, Rony; Sági, László

    2006-04-01

    Nineteen transgenic banana plants, produced via Agrobacterium-mediated transformation, were analyzed for the integration of T-DNA border regions using an improved anchored PCR technique. The method described is a relatively fast, three-step procedure (restriction digestion of genomic DNA, ligation of 'vectorette'-type adaptors, and a single round of suppression PCR) for the amplification of specific T-DNA border-containing genomic fragments. Most transgenic plants carried a low number of inserts and the method was suitable for a detailed characterization of the integration events, including T-DNA border integrity as well as the insertion of non-T-DNA vector sequences, which occurred in 26% of the plants. Furthermore, the particular band pattern generated by four enzyme/primer combinations for each individual plant served as a fingerprint, allowing the identification of plants representing identical transformation events. Genomic Southern hybridization and nucleotide sequence analysis of amplification products confirmed the data obtained by anchored PCR. Sequencing of seven right or left border junction regions revealed different T-DNA processing events for each plant, indicating a relatively low frequency of precisely nicked T-DNA integration among the plants studied.

  2. Crystal structure of a complex of a type IA DNA topoisomerase with a single-stranded DNA molecule

    SciTech Connect

    Changela, A.; Digate, R.J.; Mondragon, A.

    2010-03-05

    A variety of cellular processes, including DNA replication, transcription, and chromosome condensation, require enzymes that can regulate the ensuing topological changes occurring in DNA. Such enzymes - DNA topoisomerases - alter DNA topology by catalysing the cleavage of single-stranded DNA (ssDNA) or double-stranded DNA (dsDNA), the passage of DNA through the resulting break, and the rejoining of the broken phosphodiester backbone. DNA topoisomerase III from Escherichia coli belongs to the type IA family of DNA topoisomerases, which transiently cleave ssDNA via formation of a covalent 5' phosphotyrosine intermediate. Here we report the crystal structure, at 2.05 {angstrom} resolution, of an inactive mutant of E. coli DNA topoisomerase III in a non-covalent complex with an 8-base ssDNA molecule. The enzyme undergoes a conformational change that allows the oligonucleotide to bind within a groove leading to the active site. We note that the ssDNA molecule adopts a conformation like that of B-DNA while bound to the enzyme. The position of the DNA within the realigned active site provides insight into the role of several highly conserved residues during catalysis. These findings confirm various aspects of the type IA topoisomerase mechanism while suggesting functional implications for other topoisomerases and proteins that perform DNA rearrangements.

  3. Narrow Groove and Restricted Anchors of MHC Class I Molecule BF2*0401 Plus Peptide Transporter Restriction can Explain Disease Susceptibility of B4 Chickens

    PubMed Central

    Zhang, Jianhua; Chen, Yong; Qi, Jianxun; Gao, Feng; Liu, Yanjie; Liu, Jun; Zhou, Xuyu; Kaufman, Jim; Xia, Chun; Gao, George F.

    2016-01-01

    The major histocompatibility complex (MHC) has genetic associations with many diseases, often due to differences in presentation of antigenic peptides by polymorphic MHC molecules to T lymphocytes of the immune system. In chickens, only a single classical class I molecule in each MHC haplotype is expressed well due to co-evolution with the polymorphic transporters associated with antigen presentation (TAPs), which means that resistance and susceptibility to infectious pathogens are particularly easy to observe. Previously, structures of chicken MHC class I molecule BF2*2101 from B21 haplotype showed an unusually large peptide-binding groove that accommodates a broad spectrum of peptides to present as epitopes to cytotoxic T lymphocytes (CTL), explaining the MHC-determined resistance of B21 chickens to Marek's disease. Here, we report the crystal structure of BF2*0401 from the B4 (also known as B13) haplotype, showing a highly positively-charged surface hitherto unobserved in other MHC molecules, as well as a remarkably narrow groove due to the allele-specific residues with bulky side chains. Together, these properties limit the number of epitope peptides that can bind this class I molecule. However, peptide-binding assays show that in vitro BF2*0401 can bind a wider variety of peptides than are found on the surface of B4 cells. Thus, a combination of the specificities of the polymorphic TAP transporter and the MHC results in a very limited set of BF2*0401 peptides with negatively charged anchors to be presented to T lymphocytes. PMID:23041567

  4. Detection of single DNA molecules by multicolor quantum-dot end-labeling

    PubMed Central

    Crut, Aurélien; Géron-Landre, Bénédicte; Bonnet, Isabelle; Bonneau, Stéphane; Desbiolles, Pierre; Escudé, Christophe

    2005-01-01

    Observation of DNA–protein interactions by single molecule fluorescence microscopy is usually performed by using fluorescent DNA binding agents. However, such dyes have been shown to induce cleavage of the DNA molecule and perturb its interactions with proteins. A new method for the detection of surface-attached DNA molecules by fluorescence microscopy is introduced in this paper. Biotin- and/or digoxigenin-modified DNA fragments are covalently linked at both extremities of a DNA molecule via sequence-specific hybridization and ligation. After the modified DNA molecules have been stretched on a glass surface, their ends are visualized by multicolor fluorescence microscopy using conjugated quantum dots (QD). We demonstrate that under carefully selected conditions, the position and orientation of individual DNA molecules can be inferred with good efficiency from the QD fluorescence signals alone. This is achieved by selecting QD pairs that have the distance and direction expected for the combed DNA molecules. Direct observation of single DNA molecules in the absence of DNA staining agent opens new possibilities in the fundamental study of DNA–protein interactions. This work also documents new possibilities regarding the use of QD for nucleic acid detection and analysis. PMID:15967805

  5. Sizing of single globular DNA molecules by using a circular acceleration technique with laser trapping.

    PubMed

    Hirano, Ken; Nagata, Hideya; Ishido, Tomomi; Tanaka, Yoshio; Baba, Yoshinobu; Ishikawa, Mitsuru

    2008-07-01

    We describe a method for in situ sizing individual huge DNA molecules by laser trapping. Single DNA molecules are reversibly transformed, without mechanical fragmentation of fragile huge-sized DNA, from their random coil state into their globular state induced by condensing agents poly(ethylene glycol) and Mg(2+). With the use of a globular DNA molecule folded by condensation, the critical velocity of the circularly accelerated single globular DNA molecule by laser trapping was found to be proportional to the size of the DNA. Yeast, Saccharomyces cerevisiae, chromosome III (285 kbp) was successfully sized (281 +/- 40 kbp) from a calibration curve scaled using lambda, T4, and yeast chromosome VI (48.5, 166, and 385 kbp, respectively). The use of critical velocity as a sizing parameter makes it possible to size single DNA molecules without prior conformational information, i.e., the radius of a single globular huge DNA molecule as a nanoparticle. A sized single globular DNA molecule could be trapped again for subsequent manipulation, such as transportation of it anywhere. We also investigated a possibility of reusing the globular DNA molecules condensed by PEG and Mg(2+) for PCR and found that PCR efficiency was not deteriorated in the presence of the condensation agents.

  6. Rigid DNA beams for high-resolution single-molecule mechanics.

    PubMed

    Pfitzner, Emanuel; Wachauf, Christian; Kilchherr, Fabian; Pelz, Benjamin; Shih, William M; Rief, Matthias; Dietz, Hendrik

    2013-07-22

    Bridging the gap: Rigid DNA linkers (blue, see picture) between microspheres (green) for high-resolution single-molecule mechanical experiments were constructed using DNA origami. The resulting DNA helical bundles greatly reduce the noise generated in studies of conformation changes using optical tweezers and were applied to study small DNA secondary structures.

  7. Elongation and migration of single DNA molecules in microchannels using oscillatory shear flows.

    PubMed

    Jo, Kyubong; Chen, Yeng-Long; de Pablo, Juan J; Schwartz, David C

    2009-08-21

    Much of modern biology relies on the strategic manipulation of molecules for creating ordered arrays prior to high throughput molecular analysis. Normally, DNA arrays involve deposition on surfaces, or confinement in nanochannels; however, we show that microfluidic devices can present stretched molecules within a controlled flow in ways complementing surface modalities, or extreme confinement conditions. Here we utilize pressure-driven oscillatory shear flows generated in microchannels as a new way of stretching DNA molecules for imaging "arrays" of individual DNA molecules. Fluid shear effects both stretch DNA molecules and cause them to migrate away from the walls becoming focused in the centerline of a channel. We show experimental findings confirming simulations using Brownian dynamics accounting for hydrodynamic interactions between molecules and channel-flow boundary conditions. Our findings characterize DNA elongation and migration phenomena as a function of molecular size, shear rate, oscillatory frequency with comparisons to computer simulation studies.

  8. High-Throughput Universal DNA Curtain Arrays for Single-Molecule Fluorescence Imaging

    PubMed Central

    Gallardo, Ignacio F.; Pasupathy, Praveenkumar; Brown, Maxwell; Manhart, Carol M.; Neikirk, Dean P.; Alani, Eric; Finkelstein, Ilya J.

    2015-01-01

    Single-molecule studies of protein–DNA interactions have shed critical insights into the molecular mechanisms of nearly every aspect of DNA metabolism. The development of DNA curtains—a method for organizing arrays of DNA molecules on a fluid lipid bilayer—has greatly facilitated these studies by increasing the number of reactions that can be observed in a single experiment. However, the utility of DNA curtains is limited by the challenges associated with depositing nanometer-scale lipid diffusion barriers onto quartz microscope slides. Here, we describe a UV lithography-based method for large-scale fabrication of chromium (Cr) features and organization of DNA molecules at these features for high-throughput single-molecule studies. We demonstrate this approach by assembling 792 independent DNA arrays (containing >900 000 DNA molecules) within a single microfluidic flowcell. As a first proof of principle, we track the diffusion of Mlh1-Mlh3—a heterodimeric complex that participates in DNA mismatch repair and meiotic recombination. To further highlight the utility of this approach, we demonstrate a two-lane flowcell that facilitates concurrent experiments on different DNA substrates. Our technique greatly reduces the challenges associated with assembling DNA curtains and paves the way for the rapid acquisition of large statistical data sets from individual single-molecule experiments. PMID:26325477

  9. High-Throughput Universal DNA Curtain Arrays for Single-Molecule Fluorescence Imaging.

    PubMed

    Gallardo, Ignacio F; Pasupathy, Praveenkumar; Brown, Maxwell; Manhart, Carol M; Neikirk, Dean P; Alani, Eric; Finkelstein, Ilya J

    2015-09-22

    Single-molecule studies of protein-DNA interactions have shed critical insights into the molecular mechanisms of nearly every aspect of DNA metabolism. The development of DNA curtains-a method for organizing arrays of DNA molecules on a fluid lipid bilayer-has greatly facilitated these studies by increasing the number of reactions that can be observed in a single experiment. However, the utility of DNA curtains is limited by the challenges associated with depositing nanometer-scale lipid diffusion barriers onto quartz microscope slides. Here, we describe a UV lithography-based method for large-scale fabrication of chromium (Cr) features and organization of DNA molecules at these features for high-throughput single-molecule studies. We demonstrate this approach by assembling 792 independent DNA arrays (containing >900,000 DNA molecules) within a single microfluidic flowcell. As a first proof of principle, we track the diffusion of Mlh1-Mlh3-a heterodimeric complex that participates in DNA mismatch repair and meiotic recombination. To further highlight the utility of this approach, we demonstrate a two-lane flowcell that facilitates concurrent experiments on different DNA substrates. Our technique greatly reduces the challenges associated with assembling DNA curtains and paves the way for the rapid acquisition of large statistical data sets from individual single-molecule experiments.

  10. Investigation of the binding modes between AIE-active molecules and dsDNA by single molecule force spectroscopy

    NASA Astrophysics Data System (ADS)

    Chen, Ying; Ma, Ke; Hu, Ting; Jiang, Bo; Xu, Bin; Tian, Wenjing; Sun, Jing Zhi; Zhang, Wenke

    2015-05-01

    AIE (aggregation-induced emission)-active molecules hold promise for the labeling of biomolecules as well as living cells. The study of the binding modes of such molecules to biomolecules, such as nucleic acids and proteins, will shed light on a deeper understanding of the mechanisms of molecular interactions and eventually facilitate the design/preparation of new AIE-active bioprobes. Herein, we studied the binding modes of double-stranded DNA (dsDNA) with two types of synthetic AIE-active molecules, namely, tetraphenylethene-derived dicationic compounds (cis-TPEDPy and trans-TPEDPy) and anthracene-derived dicationic compounds (DSAI and DSABr-C6) using single molecule force spectroscopy (SMFS) and circular dichroism (CD) spectroscopy. The experimental data indicate that DSAI can strongly intercalate into DNA base pairs, while DSABr-C6 is unable to intercalate into DNA due to the steric hindrance of the alkyl side chains. Cis-TPEDPy and trans-TPEDPy can also intercalate into DNA base pairs, but the binding shows strong ionic strength dependence. Multiple binding modes of TPEDPy with dsDNA have been discussed. In addition, the electrostatic interaction enhanced intercalation of cis-TPEDPy with dsDNA has also been revealed.AIE (aggregation-induced emission)-active molecules hold promise for the labeling of biomolecules as well as living cells. The study of the binding modes of such molecules to biomolecules, such as nucleic acids and proteins, will shed light on a deeper understanding of the mechanisms of molecular interactions and eventually facilitate the design/preparation of new AIE-active bioprobes. Herein, we studied the binding modes of double-stranded DNA (dsDNA) with two types of synthetic AIE-active molecules, namely, tetraphenylethene-derived dicationic compounds (cis-TPEDPy and trans-TPEDPy) and anthracene-derived dicationic compounds (DSAI and DSABr-C6) using single molecule force spectroscopy (SMFS) and circular dichroism (CD) spectroscopy. The

  11. Next-Generation DNA Curtains for Single-Molecule Studies of Homologous Recombination.

    PubMed

    Soniat, Michael M; Myler, Logan R; Schaub, Jeffrey M; Kim, Yoori; Gallardo, Ignacio F; Finkelstein, Ilya J

    2017-01-01

    Homologous recombination (HR) is a universally conserved DNA double-strand break repair pathway. Single-molecule fluorescence imaging approaches have revealed new mechanistic insights into nearly all aspects of HR. These methods are especially suited for studying protein complexes because multicolor fluorescent imaging can parse out subassemblies and transient intermediates that associate with the DNA substrates on the millisecond to hour timescales. However, acquiring single-molecule datasets remains challenging because most of these approaches are designed to measure one molecular reaction at a time. The DNA curtains platform facilitates high-throughput single-molecule imaging by organizing arrays of DNA molecules on the surface of a microfluidic flowcell. Here, we describe a second-generation UV lithography-based protocol for fabricating flowcells for DNA curtains. This protocol greatly reduces the challenges associated with assembling DNA curtains and paves the way for the rapid acquisition of large datasets from individual single-molecule experiments. Drawing on our recent studies of human HR, we also provide an overview of how DNA curtains can be used for observing facilitated protein diffusion, processive enzyme translocation, and nucleoprotein filament dynamics on single-stranded DNA. Together, these protocols and case studies form a comprehensive introduction for other researchers that may want to adapt DNA curtains for high-throughput single-molecule studies of DNA replication, transcription, and repair. © 2017 Elsevier Inc. All rights reserved.

  12. Anchoring transition metal elements on graphene-like ZnO monolayer by CO molecule to obtain spin gapless semiconductor

    NASA Astrophysics Data System (ADS)

    Lei, Jie; Xu, Ming-Chun; Hu, Shu-Jun

    2017-09-01

    Graphene-like zinc oxide monolayer (g-ZnO) is a newfound two-dimensional material. Here we utilize the transition metal (TM) elements (Cr, Mn, Fe, Co, Ni, and Cu) to functionalize the g-ZnO with the aim of designing novel spintronics materials by using first-principles calculations. Our results show that although the adsorption of TM atoms can endow g-ZnO with magnetization and impurity states in the bandgap, the interaction between TM elements and g-ZnO is weak. We found that the attachment of CO molecule on TM is able to stabilize the TM elements on g-ZnO based on the 'donation and back-donation' mechanism. As a result, the adsorption energy of the CO-TM complex on g-ZnO is as high as 1.41-2.11 eV. Furthermore, the incorporation of CO molecule modulates the magnetic and electronic properties of the TM-decorated g-ZnO. In particular, the CO-Mn-g-ZnO is predicted to be a spin gapless semiconductor.

  13. Molecular Combing of Single DNA Molecules on the 10 Megabase Scale

    PubMed Central

    Kaykov, Atanas; Taillefumier, Thibaud; Bensimon, Aaron; Nurse, Paul

    2016-01-01

    DNA combing allows the investigation of DNA replication on genomic single DNA molecules, but the lengths that can be analysed have been restricted to molecules of 200–500 kb. We have improved the DNA combing procedure so that DNA molecules can be analysed up to the length of entire chromosomes in fission yeast and up to 12 Mb fragments in human cells. Combing multi-Mb-scale DNA molecules revealed previously undetected origin clusters in fission yeast and shows that in human cells replication origins fire stochastically forming clusters of fired origins with an average size of 370 kb. We estimate that a single human cell forms around 3200 clusters at mid S-phase and fires approximately 100,000 origins to complete genome duplication. The procedure presented here will be adaptable to other organisms and experimental conditions. PMID:26781994

  14. DNA origami as biocompatible surface to match single-molecule and ensemble experiments

    PubMed Central

    Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

    2012-01-01

    Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

  15. DNA origami as biocompatible surface to match single-molecule and ensemble experiments.

    PubMed

    Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

    2012-08-01

    Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements.

  16. Model of DNA topology simplification has come full (supercoiled) circle after two decades of research. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

    NASA Astrophysics Data System (ADS)

    Stasiak, Andrzej

    2016-09-01

    Being a geek of DNA topology, I remember very well the stir caused by 1997 Science paper showing that DNA topoisomerases have the ability to simplify DNA topology below the topological equilibrium values [1]. In their seminal experiments Rybenkov et al. [1] started with linear double-stranded DNA molecules with cohesive ends. The mutual cohesiveness of DNA ends was due to mutual complementarity of single-stranded extensions at both ends of linear double-stranded DNA molecules. When such DNA molecules were heated up and then slowly cooled down the single-stranded ends eventually annealed with each other causing DNA circularization. This experimental protocol permitted the authors to establish topological/thermodynamic equilibrium within samples of circularized DNA molecules. Among simple unknotted circles one also observed knotted and catenated DNA molecules. The fraction of knotted molecules in DNA samples at topological equilibrium was increasing with the length of DNA molecules undergoing slow circularization. The fraction of catenated molecules was increasing with the length and the concentration of the molecules undergoing slow circularization. Rybenkov et al. incubated then such equilibrated DNA samples with type II DNA topoisomerases, which pass DNA duplex regions through each other, and observed that as the result of it the fraction of knotted and catenated DNA molecules was dramatically decreased (up to 80-fold). This elegant experiment indicated for the first time that type II DNA topoisomerases acting on knotted or catenated DNA molecules have the ability to select among many potential sites of DNA-DNA passages these that result in DNA unknotting or decatenation. Without such a selection topoisomerases could only maintain the original topological equilibrium obtained during the slow cyclization. The big question was how DNA topoisomerases can be directed to do DNA-DNA passages that preferentially result in DNA unknotting and decatenation.

  17. Single-stranded DNA adsorption on chiral molecule coated Au surface: a molecular dynamics study.

    PubMed

    Liang, Haiqing; Li, Zhenyu; Yang, Jinlong

    2010-05-07

    All-atomistic molecular dynamics simulations with explicit water solution are performed to investigate the interaction between single-stranded DNA (ssDNA) molecules and chiral N-isobutyryl-cysteine (NIBC) molecule coated Au surfaces. Different contributions to the force exerted on ssDNA are analyzed. It turns out that the experimentally observed stereospecific adsorption behavior of ssDNA on d/l-NIBC self-assembled monolayer surface mainly originates from the interaction between the dipole moment of NIBC and the negative charge carried by ssDNA.

  18. Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

    2016-03-01

    We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

  19. Monitoring patterned enzymatic polymerization on DNA origami at single-molecule level.

    PubMed

    Okholm, A H; Aslan, H; Besenbacher, F; Dong, M; Kjems, J

    2015-07-07

    DNA origami has been used to orchestrate reactions with nano-precision using a variety of biomolecules. Here, the dynamics of albumin-assisted, localized single-molecule DNA polymerization by terminal deoxynucleotidyl transferase on a 2D DNA origami are monitored using AFM in liquid. Direct visualization of the surface activity revealed the mechanics of growth.

  20. How to determine local stretching and tension in a flow-stretched DNA molecule

    NASA Astrophysics Data System (ADS)

    Pedersen, Jonas N.; Marie, Rodolphe; Kristensen, Anders; Flyvbjerg, Henrik

    We determine the nonuniform stretching of and tension in a Mbp-long fragment of DNA that is flow-stretched in a nanofluidic chip. We use no markers, do not know the contour length of the DNA, and do not have the full DNA molecule inside our field-of-view. Instead we analyze the transverse thermal motion of the DNA. Tension at the center of the DNA adds up to 16 pN, giving almost fully stretched DNA. Fitted parameters agree well with simplified expressions, where the DNA is modeled as a cylinder in a parallel flow.

  1. Protective Effects of Membrane-Anchored and Secreted DNA Vaccines Encoding Fatty Acid-Binding Protein and Glutathione S-Transferase against Schistosoma japonicum

    PubMed Central

    Tu, Yaqin; Hu, Yang; Fan, Guorun; Chen, Zhihao; Liu, Lin; Man, Dandan; Liu, Shuojie; Tang, Chengwu; Zhang, Yin; Dai, Wuxing

    2014-01-01

    In order to explore the high performance bivalent DNA-based vaccine against schistosomes, SjFABP and Sj26GST were selected and used to construct a vaccine. Two strategies were used to construct the bivalent DNA vaccine. In the first strategy, a plasmid encoding antigen in the secreted form was used, while in the other, a plasmid encoding a truncated form of SjFABP and Sj26GST targeted to the cell surface was used. Various parameters, including antibody and cytokine response, proliferation, histopathological examination, and characterization of T cell subsets were used to evaluate the type of immune response and the level of protection against challenge infection. Injection with secreted pIRES-sjFABP-sj26GST significantly increased the levels of antibody, splenocyte proliferation, and production of IFN-γ, compared with membrane-anchored groups. Analysis of splenic T cell subsets showed that the secreted vaccine significantly increased the percentage of CD3+CD4+ and CD3+CD8+ T cells. Liver immunopathology (size of liver granulomas) was significantly reduced in the secreted group compared with the membrane-anchored groups. Moreover, challenge experiments showed that the worm and egg burdens were significantly reduced in animals immunized with recombinant vaccines. Most importantly, secreted Sj26GST-SjFABP markedly enhanced protection, by reducing worm and egg burdens by 31.8% and 24.78%, respectively, while the membrane-anchored group decreased worm and egg burdens by 24.80% and 18.80%, respectively. Taken together, these findings suggest that the secretory vaccine is more promising than the membrane-anchored vaccine, and provides support for the development and application of this vaccine. PMID:24466157

  2. DNA kinks and bubbles: Temperature dependence of the elastic energy of sharply bent 10-nm-size DNA molecules

    NASA Astrophysics Data System (ADS)

    Sanchez, Daniel S.; Qu, Hao; Bulla, Delenda; Zocchi, Giovanni

    2013-02-01

    A 10-nm-long DNA molecule can bend through large angles reversibly. Past the linear regime, its equilibrium nonlinear bending elasticity is governed by a critical bending torque τc≈30pN×nm at which the molecule develops a kink. This nonlinearity has long been attributed to the nucleation of a bubble or melted region in the molecule. Here we measure the temperature dependence of the critical bending torque for nicked DNA, and determine that the entropy associated with the kink in the nonlinear regime is negligible. Thus in the case of nicked DNA the kink is not a bubble, but a compact region deformed beyond a yield strain. We further argue that, with our boundary conditions, the same is likely true for intact DNA. The present measurements confirm that the critical bending torque τc is a materials parameter of DNA mechanics analogous to the bending modulus B≈200pN×nm.

  3. Sieving DNA molecules by length dependence in artificial nano-channel matrices

    NASA Astrophysics Data System (ADS)

    Wang, Chung-Hsuan; Hua Ho, Chia; Chou, Y. C.

    2013-01-01

    Nano-channel matrices are designed and fabricated for sieving DNA molecules by length. The length dependence is found to change with the size of the channels. Three regimes can be distinguished: (a) for the matrices with the size of the channels comparable to the persistence length (lp) of DNA molecules (45 nm), the mobility of DNA is found to decrease with the length of the molecules, similar to that found for the gel electrophoresis; (b) as the size of the nano-channel increases, the successful attacking frequency increases for the long molecules. The length-dependence of the mobility reverses; and (c) the Ogston mechanism holds for even larger channels. The short DNA molecules drift faster for the channels with diameter larger than 10 lp. Such a variety of the length dependence is observed for the first time in the electrophoresis in the artificial structures.

  4. Biosensing via light scattering from plasmonic core-shell nanospheres coated with DNA molecules

    NASA Astrophysics Data System (ADS)

    Xie, Huai-Yi; Chen, Minfeng; Chang, Yia-Chung; Moirangthem, Rakesh Singh

    2017-05-01

    We present both experimental and theoretical studies for investigating DNA molecules attached on metallic nanospheres. We have developed an efficient and accurate numerical method to investigate light scattering from plasmonic nanospheres on a substrate covered by a shell, based on the Green's function approach with suitable spherical harmonic basis. Next, we use this method to study optical scattering from DNA molecules attached to metallic nanoparticles placed on a substrate and compare with experimental results. We obtain fairly good agreement between theoretical predictions and the measured ellipsometric spectra. The metallic nanoparticles were used to detect the binding with DNA molecules in a microfluidic setup via spectroscopic ellipsometry (SE), and a detectable change in ellipsometric spectra was found when DNA molecules are captured on Au nanoparticles. Our theoretical simulation indicates that the coverage of Au nanosphere by a submonolayer of DNA molecules, which is modeled by a thin layer of dielectric material (which may absorb light), can lead to a small but detectable spectroscopic shift in both the Ψ and Δ spectra with more significant change in Δ spectra in agreement with experimental results. Our studies demonstrated the ultrasensitive capability of SE for sensing submonolayer coverage of DNA molecules on Au nanospheres. Hence the spectroscopic ellipsometric measurements coupled with theoretical analysis via an efficient computation method can be an effective tool for detecting DNA molecules attached on Au nanoparticles, thus achieving label-free, non-destructive, and high-sensitivity biosensing with nanoscale resolution.

  5. DNA Mapping Using Microfluidic Stretching and Single-Molecule Detection of Fluorescent Site-Specific Tags

    PubMed Central

    Chan, Eugene Y.; Goncalves, Nuno M.; Haeusler, Rebecca A.; Hatch, Amie J.; Larson, Jonathan W.; Maletta, Anthony M.; Yantz, Gregory R.; Carstea, Eugene D.; Fuchs, Martin; Wong, Gordon G.; Gullans, Steven R.; Gilmanshin, Rudolf

    2004-01-01

    We have developed a rapid molecular mapping technology—Direct Linear Analysis (DLA)—on the basis of the analysis of individual DNA molecules bound with sequence-specific fluorescent tags. The apparatus includes a microfluidic device for stretching DNA molecules in elongational flow that is coupled to a multicolor detection system capable of single-fluorophore sensitivity. Double-stranded DNA molecules were tagged at sequence-specific motif sites with fluorescent bisPNA (Peptide Nucleic Acid) tags. The DNA molecules were then stretched in the microfluidic device and driven in a flow stream past confocal fluorescence detectors. DLA provided the spatial locations of multiple specific sequence motifs along individual DNA molecules, and thousands of individual molecules could be analyzed per minute. We validated this technology using the 48.5 kb λ phage genome with different 8-base and 7-base sequence motif tags. The distance between the sequence motifs was determined with an accuracy of ±0.8 kb, and these tags could be localized on the DNA with an accuracy of ±2 kb. Thus, DLA is a rapid mapping technology, suitable for analysis of long DNA molecules. PMID:15173119

  6. Diversity of DNA beta, a satellite molecule associated with some monopartite begomoviruses.

    PubMed

    Briddon, Rob W; Bull, Simon E; Amin, Imran; Idris, Ali M; Mansoor, Shahid; Bedford, Ian D; Dhawan, Poonam; Rishi, Narayan; Siwatch, Surender S; Abdel-Salam, Aly M; Brown, Judith K; Zafar, Yusuf; Markham, Peter G

    2003-07-20

    DNA beta molecules are symptom-modulating, single-stranded DNA satellites associated with monopartite begomoviruses (family Geminiviridae). Such molecules have thus far been shown to be associated with Ageratum yellow vein virus from Singapore and Cotton leaf curl Multan virus from Pakistan. Here, 26 additional DNA beta molecules, associated with diverse plant species obtained from different geographical locations, were cloned and sequenced. These molecules were shown to be widespread in the Old World, where monopartite begomoviruses are known to occur. Analysis of the sequences revealed a highly conserved organization for DNA beta molecules consisting of a single conserved open reading frame, an adenine-rich region, and a region of high sequence conservation [the satellite conserved region (SCR)]. The SCR contains a potential hairpin structure with the loop sequence TAA/GTATTAC; similar to the origins of replication of geminiviruses and nanoviruses. Two major groups of DNA beta satellites were resolved by phylogenetic analyses. One group originated from hosts within the Malvaceae and the second from a more diverse group of plants within the Solanaceae and Compositae. Within the two clusters, DNA beta molecules showed relatedness based both on host and geographic origin. These findings strongly support coadaptation of DNA beta molecules with their respective helper begomoviruses.

  7. Preparation of multimilligram quantities of large, linear DNA molecules for structural studies.

    PubMed

    Muecke, Merlind; Samuels, Martin; Davey, Megan; Jeruzalmi, David

    2008-06-01

    We describe a method for preparing large, linear DNA molecules in amounts that are suitable for structural studies. The procedure employs self-primed DNA amplification on a starting molecule that consists of the sequence of interest flanked by the cohesive end sequences from bacteriophage lambda as well as endonuclease recognition sites. Amplification produces long polymers of DNA, tens of kilobases in length, which harbor many copies of the sequence of interest. Endonuclease digestion of these polymers, followed by chromatographic purification, yields high-quality preparations of the DNA molecule of interest. Reliance on the cohesive end sequences to initiate self-primed amplification effectively enables the synthesis of DNA molecules of interest with minimal restriction on length and sequence.

  8. Quantum dot binding to DNA: single-molecule imaging with atomic force microscopy.

    PubMed

    Li, Kungang; Zhang, Wen; Chen, Yongsheng

    2013-01-01

    The interaction between nanoparticles (NPs) and DNA is of significance for both application and implication research of NPs. In this study, a single-molecule imaging technique based on atomic force microscopy (AFM) was employed to probe the NP-DNA interactions with quantum dots (QDs) as model NPs. Reproducible high-quality images of single DNA molecules in air and in liquids were acquired on mica by optimizing sample preparation conditions. Furthermore, the binding of QDs to DNA was explored using AFM. The DNA concentration was found to be a key factor influencing AFM imaging quality. In air and liquids, the optimal DNA concentration for imaging DNA molecules was approximately 2.5 and 0.25 μg/mL, and that for imaging DNA binding with QDs was 0.5 and 0.25 μg/mL, respectively. In the presence of QDs, the DNA conformation was altered with the formation of DNA condensates. Finally, the fine conformation of QD-DNA binding sites was examined to analyze the binding mechanisms. This work will benefit investigations of NP-DNA interactions and the understanding of the structure of NP-DNA bioconjugates. See accompanying article by Wang DOI: 10.1002/biot.201200309. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.

    PubMed

    van Loenhout, Marijn T J; De Vlaminck, Iwijn; Flebus, Benedetta; den Blanken, Johan F; Zweifel, Ludovit P; Hooning, Koen M; Kerssemakers, Jacob W J; Dekker, Cees

    2013-01-01

    The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.

  10. Scanning a DNA Molecule for Bound Proteins Using Hybrid Magnetic and Optical Tweezers

    PubMed Central

    van Loenhout, Marijn T. J.; De Vlaminck, Iwijn; Flebus, Benedetta; den Blanken, Johan F.; Zweifel, Ludovit P.; Hooning, Koen M.; Kerssemakers, Jacob W. J.; Dekker, Cees

    2013-01-01

    The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ∼17 nm spatial resolution. An offset of 33±5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions. PMID:23755219

  11. Synergistic self-assembly of RNA and DNA molecules

    NASA Astrophysics Data System (ADS)

    Ko, Seung Hyeon; Su, Min; Zhang, Chuan; Ribbe, Alexander E.; Jiang, Wen; Mao, Chengde

    2010-12-01

    DNA has recently been used as a programmable 'smart' building block for the assembly of a wide range of nanostructures. It remains difficult, however, to construct DNA assemblies that are also functional. Incorporating RNA is a promising strategy to circumvent this issue as RNA is structurally related to DNA but exhibits rich chemical, structural and functional diversities. However, only a few examples of rationally designed RNA structures have been reported. Herein, we describe a simple, general strategy for the de novo design of nanostructures in which the self-assembly of RNA strands is programmed by DNA strands. To demonstrate the versatility of this approach, we have designed and constructed three different RNA-DNA hybrid branched nanomotifs (tiles), which readily assemble into one-dimensional nanofibres, extended two-dimensional arrays and a discrete three-dimensional object. The current strategy could enable the integration of the precise programmability of DNA with the rich functionality of RNA.

  12. Direct single-molecule observations of DNA unwinding by SV40 large tumor antigen under a negative DNA supercoil state.

    PubMed

    Takahashi, Shunsuke; Motooka, Shinya; Kawasaki, Shohei; Kurita, Hirofumi; Mizuno, Takeshi; Matsuura, Shun-Ichi; Hanaoka, Fumio; Mizuno, Akira; Oshige, Masahiko; Katsura, Shinji

    2017-01-05

    Superhelices, which are induced by the twisting and coiling of double-helical DNA in chromosomes, are thought to affect transcription, replication, and other DNA metabolic processes. In this study, we report the effects of negative supercoiling on the unwinding activity of simian virus 40 large tumor antigen (SV40 TAg) at a single-molecular level. The supercoiling density of linear DNA templates was controlled using magnetic tweezers and monitored using a fluorescent microscope in a flow cell. SV40 TAg-mediated DNA unwinding under relaxed and negative supercoil states was analyzed by the direct observation of both single- and double-stranded regions of single DNA molecules. Increased negative superhelicity stimulated SV40 TAg-mediated DNA unwinding more strongly than a relaxed state; furthermore, negative superhelicity was associated with an increased probability of SV40 TAg-mediated DNA unwinding. These results suggest that negative superhelicity helps to regulate the initiation of DNA replication.

  13. Single Molecule Measurements of Protelomerase TelK-DNA Complexes

    NASA Astrophysics Data System (ADS)

    Landry, Markita; Khafizov, Rustem; Huang, Wai Mun; Chemla, Yann

    2008-10-01

    Protein-DNA interactions lie at the heart of many essential cellular processes such as replication, recombination, and repair. Recent advances in optical ``tweezers'' have made it possible to resolve motions on the scale of a single base pair of DNA, 3.4å. High-resolution optical traps have the potential to reveal these interactions at their fundamental length scales and should reveal how certain proteins bind to DNA or recognize target sequences. Telomerases are enzymes that have been actively studied in various organisms because of their fundamental involvement with both cancer and aging^1. Protelomerase TelK is an enzyme responsible for forming closed DNA hairpin ends in linear DNA. TelK is not an ATP dependant enzyme, which is surprising given the degree of DNA distortion accomplished by the enzyme, and the large energy barrier intrinsic in DNA hairpin formation. Therefore, our focus is on TelK mutants lacking their c-terminal domain, and TelK YF mutants lacking their tyrosine active site amino acid. Preliminary data have shown remarkable differences in protein binding and unbinding forces caused by the removal of a single oxygen atom from a 73 kDa protein. Further measurements using high-resolution optical tweezers should provide fundamental insights into the nature and importance of the electrostatic interactions between TelK and its DNA substrate. 1. Shay, J. et al. Rad. Res. 155, 188 (2001) [1] Huang, W. et al. Mol. Cell. 27, 901 (2007).

  14. Single-stranded DNA scanning and deamination with Single molecule resolution

    NASA Astrophysics Data System (ADS)

    Rueda, David

    2012-04-01

    Over the past decade, single-molecule fluorescence resonance energy transfer spectroscopy (smFRET) has become an increasingly popular tool to study the structural dynamics of biopolymers, such as DNA, RNA and proteins. The most attractive aspect of single-molecule experiments is that, unlike ensemble-averaged techniques, they directly reveal the structural dynamics of individual molecules, which would otherwise be hidden in ensemble-averaged experiments. Here, we will present a novel single molecule assay to study, for the first time, scanning of an enzyme (APOBEC3G, involved in the defense against HIV) on single stranded DNA (ssDNA). We have investigated the ssDNA scanning and activity of Apo3G with smFRET. Our data show that Apo3G scans ssDNA randomly and bidirectionally with average excursion lengths of ˜ 10 å and ˜1 s-1 scanning rates. Apo3G quasi-localization is observed on highly reactive motifs located near the one end of the ssDNA. Motif-dependent ssDNA bending is also observed, where the bending is maximal for highly reactive targets located near the DNA end. Interestingly, both the Apo3G scanning and Apo3G-induced ssDNA bending is reduced with lowered ionic strength, indicating that Apo3G motion on ssDNA is facilitated by salt by reducing `electrostatic friction'. Although scanning is random, asymmetric catalytic orientation may be the reason for Apo3G directional activity.

  15. How to determine local stretching and tension in a flow-stretched DNA molecule

    NASA Astrophysics Data System (ADS)

    Pedersen, Jonas N.; Marie, Rodolphe; Kristensen, Anders; Flyvbjerg, Henrik

    2016-04-01

    We determine the nonuniform stretching of and tension in a mega base pairs-long fragment of deoxyribonucleic acid (DNA) that is flow stretched in a nanofluidic chip. We use no markers, do not know the contour length of the DNA, and do not have the full DNA molecule inside our field of view. Instead, we analyze the transverse thermal motion of the DNA. Tension at the center of the DNA adds up to 16 pN, giving almost fully stretched DNA. This method was devised for optical mapping of DNA, specifically, DNA denaturation patterns. It may be useful also for other studies, e.g., DNA-protein interactions, specifically, their tension dependence. Generally, wherever long strands of DNA—e.g., native DNA extracted from human cells or bacteria—must be stretched with ease for inspection, this method applies.

  16. DNA molecule stretching through thermo-electrophoresis and thermal convection in a heated converging-diverging microchannel

    PubMed Central

    2013-01-01

    A novel DNA molecule stretching technique is developed and tested herein. Through a heated converging-diverging microchannel, thermal convection and thermophoresis induced by regional heating are shown to significantly elongate single DNA molecules; they are visualized via a confocal laser scanning microscopy. In addition, electrophoretic stretching is also implemented to examine the hybrid effect on the conformation and dynamics of single DNA molecules. The physical properties of the DNA molecules are secured via experimental measurements. PMID:23414121

  17. The cytochrome b5 tail anchors and stabilizes subdomains of human DNA topoisomerase II alpha in the cytoplasm of retrovirally infected mammalian cells.

    PubMed

    Soltermann, A; Ernst, A; Leroy, D; Stahel, R A; Gasser, S M

    1999-06-15

    DNA topoisomerase II (topo II) is the target of many anticancer drugs and is often altered in drug-resistant cell lines. In some tumor cell lines truncated isoforms of topo IIalpha are localized to the cytoplasm. To study the localization and function of individual enzyme domains, we have epitope-tagged several fragments of human topo IIalpha and expressed them by retroviral infection of rodent and human cells. We find that fusion of the topo II fragments to the hydrophobic tail of human liver cytochrome b5 anchors the fusion protein to the outer face of cytoplasmic membranes, as determined by colocalization with calnexin and selective detergent permeabilization. Moreover, whereas the minimal ATPase domain (aa 1-266) is weakly and diffusely expressed, addition of the cytb5 anchor (1-266-b5) increases its steady-state level 16-fold with no apparent toxicity. Similar results are obtained with the complete ATPase domain (aa 1-426). A C-terminal domain (aa 1030-1504) of human topo IIalpha containing an intact dimerization motif is stably expressed and accumulates in the nucleus. Fusion to the cytb5 anchor counteracts the nuclear localization signal and relocalizes the protein to cytoplasmic membranes. In conclusion, we describe a technique that stabilizes and targets retrovirally expressed proteins such that they are exposed on the cytoplasmic surface of cellular membranes. This approach may be of general use for regulating the nuclear accumulation of drugs or proteins in living cells.

  18. [Polarization selectivity of interaction of DNA molecules by the action of X-ray radiation].

    PubMed

    Semchenko, I V; Kakhomov, S A; Balmakov, A P

    2010-01-01

    The optimum form of a long helical molecule, which DNA is, has been calculated in terms of the classical electromagnetic theory. Three different methods of classical electrodynamics are used: the theory of dipole radiation of electromagnetic waves, the energetic power approach, and a helical model of molecules of chiral medium. In all three cases, an identical result for the optimum geometrical form of a long spiral molecule has been obtained. The lead angle between the tangent to the helix and the plane normal to the axis of the helix should be equal to 24.5 degrees. This condition imposes restrictions on the radius and the pitch of the helical molecule. The experimentally measured geometrical characteristics of the DNA molecule satisfy the theoretically calculated condition precisely enough. Having the optimum geometrical form, the DNA molecule is not influenced by a circularly right-handed polarized electromagnetic wave in the soft X-ray range lambda = 7-8 nm. This wave, for which the right-handed DNA molecule is "transparent", should propagate orthogonally to the helix axis and form a right-handed screw in space. The wave radiated by the right-handed DNA molecule orthogonally to helix axis in the range of lambda = 7-8 nm has, accordingly, the left-handed circular polarization. The polarization selectivity of the DNA molecule by the action of X-ray radiation is exhibited strongly enough in the wavelength range of lambda = 1-35 nm. The results obtained are valid for any distribution of electric currents in DNA, i.e., for any sequence of nitrus bases in DNA.

  19. Partial sequencing of a single DNA molecule with a scanning tunnelling microscope

    NASA Astrophysics Data System (ADS)

    Tanaka, Hiroyuki; Kawai, Tomoji

    2009-08-01

    The scanning tunnelling microscope is capable of the real-space imaging and spectroscopy of molecules on an atomic scale. Numerous attempts have been made to use the scanning tunnelling microscope to sequence single DNA molecules, but difficulties in preparing samples of long-chain DNA molecules on surfaces, and problems in reproducing results have limited these experiments. Here, we report single-molecule DNA sequencing with a scanning tunnelling microscope by using an oblique pulse-injection method to deposit the molecules onto a copper surface. First, we show that guanine bases have a distinct electronic state that allows them to be distinguished from the other nucleic acid bases. Then, by comparing data on M13mp18, a single-stranded phage DNA, with a known base sequence, the `electronic fingerprint' of guanine bases in the DNA molecule is identified. These results show that it is possible to sequence individual guanine bases in real long-chain DNA molecules with high-resolution scanning tunnelling microscope imaging and spectroscopy.

  20. Immobilization of layered double hydroxides in the fluidic system for nanoextraction of specific DNA molecules

    NASA Astrophysics Data System (ADS)

    Chen, Jem-Kun; Chan, Chia-Hao; Chang, Feng-Chih

    2008-02-01

    The purpose of this study was to immobilize inorganic layered double hydroxides (LDHs) on the poly(methylmethacrylate) substrate as the media to extract the specific DNA molecules through fluidic system to enhance the efficiency of extract specific DNA molecules from extremely low concentration in sample solution. LDH immobilized through solvent swelling and plasma treatment on the polymer surface captured the specific DNA molecules lysed from Escherichia coli (E. coli) cells as the target DNA molecules with 2×10-4g/l of concentration in sample solution mixed biomacromolecules lysed from human blood. The encapsulated DNA molecules released through dissolving of LDHs by slight acid (pH=4-5) solution then amplified by polymerase chain reaction (PCR) process through the primers for E. coli cells. The DNA molecules amplified by PCR process were characterized by gel electrophoresis to recognize the existence of E. coli cells. The results show that immobilized LDHs could be regarded as the specific DNA detector for rapid disease diagnosis through fluidic system.

  1. Quantification of dye-mediated photodamage during single-molecule DNA imaging.

    PubMed

    Tycon, Michael A; Dial, Catherine F; Faison, Keia; Melvin, Whitney; Fecko, Christopher J

    2012-07-01

    Single-molecule fluorescence imaging of DNA-binding proteins has enabled detailed investigations of their interactions. However, the intercalating dyes used to visually locate DNA molecules have the undesirable effect of photochemically damaging the DNA through radical intermediaries. Unfortunately, this damage occurs as single-strand breaks (SSBs), which are visually undetectable but can heavily influence protein behavior. We investigated the formation of SSBs on DNA molecules by the dye YOYO-1 using complementary single-molecule imaging and gel electrophoresis-based damage assays. The single-molecule assay imaged hydrodynamically elongated lambda DNA, enabling the real-time detection of double-strand breaks (DSBs). The gel assay, which used supercoiled plasmid DNA, was sensitive to both SSBs and DSBs. This enabled the quantification of SSBs that precede DSB formation. Using the parameters determined from the gel damage assay, we applied a model of stochastic DNA damage to the time-resolved DNA breakage data, extracting the rates of single-strand breakage at two dye staining ratios and measuring the damage reduction from the radical scavengers ascorbic acid and β-mercaptoethanol. These results enable the estimation of the number of SSBs that occur during imaging and are scalable over a wide range of laser intensities used in fluorescence microscopy. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Design of sequence-specific DNA binding molecules for DNA methyltransferase inhibition.

    PubMed

    Kang, JeenJoo S; Meier, Jordan L; Dervan, Peter B

    2014-03-05

    The CpG dyad, an important genomic feature in DNA methylation and transcriptional regulation, is an attractive target for small molecules. To assess the utility of minor groove binding oligomers for CpG recognition, we screened a small library of hairpin pyrrole-imidazole polyamides targeting the sequence 5'-CGCG-3' and assessed their sequence specificity using an unbiased next-generation sequencing assay. Our findings indicate that hairpin polyamide of sequence PyImβIm-γ-PyImβIm (1), previously identified as a high affinity 5'-CGCG-3' binder, favors 5'-GCGC-3' in an unanticipated reverse binding orientation. Replacement of one β alanine with Py to afford PyImPyIm-γ-PyImβIm (3) restores the preference for 5'-CGCG-3' binding in a forward orientation. The minor groove binding hairpin 3 inhibits DNA methyltransferase activity in the major groove at its target site more effectively than 1, providing a molecular basis for design of sequence-specific antagonists of CpG methylation.

  3. Design of Sequence-Specific DNA Binding Molecules for DNA Methyltransferase Inhibition

    PubMed Central

    2015-01-01

    The CpG dyad, an important genomic feature in DNA methylation and transcriptional regulation, is an attractive target for small molecules. To assess the utility of minor groove binding oligomers for CpG recognition, we screened a small library of hairpin pyrrole-imidazole polyamides targeting the sequence 5′-CGCG-3′ and assessed their sequence specificity using an unbiased next-generation sequencing assay. Our findings indicate that hairpin polyamide of sequence PyImβIm-γ-PyImβIm (1), previously identified as a high affinity 5′-CGCG-3′ binder, favors 5′-GCGC-3′ in an unanticipated reverse binding orientation. Replacement of one β alanine with Py to afford PyImPyIm-γ-PyImβIm (3) restores the preference for 5′-CGCG-3′ binding in a forward orientation. The minor groove binding hairpin 3 inhibits DNA methyltransferase activity in the major groove at its target site more effectively than 1, providing a molecular basis for design of sequence-specific antagonists of CpG methylation. PMID:24502234

  4. Probe Microscopic Studies of DNA Molecules on Carbon Nanotubes

    PubMed Central

    Umemura, Kazuo; Izumi, Katsuki; Oura, Shusuke

    2016-01-01

    Hybrids of DNA and carbon nanotubes (CNTs) are promising nanobioconjugates for nanobiosensors, carriers for drug delivery, and other biological applications. In this review, nanoscopic characterization of DNA-CNT hybrids, in particular, characterization by scanning probe microscopy (SPM), is summarized. In many studies, topographical imaging by atomic force microscopy has been performed. However, some researchers have demonstrated advanced SPM operations in order to maximize its unique and valuable functions. Such sophisticated approaches are attractive and will have a significant impact on future studies of DNA-CNT hybrids. PMID:28335308

  5. Drug-DNA interactions at single molecule level: A view with optical tweezers

    NASA Astrophysics Data System (ADS)

    Paramanathan, Thayaparan

    Studies of small molecule--DNA interactions are essential for developing new drugs for challenging diseases like cancer and HIV. The main idea behind developing these molecules is to target and inhibit the reproduction of the tumor cells and infected cells. We mechanically manipulate single DNA molecule using optical tweezers to investigate two molecules that have complex and multiple binding modes. Mononuclear ruthenium complexes have been extensively studied as a test for rational drug design. Potential drug candidates should have high affinity to DNA and slow dissociation kinetics. To achieve this, motifs of the ruthenium complexes are altered. Our collaborators designed a dumb-bell shaped binuclear ruthenium complex that can only intercalate DNA by threading through its bases. Studying the binding properties of this complex in bulk studies took hours. By mechanically manipulating a single DNA molecule held with optical tweezers, we lower the barrier to thread and make it fast compared to the bulk experiments. Stretching single DNA molecules with different concentration of drug molecules and holding it at a constant force allows the binding to reach equilibrium. By this we can obtain the equilibrium fractional ligand binding and length of DNA at saturated binding. Fitting these results yields quantitative measurements of the binding thermodynamics and kinetics of this complex process. The second complex discussed in this study is Actinomycin D (ActD), a well studied anti-cancer agent that is used as a prototype for developing new generations of drugs. However, the biophysical basis of its activity is still unclear. Because ActD is known to intercalate double stranded DNA (dsDNA), it was assumed to block replication by stabilizing dsDNA in front of the replication fork. However, recent studies have shown that ActD binds with even higher affinity to imperfect duplexes and some sequences of single stranded DNA (ssDNA). We directly measure the on and off rates by

  6. Single-molecule positioning in zeromode waveguides by DNA origami nanoadapters.

    PubMed

    Pibiri, Enrico; Holzmeister, Phil; Lalkens, Birka; Acuna, Guillermo P; Tinnefeld, Philip

    2014-06-11

    Nanotechnology is challenged by the need to connect top-down produced nanostructures with the bottom-up world of chemistry. A nanobiotechnological prime example is the positioning of single polymerase molecules in small holes in metal films, so-called zeromode waveguides (ZMWs), which is required for single-molecule real-time DNA sequencing. In this work, we present nanoadapters made of DNA (DNA origami) that match the size of the holes so that exactly one nanoadapter fits in each hole. By site-selective functionalization of the DNA origami nanoadapters, we placed single dye molecules in the ZMWs, thus optimizing the hole usage and improving the photophysical properties of dyes compared to stochastically immobilized molecules.

  7. A Proteomic Characterization of Factors Enriched at Nascent DNA Molecules

    PubMed Central

    Lopez-Contreras, Andres J.; Ruppen, Isabel; Nieto-Soler, Maria; Murga, Matilde; Rodriguez-Acebes, Sara; Remeseiro, Silvia; Rodrigo-Perez, Sara; Rojas, Ana M.; Mendez, Juan; Muñoz, Javier; Fernandez-Capetillo, Oscar

    2013-01-01

    SUMMARY DNA replication is facilitated by multiple factors that concentrate in the vicinity of replication forks. Here, we developed an approach that combines the isolation of proteins on nascent DNA chains with mass spectrometry (iPOND-MS), allowing a comprehensive proteomic characterization of the human replisome and replisome-associated factors. In addition to known replisome components, we provide a broad list of proteins that reside in the vicinity of the replisome, some of which were not previously associated with replication. For instance, our data support a link between DNA replication and the Williams-Beuren syndrome and identify ZNF24 as a replication factor. In addition, we reveal that SUMOylation is wide-spread for factors that concentrate near replisomes, which contrasts with lower UQylation levels at these sites. This resource provides a panoramic view of the proteins that concentrate in the surroundings of the replisome, which should facilitate future investigations on DNA replication and genome maintenance. PMID:23545495

  8. Atomic force microscopy of DNA at high humidity: irreversible conformational switching of supercoiled molecules.

    PubMed

    Billingsley, Daniel J; Kirkham, Jennifer; Bonass, William A; Thomson, Neil H

    2010-11-28

    Three topologically different double-stranded DNA molecules of the same size (bps) have been imaged in air on mica using amplitude modulation atomic force microscopy (AM AFM) under controlled humidity conditions. At very high relative humidity (>90% RH), localized conformational changes of the DNA were observed, while at lower RH, the molecules remained immobile. The conformational changes occurred irreversibly and were driven principally by superhelical stress stored in the DNA molecules prior to binding to the mica surface. The binding mechanism of the DNA to the mica (surface equilibration versus kinetic trapping) modulated the extent of the conformational changes. In cases where DNA movement was observed, increased kinking of the DNA was seen at high humidity when more surface water was present. Additionally, DNA condensation behavior was also present in localized regions of the molecules. This study illustrates that changes in the tertiary structure of DNA can be induced during AFM imaging at high humidity on mica. We propose that AM AFM in high humidity will be a useful technique for probing DNA topology without some of the drawbacks of imaging under bulk solution.

  9. [Superparamagnetic Cobalt Ferrite Nanoparticles "Blow up" Spatial Ordering of Double-stranded DNA Molecules].

    PubMed

    Yevdokimov, Yu M; Pershina, A G; Salyanov, V I; Magaeva, A A; Popenko, V I; Shtykova, E V; Dadinova, L A; Skuridin, S G

    2015-01-01

    The formation of cholesteric liquid-crystalline dispersions formed by double-stranded DNA molecules, handled by positively charged superparamagnetic cobalt ferrite nanoparticles, as well as action of these nanoparticles on DNA dispersion, are considered. The binding of magnetic nanoparticles to the linear double-stranded DNA in solution of high ionic strength (0.3 M NaCl) and subsequent phase exclusion of these complexes from polyethylene glycol-containing solutions lead to their inability to form dispersions, whose particles do possess the spatially twisted arrangement of neighboring double-stranded DNA molecules. The action of magnetic nanoparticles on DNA dispersion (one magnetic nanoparticle per one double-stranded DNA molecule) results in such "perturbation" of DNA structure at sites of magnetic nanoparticles binding that the regular spatial structure of DNA dispersion particles "blows up"; this process is accompanied by disappearance of both abnormal optical activity and characteristic Bragg maximum on the small-angle X-ray scattering curve. Allowing with the fact that the physicochemical properties of the DNA liquid-crystalline dispersion particles reflect features of spatial organization of these molecules in chromosomes of primitive organisms, it is possible, that the found effect can have the relevant biological consequences.

  10. Recent advances in small organic molecules as DNA intercalating agents: synthesis, activity, and modeling.

    PubMed

    Rescifina, Antonio; Zagni, Chiara; Varrica, Maria Giulia; Pistarà, Venerando; Corsaro, Antonino

    2014-03-03

    The interaction of small molecules with DNA plays an essential role in many biological processes. As DNA is often the target for majority of anticancer and antibiotic drugs, study about the interaction of drug and DNA has a key role in pharmacology. Moreover, understanding the interactions of small molecules with DNA is of prime significance in the rational design of more powerful and selective anticancer agents. Two of the most important and promising targets in cancer chemotherapy include DNA alkylating agents and DNA intercalators. For these last the DNA recognition is a critical step in their anti-tumor action and the intercalation is not only one kind of the interactions in DNA recognition but also a pivotal step of several clinically used anti-tumor drugs such as anthracyclines, acridines and anthraquinones. To push clinical cancer therapy, the discovery of new DNA intercalators has been considered a practical approach and a number of intercalators have been recently reported. The intercalative binding properties of such molecules can also be harnessed as diagnostic probes for DNA structure in addition to DNA-directed therapeutics. Moreover, the problem of intercalation site formation in the undistorted B-DNA of different length and sequence is matter of tremendous importance in molecular modeling studies and, nowadays, three models of DNA intercalation targets have been proposed that account for the binding features of intercalators. Finally, despite DNA being an important target for several drugs, most of the docking programs are validated only for proteins and their ligands. Therefore, a default protocol to identify DNA binding modes which uses a modified canonical DNA as receptor is needed. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  11. Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

    NASA Astrophysics Data System (ADS)

    Buyukdagli, Sahin

    2017-02-01

    We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test-charge theory [S. Buyukdagli et al., Phys. Rev. E 94, 042502 (2016), 10.1103/PhysRevE.94.042502] to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the experimental phase diagrams for polymer solutions. First, the addition of polyvalent cations to the electrolyte solution results in the attraction of the negatively charged polymer by the DNA molecule. The glue of the like-charge attraction is the enhanced shielding of the polymer charges by the dense counterion layer at the DNA surface. Second, through the shielding of the DNA-induced electrostatic potential, mono- and polyvalent cations of large concentration both suppress the like-charge attraction. Within the same formalism, we also predict a new opposite-charge repulsion effect between the DNA molecule and a positively charged polymer. In the presence of polyvalent anions such as sulfate or phosphate, their repulsion by the DNA charges leads to the charge screening deficiency of the region around the DNA molecule. This translates into a repulsive force that results in the decomplexation of the polymer from DNA. This opposite-charge repulsion phenomenon can be verified by current experiments and the underlying mechanism can be beneficial to gene therapeutic applications where the control over polymer-DNA interactions is the key factor.

  12. Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules.

    PubMed

    Buyukdagli, Sahin

    2017-02-01

    We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test-charge theory [S. Buyukdagli et al., Phys. Rev. E 94, 042502 (2016)1539-375510.1103/PhysRevE.94.042502] to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the experimental phase diagrams for polymer solutions. First, the addition of polyvalent cations to the electrolyte solution results in the attraction of the negatively charged polymer by the DNA molecule. The glue of the like-charge attraction is the enhanced shielding of the polymer charges by the dense counterion layer at the DNA surface. Second, through the shielding of the DNA-induced electrostatic potential, mono- and polyvalent cations of large concentration both suppress the like-charge attraction. Within the same formalism, we also predict a new opposite-charge repulsion effect between the DNA molecule and a positively charged polymer. In the presence of polyvalent anions such as sulfate or phosphate, their repulsion by the DNA charges leads to the charge screening deficiency of the region around the DNA molecule. This translates into a repulsive force that results in the decomplexation of the polymer from DNA. This opposite-charge repulsion phenomenon can be verified by current experiments and the underlying mechanism can be beneficial to gene therapeutic applications where the control over polymer-DNA interactions is the key factor.

  13. Single molecule FRET shows uniformity in TBP-induced DNA bending and heterogeneity in bending kinetics†

    PubMed Central

    Blair, Rebecca H.; Goodrich, James A.; Kugel, Jennifer F.

    2012-01-01

    TATA binding protein (TBP) is a key component of the eukaryotic RNA polymerase II (Pol II) transcription machinery that binds to TATA boxes located in the core promoter regions of many genes. Structural and biochemical studies have shown that when TBP binds DNA, it sharply bends the DNA. We used single-molecule FRET (smFRET) to study DNA bending by human TBP on consensus and mutant TATA boxes in the absence and presence of TFIIA. We found that the state of the bent DNA within populations of TBP/DNA complexes is homogeneous; partially bent intermediates were not observed. In contrast to previous ensemble studies, TBP was found to bend a mutant TATA box to the same extent as the consensus TATA box. Moreover, in the presence of TFIIA the extent of DNA bending was not significantly changed, although TFIIA did increase the fraction of DNA molecules bound by TBP. Analysis of the kinetics of DNA bending and unbending revealed that on the consensus TATA box two kinetically distinct populations of TBP/DNA complexes exist, however, the bent state of the DNA is the same in the two populations. Our smFRET studies reveal that human TBP bends DNA in a largely uniform manner under a variety of different conditions, which was unexpected given previous ensemble biochemical studies. Our new observations lead to us to revise the model for the mechanism of DNA binding by TBP and for how DNA bending is affected by TATA sequence and TFIIA. PMID:22934924

  14. Topological events in single molecules of E. coli DNA confined in nanochannels.

    PubMed

    Reifenberger, Jeffrey G; Dorfman, Kevin D; Cao, Han

    2015-07-21

    We present experimental data concerning potential topological events such as folds, internal backfolds, and/or knots within long molecules of double-stranded DNA when they are stretched by confinement in a nanochannel. Genomic DNA from E. coli was labeled near the 'GCTCTTC' sequence with a fluorescently labeled dUTP analog and stained with the DNA intercalator YOYO. Individual long molecules of DNA were then linearized and imaged using methods based on the NanoChannel Array technology (Irys® System) available from BioNano Genomics. Data were collected on 189 153 molecules of length greater than 50 kilobases. A custom code was developed to search for abnormal intensity spikes in the YOYO backbone profile along the length of individual molecules. By correlating the YOYO intensity spikes with the aligned barcode pattern to the reference, we were able to correlate the bright intensity regions of YOYO with abnormal stretching in the molecule, which suggests these events were either a knot or a region of internal backfolding within the DNA. We interpret the results of our experiments involving molecules exceeding 50 kilobases in the context of existing simulation data for relatively short DNA, typically several kilobases. The frequency of these events is lower than the predictions from simulations, while the size of the events is larger than simulation predictions and often exceeds the molecular weight of the simulated molecules. We also identified DNA molecules that exhibit large, single folds as they enter the nanochannels. Overall, topological events occur at a low frequency (∼7% of all molecules) and pose an easily surmountable obstacle for the practice of genome mapping in nanochannels.

  15. Probing Nucleosome Remodeling by Unzipping Single DNA Molecules

    NASA Astrophysics Data System (ADS)

    Wang, Michelle

    2006-03-01

    At the core of eukaryotic chromatin is the nucleosome, which consists of 147 bp of DNA wrapped 1.65 turns around an octamer of histone proteins. Even this lowest level of genomic compaction presents a strong barrier to DNA-binding cellular factors that are required for essential processes such as transcription, DNA replication, recombination and repair. Chromatin remodeling enzymes use the energy of ATP hydrolysis to regulate accessibility of the genetic code by altering chromatin structure. While remodeling enzymes have been the subject of extensive research in recent years, their precise mechanism remains unclear. In order to probe the structure of individual nucleosomes and their remodeling, we assembled a histone octamer onto a DNA segment containing a strong nucleosome positioning sequence. As the DNA double helix was unzipped through the nucleosome using a feedback-enhanced optical trap, the presence of the nucleosome was detected as a series of dramatic increases in the tension in the DNA, followed by sudden tension reductions. Analysis of the unzipping force throughout the disruption accurately revealed the spatial location and fine structure of the nucleosome to near base pair precision. Using this approach, we investigate how remodeling enzymes may alter the location and structure of a nucleosome.

  16. Selective enrichment of damaged DNA molecules for ancient genome sequencing

    PubMed Central

    2014-01-01

    Contamination by present-day human and microbial DNA is one of the major hindrances for large-scale genomic studies using ancient biological material. We describe a new molecular method, U selection, which exploits one of the most distinctive features of ancient DNA—the presence of deoxyuracils—for selective enrichment of endogenous DNA against a complex background of contamination during DNA library preparation. By applying the method to Neanderthal DNA extracts that are heavily contaminated with present-day human DNA, we show that the fraction of useful sequence information increases ∼10-fold and that the resulting sequences are more efficiently depleted of human contamination than when using purely computational approaches. Furthermore, we show that U selection can lead to a four- to fivefold increase in the proportion of endogenous DNA sequences relative to those of microbial contaminants in some samples. U selection may thus help to lower the costs for ancient genome sequencing of nonhuman samples also. PMID:25081630

  17. DNA molecules sticking on a vicinal Si(111) surface observed by noncontact atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Arai, Toyoko; Tomitori, Masahiko; Saito, Masato; Tamiya, Eiichi

    2002-03-01

    The DNA molecules on a vicinal Si(111) substrate with steps of single and double bi-atomic layers are imaged by noncontact atomic force microscopy (nc-AFM) in ultrahigh vacuum. The water solution containing pBR322 plasmid DNA molecules digested by Cla I is dropped on the substrate in a pure nitrogen atmosphere in a glove box, which is connected to the introduction chamber of the AFM. The ends of DNA molecules are frequently folded and pinned at the steps on the substrate, and the DNA strings often lie along the step. The chemical and dipole interactions between the DNA and the semiconductor substrate seem to play an important role in folding, pinning and sticking on the Si(111) substrate.

  18. Effects of Tilt Angle, DNA Concentration, and Surface Potential on Directed Alignment of DNA Molecule for the Application to Nanodevices

    NASA Astrophysics Data System (ADS)

    Kim, Hyung Jin; Hong, Byungyou

    2013-03-01

    This paper reports an efficient approach to control both the density and direction of highly aligned DNA molecules and thus DNA-templated gold nanowires (AuNWs) on Si chips. We utilized tilting method to prepare stretched DNA structures on SiO2/Si substrate and found important parameters in the alignment process that tilt angle, DNA concentration, and surface potential are controlled the density and structure of DNA aligned on the surface. In additional, we also can be directly connected DNA-templated AuNWs between two terminal electrodes on Si chips. This method also describes a simple way to form singled, bundled and networked DNA arrays on Si substrates.

  19. DNA-Guided Delivery of Single Molecules into Zero-Mode Waveguides.

    PubMed

    Plénat, Thomas; Yoshizawa, Satoko; Fourmy, Dominique

    2017-09-13

    Zero-mode waveguides (ZMWs) are powerful analytical tools corresponding to optical nanostructures fabricated in a thin metallic film capable of confining an excitation volume to the range of attoliters. This small volume of confinement allows single-molecule fluorescence experiments to be performed at physiologically relevant concentrations of fluorescently labeled biomolecules. Exactly one molecule to be studied must be attached at the floor of the ZMW for signal detection and analysis; however, the massive parallelism of these nanoarrays suffers from a Poissonian-limited distribution of these biomolecules. To date, there is no method available that provides full single-molecule occupancy of massively arrayed ZMWs. Here we report the performance of a DNA-guided method that uses steric exclusion properties of large DNA molecules to bias the Poissonian-limited delivery of single molecules. Non-Poissonian statistics were obtained with DNA molecules that contain a free-biotinylated extremity for efficient binding to the floor of the ZMW, which resulted in a decrease of accessibility for a second molecule. Both random-coiled and condensed DNA conformations drove non-Poissonian single-molecule delivery into ZMW arrays. The results suggest that an optimal balance between the rigidity and flexibility of the macromolecule is critical for favorable accessibility and single occupancy. The optimized method provides a means for full exploitation of these massively parallelized analytical tools.

  20. Mechanisms of small molecule–DNA interactions probed by single-molecule force spectroscopy

    PubMed Central

    Almaqwashi, Ali A.; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C.

    2016-01-01

    There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA–ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806

  1. Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

    NASA Astrophysics Data System (ADS)

    Zhang, Yuning; Reisner, Walter

    2013-03-01

    Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

  2. Single molecule detection: Applications to sizing of DNA fragments

    SciTech Connect

    Petty, J.T.; Johnson, M.E.; Affleck, R.L.

    1994-12-31

    Using, ultrasensitive fluorescence detection and flow cytometry, size determination of ds-DNA fragments is performed using the fluorescence intensity from samples stained with a thiazole orange homodimer TOTO-1. The stained fragments pass through a low-power (30 mW) continuous-wave laser beam. Using transit times of 1-5 ms, data were acquired in times ranging from 1 to 15 mins at a rate of 40 fragments/second. As little as 50 fg of DNA was needed for the analysis. The authors have demonstrated sizing of DNA fragments in the size range from 1.5 to 150 kbp. Future applications of this approach to DNA sizing require that the factors contributing to size resolution be understood, and the authors present simulations to address this issue. To aid in the modeling, the authors have measured the saturation intensity and the relative fluorescence quantum yield of the TOTO-1/DNA complex. Applications to physical mapping of the human genome are being investigated.

  3. Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

    PubMed

    Izanloo, Cobra

    2017-09-26

    An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

  4. CHEMICAL SYNTHESIS OF GLYCOSYLPHOSPHATIDYLINOSITOL ANCHORS

    PubMed Central

    Swarts, Benjamin M.; Guo, Zhongwu

    2013-01-01

    Many eukaryotic cell-surface proteins and glycoproteins are anchored to the plasma membrane by glycosylphosphatidylinositols (GPIs), a family of glycolipids that are post-translationally attached to proteins at their C-termini. GPIs and GPI-anchored proteins play important roles in many biological and pathological events, such as cell recognition and adhesion, signal transduction, host defense, and acting as receptors for viruses and toxins. Chemical synthesis of structurally defined GPI anchors and GPI derivatives is a necessary step toward understanding the properties and functions of these molecules in biological systems and exploring their potential therapeutic applications. In the first part of this comprehensive article on the chemical synthesis of GPIs, classic syntheses of naturally occurring GPI anchors from protozoan parasites, yeast, and mammals are covered. The second part of the article focuses on recent diversity-oriented strategies for the synthesis of GPI anchors containing unsaturated lipids, “click chemistry” tags, and highly branched and modified structures. PMID:22794184

  5. Electronic density of states in sequence dependent DNA molecules

    NASA Astrophysics Data System (ADS)

    de Oliveira, B. P. W.; Albuquerque, E. L.; Vasconcelos, M. S.

    2006-09-01

    We report in this work a numerical study of the electronic density of states (DOS) in π-stacked arrays of DNA single-strand segments made up from the nucleotides guanine G, adenine A, cytosine C and thymine T, forming a Rudin-Shapiro (RS) as well as a Fibonacci (FB) polyGC quasiperiodic sequences. Both structures are constructed starting from a G nucleotide as seed and following their respective inflation rules. Our theoretical method uses Dyson's equation together with a transfer-matrix treatment, within an electronic tight-binding Hamiltonian model, suitable to describe the DNA segments modelled by the quasiperiodic chains. We compared the DOS spectra found for the quasiperiodic structure to those using a sequence of natural DNA, as part of the human chromosome Ch22, with a remarkable concordance, as far as the RS structure is concerned. The electronic spectrum shows several peaks, corresponding to localized states, as well as a striking self-similar aspect.

  6. Electrical characteristics and doping mechanism of DNA molecules doped with iodine solutions.

    PubMed

    Kim, Nam-Hoon; Lee, Woo Cheol; Roh, Yonghan

    2010-05-01

    This study examined the electrical characteristics of deoxyribonucleic acid (DNA) molecules doped with iodine solution and their chemical state changes before and after doping. The experiments were progressed in each lambda (A), poly(dA)-poly(dT) and poly(dG)-poly(dC) DNA under the same conditions. The authors prepared 20 nm gap Au/Ti electrodes fabricated by e-beam lithography. DNA solutions were dropped on the nano gap of the electrodes and DNA films were formed by drying in a vacuum. DNA films were doped with an iodine solution dissolved in methanol. The authors measured the electrical conductivity of DNA molecules as the number of iodine doping times in 10(-2) torr vacuum. As increase of the iodine solution doping number, the electrical conductivity of three sorts of DNA molecules was remarkably improved respectively. X-ray photoelectron spectroscopy (XPS) was performed to inspect the electrical conduction mechanism that holes on DNA nitrogen region were generated by transferring electrons to iodine molecules.

  7. Monitoring patterned enzymatic polymerization on DNA origami at single-molecule level

    NASA Astrophysics Data System (ADS)

    Okholm, A. H.; Aslan, H.; Besenbacher, F.; Dong, M.; Kjems, J.

    2015-06-01

    DNA origami has been used to orchestrate reactions with nano-precision using a variety of biomolecules. Here, the dynamics of albumin-assisted, localized single-molecule DNA polymerization by terminal deoxynucleotidyl transferase on a 2D DNA origami are monitored using AFM in liquid. Direct visualization of the surface activity revealed the mechanics of growth.DNA origami has been used to orchestrate reactions with nano-precision using a variety of biomolecules. Here, the dynamics of albumin-assisted, localized single-molecule DNA polymerization by terminal deoxynucleotidyl transferase on a 2D DNA origami are monitored using AFM in liquid. Direct visualization of the surface activity revealed the mechanics of growth. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr01945a

  8. Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

    PubMed Central

    Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

    2011-01-01

    DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

  9. A 3D-DNA Molecule Made of PlayMais

    ERIC Educational Resources Information Center

    Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

    2015-01-01

    More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

  10. A 3D-DNA Molecule Made of PlayMais

    ERIC Educational Resources Information Center

    Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

    2015-01-01

    More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

  11. Dissolving Hydroxyolite: A DNA Molecule into Its Hydroxyapatite Mold.

    PubMed

    Bertran, Oscar; Revilla-López, Guillermo; Casanovas, Jordi; Del Valle, Luis J; Turon, Pau; Puiggalí, Jordi; Alemán, Carlos

    2016-05-04

    In spite of the clinical importance of hydroxyapatite (HAp), the mechanism that controls its dissolution in acidic environments remains unclear. Knowledge of such a process is highly desirable to provide better understanding of different pathologies, as for example osteoporosis, and of the HAp potential as vehicle for gene delivery to replace damaged DNA. In this work, the mechanism of dissolution in acid conditions of HAp nanoparticles encapsulating double-stranded DNA has been investigated at the atomistic level using computer simulations. For this purpose, four consecutive (multi-step) molecular dynamics simulations, involving different temperatures and proton transfer processes, have been carried out. Results are consistent with a polynuclear decalcification mechanism in which proton transfer processes, from the surface to the internal regions of the particle, play a crucial role. In addition, the DNA remains protected by the mineral mold and transferred proton from both temperature and chemicals. These results, which indicate that biomineralization imparts very effective protection to DNA, also have important implications in other biomedical fields, as for example in the design of artificial bones or in the fight against osteoporosis by promoting the fixation of Ca(2+) ions.

  12. A proteomic characterization of factors enriched at nascent DNA molecules.

    PubMed

    Lopez-Contreras, Andres J; Ruppen, Isabel; Nieto-Soler, Maria; Murga, Matilde; Rodriguez-Acebes, Sara; Remeseiro, Silvia; Rodrigo-Perez, Sara; Rojas, Ana M; Mendez, Juan; Muñoz, Javier; Fernandez-Capetillo, Oscar

    2013-04-25

    DNA replication is facilitated by multiple factors that concentrate in the vicinity of replication forks. Here, we developed an approach that combines the isolation of proteins on nascent DNA chains with mass spectrometry (iPOND-MS), allowing a comprehensive proteomic characterization of the human replisome and replisome-associated factors. In addition to known replisome components, we provide a broad list of proteins that reside in the vicinity of the replisome, some of which were not previously associated with replication. For instance, our data support a link between DNA replication and the Williams-Beuren syndrome and identify ZNF24 as a replication factor. In addition, we reveal that SUMOylation is widespread for factors that concentrate near replisomes, which contrasts with lower UQylation levels at these sites. This resource provides a panoramic view of the proteins that concentrate in the surroundings of the replisome, which should facilitate future investigations on DNA replication and genome maintenance. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Comparison of the binding of the therapeutically active nucleosides to DNA molecules with different level of lesions

    NASA Astrophysics Data System (ADS)

    Kruglova, E. B.; Gladkovskaya, N. A.

    2002-12-01

    Recently we have shown that DNA molecules extracted from epididymis of the Wistar male rats exposed to low doses of gamma radiation interact with some pyrimidine nucleosides. The bindign affinities of NUC to control DNA molecules are unessential. Comparing the UV melting curves for the various DNA sammples we show that observed differences are related to conformational chagnes in the DNA double helix. The samples of the damaged DNA have been obtained by partial denaturation of the calf thymus DNA in the salt-free aqueous solutions. The level of DNA damages in the model DNA smplase depends on the DNA concentration. It was shown that damages in the DNA molecules lead to changes of the melting curves of DNA-NUC mixtures that are similar to those for the DNA samples extracted from irradiated tissues. ALso it has been found that the binding mechanisms to cytosine arabinoside and 6-azacytosine to DNA molecuels having modifeid secondary structures are different.

  14. Understanding the physics of DNA using nanoscale single-molecule manipulation

    PubMed Central

    Frey, Eric W.; Gooding, Ashton A.; Wijeratne, Sitara; Kiang, Ching-Hwa

    2013-01-01

    Processes for decoding the genetic information in cells, including transcription, replication, recombination and repair, involve the deformation of DNA from its equilibrium structures such as bending, stretching, twisting, and unzipping of the double helix. Single-molecule manipulation techniques have made it possible to control DNA conformation and simultaneously detect the induced changes, revealing a rich variety of mechanically-induced conformational changes and thermodynamic states. These single-molecule techniques helped us to reveal the physics of DNA and the processes involved in the passing on of the genetic code. PMID:23467419

  15. Single-molecule DNA hybridization on nanoporous gold nanoparticle array chip

    NASA Astrophysics Data System (ADS)

    Li, Jingting; Zhao, Fusheng; Shih, Wei-Chuan

    2017-02-01

    DNA hybridization, where two single-stranded DNA molecules form duplex through sequence-specific interactions, is a fundamental biological process. To gain better understanding, sequence-specific detection of hybridization at the singlemolecule level has been instrumental and can find a wide variety of applications. Nanoporous gold nanoparticle (NPGNP) array chip features large specific surface area and high-density plasmonic field enhancement known as "hot-spots" that are attractive in nanoplasmonic sensor development. In this paper, we discuss results on detecting single-molecule DNA hybridization on functionalizing NPG-NP array chip with unique bio-recognition elements towards both high sensitivity and specificity.

  16. Electric field influence on electronic transport in a periodic DNA molecules

    NASA Astrophysics Data System (ADS)

    Rahmani, F.; Yudiarsah, E.

    2017-07-01

    There are many factors that change the structure of DNA, and at the end, will affect electronic transport in DNA molecules. From the previous study, we know that electrical current will increase for the higher electric field. The study is focused particularly on electric field influence for charge transport properties of poly(dG)-poly(dC) DNA molecules that are presented in terms of transmission probabilities of electron flow. We calculate transmission probabilities using transfer matrix and scattering matrix method with varying voltages and twisting motion frequencies. The result shows that the extended states shift to lower energy and the extended state band widen as voltage increasing.

  17. Understanding the physics of DNA using nanoscale single-molecule manipulation.

    PubMed

    Frey, Eric W; Gooding, Ashton A; Wijeratne, Sitara; Kiang, Ching-Hwa

    2012-10-01

    Processes for decoding the genetic information in cells, including transcription, replication, recombination and repair, involve the deformation of DNA from its equilibrium structures such as bending, stretching, twisting, and unzipping of the double helix. Single-molecule manipulation techniques have made it possible to control DNA conformation and simultaneously detect the induced changes, revealing a rich variety of mechanically-induced conformational changes and thermodynamic states. These single-molecule techniques helped us to reveal the physics of DNA and the processes involved in the passing on of the genetic code.

  18. Investigation of thermal denaturation of DNA molecules based on langevin equation approach

    NASA Astrophysics Data System (ADS)

    Hui-jie, Yang; Yi-zhong, Zhuo; Xi-zhen, Wu

    1994-07-01

    In this paper, by using non-equilibrium transport theory, the thermal denaturation of DNA molecules is investigated as a preliminary step to clarify the dynamical process of DNA transcription. The distribution functions of the displacement of base pairs at different temperatures are calculated. A modified model is also proposed which can reproduce the essential features of the denaturation process. Calculations show that Langevin equation is an effective tool for describing the dynamical process of DNA molecules and it seems to be more advantageous over the Nosé method.

  19. Molecular Dynamics Simulation of Multivalent-Ion Mediated Attraction between DNA Molecules

    NASA Astrophysics Data System (ADS)

    Dai, Liang; Mu, Yuguang; Nordenskiöld, Lars; van der Maarel, Johan R. C.

    2008-03-01

    All atom molecular dynamics simulations with explicit water were done to study the interaction between two parallel double-stranded DNA molecules in the presence of the multivalent counterions putrescine (2+), spermidine (3+), spermine (4+) and cobalt hexamine (3+). The inter-DNA interaction potential is obtained with the umbrella sampling technique. The attractive force is rationalized in terms of the formation of ion bridges, i.e., multivalent ions which are simultaneously bound to the two opposing DNA molecules. The lifetime of the ion bridges is short on the order of a few nanoseconds.

  20. Understanding the physics of DNA using nanoscale single-molecule manipulation

    NASA Astrophysics Data System (ADS)

    Frey, Eric W.; Gooding, Ashton A.; Wijeratne, Sitara; Kiang, Ching-Hwa

    2012-10-01

    Processes for decoding the genetic information in cells, including transcription, replication, recombination and repair, involve the deformation of DNA from its equilibrium structures such as bending, stretching, twisting, and unzipping of the double helix. Single-molecule manipulation techniques have made it possible to control DNA conformation and simultaneously detect the induced changes, revealing a rich variety of mechanically-induced conformational changes and thermodynamic states. These single-molecule techniques helped us to reveal the physics of DNA and the processes involved in the passing on of the genetic code.

  1. Single molecule fluorescence burst detection of DNA fragments separated by capillary electrophoresis

    SciTech Connect

    Haab, B.B.; Mathies, R.A.

    1995-09-15

    A method has been developed for detecting DNA separated by capillary gel electrophoresis (CGE) using single molecule photon burst counting. A confocal fluorescence microscope was used to observe the fluorescence bursts from single molecules of DNA multiply labeled with the thiazole orange derivative TO6 as they passed through the nearly 2-{mu}m diameter focused laser beam. Amplified photo-electron pulses from the photomultiplier are grouped into bins of 360-450 {mu}s in duration, and the resulting histogram is stored in a computer for analysis. Solutions of M13 DNA were first flowed through the capillary at various concentrations, and the resulting data were used to optimize the parameters for digital filtering using a low-pass Fourier filter, selecting a discriminator level for peak detection, and applying a peak-calling algorithm. The optimized single molecule counting method was then applied to an electrophoretic separation of M13 DNA and to a separation of pBR 322 DNA from pRL 277 DNA. Clusters of discreet fluorescence bursts were observed at the expected appearance time of each DNA band. The auto-correlation function of these data indicated transit times that were consistent with the observed electrophoretic velocity. These separations were easily detected when only 50-100 molecules of DNA per band traveled through the detection region. This new detection technology should lead to the routine analysis of DNA in capillary columns with an on-column sensitivity of nearly 100 DNA molecules/band or better. 45 refs., 10 figs.

  2. Single-molecule DNA dynamics in tapered contraction-expansion microchannels under electrophoresis.

    PubMed

    Hu, Xin; Wang, Shengnian; Lee, L James

    2009-04-01

    We investigated the dynamics of single DNA molecules driven by the electrophoretic force in several tapered contraction-expansion microchannels. Under high localized electric-field gradients, fast transition between the stretching and compression of DNA molecules was achieved. Numerically, a combination of the finite element method and the coarse-grained Brownian dynamics simulation was used to capture the dynamics of single DNA molecules simplified as freely-draining bead-spring wormlike chains. A generalized predictor-corrector time marching scheme was proposed in this work. It was found that the initial conformation, the initial center-of-mass location, and the electric-field strength are three major factors affecting the DNA dynamics. The forced relaxation due to the reverse compression in the expansion zone can speed the relaxation of DNA molecules compared with the free relaxation in the bulk. We have also simulated DNA dynamics in different contraction-expansion microchannels by changing the length or the small-end width of the contraction zone (with other geometrical lengths fixed). Decreasing the small-end width can provide higher DNA stretching due to both increased Deborah number and increased accumulated strain. Increasing the length of the contraction zone, on the other hand, only slightly increases the accumulated strain, while greatly decreases the Deborah number, causing a decrease in DNA stretching. Experimentally, DNA molecules were gradually stretched in the contraction zone and then were quickly compressed back within a short distance outside the contraction zone. DNA chains in different initial configurations demonstrate different behaviors in contraction-expansion microchannels. The Brownian dynamics simulation results are in qualitative agreement with the experimental observations.

  3. Molecular characterization of a new begomovirus infecting Sida cordifolia and its associated satellite DNA molecules.

    PubMed

    Guo, Xiaojian; Zhou, Xueping

    2006-12-01

    Two virus isolates Hn57 and Hn60 were obtained from Sida cordifolia showing mild upward leaf-curling symptoms in Hainan province of China. Comparison of partial sequences of DNA-A like molecule confirmed the existence of a single type of begomovirus. The complete nucleotide sequence of DNA-A of Hn57 was determined to be 2757 nucleotides, with a genomic organization typical of begomoviruses. Complete sequence comparison with other reported begomoviruses revealed that Hn57 DNA-A has the highest sequence identity (71.0%) with that of Tobacco leaf curl Yunnan virus. Consequently, Hn57 was considered to be a new begomovirus species, for which the name Sida leaf curl virus (SiLCV) is proposed. In addition to DNA-A molecule, two additional circular single-stranded satellite DNA molecules corresponding to DNAbeta and DNA1 were found to be associated with SiLCV isolates. Both DNAbeta and DNA1 were approximately half the size of their cognate genomic DNA. Sequence analysis shows that DNAbeta of Hn57 and Hn60 share 93.8% nucleotide sequence identity, and they have the highest sequence identity (58.5%) with DNAbeta associated with Ageratum leaf curl disease (AJ316027). The nucleotide sequence identity between DNA1 of Hn57 and that of Hn60 was 83.8%, they share 58.2-79.3% nucleotide sequence identities in comparison with other previously reported DNAl.

  4. Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

    NASA Astrophysics Data System (ADS)

    Zhang, Yuning; Reisner, Walter

    2012-02-01

    Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with nanpore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a nanopore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We will discuss our recent progress on device fabrication and characterization. In particular, we demonstrate that we can detect - using fluorescent microscopy - successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the embedded pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule.

  5. The potential of combi-molecules with DNA-damaging function as anticancer agents.

    PubMed

    Sun, Guohui; Fan, Tengjiao; Zhao, Lijiao; Zhou, Yue; Zhong, Rugang

    2017-03-01

    DNA-damaging agents, such as methylating agents, chloroethylating agents and platinum-based agents, have been extensively used as anticancer drugs. However, the side effects, high toxicity, lack of selectivity and resistance severely limit their clinical applications. In recent years, a strategy combining a DNA-damaging agent with a bioactive molecule (e.g., enzyme inhibitors) or carrier (e.g., steroid hormone and DNA intercalators) to produce a new 'combi-molecule' with improved efficacy or selectivity has been attempted to overcome these drawbacks. The combi-molecule simultaneously acts on two targets and is expected to possess better potency than the parent compounds. Many studies have shown DNA-damaging combi-molecules exhibiting excellent anticancer activity in vitro and in vivo. This review focuses on the development of combi-molecules, which possess increased DNA-damaging potency, anticancer efficacy and tumor selectivity and reduced side reactions than the parent compounds. The future opportunities and challenges in the discovery of combi-molecules were also discussed.

  6. Selection and identification of malaria vaccine target molecule using bioinformatics and DNA vaccination.

    PubMed

    Shuaibu, M N; Kikuchi, M; Cherif, M S; Helegbe, G K; Yanagi, T; Hirayama, K

    2010-10-04

    Following a genome-wide search for a blood stage malaria DNA-based vaccine using web-based bioinformatic tools, 29 genes from the annotated Plasmodium yoelii genome sequence (www.PlasmoDB.org and www.tigr.org) were identified as encoding GPI-anchored proteins. Target genes were those with orthologues in P. falciparum, containing an N-terminal signal sequence containing hydrophobic amino acid stretch and signal P criteria, a transmembrane-like domain and GPI anchor motif. Focusing on the blood stage, we extracted mRNA from pRBCs, PCR-amplified 22 out of the 29 selected genes, and eventually cloned nine of these into a DNA vaccine plasmid, pVAX 200-DEST. Biojector-mediated delivery of the nine DNA vaccines was conducted using ShimaJET to C57BL/6 mice at a dose of 4 μg/mouse three times at an interval of 3 weeks. Two weeks after the second booster, immunized mice were challenged with P. y. yoelii 17XL-parasitized RBCs and the level of parasitaemia, protection and survival was assessed. Immunization with one gene (PY03470) resulted in 2-4 days of delayed onset and level of parasitaemia and was associated with increased survival compared to non-immunized mice. Antibody production was, however, low following DNA vaccination, as determined by immunofluorescence assay. Recombinant protein from this gene, GPI8p transamidase-related protein (rPyTAM) in PBS or emulsified with GERBU adjuvant was also used to immunize another set of C57BL/6 mice with 10-20 μg/mouse three times at 3-week interval. Higher antibody response was obtained as determined by ELISA with similar protective effects as observed after DNA vaccination.

  7. Nanoelectrode-Gated Detection of Individual Molecules with Potential for Rapid DNA Sequencing

    SciTech Connect

    Lee, James Weifu

    2007-01-01

    A systematic nanoelectrode-gated electron-tunneling molecular-detection concept with potential for rapid DNA sequencing has recently been invented at Oak Ridge National Laboratory (ORNL). A DNA molecule is a polymer that typically contains four different types of nucleotide bases: adenine (A), thymine (T), guanine (G), and cytosine (C) on its phosphate-deoxyribose chain. According to the nanoelectrode-gated molecular-detection concept, it should be possible to obtain genetic sequence information by probing through a DNA molecule base by base at a nanometer scale, as if looking at a strip of movie film. The nanoscale reading of DNA sequences is envisioned to take place at a nanogap (gate) defined by a pair of nanoelectrode tips as a DNA molecule moves through the gate base by base. The rationale is that sample molecules, such as the four different nucleotide bases, each with a distinct chemical composition and structure, should produce a specific perturbation effect on the tunneling electron beam across the two nanoelectrode tips. A sample molecule could thus be detected when it enters the gate. This nanoscience-based approach could lead to a new DNA sequencing technology that could be thousands of times faster than the current technology (Sanger's 'dideoxy' protocol-based capillary electrophoresis systems). Both computational and experimental studies are underway at ORNL towards demonstrating this nanotechnology concept.

  8. Single-molecule studies reveal reciprocating of WRN helicase core along ssDNA during DNA unwinding

    PubMed Central

    Wu, Wen-Qiang; Hou, Xi-Miao; Zhang, Bo; Fossé, Philippe; René, Brigitte; Mauffret, Olivier; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2017-01-01

    Werner syndrome is caused by mutations in the WRN gene encoding WRN helicase. A knowledge of WRN helicase’s DNA unwinding mechanism in vitro is helpful for predicting its behaviors in vivo, and then understanding their biological functions. In the present study, for deeply understanding the DNA unwinding mechanism of WRN, we comprehensively characterized the DNA unwinding properties of chicken WRN helicase core in details, by taking advantages of single-molecule fluorescence resonance energy transfer (smFRET) method. We showed that WRN exhibits repetitive DNA unwinding and translocation behaviors on different DNA structures, including forked, overhanging and G-quadruplex-containing DNAs with an apparently limited unwinding processivity. It was further revealed that the repetitive behaviors were caused by reciprocating of WRN along the same ssDNA, rather than by complete dissociation from and rebinding to substrates or by strand switching. The present study sheds new light on the mechanism for WRN functioning. PMID:28266653

  9. Single-molecule studies reveal reciprocating of WRN helicase core along ssDNA during DNA unwinding.

    PubMed

    Wu, Wen-Qiang; Hou, Xi-Miao; Zhang, Bo; Fossé, Philippe; René, Brigitte; Mauffret, Olivier; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2017-03-07

    Werner syndrome is caused by mutations in the WRN gene encoding WRN helicase. A knowledge of WRN helicase's DNA unwinding mechanism in vitro is helpful for predicting its behaviors in vivo, and then understanding their biological functions. In the present study, for deeply understanding the DNA unwinding mechanism of WRN, we comprehensively characterized the DNA unwinding properties of chicken WRN helicase core in details, by taking advantages of single-molecule fluorescence resonance energy transfer (smFRET) method. We showed that WRN exhibits repetitive DNA unwinding and translocation behaviors on different DNA structures, including forked, overhanging and G-quadruplex-containing DNAs with an apparently limited unwinding processivity. It was further revealed that the repetitive behaviors were caused by reciprocating of WRN along the same ssDNA, rather than by complete dissociation from and rebinding to substrates or by strand switching. The present study sheds new light on the mechanism for WRN functioning.

  10. Nanomechanical recognition measurements of individual DNA molecules reveal epigenetic methylation patterns

    NASA Astrophysics Data System (ADS)

    Zhu, Rong; Howorka, Stefan; Pröll, Johannes; Kienberger, Ferry; Preiner, Johannes; Hesse, Jan; Ebner, Andreas; Pastushenko, Vassili Ph.; Gruber, Hermann J.; Hinterdorfer, Peter

    2010-11-01

    Atomic force microscopy (AFM) is a powerful tool for analysing the shapes of individual molecules and the forces acting on them. AFM-based force spectroscopy provides insights into the structural and energetic dynamics of biomolecules by probing the interactions within individual molecules, or between a surface-bound molecule and a cantilever that carries a complementary binding partner. Here, we show that an AFM cantilever with an antibody tether can measure the distances between 5-methylcytidine bases in individual DNA strands with a resolution of 4 Å, thereby revealing the DNA methylation pattern, which has an important role in the epigenetic control of gene expression. The antibody is able to bind two 5-methylcytidine bases of a surface-immobilized DNA strand, and retracting the cantilever results in a unique rupture signature reflecting the spacing between two tagged bases. This nanomechanical approach might also allow related chemical patterns to be retrieved from biopolymers at the single-molecule level.

  11. A simple DNA handle attachment method for single molecule mechanical manipulation experiments.

    PubMed

    Min, Duyoung; Arbing, Mark A; Jefferson, Robert E; Bowie, James U

    2016-08-01

    Manipulating single molecules and systems of molecules with mechanical force is a powerful technique to examine their physical properties. Applying force requires attachment of the target molecule to larger objects using some sort of molecular tether, such as a strand of DNA. DNA handle attachment often requires difficult manipulations of the target molecule, which can preclude attachment to unstable, hard to obtain, and/or large, complex targets. Here we describe a method for covalent DNA handle attachment to proteins that simply requires the addition of a preprepared reagent to the protein and a short incubation. The handle attachment method developed here provides a facile approach for studying the biomechanics of biological systems. © 2016 The Protein Society.

  12. The diagonal hopping dependent I-V characteristics of periodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Yudiarsah, E.

    2017-07-01

    The diagonal hopping dependent I-V characteristic of a periodic DNA molecule has been studied. Exponentially twisting angle dependent hopping constant is used in the calculation. The diagonal hopping constant is modeled using semi-empirical Slater-Koster theory. A 32 base pairs doubled-stranded Poly(dG)-poly(dC) DNA molecule model sandwiched in between two metallic electrodes is used in the calculation of I-V characteristic using Landauer-Buttiker formalism by assuming symmetric voltage drop at the contacts. The I-V characteristics is calculated from the transmission probability of charge on the molecule calculated using transfer and scattering matrix methods, simultaneously. The results show that generally, as the vibration and diagonal hopping coupling constant increases, the current magnitude increases. However, at low voltage the increment of current is minute. These trends are observed in the I-V characteristic of DNA molecule for all frequencies and temperatures used.

  13. DNA compaction by the bacteriophage protein Cox studied on the single DNA molecule level using nanofluidic channels.

    PubMed

    Frykholm, Karolin; Berntsson, Ronnie Per-Arne; Claesson, Magnus; de Battice, Laura; Odegrip, Richard; Stenmark, Pål; Westerlund, Fredrik

    2016-09-06

    The Cox protein from bacteriophage P2 forms oligomeric filaments and it has been proposed that DNA can be wound up around these filaments, similar to how histones condense DNA. We here use fluorescence microscopy to study single DNA-Cox complexes in nanofluidic channels and compare how the Cox homologs from phages P2 and WΦ affect DNA. By measuring the extension of nanoconfined DNA in absence and presence of Cox we show that the protein compacts DNA and that the binding is highly cooperative, in agreement with the model of a Cox filament around which DNA is wrapped. Furthermore, comparing microscopy images for the wild-type P2 Cox protein and two mutants allows us to discriminate between compaction due to filament formation and compaction by monomeric Cox. P2 and WΦ Cox have similar effects on the physical properties of DNA and the subtle, but significant, differences in DNA binding are due to differences in binding affinity rather than binding mode. The presented work highlights the use of single DNA molecule studies to confirm structural predictions from X-ray crystallography. It also shows how a small protein by oligomerization can have great impact on the organization of DNA and thereby fulfill multiple regulatory functions.

  14. The monomeric GIY-YIG homing endonuclease I-BmoI uses a molecular anchor and a flexible tether to sequentially nick DNA.

    PubMed

    Kleinstiver, Benjamin P; Wolfs, Jason M; Edgell, David R

    2013-05-01

    The GIY-YIG nuclease domain is found within protein scaffolds that participate in diverse cellular pathways and contains a single active site that hydrolyzes DNA by a one-metal ion mechanism. GIY-YIG homing endonucleases (GIY-HEs) are two-domain proteins with N-terminal GIY-YIG nuclease domains connected to C-terminal DNA-binding and they are thought to function as monomers. Using I-BmoI as a model GIY-HE, we test mechanisms by which the single active site is used to generate a double-strand break. We show that I-BmoI is partially disordered in the absence of substrate, and that the GIY-YIG domain alone has weak affinity for DNA. Significantly, we show that I-BmoI functions as a monomer at all steps of the reaction pathway and does not transiently dimerize or use sequential transesterification reactions to cleave substrate. Our results are consistent with the I-BmoI DNA-binding domain acting as a molecular anchor to tether the GIY-YIG domain to substrate, permitting rotation of the GIY-YIG domain to sequentially nick each DNA strand. These data highlight the mechanistic differences between monomeric GIY-HEs and dimeric or tetrameric GIY-YIG restriction enzymes, and they have implications for the use of the GIY-YIG domain in genome-editing applications.

  15. Assembly of recombinant nucleosomes on nanofabricated DNA curtains for single-molecule imaging.

    PubMed

    Lee, Ja Yil; Greene, Eric C

    2011-01-01

    Eukaryotic chromosomes are highly packed into chromatin, the basic unit of which is the nucleosome. The presence of nucleosomes and the resulting organization of the genome into higher-order chromatin structures has profound consequences for virtually all aspects of DNA metabolism, including DNA transcription, repair, and chromosome segregation. We have developed novel approaches for nanofabricating "DNA curtains" for high-throughput single-molecule imaging, and we have begun adapting these new research tools in an effort to begin studying chromatin biology at the single-molecule level. In this protocol, we describe procedures for assembly and real-time single-molecule visualization of DNA curtains bound by reconstituted nucleosomes made from recombinant histones.

  16. Trapping of a single DNA molecule using nanoplasmonic structures for biosensor applications

    PubMed Central

    Kim, Jung-Dae; Lee, Yong-Gu

    2014-01-01

    Conventional optical trapping using a tightly focused beam is not suitable for trapping particles that are smaller than the diffraction limit because of the increasing need of the incident laser power that could produce permanent thermal damages. One of the current solutions to this problem is to intensify the local field enhancement by using nanoplasmonic structures without increasing the laser power. Nanoplasmonic tweezers have been used for various small molecules but there is no known report of trapping a single DNA molecule. In this paper, we present the trapping of a single DNA molecule using a nanohole created on a gold substrate. Furthermore, we show that the DNA of different lengths can be differentiated through the measurement of scattering signals leading to possible new DNA sensor applications. PMID:25136478

  17. RNase-dependent discontinuities associated with the crossovers of spontaneously formed joint DNA molecules in Physarum polycephalum.

    PubMed

    Maric, Chrystelle; Bénard, Marianne; Pierron, Gérard

    2010-12-01

    Transient four stranded joint DNA molecules bridging sister chromatids constitute an intriguing feature of replicating genomes. Here, we studied their structure and frequency of formation in Physarum polycephalum. By "3D gels", we evidenced that they are not made of four continuous DNA strands. Discontinuities, which do not interfere with the unique propensity of the joint DNA molecules to branch migrate in vitro, are linked to the crossover, enhanced by RNaseA, and affect at most half of the DNA strands. We propose a structural model of joint DNA molecules containing ribonucleotides inserted within one strand, a gapped strand, and two continuous DNA strands. We further show that spontaneous joint DNA molecules are short-lived and are as abundant as replication forks. Our results emphasize the highly frequent formation of joint DNA molecules involving newly replicated DNA in an untreated cell and uncover a transitory mechanism connecting the sister chromatids during S phase.

  18. Boron nitride nanopores: highly sensitive DNA single-molecule detectors.

    PubMed

    Liu, Song; Lu, Bo; Zhao, Qing; Li, Ji; Gao, Teng; Chen, Yubin; Zhang, Yanfeng; Liu, Zhongfan; Fan, Zhongchao; Yang, Fuhua; You, Liping; Yu, Dapeng

    2013-09-06

    The first electronic measurement of DNA translocation through ultrathin BN nanopores is demonstrated. BN nanopores show much higher detection sensitivity compared with SiN nanopores. BN has a spatial resolution as graphene. The ultrathin BN nanopores provide substantial opportunities in realizing high-spatial-sensitivity nanopore electrical devices for various applications. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Replacing the Nucleobases in DNA with Designer Molecules

    DTIC Science & Technology

    2007-11-02

    electrophiles or especially strong nucleophiles, and they generally do not change protonation near neutral pH. They offer (to the first approximation) only four...DNA bases can impart important biological activity, such as replacing the methyl group of thymine with fluorine , or the oxygen of guanine with sulfur...nucleobases that lack hydrogen- bonding functionality. The design involves replacing oxygen with fluorine and nitrogen with carbon, and keeping aromaticity

  20. DNA molecule provides a computing machine with both data and fuel

    NASA Astrophysics Data System (ADS)

    Benenson, Yaakov; Adar, Rivka; Paz-Elizur, Tamar; Livneh, Zvi; Shapiro, Ehud

    2003-03-01

    The unique properties of DNA make it a fundamental building block in the fields of supramolecular chemistry, nanotechnology, nano-circuits, molecular switches, molecular devices, and molecular computing. In our recently introduced autonomous molecular automaton, DNA molecules serve as input, output, and software, and the hardware consists of DNA restriction and ligation enzymes using ATP as fuel. In addition to information, DNA stores energy, available on hybridization of complementary strands or hydrolysis of its phosphodiester backbone. Here we show that a single DNA molecule can provide both the input data and all of the necessary fuel for a molecular automaton. Each computational step of the automaton consists of a reversible software molecule/input molecule hybridization followed by an irreversible software-directed cleavage of the input molecule, which drives the computation forward by increasing entropy and releasing heat. The cleavage uses a hitherto unknown capability of the restriction enzyme FokI, which serves as the hardware, to operate on a noncovalent software/input hybrid. In the previous automaton, software/input ligation consumed one software molecule and two ATP molecules per step. As ligation is not performed in this automaton, a fixed amount of software and hardware molecules can, in principle, process any input molecule of any length without external energy supply. Our experiments demonstrate 3 × 1012 automata per μl performing 6.6 × 1010 transitions per second per μl with transition fidelity of 99.9%, dissipating about 5 × 10-9 W/μl as heat at ambient temperature.

  1. DNA molecule provides a computing machine with both data and fuel.

    PubMed

    Benenson, Yaakov; Adar, Rivka; Paz-Elizur, Tamar; Livneh, Zvi; Shapiro, Ehud

    2003-03-04

    The unique properties of DNA make it a fundamental building block in the fields of supramolecular chemistry, nanotechnology, nano-circuits, molecular switches, molecular devices, and molecular computing. In our recently introduced autonomous molecular automaton, DNA molecules serve as input, output, and software, and the hardware consists of DNA restriction and ligation enzymes using ATP as fuel. In addition to information, DNA stores energy, available on hybridization of complementary strands or hydrolysis of its phosphodiester backbone. Here we show that a single DNA molecule can provide both the input data and all of the necessary fuel for a molecular automaton. Each computational step of the automaton consists of a reversible software molecule input molecule hybridization followed by an irreversible software-directed cleavage of the input molecule, which drives the computation forward by increasing entropy and releasing heat. The cleavage uses a hitherto unknown capability of the restriction enzyme FokI, which serves as the hardware, to operate on a noncovalent software input hybrid. In the previous automaton, software input ligation consumed one software molecule and two ATP molecules per step. As ligation is not performed in this automaton, a fixed amount of software and hardware molecules can, in principle, process any input molecule of any length without external energy supply. Our experiments demonstrate 3 x 10(12) automata per microl performing 6.6 x 10(10) transitions per second per microl with transition fidelity of 99.9%, dissipating about 5 x 10(-9) W microl as heat at ambient temperature.

  2. Escape of a knot from a DNA molecule in flow

    NASA Astrophysics Data System (ADS)

    Renner, Benjamin; Doyle, Patrick

    2014-03-01

    Macroscale knots are an everyday occurrence when trying to unravel an unorganized flexible string (e.g. an iPhone cord taken out of your pocket). In nature, knots are found in proteins and viral capsid DNA, and the properties imbued by their topologies are thought to have biological significance. Unlike their macroscale counterparts, thermal fluctuations greatly influence the dynamics of polymer knots. Here, we use Brownian Dynamics simulations to study knot diffusion along a linear polymer chain. The model is parameterized to dsDNA, a model polymer used in previous simulation and experimental studies of knot dynamics. We have used this model to study the process of knot escape and transport along a dsDNA strand extended by an elongational flow. For a range of knot topologies and flow strengths, we show scalings that result in collapse of the data onto a master curve. We show a topologically mediated mode of transport coincides with observed differences in rates of knot transport, and we provide a simple mechanistic explanation for its effect. We anticipate these results will build on the growing body of fundamental studies of knotted polymers and inform future experimental study. This work is supported by the Singapore-MIT Alliance for Research and Technology (SMART) and National Science Foundation (NSF) grant CBET-0852235.

  3. Pulsed-Field Electrophoresis: Application of a Computer Model to the Separation of Large DNA Molecules

    NASA Astrophysics Data System (ADS)

    Lalande, Marc; Noolandi, Jaan; Turmel, Chantal; Rousseau, Jean; Slater, Gary W.

    1987-11-01

    The biased reptation theory has been applied to the pulsed-field electrophoresis of DNA in agarose gels. A computer simulation of the theoretical model that calculates the mobility of large DNA molecules as a function of agarose pore size, DNA chain properties, and electric field conditions has been used to generate mobility curves for DNA molecules in the size range of the larger yeast chromosomes. Pulsed-field electrophoresis experiments resulting in the establishment of an electrophoretic karyotype for yeast, where the mobility of the DNA fragments is a monotonic function of molecular size for the entire size range that is resolved (200-2200 kilobase pairs), has been compared to the theoretical mobility curves generated by the computer model. The various physical mechanisms and experimental conditions responsible for band inversion and improved electrophoretic separation are identified and discussed in the framework of the model.

  4. Condensations of single DNA molecules induced by heptaplatin and its chiral isomer

    SciTech Connect

    Zhang, Hong-Yan; Liu, Yu-Ru; Li, Wei; Li, Hui; Dou, Shuo-Xing; Xie, Ping; Wang, Wei-Chi; Wang, Peng-Ye

    2014-08-15

    Heptaplatin is a third-generation platinum antitumor drug. It has a chiral isomer. We studied the interactions between the two isomers and DNA by using magnetic tweezers and atomic force microscopy (AFM) to investigate the effect of chiralities of the isomers on the interactions. We found that the extension curves and average condensation rates of DNA molecules incubated with heptaplatin were nearly the same as those incubated with its chiral isomer. In addition, the structures of DNA molecules incubated with heptaplatin were also similar to those incubated with its chiral isomer. These results indicate the difference in chirality of the two isomers does not induce different interactions of the isomers with DNA. Our study may facilitate the understanding of interactions of platinum complexes with DNA and the design of new antitumor platinum complexes.

  5. Laser microbeam - kinetic studies combined with molecule - structures reveal mechanisms of DNA repair

    NASA Astrophysics Data System (ADS)

    Altenberg, B.; Greulich, K. O.

    2011-10-01

    Kinetic studies on double strand DNA damages induced by a laser microbeam have allowed a precise definition of the temporal order of recruitment of repair molecules. The order is KU70 / KU80 - XRCC4 --NBS1 -- RAD51. These kinetic studies are now complemented by studies on molecular structures of the repair proteins, using the program YASARA which does not only give molecular structures but also physicochemical details on forces involved in binding processes. It turns out that the earliest of these repair proteins, the KU70 / KU80 heterodimer, has a hole with high DNA affinity. The next molecule, XRCC4, has a body with two arms, the latter with extremely high DNA affinity at their ends and a binding site for Ligase 4. Together with the laser microbeam results this provides a detailed view on the early steps of DNA double strand break repair. The sequence of DNA repair events is presented as a movie.

  6. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  7. Condensations of single DNA molecules induced by heptaplatin and its chiral isomer

    NASA Astrophysics Data System (ADS)

    Zhang, Hong-Yan; Liu, Yu-Ru; Li, Wei; Li, Hui; Dou, Shuo-Xing; Xie, Ping; Wang, Wei-Chi; Wang, Peng-Ye

    2014-08-01

    Heptaplatin is a third-generation platinum antitumor drug. It has a chiral isomer. We studied the interactions between the two isomers and DNA by using magnetic tweezers and atomic force microscopy (AFM) to investigate the effect of chiralities of the isomers on the interactions. We found that the extension curves and average condensation rates of DNA molecules incubated with heptaplatin were nearly the same as those incubated with its chiral isomer. In addition, the structures of DNA molecules incubated with heptaplatin were also similar to those incubated with its chiral isomer. These results indicate the difference in chirality of the two isomers does not induce different interactions of the isomers with DNA. Our study may facilitate the understanding of interactions of platinum complexes with DNA and the design of new antitumor platinum complexes.

  8. The conductive properties of single DNA molecules studied by torsion tunneling atomic force microscopy.

    PubMed

    Wang, W; Niu, D X; Jiang, C R; Yang, X J

    2014-01-17

    The conductive properties of single natural λ-DNA molecules are studied by torsion tunneling atomic force microscopy (TR-TUNA). The currents both parallel to and perpendicular to the DNA chains are investigated, but only weak or even no current signals are detected by TR-TUNA. To improve the conductance of DNA molecules, silver and copper metallized DNAs are fabricated and their conductivities are checked by TR-TUNA. It is found that for both Cu- and Ag-DNAs, the conductivity perpendicular to the DNA chain is enhanced significantly as the metal clusters are attached to the DNA chains. But parallel to the chain the electrical transport is still weak, most probably due to the 'beads-on-a-string' constructions of metallized DNAs.

  9. The conductive properties of single DNA molecules studied by torsion tunneling atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Wang, W.; Niu, D. X.; Jiang, C. R.; Yang, X. J.

    2014-01-01

    The conductive properties of single natural λ-DNA molecules are studied by torsion tunneling atomic force microscopy (TR-TUNA). The currents both parallel to and perpendicular to the DNA chains are investigated, but only weak or even no current signals are detected by TR-TUNA. To improve the conductance of DNA molecules, silver and copper metallized DNAs are fabricated and their conductivities are checked by TR-TUNA. It is found that for both Cu- and Ag-DNAs, the conductivity perpendicular to the DNA chain is enhanced significantly as the metal clusters are attached to the DNA chains. But parallel to the chain the electrical transport is still weak, most probably due to the ‘beads-on-a-string’ constructions of metallized DNAs.

  10. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  11. Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules

    PubMed Central

    Li, Yueqi; Xiang, Limin; Palma, Julio L.; Asai, Yoshihiro; Tao, Nongjian

    2016-01-01

    Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models. PMID:27079152

  12. Guiding the design of synthetic DNA-binding molecules with massively parallel sequencing.

    PubMed

    Meier, Jordan L; Yu, Abigail S; Korf, Ian; Segal, David J; Dervan, Peter B

    2012-10-24

    Genomic applications of DNA-binding molecules require an unbiased knowledge of their high affinity sites. We report the high-throughput analysis of pyrrole-imidazole polyamide DNA-binding specificity in a 10(12)-member DNA sequence library using affinity purification coupled with massively parallel sequencing. We find that even within this broad context, the canonical pairing rules are remarkably predictive of polyamide DNA-binding specificity. However, this approach also allows identification of unanticipated high affinity DNA-binding sites in the reverse orientation for polyamides containing β/Im pairs. These insights allow the redesign of hairpin polyamides with different turn units capable of distinguishing 5'-WCGCGW-3' from 5'-WGCGCW-3'. Overall, this study displays the power of high-throughput methods to aid the optimal targeting of sequence-specific minor groove binding molecules, an essential underpinning for biological and nanotechnological applications.

  13. Efficient vaccine against pandemic influenza: combining DNA vaccination and targeted delivery to MHC class II molecules.

    PubMed

    Grødeland, Gunnveig; Bogen, Bjarne

    2015-06-01

    There are two major limitations to vaccine preparedness in the event of devastating influenza pandemics: the time needed to generate a vaccine and rapid generation of sufficient amounts. DNA vaccination could represent a solution to these problems, but efficacy needs to be enhanced. In a separate line of research, it has been established that targeting of vaccine molecules to antigen-presenting cells enhances immune responses. We have combined the two principles by constructing DNA vaccines that encode bivalent fusion proteins; these target hemagglutinin to MHC class II molecules on antigen-presenting cells. Such DNA vaccines rapidly induce hemagglutinin-specific antibodies and T cell responses in immunized mice. Responses are long-lasting and protect mice against challenge with influenza virus. In a pandemic situation, targeted DNA vaccines could be produced and tested within a month. The novel DNA vaccines could represent a solution to pandemic preparedness in the advent of novel influenza pandemics.

  14. Direct Sequencing from the Minimal Number of DNA Molecules Needed to Fill a 454 Picotiterplate

    PubMed Central

    Martínez-Priego, Llúcia; D’Auria, Giussepe; Calafell, Francesc; Moya, Andrés

    2014-01-01

    The large amount of DNA needed to prepare a library in next generation sequencing protocols hinders direct sequencing of small DNA samples. This limitation is usually overcome by the enrichment of such samples with whole genome amplification (WGA), mostly by multiple displacement amplification (MDA) based on φ29 polymerase. However, this technique can be biased by the GC content of the sample and is prone to the development of chimeras as well as contamination during enrichment, which contributes to undesired noise during sequence data analysis, and also hampers the proper functional and/or taxonomic assignments. An alternative to MDA is direct DNA sequencing (DS), which represents the theoretical gold standard in genome sequencing. In this work, we explore the possibility of sequencing the genome of Escherichia coli from the minimum number of DNA molecules required for pyrosequencing, according to the notion of one-bead-one-molecule. Using an optimized protocol for DS, we constructed a shotgun library containing the minimum number of DNA molecules needed to fill a selected region of a picotiterplate. We gathered most of the reference genome extension with uniform coverage. We compared the DS method with MDA applied to the same amount of starting DNA. As expected, MDA yielded a sparse and biased read distribution, with a very high amount of unassigned and unspecific DNA amplifications. The optimized DS protocol allows unbiased sequencing to be performed from samples with a very small amount of DNA. PMID:24887077

  15. Single-molecule analysis of DNA uncoiling by a type II topoisomerase

    NASA Astrophysics Data System (ADS)

    Strick, Terence R.; Croquette, Vincent; Bensimon, David

    2000-04-01

    Type II DNA topoisomerases are ubiquitous ATP-dependent enzymes capable of transporting a DNA through a transient double-strand break in a second DNA segment. This enables them to untangle DNA and relax the interwound supercoils (plectonemes) that arise in twisted DNA. In vivo, they are responsible for untangling replicated chromosomes and their absence at mitosis or meiosis ultimately causes cell death. Here we describe a micromanipulation experiment in which we follow in real time a single Drosophila melanogaster topoisomerase II acting on a linear DNA molecule which is mechanically stretched and supercoiled. By monitoring the DNA's extension in the presence of ATP, we directly observe the relaxation of two supercoils during a single catalytic turnover. By controlling the force pulling on the molecule, we determine the variation of the reaction rate with the applied stress. Finally, in the absence of ATP, we observe the clamping of a DNA crossover by a single topoisomerase on at least two different timescales (configurations). These results show that single molecule experiments are a powerful new tool for the study of topoisomerases.

  16. Single DNA molecule jamming and history-dependent dynamics during motor-driven viral packaging.

    PubMed

    Keller, Nicholas; Grimes, Shelley; Jardine, Paul J; Smith, Douglas E

    2016-08-01

    In many viruses molecular motors forcibly pack single DNA molecules to near-crystalline density into ~50-100 nm prohead shells(1, 2). Unexpectedly, we found that packaging frequently stalls in conditions that induce net attractive DNA-DNA interactions(3). Here, we present findings suggesting that this stalling occurs because the DNA undergoes a nonequilibrium jamming transition analogous to that observed in many soft-matter systems, such as colloidal and granular systems(4-8). Experiments in which conditions are changed during packaging to switch DNA-DNA interactions between purely repulsive and net attractive reveal strongly history-dependent dynamics. An abrupt deceleration is usually observed before stalling, indicating that a transition in DNA conformation causes an abrupt increase in resistance. Our findings suggest that the concept of jamming can be extended to a single polymer molecule. However, compared with macroscopic samples of colloidal particles(5) we find that single DNA molecules jam over a much larger range of densities. We attribute this difference to the nanoscale system size, consistent with theoretical predictions for jamming of attractive athermal particles.(9, 10).

  17. Single DNA molecule jamming and history-dependent dynamics during motor-driven viral packaging

    NASA Astrophysics Data System (ADS)

    Keller, Nicholas; Grimes, Shelley; Jardine, Paul J.; Smith, Douglas E.

    2016-08-01

    In many viruses, molecular motors forcibly pack single DNA molecules to near-crystalline density into ~50-100 nm prohead shells. Unexpectedly, we found that packaging frequently stalls in conditions that induce net attractive DNA-DNA interactions. Here, we present findings suggesting that this stalling occurs because the DNA undergoes a nonequilibrium jamming transition analogous to that observed in many soft-matter systems, such as colloidal and granular systems. Experiments in which conditions are changed during packaging to switch DNA-DNA interactions between purely repulsive and net attractive reveal strongly history-dependent dynamics. An abrupt deceleration is usually observed before stalling, indicating that a transition in DNA conformation causes an abrupt increase in resistance. Our findings suggest that the concept of jamming can be extended to a single polymer molecule. However, compared with macroscopic samples of colloidal particles we find that single DNA molecules jam over a much larger range of densities. We attribute this difference to the nanoscale system size, consistent with theoretical predictions for jamming of attractive athermal particles.

  18. Single DNA molecule jamming and history-dependent dynamics during motor-driven viral packaging

    PubMed Central

    Keller, Nicholas; Grimes, Shelley; Jardine, Paul J.; Smith, Douglas E.

    2016-01-01

    In many viruses molecular motors forcibly pack single DNA molecules to near-crystalline density into ~50–100 nm prohead shells1, 2. Unexpectedly, we found that packaging frequently stalls in conditions that induce net attractive DNA-DNA interactions3. Here, we present findings suggesting that this stalling occurs because the DNA undergoes a nonequilibrium jamming transition analogous to that observed in many soft-matter systems, such as colloidal and granular systems4–8. Experiments in which conditions are changed during packaging to switch DNA-DNA interactions between purely repulsive and net attractive reveal strongly history-dependent dynamics. An abrupt deceleration is usually observed before stalling, indicating that a transition in DNA conformation causes an abrupt increase in resistance. Our findings suggest that the concept of jamming can be extended to a single polymer molecule. However, compared with macroscopic samples of colloidal particles5 we find that single DNA molecules jam over a much larger range of densities. We attribute this difference to the nanoscale system size, consistent with theoretical predictions for jamming of attractive athermal particles.9, 10 PMID:27540410

  19. Single molecule FRET analysis of the 11 discrete steps of a DNA actuator.

    PubMed

    Hildebrandt, Lasse L; Preus, Søren; Zhang, Zhao; Voigt, Niels V; Gothelf, Kurt V; Birkedal, Victoria

    2014-06-25

    DNA hybridization allows the design and assembly of dynamic DNA-based molecular devices. Such structures usually accomplish their function by the addition of fuel strands that drive the structure from one conformation to a new one or by internal changes in DNA hybridization. We report here on the performance and robustness of one of these devices by the detailed study of a dynamic DNA actuator. The DNA actuator was chosen as a model system, as it is the device with most discrete states to date. It is able to reversibly slide between 11 different states and can in principle function both autonomously and nonautonomously. The 11 states of the actuator were investigated by single molecule Förster Resonance Energy Transfer (smFRET) microscopy to obtain information on the static and dynamic heterogeneities of the device. Our results show that the DNA actuator can be effectively locked in several conformations with the help of well-designed DNA lock strands. However, the device also shows pronounced static and dynamic heterogeneities both in the unlocked and locked modes, and we suggest possible structural models. Our study allows for the direct visualization of the conformational diversity and movement of the dynamic DNA-based device and shows that complex DNA-based devices are inherently heterogeneous. Our results also demonstrate that single molecule techniques are a powerful tool for structural dynamics studies and provide a stringent test for the performance of molecular devices made out of DNA.

  20. DNA compaction by the bacteriophage protein Cox studied on the single DNA molecule level using nanofluidic channels

    PubMed Central

    Frykholm, Karolin; Berntsson, Ronnie Per-Arne; Claesson, Magnus; de Battice, Laura; Odegrip, Richard; Stenmark, Pål; Westerlund, Fredrik

    2016-01-01

    The Cox protein from bacteriophage P2 forms oligomeric filaments and it has been proposed that DNA can be wound up around these filaments, similar to how histones condense DNA. We here use fluorescence microscopy to study single DNA–Cox complexes in nanofluidic channels and compare how the Cox homologs from phages P2 and WΦ affect DNA. By measuring the extension of nanoconfined DNA in absence and presence of Cox we show that the protein compacts DNA and that the binding is highly cooperative, in agreement with the model of a Cox filament around which DNA is wrapped. Furthermore, comparing microscopy images for the wild-type P2 Cox protein and two mutants allows us to discriminate between compaction due to filament formation and compaction by monomeric Cox. P2 and WΦ Cox have similar effects on the physical properties of DNA and the subtle, but significant, differences in DNA binding are due to differences in binding affinity rather than binding mode. The presented work highlights the use of single DNA molecule studies to confirm structural predictions from X-ray crystallography. It also shows how a small protein by oligomerization can have great impact on the organization of DNA and thereby fulfill multiple regulatory functions. PMID:27131370

  1. DNA condensation by protamine and arginine-rich peptides: analysis of toroid stability using single DNA molecules.

    PubMed

    Balhorn, R; Brewer, L; Corzett, M

    2000-06-01

    Both somatic cells and sperm have been shown to take up exogenous DNA, but the frequency of its integration is usually low. Scanning probe microscopy studies of sperm chromatin and synthetic DNA-protamine complexes indicate that the coiling of DNA into toroidal subunits, a process initiated in the maturing spermatid to prepare its genome for delivery into the egg, can be mimicked by simply adding protamine to DNA in vitro. The increased resistance of DNA-protamine complexes to nuclease digestion and their structural similarity to native sperm chromatin suggest that the packaging of DNA by protamine might offer a new approach for improving the efficiency of DNA uptake by sperm. Decondensation experiments performed with individual DNA molecules have provided a direct measure of the stability of toroids produced using salmon protamine and smaller arginine-rich peptides. These experiments show that the arginine content of protamine-related sequences can have a dramatic effect on their rate of dissociation from DNA. This technique and the information it provides can be used to identify protamine analogs that can be bound to DNA to increase the efficiency of its uptake by sperm and other cells.

  2. Binding of two DNA molecules by type II topoisomerases for decatenation

    PubMed Central

    Kumar, Rupesh; Riley, Jane E.; Parry, Damian; Bates, Andrew D.; Nagaraja, Valakunja

    2012-01-01

    Topoisomerases (topos) maintain DNA topology and influence DNA transaction processes by catalysing relaxation, supercoiling and decatenation reactions. In the cellular milieu, division of labour between different topos ensures topological homeostasis and control of central processes. In Escherichia coli, DNA gyrase is the principal enzyme that carries out negative supercoiling, while topo IV catalyses decatenation, relaxation and unknotting. DNA gyrase apparently has the daunting task of undertaking both the enzyme functions in mycobacteria, where topo IV is absent. We have shown previously that mycobacterial DNA gyrase is an efficient decatenase. Here, we demonstrate that the strong decatenation property of the enzyme is due to its ability to capture two DNA segments in trans. Topo IV, a strong dedicated decatenase of E. coli, also captures two distinct DNA molecules in a similar manner. In contrast, E. coli DNA gyrase, which is a poor decatenase, does not appear to be able to hold two different DNA molecules in a stable complex. The binding of a second DNA molecule to GyrB/ParE is inhibited by ATP and the non-hydrolysable analogue, AMPPNP, and by the substitution of a prominent positively charged residue in the GyrB N-terminal cavity, suggesting that this binding represents a potential T-segment positioned in the cavity. Thus, after the GyrA/ParC mediated initial DNA capture, GyrB/ParE would bind efficiently to a second DNA in trans to form a T-segment prior to nucleotide binding and closure of the gate during decatenation. PMID:22989710

  3. Interaction of cationic surfactants with DNA: a single-molecule study.

    PubMed

    Husale, Sudhir; Grange, Wilfried; Karle, Marc; Bürgi, Stephan; Hegner, Martin

    2008-03-01

    The interaction of cationic surfactants with single dsDNA molecules has been studied using force-measuring optical tweezers. For hydrophobic chains of length 12 and greater, pulling experiments show characteristic features (e.g. hysteresis between the pulling and relaxation curves, force-plateau along the force curves), typical of a condensed phase (compaction of a long DNA into a micron-sized particle). Depending on the length of the hydrophobic chain of the surfactant, we observe different mechanical behaviours of the complex (DNA-surfactants), which provide evidence for different binding modes. Taken together, our measurements suggest that short-chain surfactants, which do not induce any condensation, could lie down on the DNA surface and directly interact with the DNA grooves through hydrophobic-hydrophobic interactions. In contrast, long-chain surfactants could have their aliphatic tails pointing away from the DNA surface, which could promote inter-molecular interactions between hydrophobic chains and subsequently favour DNA condensation.

  4. Anchor Modeling

    NASA Astrophysics Data System (ADS)

    Regardt, Olle; Rönnbäck, Lars; Bergholtz, Maria; Johannesson, Paul; Wohed, Petia

    Maintaining and evolving data warehouses is a complex, error prone, and time consuming activity. The main reason for this state of affairs is that the environment of a data warehouse is in constant change, while the warehouse itself needs to provide a stable and consistent interface to information spanning extended periods of time. In this paper, we propose a modeling technique for data warehousing, called anchor modeling, that offers non-destructive extensibility mechanisms, thereby enabling robust and flexible management of changes in source systems. A key benefit of anchor modeling is that changes in a data warehouse environment only require extensions, not modifications, to the data warehouse. This ensures that existing data warehouse applications will remain unaffected by the evolution of the data warehouse, i.e. existing views and functions will not have to be modified as a result of changes in the warehouse model.

  5. Chirality of Sulforhodamine Dye Molecules Incorporated in DNA Thin Films

    DTIC Science & Technology

    2008-11-13

    of the aqueous solution, but is soluble in simple organic solvents. Thin film formation by spin coating is markedly easier with organic solvents...filter. Solutions of 2.5, 5, 10, 15, 20, and 25 wt % SRh to DNA/CTMA were prepared. Thin films produced by spin coating were typically 1.5 m thick...The spin - coating process started by com- pletely flooding the substrate, followed by spreading the so- lution for 8 s at 300 rpm, a spin of 1 min at

  6. DNA sequences, recombinant DNA molecules and processes for producing bovine growth hormone-like polypeptides in high yield

    SciTech Connect

    Buell, G.N.

    1987-09-15

    This patent describes a process for increasing the yield of a bovine growth hormone-like polypeptide to at least 100 times that of a bovine growth hormone-like polypeptide encoded by a DNA sequence. The process comprises the steps of culturing a host transformed with a recombinant DNA molecule comprising DNA sequence encoding a Met ..lambda.. or ..lambda.. bovine growth hormone-like polypetide operatively linked to an expression control sequence. The ..lambda.. is an amino terminal deletion from the amino acid sequence of mature bovine growth hormone.

  7. Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations

    PubMed Central

    Dressman, Devin; Yan, Hai; Traverso, Giovanni; Kinzler, Kenneth W.; Vogelstein, Bert

    2003-01-01

    Many areas of biomedical research depend on the analysis of uncommon variations in individual genes or transcripts. Here we describe a method that can quantify such variation at a scale and ease heretofore unattainable. Each DNA molecule in a collection of such molecules is converted into a single magnetic particle to which thousands of copies of DNA identical in sequence to the original are bound. This population of beads then corresponds to a one-to-one representation of the starting DNA molecules. Variation within the original population of DNA molecules can then be simply assessed by counting fluorescently labeled particles via flow cytometry. This approach is called BEAMing on the basis of four of its principal components (beads, emulsion, amplification, and magnetics). Millions of individual DNA molecules can be assessed in this fashion with standard laboratory equipment. Moreover, specific variants can be isolated by flow sorting and used for further experimentation. BEAMing can be used for the identification and quantification of rare mutations as well as to study variations in gene sequences or transcripts in specific populations or tissues. PMID:12857956

  8. Directly observing the motion of DNA molecules near solid-state nanopores.

    PubMed

    Ando, Genki; Hyun, Changbae; Li, Jiali; Mitsui, Toshiyuki

    2012-11-27

    We investigate the diffusion and the drift motion of λ DNA molecules near solid-state nanopores prior to their translocation through the nanopores using fluorescence microscopy. The radial dependence of the electric field near a nanopore generated by an applied voltage in ionic solution can be estimated quantitatively in 3D by analyzing the motion of negatively charged DNA molecules. We find that the electric field is approximately spherically symmetric around the nanopore under the conditions investigated. In addition, DNA clogging at the nanopore was directly observed. Surprisingly, the probability of the clogging event increases with increasing external bias voltage. We also find that DNA molecules clogging the nanopore reduce the electric field amplitude at the nanopore membrane surface. To better understand these experimental results, analytical method with Ohm's law and computer simulation with Poisson and Nernst-Planck (PNP) equations are used to calculate the electric field near the nanopore. These results are of great interest in both experimental and theoretical considerations of the motion of DNA molecules near voltage-biased nanopores. These findings will also contribute to the development of solid-state nanopore-based DNA sensing devices.

  9. Single-molecule studies of high-mobility group B architectural DNA bending proteins.

    PubMed

    Murugesapillai, Divakaran; McCauley, Micah J; Maher, L James; Williams, Mark C

    2017-02-01

    Protein-DNA interactions can be characterized and quantified using single molecule methods such as optical tweezers, magnetic tweezers, atomic force microscopy, and fluorescence imaging. In this review, we discuss studies that characterize the binding of high-mobility group B (HMGB) architectural proteins to single DNA molecules. We show how these studies are able to extract quantitative information regarding equilibrium binding as well as non-equilibrium binding kinetics. HMGB proteins play critical but poorly understood roles in cellular function. These roles vary from the maintenance of chromatin structure and facilitation of ribosomal RNA transcription (yeast high-mobility group 1 protein) to regulatory and packaging roles (human mitochondrial transcription factor A). We describe how these HMGB proteins bind, bend, bridge, loop and compact DNA to perform these functions. We also describe how single molecule experiments observe multiple rates for dissociation of HMGB proteins from DNA, while only one rate is observed in bulk experiments. The measured single-molecule kinetics reveals a local, microscopic mechanism by which HMGB proteins alter DNA flexibility, along with a second, much slower macroscopic rate that describes the complete dissociation of the protein from DNA.

  10. Antigen Targeting to Human HLA Class II Molecules Increases Efficacy of DNA Vaccination

    PubMed Central

    Fredriksen, Agnete Brunsvik; Løset, Geir Åge; Vikse, Elisabeth; Fugger, Lars

    2016-01-01

    It has been difficult to translate promising results from DNA vaccination in mice to larger animals and humans. Previously, DNA vaccines encoding proteins that target Ag to MHC class II (MHC-II) molecules on APCs have been shown to induce rapid, enhanced, and long-lasting Ag-specific Ab titers in mice. In this study, we describe two novel DNA vaccines that as proteins target HLA class II (HLA-II) molecules. These vaccine proteins cross-react with MHC-II molecules in several species of larger mammals. When tested in ferrets and pigs, a single DNA delivery with low doses of the HLA-II–targeted vaccines resulted in rapid and increased Ab responses. Importantly, painless intradermal jet delivery of DNA was as effective as delivery by needle injection followed by electroporation. As an indication that the vaccines could also be useful for human application, HLA-II–targeted vaccine proteins were found to increase human CD4+ T cell responses by a factor of ×103 in vitro. Thus, targeting of Ag to MHC-II molecules may represent an attractive strategy for increasing efficacy of DNA vaccines in larger animals and humans. PMID:27671110

  11. Carrier molecules and extraction of circulating tumor DNA for next generation sequencing in colorectal cancer.

    PubMed

    Beránek, Martin; Sirák, Igor; Vošmik, Milan; Petera, Jiří; Drastíková, Monika; Palička, Vladimír

    The aims of the study were: i) to compare circulating tumor DNA (ctDNA) yields obtained by different manual extraction procedures, ii) to evaluate the addition of various carrier molecules into the plasma to improve ctDNA extraction recovery, and iii) to use next generation sequencing (NGS) technology to analyze KRAS, BRAF, and NRAS somatic mutations in ctDNA from patients with metastatic colorectal cancer. Venous blood was obtained from patients who suffered from metastatic colorectal carcinoma. For plasma ctDNA extraction, the following carriers were tested: carrier RNA, polyadenylic acid, glycogen, linear acrylamide, yeast tRNA, salmon sperm DNA, and herring sperm DNA. Each extract was characterized by quantitative real-time PCR and next generation sequencing. The addition of polyadenylic acid had a significant positive effect on the amount of ctDNA eluted. The sequencing data revealed five cases of ctDNA mutated in KRAS and one patient with a BRAF mutation. An agreement of 86% was found between tumor tissues and ctDNA. Testing somatic mutations in ctDNA seems to be a promising tool to monitor dynamically changing genotypes of tumor cells circulating in the body. The optimized process of ctDNA extraction should help to obtain more reliable sequencing data in patients with metastatic colorectal cancer.

  12. Direct observation of the interaction of single fluorescent nucleotide analogue molecules with DNA polymerase I

    NASA Astrophysics Data System (ADS)

    Ye, Jing Yong; Yamane, Yuji; Yamauchi, Masayo; Nakatsuka, Hiroki; Ishikawa, Mitsuru

    2000-04-01

    The interaction of a fluorescent nucleotide analogue, 2'- (or-3')- O-(2,4,6-trinitrophenyl) adenosine 5'-triphosphate (TNP-ATP), with the Klenow fragment of DNA polymerase I (Pol I) was visualized at a single-molecule level. Upon excitation, individual enzyme-TNP-ATP complexes resulted in bright fluorescent spots owing to the increase of the fluorescence quantum yield of TNP-ATP when it bound to the enzyme molecule, whereas unbound TNP-ATP molecules were not visible in the single molecule detection. Thus, we directly investigated the individual interactions of TNP-ATP with the enzyme using single-molecule fluorescence imaging and time-resolved spectroscopy of single enzyme-TNP-ATP complexes without prior separation of the unbound probe molecules.

  13. Passive entry of a DNA molecule into a small pore

    PubMed Central

    de Gennes, Pierre-Gilles

    1999-01-01

    I consider a vesicle with an open pore of small radius rp, exposed to a DNA solution. The crucial moment is the entry, when a chain end faces the pore and enters it. I discuss qualitatively the following three characteristic times: (i) the duration of the entry of one chain end (defining the minimum lifetime of the pore) τe ∼ 10−4 sec, (ii) the transfection time τt (the time required to be sure that one chain has gone in) τt ∼ hours, and (iii) the sliding time τS (the time between entry of one end and entry of the other end) ∼ 1 sec. A fortunate feature is that sliding may proceed even if the pore tends to close itself after entry. PMID:10377402

  14. Identifying three-way DNA junction-specific small-molecules.

    PubMed

    Vuong, Sophie; Stefan, Loïc; Lejault, Pauline; Rousselin, Yoann; Denat, Franck; Monchaud, David

    2012-02-01

    Three-way junction DNA (TWJ-DNA, also known as 3WJ-DNA) is an alternative secondary DNA structure comprised of three duplex-DNAs that converge towards a single point, termed the branch point. This point is characterized by unique geometrical properties that make its specific targeting by synthetic small-molecules possible. Such a targeting has already been demonstrated in the solid state but not thoroughly biophysically investigated in solution. Herein, a set of simple biophysical assays has been developed to identify TWJ-specific small-molecule ligands; these assays, inspired by the considerable body of work that has been reported to characterize the interactions between small-molecules and other higher-order DNA (notably quadruplex-DNA), have been calibrated with a known non-specific DNA binder (the porphyrin TMPyP4) and validated via the study of a small series of triazacyclononane (TACN) derivatives (metal-free or not) and the identification of a fairly-affinic and exquisitely TWJ-selective candidate (a TACN-quinoline construct named TACN-Q). Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  15. Rapid prototyping of multichannel microfluidic devices for single-molecule DNA curtain imaging.

    PubMed

    Robison, Aaron D; Finkelstein, Ilya J

    2014-05-06

    Single-molecule imaging and manipulation of biochemical reactions continues to reveal numerous biological insights. To facilitate these studies, we have developed and implemented a high-throughput approach to organize and image hundreds of individual DNA molecules at aligned diffusion barriers. Nonetheless, obtaining statistically relevant data sets under a variety of reaction conditions remains challenging. Here, we present a method for integrating high-throughput single-molecule "DNA curtain" imaging with poly(dimethylsiloxane) (PDMS)-based microfluidics. Our benchtop fabrication method can be accomplished in minutes with common tools found in all molecular biology laboratories. We demonstrate the utility of this approach by simultaneous imaging of two independent biochemical reaction conditions in a laminar flow device. In addition, five different reaction conditions can be observed concurrently in a passive linear gradient generator. Combining rapid microfluidic fabrication with high-throughput DNA curtains greatly expands our capability to interrogate complex biological reactions.

  16. A method to label biological molecules with dsDNA coated gold nanoparticles.

    PubMed

    Xing, Ming; Li, Fangliang; Dong, Yingshan; Yu, Zhenxiang; Chen, Xia

    2015-03-01

    We described a new method to label biological molecules using gold nanoparticles (GNPs) and double stranded DNA. Researchers can conveniently label their own samples with GNPs using this method. The label is based on dsDNA with a 93.5% coverage of GNPs (dsDNA:GNP = 303:1). Antigens, streptavidin and biotin were labeled on GNPs and the success of the method was investigated with agarose gel electrophoresis, laser particle size analysis and ultraviolet spectrophotometry. These analyses confirmed that biological molecules were successfully bound to the GNPs. These molecules retained their biological activity and were able to detect targets on PVDF and NC membranes with excellent selectivity and low levels of background. Modified GNPs were also able to detect targets on nylon membranes, but with some degree of false positives. The maximum limit of detection was 25 ng proteins.

  17. A unified sensor architecture for isothermal detection of double-stranded DNA, oligonucleotides, and small molecules.

    PubMed

    Brown, Carl W; Lakin, Matthew R; Fabry-Wood, Aurora; Horwitz, Eli K; Baker, Nicholas A; Stefanovic, Darko; Graves, Steven W

    2015-03-23

    Pathogen detection is an important problem in many areas of medicine and agriculture, which can involve genomic or transcriptomic signatures or small-molecule metabolites. We report a unified, DNA-based sensor architecture capable of isothermal detection of double-stranded DNA targets, single-stranded oligonucleotides, and small molecules. Each sensor contains independent target detection and reporter modules, enabling rapid design. We detected gene variants on plasmids by using a straightforward isothermal denaturation protocol. The sensors were highly specific, even with a randomized DNA background. We achieved a limit of detection of ∼15 pM for single-stranded targets and ∼5 nM for targets on denatured plasmids. By incorporating a blocked aptamer sequence, we also detected small molecules using the same sensor architecture. This work provides a starting point for multiplexed detection of multi-strain pathogens, and disease states caused by genetic variants (e.g., sickle cell anemia).

  18. Single-molecule analysis of DNA replication in Xenopus egg extracts.

    PubMed

    Yardimci, Hasan; Loveland, Anna B; van Oijen, Antoine M; Walter, Johannes C

    2012-06-01

    The recent advent in single-molecule imaging and manipulation methods has made a significant impact on the understanding of molecular mechanisms underlying many essential cellular processes. Single-molecule techniques such as electron microscopy and DNA fiber assays have been employed to study the duplication of genome in eukaryotes. Here, we describe a single-molecule assay that allows replication of DNA attached to the functionalized surface of a microfluidic flow cell in a soluble Xenopus leavis egg extract replication system and subsequent visualization of replication products via fluorescence microscopy. We also explain a method for detection of replication proteins, through fluorescently labeled antibodies, on partially replicated DNA immobilized at both ends to the surface.

  19. Anchoring a Defined Sequence to the 55' Ends of mRNAs : The Bolt to Clone Rare Full Length mRNAs and Generate cDNA Libraries porn a Few Cells.

    PubMed

    Baptiste, J; Milne Edwards, D; Delort, J; Mallet, J

    1993-01-01

    Among numerous applications, the polymerase chain reaction (PCR) (1,2) provides a convenient means to clone 5' ends of rare mRNAs and to generate cDNA libraries from tissue available in amounts too low to be processed by conventional methods. Basically, the amplification of cDNAs by the PCR requires the availability of the sequences of two stretches of the molecule to be amplified. A sequence can easily be imposed at the 5' end of the first-strand cDNAs (corresponding to the 3' end of the mRNAs) by priming the reverse transcription with a specific primer (for cloning the 5' end of rare messenger) or with an oligonucleotide tailored with a poly (dT) stretch (for cDNA library construction), taking advantage of the poly (A) sequence that is located at the 3' end of mRNAs. Several strategies have been devised to tag the 3' end of the ss-cDNAs (corresponding to the 55' end of the mRNAs). We (3) and others have described strategies based on the addition of a homopolymeric dG (4,5) or dA (6,7) tail using terminal deoxyribonucleotide transferase (TdT) ("anchor-PCR" [4]). However, this strategy has important limitations. The TdT reaction is difficult to control and has a low efficiency (unpublished observations). But most importantly, the return primers containing a homopolymeric (dC or dT) tail generate nonspecific amplifications, a phenomenon that prevents the isolation of low abundance mRNA species and/or interferes with the relative abundance of primary clones in the library. To circumvent these drawbacks, we have used two approaches. First, we devised a strategy based on a cRNA enrichment procedure, which has been useful to eliminate nonspecific-PCR products and to allow detection and cloning of cDNAs of low abundance (3). More recently, to avoid the nonspecific amplification resulting from the annealing of the homopolymeric tail oligonucleotide, we have developed a novel anchoring strategy that is based on the ligation of an oligonucleotide to the 35' end of ss

  20. DNA unwinding heterogeneity by RecBCD results from static molecules able to equilibrate.

    PubMed

    Liu, Bian; Baskin, Ronald J; Kowalczykowski, Stephen C

    2013-08-22

    Single-molecule studies can overcome the complications of asynchrony and ensemble-averaging in bulk-phase measurements, provide mechanistic insights into molecular activities, and reveal interesting variations between individual molecules. The application of these techniques to the RecBCD helicase of Escherichia coli has resolved some long-standing discrepancies, and has provided otherwise unattainable mechanistic insights into its enzymatic behaviour. Enigmatically, the DNA unwinding rates of individual enzyme molecules are seen to vary considerably, but the origin of this heterogeneity remains unknown. Here we investigate the physical basis for this behaviour. Although any individual RecBCD molecule unwound DNA at a constant rate for an average of approximately 30,000 steps, we discover that transiently halting a single enzyme-DNA complex by depleting Mg(2+)-ATP could change the subsequent rates of DNA unwinding by that enzyme after reintroduction to ligand. The proportion of molecules that changed rate increased exponentially with the duration of the interruption, with a half-life of approximately 1 second, suggesting that a conformational change occurred during the time that the molecule was arrested. The velocity after pausing an individual molecule was any velocity found in the starting distribution of the ensemble. We suggest that substrate binding stabilizes the enzyme in one of many equilibrium conformational sub-states that determine the rate-limiting translocation behaviour of each RecBCD molecule. Each stabilized sub-state can persist for the duration (approximately 1 minute) of processive unwinding of a DNA molecule, comprising tens of thousands of catalytic steps, each of which is much faster than the time needed for the conformational change required to alter kinetic behaviour. This ligand-dependent stabilization of rate-defining conformational sub-states results in seemingly static molecule-to-molecule variation in RecBCD helicase activity

  1. A New Direct Single-Molecule Observation Method for DNA Synthesis Reaction Using Fluorescent Replication Protein A

    PubMed Central

    Takahashi, Shunsuke; Kawasaki, Shohei; Miyata, Hidefumi; Kurita, Hirofumi; Mizuno, Takeshi; Matsuura, Shun-ichi; Mizuno, Akira; Oshige, Masahiko; Katsura, Shinji

    2014-01-01

    Using a single-stranded region tracing system, single-molecule DNA synthesis reactions were directly observed in microflow channels. The direct single-molecule observations of DNA synthesis were labeled with a fusion protein consisting of the ssDNA-binding domain of a 70-kDa subunit of replication protein A and enhanced yellow fluorescent protein (RPA-YFP). Our method was suitable for measurement of DNA synthesis reaction rates with control of the ssλDNA form as stretched ssλDNA (+flow) and random coiled ssλDNA (−flow) via buffer flow. Sequentially captured photographs demonstrated that the synthesized region of an ssλDNA molecule monotonously increased with the reaction time. The DNA synthesis reaction rate of random coiled ssλDNA (−flow) was nearly the same as that measured in a previous ensemble molecule experiment (52 vs. 50 bases/s). This suggested that the random coiled form of DNA (−flow) reflected the DNA form in the bulk experiment in the case of DNA synthesis reactions. In addition, the DNA synthesis reaction rate of stretched ssλDNA (+flow) was approximately 75% higher than that of random coiled ssλDNA (−flow) (91 vs. 52 bases/s). The DNA synthesis reaction rate of the Klenow fragment (3′-5′exo–) was promoted by DNA stretching with buffer flow. PMID:24625741

  2. Contactless experiments on individual DNA molecules show no evidence for molecular wire behavior

    PubMed Central

    Gómez-Navarro, C.; Moreno-Herrero, F.; de Pablo, P. J.; Colchero, J.; Gómez-Herrero, J.; Baró, A. M.

    2002-01-01

    A fundamental requirement for a molecule to be considered a molecular wire (MW) is the ability to transport electrical charge with a reasonably low resistance. We have carried out two experiments that measure first, the charge transfer from an electrode to the molecule, and second, the dielectric response of the MW. The latter experiment requires no contacts to either end of the molecule. From our experiments we conclude that adsorbed individual DNA molecules have a resistivity similar to mica, glass, and silicon oxide substrates. Therefore adsorbed DNA is not a conductor, and it should not be considered as a viable candidate for MW applications. Parallel studies on other nanowires, including single-walled carbon nanotubes, showed conductivity as expected. PMID:12070346

  3. Anchoring a Leviathan: How the Nuclear Membrane Tethers the Genome.

    PubMed

    Czapiewski, Rafal; Robson, Michael I; Schirmer, Eric C

    2016-01-01

    It is well established that the nuclear envelope has many distinct direct connections to chromatin that contribute to genome organization. The functional consequences of genome organization on gene regulation are less clear. Even less understood is how interactions of lamins and nuclear envelope transmembrane proteins (NETs) with chromatin can produce anchoring tethers that can withstand the physical forces of and on the genome. Chromosomes are the largest molecules in the cell, making megadalton protein structures like the nuclear pore complexes and ribosomes seem small by comparison. Thus to withstand strong forces from chromosome dynamics an anchoring tether is likely to be much more complex than a single protein-protein or protein-DNA interaction. Here we will briefly review known NE-genome interactions that likely contribute to spatial genome organization, postulate in the context of experimental data how these anchoring tethers contribute to gene regulation, and posit several hypotheses for the physical nature of these tethers that need to be investigated experimentally. Significantly, disruption of these anchoring tethers and the subsequent consequences for gene regulation could explain how mutations in nuclear envelope proteins cause diseases ranging from muscular dystrophy to lipodystrophy to premature aging progeroid syndromes. The two favored hypotheses for nuclear envelope protein involvement in disease are (1) weakening nuclear and cellular mechanical stability, and (2) disrupting genome organization and gene regulation. Considerable experimental support has been obtained for both. The integration of both mechanical and gene expression defects in the disruption of anchoring tethers could provide a unifying hypothesis consistent with both.

  4. Studying the organization of DNA repair by single-cell and single-molecule imaging

    PubMed Central

    Uphoff, Stephan; Kapanidis, Achillefs N.

    2014-01-01

    DNA repair safeguards the genome against a diversity of DNA damaging agents. Although the mechanisms of many repair proteins have been examined separately in vitro, far less is known about the coordinated function of the whole repair machinery in vivo. Furthermore, single-cell studies indicate that DNA damage responses generate substantial variation in repair activities across cells. This review focuses on fluorescence imaging methods that offer a quantitative description of DNA repair in single cells by measuring protein concentrations, diffusion characteristics, localizations, interactions, and enzymatic rates. Emerging single-molecule and super-resolution microscopy methods now permit direct visualization of individual proteins and DNA repair events in vivo. We expect much can be learned about the organization of DNA repair by linking cell heterogeneity to mechanistic observations at the molecular level. PMID:24629485

  5. Method for patterning stretched DNA molecules on mica surfaces by soft lithography.

    PubMed

    Gad, M; Sugiyama, Shigeru; Ohtani, Toshio

    2003-12-01

    Lambda DNA was stretched and patterned on mica surface using soft lithography. A highly diluted solution of amino propyl trimethoxy silane in hexane was deposited on a line patterned polydimethylsiloxane (PDMS) stamp. The functionalized stamp was then used to pick up DNA by molecular combing while the line patterns are parallel to the liquid surface. The stamp was then microcontact printed on freshly cleaved mica. We successfully obtained stretched DNA pattern on mica surface. DNA was found to be stretched in patterns perpendicular to those carved on the stamp. The stretched DNA population was large enough to be used for molecular biology mapping studies. Furthermore, the possibility of locating stretched DNA molecules in the desired position by stamping makes this method a good candidate for assembling non-semiconductor molecular devices.

  6. Determination of the elastic properties of short ssDNA molecules by mechanically folding and unfolding DNA hairpins.

    PubMed

    Alemany, Anna; Ritort, Felix

    2014-12-01

    The characterization of elastic properties of biopolymers is crucial to understand many molecular reactions determined by conformational bending fluctuations of the polymer. Direct measurement of such elastic properties using single-molecule methods is usually hindered by the intrinsic tendency of such biopolymers to form high-order molecular structures. For example, single-stranded deoxyribonucleic acids (ssDNA) tend to form secondary structures such as local double helices that prevent the direct measurement of the ideal elastic response of the ssDNA. In this work, we show how to extract the ideal elastic response in the entropic regime of short ssDNA molecules by mechanically pulling two-state DNA hairpins of different contour lengths. This is achieved by measuring the force dependence of the molecular extension and stiffness on mechanically folding and unfolding the DNA hairpin. Both quantities are fit to the worm-like chain elastic model giving values for the persistence length and the interphosphate distance. This method can be used to unravel the elastic properties of short ssDNA and RNA sequences and, more generally, any biopolymer that can exhibit a cooperative two-state transition between mechanically folded and unfolded states (such as proteins).

  7. An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules

    PubMed Central

    Kimoto, Michiko; Kawai, Rie; Mitsui, Tsuneo; Yokoyama, Shigeyuki; Hirao, Ichiro

    2009-01-01

    Toward the expansion of the genetic alphabet, we present an unnatural base pair system for efficient PCR amplification, enabling the site-specific incorporation of extra functional components into DNA. This system can be applied to conventional PCR protocols employing DNA templates containing unnatural bases, natural and unnatural base triphosphates, and a 3′→5′ exonuclease-proficient DNA polymerase. For highly faithful and efficient PCR amplification involving the unnatural base pairing, we identified the natural-base sequences surrounding the unnatural bases in DNA templates by an in vitro selection technique, using a DNA library containing the unnatural base. The system facilitates the site-specific incorporation of a variety of modified unnatural bases, linked with functional groups of interest, into amplified DNA. DNA fragments (0.15 amol) containing the unnatural base pair can be amplified 107-fold by 30 cycles of PCR, with <1% total mutation rate of the unnatural base pair site. Using the system, we demonstrated efficient PCR amplification and functionalization of DNA fragments for the extremely sensitive detection of zeptomol-scale target DNA molecules from mixtures with excess amounts (pmol scale) of foreign DNA species. This unnatural base pair system will be applicable to a wide range of DNA/RNA-based technologies. PMID:19073696

  8. Single-Molecule Imaging Reveals How Mre11-Rad50-Nbs1 Initiates DNA Break Repair.

    PubMed

    Myler, Logan R; Gallardo, Ignacio F; Soniat, Michael M; Deshpande, Rajashree A; Gonzalez, Xenia B; Kim, Yoori; Paull, Tanya T; Finkelstein, Ilya J

    2017-09-07

    DNA double-strand break (DSB) repair is essential for maintaining our genomes. Mre11-Rad50-Nbs1 (MRN) and Ku70-Ku80 (Ku) direct distinct DSB repair pathways, but the interplay between these complexes at a DSB remains unclear. Here, we use high-throughput single-molecule microscopy to show that MRN searches for free DNA ends by one-dimensional facilitated diffusion, even on nucleosome-coated DNA. Rad50 binds homoduplex DNA and promotes facilitated diffusion, whereas Mre11 is required for DNA end recognition and nuclease activities. MRN gains access to occluded DNA ends by removing Ku or other DNA adducts via an Mre11-dependent nucleolytic reaction. Next, MRN loads exonuclease 1 (Exo1) onto the free DNA ends to initiate DNA resection. In the presence of replication protein A (RPA), MRN acts as a processivity factor for Exo1, retaining the exonuclease on DNA for long-range resection. Our results provide a mechanism for how MRN promotes homologous recombination on nucleosome-coated DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. A DNA Crystal Designed to Contain Two Molecules per Asymmetric Unit

    SciTech Connect

    T Wang; R Sha; J Birktoft; J Zheng; C Mao; N Seeman

    2011-12-31

    We describe the self-assembly of a DNA crystal that contains two tensegrity triangle molecules per asymmetric unit. We have used X-ray crystallography to determine its crystal structure. In addition, we have demonstrated control over the colors of the crystals by attaching either Cy3 dye (pink) or Cy5 dye (blue-green) to the components of the crystal, yielding crystals of corresponding colors. Attaching the pair of dyes to the pair of molecules yields a purple crystal.

  10. Molecular Threading: Mechanical Extraction, Stretching and Placement of DNA Molecules from a Liquid-Air Interface

    PubMed Central

    Kemmish, Kent; Hamalainen, Mark; Bowell, Charlotte; Bleloch, Andrew; Klejwa, Nathan; Lehrach, Wolfgang; Schatz, Ken; Stark, Heather; Marblestone, Adam; Church, George; Own, Christopher S.; Andregg, William

    2013-01-01

    We present “molecular threading”, a surface independent tip-based method for stretching and depositing single and double-stranded DNA molecules. DNA is stretched into air at a liquid-air interface, and can be subsequently deposited onto a dry substrate isolated from solution. The design of an apparatus used for molecular threading is presented, and fluorescence and electron microscopies are used to characterize the angular distribution, straightness, and reproducibility of stretched DNA deposited in arrays onto elastomeric surfaces and thin membranes. Molecular threading demonstrates high straightness and uniformity over length scales from nanometers to micrometers, and represents an alternative to existing DNA deposition and linearization methods. These results point towards scalable and high-throughput precision manipulation of single-molecule polymers. PMID:23935923

  11. Macromolecular crowding induced elongation and compaction of single DNA molecules confined in a nanochannel.

    PubMed

    Zhang, Ce; Shao, Pei Ge; van Kan, Jeroen A; van der Maarel, Johan R C

    2009-09-29

    The effect of dextran nanoparticles on the conformation and compaction of single DNA molecules confined in a nanochannel was investigated with fluorescence microscopy. It was observed that the DNA molecules elongate and eventually condense into a compact form with increasing volume fraction of the crowding agent. Under crowded conditions, the channel diameter is effectively reduced, which is interpreted in terms of depletion in DNA segment density in the interfacial region next to the channel wall. Confinement in a nanochannel also facilitates compaction with a neutral crowding agent at low ionic strength. The threshold volume fraction for condensation is proportional to the size of the nanoparticle, due to depletion induced attraction between DNA segments. We found that the effect of crowding is not only related to the colligative properties of the agent and that confinement is also important. It is the interplay between anisotropic confinement and osmotic pressure which gives the elongated conformation and the possibility for condensation at low ionic strength.

  12. Macromolecular crowding induced elongation and compaction of single DNA molecules confined in a nanochannel

    PubMed Central

    Zhang, Ce; Shao, Pei Ge; van Kan, Jeroen A.; van der Maarel, Johan R. C.

    2009-01-01

    The effect of dextran nanoparticles on the conformation and compaction of single DNA molecules confined in a nanochannel was investigated with fluorescence microscopy. It was observed that the DNA molecules elongate and eventually condense into a compact form with increasing volume fraction of the crowding agent. Under crowded conditions, the channel diameter is effectively reduced, which is interpreted in terms of depletion in DNA segment density in the interfacial region next to the channel wall. Confinement in a nanochannel also facilitates compaction with a neutral crowding agent at low ionic strength. The threshold volume fraction for condensation is proportional to the size of the nanoparticle, due to depletion induced attraction between DNA segments. We found that the effect of crowding is not only related to the colligative properties of the agent and that confinement is also important. It is the interplay between anisotropic confinement and osmotic pressure which gives the elongated conformation and the possibility for condensation at low ionic strength. PMID:19805352

  13. Force-dependent persistence length of DNA-intercalator complexes measured in single molecule stretching experiments.

    PubMed

    Bazoni, R F; Lima, C H M; Ramos, E B; Rocha, M S

    2015-06-07

    By using optical tweezers with an adjustable trap stiffness, we have performed systematic single molecule stretching experiments with two types of DNA-intercalator complexes, in order to investigate the effects of the maximum applied forces on the mechanical response of such complexes. We have explicitly shown that even in the low-force entropic regime the persistence length of the DNA-intercalator complexes is strongly force-dependent, although such behavior is not exhibited by bare DNA molecules. We discuss the possible physicochemical effects that can lead to such results. In particular, we propose that the stretching force can promote partial denaturation on the highly distorted double-helix of the DNA-intercalator complexes, which interfere strongly in the measured values of the persistence length.

  14. A renormalization approach to describe charge transport in quasiperiodic dangling backbone ladder (DBL)-DNA molecules

    NASA Astrophysics Data System (ADS)

    Sarmento, R. G.; Fulco, U. L.; Albuquerque, E. L.; Caetano, E. W. S.; Freire, V. N.

    2011-10-01

    We study the charge transport properties of a dangling backbone ladder (DBL)-DNA molecule focusing on a quasiperiodic arrangement of its constituent nucleotides forming a Rudin-Shapiro (RS) and Fibonacci (FB) Poly (CG) sequences, as well as a natural DNA sequence (Ch22) for the sake of comparison. Making use of a one-step renormalization process, the DBL-DNA molecule is modeled in terms of a one-dimensional tight-binding Hamiltonian to investigate its transmissivity and current-voltage (I-V) profiles. Beyond the semiconductor I-V characteristics, a striking similarity between the electronic transport properties of the RS quasiperiodic structure and the natural DNA sequence was found.

  15. Torque measurements during the spontaneous unbraiding of DNA molecules in the absence of pulling forces

    NASA Astrophysics Data System (ADS)

    Martínez-Santiago, Carlos J.; Quiñones, Edwin

    2017-07-01

    We present an improved version of the magnetic tweezers/viscous drag (MTVD) hybrid assay that allows dynamic torque measurements during the spontaneous relaxation of DNA braids. The method relies on the ability of pairs of DNA molecules to rotate a microscopic probe attached to their upper ends using the elastic energy stored when braided. Digital tracking of the rotation of the dumbbell against the viscous drag allowed estimation of the torque exerted by the molecules. The unwinding dynamics of DNA braids against different amounts of viscous drag was characterized employing probes of two different sizes. We identified and characterized different perturbations that may affect the unbraiding dynamics. Estimates of the torques associated to the process of DNA unbraiding are reported.

  16. In vivo single-molecule imaging of bacterial DNA replication, transcription, and repair.

    PubMed

    Stracy, Mathew; Uphoff, Stephan; Garza de Leon, Federico; Kapanidis, Achillefs N

    2014-10-01

    In vivo single-molecule experiments offer new perspectives on the behaviour of DNA binding proteins, from the molecular level to the length scale of whole bacterial cells. With technological advances in instrumentation and data analysis, fluorescence microscopy can detect single molecules in live cells, opening the doors to directly follow individual proteins binding to DNA in real time. In this review, we describe key technical considerations for implementing in vivo single-molecule fluorescence microscopy. We discuss how single-molecule tracking and quantitative super-resolution microscopy can be adapted to extract DNA binding kinetics, spatial distributions, and copy numbers of proteins, as well as stoichiometries of protein complexes. We highlight experiments which have exploited these techniques to answer important questions in the field of bacterial gene regulation and transcription, as well as chromosome replication, organisation and repair. Together, these studies demonstrate how single-molecule imaging is transforming our understanding of DNA-binding proteins in cells. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  17. Distinguishable Populations Report on the Interactions of Single DNA Molecules with Solid-State Nanopores

    PubMed Central

    van den Hout, Michiel; Krudde, Vincent; Janssen, Xander J.A.; Dekker, Nynke H.

    2010-01-01

    Solid-state nanopores have received increasing interest over recent years because of their potential for genomic screening and sequencing. In particular, small nanopores (2–5 nm in diameter) allow the detection of local structure along biological molecules, such as proteins bound to DNA or possibly the secondary structure of RNA molecules. In a typical experiment, individual molecules are translocated through a single nanopore, thereby causing a small deviation in the ionic conductance. A correct interpretation of these conductance changes is essential for our understanding of the process of translocation, and for further sophistication of this technique. Here, we present translocation measurements of double-stranded DNA through nanopores down to the diameter of the DNA itself (1.8–7 nm at the narrowest constriction). In contrast to previous findings on such small nanopores, we find that single molecules interacting with these pores can cause three distinct levels of conductance blockades. We attribute the smallest conductance blockades to molecules that briefly skim the nanopore entrance without translocating, the intermediate level of conductance blockade to regular head-to-tail translocations, and the largest conductance blockades to obstruction of the nanopore entrance by one or multiple (duplex) DNA strands. Our measurements are an important step toward understanding the conductance blockade of biomolecules in such small nanopores, which will be essential for future applications involving solid-state nanopores. PMID:21112309

  18. Distinguishable populations report on the interactions of single DNA molecules with solid-state nanopores.

    PubMed

    van den Hout, Michiel; Krudde, Vincent; Janssen, Xander J A; Dekker, Nynke H

    2010-12-01

    Solid-state nanopores have received increasing interest over recent years because of their potential for genomic screening and sequencing. In particular, small nanopores (2-5 nm in diameter) allow the detection of local structure along biological molecules, such as proteins bound to DNA or possibly the secondary structure of RNA molecules. In a typical experiment, individual molecules are translocated through a single nanopore, thereby causing a small deviation in the ionic conductance. A correct interpretation of these conductance changes is essential for our understanding of the process of translocation, and for further sophistication of this technique. Here, we present translocation measurements of double-stranded DNA through nanopores down to the diameter of the DNA itself (1.8-7 nm at the narrowest constriction). In contrast to previous findings on such small nanopores, we find that single molecules interacting with these pores can cause three distinct levels of conductance blockades. We attribute the smallest conductance blockades to molecules that briefly skim the nanopore entrance without translocating, the intermediate level of conductance blockade to regular head-to-tail translocations, and the largest conductance blockades to obstruction of the nanopore entrance by one or multiple (duplex) DNA strands. Our measurements are an important step toward understanding the conductance blockade of biomolecules in such small nanopores, which will be essential for future applications involving solid-state nanopores. Copyright © 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  19. Absence of intrinsic electric conductivity in single dsDNA molecules.

    PubMed

    Kleine, H; Wilke, R; Pelargus, Ch; Rott, K; Pühler, A; Reiss, G; Ros, R; Anselmetti, D

    2004-08-26

    The intrinsic dc conductivity of long, individual lambda phage dsDNA molecules has been investigated by ultrasensitive low current-voltage-spectroscopy (IV) under ambient conditions and controlled low humidity inert gas atmosphere on microfabricated metal-insulator-metal gap structures. We found a strong dependence of the measured conductivity on the apparent humidity, which we attribute to capillary condensation of water to the immobilized DNA molecules, giving rise to additional ionic currents. Additional IV-spectroscopy experiments under controlled argon atmosphere always revealed a significant drop in electrical conductivity to 4 x 10(-15)AV(-1)microm(-1), indicating almost no considerable contribution of electrical long range charge transport.

  20. Complete nucleotide sequence of a subviral DNA molecule of porcine circovirus type 2.

    PubMed

    Wen, Han

    2016-07-01

    Porcine circovirus type 2 (PCV2) is a member of the genus Circovirus in the family Circoviridae. Most subgenomic molecules of PCV2 have been mapped. Here, the first full-length sequence of a subviral molecule of PCV2 (CH-IVT12) containing a reverse complement sequence of the PCV2 genome was determined by sequencing DNA extracted from PK15 cells infected with PCV2. The circular CH-IVT12 DNA consists of 1136 nucleotides and contains one major open reading frame.

  1. A model for the separation of large DNA molecules by crossed field gel electrophoresis.

    PubMed

    Southern, E M; Anand, R; Brown, W R; Fletcher, D S

    1987-08-11

    The idea that large DNA molecules adopt a stretched conformation as they pass through gels suggests a simple mechanism for the separation of DNA by crossed field electrophoresis: at each change in field direction a DNA molecule takes off in the new direction of the field by a movement which is led by what was formerly its back end. The effect of this ratcheting motion is to subtract from the DNA molecule's forward movement, at each step, an amount which is proportional to its length. We find that this model explains most of the features of the separation, and we describe experiments, using a novel electrophoresis apparatus, which support the model. The apparatus turns the gel between two preset orientations in a uniform electric field at preset time intervals. This separation method has the practical advantage over some others that the DNA molecules follow straight tracks. A further advantage is that the parameters which determine the separation are readily predicted from the simple theory describing their motion.

  2. Combining single-molecule manipulation and imaging for the study of protein-DNA interactions.

    PubMed

    Monico, Carina; Belcastro, Gionata; Vanzi, Francesco; Pavone, Francesco S; Capitanio, Marco

    2014-08-27

    The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method offers the opportunity of investigating interactions occurring in solution (thus avoiding problems due to closeby surfaces as in other single molecule methods), controlling the DNA extension and tracking interaction dynamics as a function of both mechanical parameters and DNA sequence. The methods for establishing successful optical trapping and nanometer localization of single molecules are illustrated. We illustrate the experimental conditions allowing the study of interaction of lactose repressor (lacI), labeled with Atto532, with a DNA molecule containing specific target sequences (operators) for LacI binding. The method allows the observation of specific interactions at the operators, as well as one-dimensional diffusion of the protein during the process of target search. The method is broadly applicable to the study of protein-DNA interactions but also to molecular motors, where control of the tension applied to the partner track polymer (for example actin or microtubules) is desirable.

  3. Combining Single-molecule Manipulation and Imaging for the Study of Protein-DNA Interactions

    PubMed Central

    Monico, Carina; Belcastro, Gionata; Vanzi, Francesco; Pavone, Francesco S.; Capitanio, Marco

    2014-01-01

    The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method offers the opportunity of investigating interactions occurring in solution (thus avoiding problems due to closeby surfaces as in other single molecule methods), controlling the DNA extension and tracking interaction dynamics as a function of both mechanical parameters and DNA sequence. The methods for establishing successful optical trapping and nanometer localization of single molecules are illustrated. We illustrate the experimental conditions allowing the study of interaction of lactose repressor (lacI), labeled with Atto532, with a DNA molecule containing specific target sequences (operators) for LacI binding. The method allows the observation of specific interactions at the operators, as well as one-dimensional diffusion of the protein during the process of target search. The method is broadly applicable to the study of protein-DNA interactions but also to molecular motors, where control of the tension applied to the partner track polymer (for example actin or microtubules) is desirable. PMID:25226304

  4. Electrochemiluminescence induced photoelectrochemistry for sensing of the DNA based on DNA-linked CdS NPs superstructure with intercalator molecules.

    PubMed

    Guo, Yingshu; Sun, Yuanshun; Zhang, Shusheng

    2011-02-07

    A novel detection protocol of DNA was developed using electrochemiluminescence (ECL) induced photoelectrochemistry (PEC) synthesis based on DNA-linked CdS NPs superstructure with methylene blue as the intercalator molecule.

  5. True single-molecule DNA sequencing of a pleistocene horse bone

    PubMed Central

    Orlando, Ludovic; Ginolhac, Aurelien; Raghavan, Maanasa; Vilstrup, Julia; Rasmussen, Morten; Magnussen, Kim; Steinmann, Kathleen E.; Kapranov, Philipp; Thompson, John F.; Zazula, Grant; Froese, Duane; Moltke, Ida; Shapiro, Beth; Hofreiter, Michael; Al-Rasheid, Khaled A.S.; Gilbert, M. Thomas P.; Willerslev, Eske

    2011-01-01

    Second-generation sequencing platforms have revolutionized the field of ancient DNA, opening access to complete genomes of past individuals and extinct species. However, these platforms are dependent on library construction and amplification steps that may result in sequences that do not reflect the original DNA template composition. This is particularly true for ancient DNA, where templates have undergone extensive damage post-mortem. Here, we report the results of the first “true single molecule sequencing” of ancient DNA. We generated 115.9 Mb and 76.9 Mb of DNA sequences from a permafrost-preserved Pleistocene horse bone using the Helicos HeliScope and Illumina GAIIx platforms, respectively. We find that the percentage of endogenous DNA sequences derived from the horse is higher among the Helicos data than Illumina data. This result indicates that the molecular biology tools used to generate sequencing libraries of ancient DNA molecules, as required for second-generation sequencing, introduce biases into the data that reduce the efficiency of the sequencing process and limit our ability to fully explore the molecular complexity of ancient DNA extracts. We demonstrate that simple modifications to the standard Helicos DNA template preparation protocol further increase the proportion of horse DNA for this sample by threefold. Comparison of Helicos-specific biases and sequence errors in modern DNA with those in ancient DNA also reveals extensive cytosine deamination damage at the 3′ ends of ancient templates, indicating the presence of 3′-sequence overhangs. Our results suggest that paleogenomes could be sequenced in an unprecedented manner by combining current second- and third-generation sequencing approaches. PMID:21803858

  6. How topoisomerase IV can efficiently unknot and decatenate negatively supercoiled DNA molecules without causing their torsional relaxation.

    PubMed

    Rawdon, Eric J; Dorier, Julien; Racko, Dusan; Millett, Kenneth C; Stasiak, Andrzej

    2016-06-02

    Freshly replicated DNA molecules initially form multiply interlinked right-handed catenanes. In bacteria, these catenated molecules become supercoiled by DNA gyrase before they undergo a complete decatenation by topoisomerase IV (Topo IV). Topo IV is also involved in the unknotting of supercoiled DNA molecules. Using Metropolis Monte Carlo simulations, we investigate the shapes of supercoiled DNA molecules that are either knotted or catenated. We are especially interested in understanding how Topo IV can unknot right-handed knots and decatenate right-handed catenanes without acting on right-handed plectonemes in negatively supercoiled DNA molecules. To this end, we investigate how the topological consequences of intersegmental passages depend on the geometry of the DNA-DNA juxtapositions at which these passages occur. We observe that there are interesting differences between the geometries of DNA-DNA juxtapositions in the interwound portions and in the knotted or catenated portions of the studied molecules. In particular, in negatively supercoiled, multiply interlinked, right-handed catenanes, we detect specific regions where DNA segments belonging to two freshly replicated sister DNA molecules form left-handed crossings. We propose that, due to its geometrical preference to act on left-handed crossings, Topo IV can specifically unknot supercoiled DNA, as well as decatenate postreplicative catenanes, without causing their torsional relaxation.

  7. How topoisomerase IV can efficiently unknot and decatenate negatively supercoiled DNA molecules without causing their torsional relaxation

    PubMed Central

    Rawdon, Eric J.; Dorier, Julien; Racko, Dusan; Millett, Kenneth C.; Stasiak, Andrzej

    2016-01-01

    Freshly replicated DNA molecules initially form multiply interlinked right-handed catenanes. In bacteria, these catenated molecules become supercoiled by DNA gyrase before they undergo a complete decatenation by topoisomerase IV (Topo IV). Topo IV is also involved in the unknotting of supercoiled DNA molecules. Using Metropolis Monte Carlo simulations, we investigate the shapes of supercoiled DNA molecules that are either knotted or catenated. We are especially interested in understanding how Topo IV can unknot right-handed knots and decatenate right-handed catenanes without acting on right-handed plectonemes in negatively supercoiled DNA molecules. To this end, we investigate how the topological consequences of intersegmental passages depend on the geometry of the DNA-DNA juxtapositions at which these passages occur. We observe that there are interesting differences between the geometries of DNA-DNA juxtapositions in the interwound portions and in the knotted or catenated portions of the studied molecules. In particular, in negatively supercoiled, multiply interlinked, right-handed catenanes, we detect specific regions where DNA segments belonging to two freshly replicated sister DNA molecules form left-handed crossings. We propose that, due to its geometrical preference to act on left-handed crossings, Topo IV can specifically unknot supercoiled DNA, as well as decatenate postreplicative catenanes, without causing their torsional relaxation. PMID:27106058

  8. [The effect of spermine on acid-base equilibrium in DNA molecule].

    PubMed

    Slonitskiĭ, S V; Kuptsov, V Iu

    1990-01-01

    The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.

  9. Measuring p53 Binding to Single DNA Molecules in a Nanofluidic Device

    NASA Astrophysics Data System (ADS)

    Whelsky, Amber; Gonzalez, Nicholas, Jr.; Gal, Susannah; Levy, Stephen

    2012-02-01

    Protein-DNA binding is central to several important cellular processes, for instance, the transfer of genetic information into proteins. The p53 protein plays a central role in regulating several major cell cycle pathways, in part by binding to well-characterized DNA sequences in the promoters of specific genes. Recent studies show that the most common mutation to the protein occurs in the region responsible for its binding to DNA. We have fabricated slit-like nanofluidic devices that allow us to trap and stretch single molecules of DNA containing a known recognition sequence of p53. We use fluorescent microscopy to observe the diffusion of a single p53 protein as it searches for its DNA recognition site. We measure the reaction rates of binding to selected DNA sequences as well as the one-dimensional, non-sequence specific diffusion of p53 along a stretched DNA molecule as a function of salt concentration. The mechanism of facilitated diffusion attempts to explain how proteins seem able to find their DNA target sequences much more quickly than would be expected from three-dimensional diffusion alone. We compare the observed search mechanism used by normal and mutated p53 from cancer cells to predictions based on this theory.

  10. Direct measurement of interaction forces between a platinum dichloride complex and DNA molecules.

    PubMed

    Muramatsu, Hiroshi; Shimada, Shogo; Okada, Tomoko

    2017-06-29

    The interaction forces between a platinum dichloride complex and DNA molecules have been studied using atomic force microscopy (AFM). The platinum dichloride complex, di-dimethylsulfoxide-dichloroplatinum (II) (Pt(DMSO)2Cl2), was immobilized on an AFM probe by coordinating the platinum to two amino groups to form a complex similar to Pt(en)Cl2, which is structurally similar to cisplatin. The retraction forces were measured between the platinum complex and DNA molecules immobilized on mica plates using force curve measurements. The histogram of the retraction force for λ-DNA showed several peaks; the unit retraction force was estimated to be 130 pN for a pulling rate of 60 nm/s. The retraction forces were also measured separately for four single-base DNA oligomers (adenine, guanine, thymine, and cytosine). Retraction forces were frequently observed in the force curves for the DNA oligomers of guanine and adenine. For the guanine DNA oligomer, the most frequent retraction force was slightly lower than but very similar to the retraction force for λ-DNA. A higher retraction force was obtained for the adenine DNA oligomer than for the guanine oligomer. This result is consistent with a higher retraction activation energy of adenine with the Pt complex being than that of guanine because the kinetic rate constant for retraction correlates to exp(FΔx - ΔE) where ΔE is an activation energy, F is an applied force, and Δx is a displacement of distance.

  11. Dynamics of topological events within single molecules of DNA confined in nanochannels

    NASA Astrophysics Data System (ADS)

    Reifenberger, Jeffrey; Dorfman, Kevin; Cao, Han

    Genome mapping in nanochannels offers the ability to search for large genomic rearrangements within individual molecules of DNA often missed by sequencing techniques. This method labels DNA at specific sequence motifs such as `GCTCTTC' with a cy3-like fluorophore and then stains the backbone of dsDNA with an intercalating dye. DNA is electrophoretically loaded into an array of nanofluidic channels and linearized in physically confined narrow conduits fabricated on the silicon chip. The fluorescently labeled sequence motifs, unique to long genomic regions, are optically imaged and digitized reflecting structural changes that can occur within cancer. However, some molecules of DNA confined within the ~42 nm wide nanochannels contain topological structures: knots, S-folds, and end-folds that could appear as false genomic rearrangements. We present a technique in which thousands of molecules of E. coli DNA are sequentially imaged in the nanochannels during several minutes allowing for topological events like diffusion of knots, unfolding at the ends, and spontaneous formation of S-folds to be measured. This technology will provide insights and a solution in error correction for making more accurate measurements. NIH R01-HG006851.

  12. Integrated view of genome structure and sequence of a single DNA molecule in a nanofluidic device

    PubMed Central

    Marie, Rodolphe; Pedersen, Jonas N.; Bauer, David L. V.; Rasmussen, Kristian H.; Yusuf, Mohammed; Volpi, Emanuela; Flyvbjerg, Henrik; Kristensen, Anders; Mir, Kalim U.

    2013-01-01

    We show how a bird’s-eye view of genomic structure can be obtained at ∼1-kb resolution from long (∼2 Mb) DNA molecules extracted from whole chromosomes in a nanofluidic laboratory-on-a-chip. We use an improved single-molecule denaturation mapping approach to detect repetitive elements and known as well as unique structural variation. Following its mapping, a molecule of interest was rescued from the chip; amplified and localized to a chromosome by FISH; and interrogated down to 1-bp resolution with a commercial sequencer, thereby reconciling haplotype-phased chromosome substructure with sequence. PMID:23479649

  13. Lesion search and recognition by thymine DNA glycosylase revealed by single molecule imaging.

    PubMed

    Buechner, Claudia N; Maiti, Atanu; Drohat, Alexander C; Tessmer, Ingrid

    2015-03-11

    The ability of DNA glycosylases to rapidly and efficiently detect lesions among a vast excess of nondamaged DNA bases is vitally important in base excision repair (BER). Here, we use single molecule imaging by atomic force microscopy (AFM) supported by a 2-aminopurine fluorescence base flipping assay to study damage search by human thymine DNA glycosylase (hTDG), which initiates BER of mutagenic and cytotoxic G:T and G:U mispairs in DNA. Our data reveal an equilibrium between two conformational states of hTDG-DNA complexes, assigned as search complex (SC) and interrogation complex (IC), both at target lesions and undamaged DNA sites. Notably, for both hTDG and a second glycosylase, hOGG1, which recognizes structurally different 8-oxoguanine lesions, the conformation of the DNA in the SC mirrors innate structural properties of their respective target sites. In the IC, the DNA is sharply bent, as seen in crystal structures of hTDG lesion recognition complexes, which likely supports the base flipping required for lesion identification. Our results support a potentially general concept of sculpting of glycosylases to their targets, allowing them to exploit the energetic cost of DNA bending for initial lesion sensing, coupled with continuous (extrahelical) base interrogation during lesion search by DNA glycosylases. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Lesion search and recognition by thymine DNA glycosylase revealed by single molecule imaging

    PubMed Central

    Buechner, Claudia N.; Maiti, Atanu; Drohat, Alexander C.; Tessmer, Ingrid

    2015-01-01

    The ability of DNA glycosylases to rapidly and efficiently detect lesions among a vast excess of nondamaged DNA bases is vitally important in base excision repair (BER). Here, we use single molecule imaging by atomic force microscopy (AFM) supported by a 2-aminopurine fluorescence base flipping assay to study damage search by human thymine DNA glycosylase (hTDG), which initiates BER of mutagenic and cytotoxic G:T and G:U mispairs in DNA. Our data reveal an equilibrium between two conformational states of hTDG–DNA complexes, assigned as search complex (SC) and interrogation complex (IC), both at target lesions and undamaged DNA sites. Notably, for both hTDG and a second glycosylase, hOGG1, which recognizes structurally different 8-oxoguanine lesions, the conformation of the DNA in the SC mirrors innate structural properties of their respective target sites. In the IC, the DNA is sharply bent, as seen in crystal structures of hTDG lesion recognition complexes, which likely supports the base flipping required for lesion identification. Our results support a potentially general concept of sculpting of glycosylases to their targets, allowing them to exploit the energetic cost of DNA bending for initial lesion sensing, coupled with continuous (extrahelical) base interrogation during lesion search by DNA glycosylases. PMID:25712093

  15. Self-assembly of molecule-like nanoparticle clusters directed by DNA nanocages.

    PubMed

    Li, Yulin; Liu, Zhiyu; Yu, Guimei; Jiang, Wen; Mao, Chengde

    2015-04-08

    Analogous to the atom-molecule relationship, nanoparticle (NP) clusters (or NP-molecules) with defined compositions and directional bonds could potentially integrate the properties of the component individual NPs, leading to emergent properties. Despite extensive efforts in this direction, no general approach is available for assembly of such NP-molecules. Here we report a general method for building this type of structures by encapsulating NPs into self-assembled DNA polyhedral wireframe nanocages, which serve as guiding agents for further assembly. As a demonstration, a series of NP-molecules have been assembled and validated. Such NP-molecules will, we believe, pave a way to explore new nanomaterials with emergent functions/properties that are related to, but do not belong to the individual component nanoparticles.

  16. Improving the performance of true single molecule sequencing for ancient DNA

    PubMed Central

    2012-01-01

    Background Second-generation sequencing technologies have revolutionized our ability to recover genetic information from the past, allowing the characterization of the first complete genomes from past individuals and extinct species. Recently, third generation Helicos sequencing platforms, which perform true Single-Molecule DNA Sequencing (tSMS), have shown great potential for sequencing DNA molecules from Pleistocene fossils. Here, we aim at improving even further the performance of tSMS for ancient DNA by testing two novel tSMS template preparation methods for Pleistocene bone fossils, namely oligonucleotide spiking and treatment with DNA phosphatase. Results We found that a significantly larger fraction of the horse genome could be covered following oligonucleotide spiking however not reproducibly and at the cost of extra post-sequencing filtering procedures and skewed %GC content. In contrast, we showed that treating ancient DNA extracts with DNA phosphatase improved the amount of endogenous sequence information recovered per sequencing channel by up to 3.3-fold, while still providing molecular signatures of endogenous ancient DNA damage, including cytosine deamination and fragmentation by depurination. Additionally, we confirmed the existence of molecular preservation niches in large bone crystals from which DNA could be preferentially extracted. Conclusions We propose DNA phosphatase treatment as a mechanism to increase sequence coverage of ancient genomes when using Helicos tSMS as a sequencing platform. Together with mild denaturation temperatures that favor access to endogenous ancient templates over modern DNA contaminants, this simple preparation procedure can improve overall Helicos tSMS performance when damaged DNA templates are targeted. PMID:22574620

  17. Effects of physiological self-crowding of DNA on shape and biological properties of DNA molecules with various levels of supercoiling

    PubMed Central

    Benedetti, Fabrizio; Japaridze, Aleksandre; Dorier, Julien; Racko, Dusan; Kwapich, Robert; Burnier, Yannis; Dietler, Giovanni; Stasiak, Andrzej

    2015-01-01

    DNA in bacterial chromosomes and bacterial plasmids is supercoiled. DNA supercoiling is essential for DNA replication and gene regulation. However, the density of supercoiling in vivo is circa twice smaller than in deproteinized DNA molecules isolated from bacteria. What are then the specific advantages of reduced supercoiling density that is maintained in vivo? Using Brownian dynamics simulations and atomic force microscopy we show here that thanks to physiological DNA–DNA crowding DNA molecules with reduced supercoiling density are still sufficiently supercoiled to stimulate interaction between cis-regulatory elements. On the other hand, weak supercoiling permits DNA molecules to modulate their overall shape in response to physiological changes in DNA crowding. This plasticity of DNA shapes may have regulatory role and be important for the postreplicative spontaneous segregation of bacterial chromosomes. PMID:25653164

  18. Mitochondrial genome of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa): A linear DNA molecule encoding a putative DNA-dependent DNA polymerase.

    PubMed

    Shao, Zhiyong; Graf, Shannon; Chaga, Oleg Y; Lavrov, Dennis V

    2006-10-15

    The 16,937-nuceotide sequence of the linear mitochondrial DNA (mt-DNA) molecule of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa) - the first mtDNA sequence from the class Scypozoa and the first sequence of a linear mtDNA from Metazoa - has been determined. This sequence contains genes for 13 energy pathway proteins, small and large subunit rRNAs, and methionine and tryptophan tRNAs. In addition, two open reading frames of 324 and 969 base pairs in length have been found. The deduced amino-acid sequence of one of them, ORF969, displays extensive sequence similarity with the polymerase [but not the exonuclease] domain of family B DNA polymerases, and this ORF has been tentatively identified as dnab. This is the first report of dnab in animal mtDNA. The genes in A. aurita mtDNA are arranged in two clusters with opposite transcriptional polarities; transcription proceeding toward the ends of the molecule. The determined sequences at the ends of the molecule are nearly identical but inverted and lack any obvious potential secondary structures or telomere-like repeat elements. The acquisition of mitochondrial genomic data for the second class of Cnidaria allows us to reconstruct characteristic features of mitochondrial evolution in this animal phylum.

  19. Single-Molecule Study of Protein-Protein and Protein-DNA Interaction Dynamics

    SciTech Connect

    Lu, H. PETER

    2005-03-01

    Protein-protein and protein-DNA interactions play critical roles in biological functions of living cells, such as cell signaling, receptor-ligand activation, cellular metabolism, DNA damage recognition and repair, gene expression, replication, etc. These protein interactions often involve complex mechanisms and inhomogeneous dynamics with significant conformational changes. Protein-protein, protein-ligand, and protein-DNA interactions are often intrinsically single-molecule processes at an induction stage associated with the initiation of crucial early eents in living cells. For example, cell-signaling processes are often initiated through a few copies of protein-interaction complexes, being amplified along the signaling pathway.

  20. A single molecule study of G-quadruplex and short duplex DNA structures

    NASA Astrophysics Data System (ADS)

    Roy, William A., Jr.

    Given that certain conditions are met, a single stranded DNA/RNA (ssDNA/RNA) structure called G-quadruplex (GQ) can form in regions throughout the genome, including at the telomeres and internal regions of the chromosomes. These structures serve various functions depending on the region in which they form which include protecting the chromosome ends, interfering with telomere elongation in cancer cells, and regulating transcription and translation level gene expression. Due to their high stability, various cellular mechanisms, such as GQ destabilizing proteins, are employed to unfold these structures during DNA replication or repair. Yet, their distinct layered structure has made GQs an attractive drug target in cancer treatment as GQ stabilizing molecules could inhibit telomerase dependent telomere elongation, a mechanism occurring in the majority of cancer cells to avoid senescence and apoptosis. However, proteins or small molecules interact with GQ that is under the influence of various cellular tension mechanisms, including the tension applied by other nearby molecules or the tension due to DNA structure within the chromatin context. Therefore, it is important to characterize the stability of various GQs and their response to interacting molecules when subjected to a tensile force. We employed a novel DNA-based nano tension generator that utilizes the elastic properties of circularized short double-stranded DNA (dsDNA) oligonucleotides to apply tension on the GQ. Since this is a completely new approach, the majority of this thesis was dedicated to proof-of-principle studies that demonstrated the feasibility and functionality of the method.

  1. Computational methods for the construction, editing, and error correction of DNA molecules and their libraries.

    PubMed

    Raz, Ofir; Ben Yehezkel, Tuval

    2015-01-01

    The field of synthetic biology is fueled by steady advances in our ability to produce designer genetic material on demand. This relatively new technological capability stems from advancements in DNA construction biochemistry as well as supporting computational technologies such as tools for specifying large DNA libraries, as well as planning and optimizing their actual physical construction. In particular, the design, planning, and construction of user specified, combinatorial DNA libraries are of increasing interest. Here we present some of the computational tools we have built over the past decade to support the multidisciplinary task of constructing DNA molecules and their libraries. These technologies encompass computational methods for [1] planning and optimizing the construction of DNA molecules and libraries, [2] the utilization of existing natural or synthetic fragments, [3] identification of shared fragments, [4] planning primers and overlaps, [5] minimizing the number of assembly steps required, and (6) correcting erroneous constructs. Other computational technologies that are important in the overall process of DNA construction, such as [1] computational tools for efficient specification and intuitive visualization of large DNA libraries (which aid in debugging library design pre-construction) and [2] automated liquid handling robotic programming [Linshiz et al., Mol Syst Biol 4:191, 2008; Shabi et al., Syst Synth Biol 4:227-236, 2010], which aid in the construction process itself, have been omitted due to length limitations.

  2. Visualizing protein-DNA interactions in live bacterial cells using photoactivated single-molecule tracking.

    PubMed

    Uphoff, Stephan; Sherratt, David J; Kapanidis, Achillefs N

    2014-03-10

    Protein-DNA interactions are at the heart of many fundamental cellular processes. For example, DNA replication, transcription, repair, and chromosome organization are governed by DNA-binding proteins that recognize specific DNA structures or sequences. In vitro experiments have helped to generate detailed models for the function of many types of DNA-binding proteins, yet, the exact mechanisms of these processes and their organization in the complex environment of the living cell remain far less understood. We recently introduced a method for quantifying DNA-repair activities in live Escherichia coli cells using Photoactivated Localization Microscopy (PALM) combined with single-molecule tracking. Our general approach identifies individual DNA-binding events by the change in the mobility of a single protein upon association with the chromosome. The fraction of bound molecules provides a direct quantitative measure for the protein activity and abundance of substrates or binding sites at the single-cell level. Here, we describe the concept of the method and demonstrate sample preparation, data acquisition, and data analysis procedures.

  3. Theory and simulations of toroidal and rod-like structures in single-molecule DNA condensation.

    PubMed

    Cortini, Ruggero; Caré, Bertrand R; Victor, Jean-Marc; Barbi, Maria

    2015-03-14

    DNA condensation by multivalent cations plays a crucial role in genome packaging in viruses and sperm heads, and has been extensively studied using single-molecule experimental methods. In those experiments, the values of the critical condensation forces have been used to estimate the amplitude of the attractive DNA-DNA interactions. Here, to describe these experiments, we developed an analytical model and a rigid body Langevin dynamics assay to investigate the behavior of a polymer with self-interactions, in the presence of a traction force applied at its extremities. We model self-interactions using a pairwise attractive potential, thereby treating the counterions implicitly. The analytical model allows to accurately predict the equilibrium structures of toroidal and rod-like condensed structures, and the dependence of the critical condensation force on the DNA length. We find that the critical condensation force depends strongly on the length of the DNA, and finite-size effects are important for molecules of length up to 10(5)μm. Our Langevin dynamics simulations show that the force-extension behavior of the rod-like structures is very different from the toroidal ones, so that their presence in experiments should be easily detectable. In double-stranded DNA condensation experiments, the signature of the presence of rod-like structures was not unambiguously detected, suggesting that the polyamines used to condense DNA may protect it from bending sharply as needed in the rod-like structures.

  4. Lac Repressor Mediated DNA Looping: Monte Carlo Simulation of Constrained DNA Molecules Complemented with Current Experimental Results

    PubMed Central

    Biton, Yoav Y.; Kumar, Sandip; Dunlap, David; Swigon, David

    2014-01-01

    Tethered particle motion (TPM) experiments can be used to detect time-resolved loop formation in a single DNA molecule by measuring changes in the length of a DNA tether. Interpretation of such experiments is greatly aided by computer simulations of DNA looping which allow one to analyze the structure of the looped DNA and estimate DNA-protein binding constants specific for the loop formation process. We here present a new Monte Carlo scheme for accurate simulation of DNA configurations subject to geometric constraints and apply this method to Lac repressor mediated DNA looping, comparing the simulation results with new experimental data obtained by the TPM technique. Our simulations, taking into account the details of attachment of DNA ends and fluctuations of the looped subsegment of the DNA, reveal the origin of the double-peaked distribution of RMS values observed by TPM experiments by showing that the average RMS value for anti-parallel loop types is smaller than that of parallel loop types. The simulations also reveal that the looping probabilities for the anti-parallel loop types are significantly higher than those of the parallel loop types, even for loops of length 600 and 900 base pairs, and that the correct proportion between the heights of the peaks in the distribution can only be attained when loops with flexible Lac repressor conformation are taken into account. Comparison of the in silico and in vitro results yields estimates for the dissociation constants characterizing the binding affinity between O1 and Oid DNA operators and the dimeric arms of the Lac repressor. PMID:24800809

  5. Investigation of localization of DNA molecules using triangular metal electrodes with varying separation

    NASA Astrophysics Data System (ADS)

    Prasad, D. Nagendra; Ghonge, Sudarshan; Banerjee, Souri

    2016-04-01

    In this paper we investigate the effect of separation of triangular metal electrodes with both convex and concave geometries, on the localization of suspended DNA molecules under the combined effect of dielectrophoresis and AC electro-osmosis through simulations using COMSOL Multiphysics. Trapping points are realized within the electrodes which are found to vary with the separation of the electrodes.

  6. Nanoconstructions on the base of double-stranded DNA molecules and their optical properties

    NASA Astrophysics Data System (ADS)

    Skuridin, S. G.; Yevdokimov, Yu. M.; Chulkov, D. P.; Gusev, V. M.; Kompanets, O. N.; Vereschagin, F. V.

    2016-12-01

    Experimental results have been presented on studying optical properties of nanoconstructions formed of orientationally ordered neighbouring double-stranded DNA molecules in the structure of their liquid-crystalline phases and dispersion particles of these phases including ones cured with intercalators.

  7. Single-molecule observations of RNA-RNA kissing interactions in a DNA nanostructure.

    PubMed

    Takeuchi, Yosuke; Endo, Masayuki; Suzuki, Yuki; Hidaka, Kumi; Durand, Guillaume; Dausse, Eric; Toulmé, Jean-Jacques; Sugiyama, Hiroshi

    2016-01-01

    RNA molecules uniquely form a complex through specific hairpin loops, called a kissing complex. The kissing complex is widely investigated and used for the construction of RNA nanostructures. Molecular switches have also been created by combining a kissing loop and a ligand-binding aptamer to control the interactions of RNA molecules. In this study, we incorporated two kinds of RNA molecules into a DNA origami structure and used atomic force microscopy to observe their ligand-responsive interactions at the single-molecule level. We used a designed RNA aptamer called GTPswitch, which has a guanosine triphosphate (GTP) responsive domain and can bind to the target RNA hairpin named Aptakiss in the presence of GTP. We observed shape changes of the DNA/RNA strands in the DNA origami, which are induced by the GTPswitch, into two different shapes in the absence and presence of GTP, respectively. We also found that the switching function in the nanospace could be improved by using a cover strand over the kissing loop of the GTPswitch or by deleting one base from this kissing loop. These newly designed ligand-responsive aptamers can be used for the controlled assembly of the various DNA and RNA nanostructures.

  8. Fluorescence enhancement of single DNA molecules confined in Si/SiO2 nanochannels.

    PubMed

    Westerlund, Fredrik; Persson, Fredrik; Kristensen, Anders; Tegenfeldt, Jonas O

    2010-08-21

    We demonstrate that the detected emission intensity from YOYO-labeled DNA molecules confined in 180 nm deep Si/SiO2 nanofunnels changes significantly and not monotonically with the width of the funnel. This effect may be of importance for quantitative fluorescence microscopy and for experiments with a tight photon budget.

  9. Topological events in single molecules of long genomic DNA confined in nanochannels

    NASA Astrophysics Data System (ADS)

    Reifenberger, Jeffrey; Dorfman, Kevin; Cao, Han

    2014-03-01

    ct- We present a rapid genome-wide analysis method based on new NanoChannel Array technology (IrysTM System) that confines and linearizes extremely long DNA molecules (100 to 1,000 kilobases) for direct image analysis at tens to hundred of gigabases per run. Genomic DNA is stained with YOYO and labeled specifically at the `GCTCTTC' sequence with fluorescent dyes allowing each molecule to be uniquely patterned and mapped to its corresponding reference. This high-throughput platform automates the imaging of such barcoded patterns on genomic DNA to identify wide spread structural variations in a genome. Here we describe a method to rule out possible topologically altered molecules in linear confinement by identifying possible topological events through a T-test looking for spikes in the fluorescence of the YOYO stained DNA backbone. These events are confirmed through aligning the marked individual molecules to a standard reference and measuring a distance differential between labels surrounding the suspected topological event compared to the reference. Such events could be flagged to distinguish from true structural variations.

  10. Homebuilt single-molecule scanning confocal fluorescence microscope studies of single DNA/protein interactions

    PubMed Central

    Zheng, Haocheng; Goldner, Lori S.; Leuba, Sanford H.

    2007-01-01

    Many technical improvements in fluorescence microscopy over the years have focused on decreasing background and increasing the signal to noise ratio (SNR). The scanning confocal fluorescence microscope (SCFM) represented a major improvement in these efforts. The SCFM acquires signal from a thin layer of a thick sample, rejecting light whose origin is not in the focal plane thereby dramatically decreasing the background signal. A second major innovation was the advent of high quantum-yield, low noise, single-photon counting detectors. The superior background rejection of SCFM combined with low-noise, high-yield detectors makes it possible to detect the fluorescence from single dye molecules. By labeling a DNA molecule or a DNA/protein complex with a donor/acceptor dye pair, fluorescence resonance energy transfer (FRET) can be used to track conformational changes in the molecule/complex itself, on a single molecule/complex basis. In this methods paper, we describe the core concepts of SCFM in the context of a study that uses FRET to reveal conformational fluctuations in individual Holliday junction DNA molecules and nucleosomal particles. We also discuss data processing methods for SCFM. PMID:17309845

  11. Homebuilt single-molecule scanning confocal fluorescence microscope studies of single DNA/protein interactions.

    PubMed

    Zheng, Haocheng; Goldner, Lori S; Leuba, Sanford H

    2007-03-01

    Many technical improvements in fluorescence microscopy over the years have focused on decreasing background and increasing the signal to noise ratio (SNR). The scanning confocal fluorescence microscope (SCFM) represented a major improvement in these efforts. The SCFM acquires signal from a thin layer of a thick sample, rejecting light whose origin is not in the focal plane thereby dramatically decreasing the background signal. A second major innovation was the advent of high quantum-yield, low noise, single-photon counting detectors. The superior background rejection of SCFM combined with low-noise, high-yield detectors makes it possible to detect the fluorescence from single-dye molecules. By labeling a DNA molecule or a DNA/protein complex with a donor/acceptor dye pair, fluorescence resonance energy transfer (FRET) can be used to track conformational changes in the molecule/complex itself, on a single molecule/complex basis. In this methods paper, we describe the core concepts of SCFM in the context of a study that uses FRET to reveal conformational fluctuations in individual Holliday junction DNA molecules and nucleosomal particles. We also discuss data processing methods for SCFM.

  12. The Dynamics of Entangled DNA Networks using Single-Molecule Methods

    NASA Astrophysics Data System (ADS)

    Chapman, Cole David

    Single molecule experiments were performed on DNA, a model polymer, and entangled DNA networks to explore diffusion within complex polymeric fluids and their linear and non-linear viscoelasticity. DNA molecules of varying length and topology were prepared using biological methods. An ensemble of individual molecules were then fluorescently labeled and tracked in blends of entangled linear and circular DNA to examine the dependence of diffusion on polymer length, topology, and blend ratio. Diffusion was revealed to possess a non-monotonic dependence on the blend ratio, which we believe to be due to a second-order effect where the threading of circular polymers by their linear counterparts greatly slows the mobility of the system. Similar methods were used to examine the diffusive and conformational behavior of DNA within highly crowded environments, comparable to that experienced within the cell. A previously unseen gamma distributed elongation of the DNA in the presence of crowders, proposed to be due to entropic effects and crowder mobility, was observed. Additionally, linear viscoelastic properties of entangled DNA networks were explored using active microrheology. Plateau moduli values verified for the first time the predicted independence from polymer length. However, a clear bead-size dependence was observed for bead radii less than ~3x the tube radius, a newly discovered limit, above which microrheology results are within the continuum limit and may access the bulk properties of the fluid. Furthermore, the viscoelastic properties of entangled DNA in the non-linear regime, where the driven beads actively deform the network, were also examined. By rapidly driving a bead through the network utilizing optical tweezers, then removing the trap and tracking the bead's subsequent motion we are able to model the system as an over-damped harmonic oscillator and find the elasticity to be dominated by stress-dependent entanglements.

  13. Adaptive resolution simulation of an atomistic DNA molecule in MARTINI salt solution

    NASA Astrophysics Data System (ADS)

    Zavadlav, J.; Podgornik, R.; Melo, M. N.; Marrink, S. J.; Praprotnik, M.

    2016-10-01

    We present a dual-resolution model of a deoxyribonucleic acid (DNA) molecule in a bathing solution, where we concurrently couple atomistic bundled water and ions with the coarse-grained MARTINI model of the solvent. We use our fine-grained salt solution model as a solvent in the inner shell surrounding the DNA molecule, whereas the solvent in the outer shell is modeled by the coarse-grained model. The solvent entities can exchange between the two domains and adapt their resolution accordingly. We critically asses the performance of our multiscale model in adaptive resolution simulations of an infinitely long DNA molecule, focusing on the structural characteristics of the solvent around DNA. Our analysis shows that the adaptive resolution scheme does not produce any noticeable artifacts in comparison to a reference system simulated in full detail. The effect of using a bundled-SPC model, required for multiscaling, compared to the standard free SPC model is also evaluated. Our multiscale approach opens the way for large scale applications of DNA and other biomolecules which require a large solvent reservoir to avoid boundary effects.

  14. The mechanics of DNA loops bridged by proteins unveiled by single-molecule experiments.

    PubMed

    Tardin, Catherine

    2017-08-10

    Protein-induced DNA bridging and looping is a common mechanism for various and essential processes in bacterial chromosomes. This mechanism is preserved despite the very different bacterial conditions and their expected influence on the thermodynamic and kinetic characteristics of the bridge formation and stability. Over the last two decades, single-molecule techniques carried out on in vitro DNA systems have yielded valuable results which, in combination with theoretical works, have clarified the effects of different parameters of nucleoprotein complexes on the protein-induced DNA bridging and looping process. In this review, I will outline the features that can be measured for such processes with various single-molecule techniques in use in the field. I will then describe both the experimental results and the theoretical models that illuminate the contribution of the DNA molecule itself as well as that of the bridging proteins in the DNA looping mechanism at play in the nucleoid of E. coli. Copyright © 2017. Published by Elsevier B.V.

  15. Structure and Stability of Individual DNA or RNA Hairpin Molecules Captured in an Ion Channel

    NASA Astrophysics Data System (ADS)

    Akeson, Mark

    2002-03-01

    Nanoscale pores can be used to analyze individual DNA or RNA molecules. For example, a prototype device based on the alpha-hemolysin protein permits serial examination of hundreds to thousands of molecules per minute. It is routinely used to identify individual polynucleotide homopolymers, and to read segments within single DNA or RNA block copolymers as they thread through a narrow, trans-membrane pore formed by the protein (1.5 nm limiting aperture). In recent reports, we have shown that this device can also be used to examine structural details of individual DNA or RNA hairpins at single base-pair precision. This is achieved by capturing each hairpin in a vestibule of the channel leading to the trans-membrane pore. Under a 120 mV applied voltage, ionic current through the channel is gated by the RNA or DNA hairpin as it is perched in the vestibule, resulting in a dynamic current pattern that is exquisitely sensitive to sequence identity. In this presentation, I will explain the ion channel device and then describe structural details of the hairpin molecules that can be resolved by the instrument. These include: i) Watson-Crick base-pair identity at the hairpin stem terminus; ii) duplex fraying caused by single base pair mismatches internal to the hairpin stem; and iii) A form (RNA) versus B form (DNA) helix conformation. I will then discuss alternative mechanisms that can account for the discrete gating patterns that underlie the analysis.

  16. Self-assembled nanowire arrays as three-dimensional nanopores for filtration of DNA molecules.

    PubMed

    Rahong, Sakon; Yasui, Takao; Yanagida, Takeshi; Nagashima, Kazuki; Kanai, Masaki; Meng, Gang; He, Yong; Zhuge, Fuwei; Kaji, Noritada; Kawai, Tomoji; Baba, Yoshinobu

    2015-01-01

    Molecular filtration and purification play important roles for biomolecule analysis. However, it is still necessary to improve efficiency and reduce the filtration time. Here, we show self-assembled nanowire arrays as three-dimensional (3D) nanopores embedded in a microfluidic channel for ultrafast DNA filtration. The 3D nanopore structure was formed by a vapor-liquid-solid (VLS) nanowire growth technique, which allowed us to control pore size of the filtration material by varying the number of growth cycles. λ DNA molecules (48.5 kbp) were filtrated from a mixture of T4 DNA (166 kbp) at the entrance of the 3D nanopore structure within 1 s under an applied electric field. Moreover, we observed single DNA molecule migration of T4 and λ DNA molecules to clarify the filtration mechanism. The 3D nanopore structure has simplicity of fabrication, flexibility of pore size control and reusability for biomolecule filtration. Consequently it is an excellent material for biomolecular filtration.

  17. Imaging and sizing of single DNA molecules on a mobile phone.

    PubMed

    Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan Lok; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

    2014-12-23

    DNA imaging techniques using optical microscopy have found numerous applications in biology, chemistry and physics and are based on relatively expensive, bulky and complicated set-ups that limit their use to advanced laboratory settings. Here we demonstrate imaging and length quantification of single molecule DNA strands using a compact, lightweight and cost-effective fluorescence microscope installed on a mobile phone. In addition to an optomechanical attachment that creates a high contrast dark-field imaging setup using an external lens, thin-film interference filters, a miniature dovetail stage and a laser-diode for oblique-angle excitation, we also created a computational framework and a mobile phone application connected to a server back-end for measurement of the lengths of individual DNA molecules that are labeled and stretched using disposable chips. Using this mobile phone platform, we imaged single DNA molecules of various lengths to demonstrate a sizing accuracy of <1 kilobase-pairs (kbp) for 10 kbp and longer DNA samples imaged over a field-of-view of ∼2 mm2.

  18. Synthesis and Single-Molecule Conductance Study of Redox-Active Ruthenium Complexes with Pyridyl and Dihydrobenzo[b]thiophene Anchoring Groups.

    PubMed

    Ozawa, Hiroaki; Baghernejad, Masoud; Al-Owaedi, Oday A; Kaliginedi, Veerabhadrarao; Nagashima, Takumi; Ferrer, Jaime; Wandlowski, Thomas; García-Suárez, Víctor M; Broekmann, Peter; Lambert, Colin J; Haga, Masa-Aki

    2016-08-26

    The ancillary ligands 4'-(4-pyridyl)-2,2':6',2''-terpyridine and 4'-(2,3-dihydrobenzo[b]thiophene)-2,2'-6',2"-terpyridine were used to synthesize two series of mono- and dinuclear ruthenium complexes differing in their lengths and anchoring groups. The electrochemical and single-molecular conductance properties of these two series of ruthenium complexes were studied experimentally by means of cyclic voltammetry and the scanning tunneling microscopy-break junction technique (STM-BJ) and theoretically by means of density functional theory (DFT). Cyclic voltammetry data showed clear redox peaks corresponding to both the metal- and ligand-related redox reactions. Single-molecular conductance demonstrated an exponential decay of the molecular conductance with the increase in molecular length for both the series of ruthenium complexes, with decay constants of βPY =2.07±0.1 nm(-1) and βBT =2.16±0.1 nm(-1) , respectively. The contact resistance of complexes with 2,3-dihydrobenzo[b]thiophene (BT) anchoring groups is found to be smaller than the contact resistance of ruthenium complexes with pyridine (PY) anchors. DFT calculations support the experimental results and provided additional information on the electronic structure and charge transport properties in those metal|ruthenium complex|metal junctions. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Structure of Escherichia coli dGTP Triphosphohydrolase: A Hexameric Enzyme with DNA Effector Molecules

    DOE PAGES

    Singh, Deepa; Gawel, Damian; Itsko, Mark; ...

    2015-02-18

    The Escherichia coli dgt gene encodes a dGTP triphosphohydrolase whose detailed role still remains to be determined. Deletion of dgt creates a mutator phenotype, indicating that the dGTPase has a fidelity role, possibly by affecting the cellular dNTP pool. In the present paper, we have investigated the structure of the Dgt protein at 3.1-Å resolution. One of the obtained structures revealed a protein hexamer that contained two molecules of single-stranded DNA. The presence of DNA caused significant conformational changes in the enzyme, including in the catalytic site of the enzyme. Dgt preparations lacking DNA were able to bind single-stranded DNAmore » with high affinity (Kd ~ 50 nM). DNA binding positively affected the activity of the enzyme: dGTPase activity displayed sigmoidal (cooperative) behavior without DNA but hyperbolic (Michaelis-Menten) kinetics in its presence, consistent with a specific lowering of the apparent Km for dGTP. A mutant Dgt enzyme was also created containing residue changes in the DNA binding cleft. This mutant enzyme, whereas still active, was incapable of DNA binding and could no longer be stimulated by addition of DNA. We also created an E. coli strain containing the mutant dgt gene on the chromosome replacing the wild-type gene. The mutant also displayed a mutator phenotype. Finally, our results provide insight into the allosteric regulation of the enzyme and support a physiologically important role of DNA binding.« less

  20. Replication of individual DNA molecules under electronic control using a protein nanopore

    NASA Astrophysics Data System (ADS)

    Olasagasti, Felix; Lieberman, Kate R.; Benner, Seico; Cherf, Gerald M.; Dahl, Joseph M.; Deamer, David W.; Akeson, Mark

    2010-11-01

    Nanopores can be used to analyse DNA by monitoring ion currents as individual strands are captured and driven through the pore in single file by an applied voltage. Here, we show that serial replication of individual DNA templates can be achieved by DNA polymerases held at the α-haemolysin nanopore orifice. Replication is blocked in the bulk phase, and is initiated only after the DNA is captured by the nanopore. We used this method, in concert with active voltage control, to observe DNA replication catalysed by bacteriophage T7 DNA polymerase (T7DNAP) and by the Klenow fragment of DNA polymerase I (KF). T7DNAP advanced on a DNA template against an 80-mV load applied across the nanopore, and single nucleotide additions were measured on the millisecond timescale for hundreds of individual DNA molecules in series. Replication by KF was not observed when this enzyme was held on top of the nanopore orifice at an applied potential of 80 mV. Sequential nucleotide additions by KF were observed upon applying controlled voltage reversals.

  1. Motion of a DNA Sliding Clamp Observed by Single Molecule Fluorescence Spectroscopy*S⃞

    PubMed Central

    Laurence, Ted A.; Kwon, Youngeun; Johnson, Aaron; Hollars, Christopher W.; O'Donnell, Mike; Camarero, Julio A.; Barsky, Daniel

    2008-01-01

    DNA sliding clamps attach to polymerases and slide along DNA to allow rapid, processive replication of DNA. These clamps contain many positively charged residues that could curtail the sliding due to attractive interactions with the negatively charged DNA. By single-molecule spectroscopy we have observed a fluorescently labeled sliding clamp (polymerase III β subunit or β clamp) loaded onto freely diffusing, single-stranded M13 circular DNA annealed with fluorescently labeled DNA oligomers of up to 90 bases. We find that the diffusion constant for the β clamp diffusing along DNA is on the order of 10–14 m2/s, at least 3 orders of magnitude less than that for diffusion through water alone. We also find evidence that the β clamp remains at the 3′ end in the presence of Escherichia coli single-stranded-binding protein. These results may imply that the clamp not only acts to hold the polymerase on the DNA but also prevents excessive drifting along the DNA. PMID:18556658

  2. Direct Measurement of Single-Molecule DNA Hybridization Dynamics with Single-Base Resolution.

    PubMed

    He, Gen; Li, Jie; Ci, Haina; Qi, Chuanmin; Guo, Xuefeng

    2016-07-25

    Herein, we report label-free detection of single-molecule DNA hybridization dynamics with single-base resolution. By using an electronic circuit based on point-decorated silicon nanowires as electrical probes, we directly record the folding/unfolding process of individual hairpin DNAs with sufficiently high signal-to-noise ratio and bandwidth. These measurements reveal two-level current oscillations with strong temperature dependence, enabling us to determine the thermodynamic and kinetic properties of hairpin DNA hybridization. More importantly, successive, stepwise increases and decreases in device conductance at low temperature on a microsecond timescale are successfully observed, indicating a base-by-base unfolding/folding process. The process demonstrates a kinetic zipper model for DNA hybridization/dehybridization at the single base-pair level. This measurement capability promises a label-free single-molecule approach to probe biomolecular interactions with fast dynamics.

  3. Sequence specific sorting of DNA molecules with FACS using 3dPCR.

    PubMed

    Sukovich, David J; Lance, Shea T; Abate, Adam R

    2017-01-04

    Genetic heterogeneity is an important feature of many biological systems, but introduces technical challenges to their characterization. Even with the best modern instruments, only a small fraction of DNA molecules present in a sample can be read, and they are recovered in the form of short, hundred-base reads. In this paper, we introduce 3dPCR, a method to sort DNA molecules with sequence specificity. 3dPCR allows heterogeneous populations of DNA to be sorted to recover long targets for deep sequencing. It is valuable whenever a target sequence is rare in a mixed population, such as for characterizing mutations in heterogeneous cancer cell populations or identifying cells containing a specific genetic sequence or infected with a target virus.

  4. Single-molecule observation of DNA compaction by meiotic protein SYCP3

    PubMed Central

    Syrjänen, Johanna L; Heller, Iddo; Candelli, Andrea; Davies, Owen R; Peterman, Erwin J G; Wuite, Gijs J L; Pellegrini, Luca

    2017-01-01

    In a previous paper (Syrjänen et al., 2014), we reported the first structural characterisation of a synaptonemal complex (SC) protein, SYCP3, which led us to propose a model for its role in chromosome compaction during meiosis. As a component of the SC lateral element, SYCP3 has a critical role in defining the specific chromosome architecture required for correct meiotic progression. In the model, the reported compaction of chromosomal DNA caused by SYCP3 would result from its ability to bridge distant sites on a DNA molecule with the DNA-binding domains located at each end of its strut-like structure. Here, we describe a single-molecule assay based on optical tweezers, fluorescence microscopy and microfluidics that, in combination with bulk biochemical data, provides direct visual evidence for our proposed mechanism of SYCP3-mediated chromosome organisation. DOI: http://dx.doi.org/10.7554/eLife.22582.001 PMID:28287952

  5. Sequence specific sorting of DNA molecules with FACS using 3dPCR

    PubMed Central

    Sukovich, David J.; Lance, Shea T.; Abate, Adam R.

    2017-01-01

    Genetic heterogeneity is an important feature of many biological systems, but introduces technical challenges to their characterization. Even with the best modern instruments, only a small fraction of DNA molecules present in a sample can be read, and they are recovered in the form of short, hundred-base reads. In this paper, we introduce 3dPCR, a method to sort DNA molecules with sequence specificity. 3dPCR allows heterogeneous populations of DNA to be sorted to recover long targets for deep sequencing. It is valuable whenever a target sequence is rare in a mixed population, such as for characterizing mutations in heterogeneous cancer cell populations or identifying cells containing a specific genetic sequence or infected with a target virus. PMID:28051104

  6. Real-time single-molecule studies of the motions of DNA polymerase fingers illuminate DNA synthesis mechanisms.

    PubMed

    Evans, Geraint W; Hohlbein, Johannes; Craggs, Timothy; Aigrain, Louise; Kapanidis, Achillefs N

    2015-07-13

    DNA polymerases maintain genomic integrity by copying DNA with high fidelity. A conformational change important for fidelity is the motion of the polymerase fingers subdomain from an open to a closed conformation upon binding of a complementary nucleotide. We previously employed intra-protein single-molecule FRET on diffusing molecules to observe fingers conformations in polymerase-DNA complexes. Here, we used the same FRET ruler on surface-immobilized complexes to observe fingers-opening and closing of individual polymerase molecules in real time. Our results revealed the presence of intrinsic dynamics in the binary complex, characterized by slow fingers-closing and fast fingers-opening. When binary complexes were incubated with increasing concentrations of complementary nucleotide, the fingers-closing rate increased, strongly supporting an induced-fit model for nucleotide recognition. Meanwhile, the opening rate in ternary complexes with complementary nucleotide was 6 s(-1), much slower than either fingers closing or the rate-limiting step in the forward direction; this rate balance ensures that, after nucleotide binding and fingers-closing, nucleotide incorporation is overwhelmingly likely to occur. Our results for ternary complexes with a non-complementary dNTP confirmed the presence of a state corresponding to partially closed fingers and suggested a radically different rate balance regarding fingers transitions, which allows polymerase to achieve high fidelity.

  7. Superresolution imaging of single DNA molecules using stochastic photoblinking of minor groove and intercalating dyes.

    PubMed

    Miller, Helen; Zhou, Zhaokun; Wollman, Adam J M; Leake, Mark C

    2015-10-15

    As proof-of-principle for generating superresolution structural information from DNA we applied a method of localization microscopy utilizing photoblinking comparing intercalating dye YOYO-1 against minor groove binding dye SYTO-13, using a bespoke multicolor single-molecule fluorescence microscope. We used a full-length ∼49 kbp λ DNA construct possessing oligo inserts at either terminus allowing conjugation of digoxigenin and biotin at opposite ends for tethering to a glass coverslip surface and paramagnetic microsphere respectively. We observed stochastic DNA-bound dye photoactivity consistent with dye photoblinking as opposed to binding/unbinding events, evidenced through both discrete simulations and continuum kinetics analysis. We analyzed dye photoblinking images of immobilized DNA molecules using superresolution reconstruction software from two existing packages, rainSTORM and QuickPALM, and compared the results against our own novel home-written software called ADEMS code. ADEMS code generated lateral localization precision values of 30-40 nm and 60-70 nm for YOYO-1 and SYTO-13 respectively at video-rate sampling, similar to rainSTORM, running more slowly than rainSTORM and QuickPALM algorithms but having a complementary capability over both in generating automated centroid distribution and cluster analyses. Our imaging system allows us to observe dynamic topological changes to single molecules of DNA in real-time, such as rapid molecular snapping events. This will facilitate visualization of fluorescently-labeled DNA molecules conjugated to a magnetic bead in future experiments involving newly developed magneto-optical tweezers combined with superresolution microscopy.

  8. Binding of viral antigens to major histocompatibility complex class I H-2Db molecules is controlled by dominant negative elements at peptide non-anchor residues. Implications for peptide selection and presentation.

    PubMed

    Hudrisier, D; Mazarguil, H; Laval, F; Oldstone, M B; Gairin, J E

    1996-07-26

    Binding of viral antigens to major histocompatibility complex (MHC) class I molecules is a critical step in the activation process of CD8(+) cytotoxic T lymphocytes. In this study, we investigated the impact of structural factors at non-anchor residues in peptide-MHC interaction using the model of lymphocytic choriomeningitis virus (LCMV) infection of its natural host, the mouse. Altering viral genes by making reassortants, recombinants, and using synthetic peptides, CD8(+) cytotoxic T lymphocytes were shown to recognize only three H-2Db-restricted epitopes, GP amino acids 33-41/43, GP 276-286, and NP 396-404. However, LCMV NP and GP proteins contain 31 other peptides bearing the H-2Db motif. These 34 LCMV peptides and 11 other known H2-Db-restricted peptides were synthesized and examined for MHC binding properties. Despite the presence of the H-2Db binding motif, the majority of LCMV peptides showed weak or no affinity for H-2Db. We observed that dominant negative structural elements located at non-anchor positions played a crucial role in peptide-MHC interaction. By comparative sequence analysis of strong versus non-binders and using molecular modeling, we delineated these negative elements and evaluated their impact on peptide-MHC interaction. Our findings were validated by showing that a single mutation of a favorable non-anchor residue in the sequence of known viral epitopes for a negative element resulted in dramatic reduction of antigen presentation properties, while conversely, substitution of one negative for a positive element in the sequence of a non-binder conferred to the peptide an ability to now bind to MHC molecules.

  9. Rational design of DNA-actuated enzyme nanoreactors guided by single molecule analysis.

    PubMed

    Dhakal, Soma; Adendorff, Matthew R; Liu, Minghui; Yan, Hao; Bathe, Mark; Walter, Nils G

    2016-02-07

    The control of enzymatic reactions using nanoscale DNA devices offers a powerful application of DNA nanotechnology uniquely derived from actuation. However, previous characterization of enzymatic reaction rates using bulk biochemical assays reported suboptimal function of DNA devices such as tweezers. To gain mechanistic insight into this deficiency and to identify design rules to improve their function, here we exploit the synergy of single molecule imaging and computational modeling to characterize the three-dimensional structures and catalytic functions of DNA tweezer-actuated nanoreactors. Our analysis revealed two important deficiencies--incomplete closure upon actuation and conformational heterogeneity. Upon rational redesign of the Holliday junctions located at their hinge and arms, we found that the DNA tweezers could be more completely and uniformly closed. A novel single molecule enzyme assay was developed to demonstrate that our design improvements yield significant, independent enhancements in the fraction of active enzyme nanoreactors and their individual substrate turnover frequencies. The sequence-level design strategies explored here may aid more broadly in improving the performance of DNA-based nanodevices including biological and chemical sensors.

  10. A novel hybrid single molecule approach reveals spontaneous DNA motion in the nucleosome

    PubMed Central

    Wei, Sijie; Falk, Samantha J.; Black, Ben E.; Lee, Tae-Hee

    2015-01-01

    Structural dynamics of nucleic acid and protein is an important physical basis of their functions. These motions are often very difficult to synchronize and too fast to be clearly resolved with the currently available single molecule methods. Here we demonstrate a novel hybrid single molecule approach combining stochastic data analysis with fluorescence correlation that enables investigations of sub-ms unsynchronized structural dynamics of macromolecules. Based on the method, we report the first direct evidence of spontaneous DNA motions at the nucleosome termini. The nucleosome, comprising DNA and a histone core, is the fundamental packing unit of eukaryotic genes that must be accessed during various genome transactions. Spontaneous DNA opening at the nucleosome termini has long been hypothesized to enable gene access in the nucleosome, but has yet to be directly observed. Our approach reveals that DNA termini in the nucleosome open and close repeatedly at 0.1–1 ms−1. The kinetics depends on salt concentration and DNA–histone interactions but not much on DNA sequence, suggesting that this dynamics is universal and imposes the kinetic limit to gene access. These results clearly demonstrate that our method provides an efficient and robust means to investigate unsynchronized structural changes of DNA at a sub-ms time resolution. PMID:26013809

  11. Electrostatic Effects on the Elasticity of Single ssDNA Molecules

    NASA Astrophysics Data System (ADS)

    McIntosh, Dustin B.; Saleh, Omar A.

    2011-03-01

    Nucleic acids are highly-charged polyelectrolytes whose structure and function strongly depend on the concentration and type of salt ions in solution. We have created a simple experimental system for studying nucleic acid/ ion interactions, based on magnetic-tweezer measurements of the elasticity of single denatured ssDNA molecules in solutions with a known salt concentration. Using this system, we were able to reconcile single-molecule force-extension data with scaling theories of self-avoiding polymers, and we found that the Kuhn length of ssDNA scales with the Debye length in NaCl solutions. (Saleh et al., PRL 102, 068301 (2009)). Here, we use the system to investigate interactions of ssDNA with multivalent salts. We find that, in divalent salt, ssDNA elasticity is qualitatively similar to that in monovalent salt, but with significant quantitative differences. Notably, at low ionic strength, ssDNA in divalent salt maintains the same low-force scaling behavior (``Pincus blob'' regime) as seen in monovalent salts. However, there are differences in the elastic behavior at high forces (> afewpN) . Inaddition , analysisofthelow - forcescalingbehaviorindicatesitrequires ~100 fold smaller concentrations of divalent salt to condense ssDNA. We discuss the data in the context of electrostatic theories, including Debye-Huckel, as well as bulk experiments on similar systems.

  12. Single-Molecule Measurements of Synthesis by DNA Polymerase with Base-Pair Resolution

    NASA Astrophysics Data System (ADS)

    Christian, Thomas; Romano, Louis; Rueda, David

    2010-03-01

    The catalytic mechanism of DNA polymerases involves multiple steps that precede and follow the transfer of a nucleotide to the 3'-hydroxyl of the growing DNA chain. Here we report a single-molecule approach to monitor the movement of E. coli DNA polymerase I (Klenow fragment) on a DNA template during DNA synthesis with single base-pair resolution. As each nucleotide is incorporated, the single-molecule F"orster resonance energy transfer intensity drops in discrete steps to values consistent with single nucleotide incorporations. Purines and pyrimidines are incorporated with comparable rates. A mismatched primer-template junction exhibits dynamics consistent with the primer moving into the exonuclease domain, which was used to determine the fraction of primer-termini bound to the exonuclease and polymerase sites. Most interestingly, we observe a structural change following the incorporation of a correctly paired nucleotide, consistent with transient movement of the polymerase past the pre-insertion site or a conformational change in the polymerase. This may represent a previously unobserved step in the mechanism of DNA synthesis that could be part of the proofreading process.

  13. Antibacterial small molecules targeting the conserved TOPRIM domain of DNA gyrase

    PubMed Central

    Labroli, Marc; Painter, Ronald E.; Wiltsie, Judyann; Sherborne, Brad; Murgolo, Nicholas; Sher, Xinwei; Mann, Paul; Zuck, Paul; Garlisi, Charles G.; Su, Jing; Kargman, Stacia; Xiao, Li; Scapin, Giovanna; Salowe, Scott; Devito, Kristine; Sheth, Payal; Buist, Nichole; Tan, Christopher M.; Black, Todd A.; Roemer, Terry

    2017-01-01

    To combat the threat of antibiotic-resistant Gram-negative bacteria, novel agents that circumvent established resistance mechanisms are urgently needed. Our approach was to focus first on identifying bioactive small molecules followed by chemical lead prioritization and target identification. Within this annotated library of bioactives, we identified a small molecule with activity against efflux-deficient Escherichia coli and other sensitized Gram-negatives. Further studies suggested that this compound inhibited DNA replication and selection for resistance identified mutations in a subunit of E. coli DNA gyrase, a type II topoisomerase. Our initial compound demonstrated weak inhibition of DNA gyrase activity while optimized compounds demonstrated significantly improved inhibition of E. coli and Pseudomonas aeruginosa DNA gyrase and caused cleaved complex stabilization, a hallmark of certain bactericidal DNA gyrase inhibitors. Amino acid substitutions conferring resistance to this new class of DNA gyrase inhibitors reside exclusively in the TOPRIM domain of GyrB and are not associated with resistance to the fluoroquinolones, suggesting a novel binding site for a gyrase inhibitor. PMID:28700746

  14. Antibacterial small molecules targeting the conserved TOPRIM domain of DNA gyrase.

    PubMed

    Walker, Scott S; Labroli, Marc; Painter, Ronald E; Wiltsie, Judyann; Sherborne, Brad; Murgolo, Nicholas; Sher, Xinwei; Mann, Paul; Zuck, Paul; Garlisi, Charles G; Su, Jing; Kargman, Stacia; Xiao, Li; Scapin, Giovanna; Salowe, Scott; Devito, Kristine; Sheth, Payal; Buist, Nichole; Tan, Christopher M; Black, Todd A; Roemer, Terry

    2017-01-01

    To combat the threat of antibiotic-resistant Gram-negative bacteria, novel agents that circumvent established resistance mechanisms are urgently needed. Our approach was to focus first on identifying bioactive small molecules followed by chemical lead prioritization and target identification. Within this annotated library of bioactives, we identified a small molecule with activity against efflux-deficient Escherichia coli and other sensitized Gram-negatives. Further studies suggested that this compound inhibited DNA replication and selection for resistance identified mutations in a subunit of E. coli DNA gyrase, a type II topoisomerase. Our initial compound demonstrated weak inhibition of DNA gyrase activity while optimized compounds demonstrated significantly improved inhibition of E. coli and Pseudomonas aeruginosa DNA gyrase and caused cleaved complex stabilization, a hallmark of certain bactericidal DNA gyrase inhibitors. Amino acid substitutions conferring resistance to this new class of DNA gyrase inhibitors reside exclusively in the TOPRIM domain of GyrB and are not associated with resistance to the fluoroquinolones, suggesting a novel binding site for a gyrase inhibitor.

  15. Integrating Optical Tweezers, DNA Tightropes, and Single-Molecule Fluorescence Imaging: Pitfalls and Traps.

    PubMed

    Wang, J; Barnett, J T; Pollard, M R; Kad, N M

    2017-01-01

    Fluorescence imaging is one of the cornerstone techniques for understanding how single molecules search for their targets on DNA. By tagging individual proteins, it is possible to track their position with high accuracy. However, to understand how proteins search for targets, it is necessary to elongate the DNA to avoid protein localization ambiguities. Such structures known as "DNA tightropes" are tremendously powerful for imaging target location; however, they lack information about how force and load affect protein behavior. The use of optically trapped microstructures offers the means to apply and measure force effects. Here we describe a system that we recently developed to enable individual proteins to be directly manipulated on DNA tightropes. Proteins bound to DNA can be conjugated with Qdot fluorophores for visualization and also directly manipulated by an optically trapped, manufactured microstructure. Together this offers a new approach to understanding the physical environment of molecules, and the combination with DNA tightropes presents opportunities to study complex biological phenomena. © 2017 Elsevier Inc. All rights reserved.

  16. Single molecule high-throughput footprinting of small and large DNA ligands.

    PubMed

    Manosas, Maria; Camunas-Soler, Joan; Croquette, Vincent; Ritort, Felix

    2017-08-21

    Most DNA processes are governed by molecular interactions that take place in a sequence-specific manner. Determining the sequence selectivity of DNA ligands is still a challenge, particularly for small drugs where labeling or sequencing methods do not perform well. Here, we present a fast and accurate method based on parallelized single molecule magnetic tweezers to detect the sequence selectivity and characterize the thermodynamics and kinetics of binding in a single assay. Mechanical manipulation of DNA hairpins with an engineered sequence is used to detect ligand binding as blocking events during DNA unzipping, allowing determination of ligand selectivity both for small drugs and large proteins with nearly base-pair resolution in an unbiased fashion. The assay allows investigation of subtle details such as the effect of flanking sequences or binding cooperativity. Unzipping assays on hairpin substrates with an optimized flat free energy landscape containing all binding motifs allows determination of the ligand mechanical footprint, recognition site, and binding orientation.Mapping the sequence specificity of DNA ligands remains a challenge, particularly for small drugs. Here the authors develop a parallelized single molecule magnetic tweezers approach using engineered DNA hairpins that can detect sequence selectivity, thermodynamics and kinetics of binding for small drugs and large proteins.

  17. Electrical conductance of DNA molecules with varied density of itinerant pi electrons.

    PubMed

    Gao, Xu-Tuan; Fu, Xue; Mei, Liang-Mo; Xie, Shi-Jie

    2006-06-21

    The electrical transport of DNA is closely related to the density of itinerant pi electrons because of the strong electron-lattice interaction. The resistivities of two typical DNA molecules [poly(dG)-poly(dC) and lambda-DNA] with varied densities of itinerant pi electrons are calculated. It is found that the dependence of the resistivity on the density of itinerant pi electrons is symmetrical about the half-filling state of itinerant pi electrons in poly(dG)-poly(dC). At the half-filling state, the Peierls phase transition takes place and poly(dG)-poly(dC) has a large resistivity. When the density of itinerant pi electrons departs far from the half-filling state, the resistivity of poly(dG)-poly(dC) becomes small. For lambda-DNA, there is no Peierls phase transition due to the aperiodicity of its base pair arrangement. The resistivity of poly(dG)-poly(dC) decreases with increasing length of the molecular chain, but the resistivity of lambda-DNA increases with increasing length. The conducting mechanisms for poly(dG)-poly(dC) and a few lambda-DNA molecules with varied densities of itinerant pi electrons are analyzed.

  18. Exploring the Interaction of Ruthenium(II) Polypyridyl Complexes with DNA Using Single-Molecule Techniques†

    PubMed Central

    Mihailovic, Aleksandra; Vladescu, Ioana; McCauley, Micah; Ly, Elaine; Williams, Mark C.; Spain, Eileen M.; Nuñez, Megan E.

    2008-01-01

    Here we explore DNA binding by a family of ruthenium(II) polypyridyl complexes using an atomic force microscope (AFM) and optical tweezers. We demonstrate using AFM that Ru(bpy)2dppz2+ intercalates into DNA (Kb= 1.5 × 105 M−1), as does its close relative Ru(bpy)2dppx2+ (Kb= 1.5 × 105 M−1). However, intercalation by Ru(phen)32+ and other Ru(II) complexes with Kb's lower than Ru(bpy)2dppz2+ are difficult to determine using AFM because of competing aggregation and surface-binding phenomena. At the high Ru(II) concentrations required to evaluate intercalation, most of the DNA strands acquire a twisted, curled conformation that is impossible to measure accurately. The condensation of DNA on mica in the presence of polycations is well known, but it clearly precludes the accurate assessment by AFM of DNA intercalation by most Ru(II) complexes, though not by ethidium bromide and other monovalent intercalators. When stretching individual DNA molecules using optical tweezers the same limitation on high metal concentration does not exist. Using optical tweezers we show that Ru(phen)2dppz2+ intercalates avidly (Kb = 3.2 × 106 M−1) while Ru(bpy)32+ does not intercalate, even at micromolar ruthenium concentrations. Ru(phen)32+ is shown to intercalate weakly, i.e. at micromolar concentrations (Kb= 8.8 × 103 M−1). The distinct differences in DNA stretching behavior between Ru(phen)32+ and Ru(bpy)32+ clearly illustrate that intercalation can be distinguished from groove binding by pulling the DNA with optical tweezers. Our results demonstrate both the benefits and challenges of two single-molecule methods in exploring DNA binding, and help to elucidate the mode of binding of Ru(phen)32+. PMID:16649785

  19. Rice pseudomolecule-anchored cross-species DNA sequence alignments indicate regional genomic variation in expressed sequence conservation

    PubMed Central

    Armstead, Ian; Huang, Lin; King, Julie; Ougham, Helen; Thomas, Howard; King, Ian

    2007-01-01

    Background Various methods have been developed to explore inter-genomic relationships among plant species. Here, we present a sequence similarity analysis based upon comparison of transcript-assembly and methylation-filtered databases from five plant species and physically anchored rice coding sequences. Results A comparison of the frequency of sequence alignments, determined by MegaBLAST, between rice coding sequences in TIGR pseudomolecules and annotations vs 4.0 and comprehensive transcript-assembly and methylation-filtered databases from Lolium perenne (ryegrass), Zea mays (maize), Hordeum vulgare (barley), Glycine max (soybean) and Arabidopsis thaliana (thale cress) was undertaken. Each rice pseudomolecule was divided into 10 segments, each containing 10% of the functionally annotated, expressed genes. This indicated a correlation between relative segment position in the rice genome and numbers of alignments with all the queried monocot and dicot plant databases. Colour-coded moving windows of 100 functionally annotated, expressed genes along each pseudomolecule were used to generate 'heat-maps'. These revealed consistent intra- and inter-pseudomolecule variation in the relative concentrations of significant alignments with the tested plant databases. Analysis of the annotations and derived putative expression patterns of rice genes from 'hot-spots' and 'cold-spots' within the heat maps indicated possible functional differences. A similar comparison relating to ancestral duplications of the rice genome indicated that duplications were often associated with 'hot-spots'. Conclusion Physical positions of expressed genes in the rice genome are correlated with the degree of conservation of similar sequences in the transcriptomes of other plant species. This relative conservation is associated with the distribution of different sized gene families and segmentally duplicated loci and may have functional and evolutionary implications. PMID:17708759

  20. Force and twist dependence of RepC nicking activity on torsionally-constrained DNA molecules

    PubMed Central

    Pastrana, Cesar L.; Carrasco, Carolina; Akhtar, Parvez; Leuba, Sanford H.; Khan, Saleem A.; Moreno-Herrero, Fernando

    2016-01-01

    Many bacterial plasmids replicate by an asymmetric rolling-circle mechanism that requires sequence-specific recognition for initiation, nicking of one of the template DNA strands and unwinding of the duplex prior to subsequent leading strand DNA synthesis. Nicking is performed by a replication-initiation protein (Rep) that directly binds to the plasmid double-stranded origin and remains covalently bound to its substrate 5′-end via a phosphotyrosine linkage. It has been proposed that the inverted DNA sequences at the nick site form a cruciform structure that facilitates DNA cleavage. However, the role of Rep proteins in the formation of this cruciform and the implication for its nicking and religation functions is unclear. Here, we have used magnetic tweezers to directly measure the DNA nicking and religation activities of RepC, the replication initiator protein of plasmid pT181, in plasmid sized and torsionally-constrained linear DNA molecules. Nicking by RepC occurred only in negatively supercoiled DNA and was force- and twist-dependent. Comparison with a type IB topoisomerase in similar experiments highlighted a relatively inefficient religation activity of RepC. Based on the structural modeling of RepC and on our experimental evidence, we propose a model where RepC nicking activity is passive and dependent upon the supercoiling degree of the DNA substrate. PMID:27488190

  1. Label-free dual sensing of DNA molecules using GaN nanowires.

    PubMed

    Chen, Chin-Pei; Ganguly, Abhijit; Wang, Chen-Hao; Hsu, Chih-Wei; Chattopadhyay, Surojit; Hsu, Yu-Kuei; Chang, Ying-Chih; Chen, Kuei-Hsien; Chen, Li-Chyong

    2009-01-01

    We demonstrate a rationale for using GaN nanowires (GaNNWs) in label-free DNA-sensing using dual routes of electrochemical impedance spectroscopy (EIS) and photoluminescence (PL) measurements, employing a popular target DNA with anthrax lethal factor (LF) sequence. The in situ EIS reveals that both high surface area and surface band-bending in the nanowires, providing more binding sites and surface-enhanced charge transfer, respectively, are responsible for the enhanced sensitivity to surface-immobilized DNA molecules. The net electron-transfer resistance can be readily deconvoluted into two components because of the coexistence of two interfaces, GaN/DNA and DNA/electrolyte interfaces, in series. Interestingly, the former, decreasing with LF concentration (C(LF)), serves as a signature for the extent of hybridization, while the latter as a fingerprint for DNA modification. For PL-sensing, the band-edge emission of GaNNWs serves as a parameter for DNA modification, which quenches exponentially with C(LF) as the incident light is increasingly blocked from reaching the core nanowire by rapidly developing a UV-absorbing DNA sheath at high C(LF). Furthermore, successful application for detection of "hotspot" mutations, related to the human p53 tumor-suppressor gene, revealed excellent selectivity and specificity, down to picomolar concentration, even in the current unoptimized sensor design/condition, and in the presence of mutations and noncomplementary strands, suggesting the potential pragmatic application in complex clinical samples.

  2. When Maxwellian demon meets action at a distance. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

    NASA Astrophysics Data System (ADS)

    Rybenkov, Valentin V.

    2016-09-01

    The ability of living systems to defy thermodynamics without explicitly violating it is a continued source of inspiration to many biophysicists. The story of type-2 DNA topoisomerases is a beautiful example from that book. DNA topoisomerases catalyze a concerted DNA cleavage-religation reaction, which is interjected by a strand passage event. This sequence of events results in a seemingly unhindered transfer of one piece of DNA through another upon their random collision. An obvious consequence of such transfer is a change in the topological state of the colliding DNAs; hence the name of the enzymes, topoisomerases. There are several classes of topoisomerases, which differ in how they capture the cleaved and transported DNA segments (which are often referred to as the gate and transfer segments; or the G- and T-segments, to be short). Type-2 topoisomerases have two cleavage-religation centers. They open a gate in double stranded DNA and transfer another piece of double stranded DNA through it [1]. And in doing so, they manage to collect information about the rest of the DNA and perform strand passage in a directional manner so as to take the molecule away from the thermodynamic equilibrium [2].

  3. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome

    PubMed Central

    Yu, Shoukai; Lemos, Bernardo

    2016-01-01

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. PMID:27797956

  4. Single-molecule DNA digestion in various alkanethiol-functionalized gold nanopores.

    PubMed

    Lee, Seungah; Kang, Seong Ho

    2013-03-30

    This paper presents the alkanethiol-functionalized environmental effects of individual DNA molecules in nanopores on enzyme digestion at the single-molecule level. A template consisting of gold deposited within a solid-state nanoporous polycarbonate membrane was used to trap individual λ-DNA and enzyme molecules. The gold surfaces were modified with various functional groups (-OH, -COOH, -NH3). The enzyme digestion rates of single DNA molecules increased with decreasing nanopore diameters. Surprisingly, the digestion rates in the l-cysteine chemisorbed nanopores were 2.1-2.6 times faster than in the mercaptoethanol chemisorbed gold nanopores, even though these nanopores had equivalent interspacial areas. In addition, the membrane of chemisorbed cysteamine with ionized functional groups of H3N(+) at pH 8.2 had a greater positive influence on the enzyme digestion rate than the membrane of chemisorbed mercaptoproponic acid with ionized carboxyl groups (COO(-)). These results suggest that the three-dimensional environment effect is strongly correlated with the functional group in confined nanopores and can significantly change the enzyme digestion rates for nanopores with different internal areas. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Single-Molecule Fluorescence Imaging of Interfacial DNA Hybridization Kinetics at Selective Capture Surfaces.

    PubMed

    Peterson, Eric M; Manhart, Michael W; Harris, Joel M

    2016-01-19

    Accurate knowledge of the kinetics of complementary oligonucleotide hybridization is integral to the design and understanding of DNA-based biosensors. In this work, single-molecule fluorescence imaging is applied to measuring rates of hybridization between fluorescently labeled target ssDNA and unlabeled probe ssDNA immobilized on glass surfaces. In the absence of probe site labeling, the capture surface must be highly selective to avoid the influence of nonspecific adsorption on the interpretation of single-molecule imaging results. This is accomplished by increasing the probe molecule site densities by a factor of ∼100 compared to optically resolvable sites so that nonspecific interactions compete with a much greater number of capture sites and by immobilizing sulfonate groups to passivate the surface between probe strands. The resulting substrates exhibit very low nonspecific adsorption, and the selectivity for binding a complementary target sequence exceeds that of a scrambled sequence by nearly 3 orders of magnitude. The population of immobilized DNA probe sites is quantified by counting individual DNA duplexes at low target concentrations, and those results are used to calibrate fluorescence intensities on the same sample at much higher target concentrations to measure a full binding isotherm. Dissociation rates are determined from interfacial residence times of individual DNA duplexes. Equilibrium and rate constants of hybridization, K(a) = 38 (±1) μM(-1), k(on) = 1.64 (±0.06) × 10(6) M(-1) s(-1), and k(off) = 4.3 (±0.1) × 10(-2) s(-1), were found not to change with surface density of immobilized probe DNA, indicating that hybridization events at neighboring probe sites are independent. To test the influence of probe-strand immobilization on hybridization, the kinetics of the probe target reaction at the surface were compared with the same reaction in free solution, and the equilibrium constants and dissociation and association rates were found to be

  6. Single-Molecule Counting of Point Mutations by Transient DNA Binding

    PubMed Central

    Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

    2017-01-01

    High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines. PMID:28262827

  7. Simultaneous single-molecule epigenetic imaging of DNA methylation and hydroxymethylation

    PubMed Central

    Song, Chun-Xiao; Brunger, Axel T.; Quake, Stephen R.

    2016-01-01

    The modifications 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) are the two major DNA epigenetic modifications in mammalian genomes and play crucial roles in development and pathogenesis. Little is known about the colocalization or potential correlation of these two modifications. Here we present an ultrasensitive single-molecule imaging technology capable of detecting and quantifying 5hmC and 5mC from trace amounts of DNA. We used this approach to perform single-molecule fluorescence resonance energy transfer (smFRET) experiments which measure the proximity between 5mC and 5hmC in the same DNA molecule. Our results reveal high levels of adjacent and opposing methylated and hydroxymethylated CpG sites (5hmC/5mCpGs) in mouse genomic DNA across multiple tissues. This identifies the previously undetectable and unappreciated 5hmC/5mCpGs as one of the major states for 5hmC in the mammalian genome and suggest that they could function in promoting gene expression. PMID:27035984

  8. Single-Molecule Counting of Point Mutations by Transient DNA Binding

    NASA Astrophysics Data System (ADS)

    Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

    2017-03-01

    High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

  9. Coil-stretch Transition of DNA Molecules in Slit-like Confinement

    PubMed Central

    Tang, Jing; Trahan, Daniel W.; Doyle, Patrick S.

    2010-01-01

    We experimentally investigate the influence of slit-like confinement on the coil-stretch transition of single DNA molecules in a homogeneous planar elongational electric field. We observe a more gradual coil-stretch transition characterized by two distinct critical strain rates for DNA in confinement, different from the unconfined case where a single critical strain rate exists. We postulate that the change in the coil-stretch transition is due to a modified spring law in confinement. We develop a dumbbell model to extract an effective spring law by following the relaxation of an initially stretched DNA. We then use this spring law and kinetic theory modeling to predict the extension and fluctuations of DNA in planar elongational fields. The model predicts that a two-stage coil-stretch transition emerges in confinement, in accord with experimental observations. PMID:21399708

  10. Digital quantification of rolling circle amplified single DNA molecules in a resistive pulse sensing nanopore.

    PubMed

    Kühnemund, M; Nilsson, M

    2015-05-15

    Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches.

  11. A transcribing RNA polymerase molecule survives DNA replication without aborting its growing RNA chain.

    PubMed

    Liu, B; Wong, M L; Alberts, B

    1994-10-25

    We have demonstrated elsewhere that a precisely placed, stalled Escherichia coli RNA polymerase ternary transcription complex (polymerase-RNA-DNA) stays on the DNA template after passage of a DNA replication fork. Moreover, the bypassed complex remains competent to resume elongation of its bound RNA chain. But the simplicity of our experimental system left several important questions unresolved: in particular, might the observation be relevant only to the particular ternary complex that we studied, and can the finding be generalized to a transcribing instead of a stalled RNA polymerase? To address these issues, we have created three additional ternary transcription complexes and examined their fates after passage of a replication fork. In addition, we have examined the fate of moving RNA polymerase molecules during DNA replication. The results suggest that our previous finding applies to all transcription intermediates of the E. coli RNA polymerase.

  12. Design, synthesis and biological activity of novel molecules designed to target PARP and DNA.

    PubMed

    Goodfellow, Elliot; Senhaji Mouhri, Zhor; Williams, Christopher; Jean-Claude, Bertrand J

    2017-02-01

    In order to enhance the cytotoxic potential of poly(ADP-ribose) polymerase (PARP) inhibitors in BRCA1 or 2 deficient tumours, we designed a series of molecules containing a 1,2,3-triazene moiety tethered to a PARP targeting scaffold. A cell-based selectivity assay involving a BRCA2-deficient Chinese hamster cell line and its corresponding BRCA2 wild type transfectant, was used to predict the PARP targeting potential of the latter agents. The results showed that adding a DNA damaging function to the PARP inhibitors decreased but did not abrogate the selective targeting of the BRCA2-deficient cells. The DNA damaging moiety augmented the potency in BRCA2 deficient cells by 2-20 fold. The most selective dual PARP-DNA targeting agent 14b was found to possess dual DNA and PARP targeting properties.

  13. Quantification of DNA-associated proteins inside eukaryotic cells using single-molecule localization microscopy

    PubMed Central

    Etheridge, Thomas J.; Boulineau, Rémi L.; Herbert, Alex; Watson, Adam T.; Daigaku, Yasukazu; Tucker, Jem; George, Sophie; Jönsson, Peter; Palayret, Matthieu; Lando, David; Laue, Ernest; Osborne, Mark A.; Klenerman, David; Lee, Steven F.; Carr, Antony M.

    2014-01-01

    Development of single-molecule localization microscopy techniques has allowed nanometre scale localization accuracy inside cells, permitting the resolution of ultra-fine cell structure and the elucidation of crucial molecular mechanisms. Application of these methodologies to understanding processes underlying DNA replication and repair has been limited to defined in vitro biochemical analysis and prokaryotic cells. In order to expand these techniques to eukaryotic systems, we have further developed a photo-activated localization microscopy-based method to directly visualize DNA-associated proteins in unfixed eukaryotic cells. We demonstrate that motion blurring of fluorescence due to protein diffusivity can be used to selectively image the DNA-bound population of proteins. We designed and tested a simple methodology and show that it can be used to detect changes in DNA binding of a replicative helicase subunit, Mcm4, and the replication sliding clamp, PCNA, between different stages of the cell cycle and between distinct genetic backgrounds. PMID:25106872

  14. A single-molecule approach to visualize the unwinding activity of DNA helicases.

    PubMed

    Fili, Natalia; Toseland, Christopher P; Dillingham, Mark S; Webb, Martin R; Molloy, Justin E

    2011-01-01

    Almost all aspects of DNA metabolism involve separation of double-stranded DNA catalyzed by helicases. Observation and measurement of the dynamics of these events at the single-molecule level provide important mechanistic details of helicase activity and give the opportunity to probe aspects that are not revealed in bulk solution measurements. The assay, presented here, provides information about helicase unwinding rates and processivity. Visualization is achieved by using a fluorescent single-stranded DNA-binding protein (SSB), which allows the time course of individual DNA unwinding events to be observed using total internal reflection fluorescence microscopy. Observation of a prototypical helicase, Bacillus subtilis AddAB, shows that the unwinding process consists of bursts of unwinding activity, interspersed with periods of pausing.

  15. Local thermodynamics of the water molecules around single- and double-stranded DNA studied by grid inhomogeneous solvation theory

    NASA Astrophysics Data System (ADS)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2016-09-01

    Thermodynamic properties of water molecules around single- and double-stranded DNAs (ssDNAs and dsDNAs) with different sequences were investigated using grid inhomogeneous solvation theory. Free energies of water molecules solvating the minor groove of dsDNAs are lower than those near ssDNAs, while water molecules should be released during the formation of dsDNA. Free energies of water molecules around dsDNA are lower than those around ssDNA even in the second and third hydration shells. Our findings will help to clarify the role of water molecules in the formation of dsDNA from ssDNAs, thus facilitating the designs of drugs or nanomaterials using DNA.

  16. Real-time analysis and selection of methylated DNA by fluorescence-activated single molecule sorting in a nanofluidic channel.

    PubMed

    Cipriany, Benjamin R; Murphy, Patrick J; Hagarman, James A; Cerf, Aline; Latulippe, David; Levy, Stephen L; Benítez, Jaime J; Tan, Christine P; Topolancik, Juraj; Soloway, Paul D; Craighead, Harold G

    2012-05-29

    Epigenetic modifications, such as DNA and histone methylation, are responsible for regulatory pathways that affect disease. Current epigenetic analyses use bisulfite conversion to identify DNA methylation and chromatin immunoprecipitation to collect molecules bearing a specific histone modification. In this work, we present a proof-of-principle demonstration for a new method using a nanofluidic device that combines real-time detection and automated sorting of individual molecules based on their epigenetic state. This device evaluates the fluorescence from labeled epigenetic modifications to actuate sorting. This technology has demonstrated up to 98% accuracy in molecule sorting and has achieved postsorting sample recovery on femtogram quantities of genetic material. We have applied it to sort methylated DNA molecules using simultaneous, multicolor fluorescence to identify methyl binding domain protein-1 (MBD1) bound to full-duplex DNA. The functionality enabled by this nanofluidic platform now provides a workflow for color-multiplexed detection, sorting, and recovery of single molecules toward subsequent DNA sequencing.

  17. Applications of Engineered DNA-Binding Molecules Such as TAL Proteins and the CRISPR/Cas System in Biology Research.

    PubMed

    Fujita, Toshitsugu; Fujii, Hodaka

    2015-09-24

    Engineered DNA-binding molecules such as transcription activator-like effector (TAL or TALE) proteins and the clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated proteins (Cas) (CRISPR/Cas) system have been used extensively for genome editing in cells of various types and species. The sequence-specific DNA-binding activities of these engineered DNA-binding molecules can also be utilized for other purposes, such as transcriptional activation, transcriptional repression, chromatin modification, visualization of genomic regions, and isolation of chromatin in a locus-specific manner. In this review, we describe applications of these engineered DNA-binding molecules for biological purposes other than genome editing.

  18. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  19. Single-molecule fluorescence imaging of DNA at a potential-controlled interface.

    PubMed

    Peterson, Eric M; Harris, Joel M

    2013-07-02

    Many interfacial chemical phenomena are governed in part by electrostatic interactions between polyelectrolytes and charged surfaces; these phenomena can influence the performance of biosensors, adsorption of natural polyelectrolytes (humic substances) on soils, and production of polyelectrolyte multilayer films. In order to understand electrostatic interactions that govern these phenomena, we have investigated the behavior of a model polyelectrolyte, 15 kbp fluorescently labeled plasmid DNA, near a polarized indium tin oxide (ITO) electrode surface. The interfacial population of DNA was monitored in situ by imaging individual molecules through the transparent electrode using total-internal-reflection fluorescence microscopy. At applied potentials of +0.8 V versus Ag/AgCl, the DNA interfacial population near the ITO surface can be increased by 2 orders of magnitude relative to bulk solution. The DNA molecules attracted to the interface do not adsorb to ITO, but rather they remain mobile with a diffusion coefficient comparable to free solution. Ionic strength strongly influences the sensitivity of the interfacial population to applied potential, where the increase in the interfacial population over a +300 mV change in potential varies from 20% in 30 mM ionic strength to over 25-fold in 300 μM electrolyte. The DNA accumulation with applied potential was interpreted using a simple Boltzmann model to predict average ion concentrations in the electrical double layer and the fraction of interfacial detection volume that is influenced by applied potential. A Gouy-Chapman model was also applied to the data to account for the dependence of the ion population on distance from the electrode surface, which indicates that the net charge on DNA responsible for interactions with the polarized surface is low, on the order of one excess electron. The results are consistent with a small fraction of the DNA plasmid being resident in the double-layer and with counterions screening

  20. Design, synthesis and selection of DNA-encoded small-molecule libraries.

    PubMed

    Clark, Matthew A; Acharya, Raksha A; Arico-Muendel, Christopher C; Belyanskaya, Svetlana L; Benjamin, Dennis R; Carlson, Neil R; Centrella, Paolo A; Chiu, Cynthia H; Creaser, Steffen P; Cuozzo, John W; Davie, Christopher P; Ding, Yun; Franklin, G Joseph; Franzen, Kurt D; Gefter, Malcolm L; Hale, Steven P; Hansen, Nils J V; Israel, David I; Jiang, Jinwei; Kavarana, Malcolm J; Kelley, Michael S; Kollmann, Christopher S; Li, Fan; Lind, Kenneth; Mataruse, Sibongile; Medeiros, Patricia F; Messer, Jeffrey A; Myers, Paul; O'Keefe, Heather; Oliff, Matthew C; Rise, Cecil E; Satz, Alexander L; Skinner, Steven R; Svendsen, Jennifer L; Tang, Lujia; van Vloten, Kurt; Wagner, Richard W; Yao, Gang; Zhao, Baoguang; Morgan, Barry A

    2009-09-01

    Biochemical combinatorial techniques such as phage display, RNA display and oligonucleotide aptamers have proven to be reliable methods for generation of ligands to protein targets. Adapting these techniques to small synthetic molecules has been a long-sought goal. We report the synthesis and interrogation of an 800-million-member DNA-encoded library in which small molecules are covalently attached to an encoding oligonucleotide. The library was assembled by a combination of chemical and enzymatic synthesis, and interrogated by affinity selection. We describe methods for the selection and deconvolution of the chemical display library, and the discovery of inhibitors for two enzymes: Aurora A kinase and p38 MAP kinase.

  1. Single-molecule four-color FRET visualizes energy-transfer paths on DNA origami.

    PubMed

    Stein, Ingo H; Steinhauer, Christian; Tinnefeld, Philip

    2011-03-30

    Fluorescence resonance energy transfer (FRET) represents a mechanism to transport light energy at the nanoscale, as exemplified by nature's light-harvesting complexes. Here we used DNA origami to arrange fluorophores that transport excited-state energy from an input dye to an output dye. We demonstrate that energy-transfer paths can be controlled on the single-molecule level by the presence of a "jumper" dye that directs the excited-state energy either to a red or to an IR output dye. We used single-molecule four-color FRET with alternating laser excitation to sort subpopulations and to visualize the control of energy transfer.

  2. Single-molecule studies of DNA transcription using atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Billingsley, Daniel J.; Bonass, William A.; Crampton, Neal; Kirkham, Jennifer; Thomson, Neil H.

    2012-04-01

    Atomic force microscopy (AFM) can detect single biomacromolecules with a high signal-to-noise ratio on atomically flat biocompatible support surfaces, such as mica. Contrast arises from the innate forces and therefore AFM does not require imaging contrast agents, leading to sample preparation that is relatively straightforward. The ability of AFM to operate in hydrated environments, including humid air and aqueous buffers, allows structure and function of biological and biomolecular systems to be retained. These traits of the AFM are ensuring that it is being increasingly used to study deoxyribonucleic acid (DNA) structure and DNA-protein interactions down to the secondary structure level. This report focuses in particular on reviewing the applications of AFM to the study of DNA transcription in reductionist single-molecule bottom-up approaches. The technique has allowed new insights into the interactions between ribonucleic acid (RNA) polymerase to be gained and enabled quantification of some aspects of the transcription process, such as promoter location, DNA wrapping and elongation. More recently, the trend is towards studying the interactions of more than one enzyme operating on a single DNA template. These methods begin to reveal the mechanics of gene expression at the single-molecule level and will enable us to gain greater understanding of how the genome is transcribed and translated into the proteome.

  3. Electrostatic energy barriers from dielectric membranes upon approach of translocating DNA molecules.

    PubMed

    Buyukdagli, Sahin; Ala-Nissila, T

    2016-02-28

    We probe the electrostatic cost associated with the approach phase of DNA translocation events. Within an analytical theory at the Debye-Hückel level, we calculate the electrostatic energy of a rigid DNA molecule interacting with a dielectric membrane. For carbon or silicon based low permittivity neutral membranes, the DNA molecule experiences a repulsive energy barrier between 10 k(B)T and 100 k(B)T. In the case of engineered membranes with high dielectric permittivities, the membrane surface attracts the DNA with an energy of the same magnitude. Both the repulsive and attractive interactions result from image-charge effects and their magnitude survive even for the thinnest graphene-based membranes of size d ≈ 6 Å. For weakly charged membranes, the electrostatic energy is always attractive at large separation distances but switches to repulsive close to the membrane surface. We also characterise the polymer length dependence of the interaction energy. For specific values of the membrane charge density, low permittivity membranes repel short polymers but attract long polymers. Our results can be used to control the strong electrostatic energy of DNA-membrane interactions prior to translocation events by chemical engineering of the relevant system parameters.

  4. Single Molecule Bioelectronics and Their Application to Amplification-Free Measurement of DNA Lengths.

    PubMed

    Gül, O Tolga; Pugliese, Kaitlin M; Choi, Yongki; Sims, Patrick C; Pan, Deng; Rajapakse, Arith J; Weiss, Gregory A; Collins, Philip G

    2016-06-24

    As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein's activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF's base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures.

  5. Electronic measurements of single-molecule processing by DNA polymerase I

    NASA Astrophysics Data System (ADS)

    Choi, Yongki; Olsen, Tivoli; Gul, Tolga; Corso, Brad; Dong, Chengjun; Brown, William; Weiss, Gregory; Collins, Philip

    2013-03-01

    A single-molecule nanocircuit technique is applied to continuously monitor DNA replication activity by the enzyme DNA polymerase I (Pol I). Using single copies of Pol I bound to a single-walled carbon nanotube device, an electrical signal was generated to reveal enzymatic function and dynamic variability. Continuous, single-molecule-resolution recordings were obtained for Pol I processing homopolymeric DNA templates over 10 minutes and through >10,000 DNA replication events. Processivity of up to 40 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. We observe that the closed complex forms a phosphodiester bond in a highly efficient process >99.8% of the time, with a mean duration of only 0.3 ms for all four dNTPs. The rate-limiting step for replication occurs during the enzyme's open state, but with a duration that is nearly twice as long for dATP or dTTP incorporation than for dCTP or dGTP. Taken together, the results provide a wealth of new information complementing prior work on the mechanism and dynamics of DNA polymerase.

  6. Single Molecule Bioelectronics and Their Application to Amplification-Free Measurement of DNA Lengths

    PubMed Central

    Gül, O. Tolga; Pugliese, Kaitlin M.; Choi, Yongki; Sims, Patrick C.; Pan, Deng; Rajapakse, Arith J.; Weiss, Gregory A.; Collins, Philip G.

    2016-01-01

    As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein’s activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF’s base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures. PMID:27348011

  7. Topology simplification: Important biological phenomenon or evolutionary relic?. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

    NASA Astrophysics Data System (ADS)

    Bates, Andrew D.; Maxwell, Anthony

    2016-09-01

    The review, Disentangling DNA molecules[1], gives an excellent technical description of the phenomenon of topology simplification (TS) by type IIA DNA topoisomerases (topos). In the 20 years since its discovery [2], this effect has attracted a good deal of attention, probably because of its apparently magical nature, and because it seemed to offer a solution to the conundrum that all type II topos rely on ATP hydrolysis, but only bacterial DNA gyrases were known to transduce the free energy of hydrolysis into torsion (supercoiling) in the DNA. It made good sense to think that the other enzymes are using the energy to reduce the level of supercoiling, knotting, and particularly decatenation (unlinking), below equilibrium, since the key activity of the non-supercoiling topos is the removal of links between daughter chromosomes [3]. As Vologodskii discusses [1], there have been a number of theoretical models developed to explain how the local effect of a type II topo can influence the global level of knotting and catenation in large DNA molecules, and he explains how features of two of the most successful models (bent G segment and hooked juxtapositions) may be combined to explain the magnitude of the effect and overcome a kinetic problem with the hooked juxtaposition model.

  8. Discovery of small-molecule interleukin-2 inhibitors from a DNA-encoded chemical library.

    PubMed

    Leimbacher, Markus; Zhang, Yixin; Mannocci, Luca; Stravs, Michael; Geppert, Tim; Scheuermann, Jörg; Schneider, Gisbert; Neri, Dario

    2012-06-18

    Libraries of chemical compounds individually coupled to encoding DNA tags (DNA-encoded chemical libraries) hold promise to facilitate exceptionally efficient ligand discovery. We constructed a high-quality DNA-encoded chemical library comprising 30,000 drug-like compounds; this was screened in 170 different affinity capture experiments. High-throughput sequencing allowed the evaluation of 120 million DNA codes for a systematic analysis of selection strategies and statistically robust identification of binding molecules. Selections performed against the tumor-associated antigen carbonic anhydrase IX (CA IX) and the pro-inflammatory cytokine interleukin-2 (IL-2) yielded potent inhibitors with exquisite target specificity. The binding mode of the revealed pharmacophore against IL-2 was confirmed by molecular docking. Our findings suggest that DNA-encoded chemical libraries allow the facile identification of drug-like ligands principally to any protein of choice, including molecules capable of disrupting high-affinity protein-protein interactions. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Single-molecule studies of DNA transcription using atomic force microscopy.

    PubMed

    Billingsley, Daniel J; Bonass, William A; Crampton, Neal; Kirkham, Jennifer; Thomson, Neil H

    2012-01-01

    Atomic force microscopy (AFM) can detect single biomacromolecules with a high signal-to-noise ratio on atomically flat biocompatible support surfaces, such as mica. Contrast arises from the innate forces and therefore AFM does not require imaging contrast agents, leading to sample preparation that is relatively straightforward. The ability of AFM to operate in hydrated environments, including humid air and aqueous buffers, allows structure and function of biological and biomolecular systems to be retained. These traits of the AFM are ensuring that it is being increasingly used to study deoxyribonucleic acid (DNA) structure and DNA-protein interactions down to the secondary structure level. This report focuses in particular on reviewing the applications of AFM to the study of DNA transcription in reductionist single-molecule bottom-up approaches. The technique has allowed new insights into the interactions between ribonucleic acid (RNA) polymerase to be gained and enabled quantification of some aspects of the transcription process, such as promoter location, DNA wrapping and elongation. More recently, the trend is towards studying the interactions of more than one enzyme operating on a single DNA template. These methods begin to reveal the mechanics of gene expression at the single-molecule level and will enable us to gain greater understanding of how the genome is transcribed and translated into the proteome.

  10. Single-molecule kinetics and footprinting of DNA bis-intercalation: the paradigmatic case of Thiocoraline

    PubMed Central

    Camunas-Soler, Joan; Manosas, Maria; Frutos, Silvia; Tulla-Puche, Judit; Albericio, Fernando; Ritort, Felix

    2015-01-01

    DNA bis-intercalators are widely used in molecular biology with applications ranging from DNA imaging to anticancer pharmacology. Two fundamental aspects of these ligands are the lifetime of the bis-intercalated complexes and their sequence selectivity. Here, we perform single-molecule optical tweezers experiments with the peptide Thiocoraline showing, for the first time, that bis-intercalation is driven by a very slow off-rate that steeply decreases with applied force. This feature reveals the existence of a long-lived (minutes) mono-intercalated intermediate that contributes to the extremely long lifetime of the complex (hours). We further exploit this particularly slow kinetics to determine the thermodynamics of binding and persistence length of bis-intercalated DNA for a given fraction of bound ligand, a measurement inaccessible in previous studies of faster intercalating agents. We also develop a novel single-molecule footprinting technique based on DNA unzipping and determine the preferred binding sites of Thiocoraline with one base-pair resolution. This fast and radiolabelling-free footprinting technique provides direct access to the binding sites of small ligands to nucleic acids without the need of cleavage agents. Overall, our results provide new insights into the binding pathway of bis-intercalators and the reported selectivity might be of relevance for this and other anticancer drugs interfering with DNA replication and transcription in carcinogenic cell lines. PMID:25690887

  11. Rational design of DNA motors: fuel optimization through single-molecule fluorescence.

    PubMed

    Tomov, Toma E; Tsukanov, Roman; Liber, Miran; Masoud, Rula; Plavner, Noa; Nir, Eyal

    2013-08-14

    While numerous DNA-based molecular machines have been developed in recent years, high operational yield and speed remain a major challenge. To understand the reasons for the limited performance, and to find rational solutions, we applied single-molecule fluorescence techniques and conducted a detailed study of the reactions involved in the operation of a model system comprised of a bipedal DNA walker that strides on a DNA origami track powered by interactions with fuel and antifuel strands. Analysis of the kinetic profiles of the leg-lifting reactions indicates a pseudo-first-order antifuel binding mechanism leading to a rapid and complete leg-lifting, indicating that the fuel-removal reaction is not responsible for the 1% operational yield observed after six steps. Analysis of the leg-placing reactions showed that although increased concentrations of fuel increase the reaction rate, they decrease the yield by consecutively binding the motor and leading to an undesirable trapped state. Recognizing this, we designed asymmetrical hairpin-fuels that by regulating the reaction hierarchy avoid consecutive binding. Motors operating with the improved fuels show 74% yield after 12 consecutive reactions, a dramatic increase over the 1% observed for motors operating with nonhairpin fuels. This work demonstrates that studying the mechanisms of the reactions involved in the operation of DNA-based molecular machines using single-molecule fluorescence can facilitate rationally designed improvements that increase yield and speed and promote the applicability of DNA-based machines.

  12. Single-molecule study of DNA unlinking by eukaryotic and prokaryotic type-II topoisomerases

    NASA Astrophysics Data System (ADS)

    Charvin, G.; Bensimon, D.; Croquette, V.

    2003-08-01

    Type-II topoisomerases are responsible for untangling DNA during replication by removing supercoiled and interlinked DNA structures. Using a single-molecule micromanipulation setup, we follow the real-time decatenation of two mechanically braided DNA molecules by Drosophila melanogaster topoisomerase (Topo) II and Escherichia coli Topo IV. Although Topo II relaxes left-handed (L) and right-handed (R-) braids similarly at a rate of 2.9 s-1, Topo IV has a marked preference for L-braids, which it relaxes completely and processively at a rate of 2.4 s-1. However, Topo IV can unlink R-braids at about half that rate when they supercoil to form L-plectonemes. These results imply that the preferred substrate for unlinking by Topo IV has the symmetry of an L-crossing and shed new light on the decatenation of daughter strands during DNA replication, which are usually assumed to be linked in an R-braid. DNA replication

  13. Electromigration of single molecules of DNA in a crystalline array of 300-nm silica colloids.

    PubMed

    Zhang, Hui; Wirth, Mary J

    2005-03-01

    The velocities and conformations of single DNA chains were probed as they electromigrated at varying electric field strength through a crystalline array of silica colloids. An optically transparent film consisting of 300-nm silica colloids was formed on glass as a transparent crystalline layer of 7 mum thickness with an effective pore size of 45 nm. The behaviors of individual lambda-DNA molecules (48,502 base pairs) electromigrating through this material were observed to be analogous to the behaviors of long DNA chains in electrophoresis gels, including chain extension, hooking of chains around the matrix, and hernia formation. The electrophoretic mobility of lambda-DNA in this dense, narrow-pore material is surprisingly high: 1.8 cm2/Vs at 10 V/cm, which is at least as high as for much wider-pore gels. Imaging of the single molecules revealed that higher field strength caused increased chain extension and increased mobility, which reached an apparent plateau just above 2.0 cm2/Vs at 200 V/cm. Pulsed, crossed electric fields of 200 V/cm at 120 degrees to one another were applied to the material. The DNA chains were observed by imaging to electromigrate in an orderly fashion, and the migration rate was found to be length-dependent. The results indicate that these thin, robust, self-assembling inorganic materials are interesting as possible alternatives to polymeric gels for higher speed electrophoresis.

  14. Observation of HIV-1 Nucleocapsid Protein induced TAR DNA melting at the single molecule level

    NASA Astrophysics Data System (ADS)

    Cosa, Gonzalo; Harbron, Elizabeth; O'Connor, Donald; Musier-Forsyth, Karin; Barbara, Paul

    2003-03-01

    Reverse transcription of the HIV-1 RNA genome involves several nucleic acid rearrangement steps, and the HIV-1 nucleocapsid protein (NC) plays a key role in this process. NC is a nucleic acid chaperone protein, which facilitates the formation of the most stable nucleic acid structures. Single molecule fluorescence resonance energy transfer (SM-FRET) measurements enable us to observe the NC-induced conformational fluctuations of a transactivation response region (TAR) DNA hairpin, which is part of the initial product of reverse transcription known as minus-strand strong-stop DNA. SM-FRET studies show that the majority of conformational fluctuations of the fluorescently-labeled TAR DNA hairpin in the presence of NC occur in <100 ms. A single molecule explores a wide range of confomations unpon NC binding, with fluctuations encompassing as many as 40 bases in both arms of the hairpin. No conformational fluctuations are observed with the dye-labeled TAR DNA hairpin in the absence of NC or when a labeled TAR DNA hairpin variant lacking bulges and internal loops is analyzed in the presence of NC. This study represents the first real-time observation of NC-mediated nucleic acid conformational fluctuations, revealing new insights into NC's nucleic acid chaperone activity.

  15. Using Amino-Labeled Nucleotide Probes for Simultaneous Single Molecule RNA-DNA FISH

    PubMed Central

    Wu, Jun; Shao, Fangwei; Zhang, Li-Feng

    2014-01-01

    Using amino-labeled oligonucleotide probes, we established a simple, robust and low-noise method for simultaneous detection of RNA and DNA by fluorescence in situ hybridization, a highly useful tool to study the large pool of long non-coding RNAs being identified in the current research. With probes either chemically or biologically synthesized, we demonstrate that the method can be applied to study a wide range of RNA and DNA targets at the single-cell and single-molecule level in cellular contexts. PMID:25226542

  16. Extension, torque, and supercoiling in single, stretched, and twisted DNA molecules.

    PubMed

    Lam, Pui-Man; Zhen, Yi

    2015-11-07

    We reinvestigate the model originally studied by Neukirch and Marko that describes the extension, torque, and supercoiling in single, stretched, and twisted DNA molecules, which consists of a mixture of extended state and supercoiled state, using now a more accurate form of the free energy for the untwisted but stretched DNA. The original model uses an approximate form of this free energy and the agreement with experiment is only qualitative. We find that this more accurate free energy significantly improves the results, which bring them into quantitative agreement with experiment, throughout the entire force regime. This is rather surprising, considering that the theory is completely parameter-free.

  17. Simultaneous Single-Molecule Force and Fluorescence Sampling of DNA Nanostructure Conformations Using Magnetic Tweezers.

    PubMed

    Kemmerich, Felix E; Swoboda, Marko; Kauert, Dominik J; Grieb, M Svea; Hahn, Steffen; Schwarz, Friedrich W; Seidel, Ralf; Schlierf, Michael

    2016-01-13

    We present a hybrid single-molecule technique combining magnetic tweezers and Förster resonance energy transfer (FRET) measurements. Through applying external forces to a paramagnetic sphere, we induce conformational changes in DNA nanostructures, which are detected in two output channels simultaneously. First, by tracking a magnetic bead with high spatial and temporal resolution, we observe overall DNA length changes along the force axis. Second, the measured FRET efficiency between two fluorescent probes monitors local conformational changes. The synchronized orthogonal readout in different observation channels will facilitate deciphering the complex mechanisms of biomolecular machines.

  18. Ultrafast and Wide Range Analysis of DNA Molecules Using Rigid Network Structure of Solid Nanowires

    PubMed Central

    Rahong, Sakon; Yasui, Takao; Yanagida, Takeshi; Nagashima, Kazuki; Kanai, Masaki; Klamchuen, Annop; Meng, Gang; He, Yong; Zhuge, Fuwei; Kaji, Noritada; Kawai, Tomoji; Baba, Yoshinobu

    2014-01-01

    Analyzing sizes of DNA via electrophoresis using a gel has played an important role in the recent, rapid progress of biology and biotechnology. Although analyzing DNA over a wide range of sizes in a short time is desired, no existing electrophoresis methods have been able to fully satisfy these two requirements. Here we propose a novel method using a rigid 3D network structure composed of solid nanowires within a microchannel. This rigid network structure enables analysis of DNA under applied DC electric fields for a large DNA size range (100 bp–166 kbp) within 13 s, which are much wider and faster conditions than those of any existing methods. The network density is readily varied for the targeted DNA size range by tailoring the number of cycles of the nanowire growth only at the desired spatial position within the microchannel. The rigid dense 3D network structure with spatial density control plays an important role in determining the capability for analyzing DNA. Since the present method allows the spatial location and density of the nanostructure within the microchannels to be defined, this unique controllability offers a new strategy to develop an analytical method not only for DNA but also for other biological molecules. PMID:24918865

  19. Interaction of cationic surfactants with DNA: a single-molecule study

    PubMed Central

    Husale, Sudhir; Grange, Wilfried; Karle, Marc; Bürgi, Stephan; Hegner, Martin

    2008-01-01

    The interaction of cationic surfactants with single dsDNA molecules has been studied using force-measuring optical tweezers. For hydrophobic chains of length 12 and greater, pulling experiments show characteristic features (e.g. hysteresis between the pulling and relaxation curves, force-plateau along the force curves), typical of a condensed phase (compaction of a long DNA into a micron-sized particle). Depending on the length of the hydrophobic chain of the surfactant, we observe different mechanical behaviours of the complex (DNA-surfactants), which provide evidence for different binding modes. Taken together, our measurements suggest that short-chain surfactants, which do not induce any condensation, could lie down on the DNA surface and directly interact with the DNA grooves through hydrophobic–hydrophobic interactions. In contrast, long-chain surfactants could have their aliphatic tails pointing away from the DNA surface, which could promote inter-molecular interactions between hydrophobic chains and subsequently favour DNA condensation. PMID:18203749

  20. Ultrafast and wide range analysis of DNA molecules using rigid network structure of solid nanowires.

    PubMed

    Rahong, Sakon; Yasui, Takao; Yanagida, Takeshi; Nagashima, Kazuki; Kanai, Masaki; Klamchuen, Annop; Meng, Gang; He, Yong; Zhuge, Fuwei; Kaji, Noritada; Kawai, Tomoji; Baba, Yoshinobu

    2014-06-11

    Analyzing sizes of DNA via electrophoresis using a gel has played an important role in the recent, rapid progress of biology and biotechnology. Although analyzing DNA over a wide range of sizes in a short time is desired, no existing electrophoresis methods have been able to fully satisfy these two requirements. Here we propose a novel method using a rigid 3D network structure composed of solid nanowires within a microchannel. This rigid network structure enables analysis of DNA under applied DC electric fields for a large DNA size range (100 bp-166 kbp) within 13 s, which are much wider and faster conditions than those of any existing methods. The network density is readily varied for the targeted DNA size range by tailoring the number of cycles of the nanowire growth only at the desired spatial position within the microchannel. The rigid dense 3D network structure with spatial density control plays an important role in determining the capability for analyzing DNA. Since the present method allows the spatial location and density of the nanostructure within the microchannels to be defined, this unique controllability offers a new strategy to develop an analytical method not only for DNA but also for other biological molecules.

  1. Investigating hexameric helicases: Single-molecule studies of DnaB and T4 gp41

    NASA Astrophysics Data System (ADS)

    Saleh, Omar; Ribeck, Noah; Berezney, John

    2011-03-01

    Hexameric, ring-shaped motor proteins serve as replicative helicases in many systems. They function by encircling and translocating along ssDNA, denaturing dsDNA in advance of its motion by sterically occluding the complementary strand to the outside of the ring. We investigate the helicase activity of two such motors using single-molecule measurements with magnetic tweezers. First, we measure the activity of the E. coli helicase DnaB complexed with the tau subunit of the Pol III holoenzyme. Tau is known from bulk measurements to stimulate DnaB activity (Kim et al., Cell, 1996); we investigate the means of this stimulation. Second, we measure helicase activity of the T4 phage helicase gp41 in multiple tethered DNA geometries. Previous work on DnaB showed a dependence of helicase activity on DNA geometry (Ribeck et al., Biophys. J., 2010); here, we test gp41 for similar behavior to see whether it is a common characteristic of hexameric helicases.

  2. Identification and molecular characterization of begomovirus and associated satellite DNA molecules infecting Cyamopsis tetragonoloba.

    PubMed

    Kumar, J; Kumar, A; Roy, J K; Tuli, R; Khan, J A

    2010-08-01

    Monopartite begomoviruses comprise DNA-A as the main genome and associated satellite DNAs. Viral DNA extracted from guar (Cyamopsis tetragonoloba) showing leaf curl symptoms exhibited positive amplification of coat protein (CP) gene of DNA-A component, suggesting the presence of begomovirus. Full length DNA-A was amplified by primer pair re-designed from CP gene nucleotide sequence. The associated alphasatellite and betasatellite DNA molecules were amplified and sequenced, confirming the presence of monopartite begomovirus. Sequence comparisons showed 89% identity with other begomoviruses. The Neighbor-Joining tree based on full length DNA-A nucleotide sequence showed that the guar infecting begomovirus clustered separately from other known begomoviruses. The betasatellite shared a high (96%) nucleotide identity to Cotton leaf curl Multan betasatellites. The alphasatellite showed 91% nucleotide identity to alphasatellite associated with begomovirus infecting Okra. Recombination analyses showed three recombinant fragments in DNA-A, two in betasatellite, and four in alphasatellite. The results suggest that the begomovirus identified in this study was a new recombinant virus. Its name was proposed as Cyamopsis tetragonoloba leaf curl virus (CyTLCuV).

  3. A Device for Performing Lateral Conductance Measurements on Individual Double-Stranded DNA Molecules

    PubMed Central

    Menard, Laurent D.; Mair, Chad E.; Woodson, Michael E.; Alarie, Jean Pierre; Ramsey, J. Michael

    2012-01-01

    A nanofluidic device is described that is capable of electrically monitoring the driven translocation of DNA molecules through a nanochannel. This is achieved by intersecting a long transport channel with a shorter orthogonal nanochannel. The ionic conductance of this transverse nanochannel is monitored while DNA is electrokinetically driven through the transport channel. When DNA passes the intersection, the transverse conductance is altered, resulting in a transient current response. In 1 M KCl solutions, this was found to be a current enhancement of 5–25%, relative to the baseline transverse ionic current. Two different device geometries were investigated. In one device, the DNA was detected after it was fully inserted into and translocating through the transport nanochannel. In the other device, the DNA was detected while it was in the process of entering the nanochannel. It was found that these two conditions are characterized by different transport dynamics. Simultaneous optical and electrical monitoring of DNA translocation confirmed that the transient events originated from DNA transport through the nanochannel intersection. PMID:22950784

  4. Structure of Escherichia coli dGTP triphosphohydrolase: a hexameric enzyme with DNA effector molecules.

    PubMed

    Singh, Deepa; Gawel, Damian; Itsko, Mark; Hochkoeppler, Alejandro; Krahn, Juno M; London, Robert E; Schaaper, Roel M

    2015-04-17

    The Escherichia coli dgt gene encodes a dGTP triphosphohydrolase whose detailed role still remains to be determined. Deletion of dgt creates a mutator phenotype, indicating that the dGTPase has a fidelity role, possibly by affecting the cellular dNTP pool. In the present study, we have investigated the structure of the Dgt protein at 3.1-Å resolution. One of the obtained structures revealed a protein hexamer that contained two molecules of single-stranded DNA. The presence of DNA caused significant conformational changes in the enzyme, including in the catalytic site of the enzyme. Dgt preparations lacking DNA were able to bind single-stranded DNA with high affinity (Kd ∼ 50 nM). DNA binding positively affected the activity of the enzyme: dGTPase activity displayed sigmoidal (cooperative) behavior without DNA but hyperbolic (Michaelis-Menten) kinetics in its presence, consistent with a specific lowering of the apparent Km for dGTP. A mutant Dgt enzyme was also created containing residue changes in the DNA binding cleft. This mutant enzyme, whereas still active, was incapable of DNA binding and could no longer be stimulated by addition of DNA. We also created an E. coli strain containing the mutant dgt gene on the chromosome replacing the wild-type gene. The mutant also displayed a mutator phenotype. Our results provide insight into the allosteric regulation of the enzyme and support a physiologically important role of DNA binding. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. A New Design Strategy and Diagnostic to Tailor the DNA-Binding Mechanism of Small Organic Molecules and Drugs.

    PubMed

    Doan, Phi; Pitter, Demar R G; Kocher, Andrea; Wilson, James N; Goodson, Theodore

    2016-11-18

    The classical model for DNA groove binding states that groove binding molecules should adopt a crescent shape that closely matches the helical groove of DNA. Here, we present a new design strategy that does not obey this classical model. The DNA-binding mechanism of small organic molecules was investigated by synthesizing and examining a series of novel compounds that bind with DNA. This study has led to the emergence of structure-property relationships for DNA-binding molecules and/or drugs, which reveals that the structure can be designed to either intercalate or groove bind with calf thymus dsDNA by modifying the electron acceptor properties of the central heterocyclic core. This suggests that the electron accepting abilities of the central core play a key role in the DNA-binding mechanism. These small molecules were characterized by steady-state and ultrafast nonlinear spectroscopies. Bioimaging experiments were performed in live cells to evaluate cellular uptake and localization of the novel small molecules. This report paves a new route for the design and development of small organic molecules, such as therapeutics, targeted at DNA as their performance and specificity is dependent on the DNA-binding mechanism.

  6. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    PubMed

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. Electrical Transport of Long DNA Molecules on Liuid-Solid Interfaces

    NASA Astrophysics Data System (ADS)

    Samuilov, Vladimir; Seo, Young-Soo; Sokolov, Jonathan; Rafailovich, Miriam; Chu, Benjamin

    2002-03-01

    The electrical transport properties of long DNA molecules were studied based upon a newly developed method of electrophoresis on flat surfaces [1]. The electrophoretic mobilities of DNA in the presence of Si surface were found to be approximately one order less than in free solution. The electropherogram peaks of 1 kb- and Hind III DNA ladders have been clearly identified. The experimental dependencies of the mobilities on molecular weight were found to be scaled with power law with the exponents of an opposite sign at 2 different buffer concentrations: negative for surface transport at 10 -2 M concentration of TBE buffer and positive at 10 -3 M. A novel mechanism responsible for DNA molecules separation in the presence of the surface at low buffer concentrations has been developed. The multi-ion system is governed by the Nernst-Planck equations (ion movement due to convection, migration and diffusion), in combination with the Poisson-Boltzmann equation. The discrepancy from charge neutrality that occurs in the diffuse double layer very close to the substrate is the driving force for the Navier-Stokes equation, which finally results in a liquid movement very close to the surface that is denoted as electro-osmosis. The adsorbed DNA move due to the electrical field parallel to the surface, and also due the electro-osmotic convection that drags the DNA chains if they are only partly adsorbed. The electric double layer is responsible for a velocity profile of the electroosmotic flow. The net electrophoretic mobility of longer DNA, being trapped closer to the surface, is higher than of the shorter ones in the electric field, oriented along the surface. The main features of the electro-hydrodynamic instability related to λ and T2 DNA molecules aggregation, observed in our system, are consistent with our model. This work was supported by NSF-MRSEC Program. [1]. N. Pernodet, V. Samuilov, K. Shin, J. Sokolov, M.H. Rafailovich, D. Gersappe, B. Chu, DNA Electrophoresis on a

  8. Single-molecule analysis of DNA cross-links using nanopore technology

    NASA Astrophysics Data System (ADS)

    Wolna, Anna H.

    The alpha-hemolysin (alpha-HL) protein ion channel is a potential next-generation sequencing platform that has been extensively used to study nucleic acids at a single-molecule level. After applying a potential across a lipid bilayer, the imbedded alpha-HL allows monitoring of the duration and current levels of DNA translocation and immobilization. Because this method does not require DNA amplification prior to sequencing, all the DNA damage present in the cell at any given time will be present during the sequencing experiment. The goal of this research is to determine if these damage sites give distinguishable current levels beyond those observed for the canonical nucleobases. Because DNA cross-links are one of the most prevalent types of DNA damage occurring in vivo, the blockage current levels were determined for thymine-dimers, guanine(C8)-thymine(N3) cross-links and platinum adducts. All of these cross-links give a different blockage current level compared to the undamaged strands when immobilized in the ion channel, and they all can easily translocate across the alpha-HL channel. Additionally, the alpha-HL nanopore technique presents a unique opportunity to study the effects of DNA cross-links, such as thymine-dimers, on the secondary structure of DNA G-quadruplexes folded from the human telomere sequence. Using this single-molecule nanopore technique we can detect subtle structural differences that cannot be easily addressed using conventional methods. The human telomere plays crucial roles in maintaining genome stability. In the presence of suitable cations, the repetitive 5'-TTAGGG human telomere sequence can fold into G-quadruplexes that adopt the hybrid fold in vivo. The telomere sequence is hypersensitive to UV-induced thymine-dimer (T=T) formation, and yet the presence of thymine dimers does not cause telomere shortening. The potential structural disruption and thermodynamic stability of the T=T-containing natural telomere sequences were studied to

  9. Ultrasonic/Sonic Anchor

    NASA Technical Reports Server (NTRS)

    Bar-Cohen, Yoseph; Sherrit, Stewart

    2009-01-01

    The ultrasonic/sonic anchor (U/S anchor) is an anchoring device that drills a hole for itself in rock, concrete, or other similar material. The U/S anchor is a recent addition to a series of related devices, the first of which were reported in "Ultrasonic/Sonic Drill/Corers With Integrated Sensors"

  10. DNA-templated nanoantennas for single-molecule detection at elevated concentrations

    NASA Astrophysics Data System (ADS)

    Acuna, G. P.; Holzmeister, P.; Möller, F. M.; Beater, S.; Lalkens, B.; Tinnefeld, P.

    2013-02-01

    The dynamic concentration range is one of the major limitations of single-molecule fluorescence techniques. Here, we show how bottom-up nano-antennas enhance the fluorescence intensity in a reduced hot-spot, ready for biological applications. We use self-assembled DNA origami structures as a breadboard where gold nanoparticle dimers are positioned with nanometer precision. A maximum of almost 100fold intensity enhancement is obtained using 100 nm gold nanoparticles within a gap of 23 nm between the particles. The results obtained are in good agreement with numerical simulations. Due to the intensity enhancement introduced by the nano-antenna, we are able to perform single molecule measurements at concentrations as high as 500 nM which represents an increment of 2 orders of magnitude compared to conventional measurements. The combination of metallic nanoparticles with DNA origami structures with docking points for biological assays paves the way for the development of bottom-up inexpensive enhancement chambers for single molecule measurements at high concentrations where processes like DNA sequencing occur.

  11. DNA-templated nanoantennas for single-molecule detection at elevated concentrations

    NASA Astrophysics Data System (ADS)

    Acuna, Guillermo P.; Holzmeister, Phil; Möller, Friederike M.; Beater, Susanne; Lalkens, Birka; Tinnefeld, Philip

    2013-06-01

    The dynamic concentration range is one of the major limitations of single-molecule fluorescence techniques. We show how bottom-up nanoantennas enhance the fluorescence intensity in a reduced hotspot, ready for biological applications. We use self-assembled DNA origami structures as a breadboard where gold nanoparticle (NP) dimers are positioned with nanometer precision. A maximum of almost 100-fold intensity enhancement is obtained using 100-nm gold NPs within a gap of 23 nm between the particles. The results obtained are in good agreement with numerical simulations. Due to the intensity enhancement introduced by the nanoantenna, we are able to perform single-molecule measurements at concentrations as high as 500 nM, which represents an increment of 2 orders of magnitude compared to conventional measurements. The combination of metallic NPs with DNA origami structures with docking points for biological assays paves the way for the development of bottom-up inexpensive enhancement chambers for single-molecule measurements at high concentrations where processes like DNA sequencing occur.

  12. Pulsed IR heating studies of single-molecule DNA duplex dissociation kinetics and thermodynamics.

    PubMed

    Holmstrom, Erik D; Dupuis, Nicholas F; Nesbitt, David J

    2014-01-07

    Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10(-11) liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20-100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (<10 bp) and long (>10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation.

  13. Single-molecule imaging of transcription factor binding to DNA in live mammalian cells.

    PubMed

    Gebhardt, J Christof M; Suter, David M; Roy, Rahul; Zhao, Ziqing W; Chapman, Alec R; Basu, Srinjan; Maniatis, Tom; Xie, X Sunney

    2013-05-01

    Imaging single fluorescent proteins in living mammalian cells is challenged by out-of-focus fluorescence excitation. To reduce out-of-focus fluorescence we developed reflected light-sheet microscopy (RLSM), a fluorescence microscopy method allowing selective plane illumination throughout the nuclei of living mammalian cells. A thin light sheet parallel to the imaging plane and close to the sample surface is generated by reflecting an elliptical laser beam incident from the top by 90° with a small mirror. The thin light sheet allows for an increased signal-to-background ratio superior to that in previous illumination schemes and enables imaging of single fluorescent proteins with up to 100-Hz time resolution. We demonstrated the single-molecule sensitivity of RLSM by measuring the DNA-bound fraction of glucocorticoid receptor (GR) and determining the residence times on DNA of various oligomerization states and mutants of GR and estrogen receptor-α (ER), which permitted us to resolve different modes of DNA binding of GR. We demonstrated two-color single-molecule imaging by observing the spatiotemporal colocalization of two different protein pairs. Our single-molecule measurements and statistical analysis revealed dynamic properties of transcription factors.

  14. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    NASA Astrophysics Data System (ADS)

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-04-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

  15. Expression and isolation of antimicrobial small molecules from soil DNA libraries.

    PubMed

    MacNeil, I A; Tiong, C L; Minor, C; August, P R; Grossman, T H; Loiacono, K A; Lynch, B A; Phillips, T; Narula, S; Sundaramoorthi, R; Tyler, A; Aldredge, T; Long, H; Gilman, M; Holt, D; Osburne, M S

    2001-04-01

    Natural products have been a critically important source of clinically relevant small molecule therapeutics. However, the discovery rate of novel structural classes of antimicrobial molecules has declined. Recently, increasing evidence has shown that the number of species cultivated from soil represents less than 1% of the total population, opening up the exciting possibility that these uncultured species may provide a large untapped pool from which novel natural products can be discovered. We have constructed and expressed in E. coli a BAC (bacterial artificial chromosome) library containing genomic fragments of DNA (5-120kb) isolated directly from soil organisms (S-DNA). Screening of the library resulted in the identification of several antimicrobial activities expressed by different recombinant clones. One clone (mg1.1) has been partially characterized and found to express several small molecules related to and including indirubin. These results show that genes involved in natural product synthesis can be cloned directly from S-DNA and expressed in a heterologous host, supporting the idea that this technology has the potential to provide novel natural products from the wealth of environmental microbial diversity and is a potentially important new tool for drug discovery.

  16. Single-molecule comparison of DNA Pol I activity with native and analog nucleotides

    NASA Astrophysics Data System (ADS)

    Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip

    2014-03-01

    DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.

  17. DNA-templated nanoantennas for single-molecule detection at elevated concentrations.

    PubMed

    Acuna, Guillermo P; Holzmeister, Phil; Möller, Friederike M; Beater, Susanne; Lalkens, Birka; Tinnefeld, Philip

    2013-06-01

    The dynamic concentration range is one of the major limitations of single-molecule fluorescence techniques. We show how bottom-up nanoantennas enhance the fluorescence intensity in a reduced hotspot, ready for biological applications. We use self-assembled DNA origami structures as a breadboard where gold nanoparticle (NP) dimers are positioned with nanometer precision. A maximum of almost 100-fold intensity enhancement is obtained using 100-nm gold NPs within a gap of 23 nm between the particles. The results obtained are in good agreement with numerical simulations. Due to the intensity enhancement introduced by the nanoantenna, we are able to perform single-molecule measurements at concentrations as high as 500 nM, which represents an increment of 2 orders of magnitude compared to conventional measurements. The combination of metallic NPs with DNA origami structures with docking points for biological assays paves the way for the development of bottom-up inexpensive enhancement chambers for single-molecule measurements at high concentrations where processes like DNA sequencing occur.

  18. A computational protocol for the discovery of lead molecules targeting DNA unique to pathogens.

    PubMed

    Mishra, Akhilesh; Pant, Pradeep; Mrinal, Nirotpal; Jayaram, B

    2017-07-19

    With the rapid emergence of drug resistant pathogens, it has become imperative to develop alternative medications as well as find new drug targets to overcome this crisis. Hence, this has become prime focus of several academic laboratories and pharmaceutical companies. Here, we report a computational protocol for identifying unique DNA sequence(s) in the pathogen which is absent in human and related non-pathogenic strains of the microbe. In order to use the unique sequence as drug target, the protocol, in the second step, uses virtual screening against a million compound library to identify candidate small molecules which can bind to these unique DNA targets in the pathogen only. Theoretically the molecules identified after screening should not bind to human DNA. This methodology is demonstrated on Mycobacterium tuberculosis H37Rv, wherein a new octamer sequence present only in H37Rv has been identified and a few candidate small molecules as potential drug have been proposed. Being fast and cost effective, this protocol could be of importance in generating new potential drug candidates against infectious organisms for further experimental studies. This methodology is freely available at http://www.scfbio-iitd.res.in/PSDDF/. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    PubMed Central

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-01-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ∼10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level. PMID:28382928

  20. Single-molecule analysis of RAG-mediated V(D)J DNA cleavage.

    PubMed

    Lovely, Geoffrey A; Brewster, Robert C; Schatz, David G; Baltimore, David; Phillips, Rob

    2015-04-07

    The recombination-activating gene products, RAG1 and RAG2, initiate V(D)J recombination during lymphocyte development by cleaving DNA adjacent to conserved recombination signal sequences (RSSs). The reaction involves DNA binding, synapsis, and cleavage at two RSSs located on the same DNA molecule and results in the assembly of antigen receptor genes. We have developed single-molecule assays to examine RSS binding by RAG1/2 and their cofactor high-mobility group-box protein 1 (HMGB1) as they proceed through the steps of this reaction. These assays allowed us to observe in real time the individual molecular events of RAG-mediated cleavage. As a result, we are able to measure the binding statistics (dwell times) and binding energies of the initial RAG binding events and characterize synapse formation at the single-molecule level, yielding insights into the distribution of dwell times in the paired complex and the propensity for cleavage on forming the synapse. Interestingly, we find that the synaptic complex has a mean lifetime of roughly 400 s and that its formation is readily reversible, with only ∼40% of observed synapses resulting in cleavage at consensus RSS binding sites.